U.S. patent application number 11/445311 was filed with the patent office on 2006-10-26 for i-flice, a novel inhibitor of tumor necrosis factor receptor-1 and cd-95 induced apoptosis.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Vishva M. Dixit, Reiner L. Gentz, Joseph J. Kenny, Jian Ni, Craig A. Rosen.
Application Number | 20060240036 11/445311 |
Document ID | / |
Family ID | 26710691 |
Filed Date | 2006-10-26 |
United States Patent
Application |
20060240036 |
Kind Code |
A1 |
Ni; Jian ; et al. |
October 26, 2006 |
I-FLICE, a novel inhibitor of tumor necrosis factor receptor-1 and
CD-95 induced apoptosis
Abstract
The present invention relates to a novel I-FLICE-1 or I-FLICE-2
protein which is a novel inhibitor of TNFR-1 and CD-95 induced
apoptosis. In particular, isolated nucleic acid molecules are
provided encoding the human I-FLICE-1 or I-FLICE-2 protein.
I-FLICE-1 or I-FLICE-2 polypeptides are also provided as are
vectors, host cells and recombinant methods for producing the same.
The invention further relates to screening methods for identifying
agonists and antagonists of I-FLICE-1 or I-FLICE-2 activity. Also
provided are therapeutic methods for treating diseases and
disorders associated with apoptosis.
Inventors: |
Ni; Jian; (Germantown,
MD) ; Rosen; Craig A.; (Laytonsville, MD) ;
Dixit; Vishva M.; (Los Altos Hills, CA) ; Gentz;
Reiner L.; (Belo Horizonte-Mg, BR) ; Kenny; Joseph
J.; (San Diego, CA) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC.;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
The Regents of the University of Michigan
Ann Arbor
MI
|
Family ID: |
26710691 |
Appl. No.: |
11/445311 |
Filed: |
June 2, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10713208 |
Nov 17, 2003 |
7056516 |
|
|
11445311 |
Jun 2, 2006 |
|
|
|
09489155 |
Jan 21, 2000 |
6680171 |
|
|
10713208 |
Nov 17, 2003 |
|
|
|
09009893 |
Jan 21, 1998 |
6623938 |
|
|
09489155 |
Jan 21, 2000 |
|
|
|
60034205 |
Jan 21, 1997 |
|
|
|
60054800 |
Aug 5, 1997 |
|
|
|
Current U.S.
Class: |
424/192.1 ;
435/320.1; 435/325; 435/6.14; 435/69.1; 435/7.23; 530/350;
530/388.23; 536/23.2 |
Current CPC
Class: |
A61P 35/00 20180101;
A61P 43/00 20180101; C12N 9/6475 20130101; A61K 38/00 20130101 |
Class at
Publication: |
424/192.1 ;
435/069.1; 435/320.1; 435/325; 530/350; 530/388.23; 536/023.2;
435/006; 435/007.23 |
International
Class: |
A61K 39/00 20060101
A61K039/00; C12Q 1/68 20060101 C12Q001/68; G01N 33/574 20060101
G01N033/574; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06 |
Claims
1. An isolated nucleic acid molecule comprising a polynucleotide
having a nucleotide sequence at least 95% identical to a sequence
selected from the group consisting of: (a) a nucleotide sequence
encoding a polypeptide comprising amino acids from about 1 to about
480 in SEQ ID NO:2; (b) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 2 to about 480 in SEQ
ID NO:2; (c) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 1 to about 75 in SEQ ID NO:2; (d)
a nucleotide sequence encoding a polypeptide comprising amino acids
from about 91 to about 171 in SEQ ID NO:2; (e) a nucleotide
sequence encoding a polypeptide comprising amino acids from about
172 to about 375 in SEQ ID NO:2; (f) a nucleotide sequence encoding
a polypeptide comprising amino acids from about 376 to about 480 in
SEQ ID NO:2; (g) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 1 to about 348 in SEQ ID NO:6;
(h) a nucleotide sequence encoding a polypeptide comprising amino
acids from about 2 to about 348 in SEQ ID NO:6; (i) a nucleotide
sequence encoding a polypeptide comprising amino acids from about 1
to about 75 in SEQ ID NO:6; (j) a nucleotide sequence encoding a
polypeptide comprising amino acids from about 76 to about 252 in
SEQ ID NO:6; (k) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 253 to about 348 in SEQ ID NO:6;
(l) a nucleotide sequence encoding a polypeptide having the amnino
acid sequence encoded by the cDNA clone contained in ATCC Deposit
No. 209041; (m) a nucleotide sequence encoding a polypeptide having
the amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 209038; and (n) a nucleotide sequence complementary to
any of the nucleotide sequences in (a), (b), (c), (d), (e), (f),
(g), (h), (i), (j), (k), (l), (m), or (n).
2. An isolated nucleic acid molecule comprising a polynucleotide
which hybridizes under stringent hybridization conditions to a
polynucleotide having a nucleotide sequence identical to a
nucleotide sequence in (a), (b), (c), (d), (e), (f), (g), (h), (i),
(j), (k), (l), (m), (n), or (o) of claim 1 wherein said
polynucleotide which hybridizes does not hybridize under stringent
hybridization conditions to a polynucleotide having a nucleotide
sequence consisting of only A residues or of only T residues.
3. A method for making a recombinant vector comprising inserting an
isolated nucleic acid molecule of claim 1 into a vector.
4. A recombinant vector produced by the method of claim 3.
5. A method of making a recombinant host cell comprising
introducing the recombinant vector of claim 4 into a host cell.
6. A recombinant host cell produced by the method of claim 5.
7. A recombinant method for producing an I-FLICE-1 or I-FLICE-2
polypeptide, comprising culturing the recombinant host cell of
claim 6 under conditions such that said polypeptide is expressed
and recovering said polypeptide.
8. An isolated I-FLICE-1 or I-FLICE-2 polypeptide having an amino
acid sequence at least 95% identical to a sequence selected from
the group consisting of: (a) amino acids from about 1 to about 480
in SEQ ID NO:2; (b) amino acids from about 2 to about 480 in SEQ ID
NO:2; (c) amino acids from about 1 to about 348 in SEQ ID NO:6; (d)
amino acids from about 2 to about 348 in SEQ ID NO:6; (e) the amino
acid sequence of the I-FLICE-1 polypeptide having the amino acid
sequence encoded by the cDNA clone contained in ATCC Deposit No.
209041; (f) the amino acid sequence of the I-FLICE-2 polypeptide
having the amino acid sequence encoded by the cDNA clone contained
in ATCC Deposit No. 209038; and (g) the amino acid sequence of an
epitope-bearing portion of any one of the polypeptides of (a), (b),
(c), (d), (e), or (f).
9. An isolated antibody that binds specifically to an I-FLICE-1 or
I-FLICE-2 polypeptide of claim 8.
10. A method for treating diseases and disorders associated with
apoptosis comprising administering to said individual a composition
comprising an isolated polypeptide of claim 8.
11. A method useful during the diagnosis of diseases and disorders
associated with aberrant cell survival in an individual comprising:
(a) measuring I-FLICE-1 or I-FLICE-2 gene expression level in cells
or body fluid of said individual; (b) comparing the I-FLICE-1 or
I-FLICE-2 gene expression level of said individual with a standard
I-FLICE-1 or I-FLICE-2 gene expression level, whereby an increase
or decrease in the I-FLICE-1 or I-FLICE-2 gene expression level of
said individual compared to said standard expression level is
indicative of disease or disorder associated with aberrant cell
survival.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/713,208, filed Nov. 17, 2003, now U.S. Pat. No. 7,056,516,
which is a divisional of U.S. application Ser. No. 09/489,155,
filed Jan. 21, 2000, now U.S. Pat. No. 6,680,171, which is a
continuation of U.S. application Ser. No. 09/009,893, filed Jan.
21,1998, now U.S. Pat. No. 6,623,938, which claims benefit under 35
U.S.C. .sctn. 119(e) of U.S. Provisional Application Nos.
60/034,205, filed Jan. 21, 1997, and 60/054,800, filed Aug. 5,
1997, all of which are incorporated by reference herein.
FIELD OF THE INVENTION
[0002] The present invention relates to a novel inhibitor of TNFR-1
and CD-95 induced apoptosis. More specifically, isolated nucleic
acid molecules are provided encoding a human I-FLICE (Inhibitor of
FLICE (FADD-like ICE)) polynucleotides. I-FLICE polypeptides are
also provided, as are vectors, host cells and recombinant methods
for producing the same. The invention further relates to screening
methods for identifying agonists and antagonists of I-FLICE
activity. Also provided are therapeutic methods for treating
diseases and disorders associated with apoptosis.
BACKGROUND OF THE INVENTION
[0003] The cell death machinery is conserved throughout evolution
and is composed of activators, inhibitors, and effectors
(Chinnaiyan, A. M. and Dixit, V. M., Curr. Biol. 6:555-562 (1996)).
The effector arm of the cell death pathway is composed of a rapidly
growing family of cysteine aspartate-specific proteases termed
caspases (Alnemri, E. S., et al., Cell 87:171 (1996)). As implied
by the name, these cysteine proteases cleave substrates following
an aspartate residue (Alnemri, E. S., et al., Cell 87:171 (1996);
Walker, N. P., et al., Cell 78:343-352 (1994)). Caspases are
normally present as single polypeptide zymogens and contain an
amino-terminal prodomain, and large and small catalytic subunits
(Wilson, K. P., et al., Nature 370:270-274 (1994); Rotonda, J., et
al., Nat. Struct. Biol. 3:619-625 (1996); Fraser, A. and Evan, G.,
Cell 85:781-784 (1996)). The two chain active enzyme (composed of
the large and small subunits) is obtained following proteolytic
processing at internal Asp residues (Wilson, K. P., et al., Nature
370:270-274 (1994); Rotonda, J., et al., Nat. Struct. Biol.
3:619-625 (1996); Fraser, A. and Evan, G., Cell 85:781-784 (1996)).
As such, caspases are capable of activating each other in a manner
analogous to zymogen activation that is observed in the coagulation
cascade (Boldin, M. P., et al., Cell 85:805-815 (1996)). The
identification of FLICE and Mch4/FLICE2 as receptor associated
caspases suggested a surprisingly direct mechanism for activation
of the death pathway by the cytotoxic receptors CD-95 and TNFR-1
(Boldin, M. P., et al., Cell 85:805-815 (1996); Muzio, M., et al.,
Cell 85:817-827 (1996); Vincenz, C. and Dixit, V. M., J. Biol.
Chem. 272:6578-6583 (1997); Chinnaiyan, A. M., et al., Cell
81:505-512 (1995)). Upon activation, both receptors use their death
domains to bind the corresponding domain in the adaptor molecule
FADD (Fas-associated death domain protein) (Muzio, M., et al., Cell
85:817-827 (1996); Vincenz, C. and Dixit, V. M., J. Biol. Chem.
272:6578-6583 (1997); Chinnaiyan, A. M., et al., Cell 81:505-512
(1995)). Dominant negative versions of FADD that lack the
N-terminal segment but still retain the death domain potently
inhibit both CD-95 and TNFR-1 induced apoptosis (Chinnaiyan, A. M.,
et al., J. Biol. Chem. 271:4961-4965 (1996); Muzio, M., et al., J.
Biol. Chem. 272:2952-2956 (1997)). Given the importance of the
N-terminal segment in engaging the death pathway, it has been
termed the death effector domain (DED) (Chinnaiyan, A. M., et al.,
J. Biol. Chem. 271:4961-4965 (1996)).
[0004] Remarkably, the DED is present within the prodomain of FLICE
and Mch4/FLICE2 and mutagenesis studies suggest that a homophilic
interaction between the DED of FADD and the corresponding domain in
FLICE or Mch4/FLICE2 is responsible for the recruitment of these
proteases to the CD-95 and TNFR-1 signaling complexes (Muzio, M.,
et al., Cell 85:817-827 (1996); Vincenz, C. and Dixit, V. M., J.
Biol. Chem. 272:6578-6583 (1997); Chinnaiyan, A. M., et al., Cell
81:505-512 (1995); Chinnaiyan, A. M., et al., J. Biol. Chem.
271:4961-4965 (1996)). Taken together, these data are consistent
with FLICE and Mch4/FLICE2 being apical enzymes that initiate
precipitous proteolytic processing of downstream caspases resulting
in apoptosis (Boldin, M. P., et al., Cell 85:805-815 (1996);
Srinivasula, S. M., et al., PNAS93:14486-14491 (1996);
Fernandes-Alnemri, T., et al., PNAS 93:7464-7469 (1996); Henkart,
P. A., Immunity 4:195-201 (1996)). A number of viral gene products
antagonize CD-95 and TNFR-1 mediated killing as a means to persist
in the infected host (Shen, Y. and Shenk, T. S., Current Opinion in
Genetics and Development 5:105-111 (1995)). The poxvirus encoded
serpin CrmA and baculovirus gene product p35 are direct caspase
inhibitors (Walker, N. P., et al., Cell 78:343-352 (1994)). In
contrast, the molluscum contagiosum virus protein MC159 and the
equine herpes virus protein E8 encode DED-containing decoy
molecules that bind to either FADD (MC159) or FLICE (E8) and
disrupt assembly of the receptor signaling complex, thereby
abrogating the death signal (Hu, S., et al., J. Biol. Chem.
272:9621-9624 (1997); Bertin, J., et al., PNAS 94:1172-1176 (1997);
Thome, M., et al., Nature 386:527-521 (1997)). The existence of
these viral inhibitors has raised the question of whether
functionally equivalent molecules are encoded in the mammalian
genome.
[0005] There is a need for factors, such as the polypeptides of the
present invention, that are useful for inhibiting apoptosis for
therapeutic purposes, for example, in the treatment of Alzheimer's
disease, Parkinson's disease, rheumatoid arthritis, septic shock,
sepsis, stroke, CNS inflammation, osteoporosis, ischemia,
reperfusion injury, cell death associated with cardiovascular
disease, polycystic kidney disease, apoptosis of endothelial cells
in cardiovascular disease, degenerative liver disease, MS and head
injury damage. There is a need, therefore, for the identification
and characterization of such factors that are inhibitors of
apoptosis, such as the I-FLICE-1 and I-FLICE-2 polypeptides of the
present invention, which can play a role in preventing,
ameliorating or correcting the diseases and disorders associated
with apoptosis.
SUMMARY OF THE INVENTION
[0006] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding the I-FLICE-1
polypeptide having the amino acid sequence shown in SEQ ID NO:2 or
the amino acid sequence encoded by the cDNA clone deposited in a
bacterial host as ATCC.RTM. Deposit Number 209041 on May 15, 1997.
The present invention provides isolated nucleic acid molecules
comprising a polynucleotide encoding the I-FLICE-2 polypeptide
having the amino acid sequence shown in SEQ ID NO:6 or the amino
acid sequence encoded by the cDNA clone deposited in a bacterial
host as ATCC.RTM. Deposit Number 209038 on May 15, 1997.
[0007] The present invention also relates to recombinant vectors,
which include the isolated nucleic acid molecules of the present
invention, and to host cells containing the recombinant vectors, as
well as to methods of making such vectors and host cells and for
using them for production of I-FLICE-1 or I-FLICE-2 polypeptides or
peptides by recombinant techniques.
[0008] The invention further provides an isolated I-FLICE-1 or
I-FLICE-2 polypeptides having an amino acid sequence encoded by the
polynucleotides described herein.
[0009] The invention further provides a diagnostic method useful
during diagnosis or prognosis of a disease states resulting from
aberrant cell proliferation due to alterations in I-FLICE-1 or
I-FLICE-2 expression.
[0010] The present invention also provides a screening method for
determining whether a candidate agonist or antagonist is capable of
enhancing or inhibiting a cellular activity of either an I-FLICE-1
or I-FLICE-2 polypeptide. The method involves contacting cells
which express one or both of the I-FLICE-1 or I-FLICE-2
polypeptides with a candidate compound, assaying a cellular
response, and comparing the cellular response to a standard
cellular response, the standard being assayed in absence of the
candidate compound, whereby an increased cellular response over the
standard indicates that the candidate compound is an agonist of the
polypeptide activity and a decreased cellular response compared to
the standard indicates that the candidate compound is an antagonist
of the activity.
[0011] An additional aspect of the invention is related to a method
for treating an individual in need of an increased level of
I-FLICE-1 or I-FLICE-2 activity in the body comprising
administering to such an individual a composition comprising a
therapeutically effective amount of an isolated I-FLICE-1 or
I-FLICE-2 polypeptide of the invention or an agonist thereof.
[0012] A still further aspect of the invention is related to a
method for treating an individual in need of a decreased level of
I-FLICE-1 or I-FLICE-2 activity in the body comprising,
administering to such an individual a composition comprising a
therapeutically effective amount of an I-FLICE-1 or I-FLICE-2
antagonist.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1A-1B show the nucleotide (SEQ ID NO:1) and deduced
amino acid (SEQ ID NO:2) sequences of I-FLICE-1 (HSLAZ11). The
protein has 480 amino acid residues and a deduced molecular weight
of about 55.3 kDa.
[0014] FIG. 2 shows the regions of similarity between the amino
acid sequences of the I-FLICE-1, I-FLICE-2, FLICE (SEQ ID NO:3),
and Mch4 (SEQ ID NO:4). Shading (with solid black) indicates
residues that match the consensus sequence exactly.
[0015] FIG. 3 shows an analysis of the I-FLICE-1 amino acid
sequence. Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown. In the "Antigenic
Index-Jameson-Wolf" graph, amino acid residues about 41 to about
92, about 155 to about 249, about 332 to about 447 in FIG. 1A-1B
(SEQ ID NO:2) correspond to the shown highly antigenic regions of
the I-FLICE-1 protein.
[0016] FIG. 4A-4C show the nucleotide (SEQ ID NO:5) and deduced
amino acid (SEQ ID NO:6) sequences of I-FLICE-2 (HCEBJ50). The
protein has 348 amino acid residues and a deduced molecular weight
of about 39.2 kDa.
[0017] FIG. 5 shows an analysis of the I-FLICE-2 amino acid
sequence. Alpha, beta, turn and coil regions; hydrophilicity and
hydrophobicity; amphipathic regions; flexible regions; antigenic
index and surface probability are shown. In the "Antigenic
Index-Jameson-Wolf" graph, amino acid residues about 62 to about
136, about 184 to about 193, about 205 to about 341 in FIG. 4A-4C
(SEQ ID NO:6) correspond to the shown highly antigenic regions of
the I-FLICE-2 protein.
[0018] FIG. 6A-6B show I-FLICE-1 inhibition of apoptosis.
Overexpression of I-FLICE-1 attenuated TNFR-1 (panel A) and CD-95
(panel B) induced cell death. 293 (panel A) or 293-EBNA (panel B)
cells were co-transfected with the indicated plasmids together with
the reporter construct pCMV .beta.-galactosidase. The data shown
are the percentage of blebbing blue cells as a function of total
number of blue cells counted.
DETAILED DESCRIPTION
[0019] The present invention provides isolated nucleic acid
molecules comprising a polynucleotide encoding an I-FLICE-1 or
I-FLICE-2 polypeptide having the amino acid sequence shown in SEQ
ID NO:2 or SEQ ID NO:6, respectively, which was determined by
sequencing a cloned cDNA. The I-FLICE-1 protein of the present
invention shares sequence homology with FLICE and Mch4 (FIG. 2)
(SEQ ID NOs:3 and 4). The nucleotide sequence shown in SEQ ID NO:1
was obtained by sequencing a cDNA clone (HSLAZ11), which was
deposited on May 15, 1997 at the American Type Culture Collection
(ATCC.RTM.), 10801 University Blvd., Manassas, Va. 20110-2209, USA
(present address), and given accession number 209041. The deposited
clone is inserted in the pBLUESCRIPT.RTM. SK(-) plasmid
(Stratagene, La Jolla, Calif.) using the EcoRI and xhoI restriction
endonuclease cleavage sites. The I-FLICE-2 protein of the present
invention shares sequence homology with FLICE and Mch4 (FIG. 2 (SEQ
ID NOs:3 and 4)). The nucleotide sequence shown in SEQ ID NO:5 was
obtained by sequencing a cDNA clone (HCEBJ50), which was deposited
on May 15, 1997 at the American Type Culture Collection
(ATCC.RTM.), 10801 University Blvd., Manassas, Va. 20110-2209, USA
(present address), and given accession number 209038. The deposited
clone is inserted in the pBLUESCRIPT.RTM. SK(-) plasmid
(Stratagene, La Jolla, Calif.) using the EcoRI and XhoI restriction
endonuclease cleavage sites.
Nucleic Acid Molecules
[0020] Unless otherwise indicated, all nucleotide sequences
determined by sequencing a DNA molecule herein were determined
using an automated DNA sequencer (such as the Model 373 from
Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were
predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined
by this automated approach, any nucleotide sequence determined
herein may contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more
typically at least about 95% to at least about 99.9% identical to
the actual nucleotide sequence of the sequenced DNA molecule. The
actual sequence can be more precisely determined by other
approaches including manual DNA sequencing methods well known in
the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual
sequence will cause a frame shift in translation of the nucleotide
sequence such that the predicted amino acid sequence encoded by a
determined nucleotide sequence will be completely different from
the amino acid sequence actually encoded by the sequenced DNA
molecule, beginning at the point of such an insertion or
deletion.
[0021] Using the information provided herein, such as the
nucleotide sequence in SEQ ID NO:1 or SEQ ID NO:5, a nucleic acid
molecule of the present invention encoding an I-FLICE-1 or
I-FLICE-2 polypeptide may be obtained using standard cloning and
screening procedures, such as those for cloning cDNAs using mRNA as
starting material. Illustrative of the invention, the nucleic acid
molecule described in SEQ ID NO:1 was discovered in a cDNA library
derived from human umbilical vein endothelial cell. The gene was
also identified in cDNA libraries from smooth muscle. The
determined nucleotide sequence of the I-FLICE-1 cDNA of SEQ ID NO:1
contains an open reading frame encoding a protein of about 480
amino acid residues and a deduced molecular weight of about 55.3
kDa. The I-FLICE-1 protein shown in SEQ ID NO:2 is overall about
29% identical and about 54% similar to FLICE (FIG. 2 (SEQ ID
NO:3)).
[0022] Also illustrative of the invention, the nucleic acid
molecule described in SEQ ID NO:5 was discovered in a cDNA library
derived from human umbilical vein endothelial cell. The gene was
also identified in cDNA libraries from brain tissue isolated from
the cerebellum. The determined nucleotide sequence of the I-FLICE-2
cDNA of SEQ ID NO:5 contains an open reading frame encoding a
protein of about 348 amino acid residues and a deduced molecular
weight of about 39 kDa. The I-FLICE-2 protein shown in SEQ ID NO:6
is overall about 28% identical and about 54% similar to FLICE (FIG.
2 (SEQ ID NO:3)).
[0023] In addition, I-FLICE-1 and I-FLICE-2 are nearly identical
over the majority of their sequences; however, I-FLICE-1 has
additional amino acids comprising the N-terminal region of the
protein. The amino terminal domains of both I-FLICE-1 and I-FLICE-2
exhibit significant sequence similarity to the DED domain of the
FADD protein (Hu, S. et al., J. Biol. Chem. 272:17255-17257 (1997);
Irmler, M., et al., Nature 388:190-195 (1997)), the domain through
which FLICE proteins and death receptors interact. The amino
terminal domain of I-FLICE-2 consists of only a single DED/FADD
homology domain (comprising amino acid residues from about 1 to
about 75 in SEQ ID NO:6), while the additional amino acids found in
the amino terminal domain of I-FLICE-1 appear to provide a second
DED/FADD homology domain (comprising amino acid residues from about
1 to about 75 and amino acids residues from about 91 to about 171
in SEQ ID NO:2). The carboxy terminal domains of the both I-FLICE-1
and I-FLICE-2 also contain significant sequence similarity to the
active subunit domains of the ICE/CED-3 family of cysteine
proteases (amino acids residues from about 172 to about 375 and
amino acid residues from about 376 to about 480 in SEQ ID NO:2;
amino acids residues from about 76 to about 252 and amino acid
residues from about 253 to about 348 in SEQ ID NO:6). Neither
I-FLICE-1 or I-FLICE-2 contain the catalytic cysteine that is
normally embedded in the conserved pentapeptide QACRG (SEQ ID
NO:33) or QACQG (SEQ ID NO:34) motif present in all known caspases.
Rather, both I-FLICE-1 and I-FLICE-2 have the pentapeptide sequence
QNYVV (SEQ ID NO:35; amino acid residues from about 358 to about
362 in SEQ ID NO:2 and amino acid residues from about 244 to about
248 in SEQ ID NO:6). Further, only three of seven conserved
residues that form the substrate binding pocket found in all
caspases are present in I-FLICE-1 and I-FLICE-2. Given the lack of
conservation of key residues involved in catalysis and substrate
binding, it can be concluded that I-FLICE-1 and I-FLICE-2 are not
cysteine proteases and are incapable of substrate binding, thus,
providing these proteins with a dominant negative inhibitory
function. I-FLICE-1 and I-FLICE-2 are the first examples of
catalytically inert caspases that can inhibit apoptosis.
[0024] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as mRNA, or in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA or RNA may be the coding
strand, also known as the sense strand, or it may be the non-coding
strand, also referred to as the anti-sense strand.
[0025] By "isolated" nucleic acid molecule(s) is intended a nucleic
acid molecule, DNA or RNA, which has been removed from its native
environment. For example, recombinant DNA molecules contained in a
vector are considered isolated for the purposes of the present
invention. Further examples of isolated DNA molecules include
recombinant DNA molecules maintained in heterologous host cells or
purified (partially or substantially) DNA molecules in solution.
Isolated RNA molecules include in vivo or in vitro RNA transcripts
of the DNA molecules of the present invention. Isolated nucleic
acid molecules according to the present invention further include
such molecules produced synthetically.
[0026] Isolated nucleic acid molecules of the present invention
include DNA molecules comprising an open reading frame (ORF) shown
in SEQ ID NO:1 or SEQ ID NO:5; DNA molecules comprising the coding
sequence for the I-FLICE -1 or I-FLICE-2 protein; and DNA molecules
which comprise a sequence substantially different from those
described above but which, due to the degeneracy of the genetic
code, still encode the I-FLICE-1 or I-FLICE-2 protein. Of course,
the genetic code is well known in the art. Thus, it would be
routine for one skilled in the art to generate such degenerate
variants.
[0027] In addition, the invention provides nucleic acid molecules
having nucleotide sequences related to extensive portions of SEQ ID
NO:1 which have been determined from the following related cDNA
clones: HOSBY07R (SEQ ID NO:23), HSAVA13R (SEQ ID NO:24), HLFBD88R
(SEQ ID NO:25), HOSAH65R (SEQ ID NO:26), HUVBS23R (SEQ ID NO:27),
HHFFJ01RA (SEQ ID NO:28), HUVBL22R (SEQ ID NO:29), and HUVBX15R
(SEQ ID NO:30).
[0028] The invention also provides nucleic acid molecules having
nucleotide sequences related to extensive portions of SEQ ID NO:5
(I-FLICE-2) which have been determined from the following related
cDNA clones: HTNBE58R (SEQ ID NO:31), HTPBE58R (SEQ ID NO:32),
HOSBY07R (SEQ ID NO:23), HSAVA13R (SEQ ID NO:24), HLFBD88R (SEQ ID
NO:25), HOSAH65R (SEQ ID NO:26), and HHFFJ01RA (SEQ ID NO:28).
[0029] In another aspect, the invention provides isolated nucleic
acid molecules encoding the I-FLICE-1 polypeptide having an amino
acid sequence as encoded by the cDNA clone contained in the plasmid
deposited as ATCC.RTM. Deposit No. 209041 on May 15, 1997. The
invention also provides isolated nucleic acid molecules encoding
the I-FLICE-2 polypeptide having an amino acid sequence as encoded
by the cDNA clone contained in the plasmid deposited as ATCC.RTM.
Deposit No. 209038 on May 15, 1997. In a further embodiment,
nucleic acid molecules are provided encoding the I-FLICE-1 or
I-FLICE-2 polypeptide or the full-length I-FLICE polypeptide
lacking the N-terminal methionine. The invention also provides an
isolated nucleic acid molecule having the nucleotide sequence shown
in SEQ ID NO:1 or SEQ ID NO:5 or the nucleotide sequence of the
I-FLICE-1 or I-FLICE-2 cDNA contained in the above-described
deposited clones, or a nucleic acid molecule having a sequence
complementary to one of the above sequences. Such isolated
molecules, particularly DNA molecules, are useful as probes for
gene mapping, by in situ hybridization with chromosomes, and for
detecting expression of the I-FLICE-1 or I-FLICE-2 gene in human
tissue, for instance, by Northern blot analysis.
[0030] The present invention is further directed to fragments of
the isolated nucleic acid molecules described herein. By a fragment
of an isolated nucleic acid molecule having the nucleotide sequence
of the deposited cDNA or the nucleotide sequence shown in SEQ ID
NO:1 or SEQ ID NO:5 is intended fragments at least about 15 nt, and
more preferably at least about 20 nt, still more preferably at
least about 30 nt, and even more preferably, at least about 40 nt
in length which are useful as diagnostic probes and primers as
discussed herein. Of course larger DNA fragments 50, 100, 150, 200,
250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850,
900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400,
1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950,
2000, or 2016 nt in length of the sequence shown in SEQ ID NO:1 are
also useful according to the present invention as are fragments
corresponding to most, if not all, of the nucleotide sequence of
the cDNA clone contained in the plasmid deposited as ATCC.RTM.
Deposit No. 209041 or as shown in SEQ ID NO:1. Similarly, larger
DNA fragments 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550,
600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150,
1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700,
1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250,
2300, 2350, 2400, 2450, 2500, or 2547 nt in length of the sequence
shown in SEQ ID NO:5 are also useful according to the present
invention as are fragments corresponding to most, if not all, of
the nucleotide sequence of the cDNA clone contained in the plasmid
deposited as ATCC.RTM. Deposit No. 209038 or as shown in SEQ ID
NO:5. By a fragment at least 20 nt in length, for example, is
intended fragments which include 20 or more contiguous bases from
the nucleotide sequence of the deposited cDNA or the nucleotide
sequence as shown in SEQ ID NO:1 or SEQ ID NO:5.
[0031] In a more specific embodiment, the nucleic acid molecules of
the present invention do not include the sequences, nucleic acid
molecules (e.g., clones), or nucleic acid inserts identified in one
or more of the following GenBank Accession Reports: AA001257,
AA151642, AA149562, C05730, AA565691, AA467756, D83882, AA002262,
AA115793, AA467995, AA115792, AA467938, W60406, AA358042, AA468056,
W23795, AA358043, T93307, AA453850, AA379905, AA296229, H15978,
AA501289, AA296309, AA296174, T30922, T48754, AA453766, C05795,
AA198928, N94588, H15052, Z42895, F13176, W52946, AA558404,
AA070614, AA613966, AA525331, AA663074, AA135811, AA526099,
AA302978, H68343, AA610255, AA229005, T05118, T30864, AA302968, or
AA364006, all of which are incorporated herein by reference.
[0032] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the I-FLICE-1 protein. In particular, such nucleic acid fragments
of the present invention include nucleic acid molecules encoding: a
polypeptide comprising amino acid residues from about 41 to about
92 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 155 to about 249 in SEQ ID NO:2; a polypeptide
comprising amino acid residues from about 332 to about 474 in SEQ
ID NO:2. The inventors have determined that the above polypeptide
fragments are antigenic regions of the I-FLICE-1 protein. Methods
for determining other such epitope-bearing portions of the
I-FLICE-1 protein are described in detail below.
[0033] Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of
the I-FLICE-2 protein. In particular, such nucleic acid fragments
of the present invention include nucleic acid molecules encoding: a
polypeptide comprising amino acid residues from about 62 to about
136 in SEQ ID NO:6; a polypeptide comprising amino acid residues
from about 184 to about 193 in SEQ ID NO:6; a polypeptide
comprising amino acid residues from about 205 to about 341 in SEQ
ID NO:6. The inventors have determined that the above polypeptide
fragments are antigenic regions of the I-FLICE-2 protein. Methods
for determining other such epitope-bearing portions of the
I-FLICE-2 protein are described in detail below.
[0034] In another aspect, the invention provides an isolated
nucleic acid molecule comprising a polynucleotide which hybridizes
under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention
described above, for instance, the cDNA clones contained in
ATCC.RTM. Deposit 209041 or ATCC.RTM. Deposit 209038. By "stringent
hybridization conditions" is intended overnight incubation at
42.degree. C. in a solution comprising: 50% formamide, 5.times.SSC
(750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH
7.6), 5.times. Denhardt's solution, 10% dextran sulfate, and 20
.mu.g/ml denatured, sheared salmon sperm DNA, followed by washing
the filters in 0.1.times.SSC at about 65.degree. C.
[0035] By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA)
hybridizing to at least about 15 nucleotides (nt), and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably about 30-70 nt of the
reference polynucleotide. These are useful as diagnostic probes and
primers as discussed above and in more detail below.
[0036] By a portion of a polynucleotide of "at least 20 nt in
length," for example, is intended 20 or more contiguous nucleotides
from the nucleotide sequence of the reference polynucleotide (e.g.,
the deposited cDNAs or the nucleotide sequence as shown in SEQ ID
NO:1 or SEQ ID NO:5). Of course, a polynucleotide which hybridizes
only to a poly A sequence (such as the 3' terminal poly(A) tract of
the I-FLICE-1 cDNA shown in SEQ ID NO:1 or the I-FLICE-2 cDNA shown
in SEQ ID NO:5), or to a complementary stretch of T (or U) resides,
would not be included in a polynucleotide of the invention used to
hybridize to a portion of a nucleic acid of the invention, since
such a polynucleotide would hybridize to any nucleic acid molecule
containing a poly (A) stretch or the complement thereof (e.g.,
practically any double-stranded cDNA clone).
[0037] As indicated, nucleic acid molecules of the present
invention which encode an I-FLICE-1 or I-FLICE-2 polypeptide may
include, but are not limited to those encoding the amino acid
sequence of the polypeptide, by itself; the coding sequence for the
mature polypeptide and additional sequences, such as those encoding
a secretory sequence, such as a pre-, or pro- or prepro- protein
sequence; the coding sequence of the polypeptide, with or without
the aforementioned additional coding sequences, together with
additional, non-coding sequences, including for example, but not
limited to introns and non-coding 5' and 3' sequences, such as the
transcribed, non-translated sequences that play a role in
transcription, mRNA processing, including splicing and
polyadenylation signals, for example--ribosome binding and
stability of mRNA; an additional coding sequence which codes for
additional amino acids, such as those which provide additional
functionalities. Thus, the sequence encoding the polypeptide may be
fused to a marker sequence, such as a sequence encoding a peptide
which facilitates purification of the fused polypeptide. In certain
preferred embodiments of this aspect of the invention, the marker
amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE vector (Qiagen, Inc.), among others, many of
which are commercially available. As described in Gentz et al.,
Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance,
hexa-histidine provides for convenient purification of the fusion
protein. The "HA" tag is another peptide useful for purification
which corresponds to an epitope derived from the influenza
hemagglutinin protein, which has been described by Wilson et al.,
Cell 37:767-778 (1984). As discussed below, other such fusion
proteins include the I-FLICE-1 or I-FLICE-2 fused to Fc at the N-
or C-terminus.
[0038] The present invention further relates to variants of the
nucleic acid molecules of the present invention, which encode
portions, analogs or derivatives of the I-FLICE-1 or I-FLICE-2
protein. Variants may occur naturally, such as a natural allelic
variant. By an "allelic variant" is intended one of several
alternate forms of a gene occupying a given locus on a chromosome
of an organism. Genes II, Lewin, B., ed., John Wiley & Sons,
New York (1985). Non-naturally occurring variants may be produced
using art-known mutagenesis techniques.
[0039] Such variants include those produced by nucleotide
substitutions, deletions or additions, which may involve one or
more nucleotides. The variants may be altered in coding regions,
non-coding regions, or both. Alterations in the coding regions may
produce conservative or non-conservative amino acid substitutions,
deletions or additions. Especially preferred among these are silent
substitutions, additions and deletions, which do not alter the
properties and activities of the I-FLICE-1 or I-FLICE-2 protein or
portions thereof. Also especially preferred in this regard are
conservative substitutions.
[0040] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 95%, 96%, 97%, 98% or 99% identical to
(a) a nucleotide sequence encoding the polypeptide having the amino
acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding
the polypeptide having the amino acid sequence in SEQ ID NO:2, but
lacking the N-terminal methionine; (c) a nucleotide sequence
encoding the polypeptide having the amino acid sequence encoded by
the cDNA clone contained in ATCC.RTM. Deposit No. 209041; or (d) a
nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), or (c).
[0041] Further embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 95%, 96%, 97%, 98% or 99% identical to
(a) a nucleotide sequence encoding the polypeptide having the amino
acid sequence in SEQ ID NO:6; (b) a nucleotide sequence encoding
the polypeptide having the amino acid sequence in SEQ ID NO:6, but
lacking the N-terminal methionine; (c) a nucleotide sequence
encoding the polypeptide having the amino acid sequence encoded by
the cDNA clone contained in ATCC.RTM. Deposit No. 209038; or (d) a
nucleotide sequence complementary to any of the nucleotide
sequences in (a), (b), or (c).
[0042] Additional embodiments of the invention include isolated
nucleic acid molecules comprising a polynucleotide having a
nucleotide sequence at least 95%, 96%, 97%, 98% or 99% identical to
(a) a nucleotide sequence encoding a polypeptide comprising amino
acids from about 1 to about 75 in SEQ ID NO:2; (b) a nucleotide
sequence encoding a polypeptide comprising amino acids from about
91 to about 171 in SEQ ID NO:2; (c) a nucleotide sequence encoding
a polypeptide comprising amino acids from about 172 to about 375 in
SEQ ID NO:2; (d) a nucleotide sequence encoding a polypeptide
comprising amino acids from about 376 to about 480 in SEQ ID NO:2;
(e) a nucleotide sequence encoding a polypeptide comprising amino
acids from about 1 to about 75 in SEQ ID NO:6; (f) a nucleotide
sequence encoding a polypeptide comprising amino acids from about
76 to about 252 in SEQ ID NO:6; (g) a nucleotide sequence encoding
a polypeptide comprising amino acids from about 253 to about 348 in
SEQ ID NO:6; (h) or a nucleotide sequence complementary to any of
the nucleotide sequences in (a), (b), (c), (d), (e), (f), or
(g).
[0043] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence
encoding an I-FLICE polypeptide is intended that the nucleotide
sequence of the polynucleotide is identical to the reference
sequence except that the polynucleotide sequence may include up to
five point mutations per each 100 nucleotides of the reference
nucleotide sequence encoding an I-FLICE polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of
the nucleotides in the reference sequence maybe deleted or
substituted with another nucleotide, or a number of nucleotides up
to 5% of the total nucleotides in the reference sequence may be
inserted into the reference sequence. These mutations of the
reference sequence may occur at the 5' or 3' terminal positions of
the reference nucleotide sequence or anywhere between those
terminal positions, interspersed either individually among
nucleotides in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0044] As a practical matter, whether any particular nucleic acid
molecule is at least 95%, 96%, 97%, 98% or 99% identical to, for
instance, the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID
NO:5 or to the nucleotides sequence of the deposited cDNA clone can
be determined conventionally using known computer programs such as
the BESTFIT.RTM. program (Wisconsin Sequence Analysis Package,
Version 8 for Unix, Genetics Computer Group, University Research
Park, 575 Science Drive, Madison, Wis. 53711). BESTFIT.RTM. uses
the local homology algorithm of Smith and Waterman, Advances in
Applied Mathematics 2:482-489 (1981), to find the best segment of
homology between two sequences. When using BESTFIT.RTM. or any
other sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference nucleotide sequence that gaps in
homology of up to 5% of the total number of nucleotides in the
reference sequence are allowed.
[0045] The present application is directed to nucleic acid
molecules at least 95%, 96%, 97%, 98% or 99% identical to the
nucleic acid sequence shown in SEQ ID NO:1 or SEQ ID NO:5 or to the
nucleic acid sequence of the deposited cDNAs, irrespective of
whether they encode a polypeptide having I-FLICE activity. This is
because even where a particular nucleic acid molecule does not
encode a polypeptide having I-FLICE activity, one of skill in the
art would still know how to use the nucleic acid molecule, for
instance, as a hybridization probe or a polymerase chain reaction
(PCR) primer. Uses of the nucleic acid molecules of the present
invention that do not encode a polypeptide having I-FLICE activity
include, inter alia, (1) isolating the I-FLICE-1 or I-FLICE-2 gene
or allelic variants thereof in a cDNA library; (2) in situ
hybridization (e.g., "FISH") to metaphase chromosomal spreads to
provide precise chromosomal location of the I-FLICE-1 or I-FLICE-2
gene, as described in Verma et al., Human Chromosomes: A Manual of
Basic Techniques, Pergamon Press, N.Y. (1988); and (3) Northern
Blot analysis for detecting I-FLICE-1 or I-FLICE-2 mRNA expression
in specific tissues.
[0046] Preferred, however, are nucleic acid molecules having
sequences at least 95%, 96%, 97%, 98% or 99% identical to a nucleic
acid sequence shown in SEQ ID NO:1 or SEQ ID NO:5 or to a nucleic
acid sequence of the deposited cDNA which do, in fact, encode a
polypeptide having I-FLICE protein activity. By "a polypeptide
having I-FLICE activity" is intended polypeptides exhibiting
I-FLICE-1 or I-FLICE-2 activity in a particular biological assay.
For example, I-FLICE-1 or I-FLICE-2 protein activity can be
measured using the cell death assay as described in Example 6.
[0047] Of course, due to the degeneracy of the genetic code, one of
ordinary skill in the art will immediately recognize that a large
number of the nucleic acid molecules having a sequence at least
95%, 96%, 97%, 98%, or 99% identical to a nucleic acid sequence of
the deposited cDNA or a nucleic acid sequence shown in SEQ ID NO:1
or SEQ ID NO:5 will encode "a polypeptide having I-FLICE activity."
In fact, since degenerate variants of these nucleotide sequences
all encode the same polypeptide, this will be clear to the skilled
artisan even without performing the above described comparison
assay. It will be further recognized in the art that, for such
nucleic acid molecules that are not degenerate variants, a
reasonable number will also encode a polypeptide having I-FLICE
activity. This is because the skilled artisan is fully aware of
amino acid substitutions that are either less likely or not likely
to significantly effect protein function (e.g., replacing one
aliphatic amino acid with a second aliphatic amino acid).
[0048] For example, guidance concerning how to make phenotypically
silent amino acid substitutions is provided in Bowie, J. U. et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990), wherein the
authors indicate that proteins are surprisingly tolerant of amino
acid substitutions.
Vectors and Host Cells
[0049] The present invention also relates to vectors which include
the isolated DNA molecules of the present invention, host cells
which are genetically engineered with the recombinant vectors, and
the production of I-FLICE-1 or I-FLICE-2 polypeptides or fragments
thereof by recombinant techniques.
[0050] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0051] The DNA insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp and tac promoters, the SV40 early and late promoters
and promoters of retroviral LTRs, to name a few. Other suitable
promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site
for translation. The coding portion of the mature transcripts
expressed by the constructs will preferably include a translation
initiating at the beginning and a termination codon (UAA, UGA or
UAG) appropriately positioned at the end of the polypeptide to be
translated.
[0052] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture and
tetracycline or ampicillin resistance genes for culturing in E.
coli and other bacteria. Representative examples of appropriate
hosts include, but are not limited to, bacterial cells, such as E.
coli, Streptomyces and Salmonella typhimurium cells; fungal cells,
such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes
melanoma cells; and plant cells. Appropriate culture mediums and
conditions for the above-described host cells are known in the
art.
[0053] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from Qiagen; pBS vectors,
PHAGESCRIPT.TM. vectors, BLUESCRIPT.RTM. vectors, pNH8A, pNH16a,
pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3,
pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred
eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG
available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available
from Pharmacia. Other suitable vectors will be readily apparent to
the skilled artisan.
[0054] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986).
[0055] The polypeptide may be expressed in a modified form, such as
a fusion protein, and may include not only secretion signals, but
also additional heterologous functional regions. For instance, a
region of additional amino acids, particularly charged amino acids,
may be added to the N-terminus of the polypeptide to improve
stability and persistence in the host cell, during purification, or
during subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to polypeptides to
engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine
techniques in the art. A preferred fusion protein comprises a
heterologous region from immunoglobulin that is useful to
solubilize proteins. For example, EP-A-O 464 533 (Canadian
counterpart 2045869) discloses fusion proteins comprising various
portions of constant region of immunoglobin molecules together with
another human protein or part thereof. In many cases, the Fc part
in a fusion protein is thoroughly advantageous for use in therapy
and diagnosis and thus results, for example, in improved
pharmacokinetic properties (EP-A 0232 262). On the other hand, for
some uses it would be desirable to be able to delete the Fc part
after the fusion protein has been expressed, detected and purified
in the advantageous manner described. This is the case when Fc
portion proves to be a hindrance to use in therapy and diagnosis,
for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such
as, hIL5-receptor has been fused with Fc portions for the purpose
of high-throughput screening assays to identify antagonists of
hIL-5. See, D. Bennett et al., Journal of Molecular Recognition,
Vol. 8:52-58 (1995) and K. Johanson et al., The Journal of
Biological Chemistry, Vol. 270, No. 16:9459-9471 (1995).
[0056] The I-FLICE-1 or I-FLICE-2 protein can be recovered and
purified from recombinant cell cultures by well-known methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification. Polypeptides of the present invention include
naturally purified products, products of chemical synthetic
procedures, and products produced by recombinant techniques from a
prokaryotic or eukaryotic host, including, for example, bacterial,
yeast, higher plant, insect and mammalian cells. Depending upon the
host employed in a recombinant production procedure, the
polypeptides of the present invention may be glycosylated or may be
non-glycosylated. In addition, polypeptides of the invention may
also include an initial modified methionine residue, in some cases
as a result of host-mediated processes.
I-FLICE-1 and I-FLICE-2 Polypeptides and Fragments
[0057] The invention further provides an isolated I-FLICE-1 or
I-FLICE-2 polypeptide having the amino acid sequence encoded by the
deposited cDNAs, or the amino acid sequence in SEQ ID NO:2 or SEQ
ID NO:6, or a peptide or polypeptide comprising a portion of the
above polypeptides.
[0058] It will be recognized in the art that some amino acid
sequences of the I-FLICE-1 or I-FLICE-2 polypeptide can be varied
without significant effect of the structure or function of the
protein. If such differences in sequence are contemplated, it
should be remembered that there will be critical areas on the
protein which determine activity.
[0059] Thus, the invention further includes variations of the
I-FLICE-1 or I-FLICE-2 polypeptide which show substantial I-FLICE-1
or I-FLICE-2 polypeptide activity or which include regions of
I-FLICE-1 or I-FLICE-2 protein such as the protein portions
discussed below. Such mutants include deletions, insertions,
inversions, repeats, and type substitutions. As indicated above,
guidance concerning which amino acid changes are likely to be
phenotypically silent can be found in Bowie, J. U., et al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino
Acid Substitutions," Science 247:1306-1310 (1990).
[0060] Thus, the fragment, derivative or analog of the polypeptide
of SEQ ID NO:2 or SEQ ID NO:6, or that encoded by the deposited
cDNAs, may be (i) one in which one or more of the amino acid
residues are substituted with a conserved or non-conserved amino
acid residue (preferably a conserved amino acid residue) and such
substituted amino acid residue may or may not be one encoded by the
genetic code, or (ii) one in which one or more of the amino acid
residues includes a substituent group, or (iii) one in which the
mature polypeptide is fused with another compound, such as a
compound to increase the half-life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino
acids are fused to the mature polypeptide, such as an IgG Fc fusion
region peptide or leader or secretory sequence or a sequence which
is employed for purification of the mature polypeptide or a
proprotein sequence. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the
teachings herein.
[0061] Of particular interest are substitutions of charged amino
acids with another charged amino acid and with neutral or
negatively charged amino acids. The latter results in proteins with
reduced positive charge to improve the characteristics of the
I-FLICE-1 or I-FLICE-2 protein. The prevention of aggregation is
highly desirable. Aggregation of proteins not only results in a
loss of activity but can also be problematic when preparing
pharmaceutical formulations, because they can be immunogenic.
(Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et
al., Diabetes 36:838-845 (1987); Cleland et al. Crit. Rev.
Therapeutic Drug Carrier Systems 10:307-377 (1993)).
[0062] The replacement of amino acids can also change the
selectivity of binding to cell surface receptors. Ostade et al.,
Nature 361:266-268 (1993) describes certain mutations resulting in
selective binding of TNF-.alpha. to only one of the two known types
of TNF receptors. Thus, the I-FLICE-1 or I-FLICE-2 of the present
invention may include one or more amino acid substitutions,
deletions or additions, either from natural mutations or human
manipulation.
[0063] As indicated, changes are preferably of a minor nature, such
as conservative amino acid substitutions that do not significantly
affect the folding or activity of the protein (see Table 1).
TABLE-US-00001 TABLE 1 Conservative Amino Acid Substitutions.
Aromatic Phenylalanine Tryptophan Tyrosine Hydrophobic Leucine
Isoleucine Valine Polar Glutamine Asparagine Basic Arginine Lysine
Histidine Acidic Aspartic Acid Glutamic Acid Small Alanine Serine
Threonine Methionine Glycine
[0064] Of course, the number of amino acid substitutions a skilled
artisan would make depends on many factors, including those
described above and below. Generally speaking, the number of
substitutions for any given I-FLICE-1 or I-FLICE-2 polypeptide, or
mutant thereof, will not be more than 50, 40, 30, 20, 10, 5, or 3,
depending on the objective.
[0065] Amino acids in the I-FLICE-1 or I-FLICE-2 protein of the
present invention that are essential for function can be identified
by methods known in the art, such as site-directed mutagenesis or
alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081 -1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. Sites that are
critical for ligand interactions can also be determined by
structural analysis such as crystallization, nuclear magnetic
resonance or photoaffinity labeling (Smith et al., J. Mol. Biol.
224:899-904 (1992) and de Vos et al. Science 255:306-312
(1992)).
[0066] The polypeptides of the present invention are preferably
provided in an isolated form. By "isolated polypeptide" is intended
a polypeptide removed from its native environment. Thus, a
polypeptide produced and/or contained within a recombinant host
cell is considered isolated for purposes of the present invention.
Also intended as an "isolated polypeptide" are polypeptides that
have been purified, partially or substantially, from a recombinant
host cell. For example, a recombinantly produced version of the
I-FLICE-1 or I-FLICE-2 polypeptide can be substantially purified by
the one-step method described in Smith and Johnson, Gene 67:31-40
(1988).
[0067] The polypeptides of the present invention include the
polypeptide encoded by the deposited cDNA; a polypeptide comprising
amino acids about 1 to about 480 in SEQ ID NO:2; a polypeptide
comprising amino acids about 2 to about 480 in SEQ ID NO:2; as well
as polypeptides which are at least 95% identical, still more
preferably at least 96%, 97%, 98% or 99% identical to those
described above and also include portions of such polypeptides with
at least 30 amino acids and more preferably at least 50 amino
acids.
[0068] The polypeptides of the present invention also include the
polypeptide encoded by the deposited cDNA; a polypeptide comprising
amino acids about 1 to about 348 in SEQ ID NO:6; a polypeptide
comprising amino acids about 2 to about 348 in SEQ ID NO:6; as well
as polypeptides which are at least 95% identical, still more
preferably at least 96%, 97%, 98% or 99% identical to those
described above and also include portions of such polypeptides with
at least 30 amino acids and more preferably at least 50 amino
acids.
[0069] The polypeptides of the present invention further include
the polypeptide comprising amino acids from about 1 to about 75 in
SEQ ID NO:2; amino acids from about 91 to about 171 in SEQ ID NO:2;
amino acids from about 172 to about 375 in SEQ ID NO:2; amino acids
from about 376 to about 480 in SEQ ID NO:2; amino acids from about
1 to about 75 in SEQ ID NO:6; amino acids from about 76 to about
252 in SEQ ID NO:6; amino acids from about 253 to about 348 in SEQ
ID NO:6; as well as polypeptides which are at least 95% identical,
still more preferably at least 96%, 97%, 98% or 99% identical to
those described above and also include portions of such
polypeptides with at least 30 amino acids and more preferably at
least 50 amino acids.
[0070] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a reference amino acid sequence of an
I-FLICE-1 or I-FLICE-2 polypeptide is intended that the amino acid
sequence of the polypeptide is identical to the reference sequence
except that the polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the reference amino
acid of the I-FLICE-1 or I-FLICE-2 polypeptide. In other words, to
obtain a polypeptide having an amino acid sequence at least 95%
identical to a reference amino acid sequence, up to 5% of the amino
acid residues in the reference sequence may be deleted or
substituted with another amino acid, or a number of amino acids up
to 5% of the total amino acid residues in the reference sequence
may be inserted into the reference sequence. These alterations of
the reference sequence may occur at the amino or carboxy terminal
positions of the reference amino acid sequence or anywhere between
those terminal positions, interspersed either individually among
residues in the reference sequence or in one or more contiguous
groups within the reference sequence.
[0071] As a practical matter, whether any particular polypeptide is
at least 95%, 96%, 97%, 98% or 99% identical to, for instance, the
amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:6 or to the
amino acid sequence encoded by deposited cDNA clones can be
determined conventionally using known computer programs such the
BESTFIT.RTM. program (Wisconsin Sequence Analysis Package, Version
8 for Unix, Genetics Computer Group, University Research Park, 575
Science Drive, Madison, Wis. 53711). When using BESTFIT.RTM. or any
other sequence alignment program to determine whether a particular
sequence is, for instance, 95% identical to a reference sequence
according to the present invention, the parameters are set, of
course, such that the percentage of identity is calculated over the
full length of the reference amino acid sequence and that gaps in
homology of up to 5% of the total number of amino acid residues in
the reference sequence are allowed.
[0072] The polypeptide of the present invention are useful as a
molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration columns using methods well known to those of skill in
the art.
[0073] in another aspect, the invention provides a peptide or
polypeptide comprising an epitope-bearing portion of a polypeptide
of the invention. The epitope of this polypeptide portion is an
immunogenic or antigenic epitope of a polypeptide described herein.
An "immunogenic epitope" is defined as a part of a protein that
elicits an antibody response when the whole protein is the
immunogen. On the other hand, a region of a protein molecule to
which an antibody can bind is defined as an "antigenic epitope."
The number of immunogenic epitopes of a protein generally is less
than the number of antigenic epitopes. See, for instance, Geysen et
al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983).
[0074] As to the selection of peptides or polypeptides bearing an
antigenic epitope (i.e., that contain a region of a protein
molecule to which an antibody can bind), it is well known in that
art that relatively short synthetic peptides that mimic part of a
protein sequence are routinely capable of eliciting an antiserum
that reacts with the partially mimicked protein. See, for instance,
Sutcliffe, J. G., Shinnick, T. M., Green, N. and Lerner, R. A.
(1983) Antibodies that react with predetermined sites on proteins.
Science 219:660-666. Peptides capable of eliciting protein-reactive
sera are frequently represented in the primary sequence of a
protein, can be characterized by a set of simple chemical rules,
and are confined neither to immunodominant regions of intact
proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl
terminals.
[0075] Antigenic epitope-bearing peptides and polypeptides of the
invention are therefore useful to raise antibodies, including
monoclonal antibodies, that bind specifically to a polypeptide of
the invention. See, for instance, Wilson et al., Cell 37:767-778
(1984) at 777.
[0076] Antigenic epitope-bearing peptides and polypeptides of the
invention preferably contain a sequence of at least seven, more
preferably at least nine and most preferably between about at least
about 15 to about 30 amino acids contained within the amino acid
sequence of a polypeptide of the invention. Non-limiting examples
of antigenic polypeptides or peptides that can be used to generate
I-FLICE-1 -specific antibodies include: a polypeptide comprising
amino acid residues from about 41 to about 92 in SEQ ID NO:2; a
polypeptide comprising amino acid residues from about 155 to about
249 in SEQ ID NO:2; a polypeptide comprising amino acid residues
from about 332 to about 474 in SEQ ID NO:2. As indicated above, the
inventors have determined that the above polypeptide fragments are
antigenic regions of the I-FLICE-1 protein.
[0077] Non-limiting examples of antigenic polypeptides or peptides
that can be used to generate I-FLICE-2 -specific antibodies
include: a polypeptide comprising amino acid residues from about 62
to about 136 in SEQ ID NO:6; a polypeptide comprising amino acid
residues from about 184 to about 193 in SEQ ID NO:6; a polypeptide
comprising amino acid residues from about 205 to about 341 in SEQ
ID NO:6. The inventors have determined that the above polypeptide
fragments are antigenic regions of the I-FLICE-2 protein:
[0078] The epitope-bearing peptides and polypeptides of the
invention may be produced by any conventional means. Houghten, R.
A. (1985) General method for the rapid solid-phase synthesis of
large numbers of peptides: specificity of antigen-antibody
interaction at the level of individual amino acids. Proc. Natl.
Acad. Sci. USA 82:5131-5135. This "Simultaneous Multiple Peptide
Synthesis (SMPS)" process is further described in U.S. Pat. No.
4,631,211 to Houghten et al. (1986).
[0079] As one of skill in the art will appreciate, I-FLICE-1 or
I-FLICE-2 polypeptides of the present invention and the
epitope-bearing fragments thereof described above can be combined
with parts of the constant domain of immunoglobulins (IgG),
resulting in chimeric polypeptides. These fusion proteins
facilitate purification and show an increased half-life in vivo.
This has been shown, e.g., for chimeric proteins consisting of the
first two domains of the human CD4-polypeptide and various domains
of the constant regions of the heavy or light chains of mammalian
immunoglobulins (EPA 394,827; Traunecker et al., Nature 331:84-86
(1988)). Fusion proteins that have adisulfide-linked dimeric
structure due to the IgG part can also be more efficient in binding
and neutralizing other molecules than the monomeric I-FLICE-1 or
I-FLICE-2 protein or protein fragment alone (Fountoulakis et al.,
J. Biochem 270:3958-3964 (1995)).
Disease Diagnosis and Prognosis
[0080] It is believed that certain tissues in mammals with specific
disease states associated with aberrant cell survival express
significantly altered levels of I-FLICE-1 or I-FLICE-2 and mRNA
encoding I-FLICE-1 or I-FLICE-2 when compared to a corresponding
"standard" mammal, i.e., a mammal of the same species not having
the disease state. Thus, the present invention is useful for
detecting such states in mammals. Preferred mammals include
monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans.
Particularly preferred are humans.
[0081] It is further believed that enhanced levels of I-FLICE-1 or
I-FLICE-2 can be detected in certain body fluids (e.g., sera,
plasma, urine, and spinal fluid) from mammals with the disease
state when compared to analogous fluids from mammals of the same
species not having the disease state. Thus, the invention provides
a diagnostic method useful during diagnco,sis of disease states,
which involves assaying the expression level of the gene encoding
I-FLICE-1 or I-FLICE-2 in mammalian cells or body fluid and
comparing the gene expression level with a standard I-FLICE-1 or
I-FLICE-2, whereby an increase or decrease in the gene expression
level over the standard is indicative of certain disease states
associated with aberrant cell survival.
[0082] Where diagnosis of a disease state involving I-FLICE-1 or
I-FLICE-2 of the present invention has already been made according
to conventional methods, the present invention is useful as a
prognostic indicator, whereby patients exhibiting significantly
aberrant I-FLICE-1 or I-FLICE-2 gene expression levels will
experience a worse clinical outcome relative to patients expressing
the gene at a lower level.
[0083] By "assaying the expression level of the gene encoding
I-FLICE-1 or I-FLICE-2" is intended qualitatively or quantitatively
measuring or estimating the level of I-FLICE-1 or I-FLICE-2 protein
or the level of the mRNA encoding I-FLICE-1 or I-FLICE-2 protein in
a first biological sample either directly (e.g., by determining or
estimating absolute protein level or mRNA level) or relatively
(e.g., by comparing to the I-FLICE-1 or I-FLICE-2 protein level or
mRNA level in a second biological sample).
[0084] Preferably, the I-FLICE-1 or I-FLICE-2 protein level or mRNA
level in the first biological sample is measured or estimated and
compared to a standard I-FLICE-1 or I-FLICE-2 protein level or mRNA
level, the standard being taken from a second biological sample
obtained from an individual not having the disease state. As will
be appreciated in the art, once a standard I-FLICE-1 or I-FLICE-2
protein level or mRNA level is known, it can be used repeatedly as
a standard for comparison.
[0085] By "biological sample" is intended any biological sample
obtained from an individual, cell line, tissue culture, or other
source which contains I-FLICE-1 or I-FLICE-2 protein or mRNA.
Biological samples include mammalian body fluids (such as sera,
plasma, urine, synovial fluid and spinal fluid) which contain
I-FLICE-1 or I-FLICE-2 protein, and ovarian, prostate, heart,
placenta, pancreas liver, spleen, lung, breast, umbilical tissue,
and other tissues. Methods for obtaining tissue biopsies and body
fluids from mammals are well known in the art. Where the biological
sample is to include mRNA, a tissue biopsy is the preferred
source.
[0086] Diseases associated with increased cell survival, or the
inhibition of apoptosis, include cancers (such as follicular
lymphomas, carcinomas with p53 mutations, hormone-dependent tumors,
and cancers of the breast, ovary, prostate, bone, liver, lung,
pancreas, and spleen); autoimmune disorders (such as systemic lupus
erythematosus and immune-related glomerulonephritis rheumatoid
arthritis) and viral infections (such as herpes viruses, pox
viruses and adenoviruses), information graft v. host disease, acute
graft rejection, and chronic graft rejection. Diseases associated
with decreased cell survival, or increased apoptosis, include
Alzheimer's disease, Parkinson's disease, rheumatoid arthritis,
septic shock, sepsis, stroke, CNS inflammation, osteoporosis,
ischemia, reperfusion injury, cell death associated with
cardiovascular disease, polycystic kidney disease, apoptosis of
endothelial cells in cardiovascular disease, degenerative liver
disease, MS and head injury damage.
[0087] Assays available to detect levels of proteins are well known
to those of skill in the art, for example, radioimmunoassays,
competitive-binding assays, Western blot analysis, and preferably
an ELISA assay may be employed.
[0088] I-FLICE-1 or I-FLICE-2 specific antibodies can be raised
against the intact I-FLICE-1 or I-FLICE-2 protein or an antigenic
polypeptide fragment thereof, which may presented together with a
carrier protein, such as an albumin, to an animal system (such as
rabbit or mouse) or, if it is long enough (at least about 25 amino
acids), without a carrier.
[0089] As used herein, the term "antibody" (Ab) or "monoclonal
antibody" (mAb) is meant to include intact molecules as well as
antibody fragments (such as, for example, Fab and F(ab').sub.2
fragments) which are capable of specifically binding to the
I-FLICE-1 or I-FLICE-2 protein. Fab and F(ab').sub.2 fragments lack
the Fc fragment of intact antibody, clear more rapidly from the
circulation, and may have less non-specific tissue binding of an
intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).
Thus, these fragments are preferred.
[0090] The antibodies of the present invention may be prepared by
any of a variety of methods. For example, cells expressing the
I-FLICE-1 or I-FLICE-2 protein or an antigenic fragment thereof can
be administered to an animal in order to induce the production of
sera containing polyclonal antibodies. In a preferred method, a
preparation of I-FLICE-1 or I-FLICE-2 protein is prepared and
purified to render it substantially free of natural contaminants.
Such a preparation is then introduced into an animal in order to
produce polyclonal antisera of greater specific activity.
[0091] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or I-FLICE-1 or I-FLICE-2
protein binding fragments thereof). Such monoclonal antibodies can
be prepared using hybridoma technology (Kohler et al., Nature
256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976);
Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al.,
In: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y.,
(1981) pp. 563-681).
[0092] Assaying I-FLICE-1 or I-FLICE-2 protein levels in a
biological sample can occur using antibody-based techniques. For
example, I-FLICE-1 or I-FLICE-2 protein expression in tissues can
be studied with classical immunohistological methods (Jalkanen, M.,
et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J.
Cell. Biol. 105:3087-3096 (1987)).
[0093] As noted above, other antibody-based methods useful for
detecting I-FLICE-1 or I-FLICE-2 protein gene expression include
immunoassays, such as the enzyme linked immunosorbent assay (ELISA)
and the radioimmunoassay (RIA).
[0094] Suitable labels are known in the art and include enzyme
labels, such as, Glucose oxidase, and radioisotopes, such as iodine
(.sup.125I, .sup.121I), carbon (.sup.14C), sulfur (.sup.35S),
tritium (.sup.3H), indium (.sup.112In), and technetium
(.sup.99mTc), and fluorescent labels, such as fluorescein and
rhodamine, and biotin.
[0095] Total cellular RNA can be isolated from a biological sample
using the single-step guanidinium-thiocyanate-phenol-chloroform
method described in Chomczynski and Sacchi, Anal. Biochem.
162:156-159 (1987). Levels of mRNA encoding the I-FLICE-1 or
I-FLICE-2 protein are then assayed using any appropriate method.
These include Northern blot analysis (Harada et al., Cell
63:303-312 (1990)), S1 nuclease mapping (Fujita et al., Cell
49:357-367 (1987)), the polymerase chain reaction (PCR), reverse
transcription in combination with the polymerase chain reaction
(RT-PCR) (Makino et al., Technique 2:295-301 (1990)), and reverse
transcription in combination with the ligase chain reaction
(RT-LCR).
Agonists and Antagonists--Assays and Molecules
[0096] The invention also provides a method of screening compounds
to identify agonists and antagonists of I-FLICE-1 or I-FLICE-2. By
"agonist" is intended naturally occurring and synthetic compounds
capable of enhancing one or more activity mediated by I-FLICE-1 or
I-FLICE-2 polypeptides. By "antagonist" is intended naturally
occurring and synthetic compounds capable of inhibiting one or more
activity mediated by I-FLICE-1 or I-FLICE-2 polypeptides.
[0097] Thus, in a further aspect, a screening method is provided
for determining whether a candidate agonist or antagonist is
capable of enhancing or inhibiting a cellular activity of either an
I-FLICE-1 or I-FLICE-2 polypeptide. The method involves contacting
cells which express one or both of the I-FLICE-1 or I-FLICE-2
polypeptides with a candidate compound, assaying a cellular
response, and comparing the cellular response to a standard
cellular response, the standard being assayed in absence of the
candidate compound, whereby an increased cellular response over the
standard indicates that the candidate compound is an agonist of the
polypeptide activity and a decreased cellular response compared to
the standard indicates that the candidate compound is an antagonist
of the activity. By "assaying a cellular response" is intended
qualitatively or quantitatively measuring a cellular response in
the presence of a candidate compound and either an I-FLICE-1 or
I-FLICE-2 polypeptide (e.g., decreased or increased TNFR-1 or CD-95
induced apoptosis, binding of I-FLICE-1 or I-FLICE-2 to natural
cellular ligands such as FLICE and Mch4/FLICE2).
[0098] Potential antagonists include small organic molecules amino
acid sequences which bind to I-FLICE-1 or I-FLICE-2, fragments of
I-FLICE-1 and I-FLICE-2, as well as anti-I-FLICE-1 and
anti-I-FLICE-2 antibodies. Fragments of I-FLICE-1 and I-FLICE-2,
which may be naturally occurring or synthetic, antagonize I-FLICE-1
and I-FLICE-2 polypeptide mediated activities by competing for
binding to natural cellular ligands. Small organic molecules can
antagonize I-FLICE-1 and I-FLICE-2 polypeptide mediated activities
by binding either competitively or non-competitively to I-FLICE-1
or I-FLICE-2 or a cellular ligand of these proteins. Examples of
small molecules include but are not limited to nucleotide sequences
and small peptides or peptide-like molecules. Such molecules may be
produced and screened for activity by a variety of methods (e.g.,
Light and Lerner, Bioorganic & Medicinal Chemistry 3(7):955-967
(1995); Cheng et al., Gene 171:1-8 (1996); Gates et al., J. Mol.
Biol. 255:373-386 (1996)).
[0099] Similarly, potential agonists also include fragments of the
polypeptides of the present invention, as well as anti-I-FLICE-1
and anti-I-FLICE-2 antibodies. Fragments of these proteins can act
as agonists of I-FLICE-1 and I-FLICE-2 polypeptide mediated
activities by binding to natural cellular ligands and inducing
activities associated with the full-length protein. Agonists and
antagonists of the present invention also include amino acid
sequences having 95% or more identity to those shown in SEQ ID
NOs:2 and 6, or fragments thereof.
[0100] Other potential antagonists include antisense
oligonucleotides and oligonucleotides capable of forming triple
helices with the sequences shown in SEQ ID NOs:1 and 5' Once a gene
sequence is known, antisense and triple helix technologies can be
used to regulate gene expression. Okano, J. Neurochem. 56:560
(1991); OLIGONUCLEOTIDES AS INHIBITORS OF GENE EXPRESSION, CRC
Press, Boca Raton, Fla. (1988); Dervan et al., Science 251:1360
(1991); Cooney et al., Science 241:456 (1988); Lee et al., Nucl.
Acids Res. 6:3073 (1979). in regards to antisense technology, for
example, an oligonucleotide maybe designed which is complementary
to a portion of the I-FLICE-1 or I-FLICE-2 DNA sequences which is
transcribed into RNA. This oligonucleotide may be delivered to
cells in a number of forms, including as antisense RNA or
incorporated into an expression vector. If incorporated into an
expression vector, the oligonucleotide is generally orientated in a
manner that an RNA molecule is produced upon in vivo expression
which is complementary to that of the I-FLICE-1 or I-FLICE-2 mRNA
sequence. The expressed antisense RNA molecule will hybridize to
I-FLICE-1 or I-FLICE-2 mRNA and block translation in vivo.
[0101] The experiments set forth in Example 5 demonstrate that
I-FLICE-1 binds to both FLICE and Mch4/FLICE2. Immunoprecipitation
assays similar to that described in Example 5 can be used to
identify additional molecules which bind to I-FLICE-1 and
I-FLICE-2. Such binding molecules are candidate antagonists and
agonists.
[0102] Example 6 sets forth a cell death assay used to demonstrate
that overexpression of I-FLICE-1 results in the inhibition of
TNFR-1 and CD-95 induced cell death. This assay can also be used to
screen for compounds having agonistic and antagonistic activity
directed to I-FLICE-1 and I-FLICE-2. Such a screening method is
used to determine whether the compound increases or decreases
TNFR-1 and CD-95 induced cell death in the presence of I-FLICE-1 or
I-FLICE-2 either individually or in combination.
[0103] Proteins and other compounds which bind the I-FLICE-1 or
I-FLICE-2 polypeptide domains are also candidate agonists and
antagonists according to the present invention. Such binding
compounds can be "captured" using the yeast two-hybrid system
(Fields and Song, Nature 340:245-246 (1989); Gyuris et al., Cell
75:791-803 (1993); Zervos et al., Cell 72:223 -232 (1993)).
[0104] The agonists may be employed for instance to enhance the
action of I-FLICE-1 or I-FLICE-2 polypeptides, for example, in the
treatment of Alzheimer's disease, Parkinson's disease, rheumatoid
arthritis, septic shock, sepsis, stroke, CNS inflammation,
osteoporosis, ischemia, reperfusion injury, cell death associated
with cardiovascular disease, polycystic kidney disease, apoptosis
of endothelial cells in cardiovascular disease, degenerative liver
disease, MS and head injury damage.
[0105] The antagonists may be employed for instance to inhibit the
action of I-FLICE-1 or I-FLICE-2 polypeptides, for example, in the
treatment of cancers (such as follicular lymphomas, carcinomas with
p53 mutations, hormone-dependent tumors, and cancers of the breast,
ovary, prostate, bone, liver, lung, pancreas, and spleen);
autoimmune disorders (such as systemic lupus erythematosus and
immune-related glomerulonephritis rheumatoid arthritis) and viral
infections (such as herpes viruses, pox viruses and adenoviruses),
information graft v. host disease, acute graft rejection, and
chronic graft rejection.
[0106] The agonists and antagonists may be employed in a
composition with a pharmaceutically acceptable carrier, e.g., as
hereinafter described.
Therapeutics
[0107] The novel mammalian inhibitors designated I-FLICE-1 and
I-FLICE-2 (for inhibitor of FLICE) of the present invention, are
catalytically inactive structural homologues of FLICE and
Mch4/FLICE2 that inhibit both TNFR-1 and CD-95 induced apoptosis.
These are the first examples of a naturally occurring catalytically
inactive caspase that can act as a dominant negative inhibitor of
apoptosis. The polypeptides of the present invention are useful for
inhibiting apoptosis for therapeutic purposes, for example, in the
treatment of Alzheimer's disease, Parkinson's disease, rheumatoid
arthritis, septic shock, sepsis, stroke, CNS inflammation,
osteoporosis, ischemia, reperfusion injury, cell death associated
with cardiovascular disease, polycystic kidney disease, apoptosis
of endothelial cells in cardiovascular disease, degenerative liver
disease, MS and head injury damage.
Modes of Administration
[0108] It will be appreciated that conditions caused by a decrease
in the standard or normal level of I-FLICE-1 or I-FLICE-2 activity
in an individual, can be treated by administration of I-FLICE-1 or
I-FLICE-2 protein. Thus, the invention further provides a method of
treating an individual in need of an increased level of I-FLICE-1
or I-FLICE-2 activity comprising administering to such an
individual a pharmaceutical composition comprising an effective
amount of an isolated I-FLICE-1 or I-FLICE-2 polypeptide of the
invention, particularly a mature form of the I-FLICE-1 or
I-FLICE-2, effective to increase the I-FLICE-1 or I-FLICE-2
activity level in such an individual.
[0109] As a general proposition, the total pharmaceutically
effective amount of I-FLICE-1 or I-FLICE-2 polypeptide administered
parenterally per dose will be in the range of about 1 .mu.g/kg/day
to 10 mg/kg/day of patient body weight, although, as noted above,
this will be subject to therapeutic discretion. More preferably,
this dose is at least 0.01 mg/kg/day, and most preferably for
humans between about 0.01 and 1 mg/kg/day for the hormone. If given
continuously, the I-FLICE-1 or I-FLICE-2 polypeptide is typically
administered at a dose rate of about 1 .mu.g/kg/hour to about 50
.mu.g/kg/hour, either by 1-4 injections per day or by continuous
subcutaneous infusions, for example, using a mini-pump. An
intravenous bag solution may also be employed.
[0110] Pharmaceutical compositions containing the I-FLICE-1 or
I-FLICE-2 of the invention may be administered orally, rectally,
parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by powders, ointments, drops or transdermal patch),
bucally, or as an oral or nasal spray. By "pharmaceutically
acceptable carrier" is meant a non-toxic solid, semisolid or liquid
filler, diluent, encapsulating material or formulation auxiliary of
any type. The term "parenteral" as used herein refers to modes of
administration which include intravenous, intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and infusion.
Chromosome Assays
[0111] The nucleic acid molecules of the present invention are also
valuable for chromosome identification. The sequence is
specifically targeted to and can hybridize with a particular
location on an individual human chromosome. The mapping of DNAs to
chromosomes according to the present invention is an important
first step in correlating those sequences with genes associated
with disease.
[0112] In certain preferred embodiments in this regard, the cDNA
herein disclosed is used to clone genomic DNA of an I-FLICE-1 or
I-FLICE-2 protein gene. This can be accomplished using a variety of
well known techniques and libraries, which generally are available
commercially. The genomic DNA then is used for in situ chromosome
mapping using well known techniques for this purpose.
[0113] In addition, in some cases, sequences can be mapped to
chromosomes by preparing PCR primers (preferably 15-25 bp) from the
cDNA. Computer analysis of the 3' untranslated region of the gene
is used to rapidly select primers that do not span more than one
exon in the genomic DNA, thus complicating the amplification
process. These primers are then used for PCR screening of somatic
cell hybrids containing individual human chromosomes.
[0114] Fluorescence in situ hybridization ("FISH") of a cDNA clone
to a metaphase chromosomal spread can be used to provide a precise
chromosomal location in one step. This technique can be used with
probes from the cDNA as short as 50 or 60 bp. For a review of this
technique, see Verma et al., Human Chromosomes: A Manual Of Basic
Techniques, Pergamon Press, N.Y. (1988).
[0115] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. Such data are found, for
example, in V. McKusick, Mendelian Inheritance In Man, available
on-line through Johns Hopkins University, Welch Medical Library.
The relationship between genes and diseases that have been mapped
to the same chromosomal region are then identified through linkage
analysis (coinheritance of physically adjacent genes).
[0116] Next, it is necessary to determine the differences in the
cDNA or genomic sequence between affected and unaffected
individuals. If a mutation is observed in some or all of the
affected individuals but not in any normal individuals, then the
mutation is likely to be the causative agent of the disease.
[0117] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1(a)
Expression and Purification of I-FLICE-1 in E. coli
[0118] The bacterial expression vector pQE60 is used for bacterial
expression in this example. (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311). pQE60 encodes ampicillin antibiotic
resistance ("Amp.sup.r") and contains a bacterial origin of
replication ("ori"), an IPTG inducible promoter, a ribosome binding
site ("RBS"), six codons encoding histidine residues that allow
affinity purification using nickel-nitrilo-tri-acetic acid
("Ni-NTA") affinity resin sold by QIAGEN, Inc., supra, and suitable
single restriction enzyme cleavage sites. These elements are
arranged such that an inserted DNA fragment encoding a polypeptide
expresses that polypeptide with the six His residues (i.e., a "6 X
His tag") covalently linked to the carboxyl terminus of that
polypeptide.
[0119] The DNA sequence encoding the desired portion I-FLICE-1
protein is amplified from the deposited cDNA clone using PCR
oligonucleotide primers which anneal to the amino terminal
sequences of the desired portion of the I-FLICE-1 protein and to
sequences in the deposited construct 3' to the cDNA coding
sequence. Additional nucleotides containing restriction sites to
facilitate cloning in the pQE60 vector are added to the 5' and 3'
sequences, respectively.
[0120] For cloning the protein, the 5' primer has the sequence: 540
CGCCCATGGCTGAAGTCATCCATCAG 3' (SEQ ID NO:7) containing the
underlined NcoI restriction site followed by 16 (i.e., 275-291)
nucleotides complementary to the amino terminal coding sequence of
the I-FLICE-1 sequence in FIG. 1A-1B (SEQ ID NO:1). One of ordinary
skill in the art would appreciate, of course, that the point in the
protein coding sequence where the 5' primer begins may be varied to
amplify a DNA segment encoding any desired portion of the complete
protein in a shorter or longer form. The 3' primer has the
sequence: 5' CGCAAGCTTGTGCTGGGATTACAGGTG 3' (SEQ ID NO:8)
containing the underlined HindIII restriction site followed by 18
(i.e., 1740-1758) nucleotides complementary to the 3' end of the
coding sequence immediately before the stop codon in the I-FLICE-1
DNA sequence in FIG. 1A-1B (SEQ ID NO:1), with the coding sequence
aligned with the restriction site so as to maintain its reading
frame with that of the six His codons in the pQE60 vector.
[0121] The amplified I-FLICE-1 DNA fragment and the vector pQE60
are digested with NcoI/HindIII and the digested DNAs are then
ligated together. Insertion of the I-FLICE-1 DNA into the
restricted pQE60 vector places the I-FLICE-1 protein coding region
downstream from the IPTG-inducible promoter and in-frame with an
initiating AUG and the six histidine codons.
[0122] The ligation mixture is transformed into competent E. coli
cells using standard procedures such as those described in Sambrook
et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E.
coli strain M15/rep4, containing multiple copies of the plasmid
pREP4, which expresses the lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing I-FLICE-1 protein, is available
commercially from QIAGEN, Inc., supra. Transformants are identified
by their ability to grow on LB plates in the presence of ampicillin
and kanamycin. Plasmid DNA is isolated from resistant colonies and
the identity of the cloned DNA confirmed by restriction analysis,
PCR and DNA sequencing.
[0123] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 .mu.g/ml) and kanamycin (25 .mu.g/ml). The O/N
culture is used to inoculate a large culture, at a dilution of
approximately 1:25 to 1:250. The cells are grown to an optical
density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-b-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation.
[0124] The cells are then stirred for 3-4 hours at 4.degree. C. in
6 M guanidine-HCl, pH 8. The cell debris is removed by
centrifugation, and the supernatant containing the I-FLICE-1 is
loaded onto a nickel-nitrilo-tri-acetic acid ("NiNTA") affinity
resin column (available from QIAGEN, Inc., supra). Proteins with a
6 .times. His tag bind to the NI-NTA resin with high affinity and
can be purified in a simple one-step procedure (for details see:
The QIAexpressionist, 1995, QIAGEN, Inc., supra). Briefly the
supernatant is loaded onto the column in 6 M guanidine-HCl, pH8,
the column is first washed with 10 volumes of 6 M guanidine-HCl,
pH8, then washed with 10 volumes of 6 M guanidine-HCl pH6, and
finally the I-FLICE-1 is eluted with 6 M guanidine-HCl, pH5.
[0125] The purified protein is then renatured by dialyzing it
against phosphate buffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear 6M-1
M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH7.4,
containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins can be eluted by the addition of 250 mM imidazole.
Imidazole is removed by a final dialyzing step against PBS or 50 mM
sodium acetate pH6 buffer plus 200 mM NaCl. The purified protein is
stored at 4.degree. C. or frozen at -80.degree. C.
Example 1(b)
Expression and Purification of I-FLICE-2 in E. coli
[0126] The bacterial expression vector pQE60 is used for bacterial
expression in this example. (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311). pQE60 encodes ampicillin antibiotic
resistance ("Amp.sup.r") and contains a bacterial origin of
replication ("ori"), an IPTG inducible promoter, a ribosome binding
site ("RBS"), six codons encoding histidine residues that allow
affinity purification using nickel-nitrilo-tri-acetic acid
("Ni-NTA") affinity resin sold by QIAGEN, Inc., supra, and suitable
single restriction enzyme cleavage sites. These elements are
arranged such that an inserted DNA fragment encoding a polypeptide
expresses that polypeptide with the six His residues (i.e., a "6 X
His tag") covalently linked to the carboxyl terminus of that
polypeptide.
[0127] The DNA sequence encoding the desired portion I-FLICE-2
protein is amplified from the deposited cDNA clone using PCR
oligonucleotide primers which anneal to the amino terminal
sequences of the desired portion of the I-FLICE-2 protein and to
sequences in the deposited construct 3' to the cDNA coding
sequence. Additional nucleotides containing restriction sites to
facilitate cloning in the pQE60 vector are added to the 5' and 3'
sequences, respectively.
[0128] For cloning the protein, the 5' primer has the sequence: 5'
CGCCCATGGAGATTGGTGAGGATTTG 3' (SEQ ID NO:9) containing the
underlined NcoI restriction site followed by 17 (i.e., 311-328)
nucleotides complementary to the amino terminal coding sequence of
the I-FLICE-2 sequence in FIG. 4A-4C (SEQ ID NO:5). one of ordinary
skill in the art would appreciate, of course, that the point in the
protein coding sequence where the 5' primer begins may be varied to
amplify a DNA segment encoding any desired portion of the complete
protein in a shorter or longer form. The 3' primer has the
sequence: 5.degree. CGCAAGCTTAGAGCATGCAGTGTCAG 3' (SEQ ID NO:10)
containing the underlined HindIII restriction site followed by 16
(i.e., 1400-1416) nucleotides complementary to the 3' end of the
coding sequence immediately before the stop codon in the I-FLICE-2
DNA sequence in FIG. 4A-4C (SEQ ID NO:5), with the coding, sequence
aligned with the restriction site so as to maintain its reading
frame with that of the six His codons in the pQE60 vector.
[0129] The amplified I-FLICE-2 DNA fragment and the vector pQE60
are digested with NcoI/HindIII and the digested DNAs are then
ligated together. Insertion of the I-FLICE-2 DNA into the
restricted pQE60 vector places the I-FLICE-2 protein coding region
downstream from the IPTG-inducible promoter and in-frame with an
initiating AUG and the six histidine codons.
[0130] The ligation mixture is transformed into competent E. coli
cells using standard procedures such as those described in Sambrook
et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E.
coli strain M15/rep4, containing multiple copies of the plasmid
pREP4, which expresses the lac repressor and confers kanamycin
resistance ("Kan.sup.r"), is used in carrying out the illustrative
example described herein. This strain, which is only one of many
that are suitable for expressing I-FLICE-2 protein, is available
commercially from QIAGEN, Inc., supra. Transformants are identified
by their ability to grow on LB plates in the presence of ampicillin
and kanamycin. Plasmid DNA is isolated from resistant colonies and
the identity of the cloned DNA confirmed by restriction analysis,
PCR and DNA sequencing.
[0131] Clones containing the desired constructs are grown overnight
("O/N") in liquid culture in LB media supplemented with both
ampicillin (100 .mu.g/ml) and kanamycin (25 .mu.g/ml). The O/N
culture is used to inoculate a large culture, at a dilution of
approximately 1:25 to 1:250. The cells are grown to an optical
density at 600 nm ("OD600") of between 0.4 and 0.6.
Isopropyl-b-D-thiogalactopyranoside ("IPTG") is then added to a
final concentration of 1 mM to induce transcription from the lac
repressor sensitive promoter, by inactivating the lacI repressor.
Cells subsequently are incubated further for 3 to 4 hours. Cells
then are harvested by centrifugation.
[0132] The cells are then stirred for 3-4 hours at 4.degree. C. in
6M guanidine-HCl, pH8. The cell debris is removed by
centrifugation, and the supernatant containing the I-FLICE-2 is
loaded onto a nickel-nitrilo-tri-acetic acid ("NiNTA") affinity
resin column (available from QIAGEN, Inc., supra). Proteins with a
6.times. His tag bind to the NI-NTA resin with high affinity and
can be purified in a simple one-step procedure (for details see:
The QIAexpressionist, 1995, QIAGEN, Inc., supra). Briefly the
supernatant is loaded onto the column in 6 M guanidine-HCl, pH8,
the column is first washed with 10 volumes of 6 M guanidine-HCl,
pH8, then washed with 10 volumes of 6 M guanidine-HCl pH6, and
finally the I-FLICE-2 is eluted with 6 M guanidine-HCl, pH5.
[0133] The purified protein is then renatured by dialyzing it
against phosphate buffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl
pH7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins can be eluted by the addition of 250 mM imidazole.
Imidazole is removed by a final dialyzing step against PBS or 50 mM
sodium acetate pH6 buffer plus 200 mM NaCl. The purified protein is
stored at 4.degree. C. or frozen at -80.degree. C.
Example 2(a)
Cloning and Expression of I-FLICE-1 protein in a Baculovirus
Expression System
[0134] In this illustrative example, the plasmid shuttle vector pA2
is used to insert the cloned DNA encoding the complete protein into
a baculovirus to express the I-FLICE-1 protein, using standard
methods as described in Summers et al., A Manual of Methods for
Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by convenient restriction sites such as BamHI and Asp718. The
polyadenylation site of the simian virus 40 ("SV40") is used for
efficient polyadenylation. For easy selection of recombinant virus,
the plasmid contains the beta-galactosidase gene from E. coli under
control of a weak Drosophila promoter in the same orientation,
followed by the polyadenylation signal of the polyhedrin gene. The
inserted genes are flanked on both sides by viral sequences for
cell-mediated homologous recombination with wild-type viral DNA to
generate viable virus that express the cloned polynucleotide.
[0135] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39.
[0136] The cDNA sequence encoding the full length I-FLICE-1 protein
in the deposited clone, including the AUG initiation codon shown in
FIG. 1A-1B (SEQ ID NO:1), is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene. The
5' primer has the sequence: 5' CGCGGATCCGCCATCATGTCTGCTGAAGTCATC 3'
(SEQ ID NO:11) containing the underlined BamHI restriction enzyme
site, an efficient signal for initiation of translation in
eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 (1987), followed by 17 (i.e., 268-285) bases of the
sequence of the complete I-FLICE-1 protein shown in FIG. 1A-1B,
beginning with the AUG initiation codon. The 3' primer has the
sequence: 5' CGCGGTACCGTGCTGGGATTACAGGTG 3' (SEQ ID NO:12)
containing the underlined, Asp718 restriction site followed by 18
(1740-1758) nucleotides complementary to the 3' noncoding sequence
in FIG. 1A-1B (SEQ ID NO:1).
[0137] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("GENECLEAN.RTM." BIO 101 Inc.,
La Jolla, Calif.). The fragment then is digested with BamHI and
Asp718 and again is purified on a 1% agarose gel. This fragment is
designated herein "F1".
[0138] The plasmid is digested with the restriction enzymes BamHI
and Asp718 and optionally, can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("GENECLEAN.RTM." BIO 101 Inc., La Jolla, Calif.).
This vector DNA is designated herein "V1".
[0139] Fragment F1 and the dephosphorylated plasmid V1 are ligated
together with T4 DNA ligase. E. coli HB 101 or other suitable E.
coli hosts such as XL-1 BLUE.RTM. (Stratagene Cloning Systems, La
Jolla, Calif.) cells are transformed with the ligation mixture and
spread on culture plates. Bacteria are identified that contain the
plasmid with the human I-FLICE-1 gene using the PCR method, in
which one of the primers that is used to amplify the gene and the
second primer is from well within the vector so that only those
bacterial colonies containing the I-FLICE-1 gene fragment will show
amplification of the DNA. The sequence of the cloned fragment is
confirmed by DNA sequencing. This plasmid is designated herein pBac
I-FLICE-1.
[0140] Five .mu.g of the plasmid pBac I-FLICE-1 is co-transfected
with 1.0 .mu.g of a commercially available linearized baculovirus
DNA ("BACULOGOLD.TM. baculovirus DNA", Pharminogen, San Diego,
Calif.), using the lipofection method described by Felgner et al.,
Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987). 1 .infin.g of
BACULOGOLD.TM. virus DNA and 5 .mu.g of the plasmid pBac I-FLICE-1
are mixed in a sterile well of a microtiter plate containing 50
.mu.l of serum-free Grace's medium (Life Technologies Inc.,
Gaithersburg, Md.). Afterwards, 10 .mu.l LIPOFECTIN.RTM. plus 90
.mu.l Grace's medium are added, mixed and incubated for 15 minutes
at room temperature. Then the transfection mixture is added
drop-wise to Sf9 insect cells (ATCC.RTM. CRL 1711) seeded in a 35
mm tissue culture plate with 1 ml Grace's medium without serum. The
plate is rocked back and forth to mix the newly added solution. The
plate is then incubated for 5 hours at 27.degree. C. After 5 hours
the transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum is
added. The plate is put back into an incubator and cultivation is
continued at 27.degree. C. for four days.
[0141] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "BLUE GAL.RTM." (Life Technologies Inc.,
Gaithersburg) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10). After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C. The recombinant virus is called V- I-FLICE-1.
[0142] To verify the expression of the I-FLICE-1 gene, Sf9 cells
are grown in Grace's medium supplemented with 10% heat inactivated
FBS. The cells are infected with the recombinant baculovirus
V-I-FLICE-1 at a multiplicity of infection ("MOI") of about 2. Six
hours later the medium is removed and is replaced with SF9001 II
medium minus methionine and cysteine (available from Life
Technologies Inc., Rockville, Md.). If radiolabeled proteins are
desired, 42 hours later, 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S-cysteine (available from Amersham) are added. The
cells are further incubated for 16 hours and then they are
harvested by centrifugation. The proteins in the supernatant as
well as the intracellular proteins are analyzed by SDS-PAGE
followed by autoradiography (if radiolabeled). Microsequencing of
the amino acid sequence of the amino terminus of purified protein
may be used to determine the amino terminal sequence of the mature
protein and thus the cleavage point and length of the secretory
signal peptide.
Example 2(b)
Cloning and Expression of I-FLICE-2 Protein in a Baculovirus
Expression System
[0143] In this illustrative example, the plasmid shuttle vector pA2
is used to insert the cloned DNA encoding the complete protein into
a baculovirus to express the I-FLICE-2 protein, using standard
methods as described in Summers et al., A Manual of Methods for
Baculovirus Vectors and Insect Cell Culture Procedures, Texas
Agricultural Experimental Station Bulletin No. 1555 (1987). This
expression vector contains the strong polyhedrin promoter of the
Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by convenient restriction sites such as BamHI and Asp718. The
polyadenylation site of the simian virus 40 ("SV40") is used for
efficient polyadenylation. For easy selection of recombinant virus,
the plasmid contains the beta-galactosidase gene from E. coli under
control of a weak Drosophila promoter in the same orientation,
followed by the polyadenylation signal of the polyhedrin gene. The
inserted genes are flanked on both sides by viral sequences for
cell-mediated homologous recombination with wild-type viral DNA to
generate viable virus that express the cloned polynucleotide.
[0144] Many other baculovirus vectors could be used in place of the
vector above, such as pAc373, pVL941 and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39.
[0145] The cDNA sequence encoding the full length I-FLICE-2 protein
in the deposited clone, including the AUG initiation codon shown in
FIG. 4A-4C (SEQ ID NO:6) is amplified using PCR oligonucleotide
primers corresponding to the 5' and 3' sequences of the gene. The
5' primer has the sequence: 5' CGCGGATCCGCCATCATGGCAGAGATTGGTGAG 3'
(SEQ ID NO:13) containing the underlined BamHI restriction enzyme
site, an efficient signal for initiation of translation in
eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 (1987), followed by 17 (304-321) bases of the sequence
of the complete I-FLICE-2 protein shown in FIG. 4A-4C, beginning
with the AUG initiation codon. The 3' primer has the sequence: 5'
CGCGGTACCAGAGCATGCAGTGTCAG 3' (SEQ ID NO:14) containing the
underlined, Asp718 restriction site followed by (i.e., 1400-1416)
nucleotides complementary to the 3' noncoding sequence in FIG.
4A-4C (SEQ ID NO:5).
[0146] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("GENECLEAN.RTM." BIO 101 Inc.,
La Jolla, Calif.). The fragment then is digested with BamHI and
Asp718 and again is purified on a 1% agarose gel. This fragment is
designated herein "F1".
[0147] The plasmid is digested with the restriction enzymes BamHI
and Asp718 and optionally, can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("GENECLEAN.RTM." BIO 101 Inc., La Jolla, Calif.).
This vector DNA is designated herein "V1".
[0148] Fragment F1 and the dephosphorylated plasmid V1 are ligated
together with T4 DNA ligase. E. coli HB 101 or other suitable E.
coli hosts such as XL-1 BLUE.RTM. (Stratagene Cloning Systems, La
Jolla, Calif.) cells are transformed with the ligation mixture and
spread on culture plates. Bacteria are identified that contain the
plasmid with the human I-FLICE-2 gene using the PCR method, in
which one of the primers that is used to amplify the gene and the
second primer is from well within the vector so that only those
bacterial colonies containing the I-FLICE-2 gene fragment will show
amplification of the DNA. The sequence of the cloned fragment is
confirmed by DNA sequencing. This plasmid is designated herein pBac
I-FLICE-2.
[0149] Five .mu.g of the plasmid pBac I-FLICE-2 is co-transfected
with 1.0 .mu.g of a commercially available linearized baculovirus
DNA ("BACULOGOLD.TM. baculovirus DNA", Pharminogen, San Diego,
Calif.), using the lipofection method described by Felgner et al.,
Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987). 1 .mu.g of
BACULOGOLD.TM. virus DNA and 5 .mu.g of the plasmid pBac I-FLICE-2
are mixed in a sterile well of a microtiter plate containing 50
.mu.l of serum-free Grace's medium (Life Technologies Inc.,
Gaithersburg, Md.). Afterwards, 10 .mu.l LIPOFECTIN.RTM. plus 90
.mu.l Grace's medium are added, mixed and incubated for 15 minutes
at room temperature. Then the transfection mixture is added
drop-wise to Sf9 insect cells (ATCC.RTM. CRL 1711) seeded in a 35
mm tissue culture plate with 1 ml Grace's medium without serum. The
plate is rocked back and forth to mix the newly added solution. The
plate is then incubated for 5 hours at 27.degree. C. After 5 hours
the transfection solution is removed from the plate and 1 ml of
Grace's insect medium supplemented with 10% fetal calf serum is
added. The plate is put back into an incubator and cultivation is
continued at 27.degree. C. for four days.
[0150] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "BLUE GAL.RTM." (Life Technologies Inc.,
Gaithersburg) is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10). After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C. The recombinant virus is called V-I-FLICE-2.
[0151] To verify the expression of the I-FLICE-2 gene, Sf9 cells
are grown in Grace's medium supplemented with 10% heat inactivated
FBS. The cells are infected with the recombinant baculovirus
V-I-FLICE-2 at a multiplicity of infection ("MOI") of about 2. Six
hours later the medium is removed and is replaced with SF900 II
medium minus methionine and cysteine (available from Life
Technologies Inc., Rockville, Md.). If radiolabeled proteins are
desired, 42 hours later, 5 .mu.Ci of .sup.35S-methionine and 5
.mu.Ci .sup.35S-cysteine (available from Amersham) are added. The
cells are further incubated for 16 hours and then they are
harvested by centrifugation. The proteins in the supernatant as
well as the intracellular proteins are analyzed by SDS-PAGE
followed by autoradiography (if radiolabeled). Microsequencing of
the amino acid sequence of the amino terminus of purified protein
may be used to determine the amino terminal sequence of the mature
protein and thus the cleavage point and length of the secretory
signal peptide.
Example 3
Cloning and Expression of I-FLICE in Mammalian Cells
[0152] A typical mammalian expression vector contains the promoter
element, which mediates the initiation of transcription of mRNA,
the protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription can be achieved with the
early and late promoters from SV40, the long terminal repeats
(LTRS) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early
promoter of the cytomegalovirus (CMV). However, cellular elements
can also be used (e.g., the human actin promoter). Suitable
expression vectors for use in practicing the present invention
include, for example, vectors such as PSVL and PMSG (Pharmacia,
Uppsala, Sweden), pRSVcat (ATCC.RTM. 37152), pSV2dhfr (ATCC.RTM.
37146) and pBC12MI (ATCC.RTM. 67109). Mammalian host cells that
could be used include, human HeLa 293, H9 and Jurkat cells, mouse
NIH3T3 and C127 cells, Cos 1, Cos 7 and CV 1, quail QC1-3 cells,
mouse L cells and Chinese hamster ovary (CHO) cells.
[0153] Alternatively, the gene can be expressed in stable cell
lines that contain the gene integrated into a chromosome. The
co-transfection with a selectable marker such as dhfr, gpt,
neomycin, or hygromycin allows the identification and isolation of
the transfected cells.
[0154] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
marker is useful to develop cell lines that carry several hundred
or even several thousand copies of the gene of interest. Another
useful selection marker is the enzyme glutamine synthase (GS)
(Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al.,
Bio/Technology 10:169-175 (1992)). Using these markers, the
mammalian cells are grown in selective medium and the cells with
the highest resistance are selected. These cell lines contain the
amplified gene(s) integrated into a chromosome. Chinese hamster
ovary (CHO) and NSO cells are often used for the production of
proteins.
[0155] The expression vectors pC1 and pC4 contain the strong
promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molec.
Cell. Biol. 5:438-447 (1985)) plus a fragment of the CMV-enhancer
(Boshart et al., Cell 41:521-530 (1985)). Multiple cloning sites,
e.g., with the restriction enzyme cleavage sites BamHI, XbaI and
Asp718, facilitate the cloning of the gene of interest. The vectors
contain in addition the 3' intron, the polyadenylation and
termination signal of the rat preproinsulin gene.
Example 3(a)
Cloning and Expression of I-FLICE-1 in COS Cells
[0156] The expression plasmid, p I-FLICE-1 HA, is made by cloning a
cDNA encoding I-FLICE-1 into the expression vector pcDNAI/Amp or
pcDNAIII (which can be obtained from Invitrogen, Inc.).
[0157] The expression vector pcDNAI/amp contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cells; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron; (5) several codons
encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate
purification) followed by a termination codon and polyadenylation
signal arranged so that a cDNA can be conveniently placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker. The HA tag corresponds to an epitope
derived from the influenza hemagglutinin protein described by
Wilson et al., Cell 37:767-778 (1984). The fusion of the HA tag to
the target protein allows easy detection and recovery of the
recombinant protein with an antibody that recognizes the HA
epitope. pcDNAIII contains, in addition, the selectable neomycin
marker.
[0158] A DNA fragment encoding the I-FLICE-1 is cloned into the
polylinker region of the vector so that recombinant protein
expression is directed by the CMV promoter. The plasmid
construction strategy is as follows. The I-FLICE-1 cDNA of the
deposited clone is amplified using primers that contain convenient
restriction sites, much as described above for construction of
vectors for expression of I-FLICE-1 in E. coli. Suitable primers
include the following, which are used in this example. The 5'
primer, containing the underlined Smal site, a Kozak sequence, an
AUG start codon and 17 bases of the 5' coding region of the
complete I-FLICE-1 has the following sequence: 5'
CGCCCCGGGGCCATCATGTCTGCTGAAGTCATC (268-285) 3' (SEQ ID NO:15). The
3' primer, containing the underlined XbaI site, a stop codon, and
18 bp of 3' coding sequence has the following sequence (at the 3'
end): 5' CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTAGTGCTGGGATTACAGG TG
(1740-1758) 3' (SEQ ID NO:16).
[0159] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with Smal and XbaI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems,11099 North Torrey Pines Road, La Jolla,
Calif. 92037), and the transformed culture is plated on ampicillin
media plates which then are incubated to allow growth of ampicillin
resistant colonies. Plasmid DNA is isolated from resistant colonies
and examined by restriction analysis or other means for the
presence of the I-FLICE-1-encoding fragment.
[0160] For expression of recombinant I-FLICE-1, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of I-FLICE-1 by the vector.
[0161] Expression of the I-FLICE-1 -HA fusion protein is detected
by radiolabeling and immunoprecipitation, using methods described
in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated
from the cell lysate and from the culture media using an
HA-specific monoclonal antibody. The precipitated proteins then are
analyzed by SDS-PAGE and autoradiography. An expression product of
the expected size is seen in the cell lysate, which is not seen in
negative controls.
Example 3(b)
Cloning and Expression of I-FLICE-1 in CHO Cells
[0162] The vector pC4 is used for the expression of I-FLICE-1
protein. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr
(ATCC' Accession No. 37146). The plasmid contains the mouse DHFR
gene under control of the SV40 early promoter. Chinese hamster
ovary- or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology 9:64-68). Cells grown in increasing concentrations of
MTX develop resistance to the drug by overproducing the target
enzyme, DHFR, as a result of amplification of the DHFR gene. If a
second gene is linked to the DHFR gene, it is usually co-amplified
and over-expressed. It is known in the art that this approach may
be used to develop cell lines carrying more than 1,000 copies of
the amplified gene(s). Subsequently, when the methotrexate is
withdrawn, cell lines are obtained which contain the amplified gene
integrated into one or more chromosome(s) of the host cell.
[0163] Plasmid pC4 contains for expressing the gene of interest the
strong promoter of the long terminal repeat (LTR) of the Rous
Sarcoma Virus (Cullen et al., Molec. Cell. Biol. 5:438-447 (1985))
plus a fragment isolated from the enhancer of the immediate early
gene of human cytomegalovirus (CMV) (Boshart et al., Cell
41:521-530 (1985)). Downstream of the promoter are BamHI, XbaI, and
Asp718 restriction enzyme cleavage sites that allow integration of
the genes. Behind these cloning sites the plasmid contains the 3'
intron and polyadenylation site of the rat preproinsulin gene.
Other high efficiency promoters can also be used for the
expression, e.g., the human P-actin promoter, the SV40 early or
late promoters or the long terminal repeats from other
retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and Tet-On
gene expression systems and similar systems can be used to express
the I-FLICE-1 in a regulated way in mammalian cells (Gossen, M.,
& Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89: 5547-5551).
For the polyadenylation of the mRNA other signals, e.g., from the
human growth hormone or globin genes can be used as well. Stable
cell lines carrying a gene of interest integrated into the
chromosomes can also be selected upon co-transfection with a
selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g., G418 plus methotrexate.
[0164] The plasmid pC4 is digested with the restriction enzymes
BamHI and Asp718 and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The vector is then
isolated from a 1% agarose gel.
[0165] The DNA sequence encoding the complete I-FLICE-1 protein
including its leader sequence is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene. The 5' primer has the sequence: 5'
CGCGGATCCGCCATCATGTCTGCTGAAGTCATC 3' (SEQ ID NO:17) containing the
underlined BamHI restriction enzyme site, an efficient signal for
initiation of translation in eukaryotic cells, as described by
Kozak, M., J. Mol. Biol. 196:947-950 (1987), followed by 17 (i.e.,
268-285) bases of the sequence of the complete I-FLICE-1 protein
shown in FIG. 1A-1B, beginning with the AUG initiation codon. The
3' primer has the sequence: 5' CGCGGTACCGTGCTGGGATTACAGGTG 3' (SEQ
ID NO:18) containing the underlined, Asp718 restriction site
followed by 18 (1740-1758) nucleotides complementary to the 3'
noncoding sequence in FIG. 1A-1B (SEQ ID NO:1).
[0166] The amplified fragment is digested with the endonucleases
BamHI and Asp718 and then purified again on a 1% agarose gel. The
isolated fragment and the dephosphorylated vector are then ligated
with T4 DNA ligase. E. coli HB101 or XL-1 BLUE.RTM. cells are then
transformed and bacteria are identified that contain the fragment
inserted into plasmid pC4 using, for instance, restriction enzyme
analysis.
[0167] Chinese hamster ovary cells lacking an active DHFR gene are
used for transfection. Five .mu.g of the expression plasmid pC4 is
cotransfected with 0.5 .mu.g of the plasmid pSV2-neo using
LIPOFECTIN.RTM. (Felgner et al., supra). The plasmid pSV2neo
contains a dominant selectable marker, the neo gene from Tn5
encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml
of metothrexate plus 1 mg/ml G418. After about 10-14 days single
clones are trypsinized and then seeded in 6-well Petri dishes or 10
ml flasks using different concentrations of methotrexate (50 nM,
100 nM, 200 nM, 400 nM, 800 nM). Clones growing at the highest
concentrations of methotrexate are then transferred to new 6-well
plates containing even higher concentrations of methotrexate (1
.mu.M, 2 .mu.M, 5 .mu.M, 10 .mu.M, 20 .mu.M). The same procedure is
repeated until clones are obtained which grow at a concentration of
100-200 .mu.M. Expression of the desired gene product is analyzed,
for instance, by SDS-PAGE and Western blot or by reverse phase HPLC
analysis.
Example 3(c)
Cloning and Expression of I-FLICE-2 in COS Cells
[0168] The expression plasmid, pI-FLICE-2HA, is made by cloning a
cDNA encoding I-FLICE-2 into the expression vector pcDNAI/Amp or
pcDNAIII (which can be obtained from Invitrogen, Inc.).
[0169] The expression vector pcDNAI/amp contains: (1) an E. coli
origin of replication effective for propagation in E. coli and
other prokaryotic cells; (2) an ampicillin resistance gene for
selection of plasmid-containing prokaryotic cells; (3) an SV40
origin of replication for propagation in eukaryotic cells; (4) a
CMV promoter, a polylinker, an SV40 intron; (5) several codons
encoding a hemagglutinin fragment (i.e., an "HA" tag to facilitate
purification) followed by a termination codon and polyadenylation
signal arranged so that a cDNA can be conveniently placed under
expression control of the CMV promoter and operably linked to the
SV40 intron and the polyadenylation signal by means of restriction
sites in the polylinker. The HA tag corresponds to an epitope
derived from the influenza hemagglutinin protein described by
Wilson et al., Cell 37:767-778 (1984). The fusion of the HA tag to
the target protein allows easy detection and recovery of the
recombinant protein with an antibody that recognizes the HA
epitope. pcDNAIII contains, in addition, the selectable neomycin
marker.
[0170] A DNA fragment encoding the I-FLICE-2 is cloned into the
polylinker region of the vector so that recombinant protein
expression is directed by the CMV promoter. The plasmid
construction strategy is as follows. The I-FLICE-2 cDNA of the
deposited clone is amplified using primers that contain convenient
restriction sites, much as described above for construction of
vectors for expression of I-FLICE-2 in E. coli. Suitable primers
include the following, which are used in this example. The 5'
primer, containing the underlined BamHI site, a Kozak sequence, an
AUG start codon and 17 codons of the 5' coding region of the
complete I-FLICE-2 has the following sequence: 5'
CGCGGATCCGCCATCATGGCAGAGATTGGTGAG 3' (SEQ ID NO:19). The 3' primer,
containing the underlined XbaI site, a stop codon, and 16 bp of 3'
coding sequence has the following sequence (at the 3' end): 5'
CGCTCTAGATCAAGCGTAGT CTGGGACGTCGTATGGGTAAGAGCATGCAGTGTCAG 3' (SEQ
ID NO:20).
[0171] The PCR amplified DNA fragment and the vector, pcDNAI/Amp,
are digested with BamHI and XbaI and then ligated. The ligation
mixture is transformed into E. coli strain SURE (available from
Stratagene Cloning Systems, 11099 North Torrey Pines Road, La
Jolla, Calif. 92037), and the transformed culture is plated on
ampicillin media plates which then are incubated to allow growth of
ampicillin resistant colonies. Plasmid DNA is isolated from
resistant colonies and examined by restriction analysis or other
means for the presence of the I-FLICE-2-encoding fragment.
[0172] For expression of recombinant I-FLICE-2, COS cells are
transfected with an expression vector, as described above, using
DEAE-DEXTRAN, as described, for instance, in Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory
Press, Cold Spring Harbor, N.Y. (1989). Cells are incubated under
conditions for expression of I-FLICE-2 by the vector.
[0173] Expression of the I-FLICE-2-HA fusion protein is detected by
radiolabeling and immunoprecipitation, using methods described in,
for example Harlow et al., Antibodies: A Laboratory Manual, 2nd
Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1988). To this end, two days after transfection, the cells are
labeled by incubation in media containing .sup.35S-cysteine for 8
hours. The cells and the media are collected, and the cells are
washed and lysed with detergent-containing RIPA buffer: 150 mM
NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated
from the cell lysate and from the culture media using an
HA-specific monoclonal antibody. The precipitated proteins then are
analyzed by SDS-PAGE and autoradiography. An expression product of
the expected size is seen in the cell lysate, which is not seen in
negative controls.
Example 3(d)
Cloning and Expression of I-FLICE-2 in CHO Cells
[0174] The vector pC4 is used for the expression of I-FLICE-2
protein. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr
(ATCC.RTM. Accession No. 37146). The plasmid contains the mouse
DHFR gene under control of the SV40 early promoter. Chinese hamster
ovary- or other cells lacking dihydrofolate activity that are
transfected with these plasmids can be selected by growing the
cells in a selective medium (alpha minus MEM, Life Technologies)
supplemented with the chemotherapeutic agent methotrexate. The
amplification of the DHFR genes in cells resistant to methotrexate
(MTX) has been well documented (see, e.g., Alt, F. W., Kellems, R.
M., Bertino, J. R., and Schimke, R. T., 1978, J. Biol. Chem.
253:1357-1370, Hamlin, J. L. and Ma, C. 1990, Biochem. et Biophys.
Acta, 1097:107-143, Page, M. J. and Sydenham, M. A. 1991,
Biotechnology 9:64-68). Cells grown in increasing concentrations of
MTX develop resistance to the drug by overproducing the target
enzyme, DHFR, as a result of amplification of the DHFR gene. If a
second gene is linked to the DHFR gene, it is usually co-amplified
and over-expressed. It is known in the art that this approach may
be used to develop cell lines carrying more than 1,000 copies of
the amplified gene(s). Subsequently, when the methotrexate is
withdrawn, cell lines are obtained which contain the amplified gene
integrated into one or more chromosome(s) of the host cell.
[0175] Plasmid pC4 contains for expressing the gene of interest the
strong promoter of the long terminal repeat (LTR) of the Rous
Sarcoma Virus (Cullen et al., Molec. Cell. Biol. 5:438-447 (1985))
plus a fragment isolated from the enhancer of the immediate early
gene of human cytomegalovirus (CMV) (Boshart et al., Cell
41:521-530 (1985)). Downstream of the promoter are BamHI, XbaI, and
Asp718 restriction enzyme cleavage sites that allow integration of
the genes. Behind these cloning sites the plasmid contains the 3'
intron and polyadenylation site of the rat preproinsulin gene.
Other high efficiency promoters can also be used for the
expression, e.g., the human P-actin promoter, the SV40 early or
late promoters or the long terminal repeats from other
retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and Tet-On
gene expression systems and similar systems can be used to express
the I-FLICE-2 in a regulated way in mammalian cells (Gossen, M.,
& Bujard, H. 1992, Proc. Natl. Acad. Sci. USA 89:5547-5551).
For the polyadenylation of the mRNA other signals, e.g., from the
human growth hormone or globin genes can be used as well. Stable
cell lines carrying a gene of interest integrated into the
chromosomes can also be selected upon co-transfection with a
selectable marker such as gpt, G418 or hygromycin. It is
advantageous to use more than one selectable marker in the
beginning, e.g., G418 plus methotrexate.
[0176] The plasmid pC4 is digested with the restriction enzymes
BamHI/Asp718 and then dephosphorylated using calf intestinal
phosphatase by procedures known in the art. The vector is then
isolated from a 1% agarose gel.
[0177] The DNA sequence encoding the complete I-FLICE-2 protein
sequence is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene. The 5' primer
has the sequence: 5' CGCGGATCCGCCATCATGGCAGAGATTGGTGAG 3' (SEQ ID
NO:21) containing the underlined BamHI restriction enzyme site, an
efficient signal for initiation of translation in eukaryotic cells,
as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987),
followed by 17 (304-321) bases of the sequence of the complete
I-FLICE-2 protein shown in FIG. 4A-4C, beginning with the AUG
initiation codon. The 3' primer has the sequence: 5'
CGCGGTACCAGAGCATGCAGTGTCAG 3' (SEQ ID NO:22) containing the
underlined, Asp718 restriction site followed by (i.e., 1400-1416)
nucleotides complementary to the 3' noncoding sequence in FIG.
4A-4C (SEQ ID NO:5).
[0178] The amplified fragment is digested with the endonucleases
BamHI and Asp718 and then purified again on a 1% agarose gel. The
isolated fragment and the dephosphorylated vector are then ligated
with T4 DNA ligase. E. coli HB101 or XL-1 BLUE.RTM. cells are then
transformed and bacteria are identified that contain the fragment
inserted into plasmid pC4 using, for instance, restriction enzyme
analysis.
[0179] Chinese hamster ovary cells lacking an active DHFR gene are
used for transfection. Five .mu.g of the expression plasmid pC4 is
cotransfected with 0.5 .mu.g of the plasmid pSV2-neo using
LIPOFECTIN.RTM. (Felgner et al., supra). The plasmid pSV2neo
contains a dominant selectable marker, the neo gene from Tn5
encoding an enzyme that confers resistance to a group of
antibiotics including G418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml G418. After 2 days, the cells are
trypsinized and seeded in hybridoma cloning plates (Greiner,
Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml
of metothrexate plus 1 mg/ml G418. After about 10-14 days single
clones are trypsinized and then seeded in 6-well Petri dishes or 10
ml flasks using different concentrations of methotrexate (50 nM,
100 nM, 200 nM, 400 nM, 800 nM). Clones growing at the highest
concentrations of methotrexate are then transferred to new 6-well
plates containing even higher concentrations of methotrexate (1
.mu.M, 2 .mu.M, 5 .mu.M, 10 .mu.M, 20 .mu.M). The same procedure is
repeated until clones are obtained which grow at a concentration of
100-200 .mu.M. Expression of the desired gene product is analyzed,
for instance, by SDS-PAGE and Western blot or by reverse phase HPLC
analysis.
Example 4(a)
Tissue Distribution of I-FLICE-1 mRNA Expression
[0180] Northern blot analysis was carried out to examine I-FLICE-1
gene expression in human tissues, using methods described by, among
others, Sambrook et al., cited above. A cDNA probe containing the
entire nucleotide sequence of the I-FLICE-1 protein (SEQ ID NO:1)
was labeled with .sup.32P using the rediprime.TM. DNA labeling
system (Amersham Life Science), according to manufacturer's
instructions. After labeling, the probe was purified using a CHROMA
SPIN- 100.TM. column (Clontech Laboratories, Inc.), according to
manufacturer's protocol number PT1200-1. The purified labeled probe
was then used to examine various human tissues for I-FLICE-1
mRNA.
[0181] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) were obtained
from Clontech and were examined with the labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots were mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
[0182] Two transcripts were observed (7.5 kb and 6 kb) which
presumably represent mRNA sequences encoding I-FLICE-1 and
I-FLICE-2. I-FLICE expression was identified in most tissues and
cell lines examined except for the brain and the lymphoblastic
leukemia line MOLT4. In particular, I-FLICE expression was evident
in peripheral blood leukocytes, spleen, placenta and heart.
Example 4(b)
Tissue Distribution of I-FLICE-2 mRNA Expression
[0183] Northern blot analysis is carried out to examine I-FLICE-2
gene expression in human tissues, using methods described by, among
others, Sambrook et al., cited above. A cDNA probe containing the
entire nucleotide sequence of the I-FLICE-2 protein (SEQ ID NO:6)
is labeled with .sup.32P using the rediprime.TM. DNA labeling
system (Amersham Life Science), according to manufacturer's
instructions. After labeling, the probe is purified using a CHROMA
SPIN-100.TM. column (Clontech Laboratories, Inc.), according to
manufacturer's protocol number PT1200-1. The purified labeled probe
is then used to examine various human tissues for I-FLICE-2
mRNA.
[0184] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) are obtained
from Clontech and are examined with the labeled probe using
ExpressHyb.TM. hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization
and washing, the blots are mounted and exposed to film at
-70.degree. C. overnight, and films developed according to standard
procedures.
Example 5
I-FLICE-1 Associates with FLICE and Mch4/FLICE-2
[0185] Previous studies have shown that the DED domain is a protein
interaction motif that mediates the binding of the adaptor molecule
FADD to the effector proteases FLICE and Mch4/FLICE2 (Muzio et al.,
Cell 85:817-27 (1996); Chinnaiyan et al., Cell 81:505-12 (1995)).
Given the striking structural similarity, the following experiment
was performed to determine whether I-FLICE-1 interacted with either
FADD or other FLICE-like caspases.
Materials and Methods
[0186] Cell Lines and Expression Vectors-Human embryonic kidney
293, 293T and 293-EBNA cells were cultured to Dulbecco's modified
Eagle's medium containing 10% fetal bovine serum, nonessential
amino acids, L-glutamine, and penicillin/streptomycin. Expression
constructs were made in pcDNA3 or pcDNA3.1/MycHisA (Invitrogen)
using standard recombinant methodologies (Sambrook, J. et al.,
Molecular Cloning 2nd Edition, Cold Spring Harbor Laboratory
Press).
[0187] Cloning of I-FLICE-1-cDNAs corresponding to the partial open
reading frame of I-FLICE-1 were identified as sequences homologous
to FLICE and Mch4/FLICE2 on searching the Human Genome Sciences
data base using established EST methods (Adams, M. D. et al.,
Science 252:1651-1656 (1991) and Adams, M. D. et al., Nature
355:632-634 (1992)). Full length cDNAs were obtained by screening a
random-primed human umbilical vein endothelial cell cDNA library
constructed in the pcDNA1 vector (Invitrogen). The sequence of
I-FLICE-1 was confirmed by sequencing plasmid DNA template on both
strands by the dideoxy chain termination method employing modified
T7 DNA polymerase (Sequenase, U.S. Biochemical Corp.).
[0188] Transfection, Coimmunoprecipitation and Western
Analysis--Transient transfections of 293T cells were performed as
described previously (O'Rourke et al., J. Biol. Chem.
267:24921-24924 (1992)). Cells were harvested 40 hour following
transfection, imrnmunoprecipitation with .alpha.-FLAG or .alpha.myc
antibodies and analyzed by immunoblotting.
Results and Discussion
[0189] Sequence analysis of a full length cDNA revealed a 1443-base
pair open reading frame that encoded a novel protein with a
predicated molecular mass of 55.3 kDa (FIG. 1A-1B). Given that the
protein had striking homology to FLICE and Mch4/FLICE2 but lacked
an active site, making it a potential dominant negative inhibitor,
it was designated I-FLICE (for inhibitor of FLICE).
[0190] The architecture of I-FLICE-1 was strikingly similar to that
of FLICE and Mch4/FLICE2, including two N-terminal DED-like tandem
repeats and a region that resembled the caspase catalytic domain.
Importantly, I-FLICE-1 did not contain the catalytic cysteine that
is normally embedded in the conserved pentapeptide QACRG (SEQ ID
NO:33) or QACQG (SEQ ID NO:34) motif present in all known caspases.
Rather, the pentapeptide sequence was QNYVV (SEQ ID NO:35). In
addition, based on the x-ray crystal structure of caspase-1 (and
caspase-3), amino acid residues His.sup.237 (His.sup.121),
Gly.sup.238 (Gly.sup.122), and Cys.sup.285 (Cys.sup.163) are
involved in catalysis, while residues Arg.sup.179 (Arg.sup.64),
Gin.sup.283 (Gin.sup.161), Arg.sup.341 (Arg.sup.207), and
Ser.sup.347 (Ser.sup.213) form a binding pocket for the carboxylate
side chain of the P1 aspartic acid (Wilson, K. P. et al., Nature
370:270-274 (1994), Rotonda, J. et al., Nat. Struct. Biol.
3:619-625 (1996), and Fraser, A. et al., Cell 85:781-784 (1996)).
These seven residues are conserved in all caspases, but only three
of them (Gly, Gln, and Ser) are found in I-FLICE-1. Given this lack
of conservation of key residues involved in catalysis and substrate
binding it can be concluded that I-FLICE-1 is not a cysteine
protease and is incapable of binding Asp at the P1 position.
Interestingly, the DED domain of I-FLICE-1 was more related to the
corresponding domains present in the viral DED-containing
inhibitors K13, MC159, and E8, sharing 34%, 31%, and 33% identity
(56%, 51%, and 44% similarity), respectively (Hu, S. et al., J.
Biol. Chem. 272:9621-9624 (1997) and Thorne, M. et al., Nature
386:517-521 (1997)).
[0191] Co-immunoprecipitation analysis revealed the ability of
I-FLICE-1 to bind FLICE and Mch4/FLICE2 but not FADD. In this
respect, I-FLICE-1 resembles the viral DED-containing molecule E8
in that it binds FLICE but not FADD (Hu et al., J. Biol. Chem.
272:9621-9624 (1997); Bertin et al., Proc. Natl. Acad. Sci.
94:1172-1176 (1997)). Since there was no association between
I-FLICE-1 and FADD, I-FLICE-1 was not recruited to the CD-95 or
TNFR-1 signaling complex as evidenced by its inability to
co-precipitate with these receptors.
Example 6
Cell Death Assay
[0192] Given the ability of the catalytically inactive I-FLICE-1 to
complex with FLICE-like caspases, the inventors reasoned that
I-FLICE-1 may be acting as a dominant negative inhibitor since the
active form of all caspases is a tetramer derived from the
processing of two zymogen forms to a four-chain assembly. It
follows that a catalytically inert zymogen, such as I-FLICE-1,
would be processed to inactive subunits that would result in the
generation of a nonfunctional tetrameric protease. This mechanism
predicts that I-FLICE-1 should inhibit TNFR-1 and CD-95 -induced
apoptosis where FLICE-like caspases play an initiating role. The
following cell death assay was performed.
Materials and Methods
[0193] Cell Death Assay-Human embryonic kidney 293 (for TNFR-1
killing) or 293 EBNA cells (for CD-95 killing) were transiently
transfected with 0.1 .mu.g of the reporter plasmid pCMV
B-galactosidase plus 0.5.mu.g of test plasmid in the presence or
absence of 2.0 .mu.g of inhibitory plasmids. 22-24 hours after
transfection, cells were fixed in 0.5% glutaraldehyde and stained
with X-gal. Percentage of apoptotic cells was determined by
calculating the fraction of membrane blebbed blue cells as a
function of total blue cells. All assays were evaluated in
duplicate and the mean and the standard deviation calculated.
Results
[0194] Consistent with the proposed mechanism, overexpression of
I-FLICE-1 resulted in substantial inhibition of TNFR-1 induced cell
death comparable to previously characterized inhibitors including
CrmA, MC159, dominant negative FLICE (DNFLICE) and Mch4/FLICE2
(DNFLICE2) (see FIG. 6A). However, under the present experimental
conditions, I-FLICE-1 appeared to be a less potent inhibitor of
CD-95 induced cell death, possibly reflecting the more potent death
signal that emanates from this receptor (see FIG. 6B).
[0195] It will be clear that the invention maybe practiced
otherwise than as particularly described in the foregoing
description and examples. Numerous modifications and variations of
the present invention are possible in light of the above teachings
and, therefore, are within the scope of the appended claims.
[0196] The entire disclosures of Hu, S. et al., J. Biol. Chem.
272:17255-17257 (1997) and Irmler, M., et al., Nature 388:190-195
(1997) are hereby incorporated by reference.
Sequence CWU 1
1
35 1 2034 DNA Homo sapiens CDS (268)..(1707) 1 cgatcgccca
gcaccaagtc cgcttccagg ctttcggttt ctttgcctcc atcttgggtg 60
cgccttcccg gcgtctaggg gagcgaaggc tgaggtggca gcggcaggag agtccggccg
120 cgacaggacg aactccccca ctggaaagga ttctgaaaga aatgaagtca
gccctcagaa 180 atgaagttga ctgcctgctg gctttctgtt gactggcccg
gagctgtact gcaagaccct 240 tgtgagcttc cctagtctaa gagtagg atg tct gct
gaa gtc atc cat cag gtt 294 Met Ser Ala Glu Val Ile His Gln Val 1 5
gaa gaa gca ctt gat aca gat gag aag gag atg ctg ctc ttt ttg tgc 342
Glu Glu Ala Leu Asp Thr Asp Glu Lys Glu Met Leu Leu Phe Leu Cys 10
15 20 25 cgg gat gtt gct ata gat gtg gtt cca cct aat gtc agg gac
ctt ctg 390 Arg Asp Val Ala Ile Asp Val Val Pro Pro Asn Val Arg Asp
Leu Leu 30 35 40 gat att tta cgg gaa aga ggt aag ctg tct gtc ggg
gac ttg gct gaa 438 Asp Ile Leu Arg Glu Arg Gly Lys Leu Ser Val Gly
Asp Leu Ala Glu 45 50 55 ctg ctc tac aga gtg agg cga ttt gac ctg
ctc aaa cgt atc ttg aag 486 Leu Leu Tyr Arg Val Arg Arg Phe Asp Leu
Leu Lys Arg Ile Leu Lys 60 65 70 atg gac aga aaa gct gtg gag acc
cac ctg ctc agg aac cct cac ctt 534 Met Asp Arg Lys Ala Val Glu Thr
His Leu Leu Arg Asn Pro His Leu 75 80 85 gtt tcg gac tat aga gtg
ctg atg gca gag att ggt gag gat ttg gat 582 Val Ser Asp Tyr Arg Val
Leu Met Ala Glu Ile Gly Glu Asp Leu Asp 90 95 100 105 aaa tct gat
gtg tcc tca tta att ttc ctc atg aag gat tac atg ggc 630 Lys Ser Asp
Val Ser Ser Leu Ile Phe Leu Met Lys Asp Tyr Met Gly 110 115 120 cga
ggc aag ata agc aag gag aag agt ttc ttg gac ctt gtg gtt gag 678 Arg
Gly Lys Ile Ser Lys Glu Lys Ser Phe Leu Asp Leu Val Val Glu 125 130
135 ttg gag aaa cta aat ctg gtt gcc cca gat caa ctg gat tta tta gaa
726 Leu Glu Lys Leu Asn Leu Val Ala Pro Asp Gln Leu Asp Leu Leu Glu
140 145 150 aaa tgc cta aag aac atc cac aga ata gac ctg aag aca aaa
atc cag 774 Lys Cys Leu Lys Asn Ile His Arg Ile Asp Leu Lys Thr Lys
Ile Gln 155 160 165 aag tac aag cag tct gtt caa gga gca ggg aca agt
tac agg aat gtt 822 Lys Tyr Lys Gln Ser Val Gln Gly Ala Gly Thr Ser
Tyr Arg Asn Val 170 175 180 185 ctc caa gca gca atc caa aag agt ctc
aag gat cct tca aat aac ttc 870 Leu Gln Ala Ala Ile Gln Lys Ser Leu
Lys Asp Pro Ser Asn Asn Phe 190 195 200 agg ctc cat aat ggg aga agt
aaa gaa caa aga ctt aag gaa cag ctt 918 Arg Leu His Asn Gly Arg Ser
Lys Glu Gln Arg Leu Lys Glu Gln Leu 205 210 215 ggc gct caa caa gaa
cca gtg aag aaa tcc att cag gaa tca gaa gct 966 Gly Ala Gln Gln Glu
Pro Val Lys Lys Ser Ile Gln Glu Ser Glu Ala 220 225 230 ttt ttg cct
cag agc ata cct gaa gag aga tac aag atg aag agc aag 1014 Phe Leu
Pro Gln Ser Ile Pro Glu Glu Arg Tyr Lys Met Lys Ser Lys 235 240 245
ccc cta gga atc tgc ctg ata atc gat tgc att ggc aat gag aca gag
1062 Pro Leu Gly Ile Cys Leu Ile Ile Asp Cys Ile Gly Asn Glu Thr
Glu 250 255 260 265 ctt ctt cga gac acc ttc act tcc ctg ggc tat gaa
gtc cag aaa ttc 1110 Leu Leu Arg Asp Thr Phe Thr Ser Leu Gly Tyr
Glu Val Gln Lys Phe 270 275 280 ttg cat ctc agt atg cat ggt ata tcc
cag att ctt ggc caa ttt gcc 1158 Leu His Leu Ser Met His Gly Ile
Ser Gln Ile Leu Gly Gln Phe Ala 285 290 295 tgt atg ccc gag cac cga
gac tac gac agc ttt gtg tgt gtc ctg gtg 1206 Cys Met Pro Glu His
Arg Asp Tyr Asp Ser Phe Val Cys Val Leu Val 300 305 310 agc cga gga
ggc tcc cag agt gtg tat ggt gtg gat cag act cac tca 1254 Ser Arg
Gly Gly Ser Gln Ser Val Tyr Gly Val Asp Gln Thr His Ser 315 320 325
ggg ctc ccc ctg cat cac atc agg agg atg ttc atg gga gat tca tgc
1302 Gly Leu Pro Leu His His Ile Arg Arg Met Phe Met Gly Asp Ser
Cys 330 335 340 345 cct tat cta gca ggg aag cca aag atg ttt ttt att
cag aac tat gtg 1350 Pro Tyr Leu Ala Gly Lys Pro Lys Met Phe Phe
Ile Gln Asn Tyr Val 350 355 360 gtg tca gag ggc cag ctg gag gac agc
agc ctc ttg gag gtg gat ggg 1398 Val Ser Glu Gly Gln Leu Glu Asp
Ser Ser Leu Leu Glu Val Asp Gly 365 370 375 cca gcg atg aag aat gtg
gaa ttc aag gct cag aag cga ggg ctg tgc 1446 Pro Ala Met Lys Asn
Val Glu Phe Lys Ala Gln Lys Arg Gly Leu Cys 380 385 390 aca gtt cac
cga gaa gct gac ttc ttc tgg agc ctg tgt act gcg gac 1494 Thr Val
His Arg Glu Ala Asp Phe Phe Trp Ser Leu Cys Thr Ala Asp 395 400 405
atg tcc ctg ctg gag cag tct cac agc tca ccg tcc ctg tac ctg cag
1542 Met Ser Leu Leu Glu Gln Ser His Ser Ser Pro Ser Leu Tyr Leu
Gln 410 415 420 425 tgc ctc tcc cag aaa ctg aga caa gaa aga aaa cgc
cca ctc ctg gat 1590 Cys Leu Ser Gln Lys Leu Arg Gln Glu Arg Lys
Arg Pro Leu Leu Asp 430 435 440 ctt cac att gaa ctc aat ggc tac atg
tat gat tgg aac agc aga gtt 1638 Leu His Ile Glu Leu Asn Gly Tyr
Met Tyr Asp Trp Asn Ser Arg Val 445 450 455 tct gcc aag gag aaa tat
tat gtc tgg ctg cag cac act ctg aga aag 1686 Ser Ala Lys Glu Lys
Tyr Tyr Val Trp Leu Gln His Thr Leu Arg Lys 460 465 470 aaa ctt atc
ctc tcc tac aca taagaaacca aaaggctggg cgtagtggct 1737 Lys Leu Ile
Leu Ser Tyr Thr 475 480 cgcacctgta atcccagcac tttgggaggc caaggagggc
ggatcacttc aggtcaggag 1797 ttcgagacca gcctggccaa catggtaaac
gctgtcccta gtaagagtgc aaaaattagc 1857 tgggtgtggg tgtgggtacc
tgtgttccca gttacttggg aggctgaggt gggaggatct 1917 tttgaaccca
ggagttcagg gtcatagcat gctgtgattg tgcctacgaa tagccactgc 1977
ataccaacct gggcaatata gcaagatccc atctttttaa aaaaaaaaaa aaaaaaa 2034
2 480 PRT Homo sapiens 2 Met Ser Ala Glu Val Ile His Gln Val Glu
Glu Ala Leu Asp Thr Asp 1 5 10 15 Glu Lys Glu Met Leu Leu Phe Leu
Cys Arg Asp Val Ala Ile Asp Val 20 25 30 Val Pro Pro Asn Val Arg
Asp Leu Leu Asp Ile Leu Arg Glu Arg Gly 35 40 45 Lys Leu Ser Val
Gly Asp Leu Ala Glu Leu Leu Tyr Arg Val Arg Arg 50 55 60 Phe Asp
Leu Leu Lys Arg Ile Leu Lys Met Asp Arg Lys Ala Val Glu 65 70 75 80
Thr His Leu Leu Arg Asn Pro His Leu Val Ser Asp Tyr Arg Val Leu 85
90 95 Met Ala Glu Ile Gly Glu Asp Leu Asp Lys Ser Asp Val Ser Ser
Leu 100 105 110 Ile Phe Leu Met Lys Asp Tyr Met Gly Arg Gly Lys Ile
Ser Lys Glu 115 120 125 Lys Ser Phe Leu Asp Leu Val Val Glu Leu Glu
Lys Leu Asn Leu Val 130 135 140 Ala Pro Asp Gln Leu Asp Leu Leu Glu
Lys Cys Leu Lys Asn Ile His 145 150 155 160 Arg Ile Asp Leu Lys Thr
Lys Ile Gln Lys Tyr Lys Gln Ser Val Gln 165 170 175 Gly Ala Gly Thr
Ser Tyr Arg Asn Val Leu Gln Ala Ala Ile Gln Lys 180 185 190 Ser Leu
Lys Asp Pro Ser Asn Asn Phe Arg Leu His Asn Gly Arg Ser 195 200 205
Lys Glu Gln Arg Leu Lys Glu Gln Leu Gly Ala Gln Gln Glu Pro Val 210
215 220 Lys Lys Ser Ile Gln Glu Ser Glu Ala Phe Leu Pro Gln Ser Ile
Pro 225 230 235 240 Glu Glu Arg Tyr Lys Met Lys Ser Lys Pro Leu Gly
Ile Cys Leu Ile 245 250 255 Ile Asp Cys Ile Gly Asn Glu Thr Glu Leu
Leu Arg Asp Thr Phe Thr 260 265 270 Ser Leu Gly Tyr Glu Val Gln Lys
Phe Leu His Leu Ser Met His Gly 275 280 285 Ile Ser Gln Ile Leu Gly
Gln Phe Ala Cys Met Pro Glu His Arg Asp 290 295 300 Tyr Asp Ser Phe
Val Cys Val Leu Val Ser Arg Gly Gly Ser Gln Ser 305 310 315 320 Val
Tyr Gly Val Asp Gln Thr His Ser Gly Leu Pro Leu His His Ile 325 330
335 Arg Arg Met Phe Met Gly Asp Ser Cys Pro Tyr Leu Ala Gly Lys Pro
340 345 350 Lys Met Phe Phe Ile Gln Asn Tyr Val Val Ser Glu Gly Gln
Leu Glu 355 360 365 Asp Ser Ser Leu Leu Glu Val Asp Gly Pro Ala Met
Lys Asn Val Glu 370 375 380 Phe Lys Ala Gln Lys Arg Gly Leu Cys Thr
Val His Arg Glu Ala Asp 385 390 395 400 Phe Phe Trp Ser Leu Cys Thr
Ala Asp Met Ser Leu Leu Glu Gln Ser 405 410 415 His Ser Ser Pro Ser
Leu Tyr Leu Gln Cys Leu Ser Gln Lys Leu Arg 420 425 430 Gln Glu Arg
Lys Arg Pro Leu Leu Asp Leu His Ile Glu Leu Asn Gly 435 440 445 Tyr
Met Tyr Asp Trp Asn Ser Arg Val Ser Ala Lys Glu Lys Tyr Tyr 450 455
460 Val Trp Leu Gln His Thr Leu Arg Lys Lys Leu Ile Leu Ser Tyr Thr
465 470 475 480 3 478 PRT Homo sapiens 3 Met Asp Phe Ser Arg Asn
Leu Tyr Asp Ile Gly Glu Gln Leu Asp Ser 1 5 10 15 Glu Asp Leu Ala
Ser Leu Lys Phe Leu Ser Leu Asp Tyr Ile Pro Gln 20 25 30 Arg Lys
Gln Glu Pro Ile Lys Asp Ala Leu Met Leu Phe Gln Arg Leu 35 40 45
Gln Glu Lys Arg Met Leu Glu Glu Ser Asn Leu Ser Phe Leu Lys Glu 50
55 60 Leu Leu Phe Arg Ile Asn Arg Leu Asp Leu Leu Ile Thr Tyr Leu
Asn 65 70 75 80 Thr Arg Lys Glu Glu Met Glu Arg Glu Leu Gln Thr Pro
Gly Arg Ala 85 90 95 Gln Ile Ser Ala Tyr Arg Val Met Leu Tyr Gln
Ile Ser Glu Glu Val 100 105 110 Ser Arg Ser Glu Leu Arg Ser Phe Lys
Phe Leu Leu Gln Glu Glu Ile 115 120 125 Ser Lys Cys Lys Leu Asp Asp
Asp Met Asn Leu Leu Asp Ile Phe Ile 130 135 140 Glu Met Glu Lys Arg
Val Ile Leu Gly Glu Gly Lys Leu Asp Ile Leu 145 150 155 160 Lys Arg
Val Cys Ala Gln Ile Asn Lys Ser Leu Leu Lys Ile Ile Asn 165 170 175
Asp Tyr Glu Glu Phe Ser Lys Glu Arg Ser Ser Ser Leu Glu Gly Ser 180
185 190 Pro Asp Glu Phe Ser Asn Gly Glu Glu Leu Cys Gly Val Met Thr
Ile 195 200 205 Ser Asp Ser Pro Arg Glu Gln Asp Ser Glu Ser Gln Thr
Leu Asp Lys 210 215 220 Val Tyr Gln Met Lys Ser Lys Pro Arg Gly Tyr
Cys Leu Ile Ile Asn 225 230 235 240 Asn His Asn Phe Ala Lys Ala Arg
Glu Lys Val Pro Lys Leu His Ser 245 250 255 Ile Arg Asp Arg Asn Gly
Thr His Leu Asp Ala Gly Leu Thr Thr Thr 260 265 270 Phe Glu Glu Leu
His Phe Glu Ile Lys Pro His Asp Asp Cys Thr Val 275 280 285 Glu Gln
Ile Tyr Glu Ile Leu Lys Ile Tyr Gln Leu Met Asp His Ser 290 295 300
Asn Met Asp Cys Phe Ile Cys Cys Ile Leu Ser His Gly Asp Lys Gly 305
310 315 320 Ile Ile Tyr Gly Thr Asp Gly Gln Glu Pro Pro Ile Tyr Glu
Leu Thr 325 330 335 Ser Gln Phe Thr Gly Leu Lys Cys Pro Ser Leu Ala
Gly Lys Pro Lys 340 345 350 Val Phe Phe Ile Gln Ala Cys Gln Gly Asp
Asn Tyr Gln Lys Gly Ile 355 360 365 Pro Val Glu Thr Asp Ser Glu Glu
Gln Pro Tyr Leu Glu Met Asp Leu 370 375 380 Ser Ser Pro Gln Thr Arg
Tyr Ile Pro Asp Glu Ala Asp Phe Leu Leu 385 390 395 400 Gly Met Ala
Thr Val Asn Asn Cys Val Ser Tyr Arg Asn Pro Ala Glu 405 410 415 Gly
Thr Trp Tyr Ile Gln Ser Leu Cys Gln Ser Leu Arg Glu Arg Cys 420 425
430 Pro Arg Gly Asp Asp Ile Leu Thr Ile Leu Thr Glu Val Asn Tyr Glu
435 440 445 Val Ser Asn Lys Asp Asp Lys Lys Asn Met Gly Lys Gln Met
Pro Gln 450 455 460 Pro Thr Phe Thr Leu Arg Lys Lys Leu Val Phe Pro
Ser Asp 465 470 475 4 479 PRT Homo sapiens 4 Met Lys Ser Gln Gly
Gln His Trp Tyr Ser Ser Ser Asp Lys Asn Cys 1 5 10 15 Lys Val Ser
Phe Arg Glu Lys Leu Leu Ile Ile Asp Ser Asn Leu Gly 20 25 30 Val
Gln Asp Val Glu Asn Leu Lys Phe Leu Cys Ile Gly Leu Val Pro 35 40
45 Asn Lys Lys Leu Glu Lys Ser Ser Ser Ala Ser Asp Val Phe Glu His
50 55 60 Leu Leu Ala Glu Asp Leu Leu Ser Glu Glu Asp Pro Phe Phe
Leu Ala 65 70 75 80 Glu Leu Leu Tyr Ile Ile Arg Gln Lys Lys Leu Leu
Gln His Leu Asn 85 90 95 Cys Thr Lys Glu Glu Val Glu Arg Leu Leu
Pro Thr Arg Gln Arg Val 100 105 110 Ser Leu Phe Arg Asn Leu Leu Tyr
Glu Leu Ser Glu Gly Ile Asp Ser 115 120 125 Glu Asn Leu Lys Asp Met
Ile Phe Leu Leu Lys Asp Ser Leu Pro Lys 130 135 140 Thr Glu Met Thr
Ser Leu Ser Phe Leu Ala Phe Leu Glu Lys Gln Gly 145 150 155 160 Lys
Ile Asp Glu Asp Asn Leu Thr Cys Leu Glu Asp Leu Cys Lys Thr 165 170
175 Val Val Pro Lys Leu Leu Arg Asn Ile Glu Lys Tyr Lys Arg Glu Lys
180 185 190 Ala Ile Gln Ile Val Thr Pro Pro Val Asp Lys Glu Ala Glu
Ser Tyr 195 200 205 Gln Gly Glu Glu Glu Leu Val Ser Gln Thr Asp Val
Lys Thr Phe Leu 210 215 220 Glu Ala Leu Pro Arg Ala Ala Val Tyr Arg
Met Asn Arg Asn His Arg 225 230 235 240 Gly Leu Cys Val Ile Val Asn
Asn His Ser Phe Thr Ser Leu Lys Asp 245 250 255 Arg Gln Gly Thr His
Lys Asp Ala Glu Ile Leu Ser His Val Phe Gln 260 265 270 Trp Leu Gly
Phe Thr Val His Ile His Asn Asn Val Thr Lys Val Glu 275 280 285 Met
Glu Met Val Leu Gln Lys Gln Lys Cys Asn Pro Ala His Ala Asp 290 295
300 Gly Asp Cys Phe Val Phe Cys Ile Leu Thr His Gly Arg Phe Gly Ala
305 310 315 320 Val Tyr Ser Ser Asp Glu Ala Leu Ile Pro Ile Arg Glu
Ile Met Ser 325 330 335 His Phe Thr Ala Leu Gln Cys Pro Arg Leu Ala
Glu Lys Pro Lys Leu 340 345 350 Phe Phe Ile Gln Ala Cys Gln Gly Glu
Glu Ile Gln Pro Ser Val Ser 355 360 365 Ile Glu Ala Asp Ala Leu Asn
Pro Glu Gln Ala Pro Thr Ser Leu Gln 370 375 380 Asp Ser Ile Pro Ala
Glu Ala Asp Phe Leu Leu Gly Leu Ala Thr Val 385 390 395 400 Pro Gly
Tyr Val Ser Phe Arg His Val Glu Glu Gly Ser Trp Tyr Ile 405 410 415
Gln Ser Leu Cys Asn His Leu Lys Lys Leu Val Pro Arg His Glu Asp 420
425 430 Ile Leu Ser Ile Leu Thr Ala Val Asn Asp Asp Val Ser Arg Arg
Val 435 440 445 Asp Lys Gln Gly Thr Lys Lys Gln Met Pro Gln Pro Ala
Phe Thr Leu 450 455 460 Arg Lys Lys Leu Val Phe Pro Val Pro Leu Asp
Ala Leu Ser Ile 465 470 475 5 2597 DNA Homo sapiens CDS
(304)..(1347) 5 gcgagcttgc agcctcaccg acgagtctca actaaaaggg
actcccggag ctaggggtgg 60 ggactcggcc tcacacagtg attgccggct
attggacttt tgtccagtga cagctgagac 120 aacaaggacc acgggaggag
gtgtaggaga gaagcgccgc gaacaggcat cgcccagcac 180 caagtccgct
tccaggcttt cggtttcttt gcctccatct tgggtgcgcc ttcccggcgt 240
ctaggggagc gaaggctgag gtggcagcgg caggagagtc cggccgcgac aggacgagtg
300 ctg atg gca gag att ggt gag gat ttg gat aaa tct gat gtg tcc tca
348 Met Ala Glu Ile Gly Glu Asp Leu Asp Lys Ser Asp Val Ser Ser 1 5
10 15 tta att ttc ctc atg aag gat tac atg ggc cga ggc aag ata agc
aag 396 Leu Ile Phe Leu Met Lys Asp Tyr Met Gly Arg Gly Lys Ile Ser
Lys 20 25 30 gag aag agt ttc ttg gac ctt gtg gtt gag ttg gag aaa
cta aat ctg 444 Glu Lys Ser Phe Leu Asp
Leu Val Val Glu Leu Glu Lys Leu Asn Leu 35 40 45 gtt gcc cca gat
caa ctg gat tta tta gaa aaa tgc cta aag aac atc 492 Val Ala Pro Asp
Gln Leu Asp Leu Leu Glu Lys Cys Leu Lys Asn Ile 50 55 60 cac aga
ata gac ctg aag aca aaa atc cag aag tac aag cag tct gtt 540 His Arg
Ile Asp Leu Lys Thr Lys Ile Gln Lys Tyr Lys Gln Ser Val 65 70 75
caa gga gca ggg aca agt tac agg aat gtt ctc caa gca gca atc caa 588
Gln Gly Ala Gly Thr Ser Tyr Arg Asn Val Leu Gln Ala Ala Ile Gln 80
85 90 95 aag agt ctc aag gat cct tca aat aac ttc agg gaa gaa cca
gtg aag 636 Lys Ser Leu Lys Asp Pro Ser Asn Asn Phe Arg Glu Glu Pro
Val Lys 100 105 110 aaa tcc att cag gaa tca gaa gct ttt ttg cct cag
agc ata cct gaa 684 Lys Ser Ile Gln Glu Ser Glu Ala Phe Leu Pro Gln
Ser Ile Pro Glu 115 120 125 gag aga tac aag atg aag agc aag ccc cta
gga atc tgc ctg ata atc 732 Glu Arg Tyr Lys Met Lys Ser Lys Pro Leu
Gly Ile Cys Leu Ile Ile 130 135 140 gat tgc att ggc aat gag aca gag
ctt ctt cga gac acc ttc act tcc 780 Asp Cys Ile Gly Asn Glu Thr Glu
Leu Leu Arg Asp Thr Phe Thr Ser 145 150 155 ctg ggc tat gaa gtc cag
aaa ttc ttg cat ctc agt atg cat ggt ata 828 Leu Gly Tyr Glu Val Gln
Lys Phe Leu His Leu Ser Met His Gly Ile 160 165 170 175 tcc cag att
ctt ggc caa ttt gcc tgt atg ccc gag cac cga gac tac 876 Ser Gln Ile
Leu Gly Gln Phe Ala Cys Met Pro Glu His Arg Asp Tyr 180 185 190 gac
agc ttt gtg tgt gtc ctg gtg agc cga gga ggc tcc cag agt gtg 924 Asp
Ser Phe Val Cys Val Leu Val Ser Arg Gly Gly Ser Gln Ser Val 195 200
205 tat ggt gtg gat cag act cac tca ggg ctc ccc ctg cat cac atc agg
972 Tyr Gly Val Asp Gln Thr His Ser Gly Leu Pro Leu His His Ile Arg
210 215 220 agg atg ttc atg gga gat tca tgc cct tat cta gca ggg aag
cca aag 1020 Arg Met Phe Met Gly Asp Ser Cys Pro Tyr Leu Ala Gly
Lys Pro Lys 225 230 235 atg ttt ttt att cag aac tat gtg gtg tca gac
ggc cag ctg gag gac 1068 Met Phe Phe Ile Gln Asn Tyr Val Val Ser
Asp Gly Gln Leu Glu Asp 240 245 250 255 agc agc ctc ttg gag gtg gat
ggg cca gcg atg aag aat gtg gaa ttc 1116 Ser Ser Leu Leu Glu Val
Asp Gly Pro Ala Met Lys Asn Val Glu Phe 260 265 270 aag gct cag aag
cga ggg ctg tgc aca gtt cac cga gaa gct gac ttc 1164 Lys Ala Gln
Lys Arg Gly Leu Cys Thr Val His Arg Glu Ala Asp Phe 275 280 285 ttc
tgg agc ctg tgt act gcg gac atg tcc ctg ctg gag cag tct cac 1212
Phe Trp Ser Leu Cys Thr Ala Asp Met Ser Leu Leu Glu Gln Ser His 290
295 300 agc tca ccg tcc ctg tac ctg cag tgc ctc tcc cag aaa ctg aga
caa 1260 Ser Ser Pro Ser Leu Tyr Leu Gln Cys Leu Ser Gln Lys Leu
Arg Gln 305 310 315 gaa agg ggg aca att ccc gga agt gga att aca gag
tca aag gac atg 1308 Glu Arg Gly Thr Ile Pro Gly Ser Gly Ile Thr
Glu Ser Lys Asp Met 320 325 330 335 cat ttt tca agc ctc gga tgc atc
tta cta gat gtc cta taggatggtc 1357 His Phe Ser Ser Leu Gly Cys Ile
Leu Leu Asp Val Leu 340 345 atatcagctt tataggagag tagctgtgtc
cctgaattct ccctgacact gcatgctctt 1417 atatttcctc aagttttgac
aatttgatag gtgaaaagtg gtatctgact gttcagatct 1477 ggaaggcttt
gttatataaa cattttttta atgtttattg gcaagaatac ttttctaaga 1537
gaaacatcag tgagctggtt tccatttaag ctgaatgaag ccacaatgta cctcaagtat
1597 aagattaact ggcctttttc agttgcactc taattacaat ttagaatgat
gtttctgagc 1657 cacctgtcaa atgcattctg ggctgtacct ctgcgtaccc
caggaataaa tctcatggcc 1717 ttctttacct ggcctcctta gtggtggccc
agcaggaagc gggggttaga gcaggagcca 1777 ctcagccttc caagatagat
actccatggg ccggtggtat tactggcctt ttgagcccat 1837 ccccatttgc
atagatgatc cacgtgggtt atcatctggc tggtatgttc ccagagtgaa 1897
actcagcagc cccttgaggg aggggatggt ggccatcagg ccagagtatt gcaagttagt
1957 ttggatcatt tgctaagcag cttgtggtgc cttcagaaag gaacagtttc
aaagaacttt 2017 cacatctgtt ggctcatttc gccctaatga cagtcttctc
tttgatattt gcatggcatt 2077 aaattttgcc tttcttgttt tctccagaaa
acgcccactc ctggatcttc acattgaact 2137 caatggctac atgtatgatt
ggaacagcag agtttctgcc aaggagaaat attatgtctg 2197 gctgcagcac
actctgagaa agaaacttat ctctcctaca cataagaaac caaaaggctg 2257
ggcgtagtgg ctcgcacctg tgatcccagc actttgggag gccgaggagg gcggatcact
2317 tcaggtcggg agttcgagac cagcctggcc agcatgtgaa cgctgtccct
agtagaagtg 2377 caaaaattgg ctggtgtggg tgtgggtacc ctgtattccc
agttgcttgg ggggctgagg 2437 tgggaggatc ttttgacccc aggagttcag
ggtcatagca tgctgtgatt gtgcctacga 2497 atagccactg cataccaacc
tgggcaatat agcaagatcc catctcttta aaaaaaaaaa 2557 aaaaaggaca
ggaactatct taaaaaaaaa aaaaaaaaaa 2597 6 348 PRT Homo sapiens 6 Met
Ala Glu Ile Gly Glu Asp Leu Asp Lys Ser Asp Val Ser Ser Leu 1 5 10
15 Ile Phe Leu Met Lys Asp Tyr Met Gly Arg Gly Lys Ile Ser Lys Glu
20 25 30 Lys Ser Phe Leu Asp Leu Val Val Glu Leu Glu Lys Leu Asn
Leu Val 35 40 45 Ala Pro Asp Gln Leu Asp Leu Leu Glu Lys Cys Leu
Lys Asn Ile His 50 55 60 Arg Ile Asp Leu Lys Thr Lys Ile Gln Lys
Tyr Lys Gln Ser Val Gln 65 70 75 80 Gly Ala Gly Thr Ser Tyr Arg Asn
Val Leu Gln Ala Ala Ile Gln Lys 85 90 95 Ser Leu Lys Asp Pro Ser
Asn Asn Phe Arg Glu Glu Pro Val Lys Lys 100 105 110 Ser Ile Gln Glu
Ser Glu Ala Phe Leu Pro Gln Ser Ile Pro Glu Glu 115 120 125 Arg Tyr
Lys Met Lys Ser Lys Pro Leu Gly Ile Cys Leu Ile Ile Asp 130 135 140
Cys Ile Gly Asn Glu Thr Glu Leu Leu Arg Asp Thr Phe Thr Ser Leu 145
150 155 160 Gly Tyr Glu Val Gln Lys Phe Leu His Leu Ser Met His Gly
Ile Ser 165 170 175 Gln Ile Leu Gly Gln Phe Ala Cys Met Pro Glu His
Arg Asp Tyr Asp 180 185 190 Ser Phe Val Cys Val Leu Val Ser Arg Gly
Gly Ser Gln Ser Val Tyr 195 200 205 Gly Val Asp Gln Thr His Ser Gly
Leu Pro Leu His His Ile Arg Arg 210 215 220 Met Phe Met Gly Asp Ser
Cys Pro Tyr Leu Ala Gly Lys Pro Lys Met 225 230 235 240 Phe Phe Ile
Gln Asn Tyr Val Val Ser Asp Gly Gln Leu Glu Asp Ser 245 250 255 Ser
Leu Leu Glu Val Asp Gly Pro Ala Met Lys Asn Val Glu Phe Lys 260 265
270 Ala Gln Lys Arg Gly Leu Cys Thr Val His Arg Glu Ala Asp Phe Phe
275 280 285 Trp Ser Leu Cys Thr Ala Asp Met Ser Leu Leu Glu Gln Ser
His Ser 290 295 300 Ser Pro Ser Leu Tyr Leu Gln Cys Leu Ser Gln Lys
Leu Arg Gln Glu 305 310 315 320 Arg Gly Thr Ile Pro Gly Ser Gly Ile
Thr Glu Ser Lys Asp Met His 325 330 335 Phe Ser Ser Leu Gly Cys Ile
Leu Leu Asp Val Leu 340 345 7 26 DNA Artificial sequence Primer 7
cgcccatggc tgaagtcatc catcag 26 8 27 DNA Artificial sequence Primer
8 cgcaagcttg tgctgggatt acaggtg 27 9 26 DNA Artificial sequence
Primer 9 cgcccatgga gattggtgag gatttg 26 10 26 DNA Artificial
sequence Primer 10 cgcaagctta gagcatgcag tgtcag 26 11 33 DNA
Artificial sequence Primer 11 cgcggatccg ccatcatgtc tgctgaagtc atc
33 12 27 DNA Artificial sequence Primer 12 cgcggtaccg tgctgggatt
acaggtg 27 13 33 DNA Artificial sequence Primer 13 cgcggatccg
ccatcatggc agagattggt gag 33 14 26 DNA Artificial sequence Primer
14 cgcggtacca gagcatgcag tgtcag 26 15 33 DNA Artificial sequence
Primer 15 cgccccgggg ccatcatgtc tgctgaagtc atc 33 16 57 DNA
Artificial sequence Primer 16 cgctctagat caagcgtagt ctgggacgtc
gtatgggtag tgctgggatt acaggtg 57 17 33 DNA Artificial sequence
Primer 17 cgcggatccg ccatcatgtc tgctgaagtc atc 33 18 27 DNA
Artificial sequence Primer 18 cgcggtaccg tgctgggatt acaggtg 27 19
33 DNA Artificial sequence Primer 19 cgcggatccg ccatcatggc
agagattggt gag 33 20 56 DNA Artificial sequence Primer 20
cgctctagat caagcgtagt ctgggacgtc gtatgggtaa gagcatgcag tgtcag 56 21
33 DNA Artificial sequence Primer 21 cgcggatccg ccatcatggc
agagattggt gag 33 22 26 DNA Artificial sequence Primer 22
cgcggtacca gagcatgcag tgtcag 26 23 414 DNA Homo sapiens
misc_feature (16)..(16) May be any nucleotide. 23 aattcggcac
gagggnggac ttggctgaac tgctctacag agtgaggcga tttgacctgc 60
tcaaacgtat cttgaagatg gacagaaaag ctgtggagac ccacctgctc aggaaccctc
120 accttgtttc ggactataga gtgctgatgg cagagattgg tgaggatttg
gataaatctg 180 atgtgtcctc attaattttc ctcatgaagg attacatggg
ccgaggcaag ataagcaagg 240 agaagagttt cttgggacct tggtggttga
gttgggagaa actaaatctg gtttgcccca 300 gatcaactng ggatttntta
ggaaaaatgc ctaaagaaca tncacaggat agacctgnag 360 acaaaantcc
agnagtacan gcagtntgtt cagggagcag ggacaattnc agga 414 24 393 DNA
Homo sapiens misc_feature (41)..(41) May be any nucleotide. 24
tgccaaggag aaatattatg tctggctgca gcacactctg ngaaagaaac ttatcctctc
60 ctacacataa gaaaccnaaa ggctgggcgt agtggctcac gcctgtnaat
cccagcactt 120 tgggaggcca aggagggcag atcacttcag gtcaggagtt
cgagaccagc ctggccaaca 180 tggtaaacgc tgtccctagt aaaantacaa
aanttagctg ggtgtgggtg tgggtacctg 240 tgttcccagt tacttgggag
gctgaggtgg gaggatcttt tggaacccag gagtttcagg 300 gtcatagcat
gctgtgnttg tgccctnacg aattagccac tgcattacca acctggggca 360
atnttaggca agatcccatn tnttttaaaa aaa 393 25 309 DNA Homo sapiens
misc_feature (229)..(229) May be any nucleotide. 25 tggatcttca
cattgaactc aatggctaca tgtatgattg gaacagcaga gtttctgcca 60
aggagaaata ttatgtctgg ctgcagcaca ctctgagaaa gaaacttatc ctctcctaca
120 cataagaaac caaaaggctg ggcgtagtgg ctcacgcctg tgatcccagc
actttgggag 180 gccggggagg gcagatcact tcaggtcagg agttcgagac
cggcctggnc aacatggtag 240 acgctgtccc tagtaaaaat gcaaaagttg
gctgggtgtg ggtgtnggta cctgtgttcc 300 cagttgctt 309 26 500 DNA Homo
sapiens misc_feature (117)..(117) May be any nucleotide. 26
aattcggcag agctcactca gggctccccc tgcatcacat caggaggatg ttcatgggag
60 attcatgccc ttatctagca gggaagccaa agatgttttt tattcagaac
tatgtgntgt 120 cagagggcca gctggaggac agcagcctct tggaggtgga
tgggccagcn atgaagaatg 180 tggaattcaa ggctcagaag cgagggctgt
gcacagttca ccgagnaagc tgacttcttc 240 tggagcctgt gtaatgcgga
catgtccctg cttggagcaa tcttcanagg ttcancgtcc 300 ctgtnacctg
catgcctttt cccagaaact gngacaagna agaaaacgnc cantnctggg 360
gntntttcac attggaactc aatggttaca anttatgntt ggggncaaca anttttttgc
420 caagggggaa ttttttgttt tgggntgnag aaaaatttng ggaaagaant
ttttcccttn 480 cnnnaaatta ggnacccaaa 500 27 324 DNA Homo sapiens 27
attctgaaaa agaatgtggg gtttccttgc agatgagttc atctgttgtt tcatttcctt
60 tacaataact cccccactgg aaaggattct gaaagaaatg aagtcagccc
tcagaaatga 120 agttgactgc ctgctggctt tctgttgact ggcctggagc
tgtactgcaa gacccttgtg 180 agcttcccta gtctaagagt aggatgtctg
ctgaagtcat ccatcaggtt gaagaagcac 240 ttgatacaga tgagaaggag
atgctgctct ttttgtgccg ggatgttgct atagatgtgg 300 ttccacctaa
tgtcagggac cttc 324 28 389 DNA Homo sapiens misc_feature (1)..(1)
May be any nucleotide. 28 naattcggca gaganaagag tctcaaggat
ccttcaaata acttcaggct ccataatggg 60 agaagtaaag aacaaagact
taaggaacag cttggcgctc aacaagaacc agtgnaagaa 120 atccattcag
gaatcagaag cttttttgcc tcagagcata cctgaagaga gatacaagat 180
gaagagcaag cccctaggga atctgcctga taaatcgatt gcattggcaa tgaggacaga
240 gcttcttcgg ggacaccttc acttccctgg gcttatgaag tnccaggaaa
ttcttgcatc 300 tcagtatgca tggtattntc ccagattttt tgggnccaat
ttgcccgtta tgnccngggc 360 ancnggggat ttangacaat tttgtggtg 389 29
308 DNA Homo sapiens misc_feature (14)..(14) May be any nucleotide.
29 attctgaaaa agantgnggg gtttccttgc agatgagttc atctnttgtt
tcatttcctt 60 tacaataact cccccactgg aaaggattct gaaagnaatg
aagtcagccc tcagaaatga 120 agttgnctgc ctgctggctt tctgttgact
ggcctggagc tgtactgcaa gacccttgtg 180 agcttcccta gtctaagagt
aggatgtctg ctgaagtcat ccatcaggtt gaagaagcac 240 ttgatacaga
tgagaaggag atgctgctct ttttgtgccg ggatgtttgc tatagatgtg 300 gttccacc
308 30 297 DNA Homo sapiens misc_feature (28)..(28) May be any
nucleotide. 30 attctgaaaa agaatgtggg gtttcctngc agatgagttc
atctgttgtt tcatttcctt 60 tacaataact cccccactgg aaaggattct
gaaagaaatg aagtcagccc tcagaaatga 120 agttgactgc ctgctggctt
tctgttgact ggcctggagc tgtactgcaa gacccttgtg 180 agcttcccta
gtctaagagt aggatgtctg ctgaagtcat ccatcaggtt gaagaagcac 240
ttgatacaga tgagaaggag atgctgctct tttttgtgcc gggatgttgc tatagat 297
31 348 DNA Homo sapiens 31 tataggatgg tcatatcagc tttataggag
agtagctgtg tccctgaatt ctccctgaca 60 ctgcatgctc ttatatttcc
tcaagttttg acaatttgat aggtgaaaag tggtatctga 120 ttgttcagat
ctggaaggct ttgttatata aacatttttt taatgtttat tggcaagaat 180
acttttctaa gagaaacatc agtgagctgg tttccattta agctgaatga agccacaatg
240 tacctcaagt ataaggttaa ctggcctttt ttcagttgca ctctaattac
aatttagaat 300 gatgtttctg agccacctgt caaatgcatt ctggggctgt acctcttg
348 32 333 DNA Homo sapiens misc_feature (48)..(48) May be any
nucleotide. 32 tataggatgg tcatatcagc tttataggag agtagctgtg
tccctgantt ctccctgaca 60 ctgcatgctc ttatatttcc tcaagttttg
acaatttgat aggtgaaaag tggtatctga 120 ctgtncagat ctggaaggct
ttgttatata aacatttttt taatgtttat tggcaagaat 180 acttttctaa
gagaaacatc agtgagctgg tttccattta agctgaatga agccacaatg 240
tacctcangt ataaggatta actggccttt ttccagttgc actctaatta caattttaga
300 atgatgttcn gaggccacct gtcaaatgca ttc 333 33 5 PRT Homo sapiens
33 Gln Ala Cys Arg Gly 1 5 34 5 PRT Homo sapiens 34 Gln Ala Cys Gln
Gly 1 5 35 5 PRT Homo sapiens 35 Gln Asn Tyr Val Val 1 5
* * * * *