U.S. patent application number 11/471396 was filed with the patent office on 2006-10-19 for use of a33 antigens and jam-it.
This patent application is currently assigned to GENENTECH, INC.. Invention is credited to Avi Ashkenazi, Sherman Fong, Audrey Goddard, Austin L. Gurney, Menno van Lookeren, Mary A. Napier, Daniel Tumas, William I. Wood.
Application Number | 20060233803 11/471396 |
Document ID | / |
Family ID | 32072869 |
Filed Date | 2006-10-19 |
United States Patent
Application |
20060233803 |
Kind Code |
A1 |
Ashkenazi; Avi ; et
al. |
October 19, 2006 |
Use of A33 antigens and JAM-it
Abstract
The present invention relates to compositions and methods of
treating and diagnosing disorders characterized the by the presence
of antigens associated with inflammatory diseases and/or
cancer.
Inventors: |
Ashkenazi; Avi; (San Mateo,
CA) ; Fong; Sherman; (Alameda, CA) ; Goddard;
Audrey; (San Francisco, CA) ; Gurney; Austin L.;
(Belmont, CA) ; Napier; Mary A.; (Hillsborough,
CA) ; Tumas; Daniel; (Orinda, CA) ; Lookeren;
Menno van; (San Francisco, CA) ; Wood; William
I.; (Hillsborough, CA) |
Correspondence
Address: |
HELLER EHRMAN LLP
275 MIDDLEFIELD ROAD
MENLO PARK
CA
94025-3506
US
|
Assignee: |
GENENTECH, INC.
|
Family ID: |
32072869 |
Appl. No.: |
11/471396 |
Filed: |
June 19, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10633008 |
Jul 31, 2003 |
|
|
|
11471396 |
Jun 19, 2006 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
10633008 |
Jul 31, 2003 |
|
|
|
PCT/US00/04414 |
Feb 22, 2000 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
PCT/US00/14042 |
May 22, 2000 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
PCT/US00/32678 |
Dec 1, 2000 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
09254465 |
Mar 5, 1999 |
6410708 |
|
|
10265542 |
Oct 3, 2002 |
|
|
|
PCT/US99/05028 |
Mar 8, 1999 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
09380138 |
Aug 25, 1999 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
09380139 |
Aug 25, 1999 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
PCT/US98/19330 |
Sep 16, 1998 |
|
|
|
10265542 |
Oct 3, 2002 |
|
|
|
09953499 |
Sep 14, 2001 |
6838554 |
|
|
10265542 |
Oct 3, 2002 |
|
|
|
PCT/US98/24855 |
Nov 20, 1998 |
|
|
|
09953499 |
Sep 14, 2001 |
|
|
|
Current U.S.
Class: |
424/145.1 |
Current CPC
Class: |
A61P 5/14 20180101; G01N
33/6893 20130101; A61P 1/00 20180101; A61P 37/06 20180101; G01N
33/574 20130101; A61P 21/00 20180101; A61P 19/08 20180101; A61P
29/00 20180101; C07K 14/705 20130101; A61P 31/12 20180101; G01N
33/566 20130101; C12Q 1/6883 20130101; G01N 33/57492 20130101; A61P
37/02 20180101; A61P 19/00 20180101; C07K 16/2803 20130101; A61P
1/16 20180101; A61P 7/06 20180101; G01N 33/57407 20130101; G01N
2800/065 20130101; A61P 25/00 20180101; A61P 13/12 20180101; C07K
2317/56 20130101; G01N 2800/127 20130101; A61P 35/00 20180101; C12Q
2600/158 20130101; G01N 33/564 20130101; G01N 2800/24 20130101;
A61P 11/00 20180101; A61P 11/06 20180101; A61K 2039/505 20130101;
C07K 16/28 20130101; A61P 17/06 20180101; G01N 2800/102 20130101;
G01N 2800/122 20130101; A61P 37/08 20180101; G01N 2333/705
20130101; A61P 7/04 20180101; A61P 7/00 20180101; A61P 3/10
20180101; C07K 2319/30 20130101; A61P 17/00 20180101; A61P 1/04
20180101; A61P 19/02 20180101 |
Class at
Publication: |
424/145.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395 |
Claims
1. A method of treating an inflammatory disorder characterized by
elevated expression of the polypeptide of SEQ ID NO: 32 in a
mammal, comprising administering to said mammal an effective amount
of an immunoadhesin comprising an extracellular domain sequence of
the polypeptide of SEQ ID NO: 32, whereby said inflammatory disease
is treated.
2. The method of claim 1 wherein said immunoadhesin comprises said
extracellular domain sequence fused to an immunoglobulin constant
region sequence.
3. The method of claim 2 wherein said extracellular domain sequence
is essentially free of transmembrane domain sequences.
4. The method of claim 2 wherein said immunoglobulin is an IgG.
5. The method of claim 4 wherein said IgG is IgG1 or IgG3.
6. The method of claim 1 wherein said mammal is human.
7. The method of claim 6 wherein said inflammatory disorder is
selected from the group consisting of rheumatoid arthritis,
pneumonia, chronic asthma, chronic hepatitis, and osteoarthritis.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of copending U.S.
patent application Ser. No. 10/633,008 filed Jul. 31, 2003, which
is a continuation in part of U.S. patent application Ser. No.
10,265,542 filed Oct. 3, 2002, which is a continuation in part of
PCT international application no. PCT/US00/04414, filed Feb. 22,
2000, as a continuation in part of PCT international application
no. PCT/US00/14042, filed May 22, 2000, as a continuation in part
of PCT international application no. PCT/US00/32678, filed Dec. 1,
2000, as a continuation in part of U.S. patent application Ser. No.
09/254,465, filed Mar. 5, 1999, now, U.S. Pat. No. 6,410,708, as a
continuation in part of PCT international application no.
PCT/US99/05028, filed Mar. 8, 1999, as a continuation in part of
U.S. patent application Ser. No. 09/380,138, filed Aug. 25, 1999,
as a continuation in part of U.S. patent application Ser. No.
09/380,139, filed Aug. 25, 1999, now abandoned, as a continuation
in part of PCT international application no. PCT/US98/19330, filed
Sep. 16, 1998, and as a continuation in part of U.S. patent
application Ser. No. 09/953,499, filed Sep. 14, 2001, which in turn
is a continuation application, claiming priority under 35 U.S.C.
.sctn.120 as a continuation of PCT international application no.
PCT/US98/24855, filed Nov. 20, 1998. The entire contents of which
are hereby incorporated by reference in their entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates generally to the
identification, isolation and recombinant production of novel DNA
and novel polypeptides the presence of which is associated with
inflammatory diseases (inflammation associated antigens) and/or
cancer, and to compositions and methods for the diagnosis and
treatment of conditions characterized by such antigens.
[0004] 2. Description of the Related Art
[0005] The inflammatory response is complex and is mediated by a
variety of signaling molecules produced locally by mast cells,
nerve endings, platelets, leukocytes and complement activation.
Certain of these signaling molecules cause the endothelial cell
lining to become more porous and/or even to express selections
which act as cell surface molecules which recognize and attract
leukocytes through specific carbohydrate recognition. Stronger
leukocyte binding is mediated by integrins, which mediate leukocyte
movement through the endothelium. Additional signaling molecules
act as chemoattractants, causing the bound leukocytes to crawl
towards the source of the attractant. Other signaling molecules
produced in the course of an inflammatory response escape into the
blood and stimulate the bone marrow to produce more leukocytes and
release them into the blood stream.
[0006] Inflammation is typically initiated by an antigen, which can
be virtually any molecule capable of initiating an immune response.
Under normal physiological conditions these are foreign molecules,
but molecules generated by the organism itself can serve as the
catalyst as is known to occur in various disease states.
[0007] T-cell proliferation in a mixed lymphocyte culture or mixed
lymphocyte reaction (MLR) is an established indication of the
ability of a compound to stimulate the immune system. In an
inflammatory response, the responding leukocytes can be
neutrophilic, eosinophilic, monocytic or lymphocytic. Histological
examination of the affected tissues provides evidence of an immune
stimulating or inhibiting response. See Current Protocols in
Immunology, ed. John E. Coligan, 1994, John Wiley and Sons,
Inc.
[0008] Inflammatory bowel disease (IBD) is a term used to
collectively describe gut disorders including both ulcerative
colitis (UC) and Crohn's disease, both of which are classified as
distinct disorders, but share common features and likely share
pathology. The commonality of the diagnostic criteria can make it
difficult to precisely determine which of the two disorders a
patient has; however the type and location of the lesion in each
are typically different. UC lesions are characteristically a
superficial ulcer of the mucosa and appear in the colon, proximal
to the rectum. CD lesions are characteristically extensive linear
fissures, and can appear anywhere in the bowel, occasionally
involving the stomach, esophagus and duodenum.
[0009] Conventional treatments for IBD usually involve the
administration of anti-inflammatory or immunosuppressive agents,
such as sulfasalazine, corticosteroids,
6-mercaptopurine/azathoprine, or cyclosporine all of which only
bring partial relief to the afflicted patient. However when
anti-inflammatory/immunosuppresive therapies fail, colectomies are
the last line of defense. Surgery is required for about 30% of CD
patients within the first year after diagnosis, with the likelihood
for operative procedure increasing about 5% annually thereafter.
Unfortunately, CD also has a high rate of reoccurrence as about 5%
of patients require subsequent surgery after the initial year. UC
patients further have a substantially increased risk of developing
colorectal cancer. Presumably this is due to the recurrent cycles
of injury to the epithelium, followed by regrowth, which
continually increases the risk of neoplastic transformation.
[0010] A recently discovered member of the immunoglobulin
superfamily known as Junctional Adhesion Molecule (JAM) has been
identified to be selectively concentrated at intercellular
junctions of endothelial and epithelial cells of different origins.
Martin-Padura, 1. et al., J. Cell Biol. 142(1): 117-27 (1998). JAM
is a type I integral membrane protein with two extracellular,
intrachain disulfide loops of the V-type. JAM bears substantial
homology to A33 antigen (FIG. 1 or FIG. 18). A monoclonal antibody
directed to JAM was found to inhibit spontaneous and
chemokine-induced monocyte transmigration through an endothelial
cell monolayer in vitro. Martin-Padura, supra. It has been recently
discovered that JAM expression is increased in the colon of CRF2-4
-/- mice with colitis. CRF 2-4 -/- (IL-10R subunit knockout mice)
develop a spontaneous colitis mediated by lymphocytes, monocytes
and neutrophils. Several of the animals also developed colon
adenocarcinoma. As a result, it is likely that the polypeptides
disclosed herein are expressed in elevated levels in or otherwise
associated with human diseases such as inflammatory bowel disease,
other inflammatory diseases of the gut as well as colorectal
carcinoma.
[0011] JAM and the polypeptides disclosed herein bear significant
homology to A33 antigen, a known colorectal cancer-associated
marker. The A33 antigen is expressed in more than 90% of primary or
metastatic colon cancers as well as normal colon epithelium. In
carcinomas originating from the colonic mucosa, the A33 antigen is
expressed homogeneously in more than 95% of all cases. The A33
antigen, however, has not been detected in a wide range of other
normal tissues, i.e., its expression appears to be organ specific.
Therefore, the A33 antigen appears to play an important role in the
induction of colorectal cancer.
[0012] Since colon cancer is a widespread disease, early diagnosis
and treatment is an important medical goal. Diagnosis and treatment
of colon cancer can be implemented using monoclonal antibodies
(mAbs) specific therefore having fluorescent, nuclear magnetic or
radioactive tags. Radioactive gene, toxins and/or drug tagged mAbs
can be used for treatment in situ with minimal patient description.
mAbs can also be used to diagnose during the diagnosis and
treatment of colon cancers. For example, when the serum levels of
the A33 antigen are elevated in a patient, a drop of the levels
after surgery would indicate the tumor resection was successful. On
the other hand, a subsequent rise in serum A33 antigen levels after
surgery would indicate that metastases of the original tumor may
have formed or that new primary tumors may have appeared.
[0013] Such monoclonal antibodies can be used in lieu of, or in
conjunction with surgery and/or other chemotherapies. For example,
preclinical analysis and localization studies in patients infected
with colorectal carcinoma with a mAb to A33 are described in Welt
et al., J. Clin. Oncol. 8: 1894-1906 (1990) and Welt et al., J.
Clin. Oncol. 12: 1561-1571 (1994), while U.S. Pat. No. 4,579,827
and U.S. Ser. No. 424,991 (E.P. 199,141) are directed to the
therapeutic administration of monoclonal antibodies, the latter of
which relates to the application of anti-A33 mAb.
SUMMARY OF THE INVENTION
[0014] In one aspect, the present invention concerns a method of
treating an inflammatory disorder in a mammal, comprising
administering to the mammal a therapeutically effective amount of
an antagonist of a native sequence STIgMA polypeptide.
[0015] In one embodiment, the STIgMA polypeptide is selected from
the group consisting of polypeptides of SEQ ID NOS: 2, 32, 33, and
34.
[0016] In another embodiment, the antagonist is an antibody, such
as a monoclonal antibody, which may have non-human complementarity
determining region (CDR) residues and contains human framework
region (FR) residues.
[0017] In a further embodiment, the antagonist is an immunoadhesin,
which comprises a STIgMA extracellular domain sequence fused to an
immunoglobulin constant region sequence.
[0018] In another embodiment, the inflammatory disorder is selected
from the group consisting of: inflammatory bowel disease; systemic
lupus erythematosus; rheumatoid arthritis; juvenile chronic
arthritis; spondyloarthropathies; systemic sclerosis, for example,
scleroderma; idiopathic inflammatory myopathies for example,
dermatomyositis, polymyositis; Sjogren's syndrome; systemic
vaculitis; sarcoidosis; autoimmune hemolytic anemia for example,
immune pancytopenia, paroxysmal nocturnal hemoglobinuria;
autoimmune thrombocytopenia, for example, idiopathic
thrombocytopenic purpura, immune-mediated thrombocytopenia;
thyroiditis, for example, Grave's disease, Hashimoto's thyroiditis,
juvenile lymphocytic thyroiditis, atrophic thyroiditis; diabetes
mellitus, immune-mediated renal disease, for example,
glomerulonephritis, tubulointerstitial nephritis; demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy; hepatobiliary
diseases such as infectious hepatitis such as hepatitis A, B, C, D,
E and other nonhepatotropic viruses; autoimmune chronic active
hepatitis; primary biliary cirrhosis; granulomatous hepatitis; and
sclerosing cholangitis; inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis); gluten-sensitive enteropathy; Whipple's
disease; autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis; allergic diseases of the lung such as eosinophilic
pneumonia, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection and graft-versus host disease.
[0019] In a different aspect, the invention concerns a method of
diagnosing an inflammatory disorder in a mammal, said method
comprising detecting the level of expression of a gene encoding a
STIgMA polypeptide (a) in a test sample of cells obtained from said
mammal, and (b) in a control sample of known normal cells of the
same cell type, wherein a higher level of expression of said gene
in the test sample as compared to the control sample is indicative
of the presence of an immune related disorder in the mammal from
which the test tissue cells were obtained.
[0020] In a further aspect, the invention concerns a method of
diagnosing an inflammatory disorder in a mammal, said method
comprising (a) contacting an anti-STIgMA antibody with a test
sample of cells obtained from said mammal, and (b) detecting the
formation of a complex between the antibody and STIgMA polypeptide
in the test sample, wherein formation of said complex is indicative
of the presence of an inflammatory disorder in said mammal.
[0021] The invention further concerns an isolated antibody which
specifically binds a STIgMA polypeptide.
[0022] In a different aspect, the invention concerns an isolated
nucleic acid molecule comprising a nucleotide sequence encoding a
polypeptide having at least about 80%, or at least about 85% or at
least about 90% or at least about 95% or at least about 99%
sequence identity with the amino acid sequence of amino acids 21 to
276 of SEQ ID NO: 32, or amino acids 21 to 182 of SEQ ID NO: 33, or
amino acids 21 to 180 of SEQ ID NO: 34.
[0023] The invention further concerns vectors and cells comprising
the nucleic acids of the invention.
[0024] In another aspect, the invention concerns a polypeptide
comprising an amino acid sequence selected from the group
consisting of amino acids 21 to 276 of SEQ ID NO: 32, amino acids
21 to 182 of SEQ ID NO: 33, and amino acids 21 to 180 of SEQ ID NO:
34.
[0025] In yet another aspect, the invention concerns an
immunoadhesin comprising amino acids from 1 or about 21 to about
276 of SEQ ID NO: 32, or amino acids from 1 or about 21 to about
182 of SEQ ID NO: 33, or amino acids 1 or about 21 to about 180 of
SEQ ID NO: 34, fused to an immunoglobulin constant region
sequence.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] FIG. 1 show a comparison between the polypeptides encoded by
A33 antigen (SEQ ID NO: 6), DNA40628 (SEQ ID NO: 1), DNA45416 (SEQ
ID NO: 2), DNA35638 (SEQ ID NO: 9) and JAM (SEQ ID NO: 10).
[0027] FIG. 2 shows the derived amino acid sequence (SEQ ID NO: 1)
of a native sequence PRO301 polypeptide. This polypeptide is 299
amino acids long, having signal sequence at residue 1 to 27, an
extracellular domain at residue 28 to about 235, Ig superfamily
homology at residue 94 to 235, a potential transmembrane domain at
residue 236 to about 258, and an intracellular domain at about
residue 259 to 299.
[0028] FIG. 3 shows the amino acid sequence (SEQ ID NO: 2) derived
from nucleotides 119-1081 of the nucleotide sequence shown in FIGS.
6A and 6B (DNA45416, SEQ ID NO: 7). Also shown in FIG. 3 as
underlines are the locations of a glycosoaminoglycan site and a
transmembrane domain.
[0029] FIG. 4A shows the consensus assembly DNA35936 (SEQ ID NO:
3), and FIG. 4B shows consen01 (SEQ ID NO: 4) which were both used
in the isolation of DNA40628 (SEQ ID NO: 11). FIG. 4C shows
consen02 (DNA42257) (SEQ ID NO: 5) which was used in the isolation
of DNA45416 (SEQ ID NO: 7).
[0030] FIG. 5 shows the nucleotide sequence of a native sequence
DNA40628 cDNA (SEQ ID NO: 11), which is a native sequence PRO301
cDNA also designated as "UNQ264" and/or "DNA40628-1216".
[0031] FIGS. 6A & B show a nucleotide sequence DNA45416 (SEQ ID
NO: 7) which is a native sequence PRO362 cDNA also designated as
"UNQ317" and/or "DNA45416-1251". Also presented are the initiator
methionine and the protein translation for a full-length PRO362
polypeptide (SEQ ID NO: 2).
[0032] FIG. 7 shows the nucleotide sequence (SEQ ID NO: 8) of a
native sequence PRO245 cDNA, wherein the nucleotide sequence is
designated as "UNQ219" and/or "DNA35638".
[0033] FIG. 8 shows the oligonucleotide sequences OL12162
(35936.f1)(SEQ ID NO: 12), OL12163 (35936.p1)(SEQ ID NO: 13),
OL12164 (35936.f2)(SEQ ID NO: 14), OL12165 (35936.r1)(SEQ ID NO:
15), OL12166 (35936.f3)(SEQ ID NO: 16), OL12167 (35936.r2)(SEQ ID
NO: 17) which were used in the isolation of DNA40628.
[0034] FIGS. 9A & B show a double stranded representation of
the DNA42257 (consen02) (SEQ ID NO: 5) along with the locations of
five oligonucleotide primers, showed in underline, all used in the
isolation of DNA45416 (SEQ ID NO: 7). The oligonucleotides depicted
are: 42257.f1 (SEQ ID NO: 18), 42257.f2 (SEQ ID NO: 19), 42257.r1
(SEQ ID NO: 20), 42257.r2 (SEQ ID NO: 21) and 42257.p1 (SEQ ID NO:
22).
[0035] FIGS. 10A and B describe the Blast score, match and percent
homology alignment between 2 overlapping fragments of DNA40628 and
A33_HUMAN, a human A33 antigen precursor. FIG. 10A compares the
coded residues 24 to 283 of DNA40628 (SEQ ID NO: 23) with the coded
residues 17 to 284 of A33 HUMAN (SEQ ID NO: 24); FIG. 10B compares
the coded residues 21 to 239 of DNA40628 (SEQ ID NO: 25) with the
coded residues 12 to 284 of A33_HUMAN (SEQ ID NO: 26),
respectively.
[0036] FIG. 11 shows the derived amino acid sequence of a native
sequence PRO245 polypeptide (SEQ ID NO: 9) encoded by the
nucleotide sequence of FIG. 7 (DNA35638, SEQ ID NO: 8). This
polypeptide is a 312 amino acids in length, having signal sequence
at residue 1 to 28 and a potential transmembrane domain at about
residue 237 to about 259.
[0037] FIG. 12 indicates a 25.3% identity between the amino acid
sequence encoded by DNA40628 (SEQ ID NO: 1) and A33 antigen (SEQ ID
NO: 6).
[0038] FIG. 13 indicates a 20.8% identity between the amino acid
sequence encoded by DNA45416 (SEQ ID NO: 2) and A33 antigen (SEQ ID
NO: 6).
[0039] FIG. 14 indicates a 24.3% identity between the amino acid
sequence encoded by DNA35638 (SEQ ID NO: 9) and A33 antigen (SEQ ID
NO: 6).
[0040] FIG. 15 indicates a 67.6% identity between the amino acid
sequence encoded by DNA40628 (SEQ ID NO: 1) and JAM (SEQ ID NO:
10).
[0041] FIG. 16 indicates a 23.3% identity between the amino acid
sequence encoded by DNA45416 (SEQ ID NO: 2) and JAM (SEQ ID NO:
10).
[0042] FIG. 17 indicates a 34.2% identity between the amino acid
sequence encoded by DNA35638 (SEQ ID NO: 29) and JAM (SEQ ID NO:
10).
[0043] FIG. 18 indicates a 26% identity between the amino acid
sequence encoded by A33 antigen (SEQ ID NO: 6) and JAM (SEQ ID NO:
16).
[0044] FIG. 19 shows the results of the dot blot hybridization
procedure described in Example 8.
[0045] FIG. 20 shows the results of the TAQMAN.TM. mRNA expression
assay described in Example 9.
[0046] FIG. 21 shows the binding of protein encoded by DNA40628 to
human neutrophils as described in Example 7.
[0047] FIG. 22 shows the amino acid sequence (SEQ ID NO: 31) of
PRO1868 with , representing a putative signal cleavage site,
.circle-solid., representing conserved extracellular cysteines, the
transmembrane domain underlined and the overlying dotted lines,
representing potential N-glycosylation sites. This polypeptide is
310 amino acids in length, having signal sequence at residue 1 to
30 and a potential transmembrane domain at about residue 242 to
about 266.
[0048] FIG. 23 shows in situ hybridization of PRO362 in mouse liver
frozen sections.
[0049] FIG. 24 shows in situ hybridization of PRO362 in human liver
frozen sections.
[0050] FIG. 25 shows in situ hybridization of PRO362 in colon
macrophages (FIG. 25A), Kupffer cells (FIG. 25B), adrenal
macrophages (FIG. 25C), Hofbauer cells (FIG. 25D).
[0051] FIG. 26 shows in situ hybridization of PRO362 mRNA in
Synovial cells.
[0052] FIG. 27 shows in situ hybridization of PRO362 mRNA in type A
synovial cells.
[0053] FIG. 28 shows in situ hybridization of PRO362 mRNA in brain
microglia cells.
[0054] FIG. 29 shows in situ hybridization of PRO362 mRNA in cells
from human asthmatic tissue.
[0055] FIG. 30 shows in situ hybridization of PRO362 mRNA in cells
from human chronic hepatitis tissue.
[0056] FIG. 31 shows in situ hybridization of PRO245 mRNA in lymph
node and tonsil high endothelial venule (HEV) cells of normal human
tissue.
[0057] FIG. 32 shows in situ hybridization of PRO245 mRNA in
arteriolar endothelium of inflamed and normal human lung tissue, as
well as in normal seminiferous tubules of testis in spermatogenic
cells.
[0058] FIG. 33 shows in situ hybridization of PRO245 mRNA in human
testicular, lung and mammary carcinoma tissue.
[0059] FIG. 34 shows in situ hybridization of PRO245 mRNA in human
breast carcinoma tissue.
[0060] FIG. 35 shows immunohistochemical analysis of PRO362 in
macrophages.
[0061] FIG. 36 shows immunohistochemical analysis of PRO362 in
Kupffer cells.
[0062] FIG. 37 shows immunohistochemical analysis of PRO362 in
microglial cells.
[0063] FIG. 38 shows immunohistochemical analysis of PRO362 in
Hofbauer cells.
[0064] FIG. 39 shows SDS-PAGE analysis of PRO1868 mRNA detected by
reverse-transcriptase PCR (RT-PCR) in T cell lines J45 and Molt4,
and B cell lines JY, RPM18866 and RAMOS.
[0065] FIG. 40 shows a schematic summarizing PRO245 binding by
cytolytic T cells, NK-T cells, and NK cells.
[0066] FIG. 41 shows flow cytometry results of binding between NK
(CD56+) cells and PRO245-Fc fusion protein.
[0067] FIG. 42 shows flow cytometry results of binding between
peripheral blood dendritic cells (PBDCs) and PRO245-Fc fusion
protein.
[0068] FIG. 43 shows a graph representing flow cytometry results of
binding between J45 T cells and PRO245-Fc fusion protein.
[0069] FIG. 44 shows flow cytometry results of binding between J45
T cells and PRO245-Fc fusion protein.
[0070] FIG. 45 shows a graph of flow cytometry results that
demonstrates the ability of excess His-tagged-PRO1868 to block J45
cell adherence to PRO245-Fc fusion protein.
[0071] FIG. 46 shows flow cytometry results of the ability of
His-tagged-PRO1868 to block PRO245-Fc fusion protein to NK (CD56+)
cells.
[0072] FIG. 47 shows a graph representing the percent adhesion of
labeled J45 cells to wells coated with varying concentrations of
PRO245.
[0073] FIG. 48 shows immunoprecipitation of biotinylated J45 cells
to Fc-cross-linked PRO245-Fc fusion protein A matrix.
[0074] FIG. 49 shows immunoprecipitation of PRO1868 from J45 and
PBMC cells using PRO245-Fc fusion protein cross-linked protein A
matrices.
[0075] FIG. 50 shows a graph representing the binding of
biotinylated PRO245 to wells coated with PRO1868.
[0076] FIG. 51 shows a graph representing the binding of
biotinylated PRO1868 to wells coated with PRO245-Fc.
[0077] FIG. 52 shows data representing inhibition of the adhesion
of J45 cells to PRO245-Fc fusion protein by anti-PRO1868
antibodies. Data are representative of three independent
experiments; error bars represent the SD in an n=6 condition.
[0078] FIG. 53 shows flow cytometry results indicating the ability
of 6.times.His-tagged PRO1868 protein to compete with binding
between CD56+NK cells and PRO245-Fc fusion protein.
[0079] FIG. 54 shows binding of PRO1868 to PRO245 expressing CHO
cells under various conditions.
[0080] FIG. 55 shows specific binding of anti-PRO1868 antibodies to
PRO245-expressing CHO cells (CuL8r).
[0081] FIG. 56 shows the amino acid sequence of human STIgMA
(hSTIgMA; SEQ ID NO: 32) and human STIgMA short (hSTIgMA short; SEQ
ID NO: 33) and alignment with murine STIgMA (SEQ ID NO: 34). The
hydrophobic leader sequence, transmembrane region, and potential
N-linked glycosylation sites are shown. The Ig domain boundaries,
deduced from the exon-intron boundaries of the human STIgMA gene,
are indicated.
[0082] FIG. 57. Northern blot analysis showing expression of human
STIgMA in placenta, lung, heart, liver and adrenal gland (A). Two
transcripts of 1.5 and 1.8 kb were present in the human tissues
expressing STIgMA.
[0083] FIG. 58. (A) TAQMAN.TM. PCR analysis showing increased
expression of human STIgMA in myelomonocytic cell lines HL60 and
THP-1 and in differentiated macrophages. Low levels of expression
were found in Jurkat T cells, MOLT3, MOLT4 and RAMOS B-cell lines.
(B) Increased expression of STIgMA mRNA during in vitro monocyte
differentiation. Monocytes isolated from human peripheral blood
were differentiated by adhering to plastic over 7 day period. Total
RNA was extracted at different time points during differentiation.
(C) Increased expression of STIgMA protein during monocyte to
macrophage differentiation. Monocytes were treated as indicated in
(B), whole cell lysates were run on a gel and transferred to
nitrocellulose membrane that was incubated with a polyclonal
antibody (4F7) to human STIgMA. The polyclonal antibody recognized
a 48 and 38 kDa band possibly representing the long and the short
form of STIgMA.
[0084] FIG. 59. Molecular characterization of huSTIgMA protein in
cell lines. (A) HuSTIgMA-gd was transiently expressed in 293E
cells, immunoprecipitated with anti gd and blots incubated with
anti gd or a polyclonal antibody to the extracellular domain of
STIgMA. (B) huSTIgMA expressed in 293 cells is a monomeric
N-glycosylated protein. STIgMA is tyrosine phosphorylated upon
treatment of HEK293 cells with sodium pervanadate but does not
recruit Syk kinase. Phosphorylated STIgMA migrated at a slightly
higher molecular mass compared to non-phosphorylated STIgMA.
[0085] FIG. 60. Selective expression of STIgMA on human
monocyte-derived macrophages. Peripheral blood mononuclear cells
were stained with antibodies specific for B, T, NK cells, monocytes
and with a ALEXA.TM. A488 conjugated monoclonal antibody (3C9) to
STIgMA. Expression was absent in all peripheral blood leukocytes as
well as in monocyte derived dendritic cells, but was expressed in
in vitro differentiated macrophages.
[0086] FIG. 61. STIgMA mRNA and protein expression was increased by
IL-10 and dexamethasone. (A) Real-time PCR shows increased
expression of STIgMA mRNA following treatment with IL-10, TGFbeta
and was highly induced by dexamethasone but was down-regulated by
treatment with LPS, IFN.gamma., and TNF.alpha.. (B)
Ficoll-separated peripheral blood mononuclear cells were treated
with various cytokines and dexamethasone for 5 days and
double-stained with anti CD14 and anti STIgMA. Flow analysis showed
a dramatic increase in STIgMA expression on the surface of
monocytes treated with dexamethasone and after treatment with IL-10
and LPS.
[0087] FIG. 62. Subcellular localization of STIgMA in
monocyte-derived macrophages. Monocytes were cultured for 7 days in
macrophage differentiation medium, fixed in acetone and stained
with polyclonal anti STIgMA antibody 6F1 or CD63 and secondary
goat-anti rabbit FITC. Cells were studied in a confocal microscope.
STIgMA is found in the cytoplasm were it co-localizes with the
lysosomal membrane protein CD63. STIgMA was also expressed at the
trailing and leading edges of macrophages in a pattern similar to
that of F-actin. Scale bar=10 .mu.m.
[0088] FIG. 63. Localization of STIgMA mRNA in chronic inflammatory
diseases. In situ hybridization showed the presence of STIgMA mRNA
in alveolar macrophages obtained from tissue of a patient with
pneumonia (A, B) or a patient with chronic asthma (C, D). STIgMA
mRNA was also expressed in liver Kupffer cells in tissue obtained
from a liver biopsy of a patient with chronic hepatitis (E, F).
[0089] FIG. 64. STIgMA mRNA expression was increased in inflamed
synovium. STIgMA mRNA was low or absent in synovial membranes of a
joint obtained from a knee replacement of a patient with no joint
inflammation (A, C) but was highly expressed in cells, potentially
synoviocytes or synovial macrophages, in the pannus of a patient
with osteoarthritis (B, D).
[0090] FIG. 65. Detection of STIgMA protein with polyclonal
antibody 6F1 in cells lining the synovium of a patient with
degenerative joint disease (A, B, C). No immunohistochemical
detection of STIgMA was found in a control synovium (D).
[0091] FIG. 66. STIgMA protein was expressed in a subtype of tissue
resident macrophages and its expression was increased in chronic
inflammatory diseases. (A) STIgMA was expressed on the membrane of
CHO cells stably expressing STIgMA. High expression of STIgMA
protein was found in alveolar macrophages (B) in tissues obtained
from a patient with chronic asthma. (C) Expression of STIgMA in
histiocytes of the human small intestine. The section was obtained
from surgically removed tissue and could have contained a neoplasm.
(D) Expression of STIgMA protein in Hofbauer cells in human
pre-term placenta. High expression of STIgMA protein in macrophages
was present in the adrenal gland (E) and in Kupffer cells of human
liver (F). Staining was performed on 5 .mu.m thick acetone-fixed
sections using DAB as the chromogen. Images were photographed at a
20.times. and 40.times. magnification.
[0092] FIG. 67. Immunohistochemical staining of CD68 and STIgMA on
a vascular plaque obtained from a patient with atherosclerosis.
Consecutive sections were fixed and stained with a monoclonal
antibody to human CD68 (A, B) and a polyclonal antibody 6F1 raised
against human STIgMA (C, D). STIgMA appeared in a population of
macrophages and phoam cells present in the atherosclerotic plaque,
and overlaped with CD68 positive macrophages, as judged from
staining on consecutive sections. Magnification: 10.times.(A, C)
and 20.times.(B, D).
[0093] FIG. 68. Co-staining of STIgMA and CD68 on heart
interstitial macrophages. 5 .mu.m sections were obtained from a
human heart (autopsy) and stained with a monoclonal antibody to
STIgMA (3C9) and a secondary anti-mouse FITC-labeled antibody. CD68
was detected by staining with a PE-labeled monoclonal antibody to
CD68. Magnification: 20.times..
[0094] FIG. 69. STIgMA mRNA is significantly increased in colon
tissue obtained from patients with ulcerative colitis, Crohn's
disease, chronic occlusive pulmonary disease (COPD) and asthma.
Real-time PCR was performed on total RNA extracted from the various
tissues. mRNA for STIgMA was significantly increased in tissues
obtained from patients with ulcerative colitis, Crohn's disease and
COPD. Statistical analysis was performed using the Mann-Whitney
U-test.
[0095] FIG. 70. Cells expressing human STIgMA showed increased
adherence to human endothelial cells. (A) STIgMA was stably
expressed in a human Jurkat T-cell line. (B) Cells were preloaded
with the fluorescent dye BCECF (Molecular Probes, Oregon) and added
to a 96 well plate coated with a monolayer of human umbilical vein
endothelial cells (HUVEC) treated with or without 10 ng/ml
TNF.alpha.. After 3 washes, fluorescence was counted in a
spectro-fluorometer which indicated the number of cells that remain
adherent to the HUVEC cells. The graph was representative of 4
independent experiments.
[0096] FIG. 71. Inhibition of progression of collagen-induced
arthritis (CIA) mouse model by muSTIgMA IgG-Fc fusion protein. A
group of (CIA) mice (n=7) was given 100 .mu.g of muSTIgMA IgG-Fc
fusion protein (squares), whereas a CIA mouse control group (n=8)
received 100 .mu.g of murine IgG1 (circles), 3 times per week for 6
weeks. Mice were examined daily for signs of inflammation and
scored on a scale of 0-16 (details in Example 25) and the results
were plotted graphically (mean.+-.SD, Student's T test
p-value=0.0004 for control IgG1 vs. test muSTIgMA protein).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
I. Definitions
[0097] The terms "PRO301", "PRO362, "PRO245", "PRO1868" or "PRO301
polypeptide," "PRO362 polypeptide," "PRO245 polypeptide," "PRO1868"
and "cancer associated antigen" when used herein encompass native
sequence PRO301, PRO362, PRO245, or PRO1868 respectively and
variants thereof (which are further defined herein). In addition
the terms "PRO301" and "JAM-1" are used interchangeably, as are the
terms "PRO362," "JAM4," STIGMA," and "STIgMA." Further, the terms
"PRO245," "JAM-IT" and "JAM-2" are used interchangeably, as are the
terms "PRO1868," "SHATR" and "JAM-3." The PRO301, PRO362, PRO245 or
PRO1868 polypeptides may be isolated from a variety of sources,
such as from human tissue types or from another source, or prepared
by recombinant or synthetic methods. As noted, the listed
designations are used to refer to the respective native sequence
molecules and their variants.
[0098] Thus, for example, STIgMA includes a polypeptide comprising
amino acids 1 to 321 of SEQ ID NO: 2; amino acids 1 to X of SEQ ID
NO: 2 (wherein X is any of amino acids 271 to 280); amino acids 21
to 321 of SEQ ID NO: 2; amino acids 21 to X of SEQ ID NO: 2
(wherein X is any of amino acids 271 to 280); amino acids 1 to 399
of SEQ ID NO: 32; amino acids 21 to 399 of SEQ ID NO: 32; amino
acids 1 to 305 of SEQ ID NO: 33; amino acids 21 to 305 of SEQ ID
NO: 33; amino acids 1 to 280 of SEQ ID NO: 34; amino acids 21 to
280 of SEQ ID NO: 34; the extracellular domains and variants in
which part or all of the transmembrane domain has been deleted or
inactivated.
[0099] The term "inflammatory disease" and "inflammatory disorder"
are used interchangeably and mean a disease or disorder in which a
component of the immune system of a mammal causes, mediates or
otherwise contributes to an inflammatory response contributing to
morbidity in the mammal. Also included are diseases in which
reduction of the inflammatory response has an ameliorative effect
on progression of the disease. Included within this term are
immune-mediated inflammatory diseases, including autoimmune
diseases.
[0100] The term "T-cell mediated" disease means a disease in which
T cells directly or indirectly mediate or otherwise contribute to
morbidity in a mammal. The T cell mediated disease may be
associated with cell mediated effects, lymphokine mediated effects,
etc. and even effects associated with B cells if the B cells are
stimulated, for example, by the lymphokines secreted by T
cells.
[0101] Examples of immune-related and inflammatory diseases, some
of which are T cell mediated, include, without limitation,
inflammatory bowel disease, systemic lupus erythematosus,
rheumatoid arthritis, juvenile chronic arthritis,
spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's
syndrome, systemic vaculitis, sarcoidosis, autoimmune hemolytic
anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic polyneuropathy, hepatobiliary
diseases such as infectious hepatitis (hepatitis A, B, C, D, E and
other nonhepatotropic viruses), autoimmune chronic active
hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and
sclerosing cholangitis, inflammatory and fibrotic lung diseases
(e.g., cystic fibrosis), gluten-sensitive enteropathy, Whipple's
disease, autoimmune or immune-mediated skin diseases including
bullous skin diseases, erythema multiforme and contact dermatitis,
psoriasis, allergic diseases of the lung such as eosinophilic
pneumonia, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation associated diseases including graft
rejection and graft-versus host disease.
[0102] "Tumor", as used herein refers to all neoplastic cell growth
and proliferation whether malignant or benign, and all
pre-cancerous cells and tissues.
[0103] The terms "cancer" and "cancerous" refer to or describe the
physiological condition in mammals that is typically characterized
by unregulated cell growth. Examples of cancer include but are not
limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
More particular examples of such cancers include breast cancer,
prostate cancer, colon cancer, squamous cell cancer, small-cell
lung cancer, non-small cell lung cancer, gastrointestinal cancer,
pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer,
liver cancer, bladder cancer, hepatoma, colorectal cancer,
endometrial carcinoma, salivary gland carcinoma, kidney cancer,
liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and
various types of head and neck cancer.
[0104] "Treatment" is an intervention performed with the intention
of preventing the development or altering the pathology of a
disorder. Accordingly, "treatment" refers to both therapeutic
treatment and prophylactic or preventative measures. Those in need
of treatment include those already with the disorder as well as
those in which the disorder is to be prevented. In treatment of an
immune related disease, a therapeutic agent may directly alter the
magnitude of response of a component of the immune response, or
render the disease more susceptible to treatment by other
therapeutic agents, e.g., antibiotics, antifungals,
anti-inflammatory agents, chemotherapeutics, etc.
[0105] The "pathology" of an immune related disease includes all
phenomena that compromise the well-being of the patient. This
includes, without limitation, abnormal or uncontrollable cell
growth (neutrophilic, eosinophilic, monocytic, lymphocytic cells),
antibody production, auto-antibody production, complement
production, interference with the normal functioning of neighboring
cells, release of cytokines or other secretory products at abnormal
levels, suppression or aggravation of any inflammatory or
immunological response, infiltration of inflammatory cells
(neutrophilic, eosinophilic, monocytic, lymphocytic) into cellular
spaces, etc.
[0106] The term "mammal" as used herein refers to any animal
classified as a mammal, including, without limitation, humans,
domestic and farm animals, and zoo, sports or pet animals such
horses, pigs, cattle, dogs, cats and ferrets, etc. In a preferred
embodiment of the invention, the mammal is a human.
[0107] Administration "in combination with" one or more further
therapeutic agents includes simultaneous (concurrent) and
consecutive administration in any order.
[0108] The term "cytotoxic agent" as used herein refers to a
substance that inhibits or prevents the function of cells and/or
causes destruction of cells. The term is intended to include
radioactive isotopes (e.g. I.sup.131, I.sup.125, Y.sup.90 and
Re.sup.186), chemotherapeutic agents, and toxins such as
enzymatically active toxins of bacterial, fungal, plant or animal
origin, or fragments thereof.
[0109] A "chemotherapeutic agent" is a compound useful in the
treatment of cancer. Examples of chemotherapeutic agents include
adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine
arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan,
cytoxin, taxoids, e.g. paclitaxel (Taxol.RTM., Bristol-Myers Squibb
Oncology, Princeton, N.J.) and doxetaxel (Taxotere.RTM.,
Rhone-Poulenc Roher, Antony, France), toxotere, methotrexate,
cisplatin, melphalan, vinblastine, bleomycin, etoposide,
ifosfamide, mitomycin C, mitoxantrone, vincristine (Loucristine),
vinorelbine, carboplatin, teniposide, daunomycin, carminomycin,
aminopterin, dactinomycin, mitomycins, esperamicins (see U.S. Pat.
No. 4,675,187), melphalan and other related nitrogen mustards. Also
included in this definition are hormonal agents that act to
regulate or inhibit hormonal action on tumors such as tamoxifen and
onapristone.
[0110] A "growth inhibitory agent" when used herein refers to a
compound or composition which inhibits growth of a cell, especially
cancer cells expressing or overexpressing any of the genes
identified herein, either in vitro or in vivo. Thus, the growth
inhibitory agent is one which significantly reduces the percentage
of cells expressing or overexpressing such genes in S phase.
Examples of growth inhibitory agents include agents that block cell
cycle progression (at a place other than S phase), such as agents
that induce G1 arrest and M-phase arrest. Classical M-phase
blockers include the vinca alkaloids (vincristine and vinblastine),
taxol, and topo II inhibitors such as doxorubicin, epirubicin,
daunorubicin, etoposide, and bleomycin. Those agents that arrest G1
also spill over into S-phase arrest, for example, DNA alkylating
agents such tamoxifen, prednisone, dacarbazine, mechlorethamine,
cisplatin, methotrexate, 5-fluorouracil, and ara-C. Further
information can be found in The Molecular Basis of Cancer,
Mendelsohn and Israel, eds., Chapter 1, entitled "Cell cycle
regulation, oncogenes, and antineoplastic drugs" by Murakami et al.
(WB Saunders, Philadelphia, 1995), especially page 13.
[0111] The term "cytokine" is a generic term for proteins released
by one cell population which act on another cell as intercellular
mediators. Examples of such cytokines are lymphokines, monokines,
and traditional polypeptide hormones. Included among the cytokines
are growth hormone such as human growth hormone, N-methionyl human
growth hormone, and bovine growth hormone, parathyroid hormone,
thyroxine, insulin, proinsulin, relaxin, prorelaxin, glycoprotein
hormones such as follicle stimulating hormone (FSH), thyroid
stimulating hormone (TSH), and luteinizing hormone (LH), hepatic
growth factor, fibroblast growth factor, prolactin, placental
lactogen, tumor necrosis factor-.alpha. and -.beta.,
mullerian-inhibiting substance, mouse gonadotropin-associated
peptide, inhibin, activin, vascular endothelial growth factor,
integrin, thrombopoietin (TPO), nerve growth factors such as
NGF-.beta., platelet-growth factor, transforming growth factors
(TGFs) such as TGF-.alpha. and TGF-.beta., insulin-like growth
factor-I and -II, erythropoietin (EPO), osteoinductive factors,
interferons such as interferon-.alpha., -.beta., and -.gamma.;
colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF),
granulocyte-macrophage-CSF (GM-CSF), and granulocyte-CSF (G-CSF),
interleukins (ILs) such as IL-1, IL-1.alpha., IL-2, IL-3, IL-4,
IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12, a tumor necrosis factor
such as TNF-.alpha. or TNF-.beta., and other polypeptide factors
including LIF and kit ligand (KL). As used herein, the term
cytokine includes proteins from natural sources or from recombinant
cell culture and biologically active equivalents of the native
sequence cytokines.
[0112] "Therapeutically effective amount" is the amount of active
PRO301, PRO362, PRO245 or PRO1868 antagonist or agonist which is
required to achieve a measurable inhibition or stimulation, as the
case may be, of the inflammatory response.
[0113] A "native sequence PRO301, PRO362, PRO245 or PRO1868",
comprises a polypeptide having the same amino acid sequence as a
PRO301, PRO362, PRO245 or PRO1868 respectively, derived from
nature. Such native sequence PRO301, PRO362, PRO245 or PRO1868 can
be isolated from nature or can be produced by recombinant or
synthetic means. The terms "native sequence PRO301", "native
sequence PRO362," "native sequence PRO245" and "native sequence
PRO1868" specifically encompass naturally-occurring truncated or
secreted forms of PRO301, PRO362, PRO245 and PRO1868 respectively
(e.g., an extracellular domain sequence), naturally-occurring
variant forms (e.g., alternatively spliced forms) and
naturally-occurring allelic variants of PRO301, PRO362, PRO245 or
PRO1868, respectively.
[0114] In one embodiment, the native sequence PRO301 is a mature or
full-length native sequence PRO301 comprising amino acids 1 to 299
of FIG. 2 (SEQ ID NO: 1), with or without the N-terminal signal
sequence, with or without the initiating methionine at position 1,
with or without the potential transmembrane domain at about
position 236 to about 258, and with or without the intracellular
domain at about position 259 to 299.
[0115] In another embodiment, the native sequence STIgMA
polypeptide is a mature or full-length native sequence PRO362
comprising amino acids 1 to 321 of FIG. 3 (SEQ ID NO: 2), with or
without an N-terminal signal sequence, with or without the
initiating methionine at position 1, with or without of any or all
of the potential transmembrane domain, at about positions 276-306,
and with or without the intracellular domain at about positions 307
to 321. In a further embodiment, the native sequence STIgMA
polypeptide is a mature or full-length polypeptide comprising amino
acids 1 to 399 of SEQ ID NO: 32 (huSTIgMA), with or without an
N-terminal signal sequence, with or without the initiating
methionine at position 1, and with or without of any or all of the
transmembrane domain at about positions 277 to 300. In a still
further embodiment, the native sequence STIgMA polypeptide is a
mature or full-length polypeptide comprising amino acids 1 to 305
of SEQ ID NO: 33 (huSTIgMA short), with or without an N-terminal
signal sequence, with or without the initiating methionine at
position 1, and with or without of any or all of the transmembrane
domain at about positions 183 to 206. In a different embodiment,
the native sequence STIgMA polypeptide is a mature or full length
polypeptide comprising amino acids 1 to 280 of SEQ ID NO: 34
(muSTIgMA), with or without an N-terminal signal sequence, with or
without the initiating methionine at positions 1, and with or
without of any or all of the transmembrane domain at about
positions 181 to 204.
[0116] In yet another embodiment, the native sequence PRO245
polypeptide is a mature or full-length native sequence PRO245
polypeptide comprising amino acids 1 to 312 of FIG. 11 (SEQ ID NO:
9), with or without an N-terminal signal sequence, with or without
the initiating methionine at position 1, with or without a
potential transmembrane domain, and with or without an
intracellular domain.
[0117] In yet another embodiment, the native sequence PRO1868
polypeptide is a mature or full-length native sequence PRO1868
polypeptide comprising amino acids 1 to 310 of FIG. 22 (SEQ ID NO:
31), with or without the N-terminal signal sequence at about
positions 1 to 30, with or without the initiating methionine at
position 1, with or without the potential transmembrane domain at
about position 242 to about 266, and with or without the
intracellular domain at about position 267 to 310.
[0118] The "PRO301, PRO362 (STIgMA), PRO245 or PRO1868
extracellular domain" or "PRO301, PRO362, PRO245 or PRO1868 ECD"
refers to a form of the PRO301, PRO362 (STIgMA), PRO245 or PRO1868
polypeptide, respectively, which is essentially free of the
transmembrane and cytoplasmic domains of the respective full length
molecules. Ordinarily, PRO301 ECD, PRO362 (STIgMA) ECD, PRO245 ECD
or PRO1868 ECD will have less than 1% of such transmembrane and/or
cytoplasmic domains and preferably, will have less than 0.5% of
such domains.
[0119] Optionally, PRO301 polypeptide ECD will comprise amino acid
residues 1 or about 28 to X, wherein X is any amino acid from amino
acid 231 to amino acid 241 of FIG. 2 (SEQ ID NO: 1).
[0120] Optionally, PRO362 (STIgMA) polypeptide ECD will comprise
amino acid residues 1 or about 21 to X of FIG. 3 (SEQ ID NO: 2), or
SEQ ID NO: 32, where X is any amino acid from about 271 to 281, or
amino acid residues 1 or about 21 to X of SEQ ID NO: 33, where X is
any amino acid from about 178 to 186, or amino acid residues 1 or
about 21 to X of SEQ ID NO: 34, wherein X is any amino acid from
about 176 to 184 of SEQ ID NO: 34.
[0121] Optionally, PRO245 polypeptide ECD will comprise amino acid
residues 1 or about 29 to X, wherein X is any amino acid from amino
acid 232 to amino acid 242.
[0122] Optionally, PRO1868 polypeptide ECD will comprise amino acid
residues 1 or about 31 to X, wherein X is any amino acid from amino
acid 237 to amino acid 247.
[0123] It will be understood that any transmembrane domain
identified for the PRO301, PRO362 (STIgMA), PRO245 or PRO1868
polypeptides of the present invention is identified pursuant to
criteria routinely employed in the art for identifying that type of
hydrophobic domain. The exact boundaries of a transmembrane domain
may vary but most likely by no more than about 5 amino acids at
either end of the domain as initially identified.
[0124] "PRO301 variant" means an active PRO301 as defined below
having at least about 80% amino acid sequence identity to (a) a DNA
molecule encoding a PRO301 polypeptide, with or without its native
signal sequence, with or without the initiating methionine, with or
without the potential transmembrane domain, and with or without the
intracellular domain or (b) the complement of the DNA molecule of
(a). In a particular embodiment, the PRO301 variant has at least
about 80% amino acid sequence homology with the PRO301 having the
deduced amino acid sequence shown in FIG. 1 (SEQ ID NO: 1) for a
full-length native sequence PRO301. Such PRO301 variants include,
for instance, PRO301 polypeptides wherein one or more amino acid
residues are added, or deleted, at the N- or C-terminus of the
sequence of FIG. 2 (SEQ ID NO: 1). Preferably, the nucleic acid or
amino acid sequence identity is at least about 85%, more preferably
at least about 90%, and even more preferably at least about 95%.
Preferably, the highest degree of sequence identity occurs within
the extracellular domains (amino acids 28 to 235 of FIG. 2, SEQ ID
NO: 1).
[0125] "PRO245 variant" means an active PRO245 as defined below
having at least about 80% amino acid sequence identity to (a) a DNA
molecule encoding a PRO245 polypeptide, with or without its native
signal sequence, with or without the initiating methionine, with or
without the potential transmembrane domain, and with or without the
intracellular domain or (b) the complement of the DNA molecule of
(a). In a particular embodiment, the PRO245 variant has at least
about 80% amino acid sequence homology with the PRO245 having the
deduced amino acid sequence shown in FIG. 1 (SEQ ID NO: 9) for a
full-length native sequence PRO245. Such PRO245 variants include,
for instance, PRO245 polypeptides wherein one or more amino acid
residues are added, or deleted, at the N- or C-terminus of the
sequence of SEQ ID NO: 9. Preferably, the nucleic acid or amino
acid sequence identity is at least about 85%, more preferably at
least about 90%, and even more preferably at least about 95%.
[0126] "PRO362 variant" means an active PRO362 polypeptide as
defined below having at least about 80% amino acid sequence
identity to (a) a DNA molecule encoding a PRO362 polypeptide, with
or without its native signal sequence, with or without the
initiating methionine, with or without the potential transmembrane
domain, and with or without the intracellular domain or (b) the
complement of the DNA molecule of (a). In a particular embodiment,
the PRO362 variant has at least about 80% amino acid sequence
homology with the PRO362 polypeptide having the deduced amino acid
sequence shown in FIG. 3 (SEQ ID NO: 2) for a full-length native
sequence PRO362 polypeptide. Such PRO362 polypeptide variants
include, for instance, PRO362 polypeptides wherein one or more
amino acid residues are added, or deleted, at the N- or C-terminus
of the sequence of FIG. 3 (SEQ ID NO: 2). Ordinarily, a PRO362
polypeptide variant will have at least about 80% amino acid
sequence identity, preferably at least about 85% amino acid
sequence identity, more preferably at least about 90% amino acid
sequence identity and even more preferably at least about 95% amino
acid sequence identity with the amino acid sequence of FIG. 3 (SEQ
ID NO: 2). Preferably, the highest degree of sequence identity
occurs within the extracellular domains (amino acids 1 to X of FIG.
3, SEQ ID NO: 2, where X is any amino acid residue from 271 to
281).
[0127] A "STIgMA variant" specifically includes the PRO362.variants
defined above, along with variants of SEQ ID NOS: 32, 33, and 34.
In particular, STIgMA variants specifically include an active
STIgMA polypeptide as defined below having at least about 80% amino
acid sequence identity to (a) a DNA molecule encoding a polypeptide
or SEQ ID NO: 32, 33, or 34, with or without its native signal
sequence, with or without the initiating methionine, with or
without all or part of the potential transmembrane domain, and with
or without the intracellular domain or (b) the complement of the
DNA molecule of (a). In a particular embodiment, the STIgMA variant
has at least about 80% amino acid sequence homology with the STIgMA
polypeptide having the deduced amino acid sequence of SEQ ID NO:
32, 33, or 34. Such STIgMA variants include, for instance, STIgMA
polypeptides wherein one or more amino acid residues are added, or
deleted, at the N- or C-terminus of the sequence of SEQ ID NOS: 32,
33, and 34. Ordinarily, a STIgMA polypeptide variant will have at
least about 80% amino acid sequence identity, preferably at least
about 85% amino acid sequence identity, more preferably at least
about 90% amino acid sequence identity and even more preferably at
least about 95% amino acid sequence identity with the amino acid
sequence of SEQ ID NO: 32, 33, or 34. Preferably, the highest
degree of sequence identity occurs within the extracellular
domains.
[0128] "PRO1868 variant" means an active PRO1868 polypeptide as
defined below having at least about 80% amino acid sequence
identity to (a) a DNA molecule encoding a PRO1868 polypeptide, with
or without its native signal sequence, with or without the
initiating methionine, with or without the potential transmembrane
domain, and with or without the intracellular domain or (b) the
complement of the DNA molecule of (a). In a particular embodiment,
the PRO1868 variant has at least about 80% amino acid sequence
homology with the with the PRO1868 polypeptide having the deduced
amino acid sequence of SEQ ID NO: 31 encoding a full-length native
sequence PRO1868 polypeptide. Such PRO1868 polypeptide variants
include, for instance, PRO1868 polypeptides wherein one or more
amino acid residues are added, or deleted, at the N- or C-terminus
of the sequence of SEQ ID NO: 31. Ordinarily, a PRO1868 polypeptide
variant will have at least about 80% amino acid sequence identity,
preferably at least about 85% amino acid sequence identity, more
preferably at least about 90% amino acid sequence identity and even
more preferably at least about 95% amino acid sequence identity
with the amino acid sequence of SEQ ID NO: 31.
[0129] "Percent (%) amino acid sequence identity" with respect to
the PRO301, PRO362 (STIgMA), PRO245 or PRO1868 sequences identified
herein is defined as the percentage of amino acid residues in a
candidate sequence that are identical with the amino acid residues
in the PRO301, PRO362 (STIgMA), PRO245 or PRO1868 sequence,
respectively, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent sequence identity, and
not considering any conservative substitutions as part of the
sequence identity. Alignment for purposes of determining percent
amino acid sequence identity can be achieved in various ways that
are within the skill in the art, for instance, using publicly
available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR) software. Those skilled in the art can determine
appropriate parameters for measuring alignment, including any
algorithms needed to achieve maximal alignment over the full length
of the sequences being compared.
[0130] "Percent (%) nucleic acid sequence identity" with respect to
the PRO301-, PRO362 (STIgMA), PRO245- or PRO1868-encoding sequences
identified herein (e.g., DNA40628, DNA45416, DNA35638, DNA77624) is
defined as the percentage of nucleotides in a candidate sequence
that are identical with the nucleotides in the PRO301-, PRO362
(STIgMA)-, PRO245- or PRO1868-encoding sequence, respectively,
after aligning the sequences and introducing gaps, if necessary, to
achieve the maximum percent sequence identity. Alignment for
purposes of determining percent nucleic acid sequence identity can
be achieved in various ways that are within the skill in the art,
for instance, using publicly available computer software such as
BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled
in the art can determine appropriate parameters for measuring
alignment, including any algorithms needed to achieve maximal
alignment over the full length of the sequences being compared.
[0131] An "isolated" nucleic acid molecule is a nucleic acid
molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the nucleic acid. An isolated
nucleic acid molecule is other than in the form or setting in which
it is found in nature. Isolated nucleic acid molecules therefore
are distinguished from the nucleic acid molecule as it exists in
natural cells. However, an isolated nucleic acid molecule includes
nucleic acid molecules contained in cells that ordinarily express
an encoded polypeptide where, for example, the nucleic acid
molecule is in a chromosomal location different from that of
natural cells.
[0132] An "isolated" PRO301, PRO362(STIgMA), PRO245 or PRO1868
polypeptide-encoding nucleic acid molecule is a nucleic acid
molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the PRO301, PRO362 (STIgMA),
PRO245 or PRO1868 polypeptide-encoding nucleic acid. An isolated
PRO301, PRO362 (STIgMA), PRO245 or PRO1868 polypeptide-encoding
nucleic acid molecule is other than in the form or setting in which
it is found in nature. Isolated PRO301, PRO362, PRO245 or PRO1868
polypeptide-encoding nucleic acid molecules therefore are
distinguished from the DNA40628, DNA45416, DNA35638 or DNA77624
nucleic acid molecules, respectively, as they exists in natural
cells. However, an isolated PRO301, PRO362, PRO245 or PRO1868
polypeptide-encoding nucleic acid molecule includes PRO301, PRO362,
PRO245 or PRO1868 polypeptide-encoding nucleic acid molecules
contained in cells that ordinarily express PRO301, PRO362, PRO245
or PRO1868 polypeptide where, for example, the nucleic acid
molecule is in a chromosomal location different from that of
natural cells.
[0133] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0134] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0135] The term "antibody" is used in the broadest sense and
specifically covers, without limitation, single anti-PRO301,
anti-PRO362 (anti-STIgMA), anti-PRO245 or anti-PRO1868 monoclonal
antibodies (including agonist, antagonist, and neutralizing
antibodies) and anti-PRO301, anti-PRO362, anti-PRO245 or
anti-PRO1868 antibody compositions with polyepitopic specificity.
The term "monoclonal antibody" as used herein refers to an antibody
obtained from a population of substantially homogeneous antibodies,
i.e., the individual antibodies comprising the population are
identical except for possible naturally-occurring mutations that
may be present in minor amounts.
[0136] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured DNA to reanneal when complementary strands
are present in an environment below their melting temperature. The
higher the degree of desired homology between the probe and
hybridizable sequence, the higher the relative temperature that can
be used. As a result, it follows that higher relative temperatures
would tend to make the reaction conditions more stringent, while
lower temperatures less so. For additional details and explanation
of stringency of hybridization reactions, see Ausubel et al.,
Current Protocols in Molecular Biology, Wiley Interscience
Publishers, (1995).
[0137] "Stringent conditions" or "high stringency conditions", as
defined herein, may be identified by those that: (1) employ low
ionic strength and high temperature for washing, for example 0.015
M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl
sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42C; or (3) employ
50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium citrate),
50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate,
5.times. Denhardt's solution, sonicated salmon sperm DNA (50
.mu.g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree. C., with
washes at 42.degree. C. in 0.2.times.SSC (sodium chloride/sodium
citrate) and 50% formamide at 55C, followed by a high-stringency
wash consisting of 0.1.times.SSC containing EDTA at 55.degree.
C.
[0138] "Moderately stringent conditions" may be identified as
described by Sambrook et al., Molecular Cloning: A Laboratory
Manual, New York: Cold Spring Harbor Press, 1989, and include the
use of washing solution and hybridization conditions (e.g.,
temperature, ionic strength and % SDS) less stringent that those
described above. An example of moderately stringent conditions is
overnight incubation at 37.degree. C. in a solution comprising: 20%
formamide, 5.times.SSC (150 mM NaCl, 15 mM trisodium citrate), 50
mM sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA,
followed by washing the filters in 1.times.SSC at about
37-50.degree. C. The skilled artisan will recognize how to adjust
the temperature, ionic strength, etc. as necessary to accommodate
factors such as probe length and the like.
[0139] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising a polypeptide of the invention
fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope against which an antibody can be
made, yet is short enough such that it does not interfere with
activity of the polypeptide to which it is fused. The tag
polypeptide preferably also is fairly unique so that the antibody
does not substantially cross-react with other epitopes. Suitable
tag polypeptides generally have at least six amino acid residues
and usually between about 8 and 50 amino acid residues (preferably,
between about 10 and 20 amino acid residues).
[0140] "Active" or "activity" in the context of variants of the
polypeptide of the invention refers to form(s) of proteins of the
invention which retain the biologic and/or immunologic activities
of a native or naturally-occurring polypeptide of the
invention.
[0141] "Biological activity" in the context of an antibody,
polypeptide or another molecule that can be identified by the
screening assays disclosed herein (e.g. an organic or inorganic
small molecule, peptide, etc.) refers, in part, to the ability of
such molecules to alter infiltration of inflammatory cells into a
tissue, to alter T-cell proliferation and to alter lymphokine
release by cells. Another preferred activity an affect on vascular
permeability.
[0142] The term "antagonist" is used in the broadest sense, and
includes any molecule that partially or fully blocks, inhibits, or
neutralizes a biological activity of a native polypeptide of the
invention disclosed herein. In a similar manner, the term "agonist"
is used in the broadest sense and includes any molecule that mimics
or stimulates a biological activity of a native polypeptide of the
invention disclosed herein. Suitable agonist or antagonist
molecules specifically include agonist or antagonist antibodies or
antibody fragments, fragments or amino acid sequence variants of
native polypeptides of the invention, peptides, small molecules,
including small organic molecules, etc.
[0143] A "small molecule" is defined herein to have a molecular
weight below about 600 daltons.
[0144] "Antibodies" (Abs) and "immunoglobulins" (Igs) are
glycoproteins having the same structural characteristics. While
antibodies exhibit binding specificity to a specific antigen,
immunoglobulins include both antibodies and other antibody-like
molecules which lack antigen specificity. Polypeptides of the
latter kind are, for example, produced at low levels by the lymph
system and at increased levels by myelomas. The term "antibody" is
used in the broadest sense and specifically covers, without
limitation, intact monoclonal antibodies, polyclonal antibodies,
multispecific antibodies (e.g. bispecific antibodies) formed from
at least two intact antibodies, and antibody fragments so long as
they exhibit the desired biological activity.
[0145] "Native antibodies" and "native immunoglobulins" are usually
heterotetrameric glycoproteins of about 150,000 daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains. Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies among
the heavy chains of different immunoglobulin isotypes. Each heavy
and light chain also has regularly spaced intrachain disulfide
bridges. Each heavy chain has at one end a variable domain
(V.sub.H) followed by a number of constant domains. Each light
chain has a variable domain at one end (V.sub.L) and a constant
domain at its other end; the constant domain of the light chain is
aligned with the first constant domain of the heavy chain, and the
light chain variable domain is aligned with the variable domain of
the heavy chain. Particular amino acid residues are believed to
form an interface between the light and heavy chain variable
domains.
[0146] The term "variable" refers to the fact that certain portions
of the variable domains differ extensively in sequence among
antibodies and are used in the binding and specificity of each
particular antibody for its particular antigen. However, the
variability is not evenly distributed throughout the variable
domains of antibodies. It is concentrated in three segments called
complementarity-determining regions (CDRs) or hypervariable regions
both in the light-chain and the heavy-chain variable domains. The
more highly conserved portions of variable domains are called the
framework (FR). The variable domains of native heavy and light
chains each comprise four FR regions, largely adopting a beta-sheet
configuration, connected by three CDRs, which form loops
connecting, and in some cases forming part of, the beta-sheet
structure. The CDRs in each chain are held together in close
proximity by the FR regions and, with the CDRs from the other
chain, contribute to the formation of the antigen-binding site of
antibodies (see Kabat et al., NIH Publ. No.91-3242, Vol. 1, pages
647-669 (1991)). The constant domains are not involved directly in
binding an antibody to an antigen, but exhibit various effector
functions, such as participation of the antibody in
antibody-dependent cellular toxicity.
[0147] "Antibody fragments" comprise a portion of an intact
antibody, preferably the antigen binding or variable region of the
intact antibody. Examples of antibody fragments include Fab, Fab',
F(ab').sub.2, and Fv fragments; diabodies; linear antibodies
(Zapata et al., Protein Eng. 8(10):1057-1062 [1995]); single-chain
antibody molecules; and multispecific antibodies formed from
antibody fragments.
[0148] Papain digestion of antibodies produces two identical
antigen-binding fragments, called "Fab" fragments, each with a
single antigen-binding site, and a residual "Fc" fragment. The
designation "Fc" reflects the ability to crystallize readily.
Pepsin treatment yields an F(ab').sub.2 fragment that has two
antigen-combining sites and is still capable of cross-linking
antigen.
[0149] "Fv" is the minimum antibody fragment which contains a
complete antigen-recognition and -binding site. This region
consists of a dimer of one heavy- and one light-chain variable
domain in tight, non-covalent association. It is in this
configuration that the three CDRs of each variable domain interact
to define an antigen-binding site on the surface of the
V.sub.H-V.sub.L dimer. Collectively, the six CDRs confer
antigen-binding specificity to the antibody. However, even a single
variable domain (or half of an Fv comprising only three CDRs
specific for an antigen) has the ability to recognize and bind
antigen, although at a lower affinity than the entire binding
site.
[0150] The Fab fragment also contains the constant domain of the
light chain and the first constant domain (CH1) of the heavy chain.
Fab' fragments differ from Fab fragments by the addition of a few
residues at the carboxy terminus of the heavy chain CH1 domain
including one or more cysteines from the antibody hinge region.
Fab'-SH is the designation herein for Fab' in which the cysteine
residue(s) of the constant domains bear a free thiol group.
F(ab').sub.2 antibody fragments originally were produced as pairs
of Fab' fragments which have hinge cysteines between them. Other
chemical couplings of antibody fragments are also known.
[0151] The "light chains" of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa (.kappa.) and lambda (.lamda.), based on the
amino acid sequences of their constant domains.
[0152] Depending on the amino acid sequence of the constant domain
of their heavy chains, immunoglobulins can be assigned to different
classes. There are five major classes of immunoglobulins: IgA, IgD,
IgE, IgG, and IgM, and several of these may be further divided into
subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.
The heavy-chain constant domains that correspond to the different
classes of immunoglobulins are called .alpha., .delta., .epsilon.,
.gamma., and .mu., respectively. The subunit structures and
three-dimensional configurations of different classes of
immunoglobulins are well known.
[0153] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen. In addition to their specificity, the
monoclonal antibodies are advantageous in that they are synthesized
by the hybridoma culture, uncontaminated by other immunoglobulins.
The modifier "monoclonal" indicates the character of the antibody
as being obtained from a substantially homogeneous population of
antibodies, and is not to be construed as requiring production of
the antibody by any particular method. For example, the monoclonal
antibodies to be used in accordance with the present invention may
be made by the hybridoma method first described by Kohler et al.,
Nature, 256:495 [1975], or may be made by recombinant DNA methods
(see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies"
may also be isolated from phage antibody libraries using the
techniques described in Clackson et al., Nature, 352:624-628 [1991]
and Marks et al., J. Mol. Biol., 222: 581-597 (1991), for example.
See also U.S. Pat. Nos. 5,750,373, 5,571,698, 5,403,484 and
5,223,409 which describe the preparation of antibodies using
phagemid and phage vectors.
[0154] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (U.S. Pat. No. 4,816,567; Morrison et
al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 [1984]).
[0155] "Humanized" forms of non-human (e.g., murine) antibodies are
chimeric immunoglobulins, immunoglobulin chains or fragments
thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which several or all residues from a complementarity-determining
region (CDR) of the recipient are replaced by residues from a CDR
of a non-human species (donor antibody) such as mouse, rat or
rabbit having the desired specificity, affinity, and capacity. In
some instances, certain Fv framework region (FR) residues of the
human immunoglobulin can also be replaced by corresponding
non-human residues. Furthermore, humanized antibodies may comprise
residues which are found neither in the recipient antibody nor in
the imported CDR or framework sequences. These modifications are
made to further refine and maximize antibody performance. In
general, the humanized antibody will comprise substantially all of
at least one, and typically two, variable domains, in which all or
substantially all of the CDR regions correspond to those of a
non-human immunoglobulin and all or substantially all of the FR
regions are those of a human immunoglobulin sequence. The humanized
antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically that of a human
immunoglobulin. For further details, see Jones et al., Nature, 321:
522-525 (1986); Reichmann et al., Nature, 332: 323-329 [1988]; and
Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992). The humanized
antibody includes a "primatized" antibody where the antigen-binding
region of the antibody is derived from an antibody produced by
immunizing macaque monkeys with the antigen of interest. Antibodies
containing residues from Old World monkeys are also possible within
the invention. See, for example, U.S. Pat. Nos. 5,658,570;
5,693,780; 5,681,722; 5,750,105; and 5,756,096.
[0156] "Single-chain Fv" or "sFv" antibody fragments comprise the
V.sub.H and V.sub.L domains of antibody, wherein these domains are
present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a polypeptide linker between the
V.sub.H and V.sub.L domains which enables the sFv to form the
desired structure for antigen binding. For a review of sFv see
Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113,
Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315
(1994).
[0157] The term "diabodies" refers to small antibody fragments with
two antigen-binding sites, which fragments comprise a heavy-chain
variable domain (V.sub.H) connected to a light-chain variable
domain (V.sub.L) in the same polypeptide chain (V.sub.H-V.sub.L).
By using a linker that is too short to allow pairing between the
two domains on the same chain, the domains are forced to pair with
the complementary domains of another chain and create two
antigen-binding sites. Diabodies are described more fully in, for
example, EP 404,097; WO 93/11161; and Hollinger et al., Proc. Natl.
Acad. Sci. USA, 90: 6444-6448 (1993).
[0158] An "isolated" polypeptide, including an isolated antibody,
is one which has been identified and separated and/or recovered
from a component of its natural environment. Contaminant components
of its natural environment are materials which would interfere with
diagnostic or therapeutic uses for the antibody, and may include
enzymes, hormones, and other proteinaceous or nonproteinaceous
solutes. In preferred embodiments, the polypeptide will be purified
(1) to greater than 95% by weight of the compound as determined by
the Lowry method, and most preferably more than 99% by weight, (2)
to a degree sufficient to obtain at least 15 residues of N-terminal
or internal amino acid sequence by use of a spinning cup
sequenator, or (3) to homogeneity by SDS-PAGE under reducing or
nonreducing conditions using Coomassie blue or, preferably, silver
stain. Isolated compound, e.g. antibody or other polypeptide,
includes the compound in situ within recombinant cells since at
least one component of the compound's natural environment will not
be present. Ordinarily, however, isolated compound will be prepared
by at least one purification step.
[0159] The word "label" when used herein refers to a detectable
compound or composition which is conjugated directly or indirectly
to a compound, e.g., antibody or polypeptide, so as to generate a
"labeled" compound. The label may be detectable by itself (e.g.
radioisotope labels or fluorescent labels) or, in the case of an
enzymatic label, may catalyze chemical alteration of a substrate
compound or composition which is detectable.
[0160] By "solid phase" is meant a non-aqueous matrix to which the
compound of the present invention can adhere. Examples of solid
phases encompassed herein include those formed partially or
entirely of glass (e.g., controlled pore glass), polysaccharides
(e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol
and silicones. In certain embodiments, depending on the context,
the solid phase can comprise the well of an assay plate; in others
it is a purification column (e.g., an affinity chromatography
column). This term also includes a discontinuous solid phase of
discrete particles, such as those described in U.S. Pat. No.
4,275,149.
[0161] A "liposome" is a small vesicle composed of various types of
lipids, phospholipids and/or surfactant which is useful for
delivery of a drug (such as the anti-ErbB2 antibodies disclosed
herein and, optionally, a chemotherapeutic agent) to a mammal. The
components of the liposome are commonly arranged in a bilayer
formation, similar to the lipid arrangement of biological
membranes.
[0162] As used herein, the term "immunoadhesin" designates
antibody-like molecules which combine the binding specificity of a
heterologous protein (an "adhesin") with the effector functions of
immunoglobulin constant domains. Structurally, the immunoadhesins
comprise a fusion of an amino acid sequence with the desired
binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is "heterologous"), and an
immunoglobulin constant domain sequence. The adhesin part of an
immunoadhesin molecule typically is a contiguous amino acid
sequence comprising at least the binding site of a receptor or a
ligand. The immunoglobulin constant domain sequence in the
immunoadhesin may be obtained from any immunoglobulin, such as
IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and
IgA-2), IgE, IgD or IgM.
II. Compositions and Methods of the Invention
[0163] A. Preparation of the PRO301, PRO362, PRO245 or PRO1868
Polypeptides
[0164] 1. Full-Length PRO301, PRO362, PRO245 or PRO1868
Polypeptides
[0165] The present invention provides newly identified and isolated
nucleotide sequences encoding polypeptides referred to in the
present application as PRO301, PRO362, PRO245 or PRO1868. In
particular, Applicants have identified and isolated cDNA encoding a
PRO301, PRO362, PRO245 or PRO1868 polypeptide, as disclosed in
further detail in the Examples below. Using BLAST and FastA
sequence alignment computer programs, Applicants found that
full-length native sequence PRO301 (FIG. 2, SEQ ID NO: 1), PRO362
(FIG. 3, SEQ ID NO: 3), PRO245 (FIG. 11, SEQ ID NO: 9) and PRO1868
(SEQ ID NO: 31) have significant homology to both A33 antigen and
JAM. (See FIGS. 1, 12-18). Accordingly, it is presently believed
that PRO301, PRO362, PRO245 and PRO1868 disclosed in the present
application are newly identified members of the A33 antigen protein
family and may be associated with inflammatory disorders such as
inflammatory bowel disease as well as human neoplastic diseases
such as colorectal cancer.
[0166] 2. PRO301, PRO362, PRO245 or PRO1868 Variants
[0167] In addition to the full-length native sequence PRO301,
PRO362, PRO245 or PRO1868 described herein, it is contemplated that
PRO301, PRO362, PRO245 or PRO1868 variants can be prepared. PRO301,
PRO362, PRO245 or PRO1868 variants can be prepared by introducing
appropriate nucleotide changes into the PRO301, PRO362, PRO245 or
PRO1868 DNA, respectively, or by synthesis of the desired PRO301,
PRO362, PRO245 or PRO1868 polypeptides. Those skilled in the art
will appreciate that amino acid changes may alter
post-translational processes of the PRO301, PRO362, PRO245 or
PRO1868, such as changing the number or position of glycosylation
sites or altering the membrane anchoring characteristics.
[0168] Variations in the native full-length sequence PRO301,
PRO362, PRO245 or PRO1868 or in various domains of the PRO301,
PRO362, PRO245 or PRO1868 described herein, can be made, for
example, using any of the techniques and guidelines for
conservative and non-conservative mutations set forth, for
instance, in U.S. Pat. No. 5,364,934. Variations may be a
substitution, deletion or insertion of one or more codons encoding
the PRO301, PRO362, PRO245 or PRO1868 that results in a change in
the amino acid sequence of the PRO301, PRO362, PRO245 or PRO1868 as
compared with the native sequence PRO301, PRO362, PRO245 or
PRO1868. Optionally the variation is by substitution of at least
one amino acid with any other amino acid in one or more of the
domains of the PRO301, PRO362, PRO245 or PRO1868. Guidance in
determining which amino acid residue may be inserted, substituted
or deleted without adversely affecting the desired activity may be
found by comparing the sequence of the PRO301, PRO362, PRO245 or
PRO1868 with that of homologous known protein molecules and
minimizing the number of amino acid sequence changes made in
regions of high homology. Amino acid substitutions can be the
result of replacing one amino acid with another amino acid having
similar structural and/or chemical properties, such as the
replacement of a leucine with a serine, i.e., conservative amino
acid replacements. Insertions or deletions may optionally be in the
range of 1 to 5 amino acids. The variation allowed may be
determined by systematically making insertions, deletions or
substitutions of amino acids in the sequence and testing the
resulting variants for activity in the in vitro assay described in
the Examples below.
[0169] The variations can be made using methods known in the art
such as oligonucleotide-mediated (site-directed) mutagenesis,
alanine scanning, and PCR mutagenesis. Site-directed mutagenesis
[Carter et al., Nucl. Acids Res, 13:4331 (1986); Zoller et al.,
Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et
al., Gene, 34:315(1985)], restriction selection mutagenesis [Wells
et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or
other known techniques can be performed on the cloned DNA to
produce the PRO301, PRO362, PRO245 or PRO1868 variant DNA.
[0170] Scanning amino acid analysis can also be employed to
identify one or more amino acids that may be varied along a
contiguous sequence. Among the preferred scanning amino acids are
relatively small, neutral amino acids. Such amino acids include
alanine, glycine, serine, and cysteine. Alanine is typically a
preferred scanning amino acid among this group because it
eliminates the side-chain beyond the beta-carbon and is less likely
to alter the main-chain conformation of the variant. Alanine is
also typically preferred because it is the most common amino acid.
Further, it is frequently found in both buried and exposed
positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.);
Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine substitution does
not yield adequate amounts of variant, an isoteric amino acid can
be used.
[0171] 3. Modifications of PRO301, PRO362, PRO245 or PRO1868
[0172] Covalent modifications of PRO301, PRO362, PRO245 or PRO1868
are included within the scope of this invention. One type of
covalent modification includes reacting targeted amino acid
residues of the PRO301, PRO362, PRO245 or PRO1868 with an organic
derivatizing agent that is capable of reacting with selected side
chains or the N- or C-terminal residues of the PRO301, PRO362,
PRO245 or PRO1868. Derivatization with bifunctional agents is
useful, for instance, for crosslinking PRO301, PRO362, PRO245 or
PRO1868 to a water-insoluble support matrix or surface for use in
the method for purifying anti-PRO301, anti-PRO362, anti-PRO245 or
anti-PRO1868 antibodies, respectively, and vice-versa. Commonly
used crosslinking agents include, e.g.,
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, for example, esters with
4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides
such as bis-N-maleimido-1,8-octane and agents such as
methyl-3-[(p-azidophenyl)dithio]propioimidate.
[0173] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .alpha.-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W.H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group.
[0174] Another type of covalent modification of the PRO301, PRO362,
PRO245 or PRO1868 polypeptide included within the scope of this
invention comprises altering the native glycosylation pattern of
the polypeptide. "Altering the native glycosylation pattern" is
intended for purposes herein to mean deleting one or more
carbohydrate moieties found in native sequence PRO301, PRO362,
PRO245 or PRO1868, and/or adding one or more glycosylation sites
that are not present in the native sequence PRO301, PRO362, PRO245
or PRO1868, and/or alteration of the ratio and/or composition of
the sugar residues attached to the glycosylation site(s).
[0175] Addition of glycosylation sites to the PRO301, PRO362,
PRO245 or PRO1868 polypeptide may be accomplished by altering the
amino acid sequence. The alteration may be made, for example, by
the addition of, or substitution by, one or more serine or
threonine residues to the native sequence PRO301, PRO362, PRO245 or
PRO1868 (for O-linked glycosylation sites). The PRO301, PRO362,
PRO245 or PRO1868 amino acid sequence may optionally be altered
through changes at the DNA level, particularly by mutating the DNA
encoding the PRO301, PRO362, PRO245 or PRO1868 polypeptide at
preselected bases such that codons are generated that will
translate into the desired amino acids.
[0176] Another means of increasing the number of carbohydrate
moieties on the PRO301, PRO362, PRO245 or PRO1868 polypeptide is by
chemical or enzymatic coupling of glycosides to the polypeptide.
Such methods are described in the art, e.g.,, in WO 87/05330
published 11 Sep. 1987, and in Aplin and Wriston, CRC Crit. Rev.
Biochem., pp. 259-306 (1981).
[0177] Removal of carbohydrate moieties present on the PRO301,
PRO362, PRO245 or PRO1868 polypeptide may be accomplished
chemically or enzymatically or by mutational substitution of codons
encoding for amino acid residues that serve as targets for
glycosylation. Chemical deglycosylation techniques are known in the
art and described, for instance, by Hakimuddin, et al., Arch.
Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem,
118:131 (1981). Enzymatic cleavage of carbohydrate moieties on
polypeptides can be achieved by the use of a variety of endo- and
exo-glycosidases as described by Thotakura et al., Meth. Enzymol.,
138:350 (1987).
[0178] Another type of covalent modification of PRO301, PRO362,
PRO245 or PRO1868 comprises linking the PRO301, PRO362, PRO245 or
PRO1868 polypeptide to one of a variety of nonproteinaceous
polymers, e.g., polyethylene glycol, polypropylene glycol, or
polyoxyalkylenes, for example in the manner set forth in U.S. Pat.
Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
4,179,337.
[0179] The PRO301, PRO362, PRO245 or PRO1868 of the present
invention may also be modified in a way to form a chimeric molecule
comprising PRO301, PRO362, PRO245 or PRO1868 fused to another,
heterologous polypeptide or amino acid sequence. In one embodiment,
such a chimeric molecule comprises a fusion of the PRO301, PRO362,
PRO245 or PRO1868 with a tag polypeptide which provides an epitope
to which an anti-tag antibody can selectively bind. The epitope tag
is generally placed at the amino- or carboxyl-terminus of the
PRO301, PRO362, PRO245 or PRO1868. The presence of such
epitope-tagged forms of the PRO301, PRO362, PRO245 or PRO1868 can
be detected using an antibody against the tag polypeptide. Also,
provision of the epitope tag enables the PRO301, PRO362, PRO245 or
PRO1868 to be readily purified by affinity purification using an
anti-tag antibody or another type of affinity matrix that binds to
the epitope tag. In an alternative embodiment, the chimeric
molecule may comprise a fusion of the PRO301, PRO362, PRO245 or
PRO1868 with an immunoglobulin or a particular region of an
immunoglobulin. For a bivalent form of the chimeric molecule, such
a fusion could be to the Fc region of an IgG molecule.
[0180] Various tag polypeptides and their respective antibodies are
well known in the art. Examples include poly-histidine (poly-his)
or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag
polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol.,
8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7
and 9E10 antibodies thereto [Evan et al., Molecular and Cellular
Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus
glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein
Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include
the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)];
the KT3 epitope peptide [Martin et al., Science, 255:192-194
(1992)]; an .alpha.-tubulin epitope peptide [Skinner et al., J.
Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein
peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA,
87:6393-6397 (1990)].
[0181] 4. Production and Isolation of PRO301, PRO362, PRO245 or
PRO1868
[0182] The description below relates primarily to production of
PRO301, PRO362, PRO245 or PRO1868 by culturing cells transformed or
transfected with a vector containing PRO301, PRO362, PRO245 or
PRO1868 nucleic acid. It is, of course, contemplated that
alternative methods, which are well known in the art, may be
employed to prepare PRO301, PRO362, PRO245 or PRO1868. For
instance, the PRO301, PRO362, PRO245 or PRO1868 sequence, or
portions thereof, may be produced by direct peptide synthesis using
solid-phase techniques [see, e.g., Stewart et al., Solid-Phase
Peptide Synthesis, W.H. Freeman Co., San Francisco, Calif. (1969);
Merrifield, J. Am. Chem. Soc, 85:2149-2154 (1963)]. In vitro
protein synthesis may be performed using manual techniques or by
automation. Automated synthesis may be accomplished, for instance,
using an Applied Biosystems Peptide Synthesizer (Foster City,
Calif.) using manufacturer's instructions. Various portions of the
PRO301, PRO362, PRO245 or PRO1868 may be chemically synthesized
separately and combined using chemical or enzymatic methods to
produce the full-length PRO301, PRO362, PRO245 or PRO1868.
[0183] a. Isolation of DNA Encoding PRO301, PRO362, PRO245 or
PRO1868
[0184] DNA encoding PRO301, PRO362, PRO245 or PRO1868 may be
obtained from a cDNA library prepared from tissue believed to
possess the PRO301, PRO362, PRO245 or PRO1868 mRNA and to express
it at a detectable level. Accordingly, human PRO301, PRO362, PRO245
or PRO1868 DNA can be conveniently obtained from a cDNA library
prepared from human tissue, such as described in the Examples. The
PRO301-, PRO362-, PRO245- or PRO1868-encoding gene may also be
obtained from a genomic library or by oligonucleotide
synthesis.
[0185] Libraries can be screened with probes (such as antibodies to
PRO301, PRO362, PRO245 or PRO1868 or oligonucleotides of at least
about 20-80 bases) designed to identify the gene of interest or the
protein encoded by it. Screening the cDNA or genomic library with
the selected probe may be conducted using standard procedures, such
as described in Sambrook et al., Molecular Cloning: A Laboratory
Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An
alternative means to isolate the gene encoding PRO301, PRO362,
PRO245 or PRO1868 is to use PCR methodology [Sambrook et al.,
supra; Dieffenbach et al., PCR Primer. A Laboratory Manual (Cold
Spring Harbor Laboratory Press, 1995)].
[0186] The Examples below describe techniques for screening a cDNA
library. The oligonucleotide sequences selected as probes should be
of sufficient length and sufficiently unambiguous that false
positives are minimized. The oligonucleotide is preferably labeled
such that it can be detected upon hybridization to DNA in the
library being screened. Methods of labeling are well known in the
art, and include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling. Hybridization conditions,
including moderate stringency and high stringency, are provided in
Sambrook et al., supra.
[0187] Sequences identified in such library screening methods can
be compared and aligned to other known sequences deposited and
available in public databases such as GenBank or other private
sequence databases. Sequence identity (at either the amino acid or
nucleotide level) within defined regions of the molecule or across
the full-length sequence can be determined through sequence
alignment using computer software programs such as BLAST, BLAST-2,
ALIGN, DNAstar, and INHERIT which employ various algorithms to
measure homology.
[0188] Nucleic acid having protein coding sequence may be obtained
by screening selected cDNA or genomic libraries using the deduced
amino acid sequence disclosed herein for the first time, and, if
necessary, using conventional primer extension procedures as
described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0189] b. Selection and Transformation of Host Cells
[0190] Host cells are transfected or transformed with expression or
cloning vectors described herein for PRO301, PRO362, PRO245 or
PRO1868 production and cultured in conventional nutrient media
modified as appropriate for inducing promoters, selecting
transformants, or amplifying the genes encoding the desired
sequences. The culture conditions, such as media, temperature, pH
and the like, can be selected by the skilled artisan without undue
experimentation. In general, principles, protocols, and practical
techniques for maximizing the productivity of cell cultures can be
found in Mammalian Cell Biotechnology: A Practical Approach, M.
Butler, ed. (IRL Press, 1991) and Sambrook et al., supra.
[0191] Methods of transfection are known to the ordinarily skilled
artisan, for example, CaPO4 and electroporation. Depending on the
host cell used, transformation is performed using standard
techniques appropriate to such cells. The calcium treatment
employing calcium chloride, as described in Sambrook et al., supra,
or electroporation is generally used for prokaryotes or other cells
that contain substantial cell-wall barriers. Infection with
Agrobacterium tumefaciens is used for transformation of certain
plant cells, as described by Shaw et al., Gene, 23:315 (1983) and
WO 89/05859 published Jun. 29, 1989. For mammalian cells without
such cell walls, the calcium phosphate precipitation method of
Graham and van der Eb, Virology, 52:456-457 (1978) can be employed.
General aspects of mammalian cell host system transformations have
been described in U.S. Pat. No. 4,399,216. Transformations into
yeast are typically carried out according to the method of Van
Solingen et al., J. Bact., 130:946 (1977) and Hsiao et al., Proc.
Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods for
introducing DNA into cells, such as by nuclear microinjection,
electroporation, bacterial protoplast fusion with intact cells, or
polycations, e.g., polybrene, polyornithine, may also be used. For
various techniques for transforming mammalian cells, see Keown et
al., Methods in Enzymology, 185:527-537 (1990) and Mansour et al.,
Nature, 336:348-352 (1988).
[0192] Suitable host cells for cloning or expressing the DNA in the
vectors herein include prokaryote, yeast, or higher eukaryote
cells. Suitable prokaryotes include but are not limited to
eubacteria, such as Gram-negative or Gram-positive organisms, for
example, Enterobacteriaceae such as E. coli. Various E. coli
strains are publicly available, such as E. coli K12 strain MM294
(ATCC 31,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110
(ATCC 27,325) and K5 772 (ATCC 53,635).
[0193] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for PRO301-, PRO362-, PRO245- or PRO1868-encoding vectors.
Saccharomyces cerevisiae is a commonly used lower eukaryotic host
microorganism.
[0194] Suitable host cells for the expression of glycosylated
PRO301, PRO362, PRO245 or PRO1868 are derived from multicellular
organisms. Examples of invertebrate cells include insect cells such
as Drosophila S2 and Spodoptera Sf9, as well as plant cells.
Examples of useful mammalian host cell lines include Chinese
hamster ovary (CHO) and COS cells. More specific examples include
monkey kidney CVI cells transformed by SV40 (COS-7, ATCC CRL 1651);
human embryonic kidney cells (293 or 293 cells subcloned for growth
in suspension culture, Graham et al., J Gen Virol., 36:59 (1977));
Chinese hamster ovary cells/-DHFR(CHO, Urlaub and Chasin, Proc.
Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4,
Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells (W138,
ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse
mammary tumor cells (MMT 060562, ATCC CCL51). The selection of the
appropriate host cell is deemed to be within the skill in the
art.
[0195] c. Selection and Use of a Replicable Vector
[0196] The nucleic acid (e.g., cDNA or genomic DNA) encoding
PRO301, PRO362, PRO245 or PRO1868 may be inserted into a replicable
vector for cloning (amplification of the DNA) or for expression.
Various vectors are publicly available. The vector may, for
example, be in the form of a plasmid, cosmid, viral particle, or
phage. The appropriate nucleic acid sequence may be inserted into
the vector by a variety of procedures. In general, DNA is inserted
into an appropriate restriction endonuclease site(s) using
techniques known in the art. Vector components generally include,
but are not limited to, one or more of a signal sequence, an origin
of replication, one or more marker genes, an enhancer element, a
promoter, and a transcription termination sequence. Construction of
suitable vectors containing one or more of these components employs
standard ligation techniques which are known to the skilled
artisan.
[0197] The PRO301, PRO362, PRO245 or PRO1868 may be produced
recombinantly not only directly, but also as a fusion polypeptide
with a heterologous polypeptide, which may be a signal sequence or
other polypeptide having a specific cleavage site at the N-terminus
of the mature protein or polypeptide. In general, the signal
sequence may be a component of the vector, or it may be a part of
the PRO301, PRO362, PRO245 or PRO1868 DNA that is inserted into the
vector. The signal sequence may be a prokaryotic signal sequence
selected, for example, from the group of the alkaline phosphatase,
penicillinase, lpp, or heat-stable enterotoxin II leaders. For
yeast secretion the signal sequence may be, e.g., the yeast
invertase leader, alpha factor leader (including Saccharomyces and
Kluyveromyces ''-factor leaders, the latter described in U.S. Pat.
No. 5,010,182), or acid phosphatase leader, the C. albicans
glucoamylase leader (EP 362,179 published Apr. 4, 1990), or the
signal described in WO 90/13646 published Nov. 15, 1990. In
mammalian cell expression, mammalian signal sequences may be used
to direct secretion of the protein, such as signal sequences from
secreted polypeptides of the same or related species, as well as
viral secretory leaders.
[0198] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Such sequences are well known for a variety of
bacteria, yeast, and viruses. The origin of replication from the
plasmid pBR322 is suitable for most Gram-negative bacteria, the 2:
plasmid origin is suitable for yeast, and various viral origins
(SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning
vectors in mammalian cells.
[0199] Expression and cloning vectors will typically contain a
selection gene, also termed a selectable marker. Typical selection
genes encode proteins that (a) confer resistance to antibiotics or
other toxins, e.g., ampicillin, neomycin, methotrexate, or
tetracycline, (b) complement auxotrophic deficiencies, or (c)
supply critical nutrients not available from complex media, e.g.,
the gene encoding D-alanine racemase for Bacilli.
[0200] An example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the PRO301, PRO362, PRO245 or PRO1868 nucleic acid, such
as DHFR or thymidine kinase. An appropriate host cell when
wild-type DHFR is employed is the CHO cell line deficient in DHFR
activity, prepared and propagated as described by Urlaub et al.,
Proc. Natl. Acad. Sci. USA, 77:4216 (1980). A suitable selection
gene for use in yeast is the trp1 gene present in the yeast plasmid
YRp7 [Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al.,
Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)]. The
trp1 gene provides a selection marker for a mutant strain of yeast
lacking the ability to grow in tryptophan, for example, ATCC No.
44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].
[0201] Expression and cloning vectors usually contain a promoter
operably linked to the PRO301, PRO362, PRO245 or PRO1868 nucleic
acid sequence to direct mRNA synthesis. Promoters recognized by a
variety of potential host cells are well known. Promoters suitable
for use with prokaryotic hosts include the .beta.-lactamase and
lactose promoter systems [Chang et al., Nature, 275:615 (1978);
Goeddel et al., Nature, 281:544 (1979)], alkaline phosphatase, a
tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res.,
8:4057 (1980); EP 36,776], and hybrid promoters such as the tac
promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80:21-25
(1983)]. Promoters for use in bacterial systems also will contain a
Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding
PRO301, PRO362, PRO245 or PRO1868.
[0202] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland,
Biochemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0203] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657.
[0204] PRO301, PRO362, PRO245 or PRO1868 transcription from vectors
in mammalian host cells is controlled, for example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowlpox
virus (UK 2,211,504 published 5 Jul. 1989), adenovirus (such as
Adenovirus 2), bovine papilloma virus, avian sarcoma virus,
cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus
40 (SV40), from heterologous mammalian promoters, e.g., the actin
promoter or an immunoglobulin promoter, and from heat-shock
promoters, provided such promoters are compatible with the host
cell systems.
[0205] Transcription of a DNA encoding the PRO301, PRO362, PRO245
or PRO1868 by higher eukaryotes may be increased by inserting an
enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from 10 to 300 bp, that act on a
promoter to increase its transcription. Many enhancer sequences are
now known from mammalian genes (globin, elastase, albumin,
.alpha.-fetoprotein, and insulin). Typically, however, one will use
an enhancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the replication origin (bp 100-270),
the cytomegalovirus early promoter enhancer, the polyoma enhancer
on the late side of the replication origin, and adenovirus
enhancers. The enhancer may be spliced into the vector at a
position 5' or 3' to the PRO301, PRO362, PRO245 or PRO1868 coding
sequence, but is preferably located at a site 5' from the
promoter.
[0206] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding PRO301,
PRO362, PRO245 or PRO1868.
[0207] Still other methods, vectors, and host cells suitable for
adaptation to the synthesis of PRO301, PRO362, PRO245 or PRO1868 in
recombinant vertebrate cell culture are described in Gething et
al., Nature, 293:620-625 (1981); Mantei et al., Nature, 281:40-46
(1979); EP 117,060; and EP 117,058.
[0208] d. Detecting Gene Amplification/Expression
[0209] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies may be employed that can recognize specific duplexes,
including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes
or DNA-protein duplexes. The antibodies in turn may be labeled and
the assay may be carried out where the duplex is bound to a
surface, so that upon the formation of duplex on the surface, the
presence of antibody bound to the duplex can be detected.
[0210] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. Antibodies
useful for immunohistochemical staining and/or assay of sample
fluids may be either monoclonal or polyclonal, and may be prepared
in any mammal. Conveniently, the antibodies may be prepared against
a native sequence PRO301, PRO362, PRO245 or PRO1868 polypeptide or
against a synthetic peptide based on the DNA sequences provided
herein or against exogenous sequence fused to PRO301, PRO362,
PRO245 or PRO1868 DNA and encoding a specific antibody epitope.
[0211] e. Purification of Polypeptide
[0212] Forms of PRO301, PRO362, PRO245 or PRO1868 may be recovered
from culture medium or from host cell lysates. If membrane-bound,
it can be released from the membrane using a suitable detergent
solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells
employed in expression of PRO301, PRO362, PRO245 or PRO1868 can be
disrupted by various physical or chemical means, such as
freeze-thaw cycling, sonication, mechanical disruption, or cell
lysing agents.
[0213] It may be desired to purify PRO301, PRO362, PRO245 or
PRO1868 from recombinant cell proteins or polypeptides. The
following procedures are exemplary of suitable purification
procedures: by fractionation on an ion-exchange column; ethanol
precipitation; reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE;
ammonium sulfate precipitation; gel filtration using, for example,
Sephadex G-75; protein A Sepharose columns to remove contaminants
such as IgG; and metal chelating columns to bind epitope-tagged
forms of the PRO301, PRO362, PRO245 or PRO1868. Various methods of
protein purification may be employed and such methods are known in
the art and described for example in Deutscher, Methods in
Enzymology, 182 (1990); Scopes, Protein Purification: Principles
and Practice, Springer-Verlag, New York (1982). The purification
step(s) selected will depend, for example, on the nature of the
production process used and the particular PRO301, PRO362, PRO245
or PRO1868 produced.
[0214] f. Detection of Cell Interactions
[0215] To determine whether the polypeptides of the invention are
trafficking or cell adhesion molecules, a number of in vitro assays
may be performed.
[0216] 1) Flow Cytometry/FACS Analysis
[0217] To examine the interaction between PRO301, PRO362, PRO245 or
PRO1868 with specific cell types, biotinylated human IgG fusion
proteins, such as PRO301-human IgG fusion, PRO362-human IgG fusion,
PRO245-human IgG fusion or PRO1868-human IgG fusion, may be
generated. Cells that interact with the biotinylated fusion
proteins may be isolated using streptavidin-conjugated magnetic
beads. The cells that interact with the biotinylated fusion
proteins may be further characterized and analyzed for surface
CD-Ag expression by flow cytometry and/or FACS sorting. Cells
examined for interaction with biotinylated PRO301-human IgG fusion,
PRO362-human IgG fusion, PRO245-human IgG fusion or PRO1868-human
IgG fusion, may include, for example, peripheral blood cells, such
as NK cells, NK/T cells or cytolytic T cells and more specifically,
purified B cells, neutrophils, monocytes or dendritic cells.
[0218] The inhibition of the interaction between PRO301, PRO362,
PRO245 or PRO1868 with specific cell types may further be
characterized by inhibition analysis, specifically the ability of
antibodies, such as anti-PRO301, anti-PRO245, anti-PRO362 or
anti-PRO1868 to inhibit such cell interaction.
[0219] 2) Coimmunoprecipitation
[0220] Upon the identification of PRO301, PRO362, PRO245 or
PRO1868-interacting cells, further analysis may be performed to
identify the particular receptor responsible for the PRO301,
PRO362, PRO245 or PRO1868 interaction. For example,
coimmunoprecipitation analysis may be performed to identify the
receptor on PRO245-interacting cells. Antibodies against PRO245 may
be incubated with the PRO245-interacting cells. The
immunoprecipitates may then be analyzed by SDS-PAGE and
immunoblotting with antibodies against potential receptors. To
determine whether the receptor for PRO245 is a protein that belongs
to the JAM family of proteins, antibodies used for the
immunoblotting may include anti-PRO301, anti-PRO362 or
anti-PRO1868. Such analysis may result in the identification of a
pair of interacting proteins that belong to the A33/JAM family of
adhesion molecules.
[0221] 5. Tissue Distribution
[0222] The location of tissues expressing the polypeptides of the
invention can be identified by determining, for example, mRNA
expression or protein expression in various human tissues. The
location of such genes provides information about which tissues are
most likely to be affected by the stimulating and inhibiting
activities of the polypeptides of the invention. The location of a
gene in a specific tissue also provides sample tissue for the
activity blocking assays discussed below.
[0223] Gene expression in various tissues may be measured by
conventional Southern blotting, Northern blotting to quantitate the
transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA,
77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ
hybridization, using an appropriately labeled probe, based on the
sequences provided herein. Alternatively, antibodies may be
employed that can recognize specific duplexes, including DNA
duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein
duplexes.
[0224] Gene expression in various tissues, alternatively, may be
measured by immunological methods, such as immunohistochemical
staining of tissue sections and assay of cell culture or body
fluids, to quantitate directly the expression of gene product.
Antibodies useful for immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be
prepared in any mammal. Conveniently, the antibodies may be
prepared against a native sequence of a polypeptide of the
invention or against a synthetic peptide based on the DNA sequences
encoding the polypeptide of the invention or against an exogenous
sequence fused to a DNA encoding a polypeptide of the invention and
encoding a specific antibody epitope. General techniques for
generating antibodies, and special protocols for Northern blotting
and in situ hybridization are provided below.
[0225] 6. Antibody Binding Studies
[0226] The activity of the polypeptides of the invention can be
further verified by antibody binding studies, in which the ability
of anti-PRO301, anti-PRO362, anti-PRO245 or anti-PRO1868 antibodies
to inhibit the effect of the PRO301, PRO362, PRO245 or PRO1868
polypeptides on tissue cells is tested. Exemplary antibodies
include polyclonal, monoclonal, humanized, bispecific, and
heteroconjugate antibodies, the preparation of which will be
described herein below.
[0227] Antibody binding studies may be carried out in any known
assay method, such as competitive binding assays, direct and
indirect sandwich assays, and immunoprecipitation assays. Zola,
Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC
Press, Inc., 1987).
[0228] Competitive binding assays rely on the ability of a labeled
standard to compete with the test sample analyte for binding with a
limited amount of antibody. The amount of target protein in the
test sample is inversely proportional to the amount of standard
that becomes bound to the antibodies. To facilitate determining the
amount of standard that becomes bound, the antibodies preferably
are insolubilized before or after the competition, so that the
standard and analyte that are bound to the antibodies may
conveniently be separated from the standard and analyte which
remain unbound.
[0229] Sandwich assays involve the use of two antibodies, each
capable of binding to a different immunogenic portion, or epitope,
of the protein to be detected. In a sandwich assay, the test sample
analyte is bound by a first antibody which is immobilized on a
solid support, and thereafter a second antibody binds to the
analyte, thus forming an insoluble three-part complex. See, e.g.,
U.S. Pat. No. 4,376,110. The second antibody may itself be labeled
with a detectable moiety (direct sandwich assays) or may be
measured using an anti-immunoglobulin antibody that is labeled with
a detectable moiety (indirect sandwich assay). For example, one
type of sandwich assay is an ELISA assay, in which case the
detectable moiety is an enzyme.
[0230] For immunohistochemistry, the tissue sample may be fresh or
frozen or may be embedded in paraffin and fixed with a preservative
such as formalin, for example.
[0231] 7. Cell-Based Assays
[0232] Cell-based assays and animal models for immune related
diseases can be used to further understand the relationship between
the genes and polypeptides identified herein and the development
and pathogenesis of immune related disease.
[0233] In a different approach, cells of a cell type known to be
involved in a particular immune related disease are transfected
with the cDNAs described herein, and the ability of these cDNAs to
alter immune function is analyzed. Suitable cells can be
transfected with the desired gene, and monitored for immune
function activity. Such transfected cell lines can then be used to
test the ability of poly- or monoclonal antibodies or antibody
compositions to alter immune function, for example to modulate
T-cell proliferation or inflammatory cell infiltration. Cells
transfected with the coding sequences of the genes identified
herein can further be used to identify drug candidates for the
treatment of immune related diseases.
[0234] In addition, primary cultures derived from transgenic
animals (as described below) can be used in the cell-based assays
herein, although stable cell lines are preferred. Techniques to
derive continuous cell lines from transgenic animals are well known
in the art (see, e.g., Small et al., Mol. Cell. Biol., 642-648
[1985]).
[0235] One suitable cell based assay is the mixed lymphocyte
reaction (MLR). Current Protocols in Immunology, unit 3.12; edited
by J E Coligan, A M Kruisbeek, D H Marglies, E M Shevach, W
Strober, National Institutes of Health, Published by John Wiley
& Sons, Inc. In this assay, the ability of a test compound to
stimulate the proliferation of activated T cells is assayed. A
suspension of responder T cells is cultured with allogenic
stimulator cells and the proliferation of T cells is measured by
uptake of tritiated thymidine. This assay is a general measure of T
cell reactivity. Since the majority of T cells respond to and
produce IL-2 upon activation, differences in responsiveness in this
assay in part reflect differences in IL-2 production by the
responding cells. The MLR results can be verified by a standard
lymphokine (IL-2) detection assay. Current Protocols in Immunology,
supra, 3.15, 6.3.
[0236] A proliferative T cell response in an MLR assay may be due
to a mitogenic response or may be due to a stimulatory response by
the T cells. Additional verification of the T cell stimulatory
activity of the polypeptides of the invention can be obtained by a
costimulation assay. T cell activation requires an antigen specific
signal mediated through the major histocompatability complex (MHC)
and a costimulatory signal mediated through a second ligand binding
interaction, for example, the B7(CD80, CD86)/CD28 binding
interaction. CD28 crosslinking increases lymphokine secretion by
activated T cells. T cell activation has both negative and positive
controls through the binding of ligands which have a negative or
positive effect. CD28 and CTLA-4 are related glycoproteins in the
Ig superfamily which bind to B7. CD28 binding to B7 has a positive
costimulation effect of T cell activation; conversely, CTLA-4
binding to B7 has a negative T cell deactivating effect. Chambers,
C. A. and Allison, J. P., Curr. Opin. Immunol. (1997) 9:396.
Schwartz, R. H., Cell (1992) 71:1065; Linsley, P. S. and Ledbetter,
J. A., Annu. Rev. Immunol. (1993) 11:191; June, C. H. et al,
Immunol. Today (1994) 15:321; Jenkins, M. K., Immunity (1994)
1:443-446.
[0237] Polypeptides of the invention, as well as other compounds of
the invention, which are stimulators (costimulators) of T cell
proliferation, as determined by MLR assays, for example, are useful
in treating immune related diseases characterized by poor,
suboptimal or inadequate immune function. These diseases are
treated by stimulating the proliferation and activation of T cells
(and T cell mediated immunity) and enhancing the immune response in
a mammal through administration of a stimulatory compound, such as
the stimulating polypeptides of the invention. The stimulating
polypeptide may be a PRO301, PRO362, PRO245 or PRO1868 polypeptide
or an agonist antibody therefor. Immunoadjuvant therapy for
treatment of tumors, described in more detail below, is an example
of this use of the stimulating compounds of the invention.
Antibodies which bind to inhibitory polypeptides function to
enhance the immune response by removing the inhibitory effect of
the inhibiting polypeptides. This effect is seen in experiments
using anti-CTLA-4 antibodies which enhance T cell proliferation,
presumably by removal of the inhibitory signal caused by CTLA-4
binding. Walunas, T. L. et al, Immunity (1994) 1:405. This use is
also validated in experiments with 4-1BB glycoprotein, a member of
the tumor necrosis factor receptor family which binds to a ligand
(4-1BBL) expressed on primed T cells and signals T cell activation
and growth. Alderson, M. E. et al., J. Immunol. (1994) 24:2219.
Inhibition of 4-1BB binding by treatment with an anti-4-1BB
antibody increases the severity of graft-versus-host disease and
may be used to eradicate tumors. Hellstrom, I. and Hellstrom, K.
E., Crit. Rev. Immunol. (1998) 18:1.
[0238] On the other hand, polypeptides of the invention, such as
antagonist antibodies, as well as other compounds of the invention,
which are inhibitors of T cell proliferation/activation and/or
lymphokine secretion, can be directly used to suppress the immune
response. These compounds are useful to reduce the degree of the
immune response and to treat immune related diseases characterized
by a hyperactive, superoptimal, or autoimmune response.
Alternatively, antibodies which bind to the stimulating
polypeptides of the invention and block the stimulating effect of
these molecules can be used to suppress the T cell mediated immune
response by inhibiting T cell proliferation/activation and/or
lymphokine secretion. Blocking the stimulating effect of the
polypeptides suppresses the immune response of the mammal.
[0239] 8. Animal Models
[0240] The results of the cell based in vitro assays can be further
verified using in vivo animal models and assays for T-cell
function. A variety of well known animal models can be used to
further understand the role of the genes identified herein in the
development and pathogenesis of immune related disease, and to test
the efficacy of candidate therapeutic agents, including antibodies,
and other antagonists of the native polypeptides, including small
molecule antagonists. The in vivo nature of such models makes them
particularly predictive of responses in human patients. Animal
models of immune related diseases include both non-recombinant and
recombinant (transgenic) animals. Non-recombinant animal models
include, for example, rodent, e.g., murine models. Such models can
be generated by introducing cells into syngenic mice using standard
techniques, e.g., subcutaneous injection, tail vein injection,
spleen implantation, intraperitoneal implantation, implantation
under the renal capsule, etc.
[0241] Contact hypersensitivity is a simple in vivo assay of cell
mediated immune function. In this procedure, epidermal cells are
exposed to exogenous haptens which give rise to a delayed type
hypersensitivity reaction which is measured and quantitated.
Contact sensitivity involves an initial sensitizing phase followed
by an elicitation phase. The elicitation phase occurs when the
epidermal cells encounter an antigen to which they have had
previous contact. Swelling and inflammation occur, making this an
excellent model of human allergic contact dermatitis. A suitable
procedure is described in detail in Current Protocols in
Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies,
E. M. Shevach and W. Strober, John Wiley & Sons, Inc., 1994,
unit 4.2. See also Grabbe, S. and Schwarz, T, Immun. Today
19(1):37-44 (1998).
[0242] Graft-versus-host disease occurs when immunocompetent cells
are transplanted into immunosuppressed or tolerant patients. The
donor cells recognize and respond to host antigens. The response
can vary from life threatening severe inflammation to mild cases of
diarrhea and weight loss. Graft-versus-host disease models provide
a means of assessing T cell reactivity against MHC antigens and
minor transplant antigens. A suitable procedure is described in
detail in Current Protocols in Immunology, supra, unit 4.3.
[0243] An animal model for skin allograft rejection is a means of
testing the ability of T cells to mediate in vivo tissue
destruction which is indicative of and a measure of their role in
anti-viral and tumor immunity. The most common and accepted models
use murine tail-skin grafts. Repeated experiments have shown that
skin allograft rejection is mediated by T cells, helper T cells and
killer-effector T cells, and not antibodies. Auchincloss, H. Jr.
and Sachs, D. H., Fundamental Immunology, 2nd ed., W. E. Paul ed.,
Raven Press, NY, 1989, 889-992. A suitable procedure is described
in detail in Current Protocols in Immunology, supra, unit 4.4.
Other transplant rejection models which can be used to test the
compounds of the invention are the allogeneic heart transplant
models described by Tanabe, M. et al, Transplantation (1994) 58:23
and Tinubu, S. A. et al, J. Immunol. (1994) 4330-4338.
[0244] Animal models for delayed type hypersensitivity provides an
assay of cell mediated immune function as well. Delayed type
hypersensitivity reactions are a T cell mediated in vivo immune
response characterized by inflammation which does not reach a peak
until after a period of time has elapsed after challenge with an
antigen. These reactions also occur in tissue specific autoimmune
diseases such as multiple sclerosis (MS) and experimental
autoimmune encephalomyelitis (EAE, a model for MS). A suitable
procedure is described in detail in Current Protocols in
Immunology, above, unit 4.5.
[0245] EAE is a T cell mediated autoimmune disease characterized by
T cell and mononuclear cell inflammation and subsequent
demyelination of axons in the central nervous system. EAE is
generally considered to be a relevant animal model for MS in
humans. Bolton, C., Multiple Sclerosis (1995) 1:143. Both acute and
relapsing-remitting models have been developed. The compounds of
the invention can be tested for T cell stimulatory or inhibitory
activity against immune mediated demyelinating disease using the
protocol described in Current Protocols in Immunology, above, units
15.1 and 15.2. See also the models for myelin disease in which
oligodendrocytes or Schwann cells are grafted into the central
nervous system as described in Duncan, I. D. et al, Molec. Med.
Today (1997) 554-561.
[0246] An animal model for arthritis is collagen-induced arthritis.
This model shares clinical, histological and immunological
characteristics of human autoimmune rheumatoid arthritis and is an
acceptable model for human autoimmune arthritis. Mouse and rat
models are characterized by synovitis, erosion of cartilage and
subchondral bone. The compounds of the invention can be tested for
activity against autoimmune arthritis using the protocols described
in Current Protocols in Immunology, above, units 15.5. See also the
model using a monoclonal antibody to CD18 and VLA-4 integrins
described in Issekutz, A. C. et al., Immunology (1996) 88:569.
[0247] A model of asthma has been described in which
antigen-induced airway hyper-reactivity, pulmonary eosinophilia and
inflammation are induced by sensitizing an animal with ovalbumin
and then challenging the animal with the same protein delivered by
aerosol. Several animal models (guinea pig, rat, non-human primate)
show symptoms similar to atopic asthma in humans upon challenge
with aerosol antigens. Murine models have many of the features of
human asthma. Suitable procedures to test the compounds of the
invention for activity and effectiveness in the treatment of asthma
are described by Wolyniec, W. W. et al, Am. J. Respir. Cell Mol.
Biol. (1998) 18:777 and the references cited therein.
[0248] Additionally, the compounds of the invention can be tested
on animal models for psoriasis like diseases. Evidence suggests a T
cell pathogenesis for psoriasis. The compounds of the invention can
be tested in the scid/scid mouse model described by Schon, M. P. et
al, Nat. Med. (1997) 3:183, in which the mice demonstrate
histopathologic skin lesions resembling psoriasis. Another suitable
model is the human skin/scid mouse chimera prepared as described by
Nickoloff, B. J. et al, Am. J. Path. (1995) 146:580.
[0249] Recombinant (transgenic) animal models can be engineered by
introducing the coding portion of the genes identified herein into
the genome of animals of interest, using standard techniques for
producing transgenic animals. Animals that can serve as a target
for transgenic manipulation include, without limitation, mice,
rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human
primates, e.g., baboons, chimpanzees and monkeys. Techniques known
in the art to introduce a transgene into such animals include
pronucleic microinjection (Hoppe and Wanger, U.S. Pat. No.
4,873,191); retrovirus-mediated gene transfer into germ lines
(e.g., Van der Putten et al., Proc. Natl. Acad. Sci. USA 82,
6148-615 [1985]); gene targeting in embryonic stem cells (Thompson
et al., Cell 56, 313-321 [1989]); electroporation of embryos (Lo,
Mol. Cell. Biol. 3, 1803-1814 [1983]); sperm-mediated gene transfer
(Lavitrano et al., Cell 57, 717-73 [1989]). For review, see, for
example, U.S. Pat. No. 4,736,866.
[0250] For the purpose of the present invention, transgenic animals
include those that carry the transgene only in part of their cells
("mosaic animals"). The transgene can be integrated either as a
single transgene, or in concatamers, e.g., head-to-head or
head-to-tail tandems. Selective introduction of a transgene into a
particular cell type is also possible by following, for example,
the technique of Lasko et al., Proc. Natl. Acad. Sci. USA 89
623-636 (1992).
[0251] The expression of the transgene in transgenic animals can be
monitored by standard techniques. For example, Southern blot
analysis or PCR amplification can be used to verify the integration
of the transgene. The level of mRNA expression can then be analyzed
using techniques such as in situ hybridization, Northern blot
analysis, PCR, or immunocytochemistry.
[0252] The animals may be further examined for signs of immune
disease pathology, for example by histological examination to
determine infiltration of immune cells into specific tissues.
Blocking experiments can also be performed in which the transgenic
animals are treated with the compounds of the invention to
determine the extent of effects on T cell proliferation. In these
experiments, blocking antibodies which bind to the polypeptide of
the invention, prepared as described above, are administered to the
animal and the effect on immune function is determined.
[0253] Alternatively, "knock out" animals can be constructed which
have a defective or altered gene encoding a polypeptide identified
herein, as a result of homologous recombination between the
endogenous gene encoding the polypeptide and altered genomic DNA
encoding the same polypeptide introduced into an embryonic cell of
the animal. For example, cDNA encoding a particular polypeptide can
be used to clone genomic DNA encoding that polypeptide in
accordance with established techniques. A portion of the genomic
DNA encoding a particular polypeptide can be deleted or replaced
with another gene, such as a gene encoding a selectable marker
which can be used to monitor integration. Typically, several
kilobases of unaltered flanking DNA (both at the 5' and 3' ends)
are included in the vector [see e.g., Thomas and Capecchi, Cell,
51:503 (1987) for a description of homologous recombination
vectors]. The vector is introduced into an embryonic stem cell line
(e.g., by electroporation) and cells in which the introduced DNA
has homologously recombined with the endogenous DNA are selected
[see e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are
then injected into a blastocyst of an animal (e.g., a mouse or rat)
to form aggregation chimeras [see e.g., Bradley, in
Teratocarcinomas and Embryonic Stem Cells. A Practical Approach, E.
J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric
embryo can then be implanted into a suitable pseudopregnant female
foster animal and the embryo brought to term to create a "knock
out" animal. Progeny harboring the homologously recombined DNA in
their germ cells can be identified by standard techniques and used
to breed animals in which all cells of the animal contain the
homologously recombined DNA. Knockout animals can be characterized
for instance, for their ability to defend against certain
pathological conditions and for their development of pathological
conditions due to absence of the polypeptide.
[0254] 9. Immuno Adjuvant Therapy
[0255] In one embodiment, compounds of the invention having an
immunostimulatory effect can be used in immunoadjuvant therapy for
the treatment of tumors (cancer). It is now well established that T
cells recognize human tumor specific antigens. One group of tumor
antigens, encoded by the MAGE, BAGE and GAGE families of genes, are
silent in all adult normal tissues, but are expressed in
significant amounts in tumors, such as melanomas, lung tumors, head
and neck tumors, and bladder carcinomas. DeSmet, C. et al, (1996)
Proc. Natl. Acad. Sci. USA, 93:7149. It has been shown that
costimulation of T cells induces tumor regression and an antitumor
response both in vitro and in vivo. Melero, I. et al, Nature
Medicine (1997) 3:682; Kwon, E. D. et al, Proc. Natl. Acad. Sci.
USA (1997) 94:8099; Lynch, D. H. et al, Nature Medicine (1997)
3:625; Finn, O. J. and Lotze, M. T., J. Immunol. (1998) 21:114. The
stimulatory compounds of the invention can be administered as
adjuvants, alone or together with a growth regulating agent,
cytotoxic agent or chemotherapeutic agent, to stimulate T cell
proliferation/activation and an antitumor response to tumor
antigens. The growth regulating, cytotoxic, or chemotherapeutic
agent may be administered in conventional amounts using known
administration regimes. Immunostimulating activity by the compounds
of the invention allows reduced amounts of the growth regulating,
cytotoxic, or chemotherapeutic agents thereby potentially lowering
the toxicity to the patient.
[0256] Cancer is characterized by the increase in the number of
abnormal, or neoplastic, cells derived from a normal tissue which
proliferate to form a tumor mass, the invasion of adjacent tissues
by these neoplastic tumor cells, and the generation of malignant
cells which eventually spread via the blood or lymphatic system to
regional lymph nodes and to distant sites (metastasis). In a
cancerous state a cell proliferates under conditions in which
normal cells would not grow. Cancer manifests itself in a wide
variety of forms, characterized by different degrees of
invasiveness and aggressiveness.
[0257] Alteration of gene expression is intimately related to the
uncontrolled cell growth and de-differentiation which are a common
feature of all cancers. The genomes of certain well studied tumors
have been found to show decreased expression of recessive genes,
usually referred to as tumor suppression genes, which would
normally function to prevent malignant cell growth, and/or
overexpression of certain dominant genes, such as oncogenes, that
act to promote malignant growth. Each of these genetic changes
appears to be responsible for importing some of the traits that, in
aggregate, represent the full neoplastic phenotype (Hunter, Cell
64, 1129 [1991]; Bishop, Cell 64, 235-248 [1991]).
[0258] A well known mechanism of gene (e.g. oncogene)
overexpression in cancer cells is gene amplification. This is a
process where in the chromosome of the ancestral cell multiple
copies of a particular gene are produced. The process involves
unscheduled replication of the region of chromosome comprising the
gene, followed by recombination of the replicated segments back
into the chromosome (Alitalo et al., Adv. Cancer Res. 47, 235-281
[1986]). It is believed that the overexpression of the gene
parallels gene amplification, i.e. is proportionate to the number
of copies made.
[0259] Proto-oncogenes that encode growth factors and growth factor
receptors have been identified to play important roles in the
pathogenesis of various human malignancies, including breast
cancer. For example, it has been found that the human ErbB2 gene
(erbB2, also known as her2, or c-erbB-2), which encodes a 185-kd
transmembrane glycoprotein receptor (p185.sup.HER2; HER2) related
to the epidermal growth factor receptor (EGFR), is overexpressed in
about 25% to 30% of human breast cancer (Slamon et al., Science
235:177-182 [1987]; Slamon et al., Science 244:707-712 [1989]).
[0260] It has been reported that gene amplification of a
protooncogene is an event typically involved in the more malignant
forms of cancer, and could act as a predictor of clinical outcome
(Schwab et al., Genes Chromosomes Cancer 1, 181-193 [1990]; Alitalo
et al., supra). Thus, erbB2 overexpression is commonly regarded as
a predictor of a poor prognosis, especially in patients with
primary disease that involves axillary lymph nodes (Slamon et al.,
[1987] and [1989], supra; Ravdin and Chamness, Gene 159:19-27
[1995]; and Hynes and Stern, Biochim Biophys Acta 1198:165-184
[1994]), and has been linked to sensitivity and/or resistance to
hormone therapy and chemotherapeutic regimens, including CMF
(cyclophosphamide, methotrexate, and fluoruracil) and
anthracyclines (Baselga et al., Oncology 11(3 Suppl 1):43-48
[1997]). However, despite the association of erbB2 overexpression
with poor prognosis, the odds of HER2-positive patients responding
clinically to treatment with taxanes were greater than three times
those of HER2-negative patients (Ibid). A recombinant humanized
anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of
the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 or
Herceptin7) has been clinically active in patients with
ErbB2-overexpressing metastatic breast cancers that had received
extensive prior anticancer therapy. (Baselga et al., J. Clin.
Oncol. 14:737-744 [1996]).
[0261] 10. Screening Assays for Drug Candidates
[0262] Screening assays for drug candidates are designed to
identify compounds that bind or complex with the polypeptides
encoded by the genes identified herein or a biologically active
fragment thereof, or interfere with the expression and/or activity
of the polypeptides encoded by genes identified herein or with the
interaction of the encoded polypeptides with other cellular
proteins. Such screening assays will include assays amenable to
high-throughput screening of chemical libraries, making them
particularly suitable for identifying small molecule drug
candidates. Small molecules contemplated include synthetic organic
or inorganic compounds, including peptides, preferably soluble
peptides, (poly)peptide-immunoglobulin fusions, and, in particular,
antibodies including, without limitation, poly- and monoclonal
antibodies and antibody fragments, single-chain antibodies,
anti-idiotypic antibodies, and chimeric or humanized versions of
such antibodies or fragments, as well as human antibodies and
antibody fragments. The assays can be performed in a variety of
formats, including protein-protein binding assays, biochemical
screening assays, immunoassays and cell based assays, which are
well characterized in the art.
[0263] All assays are common in that they call for contacting the
drug candidate with a polypeptide encoded by a nucleic acid
identified herein under conditions and for a time sufficient to
allow these two components to interact.
[0264] In binding assays, the interaction is binding and the
complex formed can be isolated or detected in the reaction mixture.
In a particular embodiment, the polypeptide encoded by the gene
identified herein or the drug candidate is immobilized on a solid
phase, e.g. on a microtiter plate, by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by
coating the solid surface with a solution of the polypeptide and
drying. Alternatively, an immobilized antibody, e.g. a monoclonal
antibody, specific for the polypeptide to be immobilized can be
used to anchor it to a solid surface. The assay is performed by
adding the non-immobilized component, which may be labeled by a
detectable label, to the immobilized component, e.g. the coated
surface containing the anchored component. When the reaction is
complete, the non-reacted components are removed, e.g., by washing,
and complexes anchored on the solid surface are detected. When the
originally non-immobilized component carries a detectable label,
the detection of label immobilized on the surface indicates that
complexing occurred. Where the originally non-immobilized component
does not carry a label, complexing can be detected, for example, by
using a labeled antibody specifically binding the immobilized
complex.
[0265] If the candidate compound interacts with but does not bind
to a particular protein encoded by a gene identified herein, its
interaction with that protein can be assayed by methods well known
for detecting protein-protein interactions. Such assays include
traditional approaches, such as, cross-linking,
co-immunoprecipitation, and co-purification through gradients or
chromatographic columns. In addition, protein-protein interactions
can be monitored by using a yeast-based genetic system described by
Fields and co-workers [Fields and Song, Nature (London) 340,
245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88,
9578-9582 (1991)] as disclosed by Chevray and Nathans [Proc. Natl.
Acad. Sci. USA 89, 5789-5793 (1991)]. Many transcriptional
activators, such as yeast GAL4, consist of two physically discrete
modular domains, one acting as the DNA-binding domain, while the
other one functioning as the transcription activation domain. The
yeast expression system described in the foregoing publications
(generally referred to as the "two-hybrid system") takes advantage
of this property, and employs two hybrid proteins, one in which the
target protein is fused to the DNA-binding domain of GAL4, and
another, in which candidate activating proteins are fused to the
activation domain. The expression of a GAL1-lacZ reporter gene
under control of a GAL4-activated promoter depends on
reconstitution of GAL4 activity via protein-protein interaction.
Colonies containing interacting polypeptides are detected with a
chromogenic substrate for .beta.-galactosidase. A complete kit
(MATCHMAKER.TM.) for identifying protein-protein interactions
between two specific proteins using the two-hybrid technique is
commercially available from Clontech. This system can also be
extended to map protein domains involved in specific protein
interactions as well as to pinpoint amino acid residues that are
crucial for these interactions.
[0266] In order to find compounds that interfere with the
interaction of a gene identified herein and other intra- or
extracellular components can be tested, a reaction mixture is
usually prepared containing the product of the gene and the intra-
or extracellular component under conditions and for a time allowing
for the interaction and binding of the two products. To test the
ability of a test compound to inhibit binding, the reaction is run
in the absence and in the presence of the test compound. In
addition, a placebo may be added to a third reaction mixture, to
serve as positive control. The binding (complex formation) between
the test compound and the intra- or extracellular component present
in the mixture is monitored as described above. The formation of a
complex in the control reaction(s) but not in the reaction mixture
containing the test compound indicates that the test compound
interferes with the interaction of the test compound and its
reaction partner.
[0267] 11. Compositions and Methods for the Treatment of Immune
Related Diseases
[0268] The compositions useful in the treatment of immune related
diseases include, without limitation, antibodies, small organic and
inorganic molecules, peptides, phosphopeptides, antisense and
ribozyme molecules, triple helix molecules, etc. that inhibit or
stimulate immune function, for example, T cell
proliferation/activation, lymphokine release, or immune cell
infiltration, depends on the disease to be treated.
[0269] For example, antisense RNA and RNA molecule act to directly
block the translation of mRNA by hybridizing to targeted mRNA and
preventing protein translation. When antisense DNA is used,
oligodeoxyribonucleotides derived from the translation initiation
site, e.g., between about -10 and +10 positions of the target gene
nucleotide sequence, are preferred.
[0270] Ribozymes are enzymatic RNA molecules capable of catalyzing
the specific cleavage of RNA. Ribozymes act by sequence-specific
hybridization to the complementary target RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a
potential RNA target can be identified by known techniques. For
further details see, e.g., Rossi, Current Biology 4, 469-471
(1994), and PCT publication No. WO 97/33551 (published Sep. 18,
1997).
[0271] Nucleic acid molecules in triple helix formation used to
inhibit transcription should be single-stranded and composed of
deoxynucleotides. The base composition of these oligonucleotides is
designed such that it promotes triple helix formation via Hoogsteen
base pairing rules, which generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further
details see, e.g., PCT publication No. WO 97/33551, supra.
[0272] These molecules can be identified by any or any combination
of the screening assays discussed above and/or by any other
screening techniques well known for those skilled in the art.
[0273] 12. Antibodies
[0274] Among the most promising drug candidates according to the
present invention are antibodies and antibody fragments which may
inhibit (antagonists) or stimulate (agonists) T cell proliferation,
leucocyte infiltration, etc. Exemplary antibodies include
polyclonal, monoclonal, humanized, bispecific and heteroconjugate
antibodies.
[0275] a. Polyclonal Antibodies
[0276] Methods of preparing polyclonal antibodies are known to
skilled artisan. Polyclonal antibodies can be raised in a mammal,
for example, by one or more injections of an immunizing agent, and,
if desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the
PRO301, PRO362, PRO245 or PRO1868 polypeptide of the invention or a
fragment or fusion protein thereof. It may be useful to conjugate
the immunizing agent to a protein known to be immunogenic in the
mammal being immunized. Examples of such immunogenic proteins
include but are not limited to keyhole limpet hemocyanin, serum
albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
Examples of adjuvants which may be employed include Freund's
complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A,
synthetic trehalose dicorynomycolate). The immunization protocol
may be selected by one skilled in the art without undue
experimentation.
[0277] b. Monoclonal Antibodies
[0278] Antibodies which recognize and bind to the polypeptides of
the invention or which act as antagonists thereto may,
alternatively be monoclonal antibodies. Monoclonal antibodies may
be prepared using hybridoma methods, such as those described by
Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method,
a mouse, hamster, or other appropriate host animal, is typically
immunized with an immunizing agent to elicit lymphocytes that
produce or are capable of producing antibodies that will
specifically bind to the immunizing agent. Alternatively, the
lymphocytes may be immunized in vitro.
[0279] The immunizing agent will typically include the PRO301,
PRO362, PRO245 or PRO1868 polypeptide of the invention, an
antigenic fragment or a fusion protein thereof. Generally, either
peripheral blood lymphocytes ("PBLs") are used if cells of human
origin are desired, or spleen cells or lymph node cells are used if
non-human mammalian sources are desired. The lymphocytes are then
fused with an immortalized cell line using a suitable fusing agent,
such as polyethylene glycol, to form a hybridoma cell [Goding,
Monoclonal Antibodies: Principles and Practice, Academic Press,
(1986) pp. 59-103]. Immortalized cell lines are usually transformed
mammalian cells, particularly myeloma cells of rodent, bovine and
human origin. Usually, rat or mouse myeloma cell lines are
employed. The hybridoma cells may be cultured in a suitable culture
medium that preferably contains one or more substances that inhibit
the growth or survival of the unfused, immortalized cells. For
example, if the parental cells lack the enzyme hypoxanthine guanine
phosphoribosyl transferase (HGPRT or HPRT), the culture medium for
the hybridomas typically will include hypoxanthine, aminopterin,
and thymidine ("HAT medium"), which substances prevent the growth
of HGPRT-deficient cells.
[0280] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Rockville, Md. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies [Kozbor, J.
Immunol, 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
[0281] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against the polypeptide of the invention or having similar
activity as the polypeptide of the invention. Preferably, the
binding specificity of monoclonal antibodies produced by the
hybridoma cells is determined by immunoprecipitation or by an in
vitro binding assay, such as radioimmunoassay (RIA) or
enzyme-linked immunoabsorbent assay (ELISA). Such techniques and
assays are known in the art. The binding affinity of the monoclonal
antibody can, for example, be determined by the Scatchard analysis
of Munson and Pollard, Anal. Biochem., 107:220 (1980).
[0282] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods [Goding, supra]. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0283] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxyapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0284] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences [U.S.
Pat. No. 4,816,567; Morrison et al., supra] or by covalently
joining to the immunoglobulin coding sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0285] The antibodies are preferably monovalent antibodies. Methods
for preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0286] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art.
[0287] c. Human and Humanized Antibodies
[0288] The antibodies of the invention may further comprise
humanized antibodies or human antibodies. Humanized forms of
non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding subsequences of antibodies)
which contain minimal sequence derived from non-human
immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which residues from a complementary
determining region (CDR) of the recipient are replaced by residues
from a CDR of a non-human species (donor antibody) such as mouse,
rat or rabbit having the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues which are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin [Jones et
al., Nature, 321:522-525 (1986); Riechmann et al., Nature,
332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596
(1992)].
[0289] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and coworkers [Jones et al., Nature,
321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988);
Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (U.S. Pat. No. 4,816,567), wherein
substantially less than an intact human variable domain has been
substituted by the corresponding sequence from a non-human species.
In practice, humanized antibodies are typically human antibodies in
which some CDR residues and possibly some FR residues are
substituted by residues from analogous sites in rodent
antibodies.
[0290] Human antibodies can also be produced using various
techniques known in the art, including phage display libraries
[Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al.
and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al.,. Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al., J.
Immunol., 147(1):86-95 (1991); U.S. Pat. No. 5,750,373]. Similarly,
human antibodies can be made by introducing of human immunoglobulin
loci into transgenic animals, e.g., mice in which the endogenous
immunoglobulin genes have been partially or completely inactivated.
Upon challenge, human antibody production is observed, which
closely resembles that seen in humans in all respects, including
gene rearrangement, assembly, and antibody repertoire. This
approach is described, for example, in U.S. Pat. Nos. 5,545,807;
5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the
following scientific publications: Marks et al., Bio/Technology 10,
779-783 (1992); Lonberg et al., Nature 368 856-859 (1994);
Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature
Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology
14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93
(1995).
[0291] d. Bispecific Antibodies
[0292] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities may be for the polypeptide of the invention, the
other one is for any other antigen, and preferably for a
cell-surface protein or receptor or receptor subunit.
[0293] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the coexpression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities (Milstein and Cuello, Nature, 305:537-539
[1983]). Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published May 13,
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0294] Antibody variable domains with the desired binding
specificities (antibody-antigen combining sites) can be fused to
immunoglobulin constant domain sequences. The fusion preferably is
with an immunoglobulin heavy-chain constant domain, comprising at
least part of the hinge, CH2, and CH3 regions. It is preferred to
have the first heavy-chain constant region (CH1) containing the
site necessary for light-chain binding present in at least one of
the fusions. DNAs encoding the immunoglobulin heavy-chain fusions
and, if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are cotransfected into a suitable
host organism. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0295] e. Heteroconjugate Antibodies
[0296] Heteroconjugate antibodies are composed of two covalently
joined antibodies. Such antibodies have, for example, been proposed
to target immune system cells to unwanted cells (U.S. Pat. No.
4,676,980), and for treatment of HIV infection (WO 91/00360; WO
92/200373; EP 03089). It is contemplated that the antibodies may be
prepared in vitro using known methods in synthetic protein
chemistry, including those involving crosslinking agents. For
example, immunotoxins may be constructed using a disulfide exchange
reaction or by forming a thioether bond. Examples of suitable
reagents for this purpose include iminothiolate and
methyl-4-mercaptobutyrimidate and those disclosed, for example, in
U.S. Pat. No. 4,676,980.
[0297] f. Effector Function Engineering
[0298] It may be desirable to modify the antibody of the invention
with respect to effector function, so as to enhance the
effectiveness of the antibody in treating an immune related
disease, for example. For example cysteine residue(s) may be
introduced in the Fc region, thereby allowing interchain disulfide
bond formation in this region. The homodimeric antibody thus
generated may have improved internalization capability and/or
increased complement-mediated cell killing and antibody-dependent
cellular cytotoxicity (ADCC). See Caron et al., J Exp Med.
176:1191-1195 (1992) and Shopes, B., J. Immunol. 148:2918-2922
(1992). Homodimeric antibodies with enhanced anti-tumor activity
may also be prepared using heterobifunctional cross-linkers as
described in Wolff et al. Cancer Research 53:2560-2565 (1993).
Alternatively, an antibody can be engineered which has dual Fc
regions and may thereby have enhanced complement lysis and ADCC
capabilities. See Stevenson et al., Anti-Cancer Drug Design,
3:219-230 (1989).
[0299] g. Immunoconjugates
[0300] The invention also pertains to immunoconjugates comprising
an antibody conjugated to a cytotoxic agent such as a
chemotherapeutic agent, toxin (e.g. an enzymatically active toxin
of bacterial, fungal, plant or animal origin, or fragments
thereof), or a radioactive isotope (i.e., a radioconjugate).
[0301] Chemotherapeutic agents useful in the generation of such
immunoconjugates have been described above. Enzymatically active
toxins and fragments thereof which can be used include diphtheria A
chain, nonbinding active fragments of diphtheria toxin, exotoxin A
chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain,
modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin
proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S),
momordica charantia inhibitor, curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin, restrictocin,
phenomycin, enomycin and the tricothecenes. A variety of
radionuclides are available for the production of radioconjugated
antibodies. Examples include .sup.212Bi, .sup.131I, .sup.131In,
.sup.90Y and .sup.186Re.
[0302] Conjugates of the antibody and cytotoxic agent are made
using a variety of bifunctional protein coupling agents such as
N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP),
iminothiolane (IT), bifunctional derivatives of imidoesters (such
as dimethyl adipimidate HCL), active esters (such as disuccinimidyl
suberate), aldehydes (such as glutareldehyde), bis-azido compounds
(such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium
derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine),
diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active
fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For
example, a ricin-immunotoxin can be prepared as described in
Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled
1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid
(MX-DTPA) is an exemplary chelating agent for conjugation of
radionucleotide to the antibody. See WO94/11026.
[0303] In another embodiment, the antibody may be conjugated to a
"receptor" (such streptavidin) for utilization in tissue
pretargeting wherein the antibody-receptor conjugate is
administered to the patient, followed by removal of unbound
conjugate from the circulation using a clearing agent and then
administration of a "ligand" (e.g. avidin) which is conjugated to a
cytotoxic agent (e.g. a radionucleotide).
[0304] h. Immunoliposomes
[0305] The proteins, antibodies, etc. disclosed herein may also be
formulated as immunoliposomes. Liposomes containing the antibody
are prepared by methods known in the art, such as described in
Epstein et al., Proc. Natl. Acad. Sci. USA, 82:3688 (1985); Hwang
et al., Proc. Natl. Acad. Sci. USA, 77:4030 (1980); and U.S. Pat.
Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation
time are disclosed in U.S. Pat. No. 5,013,556.
[0306] Particularly useful liposomes can be generated by the
reverse phase evaporation method with a lipid composition
comprising phosphatidylcholine, cholesterol and PEG-derivatized
phosphatidylethanolamine (PEG-PE). Liposomes are extruded through
filters of defined pore size to yield liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention
can be conjugated to the liposomes as described in Martin et al.,
J. Biol. Chem. 257: 286-288 (1982) via a disulfide interchange
reaction. A chemotherapeutic agent (such as doxorubicin) may be
optionally contained within the liposome. See Gabizon et al., J.
National Cancer Inst. 81(19)1484 (1989).
[0307] 13. Pharmaceutical Compositions
[0308] The active molecules of the invention, including
polypeptides and antibodies, as well as other molecules identified
by the screening assays disclosed above, can be administered for
the treatment of inflammatory diseases, in the form of
pharmaceutical compositions.
[0309] Therapeutic formulations of the active molecule, preferably
a PRO301, PRO362, PRO245 or PRO1868 polypeptide or antibody of the
invention, are prepared for storage by mixing the active molecule
having the desired degree of purity with optional pharmaceutically
acceptable carriers, excipients or stabilizers (Remington's
Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the
form of lyophilized formulations or aqueous solutions. Acceptable
carriers, excipients, or stabilizers are nontoxic to recipients at
the dosages and concentrations employed, and include buffers such
as phosphate, citrate, and other organic acids; antioxidants
including ascorbic acid and methionine; preservatives (such as
octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride;
benzalkonium chloride, benzethonium chloride; phenol, butyl or
benzyl alcohol; alkyl parabens such as methyl or propyl paraben;
catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low
molecular weight (less than about 10 residues) polypeptides;
proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; amino acids such
as glycine, glutamine, asparagine, histidine, arginine, or lysine;
monosaccharides, disaccharides, and other carbohydrates including
glucose, mannose, or dextrins; chelating agents such as EDTA;
sugars such as sucrose, mannitol, trehalose or sorbitol;
salt-forming counter-ions such as sodium; metal complexes (e.g.
Zn-protein complexes); and/or non-ionic surfactants such as
TWEEN.TM., PLURONICS.TM. or polyethylene glycol (PEG).
[0310] Compounds identified by the screening assays of the present
invention can be formulated in an analogous manner, using standard
techniques well known in the art.
[0311] Lipofections or liposomes can also be used to deliver the
polypeptide, antibody, or an antibody fragment, into cells. Where
antibody fragments are used, the smallest fragment which
specifically binds to the binding domain of the target protein is
preferred. For example, based upon the variable region sequences of
an antibody, peptide molecules can be designed which retain the
ability to bind the target protein sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA
technology (see, e.g., Marasco et al., Proc. Natl. Acad. Sci. USA
90, 7889-7893 [1993]).
[0312] The formulation herein may also contain more than one active
compound as necessary for the particular indication being treated,
preferably those with complementary activities that do not
adversely affect each other. Alternatively, or in addition, the
composition may comprise a cytotoxic agent, cytokine or growth
inhibitory agent. Such molecules are suitably present in
combination in amounts that are effective for the purpose
intended.
[0313] The active molecules may also be entrapped in microcapsules
prepared, for example, by coascervation techniques or by
interfacial polymerization, for example, hydroxymethylcellulose or
gelatin-microcapsules and poly-(methylmethacylate) microcapsules,
respectively, in colloidal drug delivery systems (for example,
liposomes, albumin microspheres, microemulsions, nano-particles and
nanocapsules) or in macroemulsions. Such techniques are disclosed
in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed.
(1980).
[0314] The formulations to be used for in vivo administration must
be sterile. This is readily accomplished by filtration through
sterile filtration membranes.
[0315] Sustained-release preparations may be prepared. Suitable
examples of sustained-release preparations include semipermeable
matrices of solid hydrophobic polymers containing the antibody,
which matrices are in the form of shaped articles, e.g. films, or
microcapsules. Examples of sustained-release matrices include
polyesters, hydrogels (for example,
poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers such as
the LUPRON DEPOT.TM. (injectable microspheres composed of lactic
acid-glycolic acid copolymer and leuprolide acetate), and
poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-glycolic acid enable release
of molecules for over 100 days, certain hydrogels release proteins
for shorter time periods. When encapsulated antibodies remain in
the body for a long time, they may denature or aggregate as a
result of exposure to moisture at 37C, resulting in a loss of
biological activity and possible changes in immunogenicity.
Rational strategies can be devised for stabilization depending on
the mechanism involved. For example, if the aggregation mechanism
is discovered to be intermolecular S--S bond formation through
thio-disulfide interchange, stabilization may be achieved by
modifying sulfhydryl residues, lyophilizing from acidic solutions,
controlling moisture content, using appropriate additives, and
developing specific polymer matrix compositions.
[0316] 14. Methods of Treatment
[0317] It is contemplated that the polypeptides, antibodies and
other active compounds of the present invention may be used to
treat various inflammatory diseases and conditions, such as T cell
mediated diseases, including those characterized by infiltration of
leucocyte cells into a tissue, stimulation of T-cell proliferation,
inhibition of T-cell proliferation, increased or decreased vascular
permeability or the inhibition thereof.
[0318] PRO301, PRO362, PRO245 and PRO1868 encode new members of a
family of proteins characterized by homology to A33 antigen. The
proinflammatory nature of these polypeptides is indicated in the in
vitro assays described below. Accordingly, antagonists of these
polypeptides would be useful to treat inflammatory diseases.
[0319] PRO301, PRO362, PRO245 and PRO1868 (SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 9 and SEQ ID NO: 31, respectively), share homology
with junctional adhesion molecule (JAM), Martin-Padura et al., J.
Cell Biol. 1998 142(1): 117-27. The most substantial identity is
shared by the PRO301 protein encoded by DNA40628 (SEQ ID NO: 1) at
67%. JAM is involved in the recruitment of monocytes in response to
MCP-1, MCP-3 and LPS in vivo. Antibodies to JAM block monocyte
transmigration in vivo. JAM is localized to the murine epithelia
and endothelia as a junctional adhesion molecule for monocyte
transmigration. Other leukocytes may also use JAM, but no
information supports this notion. JAM is elevated in the colon of
mice with colitis and likely plays a role in the recruitment of
monocytes or leukocytes into the colonic lesion.
[0320] Exemplary conditions or disorders to be treated with
antagonists of PRO301, PRO362, PRO245 or PRO1868 polypeptides,
antibodies and other compounds of the invention, include, but are
not limited to, inflammatory bowel disease (i.e, ulcerative
colitis, Crohn's disease), systemic lupus erythematosus, rheumatoid
arthritis, juvenile chronic arthritis, spondyloarthropathies,
systemic sclerosis (scleroderma), idiopathic inflammatory
myopathies (dermatomyositis, polymyositis), Sjogren's syndrome,
systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia
(immune pancytopenia, paroxysmal nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura,
immune-mediated thrombocytopenia), thyroiditis (Grave's disease,
Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic
thyroiditis), diabetes mellitus, immune-mediated renal disease
(glomerulonephritis, tubulointerstitial nephritis), demyelinating
diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic demyelinating polyneuropathy or
Guillain-Barre syndrome, and chronic inflammatory demyelinating
polyneuropathy, hepatobiliary diseases such as infectious hepatitis
(hepatitis A, B, C, D, E and other non-hepatotropic viruses),
autoimmune chronic active hepatitis, primary biliary cirrhosis,
granulomatous hepatitis, and sclerosing cholangitis, inflammatory
and fibrotic lung diseases such as cystic fibrosis,
gluten-sensitive enteropathy, and Whipple's disease, autoimmune or
immune-mediated skin diseases including bullous skin diseases,
erythema multiforme and contact dermatitis, psoriasis, allergic
diseases such as asthma, allergic rhinitis, atopic dermatitis, food
hypersensitivity and urticaria, immunologic diseases of the lung
such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis, transplantation associated diseases
including graft rejection and graft-versus-host-disease.
[0321] In systemic lupus erythematosus, the central mediator of
disease is the production of auto-reactive antibodies to self
proteins/tissues and the subsequent generation of immune-mediated
inflammation. Antibodies either directly or indirectly mediate
tissue injury. Though T lymphocytes have not been shown to be
directly involved in tissue damage, T lymphocytes are required for
the development of auto-reactive antibodies. The genesis of the
disease is thus T lymphocyte dependent. Multiple organs and systems
are affected clinically including kidney, lung, musculoskeletal
system, mucocutaneous, eye, central nervous system, cardiovascular
system, gastrointestinal tract, bone marrow and blood.
[0322] Rheumatoid arthritis (RA) is a chronic systemic autoimmune
inflammatory disease that mainly involves the synovial membrane of
multiple joints with resultant injury to the articular cartilage.
The pathogenesis is T lymphocyte dependent and is associated with
the production of rheumatoid factors, auto-antibodies directed
against self IgG, with the resultant formation of immune complexes
that attain high levels in joint fluid and blood. These complexes
in the joint may induce the marked infiltrate of lymphocytes and
monocytes into the synovium and subsequent marked synovial changes;
the joint space/fluid is infiltrated by similar cells with the
addition of numerous neutrophils. Tissues affected are primarily
the joints, often in symmetrical pattern. However, extra-articular
disease also occurs in two major forms. One form is the development
of extra-articular lesions with ongoing progressive joint disease
and typical lesions of pulmonary fibrosis, vasculitis, and
cutaneous ulcers. The second form of extra-articular disease is the
so called Felty's syndrome which occurs late in the RA disease
course, sometimes after joint disease has become quiescent, and
involves the presence of neutropenia, thrombocytopenia and
splenomegaly. This can be accompanied by vasculitis in multiple
organs with formations of infarcts, skin ulcers and gangrene.
Patients often also develop rheumatoid nodules in the subcutis
tissue overlying affected joints; the nodules late stages have
necrotic centers surrounded by a mixed inflammatory cell
infiltrate. Other manifestations which can occur in RA include:
pericarditis, pleuritis, coronary arteritis, interstitial
pneumonitis with pulmonary fibrosis, keratoconjunctivitis sicca,
and rheumatoid nodules.
[0323] Juvenile chronic arthritis is a chronic idiopathic
inflammatory disease which begins often at less than 16 years of
age. Its phenotype has some similarities to RA; some patients which
are rheumatoid factor positive are classified as juvenile
rheumatoid arthritis. The disease is sub-classified into three
major categories: pauciarticular, polyarticular, and systemic. The
arthritis can be severe and is typically destructive and leads to
joint ankylosis and retarded growth. Other manifestations can
include chronic anterior uveitis and systemic amyloidosis.
[0324] Spondyloarthropathies are a group of disorders with some
common clinical features and the common association with the
expression of HLA-B27 gene product. The disorders include:
ankylosing spondylitis, Reiter's syndrome (reactive arthritis),
arthritis associated with inflammatory bowel disease, spondylitis
associated with psoriasis, juvenile onset spondyloarthropathy and
undifferentiated spondyloarthropathy. Distinguishing features
include sacroileitis with or without spondylitis; inflammatory
asymmetric arthritis; association with HLA-B27 (a serologically
defined allele of the HLA-B locus of class I MHC); ocular
inflammation, and absence of autoantibodies associated with other
rheumatoid disease. The cell most implicated as key to induction of
the disease is the CD8+ T lymphocyte, a cell which targets antigen
presented by class I MHC molecules. CD8+ T cells may react against
the class I MHC allele HLA-B27 as if it were a foreign peptide
expressed by MHC class I molecules. It has been hypothesized that
an epitope of HLA-B27 may mimic a bacterial or other microbial
antigenic epitope and thus induce a CD8+ T cells response.
[0325] Systemic sclerosis (scleroderma) has an unknown etiology. A
hallmark of the disease is induration of the skin; likely this is
induced by an active inflammatory process. Scleroderma can be
localized or systemic; vascular lesions are common and endothelial
cell injury in the microvasculature is an early and important event
in the development of systemic sclerosis; the vascular injury may
be immune mediated. An immunologic basis is implied by the presence
of mononuclear cell infiltrates in the cutaneous lesions and the
presence of anti-nuclear antibodies in many patients. ICAM-1 is
often upregulated on the cell surface of fibroblasts in skin
lesions suggesting that T cell interaction with these cells may
have a role in the pathogenesis of the disease. Other organs
involved include: the gastrointestinal tract: smooth muscle atrophy
and fibrosis resulting in abnormal peristalsis/motility; kidney:
concentric subendothelial intimal proliferation affecting small
arcuate and interlobular arteries with resultant reduced renal
cortical blood flow, results in proteinuria, azotemia and
hypertension; skeletal muscle: atrophy, interstitial fibrosis;
inflammation; lung: interstitial pneumonitis and interstitial
fibrosis; and heart: contraction band necrosis,
scarring/fibrosis.
[0326] Idiopathic inflammatory myopathies including
dermatomyositis, polymyositis and others are disorders of chronic
muscle inflammation of unknown etiology resulting in muscle
weakness. Muscle injury/inflammation is often symmetric and
progressive. Autoantibodies are associated with most forms. These
myositis-specific autoantibodies are directed against and inhibit
the function of components, proteins and RNA's, involved in protein
synthesis.
[0327] Sjogren's syndrome is due to immune-mediated inflammation
and subsequent functional destruction of the tear glands and
salivary glands. The disease can be associated with or accompanied
by inflammatory connective tissue diseases. The disease is
associated with autoantibody production against Ro and La antigens,
both of which are small RNA-protein complexes. Lesions result in
keratoconjunctivitis sicca, xerostomia, with other manifestations
or associations including bilary cirrhosis, peripheral or sensory
neuropathy, and palpable purpura.
[0328] Systemic vasculitis includes diseases in which the primary
lesion is inflammation and subsequent damage to blood vessels which
results in ischemia/necrosis/degeneration to tissues supplied by
the affected vessels and eventual end-organ dysfunction in some
cases. Vasculitides can also occur as a secondary lesion or
sequelae to other immune-inflammatory mediated diseases such as
rheumatoid arthritis, systemic sclerosis, etc., particularly in
diseases also associated with the formation of immune complexes.
Diseases in the primary systemic vasculitis group include: systemic
necrotizing vasculitis: polyarteritis nodosa, allergic angiitis and
granulomatosis, polyangiitis; Wegener's granulomatosis;
lymphomatoid granulomatosis; and giant cell arteritis.
Miscellaneous vasculitides include: mucocutaneous lymph node
syndrome (MLNS or Kawasaki's disease), isolated CNS vasculitis,
Behet's disease, thromboangiitis obliterans (Buerger's disease) and
cutaneous necrotizing venulitis. The pathogenic mechanism of most
of the types of vasculitis listed is believed to be primarily due
to the deposition of immunoglobulin complexes in the vessel wall
and subsequent induction of an inflammatory response either via
ADCC, complement activation, or both.
[0329] Sarcoidosis is a condition of unknown etiology which is
characterized by the presence of epithelioid granulomas in nearly
any tissue in the body; involvement of the lung is most common. The
pathogenesis involves the persistence of activated macrophages and
lymphoid cells at sites of the disease with subsequent chronic
sequelae resultant from the release of locally and systemically
active products released by these cell types.
[0330] Autoimmune hemolytic anemia including autoimmune hemolytic
anemia, immune pancytopenia, and paroxysmal noctural hemoglobinuria
is a result of production of antibodies that react with antigens
expressed on the surface of red blood cells (and in some cases
other blood cells including platelets as well) and is a reflection
of the removal of those antibody coated cells via complement
mediated lysis and/or ADCC/Fc-receptor-mediated mechanisms.
[0331] In autoimmune thrombocytopenia including thrombocytopenic
purpura, and immune-mediated thrombocytopenia in other clinical
settings, platelet destruction/removal occurs as a result of either
antibody or complement attaching to platelets and subsequent
removal by complement lysis, ADCC or FC-receptor mediated
mechanisms.
[0332] Thyroiditis including Grave's disease, Hashimoto's
thyroiditis, juvenile lymphocytic thyroiditis, and atrophic
thyroiditis, are the result of an autoimmune response against
thyroid antigens with production of antibodies that react with
proteins present in and often specific for the thyroid gland.
Experimental models exist including spontaneous models: rats (BUF
and BB rats) and chickens (obese chicken strain); inducible models:
immunization of animals with either thyroglobulin, thyroid
microsomal antigen (thyroid peroxidase).
[0333] Type I diabetes mellitus or insulin-dependent diabetes is
the autoimmune destruction of pancreatic islet .beta. cells; this
destruction is mediated by auto-antibodies and auto-reactive T
cells. Antibodies to insulin or the insulin receptor can also
produce the phenotype of insulin-non-responsiveness.
[0334] Immune mediated renal diseases, including glomerulonephritis
and tubulointerstitial nephritis, are the result of antibody or T
lymphocyte mediated injury to renal tissue either directly as a
result of the production of autoreactive antibodies or T cells
against renal antigens or indirectly as a result of the deposition
of antibodies and/or immune complexes in the kidney that are
reactive against other, non-renal antigens. Thus other
immune-mediated diseases that result in the formation of
immune-complexes can also induce immune mediated renal disease as
an indirect sequelae. Both direct and indirect immune mechanisms
result in inflammatory response that produces/induces lesion
development in renal tissues with resultant organ function
impairment and in some cases progression to renal failure. Both
humoral and cellular immune mechanisms can be involved in the
pathogenesis of lesions.
[0335] Demyelinating diseases of the central and peripheral nervous
systems, including Multiple Sclerosis; idiopathic demyelinating
polyneuropathy or Guillain-Barr syndrome; and Chronic Inflammatory
Demyelinating Polyneuropathy, are believed to have an autoimmune
basis and result in nerve demyelination as a result of damage
caused to oligodendrocytes or to myelin directly. In MS there is
evidence to suggest that disease induction and progression is
dependent on T lymphocytes. Multiple Sclerosis is a demyelinating
disease that is T lymphocyte-dependent and has either a
relapsing-remitting course or a chronic progressive course. The
etiology is unknown; however, viral infections, genetic
predisposition, environment, and autoimmunity all contribute.
Lesions contain infiltrates of predominantly T lymphocyte mediated,
microglial cells and infiltrating macrophages; CD4+T lymphocytes
are the predominant cell type at lesions. The mechanism of
oligodendrocyte cell death and subsequent demyelination is not
known but is likely T lymphocyte driven.
[0336] Inflammatory and Fibrotic Lung Disease, including
eosinophilic pneumonia, idiopathic pulmonary fibrosis and
hypersensitivity pneumonitis may involve a disregulated
immune-inflammatory response. Inhibition of that response would be
of therapeutic benefit.
[0337] Autoimmune or Immune-mediated Skin Disease including Bullous
Skin Diseases, Erythema Multiforme, and Contact Dermatitis are
mediated by auto-antibodies, the genesis of which is T
lymphocyte-dependent.
[0338] Psoriasis is a T lymphocyte-mediated inflammatory disease.
Lesions contain infiltrates of T lymphocytes, macrophages and
antigen processing cells, and some neutrophils.
[0339] Allergic diseases, including asthma; allergic rhinitis;
atopic dermatitis; food hypersensitivity; and urticaria are T
lymphocyte dependent. These diseases are predominantly mediated by
T lymphocyte induced inflammation, IgE mediated-inflammation or a
combination of both.
[0340] Transplantation associated diseases, including Graft
rejection and Graft-Versus-Host-Disease (GVHD) are T
lymphocyte-dependent; inhibition of T lymphocyte function is
ameliorative.
[0341] Patients suffering from other diseases may benefit from
enhancement of the immune and/or inflammatory response. Such
diseases include, but are not limited to viral infection (including
but not limited to AIDS, hepatitis A, B, C, D, E) bacterial
infection, fungal infections, and protozoan and parasitic
infections (molecules or derivatives/agonists which stimulate the
MLR can be utilized therapeutically to enhance the immune response
to infectious agents), diseases of immunodeficiency, including
inherited, acquired, infectious induced (as in HIV infection), or
iatrogenic (i.e. as from chemotherapy) immunodeficiency, and
neoplasia.
[0342] It has been demonstrated that some human cancer patients
develop an antibody and/or T lymphocyte response to antigens on
neoplastic cells. It has also been shown in animal models of
neoplasia that enhancement of the immune response can result in
rejection or regression of that particular neoplasm. Molecules that
affect the T lymphocyte response in the MLR have utility in vivo in
altering the immune response against neoplasia.
[0343] The inhibition of molecules with proinflammatory properties
may also have therapeutic benefit in reperfusion injury; stroke;
myocardial infarction; atherosclerosis; acute lung injury;
hemorrhagic shock; burn; sepsis/septic shock; acute tubular
necrosis; endometriosis; degenerative joint disease and
pancreatitis.
[0344] PRO301, PRO362 and PRO245 polypetides are active as
stimulators of the proliferation of stimulated T-lymphocytes
(Example 5). Thus, antagonists of PRO301, PRO362 and PRO245 would
be useful in treating immune related disorders, particularly
inflammatory disorders, such as by inhibiting the stimulatory
effect of PRO301, PRO362 and PRO245 polypeptides. On the other
hand, the PRO301, PRO362 and PRO245 polypeptides and agonists
thereof would be useful in treating disorders that benefit from
stimulation of an inflammatory response.
[0345] PRO1868 polypeptides of the invention induced
redifferentiation of chondrocytes (Example 19). Thus, PRO1868 and
agonists of PRO1868 may be used in the treatment of various bone
and/or cartilage related disorders.
[0346] The PRO301, PRO362, PRO245 and PRO1868 polypeptides,
antibodies and other compounds of the present invention are
administered to a mammal, preferably a human, in accord with known
methods, such as intravenous administration as a bolus or by
continuous infusion over a period of time, by intramuscular,
intraperitoneal, intracerebrospinal, subcutaneous, intra-articular,
intrasynovial, intrathecal, oral, topical, or inhalation
(intranasal, intrapulmonary) routes. Intravenous or inhaled
administration of polypeptides and antibodies is preferred.
[0347] In immunoadjuvant therapy, other therapeutic regimens, such
administration of an anti-cancer agent, may be combined with the
administration of the proteins, antibodies or compounds of the
instant invention. For example, the patient to be treated with the
immunoadjuvants of the invention may also receive an anti-cancer
agent (chemotherapeutic agent) or radiation therapy. Preparation
and dosing schedules for such chemotherapeutic agents may be used
according to manufacturers' instructions or as determined
empirically by the skilled practitioner. Preparation and dosing
schedules for such chemotherapy are also described in Chemotherapy
Service Ed., M. C. Perry, Williams & Wilkins, Baltimore, Md.
(1992). The chemotherapeutic agent may precede, or follow
administration of the immunoadjuvant or may be given simultaneously
therewith. Additionally, an anti-oestrogen compound such as
tamoxifen or an anti-progesterone such as onapristone (see, EP
616812) may be given in dosages known for such molecules.
[0348] It may be desirable to also administer antibodies against
other immune disease associated or tumor associated antigens, such
as, without limitation, antibodies which bind to CD20, CD11a, CD18,
ErbB2, EGFR, ErbB3, ErbB4, or vascular endothelial factor (VEGF).
Alternatively, or in addition, two or more antibodies binding the
same or two or more different antigens disclosed herein may be
coadministered to the patient. Sometimes, it may be beneficial to
also administer one or more cytokines to the patient. In one
embodiment, the polypeptides or other compounds of the invention
are coadministered with a growth inhibitory agent. For example, the
growth inhibitory agent may be administered first, followed by a
polypeptide or other compound of the invention. However,
simultaneous administration or administration first is also
contemplated. Suitable dosages for the growth inhibitory agent are
those presently used and may be lowered due to the combined action
(synergy) of the growth inhibitory agent and the polypeptide or
other compound of the invention.
[0349] For the treatment or reduction in the severity of immune
related disease, the appropriate dosage of an a compound of the
invention will depend on the type of disease to be treated, as
defined above, the severity and course of the disease, whether the
agent is administered for preventive or therapeutic purposes,
previous therapy, the patient's clinical history and response to
the compound, and the discretion of the attending physician. The
compound is suitably administered to the patient at one time or
over a series of treatments. Preferably, it is desirable to
determine the dose-response curve and the pharmaceutical
composition of the invention first in vitro, and then in useful
animal models prior to testing in humans.
[0350] For example, depending on the type and severity of the
disease, about 1 .mu.g/kg to 15 mg/kg (e.g. 0.1-20 mg/kg) of
polypeptide or antibody is an initial candidate dosage for
administration to the patient, whether, for example, by one or more
separate administrations, or by continuous infusion. A typical
daily dosage might range from about 1 .mu.g/kg to 100 mg/kg or
more, depending on the factors mentioned above. For repeated
administrations over several days or longer, depending on the
condition, the treatment is sustained until a desired suppression
of disease symptoms occurs. However, other dosage regimens may be
useful. The progress of this therapy is easily monitored by
conventional techniques and assays.
[0351] 15. Articles of Manufacture
[0352] In another embodiment of the invention, an article of
manufacture containing materials useful for the diagnosis or
treatment of the disorders described above is provided. The article
of manufacture comprises a container and a label. Suitable
containers include, for example, bottles, vials, syringes, and test
tubes. The containers may be formed from a variety of materials
such as glass or plastic. The container holds a composition, which
is effective for diagnosing or treating the condition, and may have
a sterile access port (for example the container may be an
intravenous solution bag or a vial having a stopper pierceable by a
hypodermic injection needle). The active agent in the composition
is usually a polypeptide or an antibody of the invention. The label
on, or associated with, the container indicates that the
composition is used for diagnosing or treating the condition of
choice, particularly an immune related condition. The article of
manufacture may further comprise a second container comprising a
pharmaceutically-acceptable buffer, such as phosphate-buffered
saline, Ringer's solution and dextrose solution. It may further
include other materials desirable from a commercial and user
standpoint, including other buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use.
[0353] 16. Diagnosis and Prognosis of Disease
[0354] Cell surface proteins, such as proteins, which are
overexpressed in certain immune related diseases, are excellent
targets for drug candidates or disease treatment. The same proteins
along with secreted proteins encoded by the genes amplified in
immune related disease states find additional use in the diagnosis
and prognosis of these diseases. For example, antibodies directed
against the protein products of genes amplified in multiple
sclerosis, rheumatoid arthritis, or another immune related disease,
can be used as diagnostics or prognostics. Such antibodies and a
carrier (e.g., a buffer) may be included in a diagnostic kit in
suitable packaging along with instructions for using the antibody
to detect the protein product.
[0355] PRO1868 polypeptides were significantly overexpressed in
various human tumor tissues (Example 20), for example lung and
breast tumors. Thus, PRO1868 antibodies may be used to diagnose
tumors in patients.
[0356] The expression of PRO362 polypeptides was found to be
significantly increased in tissues associated with neoplasia, as
well as inflammatory disease. The expression of PRO245 polypeptides
was also significantly increased in tissues with chronic
inflammatory diseases and neoplasms. Thus, PRO362 and PRO235
antibodies to diagnose inflammed tissues and neoplasms.
[0357] For example, antibodies, including antibody fragments, can
be used to qualitatively or quantitatively detect the expression of
proteins encoded by the overexpressed or highly expressed genes.
The antibody preferably is equipped with a detectable, e.g.,
fluorescent label, and binding can be monitored by light
microscopy, flow cytometry, fluorimetry, or other techniques known
in the art. These techniques are particularly suitable, if the
overexpressed gene encodes a cell surface protein. Such binding
assays are well known in the art and may be performed essentially
as described above.
[0358] In situ detection of antibody binding to the marker gene
products can be performed, for example, by immunofluorescence or
immunoelectron microscopy. For this purpose, a histological
specimen is removed from the patient, and a labeled antibody is
applied to it, preferably by overlaying the antibody on a
biological sample. This procedure also allows for determining the
distribution of the marker gene product in the tissue examined. It
will be apparent for those skilled in the art that a wide variety
of histological methods are readily available for in situ
detection.
[0359] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0360] All patent and literature references cited in the present
specification are hereby incorporated by reference in their
entirety.
EXAMPLES
[0361] Commercially available reagents referred to in the examples
were used according to manufacturer's instructions unless otherwise
indicated. The source of those cells identified in the following
examples, and throughout the specification, by ATCC accession
numbers is the American Type Culture Collection, 10801 University
Boulevard, Manassas, Va. 20110-2209.
Example 1
Isolation of cDNA Clones Encoding Human PRO301
[0362] The extracellular domain (ECD) sequences (including the
secretion signal sequence, if any) from about 950 known secreted
proteins from the Swiss-Prot public database were used to search
EST databases. The EST databases included public EST databases
(e.g., GenBank), a proprietary EST database (LIFESEQ.RTM., Incyte
Pharmaceuticals, Palo Alto, Calif.). The search was performed using
the computer program BLAST or BLAST2 [Altschul et al., Methods in
Enzymology, 266:460-480 (1996)] as a comparison of the ECD protein
sequences to a 6-frame translation of the EST sequences. Those
comparisons resulting in a BLAST score of 70 (or in some cases, 90)
or greater that did not encode known proteins were clustered and
assembled into consensus DNA sequences with the program "phrap"
(Phil Green, University of Washington, Seattle, Wash.).
[0363] A consensus DNA sequence encoding DNA35936 was assembled
using phrap. In some cases, the consensus DNA sequence was extended
using repeated cycles of blast and phrap to extend the consensus
sequence as far as possible using the three sources of EST
sequences listed above.
[0364] Based on this consensus sequence, oligonucleotides were
synthesized: 1) to identify by PCR a cDNA library that contained
the sequence of interest, and 2) for use as probes to isolate a
clone of the full-length coding sequence. Forward and reverse PCR
primers (notated as *.f and *.r, respectively) may range from 20 to
30 nucleotides (typically about 24), and are designed to give a PCR
product of 100-1000 bp in length. The probe sequences (notated as
*.p) are typically 40-55 bp (typically about 50) in length. In some
cases, additional oligonucleotides are synthesized when the
consensus sequence is greater than 1-1.5 kbp. In order to screen
several libraries for a source of a full-length clone, DNA from the
libraries was screened by PCR amplification, as per Ausubel et al.,
Current Protocols in Molecular Biology, with the PCR primer pair. A
positive library was then used to isolate clones encoding the gene
of interest by the in vivo cloning procedure suing the probe
oligonucleotide and one of the PCR primers.
[0365] In order to screen several libraries for a source of a
full-length clone, DNA from the libraries was screened by PCR
amplification with the PCR primer pair identified above. A positive
library was then used to isolate clones encoding the PR301 gene
using the probe oligonucleotide and one of the PCR primers.
[0366] RNA for construction of the cDNA libraries was isolated from
human fetal kidney. The cDNA libraries used to isolated the cDNA
clones were constructed by standard methods using commercially
available reagents (e.g., Invitrogen, San Diego, Calif.; Clontech,
etc.) The cDNA was primed with oligo dT containing a NotI site,
linked with blunt to SalI hemikinased adaptors, cleaved with NotI,
sized appropriately by gel electrophoresis, and cloned in a defined
orientation into a suitable cloning vector (such as pRKB or PRKD;
pRK5B is a precursor of pRK5D that does not contain the SfiI site;
see, Holmes et al., Science, 253:1278-1280 (1991)) in the unique
XhoI and NotI sites.
[0367] A cDNA clone was sequenced in its entirety. The full-length
nucleotide sequence of native sequence DNA40628 is shown in FIG. 5
(SEQ ID NO: 11). Clone DNA40628 contains a single open reading
frame with an apparent translational initiation site at nucleotide
positions 52-54 (FIG. 5; SEQ ID NO: 11). The predicted polypeptide
precursor is 299 amino acids long with a predicted molecular weight
of 32583 daltons and pI of 8.29. Clone DNA40628 has been deposited
with ATCC and is assigned ATCC deposit No. 209432.
[0368] Based on a BLAST and FastA sequence alignment analysis of
the full-length sequence, PRO301 encoded by DNA40628 shows amino
acid sequence identity to A33 antigen precursor (30%) and coxsackie
and adenovirus receptor protein (29%).
[0369] The oligonucleotide sequences used in the above procedure
were the following: TABLE-US-00001 OL12162 (35936.f1)(SEQ ID NO:
12) TCGCGGAGCTGTGTTCTGTTTCCC OL12163 (35936.p1)(SEQ ID NO: 13)
TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT OL12164
(35936.f2)(SEQ ID NO: 14) ACACCTGGTTCAAAGATGGG OL12165
(35936.r1)(SEQ ID NO: 15) TAGGAAGAGTTGCTGAAGGCACGG OL12166
(35936.f3)(SEQ ID NO: 16) TTGCCTTACTCAGGTGCTAC OL12167
(35936.r2)(SEQ ID NO: 17) ACTCAGCAGTGGTAGGAAAG
Example 2
Isolation of cDNA Clones Encoding Human PRO362
[0370] The extracellular domain (ECD) sequences (including the
secretion signal, if any) of about 950 known secreted proteins from
the Swiss-Prot public protein database were used to search
expressed sequences tag (EST) databases. The EST databases included
public EST databases (e.g., GenBank) and a proprietary EST DNA
database (LIFESEQ.RTM., Incyte Pharmaceuticals, Palo Alto, Calif.).
The search was performed using the computer program BLAST or
BLAST-2 (e.g., Altshul et al., Methods in Enzymology 266: 460-480
(1996)) as a comparison of the ECD protein sequences to a 6 frame
translation of the EST sequence. Those comparisons resulting in a
BLAST score 70 (or in some cases 90) or greater that did not encode
known proteins were clustered and assembled into consensus DNA
sequences with the program "phrap" (Phil Green, University of
Washington, Seattle, Wash.
[0371] A consensus DNA sequence was assembled relative to other EST
sequences using phrap. This consensus sequence is herein designated
DNA42257 (SEQ ID NO: 5) (see FIG. 4C). Based on the DNA42257 (SEQ
ID NO: 5) consensus sequence shown in FIG. 4C, oligonucleotides
were synthesized: 1) to identify by PCR a cDNA library that
contained the sequence of interest, and 2) for use as probes to
isolate a clone of the full-length coding sequence for PRO362.
Forward and reverse PCR primers generally range from 20 to 30
nucleotides and are often designed to give a PCR product of about
100-1000 bp in length. The probe sequences are typically 40-55 bp
in length. In some cases, additional oligonucleotides are
synthesized when the consensus sequence is greater than about 1-1.5
kbp. In order to screen several libraries for a full-length clone,
DNA from the libraries was screened by PCR amplification, as per
Ausubel et al., Current Protocols in Molecular Biology, with the
PCR primer pair. A positive library was then used to isolate clones
encoding the gene of interest using the probe oligonucleotide and
one of the primer pairs.
[0372] PCR primers (forward and reverse) were synthesized:
TABLE-US-00002 forward PCR primer 1 (42257.f1)
5'-TATCCCTCCAATTGAGCACCCTGG-3' (SEQ ID NO: 18) forward PCR primer 2
(42257.f2) 5'-GTCGGAAGACATCCCAACAAG-3' (SEQ ID NO: 19) reverse PCR
primer 1 (42257.r1) 5'-CTTCACAATGTCGCTGTGCTGCTC-3' (SEQ ID NO: 20)
reverse PCR primer 2 (42257.r2 5'-AGCCAAATCCAGCAGCTGGCTTAC-3' (SEQ
ID NO: 21)
[0373] Additionally, a synthetic oligonucleotide hybridization
probe was constructed from the consensus DNA42257 sequence which
had the following nucleotide sequence: TABLE-US-00003 Hybridization
probe (42257.p1) (SEQ ID NO: 22) 5'-
TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT- 3'.
[0374] In order to screen several libraries for a source of a
full-length clone, DNA from the libraries was screened by PCR
amplification with the PCR primer pairs identified above. A
positive library was then used to isolate clones encoding the
PRO362 gene using the probe oligonucleotide and one of the PCR
primers.
[0375] RNA for construction of the cDNA libraries was isolated from
human fetal brain tissue (LIB 153). The cDNA libraries used to
isolate the cDNA clones were constructed by standard methods using
commercially available reagents such as those from Invitrogen, San
Diego, Calif. The cDNA was primed with oligo dT containing a NotI
site linked with blunt to SalI hemikinased adaptors, cleaved with
NotI, sized appropriately be gel electrophoresis, and cloned in a
defined orientation into a suitable cloning vector (such as pRKB or
pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI
site; see Holmes et al., Science 253: 1278-1280 (1991)) in the
unique XhoI and NotI sites.
[0376] DNA sequencing of the clones isolated as described gave the
full-length DNA sequence for an isolated PRO362 (herein designated
as UNQ317 (DNA45416-1251)(SEQ ID NO: 7).
[0377] The entire nucleotide sequence of UNQ317
(DNA45416-.sup.1251) is shown in FIG. 6 (SEQ ID NO: 7). Clone
UNQ367 (DNA45416-1251) (SEQ ID NO: 7) contains a single open
reading frame with an apparent translational initiation site at
nucleotide positions 1082-1084 (FIG. 6, SEQ ID NO: 7). The
predicted polypeptide precursor is 321 amino acids long (FIG. 3,
SEQ ID NO: 2). The full-length PRO362 protein shown if FIG. 3 has
an estimated molecular weight of about 35,544 daltons and a pI of
about 8.51. Analysis of the full-length PRO362 polypeptide as shown
in FIG. 3 (SEQ ID NO: 2) evidences the presence of a
glycosaminoglycan attachment site at about amino acid 149 to about
amino acid 152 and a transmembrane domain from about amino acid 276
to about amino acid 306. Clone UNQ317 (t)NA45416-1251) has been
deposited with ATCC deposit No.: 209620.
Example 3
Isolation of cDNA Clones Encoding Human PRO245
[0378] The extracellular domain (ECD) sequences (including the
secretion signal, if any) of about 950 known secreted proteins from
the Swiss-Prot public protein database were used to search
expressed sequences tag (EST) databases. The EST databases included
public EST databases (e.g., GenBank) and a proprietary EST DNA
database (LIFESEQ.RTM., Incyte Pharmaceuticals, Palo Alto, Calif.).
The search was performed using the computer program BLAST or
BLAST-2 (e.g., Altshul et al., Methods in Enzymology 266: 460-480
(1996)) as a comparison of the ECD protein sequences to a 6 frame
translation of the EST sequence. Those comparisons resulting in a
BLAST score 70 (or in some cases 90) or greater that did not encode
known proteins were clustered and assembled into consensus DNA
sequences with the program "phrap" (Phil Green, University of
Washington, Seattle, Wash.
[0379] A consensus DNA sequence was assembled relative to other EST
sequences, wherein the consensus sequence is herein designated
DNA30954 (SEQ ID NO: 27). Based on the DNA30954 consensus sequence,
oligonucleotides were synthesized to identify by PCR a cDNA library
that contained the sequence of interest and for use as probes to
isolate a clone of the full-length coding sequence for PRO245.
[0380] A pair of PCR primers (forward and reverse) were
synthesized: TABLE-US-00004 forward PCR primer
5'-ATCGTTGTGAAGTTAGTGCCCC-3' (SEQ ID NO: 28) reverse PCR primer
5'-ACCTGCGATATCCAACAGAATTG-3' (SEQ ID NO: 29)
[0381] Forward and reverse PCR primers generally range from 20 to
30 nucleotides and are often designed to give a PCR product of
about 100-1000 bp in length. The probe sequences are typically
40-55 bp in length. In some cases, additional oligonucleotides are
synthesized when the consensus sequence is greater than about 1-1.5
kbp. In order to screen several libraries for a full-length clone,
DNA from the libraries was screened by PCR amplification, as per
Ausubel et al., Current Protocols in Molecular Biology, with the
PCR primer pair.
[0382] Additionally, a synthetic oligonucleotide hybridization
probes was constructed from the consensus DNA30954 sequences which
had the following nucleotide sequence: TABLE-US-00005 hybridization
probe: (SEQ ID NO: 30) 5'-
GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC- 3'.
[0383] In order to screen several libraries for a source of a
full-length clone, DNA form the libraries was screened by PCR
amplification with the PCR primer pair identified above. A positive
library was then used to isolated clones encoding the PRO245 gene
using the probe oligonucleotide and one of the PCR primers.
[0384] RNA for construction of the cDNA libraries was isolated from
human fetal liver tissue. The cDNA libraries used to isolate the
cDNA clones were constructed by standard methods using commercially
available reagents such as those from Invitrogen, San Diego, Calif.
The cDNA was primed with oligo dT containing a NotI site, linked
with blunt to SalI hemikinased adaptors, cleaved with NotI, sized
appropriately by gel electrophoresis, and cloned in a defined
orientation into a suitable cloning vector (such as pRKB or pRKD;
pRK5B is a precursor of pRK5D that does not contain the SfiI site;
see Holmes et al., Science 253: 1278-1280 (1991)) in the unique
XhoI and NotI sites.
[0385] DNA sequencing of the clones isolated as described above
gave the full-length DNA sequence for a native sequence PRO245
[herein designated as UNQ219 (DNA35638)(SEQ ID NO: 8)] and the
derived protein sequence (SEQ ID NO: 9).
[0386] The entire nucleotide sequence of UNQ219 (DNA35638) is shown
in FIG. 7 (SEQ ID NO: 8). Clone UNQ219 (DNA35638)(SEQ ID NO: 8)
contains a single open reading frame with an apparent translational
initiation site at nucleotide positions 89-91 (Kozak et al., supra)
and ending at the stop codon at nucleotide positions 1025-1027
(FIG. 7, SEQ ID NO: 8). The predicted polypeptide precursor is 312
amino acids long (FIG. 11)(SEQ ID NO: 9). Clone UNQ219 (DNA35638)
has been deposited with the ATCC on Sep. 17, 1997 and is assigned
ATCC deposit No. 209265.
Example 4
Inhibition of VEGF Stimulated Proliferation of Endothelial Cell
Growth
[0387] Bovine adrenal cortical capillary endothelial (ACE) cells
(from primary culture, maximum 12-14 passages) were plated on
96-well microtiter plates (Amersham Life Science) at a density of
500 cells/well per 100 .mu.L in low glucose DMEM, 10% calf serum, 2
mM glutamine, 1.times.pen/strep and fungizone, supplemented with 3
ng/mL VEGF. Controls were plated the same way but some did not
include VEGF. A test sample of the PRO301 and PRO245 polypeptide
was added in a 100 .mu.l volume for a 200 mcL final volume. Cells
were incubated for 6-7 days at 37.degree. C. The media was
aspirated and the cells washed 1.times. with PBS. An acid
phosphatase reaction mixture (100 .mu.L, 0.1M sodium acetate, pH
5.5, 0.1% Triton-100, 10 mM p-nitrophenyl phosphate) was added.
After incubation for 2 hours at 37.degree. C., the reaction was
stopped by addition of 10 mcL 1N NaOH. OD was measured on
microtiter plate reader at 405 nm. Controls were no cells, cells
alone, cells+FGF (5 ng/mL), cells+VEGF (3 ng/mL), cells+VEGF (3
ng/ml)+TGF-.beta. (1 ng/ml), and cells+VEGF (3 ng/mL)+LIF (5
ng/mL). (TGF-.beta. at a 1 ng/ml concentration is known to block
70-90% of VEGF stimulated cell proliferation.)
[0388] The results were assessed by calculating the percentage
inhibition of VEGF (3 ng/ml) stimulated cells proliferation,
determined by measuring acid phosphatase activity at OD.sub.405 nm,
(1) relative to cells without stimulation, and (2) relative to the
reference TGF-.beta. inhibition of VEGF stimulated activity. The
results, shown in Table 1, are indicative of the utility of the
PRO301 and PRO245 polypeptide in the inhibition of cell growth,
especially cancer therapy and specifically in inhibiting tumor
angiogenesis. TABLE-US-00006 TABLE 1 % Proliferation relative to
Compound Tested Concentration control DNA40628 protein (SEQ ID NO:
1) 7.0 nM 1.02 DNA40628 protein (SEQ ID NO: 1) 70.0 nM 0.88
DNA40628 protein (SEQ ID NO: 1) 700.0 nM 0.44 DNA40628 protein (SEQ
ID NO: 1) 0.01% 0.92 DNA40628 protein (SEQ ID NO: 1) 0.1% 0.85
DNA40628 protein (SEQ ID NO: 1) 1.0% 0.68 DNA35638 protein (SEQ ID
NO: 9) 0.01% 0.76 DNA35638 protein (SEQ ID NO: 9) 0.1% 0.35
DNA35638 protein (SEQ ID NO: 9) 1.0% 0.11 DNA35638 protein (SEQ ID
NO: 9) 0.48 nM 1.03 DNA35638 protein (SEQ ID NO: 9) 4.8 nM 0.95
DNA35638 protein (SEQ ID NO: 9) 48.0 nM 0.49
Example 5
Stimulatory Activity in Mixed Lymphocyte Reaction (MLR) Assay
[0389] The following describes assays for determining whether
PRO301, PRO362, PRO245 and PRO1868 polypeptides are able to
stimulate proliferation of stimulated T-lymphocytes. Compounds
which stimulate proliferation of lymphocytes are useful
therapeutically where enhancement of an inflammatory response is
beneficial, for example enhancement of the immune response against
neoplasia. Antagonists to such compounds that stimulate
proliferation of lymphocytes are useful therapeutically where a
reduction in the inflammatory response is beneficial. A therapeutic
agent may take the form of an agonist or an antagonist of the
polypeptide of the invention, for example, murine-human chimeric,
humanized or human antibodies against the polypeptide.
[0390] The basic protocol for this assay is described in Current
Protocol in Immunology, Unit 3.12, J. E. Coligan, A. M. Kruisbeek,
D H Marglies, E M Shevach and W Strober, Eds, National Institute of
Health, Published by John Wiley & Sons, Inc.
[0391] More specifically, in one assay variant, peripheral blood
mononuclear cells (PBMC) are isolated from mammalian individuals,
for example a human volunteer, by leukopheresis (one donor will
supply stimulatory PBMCs, the other donor will supply responder
PBMCs). If desired, the cells are frozen in fetal bovine serum and
DMSO after isolation. Frozen cells may be thawed overnight in assay
media (37.degree. C., 5% CO.sub.2) and then washed and resuspended
to 3.times.10.sup.6 cells/ml of assay media (RPMI; 10% fetal bovine
serum, 1% penicillin/streptomycin, 1% glutamine, 1% HEPES, 1%
non-essential amino acids, 1% pyruvate).
[0392] The stimulator PBMCs are prepared by irradiating the cells
(about 3000 Rads). The assay is prepared by plating in triplicate
wells a mixture of: 100 .mu.l of test sample diluted to 1% or 0.1%;
50 .mu.l of irradiated stimulator cells and 50 .mu.l of responder
PBMC cells. 100 .mu.L of cell culture media or 100 ml of CD4-IgG is
used as the control. The wells are then incubated at 37.degree. C.,
5% CO.sub.2 for 4 days. On day 5, each well is pulsed with
tritiated thymidine (1.0 mC/well; Amersham). The cells are washed 3
times and then the uptake of the label is evaluated.
[0393] PRO301, PRO362 and PRO245 polypeptides were tested in
another variant of the assay. In this variant assay, PBMC's were
isolated from the spleens of BALB/c mice and C57B6 mice. The cells
were teased from freshly harvested spleens in assay media (RPMI;
10% fetal bovine serum, 1% penicillin/streptomycin, 1% glutamine,
1% HEPES, 1% non-essential amino acids, 1% pyruvate) and the PBMCs
were isolated by overlaying these cells over Lympholyte M (Organon
Teknika), centrifuging at 2000 rpm for 20 minutes, collecting and
washing the mononuclear cell layer in assay media and resuspending
the cells to 1.times.10.sup.7 cells/ml of assay media. The assay
was then conducted as described above.
[0394] The results, shown below in Table 2, indicate that the
PRO301, PRO362 and PRO245 polypeptides of the invention are active
as stimulators of the proliferation of stimulated T-lymphocytes.
Positive increases over control are considered positive with
increases of greater than or equal to 180% being preferred.
However, any value greater than control indicates a stimulatory
effect for the test protein. TABLE-US-00007 TABLE 2 Percent
Increase Compound Concentration over Control DNA40628 protein (SEQ
ID NO: 1) 0.1% 181.7 DNA40628 protein (SEQ ID NO: 1) 1.0% 187.3
DNA40628 protein (SEQ ID NO: 1) 0.1% 193.4 DNA40628 protein (SEQ ID
NO: 1) 1.0% 204.1 DNA45416 protein (SEQ ID NO: 2) 0.1% 87.4
DNA45416 protein (SEQ ID NO: 2) 1.0% 180.2 DNA35638 protein (SEQ ID
NO: 9) 0.1% 189.7 DNA35638 protein (SEQ ID NO: 9) 0.1% 193.7
DNA35638 protein (SEQ ID NO: 9) 1.0% 212.5 DNA35638 protein (SEQ ID
NO: 9) 1.0% 300.5
Example 6
Inflammatory Cell Infiltrates into Guinea Pig Skin
[0395] The following example shows that the polypeptides of the
invention are proinflammatory in that they stimulate inflammatory
cell infiltrates (i.e., neutrophilic, eosinophilic, monocytic or
lymphocytic) into guinea pig skin. The assay described herein
monitors the capacity of each protein to induce an inflammatory
cell infiltrate into the skin of a guinea pig. Compounds which
stimulate inflammatory infiltration are useful therapeutically
where enhancement of an inflammatory response is beneficial.
Compounds which inhibit proliferation of lymphocytes are useful
therapeutically where suppression of an inflammatory response is
beneficial. A therapeutic agent may take the form of antagonists of
the polypeptides of the invention, for example, murine-human
chimeric, humanized or human antibodies against the
polypeptide.
[0396] Hairless guinea pigs (Charles River Labs) weighing 350 grams
or more were anesthetized with ketamine (75-80 mg/kg body weight)
and xylazine (5 mg/kg body weight) intramuscularly. The protein
samples of PRO301, PRO362 and PRO245 and control proteins were
injected intradermally into the backs of each animal at a volume of
100 .mu.l per injection site. There were approximately 16-24
injection sites per animal. One mL of Evans blue dye (1% in
physiological buffered saline) was injected intracardially. The
animals were euthanized after 6 hours and each skin injection site
was biopsied and fixed in formalin. The skins were prepared for
histopathological evaluation. Each site was evaluated for
inflammatory cell infiltration into the skin. Sites with visible
inflammatory cells were scored as positive. Samples inducing an
inflammatory cell infiltrate were scored as proinflammatory
substances. TABLE-US-00008 TABLE 3 Compound Proinflammatory
activity DNA40628 protein (SEQ ID NO: 1) + DNA45416 protein (SEQ ID
NO: 2) + DNA35638 protein (SEQ ID NO: 9) + Negative control - Based
on these results PRO1868 (SEQ ID NO: 31) also likely has
proinflammatory activity.
Example 7
Interaction with Human Neutrophils
[0397] The following example shows the ability of the polypeptides
of the invention to bind to human neutrophils, a molecule
associated with inflammation and the inflammatory response.
[0398] Neutrophils isolated from the blood of human donors (PMN) as
described in Scan. J. Clin. Lab Invest. Suppl. 97: 51-76 (1968),
were incubated with an Ig-fusion of protein encoded by DNA40628
(prepared as discussed in the following examples) or a negative
control humanized antibody.
[0399] The PMNs were resuspended in a microfuge tube in PBS at a
density of 2.times.10.sup.6 cell equivalents per condition. The
cells were washed twice with ice cold PBS and pelleted at
400.times.g between washes. The PMN cells were blocked with 0.5%
BSA in PBS (blocking reagent) at 4.degree. C. for 1 hour. After the
incubation, the cells were further washed two additional times with
blocking reagent. The PMNs were pelleted after the final wash and
resuspended in 1 ml of blocking buffer at 0.1 .mu.g/ml in both
DNA40628 protein and control antibody. The incubation was carried
out for 2 hours at 4.degree. C. The PMN cells were gently
resuspended every 15 minutes on ice, then washed and pelleted 5
times in blocking buffer, with each wash lasting 5 minutes at
4.degree. C. and pelleting occurring at 400.times.g. A 1:1000
dilution of goat and anti-human IgG Fc specific-alkaline
phosphatase-conjugated in the blocking buffer was then applied to
the PMN cells. The PMN cells were incubated for 1 hour at 4.degree.
C., with gently mixing every 15 minutes on ice. The PMN cells were
then washed 5 times with blocking buffer, resuspended in the
appropriate substrate for alkaline phosphatase and distributed in 4
equi-100 .mu.l aliquots onto a microtiter plate. Color development
was read at O.D. 405. The results are shown in FIG. 21.
Example 8
Dot Blot Tissue Hybridization
[0400] A human RNA master blot (Clontech) was hybridized overnight
at 65.degree. C. in EXPRESSHYB.RTM. buffer (Clontech) per the
manufacturer's instructions with 100 nM of psoralen-biotin labeled
DNA40628 cDNA probe (SEQ ID NO: 7). Streptavidin-alkaline
phosphatase was used to detect the biotinylated probe. The blot was
developed with CDP-star substrate (Ambion) and exposed for various
times on Biomax film (Kodak). A cDNA hybridization analysis of
human tissues show that DNA40628 mRNA is expressed in a wide range
of tissues, but not in the cerebellum and spinal cord (FIG. 19).
DNA40628 mRNA is highly expressed in the colon, prostate, stomach,
ovary, salivary gland, kidney, lung, trachea and placenta.
Example 9
Gene Product Overexpression
[0401] This example shows that genes encoding the various proteins
indicated in FIG. 20 are overexpressed in colitic colon of
CRF2-4-/- "knock out" mice. Therapeutic agents may take the form of
antagonists of the indicated gene products, for example,
murine-human chimeric, humanized or human antibodies
thereagainst.
[0402] CRF 2-4 -/- mice (Spencer et al., J. Exp. Med. 187, 571-578
(1998)), are IL-10 receptor knockout animals that have a subunit of
the gene encoding the IL-10 receptor removed. The mice are
unresponsive to the downregulatory functions of IL-10 for
macrophage activation, and cannot downregulate response to
lipopolysaccharide triggering of macrophage TNF-.alpha. secretion.
They develop a chronic colitis which can lead to colonic
adenocarcinoma. The spontaneous colitis is mediated by lymphocytes,
monocytes and neutrophils. IL-10 suppresses the inflammatory
response by modulating expression of certain inflammatory
cytokines.
[0403] The probes for the proteins indicated in FIG. 20 were
created from mRNA templates for the indicated gene products and
used in the 5'-nuclease assay (e.g., TAQMAN.TM.) and real-time
quantitative PCR (e.g., ABI PRIZM 7700 SEQUENCE DETECTION
SYSTEM.TM. (Perkin-Elmer, Applied Biosystems Division, Foster City,
Calif.). The results are reported in delta CT units. One unit
corresponds to 1 PCR cycle or approximately a 2-fold amplification
relative to normal, two units correspond to 4-fold, 3 units to
8-fold, etc. Quantitation was obtained using primers and a
TAQMAN.TM. fluorescent tagged-mRNA derived from the tested
inflammatory-related gene products indicated in FIG. 20. Regions of
the indicated gene products which are most likely to contain unique
nucleic acid sequences and which are least likely to have spliced
out introns are preferred for the primer derivation, e.g.,
3'-untranslated region.
[0404] The 5'-nuclease assay reaction is a fluorescent PCR-based
technique which makes use of the 5'-exonuclease activity of Taq DNA
polymerase enzyme to monitor amplification in real time. Two
oligonucleotide primers are used to generate an amplicon typical of
a PCR reaction. A third oligonucleotide, or probe, is designed to
detect nucleotide sequence located between the two PCR primers. The
probe is non-extendible by Taq DNA polymerase enzyme, and is
labeled with a reported fluorescent dye and a quencher fluorescent
dye. Any laser-induced emission from the reporter dye is quenched
by the quenching dye when the two dyes are located close together
as they are on the probe. During the amplification reaction, the
probe is cleaved by the Taq DNA polymerase enzyme in a
template-dependent manner. The resultant probe fragments
disassociate in solution, and the signal from the release reporter
dye is free from the quenching effect of the second fluorophore.
One molecule of reporter dye is liberated for each new molecule
synthesized, and detection of the unquenched reporter dye provided
the basis for quantitative interpretation of the data.
[0405] The 5'-nuclease procedure is run on a real-time quantitative
PCR device such as the ABI Prism 7700.TM. Sequence Detection. The
system consists of a thermocycler, laser, charge-coupled device
(CCD) camera and computer. The system amplifies samples in a
96-well format on a thermocycler. During amplification,
laser-induced fluorescent signal is collected in real-time through
fiber optics cables for all 96 wells, and detected at the CCD. The
system includes software for running the instrument and for
analyzing the data.
[0406] The 5'-nuclease assay data are initially expressed as Ct, or
the threshold cycle. This is defined as the cycle at which the
reporter signal accumulates above the background level of
fluorescence. The Ct values are used as quantitative measurement of
the relative number of starting copies of a particular target
sequence in a nucleic acid sample.
[0407] The results of the mRNA amplification are shown in FIG. 20.
Expression in wild-type animals were compared with CRF2-4 -/- KO
animals with beta-actin as the reference standard. Four animals
were measured in each group. All four KO animals were diagnosed
with colitis and in addition, three of these had colon
adenocarcinoma.
[0408] FIG. 20 shows that JAM mRNA is increased 3.3-fold in the
colon of CRF2-4 -/- mice with colitis.
[0409] As a result, it is likely that PRO301, PRO362, PRO245 and
PRO1868 would also have elevated expression in inflammatory human
disease, such as inflammatory bowel disease and other inflammatory
diseases of the gut.
Example 10
Induction of Endothelial Cell Apoptosis
[0410] The ability of the polypeptides of the invention to induce
apoptosis in endothelial cells was tested in human venous umbilical
vein endothelial cells (HUVEC, Cell Systems). The first day, the
cells were plated on 96-well microtiter plates (Amersham Life
Sciences, cytostar-T scintillating microplate, RPNQ160, sterile,
tissue-culture treated, individually wrapped), in 10% serum
(CSG-medium, Cell Systems), at a density of 2.times.10.sup.4 cells
per well in a total volume of 100 .mu.l. The second day, PRO301 and
PRO245 polypeptide encoded by DNA40628 and DNA35638, respectively,
was added in triplicate at dilutions of 1%, 0.33% and 0.11%. On the
third day, the ability of the PRO301 and PRO245 polypeptides to
induce apoptosis was determined using a commercially available kit,
Apoptosis Detection Kit (R&D Systems, Minnesota) in which
annexin V, a member of the calcium and phospholipid binding
proteins, is used to detect apoptosis, following the protocol
recommended by the manufacturer. Fluroescein-labeled annexin V and
propidium iodide were added to the cells. Analysis was performed
with cytometers equipped with a single laser emitting excitation
light at 488 nm. In this test, live cells will not stain with
either fluorochrome, necrotic cells will stain with both
fluorochromes, and cells undergoing apoptosis will stain only with
the annexin V-FITC reagent. The annexin V-FITC generated signal was
detected in the FITC signal detector. The results are indicated in
the Table 4 below. TABLE-US-00009 TABLE 4 Compound tested % over
fluorescence Concentration background DNA40628 protein (SEQ ID NO:
1) 0.11% 115.8 DNA40628 protein (SEQ ID NO: 1) 0.33% 199.3 DNA40628
protein (SEQ ID NO: 1) 1.0% 335.6 DNA35638 protein (SEQ ID NO: 9)
0.11% 77.6 DNA35638 protein (SEQ ID NO: 9) 0.33% 143.7 DNA35638
protein (SEQ ID NO: 9) 1.0% 146.0 DNA35638 protein (SEQ ID NO: 9)
6.82 nM 67.2 DNA35638 protein (SEQ ID NO: 9) 20.46 nM 102.6
DNA35638 protein (SEQ ID NO: 9) 62.0 nM 118.8
[0411] The ability of the protein compounds of the invention to
induce endothelial cell apoptosis, particularly in combination with
the disruption of cell junction formation as indicated in Example 4
is indicative that the compounds play roles in cell adhesion and
transmigration. Similar to murine JAM, the compounds are likely
cell junction molecules in epithelia and endothelia, which explains
their broad tissue distribution. The induction of endothelial cell
apoptosis indicates a role in cell growth and apoptosis.
Example 11
In Vitro Antitumor Assay
[0412] The antiproliferative activity of the PRO301 and PRO362
polypeptides of the invention was determined in the
investigational, disease-oriented in vitro anti-cancer drug
discovery assay of the National Cancer Institute (NCI), using
sulforhodamine B (SRB) dye binding assay essentially as described
by Skehan et al., J. Natl. Cancer Inst. 82: 1107-1112 (1990). The
60 tumor cell lines employed in this study ("the NCI panel") as
well as conditions for their maintenance and culture in vitro have
been described by Monks et al., J. Natl. Cancer Inst. 83: 757-766
(1991). The purpose of this screen is to initially evaluate the
cytotoxic and/or cytostatic activity of the test compounds against
different types of tumors (Monks et al., supra, Boyd, Cancer:
Princ. Pract. Oncol. Update 3(10): 1-12 (1989)).
[0413] Cells from the approximately 60 human tumor cell lines were
harvested with trypsin/EDTA (Gibco), washed once, resuspended in
IMEM and their viability was determined. The cell suspensions were
added by pipet (100 .mu.L volume) into separate 96-well microtiter
plates. The cell density for the 6-day incubation was less than for
the 2-day incubation to prevent overgrowth. Inoculates were allowed
a preincubation period of 24 hours at 37.degree. C. for
stabilization. Dilutions at twice the intended test concentration
were added at time zero in 100 ml aliquots to the microtiter plates
wells (1:2 dilution). Test compounds were evaluated at given
half-log dilutions (1000 to 100,000 fold). Incubations took place
for two days and six days in a 5% CO.sub.2 atmosphere and 100%
humidity.
[0414] After incubation, the medium was removed and the cells were
fixed in 0.1 ml of 10% trichloroacetic acid at 40.degree. C. The
plates were rinsed five times with deionized water, dried, stained
for 30 minutes with 0.1 ml of 0.4% sulforhodamine B dye (Sigma)
dissolved in 1% acetic acid, rinsed four times with 1% acetic acid
to remove unbound dye, dried, and the stain was extracted for five
minutes with 0.1 ml of 10 mM Tris base
[tris(hydroxymethyl)aminomethane], pH 10.5. The absorbance (OD) of
sulforhodamine B at 492 nm was measured using a
computer-interfaced, 96-well microtiter plate reader.
[0415] A test sample was considered positive if it showed at least
50% growth inhibitory effect at one or more concentrations. The
positive results are shown in the following table, where the
abbreviations are as follows:
NSCL=non-small lung carcinoma
CNS=central nervous system
[0416] Leuk=leukemia TABLE-US-00010 TABLE 5 Length Concen- of Tumor
cell line Test compound tration assay Type Designation DNA40628
0.075 nM 6 Colon HCC-2998 protein Melanoma M14 (SEQ ID NO: 1)
DNA40638 700 nM 6 Melanoma M14 protein (SEQ ID NO: 1) DNA40628 152
nM 6 Colon SR protein Melanoma LOX IMVI (SEQ ID NO: 1) DNA40628
15.2 nM 6 Melanoma LOX IMVI protein (SEQ ID NO: 1) DNA40628 0.85 nM
6 NSCL HOP62 protein Ovarian OVCAR-3 (SEQ ID NO: 1) Prostate PC3
DNA45416 15 nM 2 Ovarian SK-OV-3 protein (SEQ ID NO: 2) DNA45416 15
nM 6 NSCL NCI-H322M protein Prostate PC-3 (SEQ ID NO: 2) DNA45416
4.7 nM 6 Melanoma LOX IMVI protein (SEQ ID NO: 2) DNA45416 47 nM 6
NSCL NCI-H322M protein Colon Colo 205 (SEQ ID NO: 2) DNA45416 152
nM 2 CNS SR-295 protein Breast T047D (SEQ ID NO: 2) DNA45416 152 nM
6 Leuk SR, HL-60 (TB), protein MOLT-4, K-562 (SEQ ID NO: 2) NSCL
NCI-H23, EKVX Colon HCC-2998 CNS U251 Melanoma UACC-62, UACC-257,
LOX IMVI DNA35638 0.35 nM 2 NSCL HOP92 protein Ovarian OVCAR-4 (SEQ
ID NO: 9) DNA35638 0.35 nM 2 Leuk SR protein (SEQ ID NO: 9)
DNA35638 0.35 nM 6 Colon HCC-2998 protein (SEQ ID NO: 9) DNA35638
3.5 nM 6 Leuk SR protein Colon SW-620 (SEQ ID NO: 9) DNA35638 6.2
nM 6 Colon HCT-116 protein (SEQ ID NO: 9) DNA35638 6.2 nM 6 Leuk
RPMI-8226 protein (SEQ ID NO: 9)
Example 12
Use of PRO301, PRO362, PRO245 or PRO1868 as a Hybridization
Probe
[0417] The following method describes use of a nucleotide sequence
encoding a PRO301, PRO362, PRO245 or PRO1868 as a hybridization
probe.
[0418] DNA comprising the coding sequence of native sequence
PRO301, PRO362, PRO245 or PRO1868 (as shown in FIGS. 5-7 and 61,
SEQ ID NO: 11, 7, 8 and 31), respectively, is employed as a probe
to screen for homologous DNAs (such as those encoding
naturally-occurring variants of PRO301, PRO362, PRO245 or PRO1868,
respectively) in human tissue cDNA libraries or human tissue
genomic libraries.
[0419] Hybridization and washing of filters containing either cDNA
or genomic library DNAs is performed under the following high
stringency conditions. Hybridization of radiolabeled PRO301-,
PRO362-, PRO245 or PRO1868-derived probe to the filters is
performed in a solution of 50% formamide, 5.times.SSC, 0.1% SDS,
0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2.times.
Denhardt's solution, and 10% dextran sulfate at 42.degree. C. for
20 hours. Washing of the filters is performed in an aqueous
solution of 0.1.times.SSC and 0.1% SDS at 42.degree. C.
[0420] DNAs having a desired sequence identity with the DNA
encoding a full-length native sequence PRO301, PRO362, PRO245 or
PRO1868 are then identified using standard techniques known in the
art.
Example 13
Expression of PRO301, PRO362. PRO245 or PRO1868 in E. coli
[0421] This example illustrates preparation of an unglycosylated
form of PRO301, PRO362, PRO245 or PRO1868 by recombinant expression
in E. coli.
[0422] The DNA sequence encoding PRO301, PRO362, PRO245 or PRO1868
is initially amplified using selected PCR primers. The primers
should contain restriction enzyme sites which correspond to the
restriction enzyme sites on the selected expression vector. A
variety of expression vectors may be employed. An example of a
suitable vector is pBR322 (derived from E. coli; see Bolivar et
al., Gene, 2:95 (1977)) which contains genes for ampicillin and
tetracycline resistance. The vector is digested with restriction
enzyme and dephosphorylated. The PCR amplified sequences are then
ligated into the vector. The vector will preferably include
sequences which encode for an antibiotic resistance gene, a trp
promoter, a polyhis leader (including the first six STII codons,
polyhis sequence, and enterokinase cleavage site), the PRO301,
PRO362, PRO245 or PRO1868 coding region, lambda transcriptional
terminator, and an argU gene.
[0423] The ligation mixture is then used to transform a selected E.
coli strain using the methods described in Sambrook et al., supra.
Transformants are identified by their ability to grow on LB plates
and antibiotic resistant colonies are then selected. Plasmid DNA
can be isolated and confirmed by restriction analysis and DNA
sequencing.
[0424] Selected clones are grown overnight in liquid culture medium
such as LB broth supplemented with antibiotics. The overnight
culture is subsequently be used to inoculate a larger scale
culture. The cells are then grown to a desired optical density,
during which the expression promoter is turned on.
[0425] After culturing the cells for several more hours, the cells
are harvested by centrifugation. The cell pellet obtained by the
centrifugation can be solubilized using various agents known in the
art, and the solubilized PRO301, PRO362, PRO245 or PRO1868 protein
is purified, for example by using a metal chelating column under
conditions that allow tight binding of the protein.
[0426] PRO301 was expressed in E. coli in a poly-His tagged form,
using the following procedure. The DNA encoding PRO301 was
initially amplified using selected PCR primers. The primers
contained restriction enzyme sites which correspond to the
restriction enzyme sites on the selected expression vector, and
other useful sequences providing for efficient and reliable
translation initiation, rapid purification on a metal chelation
column, and proteolytic removal with enterokinase. The
PCR-amplified, poly-His tagged sequences were then ligated into an
expression vector, which was used to transform an E. coli host
based on strain 52 (W3110 fuhA(tonA) Ion galE rpoHts(htpRts)
clpP(lacIq). Transformants were first grown in LB containing 50
mg/ml carbenicillin at 30.degree. C. with shaking until an O.D.600
of 3-5 was reached. Cultures were then diluted 50-100 fold into
CRAP media (prepared by mixing 3.57 g (NH.sub.4).sub.2SO.sub.4,
0.71 g sodium citrateA2H2O, 1.07 g KCl, 5.36 g Difco yeast extract,
5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS,
pH 7.3, 0.55% (w/v) glucose and 7 mM MgSO.sub.4) and grown for
approximately 20-30 hours at 30.degree. C. with shaking. Samples
were removed to verify expression by SDS-PAGE analysis, and the
bulk culture is centrifuged to pellet the cells. Cell pellets were
frozen until purification and refolding.
[0427] E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets)
was resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris,
pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added
to make final concentrations of 0.1M and 0.02 M, respectively, and
the solution was stirred overnight at 4.degree. C. This step
results in a denatured protein with all cysteine residues blocked
by sulfitolization. The solution was centrifuged at 40,000 rpm in a
Beckman Ultracentrifuge for 30 min. The supernatant was diluted
with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20
mM Tris, pH 7.4) and filtered through 0.22 micron filters to
clarify. Depending the clarified extract was loaded onto a 5 ml
Qiagen Ni-NTA metal chelate column equilibrated in the metal
chelate column buffer. The column was washed with additional buffer
containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The
protein was eluted with buffer containing 250 mM imidazole.
Fractions containing the desired protein were pooled and stored at
4.degree. C. Protein concentration was estimated by its absorbance
at 280 nm using the calculated extinction coefficient based on its
amino acid sequence.
[0428] The protein was refolded by diluting sample slowly into
freshly prepared refolding buffer consisting of: 20 mM Tris, pH
8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM
EDTA. Refolding volumes were chosen so that the final protein
concentration was between 50 to 100 micrograms/ml. The refolding
solution was stirred gently at 4.degree. C. for 12-36 hours. The
refolding reaction was quenched by the addition of TFA to a final
concentration of 0.4% (pH of approximately 3). Before further
purification of the protein, the solution was filtered through a
0.22 micron filter and acetonitrile was added to 2-10% final
concentration. The refolded protein was chromatographed on a Poros
R1/H reversed phase column using a mobile buffer of 0.1% TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of
fractions with A280 absorbance were analyzed on SDS polyacrylamide
gels and fractions containing homogeneous refolded protein were
pooled. Generally, the properly refolded species of most proteins
are eluted at the lowest concentrations of acetonitrile since those
species are the most compact with their hydrophobic interiors
shielded from interaction with the reversed phase resin. Aggregated
species are usually eluted at higher acetonitrile concentrations.
In addition to resolving misfolded forms of proteins from the
desired form, the reversed phase step also removes endotoxin from
the samples.
[0429] Fractions containing the desired folded PRO301 protein,
respectively, were pooled and the acetonitrile removed using a
gentle stream of nitrogen directed at the solution. Proteins were
formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and
4% mannitol by dialysis or by gel filtration using G25 Superfine
(Pharmacia) resins equilibrated in the formulation buffer and
sterile filtered.
Example 14
Expression of PRO301, PRO362, PRO245 or PRO1868 in Mammalian
Cells
[0430] This example illustrates preparation of a glycosylated form
of a PRO301, PRO362, PRO245 or PRO1868 by recombinant expression in
mammalian cells.
[0431] The vector, pRK5 (see EP 307,247, published Mar. 15, 1989),
is employed as the expression vector. Optionally, the PRO301,
PRO362, PRO245 or PRO186 DNA is ligated into pRK5 with selected
restriction enzymes to allow insertion of the PRO301, PRO362,
PRO245 or PRO1868 DNA using ligation methods such as described in
Sambrook et al., supra. The resulting vector is called pRK5-PRO301,
pRK5-PRO362, pRK5-PRO245 or pRK5-PRO1868, respectively.
[0432] In one embodiment, the selected host cells may be 293 cells.
Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue
culture plates in medium such as DMEM supplemented with fetal calf
serum and optionally, nutrient components and/or antibiotics. About
10 .mu.g pRK5-PRO301; pRK5-PRO362, pRK5-PRO245 DNA or pRK5-PRO1868
is mixed with about 1 .mu.g DNA encoding the VA RNA gene
[Thimmappaya et al., Cell, 31:543 (1982)] and dissolved in 500
.mu.l of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl.sub.2. To this
mixture is added, dropwise, 500 .mu.l of 50 mM HEPES (pH 7.35), 280
mM NaCl, 1.5 mM NaPO.sub.4, and a precipitate is allowed to form
for 10 minutes at 25.degree. C. The precipitate is suspended and
added to the 293 cells and allowed to settle for about four hours
at 37.degree. C. The culture medium is aspirated off and 2 ml of
20% glycerol in PBS is added for 30 seconds. The 293 cells are then
washed with serum free medium, fresh medium is added and the cells
are incubated for about 5 days.
[0433] Approximately 24 hours after the transfections, the culture
medium is removed and replaced with culture medium (alone) or
culture medium containing 200 .mu.Ci/ml .sup.35S-cysteine and 200
.mu.Ci/ml .sup.35S-methionine. After a 12 hour incubation, the
conditioned medium is collected, concentrated on a spin filter, and
loaded onto a 15% SDS gel. The processed gel may be dried and
exposed to film for a selected period of time to reveal the
presence of PRO301, PRO362, PRO245 or PRO1868 polypeptide. The
cultures containing transfected cells may undergo further
incubation (in serum free medium) and the medium is tested in
selected bioassays.
[0434] In an alternative technique, PRO301, PRO362, PRO245 or
PRO1868 DNA may be introduced into 293 cells transiently using the
dextran sulfate method described by Somparyrac et al., Proc. Natl.
Acad. Sci., 12:7575 (1981). 293 cells are grown to maximal density
in a spinner flask and 700 .mu.g pRK5-PRO301, pRK5-PRO362,
pRK5-PRO245 or pRK5-PRO1868 DNA is added. The cells are first
concentrated from the spinner flask by centrifugation and washed
with PBS. The DNA-dextran precipitate is incubated on the cell
pellet for four hours. The cells are treated with 20% glycerol for
90 seconds, washed with tissue culture medium, and re-introduced
into the spinner flask containing tissue culture medium, 5 .mu.g/ml
bovine insulin and 0.1 .mu.g/ml bovine transferrin. After about
four days, the conditioned media is centrifuged and filtered to
remove cells and debris. The sample containing expressed PRO301,
PRO362, PRO245 or PRO1868 can then be concentrated and purified by
any selected method, such as dialysis and/or column
chromatography.
[0435] In another embodiment, PRO301, PRO362, PRO245 or PRO1868 can
be expressed in CHO cells. The pRK5-PRO301, pRK5-PRO362,
pRK5-PRO245 or pRK5-PRO1868 can be transfected into CHO cells using
known reagents such as CaPO.sub.4 or DEAE-dextran. As described
above, the cell cultures can be incubated, and the medium replaced
with culture medium (alone) or medium containing a radiolabel such
as .sup.35S-methionine. After determining the presence of PRO301,
PRO362, PRO245 or PRO1868 polypeptide, the culture medium may be
replaced with serum free medium. Preferably, the cultures are
incubated for about 6 days, and then the conditioned medium is
harvested. The medium containing the expressed PRO301, PRO362,
PRO245 or PRO1868 can then be concentrated and purified by any
selected method.
[0436] Epitope-tagged PRO301, PRO362, PRO245 or PRO1868 may also be
expressed in host CHO cells. The PRO301, PRO362, PRO245 or PRO1868
may be subcloned out of the pRK5 vector. The subclone insert can
undergo PCR to fuse in frame with a selected epitope tag such as a
poly-his tag into a Baculovirus expression vector. The poly-his
tagged PRO301, PRO362, PRO245 or PRO1868 insert can then be
subcloned into a SV40 driven vector containing a selection marker
such as DHFR for selection of stable clones. Finally, the CHO cells
can be transfected (as described above) with the SV40 driven
vector. Labeling may be performed, as described above, to verify
expression. The culture medium containing the expressed poly-His
tagged PRO301, PRO362, PRO245 or PRO1868 can then be concentrated
and purified by any selected method, such as by Ni.sup.2+-chelate
affinity chromatography.
[0437] PRO301, PRO362, PRO245 and PRO1868 were expressed in CHO
cells by both a transient and stable expression procedure.
[0438] Stable expression in CHO cells was performed using the
following procedure. The proteins were expressed as an IgG
construct (immunoadhesin), in which the coding sequences for the
soluble forms (e.g., extracellular domains) of the respective
proteins were fused to an IgG1 constant region sequence containing
the hinge, CH2 and CH2 domains and/or as a poly-His tagged
form.
[0439] Following PCR amplification, the respective DNAs were
subcloned in a CHO expression vector using standard techniques as
described in Ausubel et al., Current Protocols of Molecular
Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression
vectors are generally constructed to have compatible restriction
sites 5=and 3=of the DNA of interest to allow the convenient
shuttling of cDNAs. The vector used here for expression in CHO
cells is as described in Lucas et al., Nucl. Acids Res. 24: 9
(1774-1779 (1996), and uses the SV40 early promoter/enhancer to
drive expression of the cDNA of interest and dihydrofolate
reductase (DHFR). DHFR expression permits selection for stable
maintenance of the plasmid following transfection.
[0440] Twelve micrograms of the desired plasmid DNA were introduced
into approximately 10 million CHO cells using the commercially
available transfection reagent Superfect.sup.7 (Qiagen),
Dosper.sup.7 or Fugene.sup.7 (Boehringer Mannheim). The cells were
grown as described in Lucas et al., supra. Approximately
3.times.10.sup.-7 cells were frozen in an ampule for further growth
and production as described below.
[0441] The ampules containing the plasmid DNA were thawed by
placement into a water bath and mixed by vortexing. The contents
were pipetted into a centrifuge tube containing 10 mLs of media and
centrifuged at 1000 rpm for 5 minutes. The supernatant was
aspirated and the cells were resuspended in 10 mL of selective
media (0.2 :m filtered PS20 with 5% 0.2 :m diafiltered fetal bovine
serum). The cells were then aliquoted into a 100 mL spinner
containing 90 mL of selective media. After 1-2 days, the cells were
transferred into a 250 mL spinner filled with 150 mL selective
growth medium and incubated at 37EC. After another 2-3 days, a 250
mL, 500 mL and 2000 mL spinners were seeded with 3.times.10.sup.5
cells/mL. The cell media was exchanged with fresh media by
centrifugation and resuspension in production medium. Although any
suitable CHO media may be employed, a production medium described
in U.S. Pat. No. 5,122,469, issued Jun. 16, 1992 was actually used.
3L production spinner is seeded at 1.2.times.10.sup.6 cells/mL. On
day 0, the cell number and pH were determined. On day 1, the
spinner was sampled and sparging with filtered air was commenced.
On day 2, the spinner was sampled, the temperature shifted to 33EC,
and 30 mL of 500 g/L glucose and 0.6 mL of 10% antifoam (e.g., 35%
polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade
Emulsion). Throughout the production, pH was adjusted as necessary
to keep at around 7.2. After 10 days, or when viability dropped
below 70%, the cell culture was harvested by centrifugation and
filtering through a 0.22:m filter. The filtrate was either stored
at 4EC or immediately loaded onto columns for purification.
[0442] For the poly-His tagged constructs, the proteins were
purified using a Ni-NTA column (Qiagen). Before purification,
imidazole was added to the conditioned media to a concentration of
5 mM. The conditioned media was pumped onto a 6 ml Ni-NTA column
equilibrated in 20 mM Hepes, pH 7.4, buffer containing 0.3 M NaCl
and 5 mM imidazole at a flow rate of 4-5 ml/min. at 4EC. After
loading, the column was washed with additional equilibration buffer
and the protein eluted with equilibration buffer containing 0.25 M
imidazole. The highly purified protein was subsequently desalted
into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4%
mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and
stored at -80EC.
[0443] Immunoadhesin (Fc containing) constructs of the proteins
were purified from the conditioned media as follows. The
conditioned medium was pumped onto a 5 ml Protein A column
(Pharmacia) which had been equilibrated in 20 mM Na phosphate
buffer, pH 6.8. After loading, the column was washed extensively
with equilibration buffer before elution with 100 mM citric acid,
pH 3.5. The eluted protein was immediately neutralized by
collecting 1 ml fractions into tubes containing 275 :L of 1 M Tris
buffer, pH 9. The highly purified protein was subsequently desalted
into storage buffer as described above for the poly-His tagged
proteins. The homogeneity was assessed by SDS polyacrylamide gels
and by N-terminal amino acid sequencing by Edman degradation.
[0444] PRO301, PRO362 PRO245 and PRO1868 were also produced by
transient expression in COS cells.
Example 15
Expression of PRO301, PRO362, PRO245 or PRO1868 in Yeast
[0445] The following method describes recombinant expression of
PRO301, PRO362, PRO245 or PRO1868 in yeast.
[0446] First, yeast expression vectors are constructed for
intracellular production or secretion of PRO301, PRO362, PRO245 or
PRO1868 from the ADH2/GAPDH promoter. DNA encoding PRO301, PRO362,
PRO245 or PRO1868, a selected signal peptide and the promoter is
inserted into suitable restriction enzyme sites in the selected
plasmid to direct intracellular expression of PRO301, PRO362,
PRO245 or PRO1868. For secretion, DNA encoding PRO301, PRO362,
PRO245 or PRO1868 can be cloned into the selected plasmid, together
with DNA encoding the ADH2/GAPDH promoter, the yeast alpha-factor
secretory signal/leader sequence, and linker sequences (if needed)
for expression of PRO301, PRO362, PRO245 or PRO1868.
[0447] Yeast cells, such as yeast strain AB110, can then be
transformed with the expression plasmids described above and
cultured in selected fermentation media. The transformed yeast
supernatants can be analyzed by precipitation with 10%
trichloroacetic acid and separation by SDS-PAGE, followed by
staining of the gels with Coomassie Blue stain.
[0448] Recombinant PRO301, PRO362, PRO245 or PRO1868 can
subsequently be isolated and purified by removing the yeast cells
from the fermentation medium by centrifugation and then
concentrating the medium using selected cartridge filters. The
concentrate containing PRO301, PRO362, PRO245 or PRO1868 may
further be purified using selected column chromatography
resins.
Example 16
Expression of PRO301, PRO362, PRO245 or PRO1868 in
Baculovirus-Infected Insect Cells
[0449] The following method describes recombinant expression of
PRO301, PRO362 or PRO245 in Baculovirus-infected insect cells.
[0450] The PRO301, PRO362, PRO245 or PRO1868 is fused upstream of
an epitope tag contained with a baculovirus9 expression vector.
Such epitope tags include poly-his tags and immunoglobulin tags
(like Fc regions of IgG). A variety of plasmids may be employed,
including plasmids derived from commercially available plasmids
such as pVL1393 (Novagen). Briefly, the PRO301, PRO362, PRO245 or
PRO1868 or the desired portion of the PRO301, PRO362, PRO245 or
PRO1868 (such as the sequence encoding the extracellular domain) is
amplified by PCR with primers complementary to the 5' and 3'
regions. The 5' primer may incorporate flanking (selected)
restriction enzyme sites. The product is then digested with those
selected restriction enzymes and subcloned into the expression
vector.
[0451] Recombinant baculovirus is generated by co-transfecting the
above plasmid and BACULOGOLD.TM. virus DNA (Pharmingen) into
Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using
lipofectin (commercially available from GIBCO-BRL). After 4-5 days
of incubation at 28.degree. C., the released viruses are harvested
and used for further amplifications. Viral infection and protein
expression is performed as described by O'Reilley et al.,
Baculovirus expression vectors: A laboratory Manual, Oxford: Oxford
University Press (1994).
[0452] Expressed poly-his tagged PRO301, PRO362, PRO245 or PRO1868
can then be purified, for example, by Ni.sup.2+-chelate affinity
chromatography as follows. Extracts are prepared from recombinant
virus-infected Sf9 cells as described by Rupert et al., Nature,
362:175-179 (1993). Briefly, Sf9 cells are washed, resuspended in
sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl.sub.2; 0.1 mM
EDTA; 10% Glycerol; 0.1% NP-40; 0.4 M KCl), and sonicated twice for
20 seconds on ice. The sonicates are cleared by centrifugation, and
the supernatant is diluted 50-fold in loading buffer (50 mM
phosphate, 300 mM NaCl, 10% Glycerol, pH 7.8) and filtered through
a 0.45 Fm filter. A Ni.sup.2+-NTA agarose column (commercially
available from Qiagen) is prepared with a bed volume of 5 mL,
washed with 25 mL of water and equilibrated with 25 mL of loading
buffer. The filtered cell extract is loaded onto the column at 0.5
mL per minute. The column is washed to baseline A.sub.280 with
loading buffer, at which point fraction collection is started.
Next, the column is washed with a secondary wash buffer (50 mM
phosphate; 300 mM NaCl, 10% Glycerol, pH 6.0), which elutes
nonspecifically bound protein. After reaching A.sub.280 baseline
again, the column is developed with a 0 to 500 mM Imidazole
gradient in the secondary wash buffer. One mL fractions are
collected and analyzed by SDS-PAGE and silver staining or western
blot with Ni.sup.2+-NTA-conjugated to alkaline phosphatase
(Qiagen). Fractions containing the eluted His.sub.10-tagged PRO301,
PRO362, PRO245 or PRO1868 are pooled and dialyzed against loading
buffer.
[0453] Alternatively, purification of the IgG tagged (or Fc tagged)
PRO301, PRO362, PRO245 or PRO1868 can be performed using known
chromatography techniques, including for instance, Protein A or
protein G column chromatography.
[0454] PRO301, PRO362 and PRO245 were expressed in baculovirus
infected Sf9 insect cells. While the expression was actually
performed in a 0.5-2 L scale, it can be readily scaled up for
larger (e.g., 8 L) preparations. The proteins were expressed as an
IgG construct (immunoadhesin), in which the protein extracellular
region was fused to an IgG1 constant region sequence containing the
hinge, CH2 and CH3 domains and/or in poly-His tagged forms.
[0455] Following PCR amplification, the respective coding sequences
were subcloned into a baculovirus expression vector (pb.PH.IgG for
IgG fusions and pb.PH.His.c for poly-His tagged proteins), and the
vector and BACULOGOLD.TM. baculovirus DNA (Pharmingen) were
co-transfected into 105 Spodoptera frugiperda ("Sf9") cells (ATCC
CRL 1711), using Lipofectin (Gibco BRL). pb.PH.IgG and pb.PH.His
are modifications of the commercially available baculovirus
expression vector pVL1393 (Pharmingen), with modified polylinker
regions to include the His or Fc tag sequences. The cells were
grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone).
Cells were incubated for 5 days at 28.degree. C. The supernatant
was harvested and subsequently used for the first viral
amplification by infecting Sf9 cells in Hink's TNM-FH medium
supplemented with 10% FBS at an approximate multiplicity of
infection (MOI) of 10. Cells were incubated for 3 days at
28.degree. C. The supernatant was harvested and the expression of
the constructs in the baculovirus expression vector was determined
by batch binding of 1 ml of supernatant to 25 mL of Ni-NTA beads
(QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B
beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE
analysis comparing to a known concentration of protein standard by
Coomassie blue staining.
[0456] The first viral amplification supernatant was used to infect
a spinner culture (500 ml) of Sf9 cells grown in ESF-921 medium
(Expression Systems LLC) at an approximate MOI of 0.1. Cells were
incubated for 3 days at 28.degree. C. The supernatant was harvested
and filtered. Batch binding and SDS-PAGE analysis was repeated, as
necessary, until expression of the spinner culture was
confirmed.
[0457] The conditioned medium from the transfected cells (0.5 to 3
L) was harvested by centrifugation to remove the cells and filtered
through 0.22 micron filters. For the poly-His tagged constructs,
the protein construct were purified using a Ni-NTA column (Qiagen).
Before purification, imidazole was added to the conditioned media
to a concentration of 5 mM. The conditioned media were pumped onto
a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7.4, buffer
containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5
ml/min. at 4.degree. C. After loading, the column was washed with
additional equilibration buffer and the protein eluted with
equilibration buffer containing 0.25 M imidazole. The highly
purified protein was subsequently desalted into a storage buffer
containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a
25 ml G25 Superfine (Pharmacia) column and stored at -80.degree.
C.
[0458] Immunoadhesin (Fc containing) constructs of proteins were
purified from the conditioned media as follows. The conditioned
media were pumped onto a 5 ml Protein A column (Pharmacia) which
had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After
loading, the column was washed extensively with equilibration
buffer before elution with 100 mM citric acid, pH 3.5. The eluted
protein was immediately neutralized by collecting 1 ml fractions
into tubes containing 275 mL of 1 M Tris buffer, pH 9. The highly
purified protein was subsequently desalted into storage buffer as
described above for the poly-His tagged proteins. The homogeneity
of the proteins was verified by SDS polyacrylamide gel (PEG)
electrophoresis and N-terminal amino acid sequencing by Edman
degradation.
[0459] PRO301, PRO362 and PRO245 were also expressed in baculovirus
infected High-5 cells using an analogous procedure. High-5 cells
were grown to a confluency of 50% at 27.degree. C., no CO.sub.2, no
penicillin and no streptomycin. For each 150 mm plate, 30 .mu.g of
pIE based vector containing PRO301, PRO362 or PRO245 was mixed with
1 ml Ex-Cell medium (Media: Ex-cell 401, 1/100 L-Glu JRH
Biosciences, #14401-78P, note: medium is light sensitive), and in a
separate tube, 100 .mu.l of CELLFECTIN.TM. (GibcoBRL #10362-010)
was mixed with 1 ml of Ec-Cell medium. The pIE1-1 and pIE 1-2
vectors are designed for constitutive expression of recombinant
proteins from the baculovirus ie1 promoter in stably-transformed
insect cells (Cartier, J. L., et al., J. Virol. 68, 7728-7737)
(1994). The plasmids differ only in the orientation of the multiple
cloning sites and contain all promoter sequences known to be
important for ie1-mediated gene expression in uninfected insect
cells as well as the hr5 enhancer element. pIE1-1 and pIE1-2
include the ie1 translation initiation site and can be used to
produce fusion proteins.
[0460] The two solutions were combined and allowed to incubate at
room temperature for 15 minutes. 8 ml of Ex-Cell media was added to
the 2 ml of DNA/CELLFECTIN.TM. mix and is layered on High-5 cells
previously washed with Ex-Cell media. The plate was incubated in
darkness for 1 hour at room temperature. The DNA/CELLFECTIN.TM. mix
was aspirated, and the cells washed once with Ex-Cell to remove
excess CELLFECTIN.TM.. Fresh Ex-cell medium (30 ml) was added and
the cells incubated for 3 days at 28.degree. C. The supernatant was
harvested and the expression of PRO301, PRO362 or PRO245 was
determined by batch binding in a manner similar to that described
for Sf9 cells.
Example 17
Preparation of Antibodies that Bind PRO301, PRO362, PRO245 and
PRO1868
[0461] This example illustrates preparation of monoclonal
antibodies which can specifically bind PRO301, PRO362, PRO245 or
PRO1868.
[0462] Techniques for producing the monoclonal antibodies are known
in the art and are described, for instance, in Goding, supra.
Immunogens that may be employed include purified PRO301, PRO362,
PRO245 and PRO1868, fusion proteins containing PRO301, PRO362,
PRO245 and PRO1868, and cells expressing recombinant PRO301,
PRO362, PRO245 and PRO1868 on the cell surface. Selection of the
immunogen can be made by the skilled artisan without undue
experimentation.
[0463] Mice, such as BALB/c, are immunized with the PRO301, PRO362,
PRO245 and PRO1868 immunogen emulsified in complete Freund's
adjuvant and injected subcutaneously or intraperitoneally in an
amount from 1-100 micrograms. Alternatively, the immunogen is
emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research,
Hamilton, Mont.) and injected into the animal's hind foot pads. The
immunized mice are then boosted 10 to 12 days later with additional
immunogen emulsified in the selected adjuvant. Thereafter, for
several weeks, the mice may also be boosted with additional
immunization injections. Serum samples may be periodically obtained
from the mice by retro-orbital bleeding for testing in ELISA assays
to detect PRO301, PRO362, PRO245 and PRO1868 antibodies.
[0464] After a suitable antibody titer has been detected, the
animals "positive" for antibodies can be injected with a final
intravenous injection of PRO301, PRO362, PRO245 and PRO1868. Three
to four days later, the mice are sacrificed and the spleen cells
are harvested. The spleen cells are then fused (using 35%
polyethylene glycol) to a selected murine myeloma cell line such as
P3X63AgU.1, available from ATCC, No. CRL 1597. The fusions generate
hybridoma cells which can then be plated in 96 well tissue culture
plates containing HAT (hypoxanthine, aminopterin, and thymidine)
medium to inhibit proliferation of non-fused cells, myeloma
hybrids, and spleen cell hybrids.
[0465] The hybridoma cells are screened in an ELISA for reactivity
against PRO301, PRO362, PRO245 or PRO1868. Determination of
"positive" hybridoma cells secreting the desired monoclonal
antibodies against PRO301, PRO362, PRO245 or PRO1868 is within the
skill in the art.
[0466] The positive hybridoma cells can be injected
intraperitoneally into syngenic BALB/c mice to produce ascites
containing the anti-PRO301, anti-PRO362, anti-PRO245 or
anti-PRO1868 monoclonal antibodies. Alternatively, the hybridoma
cells can be grown in tissue culture flasks or roller bottles.
Purification of the monoclonal antibodies produced in the ascites
can be accomplished using ammonium sulfate precipitation, followed
by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can be employed.
[0467] Human PRO245 and PRO1868 cDNA were isolated from a human
colonic cDNA library by colony hybridization. Human IgG1 Fc fusion
protein (immunoadhesins) of PRO245 (PRO245.Fc, also called
JAM-IT.Fc or JAM2.Fc) and PRO1868 (PRO1868.Fc or JAM3.Fc) were
prepared as described in Ashkenazi et al. Curr. Opin. Immun. 9:195
(1997) and purified over a protein A column (Amersham Pharmacia
Biotech, NJ, USA). Identity was verified by N-terminal sequence
analysis.
[0468] BALB/c females were immunized and boosted with 10 .mu.g of
PRO245.Fc or 8.times.His-tagged PRO1868 via footpad injection.
Single clones were screened against PRO245.Fc or 8.times.His-tagged
PRO1868. Select clones were tested for cross reactivity against
A33/JAM family members and human IgG Fc. Clones were titrated out
to single cell densities and rescreened. Clone 12D10.2F9 was
discovered to be selectively reactive to JAM2 (PRO245) and not JAM
or JAM3. Clone MaJIR1 was found to be selectively reactive to JAM3
and not to JAM or JAM2. Both clones were isolated and used for
ascites generation. Abs were purified over a protein G column.
[0469] Anti-PRO245 antibody 12D10.2F9 was specific for interaction
with PRO245 expressing CHO cells and did not interact with human
PRO301-expressing CHO cells (FIG. 58). Briefly, PRO245 cDNA was
amplified by PCR from a human colon cDNA library (Clontech
Laboratories, Palo Alto, Calif., USA) using primers specific for
the 5' and 3' ends of the coding sequence. The fragment was
purified and ligated into pSD5 expression vector, transfected into
Chinese hamster ovary (CHO) cells and selected as described in
Lucas et al. Nuc. Acids Res. 24:1774 (1996). Stable cell clones
were screened for antibody reactivity. As can be seen in FIG. 58,
The anti-PRO245 antibody (12D10.2F9) did not bind to huJAM
expressing CHO transfectant CuL8r. CuL8r does interact with the
anti-huJAM antibody 10A5.
Example 18
Isolation of cDNA Clones Encoding Human PRO1868 by Expression
Cloning
[0470] Identification of PRO1868 was done by transiently
transfecting pooled cDNA libraries encoding secreted and
transmembrane proteins into COS cells grown on glass chamber
slides. Twenty-four hours after transfection, PRO245 or PRO245-Fc
fusions were added (0.5 .mu.g/ml) and incubated for 30 minutes.
PRO245/PRO245-Fc fusion binding was determined (Klein et al.,
Nature, 387:717 and 392:210 (1998)). Clones that were positive for
the ability to bind to PRO245/PRO245-Fc fusions were selected for
further characterization.
Example 19
Induction of Chondrocyte Re-Differentiation
[0471] The ability of the polypeptides of the invention to induce
redifferentiation were tested in chondrocytes. Proteins with the
ability to induce redifferentiation of chondrocytes are useful for
the treatment of various bone and/or cartilage disorders such as,
for example, sports injuries and arthritis.
[0472] Porcine chondrocytes were isolated by overnight collagenase
digestion of articulary cartilage of metacarpophalangeal joints of
4-6 month old female pigs. The isolated cells were then seeded at
25,000 cells/cm.sup.2 in Ham F-12 containing 10% FBS and 4 .mu.g/ml
gentamycin. The culture media was changed every third day and the
cells were then seeded in 96 well plates at 5,000 cells/well in 100
.mu.l of the same media without serum and 100 .mu.l of the test
PRO1868 polypeptide, 5 nM staurosporin (positive control) or medium
alone (negative control) was added to give a final volume of 200
.mu.l/well. After 5 days of incubation at 37.degree. C., a picture
of each well was taken and the differentiation state of the
chondrocytes was determined. A positive result in the assay
resulted when the redifferentiation of the chondrocytes was
determined to be more similar to the positive control than the
negative control.
[0473] PRO1868 polypeptides tested positive for the ability to
induce redifferentiation of chondrocytes.
Example 20
Overexpression of PRO1868 Polypeptides in Cancerous Tumors
[0474] In the present example, the expression level of PRO1868
polypeptides in cancerous tissues was examined. Polypeptides that
are overexpressed in cancerous tumors may be useful as not only
diagnostic markers for the presence of one or more cancerous
tumors, but also may serve as therapeutic targets for the treatment
of those tumors.
[0475] For detection of overexpression of PRO1868 polypeptides,
nucleic acid microarrays were used to identify differentially
expressed genes in diseased tissues as compared to their normal
counterparts. Using nucleic acid microarrays, test and control mRNA
samples from test and control tissue samples are reverse
transcribed and labeled to generate cDNA probes. The cDNA probes
are then hybridized to an array of nucleic acids immobilized on a
solid support. The array is configured such that the sequence and
position of each member of the array is known. For example, a
selection of genes known to be expressed in certain disease states
may be arrayed on a solid support. Hybridization of a labeled probe
with a particular array member indicates that the sample from which
the probe was derived expresses that gene. If the hybridization
signal of a probe from a test (disease tissue) sample is greater
than hybridization signal of a probe from a control (normal tissue)
sample, the gene or genes overexpressed in the disease tissue are
identified. The implication of this result is that an overexpressed
protein in a diseased tissue is useful not only as a diagnostic
marker for the presence of the disease condition, but also as a
therapeutic target for treatment of the disease condition. The
methodology of hybridization of nucleic acids and microarray
technology is well known in the art.
[0476] In the present example, cancerous tumors derived from
various human tissues were studied for PRO1868 polypeptide-encoding
gene expression relative to non-cancerous human tissue in an
attempt to identify those PRO1868 polypeptides which are
overexpressed in cancerous tumors. The specific preparation of
nucleic acids for hybridization and probes, slides, and
hybridization conditions are all detailed in U.S. Provisional
Patent Application Ser. No. 60/193,767, filed on Mar. 31, 2000 and
which is herein incorporated by reference. Two sets of experimental
data were generated. In one set, cancerous human colon tumor tissue
and matched non-cancerous human colon tumor tissue from the same
patient ("matched colon control") were obtained and analyzed for
PRO1868 polypeptide expression using the above described microarray
technology. In the second set of data, cancerous human tumor tissue
from a variety of different human tumors, including lung and breast
tumors, was obtained and compared to a "universal" epithelial
control sample which was prepared by pooling non-cancerous human
tissues of epithelial origin, including liver, kidney, and lung.
mRNA isolated from the pooled tissues represents a mixture of
expressed gene products from these different tissues. Microarray
hybridization experiments using the pooled control samples
generated a linear plot in a 2-color analysis. The slope of the
line generated in a 2-color analysis was then used to normalize the
ratios of (test:control detection) within each experiment. The
normalized ratios from various experiments were then compared and
used to identify clustering of gene expression. Thus, the pooled
"universal control" sample not only allowed effective relative gene
expression determinations in a simple 2-sample comparison, it also
allowed multi-sample comparisons across several experiments.
[0477] Nucleic acid probes derived from the herein described
PRO1868 polypeptide-encoding nucleic acid sequences were used in
the creation of the microarray and RNA from the tumor tissues
listed above were used for the hybridization thereto. A value based
upon the normalized ratio:experimental ratio was designated as a
"cutoff ratio". Only values that were above this cutoff ratio were
determined to be significant. PRO1868 polypeptides of the present
invention are significantly overexpressed in various human tumor
tissues, for example lung and breast tumors, as compared to a
non-cancerous human tissue control.
[0478] These data indicate that the PRO polypeptides of the
invention are useful as both diagnostic markers and therapeutic
targets for the treatment of tumors.
Example 21
Induction of Cell Proliferation
[0479] A. Endothelial Cell Proliferation
[0480] The ability of polypeptides of the invention to induce
proliferation in endothelial cells was tested in human umbilical
vein endothelial cells (HUVEC, Cell Systems). Polypeptides with the
ability to induce endothelial cell proliferation function as useful
growth factors.
[0481] On day 0, pooled human umbilical vein endothelial cells
(from cell lines, maximum of 12-14 passages) were plated in 96-well
plates at 1000 cells/well per 100 microliter and incubated
overnight in complete media [epithelial cell growth media (EGM,
Clonetics), plus supplements: human epithelial growth factor
(hEGF), bovine brain extract (BBE), hydrocortisone, GA-1000, and
fetal bovine serum (FBS, Clonetics)]. On day 1, complete media was
replaced by basal media [EGM plus 1% FBS] and addition of PRO1868
polypeptides at 1%, 0.1% and 0.01%. On day 7, an assessment of cell
proliferation was performed by ALAMAR BLUE.TM. assay followed by
Crystal Violet. Results were expressed as a % of the cell growth
observed with control buffer.
[0482] PRO1868 polypeptides tested positive in this assay for the
ability to induce proliferation of pooled human umbilical vein
endothelial cells in culture, and as a result, to function as
useful growth factors.
[0483] B. Human Coronary Artery Smooth Muscle Cell
Proliferation
[0484] The ability of polypeptides of the invention to induce cell
proliferation was tested in human coronary artery smooth muscle
cells in culture. Polypeptides of the invention with the ability to
induce cell proliferation are useful as growth factors.
[0485] On day 0, human coronary artery smooth muscle cells (from
cell lines, maximum of 12-14 passages) were plated in 96-well
plates at 1000 cells/well per 100 microliter and incubated
overnight in complete media [smooth muscle growth media (SmGM,
Clonetics), plus supplements: insulin, human epithelial growth
factor (hEGF), human fibroblast growth factor (hFGF), GA-1000, and
fetal bovine serum (FBS, Clonetics)]. On day 1, complete media was
replaced by basal media [SmGM plus 1% FBS] and addition of PRO1868
polypeptides at 1%, 0.1% and 0.01%. On day 7, an assessment of cell
proliferation was performed by ALAMAR BLUE.TM. assay followed by
Crystal Violet. Results were expressed as a % of the cell growth
observed with control buffer.
[0486] PRO1868 polypeptides tested positive in the assay for the
ability to induce proliferation of human coronary artery smooth
muscle cells in culture and to function as a useful growth
factor.
Example 22
PRO mRNA and Polypeptide Expression
[0487] A. In Situ Hybridization and Immunohistochemistry
[0488] Expression of PRO362, PRO245 and PRO1868 mRNA was evaluated
by in situ hybridization, immunohistochemistry and RT-PCR in
various types of tissues.
[0489] For in situ hybridization, tissues were fixed (4% formalin),
paraffin-embedded, sectioned (3-5 .mu.m thick), deparaffinized,
deproteinated (20 .mu.g/ml) with proteinase K (15 minutes at
37.degree. C.), and processed for in situ hybridization. Probes to
the polypeptides of the invention were produced by PCR. Primers
included T7 or T3 RNA polymerase initiation sites to allow for in
vitro transcription of sense or antisense probes from the amplified
products. .sup.33P-UTP labeled sense and antisense probes were
hybridized overnight (55.degree. C.), washed (0.1.times.SSC for 2
hours at 55.degree. C.), dipped in NBT2 nuclear track emulsion
(Eastman Kodak, Rochester, N.Y.), exposed (4-6 weeks at 4.degree.
C.), and developed and counterstained with hematoxylin and eosin.
Representative paired bright and darkfield images are typically
shown.
[0490] Immunohistochemical staining was performed on 5 mm thick
frozen sections using a DAKO Autostainer. Endogenous peroxidase
activity was blocked with Kirkegaard and Perry Blocking Solution
(1:10,4 minutes at 20C). 10% NGS in TBS/0.05% Tween-20 (DAKO) was
used for dilution and blocking. MAb 4F722.2 anti-STIgMA
(anti-PRO362) or mouse IgG was used at 0.13 mg/ml. Biotinylated
goat anti-mouse IgG (Vector Labs), Burlingame, Calif.) was used at
1:200 and detected with Vector Labs Standard ABC Elite Kit (Vector
Labs, Burlingame, Calif.). Slides were developed using Pierce
metal-enhanced diaminobenzidine (Pierce Chemicals, Rockford, Ill.).
Dual immunohistochemistry for PRO362 (STIgMA) and CD68 expression
was performed on frozen sections to demonstrate localization of
STIgMA expression to macrophages. mAb 4F7.22.2 anti-STIgMA and
anti-CD68 mAb KP-1 from (DAKO) were utilized and detected by
phycoerythrin and FITC markers, respectively.
[0491] 1. Tissues Examined
[0492] Expression was examined in a wide variety of tissues and
cell types from humans and other mammals.
[0493] a. Normal Tissue
[0494] Normal human adult tissues that were examined included
tonsil, lymph node, spleen, kidney, urinary bladder, lung, heart,
aorta, coronary artery, liver, gall bladder, prostate, stomach,
small intestine, colon, pancrease, thyroid gland, skin, adrenal
gland, placenta, uterus, ovary, testis, retina, and brain
(cerebellum, brainstem, cerebral cortex). Normal human fetal
tissues including E12-E16 week-old brain, spleen, bowel and thyroid
were also tested. In addition, expression was investigated in
murine liver.
[0495] b. Inflamed Tissue
[0496] Inflamed tissues examined by in situ hybridization included
tissues with chronic inflammatory disease such as lungs with
chronic asthma, chronic bronchopneumonia, chronic
bronchitis/chronic obstructive pulmonary disease, kidneys with
chronic lymphocytic interstitial nephritis, and livers with chronic
inflammation and cirrhosis due to chronic hepatitis C infection,
autoimmune hepatitis or alcoholic cirrhosis.
[0497] c. Primary Neoplasms
[0498] Primary human neoplasms that were examined by in situ
hybridization for PRO362, PRO245 and PRO1868 expression included
breast carcinoma, pulmonary squamous cell carcinoma, pulmonary
adenocarcinoma, prostatic adenocarcinoma, and colonic
adenocarcinoma.
[0499] 2. Results
[0500] a. PRO362 Expression
[0501] PRO362 was found to be expressed in mouse liver frozen
sections (FIG. 23), human liver frozen sections (FIG. 24) and a
number of tissue macrophage-like cells, including colon macrophages
(FIG. 25A), Kupffer cells (FIG. 25B), adrenal macrophages (FIG.
25C), Hofbauer cells (FIG. 25D), synovial cells (FIG. 26), alveolar
macrophages, resident macrophages in the intestinal lamina propria
and interstitial macrophages in many tissues. PRO362 was also
significantly expressed in brain microglia. The expression of
PRO362 was significantly increased in these tissues when activated
by the presence of neoplasia or inflammatory disease, including
rheumatoid arthritis (FIG. 27), inflammatory bowel disease, chronic
hepatitis (FIG. 28), pneumonia, chronic asthma (FIG. 29), glioma
(FIG. 30) and bronchitis.
[0502] To further examine expression of PRO362, immunohistochemical
staining was performed on various tissue types. Dual
immunohistochemical staining for PRO362 and CD68 was performed on
tissue macrophages, including adrenal gland macrophages, liver
Kupffer cells, brain microglial cells, and placental Hofbauer cells
was performed to determine whether PRO362 and CD68 are expressed in
the same tissues.
[0503] PRO362 was found to be coexpressed with CD68 on adrenal
gland macrophages (FIG. 35), liver Kupffer cells (FIG. 36), brain
microglial cells (FIG. 37), and placental Hofbauer cells (FIG.
38).
[0504] b. PRO245 Expression
[0505] PRO245 was found to be significantly localized to epithelial
tissue and inflammed tissues.
[0506] (i) Normal Tissue
[0507] Expression of PRO245 mRNA in normal adult human tissues was
significant in the high endothelial venules (HEVs) in tonsils and
lymph nodes (FIG. 31), the spermatogenic cells of the epithelium in
the testicular seminiferous tubules (FIG. 32I and J), and the
intermediate trophoblasts of the placenta.
[0508] Expression of PRO245 mRNA in normal human fetal tissues was
significant in endothelial cells, but more specifically, was found
in the vascular endothelium of small and large vessels (excluding
capillaries), in mesenteric vessels, mural vessels of the bowel
wall, and small vessels of the developing mesenteric lymph nodes
and thyroid.
[0509] Expression of PRO245 was not significant in the spleen,
normal skin or foreskin, normal lung, thyroid, normal bowel, normal
cardiac tissue or adrenal glands.
[0510] (ii) Inflamed Tissue
[0511] The expression of PRO245 was more extensive in tissues with
chronic inflammatory diseases. In biopsies of lung with chronic
bronchopneumonia, PRO245 mRNA was expressed in the endothelium of
small-(FIGS. 32A and B), medium-(FIGS. 32C and D), and
large-caliber arterioles (FIGS. 32E and F) present within or
immediately adjacent to foci of lymphocytic inflammation. PRO245
mRNA was not observed in normal lung tissue (FIGS. 32G and H).
Further, PRO245 was found to be significantly expressed in the
vascular endothelium in active or chronic inflammation in the
following: arterioles, veins and capillaries from tissues
associated with chronic interstitial pneumonia, superficial dermal
vessels of psoriatic skin from tissues associated with psoriasis,
arterioles from tissues associated with chronic sclerosing
nephritis, vascular endothelium and capillaries in inflammed foci
from tissues associated with appendicitis, endothelium of numerous
vessels, HEVs, capillaries, small arterioles and veins from tissues
associated with tonsil and perifollicular sinuses, and capillaries
in periarterial interstitial tissue in aorta and aorta associated
with atherosclerosis. PRO245 was not significantly expressed in
aortic intima.
[0512] In biopsies of kidney with chronic lymphocytic interstitial
nephritis and liver with chronic lymphocytic hepatitis, PRO245
expression was significant in the endothelium of arterioles in and
adjacent to sites of lymphocytic inflammation. PRO245 expression
was not significant in chronically inflammed or cirrhotic
liver.
[0513] In biopsies of liver with chronic inflammation and
cirrhosis, PRO245 was not significantly expressed.
[0514] PRO245 expression was not significantly expressed in
inflammed large bowel or brain with meningitis.
[0515] (iii) Neoplastic Tissue
[0516] PRO245 expression was observed in the endothelium of small-
and medium-caliber arterioles in a number of primary neoplasms,
including colonic adenocarcinoma, testicular carcinoma (FIGS. 33A
and B), pulmonary adenocarcinoma (FIGS. 33C and D), mammary
adenocarcinoma (FIGS. 33E and F) and significantly in prostatic
adenocarcinoma and colonic adenocarcinoma. PRO245 mRNA was found to
be expressed in breast carcinoma (FIG. 34). However, PRO245 was not
significantly expressed in adjacent normal breast tissue, as shown
in FIGS. 33G and H, where breast carcinoma is denoted with an
asterisk and normal breast tissue with an arrow. PRO245 expression
is observed uniquely in vessels adjacent to the tumor (arrowheads),
but not in normal tissue.
[0517] PRO245 expression was found in the vascular endothelium of
epididymis and within areas of chronic lymphocytic inflammation in
testicular carcinomas or seminomas, in the vascular endothelium of
tumor foci within areas of chronic lymphocytic inflammation of lung
adenocarcinoma, in the vascular endothelium in tumor foci within
areas of chronic lymphocytic inflammation in lung squamous cell
carcinoma, in the vascular endothelium adjacent to tumor foci and
within areas of chronic lymphocytic inflammation of breast
carcinomas, and in areas adjacent to vascular endothelium in
arterioles, veins, and capillaries in chondrosarcomas.
[0518] c. PRO1868 Expression
[0519] PRO1868 was found to be expressed on NK cells, CD8+ T cells
and dendritic cells.
[0520] B. Reverse Transcription-Polymerase Chain (RT-PCR)
[0521] Reverse Transcription-polymerase chain reaction (RT-PCR) is
a sensitive technique for mRNA detection and quantitation that
consists of synthesis of cDNA from RNA by reverse transcription. To
detect expression of PRO1868, the presence of PRO1868 mRNA was
detected by RT-PCR.
[0522] PRO1868 mRNA was significantly detected by
reverse-transcriptase PCR (RT-PCR) in the T cell lines, J45 and
Molt5, but not in the B cell lines, JY, RPM18866 and RAMOS (FIG.
39).
Example 22
Interaction of PRO245 with Specific Cell Types
[0523] As determined by flow cytometry, peripheral blood cells do
not significantly express PRO245 (Table 6, top half). To determine
whether PRO245 interacted with discrete subsets of peripheral blood
cells a number of PRO245-cell assays were performed. These included
magnetic or FACS sorting of PRO245-interacting cells. Peripheral
blood was obtained for all experiments as described below.
[0524] A. Magnetic Sorting and Flow Cytometry
[0525] To determine whether PRO245 interacts with peripheral blood
leukocytes, a biotinylated PRO245-human IgG fusion protein was
generated, as described below. PRO245-interacting peripheral blood
leukocytes were isolated using streptavidin-conjugated magnetic
beads. Isolated cells were then examined for surface CD-Ag
expression. Results obtained using biotinylated PRO-245-human IgG
fusion were compared to results using biotinylated human IgG.
[0526] Biotinylated PRO245-human IgG fusion proteins or human IgG1
proteins were incubated for 1 hour at 4.degree. C. with PBMC (10
.mu.g/10.sup.7) in SerF buffer (10% FBS (v/v; Life Technologies)
plus 0.1% NaN3 (w/v; Sigma-Aldrich, St. Louis, Mo.) in HBSS without
phenol red or sodium bicarbonate (HBSS+; Life Technologies)
buffered with 10 mM HEPES (Life Technologies), pH 7.4). Cells were
washed in SerF buffer and resuspended at 80 .mu.l/10.sup.7 cells.
Streptavidin magnetic beads (Miltenyi Biotec) were added at 20
.mu.l/10.sup.7 cells and incubated for 15 minutes at 4C, washed
with SerF buffer, resuspended at 500 ml/108 cells, and passed over
a positive selecting MACS column. Positively selected cells were
eluted per the manufacturer's instructions, washed with SerF
buffer, and analyzed by flow cytometry for surface CD Ags at
2.times.10.sup.5 cells per condition. The data are presented as
percentage positive, representing the percentage of positively
stained cells in a total of 2.times.10.sup.5 cells collected per
staining condition for flow cytometry.
[0527] 1. Protein Conjugation
[0528] PRO245-human IgG fusion, human IgG1, or PRO362-human IgG
fusion were biotinylated with 200 .mu.g of EZ-Link
sulfo-NHS-LC-biotin (Pierce) per 1 mg of protein in PBS for 30
minutes at room temperature. Biotinylation was quenched with the
addition of (final concentration) 200 mM Tris, pH 8, and incubated
for 30 minutes at room temperature. Biotinylated proteins were then
dialyzed extensively against PBS and concentrated to a
concentration of 2 mg/ml with Centricon-10 microconcentrators
(Millipore, Bedford, Mass.).
[0529] Alexa-488 (Molecular Probes, Eugene, Oreg.) protein
conjugation kit was used per the manufacturer's instructions for
the conjugation of Alexa-488 onto PRO245-human IgG fusion or human
IgG1.
[0530] 2. Flow Cytometry
[0531] Cells for use in flow cytometric analysis were blocked for
30 minutes at 4.degree. C. with SerF buffer and stained with Abs to
CD3, CD4, CD8, CD14, CD19 or CD56, conjugated to either FITC, PE,
or CyChrome (BD PharMingen, San Diego, Calif.).
[0532] 3. Results
[0533] The following four cell populations of peripheral blood
leukocytes were found to significantly interact with PRO245: T
cells (CD3+), CD8+ cells, B cells (CD19+) and NK cells (CD56+). The
percentage of cells that were able to interact with PRO245 in a
single experiment were as follows: 20.99% for CD3+ cells, 6.68% for
CD8+ cells, 9.66% for CD19+cells, and 36.89% for CD56+cells. The
percentage of cells that were able to interact with the human IgG
control were as follows: 2.39% for CD3+ cells, 1.78% for CD8+
cells, 4.42% for CD19+ cells, and 6.69% for CD56+ cells.
[0534] B. FACS Sorting and Flow Cytometry
[0535] PRO245-human IgG fusion protein-binding peripheral blood
cells were sorted by FACS sorting.
[0536] For FACS sorting, cells were incubated (30 minutes at
4.degree. C.) with Alexa-488-conjugated human IgG1 or PRO245-human
IgG fusion protein (10 .mu.g/10.sup.6 cells) in a modified SerF
buffer (SerF buffer with 5 .mu.g/ml anti-CD16 Ab 3G8 (BD
PharMingen) and 20 .mu.g/ml human IgG1 (Calbiochem, San Diego,
Calif.)), washed and sorted on an Elite ESP (Beckman Coulter,
Miami, Fla.). In these conditions, Alexa-488-conjugated PRO245 or
human IgG was used as background. For competition assays, the
competitor (20 .mu.g/10.sup.6 cells) was mixed with the cells for
20 minutes at room temperature in SerF buffer before
Alexa-488-conjugated PRO245-human IgG fusion protein or human IgG
were introduced. The cells were then washed and analyzed by flow
cytometry as described above.
[0537] Of the cells that interact with PRO245-human IgG fusion
protein (JAM-IT.Fc), 12.5% were CD3+ T cells, 32.4% were CD8+ T
cells, and 50.4% were CD56+ NK cells. CD19+ B cells were not
detected in the FACS sorting assay. Of the CD56+ NK cells, 22.4%
expressed CD3 and 40.2% expressed CD8. Of the CD8+ T cells, 23.5%
expressed CD3 and 73.2% expressed CD56 (FIG. 40). TABLE-US-00011
TABLE 6 Expression of PRO245 on peripheral blood cells and binding
of peripheral blood cells to PRO245 Secondary Staining Primary
Staining CD3 CD4 CD8 CD14 CD19 CD56 PMN anti-PRO245 Positive 0.2%
0.1% 0.1% 0.7% 0.1% 0.3% 0.9% anti-PRO301 Positive 76.7% 73.9%
80.4% 99% 90% 85% 98.7% anti-mouse IgG Positive 0.25 0.1% 0.1% 0.7%
0.1% 0.3% 0.9% Percent of total PRO245 12.6% 1.1% 32.4% 0.3% 0.4%
50.4% NA binding cells Percent of PRO245 binding 22.4% 0.2% 40.2%
0.5% 0.4% NA CD56 positive cells Percent of PRO245 binding 23.5%
0.1% 0.6% 0.3% 73.2% NA CD8 positive cells
[0538] C. Binding to Purified Cells
[0539] Purified B cells, neutrophils, CD14+monocytes, peripheral
blood dendritic cells (PBDCs) from Clonetics (San Diego, Calif.),
peripheral blood CD56+NK cells obtained by negative selection, and
J45, a CD3+ T cell line, were analyzed for their ability to
interact with Alexa-488-conjugated PRO245-human IgG fusion protein
by flow cytometry. The ability to interact with
Alexa-488-conjugated human IgG1 protein was analyzed at the same
time as a control.
[0540] Blood was obtained from healthy adult volunteers by venous
puncture and separated using Ficoll-Plaque PLUS (Amersham Pharmacia
Biotech) per the manufacturer's instructions. PBMC were obtained
from the interface, washed in cold PBS, lysed (with 0.2% NaCl for
30 seconds and neutralized with 1.6% NaCl) as needed, counted, and
kept on ice at 5.times.10.sup.7 cells/ml until use. By flow
cytometric analysis, no contaminating platelets were observed in
the purified PBMC fractions. Neutrophils were obtained from the
pellet after lysis of contaminating RBCs. Neutrophils were washed
in cold PBS, counted, and kept at 5.times.10.sup.7 cells/ml until
use on ice. To isolated peripheral blood subsets, "untouched" MACS
kits (Miltenyi Biotec, Auburn, Calif.) were used following the
manufacturer's instructions.
[0541] Purified B cells, neutrophils and CD14+monocytes did not
interact with PRO245-human IgG fusion protein as detected by flow
cytometry. However, a number of other cell types were found to
interact with PRO245.Fc. FIG. 41 shows that PRO245.Fc interacts
with CD56+ NK cells. This interaction was specific, as it was
blocked by the addition of an anti-PRO245 antibody. PRO1868 (also
called 77624, JAM3 and SHATr) was found to block the interaction of
PRO245 and CD56+ NK cells (FIG. 46, bottom, and FIG. 53, lower
right). Addition of unlabeled, His tagged PRO1868 (JAM3) blocked
the shift in fluorescence observed with the addition of PRO245.Fc.
On the other hand, as can be seen in FIG. 53, upper right, addition
of PRO301 does not block the interaction of PRO245 and NK
cells.
[0542] Peripheral blood dendritic cells (PBDCs) also interact with,
but do not express PRO24 (FIG. 42). PBDC were obtained from
Clonetics. FIG. 411 shows that PRO245.Fc (solid line) interacts
strongly with the PBDCs compared to human IgG1 (shaded histogram).
However, PBDS were not observed to express PRO245 (FIG. 41II; mouse
IgG--filled histogram; anti-PRO245 antibody 12D10.2F9--solid
line).
[0543] In addition, J45 T cells, which have no detectable surface
expression of PRO245, were found to interact with PRO245 (FIGS. 43
and 44). Interaction between Alexa-488 conjugated PRO245-Fc fusion
protein and J45 cells was detected by a shift in the peak of
fluorescence when compared to the conjugated human IgG1 (FIG. 44).
The shift was blocked by addition of anti-PRO245 antibody (FIG.
44). The interaction between Alexa-488 conjugated PRO245-Fc fusion
protein and J45 cells was also inhibited by unlabeled PRO1868
(His-PRO1868 protein) (FIG. 45). Further, an anti-PRO1868 antibody
(MaJIR1) was found to inhibit PRO245 dependent J45 adhesion, while
mouse IgG had no effect on adhesion (FIG. 52).
[0544] Accordingly, PRO245-interacting cell types were as follows:
CD56+ cells, including CD56+ NK cells, CD56+ CD3+ NK/T cells,
CD56+CD3+ CD8+ cytolytic T cells, PBDCs and J45 T cells. Further,
excess PRO1868 protein inhibited PRO245 binding to J45 and CD56+NK
cells, and anti-PRO1868 antibodies inhibited PRO245 binding to
CD56+ NK cells.
[0545] D. Plate-Based Adhesion Assay
[0546] For plate-based analysis of cells that are able to interact
with PRO245, microtitre wells (NUNC Maxisor 96-well plates; VWR,
Scientific Products, Brisbane, Calif.) were coated with conditions
at 50 .mu.l/well (in HBSS+), 10 .mu.l/ml for 2 hours at room
temperature, unless otherwise noted. For adhesion assays, 50 .mu.l
of 10 .mu.g/ml goat anti-human IgG1 Fc-specific Ab, for example
PRO245-human IgG fusion protein, was first coated and blocked
before the addition of conditions in binding/blocking buffer (BBB;
HBSS+containing 10% (v/v) FBS) for 1 hour at room temperature
before the addition of coating condition. Cells (5.times.10.sup.6
cells/ml in BBB) were treated (10 minutes at 37.degree. C. with 5%
CO.sub.2) with 5 mg/ml 2',7'-bis-(2-carboxyethyl)-5 (and
-6)-carboxyfluorescein, acetyoxymethyl esther (BCECF AM) (Molecular
Probes), washed, and allowed to adhere to coated wells
(2.times.10.sup.5 cells/well in BBB) for 1 hour at 37.degree. C./5%
CO.sub.2.
[0547] Plates were read on a SpectraMax fluorescence plate reader
(Molecular Devices, Sunnyvale, Calif.) for total applied
fluorescence, gently washed three times (by aspiration with a
28-gauge needle), and read for total adherent fluorescence.
Percentage of adherence was calculated using the following
equation: ((total fluorescence of adherent)/(total fluorescence of
applied)).times.100. Blank wells consisted of BBB-coated wells
exposed to BCECF AM-labeled J45 cells. Values obtained from the
blank wells (percentage of adherence) were subtracted from all
experimental conditions to derive a final value.
[0548] Using the plate-based adhesion assay, J45 T cells were found
to adhere to PRO245-human IgG fusion (VJ2.Fc) coated wells (FIG.
47). Anti-PRO245 antibodies, but not mouse IgG, inhibited adhesion
of J45 cells to PRO245-human IgG1 fusion protein, indicating that
the interaction is specific (FIG. 47).
Example 23
Identification of Receptors for PRO245
[0549] To identify the protein in PRO245-interacting cells that is
responsible for the interaction, immunoprecipitation studies were
performed.
[0550] A. CD56+ NK Cells and J45 Cells
[0551] To isolate the cell surface receptor on J45 or NK cells for
PRO245, PRO245 interacting cells were biotinylated and then lysed.
The supernatants from the lysed cells were subjected to
immunoprecipitation with a Fc-cross-linked PRO245-human IgG fusion
protein A matrix. The precipitates were analyzed by Western
blotting.
[0552] 1. Biotinylation
[0553] For biotinylated conditions, cells were first washed in
HBSS+ before being biotinylated (200 .mu.g/10.sup.6 cells) with
sulfo-NHS-LC-biotin for 30 minutes at 4.degree. C. Cells were
washed with TBS for 30 minutes at 4.degree. C. to quench the
biotinylation.
[0554] 2. Lysis
[0555] Cells were lysed (108 cells/ml) with lysis buffer (HBSS+
containing 1% Triton X-100 and 1 Complete-Mini EDTA free protease
inhibitor tablet (Roche Biochemicals, Indianapolis, Ind.) per 7 ml
of lysis buffer) for 30 minutes at 4.degree. C. Lysates were spun
at 22,000.times.g for 1 hour at 4.degree. C. and 0.2 .mu.m
filtered. Lysates were precleared for 2 hours at 4.degree. C. with
5 .mu.l/10.sup.6 cells of recombinant protein A beads (Amersham
Pharmacia Biotech).
[0556] 3. Immunoprecipitation
[0557] Cleared lysates were 0.2 .mu.m filtered and incubated for 2
hours at 4.degree. C. with 5 .mu.g/10.sup.6 cells of either
PRO245-human IgG fusion protein or human IgG1, conjugated to
protein A matrix using the ImmunoPure Protein A IgG Plus
Orientation kit (Pierce). Beads were pelleted and washed with lysis
buffer and denatured by the addition of 15 .mu.l/10.sup.6 cells of
nonreducing SDS sample buffer (Standard sample buffer with 2 mM
iodoacetamide, but without DTT or 2-mercaptoethanol) and boiled for
3 minutes at 100.degree. C.
[0558] 4. Western Blotting
[0559] Samples at a concentration of 15 .mu.l/lane were resolved on
a 4-20% Bio-Rad Tris-HCl Ready Gel (Bio-Rad, Hercules, Calif.) and
transferred onto 0.2-.mu.m Protran nitrocellulose membrane
(Schleicher & Schuell, Keene, N.H.) at 100 mA for 2 hours at
4.degree. C. Blots were blocked for 1 hour in Blotto (TBS
containing 5% nonfat milk and 0.05% TWEEN.TM. 20; Bio-Rad). For
biotinylated samples, HRP-conjugated streptavidin (Pierce) was used
at 0.5 .mu.g/ml for 30 minutes at room temperature. For
nonbiotinylated samples, anti-PRO1868 antibodies (MaJIR1) was used
at 10 .mu.g/ml in Blotto and incubated for 1 hour at 25.degree. C.
before the application of 1 .mu.g/ml HRP-conjugated goat anti-mouse
IgG (Caltag Laboratories, Burlingame, Calif.) in Blotto for 30
minutes at room temperature. Blots were washed thoroughly with TTBS
(TBS containing 0.05% Tween 20(and developed with the ECL Plus
reagent (Amersham Pharmacia Biotech) before exposing onto Kodak
BioMax ML film and development with Kodak M35A X-OMAT Film
Processor (Eastman Kodak).
[0560] 5. Results
[0561] Immunoprecipitation of biotinylated samples with an
Fc-cross-linked PRO245-human IgG fusion protein A matrix and
analysis by Western blotting allowed identification of a single
streptavidin-reactive band of about 40 kDa that interacts with
PRO245-human IgG fusion (FIG. 48). The 40 kDa band was not present
in immunoprecipitations performed with an Fc-cross-linked human IgG
protein A matrix, nor in PRO245-immunoprecipitations performed with
an Fc-cross-linked human IgG protein A matrix in the
non-PRO245-binding Ramos/HH B cell line.
[0562] To determine whether the 40 kDA band represented PRO1868,
immunoprecipitation was performed on non-biotinylated samples from
Ramos/HH cells (non-PRO245 interacting), MOLT4 cells (PRO245
binding) and PBMCs (PRO245 binding) with PRO245-human IgG fusion
protein A matrixes. The precipitates were analyzed by
immunoblotting with anti-PRO1868 antibodies. The immunoblotting
verified that the 40 kDa PRO245-interacting band represented
PRO1868 (FIG. 49).
[0563] 6. Confirmation of Binding Between PRO245 and PRO1868 by
ELISA
[0564] Using anti-PRO1868 antibodies, purified PRO245 and PRO1868
fusion proteins, an interaction between PRO245 and PRO1868 was
confirmed in a plate-based assay. Plate-bound PRO1868-Fc fusion
protein (JAM3.Fc) or a control human PRO301-Fc fusion protein
(huJAM.Fc) were exposed to biotinylated PRO245-Fc fusion protein in
the presence of 0.25 .mu.g/well mouse IgG or an anti-PRO1868 Ab
(FIG. 50). Streptavidin HRP was used to detect binding between the
PRO1868-Fc fusion protein-coated wells to PRO245-Fc biotin.
Alternatively, PRO245-Fc fusion was captured onto a plate, and
biotinylated PRO1868-Fc fusion was used at specific concentrations
to examine the PRO245-PRO1868 interaction (FIG. 51). Further,
inhibition of such a plate-based interaction between PRO245 and
PRO1868 by anti-PRO1868 antibodies and anti-PRO245 antibodies was
tested.
[0565] For ELISA, the plates were blocked after condition coating
with BBB for 30 minutes at room temperature and incubated with
binding conditions for 1 hour at room temperature. For conditions
requiring EDTA, a modified BBB (HBSS without calcium and magnesium
containing EDTA instead of the normal HBSS+) was used throughout
the experiment. Plates were washed three times, incubated with 1
.mu.g/ml streptavidin HRP (Pierce) for 30 minutes at room
temperature, and assessed via color development using the
tetramethylbenzidine substrate (Kirkegaard & Perry
Laboratories, Gaithersburg, Md.) and read on the ThermoMax
Microplate Reader (Molecular Devices).
[0566] An interaction between PRO245 and PRO1868 was identified
through the plate-based assays (FIGS. 50 and 51). FIG. 50 shows
that PRO1868.Fc (JAM3.Fc) coated wells demonstrated PRO245.Fc
binding while PRO301.Fc coated wells did not. Mouse IgG (MIgG) had
no effect on binding while the anti-PRO1868 antibody (MaJIR1)
inhibited PRO245 binding. When PRO245.Fc was bound to the plate
(FIG. 51), interaction of PRO245.Fc and PRO1868.Fc was again
observed. In addition, the anti-PRO1868 antibody MaJIR1 was again
able to inhibit the interaction, while the mouse IgG had no
effect.
[0567] B. Panel of Potential Receptors
[0568] PRO245 polypeptide was incubated with a panel of potential
receptor molecules for the purpose of identifying the
receptor/ligand interaction. The identification of a ligand for a
known receptor, a receptor for a known ligand or a novel
receptor/ligand pair is useful for a variety of indications
including, for example, targeting bioactive molecules (linked to
the ligand or receptor) to a cell known to express the receptor or
ligand, use of the receptor or ligand as a reagent to detect the
presence of the ligand or receptor in a composition suspected of
containing the same, wherein the composition may comprise cells
suspected of expressing the ligand or receptor, modulating the
growth of or another biological or immunological activity of a cell
known to express or respond to the receptor or ligand, modulating
the immune response of cells or toward cells that express the
receptor or ligand, allowing the preparation of agonists,
antagonists and/or antibodies directed against the receptor or
ligand which will modulate the growth of or a biological or
immunological activity of a cell expressing the receptor or ligand,
and various other indications which will be readily apparent to the
ordinarily skilled artisan.
[0569] A PRO245 polypeptide of the present invention suspected of
being a ligand for a receptor is expressed as a fusion protein
containing the Fc domain of human IgG (an immunoadhesin).
Receptor-ligand binding is detected by allowing interaction of the
PRO245 immunoadhesin polypeptide with cells (e.g., COS cells)
expressing candidate receptors, including the PRO1868 polypeptide
receptor, and visualization of bound immunoadhesin with fluorescent
reagents directed toward the Fc fusion domain and examination by
microscope. Cells expressing candidate receptors are produced by
transient transfection, in parallel, of defined subsets of a
library of cDNA expression vectors, for example, encoding PRO1868
polypeptides, that may function as receptor molecules. Cells are
then incubated for 1 hour in the presence of the PRO245 polypeptide
immunoadhesin being tested for possible receptor binding. The cells
are then washed and fixed with paraformaldehyde. The cells are then
incubated with fluorescent conjugated antibody directed against the
Fc portion of the PRO245 polypeptide immunoadhesin (e.g., FITC
conjugated goat anti-human-Fc antibody). The cells are then washed
again and examined by microscope. A positive interaction is judged
by the presence of fluorescent labeling of cells transfected with
cDNA encoding a particular PRO1868 polypeptide receptor or pool of
receptors and an absence of similar fluorescent labeling of
similarly prepared cells that have been transfected with other cDNA
or pools of cDNA. If a defined pool of cDNA expression vectors is
judged to be positive for interaction with a PRO245 polypeptide
immunoadhesin, the individual cDNA species that comprise the pool
are tested individually (the pool is "broken down") to determine
the specific cDNA that encodes a receptor able to interact with the
PRO245 polypeptide immunoadhesin.
[0570] In another embodiment of this assay, an epitope-tagged
potential ligand PRO245 polypeptide (e.g., 8 histidine "His" tag)
is allowed to interact with a panel of potential receptor
polypeptide molecules that have been expressed as fusions with the
Fc domain of human IgG (immunoadhesins). Following a 1 hour
co-incubation with the epitope tagged PRO245 polypeptide, the
candidate receptors are each immunoprecipitated with protein A
beads and the beads are washed. Potential ligand interaction is
determined by western blot analysis of the immunoprecipitated
complexes with antibody directed towards the epitope tag. An
interaction is judged to occur if a band of the anticipated
molecular weight of the epitope tagged protein is observed in the
western blot analysis with a candidate receptor, but is not
observed to occur with the other members of the panel of potential
receptors.
[0571] Using these assays, the following receptor/ligand
interactions have been herein identified: PRO245 (DNA35638-1141)
binds to PRO1868 (DNA77624-2515).
[0572] C. JAM Family Proteins
[0573] Flow cytometry analysis was performed to further investigate
the interactions of members of the JAM protein family. PRO245 was
expressed in CHO cells as described in Example 14. The
PRO245-expressing CHO cells were then incubated with His-tagged JAM
proteins, including PRO245, PRO301, and PRO1868. Binding of
His-tagged PRO362, PRO1868 or PRO301 proteins to PRO245-expressing
CHO cells were analyzed by flow cytometry.
[0574] For binding of PRO1868 to PRO245-expressing CHO cells, 5
.mu.g/ml of PRO1868-HIS (SHATr.His) tagged protein was incubated
with PRO245-expressing CHO cells. PRO1868 (SHATr.His) was able to
interact with PRO245-expressing CHO cells (FIG. 54). Varying
competitor proteins were examined for their ability to inhibit
binding of PRO1868 to PRO245. PRO1868 protein (SHATr.His) and
anti-PRO245 antibody (12D10.2F9) were able to compete with
PRO1868-HIS tagged protein for binding of PRO245 on the surface of
CHO cells (FIG. 54). In contrast, PRO301.Fc, PRO362.Fc, mouse IgG
and His control were not able to inhibit binding (FIG. 54).
[0575] Based on the results described above, PRO245 interacts with
PRO1868.
Example 24
Involvement of STIGMA (PRO362) in Chronic Inflammation
[0576] The novel macrophage associated receptor with homology to
A33 antigen and JAM1 was cloned as described in Example 2 and
below, and was identified as a single transmembrane Ig superfamily
member macrophage associated (STIgMA or PRO362 or JAM4).
[0577] STIgMA is expressed as two spliced variants, one containing
an N-terminal IgV like domain and a C-terminal IgC2 like domain and
a spliced form lacking the C-terminal domain. Both receptors have a
single transmembrane domain and a cytoplasmic domain containing
tyrosine residues which are constitutively phosphorylated in
macrophages in vitro.
[0578] The present study demonstrates that STIgMA is selectively
expressed on a subset of tissue resident macrophages, and is
associated with chronic inflammation.
Materials and Methods
[0579] Cells
[0580] Blood was obtained from healthy adult volunteers by venous
puncture and separated using Ficoll-Paque PLUS (Amersham Pharmacia
Biotech) per manufacturers instruction. PBMCs were obtained from
the interface, washed in cold PBS, lysed with 0.2% NaCl for 30 s
and neutralized with 1.6% NaCl. Cells were counted and kept on ice
until use. To isolate peripheral blood subsets, untouched MACS kits
(Miltenyi Biotech, Auburn, Calif.) were used following the
manufacturers instructions. To culture differentiated macrophages,
negatively selected monocytes were transferred to 6 well culture
dishes in HGDMEM containing 20% fetal bovine serum and 10% human
serum. Medium was replaced at day 5. For flow cytometric analysis,
cells were dissociated from the culture dish using ice-cold cell
dissociation solution (Sigma). Lysates for Western blot analysis
were prepared by adding 0.5 ml lysis buffer directly to the wells.
Lysates were mixed with sample buffer containing SDS and
beta-mercaptoethanol, run on a Tris-Glycine gel and transferred to
a nitrocellulose membrane.
[0581] Flow Cytometry
[0582] Cells for use in flow cytometric analysis were blocked for
30 min at 4 C with PBS containing 2% fetal bovine serum and 5
.mu.g/ml human IgG (Calbiochem, San Diego, Calif.). Nex, cells were
incubated with 3C9, an anti-STIgMA (anti-PRO362) monoclonal
antibody. After washing in PBS, cells were stained with
phycoerythrin (PE)-conjugated antibodies to CD11b, CD14, CD163,
CD15, CD68 were obtained from Pharmingen.
[0583] Cell-Cell Adhesion Studies
[0584] A pRK expression vector containing full length STIgMA was
stably expressed in a human Jurkat T-cell line using neomycin
selection and autoclone sorting as described elsewhere. Cells were
preloaded with the fluorescent dye BCECF (Molecular Probes, Oregon)
and added to a 96 well Maxisorb plate (CORNING.TM.) coated with a
monolayer of human umbilical vein endothelial cells (HUVEC) treated
with or without 10 ng/ml TNFalpha. Cells were gently washed by
loading the wells with incubation buffer (HBSS contained 10 mM
CaCl, 10 mM magnesium and 1.5 mM NaCl) followed by inverting the
plate on a piece of blotting paper. After 3 washes, fluorescence
was counted in a fluorospectrometer. The fluorescent readout is
representative of the number of cells that remain adherent to the
HUVEC cells.
[0585] Northern Blot Analysis
[0586] Multiple tissue Northern blots (CLONTECH) were probed with a
.sup.32P labeled probe of random-primed full-length STIgMA cDNA
using Ambion kit according to manufacturers recommendations. Blots
were exposed to a phosphorimaging screen and analyzed with a Storm
phosphorimager.
[0587] Real Time RtPCR analysis
[0588] For quantitative PCR analysis (TAQMAN.TM.), total mRNA from
human tissues or primary cells (100 ng) was recommended
(PerkinElmer Life Sciences) with primers based on the coding
sequence of STIgMA.
Fc- and His-Fusion Protein Production
[0589] Human STIgMA was cloned into the baculovirus expression
vector pHIF (Pharmingen). The HIS-tagged STIgMA fusion protein
consisted of the extracellular domain of STIgMA fused to 8
histidines. His-tagged fusion protein was purified from the
supernatant of baculovirus-infected insect cells grown in
suspension using nickel affinity resin.
[0590] Monoclonal and Polyclonal Antibody Production
[0591] BALBc females were immunized and boosted with 10 .mu.g
STIgMA-His8 via footpad injections, as previously described. Single
clones were screened against STIgMA (PRO362)-His by ELISA. Selected
clones selected clones were tested against JAM family members and
human IgG Fc. Clones were titrated out to single cell densities and
rescreened. Clone 3C9 (IgG1) was found to be selectively reactive
to STIgMA. Clones were used for ascites generation and purified
over protein G (Amersham Pharmacia Biotech); protein concentration
was determined using the Pierce BCA reagent (Pierce, Rockford,
Ill.).
[0592] Polyclonal antibodies were generated by injecting 150 .mu.g
STIgMA-His in New Zealand Rabbits. Serum titers were determined by
ELISA. Serum was collected at the peak of circulating IgG levels
and purified over a protein A column.
In Situ Hybridization
[0593] PCR primers (upper 5'-TCTCTGTCTCCAAGCCCACAG (SEQ ID NO: 35),
and lower, 5'-CTTTGAGGAGTCTTTGACC (SEQ ID NO: 36)) were designed to
amplify a 700 bp fragment of huJAM4. Primers included T7 or T3 RNA
polymerase initiation sites to allow for in vitro transcription of
sense or antisense probes, respectively, from the amplified
products. Normal human tissues included tonsil, lymph node, spleen,
kidney, lung and heart. Tissues with chronic inflammatory disease
included lung with chronic asthma, chronic bronchitis, livers with
chronic inflammation and cirrhosis due to chronic hepatitis C
infection. Tissues were fixed in 4% formalin, paraffin embedded,
sectioned (3-5 .mu.m thick) deparaffinized, deproteinated with 20
.mu.g/ml proteinase K (15 min at 37.degree. C.) and processed for
in situ hybridization as described elsewhere.
[0594] Immunohistochemistry
[0595] Immunohistochemical staining was performed on 5-.mu.m thick
frozen sections using a DAKO autostainer. Endogenous peroxidase
activity was blocked with Kirkegaard and Perry blocking solution
(1:10, 4 min 20.degree. C.). Normal goat serum (NGS) at 10% in
TBS/0.05% Tween-20 was used for dilution and blocking. Mab 3C9 was
used at 1 ug/ml. Slides were developed using metal-enhanced
diaminobenzidine (Pierce Chemicals).
[0596] For immunofluoresence staining of sections, sections were
blocked with PBS/10% NGS and incubated with mAb 3C9 for 1 hr at
20.degree. C. A rabbit-anti mouse FITC-labeled secondary antibody
conjugated to FITS was used as detections agent. For double
staining procedure, sections were subsequently stained with a
PE-conjugated monoclonal antibody to human CD68.
Results
[0597] Molecular Cloning of Human STIgMA
[0598] HuSTIgMA was cloned from a human fetal cDNA library using
degenerate primers recognizing conserved Ig domains of human JAM1.
Sequencing of several clones revealed an open reading frame of 400
amino acids. Blast searches confirmed similarity to Z39Ig, a type 1
transmembrane protein (Langnaese et al., Biochim Biophys Acta 1492
(2000) 522-525. The extracellular region of STIgMA consisted of 2
Ig-like domains, comprising an N-terminal V-set domain and a
C-terminal C2-set domain. Using 3' and 5' primers, a splice variant
of STIgMA, STIgMA short which lacks the membrane proximal IgC
domain and is 50 amino acids shorter was cloned.
[0599] Cloning of Murine STIgMA and Sequence Comparison with Human
STIgMA
[0600] The murine expressed sequence tags (EST) database was
searched using the full open reading frame of huSTIgMA (PRO362) and
the tblastn algorithm. DNA sequencing of 3 clones gave rise to
identical complete open reading frames of 280 amino acids. Primers
to the 3 prime regions were used to clone a full length transcript
from a mouse spleen library. The murine clone resembled the spliced
form of hu STIgMA in that, it lacked the C-terminal Ig-like domain.
The extracellular IgV-domain was well conserved between the human
and murine receptor with 93% identity. The murine cytoplasmic
domain was poorly conserved being 20 amino acids shorter than its
human counterpart and was 40% identical.
[0601] STIgMA is Expressed on a Subset of Resident Macrophages in
Diverse Tissues and its Expression is Increased in Inflammation
[0602] Northern blot analysis of huSTIgMA showed two transcripts of
1.8 and 2.2 kb (FIG. 57) with highest expression in the adrenal
gland, lung and placenta, and lower expression in heart, spinal
chord, thyroid gland, mammary gland and lymph node. In all tissues,
the 2.2 kb transcript was the most abundantly expressed transcript
and presumably, encodes the long form of STIgMA.
[0603] TAQMAN.TM. Real-Time PCR Analysis
[0604] To identify specific cell lines expressing STIgMA, real-time
quantitative PCR and primers/probes specific for the N-terminal Ig
domain was used. Low but detectable mRNA expression was found in
the myeloid cell line HL-60 treated with PMA and the monocytic cell
line THP-1. Expression was absent in B- and T-cell lines (FIG.
58A).
[0605] STIgMA (PRO362) Expression on Differentiated Monocytes.
[0606] In order to establish details of when STIgMA was expressed
in differentiating monocytes/macrophages, we determined STIgMA mRNA
levels in non-adherent monocytes and in adherent monocytes, induced
to differentiate in the presence of human autologous serum. STIgMA
mRNA levels gradually increased over time and reached maximum
levels at 7 days following plating (FIG. 58B). At this
differentiation stage, mRNA levels were 100 fold higher as compared
to those in undifferentiated monocytes.
[0607] Western blotting of monocyte/macrophage lysates showed an
increase in STIgMA protein expression (FIG. 58C) in parallel with
the increase in STIgMA mRNA expression, indicating that STIgMA was
expressed when monocytes differentiated to form macrophages. A band
of 48 kDa and a band of 40 kDa appeared on the blot, presumably
representing the long and the short forms of human STIgMA.
[0608] Molecular Characterization of STIgMA (PRO362)
[0609] STIgMA migrated similarly under reduced and non-reduced
conditions indicating that it was expressed as a monomer (FIG.
59A). Only slight changes in migration patterns were observed when
STIgMA was deglycosylated using PNGase F, indicating insignificant
N-glycosylation. STIgMA was phosphorylated when STIgMA
overexpressing cells were treated with pervanadate (FIG. 59B).
Phosphorylated STIgMA migrated as a slightly higher Mw protein (55
kDa). In human HEK 293 cells, tyrosine-phosphorylated STIgMA
cytoplasmic domain does not recruit Syk kinase (results not
shown).
[0610] Flow Cytometry Analysis of STIgMA Expression on Peripheral
Blood Mononuclear Cells
[0611] In order to determine the expression pattern of STIgMA in
circulating leukocytes, flow cytometric analysis was performed on
lymphocytes isolated from blood from a healthy donor using
monoclonal anti-human STIgMA antibody 3C9 directly conjugated with
ALEXA.TM. A488. Counterstaining was performed with PE conjugate
antibodies to several immune-cell surface antigens. STIgMA was
absent on the surface of all leukocytes, including B- T- Nk cells,
monocytes and granulocytes (FIG. 60). STIgMA was however expressed
on monocytes cultured for 7 days in macrophage differentiation
medium.
[0612] Regulation of STIgMA Expression in Monocytes
[0613] In order to study the regulation of expression of STIgMA, 7
day macrophages were cultured in the presence of various pro-and
anti-inflammatory cytokines and STIgMA expression levels were
determined by real-time PCR or flow analysis. Expression of STIgMA
mRNA was increased after treatment of macrophages for 2 days with
IL-10 and TGF-.beta. and down regulated by IL-4, IL13 and LPS (FIG.
61A). Treatment with dexamethasone increased expression to 5 fold
compared to control non-treated macrophages. In order to determine
the regulation of cell-surface expressed STIgMA, flow cytometry was
performed on peripheral blood monocytes treated with various
cytokines and dexamethasone for 5 days. STIgMA was detected using
monoclonal antibody clone 3C9 conjugated to ALEXA.TM. A488. Cells
were co-stained with anti CD-14 antibodies. Increased surface
expression of STIgMA was found following treatment of monocytes
with IL-10 and LPS for 5 days (FIG. 61B). A dramatic increase in
surface STIgMA expression was found after treatment with
dexamethasone.
Subcellular Distribution of STIgMA
[0614] In order to study the subcellular distribution of STIgMA,
MDMs were kept in culture for 15 days after which they were fixed
and stained with a monoclonal antibody (clone 3C9) or polyclonal
rabbit antibody 4F7 followed by FITC conjugated secondary antibody
and a PE-labeled anti CD63 antibody. Confocal microscopy showed
high expression of STIgMA in the perinuclear cytoplasm, overlapping
with the expression of the lysosomal membrane protein CD63 (FIG.
62A,B). STIgMA was also expressed in the leading and trailing edges
of the macrophages where its staining pattern did not overlap with
that of CD63.
[0615] Expression of STIgMA in Normal and Disease Tissues
[0616] STIgMA expression in tissue resident macrophages and changes
in its expression in tissues with chronic inflammatory diseases was
studied. Using in situ hybridization, STIgMA mRNA expression was
determined on panels of paraformaldehyde-fixed human tissues. High
expression levels were found in alveolar macrophages obtained from
a lung autopsy of a patient with pneumonia or chronic asthma (FIG.
63A-D). High mRNA expression was found in Kupffer cells in the
liver of a patient with chronic hepatitis (FIG. 63E, F).
[0617] In a previous study (Walker, Biochimica et Biophysica Acta
1574 (2002) 387-390), and in electronic screening of libraries,
high expression of STIgMA mRNA was found in the synovium of
patients with rheumatoid arthritis. Therefore, the expression
pattern of STIgMA in synovium obtained from patients with
rheumatoid arthritis, osteoarthritis and degenerative bone disease
was studied. High expression of STIgMA mRNA was found in synovial
cells obtained from a patient with osteoarthritis (FIG. 64A-D).
Synovial cells in the superficial layers had the highest expression
of STIgMA (FIG. 64D). In addition, polyclonal antibody 6F1 was used
to study STIgMA expression in frozen sections of human synovium
obtained from a patient with rheumatoid arthritis. STIgMA was
expressed in a subset of synovial cells (20-40%) and in tissue
macrophages in the synovium (FIG. 65A-C). These cells were, most
likely, type A macrophage-like synovial cells. Staining was absent
in control synovium (FIG. 65D).
[0618] Expression of STIgMA protein was found on macrophages in a
number of different tissues. Frozen sections prepared from CHO
cells stably expressing STIgMA show membrane localization of STIgMA
(FIG. 66A). STIgMA protein was found in alveolar macrophages (FIG.
66B), histiocytes in the lamina propria of the small intestine
(FIG. 66C), Hofbauer cells in the placenta (FIG. 66D),
macrophagesin the adrenal gland (FIG. 66E) and Kupffer cells in the
liver (FIG. 66F).
[0619] Atherosclerotic plaques contained a high number of
macrophages or macrophage-foam cells that adhered tightly to the
luminal wall of the aorta. Considering a role for STIgMA in
macrophage-endothelium adhesion, the expression of STIgMA in
atherosclerotic plaques was studied. Alternate sections of plaques
were stained with anti CD63 (FIGS. 67A and B) or anti-STIgMA (FIGS.
67C and D). Overlapping staining patterns of anti-CD63 and STIgMA
was found on foam cells aligning the vessel wall indicating a role
for STIgMA in atherosclerosis.
[0620] In order to determine whether STIgMA was selectively
expressed on macrophages, double staining immunofluorescence was
performed on heart interstitial macrophages (FIG. 68). As shown in
the overlay (FIG. 68C) most of the interstitial macrophages
positive for STIgMA were also positive for CD68. Not all CD68
positive macrophages were positive for STIgMA, indicating that the
latter was specific for a subtype of tissue resident
macrophages.
[0621] In order to quantitatively determine mRNA expression levels
in inflammatory bowel disease (IBD) syndrome, mRNA was extracted
from colon tissue obtained from patients with ulcerative colitis,
Crohn's disease or from patients with no manifestation of IBD. Real
time PCR was performed using primers specific for STIgMA, to
measure relative expression levels. Expression levels were 16 fold
higher in a patient with ulcerative colitis and, 5 fold higher in a
patient with Crohn's disease, as compared to control tissue (FIG.
69A). Similarly, relative RNA equivalents were determined in lung
tissue and was found to be highest in tissue from a patient with
chronic occlusive pulmonary disease (COPD: 14 fold over normal) and
was not significantly different from normal in a patient with
asthma (FIG. 69B).
[0622] Molecules of the Ig superfamily are well known to mediate
cell surface recognition and cell-cell adhesion. Since STIgMA
expression was high in interstitial macrophages aligning blood
vessels, STIgMA involvement in macrophage-endothelial cell adhesion
was studied. A Jurkat cell line, stably transfected with full
length STIgMA-long (FIG. 70A) was loaded with the fluorescent dye
BCECF and added to the wells of a 96 well maxisorb plate on which a
monolayer of HUVEC cells had been cultured. Adhesion was measured
by the amount of fluorescence retained after 3 gentle washes.
Jurkat cells expressing STIgMA were more adherent to both, control
and TNF.alpha. stimulated endothelium, as compared to Jurkat cells
stably transfected with a control plasmid (FIG. 70B).
Discussion
[0623] This study, for the first time, described the tissue
distribution, regulation of expression and molecular
characterization of a novel Ig superfamily member STIgMA/Z39Ig and
confirmed its selective expression in tissue resident
macrophages.
[0624] STIgMA expression was found on resident macrophages which
had a fully differentiated phenotype. Its expression was increased
in tissues with chronic inflammation like, rheumatoid arthritis and
inflammatory bowel disease. The increase of STIgMA expression in
these diseases, which was often characterized as Th2 type diseases,
may be in line with the regulation of its expression by Th2
cytokines in vitro. Whether this increased expression is due to an
increased presence of STIgMA positive macrophages or an increased
expression on the inflammatory macrophages has yet to be
determined.
[0625] STIgMA may mediate one of the effector functions of human
macrophages, which include bacterial recognition, phagocytosis,
antigen presentation and cytokine release. However, so far, no
evidence was found for its role in any of these processes. STIgMA
contained 3 tyrosine residues in its cytoplasmic domain which can
be phosphorylated by tyrosine kinases. Therefore, STIgMA may act as
a receptor. So far, no ligand has been found for STIgMA.
[0626] These results indicated a role for STIgMA in adhesion, and
possibly motility, of macrophages to the endothelial cell wall of
vessels.
[0627] STIgMA expression was increased in non-microbial
inflammatory diseases like ulcerative colitis and chronic occlusive
pulmonary disease (COPD) but was downregulated in isolated
macrophages upon treatment with LPS or other bacterial cell wall
components like lipoteichoic acid and bacterial lipoprotein. Long
term treatment, over 2 days, with LPS caused an increase in the
expression of STIgMA. This could be due to an autocrine effect of
IL-10 secreted by LPS-stimulated macrophages. A striking
up-regulation of STIgMA, both at the mRNA and protein levels, was
observed upon treatment of monocytes or macrophages with
dexamethasone. Few monocyte/macrophage surface receptors have been
found to increase in expression upon dexamethasone treatment. One
example is CD163, but its induction by dexamethasone is far less
dramatic. The up-regulation of STIgMA by anti-inflammatory
cytokines IL10 and TGF.beta. was of considerable interest and
indicates that STIgMA may mediate the anti-inflammatory role of
glucocorticosteroids.
[0628] As described here, STIgMA was expressed on a subset of CD68
positive macrophages which may represent activated macrophages.
Using blocking and activating antibodies to STIgMA and STIgMA-Fc
fusion protein, its role in macrophage effector function, adhesion
and migration and its role in chronic inflammatory diseases has
been investigated, and is described in Example 25.
[0629] Only few cell surface markers were specifically expressed on
differentiated macrophages, such as CD68 and CD163. Although CD68
was apparently expressed on all human macrophage populations, the
antigen could also be detected on other myeloid cells and also on
certain non-myeloid cells. Therefore, STIgMA represented the first
cell surface antigen selectively expressed on a subset of
interstitial mature macrophages.
Example 25
STIGMA Fusion Proteins in Collagen-Induced Arthritis (CIA) in
DBA-1J Mice
[0630] This experiment aimed to compare STIgMA fusion proteins to
control murine IgG1 in the development of disease and progression
of CIA (collagen-induced arthritis, an experimental animal model
system of rheumatoid arthritis).
[0631] As discussed in Example 24, STIgMA is highly and
specifically expressed on a subset of macrophages and is elevated
in tissues with chronic inflammation. Murine STIgMA is highly
expressed in macrophages and synoviocytes in inflamed joints of
mice with collagen-induced arthritis. In vitro studies have shown
that STIgMA is involved in adhesion of macrophages to endothelium.
STIgMA-Fc fusion protein influences the course of an autoimmune
disease, in this case collagen-induced arthritis in mice, either by
influencing the properties of tissue macrophages or by influencing
immune response of other cells (e.g., T cells, B cell, epithelial
cells, endothelial cells). This may result in alleviation of
inflammation, swelling and long term bone erosion in joints.
Animal Model Species: Mouse
Strain(s): DBA-1J
Supplier(s): JACKSON
Age Range: 7 to 8 week old
Pain Category: 3--These procedures cause more than minimal or
transient pain and/or distress but cannot be performed using
anesthetics, analgesics or tranquilizers without adversely
affecting the study.
[0632] The mouse was chosen as the species to study CIA because CIA
is an inflammatory polyarthritis with clinical and pathological
features similar to human RA (rheumatoid arthritis). This animal
model has been used by many laboratories and the histopathology of
CIA resembles those seen in RA with synovial proliferation that
progresses to pannus formation, cartilage degeneration/destruction
and marginal bone erosions with subsequent joint deformities. Also,
mouse is phylogenetically the lowest mammal.
[0633] Also, there is no in vitro model available to mimic the
complex, multifactorial pathogenesis of RA (Rheumatoid
Arthritis).
Experimental Design
[0634] Treatment Groups:
[0635] 1) mIgG1 isotype 6 mg/kg in 200 .mu.l saline subcutaneous
(SC) 3 times/wk for 7 weeks (n=8).
[0636] 2) muSTIgMA (PRO362) 4 mg/kg in 100 .mu.l saline SC 3
times/wk for 7 weeks (n=8).
[0637] Mice were immunized interdermally with bovine CII (100 ug,
Sigma, St Louis) emulsified in CFS (Difco). Mice were rechallenged
with CII in IFA (Difco) 21 days later. Starting on day 24, one
group of mice (n=7) was given 100 ug muSTIgMA (PRO362) Fc three
times per week for 6 weeks, and the second group (n=8) received 100
ug of murine IgG1, as a control. Mice were examined daily for signs
of joint inflammation and scored as follows: 0, normal; 1, erythema
and mild swelling confined to the ankle joint; 2, erythema and mild
swelling extending from the ankle to metatarsal and metacarpal
joints;, 3 erythema and moderate swelling extending from the ankle
to metatarsal or metacarpal joints. 4, erythema and severe swelling
extending from the ankle to the digits. The maximum arthritic score
per paw was 4, and the maximal score per mouse was 16 (FIG.
71).
[0638] All mice were immunized with 100 .mu.g bovine collagen type
II in 100 .mu.l complete Freunds Adjuvant (CFA) on day 0. Collagen
type II in CFA was injected intradermally at the base of the tail
on the right side. On day 21, a 2nd immunization with 100 .mu.g
bovine collagen type II in 100 .mu.l of incomplete Freunds adjuvant
was given i.d. at the left side of the tail. Animals were checked
daily (M-F) by the investigative staff. Nestlets were used as an
enrichment device, and to provide extra padding for the animals. If
necessary, moistened food was provided at the bottom of the cages.
Debilitated animals were sacrificed after consultation with the
veterinary staff. Terminal faxitron X-Rays and microCT were taken
at the end of study and joint lesion/erosion was evaluated. In
addition, animals were weighed before treatment and at
termination.
[0639] On day 35 and at the termination of the study, mice in
Groups 1 to 8 were bled for serum pK and to determine anti-collagen
type II antibody titer (100 .mu.l orbital bleed).
[0640] On day 70 all mice were terminally bled intracardially under
3% isoflurane for a terminal hemogram, for a differential leukocyte
count and for serum pK (G3) evaluation.
[0641] The mice were euthanized at day 70, post induction of
arthritis. All four limbs were collected for radiographs, 5CT and
histopathology.
[0642] Housing and Diet for Animals
[0643] Cotton pad and moistened feed was provided on the floor of
the cage to promote access to food and comfort.
Drugs Used For Restraint
[0644] Isoflurane--inhalation to effect
[0645] Euthanasia Methods: Exsanguination by Cardiac Puncture
(Percutaneous) Under Anesthesia
[0646] Isoflurane--inhalation to effect
Results
[0647] Systemic injection of the STIgMA fusion protein,
muSTIgMA-Fc, into a collagen-induced arthritic mouse (animal model
for rheumatoid arthritis) showed significant (see FIG. 71:
p-value=0.0004) reduction in the progression of CIA in the test
group of mice that received the STIgMA fusion protein (squares)
versus the control group of mice that received IgG1 (circles).
Deposit of Material
[0648] The following materials have been deposited with the
American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209, USA (ATCC): TABLE-US-00012 Designation
ATCC Dep. No. Deposit Date pRK5-based plasmid 209432 Nov. 7, 1997
DNA40628-1216 DNA45416-1251 209620 Feb. 5, 1998 DNA35638-1141
209265 Sep. 16, 1997 DNA77624-2515 203553 Dec. 22, 1998
[0649] These deposits were made under the provisions of the
Budapest Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposit will be made available by ATCC under the terms
of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC '122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn. 1.14
with particular reference to 8860G 638).
[0650] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0651] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
36 1 299 PRT Homo sapiens 1 Met Gly Thr Lys Ala Gln Val Glu Arg Lys
Leu Leu Cys Leu Phe Ile 1 5 10 15 Leu Ala Ile Leu Leu Cys Ser Leu
Ala Leu Gly Ser Val Thr Val His 20 25 30 Ser Ser Glu Pro Glu Val
Arg Ile Pro Glu Asn Asn Pro Val Lys Leu 35 40 45 Ser Cys Ala Tyr
Ser Gly Phe Ser Ser Pro Arg Val Glu Trp Lys Phe 50 55 60 Asp Gln
Gly Asp Thr Thr Arg Leu Val Cys Tyr Asn Asn Lys Ile Thr 65 70 75 80
Ala Ser Tyr Glu Asp Arg Val Thr Phe Leu Pro Thr Gly Ile Thr Phe 85
90 95 Lys Ser Val Thr Arg Glu Asp Thr Gly Thr Tyr Thr Cys Met Val
Ser 100 105 110 Glu Glu Gly Gly Asn Ser Tyr Gly Glu Val Lys Val Lys
Leu Ile Val 115 120 125 Leu Val Pro Pro Ser Lys Pro Thr Val Asn Ile
Pro Ser Ser Ala Thr 130 135 140 Ile Gly Asn Arg Ala Val Leu Thr Cys
Ser Glu Gln Asp Gly Ser Pro 145 150 155 160 Pro Ser Glu Tyr Thr Trp
Phe Lys Asp Gly Ile Val Met Pro Thr Asn 165 170 175 Pro Lys Ser Thr
Arg Ala Phe Ser Asn Ser Ser Tyr Val Leu Asn Pro 180 185 190 Thr Thr
Gly Glu Leu Val Phe Asp Pro Leu Ser Ala Ser Asp Thr Gly 195 200 205
Glu Tyr Ser Cys Glu Ala Arg Asn Gly Tyr Gly Thr Pro Met Thr Ser 210
215 220 Asn Ala Val Arg Met Glu Ala Val Glu Arg Asn Val Gly Val Ile
Val 225 230 235 240 Ala Ala Val Leu Val Thr Leu Ile Leu Leu Gly Ile
Leu Val Phe Gly 245 250 255 Ile Trp Phe Ala Tyr Ser Arg Gly His Phe
Asp Arg Thr Lys Lys Gly 260 265 270 Thr Ser Ser Lys Lys Val Ile Tyr
Ser Gln Pro Ser Ala Arg Ser Glu 275 280 285 Gly Glu Phe Lys Gln Thr
Ser Ser Phe Leu Val 290 295 2 321 PRT Homo sapiens 2 Met Gly Ile
Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val Asp 1 5 10 15 Thr
Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr Gly Pro 20 25
30 Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro Leu Gln Gly
35 40 45 Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln Arg Gly Ser
Asp Pro 50 55 60 Val Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp His
Ile Gln Gln Ala 65 70 75 80 Lys Tyr Gln Gly Arg Leu His Val Ser His
Lys Val Pro Gly Asp Val 85 90 95 Ser Leu Gln Leu Ser Thr Leu Glu
Met Asp Asp Arg Ser His Tyr Thr 100 105 110 Cys Glu Val Thr Trp Gln
Thr Pro Asp Gly Asn Gln Val Val Arg Asp 115 120 125 Lys Ile Thr Glu
Leu Arg Val Gln Lys Leu Ser Val Ser Lys Pro Thr 130 135 140 Val Thr
Thr Gly Ser Gly Tyr Gly Phe Thr Val Pro Gln Gly Met Arg 145 150 155
160 Ile Ser Leu Gln Cys Gln Ala Arg Gly Ser Pro Pro Ile Ser Tyr Ile
165 170 175 Trp Tyr Lys Gln Gln Thr Asn Asn Gln Glu Pro Ile Lys Val
Ala Thr 180 185 190 Leu Ser Thr Leu Leu Phe Lys Pro Ala Val Ile Ala
Asp Ser Gly Ser 195 200 205 Tyr Phe Cys Thr Ala Lys Gly Gln Val Gly
Ser Glu Gln His Ser Asp 210 215 220 Ile Val Lys Phe Val Val Lys Asp
Ser Ser Lys Leu Leu Lys Thr Lys 225 230 235 240 Thr Glu Ala Pro Thr
Thr Met Thr Tyr Pro Leu Lys Ala Thr Ser Thr 245 250 255 Val Lys Gln
Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr Leu Gly 260 265 270 Glu
Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala Ile Ile 275 280
285 Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met Ala Tyr Ile
290 295 300 Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr Glu
Ala Ala 305 310 315 320 Arg 3 390 DNA Homo sapiens 3 cttcttgcca
actggtatca ccttcaagtc cgtgacacgg gaagacactg ggacatacac 60
ttgtatggtc tctgaggaag gcggcaacag ctatggggag gtcaaggtca agctcatcgt
120 gcttgtgcct ccatccaagc ctacagttaa catcccctcc tctgccacca
ttgggaaccg 180 ggcagtgctg acatgctcag aacaagatgg ttccccacct
tctgaataca cctggttcaa 240 agatgggata gtgatgccta cgaatcccaa
aagcacccgt gccttcagca actcttccta 300 tgtcctgaat cccacaacag
gagagctggt ctttgatccc ctgtcagcct ctgatactgg 360 agaatacagc
tgtgaggcac ggaatgggta 390 4 726 DNA Homo sapiens Homo sapiens 4
tctcagtccc ctcgctgtag tcgcggagct gtgttctgtt tcccaggagt ccttcggcgg
60 ctgttgtgct caggtgcgcc tgatcgcgat ggggacaaag gcgcaagctc
gagaggaaac 120 tgttgtgcct cttcatattg gcgatcctgt tgtgctccct
ggcattgggc agtgttacag 180 ttgcactctt ctgaacctga agtcagaatt
cctgagaata atcctgtgaa gttgtcctgt 240 gcctactcgg gcttttcttc
tccccgtgtg gagtggaagt ttgaccaagg agacaccacc 300 agactcgttt
gctataataa caagatcaca gcttcctatg aggaccgggt gaccttcttg 360
ccaactggta tcaccttcaa gtccgtgaca cgggaagaca ctgggacata cacttgtatg
420 gtctctgagg aaggcggcaa cagctatggg gaggtcaagg tcaagctcat
cgtgcttgtg 480 cctccatcca agcctacagt taacatcccc tcctctgcca
ccattgggaa ccgggcagtg 540 ctgacatgct cagaacaaga tggttcccca
ccttctgaat acacctggtt caaagatggg 600 atagtgatgc ctacgaatcc
caaaagcacc cgtgccttca gcaactcttc ctatgtcctg 660 aatcccacaa
caggagagct ggtctttgat cccctgtcag cctctgatac tggagaatac 720 agctgt
726 5 1503 DNA Homo sapiens Homo sapiens 5 gcaggcaaag taccagggcc
gcctgcatgt gagccacaag gttccaggag atgtatccct 60 ccaattgagc
accctggaga tggatgaccg gagccactac acgtgtgaag tcacctggca 120
gactcctgat ggcaaccaag tcgtgagaga taagattact gagctccgtg tccagaaact
180 ctctgtctcc aagcccacag tgacaactgg cagcggttat ggcttcacgg
tgccccaggg 240 aatgaggatt agccttcaat gccagggttc ggggttctcc
tcccatcagt tatatttggt 300 ataagcaaca gactaataac cagggaaccc
atcaaagtag caaccctaag taccttactc 360 ttcaagcctg cggtgatagc
cgactcaggc tcctatttct gcactgccaa gggccaggtt 420 ggctctgagc
agcacagcga cattgtgaag tttgtggtca aagactcctc aaagctactc 480
aagaccaaga ctgaggcacc tacaaccatg acatacccct tgaaagcaac atctacagtg
540 aagcagtcct gggactggac cactgacatg gatggctacc ttggagagac
cagtgctggg 600 ccaggaaaga gcctgcctgt ctttgccatc atcctcatca
tctccttgtg ctgtatggtg 660 gtttttacca tggcctatat catgctctgt
cggaagacat cccaacaaga gcatgtctac 720 gaagcagcca gggcacatgc
cagagaggcc aacgactctg gagaaaccat gagggtggcc 780 atcttcgcaa
gtggctgctc cagtgatgag ccaacttccc agaatctggg gcaacaacta 840
ctctgatgag ccctgcatag gacaggagta ccagatcatc gcccagatca atggcaacta
900 cgcccgcctg ctggacacag ttcctctgga ttatgagttt ctggccactg
agggcaaaag 960 tgtctgttaa aaatgcccca ttaggccagg atctgctgac
ataattgcct agtcagtcct 1020 tgccttctgc atggccttct tccctgctac
ctctcttcct ggatagccca aagtgtccgc 1080 ctaccaacac tggagccgct
gggagtcact ggctttgccc tggaatttgc cagatgcatc 1140 tcaagtaagc
cagctgctgg atttggctct gggcccttct agtatctctg ccgggggctt 1200
ctggtactcc tctctaaata ccagagggaa gatgcccata gcactaggac ttggtcatca
1260 tgcctacaga cactattcaa ctttggcatc ttgccaccag aagacccgag
gggaggctca 1320 gctctgccag ctcagaggac cagctatatc caggatcatt
tctctttctt cagggccaga 1380 cagcttttaa ttgaaattgt tatttcacag
gccagggttc agttctgctc ctccactata 1440 agtctaatgt tctgactctc
tcctggtgct caataaatat ctaatcataa cagcaaaaaa 1500 aaa 1503 6 319 PRT
Homo sapiens 6 Met Val Gly Lys Met Trp Pro Val Leu Trp Thr Leu Cys
Ala Val Arg 1 5 10 15 Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro
Gln Asp Val Leu Arg 20 25 30 Ala Ser Gln Gly Lys Ser Val Thr Leu
Pro Cys Thr Tyr His Thr Ser 35 40 45 Thr Ser Ser Arg Glu Gly Leu
Ile Gln Trp Asp Lys Leu Leu Leu Thr 50 55 60 His Thr Glu Arg Val
Val Ile Trp Pro Phe Ser Asn Lys Asn Tyr Ile 65 70 75 80 His Gly Glu
Leu Tyr Lys Asn Arg Val Ser Ile Ser Asn Asn Ala Glu 85 90 95 Gln
Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu Thr Met Ala Asp Asn 100 105
110 Gly Thr Tyr Glu Cys Ser Val Ser Leu Met Ser Asp Leu Glu Gly Asn
115 120 125 Thr Lys Ser Arg Val Arg Leu Leu Val Leu Val Pro Pro Ser
Lys Pro 130 135 140 Glu Cys Gly Ile Glu Gly Glu Thr Ile Ile Gly Asn
Asn Ile Gln Leu 145 150 155 160 Thr Cys Gln Ser Lys Glu Gly Ser Pro
Thr Pro Gln Tyr Ser Trp Lys 165 170 175 Arg Tyr Asn Ile Leu Asn Gln
Glu Gln Pro Leu Ala Gln Pro Ala Ser 180 185 190 Gly Gln Pro Val Ser
Leu Lys Asn Ile Ser Thr Asp Thr Ser Gly Tyr 195 200 205 Tyr Ile Cys
Thr Ser Ser Asn Glu Glu Gly Thr Gln Phe Cys Asn Ile 210 215 220 Thr
Val Ala Val Arg Ser Pro Ser Met Asn Val Ala Leu Tyr Val Gly 225 230
235 240 Ile Ala Val Gly Val Val Ala Ala Leu Ile Ile Ile Gly Ile Ile
Ile 245 250 255 Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp Asn Thr Glu
Asp Lys Glu 260 265 270 Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu
Pro Pro Glu Gln Leu 275 280 285 Arg Glu Leu Ser Arg Glu Arg Glu Glu
Glu Asp Asp Tyr Arg Gln Glu 290 295 300 Glu Gln Arg Ser Thr Gly Arg
Glu Ser Pro Asp His Leu Asp Gln 305 310 315 7 2181 DNA Homo sapiens
7 cccacgcgtc cgcccacgcg tccgcccacg ggtccgccca cgcgtccggg ccaccagaag
60 tttgagcctc tttggtagca ggaggctgga agaaaggaca gaagtagctc
tggctgtgat 120 ggggatctta ctgggcctgc tactcctggg gcacctaaca
gtggacactt atggccgtcc 180 catcctggaa gtgccagaga gtgtaacagg
accttggaaa ggggatgtga atcttccctg 240 cacctatgac cccctgcaag
gctacaccca agtcttggtg aagtggctgg tacaacgtgg 300 ctcagaccct
gtcaccatct ttctacgtga ctcttctgga gaccatatcc agcaggcaaa 360
gtaccagggc cgcctgcatg tgagccacaa ggttccagga gatgtatccc tccaattgag
420 caccctggag atggatgacc ggagccacta cacgtgtgaa gtcacctggc
agactcctga 480 tggcaaccaa gtcgtgagag ataagattac tgagctccgt
gtccagaaac tctctgtctc 540 caagcccaca gtgacaactg gcagcggtta
tggcttcacg gtgccccagg gaatgaggat 600 tagccttcaa tgccaggctc
ggggttctcc tcccatcagt tatatttggt ataagcaaca 660 gactaataac
caggaaccca tcaaagtagc aaccctaagt accttactct tcaagcctgc 720
ggtgatagcc gactcaggct cctatttctg cactgccaag ggccaggttg gctctgagca
780 gcacagcgac attgtgaagt ttgtggtcaa agactcctca aagctactca
agaccaagac 840 tgaggcacct acaaccatga catacccctt gaaagcaaca
tctacagtga agcagtcctg 900 ggactggacc actgacatgg atggctacct
tggagagacc agtgctgggc caggaaagag 960 cctgcctgtc tttgccatca
tcctcatcat ctccttgtgc tgtatggtgg tttttaccat 1020 ggcctatatc
atgctctgtc ggaagacatc ccaacaagag catgtctacg aagcagccag 1080
gtaagaaagt ctctcctctt ccatttttga ccccgtccct gccctcaatt ttgattactg
1140 gcaggaaatg tggaggaagg ggggtgtggc acagacccaa tcctaaggcc
ggaggccttc 1200 agggtcagga catagctgcc ttccctctct caggcacctt
ctgaggttgt tttggccctc 1260 tgaacacaaa ggataattta gatccatctg
ccttctgctt ccagaatccc tgggtggtag 1320 gatcctgata attaattggc
aagaattgag gcagaagggt gggaaaccag gaccacagcc 1380 ccaagtccct
tcttatgggt ggtgggctct tgggccatag ggcacatgcc agagaggcca 1440
acgactctgg agaaaccatg agggtggcca tcttcgcaag tggctgctcc agtgatgagc
1500 caacttccca gaatctgggc aacaactact ctgatgagcc ctgcatagga
caggagtacc 1560 agatcatcgc ccagatcaat ggcaactacg cccgcctgct
ggacacagtt cctctggatt 1620 atgagtttct ggccactgag ggcaaaagtg
tctgttaaaa atgccccatt aggccaggat 1680 ctgctgacat aattgcctag
tcagtccttg ccttctgcat ggccttcttc cctgctacct 1740 ctcttcctgg
atagcccaaa gtgtccgcct accaacactg gagccgctgg gagtcactgg 1800
ctttgccctg gaatttgcca gatgcatctc aagtaagcca gctgctggat ttggctctgg
1860 gcccttctag tatctctgcc gggggcttct ggtactcctc tctaaatacc
agagggaaga 1920 tgcccatagc actaggactt ggtcatcatg cctacagaca
ctattcaact ttggcatctt 1980 gccaccagaa gacccgaggg aggctcagct
ctgccagctc agaggaccag ctatatccag 2040 gatcatttct ctttcttcag
ggccagacag cttttaattg aaattgttat ttcacaggcc 2100 agggttcagt
tctgctcctc cactataagt ctaatgttct gactctctcc tggtgctcaa 2160
taaatatcta atcataacag c 2181 8 1295 DNA Homo sapiens 8 cccagaagtt
caagggcccc cggcctcctg cgctcctgcc gccgggaccc tcgacctcct 60
cagagcagcc ggctgccgcc ccgggaagat ggcgaggagg agccgccacc gcctcctcct
120 gctgctgctg cgctacctgg tggtcgccct gggctatcat aaggcctatg
ggttttctgc 180 cccaaaagac caacaagtag tcacagcagt agagtaccaa
gaggctattt tagcctgcaa 240 aaccccaaag aagactgttt cctccagatt
agagtggaag aaactgggtc ggagtgtctc 300 ctttgtctac tatcaacaga
ctcttcaagg tgattttaaa aatcgagctg agatgataga 360 tttcaatatc
cggatcaaaa atgtgacaag aagtgatgcg gggaaatatc gttgtgaagt 420
tagtgcccca tctgagcaag gccaaaacct ggaagaggat acagtcactc tggaagtatt
480 agtggctcca gcagttccat catgtgaagt accctcttct gctctgagtg
gaactgtggt 540 agagctacga tgtcaagaca aagaagggaa tccagctcct
gaatacacat ggtttaagga 600 tggcatccgt ttgctagaaa atcccagact
tggctcccaa agcaccaaca gctcatacac 660 aatgaataca aaaactggaa
ctctgcaatt taatactgtt tccaaactgg acactggaga 720 atattcctgt
gaagcccgca attctgttgg atatcgcagg tgtcctggga aacgaatgca 780
agtagatgat ctcaacataa gtggcatcat agcagccgta gtagttgtgg ccttagtgat
840 ttccgtttgt ggccttggtg tatgctatgc tcagaggaaa ggctactttt
caaaagaaac 900 ctccttccag aagagtaatt cttcatctaa agccacgaca
atgagtgaaa atgtgcagtg 960 gctcacgcct gtaatcccag cactttggaa
ggccgcggcg ggcggatcac gaggtcagga 1020 gttctagacc agtctggcca
atatggtgaa accccatctc tactaaaata caaaaattag 1080 ctgggcatgg
tggcatgtgc ctgcagttcc agctgcttgg gagacaggag aatcacttga 1140
acccgggagg cggaggttgc agtgagctga gatcacgcca ctgcagtcca gcctgggtaa
1200 cagagcaaga ttccatctca aaaaataaaa taaataaata aataaatact
ggtttttacc 1260 tgtagaattc ttacaataaa tatagcttga tattc 1295 9 312
PRT Homo sapiens 9 Met Ala Arg Arg Ser Arg His Arg Leu Leu Leu Leu
Leu Leu Arg Tyr 1 5 10 15 Leu Val Val Ala Leu Gly Tyr His Lys Ala
Tyr Gly Phe Ser Ala Pro 20 25 30 Lys Asp Gln Gln Val Val Thr Ala
Val Glu Tyr Gln Glu Ala Ile Leu 35 40 45 Ala Cys Lys Thr Pro Lys
Lys Thr Val Ser Ser Arg Leu Glu Trp Lys 50 55 60 Lys Leu Gly Arg
Ser Val Ser Phe Val Tyr Tyr Gln Gln Thr Leu Gln 65 70 75 80 Gly Asp
Phe Lys Asn Arg Ala Glu Met Ile Asp Phe Asn Ile Arg Ile 85 90 95
Lys Asn Val Thr Arg Ser Asp Ala Gly Lys Tyr Arg Cys Glu Val Ser 100
105 110 Ala Pro Ser Glu Gln Gly Gln Asn Leu Glu Glu Asp Thr Val Thr
Leu 115 120 125 Glu Val Leu Val Ala Pro Ala Val Pro Ser Cys Glu Val
Pro Ser Ser 130 135 140 Ala Leu Ser Gly Thr Val Val Glu Leu Arg Cys
Gln Asp Lys Glu Gly 145 150 155 160 Asn Pro Ala Pro Glu Tyr Thr Trp
Phe Lys Asp Gly Ile Arg Leu Leu 165 170 175 Glu Asn Pro Arg Leu Gly
Ser Gln Ser Thr Asn Ser Ser Tyr Thr Met 180 185 190 Asn Thr Lys Thr
Gly Thr Leu Gln Phe Asn Thr Val Ser Lys Leu Asp 195 200 205 Thr Gly
Glu Tyr Ser Cys Glu Ala Arg Asn Ser Val Gly Tyr Arg Arg 210 215 220
Cys Pro Gly Lys Arg Met Gln Val Asp Asp Leu Asn Ile Ser Gly Ile 225
230 235 240 Ile Ala Ala Val Val Val Val Ala Leu Val Ile Ser Val Cys
Gly Leu 245 250 255 Gly Val Cys Tyr Ala Gln Arg Lys Gly Tyr Phe Ser
Lys Glu Thr Ser 260 265 270 Phe Gln Lys Ser Asn Ser Ser Ser Lys Ala
Thr Thr Met Ser Glu Asn 275 280 285 Val Gln Trp Leu Thr Pro Val Ile
Pro Ala Leu Trp Lys Ala Ala Ala 290 295 300 Gly Gly Ser Arg Gly Gln
Glu Phe 305 310 10 300 PRT Mus musculus 10 Met Gly Thr Glu Gly Lys
Ala Gly Arg Lys Leu Leu Phe Leu Phe Thr 1 5 10 15 Ser Met Ile Leu
Gly Ser Leu Val Gln Gly Lys Gly Ser Val Tyr Thr 20 25 30 Ala Gln
Ser Asp Val Gln Val Pro Glu Asn Glu Ser Ile Lys Leu Thr 35 40 45
Cys Thr Tyr Ser Gly Phe Ser Ser Pro Arg Val Glu Trp Lys Phe Val 50
55 60 Gln Gly Ser Thr Thr Ala Leu Val Cys Tyr Asn Ser Gln Ile Thr
Ala 65 70 75 80 Pro Tyr Ala Asp Arg Val Thr Phe Ser Ser Ser Gly Ile
Thr Phe Ser 85 90 95 Ser Val Thr Arg Lys Asp Asn Gly Glu Tyr Thr
Cys Met Val Ser Glu 100 105 110 Glu Gly Gly Gln Asn Tyr Gly Glu Val
Ser Ile His Leu Thr Val Leu 115 120 125 Val Pro Pro Ser Lys Pro Thr
Ile Ser Val Pro Ser Ser Val
Thr Ile 130 135 140 Gly Asn Arg Ala Val Leu Thr Cys Ser Glu His Asp
Gly Ser Pro Pro 145 150 155 160 Ser Glu Tyr Ser Trp Phe Lys Asp Gly
Ile Ser Met Leu Thr Ala Asp 165 170 175 Ala Lys Lys Thr Arg Ala Phe
Met Asn Ser Ser Phe Thr Ile Asp Pro 180 185 190 Lys Ser Gly Asp Leu
Ile Phe Asp Pro Val Thr Ala Phe Asp Ser Gly 195 200 205 Glu Tyr Tyr
Cys Gln Ala Gln Asn Gly Tyr Gly Thr Ala Met Arg Ser 210 215 220 Glu
Ala Ala His Met Asp Ala Val Glu Leu Asn Val Gly Gly Ile Val 225 230
235 240 Ala Ala Val Leu Val Thr Leu Ile Leu Leu Gly Leu Leu Ile Phe
Gly 245 250 255 Val Trp Phe Ala Tyr Ser Arg Gly Tyr Phe Glu Thr Thr
Lys Lys Gly 260 265 270 Thr Ala Pro Gly Lys Lys Val Ile Tyr Ser Gln
Pro Ser Thr Arg Ser 275 280 285 Glu Gly Glu Phe Lys Gln Thr Ser Ser
Phe Leu Val 290 295 300 11 1842 DNA Homo sapiens 11 gtctgttccc
aggagtcctt cggcggctgt tgtgtcggga gcctgatcgc gatggggaca 60
aaggcgcaag tcgagaggaa actgttgtgc ctcttcatat tggcgatcct gttgtgctcc
120 ctggcattgg gcagtgttac agtgcactct tctgaacctg aagtcagaat
tcctgagaat 180 aatcctgtga agttgtcctg tgcctactcg ggcttttctt
ctccccgtgt ggagtggaag 240 tttgaccaag gagacaccac cagactcgtt
tgctataata acaagatcac agcttcctat 300 gaggaccggg tgaccttctt
gccaactggt atcaccttca agtccgtgac acgggaagac 360 actgggacat
acacttgtat ggtctctgag gaaggcggca acagctatgg ggaggtcaag 420
gtcaagctca tcgtgcttgt gcctccatcc aagcctacag ttaacatccc ctcctctgcc
480 accattggga accgggcagt gctgacatgc tcagaacaag atggttcccc
accttctgaa 540 tacacctggt tcaaagatgg gatagtgatg cctacgaatc
ccaaaagcac ccgtgccttc 600 agcaactctt cctatgtcct gaatcccaca
acaggagagc tggtctttga tcccctgtca 660 gcctctgata ctggagaata
cagctgtgag gcacggaatg ggtatgggac acccatgact 720 tcaaatgctg
tgcgcatgga agctgtggag cggaatgtgg gggtcatcgt ggcagccgtc 780
cttgtaaccc tgattctcct gggaatcttg gtttttggca tctggtttgc ctatagccga
840 ggccactttg acagaacaaa gaaagggact tcgagtaaga aggtgattta
cagccagcct 900 agtgcccgaa gtgaaggaga attcaaacag acctcgtcat
tcctggtgtg agcctggtcg 960 gctcaccgcc tatcatctgc atttgcctta
ctcaggtgct actggactct ggcccctgat 1020 gtctgtagtt tcacaggatg
ccttatttgt cttctacacc ccacagggcc ccctacttct 1080 tcggatgtgt
ttttaataat gtcagctatg tgccccatcc tccttcatgc cctccctccc 1140
tttcctacca ctgctgagtg gcctggaact tgtttaaagt gtttattccc catttctttg
1200 agggatcagg aaggaatcct gggtatgcca ttgacttccc ttctaagtag
acagcaaaaa 1260 tggcgggggt cgcaggaatc tgcactcaac tgcccacctg
gctggcaggg atctttgaat 1320 aggtatcttg agcttggttc tgggctcttt
ccttgtgtac tgacgaccag ggccagctgt 1380 tctagagtgg gaattagagg
ctagagcggc tgaaatggtt gtttggtgat gacactgggg 1440 tccttccatc
tctggggccc actctcttct gtcttcccat gggaagtgcc actgggatcc 1500
ctctgccctg tcctcctgaa tacaagctga ctgacattga ctgtgtctgt ggaaaatggg
1560 agctcttgtt gtggagagca tagtaaattt tcagagaact tgaagcgaaa
aggatttaaa 1620 accgctgctc taaagaaaag aaaactggag gctgggcgca
gtggctcacg cctgtaatcc 1680 cagaggctga ggcaggcgga tcacctgagg
tcgggagttc gggatcagcc tgaccaacat 1740 ggagaaaccc tgctggaaat
acagagttag ccaggcatgg tggtgcatgc ctgtagtccc 1800 agctgctcag
gagcctggca acaagagcaa aactccagct ca 1842 12 24 DNA Artificial
Sequence Synthetic oligonucloetide probe 12 tcgcggagct gtgttctgtt
tccc 24 13 50 DNA Artificial Sequence Synthetic oligonucloetide
probe 13 tgatcgcgat ggggacaaag gcgcaagctc gagaggaaac tgttgtgcct 50
14 20 DNA Artificial Sequence Synthetic oligonucloetide probe 14
acacctggtt caaagatggg 20 15 24 DNA Artificial Sequence Synthetic
oligonucloetide probe 15 taggaagagt tgctgaaggc acgg 24 16 20 DNA
Artificial Sequence Synthetic oligonucloetide probe 16 ttgccttact
caggtgctac 20 17 20 DNA Artificial Sequence Synthetic
oligonucloetide probe 17 actcagcagt ggtaggaaag 20 18 24 DNA
Artificial Sequence Synthetic oligonucloetide probe 18 tatccctcca
attgagcacc ctgg 24 19 21 DNA Artificial Sequence Synthetic
oligonucloetide probe 19 gtcggaagac atcccaacaa g 21 20 24 DNA
Artificial Sequence Synthetic oligonucloetide probe 20 cttcacaatg
tcgctgtgct gctc 24 21 24 DNA Artificial Sequence Synthetic
oligonucloetide probe 21 agccaaatcc agcagctggc ttac 24 22 50 DNA
Artificial Sequence Synthetic oligonucloetide probe 22 tggatgaccg
gagccactac acgtgtgaag tcacctggca gactcctgat 50 23 260 PRT Homo
sapiens 23 Leu Ala Leu Gly Ser Val Thr Val His Ser Ser Glu Pro Glu
Val Arg 1 5 10 15 Ile Pro Glu Asn Asn Pro Val Lys Leu Ser Cys Ala
Tyr Ser Gly Phe 20 25 30 Ser Ser Pro Arg Val Glu Trp Lys Phe Asp
Gln Gly Asp Thr Thr Arg 35 40 45 Leu Val Cys Tyr Asn Asn Lys Ile
Thr Ala Ser Tyr Glu Asp Arg Val 50 55 60 Thr Phe Leu Pro Thr Gly
Ile Thr Phe Lys Ser Val Thr Arg Glu Asp 65 70 75 80 Thr Gly Thr Tyr
Thr Cys Met Val Ser Glu Glu Gly Gly Asn Ser Tyr 85 90 95 Gly Glu
Val Lys Val Lys Leu Ile Val Leu Val Pro Pro Ser Lys Pro 100 105 110
Thr Val Asn Ile Pro Ser Ser Ala Thr Ile Gly Asn Arg Ala Val Leu 115
120 125 Thr Cys Ser Glu Gln Asp Gly Ser Pro Pro Ser Glu Tyr Thr Trp
Phe 130 135 140 Lys Asp Gly Ile Val Met Pro Thr Asn Pro Lys Ser Thr
Arg Ala Phe 145 150 155 160 Ser Asn Ser Ser Tyr Val Leu Asn Pro Thr
Thr Gly Glu Leu Val Phe 165 170 175 Asp Pro Leu Ser Ala Ser Asp Thr
Gly Glu Tyr Ser Cys Glu Ala Arg 180 185 190 Asn Gly Tyr Gly Thr Pro
Met Thr Ser Asn Ala Val Arg Met Glu Ala 195 200 205 Val Glu Arg Asn
Val Gly Val Ile Val Ala Ala Val Leu Val Thr Leu 210 215 220 Ile Leu
Leu Gly Ile Leu Val Phe Gly Ile Trp Phe Ala Tyr Ser Arg 225 230 235
240 Gly His Phe Asp Arg Thr Lys Lys Gly Thr Ser Ser Lys Lys Val Ile
245 250 255 Tyr Ser Gln Pro 260 24 268 PRT Homo sapiens 24 Val Thr
Val Asp Ala Ile Ser Val Glu Thr Pro Gln Asp Val Leu Arg 1 5 10 15
Ala Ser Gln Gly Lys Ser Val Thr Leu Pro Cys Thr Tyr His Thr Ser 20
25 30 Thr Ser Ser Arg Glu Gly Leu Ile Gln Trp Asp Lys Leu Leu Leu
Thr 35 40 45 His Thr Glu Arg Val Val Ile Trp Pro Phe Ser Asn Lys
Asn Tyr Ile 50 55 60 His Gly Glu Leu Tyr Lys Asn Arg Val Ser Ile
Ser Asn Asn Ala Glu 65 70 75 80 Gln Ser Asp Ala Ser Ile Thr Ile Asp
Gln Leu Thr Met Ala Asp Asn 85 90 95 Gly Thr Tyr Glu Cys Ser Val
Ser Leu Met Ser Asp Leu Glu Gly Asn 100 105 110 Thr Lys Ser Arg Val
Arg Leu Leu Val Leu Val Pro Pro Ser Lys Pro 115 120 125 Glu Cys Gly
Ile Glu Gly Glu Thr Ile Ile Gly Asn Asn Ile Gln Leu 130 135 140 Thr
Cys Gln Ser Lys Glu Gly Ser Pro Thr Pro Gln Tyr Ser Trp Lys 145 150
155 160 Arg Tyr Asn Ile Leu Asn Gln Glu Gln Pro Leu Ala Gln Pro Ala
Ser 165 170 175 Gly Gln Pro Val Ser Leu Lys Asn Ile Ser Thr Asp Thr
Ser Gly Tyr 180 185 190 Tyr Ile Cys Thr Ser Ser Asn Glu Glu Gly Thr
Gln Phe Cys Asn Ile 195 200 205 Thr Val Ala Val Arg Ser Pro Ser Met
Asn Val Ala Leu Tyr Val Gly 210 215 220 Ile Ala Val Gly Val Val Ala
Ala Leu Ile Ile Ile Gly Ile Ile Ile 225 230 235 240 Tyr Cys Cys Cys
Cys Arg Gly Lys Asp Asp Asn Thr Glu Asp Lys Glu 245 250 255 Asp Ala
Arg Pro Asn Arg Glu Ala Tyr Glu Glu Pro 260 265 25 263 PRT Homo
sapiens 25 Leu Cys Ser Leu Ala Leu Gly Ser Val Thr Val His Ser Ser
Glu Pro 1 5 10 15 Glu Val Arg Ile Pro Glu Asn Asn Pro Val Lys Leu
Ser Cys Ala Tyr 20 25 30 Ser Gly Phe Ser Ser Pro Arg Val Glu Trp
Lys Phe Asp Gln Gly Asp 35 40 45 Thr Thr Arg Leu Val Cys Tyr Asn
Asn Lys Ile Thr Ala Ser Tyr Glu 50 55 60 Asp Arg Val Thr Phe Leu
Pro Thr Gly Ile Thr Phe Lys Ser Val Thr 65 70 75 80 Arg Glu Asp Thr
Gly Thr Tyr Thr Cys Met Val Ser Glu Glu Gly Gly 85 90 95 Asn Ser
Tyr Gly Glu Val Lys Val Lys Leu Ile Val Leu Val Pro Pro 100 105 110
Ser Lys Pro Thr Val Asn Ile Pro Ser Ser Ala Thr Ile Gly Asn Arg 115
120 125 Ala Val Leu Thr Cys Ser Glu Gln Asp Gly Ser Pro Pro Ser Glu
Tyr 130 135 140 Thr Trp Phe Lys Asp Gly Ile Val Met Pro Thr Asn Pro
Lys Ser Thr 145 150 155 160 Arg Ala Phe Ser Asn Ser Ser Tyr Val Leu
Asn Pro Thr Thr Gly Glu 165 170 175 Leu Val Phe Asp Pro Leu Ser Ala
Ser Asp Thr Gly Glu Tyr Ser Cys 180 185 190 Glu Ala Arg Asn Gly Tyr
Gly Thr Pro Met Thr Ser Asn Ala Val Arg 195 200 205 Met Glu Ala Val
Glu Arg Asn Val Gly Val Ile Val Ala Ala Val Leu 210 215 220 Val Thr
Leu Ile Leu Leu Gly Ile Leu Val Phe Gly Ile Trp Phe Ala 225 230 235
240 Tyr Ser Arg Gly His Phe Asp Arg Thr Lys Lys Gly Thr Ser Ser Lys
245 250 255 Lys Val Ile Tyr Ser Gln Pro 260 26 273 PRT Homo sapiens
26 Leu Cys Ala Val Arg Val Thr Val Asp Ala Ile Ser Val Glu Thr Pro
1 5 10 15 Gln Asp Val Leu Arg Ala Ser Gln Gly Lys Ser Val Thr Leu
Pro Cys 20 25 30 Thr Tyr His Thr Ser Thr Ser Ser Arg Glu Gly Leu
Ile Gln Trp Asp 35 40 45 Lys Leu Leu Leu Thr His Thr Glu Arg Val
Val Ile Trp Pro Phe Ser 50 55 60 Asn Lys Asn Tyr Ile His Gly Glu
Leu Tyr Lys Asn Arg Val Ser Ile 65 70 75 80 Ser Asn Asn Ala Glu Gln
Ser Asp Ala Ser Ile Thr Ile Asp Gln Leu 85 90 95 Thr Met Ala Asp
Asn Gly Thr Tyr Glu Cys Ser Val Ser Leu Met Ser 100 105 110 Asp Leu
Glu Gly Asn Thr Lys Ser Arg Val Arg Leu Leu Val Leu Val 115 120 125
Pro Pro Ser Lys Pro Glu Cys Gly Ile Glu Gly Glu Thr Ile Ile Gly 130
135 140 Asn Asn Ile Gln Leu Thr Cys Gln Ser Lys Glu Gly Ser Pro Thr
Pro 145 150 155 160 Gln Tyr Ser Trp Lys Arg Tyr Asn Ile Leu Asn Gln
Glu Gln Pro Leu 165 170 175 Ala Gln Pro Ala Ser Gly Gln Pro Val Ser
Leu Lys Asn Ile Ser Thr 180 185 190 Asp Thr Ser Gly Tyr Tyr Ile Cys
Thr Ser Ser Asn Glu Glu Gly Thr 195 200 205 Gln Phe Cys Asn Ile Thr
Val Ala Val Arg Ser Pro Ser Met Asn Val 210 215 220 Ala Leu Tyr Val
Gly Ile Ala Val Gly Val Val Ala Ala Leu Ile Ile 225 230 235 240 Ile
Gly Ile Ile Ile Tyr Cys Cys Cys Cys Arg Gly Lys Asp Asp Asn 245 250
255 Thr Glu Asp Lys Glu Asp Ala Arg Pro Asn Arg Glu Ala Tyr Glu Glu
260 265 270 Pro 27 413 DNA Homo sapiens 27 ctcgagccgc tcgagccgtg
cggggaaata tcgttgtgaa gttagtgccc catctgagca 60 aggccaaaac
ctggaagagg atacagtcac tctggaagta ttagtggctc cagcagttcc 120
atcatgtgaa gtaccctctt ctgctctgag tggaactgtg gtagagctac gatgtcaaga
180 caaagaaggg aatccagctc ctgaatacac atggtttaag gatggcatcc
gtttgctaga 240 aaatcccaga cttggctccc aaagcaccaa cagctcatac
acaatgaata caaaaactgg 300 aactctgcaa tttaatactg tttccaaact
ggacactgga gaatattcct gtgaagcccg 360 caattctgtt ggatatcgca
ggtgtcctgg ggaaacgaat gcaagtagat gat 413 28 22 DNA Artificial
Sequence Synthetic oligonucloetide probe 28 atcgttgtga agttagtgcc
cc 22 29 23 DNA Artificial Sequence Synthetic oligonucloetide probe
29 acctgcgata tccaacagaa ttg 23 30 48 DNA Artificial Sequence
Synthetic oligonucloetide probe 30 ggaagaggat acagtcactc tggaagtatt
agtggctcca gcagttcc 48 31 310 PRT Homo sapiens 31 Met Ala Leu Arg
Arg Pro Pro Arg Leu Arg Leu Cys Ala Arg Leu Pro 1 5 10 15 Asp Phe
Phe Leu Leu Leu Leu Phe Arg Gly Cys Leu Ile Gly Ala Val 20 25 30
Asn Leu Lys Ser Ser Asn Arg Thr Pro Val Val Gln Glu Phe Glu Ser 35
40 45 Val Glu Leu Ser Cys Ile Ile Thr Asp Ser Gln Thr Ser Asp Pro
Arg 50 55 60 Ile Glu Trp Lys Lys Ile Gln Asp Glu Gln Thr Thr Tyr
Val Phe Phe 65 70 75 80 Asp Asn Lys Ile Gln Gly Asp Leu Ala Gly Arg
Ala Glu Ile Leu Gly 85 90 95 Lys Thr Ser Leu Lys Ile Trp Asn Val
Thr Arg Arg Asp Ser Ala Leu 100 105 110 Tyr Arg Cys Glu Val Val Ala
Arg Asn Asp Arg Lys Glu Ile Asp Glu 115 120 125 Ile Val Ile Glu Leu
Thr Val Gln Val Lys Pro Val Thr Pro Val Cys 130 135 140 Arg Val Pro
Lys Ala Val Pro Val Gly Lys Met Ala Thr Leu His Cys 145 150 155 160
Gln Glu Ser Glu Gly His Pro Arg Pro His Tyr Ser Trp Tyr Arg Asn 165
170 175 Asp Val Pro Leu Pro Thr Asp Ser Arg Ala Asn Pro Arg Phe Arg
Asn 180 185 190 Ser Ser Phe His Leu Asn Ser Glu Thr Gly Thr Leu Val
Phe Thr Ala 195 200 205 Val His Lys Asp Asp Ser Gly Gln Tyr Tyr Cys
Ile Ala Ser Asn Asp 210 215 220 Ala Gly Ser Ala Arg Cys Glu Glu Gln
Glu Met Glu Val Tyr Asp Leu 225 230 235 240 Asn Ile Gly Gly Ile Ile
Gly Gly Val Leu Val Val Leu Ala Val Leu 245 250 255 Ala Leu Ile Thr
Leu Gly Ile Cys Cys Ala Tyr Arg Arg Gly Tyr Phe 260 265 270 Ile Asn
Asn Lys Gln Asp Gly Glu Ser Tyr Lys Asn Pro Gly Lys Pro 275 280 285
Asp Gly Val Asn Tyr Ile Arg Thr Asp Glu Glu Gly Asp Phe Arg His 290
295 300 Lys Ser Ser Phe Val Ile 305 310 32 399 PRT Homo sapiens 32
Met Gly Ile Leu Leu Gly Leu Leu Leu Leu Gly His Leu Thr Val Asp 1 5
10 15 Thr Tyr Gly Arg Pro Ile Leu Glu Val Pro Glu Ser Val Thr Gly
Pro 20 25 30 Trp Lys Gly Asp Val Asn Leu Pro Cys Thr Tyr Asp Pro
Leu Gln Gly 35 40 45 Tyr Thr Gln Val Leu Val Lys Trp Leu Val Gln
Arg Gly Ser Asp Pro 50 55 60 Val Thr Ile Phe Leu Arg Asp Ser Ser
Gly Asp His Ile Gln Gln Ala 65 70 75 80 Lys Tyr Gln Gly Arg Leu His
Val Ser His Lys Val Pro Gly Asp Val 85 90 95 Ser Leu Gln Leu Ser
Thr Leu Glu Met Asp Asp Arg Ser His Tyr Thr 100 105 110 Cys Glu Val
Thr Trp Gln Thr Pro Asp Gly Asn Gln Val Val Arg Asp 115 120 125 Lys
Ile Thr Glu Leu Arg Val Gln Lys Leu Ser Val Ser Lys Pro Thr 130 135
140 Val Thr Thr Gly Ser Gly Tyr Gly Phe Thr Val Pro Gln Gly Met Arg
145 150 155 160 Ile Ser Leu Gln Cys Gln Ala Arg Gly Ser Pro Pro Ile
Ser Tyr Ile 165 170 175 Trp Tyr Lys Gln Gln Thr Asn Asn Gln Glu Pro
Ile Lys Val Ala Thr 180 185 190 Leu Ser Thr Leu Leu Phe Lys Pro Ala
Val Ile Ala Asp Ser Gly Ser 195 200 205 Tyr Phe Cys Thr Ala Lys Gly
Gln Val Gly Ser Glu Gln His Ser Asp 210 215 220 Ile Val Lys Phe Val
Val Lys Asp Ser Ser Lys Leu Leu Lys Thr Lys 225 230 235 240 Thr
Glu
Ala Pro Thr Thr Met Thr Tyr Pro Leu Lys Ala Thr Ser Thr 245 250 255
Val Lys Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr Leu Gly 260
265 270 Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala Ile
Ile 275 280 285 Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met
Ala Tyr Ile 290 295 300 Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His
Val Tyr Glu Ala Ala 305 310 315 320 Arg Ala His Ala Arg Glu Ala Asn
Asp Ser Gly Glu Thr Met Arg Val 325 330 335 Ala Ile Phe Ala Ser Gly
Cys Ser Ser Asp Glu Pro Thr Ser Gln Asn 340 345 350 Leu Gly Asn Asn
Tyr Ser Asp Glu Pro Cys Ile Gly Gln Glu Tyr Gln 355 360 365 Ile Ile
Ala Gln Ile Asn Gly Asn Tyr Ala Arg Leu Leu Asp Thr Val 370 375 380
Pro Leu Asp Tyr Glu Phe Leu Ala Thr Glu Gly Lys Ser Val Cys 385 390
395 33 305 PRT Homo sapiens 33 Met Gly Ile Leu Leu Gly Leu Leu Leu
Leu Gly His Leu Thr Val Asp 1 5 10 15 Thr Tyr Gly Arg Pro Ile Leu
Glu Val Pro Glu Ser Val Thr Gly Pro 20 25 30 Trp Lys Gly Asp Val
Asn Leu Pro Cys Thr Tyr Asp Pro Leu Gln Gly 35 40 45 Tyr Thr Gln
Val Leu Val Lys Trp Leu Val Gln Arg Gly Ser Asp Pro 50 55 60 Val
Thr Ile Phe Leu Arg Asp Ser Ser Gly Asp His Ile Gln Gln Ala 65 70
75 80 Lys Tyr Gln Gly Arg Leu His Val Ser His Lys Val Pro Gly Asp
Val 85 90 95 Ser Leu Gln Leu Ser Thr Leu Glu Met Asp Asp Arg Ser
His Tyr Thr 100 105 110 Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn
Gln Val Val Arg Asp 115 120 125 Lys Ile Thr Glu Leu Arg Val Gln Lys
His Ser Ser Lys Leu Leu Lys 130 135 140 Thr Lys Thr Glu Ala Pro Thr
Thr Met Thr Tyr Pro Leu Lys Ala Thr 145 150 155 160 Ser Thr Val Lys
Gln Ser Trp Asp Trp Thr Thr Asp Met Asp Gly Tyr 165 170 175 Leu Gly
Glu Thr Ser Ala Gly Pro Gly Lys Ser Leu Pro Val Phe Ala 180 185 190
Ile Ile Leu Ile Ile Ser Leu Cys Cys Met Val Val Phe Thr Met Ala 195
200 205 Tyr Ile Met Leu Cys Arg Lys Thr Ser Gln Gln Glu His Val Tyr
Glu 210 215 220 Ala Ala Arg Ala His Ala Arg Glu Ala Asn Asp Ser Gly
Glu Thr Met 225 230 235 240 Arg Val Ala Ile Phe Ala Ser Gly Cys Ser
Ser Asp Glu Pro Thr Ser 245 250 255 Gln Asn Leu Gly Asn Asn Tyr Ser
Asp Glu Pro Cys Ile Gly Gln Glu 260 265 270 Tyr Gln Ile Ile Ala Gln
Ile Asn Gly Asn Tyr Ala Arg Leu Leu Asp 275 280 285 Thr Val Pro Leu
Asp Tyr Glu Phe Leu Ala Thr Glu Gly Lys Ser Val 290 295 300 Cys 305
34 280 PRT Mus musculus 34 Met Glu Ile Ser Ser Gly Leu Leu Phe Leu
Gly His Leu Ile Val Leu 1 5 10 15 Thr Tyr Gly His Pro Thr Leu Lys
Thr Pro Glu Ser Val Thr Gly Thr 20 25 30 Trp Lys Gly Asp Val Lys
Ile Gln Cys Ile Tyr Asp Pro Leu Arg Gly 35 40 45 Tyr Arg Gln Val
Leu Val Lys Trp Leu Val Arg His Gly Ser Asp Ser 50 55 60 Val Thr
Ile Phe Leu Arg Asp Ser Thr Gly Asp His Ile Gln Gln Ala 65 70 75 80
Lys Tyr Arg Gly Arg Leu Lys Val Ser His Lys Val Pro Gly Asp Val 85
90 95 Ser Leu Gln Ile Asn Thr Leu Gln Met Asp Asp Arg Asn His Tyr
Thr 100 105 110 Cys Glu Val Thr Trp Gln Thr Pro Asp Gly Asn Gln Val
Ile Arg Asp 115 120 125 Lys Ile Ile Glu Leu Arg Val Arg Lys Tyr Asn
Pro Pro Arg Ile Asn 130 135 140 Thr Glu Ala Pro Thr Thr Leu His Ser
Ser Leu Glu Ala Thr Thr Ile 145 150 155 160 Met Ser Ser Thr Ser Asp
Leu Thr Thr Asn Gly Thr Gly Lys Leu Glu 165 170 175 Glu Thr Ile Ala
Gly Ser Gly Arg Asn Leu Pro Ile Phe Ala Ile Ile 180 185 190 Phe Ile
Ile Ser Leu Cys Cys Ile Val Ala Val Thr Ile Pro Tyr Ile 195 200 205
Leu Phe Arg Cys Arg Thr Phe Gln Gln Glu Tyr Val Tyr Gly Val Ser 210
215 220 Arg Val Phe Ala Arg Lys Thr Ser Asn Ser Glu Glu Thr Thr Arg
Val 225 230 235 240 Thr Thr Ile Ala Thr Asp Glu Pro Asp Ser Gln Ala
Leu Ile Ser Asp 245 250 255 Tyr Ser Asp Asp Pro Cys Leu Ser Gln Glu
Tyr Gln Ile Thr Ile Arg 260 265 270 Ser Thr Met Ser Ile Pro Ala Cys
275 280 35 21 DNA Artificial Sequence Synthetic oligonucloetide
primer 35 tctctgtctc caagcccaca g 21 36 19 DNA Artificial Sequence
Synthetic oligonucloetide primer 36 ctttgaggag tctttgacc 19
* * * * *