U.S. patent application number 11/367800 was filed with the patent office on 2006-10-12 for arrays of nucleic acid probes for analyzing biotransformation genes.
This patent application is currently assigned to Affymetrix, INC.. Invention is credited to Mark Chee, Maureen T. Cronin, Stephen P.A. Fodor, Xiaohua C. Huang, Earl A. Hubbell, Robert J. Lipshutz, Peter E. Lobban, Charles G. Miyada, MacDonald S. Morris, Edward L. Sheldon.
Application Number | 20060229824 11/367800 |
Document ID | / |
Family ID | 27808889 |
Filed Date | 2006-10-12 |
United States Patent
Application |
20060229824 |
Kind Code |
A1 |
Cronin; Maureen T. ; et
al. |
October 12, 2006 |
Arrays of nucleic acid probes for analyzing biotransformation
genes
Abstract
The invention provides arrays of immobilized probes, and methods
employing the arrays, for detecting mutations in the
biotransformation genes, such as cytochromes P450. For example, one
such array comprises four probe sets. A first probe set comprises a
plurality of probes, each probe comprising a segment of at least
three nucleotides exactly complementary to a subsequence of a
reference sequence from a biotransformation gene, the segment
including at least one interrogation position complementary to a
corresponding nucleotide in the reference sequence. Second, third
and fourth probe sets each comprise a corresponding probe for each
probe in the first probe set. The probes in the second, third and
fourth probe sets are identical to a sequence comprising the
corresponding probe from the first probe set or a subsequence of at
least three nucleotides thereof that includes the at least one
interrogation position, except that the at least one interrogation
position is occupied by a different nucleotide in each of the four
corresponding probes from the four probe sets.
Inventors: |
Cronin; Maureen T.; (Los
Altos, CA) ; Miyada; Charles G.; (San Jose, CA)
; Hubbell; Earl A.; (Los Angeles, CA) ; Chee;
Mark; (Palo Alto, CA) ; Fodor; Stephen P.A.;
(Palo Alto, CA) ; Huang; Xiaohua C.; (Mountain
View, CA) ; Lipshutz; Robert J.; (Palo Alto, CA)
; Lobban; Peter E.; (Mountain View, CA) ; Morris;
MacDonald S.; (Felton, CA) ; Sheldon; Edward L.;
(San Diego, CA) |
Correspondence
Address: |
AFFYMETRIX, INC;ATTN: CHIEF IP COUNSEL, LEGAL DEPT.
3420 CENTRAL EXPRESSWAY
SANTA CLARA
CA
95051
US
|
Assignee: |
Affymetrix, INC.
Santa Clara
CA
|
Family ID: |
27808889 |
Appl. No.: |
11/367800 |
Filed: |
March 3, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09798260 |
May 1, 2002 |
|
|
|
11367800 |
Mar 3, 2006 |
|
|
|
08778794 |
Jan 3, 1997 |
6309823 |
|
|
09798260 |
May 1, 2002 |
|
|
|
08544381 |
Oct 10, 1995 |
6027880 |
|
|
08778794 |
Jan 3, 1997 |
|
|
|
08510521 |
Aug 2, 1995 |
|
|
|
08544381 |
Oct 10, 1995 |
|
|
|
PCT/US94/12305 |
Oct 26, 1994 |
|
|
|
08510521 |
Aug 2, 1995 |
|
|
|
08284064 |
Aug 2, 1994 |
|
|
|
PCT/US94/12305 |
Oct 26, 1994 |
|
|
|
08143312 |
Oct 26, 1993 |
|
|
|
08284064 |
Aug 2, 1994 |
|
|
|
Current U.S.
Class: |
702/19 ;
702/20 |
Current CPC
Class: |
B01J 2219/00605
20130101; B82Y 30/00 20130101; C12Q 2600/172 20130101; B01J
2219/00659 20130101; B01J 2219/00644 20130101; C12Q 2600/156
20130101; B01J 2219/00612 20130101; C07H 21/00 20130101; C12Q
1/6837 20130101; C12Q 2600/106 20130101; C07B 2200/11 20130101;
C40B 40/06 20130101; B01J 2219/00608 20130101; C40B 60/14 20130101;
B01J 2219/00617 20130101; B01J 19/0046 20130101; B01J 2219/00722
20130101; C12Q 1/6874 20130101; B01J 2219/00711 20130101; C12Q
1/6876 20130101; B01J 2219/00529 20130101; B01J 2219/00626
20130101; B01J 2219/00432 20130101 |
Class at
Publication: |
702/019 ;
702/020 |
International
Class: |
G06F 19/00 20060101
G06F019/00 |
Claims
1. An array comprising one or more array information features.
2. The array of claim 1, wherein said one or more array information
features comprises at least 4 features.
3. The array of claim 2, wherein said features are positioned in a
defined pattern on said array.
4. The array of claim 3, wherein said defined pattern provides a
symbol when specifically bound to target.
5. The array of claim 1, wherein said one or more features provides
coded information when specifically bound to target.
6. The array of claim 5, wherein said coded information is binary
or non-binary coded information.
7. A method for providing information about an array, said method
comprising: contacting an array of claim 1 with a sample comprising
a target that binds to at least one of said one or more information
features to produce at least one signal that provides information
about said microarray.
8. The method of claim 7, wherein said target is spiked into said
sample prior to contacting of said array with said sample.
9. The method of claim 7, wherein said information is provided by
assessing binding of said target to said one or more array
information probes.
10. The method of claim 9, wherein said assessing is by determining
the presence, absence or level of binding to control levels of
binding.
11. The method of claim 7, further comprising determining the
presence, absence or level of at least one signal that provides
said information.
12. The method of claim 11, wherein said at least one signal
provides a binary code, where 0 is represented by no detectable
signal and 1 is represented by a detectable signal.
13. The method of claim 11, wherein said at least one signal
provides a binary code, where 1 is represented by no detectable
signal and 0 is represented by a detectable signal.
14. The method of claim 11, wherein said at least one signal
provides a binary code, where 0 is represented by a signal
generated by a first label and 1 is represented by a signal
generated by a second label that is detectably distinguishable from
the first label.
15. The method of claim 7, further comprising determining a level
of said at least one signal to provide a non-binary code that
provides said information.
16. The method of claim 15, wherein said non-binary code is
represented by levels of signal relative to a control level of
signal.
17. A composition comprising a labeled array information target
that specifically binds to an array information probe.
18. A kit comprising: (a) an array information probe; and (b) a
target that binds to said array information probe under specific
binding conditions to produce a signal and thereby provide
information about an array.
19. The kit of claim 18, further comprising instructions for using
said array information probe and said target to provide information
about a microarray.
20. The kit of claim 19, wherein said probe is present in one or
more array information elements on the surface on an array.
21. The kit of claim 18, wherein said instructions include a
protocol for spiking a sample with said target prior to contacting
said array with said sample.
22. A system for providing information about an array, said system
comprising: a) an array comprising one or more array information
features; and b) a target that specifically binds to at least one
of said one or more array information features.
23. A method of detecting the presence of an analyte in a sample,
said method comprising: (a) contacting a sample suspected of
containing said analyte with an array of claim 1, wherein said
array comprises a probe for said analyte; (b) detecting any
resultant binding complexes on the surface of said array to obtain
binding complex data to determine whether said analyte is present
in said sample.
24. The method of claim 23, further comprising obtaining
information about said array by assessing binding of target to said
one or more array information features.
25. The method of claim 23, wherein said analyte is a nucleic acid
and said array is an array of nucleic acid probes.
26. A method comprising transmitting a result obtained from a
method of claim 23 from a first location to a second location.
27. The method of claim 26, wherein said second location is a
remote location.
28. A method comprising receiving a result of a method of claim
23.
29. A hybridization assay comprising the steps of: (a) contacting
at least one sample containing nucleic acids labeled with a
detectable label with a nucleic acid array comprising one or more
array information features to produce a hybridization pattern for
said nucleic acid sample; and (b) analyzing said hybridization
pattern for each detectable label to produce data on the amounts of
said target nucleic acid in said sample and provide information
about the array.
30. A computer readable medium comprising programming to obtain
information about an array from data obtained using the array.
31. A computer-readable medium comprising: information for decoding
encoded array information obtained from an array comprising one or
more array information features.
32. The computer readable medium of claim 31, wherein said array is
an array of nucleic acids.
33. The computer-readable medium of claim 31, wherein said
information comprises a table that contains: a list of feature
identifiers; and a list of probe identifiers corresponding to said
feature identifiers.
34. The computer-readable medium of claim 33, wherein said table
indicates that certain features of said array are array information
features.
35. The computer readable medium of claim 33, wherein said table
indicates which features correspond to which bit of a code.
36. The computer-readable medium of claim 31, wherein said
information indicates an executable program for decoding said
encoded array information.
37. The computer-readable medium of claim 31, wherein said
information is a file that has a unique identifier that corresponds
to a unique identifier of an array.
38. The computer-readable medium of claim 31, wherein said array
information features encode binary coded information, and said file
contains information for decoding said binary coded
information.
39. A method for obtaining information about an array, comprising:
reading an array comprising one or more array information features
to provide encoded information for said array; and decoding said
encoded information using a computer readable medium of claim 31 to
provide information about said array.
40. The method of claim 39, wherein said array is a nucleic acid
array.
41. The method of claim 39, wherein said scanning provides a data
file comprising feature identifiers and numerical assessments of
the brightness of said array information features.
42. The method of claim 39, wherein said decoding comprises
identifying an executable program using said file, and executing
said program, to decode said encoded information and provide
information about said array.
43. The method of claim 42, wherein said executable program is
obtained from a remote location.
44. A method for obtaining information about an array, comprising:
encoding information on an array using one or more array
information features; and providing information for decoding said
encoded information.
45. The method of claim 44, wherein said array information is
provided from a location remote to said array.
46. A method of assaying a sample, said method comprising: (a)
contacting said sample with an array comprising one or more array
information features, (b) reading said array with an array scanner
to obtain data, and (c) decoding said data using a computer
readable medium of claim 31 to provide information for said
array.
47. The method according to claim 46, wherein said array is a
nucleic acid array.
48. A method comprising transmitting a result obtained from a
method of claim 46 from a first location to a second location.
49. The method of claim 48, where said second location is a remote
location.
50. A method comprising receiving data representing said data
obtained by the method of claim 46.
51. A kit for use with an array scanner, said kit comprising: (a) a
computer-readable medium according to claim 31; and (b)
instructions for operating said scanner according to said
programming.
52. The kit of claim 51, further comprising an array.
53. A kit for use with an array scanner, said kit comprising: (a)
an array comprising array information features; and (b)
instructions for obtaining information for decoding encoded array
information encoded by said array information features.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S. Ser. No.
09/798,260, filed on Mar. 1, 2001, which is a continuation of U.S.
Ser. No. 08/778,794, filed on Jan. 3, 1997, now U.S. Pat. No.
6,309,823, which is a continuation in part of U.S. Ser. No.
08/544,381, filed on Oct. 10, 1995, now U.S. Pat. No. 6,027,880,
which is a continuation in part of U.S. Ser. No. 08/510,521, filed
Aug. 2, 1995, which is a continuation-in-part of PCT/US94/12305,
filed Oct. 26,1994,-which is a continuation in part of U.S. Ser.
No. 08/284,064, filed Aug. 2,1994, which is a continuation in part
of U.S. Ser. No. 08/143,312, filed Oct. 26, 1993, each of which is
incorporated by reference in its entirety for all purposes.
Research leading to the invention was funded in part by NIH grant
No.1R01HG00813-01, and the government may have certain rights to
the invention.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention provides arrays of oligonucleotide
probes immobilized in microfabricated patterns on chips for
analyzing biotransformation genes, such as cytochromes P450.
[0004] 2. Description of Related Art
[0005] Virtually all substances introduced into the human body
(xenobiotics) as well as most endogenous compounds (endobiotics)
undergo some form of biotransformation in order to be eliminated
from the body. Many enzymes contribute to the phase I and phase II
metabolic pathways responsible for this bioprocessing. Phase I
enzymes include reductases, oxidases and hydolases. Among the phase
I enzymes are the cytochromes P450, a superfamily of hemoproteins
involved in the oxidative metabolism of steroids, fatty adds,
prostaglandins, leukotrienes, biogenic amines, pheromones, plant
metabolites and chemical carcinogens as well as a large number of
important drugs (Heim & Meyer, Genomics 14, 49-58 (1992)).
Phase II enzymes are primarily transferases responsible for
transferring glucuronic acid, sulfate or glutathione to compounds
already processed by phase I enzymes (Gonzales & Idle, Clin.
Pharmacokinet. 26, 59-74 (1994)). Phase II enzymes include epoxide
hydrolase, catalase, glutathione peroxidase, superoxide dismutase
and glutathione S-transferase.
[0006] Many drugs are metabolized by biotransformation enzymes. For
some drugs, metabolism occurs after the drug has exerted its
desired effect, and result in detoxification of the drug and
elimination of the drug from the body. Similarly, the
biotransformation enzymes also have roles in detoxifying harmful
environmental compounds. For other drugs, metabolism is required to
convert the drug to an active state before the drug can exert its
desired effect.
[0007] Genetic polymorphisms of cytochromes P450 and other
biotransformation enzymes result in phenotypically-distinct
subpopulations that differ in their ability to perform
biotransformations of particular drugs and other chemical
compounds. These phenotypic distinctions have important
implications for selection of drugs. For example, a drug that is
safe when administered to most human may cause intolerable
side-effects in an individual suffering from a defect in an enzyme
required for detoxification of the drug. Alternatively, a drug that
is effective in most humans may be ineffective in a particular
subpopulation because of lack of a enzyme required for conversion
of the drug to a metabolically active form. Further, individuals
lacking a biotransformation enzyme are often susceptible to cancers
from environmental chemicals due to inability to detoxify the
chemicals. Eichelbaum et al., Toxicology Letters 64/65, 155-122
(1992). Accordingly, it is important to identify individuals who
are deficient in a particular P450 enzyme., so that drugs known or
suspected of being metabolized by the enzyme are not used, or used
only with special precautions (e.g., reduced dosage, close
monitoring) in such individuals. Identification of such individuals
is also important so that such individuals can be subjected to
regular monitoring for the onset of cancers.
[0008] Existing methods of identifying deficiencies are not
entirely satisfactory. Patient metabolic profiles are currently
assessed with a bioassay after a probe drug administration. For
example, a poor drug metabolizer with a CYP2D6 defect is identified
by administering one of the probe drugs, debrisoquine, sparteine or
dextromethorphan, then testing urine for the ratio of unmodified to
modified drug. Poor metabolizers (PM) exhibit physiologic
accumulation of unmodified drug and have a high metabolic ratio of
probe drug to metabolite. This bioassay has a number of
limitations: lack of patient cooperation, adverse reactions to
probe drugs, and inaccuracy due to coadministration of other
pharmacological agents or disease effects. Genetic assays by RFLP
(restriction fragment length polymorphism), ASO PCR (allele
specific oligonucleotide hybridization to PCR products or PCR using
mutant/wildtype specific oligo primers), SSCP (single stranded
conformation polymorphism) and TGGE/DGGE (temperature or denaturing
gradient gel electrophoresis), MDE (mutation detection
electrophoresis) are time-consuming, technically demanding and
limited in the number of gene mutation sites that can be tested at
one time.
[0009] The difficulties inherent in previous methods are overcome
by the use of DNA chips to analyze mutations in biotransformation
genes. The development of VLSIPS.TM. technology has provided
methods for making very large arrays of oligonucleotide probes in
very small areas. See U.S Pat. No. 5,143,854, WO 90/15070 and WO
92/10092, each of which is incorporated herein by reference. U.S.
Ser. No. 08/082,937, filed Jun. 25, 1993, describes methods for
making arrays of oligonucleotide probes that can be used to provide
the complete sequence of a target nucleic acid and to detect the
presence of a nucleic acid containing a specific nucleotide
sequence. Others have also proposed the use of large numbers of
oligonucleotide probes to provide the complete nucleic acid
sequence of a target nucleic acid but failed to provide an enabling
method for using arrays of immobilized probes for this purpose. See
U.S. Pat. No. 5,202,231, U.S. Pat. No. 5,002,867 and WO
93/17126.
[0010] Microfabricated arrays of large numbers of oligonucleotide
probes, called "DNA chips" offer great promise for a wide variety
of applications. The present application describes the use of such
chips for inter alia analysis of the biotransformation genes, such
as cytochromes P450.
SUMMARY OF THE INVENTION
[0011] The invention provides arrays of probes immobilized on a
solid support for analyzing biotransformation genes. In a first
embodiment, the invention provides a tiling strategy employing an
array of immobilized oligonucleotide probes comprising at least two
sets of probes. A first probe set comprises a plurality of probes,
each probe comprising a segment of at least three nucleotides
exactly complementary to a subsequence of a reference sequence from
a biotransformation gene, the segment including at least one
interrogation position complementary to a corresponding nucleotide
in the reference sequence. A second probe set comprises a
corresponding probe for each probe in the first probe set, the
corresponding probe in the second probe set being identical to a
sequence comprising the corresponding probe from the first probe
set or a subsequence of at least three nucleotides thereof that
includes the at least one interrogation position, except that the
at least one interrogation position is occupied by a different
nucleotide in each of the two corresponding probes from the first
and second probe sets. The probes in the first probe set have at
least two interrogation positions corresponding to two contiguous
nucleotides in the reference sequence. One interrogation position
corresponds to one of the contiguous nucleotides, and the other
interrogation position to the other. In this, and other forms of
array, biotransformation genes of particular interest for analysis
include cytochromes P450, particularly 2D6 and 2C19, N-acetyl
transferase II, glucose 6-phosphate dehydrogenase,
pseudocholinesterase, catechol-O-methyl transferase, and
dihydropyridine dehydrogenase.
[0012] In a second embodiment, the invention provides a tiling
strategy employing an array comprising four probe sets. A first
probe set comprises a plurality of probes, each probe comprising a
segment of at least three nucleotides exactly complementary to a
subsequence of a reference sequence from a biotransformation gene,
the segment including at least one interrogation position
complementary to a corresponding nucleotide in the reference
sequence. Second, third and fourth probe sets each comprise a
corresponding probe for each probe in the first probe set. The
probes in the second, third and fourth probe sets are identical to
a sequence comprising the corresponding probe from the first probe
set or a subsequence of at least three nucleotides thereof that
includes the at least one interrogation position, except that the
at least one interrogation position is occupied by a different
nucleotide in each of the four corresponding probes from the four
probe sets.
[0013] In a third embodiment, the invention provides arrays
comprising first and second groups of probe sets, each group
comprising first, second and optionally, third and fourth probe
sets as defined above. The first probe sets in the first and second
groups are designed to be exactly complementary to first and second
reference sequences. For example, the first reference can include a
site of mutation rendering the gene nonfunctional, and the second
reference sequence can include a site of a silent polymorphism.
[0014] In a fourth embodiment, the invention provides a block of
oligonucleotides probes (sometimes referred to as an optiblock)
immobilized on a support. The array comprises a perfectly matched
probe comprising a segment of at least three nucleotides exactly
complementary to a subsequence of a reference sequence from a
biotransformation gene, the segment having a plurality of
interrogation positions respectively corresponding to a plurality
of nucleotides in the reference sequence. For each interrogation
position, the array further comprises three mismatched probes, each
identical to a sequence comprising the perfectly matched probe or a
subsequence of at least three nucleotides thereof including the
plurality of interrogation positions, except in the interrogation
position, which is occupied by a different nucleotide in each of
the three mismatched probes and the perfectly matched probe.
[0015] In a fifth embodiment (sometimes referred to as deletion
tiling), the invention provides an array comprising at least four
probes. A first probe comprises first and second segments, each of
at least three nucleotides and exactly complementary to first and
second subsequences of a reference sequence-from a
biotransformation gene, the segments including at least one
interrogation position corresponding to a nucleotide in the
reference sequence, wherein either (1) the first and second
subsequences are noncontiguous, or (2) the first and second
subsequences are contiguous and the first and second-segments are
inverted relative to the complement of the first and second
subsequences in the reference sequence. The array further comprises
second, third and fourth probes, identical to a sequence comprising
the first probe or a subsequence thereof comprising at least three
nucleotides from each of the first and second segments, except in
the at least one interrogation position, which differs in each of
the probes.
[0016] In a sixth embodiment, the invention provides a method of
comparing a target nucleic acid with a reference sequence from a
biotransformation gene. The method comprises hybridizing a sample
comprising the target nucleic acid to one of the arrays of
oligonucleotide probes described above. The method then determines
which probes, relative to one another, specifically bind to the
target nucleic acid, the relative specific binding of corresponding
probes indicating whether a nucleotide in the target sequence is
the same or different from the corresponding nucleotide in the
reference sequence.
[0017] For example, for the array of the second embodiment which
has four probe sets, the array can be analyzed by comparing the
relative specific binding of four corresponding probes from the
first, second, third and fourth probe sets, assigning a nucleotide
in the target sequence as the complement of the interrogation
position of the probe having the greatest specific binding, and
repeating these steps until each nucleotide of interest in the
target sequence has been assigned.
[0018] In some methods, the reference sequence includes a site of a
mutation in the biotransformation gene and a silent polymorphism in
or flanking the biotransformation gene, and the target nucleic acid
comprises one or more different alleles of the biotransformation
gene. In this situation, the relative specific binding of probes
having an interrogation position aligned with the silent
polymorphism indicates the number of different alleles and the
relative specific binding of probes having an interrogation
position aligned with the mutation indicates whether the mutation
is present in at least one of the alleles.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1: Basic tiling strategy. The figure illustrates the
relationship between an interrogation position (I) and a
corresponding nucleotide (n) in the reference sequence, and between
a probe from the first probe set and corresponding probes from
second, third and fourth probe sets.
[0020] FIG. 2: Segment of complementarity in a probe from the first
probe set.
[0021] FIG. 3A: Incremental succession of probes in a basic tiling
strategy. The figure shows four probe sets, each having three
probes. Note that each probe differs from its predecessor in the
same set by the acquisition of a 5' nucleotide and the loss of a 3'
nucleotide, as well as in the nucleotide occupying the
interrogation position.
[0022] FIG. 3B: Arrangement of probe sets in tiling arrays lacking
a perfectly matched probe set.
[0023] FIG. 4A: Exemplary arrangement of lanes on a chip. The chip
shows four probe sets, each having five probes and each having a
total of five interrogation positions (I1-I5), one per probe.
[0024] FIG. 4B: A tiling strategy for analyzing closing spaced
mutations.
[0025] FIG. 4C: A tiling strategy for avoiding loss of signal due
to probe self-annealing.
[0026] FIG. 5: Hybridization pattern of chip having probes laid
down in lanes. Dark patches indicate hybridization. The probes in
the lower part of the figure occur at the column of the array
indicated by the arrow when the probes length is 15 and the
interrogation position 7.
[0027] FIG. 6: Strategies for detecting deletion and insertion
mutations. Bases in brackets may or may not be present.
[0028] FIG. 7: Block tiling strategy. The perfectly matched probe
has three interrogation positions. The probes from the other probe
sets have only one of these interrogation positions.
[0029] FIG. 8: Multiplex tiling strategy. Each probe has two
interrogation positions.
[0030] FIG. 9: Helper mutation strategy. The segment of
complementarity differs from the complement of the reference
sequence at a helper mutation as well as the interrogation
position.
[0031] FIG. 10: Layout of probes on chip for analysis of cytochrome
P450 2D6 and cytochrome P450 2C19.
[0032] FIG. 11: Alternative tiling for analysis of CyP2D6/CYP2D7
polymorphism. FIG. 12: Optiblock for analysis of CYP2D6P34S
polymorphism.
[0033] FIG. 13: The chip shown in FIG. 10 hybridized to a CYP2D6-B
target.
[0034] FIG. 14: Magnification of the hybridization patterns of the
cytochrome P450 2D6 L421P and S486 polymorphism opti-tiling
blocks.
[0035] FIG. 15: Hybridization of the chip shown in FIG. 10 to
cytochrome P450 2C19.
[0036] FIG. 16: VLSIPS.TM. technology applied to the light directed
synthesis of oligonucleotides. Light (hv) is shone through a mask
(M.sub.1) to activate functional groups (--OH) on a surface by
removal of a protecting group (X). Nucleoside building blocks
protected with photoremovable protecting groups (T-X, C-X) are
coupled to the activated areas. By repeating the irradiation and
coupling steps, very complex arrays of oligonucleotides can be
prepared.
[0037] FIG. 17: Use of the VLSIPS.TM. process to prepare
"nucleoside combinatorials" or oligonucleotides synthesized by
coupling all four nucleosides to form dimers, trimers, and so
forth.
[0038] FIG. 18: Deprotection, coupling, and oxidation steps of a
solid phase DNA synthesis method.
[0039] FIG. 19: An illustrative synthesis route for the nucleoside
building blocks used in the VLSIPS.TM. method.
[0040] FIG. 20: A preferred photoremovable protecting group,
MeNPOC, and preparation of the group in active form. FIG. 21:
Detection system for scanning a DNA chip.
DETAILED DESCRIPTION OF THE INVENTION
[0041] The invention provides a number of strategies for comparing
a polynucleotide of known sequence (a reference sequence) with
variants of that sequence (target sequences). The comparison can be
performed at the level of entire genomes, chromosomes, genes, exons
or introns, or can focus on individual mutant sites and immediately
adjacent bases. The strategies allow detection of variations, such
as mutations or polymorphisms, in the target sequence irrespective
whether a particular variant has previously been characterized. The
strategies both define the nature of a variant and identify its
location in a target sequence.
[0042] The strategies employ arrays of oligonucleotide probes
immobilized to a solid support. Target sequences are analyzed by
determining the extent of hybridization at particular probes in the
array. The strategy in selection of probes facilitates distinction
between perfectly matched probes and probes showing single-base or
other degrees of mismatches. The strategy usually entails sampling
each nucleotide of interest in a target sequence several times,
thereby achieving a high degree of confidence in its identity. This
level of confidence is further increased by sampling of adjacent
nucleotides in the target sequence to nucleotides of interest. The
present tiling strategies result in sequencing and comparison
methods suitable for routine large-scale practice with a high
degree of confidence in the sequence output.
I. General Tiling Strategies
[0043] A. Selection of Reference Sequence
[0044] The chips are designed to contain probes exhibiting
complementarity to one or more selected reference sequence whose
sequence is known. The chips are used to read a target sequence
comprising either the reference sequence itself or variants of that
sequence. Target sequences may differ from the reference sequence
at one or more positions but show a high overall degree of sequence
identity with the reference sequence (e.g., at least 75, 90, 95,
99, 99.9 or 99.99%). Any polynucleotide of known sequence can be
selected as a reference sequence. Reference sequences of interest
include sequences known to include mutations or polymorphisms
associated with phenotypic changes having clinical significance in
human patients. For example, the CFTR gene and P53 gene in humans
have been identified as the location of several mutations resulting
in cystic fibrosis or cancer respectively. Other reference
sequences of interest include those that serve to identify
pathogenic microorganisms and/or are the site of mutations by which
such microorganisms acquire drug resistance (e.g., the HIV reverse
transcriptase gene). Other reference sequences of interest include
regions where polymorphic variations are known to occur (e.g., the
D-loop region of mitochondrial DNA). These reference sequences have
utility for, e.g., forensic or epidemiological studies. Other
reference sequences of interest include p34 (related to p53), p65
(implicated in breast, prostate and liver cancer), and DNA segments
encoding cytochromes P450 and other biotransformation genes (see
Meyer et al., Pharmac. Ther. 46, 349-355 (1990)). Other reference
sequences of interest include those from the genome of pathogenic
viruses (e.g., hepatitis (A, B, or C), herpes virus (e.g., VZV,
HSV-1, HAV-6, HSV-II, and CMV, Epstein Barr virus), adenovirus,
influenza virus, flaviviruses, echovirus, rhinovirus, coxsackie
virus, cornovirus, respiratory syncytial virus, mumps virus,
rotavirus, measles virus, rubella virus, parvovirus, vaccinia
virus, HTLV virus, dengue virus, papillomavirus, molluscum virus,
poliovirus, rabies virus, JC virus and arboviral encephalitis
virus. Other reference sequences of interest are from genomes or
episomes of pathogenic bacteria, particularly regions that confer
drug resistance or allow phylogenic characterization of the host
(e.g., 16S rRNA or corresponding DNA). For example, such bacteria
include chlamydia, rickettsial bacteria, mycobacteria,
staphylococci, treptocci, pneumonococci, meningococci and
conococci, klebsiella, proteus, serratia, pseudomonas, legionella,
diphtheria, salmonella, bacilli, cholera, tetanus, botulism,
anthrax, plague, leptospiros is, and Lymes disease bacteria. Other
reference sequences of interest include those in which mutations
result in the following autosomal recessive disorders: sickle cell
anemia, .beta.-thalassemia, phenylketonuria, galactosemia, Wilson's
disease, hemochromatosis, severe combined immunodeficiency,
alpha-1-antitrypsin deficiency, albinism, alkaptonuria, lysosomal
storage diseases and Ehlers-Danlos syndrome. Other reference
sequences of interest include those in which mutations result in
X-linked recessive disorders: hemophilia, glucose-6-phosphate
dehydrogenase, agammaglobulimenia, diabetes insipidus, Lesch-Nyhan
syndrome, muscular dystrophy, Wiskott-Aldrich syndrome, Fabry's
disease and fragile X-syndrome. Other reference sequences of
interest includes those in which mutations result in the following
autosomal dominant disorders: familial hypercholesterolemia,
polycystic kidney disease, Huntingdon's disease, hereditary
spherocytosis, Marfan's syndrome, von Willebrand's disease,
neurofibromatosis, tuberous sclerosis, hereditary hemorrhagic
telangiectasia, familial colonic polyposis, Ehlers-Danlos syndrome,
myotonic dystrophy, muscular dystrophy, osteogenesis imperfecta,
acute intermittent porphyria, and von Hippel-Lindau disease.
[0045] The length of a reference sequence can vary widely from a
full-length genome, to an individual chromosome, episome, gene,
component of a gene, such as an exon, intron or regulatory
sequences, to a few nucleotides. A reference sequence of between
about 2, 5, 10, 20, 50, 100, 5000, 1000, 5,000 or 10,000, 20,000 or
100,000 nucleotides is common. Sometimes only particular regions of
a sequence (e.g., exons of a gene) are of interest. In such
situations, the particular regions can be considered as separate
reference sequences or can be considered as components of a single
reference sequence, as matter of arbitrary choice.
[0046] A reference sequence can be any naturally occurring, mutant,
consensus or purely hypothetical sequence of nucleotides, RNA or
DNA. For example, sequences can be obtained from computer data
bases, publications or can be determined or conceived de novo.
Usually, a reference sequence is selected to show a high degree of
sequence identity to envisaged target sequences. Often,
particularly, where a significant degree of divergence is
anticipated between target sequences, more than one reference
sequence is selected. Combinations of wildtype and mutant reference
sequences are employed in several applications of the tiling
strategy.
[0047] B. Chin Design
[0048] 1. Basic Tiling Strategy
[0049] The basic tiling strategy provides an array of immobilized
probes for analysis of target sequences showing a high degree of
sequence identity to one or more selected reference sequences. The
strategy is first illustrated for an array that is subdivided into
four probe sets, although it will be apparent that in some
situations, satisfactory results are obtained from only two probe
sets. A first probe set comprises a plurality of probes exhibiting
perfect complementarity with a selected reference sequence. The
perfect complementarity usually exists throughout the length of the
probe. However, probes having a segment or segments of perfect
complementarily that is/are flanked by leading or trailing
sequences lacking complementarity to the reference sequence can
also be used. Within a segment of complementarity, each probe in
the first probe set has at least one interrogation position that
corresponds to a nucleotide in the reference sequence. That is, the
interrogation position is aligned with the corresponding nucleotide
in the reference sequence, when the probe and reference sequence
are aligned to maximize complementarity between the two. If a probe
has more than one interrogation position, each corresponds with a
respective nucleotide in the reference sequence. The identity of an
interrogation position and corresponding nucleotide in a particular
probe in the first probe set cannot be determined simply by
inspection of the probe in the first set. As will become apparent,
an interrogation position and corresponding nucleotide is defined
by the comparative structures of probes in the first probe set and
corresponding probes from additional probe sets.
[0050] In principle, a probe could have an interrogation position
at each position in the segment complementary to the reference
sequence. Sometimes, interrogation positions provide more accurate
data when located away from the ends of a segment of
complementarity. Thus, typically a probe having a segment of
complementarity of length x does not contain more than x-2
interrogation positions. Since probes are typically 9-21
nucleotides, and usually all of a probe is complementary, a probe
typically has 1-19 interrogation positions. Often the probes
contain a single interrogation position, at or near the center of
probe.
[0051] For each probe in the first set, there are, for purposes of
the present illustration, up to three corresponding probes from
three additional probe sets. See FIG. 1. Thus, there are four
probes corresponding to each nucleotide of interest in the
reference sequence. Each of the four corresponding probes has an
interrogation position aligned with that nucleotide of interest.
Usually, the probes from the three additional probe sets are
identical to the corresponding probe from the first probe set with
one exception. The exception is that at least one (and often only
one).interrogation position, which occurs in the same position in
each of the four corresponding probes from the four probe sets, is
occupied by a different nucleotide in the four probe sets. For
example, for an A nucleotide in the reference sequence, the
corresponding probe from the first probe set has its interrogation
position occupied by a T, and the corresponding probes from the
additional three probe sets have their respective interrogation
positions occupied by A, C, or G, a different nucleotide in each
probe. Of course, if a probe from the first probe set comprises
trailing or flanking sequences lacking complementarity to the
reference sequences (see. FIG. 2), these sequences need not be
present in corresponding probes from the three additional sets.
Likewise corresponding probes from the three additional sets can
contain leading or trailing sequences outside the segment of
complementarity that are not present in the corresponding probe
from the first probe set. Occasionally, the probes from the
additional three probe set are identical (with the exception of
interrogation position(s)) to a contiguous subsequence of the full
complementary segment of the corresponding probe from the first
probe set. In this case, the subsequence includes the interrogation
position and usually differs from the full-length probe only in the
omission of one or both terminal nucleotides from the termini of a
segment of complementarity. That is, if a probe from the first
probe set has a segment of complementarity of length n,
corresponding probes from the other sets will usually include a
subsequence of the segment of at least length n-2. Thus, the
subsequence is usually at least 3, 4, 7, 9., 15, 21, or 25
nucleotides long, most typically, in the range of 9-21 nucleotides.
The subsequence should be sufficiently long to allow a probe to
hybridize detectably more strongly to a variant of the reference
sequence mutated at the interrogation position than to the
reference sequence.
[0052] The probes can be oligodeoxyribonucleotides or
oligoribonucleotides, or any modified forms of these polymers that
are capable of hybridizing with a target nucleic sequence by
complementary base-pairing. Complementary base pairing means
sequence-specific base pairing which includes e.g., Watson-Crick
base pairing as well as other forms of base pairing such as
Hoogsteen base pairing. Modified forms include 2'-O-methyl
oligoribonucleotides and so-called. PNAs, in which
oligodeoxyribonucleotides are linked via peptide bonds rather than
phophodiester bonds. The probes can be attached by any linkage to a
support (e.g., 3', 5' or via the base). 3' attachment is more usual
as this orientation is compatible with the preferred chemistry for
solid phase synthesis of oligonucleotides.
[0053] The number of probes in the first probe set (and as a
consequence the number of probes in additional probe sets) depends
on the length of the reference sequence, the number of nucleotides
of interest in the reference sequence and the number of
interrogation positions per probe. In general, each nucleotide of
interest in the reference sequence requires the same interrogation
position in the four sets of probes. Consider, as an example, a
reference sequence of 100 nucleotides, 50 of which are of interest,
and probes each having a single interrogation position. In this
situation, the first probe set requires fifty probes, each having
one interrogation position corresponding to a nucleotide of
interest in the reference sequence. The second, third and fourth
probe sets each have a corresponding probe for each probe in the
first probe set, and so each also contains a total of fifty probes.
The identity of each nucleotide of interest in the reference
sequence is determined by comparing the relative hybridization
signals at four probes having interrogation positions corresponding
to that nucleotide from the four probe sets.
[0054] In some reference sequences, every nucleotide is of
interest. In other reference sequences, only certain portions in
which variants (e.g., mutations or polymorphisms) are concentrated
are of interest. In other reference sequences, only particular
mutations or polymorphisms and immediately adjacent nucleotides are
of interest. Usually, the first probe set has interrogation
positions selected to correspond to at least a nucleotide (e.g.,
representing a point mutation) and one immediately adjacent
nucleotide. Usually, the probes in the first set have interrogation
positions corresponding to at least 3, 10, 50, 100, 1000, or 20,000
contiguous nucleotides. The probes usually have interrogation
positions corresponding to at least 5, 10, 30, 50, 75, 90, 99 or
sometimes 100% of the nucleotides in a reference sequence.
Frequently, the probes in the first probe set completely span the
reference sequence and overlap with one another relative to the
reference sequence. For example, in one common arrangement each
probe in the first probe set differs from another probe in that set
by the omission of a 3' base complementary to the reference
sequence and the acquisition of a 5' base complementary to the
reference sequence. See FIG. 3A.
[0055] The number of probes on the chip can be quite large (e.g.,
10.sup.5-10.sup.6). However, often only a relatively small
proportion (i.e., less than about 50%, 25%, 10%, 5% or 1%) of the
total number of probes of a given length are selected to pursue a
particular tiling strategy. For example, a complete set of octomer
probes comprises 65,536 probes; thus, an array of the invention
typically has fewer than 32,768 octomer probes. A complete array of
decamer probes comprises 1,048,576 probes; thus, an array of the
invention typically has fewer than about-500,000 decamer probes.
Often arrays have a lower limit of 25, 50 or 100 probes and an
upper limit of 1,000,000, 100,,000, 10,000 or 1000 probes. The
arrays can have other components besides the probes such as linkets
attaching the probes to a support.
[0056] Some advantages of the use of only a proportion of all
possible probes of a given length include: (i) each position in the
array is highly informative, whether or not hybridization occurs;
(ii) nonspecific hybridization is minimized; (iii) it is
straightforward to correlate hybridization differences with
sequence differences, particularly with reference to the
hybridization pattern of a known standard; and (iv) the ability to
address each probe independently during synthesis, using high
resolution photolithography, allows the array to be designed and
optimized for any sequence. For example the length of any probe can
be varied independently of the others.
[0057] For conceptual simplicity, the probes in a set are usually
arranged in order of the sequence in a lane across the chip. A lane
contains a series of overlapping probes, which represent or tile
across, the selected reference sequence (see FIG. 3A). The
components of the four sets of probes are usually laid down in four
parallel lanes, collectively constituting a row in the horizontal
direction and a series of 4-member columns in the vertical
direction. Corresponding probes from the four probe sets (i.e.,
complementary to the same subsequence of the reference sequence)
occupy a column. Each probe in a lane usually differs from its
predecessor in the lane by the omission of a base at one end and
the inclusion of additional base at the other end as shown in FIG.
3A. However, this orderly progression of probes can be interrupted
by the inclusion of control probes or omission of probes in certain
columns of the array. Such columns serve as controls to orient the
chip, or gauge the background, which can include target sequence
nonspecifically bound to the chip.
[0058] The probes sets are usually laid down in lanes such that all
probes having an interrogation position occupied by an A form an
A-lane, all probes having an interrogation position occupied by a C
form a C-lane, all probes having an interrogation position occupied
by a G form a G-lane, and all probes having an interrogation
position occupied by a T (or U) form a T lane (or a U lane). Note
that in this arrangement there is not a unique correspondence
between probe sets and lanes. Thus, the probe from the first probe
set is laid down in the A-lane, C-lane, A-lane, A-lane and T-lane
for the five columns in FIG. 4A. The interrogation position on a
column of probes corresponds to the position in the target sequence
whose identity is determined from analysis of hybridization to the
probes in that column. Thus, I.sub.1-I.sub.5 respectively
correspond to N.sub.1-N.sub.5 in FIG. 4A. The interrogation
position an be anywhere in a probe but is usually at or near the
central position of the probe to maximize differential
hybridization signals between a perfect match and a single-base
mismatch. For example, for an 11 mer probe, the central position is
the sixth nucleotide.
[0059] Although the array of probes is usually laid down in rows
and columns as described above, such a physical arrangement of
probes on the chip is not essential. Provided that the spatial
location of each probe in an array is known, the data from the
probes can be collected and processed to yield the sequence of a
target irrespective of the physical arrangement of the probes on a
chip. In processing the data, the hybridization signals from the
respective probes can be reasserted into any conceptual array
desired for subsequent data reduction whatever the physical
arrangement of probes on the chip.
[0060] A range of lengths of probes can be employed in the chips.
As noted above, a probe may consist exclusively of a complementary
segments, or may have one or more complementary segments juxtaposed
by flanking, trailing and/or intervening segments. In the latter
situation, the total length of complementary segment(s) is more
important that the length of the probe. In functional terms, the
complementary segment(s) -of the first probe sets should be
sufficiently long to allow the probe to hybridize detectably more
strongly to a reference sequence compared with a variant of the
reference including a single base mutation at the nucleotide
corresponding to the interrogation position of the probe.
Similarly, the complementary segment(s) in corresponding probes
from additional probe sets should be sufficiently long to allow a
probe to hybridize detectably more strongly to a variant of the
reference sequence having a single nucleotide substitution at the
interrogation position relative to the reference sequence. A probe
usually has a single complementary segment having a length of at
least 3 nucleotides, and more usually at least 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 30
bases exhibiting perfect complementarity (other than possibly at
the interrogation position(s) depending on the probe set) to the
reference sequence. In bridging strategies, where more than one
segment of complementarity is present, each segment provides at
least three complementary nucleotides to the reference sequence and
the combined segments provide at least two segments of three or a
total of six complementary nucleotides. As in the other strategies,
the combined length of complementary segments is typically from
6-30 nucleotides, and preferably from about 9-21 nucleotides. The
two segments are often approximately the same length. Often, the
probes (or segment of complementarity within probes) have an odd
number of bases, so that an interrogation position can occur in the
exact center of the probe.
[0061] In some chips, all probes are the same length.
[0062] Other chips employ different groups of probe sets, in which
case the probes are of the same size within a group, but differ
between different groups. For example, some chips have one group
comprising four sets of probes as described above in which all the
probes are 11 mers, together with a second group comprising four
sets of probes in which, all of the probes are 13 mers. Of course,
additional groups of probes can be added.
[0063] Thus, some chips contain, e.g., four groups of probes having
sizes of 11 mers, 13 mers, 15 mers and 17 mers. Other chips have
different size probes within the same group of four probe sets. In
these chips, the probes in the first set can vary in length
independently of each other. Probes in the other sets are usually
the same length as the probe occupying the same column from the
first set. However, occasionally different lengths of probes can be
included at the same column position in the four lanes. The
different length probes are included equalize hybridization signals
from probes irrespective of whether A-T or C-G bonds are formed at
the interrogation position.
[0064] The length of probe can be important in distinguishing
between a perfectly matched probe and probes showing a single base
mismatch with the target sequence. The discrimination is usually
greater for short probes. Shorter probes are usually also less
susceptible to formation of secondary structures. However, the
absolute amount of target sequence bound, and hence the signal, is
greater for larger probes. The probe length representing the
optimum compromise between these competing considerations may vary
depending on inter alia the GC content of a particular region of
the target DNA sequence, secondary structure, synthesis efficiency
and cross-hybridization. In some regions of the target, depending
on hybridization conditions, short probes (e.g., 11 mers) may
provide information that is inaccessible from longer probes (e.g.,
19 mers) and vice versa. Maximum sequence information can be read
by including several groups of different sized probes on the chip
as noted above. However, for many regions of the target sequence,
such a strategy provides redundant information in that the same
sequence is read multiple times from the different groups of
probes. Equivalent information can be obtained from a single group
of different sized probes in which the sizes are selected to
maximize readable sequence S at particular regions of the target
sequence. The strategy of customizing probe length within a single
group of probe sets minimizes the total number of probes required
to read a particular target sequence. This leaves ample capacity
for the chip to include probes to other reference sequences.
[0065] The invention provides an optimization block which allows
systematic variation of probe length and interrogation position to
optimize the selection of probes for analyzing a particular
nucleotide in a reference sequence. The block comprises-alternating
columns of probes complementary to the wildtype target and probes
complementary to a specific mutation. The interrogation position is
varied between columns and probe length is varied down a
column.
[0066] Hybridization of the chip to the reference sequence or the
mutant form of the reference sequence identifies the probe length
and interrogation position providing the greatest differential
hybridization signal.
[0067] Variation of interrogation position in probes for analyzing
different regions of a target sequence offers a number of
advantages. If a segment of a target sequence contains two closely
spaced mutations, m1, and m2, and probes for analyzing that segment
have an interrogation position at or near the middle, then no probe
has an interrogation position aligned with one of the mutations
without overlapping the other mutation (see first probe in FIG.
4B). Thus, the presence of a mutation would have to be detected by
comparing the hybridization signal of a single-mismatched probe
with a double-mismatched probe. By contrast, if the interrogation
position is near the 3' end of the probes, probes can have their
interrogation position aligned with m1 without overlapping m2
(second probe in FIG. 4B). Thus, the mutation can be detected by a
comparison of a perfectly matched probe with single based
mismatched probes. Similarly, if the interrogation position is near
the 5' end of the probes, probes can have their interrogation
position aligned with m2 without overlapping m1 (third probe in
FIG. 4B).
[0068] Variation of the interrogation position also offers the
advantage of reducing loss of signal due to self-annealing of
certain probes. FIG. 4C shows a target sequence having a nucleotide
X, which can be read either from the relative signals of the four
probes having a central interrogation position (shown at the left
of the figure) or from the four probes having the interrogation
position near the three prime end (shown at the right of the
figure). Only the probes having the central interrogation position
are capable of self-annealing. Thus, a higher signal is obtained
from the probes having the interrogation position near the
terminus.
[0069] The probes are designed to be complementary to either strand
of the reference sequence (e.g., coding or non-coding). Some chips
contain separate groups of probes, one complementary to the coding
strand, the other complementary to the noncoding strand.
Independent analysis of coding and noncoding strands provides
largely redundant information. However, the regions of ambiguity in
reading the coding strand are not always the same as those in
reading the noncoding strand. Thus, combination of the information
from coding and noncoding strands increases the overall accuracy of
sequencing.
[0070] Some chips contain additional probes or groups of probes
designed to be complementary to a second reference sequence. The
second reference sequence is often a subsequence of the first
reference sequence bearing one or more commonly occurring mutations
or interstrain variations. The second group of probes is designed
by the same principles as described above except that the probes
exhibit complementarity to the second reference sequence. The
inclusion of a second group is particular useful for analyzing
short subsequences of the primary reference sequence in which
multiple mutations are expected to occur within a short distance
commensurate with the length of the probes (i.e., two or more
mutations within 9 to 21 bases). Of course, the same principle can
be extended to provide chips containing groups of probes for any
number of reference sequences. Alternatively, the chips may contain
additional probe(s) that do not form part of a tiled array as noted
above, but rather serves as probe(s) for a conventional reverse dot
blot. For example, the presence of mutation can be detected from
binding of a target sequence to a single oligomeric probe harboring
the mutation. Preferably, an additional probe containing the
equivalent region of the wildtype sequence is included as a
control.
[0071] Although only a subset of probes is required to analyze a
particular target sequence, it is quite possible that other probes
superfluous to the contemplated analysis are also included on the
chip. In the extreme case, the chip could can a complete set of all
probes of a given length notwithstanding that only a small subset
is required to analyze the particular reference sequence of
interest. Although such a situation might appear wasteful of
resources, a chip including a complete set of probes offers the
advantage of including the appropriate subset of probes for
analyzing any reference sequence. Such a chip also allows
simultaneous analysis of a reference sequence from different
subsets of probes (e.g., subsets having the interrogation site at
different positions in the probe).
[0072] In its simplest terms, the analysis of a chip reveals
whether the target sequence is the same or different from the
reference sequence. If the two are the same, all probes in the
first probe set show a stronger hybridization signal than
corresponding probes from other probe sets. If the two are
different, most probes from the first probe set still show a
stronger hybridization signal than corresponding probes from the
other probe sets, but some probes from the first probe set do not.
Thus, when a probe from another probe sets light up more strongly
than the corresponding probe from the first probe set, this
provides a simple visual indication that the target sequence and
reference sequence differ.
[0073] The chips also reveal the nature and position of differences
between the target and reference sequence. The chips are read by
comparing the intensities of labelled target bound to the probes in
an array. Specifically, for each nucleotide of interest in the
target sequence, a comparison is performed between probes having an
interrogation position aligned with that position. These probes
form a column (actual or conceptual) on the chip. For example, a
column often contains one probe from each of A, C, G and T lanes.
The nucleotide in the target sequence is identified as the
complement of the nucleotide occupying the interrogation position
in the probe showing the highest hybridization signal from a
column. FIG. 6 shows the hybridization pattern of a chip hybridized
to its reference sequence. The dark square in each column
represents the probe from the column having the highest
hybridization signal. The sequence can be read by following the
pattern of dark squares from left to right across the chip. The
first dark square is in the A lane indicating that the nucleotide
occupying the interrogation position of the probe represented by
this square is an A. The first nucleotide in the reference sequence
is the complement of nucleotide occupying the interrogation
position of this probe (i.e., a T). Similarly, the second dark
square is in the T-lane, from which it can be deduced that the
second nucleotide in the reference sequence is an A. Likewise the
third dark square is in the T-lane, from which it can be deduced
that the third nucleotide in the reference sequence is also an A,
and so forth. By including probes in the first probe set (and by
implication in the other probe sets) with interrogation positions
corresponding to every nucleotide in a reference sequence, it is
possible to read substantially every nucleotide in a target
sequence, thereby revealing the complete or nearly complete
sequence of the target.
[0074] Of the four probes in a column, only one can exhibit a
perfect match to the target sequence whereas the others usually
exhibit at least a one base pair mismatch. The probe exhibiting a
perfect match usually produces a substantially greater
hybridization signal than the other three probes in the column and
is thereby easily identified. However, in some regions of the
target sequence, the distinction between a perfect match and a
one-base mismatch is less clear. Thus, a call ratio is established
to define the ratio of signal from the best hybridizing probes to
the second best hybridizing probe that must be exceeded for a
particular target position to be read from the probes. A high call
ratio ensures that few if any errors are made in calling target
nucleotides, but can result in some nucleotides being scored as
ambiguous, which could in fact be accurately read. A lower call
ratio results in fewer ambiguous calls, but can result in more
erroneous calls. It has been found that at a call ratio of 1.2
virtually all calls are accurate. However, a small but significant
number of bases (e.g., up to about 10%) may have to be scored as
ambiguous.
[0075] Although small regions of the target sequence can sometimes
be ambiguous, these regions usually occur at the same or similar
segments in different target sequences. Thus, for precharacterized
mutations, it is known in advance whether that mutation is likely
to occur within a region of unambiguously determinable
sequence.
[0076] An array of probes is most useful for analyzing the
reference sequence from which the probes were designed and variants
of that sequence exhibiting substantial sequence similarity with
the reference sequence (e.g., several single-base mutants spaced
over the reference sequence). When an array is used to analyze the
exact reference sequence from which it was designed, one probe
exhibits a perfect match to the reference sequence, and the other
three probes in the same column exhibits single-base mismatches.
Thus, discrimination between hybridization signals is usually high
and accurate sequence is obtained. High accuracy is also obtained
when an array is used for analyzing a target sequence comprising a
variant of the reference sequence that has a single mutation
relative to the reference sequence, or several widely spaced
mutations relative to the reference sequence. At different mutant
loci, one probe exhibits a perfect match to the target, and the
other three probes occupying the same column exhibit single-base
mismatches, the difference (with respect to analysis of the
reference sequence) being the lane in which the perfect match
occurs.
[0077] For target sequences showing a high degree of divergence
from the reference strain or incorporating several closely spaced
mutations from the-reference strain, a single group of probes
(i.e., designed with respect to a single reference sequence) will
not always provide accurate sequence for the highly variant region
of this sequence. At some particular columnar positions, it may be
that no single probe exhibits perfect complementarity to the target
and that any comparison must be based on different degrees of
mismatch between the four probes. Such a comparison does not always
allow the target nucleotide corresponding to that columnar position
to be called. Deletions in target sequences can be detected by loss
of signal from probes having interrogation positions encompassed by
the deletion. However, signal may also be lost from probes having
interrogation positions closely proximal to the deletion resulting
in some regions of the target sequence that cannot be read. Target
sequence bearing insertions will also exhibit short regions
including and proximal to the insertion that usually cannot be
read.
[0078] The presence of short regions of difficult-to-read target
because of closely spaced mutations, insertions or deletions, does
not prevent determination of the remaining sequence of the target
as different regions of a target sequence are determined
independently. Moreover,.such ambiguities as might result from
analysis of diverse variants with a single group of probes can be
avoided by including multiple groups of probe sets on a chip. For
example, one group of probes can be designed based on a full-length
reference sequence, and the other groups on subsequences of the
reference sequence incorporating frequently occurring mutations or
strain variations.
[0079] A particular advantage of the present sequencing strategy
over conventional sequencing methods is the capacity simultaneously
to detect and quantify proportions of multiple target sequences.
Such capacity is valuable, e.g., for diagnosis of patients who are
heterozygous with respect to a gene or who are infected with a
virus, such as HIV, which is usually present in several polymorphic
forms. Such capacity is also useful in analyzing targets from
biopsies of tumor cells and surrounding tissues. The presence of
multiple target sequences is detected from the relative signals of
the four probes at the array columns corresponding to the target
nucleotides at which diversity occurs. The relative signals of the
four probes for the mixture under test are compared with the
corresponding signals from a homogeneous reference sequence. An
increase in a signal from a probe that is mismatched with respect
to the reference sequence, and a corresponding decrease in the
signal from the probe which is matched with the reference sequence,
signal the presence of a mutant strain in the mixture. The extent
in shift in hybridization signals of the probes is related to the
proportion of a target sequence in the mixture. Shifts in relative
hybridization signals can be quantitatively related to proportions
of reference and mutant sequence by prior calibration of the chip
with seeded mixtures of the mutant and reference sequences. By this
means, a chip can be used to detect variant or mutant strains
constituting as little as 1, 5, 20, or 25% of a mixture of
stains.
[0080] Similar principles allow the simultaneous analysis of
multiple target sequences even when none is identical to the
reference sequence. For example, with a mixture of two target
sequences bearing first and second mutations, there would be a
variation in the hybridization patterns of probes having
interrogation positions corresponding to the first and second
mutations relative to the hybridization pattern with the reference
sequence. At each position, one of the probes having a mismatched
interrogation position relative to the reference sequence would
show an increase in hybridization signal, and the probe having a
matched interrogation position relative to the reference sequence
would show a decrease in hybridization signal. Analysis of the
hybridization pattern of the mixture of mutant target sequences,
preferably in comparison with the hybridization pattern of the
reference sequence, indicates the presence of two mutant target
sequences, the position and nature of the mutation in each strain,
and the relative proportions of each strain.
[0081] In a variation of the above method, several target sequences
target sequences are differentially labelled before being
simultaneously applied to the array. For example, each different
target sequence can be labelled with a fluorescent labels emitting
at different wavelength. After applying a mixtures of target
sequence to the arrays, the individual target sequences can be
distinguished and independently analyzed by virtue of the
differential labels. For example, the methods target sequences
obtained from a patient at different stages of a disease can be
differently labelled and analyzed simultaneously, facilitating
identification of new mutations.
[0082] 2. Omission of Probes
[0083] The basic strategy outlined above employs four probes to
read each nucleotide of interest in a target sequence. One probe
(from the first probe set) shows a perfect match to the reference
sequence and the other three probes (from the second, third and
fourth probe sets) exhibit a mismatch with the reference sequence
and a perfect match with a target sequence bearing a mutation at
the nucleotide of interest. The provision of three probes from the
second, third and fourth probe sets allows detection of each of the
three possible nucleotide substitutions of any nucleotide of
interest. However, in some reference -sequences or regions of
reference sequences, it is known in advance that only certain
mutations are likely to occur. Thus, for example, at one site it
might be known that an A nucleotide in the reference sequence may
exist as a T mutant in some target sequences but s unlikely to
exist as a C or G mutant. Accordingly, for analysis of this region
of the reference sequence, one might include only the first and
second probe sets, the first probe set exhibiting perfect
complementarity to the reference sequence, and the second probe set
having an interrogation position occupied by an invariant A residue
(for detecting the T mutant). In other situations, one might
include the first, second and third probes sets (but not the
fourth) for detection of a wildtype nucleotide in the reference
sequence and two mutant variants thereof in target sequences. In
some chips, probes that would detect silent mutations (i.e., not
affecting amino acid sequence) are omitted.
[0084] Some chips effectively contain the second, third and
optionally, the fourth probes sets described in the basic tiling
strategy (i.e., the mismatched probe sets) but omit some or all of
the probes from the first probe set (i.e., perfectly matched
probes). Therefore, such chips comprise at least two probe sets,
which will arbitrarily be referred to as probe sets A and B (to
avoid confusion with the nomenclature used to describe the four
probe sets in the basic tiling strategy). Probe set A has a
plurality of probes. Each probe comprises a segment exactly
complementary to a subsequence of a reference sequence except in at
least one interrogation position. The interrogation position
corresponds to a nucleotide in the reference sequence juxtaposed
with the interrogation position when the reference sequence and
probe are maximally aligned. Probe set B has a corresponding probe
for each probe in the first probe set. The corresponding probe in
probe set B is identical to a sequence comprising the corresponding
probe from the first probe set or a subsequence thereof that
includes the at least one (and usually only one) interrogation
position except that the at least one interrogation position is
occupied by a different nucleotide in each of the two corresponding
probes from the probe sets A and B. An additional probe set C, if
present, also comprises a corresponding probe for each probe in the
probe set A except in the at least one interrogation position,
which differs in the corresponding probes from probe sets A, B and
C. The arrangement of probe sets A, B and C is shown in FIG. 3B.
FIG. 3B is the same as FIG. 3A except that the first probe set has
been omitted and the second, third and fourth probe sets in FIG. 3A
have been relabelled as probe sets A, B and C in FIG. 3B.
[0085] Chips lacking perfectly matched probes are preferably
analyzed by hybridization to both target and reference sequences.
The hybridizations can be performed sequentially, or, if the target
and reference are differentially labelled, concurrently. The
hybridization data are then analyzed in two ways. First,
considering only the hybridization signals of the probes to the
target sequence, one compares the signals of corresponding probes
for each position of interest in the target sequence. For a
position of mismatch with the reference sequence, one of the probes
having an interrogation position aligned with that position in the
target sequence shows a substantially higher signal than other
corresponding probes. The nucleotide occupying the position of
mismatch in the target sequence is the complement of the nucleotide
occupying the interrogation position of the corresponding probe
showing the highest signal. For a position where target and
reference sequence are the same, none of the corresponding probes
having an interrogation position aligned with that position in the
target sequence is matched, and corresponding probes generally show
weak signals, which may vary somewhat from each other.
[0086] In a second level of analysis, the ratio of hybridization
signals to the target and reference sequences is determined for
each probe in the array. For most probes in the array the ratio of
hybridization signals is about the same. For such a probe, it can
be deduced that the interrogation position of the probe corresponds
to a nucleotide that is the same in target and reference sequences.
A few probes show a much higher ratio of target hybridization to
reference hybridization than the majority of probes. For such a
probe, it can be deduced that the interrogation position of the
probe corresponds to a nucleotide that differs between target and
reference sequences, and that in the target, this nucleotide is the
complement of the nucleotide occupying the interrogation position
of the probe. The second level of analysis serves as a control to
confirm the identification of differences-between target and
reference sequence from the first level of analysis.
[0087] 3. Wildtype Probe Lane
[0088] When the chips comprise four probe sets, as discussed supra,
and the probe sets are laid down in four lanes, an A lane, a
C-lane, a G lane and a T or U lane, the probe having a segment
exhibiting perfect complementarity to a reference sequence varies
between the four lanes from one column to another. This does not
present any significant difficulty in computer analysis of the data
from the chip. However, visual inspection of the hybridization
pattern of the chip is sometimes facilitated by provision of an
extra lane of probes, in which each probe has a segment exhibiting
perfect complementarity to the reference sequence. See FIG. 4A.
This extra lane of probes is called the wildtype lane and contains
only probes from the first probe set. Each wildtype lane probe has
a segment that is identical to a segment from one of the probes in
the other four lanes (which lane depending on the column position).
The wildtype lane hybridizes to a target sequence at all nucleotide
positions except those in which deviations from the reference
sequence occurs. The hybridization pattern of the wildtype lane
thereby provides a simple visual indication of mutations.
[0089] 4. Deletion, Insertion and Multiple-Mutation Probes
[0090] Some chips provide an additional probe set specifically
designed for analyzing deletion mutations. The additional probe set
comprises a probe corresponding to each probe in the first probe
set as described above. However, a probe from the additional probe
set differs from the corresponding probe in the-first probe set in
that the nucleotide occupying the interrogation position is deleted
in the probe from the additional probe set. See FIG. 6. Optionally,
the probe from the additional probe set bears an additional
nucleotide at one of its termini relative to the corresponding
probe from the first probe set (shown in brackets in FIG. 6). The
probe from the additional probe set will hybridize more strongly
than the corresponding probe from the first probe set to a target
sequence having a single base deletion at the nucleotide
corresponding to the interrogation position. Additional probe sets
are provided in which not only the interrogation position, but also
an adjacent nucleotide is deleted.
[0091] Similarly, other chips provide additional probe sets for
analyzing insertions. For example, one additional probe set has a
probe corresponding to each probe in the first probe set as
described above. However, the probe in the additional probe set has
an extra T nucleotide inserted adjacent to the interrogation
position. See FIG. 6 (the extra T is shown in a square box).
Optionally, the probe has one fewer nucleotide at one of its
termini relative to the corresponding probe from the first probe
set (shown in brackets). The probe from the additional probe set
hybridizes more strongly than the corresponding probe from the
first probe set to a target sequence having an A insertion to the
left of nucleotide "n" the reference sequence in FIG. 6. Similar
additional probe sets can be constructed having C, G or A
nucleotides inserted adjacent to the interrogation position.
[0092] Usually, four such additional probe sets, one for each
nucleotide, are used in combination. Comparison of the
hybridization signal of the probes from the additional probe sets
with the corresponding probe from the first probe set indicates
whether the target sequence contains and insertion. For example, if
a probe from one of the additional probe sets shows a higher
hybridization signal than a corresponding probe From the first
probe set, it is deduced that the target sequence contains an
insertion adjacent to the corresponding nucleotide (n) in the
target sequence. The inserted base in the target is the complement
of the inserted base in the probe from the additional probe set
showing the highest hybridization signal. If the corresponding
probe from the first probe set shows a higher hybridization signal
than the corresponding probes from the additional probe sets, then
the target sequence does not contain an insertion to the left of
corresponding position (("n" in FIG. 6)) in the target
sequence.
[0093] Other chips provide additional probes (multiple-mutation
probes) for analyzing target sequences having multiple closely
spaced mutations. A multiple-mutation probe is usually identical to
a corresponding probe from the first set as described above, except
in the base occupying the interrogation position, and except at one
or more additional positions, corresponding to nucleotides in which
substitution may occur in the reference sequence. The one or more
additional positions in the multiple mutation probe are occupied by
nucleotides complementary to the nucleotides occupying
corresponding positions in the reference sequence when the possible
substitutions have occurred.
[0094] 5. Block Tiling
[0095] In block tiling, a perfectly matched (or wildtype) probe is
compared with multiple sets of mismatched or mutant probes. The
perfectly matched probe and the multiple sets of mismatched probes
with which it is compared collectively form a group or block of
probes on the chip. Each set comprises at least one, and usually,
three mismatched probes. FIG. 7 shows a perfectly matched probe
(CAATCGA) having three interrogation positions (I.sub.1, I.sub.2
and I.sub.3). The perfectly matched probe is compared with three
sets of probes (arbitrarily designated A, B and C), each having
three mismatched probes. In set A, the three mismatched probes are
identical to a sequence comprising the perfectly matched probe or a
subsequence thereof including the interrogation positions, except
at the first interrogation position. That is, the mismatched probes
in the set A differ from the perfectly matched probe set at the
first interrogation position. Thus, the relative hybridization
signals of the perfectly matched probe and the mismatched probes in
the set A indicates the identity of the nucleotide in a target
sequence corresponding to the first interrogation position. This
nucleotide is the complement of the nucleotide occupying the
interrogation position of the probe showing the highest signal.
Similarly, set B comprises three mismatched probes, that differ
from the perfectly matched probe at the second interrogation
position. The relative hybridization intensities of the perfectly
matched probe and the three mismatched probes of set B reveal the
identity of the nucleotide in the target sequence corresponding to
the second interrogation position (i.e., n2, in FIG. 7). Similarly,
the three mismatched probes in set C in FIG. 7 differ from the
perfectly matched probe at the third interrogation position.
Comparison of the hybridization intensities of the perfectly
matched probe and the mismatched probes in the set C reveals the
identity of the nucleotide in the target sequence corresponding to
the third interrogation position (n3).
[0096] As noted above, a perfectly matched probe may have seven or
more interrogation positions. If there are seven interrogation
positions, there are seven sets of three mismatched probe, each set
serving to identify the nucleotide corresponding to one of the
seven interrogation positions. Similarly, if there are 20
interrogation positions in the perfectly matched probe, then 20
sets of three mismatched probes are employed. As in other tiling
strategies, selected probes can be omitted if it is known in
advance that only certain types of mutations are likely to
arise.
[0097] Each block of probes allows short regions of a target
sequence to be read. For example, for a block of z,999 aving seven
interrogation positions, seven nucleotides in the target sequence
can be read. Of course, a chip can contain any number of blocks
depending on how many nucleotides of the target are of interest.
The hybridization signals for each block can be analyzed
independently of any other block. The block tiling strategy can
also be combined with other tiling strategies, with different parts
of the same reference sequence being tiled by different
strategies.
[0098] The block tiling strategy is a species of the basic tiling
strategy discussed above, in which the probe from the first probe
set has more than one interrogation position. The perfectly matched
probe in the block tiling strategy is equivalent to a probe from
the first probe set in the basic tiling strategy. The three
mismatched probes in set A in block tiling are equivalent to probes
from the second, third and fourth probe sets in the basic tiling
strategy. The three mismatched probes in set B of block tiling are
equivalent to probes from additional probe sets in basic tiling
arbitrarily designated the fifth, sixth and seventh probe sets. The
three mismatched probes in set C of blocking tiling are equivalent
to probes from three further probe sets in basic tiling arbitrarily
designated the eighth, ninth and tenth probe sets.
[0099] The block tiling strategy offers two advantages over a basic
strategy in which each probe in the first set has a single
interrogation position. One advantage is that the same sequence
information can be obtained from fewer probes. A second advantage
is that each of the probes constituting a block (i.e.,.a probe from
the first probe set and a corresponding probe from each of the
other probe sets) can have identical 3' and 5' sequences, with the
variation confined to a central segment containing the
interrogation positions. The identity of 3' sequence between
different probes simplifies the strategy for solid phase synthesis
of the probes on the chip and results in more uniform deposition of
the different probes on the chip, thereby in turn increasing the
uniformity of signal to noise ratio for different regions of the
chip.
[0100] 6. Multiplex Tiling
[0101] In the block tiling strategy discussed above, the identity
of a nucleotide in a target or reference sequence is determined by
comparison of hybridization patterns of one probe having a segment
showing a perfect match with that of other probes (usually three
other probes) showing a single base mismatch. In multiplex tiling,
the identity of at least two nucleotides in a reference or target
sequence is determined by comparison of hybridization signal
intensities of four probes, two of which have a segment showing
perfect complementarity or a single base mismatch to the reference
sequence, and two of which have a segment showing perfect
complementarity or a double-base mismatch to a segment. The four
probes whose hybridization patterns are to be compared each have a
segment that is exactly complementary to a reference sequence
except at two interrogation positions, in which the segment may or
may not be complementary to the reference sequence. The
interrogation positions correspond to the nucleotides in a
reference or target sequence which are determined by the comparison
of intensities. The nucleotides occupying the interrogation
positions in the four probes are selected according to the
following rule. The first interrogation position is occupied by a
different nucleotide in each of the four probes. The second
interrogation position is also occupied by a different nucleotide
in each of the four probes. In two of the four probes, designated
the first and second probes, the segment is exactly complementary
to the reference sequence except at not more than one of the two
interrogation positions. In other words, one of the interrogation
positions is occupied by a nucleotide that is complementary to the
corresponding nucleotide from the reference sequence and the other
interrogation position may or may not be so occupied. In the other
two of the four probes, designated the third and fourth probes, the
segment is exactly complementary to the reference sequence except
that both interrogation positions are occupied by nucleotides which
are noncomplementary to the respective corresponding nucleotides in
the reference sequence.
[0102] There are number of ways of satisfying these conditions
depending on whether the two nucleotides in the reference sequence
corresponding to the two interrogation positions are the same or
different. If these two nucleotides are different in the reference
sequence (probability 3/4), the conditions are satisfied by each of
the two interrogation positions being occupied by the same
nucleotide in any given probe. For example, in the first probe, the
two interrogation positions would both be A, in the second probe,
both would be C, in the third probe, each would be G, and in the
fourth probe each would be T or U. If the two nucleotides in the
reference sequence corresponding to the two interrogation positions
are different, the conditions noted above are satisfied by each of
the interrogation positions in any one of the four probes being
occupied by complementary nucleotides. For example, in the first
probe, the interrogation positions could be occupied by A and T, in
the second probe by C and G, in the third probe by G and C, and in
the four probe, by T and A. See (FIG. 8).
[0103] When the four probes are hybridized to a target that is the
same as the reference sequence or differs from the reference
sequence at:one (but not both) of the interrogation positions, two
of the four probes show a double-mismatch with the target and two
probes show a single mismatch. The identity of probes showing these
different degrees of mismatch can be determined from the different
hybridization signals. From the identity of the probes showing the
different degrees of mismatch, the nucleotides occupying both of
the interrogation positions in the target sequence can be
deduced.
[0104] For ease of illustration, the multiplex strategy has been
initially described for the situation where there are two
nucleotides of interest in a reference sequence and only four
probes in an array. Of course, the strategy can be extended to
analyze any number of nucleotides in a target sequence by using
additional probes. In one variation, each pair of interrogation
positions is read from a unique group of four probes. In a block
variation, different groups of four probes exhibit the same segment
of complementarity with the reference sequence, but the
interrogation positions move within a block. The block and standard
multiplex tiling variants can of course be used in combination for
different regions of a reference sequence. Either or both variants
can also be used in combination with any of the other tiling
strategies described.
[0105] 7. Helper Mutations
[0106] Occasionally, small regions of a reference sequence give a
low hybridization signal as a result of annealing of probes. The
self-annealing reduces the amount of probe effectively available
for hybridizing to the target. Although such regions of the target
are generally small and the reduction of hybridization signal is
usually not so substantial as to obscure the sequence of this
region, this concern can be avoided by the use of probes
incorporating helper mutations. A helper mutation refers to a
position of mismatch in a probe other than at an interrogation
position. The helper mutation(s) serve to break-up regions of
internal complementarity within a probe and thereby prevent
annealing. Usually, one or two helper mutations are quite
sufficient for this purpose. The inclusion of helper mutations can
be beneficial in any of the tiling strategies noted above. In
general each probe having a particular interrogation position has
the same helper mutation(s). Thus, such probes have a segment in
common which shows perfect complementarity with a reference
sequence, except that the segment contains at least one helper
mutation (the same in each of the probes) and at least one
interrogation position (different in all of the probes). For
example, in the basic tiling strategy, a probe from the first probe
set comprises a segment containing an interrogation position and
showing..perfect complementarity with a reference sequence except
for one or two helper mutations. The corresponding probes from the
second, third and fourth probe sets usually comprise the same
segment (or sometimes a subsequence thereof including the helper
mutation(s) and interrogation position), except that the base
occupying the interrogation position varies in each probe. See FIG.
9.
[0107] Usually, the helper mutation tiling strategy is used in
conjunction with one of the tiling strategies described above. The
probes containing helper mutations are used to tile regions of a
reference sequence otherwise giving low hybridization
signal.(e.g.,.because of self-complementarity), and the alternative
tiling strategy is used to tile intervening regions.
[0108] 8. Pooling Strategies
[0109] Pooling strategies also employ arrays of immobilized probes.
Probes are immobilized in cells of an array, and the hybridization
signal of each cell can be determined independently of any other
cell. A particular cell may be occupied by pooled mixture of
probes. Although the identity of each probe in the mixture is
known, the individual probes in the pool are not separately
addressable. Thus, the hybridization signal from a cell is the
aggregate of that of the different probes occupying the cell. In
general, a cell is scored as hybridizing to a target-sequence if at
least one probe occupying the cell comprises a segment exhibiting
perfect complementarity to the target sequence..
[0110] A simple strategy to show the increased power of pooled
strategies over a standard tiling is to create three cells each
containing a pooled probe having a single pooled position, the
pooled position being the same in each of the pooled probes. At the
pooled position, there are two possible nucleotide, allowing the
pooled probe to hybridize to two target sequences. In tiling
terminology, the pooled position of each probe is an interrogation
position. As will become apparent, comparison of the hybridization
intensities of the pooled probes from the three cells reveals the
identity of the nucleotide in the target sequence corresponding to
the interrogation position (i.e., that is matched with the
interrogation position when the targets sequence and pooled probes
are maximally aligned for complementarity)
[0111] The three cells are assigned probe pools that are perfectly
complementary to the target except at the pooled position, which is
occupied by a different pooled nucleotide in each probe as
follows:
[0112] [AC]=M, [GT]=K, [AG]=R as substitutions in the probe IUPAC
standard ambiguity notation) TABLE-US-00001 X - interrogation
position Target: TAACCACTCACGGGAGCA Pool 1: ATTGGMGAGTGCCC
=ATTGGaGAGTGCCC (complement to mutant `t`) +ATTGGcGAGTGCCC
(complement to mutant `g`) Pool 2: ATTGGKGAGTGCCC =ATTGGgGAGTGCCC
(complement to mutant `c`) +ATTGGtGAGTGCCC (complement to wild type
`a`) Pool 3: ATTGGRGAGTGCCC =ATTGGaGAGTGCCC (complement to mutant
`t`) +ATTGGgGAGTGCCC (complement to mutant `c`)
[0113] With 3 pooled probes, all 4 possible single base pair states
(wild and 3 mutants) are detected. A pool hybridizes with a target
if some probe contained within that pool is complementary to that
target. TABLE-US-00002 Hybridization? Pool: 1 2 3 Target:
TAACCACTCACGGGAGCA n y n Mutant: TAACCcCTCACGGGAGCA n y y Mutant:
TAACCgCTCACGGGAGCA y n n Mutant: TAACCtCTCACGGGAGCA y n y
[0114] A cell containing a pair (or more) of oligonucleotides
lights up when a target complementary to any of the oligonucleotide
in the cell is present. Using the simple strategy, each of the four
possible targets (wild and three mutants) yields a unique
hybridization pattern among the three cells.
[0115] Since a different pattern of hybridizing pools is obtained
for each possible nucleotide in the target sequence corresponding
to the pooled interrogation position in the probes, the identity of
the nucleotide can be determined from the hybridization pattern of
the pools. Whereas, a standard tiling requires four cells to detect
and identify the possible single-base substitutions at one
location, this simple pooled strategy only requires three
cells.
[0116] A more efficient pooling strategy for sequence analysis is
the `Trellis` strategy. In this strategy, each pooled probe has a
segment of perfect complementarity to a reference sequence except
at three pooled positions. One pooled position is an N pool (IUPAC
standard ambiguity code). The three pooled positions may or may not
be contiguous in a probe. The other two pooled positions are
selected from the group of three pools consisting of (1) M or K,
(2) R or Y and (3) W or S, where the single letters are IUPAC
standard ambiguity codes. The sequence of a pooled probe is thus,
of the form XXXN [(M/K) or (R/Y) or (W/S)].[(M/K) or (R/Y) or
(W/S)]XXXXX, where XXX represents bases complementary to the
reference sequence. The three pooled positions may be in any order,
and may be contiguous or separated by intervening nucleotides. For,
the two positions occupied by [(M/K) or (R/Y) or (W/S)], two
choices must be made. First, one must select one of the following
three pairs of pooled nucleotides. (1) M/K, (2) R/Y and (3) W/S.
The one of three pooled nucleotides selected may be the same or
different at the two pooled positions. Second, supposing, for
example, one selects M/K at one position, one must then choose
between M or K. This choice should result in selection of a pooled
nucleotide comprising a nucleotide that complements the
corresponding nucleotide in a reference sequence, when the probe
and reference sequence are maximally aligned. The same principle
governs the selection between R and Y, and between W and S. A
trellis pool probe has one pooled position with four possibilities,
and two pooled positions, each with two possibilities. Thus, a
trellis pool probe comprises a mixture of 16 (4.times.2.times.2)
probes. Since each pooled position includes one nucleotide that
complements the corresponding nucleotide from the reference
sequence, one of these 16 probes has a segment that is the exact
complement of the reference sequence. A target sequence that is the
same as the reference sequence (i.e., a wildtype target) gives a
hybridization signal to each probe cell. Here, as in other tiling
methods, the segment of complementarity should be sufficiently long
to permit specific hybridization of a pooled probe to a reference
sequence be detected relative to a variant of that reference
sequence. Typically, the segment of complementarity-is about is
9-21 nucleotides.
[0117] A target sequence is analyzed by comparing hybridization
intensities at three pooled probes, each having the structure
described above. The segments complementary to the reference
sequence present in the three pooled probes show some overlap.
Sometimes the segments are identical (other than at the
interrogation positions). However, this need not be the case. For
example, the segments can tile across a reference sequence in
increments of one nucleotide (i.e., one pooled probe differs from
the next by the acquisition of one nucleotide at the 5' end and
loss of a nucleotide at the 3' end). The three interrogation
positions may or may not occur at the same relative positions
within each pooled probe (i.e., spacing from a probe terminus). All
that is required is that one of the three interrogation positions
from each of the three pooled probes aligns with the same
nucleotide in the reference sequence, and that this interrogation
position is occupied by a different pooled nucleotide in each of
the three probes. In one of the three probes, the interrogation
position is occupied by an N. In the other two pooled probes the
interrogation position is occupied by one of (M/K) or (R/Y) or
(W/S).
[0118] In the simplest form of the trellis strategy, three pooled
probes are used to analyze a single nucleotide in the reference
sequence. Much greater economy of probes is achieved when more
pooled probes are included in an array. For example, consider an
array of five pooled probes each having the general structure
outlined above. Three of these pooled probes have an interrogation
position that aligns with the same nucleotide in the reference
sequence and are used to read that nucleotide. A different
combination of three probes have an interrogation position that
aligns with a different nucleotide in the reference sequence.
Comparison of these three probe intensities allows analysis of this
second nucleotide. Still another combination of three pooled probes
from the set of five have an interrogation position that aligns
with a third nucleotide in the reference sequence and, these probes
are used to analyze that nucleotide. Thus, three nucleotides in the
reference sequence are fully analyzed from only five pooled probes.
By comparison, the basic tiling strategy would require 12 probes
for a similar analysis.
[0119] As an example, a pooled probe for analysis of a target
sequence by the trellis strategy is shown below: TABLE-US-00003
Target: ATTAACCACTCACGGGAGCTCT Pool: TGGTGNKYGCCCT
[0120] The pooled probe actually comprises 16 individual probes:
TABLE-US-00004 TGGTGAGcGCCCT +TGGTGcGcGCCCT +TGGTGgGcGCCCT
+TGGTGtGcGCCCT +TGGTGAtcGCCCT +TGGTGctcGCCCT +TGGTGgtcGCCCT
+TGGTGttcGCCCT +TGGTGAGTGCCCT +TGGTGcGTGCCCT +TGGTGgGTGCCCT
+TGGTGtGTGCCCT +TGGTGAtTGCCCT +TGGTGctTGCCCT +TGGTGgtTGCCCT
+TGGTGttTGCCCT
[0121] The trellis strategy employs an array of probes having at
least three cells, each of which is occupied by a pooled probe as
described above. Consider the use of three such pooled probes for
analyzing a target sequence, of which one position may contain any
single base substitution to the reference sequence (i.e., there are
four possible target sequences to be distinguished). Three cells
are occupied by pooled probes having a pooled interrogation
position corresponding to the position of possible substitution in
the target sequence, one cell with an `N`, one cell with one of `M`
or `K`, and one cell with `R` or `Y`. An interrogation position
corresponds to a nucleotide in the target sequence if it aligns
adjacent with that nucleotide when the probe and target sequence
are aligned to maximize complementarity. Note that although each of
the pooled probes has two other pooled positions, these positions
are not relevant for the present illustration. The positions are
only relevant when more than one position in the target sequence is
to be read, a circumstance that will be considered later. For
present purposes, the cell with the `N` in the interrogation
position lights up for the wildtype sequence and any of the three
single base substitutions of the target sequence. The cell with M/K
in the interrogation position lights up for the wildtype sequence
and one of the single-base substitutions. The cell with R/Y in the
interrogation position lights up for the wildtype sequence and a
second of the single-base substitutions. Thus, the four possible
target sequences hybridize to the three pools of probes in four
distinct patterns, and the four possible target sequences can be
distinguished.
[0122] To illustrate further, consider four possible target
sequences (differing at a single position) and a pooled probe
having three pooled positions, N, K and Y with the Y position as
the interrogation position (ie., aligned with the variable position
in the target sequence): TABLE-US-00005 Target Wild:
ATTAACCACTCACGGGAGCTCT (w) Mutants: ATTAACCACTCcCGGGAGCTCT (c)
Mutants: ATTAACCACTCgCGGGAGCTCT (g) Mutants: ATTAACCACTCtCGGGAGCTCT
(t) TGGTGNKYGCCCT (pooled probe).
[0123] The sixteen individual component probes of the pooled probe
hybridize to the four possible target sequences as follows:
TABLE-US-00006 TARGET w c g t TGGTGAGcGCCCT n n y n TGGTGcGcGCCCT n
n n n TGGTGgGcGCCCT n n n n TGGTGtGcGCCCT n n n n TGGTGAtcGCCCT n n
n n TGGTGctcGCCCT n n n n TGGTGgtcGCCCT n n n n TGGTGttcGCCCT n n n
n TGGTGAGTGCCCT y n n n TGGTGcGTGCCCT n n n n TGGTGgGTGCCCT n n n n
TGGTGtGTGCCCT n n n n TGGTGAtTGCCCT n n n n TGGTGctTGCCCT n n n n
TGGTGgtTGCCCT n n n n TGGTGttTGCCCT n n n n
[0124] The pooled probe hybridizes according to the aggregate of
its components: TABLE-US-00007 Pool: TGGTGNKYGCCCT y n y n
thus, as stated above, it can be seen that a pooled probe having a
y at the interrogation position hybridizes to the wildtype target
and one of the mutants. Similar tables can be drawn to illustrate
the hybridization patterns of probe pools having other pooled
nucleotides at the interrogation position.
[0125] The above strategy of using pooled probes to analyze a
single base in a target sequence can readily be extended to analyze
any number of bases. At this point, the purpose of including three
pooled positions within each probe will become apparent. In the
example that follows, ten pools of probes, each containing three
pooled probe positions, can be used to analyze a each of a
contiguous sequence of eight nucleotides in a target sequence.
TABLE-US-00008 ATTAACCACTCACGGGAGCTCT Reference sequence --------
Readable nucleotides Pools: 4 TAATTNKYGAGTG 5 AATTGNKRAGTGC 6
ATTGGNKRGTGCC 7 TTGGTNMRTGCCC 8 TGGTGNKYGCCCT 9 GGTGANKRCCCTC 10
GTGAGNKYCCTCG 11 TGAGTNMYCTCGA 12 GAGTGNMYTCGAG 13
AGTGCNMYCGAGA
[0126] In this example, the different pooled probes tile across the
reference sequence, each pooled probe differing from the next by
increments of one nucleotide. For each of the readable nucleotides
in the reference sequence, there are three probe pools having a
pooled interrogation position aligned with the readable nucleotide.
For example, the 12th nucleotide from the left in the reference
sequence is aligned with pooled interrogation positions in pooled
probes 8, 9, and 10. Comparison of the hybridization intensities of
these pooled probes reveals the identity of the nucleotide
occupying position 12 in a target sequence. TABLE-US-00009 Pools
Targets 8 9 10 Wild: ATTAACCACTCACGGGAGCTCT Y Y Y Mutants:
ATTAACCACTCcCGGGAGCTCT N Y Y Mutants: ATTAACCACTCgCGGGAGCTCT Y N Y
Mutants: ATTAACCACTCtCGGGAGCTCT N N Y
[0127] Example Intensities: TABLE-US-00010 ##STR1##
Thus, for example, if pools 8, 9 and 10 all light up, one knows the
target sequence is wildtype. If pools, 9 and 10 light up, the
target sequence has a C mutant at position 12. If pools 8 and 10
light up, the target sequence has a G mutant at position 12. If
only pool 10 lights up, the target sequence has a t mutant at
position 12. and 10 light up, the target sequence has a C mutant at
position 12. If pools 8 and 10 light up, the target sequence has a
G mutant at position 12. If only pool 10 lights up, the target
sequence has a t mutant at position 12.
[0128] The identity of other nucleotides in the target sequence is
determined by a comparison of other sets of three pooled probes.
For example, the identity of the 13th nucleotide in the target
sequence is determined by comparing the hybridization patterns of
the probe pools designated 9, 10 and 11. Similarly, the identity of
the 14th nucleotide in the target sequence is determined by
comparing the hybridization patterns of the probe pools designated
10, 11, and 12.
[0129] In the above example, successive probes tile across the
reference sequence in increments of one nucleotide, and each probe
has three interrogation positions occupying the same positions in
each probe relative to the terminus of the probe (i.e., the 7, 8
and 9th positions relative to the 3' terminus). However, the
trellis strategy does not require that probes tile in increments of
one or that the interrogation position positions occur in the same
position in each probe. In a variant of trellis tiling referred to
as "loop" tiling, a nucleotide of interest in a target sequence is
read by comparison of pooled probes, which each have a pooled
interrogation position corresponding to the nucleotide of interest,
but in which the spacing of the interrogation position in the probe
differs from probe to probe. Analogously to the block-tiling
approach, this allows several nucleotides to be read from a target
sequence from a collection of probes that are identical except at
the interrogation position. The identity in sequence of probes,
particularly at their 3' termini, simplifies synthesis of the array
and result in more uniform probe density per cell.
[0130] To illustrate the loop strategy, consider a reference
sequence of which the 4, 5, 6, 7 and 8th nucleotides (from the 3'
termini are to be read. All of the four possible nucleotides at
each of these positions can be read from comparison of
hybridization intensities of five pooled probes. Note that the
pooled positions in the probes are different (for example in probe
55, the pooled positions are 4, 5 and 6 and in probe 56, 5, 6 and
7). TABLE-US-00011 TAACCACTCACGGGAGCA Reference sequence 55
ATTNKYGAGTGCC 56 ATTGNKRAGTGCC 57 ATTGGNKRGTGCC 58 ATTRGTNMGTGCC 59
ATTKRTGNGTGCC
[0131] Each position of interest in the reference sequence is read
by comparing hybridization intensities for the three probe
pools-that have an interrogation position aligned with the
nucleotide of interest in the reference sequence. For ;example, to
read the fourth nucleotide in the reference sequence, probes 55, 58
and 59 provide pools at the fourth position. Similarly, to read the
fifth nucleotide in the reference sequence, probes 55, 56 and 59
provide pools at the fifth position. As in the previous trellis
strategy, one of the three probes being compared has an N at the
pooled position and-the other two have M or K, and (2) R or Y and
(3) W or S.
[0132] The hybridization pattern of the five pooled probes to
target sequences representing each possible nucleotide substitution
at five positions in the reference sequence is shown below. Each
possible substitution results in a unique hybridization pattern at
three pooled probes, and the identity of the nucleotide at that
position can be deduced from the hybridization pattern.
TABLE-US-00012 Pools Targets 55 56 57 58 59 Wild:
TAACCACTCACGGGAGCA Y Y Y Y Y Mutant: TAAgCACTCACGGGAGCA Y N N N N
Mutant: TAAtCACTCACGGGAGCA Y N N Y N Mutant: TAAaCACTCACGGGAGCA Y N
N N Y Mutant: TAACgACTCACGGGAGCA N Y N N N Mutant:
TAACtACTCACGGGAGCA N Y N N Y Mutant: TAACaACTCACGGGAGCA Y Y N N N
Mutant: TAACCcCTCACGGGAGCA N Y Y N N Mutant: TAACCgCTCACGGGAGCA Y N
Y N N Mutant: TAACCtCTCACGGGAGCA N N Y N N Mutant:
TAACCAgTCACGGGAGCA N N N Y N Mutant: TAACCAtTCACGGGAGCA N Y N Y N
Mutant: TAACCAaTCACGGGAGCA N N Y Y N Mutant: TAACCACaCACGGGAGCA N N
N N Y Mutant: TAACCACcCACGGGAGCA N N Y N Y Mutant:
TAACCACgCACGGGAGCA N N N Y Y
[0133] Many variations on the loop and trellis tilings can be
created. All that is required is that each position in sequence
must have a probe with a `N`, a probe containing one of R/Y, M/K or
W/S, and a probe containing a different pool from that set,
complementary to the wild type target at that position, and at
least one probe with no pool at all at that position. This
combination allows all mutations at that position to be uniquely
detected and identified.
[0134] A further class of strategies involving pooled probes are
termed coding strategies. These strategies assign code words from
some set of numbers to variants of a reference sequence. Any number
of variants can be coded. The variants can include multiple closely
spaced substitutions, deletions or insertions. The designation
letters or other symbols assigned to each variant may be any
arbitrary set of numbers, in any order. For example, a binary code
is often used, but codes to other bases are entirely feasible. The
numbers are often assigned such that each variant has a designation
having at least one digit and at least one nonzero value for that
digit. For example, in a binary system, a variant assigned the
number 101, has a designation of three digits, with one possible
nonzero value for each digit.
[0135] The designation of the variants are coded into an array of
pooled probes comprising a pooled probe for each nonzero value of
each digit in the numbers assigned to the variants. For example, if
the variants are assigned successive number in a numbering system
of base m, and the highest number assigned to a variant has n
digits, the array would have about n.times.(m-1) pooled probes. In
general, log.sub.m (3N+1) probes are required to analyze all
variants of N locations in a reference sequence, each having three
possible mutant substitutions. For example, 10 base pairs of
sequence may be analyzed with only 5 pooled probes using a binary
coding system.
[0136] Each pooled probe has a segment exactly complementary to the
reference sequence except that certain positions are pooled. The
segment should be sufficiently long to allow specific hybridization
of the pooled probe to the reference sequence relative to a mutated
form of the reference sequence. As in other tiling strategies,
segments lengths of 9-21 nucleotides are typical. Often the probe
has no nucleotide's other than the 9-21 nucleotide segment. The
pooled positions comprise nucleotides that allow the pooled probe
to hybridize to every variant assigned a particular nonzero value
in a particular digit.. Usually, the pooled positions further
comprises a nucleotide that allows the pooled probe to hybridize to
the reference sequence. Thus, a wildtype target (or reference
sequence) is immediately recognizable from all the pooled probes
being lit.
[0137] When a target is hybridized to the pools, only those pools
comprising a component probe having a segment that is exactly
complementary to the target light up. The identity of the target is
then decoded from the pattern of hybridizing pools. Each pool that
lights up is correlated with a particular value in a particular
digit. Thus, the aggregate hybridization patterns of each lighting
pool reveal the value of each digit in the code defining the
identity of the target hybridized to the array.
[0138] As an example, consider a reference sequence having four
positions, each of which can be occupied by three possible
mutations. Thus, in total there are 4.times.3 possible variant
forms of the reference sequence. Each variant is assigned a binary
number 0001-1100 and the wildtype reference sequence is assigned
the binary number 1111. TABLE-US-00013 Positions X X X X - 4
Target: TAACCACGGGAGCA C = 1111 A = 1111 C = 1111 T = 1111 G = 0001
C = 0010 G = 0011 A = 0100 T = 0101 G = 0110 T - 0111 C = 1000 A =
1001 T = 1010 A = 1011 G = 1100
[0139] A first pooled probe is designed by including probes that
complement exactly each variant having a 1 in the first digit.
TABLE-US-00014 target(1111): TAAC C A C T CACGGGAGCA Mutant(0001):
TAAC g A C T CACGGGAGCA Mutant(0101): TAAC t A C T CACGGGAGCA
Mutant(1001): TAAC a A C T CACGGGAGCA Mutant(0011): TAAC C A g T
CACGGGAGCA Mutant(0111): TAAC C A t T CACGGGAGCA Mutant(1101): TAAC
C A a T CACGGGAGCA First pooled probe = ATTG [GCAT] T [GCAT] A
GTGCCC = ATTG N T N A GTGCCC
[0140] Second, third and fourth pooled probes are then designed
respectively including component probes that hybridize.to each
variant having a 1 in the second, third and fourth digit.
TABLE-US-00015 XXXX - 4 positions examined Target:
TAACCACTCACGGGAGCA Pool 1(1): ATTGnTnAGTGCCC = 16 probes
(4.times.1.times.4.times.1) Pool 2(2): ATTGGnnAGTGCCC = 16 probes
(1.times.4.times.4.times.1) Pool 3(4): ATTGyrydGTGCCC = 24 probes
(2.times.2.times.2.times.3) Pool 4(8): ATTGmwmbGTGCCC = 24 probes
(2.times.2.times.2.times.3)
[0141] The pooled probes hybridize to variant targets as follows:
TABLE-US-00016 Pools Targets 1 2 3 4 Wild(1111) TAACCACTCACGGGAGCA
Y Y Y Y Mutant(0001): TAACgACTCACGGGAGCA Y N N N Mutant(0101):
TAACtACTCACGGGAGCA Y N Y N Mutant(1001): TAACaACTCACGGGAGCA Y N N Y
Mutant(0010): TAACCcCTCACGGGAGCA N Y N N Mutant(0110):
TAACCgCTCACGGGAGCA N Y Y N Mutant(1010): TAACCtCTCACGGGAGCA N Y N Y
Mutant(0011): TAACCAgTCACGGGAGCA Y Y N N Mutant(0111):
TAACCAtTCACGGGAGCA Y Y Y N Mutant(1101): TAACCAaTCACGGGAGCA Y N Y Y
Mutant(0100): TAACCACaCACGGGAGCA N N Y N Mutant(1000):
TAACCACcCACGGGAGCA N N N Y Mutant(1100): TAACCACgCACGGGAGCA N N Y
Y
[0142] The identity of a variant (i.e., mutant) target is read
directly from the hybridization pattern of the pooled probes. For
example the mutant assigned the number 0001 gives a hybridization
pattern of NNNY with respect to probes 4, 3, 2 and 1
respectively.
[0143] In the above example, variants are assigned successive
numbers in a numbering system. In other z,999 odiments, sets of
numbers can be chosen for their properties. If the codewords are
chosen from an error-control code, the properties of that code
carry over to sequence analysis. An error code is a numbering
system in which some designations are assigned to variants and
other designations serve to indicate errors that may have occurred
in the hybridization process. For example, if all codewords, have
an odd number of nonzero digits (binary coding+error detection),
any single error in hybridization will be detected by having an
even number of pools lit. TABLE-US-00017 Wild Target:
TAACCACTCACGGGAGCA Pool 1(1): ATTGnAnAGTGCCC = 16 Probes
(4.times.1.times.4.times.1) Pool 2(2): ATTGGnnAGTGCCC = 16 Probes
(1.times.4.times.4.times.1) Pool 3(4): ATTGryrhGTGCCC = 24 Probes
(2.times.2.times.2.times.3) Pool 4(8): ATTGkwkvGTGCCC = 24 Probes
(2.times.2.times.2.times.3)
[0144] A fifth probe can be added to make the number of pools that
hybridize to any single mutation odd. TABLE-US-00018 Pool 5(c):
ATTGdhsmGTGCCC = 36 probes (2.times.2.times.3.times.3)
Hybridization of pooled probes to targets: Pool Target 1 2 3 4 5
Target(11111): TAACCACTCACGGGAGCA Y Y Y Y Y Mutant(00001):
TAACgACTCACGGGAGCA Y N N N N Mutant(10101): TAACtACTCACGGGAGCA Y N
N N N Mutant(11001): TAACaACTCACGGGAGCA Y N N Y Y Mutant(00010):
TAACCcCTCACGGGAGCA N Y N N N Mutant(10110): TAACCgCTCACGGGAGCA N Y
Y N Y Mutant(11010): TAACCtCTCACGGGAGCA N Y N Y Y Mutant(10011):
TAACCAgTCACGGGAGCA Y Y N N Y Mutant(00111): TAACAtTCACGGGAGCA Y Y Y
N N Mutant(01101): TAACCAaTCACGGGAGCA Y N Y Y N Mutant(00100):
TAACCACaCACGGGAGCA N N Y N N Mutant(01000): TAACCAcCCACGGGAGCA N N
N Y N Mutant(11100): TAACCACgCACGGGAGCA N N Y Y Y
[0145] 9. Bridging Strategy
[0146] Probes that contain partial matches to two separate (i.e.,
non contiguous) subsequences of a target sequence sometimes
hybridize strongly to the target sequence. In certain instances,
such probes have generated stronger signals than probes of the same
length which are perfect matches to the target sequence. It is
believed (but not necessary to the invention) that this observation
results from interactions of a single target sequence with two or
more probes simultaneously. This invention exploits this
observation to provide arrays of probes having at least first and
second segments, which are respectively complementary to first and
second subsequences of a reference sequence. Optionally, the probes
may have a third or more complementary segments. These probes can
be employed in any of the strategies noted above. The two segments
of such a probe can be complementary to disjoint subsequences of
the reference sequences or contiguous subsequences. If the latter,
the two segments in the probe are inverted relative to the order of
the complement of the reference sequence. The two subsequences of
the reference sequence each typically comprises about 3 to 30
contiguous nucleotides. The subsequences of the reference sequence
are sometimes separated by 0, 1, 2 or 3 bases. Often the sequences,
are adjacent and nonoverlapping.
[0147] For example, a wildtype probe is created by complementing
two sections of a reference sequence (indicated by subscript and
superscript) and reversing their order. The interrogation position
is designated (*) and is apparent from comparison of the structure
of the wildtype probe with the three mismatched probes. The
corresponding nucleotide in the reference sequence is the "a" in
the superscripted segment. TABLE-US-00019 Reference: 5'
T.sub.GGCTA.sup.CGAGGAATCATCTGTTA * Probes: 3' GCTCC CCGAT (Probe
from first probe set) 3' GCACC CCGAT 3' GCCCC CCGAT 3' GCGCC CCGAT
The expected hybridizations are: Match: GCTCCCCGAT
...TGGCTACGAGGAATCATCTGTTA GCTCCCCGAT Mismatch: GCTCCCCGAT
...TGGCTACGAGGAATCATCTGTTA GCGCCCCGAT
[0148] Bridge tilings are specified using a notation which gives
the length of the two constituent segments and the relative
position of the interrogation position. The designation n/m
indicates a segment complementary to a region of the reference
sequence which extends for n bases and is located such that the
interrogation position is in the mth base from the 5' end. If m is
larger than n, this indicates that the entire segment is to the 5'
side of the interrogation position. If m is negative, it indicates
that the interrogation position is the absolute value of m bases 5'
of the first base of the segment (m cannot be zero). Probes
comprising multiple segments, such as n/m+a/b+ . . . have a first
segment at the 3' end of the probe and additional segments added 5'
with respect to the first segment. For example, a 4/8 tiling
consists of (from the 3' end of the probe) a 4 base complementary
segment, starting 7 bases 5' of the interrogation position,
followed by a 6 base region in which the interrogation position is
located at the third base. Between these two segments, one base
from the reference sequence is omitted. By this notation, the set
shown above is a 5/3+5/8 tiling. Many different tilings are
possible with this method, since the lengths of both segments can
be varied, as well as their relative position (they may be in
either order and there may be a gap between them) and their
location relative to the interrogation position.
[0149] As an example, a 16 mer oligo target was hybridized to a
chip containing all 4.sup.10 probes of length 10. The chip includes
short tilings of both standard and bridging types. The data from a
standard 10/5 tiling was compared to data from a 5/35/8 bridge
tiling (see Table 1). Probe intensities (mean count/pixel) are
displayed along with discrimination ratios (correct probe
intensity/highest incorrect probe intensity). Missing intensity
values are less than 50 counts. Note that for each base displayed
the bridge tiling has a higher discrimination value. TABLE-US-00020
TABLE 1 Comparison of Standard and Bridge Tilings CORRECT PROBE
BASE TILING PROBE BASE: C A C C STANDARD A 92 496 294 299 (10/5) C
536 148 532 534 G 69 167 72 52 T 146 95 212 126 DISCRIMINATION: 3.7
3.0 1.8 1.8 BRIDGING A -- 404 -- 156 5/3 + 5/8 C 276 -- 345 379 G
-- 80 -- -- T -- -- -- 58 DISCRIMINATION: >5.5 5.1 2.4 1.26
[0150] The bridging strategy offers the following advantages:
[0151] (1) Higher discrimination between matched and mismatched
probes,
[0152] (2) The possibility of using longer probes in a bridging
tiling, thereby increasing the specificity of the hybridization,
without sacrificing discrimination,
[0153] (3) The use of probes in which an interrogation position is
located very off-center relative to the regions of target
complementarity. This may be of particular advantage when, for
example, when a probe centered about one region of the target gives
low hybridization signal. The low signal is overcome by using a
probe centered about an adjoining region giving a higher
hybridization signal.
[0154] (4) Disruption of secondary structure that might result in
annealing of certain probes (see previous discussion of helper
mutations).
[0155] 10. Deletion Tiling
[0156] Deletion tiling is related to both the bridging and helper
mutant.strategies described above. In the deletion strategy,
comparisons are performed between probes sharing a common deletion
but differing from each other at an interrogation position located
outside the deletion. For example, a first probe comprises first
and second segments, each exactly complementary to respective first
and second subsequences of a reference sequence, wherein the first
and second subsequences of the reference sequence are separated by
a short distance (e.g., 1 or 2 nucleotides). The order of the first
and second segments in the probe is usually the same as that of the
complement to the first and second subsequences in the reference
sequence. The interrogation position is usually separated from The
comparison is performed with three other probes, which are
identical to the first probe except at an interrogation position,
which is different in each probe. Reference: . . . AGTACCAGATCTCTAA
. . . Probe set: CATGGNC AGAGA (N=interrogation position).
[0157] Such tilings sometimes offer superior discrimination in
hybridization intensities between the probe having an interrogation
position complementary to the target and other probes.
Thermodynamically, the difference between the hybridizations to
matched and mismatched targets for the probe set shown above is the
difference between a single-base bulge, and a large asymmetric loop
(e.g., two bases of target, one of probe). This often results in a
larger difference in stability than the comparison of a perfectly
matched probe with a probe showing a single base mismatch in the
basic tiling strategy.
[0158] The superior discrimination offered by deletion tiling is
illustrated by Table 2, which compares hybridization data from a
standard 10/5 tiling with a ( 4/8+ 6/3) deletion tiling of the
reference sequence. (The numerators indicate the length of the
segments and the denominators, the spacing of the deletion from the
far termini of the segments.) Probe intensities (mean count/pixel)
are displayed along with discrimination ratios (correct probe
intensity/highest incorrect probe intensity). Note that for each
base displayed the deletion tiling has a higher discrimination
value than either standard tiling shown. TABLE-US-00021 TABLE 2
Comparison of Standard and Deletion Tilings CORRECT PROBE BASE
TILING PROBE BASE: C A C C STANDARD A 92 496 294 299 (10/5) C 536
148 532 534 G 69 167 72 52 T 146 95 212 126 DISCRIMINATION: 3.7 3.0
1.8 1.8 DELETION A 6 412 29 48 4/8 + 6/3 C 297 32 465 160 G 8 77 10
4 T 8 26 31 5 DISCRIMINATION: 37.1 5.4 15 3.3 STANDARD A 347 533
228 277 (10/7) C 729 194 536 496 G 232 231 102 89 T 344 133 163 150
DISCRIMINATION: 2.1 2.3 2.3 1.8
[0159] The use of deletion or bridging probes is quite general.
These probes can be used in any of the tiling strategies of the
invention. As well as offering superior discrimination, the use of
deletion or bridging strategies is advantageous for certain probes
to avoid self-hybridization (either within a probe or between two
probes of the same sequence)
[0160] 11. Nucleotide Repeats
[0161] Recently a new form of human mutation, expansion of
trinucleotide repeats, has been found to cause the diseases of
fragile X-syndrome, spinal and bulbar atrophy, myotonic dystrophy
and Huntington's disease.. See Ross et al., TINS 16, 254-259
(1993). Long lengths of trinucleotide repeats are associated with
the mutant form of a gene. The longer the length, the more severe
the consequences of the mutation and the earlier the age of onset.
The invention provides arrays and methods for analyzing the length
of such repeats.
[0162] The different probes in such an array comprise different
numbers of repeats of the complement of the trinucleotide repeat of
interest. For example, one probe might be a trimer, having one copy
of the repeat, a second probe might be a sixmer, having two copies
of the repeat, and a third probe might be a ninmer having three
copies, and so forth. The largest probes can have up to about sixty
bases or 20 trinucleotide repeats.
[0163] The hybridization signal of such probes to a target of
trinucleotide repeats is related to the length of the target. It
has been found that on increasing the target size up to about the
length of the probe, the hybridization signal shows a relatively
large increase for each complete trinucleotide repeat unit in the
target, and a small increase for each additional base in the target
that does not complete a trinucleotide repeat. Thus, for example,
the hybridization signals for different target sizes to a 20 mer
probe show small increases as the target size is increased from 6-8
nucleotides and a larger increase as the target size is increased
to 9 nucleotides.
[0164] Arrays of probes having different numbers of repeats are
usually calibrated using known amounts of target of different
length. For each target of known length, the hybridization
intensity is recorded for each probe. Thus, each target size is
defined by the relative hybridization signals of a series of probes
of different lengths. The array is then hybridized to an unknown
target sequence and the relative hybridization signals of the
different sized probes are determined. Comparison of the relative
hybridization intensity profile for different probes with
comparable data for targets of known size allows interpolation of
the size of the unknown target. Optionally, hybridization of the
unknown target is performed simultaneously with hybridization of a
target of known size labelled with a different color.
[0165] C. Preparation of Taraet Samples
[0166] The target polynucleotide, whose sequence is to be
determined, is usually isolated from a tissue sample. If the target
is genomic, the sample may be from any tissue (except exclusively
red blood cells). For example, whole blood, peripheral blood
lymphocytes or PBMC, skin, hair or semen are convenient sources of
clinical samples. These sources are also suitable if the target is
RNA. Blood and other body fluids are also a convenient source for
isolating viral nucleic acids. If the target is mRNA, the sample is
obtained from a tissue in which the mRNA is expressed. If the
polynucleotide in the sample is RNA, it is usually reverse
transcribed to DNA. DNA samples or cDNA resulting from reverse
transcription are usually amplified, e.g., by PCR. Depending on the
selection of primers and amplifying enzyme(s), the amplification
product can be RNA or DNA. Paired primers are selected to flank the
borders of a target polynucleotide of interest. More than one
target can be simultaneously amplified by multiplex PCR in which
multiple paired primers are employed. The target can be labelled at
one or more nucleotides during or after amplification. For some
target polynucleotides (depending on size of sample), e.g.,
episomal DNA, sufficient DNA is present in the tissue sample to
dispense with the amplification step.
[0167] When the target strand is prepared in single-stranded form
as in preparation of target RNA, the sense of the strand should of
course be complementary to that of the probes on the chip. This is
achieved by appropriate selection of primers. The target is
preferably fragmented before application to the chip to reduce or
eliminate the formation of secondary structures in the target. The
average size of targets segments following hybridization is usually
larger than the size of probe on the chip.
II. Biotransformation Gene Chips
[0168] A. Biotransformation Genes
[0169] Biotransformation genes tiled by the invention include any
of the 481 known cytochrome P450 genes, particularly, the human
P450 genes (see Nebert, DNA & Cell Biol. 10, 1-14 (1991);
Nelson et al., Pharmacogenetics 6, 1-42 (1996), acetylase genes,
monoamine oxidase genes, and genes known to specifically
biotransform particular drugs, such as the gene encoding
glucuronidase that participates in the pathway by which codeine or
morphine are converted to active form. Paul et al., J. Pharm. Exp.
Ther. 251, 477 (1989). Other genes of particular interest include
P450 2D6, P450 2C19, N-acetyl transferase II, glucose 6-phosphate
dehydrogenase, pseudocholinesterase, catechol-O-methyl transferase,
thiopurine methyltransferase and dihydropyridine dehydrogenase.
cDNA and at least partial-genomic DNA sequences are available for
these genes, e.g., from data bases such as GenBank and EMBL (see
Table 3). TABLE-US-00022 TABLE 3 ACCESSION NUMBER CYP LIST
ACCESSION GENE NUMBER(S) IMPORTANCE CYP1A1 D12525 Cancer
Susceptibility D01198 CYP1A2 M31664 M31665 M31666 M31667 U02993
CYP2A X13897 CYP2A3 M33318 Coumarin 7-hydroxylation M33316 CYP2A4
X13930 CYP2C8 X54807 X54808 CYP2C9 M61855 Warfarin Metabolism
J05326 M61857 J05326 L16877 CYP2C17 M61858 J05326 CYP2C18 M61853
Drug Metabolism J05326 M61856 CYP2C19 L07093 S-mephenytoin
4-hydroxylase M61854 J05326 M15331 CYP2D6 M20403
Debrisoquin/Sparteine Polymorphism M19697 M24499 X16866 X58467
CYP2D7P pseudogene X58468 CYP2D8P pseudogene CYP2E1 D10014 Ethanol
Inducible J02843 CYP3A4 D11131 Polymorphic Drug Metabolism M14096
CYP4F2 U02388 Leukotriene B4 omega hydroxylase NAT2 U23052 Drug
Acetylation/Drug Induced Disease U23434 TPMT U11424 Thiopurine
Methyl Transferase- transplantation and childhood leukemia
U12387
[0170] Additional genomic sequence flanking the regions already
sequenced are easily determined by PCR-based gene walking. See
Parker et al., Nucl. Acids Res. 19:3055-3060. A specific primer for
the sequenced region is primed with a general primer that
hybridizes to the flanking region.
[0171] The CYP2D6 enzyme has debrisoquine oxidase activity. See
e.g., Kimura et al., Am. J. Human. Genet. 45, 889-904 (1989).
[0172] Several therapeutically important compounds are metabolized
by CYP2D6. The list includes cardioactive drugs: .beta.-blockers
(bufuralol, propranolol, metoprolol, timolol) and. antiarrhythmics
(sparteine, encainide, flecainide, mexiletine) (Buchert &
Woosley, Pharmacogenetics 2, 2-11 (1992); Birgersdotter et al.,
Brit. J. Clin. Pharmacol. 33, 275-280 (1992)); psychoactive drugs
including tricyclic antidepressants (imipramine, desipramine,
nortriptyline) and antipsychotics (clozapine and haloperidol) (Dahl
& Bertilsson, Pharmacogenetics 3, 61-70 (1993); Fischer et al.,
J. Pharmacol. Exp. Ther. 260, 1355-1360 (1992); Lerena et al., Drug
Monitor 14, 92-97 (1992)); as well as a variety of other commonly
used drugs including codeine and dextromethorphan (Eichelbaum &
Gross, Pharmac. Ther. 46, 377-394 (1990)) as well as amphetamine,
and cocaine. Ten percent of the general population is defective in
P450 2D6, an enzyme that demethethylates codeine at an earlier
stage in the activation pathway, and therefore derives no analgesic
benefit from codeine (see Sindrup & Brosen, Pharmacogenetics 5,
335-346 (1995))
[0173] At least seven different polymorphic variants of the CYP2D6
gene demonstrating autosomal recessive inheritance are associated
with a poor drug metabolizer phenotype (see Table 4). These alleles
are designated CYP2D6A, CYP2D6B, CYP2D6C, CYP2D6D, CYP2D6E,
CYP2D6F, and CYP2D6J (Gonzales & Idle, Clin. Pharmacokinet.
26(1), 59-70 (1994); Nelson et al., DNA & Cell Biol. 12(1),
1-51 (1993)). CYP2D6A, CYP2D6E and CYP2D6F are minor variants of
the wild type gene. CYP2D6A has a single nucleotide deletion in
exon 5 with a consequent frame shift (Kagimoto et al., J. Biol.
Chem. 265, 17209-17214 (1990)). CYP2D6E and CYP2D6F are rare,
recently described variants (Gonzales & Idle, supra). CYP2D6B
accounts for about 70% of defective alleles. This variant has point
mutations in exons 1, 3, 8 and 9 as well as a base change at the
third intron splice site that results in aberrant transcript
splicing (Gonzales et al., Nature 331, 442-446 (1988); Kagimoto et
al., J. Biol. Chem. 265, 17209-17214 (1990)). CYP2D6C has a three
base deletion in exon 5 (Broly and Meyer, Pharmacogenetics 3,
123-130 (1993)) and, on the CYP2D6D allele, the entire functional
gene is deleted although the pseudogenes remain intact (Gaedigk et
al., Am. J. Hum. Genet. 48, 943-950 (1991)). The CYP2D6J allele has
base changes in both the first and ninth exons that result in amino
acid changes (Yokota et al., Pharmacogenetics 3, 256-263 (1993).
The CYP2D6 gene clusters with other CYP2D genes on human chromosome
22. Also present in this region are two or three highly conserved
pseudogenes. Of these, CYP2D7P (three variant forms) and CYP2D8P
have been isolated and sequenced (Kimura et al., supra; Helm &
Meyer, supra). TABLE-US-00023 TABLE 4 (EXON) XBAI NUCLEOTIDE HAP-
ENZYME ALLELE CHANGES LOTYPE ACTIVITY REF. CYP2D6-wt 29 kb NORMAL
(97) (9) CYP2D6-LI (3) 1726 G .fwdarw. C 29 kb (12) (6) 2938 C
.fwdarw. (11) T/296 Arg .fwdarw. Cys (13) (9) 4268 G .fwdarw. C/486
Ser .fwdarw. Thr (6) 2938 C .fwdarw. T/296 Arg .fwdarw. Cys (6)
2938 C .fwdarw. T/296 Arg .fwdarw. Cys CYP2D6-A (5) 2637 .DELTA.A
29 kb ABSENT (15) CYP2D6-B (4) 1934A (+6 29 kb (15) other
mutations) 44 kb (14) 9 + 16 kb (99) CYP2D6-D Deletion 11.5 kb (13
kb) CYP2D6-E (6) 3023 A .fwdarw. 29 kb C/324 His .fwdarw. Pro
CYP2D6- (3) 1795 .DELTA.T/ 29 kb (98, .DELTA.T1795 152 Try .fwdarw.
Gly 100) 153 Stop CYP2D6-C (5) 2703-5 .DELTA.AAG/ 29 kb DE- (44)
281 .DELTA.Lys CREASED (101) CYP2D6-J (1) 188 C .fwdarw. 29 kb (16)
T/Pro 34 Pro .fwdarw. Ser 44 kb (3) 1749 G .fwdarw. C (9) 4268 G
.fwdarw. C/486 Ser .fwdarw. Thr CYP2D6-W (1) 188 C .fwdarw. T/34 29
kb (102) Pro .fwdarw. Ser 44 kb (9) 4268 G .fwdarw. C/486 Ser
.fwdarw. Thr CYP2D6- (1) 188 C .fwdarw. T/34 29 kb (103) Ch1 Pro
.fwdarw. Ser 44 kb (2) 1127 C .fwdarw. T (3) 1749 G .fwdarw. C (9)
4268 G .fwdarw. C/486 Ser .fwdarw. Thr (CYP2D6- Amplification of
175 kb IN- (12) L).sub.12 D6-L 42 kb CREASED (12) (CYP2D6-
Duplication of D6-L L).sub.2 Presently used trivial names of CYP2D6
alleles, summary of CYP2D6-Alleles, haplotypes and their phenotypic
consequences (modified from U. A. Meyer). (9) Kimura et al. Am J
Hum Genet 45: 889-904 (1989) (11) Armstrong et al. Hum Genet 91:
616-617 (1993) (12) Johansson et al. PNAS 90: 11825-11829 (1993)
(13) Tsuneoka et al. J. Biochem Tokyo 114: 263-266 (1993) (14)
Gaedigk et al. Am J Hum Genet 48: 943-950 (1991) (15) Kagimoto et
al. J Biol Chem 265: 17209-17214 (1990) (16) Yokota et al.
Pharmacogenet 3: 256-263 (1993) (44) Tyndale et al. Pharmacogenet
1: 26-32 (1991) (97) Gonzales et al. Nature 331: 442-446 (1988)
(98) Evert et al. Pharmacogenet 4: 271-274 (1994) (99) Evert et al.
Naunyn-Schmiedebergs Arch Pharmacol 350: 434-439 (1994) (100)
Saxena et al. Hum Mol Genet 3: 923-926 (1994) (101) Broly et al.
Pharmacogenet 3: 123-130 (1993) (102) Wang et al. Clin Pharmacol
Ther 53: 410-418 (1993) (103) Johansson et al. Mol Pharmacol 46:
452-459 (1994) The 2C19 gene is the principal human determinant of
S-mephenytoin hydroxylase. Drugs metabolized by this enzyme in
addition to mephenytoin include antidepressants and neuroleptics.
Variant alleles are described in de Morais et al., J. Biol. Chem.
269(22), 15419-15422 (1994); # de Morais et al., Molecular
Pharmacology 46, 594-598 (1994). Mutations are known to occur at
nucleotides 636 (G-A) and 681 (G-A) of the coding sequence. CYP2E1
is responsible for metabolizing several anesthetics including
ethanol. CYP2A6 metabolizes nicotine. CYP2C9 metabolizes warfarin.
A table showing other pairs of drugs and cytochromes P450 that
either metabolize the drug or are inhibited by it appears
below.
[0174] TABLE-US-00024 TABLE 5 Cytochrome P450 (CYP) Isoenzyme
Inhibited Drug Class Metabolizing Enzymes Enzymes Comments
Roxithromycin Antibiotic 3A4 Cin Pharm and Ther 1991, 49, 158
Spiramycin Antibiotic 3A4 Cin Pharm and Ther 1991, 49, 158 Taxol
Antitumor 6a-hydroxylation - 3A J Pharm Exp Ther 1994, 268,
1160-1165 Tiracizine Antiarrhythmic Urethane cleavage - Abstracts -
10th Int Symp 2D6 Mic & Drug Oxid 1994, p 590 Trimipramine
Antidepressant Hydroxylation - 2D6 Chem Path Pharm 1993, 82,
111-120 Tropisetron 5-HT3 5,6,7-hydroxylation - Drug Met Disp 1994,
22, antogonist 2D6 269-274 Zanoterone Anticancer Hydroxylation -
3A4/5 Abstracts - 10th Int Symp Mic & Drug Oxid 1994, p 593
Econazole Antifungal 3A4 > 1A2 > 2C, Clin Pharm and Ther
1991, 2D6 49, 158 (abstract P11-37) Ethosuximide Anticonvulsant 3A
Xenobiotic 1993, 23, 307-315 Finasteride 5.alpha.-Reductase 3A4
Abstracts - 10th Int Symp Inhibitor Mic & Drug Oxide 1994, p
594 FK 506 Immunosuppressant 3A4 (major), 2D6 Abstracts - 10th Int
Symp (<10%) Mic & Drug Oxid 1994, p 587 Flexeril Muscle
N-demethylation - Abstracts - 10th Int Symp relaxant 1A2, 3A4, 2D6
(minor) Mic & Drug Oxid 1994, p 592 Haloperidol Neuroleptic 3A
Abstracts - 10th Int Symp Agent Mic & Drug Oxid 1994, p 179
Ibuprofen NSAID 2C8, 2C9, 2C18 Clin Pharmacokinetics 1994, 26,
59-70 Ifosfamide Anticancer 4-hydroxylation, N- Biochem Pharmacol
1994, 47, dechloroethylation - 1157-1163 3A4 Itraconazole
Antifungal 3A4 > 1A2 > 2C, Clin Pharm and Ther 1991, 2D6 49,
158 (abstract PII-37) Labetalol Antihypertensive 2D6 Drug Met Disp
1985, 13, 443-448 Ondansetron 5-HT3 7,8-hydroxylation - Drug Met
Disp 1994, 22, antongonist 3A, 2D6 269-274 Oxodipine
Antihypertensive 3A4 J Pharm Exp Ther 1992, 261, 381-386
Prednisolone Corticosteroid 3A4 Drug Met Disp 1990, 18, 595-606
Alfentanil Analgesic 3A4 Anesthesiology 1992, 77, 467-474
Amiflamine MAO-A 2D6 Clin Pharmacol Ther 1984, Inhibitor 36,
515-519 Azithromycin Antibiotic 3A4 Clin Pharm and Ther 1991, 49,
158 Benzphetamine Anorectic 2C8, 2C9, 2C18, 3A4 Clin
Pharmacokinetics 1994, 26, 59-70 Captopril Antihypertensive 2D6 Eur
J Clin Pharm 1987, 31, 633-641 Citalopram Antidepressant 2C18, 2C19
Ther Drug Monit 1993, 15, 11-17 Clarithromycin Antibiotic 3A4 Clin
Pharm and Ther 1991, 49, 158 Clonazepam Anticonvulsant
Nitroreduction - 3A4 Fundam Clin Pharm 1993, 7, 69-75 Clotramizole
Antifungal 3A4 > 1A2 > 2C, Clin Pharm and Ther 1991, 2D6 49,
158 (abstract PII-37) Cocaine N-demethylation - 3A4 Pharmacol 1993,
46, 294-300 Dapsone Antibacterial N-hydroxylation - 3A4 Mol
Pharmacol 1992, 41, 975-980 Delavirdine HIV-1 Reverse Hydroxylation
- 3A4 Abstracts - 10th Int Symp transciptase N-dealkylation - 3A4,
Mic & Drug Oxid 1994, p 240 Inhibitor 2D6 Dextromethorphan
Antitussive O-demethylation - 2D6 Biochem Pharm 1994, 48,
N-demethylation - 173-182 3A4, 3A5 Diazepam CNS Depressant 2C8,
2C9, 2C18 Clin Pharmacokinetics 1994, 26, 59-70 Diclofenac NSAID
2C8, 2C9, 2C18 Clin Pharmacokinetics 1994, 26, 59-70 Tamoxifen
Antiestrogen 3A4, 1A1 ISSX Proceedings Vol. 3, 44 Taxotere
Antimitotic 3A ISSX Proceedings Vol. 3, 36 Tenoxicam NSAID 2C Life
Sci 1992, 51, 575-581 Terfenadine Antihistamine 3A4 Drug Met Disp
1993, 21, 403-409 Timolol .beta.-blocker 2D6 TiPS 1992, 13, 434-439
Thioridazine Neuroleptic 2D6 TiPS 1992, 13, 434-439 Tolbutamide
Blood glucose 2C18 lowering agent Tomoxetine Antidepressant 2D6
TiPS 1992, 13, 434-439 Toremifene Antiestrogen 3A4/3A5 - (N- ISSX
Proceedings Vol 3, 22 demethylation), 1A Triazolam Hypnotic 3A4
Trifluperidol Neuroleptic 2D6 TiPS 1992, 13, 434-439 Troleandomycin
Antibiotic 3A4 Verapamil Antihypertensive 3A4 (mainly), also Arch
Pharmacol 1993, 348, 1A2 for D-617 332-337 metabolite Vinblastine
Antitumor 3A4 Warfarin Anticoagulant 3A, 2C, 1A2 Zonisamide
Anticonvulsant 3A Molec Pharm 1993, 44, 216-221 Acetaminophen
Antipyretic 3A4, 2E1, 1A2 Chem Res Tox 1993, 6, 511 Amiodarone
Antiarrhythmic 3A - deethylatin, 1A2 1A2, Drug Met Disp 1993, 21,
2C18, 978-985 2D6, 3A4 Amitriptyline Antidepressant 2C18, 2D6
Astemizole Anthistamine 3A4 Bufuralol .beta.-Blocker 2D6 TiPS 1992,
13, 434-439 Carbamazepine Anticonvulsant 3A Inducer of 3A4; Clin
Pharmacokin 1993, 25, 450-482 Chlorzoxazone Muscle 2E1 - 6-OH
metabolite Chem Res Tox 1990, 3, 566-573 relaxant Cimetidine
Antiulcer 3A4, 2D6 > 1A2, Gastroent 1991, 101, 1680-1691 2E1
Ciprofloxacin Antimicrobial 3A4 Clin Pharmacokinet 1992, 23,
132-146 Clomipramine Antidepressant 2C18, 2F6 Clozapine Neuroleptic
2D6 TiPS 1992, 13, 434-439 Codeine Analgesic 2D6 - demethylation
Cyclosporin Immunospressant 3A4 hydroxylated and N- demethylated
metabolites Dapsone Antibacterial 3A4 Debrisoquine Antihypertensive
2D6 Desipramine Antidepressant 2D6 TiPS 1992, 13, 434-439
Dextromethorphan Antitussive 2D6 Diazepam CNS Depressant 2C18
Diltiazam Antihypertensive 3A4 Ebastine Antihistamine 3A4, 2D6
Structure similar to terfenadine Encainide Antiarrhythmic 2D6
Erythromycin Antibiotic 3A4 3A, 1A2 noncompetitive inhibitor
Felodipine Antihypertensive 3A4 Flecainde Antiarrhymic 2D6
Fluoxetine Antidepressant 2D6, 3A? - 2D6 (S > R) J Pharm Exp
Ther 1993, 266, Demethylation 964-971) Fluphenazine Neuroleptic 2D6
TiPS 1992, 13, 434-439 Guanoxan Antihypertensive 2D6 TiPS 1992, 13,
434-439 Hydrocortisone Antiinflammatory 3A4 Imipramine
Antidepressant 2D6-hydroxylation Biol Pharm Bull 1993, 16, 3A4,
2C19 - 571 demethylation Indoramin Antihypertensive 2D6 TiPS 1992,
13, 434-439 Ketoconazole Antifungal 3A4 > 1A2 > 2C, 2D6
Lidocane Anesthetic 3A4 Clin Pharm Ther 1989, 46, 521-527
Loratadine Antihistamine 3A4, 2D6 formation of SCH 34117 Lovastatin
Cholesterol 3A4 Arch Biochem Biophys 1991, lowing agent 290, 355
Mephenytoin Anticonvulsant 2C18 Metoprolol Antihypertensive 2D6
Mexiletine Antiarrhythmic 2D6 TiPS 1992, 13, 434-439 Nifedipine
Antihypertensive 3A J Biol Chem 1986, 261, 5051-50601 Nitrendipine
Antihypertensive 3A4 Nortriptylin Antidepressant 2D6 TiPS 1992, 13,
434-439 Omeprazole Antiulcer 3A4 (major), 2C18 2C18 ISSX
Proceedings Vol 3, 45-46; Inducer of 1A2, Clin Pharmacokin 1993,
25, 450-482 Perphenazine Neurologic 2D6 TiPS 1992, 13, 434-439
Phenytoin Antiepileptic 3A, 2C18 Probable inducer of 3A4; Clin
Pharmacokin 1993, 25, 450-482 Propafenone Antiarrhythmic 3A4, 1A2 -
Molec Pharm 1993, 43, 120-126 demethylation, 2D6 Propanalol
Antihypertensive 2C18, 2D6 Quinidine Antiarrhymic 3A4 2D6
Ranitidine Antiulcer 2D6 Bunitrolol antihypertensive
4-hydroxylation - 2D6
[0175] B. Tissue Sample Preparation
[0176] The source of target DNA for detecting mutations in
biotransformation genes is usually genomic. In adults, samples can
conveniently be obtained from blood or mouthwash or cheek scraping
epithelial cells. cDNA can be obtained only from tissues in which
biotransformation genes are expressed. The liver is a good source,
but a surgical biopsy is required to remove a sample from living
patients.
[0177] C. Amplification
[0178] The target DNA is usually amplified by PCR. Primers can be
readily devised from the known genomic and cDNA sequences of
biotransformation genes. The selection of primers, of course,
depends on the areas of the target sequence that are to be
screened. The choice of primers also depends on the strand to be
amplified. Because some nonallelic P450 genes show a high degree of
sequence identity, selection of primers can be important in
determining whether one or more nonallelic seqments is amplified.
Usually, primers will be selected to be perfectly complementary to
a unique sequence within a selected target resulting in
amplification of only that target. Examples of suitable primers are
shown in Table 6 (F=forward primer, R=reverse primer).
TABLE-US-00025 TABLE 6 SEQUENCE NAME SEQUENCE CYP2DE1F
GCCAGGTGTGTCCAGAGGAGCCCAT CYP2DE1R CTGGTAGGGGAGCCTCAGCACCTCT
CYP2DE2F TAGGACTAGGACCTGTAGTCTGGGGT CYP2DE2R
GGTCCCACGGAAATCTGTCTCTGT CYP2DE34F CTAATGCCTTCATGGCCACGCGCA
CYP2DE34R TCGGGAGCTCGCCCTGCAGAGA CYP2DE5F GGGCCTGAGACTTGTCCAGGTGAA
CYP2DE5R CCCTCATTCCTCCTGGGACGCTCAA CYP2DE6F
CCCGTTCTGTCCCGAGTATGCTCT CYP2DE6R TCGGCCCCTGCACTGTTTCCCAGA CYP2DE7F
GCTGACCCATTGTGGGGACGCAT CYP2DE7R CTATCACCAGGTGCTGGTGCTGAGCT
CYP2DE89F GGGAGACAAACCAGGACCTGCCAGA CYP2DE89R
CTCAGCCTCAACGTACCCCTGTCT CYP2D678-F TGAGAGCAGCTTCAATGATGAGAACCT
CYP2D678-R GTAGGATCATGAGCAGGAGGCCCCA CYP-PCR8-F
TCCCCCGTGTGTTTGGTGGCA CYP-PCR9-R TGCTTTATTGTACATTAGAGC
[0179] For analysis of mutants through all or much of a gene, it is
often desirable to amplify several segments from several paired
primers. The different segments may be amplified sequentially or
simultaneously by multiplex PCR. Frequently, fifteen or more
segments of a gene are simultaneously amplified by PCR. The primers
and amplifications conditions are preferably selected to generate
fluorescently labelled DNA targets. Double stranded targets are
enzymically degraded to fragments of about 100 bp and denatured
before hybridization.
[0180] D. Tiling Strategies
[0181] Mutations in biotransformation genes can be detected by any
of the tiling strategies noted above. For detection of hitherto
uncharacterized mutations, the basic tiling strategy is one
suitable strategy. The chips contain-probes tiling across some or
all of a reference sequence.
[0182] For detecting precharacterized mutations, which account for
the large majority of poor metabolizers in the preferred reference
genes described above, the block tiling strategy is one
particularly useful approach. In this strategy, a group (or block)
of probes is used to analyze a short segment of contiguous
nucleotides (e.g., 3, 5, 7 or 9) from a biotransformation gene
centered around the site of a mutation.
[0183] In a preferred embodiment, a first group of probes is tiled
based on a wildtype reference sequence and a second group is tiled
based a mutant version of the wildtype reference sequence. The
mutation can be a point mutation, insertion or deletion or any
combination of these. The presence of first and second groups of
probes facilitates analysis when multiple target sequences are
simultaneously applied to the chip, as is the case when a patient
being diagnosed is heterozygous in a biotransformation gene. The
principles of chip design and analysis are as described for the
CFTR chip.
[0184] E. Modifications for Determining Gene Copy Number
[0185] As discussed in connection with the CFTR chip, the tiling
arrays of the invention are usually capable of simultaneously
analyzing heterozygous alleles of a target sequence. The presence
of heterozygous alleles is signalled by two probes having
interrogations positions aligned with the mutation showing specific
hybridization, rather than one, as would be the case for homozygous
alleles. Interpretation of hybridization patterns is, however,
sometimes complicated by the presence of less than, or more than,
the two expected copies of a biotransformation gene in an
individual.
[0186] For example, an individual having one wildtype copy of the
gene, and a wholly deleted second copy of the gene would show a
similar hybridization pattern to an individual with two wildtype
copies (other than for possible differences in overall intensity of
the pattern). In fact, complete gene deletions of one or both
copies of a gene account for approximately 15% of slow metabolizers
having defective biotransformation enzymes. Analogous loss of
heterozygosity occurs in other diseases such as cancer (p53) and
muscular dystrophy (dystrophin gene).
[0187] Further, an individual with three wildtype copies of a
biotransformation gene would show a similar hybridization pattern
to an individual with two copies of the gene, other than for a
difference in overall intensity. Individuals having multiple copies
of a biotransformation gene are referred to as super metabolizers,
because of their elevated levels of enzymes.
[0188] Additional complications in interpreting a hybridization
pattern can result from the presence of pseudogenes in an
individual. A pseudogene is an analog of a true gene that shows
strong sequence identity to the true gene but is not expressed.
Most pseudogenes having counterparts among the biotransformation
genes have been sufficiently well characterized that their presence
can be avoided by appropriate selection of amplification primers
(i.e., primers are selected that hybridize to the true gene of
interest without hybridizing to the pseudogene). For example, 5'
TGA JAG CAG CTT CAA TGA TGA GAA CCT 3' and 5' GTA GGA TCA TGA GCA
GGA GGC CCC A 3', can be used for amplifying exon 6. However,
occasionally a pseudogene might be unexpectedly amplified together
with a true gene, and the presence of mutations in the psuedogene
(which in fact have no phenotypic effect) might be mistakenly
thought to occur in the true gene.
[0189] The invention provides tiling arrays to overcome these
difficulties by indicating how many copies of a target are present
in a sample. In addition to containing the probes required for the
tiling strategies described above, these arrays contain probes for
analyzing polymorphic sites of a target gene, which do not exert
any phenotypic effect (i.e., silent polymorphic sites). The
frequency and diversity of such sites is usually greater than that
of mutations whose presence does exert a phenotypic effect. Silent
sites are predominantly found in intronic regions and in flanking
regions (i.e., within about 20 kb of transcribed regions), where
selective pressure is generally lower relative to the coding
regions. Any number of additional polymorphic sites can be tiled
using the same strategies as previously described. For any
particular polymorphic site, each form of the polymorphism at that
sites serves as a reference sequence for a separate tiling. In some
instances, silent polymorphic sites can be amplified from the same
primers and on the same amplicon as the sites of potential
mutations. In other instances, separate amplification is
required.
[0190] Silent polymorphic regions can be identified by comparing
segments of target DNA, particularly introns and flanking regions,
from different individuals. Comparison can be performed using the
general tiling strategies disclosed above or by conventional
techniques such as single-stranded conformational analysis. See,
e.g., Ha yashi, PCR Methods & Applications 1, 34-38 (1991);
Orita, Proc. Natl. Acad. Sci. USA 86, 2766-2270 (1989); Orita et
al., Genomics 5, 874-879 (1989). This method has been successfully
employed in dystrophin gene analysis coupled with heteroduplex
formation to scan for new mutations. Prior et al., Human Molecular
Genetics 2, 311-313 (1993).
[0191] Analysis of the hybridization pattern of a probe array
tiling a silent polymorphic region indicates which of the
polymorphic forms are present at this region. Consider a
polymorphism constituting a single base change. If the polymorphism
and flanking sequences are tiled according to the basic strategy
using four probe sets, there are four probes having an
interrogation position aligned with the single base at which the
polymorphism occurs. The number of these four probes to show
specific hybridization indicates the number of different
polymorphic forms present, and hence, the minimum number of copies
of a gene present. For example, if two probes show specific
hybridization, at least two polymorphic forms are present. There
may be more copies of the gene than polymorphic forms observed at
any one site, because the same polymorphic form may be present in
more than one copy of the gene. However, if sufficient polymorphic
sites are examined, it is likely that a site will be found at which
each copy of the gene exists in a different polymorphic form. Thus,
the copy number of a gene can be deduced from the number of
polymorphic forms present at the polymorphic site(s) showing the
greatest number of polymorphic forms.
[0192] If a silent pqlymorphism is more complicated than a
single-base change (e.g., deletion or insertion), the number of
polymorphic forms can be determined from alternative tilings to the
different forms, as generally described in .sctn.I. B.1. For
example, if all the perfectly matched probes in a first tiling
hybridize, it is concluded that the polymorphic form constituting
the reference sequence for the first tiling is present. If, all the
perfectly matched probes in two (or more) tilings hybridize, it is
concluded that two (or more) polymorphic forms are present.
[0193] F. Applications
[0194] In general, the biotransformation genes described above are
inherited in an autosomal recessive fashion. The presence of a
homozygous mutation or two heterozygous mutations in an individual
signals that the individual is a poor metabolizer of any drug
metabolized by the biotransformation gene in which the mutation
occurs. Some individuals with one mutant and one normal gene show a
near wildtype phenotype, but other such individuals show an
intermediate phenotype between normal and homozygous mutant.
Individuals having additional copies of a biotransformation gene
usually express the gene product at higher levels than a wildtype
individual.
[0195] The screening methods can be routinely applied as precaution
before administering a drug to a patient for the first time. If the
patient is found to lack both copies of a gene expressing an enzyme
required for detoxification of a particular drug, the patient
generally should not be administered the drug or, should be
administered the drug in smaller doses compared with patients
having normal levels of the enzyme. The latter course may be
necessary if no alternative treatment is available. If the patient
is found to lack both copies of a gene expressing an enzyme
required for activation of a particular drug, the drug will have no
beneficial effect on the patient and should not be administered.
Patients having one wildtype copy of a gene and one mutant copy of
a gene, and who are at risk of having lower levels of an enzyme,
should be administered drugs metabolized by that enzyme only with
some caution, again depending on whether alternatives are
available. If the drug is detoxified by the enzyme in question, the
patient should in general be administered a lower dose of the drug.
If the drug is activated by the enzyme, the heterozygous patient
should be administered a higher dosage of the drug. The reverse
applies for patients having additional copy(ies) of a particular
biotransformation gene, who are at risk of having elevated levels
of an enzyme. The more rational selection of therapeutic agents
that can be made with the benefit of screening results in fewer
side effects and greater drug efficacy in poor metabolizer
patients.
[0196] The methods are also useful for screening populations of
patients who are to be used in a clinical trial of a new drug. The
screening identifies a pool of patients, each of whom has wildtype
levels of the full complement of biotransformation enzymes. The
pool of patients are then used for determining safety and efficacy
of the drugs. Drugs shown to be effective by such trials are
formulated for therapeutic use with a pharmaceutical carrier such
as sterile distilled water, physiological saline, Ringer's
solution, dextrose solution, and Hank's solution.
[0197] The chips are also useful for screening patients for
increased risk of cancer in similar manner to the p53 chips of the
invention. Some biotransformation enzymes have roles in activating
environmental procarcinogens to carcinogenic form (e.g., 1A1, 2D6,
2E1 and N-acetyltransferase). Mutations in genes encoding these
enzymes are associated with reduced cancer risk. Other
biotransformation enzymes have roles in detoxifying environmental
carcinogens, e.g., glutathione S-transferase M1. Mutations in one,
and especially both, copies of genes encoding such enzymes are
associated with enhanced susceptibility to cancer. See Shields,
Environmental Health Perspectives 102 (sup. 11), 81-87 (1994).
[0198] CYP genotype information can be useful to prevent drug-drug
interactions in two main ways. First, some drugs are known to
inhibit specific CYP enzymes. When such a drug is given, care
should be taken not to give a second drug handled by the inhibited
pathway (see Table 4). Second, when a person is genotyped as a poor
metabolizer, not only should drug doses be decreased, second drugs
handled by the poor metabolizing pathway should not be added to the
therapy.
EXAMPLE
[0199] FIG. 10 shows the layout of probes and a computer-simulated
hybridization pattern for an exemplary chip containing tilings for
CYP2D6 and CYP2C19 (wildtype). The chip contains a number of
separate tilings as follows.
[0200] (1) A tiling (basic strategy) of all 9 exons plus 5
nucleotides of each intron bordering the exons of the CYP2D6 gene.
The probes were 14 mers with the interrogation position at
nucleotide 7. This tiling is the upper right of the figure
(excluding the eleven columns of probe sets on the left of the
chip). Each lane of probes is divided into four columns, occupied
by probes differing at the interrogation position. At any one
column, a nucleotide in the target sequence aligned with the column
position is identified as the complement of the nucleotide in the
column having the highest fluorescent intensity.
[0201] (2) A tiling (basic strategy) of the complete coding
sequence (cDNA/mRNA) of CYP2C19 (wildtype). The probes were 15 mers
with the interrogation position at nucleotide 7. This tiling is in
the lower half of the figure (excluding the eleven columns of
probes at the left of the figure).
[0202] (3) A series of "opti-block" tilings for analysis of known
mutations in CYP2D6 and CYP2C19. These blocks run down the left
hand eleven columns of the figure. These blocks are labelled 2C19
m2 (mutation in cytochrome P450 2C19), p34S, L91M, H94A, p1085,
p1127, Delta T 1795, p1749, ss 1934, G212E, 2637DeltaA, delta281,
296C, H324P, L421P, S486T, 2C19 ml (mutation in cytochrome P450
2C19). Unless otherwise indicated, the mutations occur in
cytochrome P450 2D6.
[0203] (4) A series of alternative tilings for analysis of known
polymorphic differences between CYP2D6 and its pseudogenes CYP2D7P,
CYP2D7AP and CYP2DAP. These tilings are also in the left hand
column of the figure. These tilings are labelled Ex6p 2D6/2D7, Ex2p
2D6/2D7, Ex2p 2D6/2D8, Ex4p 2D6/2D7, Ex4p 2D6/2D8, Ex6p 2D6/2D8,
Ex7p 2D6/2D7, 2D6/2D7.
[0204] FIG. 11 shows an alternative tiling designed to distinguish
2D6 from the pseudogene 2D7 in CYP2D6. Alternative tilings are
formed from two interdigitated tilings, each designed according to
the basic tiling strategy based on two different reference
sequences, in this case 2D6 and 2D7. The first column contains four
probes complementary to the CYP2D6 sequence except at the
interrogation position. The second column contains four probes
complementary to the CYP2D7 sequence except at the interrogation
position. The interrogation positions of the first and second
columns of probes align with the same positions of the target
sequence. The same strategy of alternating probes from the
respective 2D6 and 2D7 reference sequences continues throughout the
alternative tiling. When the tiling is hybridized to only the
CYP2D6 form, only probes complementary to CYP2D6 (i.e., the columns
labelled 6) light up. Conversely when the tiling is hybridized to
only the CYP2D7 form, only probes in the columns labelled 7 light
up. When the tiling is hybridized to a mixture of CYP2D6 and
CYP2D7, the pattern is the sum of the pattern for the two
individual forms. The characteristic patterns throughout the tiling
allow distinction of whether CYP2D6, CYP2D7 or both are
present.
[0205] FIG. 12 shows an optiblock of probes for distinguishing the
P34S mutation from the wildtype sequence of CYP2D6. In an
optiblock, probes are selected based on the block tiling strategy.
That is all probes align with the same segment of target DNA but
differ in the location of the interrogation position and in whether
the probes are tiled based on a wildtype or mutant reference
sequence. The notation "n" above the chip indicates that the
interrogation position is aligned with the site of the P34S
mutation in the target DNA and, the notation n-1 and n+1 indication
interrogation positions aligned one base either side of the site of
mutation, and so forth. As in the alternate tiling, probes tiled on
wildtype and mutant sequences (sometimes referred to as wildtype
and mutant probes) are interdigitated. The result of hybridizing
the optiblock to wildtype target is that all columns containing
probes tiled based on the wildtype sequence light up. In addition,
one column of probes based on the mutant sequence lights up, this
being the column of probes having an interrogation position aligned
with the "n" nucleotide in the target. The result of hybridizing
the optiblock to the mutant target is the reverse; that is all
columns of probes tiled based on the mutant target sequence light
up, and a single column of probes tiled based on the wildtype
sequence lights up. When the optiblock is hybridized to a
heterozygous target containing wildtype and mutant forms, the
pattern is the sum of those obtained with the individual targets
alone. Thus, all three possible targets, homozygous wildtype,
homozygous mutant and heterozygote give distinct patterns of
hybridization and dan be distinguished.
[0206] The chip was hybridized with fluorescein-labelled-dGTP
double-stranded DNA made by PCR from a plasmid template containing
the genomic clone of CYP2D6-B. The entire gene is amplified as 4
separate PCR products, all of which were present during
hybridization. dUTP was incorporated during PCR and the PCR
products were treated with uracil DNA glycosylase, then heated to
95.degree. C. for 5 min before hybridization to fragment and
denature double-stranded material. Hybridization was for 30 min at
37.degree. C. in 0.5 M LiCl plus 0.0005% NaLauroylSarkosine.
Washing was performed prior to scanning the same solution without
target DNA for 5 min at room temperature.
[0207] FIG. 13 shows the chip hybridized to a CYP2D6-B target. A
portion of the basic tiling pattern is shown magnified in the lower
right hand corner. Successive nucleotides in the target sequence
can be read by eye by comparing the sequence intensities of the
four squares in a column. From top to bottom, these squares are
respectively occupied by probes having A, C, G and T at the
interrogation position. The nucleotide occupying the position in
the target sequence aligned with the interrogation position of a
column of probes is the complement of the interrogation position of
the probe showing the highest signal. The SS1934 :mutation in
CYP2D6-B results in a G-A transition and loss of function. The
enlarged hybridization pattern in the lower right of the figure has
an arrow in the column corresponding to nucleotide 1934. In this
column, the probe hybridizing most strongly has a T in the
interrogation position. This implies that the corresponding
nucleotide in the target is the complement of T, i.e., A,
indicating that the mutant form of the target is present. The same
result is apparent from the optiblock shown in the upper left of
the figure. This block shows three consecutive columns in which the
T-probe lights up. Two of these columns are from wildtype and
mutant probes having interrogation positions aligned with
nucleotide 1934. The third column (the leftmost of the three) is
the mutant probe having an interrogation position aligned with
nucleotide 1933.
[0208] FIG. 14 shows magnifications of the hybridization patterns
of L421P and S486 opti-tiling blocks. In each case, the first,
third, fifth, sixth, seventh, and ninth columns light up. This
pattern indicates that homozygous wildtype sequence is present (see
the idealized pattern for homozygous wildtype in FIG. 12).
[0209] In a separate experiment, the chip was hybridized to CYP2C19
cDNA, as shown in FIG. 15. The Figure shows that the lower-portion
of the chip containing the 2C19 tiles is lit. A magnification of
part of the hybridization pattern from the basic tiling sequence is
shown in the upper right of the Figure. Again, the sequence can be
read by eye by comparing the intensities of the four probes forming
a column.
III. Modes of Practicing The Invention
[0210] A. VLSIPS.TM. Technology
[0211] As noted above, the VLSIPS.TM. technology is described in a
number of patent publications and is preferred for making the
oligonucleotide arrays of the invention. A brief description of how
this technology can be used to make and screen DNA chips is
provided in this Example and the accompanying Figures. In the
VLSIPS.TM. method, light is shone through a mask to activate
functional (for oligonucleotides, typically an --OH) groups
protected with a photoremovable protecting group on a surface of a
solid support. After light activation, a nucleoside building block,
itself protected with a photoremovable protecting group (at the
5'-OH), is coupled to the activated areas of the support. The
process can be repeated, using different masks or mask orientations
and building blocks, to prepare very dense arrays of many different
oligonucleotide probes. The process is illustrated in FIG. 16; FIG.
17 illustrates how the process can be used to prepare "nucleoside
combinatorials" or oligonucleotides synthesized by coupling all
four nucleosides to form dimers, trimers and so forth.
[0212] New methods for the combinatorial chemical synthesis of
peptide, polycarbamate, and oligonucleotide arrays have recently
been reported (see Fodor et al., 1991, Science 251: 767-773; Cho et
al., 1993, Science 261: 1303-1305; and. Southern et al., 1992,
Genomics 13: 1008-10017, each of which is incorporated herein by
reference). These arrays, or biological chips (see Fodor et al.,
1993, Nature 364: 555-556, incorporated herein by reference),
harbor specific chemical compounds at precise locations in a
high-density, information rich format, and are a powerful tool for
the study of biological recognition processes. A particularly
exciting application of the array technology is in the field of DNA
sequence analysis. The hybridization pattern of a DNA target to an
array of shorter oligonucleotide probes is used to gain primary
structure information of the DNA target. This format has important
applications in sequencing by hybridization, DNA diagnostics and in
elucidating the thermodynamic parameters affecting nucleic acid
recognition.
[0213] Conventional DNA sequencing technology is a laborious
procedure requiring electrophoretic size separation of labeled DNA
fragments. An alternative approach, termed Sequencing By
Hybridization (SBH), has been proposed (Lysov et al., 1988,
Dokl.Akad.Nauk SSSR 303:1508-1511; Bains et al., 1988, J. Theor.
Biol. 135:303-307; and Drmanac et al., 1989, Genomics 4:114-128,
incorporated herein by reference and discussed in Description of
Related Art, supra). This method uses a set of short
oligonucleotide probes of defined sequence to search for
complementary sequences on a longer target strand of DNA. The
hybridization pattern is used to reconstruct the target DNA
sequence. It is envisioned that hybridization analysis of large
numbers of probes can be used to sequence long stretches of DNA. In
immediate applications of this methodology, a small number of
probes can be used to interrogate local DNA sequence. The strategy
of SBH can be illustrated by the following example. A 12-mer target
DNA sequence, AGCCTAGCTGAA, is mixed with a complete set of
octanucleotide probes. If only perfect complementarity is
considered, five of the 65,536 octamer probes -TCGGATCG, CGGATCGA,
GGATCGAC, GATCGACT, and ATCGACTT will hybridize to the target.
Alignment of the overlapping sequences from the hybridizing probes
reconstructs the complement of the original 12-mer target:
TABLE-US-00026 TCGGATCG CGGATCGA GGATCGAC GATCGACT ATCGACTT
TCGGATCGACTT
[0214] Hybridization methodology can be carried out by attaching
target DNA to a surface. The target is interrogated with a set of
oligonucleotide probes, one at a time (see Strezoska et al., 1991,
Proc. Natl. Acad. Sci. USA 88:10089-10093, and Drmanac et al.,
1993, Science 260:1649-1652, each of which is incorporated herein
by reference). This approach can be implemented with well
established methods of immobilization and hybridization detection,
but involves a large number of manipulations. For example, to probe
a sequence utilizing a full set of octanucleotides, tens of
thousands of hybridization reactions must be performed.
Alternatively, SBH can be carried out by attaching probes to a
surface in an array format where the identity of the probes at each
site is known. The target DNA is then added to the array of probes.
The hybridization pattern determined in a single experiment
directly reveals the identity of all complementary probes.
[0215] As noted above, a preferred method of oligonucleotide probe
array synthesis involves the use of light to direct the synthesis
of oligonucleotide probes in high-density, miniaturized arrays.
Photolabile 5'-protected N-acyl-deoxynucleoside phosphoramidites,
surface linker chemistry, and versatile combinatorial synthesis
strategies have been developed for this technology. Matrices of
spatially-defined oligonucleotide probes have been generated, and
the ability to use these arrays to identify complementary sequences
has been demonstrated by hybridizing fluorescent labeled
oligonucleotides to the DNA chips produced by the methods. The
hybridization pattern demonstrates a high degree of base
specificity and reveals the sequence of oligonucleotide
targets.
[0216] The basic strategy for light-directed oligonucleotide
synthesis (1) is outlined in FIG. 18. The surface of a solid
support modified with photolabile protecting groups (X) is
illuminated through a photolithographic mask, yielding reactive
hydroxyl groups in the illuminated regions. A 3'-O-phosphoramidite
activated deoxynucleoside (protected at the 5'-hydroxyl with a
photolabile group) is then presented to he surface and coupling
occurs at sites that were exposed to light. Following capping, and
oxidation, the substrate is rinsed and the surface illuminated
through a second mask, to expose additional hydroxyl groups for
coupling. A second 5-protected, 3'-O-phosphoramidite activated
deoxynucleoside is presented to the surface. The selective
photodeprotection and coupling cycles are repeated until the
desired set of products is obtained.
[0217] Light directed chemical synthesis lends itself to highly
efficient synthesis strategies which will generate a maximum number
of compounds in a minimum number of chemical steps. For example,
the complete set of .sub.4.sup.n polynucleotides (length n), or any
subset of this set can be produced in only 4.times.n chemical
steps. See FIG. 17. The patterns of illumination and the order of
chemical reactants ultimately define the products and their
locations. Because photolithography is used, the process can be
miniaturized to generate high-density arrays of oligpnucleotide
probes. For an example of the nomenclature useful for describing
such arrays, an array containing all possible octanucleotides of dA
and dT is written as (A+T).sup.8. Expansion of this polynomial
reveals the identity of all 256 octanucleotide probes from AAAAAAAA
to TTTTTTTT. A DNA array composed of complete sets of dinucleotides
is referred to as having a complexity of 2. The array given by
(A+T+C+G)8 is the full 65,536 octanucleotide array of complexity
four. Computer-aided methods of laying down predesigned arrays of
probes using VLSIPS.TM. technology are described in
commonly-assigned co-pending application U.S. Ser. No. 08/249,188,
filed May 24, 1994 (incorporated by reference in its entirety for
all purposes).
[0218] In a variation of the VLSIPS.TM. methods, multiple copies of
an array of probes are synthesized simultaneously. The multiple
copies are effectively stacked in a pile during the synthesis
process in a manner such that each copy is accessible to
irradiation. For example, synthesis can occur through the volume of
a slab of polymer gel that is transparent to the source of
radiation used to remove photoprotective groups. Suitable polymers
are described in U.S. Ser. No. 08/431,196, filed Apr. 27, 1995
(incorporated by reference in its entirety for all purposes). For
example, a polymer formed from a 90:10% w/w mixture of acrylamide
and N-2-aminoethylacrylamide is suitable.
[0219] After synthesis, the gel is sliced into thin layers (e.g.,
with a microtome). Each layer is attached to a glass substrate to
constitute a separate chip. Alternatively, a pile can be formed
from layers of gel separated by layers of a transparent substance
that can be mechanically or chemically removed after synthesis has
occurred. Using these methods, up to about 10, 100 or 1000
identical arrays can be synthesized simultaneously.
[0220] To carry out hybridization of DNA targets to the probe
arrays, the arrays are mounted in a thermostatically controlled
hybridization chamber. Fluorescein labeled DNA targets are injected
into the chamber and hybridization is allowed to proceed for 5 min
to 24 hr. The surface of the matrix is scanned in an
epifluorescence microscope (Zeiss Axioscop 20) equipped with photon
counting electronics using 50-100 .mu.W of 488 nm excitation from
an Argon ion laser (Spectra Physics Model 2020). Measurements may
be made with the target solution in contact with the probe matrix
or after washing. Photon counts are stored and image files are
presented after conversion to an eight bit image format. See FIG.
21.
[0221] When hybridizing a DNA target to an oligonucleotide array,
N=Lt-(Lp-1) complementary hybrids are expected, where N is the
number of hybrids, Lt is the length of the DNA target, and Lp is
the length of the oligonucleotide probes on the array. For example,
for an 11-mer target hybridized to an octanucleotide array, N=4.
Hybridizations with mismatches at positions that are 2 to 3
residues from either end of the probes will generate detectable
signals. Modifying the above expression for N, one arrives at a
relationship estimating the number of detectable hybridizations
(Nd) for a DNA target of length Lt and an array of complexity C.
Assuming an average of 5 positions giving signals above background:
[0222] Nd=(1+5(C-1)) [Lt-(Lp-1)].
[0223] Arrays of oligonucleotides can be efficiently generated by
light-directed synthesis and can be used to determine the identity
of DNA target sequences. Because combinatorial strategies are used,
the number of compounds increases exponentially while the number of
chemical coupling cycles increases only linearly. For example,
synthesizing the complete set of 48 (65,536) octanucleotides will
add only four hours to the synthesis for the 16 additional cycles.
Furthermore, combinatorial synthesis strategies can be implemented
to generate arrays of any desired composition. For example, because
the entire set of dodecamers (4.sup.12) can be produced in 4.sup.8
photolysis and coupling cycles (b.sup.n compounds requires
b.times.n cycles), any subset of the dodecamers (including any
subset of shorter oligonucleotides) can be constructed with the
correct lithographic mask design in 48 or fewer chemical coupling
steps. In addition, the number of compounds in an array is limited
only by the density of synthesis sites and the overall array size.
Recent experiments have demonstrated hybridization to probes
synthesized in 25 .mu.m sites. At this resolution, the entire set
of 65,536 octanucleotides can be placed in an array measuring 0.64
cm square, and the set of 1,048,576 dodecanucleotides requires only
a 2.56 cm array.
[0224] Genome sequencing projects will ultimately be limited by DNA
sequencing technologies. Current sequencing methodologies are
highly reliant on complex procedures and require substantial manual
effort. Sequencing by hybridization has the potential for
transforming many of the manual efforts into more efficient and
automated formats. Light-directed synthesis is an efficient means
for large scale production of miniaturized arrays for SBH. The
oligonucleotide arrays are not limited to primary sequencing
applications. Because single base changes cause multiple changes in
the hybridization pattern, the oligonucleotide arrays provide a
powerful means to check the accuracy of previously elucidated DNA
sequence, or to scan for changes within a sequence. In the case of
octanucleotides, a single base change in the target DNA results in
the loss of eight complements, and generates eight new complements.
Matching of hybridization patterns may be useful in resolving
sequencing ambiguities from standard gel techniques, or for rapidly
detecting DNA mutational events. The potentially very high
information content of light-directed oligonucleotide arrays will
change genetic diagnostic testing. Sequence comparisons of hundreds
to thousands of different genes will be assayed simultaneously
instead of the current one, or few at a time format. Custom arrays
can also be constructed to contain genetic markers for the rapid
identification of a wide variety of pathogenic organisms.
[0225] Oligonucleotide arrays can also be applied to study the
sequence specificity of RNA or protein-DNA interactions.
Experiments can be designed to elucidate specificity rules of non
Watson-Crick oligonucleotide structures or to investigate the use
of novel synthetic nucleoside analogs for antisense or triple helix
applications. Suitably protected RNA monomers may be employed for
RNA synthesis. The oligonucleotide arrays should find broad
application deducing the thermodynamic and kinetic rules governing
formation and stability of oligonucleotide complexes.
[0226] Other than the use of photoremovable protecting groups, the
nucleoside coupling chemistry is very similar to that used
routinely today for oligonucleotide synthesis. FIG. 18 shows the
deprotection, coupling, and oxidation steps of a solid phase DNA
synthesis method. FIG. 19 shows an illustrative synthesis route for
the nucleoside building blocks used in the method. FIG. 20 shows a
preferred photoremovable protecting group, MeNPOC, and how to
prepare the group in active form. The procedures described below
show how to prepare these reagents. The nucleoside building blocks
are 5'-MeNPOC-THYMIDINE-3'-OCEP; 5'-MeNPOC-N.sup.4-t-BUTYL
PHENOXYACETYL-DEOXYCYTIDINE-3'-OCEP; 5'-MeNPOC-N.sup.4-t-BUTYL
PHENOXYACETYL-DEOXYGUANOSINE-3'-OCEP; and 5'-MeNPOC-N.sup.4-t-BUTYL
PHENOXYACETYL-DEOXYADENOSINE-3'-OCEP. 1. Preparation of
4,5-methylenedioxy-2-nitroacetophenone ##STR2##
[0227] A solution of 50 g (0.305 mole)
3,4-methylenedioxy-acetophenone (Aldrich) in 200 mL glacial acetic
acid was added dropwise over 30 minutes to 700 mL of cold
(2-4.degree. C.) 70% HNO.sub.3 with stirring (NOTE: the reaction
will overheat without external cooling from an ice bath, which can
be dangerous and lead to side products). At temperatures below
0.degree. C., however, the reaction can be sluggish. A temperature
of 3-5.degree. C. seems to be optimal). The mixture was left
stirring for another 60 minutes at 3-5.degree. C., and then allowed
to approach ambient temperature. Analysis by TLC (25% EtOAc in
hexane) indicated complete conversion of the starting material
within 1-2 hr. When the reaction was complete, the mixture was
poured into .sup..about.3 liters of crushed ice, and the resulting
yellow solid was filtered off, washed with water and then
suction-dried. Yield .sup..about.53 g (84%), used without further
purification. 2. Preparation of 1-(4,5-Methylenedioxy2-nitrophenyl)
ethanol ##STR3##
[0228] Sodium borohydride (10 g; 0.27 mol) was added slowly to a
cold, stirring suspension of 53 g (0.25 mol) of
4,5-methylenedioxy-2-nitroacetophenone in 400 mL methanol. The
temperature was kept below 10.degree. C. by slow addition of the
NaBH.sub.4 and external cooling with an ice bath. Stirring was
continued at ambient temperature for another two hours, at which
time TLC (CH.sub.2Cl.sub.2) indicated complete conversion of the
ketone. The mixture was poured into one liter of ice-water and the
resulting suspension was neutralized with ammonium chloride and
then extracted three times with 400 mL CH.sub.2Cl.sub.2 or EtOAc
(the product can be collected by filtration and washed at this
point, but it is somewhat soluble in water and this results in a
yield of only .sup..about.60%). The combined organic extracts were
washed with brine, then dried with MgSO.sub.4 and evaporated. The
crude product was purified from the main byproduct by dissolving it
in a minimum volume of CH.sub.2Cl.sub.2 or THF(.sup..about.175 ml)
and then precipitating it by slowly adding hexane (1000 ml) while
stirring (yield 51 g; 80% overall). It can also be recrystallized
(e.g., toluene-hexane), but this reduces the yield. 3. Preparation
of 1-(4,5-methylenedioxy-2-nitrophenyl) ethyl chloroformate
(MeNPOC-Cl) ##STR4##
[0229] Phosgene (500 mL of 20% w/v in toluene from Fluka: 965
mmole; 4 eq.) was added slowly to a cold, stirring solution of. 50g
(237 mmole; 1 eq.) of 1-(4,5-methylenedioxy-2-nitrophenyl) ethanol
in 400 mL dry The solution was stirred overnight at ambient
temperature at which point TLC (20% Et.sub.2O/hexane) indicated
>95% conversion. The mixture was evaporated (an oil-less pump
with downstream aqueous NaOH trap is recommended to remove the
excess phosgene) to afford a viscous brown oil. Purification was
effected by flash chromatography on a short (9.times.13 cm) column
of silica gel eluted with 20% Et.sub.2O/hexane. Typically 55 g
(85%) of the solid yellow MeNPOC-Cl is obtained by this procedure.
The crude material has also been recrystallized in 2-3 crops from
1:1 ether/hexane. On this scale, .sup..about.100 ml is used for the
first crop, with a few percent THF added to aid dissolution, and
then cooling overnight at -20.degree. C. (this procedure has not
been optimized). The product should be stored desiccated at
-20.degree. C.
4. Synthesis of 5'-Menpoc-2'-deoxynucleoside-3'- (N,N-diisopropyl
2-cyanoethyl phosphoramidites
[0230] (a) 5'-MeNPOC-Nucleosides ##STR5##
[0231] Base=THYMIDINE (T); N-4-ISOBUTYRYL 2'-DEOXYCYTIDINE
(ibu-dC); N-2-PHENOXYACETYL 2'DEOXYGUANOSINE (PAC-dG); and
N-6-PHENOXYACETYL 2'DEOXYADENOSINE (PAC-dA)
[0232] All four of the 5'-MeNPOC nucleosides were prepared from the
base-protected 2'-deoxynucleosides by the following procedure. The
protected 2'-deoxynucleoside (90 mmole) was dried by co-evaporating
twice with 250 mL anhydrous pyridine. The nucleoside was then
dissolved in 300 mL anhydrous pyridine (or 1:1 pyridine/DMF, for
the dGPAC nucleoside) under argon and cooled to
.sup..about.2.degree. C. in an ice bath. A solution of 24.6 g (90
mmole) MeNPOC-Cl in 100 mL dry THF was then added with stirring
over 30 minutes. The ice bath was removed, and the solution allowed
to stir overnight at room temperature (TLC: 5-10% MeOH in
CH.sub.2Cl.sub.2; two diastereomers). After evaporating the
solvents under vacuum, the crude material was taken up in 250 mL
ethyl acetate and extracted with saturated aqueous NaHCO.sub.3 and
brine. The organic phase was then dried over Na.sub.2SO.sub.4,
filtered and evaporated to obtain a yellow foam. The crude products
were finally purified by flash chromatography (9.times.30 cm silica
gel column eluted with a stepped gradient of 2% - 6% MeOH in
CH.sub.2Cl.sub.2). Yields of the purified diastereomeric mixtures
are in the range of 65-75%. (b)
5'-Menpoc-2'-deoxynucleoside-3'-(N,N- diisopropyl 2-cyanoethyl
phosphoramidites) ##STR6##
[0233] The four deoxynucleosides were phosphitylated using either
2-cyanoethyl- N,N-diisopropyl chlorophosphoramidite, or
2-cyanoethyl- N,N,N',N'-tetraisopropylphosphorodiamidite. The
following is a typical procedure. Add 16.6g (17.4 ml; 55 mmole) of
2-cyanoethyl-N, N,N',N'- tetraisopropylphosphoro-diamidite to a
solution of 50 mmole 5'-MeNPOC-nucleoside and 4.3 g (25 mmole)
diisopropylammonium tetrazolide in 250 mL dry CH.sub.2Cl.sub.2
under argon at ambient temperature. Continue stirring for 4-16
hours (reaction monitored by TLC: 45:45:10
hexane/CH.sub.2Cl.sub.2/Et.sub.3N). Wash the organic phase with
saturated aqueous NaHCO.sub.3 and brine., then dry over
Na.sub.2SO.sub.4, and evaporate to dryness. Purify the crude
amidite by flash chromatography (9.times.25 cm silica gel column
eluted with hexane/CH.sub.2Cl.sub.2/TEA-45:45:10 for A, C, T; or
0:90:10 for G). The yield of purified amidite is about 90% .
B. Preparation of Labeled DNA/Hybridization To Array
[0234] 1. PCR
[0235] PCR amplification reactions are typically conducted in a
mixture composed of, per reaction: 1 .mu.l genomic DNA; 10 .mu.l
each primer (10 pmol/.mu.l stocks); 10 .mu.l 10.times. PCR buffer
(100 mM Tris.Cl pH8.5, 500 mM KCl, 15 mM MgCl.sub.2); 10 .mu.l 2 mM
dNTPs (made from 100 mM dNTP stocks); 2.5 U Taq polymerase (Perkin
Elmer AmpliTaq.TM., 5 U/.mu.l); and H.sub.2O to 100 .mu.l . The
cycling conditions are usually 40 cycles (94.degree. C. 45 sec,
55.degree. C. 30 sec, 72.degree. C. 60 sec) but may need to be
varied considerably from sample type to sample type. These
conditions are for 0.2 mL thin wall tubes in a Perkin Elmer 9600
thermocycler. See Perkin Elmer 1992/93 catalogue for 9600 cycle
time information. Target, primer length and sequence composition,
among other factors, may also affect parameters.
[0236] For products in the 200 to 1000 bp size range, check 2 .mu.l
of the reaction on a 1.5% 0.5.times. TBE a garose gel using an
appropriate size standard (phiX174 cut with HaeIII is convenient).
The PCR reaction should yield several picomoles of product. It is
helpful to include a negative control (i.e., 1 .mu.l TE instead of
genomic DNA) to check for possible contamination. To avoid
contamination, keep PCR products from previous experiments away
from later reactions, using filter tips as appropriate. Using a set
of working solutions and storing master solutions separately is
helpful, so long as one does not contaminate the master stock
solutions.
[0237] For simple amplifications of short fragments from genomic
DNA it is, in general, unnecessary to optimize Mg.sup.2+
concentrations. A good procedure is the following: make a master
mix minus enzyme; dispense the genomic DNA samples to individual
tubes or reaction wells; add enzyme to the master mix; and mix and
dispense the master solution to each well, using a new filter tip
each time..
[0238] 2. Purification
[0239] Removal of unincorporated nucleotides and primers from PCR
samples can be accomplished using the Promega Magic PCR Preps DNA
purification kit. One can purify the whole sample, following the
instructions supplied with the kit (proceed from section IIIB,
Sample preparation for direct purification from PCR reactions`).
After elution of the PCR product in 50 .mu.l of TE or H.sub.2O, one
centrifuges the eluate for 20 sec at 12,000 rpm in a microfuge and
carefully transfers 45 .mu.l to a new microfuge tube, avoiding any
visible pellet. Resin is sometimes carried over during the elution
step. This transfer prevents accidental contamination of the linear
amplification reaction with `Magic PCR` resin. Other methods, e.g.,
size exclusion chromatography, may also be used.
[0240] 3. Linear Amplification
[0241] In a 0.2 mL thin-wall PCR tube mix: 4 .mu.l purified PCR
product; 2 .mu.l primer (10 pmol/.mu.l); 4 .mu.l 10.times. PCR
buffer; 4 .mu.l dNTPs (2 mM dA, dC, dG, 0.1 mM dT); 4 .mu.l 0.1 mM
dUTP; 1 .mu.l 1 mM fluorescein dUTP (Amersham RPN 2121); 1 U Taq
polymerase (Perkin Elmer, 5 U/.mu.l); and add H2O to 40 .mu.l.
Conduct 40 cycles (92.degree. C. 30 sec, 55.degree. C. 30 sec,
72.degree. C. 90 sec) of PCR. These conditions have been used to
amplify a 300 nucleotide mitochondrial DNA fragment but are
applicable to other fragments. Even in the absence of a visible
product band on an agarose gel, there should still be enough
product to give an easily detectable hybridization signal. If one
is not treating the DNA with uracil DNA glycosylase (see Section
4), dUTP can be omitted from the reaction.
[0242] 4. Fragmentation
[0243] Purify the linear amplification product using the Promega
Magic PCR Preps DNA purification kit, as per Section 2 above. In a
0.2 mL thin-wall PCR tube mix: 40 .mu.l purified Labeled DNA; 4
.mu.l 10.times. PCR buffer; and 0.5 .mu.l uracil DNA glycosylase
(BRL 1U/.mu.l). Incubate the mixture 15 min at 37.degree. C., then
10 min at 97.degree. C.; store at -20.degree. C. until ready to
use.
[0244] 5. Hybridization, Scanning & Stripping
[0245] A blank scan of the slide in hybridization buffer only is
helpful to check that the slide is ready for use. The buffer is
removed from the flow cell and replaced with 1 ml of (fragmented)
DNA in hybridization buffer and mixed well optionally, standard
hybridization buffer can be supplemented with tetramethylammonium
chloride (TMACL) or betaine (N,N,N-trimethylglycine;
(CH.sub.3).sub.3 N+CH.sub.2COO.sup.-) to improve discrimination
between perfectly matched targets and single-base mismatches.
Betaine is zwitterionic at neutral pH and alters the
composition-dependent stability of nucleic acids without altering
their polyelectrolyte behavior. Betaine is preferably used at a
concentration between 1 and 10 M and, optimally, at about 5 M. For
example, 5 M betaine in 2.times.SSPE is suitable. Inclusion of
betaine at this concentration lowers the average hybridization
signal about four fold, but increases the discrimination between
matched and mismatched probes.
[0246] The scan is performed in the presence of the labeled target.
FIG. 21 illustrates an illustrative detection system for scanning a
DNA chip. A series of scans at 30 min intervals using a
hybridization temperature of 25.degree. C. yields a very clear
signal, usually in at least 30 min to two hours, but it may be
desirable to hybridize longer, i.e., overnight. Using a laser power
of 50 .mu.W and 50 .mu.m pixels, one should obtain maximum counts
in the range of hundreds to low thousands/pixel for a new slide.
When finished, the slide can be stripped using 50% formamide.
rinsing well in deionized H.sub.2O, blowing dry, and storing at
room temperature.
[0247] C. Preparation of Labeled RNA/Hybridization To Array
[0248] 1. Tagged Primers
[0249] The primers used to amplify the target nucleic acid should
have promoter sequences if one desires to produce RNA from the
amplified nucleic acid. Suitable promoter sequences are shown below
and include: TABLE-US-00027 (1) the T3 promoter sequence:
5'-CGGAATTAACCCTCACTAAAGG 5'-AATTAACCCTCACTAAAGGGAG; (2) the T7
promoter sequence: 5'-TAATACGACTCACTATAGGGAG; and (3) the SP6
promoter sequence: 5' ATTTAGGTGACACTATAGAA.
[0250] The desired promoter sequence is added to the 5' end of the
PCR primer. It is convenient to add a different promoter to each
primer of a PCR primer pair so that either strand may be
transcribed from a single PCR product.
[0251] Synthesize PCR primers so as to leave the DMT group on.
DMT-on purification is unnecessary for PCR but appears to be
important for transcription. Add 25 .mu.l 0.5 M NaOH to collection
vial prior to collection of oligonucleotide to keep the DMT group
on. Deprotect using standard chemistry---55.degree. C. overnight is
convenient.
[0252] HPLC purification is accomplished by drying down the
oligonucleotides, resuspending in 1 mL 0.1 M TEAA (dilute 2.0 M
stock in deionized water, filter through 0.2 micron filter) and
filter through 0.2 micron filter. Load 0.5 mL on reverse phase HPLC
(column can be a Hamilton PRP-1 semi-prep, #79426). The gradient is
0.fwdarw.50% CH.sub.3CN over 25 min (program 0.2 .mu.mol.prep.0-50,
25 min). Pool the desired fractions, dry down, resuspend in 200
.mu.l 80% HAc. 30 min RT. Add 200 .mu.l EtOH; dry down. Resuspend
in 200 .mu.l H.sub.2O, plus 20 .mu.l NaAc pH5.5, 600 .mu.l EtOH.
Leave 10 min on ice; centrifuge 12,000 rpm for 10 min in microfuge.
Pour off supernatant. Rinse pellet with 1 mL EtOH, dry, resuspend
in 200 .mu.l H2O. Dry, resuspend in 200 .mu.l TE. Measure A260,
prepare a 10 pmol/.mu.l solution in TE (10 mM Tris.Cl pH 8.0, 0.1
mM EDTA). Following HPLC purification of a 42 mer, a yield in the
vicinity of 15 nmol from a 0.2 .mu.mol scale synthesis is
typical.
[0253] 2. Genomic DNA Preparation
[0254] Add 500 .mu.l (10 mM Tris.Cl pH8.0, 10 mM EDTA, 100 mM NaCl,
2% (w/v) SDS, 40 mM DTT, filter sterilized) to the sample. Add 1.25
.mu.l 20 mg/ml proteinase K (Boehringer) Incubate at 55.degree. C.
for 2 hours, vortexing once or twice. Perform 2.times.0.5 mL 1:1
phenol:CHCl.sub.3 extractions. After each extraction, centrifuge
12,000 rpm 5 min in a microfuge and recover 0.4 mL supernatant. Add
35 .mu.l NaAc pH5.2 plus 1 mL EtOH. Place sample on ice 45 min;
then centrifuge 12,000 rpm 30 min, rinse, air dry 30 min, and
resuspend in 100 .mu.l TE.
[0255] 3. PCR
[0256] PCR is performed in a mixture containing, per reaction: 1
.mu.l genomic DNA; 4 .mu.l each primer (10 pmol/.mu.l stocks); 4
.mu.l 10.times. PCR buffer (100 mM Tris.Cl pH8.5, 500 mM KCl, 15 mM
MgCl.sub.2); 4 .mu.l 2 mM dNTPs (made from 100 mM dNTP stocks); 1 U
Taq polymerase (Perkin Elmer,. 5 U/.mu.l); H.sub.2O to 40 .mu.l .
About 40 cycles (94.degree. C. 30 sec, 55.degree. C. 30 sec,
72.degree. C 30 sec) are performed, but cycling conditions may need
to be varied. These conditions are for 0.2 mL thin wall tubes in
Perkin Elmer 9600. For products in the 200 to 1000 bp size range,
check 2 .mu.l of the reaction on a 1.5% 0.5.times.TBE agarose gel
using an appropriate size standard. For larger or smaller volumes
(20-100 .mu.l), one can use the same amount of genomic DNA but
adjust the other ingredients accordingly.
[0257] 4. In Vitro Transcription
[0258] Mix: 3 .mu.l PCR product; 4 .mu.l 5.times.buffer; 2 .mu.l
DTT; 2.4 .mu.l 10 mM rNTPs (100 mM solutions from Pharmacia); 0.48
.mu.l 10 mM fluorescein-UTP (Fluorescein-12-UTP, 10 mM solution,
from Boehringer Mannheim); 0.5 .mu.l RNA polymerase (Promega T3 or
T7 RNA polymerase); and add H.sub.2O to 20 .mu.l. Incubate at
37.degree. C. for 3 h. Check 2 .mu.l of the reaction on a 1.5%
0.5.times.TBE agarose gel using a size standard. 5.times.buffer is
200 mM Tris pH. 7.5, 30 MM MgCl.sub.2, 10 mM spermidine, 50 mM
NaCl, and 100 mM DTT (supplied with enzyme). The PCR product needs
no purification and can be added directly to the transcription
mixture. A 20 .mu.l reaction is suggested for an initial test
experiment and hybridization; a 100 .mu.l reaction is considered
"preparative" scale (the reaction can be scaled up to obtain more
target) The amount of PCR product to add is variable; typically a
PCR reaction will yield several picomoles of DNA. If the PCR
reaction does not produce that much target, then one should
increase the amount of DNA added to the transcription reaction (as
well as optimize the PCR). The ratio of fluorescein-UTP to UTP
suggested above is 1:5, but ratios from 1:3 to 1:10--z,999 work
well. One can also label with biotin-UTP and detect with
streptavidin-FITC to obtain similar results as with fluorescein-UTP
detection.
[0259] For nondenaturing agarose gel electrophoresis of RNA, note
that the RNA band will normally migrate somewhat faster than the
DNA template band, although sometimes the two bands will comigrate.
The temperature of the gel can effect the migration of the RNA
band. The RNA produced from in vitro transcription is quite stable
and can be stored for months (at least) at -20.degree. C. without
any evidence of degradation. It can be stored in unsterilized
6.times.SSPE 0.1% triton X-100 at -20.degree. C. for days (at
least) and reused twice (at least) for hybridization, without
taking any special precautions in preparation or during use. RNase
contamination should of course be avoided. When extracting RNA from
cells, it is preferable to work very rapidly and to use strongly
denaturing conditions. Avoid using glassware previously
contaminated with RNases. Use of new disposable plasticware (not
necessarily sterilized) is preferred, as new plastic tubes, tips,
etc., are essentially RNase free. Treatment with DEPC or
autoclaving is typically not necessary.
[0260] 5. Fragmentation
[0261] Heat transcription mixture at 94 degrees for forty min. The
extent of fragmentation is controlled by varying Mg.sup.2+
concentration (30 mM is typical), temperature, and duration of
heating.
[0262] 6. Hybridization, Scanning & Stripping
[0263] A blank scan of the slide in hybridization buffer only is
helpful to check that the slide is ready for use. The buffer is
removed from the flow cell and replaced with 1 mL of (hydrolysed)
RNA in hybridization buffer and mixed well. Incubate for 15-30 min
at 18.degree. C. Remove the hybridization. solution, which can be
saved for subsequent experiments. Rinse the flow cell 4-5 times
with fresh changes of 6.times.SSPE 0.1% Triton X-100, equilibrated
to 18.degree. C. The rinses can be performed rapidly, but it is
important to empty the flow cell before each new rinse and to mix
the liquid in the cell thoroughly. A series of scans at 30 min
intervals using a hybridization temperature of 25.degree. C. yields
a very clear signal, usually in at least 30 min to two hours, but
it may be desirable to hybridize longer, i.e., overnight. Using a
laser power of 50 .mu.W and 50 .mu.m pixels, one should obtain
maximum counts in the range of hundreds to low thousands/pixel for
a new slide. When finished, the slide can be stripped using warm
water.
[0264] These conditions are illustrative and assume a probe length
of .sup..about.15 nucleotides. The stripping conditions suggested
are fairly severe, but some signal may remain on the slide if the
washing is not stringent. Nevertheless, the counts remaining after
the wash should be very low in comparison to the signal in presence
of target RNA. In some cases, much gentler stripping conditions are
effective. The lower the hybridization temperature and the longer
the duration of hybridization, the more difficult it is to strip
the slide. Longer targets may be more difficult to -strip than
shorter targets.
[0265] 7. Amplification of Signal
[0266] A variety of methods can be used to enhance detection of
labelled targets bound to a probe on the array. In one embodiment,
the protein MutS (from E. coli) or equivalent proteins such as
yeast MSH1, MSH2, and MSH3; mouse Rep-3, and Streptococcus Hex-A,
is used in conjunction with target hybridization to detect
probe-target complex that contain mismatched base pairs. The
protein, labeled directly or indirectly, can be added to the chip
during or after hybridization of target nucleic acid, and
differentially binds to homo- and heteroduplex nucleic acid. A wide
variety of dyes and other labels can be used for similar purposes.
For instance, the dye YOYO-1 is known to bind preferentially to
nucleic acids containing sequences comprising runs of 3 or more G
residues.
[0267] 8. Detection Of Repeat Sequences
[0268] In some circumstances, i.e., target nucleic acids with
repeated sequences or with high G/C content, very long probes are
sometimes required for optimal detection. In one embodiment for
detecting specific sequences in a target nucleic acid with a DNA
chip, repeat sequences are detected as follows. The chip comprises
probes of length sufficient to extend into the repeat region
varying distances from each end. The sample, prior to
hybridization, is treated with a labelled oligonucleotide that is
complementary to a repeat region but shorter than the full length
of the repeat. The target nucleic is labelled with a second,
distinct label. After hybridization, the chip is scanned for probes
that have bound both the labelled target and the labelled
oligonucleotide probe; the presence of such bound probes shows that
at least two repeat sequences are present..
[0269] While the foregoing invention has been described in some
detail for purposes of clarity and understanding, it will be clear
to one skilled in the art from a reading of this disclosure that
various changes in form and detail can be made without departing
from the true scope of the invention. All publications and patent
documents cited in this application are incorporated by reference
in their entirety for all purposes to the same extent as if each
individual publication or patent document were so individually
denoted.
Sequence CWU 1
1
156 1 16 DNA Artificial Sequence Description of Artificial Sequence
Reference sequence 1 actgttagct aattgg 16 2 16 DNA Artificial
Sequence Description of Artificial Sequence Probe 2 ggggggagct
aacggg 16 3 26 DNA Artificial Sequence Description of Artificial
Sequence Probe 3 aaagaaaaaa gacagtacta aatgga 26 4 13 DNA
Artificial Sequence Description of Artificial Sequence Probe 4
tactgtattt ttt 13 5 13 DNA Artificial Sequence Description of
Artificial Sequence Probe 5 tactgtcttt ttt 13 6 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 6 tactgtgttt ttt
13 7 13 DNA Artificial Sequence Description of Artificial Sequence
Probe 7 tactgttttt ttt 13 8 13 DNA Artificial Sequence Description
of Artificial Sequence Probe 8 gtactgactt ttt 13 9 13 DNA
Artificial Sequence Description of Artificial Sequence Probe 9
gtactgcctt ttt 13 10 13 DNA Artificial Sequence Description of
Artificial Sequence Probe 10 gtactggctt ttt 13 11 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 11 gtactgtctt ttt
13 12 13 DNA Artificial Sequence Description of Artificial Sequence
Probe 12 agtactatct ttt 13 13 13 DNA Artificial Sequence
Description of Artificial Sequence Probe 13 agtactctct ttt 13 14 13
DNA Artificial Sequence Description of Artificial Sequence Probe 14
agtactgtct ttt 13 15 13 DNA Artificial Sequence Description of
Artificial Sequence Probe 15 agtactttct ttt 13 16 25 DNA Artificial
Sequence Description of Artificial Sequence Probe 16 aaagaaaaaa
gacagtacta atgga 25 17 16 DNA Artificial Sequence Description of
Artificial Sequence Probe 17 ggttaatcga ttgtca 16 18 11 DNA
Artificial Sequence Description of Artificial Sequence Probe 18
gggnccctta a 11 19 16 DNA Artificial Sequence Description of
Artificial Sequence Probe 19 taaagtaaga cataac 16 20 16 DNA
Artificial Sequence Description of Artificial Sequence Probe 20
ggctgacgtc agcaat 16 21 12 DNA Artificial Sequence Description of
Artificial Sequence Reference sequence 21 attcccggga tc 12 22 17
DNA Artificial Sequence Description of Artificial Sequence CYP2D6-B
target sequence 22 cccccrgacg ccccttt 17 23 18 DNA Artificial
Sequence Description of Artificial Sequence Target sequence 23
taaccactca cgggagca 18 24 14 DNA Artificial Sequence Description of
Artificial Sequence Pool 1 probes 24 attggmgagt gccc 14 25 14 DNA
Artificial Sequence Description of Artificial Sequence Pool 1
probes 25 attggagagt gccc 14 26 14 DNA Artificial Sequence
Description of Artificial Sequence Pool 1 probes 26 attggcgagt gccc
14 27 14 DNA Artificial Sequence Description of Artificial Sequence
Pool 2 probe 27 attggkgagt gccc 14 28 14 DNA Artificial Sequence
Description of Artificial Sequence Pool 2 probe 28 attggggagt gccc
14 29 14 DNA Artificial Sequence Description of Artificial Sequence
Pool 2 probe 29 attggtgagt gccc 14 30 14 DNA Artificial Sequence
Description of Artificial Sequence Pool 3 probe 30 attggrgagt gccc
14 31 18 DNA Artificial Sequence Description of Artificial Sequence
Mutant sequence 31 taacccctca cgggagca 18 32 18 DNA Artificial
Sequence Description of Artificial Sequence Mutant sequence 32
taaccgctca cgggagca 18 33 18 DNA Artificial Sequence Description of
Artificial Sequence Mutant sequence 33 taacctctca cgggagca 18 34 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 34 nnnnmmnnnn n 11 35 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 35
nnnnmknnnn n 11 36 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 36 nnnnmrnnnn n 11 37 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 37 nnnnmynnnn n 11 38 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 38
nnnnmwnnnn n 11 39 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 39 nnnnmsnnnn n 11 40 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 40 nnnnkmnnnn n 11 41 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 41
nnnnkknnnn n 11 42 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 42 nnnnkrnnnn n 11 43 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 43 nnnnkynnnn n 11 44 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 44
nnnnkwnnnn n 11 45 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 45 nnnnksnnnn n 11 46 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 46 nnnnrmnnnn n 11 47 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 47
nnnnrknnnn n 11 48 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 48 nnnnrrnnnn n 11 49 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 49 nnnnrynnnn n 11 50 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 50
nnnnrwnnnn n 11 51 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 51 nnnnrsnnnn n 11 52 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 52 nnnnymnnnn n 11 53 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 53
nnnnyknnnn n 11 54 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 54 nnnnyrnnnn n 11 55 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 55 nnnnyynnnn n 11 56 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 56
nnnnywnnnn n 11 57 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 57 nnnnysnnnn n 11 58 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 58 nnnnwmnnnn n 11 59 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 59
nnnnwknnnn n 11 60 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 60 nnnnwrnnnn n 11 61 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 61 nnnnwynnnn n 11 62 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 62
nnnnwwnnnn n 11 63 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 63 nnnnwsnnnn n 11 64 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 64 nnnnsmnnnn n 11 65 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 65
nnnnsknnnn n 11 66 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 66 nnnnsrnnnn n 11 67 11
DNA Artificial Sequence Description of Artificial Sequence Pooled
probe sequence 67 nnnnsynnnn n 11 68 11 DNA Artificial Sequence
Description of Artificial Sequence Pooled probe sequence 68
nnnnswnnnn n 11 69 11 DNA Artificial Sequence Description of
Artificial Sequence Pooled probe sequence 69 nnnnssnnnn n 11 70 22
DNA Artificial Sequence Description of Artificial Sequence Target
sequence 70 attaaccact cacgggagct ct 22 71 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 71 tggtgnkygc cct
13 72 13 DNA Artificial Sequence Description of Artificial Sequence
Probe 72 tggtgagcgc cct 13 73 13 DNA Artificial Sequence
Description of Artificial Sequence Probe 73 tggtgcgcgc cct 13 74 13
DNA Artificial Sequence Description of Artificial Sequence Probe 74
tggtgggcgc cct 13 75 13 DNA Artificial Sequence Description of
Artificial Sequence Probe 75 tggtgtgcgc cct 13 76 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 76 tggtgatcgc cct
13 77 13 DNA Artificial Sequence Description of Artificial Sequence
Probe 77 tggtgctcgc cct 13 78 13 DNA Artificial Sequence
Description of Artificial Sequence Probe 78 tggtggtcgc cct 13 79 13
DNA Artificial Sequence Description of Artificial Sequence Probe 79
tggtgttcgc cct 13 80 13 DNA Artificial Sequence Description of
Artificial Sequence Probe 80 tggtgagtgc cct 13 81 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 81 tggtgcgtgc cct
13 82 13 DNA Artificial Sequence Description of Artificial Sequence
Probe 82 tggtgggtgc cct 13 83 13 DNA Artificial Sequence
Description of Artificial Sequence Probe 83 tggtgtgtgc cct 13 84 13
DNA Artificial Sequence Description of Artificial Sequence Probe 84
tggtgattgc cct 13 85 13 DNA Artificial Sequence Description of
Artificial Sequence Probe 85 tggtgcttgc cct 13 86 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 86 tggtggttgc cct
13 87 13 DNA Artificial Sequence Description of Artificial Sequence
Probe 87 tggtgtttgc cct 13 88 22 DNA Artificial Sequence
Description of Artificial Sequence Mutant sequence 88 attaaccact
cccgggagct ct 22 89 22 DNA Artificial Sequence Description of
Artificial Sequence Mutant sequence 89 attaaccact cgcgggagct ct 22
90 22 DNA Artificial Sequence Description of Artificial Sequence
Mutant sequence 90 attaaccact ctcgggagct ct 22 91 13 DNA Artificial
Sequence Description of Artificial Sequence Pool 4 probe 91
taattnkyga gtg 13 92 13 DNA Artificial Sequence Description of
Artificial Sequence Pool 5 probe 92 aattgnkrag tgc 13 93 13 DNA
Artificial Sequence Description of Artificial Sequence Pool 6 probe
93 attggnkrgt gcc 13 94 13 DNA Artificial Sequence Description of
Artificial Sequence Mutant sequence 94 ttggtnmrtg ccc 13 95 13 DNA
Artificial Sequence Description of Artificial Sequence Pool 8 probe
95 tggtgnkygc cct 13 96 13 DNA Artificial Sequence Description of
Artificial Sequence Pool 9 probe 96 ggtgankrcc ctc 13 97 13 DNA
Artificial Sequence Description of Artificial Sequence Pool 10
probe 97 gtgagnkycc tcg 13 98 13 DNA Artificial Sequence
Description of Artificial Sequence Pool 11 probe 98 tgagtnmyct cga
13 99 13 DNA Artificial Sequence Description of Artificial Sequence
Pool 12 probe 99 gagtgnmytc gag 13 100 13 DNA Artificial Sequence
Description of Artificial Sequence Pool 13 probe 100 agtgcnmycg aga
13 101 13 DNA Artificial Sequence Description of Artificial
Sequence Probe 55 101 attnkygagt gcc 13 102 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 56 102 attgnkragt
gcc 13 103 13 DNA Artificial Sequence Description of Artificial
Sequence Probe 58 103 attrgtnmgt gcc 13 104 13 DNA Artificial
Sequence Description of Artificial Sequence Probe 59 104 attkrtgngt
gcc 13 105 18 DNA Artificial Sequence Description of Artificial
Sequence Mutant sequence 105 taagcactca cgggagca 18 106 18 DNA
Artificial Sequence Description of Artificial Sequence Mutant
sequence 106 taatcactca cgggagca 18 107 18 DNA Artificial Sequence
Description of Artificial Sequence Mutant sequence 107 taaacactca
cgggagca 18 108 18 DNA Artificial Sequence Description of
Artificial Sequence Mutant sequence 108 taacgactca cgggagca 18 109
18 DNA Artificial Sequence Description of Artificial Sequence
Mutant sequence 109 taactactca cgggagca 18 110 18 DNA Artificial
Sequence Description of Artificial Sequence Mutant sequence 110
taacaactca cgggagca 18 111 18 DNA Artificial Sequence Description
of Artificial Sequence Mutant sequence 111 taaccagtca cgggagca 18
112 18 DNA Artificial Sequence Description of Artificial Sequence
Mutant sequence 112 taaccattca cgggagca 18 113 18 DNA Artificial
Sequence Description of Artificial Sequence Mutant sequence 113
taaccaatca cgggagca 18
114 18 DNA Artificial Sequence Description of Artificial Sequence
Mutant sequence 114 taaccacaca cgggagca 18 115 18 DNA Artificial
Sequence Description of Artificial Sequence Mutant sequence 115
taaccaccca cgggagca 18 116 18 DNA Artificial Sequence Description
of Artificial Sequence Mutant sequence 116 taaccacgca cgggagca 18
117 10 DNA Artificial Sequence Description of Artificial Sequence
Target sequence 117 cacgggagca 10 118 14 DNA Artificial Sequence
Description of Artificial Sequence Pool 1 (1) probe 118 attgntnagt
gccc 14 119 14 DNA Artificial Sequence Description of Artificial
Sequence Pool 2(2) probe 119 attggnnagt gccc 14 120 14 DNA
Artificial Sequence Description of Artificial Sequence Pool 3(4)
probe 120 attgyrydgt gccc 14 121 14 DNA Artificial Sequence
Description of Artificial Sequence Pool 4(8) probe 121 attgmwmbgt
gccc 14 122 14 DNA Artificial Sequence Description of Artificial
Sequence Pool 1(1) 122 attgnanagt gccc 14 123 14 DNA Artificial
Sequence Description of Artificial Sequence Pool 3(4) 123
attgryrhgt gccc 14 124 14 DNA Artificial Sequence Description of
Artificial Sequence Pool 4(8) 124 attgkwkvgt gccc 14 125 14 DNA
Artificial Sequence Description of Artificial Sequence Pool 5(c)
target sequence 125 attgdhsmgt gccc 14 126 23 DNA Artificial
Sequence Description of Artificial Sequence Reference sequence 126
tggctacgag gaatcatctg tta 23 127 10 DNA Artificial Sequence
Description of Artificial Sequence Complementary sequence 127
tagcccctcg 10 128 10 DNA Artificial Sequence Description of
Artificial Sequence Probe 128 tagccccacg 10 129 10 DNA Artificial
Sequence Description of Artificial Sequence Probe 129 tagccccccg 10
130 10 DNA Artificial Sequence Description of Artificial Sequence
Probe 130 tagccccgcg 10 131 16 DNA Artificial Sequence Description
of Artificial Sequence Reference sequence 131 agtaccagat ctctaa 16
132 12 DNA Artificial Sequence Description of Artificial Sequence
Probe 132 catggncaga ga 12 133 25 DNA Artificial Sequence
Description of Artificial Sequence CYP2DE1F 133 gccaggtgtg
tccagaggag cccat 25 134 25 DNA Artificial Sequence Description of
Artificial Sequence CYP2DE1R 134 ctggtagggg agcctcagca cctct 25 135
26 DNA Artificial Sequence Description of Artificial Sequence
CYP2DE2F 135 taggactagg acctgtagtc tggggt 26 136 24 DNA Artificial
Sequence Description of Artificial Sequence CYP2DE2R 136 ggtcccacgg
aaatctgtct ctgt 24 137 24 DNA Artificial Sequence Description of
Artificial Sequence CYP2DE34F 137 ctaatgcctt catggccacg cgca 24 138
22 DNA Artificial Sequence Description of Artificial Sequence
CYP2DE34R 138 tcgggagctc gccctgcaga ga 22 139 24 DNA Artificial
Sequence Description of Artificial Sequence CYP2DE5F 139 gggcctgaga
cttgtccagg tgaa 24 140 25 DNA Artificial Sequence Description of
Artificial Sequence CYP2DE5R 140 ccctcattcc tcctgggacg ctcaa 25 141
24 DNA Artificial Sequence Description of Artificial Sequence
CYP2DE6F 141 cccgttctgt cccgagtatg ctct 24 142 24 DNA Artificial
Sequence Description of Artificial Sequence CYP2DE6R 142 tcggcccctg
cactgtttcc caga 24 143 23 DNA Artificial Sequence Description of
Artificial Sequence CYP2DE7F 143 gctgacccat tgtggggacg cat 23 144
26 DNA Artificial Sequence Description of Artificial Sequence
CYP2DE7R 144 ctatcaccag gtgctggtgc tgagct 26 145 25 DNA Artificial
Sequence Description of Artificial Sequence CYP2DE89F 145
gggagacaaa ccaggacctg ccaga 25 146 24 DNA Artificial Sequence
Description of Artificial Sequence CYP2DE89R 146 ctcagcctca
acgtacccct gtct 24 147 27 DNA Artificial Sequence Description of
Artificial Sequence CYP2D678-F 147 tgagagcagc ttcaatgatg agaacct 27
148 25 DNA Artificial Sequence Description of Artificial Sequence
CYP2D678-R 148 gtaggatcat gagcaggagg cccca 25 149 21 DNA Artificial
Sequence Description of Artificial Sequence CYP-PCR8-F 149
tcccccgtgt gtttggtggc a 21 150 21 DNA Artificial Sequence
Description of Artificial Sequence CYP-PCR9-R 150 tgctttattg
tacattagag c 21 151 12 DNA Artificial Sequence Description of
Artificial Sequence Target sequence 151 agcctagctg aa 12 152 12 DNA
Artificial Sequence Description of Artificial Sequence Hybridizable
probe 152 tcggatcgac tt 12 153 22 DNA Artificial Sequence
Description of Artificial Sequence T3 promoter sequence 153
cggaattaac cctcactaaa gg 22 154 22 DNA Artificial Sequence
Description of Artificial Sequence T3 promoter sequence 154
aattaaccct cactaaaggg ag 22 155 22 DNA Artificial Sequence
Description of Artificial Sequence T7 promoter sequence 155
taatacgact cactataggg ag 22 156 20 DNA Artificial Sequence
Description of Artificial Sequence SP6 promoter sequence 156
atttaggtga cactatagaa 20
* * * * *