U.S. patent application number 11/244538 was filed with the patent office on 2006-10-05 for novel receptor.
Invention is credited to Ashley Antony Barnes, Steven Michael Foord, Neil James Fraser, Fiona Hamilton Marshall, Julia Helen Margaret White, Alan Wise.
Application Number | 20060223112 11/244538 |
Document ID | / |
Family ID | 10838424 |
Filed Date | 2006-10-05 |
United States Patent
Application |
20060223112 |
Kind Code |
A1 |
Barnes; Ashley Antony ; et
al. |
October 5, 2006 |
Novel receptor
Abstract
The present invention relates to the novel GABA.sub.B receptor
subtypes GABA.sub.B-R1c and GABA.sub.B-R2 as well as to a novel,
functional GABA.sub.B receptor which comprises a heterodimer of
GABA.sub.B-R1 and GABA.sub.B-R2 receptor subunits. The present
invention also relates to variants of the receptors, nucleotide
sequences encoding the receptors and variants thereof and novel
vectors, stable cell lines, antibodies, screening methods, methods
of treatment and methods of receptor production.
Inventors: |
Barnes; Ashley Antony;
(Herts, GB) ; Wise; Alan; (Bedfordshire, GB)
; Marshall; Fiona Hamilton; (Hertfordshire, GB) ;
Fraser; Neil James; (Herts, GB) ; White; Julia Helen
Margaret; (Herts, GB) ; Foord; Steven Michael;
(Buckinghamshire, GB) |
Correspondence
Address: |
GLAXOSMITHKLINE;CORPORATE INTELLECTUAL PROPERTY, MAI B475
FIVE MOORE DR., PO BOX 13398
RESEARCH TRIANGLE PARK
NC
27709-3398
US
|
Family ID: |
10838424 |
Appl. No.: |
11/244538 |
Filed: |
October 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10300616 |
Nov 20, 2002 |
|
|
|
11244538 |
Oct 6, 2005 |
|
|
|
09390134 |
Sep 3, 1999 |
6518399 |
|
|
10300616 |
Nov 20, 2002 |
|
|
|
60103670 |
Oct 9, 1998 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
435/320.1; 435/369; 435/69.1; 514/17.4; 514/17.8; 514/18.1;
514/18.3; 514/20.6; 530/350; 530/388.22; 536/23.5 |
Current CPC
Class: |
A61K 38/00 20130101;
C07K 16/28 20130101; G01N 33/9426 20130101; C07K 14/70571 20130101;
G01N 2500/00 20130101 |
Class at
Publication: |
435/007.1 ;
435/069.1; 435/320.1; 435/369; 530/350; 530/388.22; 536/023.5;
514/012 |
International
Class: |
G01N 33/53 20060101
G01N033/53; A61K 38/17 20060101 A61K038/17; C07K 14/705 20060101
C07K014/705; C07K 16/28 20060101 C07K016/28; C07H 21/04 20060101
C07H021/04; C12P 21/06 20060101 C12P021/06 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 7, 1998 |
GB |
GB9819420.2 |
Claims
1-37. (canceled)
38. A method for identification of a compound which exhibits GABAb
receptor modulating activity, comprising contacting the GABAb
receptor with a test compound and detecting modulating activity or
inactivity, wherein said GABAb receptor comprises a heterodimer
between a GABAb-R1 receptor protein and a GABAb-R2 receptor protein
wherein the GABAb-R1 comprises the no acid sequence for GABAb-R1a,
GABAb-R1b or GABAb-R1c as set forth in FIG. 2 and wherein the
GABAb-R2 receptor comprises the amino acid sequence set forth in
FIG. 1b.
39-46. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This US patent application claims priority to GB9819420.2
filed on Sep. 7, 1998 in the United Kingdom and to U.S. provisional
application 60/103,670 filed on Oct. 9, 1998 in the United States
Patent Office.
FIELD OF THE INVENTION
[0002] The present invention relates to the novel GABA.sub.B
receptor subtypes GABA.sub.B-R1c and GABA.sub.B-R2 as well as to a
novel, functional GABA.sub.B receptor which comprises a heterodimer
of GABA.sub.B-R1 and GABA.sub.B-R2 receptor subunits. The present
invention also relates to variants of the receptors, nucleotide
sequences encoding the receptors and variants thereof and novel
vectors, stable cell lines, antibodies, screening methods, methods
of treatment and methods of receptor production.
BACKGROUND OF THE INVENTION
[0003] GABA (.gamma.-amino-butyric acid) is the main inhibitory
neurotransmitter in the central nervous system (CNS) activating two
distinct families of receptors; the ionotropic GABA.sub.A and
GABA.sub.C receptors for fast synaptic transmissions, and the
metabotropic GABA.sub.B receptors governing a slower synaptic
transmission. GABA.sub.B receptors are members of the superfamily
of 7-transmembrane G protein-coupled receptors. Activation results
in signal transduction through a variety of pathways mediated
principally via members of the G.sub.i/G.sub.o family of pertussis
toxin-sensitive G proteins. GABA.sub.B receptors have been shown to
inhibit N, P/Q and T-type Ca.sup.2+ channels in a pertussis
toxin-sensitive manner (Kobrinsky et al., 1993; Menon-Johansson et
al., 1993; Harayama et al., 1998) and indeed there is also some
evidence for direct interactions between GABA, receptors and
Ca.sup.2+ channels since Ca.sup.2+ channel ligands can modify the
binding of GABA.sub.B agonists (Ohmori et al., 1990). GABA.sub.B
receptor-mediated Ca.sup.2+ channel inhibition is the principle
mechanism for presynaptic inhibition of neurotransmitter release.
Post-synaptically the major effect of GABA.sub.B receptor
activation is to open potassium channels, to generate post-synaptic
inhibitory potentials.
[0004] Autoradiographic studies show that GABA.sub.B receptors are
abundant and heterogeneously distributed throughout the CNS, with
particularly high levels in the molecular layer of the cerebellum,
interpeduncular nucleus, frontal cortex, olfactory nuclei and
thalamic nuclei. GABA % receptors are also widespread in the globus
pallidus, temporal cortex, raphe magnus and spinal cord (Bowery et
al., 1987). GABA.sub.B receptors are an important therapeutic
target in the CNS for conditions such as spasticity, epilepsy,
Alzheimer's disease, pain, affective disorders and feeding.
GABA.sub.B receptors are also present in the peripheral nervous
system, both on sensory nerves and on parasympathetic nerves. Their
ability to modulate these nerves gives them potential as targets in
disorders of the lung, GI tract and bladder (Kerr and Ong, 1995;
1996; Malcangio and Bowery, 1995).
[0005] Despite the widespread abundance of GABA.sub.B receptors,
considerable evidence from neurochemical, electrophysiological and
behavioural studies suggests that multiple subtypes of GABA,
receptors exist. This heterogeneity of GABA.sub.B receptors may
allow the development of selective ligands, able to target specific
aspects of GABA.sub.B receptor function. This would lead to the
development of drugs with improved selectivity profiles relative to
current compounds (such as baclofen) which are relatively
non-selective and show a variety of undesirable behavioural actions
such as sedation and respiratory depression. Multiple receptor
subtypes are best classified by the differing profiles of agonist
and antagonist ligands.
[0006] To date screening for GABA.sub.B ligands and subsequent
structure/activity determinations has relied on radioligand binding
assays to rat brain membranes. Further analysis of such ligands in
animal models has indicated differences in their behavioural
profile. However, due to the absence of cloned GABA.sub.B receptors
the molecular basis for such differences has not been defined, and
therefore it has not been possible to optimise GABA.sub.B ligands
for therapeutic use.
[0007] GABA.sub.B receptors were first described nearly 20 years
ago (Hill and Bowery, 1981), but despite extensive efforts using
conventional expression cloning strategies, for example in Xenopus
oocytes, or cloning based on sequence homology, the molecular
nature of the GABA.sub.B receptor remained elusive. The development
of a high affinity antagonist for the receptor finally allowed
Kaupmann et al., (1997) to expression clone the receptor from a rat
cerebral cortex cDNA using a radioligand binding assay. Two splice
variants of the receptor were identified, GABA.sub.B-R1a encoding a
960 amino acid protein and GABA.sub.B-R1b, encoding an 844 amino
acid protein, differing only in the lengths of their N-termini.
These two splice variants have distinct spatial distributions
within the brain, but both reside within neuronal rather than glial
cells. Pharmacologically, the two splice variants are similar,
showing binding affinities for a range of antagonists, but about 10
fold lower than those of native receptors, as well as agonist
displacement constants which are about 100-150 fold lower than
those of native receptors. These observations have led to
speculation that the cloned receptor was a low affinity receptor
and an additional high affinity, pharmacologically distinct
GABA.sub.B receptor subtype could exist in the brain.
Alternatively, it was argued that G-protein coupling was
inefficient or the receptor was desensitising in the recombinant
systems used.
[0008] A number of groups working in the area have, however, found
that the cloned receptor fails to behave as a functional GABA.sub.B
receptor either in mammalian cells or in Xenopus oocytes. The
present invention describes the cloning of a novel human GABA.sub.B
receptor subtype, GABA.sub.B-R2, the identification of a novel
splice variant GABA.sub.B-R1c, and the surprising observation that
GABA.sub.B-R1 and GABA.sub.B-R2 strongly interact via their
C-termini to form heterodimers. Co-expression of GABA.sub.B-R1 and
GABA.sub.B-R2 allows trafficking of GABA.sub.B-R1 to the cell
surface and results in a high affinity functional GABA.sub.B
receptor in both mammalian cells and Xenopus oocytes.
[0009] These surpising findings provide a unique opportunity to
define GABA.sub.B subtypes at the molecular level, which in turn
will lead to the identification of novel subtype-specific
drugs.
SUMMARY OF THE INVENTION
[0010] According to one embodiment of the present invention there
is provided an isolated GABA.sub.B-R2 receptor protein or a variant
thereof.
[0011] According to another embodiment of the invention there is
provided an isolated GABA.sub.B-R2 receptor protein having amino
acid sequence provided in FIG. 1B, or a variant thereof.
[0012] According to a further embodiment of the invention there is
provided a nucleotide sequence encoding a GABA.sub.B-R2 receptor or
a variant thereof, or a nucleotide sequence which is complementary
thereto.
[0013] According to a further embodiment of the invention there is
provided a nucleotide sequence encoding a GABA.sub.B-R2 receptor,
as shown in FIG. 1A, or a variant thereof, or a nucleotide sequence
which is complementary thereto.
[0014] According to a further embodiment of the invention there is
provided an expression vector comprising a nucleotide sequence as
referred to above which is capable of expressing a GABA.sub.B-R2
receptor protein or a variant thereof.
[0015] According to a still further embodiment of the invention
there is provided a stable cell line comprising a vector as
referred to above.
[0016] According to another embodiment of the invention there is
provided an antibody specific for a GABA.sub.B-R2 receptor protein
or a variant thereof.
[0017] According to another embodiment of the invention there is
provided an isolated GABA.sub.B-R1c receptor protein or a variant
thereof.
[0018] According to another embodiment of the invention there is
provided an isolated GABA.sub.B-R1c receptor protein having amino
acid sequence provided in FIG. 2, or a variant thereof.
[0019] According to another embodiment of the invention there is
provided a nucleotide sequence encoding a GABA.sub.B-R1c receptor
protein or a variant thereof, or a nucleotide sequence which is
complementary thereto.
[0020] According to another embodiment of the invention there is
provided an expression vector comprising a nucleotide sequence as
referred to above, which is capable of expressing a GABA.sub.B-R1c
receptor protein or a variant thereof.
[0021] According to another embodiment of the invention there is
provided a stable cell line comprising a vector as referred to
above.
[0022] According to a further embodiment of the invention there is
provided an antibody specific for a GABA.sub.B-R1c receptor protein
or a variant thereof.
[0023] According to a further embodiment of the invention there is
provided a GABA.sub.B receptor comprising an heterodimer between a
GABA.sub.B-R1 receptor protein or a variant thereof and a
GABA.sub.B-R2 receptor protein or a variant thereof.
[0024] According to a further embodiment of the invention there is
provided an expression vector comprising a nucleotide sequence
encoding for a GABA.sub.B-R1 receptor or a variant thereof and a
nucleotide sequence encoding for a GABA.sub.B-R2-receptor or
variant thereof, said vector being capable of expressing both
GABA.sub.B-R1 and GABA.sub.B-R2 receptor proteins or variants
thereof.
[0025] According to a further embodiment of the invention there is
provided a stable cell line comprising a vector as referred to
above.
[0026] According to a further embodiment of the invention there is
provided a stable cell line modified to express both GABA.sub.B-R1
and GABA.sub.B-R2 receptor proteins or variants thereof.
[0027] According to a further embodiment of the invention there is
provided a GABA.sub.B receptor produced by a stable cell line as
referred to above.
[0028] According to a further embodiment of the invention there is
provided an antibody specific for a GABA.sub.B receptor as referred
to above.
[0029] According to a further embodiment of the invention there is
provided a method for identification of a compound which exhibits
GABA.sub.B receptor modulating activity, comprising contacting a
GABA.sub.B receptor as referred to above with a test compound and
detecting modulating activity or inactivity.
[0030] According to a further embodiment of the invention there is
provided a compound which modulates GABA.sub.B receptor activity,
identifiable by a method as referred to above.
[0031] According to a further embodiment of the invention there is
provided a method of treatment or prophylaxis of a disorder which
is responsive to modulation of GABA.sub.B receptor activity in a
mammal, which comprises administering to said mammal an effective
amount of a compound identifiable by the method referred to
above.
BRIEF DESCRIPTION OF THE FIGURES
[0032] FIG. 1A (2 Pages) and 1B. Nucleotide and Protein Sequences
of Human GABA.sub.B-R2
[0033] Nucleotide sequence (a) and the translated protein sequence
(b) for Human GABA.sub.B-R2 are shown.
[0034] FIG. 2 (3 Pages). Protein Alignments Between GABA.sub.B-R1a,
GABA.sub.B-R1b, GABA.sub.B-R1c splice variants and
GABA.sub.B-R2.
[0035] Amino-acid sequences of the human GABA.sub.B-R1a,
GABA.sub.B-R1b and GABA.sub.B-R2 receptors aligned for comparison.
Signal sequences and predicted cleavage point (), together with the
N-terminal splice points for GABA.sub.B-R1a and GABA.sub.B-R1b are
shown. GABA.sub.B-R1c sequence is exactly that of GABA.sub.B-R1a,
except for the deletion of 63 amino acids (open box). Amino acids
conserved between GABA.sub.B-R1a and GABA.sub.B-R1b are in bold
type and potential N-glycosylation sites (*) are shown. Lines
beneath the text show positions of the seven predicted TM domains
and regions encoding coiled coil structure are indicated by
shading. The C-terminal region of GABA.sub.B-R1 used as the bait in
the yeast two hybrid analysis is marked as `BAIT.fwdarw.`, and
GABA.sub.B-R2 C-terminal domains recovered from the library screen
against GABA.sub.B-R1 C-terminus are shown as `YTH
HITS.fwdarw.`.
[0036] FIG. 3. Hydrophobicity Profile of GABA.sub.B-R2.
[0037] Hydrophobicity profiles of GABA.sub.B-R2 sequence were
determined using the Kyte-Doolittle algorithm, whereby positive
values indicate hydrophobic regions. The predicted signal sequence
and seven trans-membrane domains are shown.
[0038] FIGS. 4A and 4B. Tissue Distribution Studies for Human
GABA.sub.B-R1 and GABA.sub.B-R2.
[0039] A Human RNA Master Blot (Clontech), containing normalised
polyA.sup.+ mRNA from multiple tissues of adult and fetal origin,
were probed sequentially with a pan specific probe for GABA-R1 (all
splice variants) followed by a GABA.sub.B-R2 specific probe.
Resulting autoradiographic analysis of the blots are shown,
together with a grid identifying tissue type. Specificity controls
include yeast RNA and E. coli DNA.
[0040] FIG. 5. Heterodimerisation and Homodimerisation Between the
C-Terminal Domains of the GABA.sub.B-R1 and GABA.sub.B-R2 Receptors
in the Yeast Two Hybrid System.
[0041] .beta.-galactosidase activity was measured in yeast Y190
cells expressing the GABA.sub.B-R1 or the GABA, --R2 C-termini,
either against empty vector or against each other in all
combinations, using ONPG. Of each pair of proteins expressed in the
two hybrid system, the first always refers to the GAL4.sub.BD
fusion construct whilst the second refers to the GAL4.sub.AD fusion
construct. O-galactosidase activity is determined relative to cell
numbers and is in arbitary units.
[0042] FIG. 6. Co-Immunoprecipitation Studies of the GABA.sub.B
Heterodimer in HEK239 Cells.
[0043] HEK293T cells were transfected with 1 .mu.g each of either
Myc-GABA.sub.B-R1b or HA-GABA.sub.B-R2 alone or in combination.
Cells were harvested 48 h after transfection, lysed and epitope
tagged receptors immunoprecipitated using 12CA5 (HA) or 9E10 (Myc)
antisera as described in Methods. Immune complexes were then
subjected to SDS-PAGE, transferred to nitrocellulose, and captured
Myc-GABA.sub.B-R1b and HA-GABA.sub.B-R2 identified by
immunoblotting with Myc and HA, respectively. Lanes 1 and 4,
immunoprecipitates of cells transfected with Myc-GABA.sub.B-R1b
only; lanes 2 and 5, HA-GABA.sub.B-R2 only; lanes 3 and 6,
immunoprecipitates of cells transfected with Myc-GABA.sub.B-R1b
together with HA-GABA.sub.B-R2. Lanes 1-3, lysates
immunoprecipitated with 9E10 (Myc) and blotted to 12CA5(HA); lanes
4-6, lysates immunoprecipitated with 12CA5(HA) and blotted with
9E10 (Myc)
[0044] FIG. 7. Cell Surface Localisation of GABA.sub.B-R1 Receptor
is Dependent Upon Coexpression with GABA.sub.B-R2.
[0045] Flow cytometry was performed on HEK293T cells transfected
with 1 .mu.g of either Myc-GABA.sub.B-R1b or HA-GABA.sub.B-R2 or
both receptors in combination. (A) Analysis using 9E10 (c-Myc) as
primary antibody to detect Myc-GABA.sub.B-R1b; intact cells. (B)
Analysis using 9E10 (c-Myc) as primary antibody to detect
Myc-GABA.sub.B-R1b; permeabilised cells. (C) Analysis using 12CA5
(HA) as primary antibody to detect HA-GABA.sub.B-R2; intact cells.
Mock transfected cells, reflecting background fluorescence, are
shaded and the marker indicates fluorescence measured over
background levels. Myc-GABA.sub.B-R1b data is shown as a grey line
whereas co-expression of Myc-GABA.sub.B-R1b with HA-GABA.sub.B-R2
is shown in black. 30,000 cells were analysed in each sample.
Histograms shown are from a single experiment. Quoted statistics
are from mean of three separate transfections and analysis.
[0046] FIG. 8. Coexpression of GABA.sub.B-R1a and 1b splice
Variants with GABA.sub.B-R2 Receptors in HEK293T Cells Results in
Terminal Glycosylation of Both GABA.sub.B-R1a and
GABA.sub.B-R1b.
[0047] P2 membrane fractions were derived from HEK293T cells that
were transfected with 1 .mu.g of either GABA.sub.B-R1a (lanes 1-3),
GABA %-R1b (lanes 4-6) or HA-GABA.sub.B-R2 (lanes 13-15), or with 1
.mu.g each of HA-GABA.sub.B-R2 in combination with 1 .mu.g of
either GABA-R1a (lanes 7-9, 16-18) or GABA.sub.B-R1b (lanes 10-12,
19-21). Glycosylation status of transfected receptors was assessed
following treatment of P2 fractions (50 .mu.g of membrane protein)
with either vehicle (lanes 1, 4, 7, 10, 13, 16 and 19),
endoglycosidase F (lanes 2, 5, 8, 11, 14, 17 and 20) or
endoglycosidase H (lanes 3, 6, 9, 12, 15, 18 and 21). Samples were
resolved by SDS-PAGE (10% (w/v) acrylamide), transferred to
nitrocellulose, and immunoblotted. Upper panel, antiserum 501 was
used as primary reagent to allow identification of both
GABA.sub.B-R1a and 1b. Lower panel, 12CA5 anti-HA antiserum was
employed to identify HA-GABA-R2. *, denotes terminally glycosylated
forms of GABA.sub.B-R1a and 1b.
[0048] FIGS. 9A and 9B. Coexpression of GABA.sub.B-R1 and
GABA.sub.B-R2 Receptors in HEK293T Cells Leads to GABA-Mediated
Stimulation of [.sup.35S]GTP.gamma.S Binding Activity.
[0049] [.sup.35S]GTP.gamma.S binding activity was measured on P2
particulate fractions derived from HEK293T cells transfected with 1
.mu.g of G.sub.o1.alpha. together with 1 .mu.g of either
GABA.sub.B-R1a, GABA.sub.B-R1b or HA-GABA.sub.B-R2; or with 1 .mu.g
each of G.sub.o1.alpha. and HA-GABA.sub.B-R2 in combination with 1
.mu.g of either GABA.sub.B-R1a or GABA.sub.B-R1b. (A)
[.sup.35S]GTP.gamma.S binding was measured in the absence (open
bars) or presence (hatched bars) of GABA (10 mM) as described in
Methods. (B) The ability of varying concentrations of GABA to
stimulate the binding of [.sup.35S]GTP.gamma.S was measured on P2
membrane fractions from HEK293T cells expressing either
G.sub.o1.alpha. and HA-GABA.sub.B-R2 alone (open circles) or in
combination with either GABA.sub.B-R1a (closed squares) or
GABA.sub.B-R1b (closed triangles). The data shown are the
means.+-.S.D. of triplicate measurements and are representative of
three independent experiments.
[0050] FIG. 10. GABA-Mediated Stimulation of [.sup.35S]GTP.gamma.S
Binding Activity in HEK293T Cells Coexpressing GABA.sub.B-R1 and
GABA.sub.B-R2 Receptors Requires Cotransfection with Additional
G.sub.iG Protein, G.sub.o1.alpha..
[0051] [.sup.35S]GTP.gamma.S binding activity was measured on P2
particulate fractions derived from HEK293T cells transfected with
HA-GABA.sub.B-R1b (1 .mu.g) together with HA-GABA.sub.B-R2 (1
.mu.g) and G.sub.o1.alpha. (1 .mu.g) (closed triangles), or in
combination with either HA-GABA.sub.B-R2 (1 .mu.g) (open circles)
or G.sub.o1.alpha. (1 .mu.g) (closed circles). The ability of
varying concentrations of GABA to stimulate the binding of
[.sup.35S]GTP.gamma.S was determined. Data shown are the
mean.+-.S.D. of triplicate measurements.
[0052] FIGS. 11A and 11B. Coexpression of GABA.sub.B-R1 and
GABA.sub.B-R2 Receptors in HEK293T Cells Permits GABA-MEDIATED
Inhibition of Forskolin-Stimulated Adenylate Cyclase Activity
[0053] cAMP levels were measured in HEK293T cells transfected with
1 .mu.g of G.sub.i1.alpha. together with 1 .mu.g of either
GABA.sub.B-R1a, GABA.sub.B-R1b or HA-GABA.sub.B-R2; or with 1 .mu.g
each of G.sub.i1.alpha. and HA-GABA.sub.B-R2 in combination with 1
.mu.g of either GABA.sub.B-R1a or GABA.sub.B-R1b, as described in
Methods. (A) cAMP levels were determined in cells treated with
forskolin (50 .mu.M) in the absence (open bars) or presence
(hatched bars) of GABA (1 mM). (B) ability of varying
concentrations of GABA to inhibit forskolin-elevated adenylate
cyclase activity in HEK293T cells expressing G.sub.i1.alpha. and
HA-GABA.sub.B-R2 in combination with GABA.sub.B-R1b. The data shown
are the means.+-.S.D. of triplicate measurements.
[0054] FIGS. 12A and 12B. Co-Expression of GABA.sub.B-R1 and
GABA-R2 Receptors in Xenopus oocytes Permits Agonist-Dependant
Activation of Ion Flux through CFTR and GIRK1/4.
[0055] Xenopus oocytes were injected with cRNA encoding
GABA.sub.B-R1 and GABA.sub.B-R2 receptors (in equal amounts for
CFTR, 1:2 ratio for GIRK) plus either CFTR (A) or the GIRK1/GIRK4
heteromer (B). A, Time course plot for an oocyte expressing
GABA.sub.B-R1, GABA.sub.B-R2 and CFTR. Application of 100 mM GABA,
100 mM SKF97541 or 1 mM Baclofen (arrows) activated a large inward
CFTR current. Note the increase in CFTR response seen with repeated
GABA application. B, Time course plot for an oocyte expressing
GABA.sub.B-R1, GABA.sub.B-R2, GIRK1 and GIRK4. Switching from ND96
(low potassium) to 90K (high potassium) solution led to an inward
shift in holding current, showing that the GIRK1/GIRK4 channel is
expressed in this oocyte. Subsequent application of 100 mM GABA
activated a large inward current (middle panel). Negative and
positive control experiments are shown from oocytes expressing the
GABA.sub.B-R2 receptor alone (left panel) and those expressing the
adenosine A1 receptor (right panel).
[0056] FIG. 13. Current-Voltage Curves in an Oocyte Expressing
GABA.sub.B-R1, GABA.sub.B-R2 and the Potassium Channels GIRK1 and
GIRK4.
[0057] Current-voltage curves are shown for a single oocyte
following application of 200 ms voltage-clamp pulses from a holding
potential of -60 mV to test potentials between -100 mV and +50 mV.
Steady-state current is plotted against test potential in ND96
solution (low potassium), 90K solution (90 mM potassium) and 90K
plus 100 mM GABA. Note the basal GIRK1/4 current recorded in 90K
solution and the large agonist-evoked activation of the GIRK
potassium channel.
[0058] FIG. 14. GABA-Mediated Stimulation of [.sup.35S]GTP.gamma.S
Binding Activity is Dependent on the Relative Levels of Expression
of GABA.sub.B-R1 and GABA.sub.B-R2 Receptors
[0059] HEK293T cells were transfected with HA-GABA.sub.B-R2 (1
.mu.g) and G.sub.o1.alpha. (1 .mu.g) together with various amounts
(0-1 .mu.g) of HA-GABA.sub.B-R1b. Cells were harvested 48 h after
transfection and P2 membrane fractions were prepared. (A) Agonist
stimulation of [.sup.35S]GTP.gamma.S binding activity measured in
transfected cell membranes in the presence of GABA (10 mM). Data
are shown as stimulation above basal (cpm) and are the mean.+-.S.D.
of triplicate measurements. (B) Cell membranes were immunoblotted
with anti-HA antiserum to allow the relative levels of
HA-GABA.sub.B-R2 and HA-GABA.sub.B-R1b receptors to be
evaluated.
[0060] FIG. 15. Co-Expression of GABA.sub.B-R1 and GABA.sub.B-R2
Receptors in HEK293T Cells Generates a High Affinity GABA.sub.B
Binding Site Similar to Brain GABA.sub.B Receptors.
[0061] P2 membrane fractions were prepared from HEK 293T cells
transfected using the same conditions described for GTP.gamma.S
binding studies. % specific binding was determined for the
displacement of [3H]-CGP54626 by GABA. Data shown are the mean of
minimum of triplicate studies.+-.sem.
DETAILED DESCRIPTION OF THE INVENTION
[0062] Throughout the present specification and the accompanying
claims the words "comprise" and "include" and variations such as
"comprises", "comprising", "includes" and "including" are to be
interpreted inclusively. That is, these words are intended to
convey the possible inclusion of other elements or integers not
specifically recited, where the context allows.
[0063] As previously explained, the present invention includes a
number of important aspects. In particular the present invention
relates to isolated GABA.sub.B-R2 receptor proteins and variants
thereof, isolated GABA.sub.B-R1c receptor proteins and variants
thereof, GABA.sub.B receptors comprising an heterodimer between a
GABA.sub.B-R1 receptor protein or a variant thereof and a
GABA.sub.B-R2 receptor protein or a variant thereof, as well as
other related aspects. In the context of the present invention the
wording "isolated" is intended to convey that the receptor protein
is not in its native state, insofar as it has been purified at
least to some extent or has been synthetically produced, for
example by recombinant methods. The term "isolated" therefore
includes the possibility of the receptor protein being in
combination with other biological or non-biological material, such
as cells, suspensions of cells or cell fragments, proteins,
peptides, organic or inorganic solvents, or other materials where
appropriate, but excludes the situation where the receptor protein
is in a state as found in nature.
[0064] Routine methods, as further explained in the subsequent
experimental section, can be employed to purify and/or synthesise
the receptor proteins according to the invention. Such methods are
well understood by persons skilled in the art, and include
techniques such as those disclosed in Sambrook, J. et al, 1989, the
disclosure of which is included herein in its entirety by way of
reference.
[0065] The present invention not only includes the GABA.sub.B
receptor proteins specifically recited, but also variants thereof.
By the term "variant" what is meant throughout the specification
and claims is that other peptides or proteins which retain the same
essential character of the receptor proteins for which sequence
information is provided, are also intended to be included within
the scope of the invention. For example, other peptides or proteins
with greater than about 80%, preferably at least 90% and
particularly preferably at least 95% homology with the sequences
provided are considered as variants of the receptor proteins. Such
variants may include the deletion, modification or addition of
single amino acids or groups of amino acids within the protein
sequence, as long as the biological functionality of the peptide is
not adversely affected.
[0066] The invention also includes nucleotide sequences which
encode for GABA.sub.B-R2 or GABA.sub.B-R1c receptors or variants
thereof as well as nucleotide sequences which are complementary
thereto. Preferably the nucleotide sequence is a DNA sequence and
most preferably, a cDNA sequence.
[0067] The present invention also includes expression vectors which
comprise nucleotide sequences encoding for the GABA.sub.B-R2 or
GABA.sub.B-R1 c receptor subtypes or variants thereof. A further
aspect of the invention relates to an expression vector comprising
nucleotide sequences encoding for a GABA.sub.B-R1 receptor protein
and a GABA.sub.B-R2 receptor protein or variants thereof. Such
expression vectors are routinely constructed in the art of
molecular biology and may involve the use of plasmid DNA and
appropriate initiators, promoters, enhancers and other elements,
which may be necessary, and which are positioned in the correct
orientation, in order to allow for protein expression.
[0068] The invention also includes cell lines which have been
modified to express the novel receptor. Such cell lines include
transient, or preferably stable higher eukaryotic cell lines, such
as mammalian cells or insect cells, lower eukaryotic cells, such as
yeast or prokaryotic cells such as bacterial cells. Particular
examples of cells which have been modified by insertion of vectors
encoding for the receptor proteins according to the invention
include HEK293T cells and oocytes. Preferably the cell line
selected will be one which is not only stable, but also allows for
mature glycosylation and cell surface expression of the inventive
receptors. In the case of the functional GABA, receptor which
comprises a heterodimer of GABA.sub.B-R1 and GABA.sub.B-R2
subunits, the cell line may include a single vector which allows
for expression of both of the receptor subtypes, or alternatively
separate vectors for each subunit. It is preferred however, that
the receptor subtypes should be co-expressed in order to optimise
the dimerisation process, which will result in full glycosylation
and transport of the glycosylated dimer to the cell surface.
[0069] It is also possible for the receptors of the invention to be
transiently expressed in a cell line or on a membrane, such as for
example in a baculovirus expression system. Such systems, which are
adapted to express the receptors according to the invention, are
also included within the scope of the present invention.
[0070] A particularly preferred aspect of the invention is the
heterodimer formed between the GABA.sub.B-R1 and GABA.sub.B-R2
receptor proteins which results in the formation of a functional
GABA.sub.B receptor. Without wishing to be bound by theory, it
appears that the formation of the heterodimer takes place via the
coiled-coil domains within the receptor C-terminal tails, and that
this in turn is a pre-requisite for transport and full
glycosylation of a GABA.sub.B-R1, and also for generation of an
high affinity GABA.sub.B receptor at the cell surface.
[0071] The heterodimer which forms a functional GABA.sub.B receptor
can comprise any GABA.sub.B-R1 receptor subtype or splice variant,
or variants thereof. Although we are presently only aware of only
one GABA.sub.B-R2 subtype, it is envisaged that the heterodimers
according to the present invention can include other GABA.sub.B-R2
subtypes or splice variants which have not yet been identified, as
well as variants of the already identified GABA.sub.B-R2 receptor
proteins.
[0072] In particular, the functional GABA, receptor may include
GABA.sub.B-R1 receptor proteins selected from GABA.sub.B-R1a,
GABA.sub.B-R1b, GABA.sub.B-R1c splice variants, variants thereof or
even other GABA.sub.B-R1 receptor subtypes or splice variants which
have not yet been identified.
[0073] According to another aspect, the present invention also
relates to antibodies which have been raised by standard techniques
and are specific for the receptor proteins or variants thereof
according to the invention. Such antibodies could for example, be
useful in purification, isolation or screening involving immuno
precipitation techniques and may be used as tools to further
ellucidate GABA.sub.B receptor function, or indeed as therapeutic
agents in their own right. Antibodies may also be raised against
specific epitopes of the receptors according to the invention, as
opposed to the monomer subunits.
[0074] An important aspect of the present invention is the use of
receptor proteins according to the invention, particularly the
heterodimer GABA.sub.B receptor, in screening methods designed to
identify compounds which act as receptor ligands and which may be
useful to modulate receptor activity. In general terms, such
screening methods will involve contacting the receptor protein
concerned, preferably the heterodimeric GABA.sub.B receptor, with a
test compound and then detecting modulation in the receptor
activity, or indeed detecting receptor inactivity, which results.
The present invention also includes within its scope those
compounds which are identified as possessing useful GABA.sub.B
receptor modulation activity, by the screening methods referred to
above. The screening methods comprehended by the invention are
generally well known to persons skilled in the art, and are further
discussed in the experimental section which follows.
[0075] Another aspect of the present invention is the use of
compounds which have been identified by screening techniques
referred to above in the treatment or prophylaxis of disorders
which are responsive to modulation of a GABA.sub.B receptor
activity, in a mammal. By the term "modulation" what is meant is
that there will be either agonism or antagonism at the receptor
site which results from ligand binding of the compound at the
receptor. GABA.sub.B receptors have been implicated in disorders of
the central nervous system (CNS), gastrointestinal (GI) tract,
lungs and bladder and therefore modulation of GABA.sub.B receptor
activity in these tissues will result in a positive therapeutic
outcome in relation to such disorders. In particular, the compounds
which will be identified using the screening techniques according
to the invention will have utility for treatment and/or prophylaxis
of disorders such as spasticity, epilepsy, Alzheimer's disease,
pain as well as affective disorders and feeding disorders. It is to
be understood however, that the mention of such disorders is by way
of example only, and is not intended to be limiting on the scope of
the invention.
[0076] The compounds which are identified according to the
screening methods outlined above may be formulated with standard
pharmaceutically acceptable carriers and/or excipients as is
routine in the pharmaceutical art, and as fully described in
Remmington's Pharmaceutical Sciences, Mack Publishing Company,
Eastern Pennsylvania, 17th Ed, 1985, the disclosure of which is
included herein in its entirety by way of reference.
[0077] The compounds may be administered via enteral or parenteral
routes such as via oral, buccal, anal, pulmonary, intravenous,
intraarterial, intramuscular, intraperitoneal, topical or other
appropriate administration routes.
[0078] Other aspects of the present invention will be further
explained, by way of example, in the appended experimental
section.
EXPERIMENTAL
Results
1. Cloning of Human GABA.sub.B-R1 and a Novel Receptor Subtype,
GABA.sub.B-R2
[0079] Human homologues to the rat GABA.sub.B-R1a and 1b splice
variants were identified from ESTs and subcloned from Human
cerebellum cDNA, using a combination of PCR and Rapid amplification
of cDNA ends (RACE) PCR. Human GABA.sub.B-R1a and 1b sequences
reveal over 99% identity to the rat GABA.sub.B-R1a and
GABA.sub.B-R1b (data not shown). These receptors, like their rat
counterparts, both have signal sequences, followed by extended
N-termini, a typical seven-transmembrane topology and short
intracellular C-terminal tail. The N-terminus encodes the GABA
binding domain, which is predicted by limited homology to bacterial
periplasmic proteins to exist as two globular domains that capture
GABA (Bettler et al, 1998), as well as three potential
N-glycosylation sites. Interestingly the GABA.sub.B-R1a splice
variant N-terminus encodes 129 amino acids over that of
GABA.sub.B-R1b, which encode two tandem copies of the `short
consensus repeat` or sushi domain. Sushi domains are approximately
60 amino acids in length and exist in a wide range of proteins
involved in complement and cell-cell adhesion (Chou and Heinrikson,
1997). Therefore the sushi domains within GABA.sub.B-R1a may direct
protein-protein interactions, possibly through cell-cell contact
and may reflect a further role for GABA.sub.B-R1a, over and above
that of GABA.sub.B-R1b. Interestingly during the isolation of these
clones, a novel N-terminal splice variant, GABA.sub.B-R1c was
identified. GABA.sub.B-R1c differs from GABA.sub.B-R1a by a 185 bp
deletion from bases 290 to 475 (see FIG. 2). This region encodes
one of the two Sushi domains unique to GABA.sub.B-R1a and therefore
the GABA.sub.B-R1a and GABA.sub.B-R1c splice variants, together
with their cellular localisation, may be significant in the biology
of GABA.sub.B receptors. Indeed, in situ hybridisations suggest
that GABA.sub.B-R1a and GABA.sub.B-R1b have different sub-cellular
localisations, with GABA.sub.B-R1a expressed at pre-synaptic rather
than at post-synaptic sites (Bettler et al., 1998).
[0080] Database searches also identified a number of ESTs showing
weaker homology to GABA.sub.B-R1, suggesting the existence of a
novel GABA.sub.B receptor subtype. Using PCR on Human Brain
cerebellum cDNA, we confirmed the existence of such a novel
GABA.sub.B receptor which we cloned and sequenced (FIG. 1). This
novel receptor, which we have called GABA.sub.B-R2, shows an
overall 54% similarity and 35% identity to GABA.sub.B-R1 over the
full length of the protein (FIG. 2). As expected, hydrophobicity
profiles for GABA.sub.B-R2 (FIG. 3) suggested that the protein has
a 42 amino acid signal peptide followed by an extracellular
N-terminal domain comparable in size to that of GABA.sub.B-R1b and
seven membrane spanning regions. In total five N-glycosylation
sites were predicted over the N-terminal domain, three of which are
conserved within GABA.sub.B-R1. Finally, the receptor encodes an
intracellular C-terminal domain, which is considerably larger than
that of GABA.sub.B-R1. No sushi domains were identified within
GABA.sub.B-R2 sequence and we have no evidence for any splice
variants to date.
2. Tissue Distribution
[0081] Expression levels of both GABA.sub.B-R1 and GABA.sub.B-R2
were determined and compared in different tissues and developmental
stages by probing Human RNA Master Blots (Clontech). These blots
contain polyA.sup.+ RNA samples from 50 human tissues that have
been normalized to the mRNA expression levels of eight different
"housekeeping" genes. GABA.sub.B-R1 levels were examined using a
pan-specific probe covering all splice variants (FIG. 4a) and the
blots indicate that in accordance with the observations of Kaupmann
et al., (1997), GABA.sub.B-R1 is highly expressed in the CNS, in
all areas of the brain and spinal cord. However, in contrast to
Kaupmann et al., (1997), we find that GABA.sub.B-R1 is also
expressed at comparable levels in peripheral tissues, with
particularly high levels of expression in the pituitary, lung,
ovary, kidney, small intestine, and spleen. In marked contrast,
GABA.sub.B-R2 is specifically expressed at high levels only in the
CNS, with the possible exception of spinal cord where expression
appears somewhat lower. No signal is seen for peripheral tissues,
in either adult or fetal tissues (FIG. 4b). This markedly different
distribution of mRNA levels between GABA.sub.B-R1 and GABA.sub.B-R2
suggests that the two subtypes may have distinct roles in the CNS
and periphery.
3. Initial Expression Studies
[0082] We reasoned that GABA.sub.B-R2 could be a high affinity
GABA.sub.B receptor and therefore, expressed the receptor in both
Xenopus oocytes and HEK293T cells and looked for functional
responses. However, despite repeated attempts, we were unable to
detect any functional activation of GABA.sub.B-R2 or indeed,
GABA.sub.B-R1a, GABA.sub.B-R1b or GABA.sub.B-R1c receptors by
either GABA itself or GABA.sub.B selective agonists (See FIGS. 9,
11 and 12). Several lines of evidence clearly indicated that
GABA.sub.B-R1 was not expressed as predicted in vivo. Firstly, flow
cytometry of HEK293T cells, expressing GABA.sub.B-R1b, revealed
that receptors were retained on internal membranes rather than
expressed at the cell surface (FIG. 7). Secondly, GABA.sub.B-R1a
and GABA.sub.B-R1b were expressed as immature glycoproteins, by
virtue of their sensitivity to endoglycosidases F and H (FIG. 8,
lanes 1-6) and finally, GABA.sub.B-R1 co-expression in oocytes with
either GIRK or CFTR, gave no indication of a functional response
(data not shown). We concluded that some additional co-factor must
be required to promote a functional response.
4. Yeast Two Hybrid Library Screening
[0083] The calcitonin-receptor like receptor is retained as an
immature glycoprotein within the endoplasmic reticulum and requires
an accessory protein from the recently identified RAMP protein
family to transport the receptor to the surface to generate a
functional CGRP (Calcitonin gene-related peptide) or adrenomedullin
receptor (McLatchie et al., 1998). We anticipated that
GABA.sub.B-R1 receptors should require an analogous trafficking
factor or some other protein co-factor for its transport to the
cell surface to generate a high affinity receptor To identify such
potential interacting proteins, a yeast two hybrid library screen
was run using the C-terminal 108 amino acids of GABA.sub.B-R1
against a Human Brain cDNA library. Interestingly, motif searches
revealed a strong coiled-coil domain within these 108 residues, a
structure known to mediate protein-protein interactions (Lupas,
1996). From a total of 4.3.times.10.sup.6 cDNAs, 122 positives hits
were recovered, 33 of which encoded the whole C-terminal domain of
GABA.sub.B-R2. This domain of the GABA.sub.B-R2 is likewise
predicted to contain a coiled-coil motif, which aligns exactly with
that of GABA.sub.B-R1 (see FIG. 2). This observation strongly
suggests that the two receptors interact via their C-termini to
form a heterodimer. Significantly, the screen did not retrieve the
C-terminal domain of the GABA.sub.B-R1 itself, implying that
GABA.sub.B-R1 is unable to homodimerise. This interaction was
tested directly in the yeast two hybrid system using the C-termini
of the two receptors (FIG. 5). GABA.sub.B-R1 and GABA.sub.B-R2 were
able to strongly interact via their C-termini, whilst neither
receptor was able to homodimerise. This observation suggested that
GABA.sub.B-R1 and GABA.sub.B-R2 form heterodimers via their
C-terminal coiled-coil domains and led to speculation that
homodimerisation may bring about a functional binding site in vivo.
Therefore, we next confirmed the interaction between the two
receptor subtypes by immunoprecipitation studies upon whole
epitope-tagged receptor in transfected HEK293T cells.
5. Co-Immunoprecipitation Studies.
[0084] Epitope tagged receptors, Myc-GABA.sub.B-R1b and
HA-GABA.sub.B-R2 were transiently expressed in HEK293T cells either
alone or in combination. Immunoprecipitation of Myc-GABA.sub.B-R1b
from detergent-solubilised cell fractions with Myc antisera led to
immunodetection of HA-GABA.sub.B-R2 within immune complexes using
HA as the primary antibody, but only upon receptor co-expression
(FIG. 6, lanes 1-3). GABA.sub.B-R1 and GABA.sub.B-R2 association
was confirmed by co-immunodetection of Myc-GABA.sub.B-R1b from
immune complexes captured using the anti-HA antibody. Once again,
co-immunoprecipitation could only be seen when the two receptor
forms were co-expressed (FIG. 6, lanes 4-6). Hence in agreement
with the yeast two hybrid observations, these data provide
compelling evidence for heterodimerisation between full-length
expressed GABA.sub.B-R1 and GABA.sub.B-R2 in mammalian cells.
Therefore, we next examined GABA.sub.B receptor responses following
co-expression of both receptor subtypes in HEK293T cells or in
Xenopus oocytes.
6. Surface Expression of the Heterodimer
[0085] HEK293T cells were transiently transfected with
Myc-GABA.sub.B-R1b alone or in combination with HA-GABA.sub.B-R2
and transfectants analysed by flow cytometry (FIG. 7).
Myc-immunoreactivity could not be detected on the surface of cells
transfected with Myc-GABA.sub.B-R1b alone (FIG. 7a), although cell
permeabilisation revealed immunoreactivity in 35% (n=3) of the cell
population (FIG. 7b). This latter observation indicated that cells
were efficiently transfected and suggested that expressed
Myc-GABA.sub.B-R1 receptors were localised exclusively on internal
membranes. In contrast, 14% (n=3) of HEK293T cells transfected with
HA-GABA.sub.B-R2 showed surface immunoreactivity (FIG. 7c).
However, co-transfection of both Myc-GABA.sub.B-R1b and
HA-GABA.sub.B-R2 led to the appearance of Myc-GABA.sub.B-R1b on the
surface of 20% (n=3) of cells analysed (FIG. 7a), strongly
suggesting that co-expression of GABA.sub.B-R1b with GABA.sub.B-R2
is necessary for surface expression of GABA.sub.B-R1b.
7. Receptor Glycosylation Studies
[0086] Endoglycosidases F and H can be used to differentiate
between core and terminally glycosylated N-linked glycoproteins.
Therefore, these enzymes were used to examine the glycosylation
status of both GABA.sub.B-R1 and GABA.sub.B-R2 following expression
in HEK293T cells. Membranes from transfected cells were treated
with either endoglycosidase F or endoglycosidase H and expressed
GABA.sub.B receptors were characterised by immunoblotting to
compare relative electrophoretic mobilities of the receptors (FIG.
8) Cell membranes expressing either GABA.sub.B-R1a or 1b produced
distinct bands of M.sub.r 130 and 100K respectively (FIG. 8, lanes
1 and 4) which following endoglycosidase F treatment, decreased in
size to single immunoreactive species of M, 110 and 80K;
representing GABA.sub.B-R1a and GABA.sub.B-R1b respectively (FIG.
8, lanes 2 and 5) This shows that recombinant GABA.sub.B-R1a and 1b
are glycoproteins, in agreement with the observations of Kaupmann
et al., (1997). However, both GABA.sub.B-R1 a and 1b splice variant
forms were also sensitive to endoglycosidase H treatment,
indicating that the expressed proteins are only core glycosylated
(lanes 3 and 6) and lack terminal glycosylation. This observation,
together with the FACS analysis, suggests that the proteins are
immaturely glycosylated and retained on internal membranes.
Significantly, when either GABA.sub.B-R1a (lanes 7-9) or
GABA.sub.B-R1b (lanes 10-12) was co-expressed with
HA-GABA.sub.B-R2, a component of GABA.sub.B-R1a or 1b was resistant
to endoglycosidase H digestion suggesting that when co-expressed
with GABA.sub.B-R2, a significant fraction of GABA.sub.B-R1 is now
a mature glycoprotein (lanes 9 and 12).
[0087] Similar studies with HA-GABA.sub.B-R2 gave an immunoreactive
species with an M, of 120 K (FIG. 8, lanes 13, 16, 19) which was
sensitive to endoglycosidase F (lanes 14, 17 and 20) but resistant
to endoglycosidase H (lanes 15, 18 and 21) treatment, whether
expressed alone or in combination with GABA.sub.B-R1. Thus, these
data indicate that expressed HA-GABA.sub.B-R2 is a mature
glycoprotein whose glycosylation status is not affected by
co-expression with GABA.sub.B-R1. Thus, heterodimerisation between
GABA.sub.B-R1 and GABA.sub.B-R2, possibly in the Golgi complex,
could be a prerequisite for maturation and transport of
GABA.sub.B-R1 to the plasma membrane.
8. Functional Studies
[0088] To determine whether co-expression of GABA.sub.B-R1 and
GABA.sub.B-R2 and its subsequent mature glycosylation and cell
surface expression, generated a receptor complex able to
functionally respond to GABA, we measured three types of
signalling. We used transiently transfected HEK239T cells to
examine firstly, activation of [.sup.35S]GTP.gamma.S binding in
membranes and secondly, inhibition of forskolin stimulated cAMP
activation in whole cells. Thirdly we expressed GABA.sub.B-R1 and
GABA.sub.B-R2 in Xenopus oocytes, expressing either the cystic
fibrosis transmembrane regulator (CFTR) or inwardly rectifying
K.sup.+ channels (GIRK and KATP) and examined activation of ion
flux in response to agonist.
i. [.sup.35S]GTP.gamma.S Binding
[0089] No GABA stimulated [.sup.35S]GTP.gamma.S binding was
observed in membranes prepared from cells transfected with either
GABA.sub.B-R1 or HA-GABA.sub.B-R2 in combination with
G.sub.o1.alpha.. However, co-expression of GABA.sub.B-R1 and
HA-GABA.sub.B-R2 together with G.sub.o1.alpha. resulted in a robust
stimulation of [.sup.35S]GTP.gamma.S binding activity (FIG. 9a).
This was found to be concentration-dependent with similar EC.sub.50
(mean, .+-.S.E.M., n=3) values determined for membranes from cells
transfected with HA-GABA.sub.B-R2 and GABA.sub.B-R1 together with
either GABA.sub.B-R1a (9.5.+-.1.1.times.10.sup.-5M) or
GABA.sub.B-R1b (7.8.+-.0.4.times.10.sup.-5M) (FIG. 9b). These
values are equivalent to those of GABA.sub.B-mediated stimulation
of [.sup.35S]GTP.gamma.S binding to rat brain membranes
(5.9.+-.0.4.times.10.sup.-5M) (data not shown). We were concerned
that an N-terminal HA epitope tag on GABA.sub.B-R2 could alter
receptor function and so we performed parallel studies in HEK293T
cells, expressing untagged versions of GABA.sub.B-R2 and
GABA.sub.B-R1 together with G.sub.o1.alpha.. Similar efficacies and
potencies of GABA action were observed in membranes from these
cells, as reported for the epitope tagged receptors (data not
shown), clearly suggesting that the addition of these peptide
sequences to the N-termini of GABA.sub.B-R2 and GABA.sub.B-R1 did
not significantly alter receptor function. It is noteworthy that a
measurable GABA-mediated elevation of [.sup.35S]GTP.gamma.S binding
activity was only observed upon co-expression of GABA.sub.B-R1 and
HA-GABA.sub.B-R2 together with additional G.sub.o1.alpha. (FIG.
10). The requirement for additional G protein is most likely due to
relatively low levels of endogenously expressed G.sub.i/o family G
proteins, thus precluding a discernible GABA-mediated response upon
GABA.sub.B-R1 and GABA.sub.B-R2 co-expression.
ii cAMP Inhibition
[0090] Similar results were obtained from HEK293T cells transiently
transfected with GBA.sub.B-R1 and GABA.sub.B-R2, using inhibition
of forskolin evoked cAMP as a readout. Once again, functional
responses were only observed when both GABA.sub.B-R1 and
GABA.sub.B-R2 were co-expressed (FIG. 11).
iii Xenopus oocytes
Xenopus Oocytes can Assay for Three Classes of G-Protein:
[0091] 1) Endogenous oocyte Ca.sup.2+-activated chloride
conductance can assay for activation of G.sub.q and a subsequent
rise in intracellular calcium (Uezono et al., 1993).
[0092] 2) Cystic fibrosis transmembrane regulator (CFTR), which
contains a cAMP-activated chloride channel, can assay for receptor
activation via G.sub.s or G.sub.i/o (Uezono et al., 1993; Wotta et
al., 1997).
[0093] 3) G-protein regulated potassium channels GIRK1 (Kir 3.1;
Kubo et al., 1993) and GIRK4 (or CIR, Kir 3.4, Kaprivinsky et al.,
1995), injected in equal amounts to generate a heteromeric channel,
can assay for activation of pertussis toxin sensitive G-proteins
(Kovoor et al., 1997).
[0094] No functional responses to GABA or baclofen were seen when
cloned GABA.sub.B-R1a, GABA.sub.B-R1b or GABA.sub.B-R2 receptors
were expressed in oocytes in combination with CFTR or GIRK114 (data
not shown; see FIG. 12b). When GABA.sub.B-R1 and GABA.sub.B-R2 were
co-expressed with CFTR, several significant, robust responses were
recorded following application of 100 .mu.M GABA (FIG. 12a).
Moreover, repeated application of GABA led to a progressive
increase in the size of the CFTR response, suggesting that the
functional response of the heterodimer is now sensitised to further
challenge by agonist. This phenomenon has not been observed for
other cloned receptors expressed in oocytes and may be related to
the heterodimerisation or even oligomerisation of the GABA.sub.B
receptors. Finally, two other GABA.sub.B-selective agonists,
Baclofen and SKF97541 elicted similar functional responses through
CFTR to that of GABA (FIG. 12a). In contrast, antagonists gave no
response (data not shown).
[0095] Next, we examined the GABA.sub.B-R1/GABA.sub.B-R2
heterodimer with the G-protein regulated potassium channels GIRK1
and GIRK4 and once again found agonist dependant responses. Time
course plots were examined for three individual oocytes expressing
GABA.sub.B-R2 alone (left panel), GABA.sub.B-R1 plus GABA.sub.B-R2
(middle panel) and the adenosine A1 receptor (as a positive
control, right panel) (FIG. 12b). In each case, switching from a
low potassium physiological solution (ND96) to a high potassium
extracellular solution (90 mM K.sup.+) led to an inward shift in
holding current, resulting from agonist-independent influx of
potassium ions through the GIRK1/4 channel. No GABA response was
seen in oocytes expressing GABA.sub.6-R2 in isolation (FIG. 12b,
left panel) and similarly, GABA.sub.B-R1a and GABA.sub.B-R1b
expressed alone also gave no response to GABA (data not shown).
Significantly, a large GABA response was recorded in oocytes
co-expressing GABA.sub.B-R1 and GABA.sub.B-R2 (FIG. 12b, middle
panel) of a similar magnitude to that of the adenosine A1 receptor
in response to the agonist NECA (FIG. 12b, right panel). Thus, once
again co-expression of the two receptor subtypes elicits a
functional agonist-dependant response, whereas expression of either
subtype receptor alone does not. We also examined whether
co-expression of the two receptors in oocytes could activate
endogenous Ca.sup.2+-activated chloride conductance. No evidence
for activation was seen (data not shown) suggesting that at least
in oocytes, the GABA.sub.B-R1/GABA.sub.B-R2 receptor complex does
not signal through G.sub.q. Finally, a current-voltage curve were
constructed for an oocyte co-expressing GABA-R1 and GABA.sub.B-R2
(FIG. 13). This clearly demonstrates that GABA, bound to the
GABA.sub.B receptor, activates a large inwardly rectifying current
consistent with activation of the GIRK potassium channel in a fully
dose dependant manner.
9. Stoichiometric Studies on the Heterodimer
[0096] Since co-expression of GABA.sub.B-R1 and GABA.sub.B-R2 is
necessary for a functional GABA.sub.B receptor, we decided to
investigate stoichiometric ratio between the two receptor subtypes
in vivo. Relative levels of expression for both GABA.sub.B-R1 and
GABA.sub.B-R2 were measured following transfection into HEK293T
cells and compared to receptor function, as determined by
GTP.gamma.S binding (FIG. 14). Increasing amounts of
HA-GABA.sub.B-R1 (up to 1 .mu.g) plasmid were transfected into
HEK293T cells along with a constant (1 .mu.g) amount of
HA-GABA.sub.B-R2. GABA caused stimulation of [.sup.35S]GTP.gamma.S
binding above basal levels in membranes extracted from these cells,
which increased with increasing amount of transfected
HA-GABA.sub.B-R1 until binding reached a plateau when levels of
HA-GABA.sub.B-R1 were greater than 0.25 kg (FIG. 14a).
Immunoblotting of the same membrane samples revealed equivalent
levels of expression of HA-GABA.sub.B-R1 and HA-GABA.sub.B-R2 in
membranes transfected with 0.25-0.5 .mu.g of HA-GABA.sub.B-R1 (FIG.
14b). This corresponded to the plateau of GABA-mediated elevation
of [.sup.35S]GTP.gamma.S binding activity and therefore strongly
suggests that GABA.sub.B-R1 and GABA.sub.B-R2 functionally interact
in a 1:1 stoichiometric ratio.
10. Competition Binding Studies
[0097] Finally, we determined whether the observed functional
responses were due to a high affinity GABA.sub.B receptor, composed
of a heterodimer of the two receptors. HEK293T cells were
transfected with either 1 .mu.g HA-GABA.sub.B-R1b and
HA-GABA.sub.B-R2 individually or with increasing amounts (up to 1
.mu.g) of HA-GABA.sub.B-R1b and a fixed amount (1 .mu.g) of
HA-GABA.sub.B-R2 together with G.sub.o1.alpha.. Competition binding
assays were then performed upon purified membranes. Expression of
HA-GABA.sub.B-R1b alone produced high levels of specific binding of
[.sup.3H]-CGP54626 (Bittiger et al., 1992), a structural analogue
of [.sup.125I]-CGP64213 and the antagonist originally used to
expression clone GABA.sub.B-R1 (Kaupmann et al., 1997). However, as
previously reported for [.sup.125I]-CGP64213, GABA inhibition
curves were significantly shifted to the right compared with
binding to rat brain membranes (FIG. 15), giving approximately
22-fold lower IC.sub.50 than rat brain binding. Significantly,
co-expression of equivalent amounts of HA-GABA.sub.B-R1b and
HA-GABA/B-R2 protein revealed high levels of specific binding. In a
control experiment using untagged receptors similar values were
obtained (data not shown). Achievement of a 1:1 stoichiometric
ratio of expression of HA-GABA.sub.B-R1b and HA-GABA.sub.B-R2 led
to agonist inhibition curves similar to those obtained in rat brain
membranes (IC.sub.50.+-.95% confidence intervals for 1 .mu.g
HA-GABA.sub.B-R2/0.25 .mu.g HA-GABA.sub.B-R1b=2.29 .mu.M (1.48-3.55
.mu.M) and for rat brain=1.04 .mu.M (0.69-1.58 .mu.M). Such
comparable levels of receptor expression were also shown to permit
optimal agonist activation in the GTP.gamma.S assay (see FIG. 14).
Alteration of receptor ratio from 1:1, such that GABA.sub.B-R1b was
the most prevalent receptor, led to reduced agonist affinity,
presumably due to binding at non-dimerised and immaturely
glycosylated GABA.sub.B-R1b receptors (FIG. 15).
[0098] In addition, despite its apparent cell surface expression,
we were unable to detect any [.sup.3H]-CGP54626 specific binding to
HEK293T cells transiently transfected with HA-GABA.sub.B-R2 alone
(data not shown). We conclude that heterodimerisation of the
GABA.sub.B-R1 and GABA.sub.B-R2 subtypes are necessary to generate
a high affinity GABA.sub.B receptor. There are a number of possible
explanations for the change in GABA affinity following
co-expression of the two receptor subtypes. Appearance of the
GABA.sub.8 receptor complex at the cell surface would be expected
to allow G protein coupling of the receptor which would increase
agonist affinity. However, in previous studies is has been shown
that the lack of G protein coupling alone cannot account for the
difference in agonist affinity between rat brain receptors and
GABA.sub.B-R1 (Kaupmann et al, 1997). Furthermore, we have noted
that [.sup.3H]-CGP54626 appears to primarily bind the low affinity
state of the receptor, even in rat brain membranes, as demonstrated
by the fact that GTP.gamma.S is unable to shift agonist inhibition
curves and actually increases the level of .sup.3H-CGP54626
specific binding (data not shown). Therefore, a more likely
explanation for the change in GABA affinity following co-expression
of the two GABA.sub.B receptors is that heterodimerisation together
with the mature glycosylation state of the protein, produces a
binding site conformation with an inherent higher affinity.
Discussion
[0099] Functional GABA.sub.B receptors within the CNS comprise a
cell surface heterodimer of two distinct 7-transmembrane receptor
subunits, GABA.sub.B-R1 and GABA.sub.B-R2 in a 1:1 stoichiometric
ratio. In vivo, GABA.sub.B receptors may exist simply as
heterodimers or form even larger multimeric complexes of many
heterodimers-Formation of the heterodimer via the coiled-coil
domains within the receptor C-terminal tails appears to be a
pre-requisite for transport and full glycosylation of
GABA.sub.B-R1, as well as for the generation of a high affinity
GABA.sub.B receptor at the cell surface. Using this information, we
have been able to reproduce GABA.sub.B sites in both mammalian
HEK293T cells as well as in oocytes, using several functional
readouts such as activation of ion flux through CFTR or GIRK in
oocytes, or inhibition of adenylyl cyclase in HEK293T cells. Indeed
the lack of functional responses in cells expressing GABA.sub.B-R1
alone and the need for expression of a second 7TM receptor explains
why many groups have encountered extreme difficulty in expression
cloning a GABA.sub.B receptor via conventional means. We believe
this is the first report of receptor heterodimerisation as an
obligate requirement to generate a high affinity, fully functional
receptor in recombinant systems, which is fully equivalent to that
of endogenous tissues.
[0100] Dimerisation has been reported for other receptor families,
such as the opioid family as a part of their desensitisation
process, the .beta.2-adrenergic receptor, where homodimers may play
a role in signalling, and the metabotropic glutamate receptors
(mGluRs, Hebert et al, 1996; Romano et al., 1996; Cvejic et al.,
1997, Hebert and Bouvier, 1998). Significantly, dimerisation in
these receptor families does not appear to be an absolute
requirement for functional coupling in recombinant systems. In the
case of the mGluRs, which are a closely related receptor family to
GABA.sub.B (Kaupmann et al., 1997), homodimerisation is mediated
through disulphide bridges between the N-terminal extracellular
domains rather than a C-terminal coiled-coil. Indeed,
heterodimerisation between two 7-transmembrane receptors, leading
to both trafficking and mature glycosylation of the proteins to
yield a functional receptor is unprecedented and is unique in the
GPCR field. Certainly, mGluRs have not been found to form
heterodimers (Romano et al., 1996) and the fact that two such
closely related receptors families have evolved such different
mechanisms of dimer formation suggests that this is a fundamentally
important process for receptor function.
[0101] In vivo, pharmacological evidence suggests that there are
many different GABA.sub.B receptor subtypes, both within the CNS as
well as in peripheral tissues. How are such pharmacological
subtypes of GABA.sub.B receptors formed? Only GABA.sub.B-R1 and
GABA.sub.B-R2 have been identified as separate genes to date and
database trawling has not identified any further receptors
homologous to known GABA.sub.B receptors. This does not exclude the
possibility that more, as yet unrecognised GABA.sub.B receptors do
exist. Differences in distribution exist for the two GABA.sub.B
receptors, for example GABA.sub.B-R2 is specifically expressed in
the CNS whereas GABA.sub.B-R1 is expressed in both central and
peripheral sites. These differences in distribution clearly add
further complexity leading to the pharmacologically distinct
receptor subtypes. Moreover, the genes encoding the GABA.sub.B
receptors may be differentially spliced. GABA.sub.B-R1 encodes
three N-terminal splice variants and yet more may remain to be
detected. Interestingly, these splice variants have alterations in
their N-terminal extracellular domain, the region involved in GABA
binding (Takahashi et al., 1993, O'Hara et al., 1993) and encode
either two (GABA.sub.B-R1a), one (GABA.sub.B-R1c) or no
(GABA.sub.B-R1b) sushi domains. Given that the sushi domains
mediate cell-cell protein-protein contact, the differences in these
three splice variants may account for yet more of the
pharmacologically defined GABA.sub.B receptor subtypes. To date, we
have not detected any splice variants to GABA.sub.B-R2. Furthermore
there are significant differences in the distribution of the
individual splice variants suggesting that they may serve different
functions within the CNS. For instance, GABA.sub.B-R1a splice
variant is reported as presynaptic within the brain (Bettler et
al., 1998) and therefore may define presynaptic GABA.sub.B
autoreceptors. It seems likely that these splice variants of
GABA.sub.B-R1 may account for at least some of the
pharmacologically defined subtypes. Finally, with this novel
observation of obligate receptor heterodimerisation, a further
level of complexity has been added since functional GABA.sub.B
binding sites require a heterodimerisation partner.
[0102] Now the molecular nature of the GABA.sub.B receptor is more
fully understood, recombinant systems can be established for high
throughput screening for compounds against individual
pharmacologically defined GABA.sub.B sites. By these means,
compounds with greater specificity and with fewer unwanted side
effects can be discovered. For this, GABA.sub.B-R1 and
GABA.sub.B-R2 (including all spice variants, and any fragments of
the receptor) should be co-expressed either stably or transiently
in suitable host cells. Suitable host cells include higher
eukaryotic cell lines, such as mammalian cells, insect cells, lower
eukaryotic cells, such as yeast or prokaryotic cells such as a
bacterial cells. Screening assays with these recombinant cell lines
could involve the use of radioligand binding to the dimer or
individual subunits within the dimer. The activity profile in a
binding assay to the dimer is likely to be different from the
activity of compounds assayed using binding assays to GABA.sub.B-R1
alone due to alterations in the glycosylation status and the
conformation of the receptor as a result of co-expressing
GABA.sub.B-R1 or GABA.sub.B-R2. Functional assays, which measure
events downstream of receptor activation, can also be used for
screening compounds. Such assays include [S]-GTP.gamma.S binding to
membranes isolated from cells expressing the dimer, activation or
inhibition of ion channels using electrophysiological recording or
ion flux assays; mobilisation of intracellular calcium; modulation
of cAMP levels; activation or inhibition of MAP kinase pathways or
alterations in the activity of transcription factors with the use
of reporter genes. Further to this, secondary screens can be
established in a similar manner, using different heterodimer
combinations to exclude unwanted activity and thereby establish
subtype selective GABA.sub.8 compounds.
[0103] In addition, any approach targetting the disruption or
enhancemant of dimer formation of the GABA.sub.B heterodimer could
represent a novel therapeutic approach with which to target
GABA.sub.B receptors. Such strategies could include peptides or
proteins physically associated with the coiled-coil domain or
indeed, any other interacting regions of the dimer. Small molecules
could also be identified which act at the points of contact formed
by interaction of the components of the dimer. These may either
promote or enhance the receptor function. Finally, antibodies could
be made which specifically recognise epitopes on the dimer, as
opposed to the monomer subunits. These could be used as tools to
further elucidate the function of GABA.sub.8 receptors in disease
or as therapeutic agents in their own right.
Methods
DNA Manipulation
[0104] Standard molecular biology protocols were used throughout
(Sambrook et al., 1989) and all bacterial manipulations used
Escherichia coli XL-1Blue (Stratagene) according to the
manufacturers instructions. Standard PCR conditions were used
throughout, unless otherwise stated. PCR reaction mixture contained
10-50 ng of target DNA, 1 pmol of each primer, 200 .mu.M dNTPs and
2.5 U of either Taq polymerase (Perkin-Elmer) or Pful polymerase
(Stratagene) with the appropriate buffer as supplied by the
manufacturer. Cycling parameters were 1 cycle 95.degree. C. 2 mins;
25 cycles 95.degree. C. 45 secs 55.degree. C. 45 secs 72.degree. C.
1 min; 1 cycle 72.degree. C. 10 mins. All PCR were carried out
using either a Perkin Elmer 9600 PCR machine or a Robocycler
Gradient 96 (Stratagene) PCR machine.
GABA.sub.B-R1--Cloning of Human Homologues and Splice Variants
[0105] Several human EST's (X90542; X90543; D80024; AA348199;
T06711; T07518 and AA38224) were identified as homologous to the
rat GABA.sub.B-R1a and GABA.sub.B-R1b sequences (Y10369; Y10370).
The ESTs were aligned and the predicted open reading frame was
amplified by RT-PCR from human brain cerebellum polyA.sup.+ RNA
(Clontech) using the Superscript Preamplification System (Life
Technologies). The 3' end of the receptor (1545-2538 bp;
GABA.sub.B-R1b) was amplified using primers
5'-GCGACTGCTGTGGGCTGCTTACT GGC-3 and
5'-GCGAATTCCCTGTCCTCCCTCACCCTACCC-3'. The central section (277-1737
bp of GABA.sub.B-R1b) was amplified using
5'-CCGAGCTCAAGCTCATCCACCACG-3' and 5'-TCTTCCTCCACTCCTCTTTTCTT-3'.
PCR products were subcloned into pCR-Script SK(+) (PCR-script Amp
cloning kit; Stratagene). Error free PCR product were assembled in
a three-way BstEII, SacI and EcoRI ligation and subcloned into
pBluescript SK (-) (Stratagene).
[0106] The N-termini of the splice variants were generated using
RACE (rapid amplification of cDNA ends) PCR with the Marathon cDNA
amplification kit against Marathon-Ready human cerebellum cDNA
(Clontech). RACE PCR was primed from a conserved sequence within
GABA.sub.B-R1 using primer 5'-TGAGCTGGAGCCATAGGAAAGCACAAT-3' to
generate a 700 bp product. This further PCR amplified using the AP2
primer (Marathon) and a second internal GABA.sub.B-R1 primer
5'-GATCTTGATAGGGTCGTTGTAGAGCA-3'. The resulting 600 bp product was
subcloned using the Zero blunt PCR cloning kit (Invitrogen).
Sequence information achieved from this RACE PCR was used to clone
the N-terminus of the GABA.sub.B-R1b splice variant, using primers
5'-GCTCCTAACGCTCCCCAACA-3' and 5'-GGCCTGGATCACACTTGCTG-3' into
pCR-Script SK (+)(Stratagene). Human GABA.sub.B-R1a 5' sequences
were retrieved from Incyte database EST's (1005101;3289832) and
used to design primers 5'-CCCAACGCCACCTCAGAAG-3' and
5'-CCGCTCATGGGAAACAGTG C-3'. PCR on cerebellum cDNA and KELLY
neuroblastoma cell line cDNA produced two discreet bands at 300 bp
and 400 bp, which were cloned into pCR-Script SK (+) (Stratagene).
Sequencing revealed that the 400 bp product encoded some of the
Human GABA.sub.B-R1a 5' sequences and the 300 bp product encoded
the novel splice variant, GABA.sub.B-R1c. Next, primer,
5'-CCCCGGCACACATACTCAATCTCATAG-3' was designed to RACE PCR the
missing .about.225 bp of GABA.sub.B-R1a. A 250 bp product was
obtained and reamplified using primer 5'-CCGGTACCTGATGCCCCCTTCC-3'
with primer AP2 (Marathon). A .about.250 bp band was once again
generated, subcloned into pCR-Script SK (+) and when sequenced,
encoded the 5' end of GABA.sub.B-R1a. Next, clones spanning both
the conserved receptor sequence and the %' ends of the splice
variants GABA.sub.B-R1a and GABA.sub.B-R1c were generated. Primer
5'-CGAGATGTTGCTGCTGCTGCTA-3', priming from the start codon and the
reverse RACE primer generated a predicted .about.800 bp band and
this was subcloned into pCR-Script SK(+). Now, full-length
GABA.sub.B-R1a, GABA.sub.B-R1b and GABA.sub.B-R1c clones can be
assembled in pcDNA3.1(-) (Invitrogen). For GABA.sub.B-R1b, 5'
sequences, restricted NotI/SacI, and the conserved region of the
receptor, cut EcoRI/SacI were both co-ligated into pcDNA3.1(-),
restricted NotI/EcoRI. Likewise, the GABA.sub.B-R1a and
GABA.sub.B-R1c 5' fragments were subcloned XhoI/SacI with the
EcoRI/SacI conserved fragment and co-ligated into pcDNA3.1(-), cut
XhoI/EcoRI to reconstitute full length clones.
Tagging of GABA.sub.B-R1b
[0107] GABA.sub.B-R1b was tagged with either myc or HA epitopes.
PCR primers 5'-TAGGATCCCACTCCCCCCATCCC-3' and
5'-CCAGCGTGGAGACAGAGCTG-3' were used to amplify a region
immediately following the proposed signal sequence (position 88) to
approx. 20 bp downstream of a unique PstI site at position 389 of
the coding sequence, creating a unique 5' in-frame BamHI site. This
fragment was cloned BamHI/PstI, into a vector containing the CD97
signal sequence, the myc epitope and an in-frame BamHI site. This
construct also contains a NotI site 5' to the CD97 signal sequence
and an EcoRI site downstream of the PstI site. GABA %-R1b sequences
downstream to the PstI site and upto an external EcoRI site were
subcloned from full length receptor into the vector described above
likewise cut with PstI/EcoRI, to assemble full length tagged
GABA.sub.B-R1b. CD97 signal sequence, myc epitope and
GABA.sub.B-R1b coding sequence were subcloned, NotI/EcoRI, into
pcDNA3.1(-) (Invitrogen). HA epitope was added to GABA.sub.B-R1b by
co-ligation of the 5' BamHI/PstI and 3' PstI/EcoRI fragments into
pCIN6 cut with BamHI/EcoRI. This vector contains a T8 signal
sequence and 12CA5 HA epitope immediately preceding an in-frame
BamHI site.
Cloning of GABA.sub.B-R2, the novel GABA.sub.B Receptor Subtype
[0108] EST clones (H14151, R76089, R80651, AA324303, T07621,
Z43654) were identified with approximately 50% nucleotide identity
to GABA.sub.B-R1. PCR revealed that H14151 contained a 1.5 Kb
insert and encoded sufficient sequence for a substantial portion
the novel GABA.sub.B receptor. PCR between the 3' end of H14151 and
the 5' end of AA324303, using a cerebellum cDNA library as
template, produced a .about.700 bp product, which when cloned into
the T-vector (TA cloning kit, Invitrogen) and sequenced, revealed
that T07621 overlaps within AA324303. Also, Z43654 as well as
genomic DNA fragments R76089 and R80651 were found to overlap
AA324303 and together provided sequence data for the 3' end of the
GABA.sub.B subtype receptor. Further sequencing of H14151 provided
the full sequence for the novel receptor subtype. However, because
of ambiguities in the position of the stop codon in
Z43654/R80448/R80651, Incyte clones 662098 and 090041, which
overlap this region, were sequenced. The stop codon was identified
and sequence for GABA.sub.B-R2 was confirmed as within H14151 (5'
end) and 662098 (3' end). 5' sequences of GABA.sub.B-R2 were PGR
generated using primers 5'-ATGGCTTCCCCGCGGAG-3' to provide the
start codon of the receptor and primer 5'-GAACAGGCGTGGTTGCAG-3',
priming beyond a unique EagI site. The expected .about.250 bp
product was cloned into pCRSCRIPT and sequenced. Full length
receptor was then assembled with a three way ligation between
H14151, cut with ApaLI/EagI; 662098, cut with ApaLI/NotI and
pCRSCRIPT-GABA.sub.B-R2-5' PCR product, restricted by EagI.Full
length GABA.sub.B-R2 was removed from the pCRSCRIPT vector using
EcoRI/NotI and ligated into pcDNA3 (Invitrogen) for expression
studies.
[0109] HA-epitope tagged GABA.sub.B-R2 was constructed in pCIN6. A
linker was constructed encoding amino acids between the
GABA.sub.B-R2 signal sequence and the unique EagI site.
TABLE-US-00001 HindIII XhoI EagI EcoRI AGCTT CTC GAG GCT TGG GGA
TGG GCA CGA GGA GCT CCT GCT CGG CCG G A GAG CTC CGA ACC CCT ACC CGT
GCT CCT CGT GGT CGA GCC GGC CTT AA Ala Trp Gly Trp Ala Arg Gly Ala
Pro Arg
The linker was cloned into pUC18 (EcoRI/HindIII) followed by full
length GABA.sub.B-R2, from pCRSCRIPT as an EagI/NotI fragment.
Finally, the modified GABA.sub.B-R2 was cloned into pCIN6 as a XhoI
fragment. Distribution Studies
[0110] Blots were hybridized overnight at 65.degree. C. according
to the manufacturers' instructions with radioactively randomly
primed cDNA probes using ExpressHyb Hybridization solution. Probe
for GABA.sub.B-R1, corresponding to residues 1129-1618 of the
GABA.sub.B-R1b coding sequence was PCR amplified using primers
5'-CGCCTGGAGGACTTCAACTACAA-3' and 5'-TCCTCCCAATGTGGTAACCATCG-3'
against GABA.sub.B-R1b DNA as template. GABA.sub.B-R2 cDNA probe,
corresponding to residues 1397-1800, was amplified by PCR using
primers 5'-ACAAGACCATCATCCTGGA-3' and 5'-GATCACAAGCAGTTTCTGGTC-3'
with GABA.sub.B-R2 DNA as template. DNA fragments were labelled
with .sup.32P-.alpha.-dCTP using a Rediprime DNA labelling system
(Amersham). Probes were labelled to a specific activity of
>10.sup.9 cpm/.mu.g and were used at a concentration of
approximately 5 ng/ml hybridization solution. Following
hybridization, blots were washed with 2.times.SSC/1% SDS at
65.degree. C., and 0.1.times.SSC/0.5% SDS at 55.degree. C.
(20.times.SSC is 3M NaCl/0.3M Na.sub.3Citrate.2H.sub.2O pH7.0) and
were exposed to X-ray film.
Yeast Two Hybrid Studies
[0111] Saccharomyces cerevisiae Y190 [MATa, gal4 gal80, ade2-101,
his3, trp1-901, ura3-52, leu2-3,112, URA3::GAL1-lacZ,
LYS2::GAL1-HIS3, cyh.sup.R] was used for all described yeast two
hybrid work (Harper et al., 1993, Clontech Laboratories, 1996).
GAL4 binding-domain (GAL4.sub.BD) fusion vectors were constructed
in either pYTH9 (Fuller et al., 1998) or pYTH16, an episomal
version of pYTH9. All GAL4 activation-domain fusions were made in
pACT2 (Clontech Laboratories, 1998) All yeast manipulations were
carried out using standard yeast media (Sherman, 1991). Human Brain
MATCHMAKER library (HL4004AH) in pACT2 was purchased from Clontech
Laboratories and amplified according to the manufacturers'
instructions. The GABA.sub.B-R1 C-terminal domain was amplified
from a full length clone, using primers 5
GTTGTCCCCATGGTGCCCAAGATGCGCA GGCTGATCACC-3' and
5'-GTCCTGCGGCCGCGGATCCTCACTTATAAAGCAAATGCACT CG-3'. PCR product was
size-fractionated on 0.8% agarose gel, purified and force-cloned
NcoI/NotI into pYTH9 and subsequently into pACT2. The GABA.sub.B-R2
C-terminal domain was similarly generated with primers
5'-CTCTGCCCCATGGCCGTGCCGAAGCTCATCACCCTGA GAACAAACCC-3' and
5'-GGCCCAGGGCGGCCGCACTTACAGGCCCGAGACCATGACTC GGAAGGAGGG-3' and
subcloned into pYTH9, pYTH16 and pACT2. All cloned PCR products
were sequenced and confirmed as error free.
[0112] The GAL4.sub.BD-GABA.sub.B-R1 C-terminus fusion in pYTH9 was
stably integrated into the trp1 locus of Y190 by targetted
homologous recombination. Yeast expressing
GAL4.sub.BD-GABA.sub.B-R1 C-terminus were selected and transformed
with Human brain cDNA library under leucine selection, using a high
efficiency Lithium acetate transformation protocol (Clontech
Laboratories, 1998). Sufficient independent cDNAs were transformed
to give a three fold representation of the library. Interacting
clones were selected by growth under 20 mM 3-amino-1,2,4-triazole
(Sigma) selection, followed by production of .beta.-galactosidase,
as determined by a freeze-fracture assay (Clontech Laboratories,
1998). Plasmid DNA was recovered from yeast cells following
digestion of the cell wall by 400 .mu.g/ml Zymolase 100T (ICN
Biochemicals) in 250 .mu.l 1.2M Sorbitol; 0.1M potassium phosphate
buffer (pH 7.4) at 37.degree. for 2 h. Plasmid DNA was extracted by
standard Qiagen alkaline lysis miniprep as per manufacturers'
instructions and transformed into Ultracompetent XL-2Blue cells
(Stratagene). Plasmid DNA was sequenced using primer
5'-CAGGGATGTTTAATACCACTACAATGG-3' using automated ABI sequencing
and resulting sequences were blasted against the databases.
[0113] Yeast Y190 was transformed with pYTH16 and pACT2 expressing
GABA.sub.B-R1 C-terminal domain and the GABA.sub.B-R2 C-terminal
domain in all combinations, as well as against empty vectors.
Transformants were grown in liquid media to mid-logarithmic phase
and approximately 1.5 ml harvested. .beta.-galactosidase activity
was quantified using substrate o-nitrophenyl
.beta.-D-galactopyranoside (ONPG; Sigma) using a liquid nitrogen
freeze fracture regime essentially as described by Harshman et al.,
(1988).
Two-Microelectrode Voltage-Clamp in Xenopus oocytes
[0114] Adult female Xenopus laevis (Blades Biologicals) were
anaesthetised using 0.2% tricaine (3-aminobenzoic acid ethyl
ester), killed and the ovaries rapidly removed. Oocytes were
de-folliculated by collagenase digestion (Sigma type I, 1.5 mg
ml.sup.-1) in divalent cation-free OR2 solution (82.5 mM NaCl, 2.5
mM KCl, 1.2 mM NaH.sub.2PO.sub.4, 5 mM HEPES; pH 7.5 at 25.degree.
C.). Single stage V and VI oocytes were transferred to ND96
solution (96 mM NaCl, 2 mM KCl, 1 mM MgCl.sub.2, 1.8 mM CaCl.sub.2,
5 mM HEPES; pH 7.5 at 25.degree. C.) which contained 50 .mu.g
ml.sup.-1 gentamycin and stored at 18.degree. C.
[0115] GABA.sub.B-R1a, GABA.sub.B-R1b (both in pcDNA3.1rev,
Invitrogen), GABA.sub.B-R2, GIRK1, GIRK4 (in pcDNA3) and cystic
fibrosis transmembrane regulator (CFTR; in pBluescript, Stratagene)
were linearised and transcribed to RNA using T7 or T3 polymerase
(Promega Wizard kit). m'G(5')pp(5')GTP capped cRNA was injected
into oocytes (20-50 nl of 1 .mu.g.mu.l.sup.-1 RNA per oocyte) and
whole-cell currents were recorded using two-microelectrode
voltage-clamp (Geneclamp amplifier, Axon instruments Inc.) 3 to 7
days post-RNA injection. Microelectrodes had a resistance of 0.5 to
2M.OMEGA. when filled with 3M KCl. In all experiments oocytes were
voltage-clamped at a holding potential of -60 mV in ND96 solution
(superfused at 2 ml per min.) and agonists were applied by addition
to this extracellular solution. In GIRK experiments the
extracellular solution was changed to a high potassium solution
prior to agonist application, to facilitate the recording of inward
potassium currents. Current-voltage curves were constructed by
applying 200 ms voltage-clamp pulses from the holding potential of
-60 mV to test potentials between -100 V and +50 mV.
Mammalian Cell Culture and Transfections
[0116] HEK293T cells (HEK293 cells stably expressing the SV40 large
T-antigen) were maintained in DMEM containing 10% (v/v) foetal calf
serum and 2 mM glutamine. Cells were seeded in 60 mm culture dishes
and grown to 60-80% confluency (18-24 h) prior to transfection with
pcDNA3 containing the relevant DNA species using Lipofectamine
reagent. For transfection, 3 .mu.g of DNA was mixed with 10 .mu.l
of Lipofectamine in 0.2 ml of Opti-MEM (Life Technologies Inc.) and
was incubated at room temperature for 30 min prior to the addition
of 1.6 ml of Opti-MEM. Cells were exposed to the Lipofectamine/DNA
mixture for 5 h and 2 ml of 20% (v/v) newborn calf serum in DMEM
was then added. Cells were harvested 48-72 h after
transfection.
Preparation of Membranes
[0117] Plasma membrane-containing P2 particulate fractions were
prepared from cell pastes frozen at -80.degree. C. after harvest.
All procedures were carried out at 4.degree. C. Cell pellets were
resuspended in 1 ml of 10 mM Tris-HCl and 0.1 mM EDTA, pH 7.5
(buffer A) and by homogenisation for 20 s with a polytron
homogeniser followed by passage (5 times) through a 25-guage
needle. Cell lysates were centrifuged at 1,000 g for 10 min in a
microcentrifuge to pellet the nuclei and unbroken cells and P2
particulate fractions were recovered by microcentrifugation at
16,000 g for 30 min. P2 particulate fractions were resuspended in
buffer A and stored at -80.degree. C. until required. Protein
concentrations were determined using the bicinchoninic acid (BCA)
procedure (Smith et al., 1985) using BSA as a standard.
High Affinity [.sup.35S]GTP.gamma.S Binding
[0118] Assays were performed in 96-well format using a method
modified from Wieland and Jakobs, 1994. Membranes (10 mg per point)
were diluted to 0.083 mg/ml in assay buffer (20 mM HEPES, 100 mM
NaCl, 10 mM MgCl.sub.2, pH7.4) supplemented with saponin (10 mg/l)
and pre-incubated with 40 mM GDP. Various concentrations of GABA
were added, followed by [.sup.35S]GTPgS (1170 Ci/mmol, Amersham) at
0.3 nM (total vol. of 100 ml) and binding was allowed to proceed at
room temperature for 30 min. Non-specific binding was determined by
the inclusion of 0.6 mM GTP. Wheatgerm agglutinin SPA beads
(Amersham) (0.5 mg) in 25 ml assay buffer were added and the whole
was incubated at room temperature for 30 min with agitation. Plates
were centrifuged at 1500 g for 5 min and bound [.sup.35S]GTPgS was
determined by scintillation counting on a Wallac 1450 microbeta
Trilux scintillation counter.
Measurement of cAMP Levels
[0119] 24 hours following transfection, each 60 mm dish of HEK293T
cells was split into 36 wells of a 96-well plate and the cells were
allowed to reattach overnight. Cells were washed with PBS and
pre-incubated in DMEM medium containing 300 .mu.M IBMX for 30
minutes at 37.degree. C. Forskolin (50 .mu.M) and varying
concentrations of GABA were added and cells incubated for a further
30 min prior to CAMP extraction with 0.1M HCl for 1 h at 4.degree.
C. Assays were neutralised with 0.1 M KHCO.sub.3 and CAMP levels
determined using scintillation proximity assays (Biotrak Kit,
Amersham).
Flow Cytometric Analysis
[0120] HEK293T cells were transiently transfected with cDNA as
described. 48-72 h following transfection, cells were recovered and
washed twice in PBS supplemented with 0.1% (w/v) NaN.sub.3 and 2.5%
(v/v) foetal calf serum Cells were resuspended in buffer and
incubated with primary antibodies 9E10 (c-Myc) or 12CA5 (HA) for 15
min at room temperature. Following three further washes with PBS,
cells were incubated with secondary antibody (sheep anti-mouse
Fab.sub.2 coupled with fluorescein isothiocyanate (FITC)) diluted
1:30 for 15 min at room temperature. For permeabilised cells, a Fix
and Perm kit (Caltag) was used. Cell analysis was performed on a
Coulter Elite flow-cytometer set up to detect FITC fluoresence.
30,000 cells were analysed for each sample.
Immunological Studies
[0121] Antiserum 501 was raised against a synthetic peptide
corresponding to the C-terminal 15 amino acids of the GABA.sub.B-R1
receptor and was produced in a sheep, using a conjugate of this
peptide and keyhole limpet hemocyanin (Calbiochem) as antigen.
Membrane samples 30-60 .mu.g) were resolved by SDS-PAGE using 10%
(w/v) acrylamide. Following electrophoresis, proteins were
subsequently transferred to nitrocellulose (Hybond ECL, Amersham),
probed with antiserum 501 at 1:1000 dilution and visualised by
enhanced chemiluminescence (ECL, Amersham). Epitope tags were
visualised by immunoblotting with anti-Myc (9E10; 1:100 dilution)
or anti-HA (12CA5; 1:500) monoclonal antibodies.
Deglycosylation
[0122] Enzymatic removal of asparagine-linked (N-linked)
carbohydrate moieties with endoglycosidases F and H was performed
essentially according to manufacturers' instructions (Boehringer
Mannheim) using 50 .mu.g of membrane protein per enzyme reaction.
GABA.sub.B receptor glycosylation status was studied following
SDS-PAGE/immunoblotting of samples.
[0123] Immunoprecipitation Procedures
[0124] Transiently transfected HEK293T cells were harvested as
described above from 60 mm culture dishes. Cells from each dish
were resuspended in 1 ml of 50 mM Tris-HCl, 150 mM NaCl, 1% (v/v)
Nonidet.RTM. P40, 0.5% (w/v) sodium deoxycholate, pH 7.5 (lysis
buffer) supplemented with Completes protease inhibitor cocktail
tablets (1 tablet/25 ml) (Boehringer Mannheim). Cell lysis and
membrane protein solubilisation was achieved by homogenisation for
20 seconds with a polytron homogeniser, followed by gentle mixing
for 30 min at 4.degree. C. Insoluble debris was removed by
microcentrifugation at 16,000 g for 15 min at 4.degree. C. and the
supernatant was pre-cleared by incubating with 50 .mu.l of Protein
A-agarose (Boehringer Mannheim) for 3 h at 4.degree. C. on a
helical wheel to reduce non-specific background. Solubilised
supernatant was divided into 2.times.500 .mu.l aliquots and 20
.mu.l of either HA or Myc antisera was added to each.
Immunoprecipitation was allowed to proceed for 1 h at 4.degree. C.
on a helical wheel prior to the addition of 50 .mu.l of Protein
A-agarose suspension. Capture of immune complexes was progressed
overnight at 4.degree. C. on a helical wheel. Complexes were
collected by microcentrifugation 12,000 g for 1 min at 4.degree. C.
and supernatant was discarded. Beads were washed by gentle
resuspension and agitation sequentially in 1 ml of 50 mM Tris-HCl,
pH 7.5, 500 mM NaCl, 0.1% (v/v) Nonidet.RTM. P40 and 0.05% (w/v)
sodium deoxycholate followed by 1 ml of 50 mM Tris-HCl, pH 7.5,
0.1% (v/v) Nonidet.RTM. P40 and 0.05% (w/v) sodium deoxycholate.
Immunoprecipitated proteins were released from Protein A-agarose by
incubation in 30 .mu.l of SDS-PAGE sample buffer at 70.degree. C.
for 10 min and analysed by SDS-PAGE followed by immunoblotting.
Binding Assays
[0125] Competition binding assays were performed in 50 mM Tris HCl
buffer (pH7.4) containing 40 .mu.M isoguvacine (Tocris Cookson) to
block rat brain GABA.sub.A binding sites. P2 membrane preparations
were made from HEK293T cells transfected using conditions described
above. Increasing concentrations of GABA were added to displace the
antagonist [3H]-CGP 54626 (Tocris Cookson, 40 Ci/mmol). Assay
conditions were 0.4-0.6 nM [.sup.3H]-CGP54626, incubated with 50
.mu.g/tube crude rat brain `mitochondrial` fractions or 25
.mu.g/tube HEK293T P2 membranes at room temperature for 20 minutes.
The total volume per tube was 0.5 ml and non specific binding was
determined using 1 mM GABA. Bound ligand was recovered using a
Brandel 48 well harvester onto GF/B filters (Whatman) and measured
by liquid scintillation using a Beckman LS6500 counter.
REFERENCES
[0126] Bettler, B., Kaupmann, K and Bowery, N. Curr Opin in
Neurobiol 8: 345-350 (1998) [0127] Bittiger, H., Froestl, W.,
Gentsch, C., Jaekel., J., Mickel, S. J., Mondori, C., Olpe, H. R.,
Schmuz, M. (1996) in GABA: receptors, transporters and metabolism
Ed: C. Tanaka and N. G. Bowery. Birkhauser Verlag Basel
Switzerland. [0128] Bittiger, H., Reymann, N., Froestl, W. &
Mickel, S. J. Pharmacology Communications 2:1-2: 23 (1992) [0129]
Bowery, N. G., Hudson, A. L., Price, G. W. Neuroscience 20: 365-383
(1987) [0130] Chou, K. C. and Heinrikson, R. L. J. Protein Chem 16:
765-773 (1997) [0131] Clontech Laboratories. CLONTECH
MATCHMAKER.TM. GAL4 Two Hybrid system User Manual, Protocol
PT3061-1 Palo Alto, Calif. (1996) [0132] Cvejic, S. and Devi, L. A.
J. Biol Chem 272: 26959-26964 (1997) [0133] Fuller, K. J., Morse,
M. A., White, J. H. M., Dowell, S. J. and Sims, M. J. BioTechniques
25: 85-92 (1998) [0134] Gemignani, A., Paudice, P., Bonanno, G.,
Raiteri, M. Mol Pharmacol 46: 558-562 (1994) [0135] Harayama, N.,
Shibuya, I., Tanaka, K., Kabashima, N., Ueta, Y., Yamashita, H. J.
Physiol (Lond) 509: 371-383 (1998) [0136] Harper, J. W., Adami, G.
R., Wei, N. Keyomarsi, K. and Elledge, S. J. Cell 75: 805-816
(1993) [0137] Harshmann, K. D., MoyeRowley, W. S. and Parker, C. S:
Cell 53: 321-330 (1988) [0138] Hebert, T. E. and Bouvier, M.
Biochem. Cell. Biol. 76: 1-11 (1998) [0139] Hebert, T. E., Moffett,
S., Morello, J. P., Loisel, T. P., Bichet, D. G., Barret, C., and
Bouvier, M. J. Biol Chem 271: 16384-16392 (1997) [0140] Hill, D. R.
and Bowery, N. G. Nature (Lond) 290: 149-152 (1981) [0141]
Kaprivinsky, G., Gordon, E. A., Wickman, K., Velimirovic, B.,
Kaprivinsky, L. and Clapham, D. E. Nature (Lond) 374:135-141 (1995)
[0142] Kaupmann, K., Huggel, K., Heid, J., Flor, P. J., Bischoff,
S., Mickel, S-J., McMaster, G., Angst, C., Bittiger, H., Froesti,
W. and Bettler, B. Nature(Lond) 386, 239-246 (1997) [0143] Kerr, D.
I., Humeniuk, R. E., and Ong, J. Eur. J. Pharmacol. 262: 189-192
(1994) [0144] Kerr, D. I. and Ong, J. Pharmacol. Ther. 67: 187-246
(1995) [0145] Kerr, D. I. and Ong, J. DDT 1: 371-380 (1996) [0146]
Kobrinsky, E. M., Pearson, H. A. and Dolphin, A. C. Neuroscience
58: 539-552 (1994). [0147] Kovoor, A., Nappey, V., Kieffer, B. L.
and Chavkin, C. J. Biol. Chem. 272: 27605-27611. (1997) [0148]
Kubo, Y., Reuveny, E., Slesinger, P. A., Jan, Y. H. and Jan, L. Y.
Nature (Lond) 364: 802-806. (1993) [0149] Lovinger, D. M.,
Harrison, N. L. and Lambert, N. A. Eur. J. Pharmacol. 211: 337-341
(1992) [0150] Lupas, A. Trends in Biol. Sci. 21: 375-382 (1996)
[0151] Malcangio, M. and Bowery, N. G. Clin Neuropharmacol 18:
285-305 (1995) [0152] McLatchie, L. M., Fraser N. J., Main, M. J.
Wise A., Brown, J., Thompson, N., Solari, R., Lee, M. G and Foord,
S. M. Nature (Lond) 393: 333-339 (1998) [0153] Menon-Johansson, A.
S., Berrow, N. and Dolphin, A. C. Pflugers Arch 425: 335-343 (1993)
[0154] Ohmori, Y., Hirouchi, M., Taguchim J. and Kuriyama, K. J.
Neurochem 54: 80-85 (1990) [0155] Ong, J., Kerr, D. I., Doolette,
D. J., Duke, R. K., Meweft, K. N., Allen, R. D. and Johnston, G. A.
Eur J Pharmacol 233:169-172 (1993). [0156] O'Hara, P. J., Sheppard,
P. O., Thogersen, H., Venezia, D., Haldeman, B. A., McGrane, V.,
Houamed, K. M., Thomsen, C., Gilbert, T. L. and Mulvihill, E. R.
Neuron 11: 41-52 (1993) [0157] Raiteri, M., Bonanno, G., Gemignani,
A., Pende, M., Vellebuona, F. and Lanza, M. Adv. Biochem.
Psychopharmacol. 47: 205-216 (1992) [0158] Romano, C., Yang, W-L.
and O'Malley, K. L. J. Biol. Chem. 271: 28612-28616 (1996). [0159]
Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: a
Laboratory Manual. 2.sup.nd Edition. CSH Laboratory Press. (1989)
[0160] Sherman, F. Methods Enzymol. 194:3-21 (1991) [0161] Smith,
P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F.
H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J.
and Klenk, D. C. Anal. Biochem. 150: 76-85 (1985) [0162] Takahashi,
K, Tsuchida, K., Tanabe, Y., Masu, M. and Nakanishi, S. J. Biol.
Chem. 268: 19341-19345 (1993) [0163] Uezono, Y., Bradley, J., Min,
C., McCarty, N. A., Quick, M., Riordan, J. R., Chavkin, C., Zinn,
K., Lester, A. and Davidson, N. Receptors and Channels 1: 233-241
(1993) [0164] Wotta, D. R., Birnbaum, A. K., Wilcox, G. L., Elde,
R. and Law, P. Y. Brain Res. Mol. Brain Res. 44: 5565 (1997)
Sequence CWU 1
1
31 1 26 DNA Artificial Sequence primer 1 gcgactgctg tgggctgctt
actggc 26 2 30 DNA Artificial Sequence primer 2 gcgaattccc
tgtcctccct caccctaccc 30 3 24 DNA Artificial Sequence primer 3
ccgagctcaa gctcatccac cacg 24 4 24 DNA Artificial Sequence primer 4
tcttcctcca ctccttcttt tctt 24 5 27 DNA Artificial Sequence primer 5
tgagctggag ccataggaaa gcacaat 27 6 26 DNA Artificial Sequence
primer 6 gatcttgata gggtcgttgt agagca 26 7 20 DNA Artificial
Sequence primer 7 gctcctaacg ctccccaaca 20 8 20 DNA Artificial
Sequence primer 8 ggcctggatc acacttgctg 20 9 19 DNA Artificial
Sequence primer 9 cccaacgcca cctcagaag 19 10 19 DNA Artificial
Sequence primer 10 ccgctcatgg gaaacagtg 19 11 27 DNA Artificial
Sequence primer 11 ccccggcaca catactcaat ctcatag 27 12 22 DNA
Artificial Sequence primer 12 ccggtacctg atgccccctt cc 22 13 22 DNA
Artificial Sequence primer 13 cgagatgttg ctgctgctgc ta 22 14 23 DNA
Artificial Sequence primer 14 taggatccca ctccccccat ccc 23 15 20
DNA Artificial Sequence primer 15 ccagcgtgga gacagagctg 20 16 17
DNA Artificial Sequence primer 16 atggcttccc cgcggag 17 17 18 DNA
Artificial Sequence primer 17 gaacaggcgt ggttgcag 18 18 48 DNA
Artificial Sequence constructed oligo 18 agcttctcga ggcttgggga
tgggcacgag gagctcctgc tcggccgg 48 19 48 DNA Artificial Sequence
constructed oligo 19 agagctccga acccctaccc gtgctcctcg tggtcgagcc
ggccttaa 48 20 10 PRT Artificial Sequence synthetic peptide 20 Ala
Trp Gly Trp Ala Arg Gly Ala Pro Arg 1 5 10 21 23 DNA Artificial
Sequence primer 21 cgcctggagg acttcaacta caa 23 22 23 DNA
Artificial Sequence primer 22 tcctcccaat gtggtaacca tcg 23 23 19
DNA Artificial Sequence primer 23 acaagaccat catcctgga 19 24 21 DNA
Artificial Sequence primer 24 gatcacaagc agtttctggt c 21 25 39 DNA
Artificial Sequence primer 25 gttgtcccca tggtgcccaa gatgcgcagg
ctgatcacc 39 26 43 DNA Artificial Sequence primer 26 gtcctgcggc
cgcggatcct cacttataaa gcaaatgcac tcg 43 27 47 DNA Artificial
Sequence primer 27 ctctgcccca tggccgtgcc gaagctcatc accctgagaa
caaaccc 47 28 51 DNA Artificial Sequence primer 28 ggcccagggc
ggccgcactt acaggcccga gaccatgact cggaaggagg g 51 29 27 DNA
Artificial Sequence primer 29 cagggatgtt taataccact acaatgg 27 30
2826 DNA Homo sapiens 30 atggcttccc cgcggagctc cgggcagccc
gggccgccgc cgccgccgcc accgccgccc 60 gcgcgcctgc tactgctact
gctgctgccg ctgctgctgc ctctggcgcc cggggcctgg 120 ggctgggcgc
ggggcgcccc ccggccgccg cccagcagcc cgccgctctc catcatgggc 180
ctcatgccgc tcaccaagga ggtggccaag ggcagcatcg ggcgcggtgt gctccccgcc
240 gtggaactgg ccatcgagca gatccgcaac gagtcactcc tgcgccccta
cttcctcgac 300 ctgcggctct atgacacgga gtgcgacaac gcaaaagggt
tgaaagcctt ctacgatgca 360 ataaaatacg ggcctaacca cttgatggtg
tttggaggcg tctgtccatc cgtcacatcc 420 atcattgcag agtccctcca
aggctggaat ctggtgcagc tttcttttgc tgcaaccacg 480 cctgttctag
ccgataagaa aaaataccct tatttctttc ggaccgtccc atcagacaat 540
gcggtgaatc cagccattct gaagttgctc aagcactacc agtggaagcg cgtgggcacg
600 ctgacgcaag acgttcagag gttctctgag gtgcggaatg acctgactgg
agttctgtat 660 ggcgaggaca ttgagatttc agacaccgag agcttctcca
acgatccctg taccagtgtc 720 aaaaagctga aggggaatga tgtgcggatc
atccttggcc agtttgacca gaatatggca 780 gcaaaagtgt tctgttgtgc
atacgaggag aacatgtatg gtagtaaata tcagtggatc 840 attccgggct
ggtacgagcc ttcttggtgg gagcaggtgc acacggaagc caactcatcc 900
cgctgcctcc ggaagaatct gcttgctgcc atggagggct acattggcgt ggatttcgag
960 cccctgagct ccaagcagat caagaccatc tcaggaaaga ctccacagca
gtatgagaga 1020 gagtacaaca acaagcggtc aggcgtgggg cccagcaagt
tccacgggta cgcctacgat 1080 ggcatctggg tcatcgccaa gacactgcag
agggccatgg agacactgca tgccagcagc 1140 cggcaccagc ggatccagga
cttcaactac acggaccaca cgctgggcag gatcatcctc 1200 aatgccatga
acgagaccaa cttcttcggg gtcacgggtc aagttgtatt ccggaatggg 1260
gagagaatgg ggaccattaa atttactcaa tttcaagaca gcagggaggt gaaggtggga
1320 gagtacaacg ctgtggccga cacactggag atcatcaatg acaccatcag
gttccaagga 1380 tccgaaccac caaaagacaa gaccatcatc ctggagcagc
tgcggaagat ctccctacct 1440 ctctacagca tcctctctgc cctcaccatc
ctcgggatga tcatggccag tgcttttctc 1500 ttcttcaaca tcaagaaccg
gaatcagaag ctcataaaga tgtcgagtcc atacatgaac 1560 aaccttatca
tccttggagg gatgctctcc tatgcttcca tatttctctt tggccttgat 1620
ggatcctttg tctctgaaaa gacctttgaa acactttgca ccgtcaggac ctggattctc
1680 accgtgggct acacgaccgc ttttggggcc atgtttgcaa agacctggag
agtccacgcc 1740 atcttcaaaa atgtgaaaat gaagaagaag atcatcaagg
accagaaact gcttgtgatc 1800 gtggggggca tgctgctgat cgacctgtgt
atcctgatct gctggcaggc tgtggacccc 1860 ctgcgaagga cagtggagaa
gtacagcatg gagccggacc cagcaggacg ggatatctcc 1920 atccgccctc
tcctggagca ctgtgagaac acccatatga ccatctggct tggcatcgtc 1980
tatgcctaca agggacttct catgttgttc ggttgtttct tagcttggga gacccgcaac
2040 gtcagcatcc ccgcactcaa cgacagcaag tacatcggga tgagtgtcta
caacgtgggg 2100 atcatgtgca tcatcggggc cgctgtctcc ttcctgaccc
gggaccagcc caatgtgcag 2160 ttctgcatcg tggctctggt catcatcttc
tgcagcacca tcaccctctg cctggtattc 2220 gtgccgaagc tcatcaccct
gagaacaaac ccagatgcag caacgcagaa caggcgattc 2280 cagttcactc
agaatcagaa gaaagaagat tctaaaacgt ccacctcggt caccagtgtg 2340
aaccaagcca gcacatcccg cctggagggc ctacagtcag aaaaccatcg cctgcgaatg
2400 aagatcacag agctggataa agacttggaa gaggtcacca tgcagctgca
ggacacacca 2460 gaaaagacca cctacattaa acagaaccac taccaagagc
tcaatgacat cctcaacctg 2520 ggaaacttca ctgagagcac agatggagga
aaggccattt taaaaaatca cctcgatcaa 2580 aatccccagc tacagtggaa
cacaacagag ccctctcgaa catgcaaaga tcctatagaa 2640 gatataaact
ctccagaaca catccagcgt cggctgtccc tccagctccc catcctccac 2700
cacgcctacc tcccatccat cggaggcgtg gacgccagct gtgtcagccc ctgcgtcagc
2760 cccaccgcca gcccccgcca cagacatgtg ccaccctcct tccgagtcat
ggtctcgggc 2820 ctgtaa 2826 31 941 PRT Homo sapiens 31 Met Ala Ser
Pro Arg Ser Ser Gly Gln Pro Gly Pro Pro Pro Pro Pro 1 5 10 15 Pro
Pro Pro Pro Ala Arg Leu Leu Leu Leu Leu Leu Leu Pro Leu Leu 20 25
30 Leu Pro Leu Ala Pro Gly Ala Trp Gly Trp Ala Arg Gly Ala Pro Arg
35 40 45 Pro Pro Pro Ser Ser Pro Pro Leu Ser Ile Met Gly Leu Met
Pro Leu 50 55 60 Thr Lys Glu Val Ala Lys Gly Ser Ile Gly Arg Gly
Val Leu Pro Ala 65 70 75 80 Val Glu Leu Ala Ile Glu Gln Ile Arg Asn
Glu Ser Leu Leu Arg Pro 85 90 95 Tyr Phe Leu Asp Leu Arg Leu Tyr
Asp Thr Glu Cys Asp Asn Ala Lys 100 105 110 Gly Leu Lys Ala Phe Tyr
Asp Ala Ile Lys Tyr Gly Pro Asn His Leu 115 120 125 Met Val Phe Gly
Gly Val Cys Pro Ser Val Thr Ser Ile Ile Ala Glu 130 135 140 Ser Leu
Gln Gly Trp Asn Leu Val Gln Leu Ser Phe Ala Ala Thr Thr 145 150 155
160 Pro Val Leu Ala Asp Lys Lys Lys Tyr Pro Tyr Phe Phe Arg Thr Val
165 170 175 Pro Ser Asp Asn Ala Val Asn Pro Ala Ile Leu Lys Leu Leu
Lys His 180 185 190 Tyr Gln Trp Lys Arg Val Gly Thr Leu Thr Gln Asp
Val Gln Arg Phe 195 200 205 Ser Glu Val Arg Asn Asp Leu Thr Gly Val
Leu Tyr Gly Glu Asp Ile 210 215 220 Glu Ile Ser Asp Thr Glu Ser Phe
Ser Asn Asp Pro Cys Thr Ser Val 225 230 235 240 Lys Lys Leu Lys Gly
Asn Asp Val Arg Ile Ile Leu Gly Gln Phe Asp 245 250 255 Gln Asn Met
Ala Ala Lys Val Phe Cys Cys Ala Tyr Glu Glu Asn Met 260 265 270 Tyr
Gly Ser Lys Tyr Gln Trp Ile Ile Pro Gly Trp Tyr Glu Pro Ser 275 280
285 Trp Trp Glu Gln Val His Thr Glu Ala Asn Ser Ser Arg Cys Leu Arg
290 295 300 Lys Asn Leu Leu Ala Ala Met Glu Gly Tyr Ile Gly Val Asp
Phe Glu 305 310 315 320 Pro Leu Ser Ser Lys Gln Ile Lys Thr Ile Ser
Gly Lys Thr Pro Gln 325 330 335 Gln Tyr Glu Arg Glu Tyr Asn Asn Lys
Arg Ser Gly Val Gly Pro Ser 340 345 350 Lys Phe His Gly Tyr Ala Tyr
Asp Gly Ile Trp Val Ile Ala Lys Thr 355 360 365 Leu Gln Arg Ala Met
Glu Thr Leu His Ala Ser Ser Arg His Gln Arg 370 375 380 Ile Gln Asp
Phe Asn Tyr Thr Asp His Thr Leu Gly Arg Ile Ile Leu 385 390 395 400
Asn Ala Met Asn Glu Thr Asn Phe Phe Gly Val Thr Gly Gln Val Val 405
410 415 Phe Arg Asn Gly Glu Arg Met Gly Thr Ile Lys Phe Thr Gln Phe
Gln 420 425 430 Asp Ser Arg Glu Val Lys Val Gly Glu Tyr Asn Ala Val
Ala Asp Thr 435 440 445 Leu Glu Ile Ile Asn Asp Thr Ile Arg Phe Gln
Gly Ser Glu Pro Pro 450 455 460 Lys Asp Lys Thr Ile Ile Leu Glu Gln
Leu Arg Lys Ile Ser Leu Pro 465 470 475 480 Leu Tyr Ser Ile Leu Ser
Ala Leu Thr Ile Leu Gly Met Ile Met Ala 485 490 495 Ser Ala Phe Leu
Phe Phe Asn Ile Lys Asn Arg Asn Gln Lys Leu Ile 500 505 510 Lys Met
Ser Ser Pro Tyr Met Asn Asn Leu Ile Ile Leu Gly Gly Met 515 520 525
Leu Ser Tyr Ala Ser Ile Phe Leu Phe Gly Leu Asp Gly Ser Phe Val 530
535 540 Ser Glu Lys Thr Phe Glu Thr Leu Cys Thr Val Arg Thr Trp Ile
Leu 545 550 555 560 Thr Val Gly Tyr Thr Thr Ala Phe Gly Ala Met Phe
Ala Lys Thr Trp 565 570 575 Arg Val His Ala Ile Phe Lys Asn Val Lys
Met Lys Lys Lys Ile Ile 580 585 590 Lys Asp Gln Lys Leu Leu Val Ile
Val Gly Gly Met Leu Leu Ile Asp 595 600 605 Leu Cys Ile Leu Ile Cys
Trp Gln Ala Val Asp Pro Leu Arg Arg Thr 610 615 620 Val Glu Lys Tyr
Ser Met Glu Pro Asp Pro Ala Gly Arg Asp Ile Ser 625 630 635 640 Ile
Arg Pro Leu Leu Glu His Cys Glu Asn Thr His Met Thr Ile Trp 645 650
655 Leu Gly Ile Val Tyr Ala Tyr Lys Gly Leu Leu Met Leu Phe Gly Cys
660 665 670 Phe Leu Ala Trp Glu Thr Arg Asn Val Ser Ile Pro Ala Leu
Asn Asp 675 680 685 Ser Lys Tyr Ile Gly Met Ser Val Tyr Asn Val Gly
Ile Met Cys Ile 690 695 700 Ile Gly Ala Ala Val Ser Phe Leu Thr Arg
Asp Gln Pro Asn Val Gln 705 710 715 720 Phe Cys Ile Val Ala Leu Val
Ile Ile Phe Cys Ser Thr Ile Thr Leu 725 730 735 Cys Leu Val Phe Val
Pro Lys Leu Ile Thr Leu Arg Thr Asn Pro Asp 740 745 750 Ala Ala Thr
Gln Asn Arg Arg Phe Gln Phe Thr Gln Asn Gln Lys Lys 755 760 765 Glu
Asp Ser Lys Thr Ser Thr Ser Val Thr Ser Val Asn Gln Ala Ser 770 775
780 Thr Ser Arg Leu Glu Gly Leu Gln Ser Glu Asn His Arg Leu Arg Met
785 790 795 800 Lys Ile Thr Glu Leu Asp Lys Asp Leu Glu Glu Val Thr
Met Gln Leu 805 810 815 Gln Asp Thr Pro Glu Lys Thr Thr Tyr Ile Lys
Gln Asn His Tyr Gln 820 825 830 Glu Leu Asn Asp Ile Leu Asn Leu Gly
Asn Phe Thr Glu Ser Thr Asp 835 840 845 Gly Gly Lys Ala Ile Leu Lys
Asn His Leu Asp Gln Asn Pro Gln Leu 850 855 860 Gln Trp Asn Thr Thr
Glu Pro Ser Arg Thr Cys Lys Asp Pro Ile Glu 865 870 875 880 Asp Ile
Asn Ser Pro Glu His Ile Gln Arg Arg Leu Ser Leu Gln Leu 885 890 895
Pro Ile Leu His His Ala Tyr Leu Pro Ser Ile Gly Gly Val Asp Ala 900
905 910 Ser Cys Val Ser Pro Cys Val Ser Pro Thr Ala Ser Pro Arg His
Arg 915 920 925 His Val Pro Pro Ser Phe Arg Val Met Val Ser Gly Leu
930 935 940
* * * * *