U.S. patent application number 11/271444 was filed with the patent office on 2006-10-05 for compositions and methods for detecting group a streptococci.
This patent application is currently assigned to Gen-Probe Incorporated. Invention is credited to Paul M. Darby, Reinhold B. Pollner.
Application Number | 20060223080 11/271444 |
Document ID | / |
Family ID | 37570914 |
Filed Date | 2006-10-05 |
United States Patent
Application |
20060223080 |
Kind Code |
A1 |
Pollner; Reinhold B. ; et
al. |
October 5, 2006 |
Compositions and methods for detecting group a streptococci
Abstract
Compositions, methods and kits for detecting Group A
streptococci. Particularly described are oligonucleotides that are
useful as amplification primers and hybridization probes for
detecting very low levels of Group A streptococci nucleic
acids.
Inventors: |
Pollner; Reinhold B.; (San
Diego, CA) ; Darby; Paul M.; (San Diego, CA) |
Correspondence
Address: |
GEN PROBE INCORPORATED
10210 GENETIC CENTER DRIVE
SAN DIEGO
CA
92121
US
|
Assignee: |
Gen-Probe Incorporated
San Diego
CA
|
Family ID: |
37570914 |
Appl. No.: |
11/271444 |
Filed: |
November 9, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60626438 |
Nov 9, 2004 |
|
|
|
Current U.S.
Class: |
435/6.15 ;
536/24.1 |
Current CPC
Class: |
C12Q 1/689 20130101 |
Class at
Publication: |
435/006 ;
536/024.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04 |
Claims
1. A hybridization assay probe for detecting a Streptococcus
pyogenes nucleic acid comprising: a probe sequence that comprises a
target-complementary sequence of bases, and optionally one or more
base sequences that are not complementary to said nucleic acid that
is to be detected, wherein said target-complementary sequence of
bases consists of 13-22 contiguous bases contained within the
sequence of SEQ ID NO:3, or the complement thereof, allowing for
the presence of RNA and DNA equivalents and nucleotide analogs, and
wherein said hybridization assay probe has a length of up to 30
bases and does not comprise any other base sequences that hybridize
to nucleic acid derived from Streptococcus pyogenes.
2. The hybridization assay probe of claim 1, wherein said probe
sequence comprises said optional one or more base sequences that
are not complementary to said nucleic acid that is to be
detected.
3. The hybridization assay probe of claim 2, further comprising a
detectable label.
4. The hybridization assay probe of claim 2, further comprising a
fluorophore moiety and a quencher moiety, said hybridization assay
probe being a molecular beacon.
5. The hybridization assay probe of claim 4, wherein said
target-complementary sequence of bases is selected from the group
consisting of SEQ ID NO:23, SEQ ID NO:24 and SEQ ID NO:25.
6. The hybridization assay probe of claim 1, wherein said probe
sequence does not comprise said optional one or more base sequences
that are not complementary to said nucleic acid that is to be
detected.
7. The hybridization assay probe of claim 6, further comprising a
detectable label.
8. The hybridization assay probe of claim 7, wherein said
detectable is selected from the group consisting of a
chemiluminescent label and a fluorescent label.
9. The hybridization assay probe of claim 8, wherein said
target-complementary sequence of bases is selected from the group
consisting of SEQ ID NO:19, SEQ ID NO:20 and SEQ ID NO:21.
10. A kit for amplifying a Streptococcus pyogenes nucleic acid
sequence that may be present in a biological sample comprising: a
first primer that comprises a 3' terminal target-complementary
sequence and optionally a first primer upstream sequence that is
not complementary to said Streptococcus pyogenes nucleic acid
sequence that is to be amplified, said 3' terminal
target-complementary sequence of said first primer comprising 20
contiguous bases contained within SEQ ID NO:2, allowing for the
presence of RNA and DNA equivalents and nucleotide analogs; and a
second primer that comprises a 3' terminal target-complementary
sequence and optionally a second primer upstream sequence that is
not complementary to said Streptococcus pyogenes nucleic acid
sequence that is to be amplified, said 3' terminal
target-complementary sequence of said second primer comprising 26
contiguous bases contained within SEQ ID NO:1, allowing for the
presence of RNA and DNA equivalents and nucleotide analogs.
11. The kit of claim 10, wherein said first primer and said second
primer are each up to 60 bases in length.
12. The kit of claim 10, wherein said 3' terminal
target-complementary sequence of said first primer and said 3'
terminal target-complementary sequence of said second primer are
each up to 33 bases in length.
13. The kit of claim 12, wherein said 3' terminal
target-complementary sequence of said second primer is up to 28
bases in length.
14. The kit of claim 13, wherein said first primer comprises said
first primer upstream sequence.
15. The kit of claim 14, wherein said first primer upstream
sequence comprises a promoter sequence for T7 RNA polymerase.
16. The kit of claim 13, wherein said 3' terminal
target-complementary sequence of said first primer is selected from
the group consisting of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11,
SEQ ID NO:12 and SEQ ID NO:13, and wherein said 3' terminal
target-complementary sequence of said second primer is selected
from the group consisting of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6,
and SEQ ID NO:7.
Description
RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/626,438, filed Nov. 9, 2004. The entire
disclosure of this prior application is hereby incorporated by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the field of biotechnology.
More specifically, the invention relates to diagnostic assays for
detecting the nucleic acids of Group A streptococci (GAS).
BACKGROUND OF THE INVENTION
[0003] Streptococcus pyogenes, more commonly known as group A
.beta.-hemolytic Streptococcus, is the etiologic agent of a number
of infections in humans including acute pharyngitis, sinusitis,
lymphadenitis, pyoderma, endocarditis, meningitis, septicemia,
tonsillitis, impetigo, and upper respiratory tract infections.
Streptococcus pyogenes infections are of particular concern because
serious complications such as glomerulonephritis, rheumatic fever
and scarlet fever may result if left untreated. Group A
.beta.-hemolytic streptococci are universally susceptible to
penicillin G, a fact that makes antimicrobial susceptibility
testing for this organism unnecessary unless the patient is
allergic to penicillin.
[0004] Over ninety percent of all streptococcal infections are
caused by Streptococcus pyogenes. Asymptomatic carriers colonized
in the nasopharynx, skin, vagina or rectum are thought to transmit
this organism through close person-to-person contact. Contaminated
food may also be a source of transmission and infections in
humans.
[0005] Presumptive identification of Streptococcus pyogenes was
traditionally based upon physiological and biochemical traits.
These include colony morphology, .beta.-hemolytic activity on sheep
blood agar, gram strain, susceptibility to bacitracin, and the
ability to hydrolyze L-pyrrolidonyl-.beta.-naphthylamide (PYR).
Commercial antibody tests such as latex agglutination targeted the
Streptococcus group A antigen. Occasionally, these tests were shown
to react positively with some strains of Streptococcus anginosus
containing the group A antigen. In addition, these tests
occasionally required repeat testing due to equivocal results.
Serological grouping was the method of choice for definitive
identification of Streptococcus pyogenes. Lancefield serological
grouping is determined from group-specific carbohydrate antigen
extracted from cell walls and group-specific antisera. This method
can be time-consuming and costly, therefore most laboratories
relied on the traditional physiological and biochemical
methods.
[0006] More recently, DNA probe assays have aided in the diagnosis
of Group A Streptococcal pharyngitis from throat swabs. The DNA
probe assays use nucleic acid hybridization for the qualitative
detection of Group A Streptococcal DNA and RNA. Such tests offer a
non-subjective, accurate and rapid identification method for
definitively identifying Streptococcus pyogenes from throat swabs.
Identification is based upon the detection of specific ribosomal
RNA sequences that are unique to Streptococcus pyogenes. Such tests
identify Streptococcus pyogenes organisms from throat swabs within
60 minutes of sample preparation.
[0007] The present invention improves upon the DNA probe assays by:
increasing the sensitivity, precision and specific detection of
Group A streptococci; providing for the ability of qualitative and
quantitative measurements; and, increasing the speed of detection
of low target copy levels due to the combination of amplification
and detection in real-time.
SUMMARY OF THE INVENTION
[0008] A first aspect of the invention relates to a hybridization
assay probe for detecting a Streptococcus pyogenes nucleic acid.
This hybridization assay probe includes a probe sequence that has a
target-complementary sequence of bases, and optionally one or more
base sequences that are not complementary to the nucleic acid that
is to be detected. The target-complementary sequence of bases
consists of 13-22 contiguous bases contained within the sequence of
SEQ ID NO:3, or the complement thereof, allowing for the presence
of RNA and DNA equivalents and nucleotide analogs. In general, the
hybridization assay probe can have a length of up to 30 bases. In a
preferred embodiment, the probe sequence includes the optional base
sequences that are not complementary to the nucleic acid that is to
be detected. More preferably, the hybridization assay probe
includes a detectable label. For example, the probe may include a
fluorophore moiety and a quencher moiety. In such an instance, the
hybridization assay probe can be a molecular beacon. An exemplary
molecular beacon can include a target-complementary sequence of
bases selected from the group consisting of SEQ ID NO:23, SEQ ID
NO:24 and SEQ ID NO:25. In accordance with another preferred
embodiment, the probe sequence does not include the optional base
sequences that are not complementary to the nucleic acid that is to
be detected. More preferably, the hybridization assay probe
includes a detectable label. This detectable label can be either a
chemiluminescent label or a fluorescent label. An exemplary probe
can include a target-complementary sequence of bases selected from
the group consisting of SEQ ID NO:19, SEQ ID NO:20 and SEQ ID
NO:21.
[0009] Another aspect of the invention relates to a kit for
amplifying a Streptococcus pyogenes nucleic acid sequence that may
be present in a biological sample. The kit contains a first primer
that has a 3' terminal target-complementary sequence and optionally
a first primer upstream sequence that is not complementary to the
target nucleic acid sequence that is to be amplified. The 3'
terminal target-complementary sequence of this first primer
includes 20 contiguous bases contained within SEQ ID NO:2, allowing
for the presence of RNA and DNA equivalents and nucleotide analogs.
Also included in the kit is a second primer that has a 3' terminal
target-complementary sequence and optionally a second primer
upstream sequence that is not complementary to the target nucleic
acid sequence that is to be amplified. The 3' terminal
target-complementary sequence of the second primer includes 26
contiguous bases contained within SEQ ID NO:1, allowing for the
presence of RNA and DNA equivalents and nucleotide analogs. In a
preferred embodiment of the kit, the first primer and the second
primer are each up to 60 bases in length. In another preferred
embodiment, the 3' terminal target-complementary sequence of the
first primer and the 3' terminal target-complementary sequence of
the second primer are each up to 33 bases in length. When this is
the case, it is more preferable for the 3' terminal
target-complementary sequence of the second primer to be up to 28
bases in length. Still more preferably, the first primer includes a
first primer upstream sequence, such as a promoter sequence for T7
RNA polymerase. In accordance with another preferred embodiment of
the kit, when the 3' terminal target-complementary sequence of the
first primer is up to 33 bases in length, and when the 3' terminal
target-complementary sequence of the second primer is up to 28
bases in length, the 3' terminal target-complementary sequence of
the first primer is preferably selected from the group consisting
of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 and SEQ ID
NO:13, and the 3' terminal target-complementary sequence of the
second primer is preferably selected from the group consisting of
SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7.
DEFINITIONS
[0010] The following terms have the following meanings for the
purpose of this disclosure, unless expressly stated to the contrary
herein.
[0011] As used herein, a "biological sample" is any tissue or
polynucleotide-containing material obtained from a human, animal,
or environmental sample. Biological samples in accordance with the
invention include peripheral blood, plasma, serum or other body
fluid, bone marrow or other organ, biopsy tissues, or other
materials of biological origin. A biological sample may be treated
to disrupt tissue or cell structure, thereby releasing
intracellular components into a solution which may contain enzymes,
buffers, salts, detergents, and the like.
[0012] As used herein, "polynucleotide" means either RNA or DNA,
along with any synthetic nucleotide analogs or other molecules that
may be present in the sequence and that do not prevent
hybridization of the polynucleotide with a second molecule having a
complementary sequence.
[0013] As used herein, a "detectable label" is a chemical species
that can be detected or can lead to a detectable response.
Detectable labels in accordance with the invention can be linked to
polynucleotide probes either directly or indirectly, and include
radioisotopes, enzymes, haptens, chromophores such as dyes or
particles that impart a detectable color (e.g., latex beads or
metal particles), luminescent compounds (e.g., bioluminescent,
phosphorescent or chemiluminescent moieties), and fluorescent
compounds.
[0014] A "homogeneous detectable label" refers to a label that can
be detected in a homogeneous fashion by determining whether the
label is on a probe hybridized to a target sequence. That is,
homogeneous detectable labels can be detected without physically
removing hybridized from unhybridized forms of the label or labeled
probe. Homogeneous detectable labels are preferred when using
labeled probes for detecting GAS nucleic acids. Examples of
homogeneous labels have been described in detail by Arnold et al.,
U.S. Pat. No. 5,283,174; Woodhead et al., U.S. Pat. No. 5,656,207;
and, Nelson et al., U.S. Pat. No. 5,658,737. Preferred labels for
use in homogenous assays include chemiluminescent compounds (see,
e.g., Woodhead et al., U.S. Pat. No. 5,656,207; Nelson et al., U.S.
Pat. No. 5,658,737; and, Arnold et al., U.S. Pat. No. 5,639,604).
Preferred chemiluminescent labels are acridinium ester (AE)
compounds, such as standard AE or derivatives thereof (e.g.,
naphthyl-AE, ortho-AE, 1- or 3-methyl-AE, 2,7-dimethyl-AE,
4,5-dimethyl-AE, ortho-dibromo-AE, ortho-dimethyl-AE,
meta-dimethyl-AE, ortho-methoxy-AE, ortho-methoxy(cinnamyl)-AE,
ortho-methyl-AE, ortho-fluoro-AE, 1- or 3-methyl-ortho-fluoro-AE,
1- or 3-methyl-meta-difluoro-AE, and 2-methyl-AE).
[0015] A "homogeneous assay" refers to a detection procedure that
does not require physical separation of hybridized probe from
unhybridized probe prior to determining the extent of specific
probe hybridization. Exemplary homogeneous assays, such as those
described herein, can employ molecular beacons or other
self-reporting probes that emit fluorescent signals when hybridized
to an appropriate target, chemiluminescent acridinium ester labels
that can be selectively destroyed by chemical means unless present
in a hybrid duplex, and other homogeneously detectable labels that
will be familiar to those having an ordinary level of skill in the
art.
[0016] As used herein, "amplification" refers to an in vitro
procedure for obtaining multiple copies of a target nucleic acid
sequence, its complement or fragments thereof.
[0017] By "target nucleic acid" or "target" is meant a nucleic acid
containing a target nucleic acid sequence. In general, a target
nucleic acid sequence that is to be amplified will be positioned
between two oppositely disposed primers, and will include the
portion of the target nucleic acid that is fully complementary to
each of the primers.
[0018] By "target nucleic acid sequence" or "target sequence" or
"target region" is meant a specific deoxyribonucleotide or
ribonucleotide sequence comprising all or part of the nucleotide
sequence of a single-stranded nucleic acid molecule, and the
deoxyribonucleotide or ribonucleotide sequence complementary
thereto.
[0019] By "transcription associated amplification" is meant any
type of nucleic acid amplification that uses an RNA polymerase to
produce multiple RNA transcripts from a nucleic acid template. One
example of a transcription associated amplification method, called
"Transcription Mediated Amplification" (TMA), generally employs an
RNA polymerase, a DNA polymerase, deoxyribonucleoside
triphosphates, ribonucleoside triphosphates, and a
promoter-template complementary oligonucleotide, and optionally may
include one or more analogous oligonucleotides. Variations of TMA
are well known in the art as disclosed in detail in Burg et al.,
U.S. Pat. No. 5,437,990; Kacian et al., U.S. Pat. Nos. 5,399,491
and 5,554,516; Kacian et al., PCT Int'l Publ. No. WO 93/22461;
Gingeras et al., PCT Int'l Publ. No. WO 88/01302; Gingeras et al.,
PCT Int'l Publ. No. WO 88/10315; Malek et al., U.S. Pat. No.
5,130,238; Urdea et al., U.S. Pat. Nos. 4,868,105 and 5,124,246;
McDonough et al., PCT Int'l Publ. No. WO 94/03472; and, Ryder et
al., PCT Int'l Publ. No. WO 95/03430. The methods of Kacian et al.
are preferred for conducting nucleic acid amplification procedures
of the type disclosed herein.
[0020] As used herein, an "oligonucleotide" or "oligomer" is a
polymeric chain of at least two, generally between about five and
about 100, chemical subunits, each subunit comprising a nucleotide
base moiety, a sugar moiety, and a linking moiety that joins the
subunits in a linear spacial configuration. Common nucleotide base
moieties are guanine (G), adenine (A), cytosine (C), thymine (T)
and uracil (U), although other rare or modified nucleotide bases
able to hydrogen bond are well known to those skilled in the art.
Oligonucleotides may optionally include analogs of any of the sugar
moieties, the base moieties, and the backbone constituents.
Preferred oligonucleotides of the present invention fall in a size
range of about 10 to about 100 residues. Oligonucleotides may be
purified from naturally occurring sources, but preferably are
synthesized using any of a variety of well known enzymatic or
chemical methods.
[0021] As used herein, a "probe" is an oligonucleotide that
hybridizes specifically to a target sequence in a nucleic acid,
preferably in an amplified nucleic acid, under conditions that
promote hybridization, to form a detectable hybrid. A probe
optionally may contain a detectable moiety which either may be
attached to the end(s) of the probe or may be internal. The
nucleotides of the probe that combine with the target
polynucleotide need not be strictly contiguous, as may be the case
with a detectable moiety internal to the sequence of the probe.
Detection may either be direct (i.e., resulting from a probe
hybridizing directly to the target sequence or amplified nucleic
acid) or indirect (i.e., resulting from a probe hybridizing to an
intermediate molecular structure that links the probe to the target
sequence or amplified nucleic acid). The "target" of a probe
generally refers to a sequence contained within an amplified
nucleic acid sequence which hybridizes specifically to at least a
portion of a probe oligonucleotide using standard hydrogen bonding
(i.e., base pairing). A probe may comprise target-specific
sequences and optionally other sequences that are non-complementary
to the target sequence that is to be detected. These
non-complementary sequences may comprise a promoter sequence, a
restriction endonuclease recognition site, or sequences that
contribute to three-dimensional conformation of the probe (see,
e.g., Lizardi et al., U.S. Pat. Nos. 5,118,801 and 5,312,728).
Sequences that are "sufficiently complementary" allow stable
hybridization of a probe oligonucleotide to a target sequence that
is not completely complementary to the probe's target-specific
sequence.
[0022] As used herein, an "amplification primer" is an
oligonucleotide that hybridizes to a target nucleic acid, or its
complement, and participates in a nucleic acid amplification
reaction. For example, amplification primers, or more simply
"primers," may be optionally modified oligonucleotides that are
capable of hybridizing to a template nucleic acid and that have a
3' end that can be extended by a DNA polymerase activity. In
general, a primer will have a downstream sequence that is
complementary to GAS nucleic acids, and optionally an upstream
sequence that is not complementary to GAS nucleic acids. The
optional upstream sequence may, for example, serve as an RNA
polymerase promoter or contain restriction endonuclease cleavage
sites.
[0023] By "substantially homologous," "substantially corresponding"
or "substantially corresponds" is meant that the subject
oligonucleotide has a base sequence containing an at least 10
contiguous base region that is at least 70% homologous, preferably
at least 80% homologous, more preferably at least 90% homologous,
and most preferably 100% homologous, to an at least 10 contiguous
base region present in a reference base sequence (excluding RNA and
DNA equivalents). Those skilled in the art will readily appreciate
modifications that could be made to the hybridization assay
conditions at various percentages of homology to permit
hybridization of the oligonucleotide to the target sequence while
preventing unacceptable levels of non-specific hybridization. The
degree of similarity is determined by comparing the order of
nucleobases making up the two sequences and does not take into
consideration other structural differences which may exist between
the two sequences, provided the structural differences do not
prevent hydrogen bonding with complementary bases. The degree of
homology between two sequences can also be expressed in terms of
the number of base mismatches present in each set of at least 10
contiguous bases being compared, which may range from 0-2 base
differences.
[0024] By "substantially complementary" is meant that the subject
oligonucleotide has a base sequence containing an at least 10
contiguous base region that is at least 70% complementary,
preferably at least 80% complementary, more preferably at least 90%
complementary, and most preferably 100% complementary, to an at
least 10 contiguous base region present in a target nucleic acid
sequence (excluding RNA and DNA equivalents). Those skilled in the
art will readily appreciate modifications that could be made to the
hybridization assay conditions at various percentages of
complementarity to permit hybridization of the oligonucleotide to
the target sequence while preventing unacceptable levels of
non-specific hybridization. The degree of complementarity is
determined by comparing the order of nucleobases making up the two
sequences and does not take into consideration other structural
differences which may exist between the two sequences, provided the
structural differences do not prevent hydrogen bonding with
complementary bases. The degree of complementarity between two
sequences can also be expressed in terms of the number of base
mismatches present in each set of at least 10 contiguous bases
being compared, which may range from 0-2 base mismatches.
[0025] By "sufficiently complementary" is meant a contiguous
nucleic acid base sequence that is capable of hybridizing to
another base sequence by hydrogen bonding between a series of
complementary bases. Complementary base sequences may be
complementary at each position in the base sequence of an
oligonucleotide using standard base pairing (e.g., G:C, A:T or A:U
pairing) or may contain one or more residues that are not
complementary using standard hydrogen bonding (including a basic
nucleotides), but in which the entire complementary base sequence
is capable of specifically hybridizing with another base sequence
under appropriate hybridization conditions. Contiguous bases are
preferably at least about 80%, more preferably at least about 90%,
and most preferably about 100%, complementary to a sequence to
which an oligonucleotide is intended to specifically hybridize.
Appropriate hybridization conditions are well known to those
skilled in the art, can be predicted readily based on base sequence
composition, or can be determined empirically by using routine
testing (see, e.g., Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2.sup.nd ed. (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, N.Y., 1989) at .sctn..sctn. 1.90-1.91,
7.37-7.57, 9.47-9.51 and 11.47-11.57, particularly at .sctn..sctn.
9.50-9.51, 11.12-11.13, 11.45-11.47 and 11.55-11.57).
[0026] By "capture oligonucleotide" is meant at least one nucleic
acid oligonucleotide that provides means for specifically joining a
target sequence and an immobilized oligonucleotide due to base pair
hybridization. A capture oligonucleotide preferably includes two
binding regions: a target sequence-binding region and an
immobilized probe-binding region. Usually the two binding regions
are contiguous on the same oligonucleotide, although the capture
oligonucleotide may include a target sequence-binding region and an
immobilized probe-binding region that are present on two different
oligonucleotides joined together by one or more linkers. For
example, an immobilized probe-binding region may be present on a
first oligonucleotide, the target sequence-binding region may be
present on a second oligonucleotide, and the two different
oligonucleotides are joined by hydrogen bonding with a linker that
is a third oligonucleotide containing sequences that hybridize
specifically to the sequences of the first and second
oligonucleotides.
[0027] By "immobilized probe" or "immobilized nucleic acid" is
meant a nucleic acid that joins, directly or indirectly, a capture
oligonucleotide to an immobilized support. An immobilized probe is
an oligonucleotide joined to a solid support that facilitates
separation of bound target sequence from unbound material in a
sample.
[0028] By "separating" or "purifying" is meant that one or more
components of the biological sample are removed from one or more
other components of the sample. Sample components include nucleic
acids in a generally aqueous solution phase which may also include
materials such as proteins, carbohydrates, lipids, and labeled
probes. Preferably, the separating or purifying step removes at
least about 70%, more preferably at least about 90%, and even more
preferably at least about 95%, of the other components present in
the sample.
[0029] By "RNA and DNA equivalents" or "RNA and DNA equivalent
bases" is meant molecules, such as RNA and DNA, having the same
complementary base pair hybridization properties. RNA and, DNA
equivalents have different sugar moieties (i.e., ribose versus
deoxyribose) and may differ by the presence of uracil in RNA and
thymine in DNA. The differences between RNA and DNA equivalents do
not contribute to differences in homology because the equivalents
have the same degree of complementarity to a particular
sequence.
[0030] By "consisting essentially of" is meant that additional
component(s), composition(s) or method step(s) that do not
materially change the basic and novel characteristics of the
present invention may be included in the compositions or kits or
methods of the present invention. Such characteristics include the
ability to selectively detect GAS nucleic acids in biological
samples such as whole blood or plasma. Any component(s),
composition(s) or method step(s) that have a material effect on the
basic and novel characteristics of the present invention would fall
outside of this term.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 is a schematic diagram illustrating the various
polynucleotides that can be used for detecting a target region
within the GAS nucleic acid (represented by a thick horizontal
line). Positions of the following nucleic acids are shown relative
to the target region: "Non-T7 Primer" and "T7 Promoter-Primer"
represent two amplification primers used for conducting TMA, where
"P" indicates the promoter sequence of the T7 promoter-primer; and
"Probe" refers to the probe used for detecting amplified nucleic
acid.
DETAILED DESCRIPTION OF THE DRAWINGS
[0032] Disclosed herein are compositions, methods and kits for
selectively detecting GAS nucleic acids in biological samples such
as blood, plasma, serum or other body fluid, or tissue. The
primers, probes and methods of the invention can be used in
diagnostic applications.
Introduction and Overview
[0033] The present invention includes compositions (primers and
probes), methods and kits that are particularly useful for
detecting GAS nucleic acids in a biological sample. To design
oligonucleotide sequences appropriate for such uses, known GAS
nucleic acid sequences were first compared to identify candidate
regions of the bacterial genome that could serve as targets in a
diagnostic assay. As a result of these comparisons, three different
regions of the GAS genome (SEQ ID NOs:1-3) were selected as targets
for detection using the primers and probes shown schematically in
FIG. 1. Portions of sequences containing relatively few variants
between the compared sequences were chosen as starting points for
designing synthetic oligonucleotides suitable for use in
amplification and detection of amplified sequences.
[0034] Based on these analyses, the amplification primer and probe
sequences presented below were designed. Those having an ordinary
level of skill in the art will appreciate that any primer sequences
specific for GAS or other bacterial target, with or without a T7
promoter sequence, may be used as primers in the various
primer-based in vitro amplification methods described below. It is
also contemplated that oligonucleotides having the sequences
disclosed herein could serve alternative functions in assays for
detecting GAS nucleic acids. For example, the hybridization probes
disclosed herein could be used as amplification primers, and the
amplification primers disclosed herein could be used as
hybridization probes in alternative detection assays. It is further
contemplated that capture oligonucleotides may be used to hybridize
to and capture a target nucleic acid prior to amplification.
[0035] The amplification primers disclosed herein are particularly
contemplated as components of multiplex amplification reactions
wherein several amplicon species can be produced from an assortment
of target-specific primers. For example, it is contemplated that
certain preferred GAS-specific primers disclosed herein can be used
in multiplex amplification reactions that are capable of amplifying
polynucleotides of unrelated bacteria without substantially
compromising the sensitivities of those assays.
Useful Amplification Methods
[0036] Amplification methods useful in connection with the present
invention include Transcription Mediated Amplification (TMA),
Nucleic Acid Sequence-Based Amplification (NASBA), the Polymerase
Chain Reaction (PCR), Strand Displacement Amplification (SDA), and
amplification methods using self-replicating polynucleotide
molecules and replication enzymes such as MDV-1 RNA and Q-beta
enzyme. Methods for carrying out these various amplification
techniques can be found respectively in U.S. Pat. No. 5,399,491;
published European Patent Appl. No. EP 0 525 882; U.S. Pat. No.
4,965,188; U.S. Pat. No. 5,455,166; U.S. Pat. No. 5,472,840; and,
Lizardi et al., BioTechnology 6:1197 (1988). The disclosures of
these documents which describe how to perform nuleic acid
amplification reactions are hereby incorporated by reference.
[0037] In a highly preferred embodiment of the invention, GAS
nucleic acid sequences are amplified using a TMA protocol.
According to this protocol, the reverse transcriptase which
provides the DNA polymerase activity also possesses an endogenous
RNase H activity. One of the primers used in this procedure
contains a promoter sequence positioned upstream of a sequence that
is complementary to one strand of a target nucleic acid that is to
be amplified. In the first step of the amplification, a
promoter-primer hybridizes to the GAS target at a defined site.
Reverse transcriptase creates a complementary DNA copy of the
target RNA by extension from the 3' end of the promoter-primer.
Following interaction of an opposite strand primer with the newly
synthesized DNA strand, a second strand of DNA is synthesized from
the end of the primer by reverse transcriptase, thereby creating a
double-stranded DNA molecule. RNA polymerase recognizes the
promoter sequence in this double-stranded DNA template and
initiates transcription. Each of the newly synthesized RNA
amplicons re-enters the TMA process and serves as a template for a
new round of replication, thereby leading to an exponential
expansion of the RNA amplicon. Since each of the DNA templates can
make 100-1000 copies of RNA amplicon, this expansion can result in
the production of 10 billion amplicons in less than one hour. The
entire process is autocatalytic and is performed at a constant
temperature.
Structural Features of Primers
[0038] As indicated above, a "primer" refers to an optionally
modified oligonucleotide that is capable of participating in a
nucleic acid amplification reaction. Preferred primers are capable
of hybridizing to a template nucleic acid and have a 3' end that
can be extended by a DNA polymerase activity. The 5' region of the
primer may be non-complementary to the target nucleic acid. If the
5' non-complementary region includes a promoter sequence, it is
referred to as a "promoter-primer." Those skilled in the art will
appreciate that any oligonucleotide that can function as a primer
(i.e., an oligonucleotide that hybridizes specifically to a target
sequence and has a 3' end capable of extension by a DNA polymerase
activity) can be modified to include a 5' promoter sequence, and
thus could function as a promoter-primer. Similarly, any
promoter-primer can be modified by removal of, or synthesis
without, a promoter sequence and still function as a primer.
[0039] Nucleotide base moieties of primers may be modified (e.g.,
by the addition of propyne groups), so long as the modified base
moiety retains the ability to form a non-covalent association with
G, A, C, T or U, and so long as an oligonucleotide comprising at
least one modified nucleotide base moiety or analog is not
sterically prevented from hybridizing with a single-stranded
nucleic acid. As indicated below in connection with the chemical
composition of useful probes, the nitrogenous bases of primers in
accordance with the invention may be conventional bases (A, G, C,
T, U), known analogs thereof (e.g., inosine or "I" having
hypoxanthine as its base moiety; see The Biochemistry of the
Nucleic Acids 5-36, Adams et al., ed., 11.sup.th ed., 1992), known
derivatives of purine or pyrimidine bases (e.g., N.sup.4-methyl
deoxyguanosine, deaza- or aza-purines and deaza- or
aza-pyrimidines, pyrimidine bases having substituent groups at the
5 or 6 position, purine bases having an altered or a replacement
substituent at the 2, 6 or 8 positions,
2-amino-6-methylaminopurine, O.sup.6-methylguanine,
4-thio-pyrimidines, 4-amino-pyrimidines,
4-dimethylhydrazine-pyrimidines, and O.sup.4-alkyl-pyrimidines (see
Cook, PCT Int'l Pub. No. WO 93/13121)), and "abasic" residues where
the backbone includes no nitrogenous base for one or more residues
of the polymer (see Arnold et al., U.S. Pat. No. 5,585,481). Common
sugar moieties that comprise the primer backbone include ribose and
deoxyribose, although 2'-O-methyl ribose (2'-OMe), halogenated
sugars, and other modified sugar moieties may also be used.
Usually, the linking group of the primer backbone is a
phosphorus-containing moiety, most commonly a phosphodiester
linkage, although other linkages, such as, for example,
phosphorothioates, methylphosphonates, and
non-phosphorus-containing linkages such as the linkages found in
"locked nucleic acids" (LNA) and the peptide-like linkages found in
"peptide nucleic acids" (PNA) also are intended for use in the
assay disclosed herein.
Useful Probe Labeling Systems and Detectable Moieties
[0040] Essentially any labeling and detection system that can be
used for monitoring specific nucleic acid hybridization can be used
in conjunction with the present invention. Included among the
collection of useful labels are radiolabels, enzymes, haptens,
linked oligonucleotides, chemiluminescent molecules, fluorescent
moieties (either alone or in combination with "quencher" moieties),
and redox-active moieties that are amenable to electronic detection
methods. Preferred chemiluminescent molecules include acridinium
esters of the type disclosed in Arnold et al., U.S. Pat. No.
5,283,174 for use in connection with homogenous protection assays,
and of the type disclosed in Woodhead et al., U.S. Pat. No.
5,656,207 for use in connection with assays that quantify multiple
targets in a single reaction. The disclosures contained in these
patent documents are hereby incorporated by reference. Preferred
electronic labeling and detection approaches are disclosed in U.S.
Pat. Nos. 5,591,578 and 5,770,369, and PCT Int'l Publ. No. WO
98/57158, the disclosures of which are hereby incorporated by
reference. Redox active moieties useful as labels in the present
invention include transition metals such as Cd, Mg, Cu, Co, Pd, Zn,
Fe, and Ru.
[0041] Particularly preferred detectable labels for probes in
accordance with the present invention are detectable in homogeneous
assay systems (i.e., where, in a mixture, bound labeled probe
exhibits a detectable change, such as stability or differential
degradation, compared to unbound labeled probe). While other
homogeneously detectable labels, such as fluorescent labels and
electronically detectable labels, are intended for use in the
practice of the present invention, a preferred label for use in
homogenous assays is a chemiluminescent compound (e.g., as
described in Woodhead et al., U.S. Pat. No. 5,656,207; Nelson et
al., U.S. Pat. No. 5,658,737; or Arnold et al., U.S. Pat. No.
5,639,604). Particularly preferred chemiluminescent labels include
acridinium ester (AE) compounds, such as standard AE or derivatives
thereof, such as naphthyl-AE, ortho-AE, 1- or 3-methyl-AE,
2,7-dimethyl-AE, 4,5-dimethyl-AE, ortho-dibromo-AE,
ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE,
ortho-methoxy(cinnamyl)-AE, ortho-methyl-AE, ortho-fluoro-AE, 1- or
3-methyl-ortho-fluoro-AE, 1- or 3-methyl-meta-difluoro-AE, and
2-methyl-AE.
[0042] In some applications, probes exhibiting at least some degree
of self-complementarity are desirable to facilitate detection of
probe:target duplexes in a test sample without first requiring the
removal of unhybridized probe prior to detection. By way of
example, structures referred to as "molecular torches" are designed
to include distinct regions of self-complementarity (coined "the
target binding domain" and "the target closing domain") which are
connected by a joining region and which hybridize to one another
under predetermined hybridization assay conditions. When exposed to
denaturing conditions, the two complementary regions of the
molecular torch, which may be fully or partially complementary,
melt, leaving the target binding domain available for hybridization
to a target sequence when the predetermined hybridization assay
conditions are restored. Molecular torches are designed so that the
target binding domain favors hybridization to the target sequence
over the target closing domain. The target binding domain and the
target closing domain of a molecular torch include interacting
labels (e.g., a fluorescent/quencher pair) positioned so that a
different signal is produced when the molecular torch is
self-hybridized as opposed to when the molecular torch is
hybridized to a target nucleic acid, thereby permitting detection
of probe:target duplexes in a test sample in the presence of
unhybridized probe having a viable label associated therewith.
Molecular torches are fully described in U.S. Pat. No. 6,361,945,
the disclosure of which is hereby incorporated by reference.
[0043] Another example of a self-complementary hybridization assay
probe that may be used in conjunction with the invention is a
structure commonly referred to as a "molecular beacon." Molecular
beacons comprise nucleic acid molecules having a target
complementary sequence, an affinity pair (or nucleic acid arms)
that holds the probe in a closed conformation in the absence of a
target nucleic acid sequence, and a label pair that interacts when
the probe is in a closed conformation. Hybridization of the
molecular beacon target complementary sequence to the target
nucleic acid separates the members of the affinity pair, thereby
shifting the probe to an open conformation. The shift to the open
conformation is detectable due to reduced interaction of the label
pair, which may be, for example, a fluorophore and a quencher
(e.g., DABCYL and EDANS). Molecular beacons are fully described in
U.S. Pat. No. 5,925,517, the disclosure of which is hereby
incorporated by reference. Molecular beacons useful for detecting
GAS-specific nucleic acid sequences may be created by appending to
either end of one of the probe sequences disclosed herein, a first
nucleic acid arm comprising a fluorophore and a second nucleic acid
arm comprising a quencher moiety. In this configuration, the
GAS-specific probe sequence disclosed herein serves as the
target-complementary "loop" portion of the resulting molecular
beacon.
[0044] Molecular beacons are preferably labeled with an interactive
pair of detectable labels. Preferred detectable labels interact
with each other by FRET or non-FRET energy transfer mechanisms.
Fluorescence resonance energy transfer (FRET) involves the
radiationless transmission of energy quanta from the site of
absorption to the site of its utilization in the molecule or system
of molecules by resonance interaction between chromophores, over
distances considerably greater than interatomic distances, without
conversion to thermal energy, and without the donor and acceptor
coming into kinetic collision. The "donor" is the moiety that
initially absorbs the energy, and the "acceptor" is the moiety to
which the energy is subsequently transferred. In addition to FRET,
there are at least three other "non-FRET" energy transfer processes
by which excitation energy can be transferred from a donor to an
acceptor molecule.
[0045] When two labels are held sufficiently close such that energy
emitted by one label can be received or absorbed by the second
label, whether by a FRET or non-FRET mechanism, the two labels are
said to be in an "energy transfer relationship." This is the case,
for example, when a molecular beacon is maintained in the closed
state by formation of a stem duplex and fluorescent emission from a
fluorophore attached to one arm of the molecular beacon is quenched
by a quencher moiety on the other arm.
[0046] Highly preferred label moieties for the invented molecular
beacons include a fluorophore and a second moiety having
fluorescence quenching properties (i.e., a "quencher"). In this
embodiment, the characteristic signal is likely fluorescence of a
particular wavelength, but alternatively could be a visible light
signal. When fluorescence is involved, changes in emission are
preferably due to FRET, or to radiative energy transfer or non-FRET
modes. When a molecular beacon having a pair of interactive labels
in the closed state is stimulated by an appropriate frequency of
light, a fluorescent signal is generated at a first level, which
may be very low. When this same molecular beacon is in the open
state and is stimulated by an appropriate frequency of light, the
fluorophore and the quencher moieties are sufficiently separated
from each other such that energy transfer between them is
substantially precluded. Under that condition, the quencher moiety
is unable to quench the fluorescence from the fluorophore moiety.
If the fluorophore is stimulated by light energy of an appropriate
wavelength, a fluorescent signal of a second level, higher than the
first level, will be generated. The difference between the two
levels of fluorescence is detectable and measurable. Using
fluorophore and quencher moieties in this manner, the molecular
beacon is only "on" in the "open" conformation and indicates that
the probe is bound to the target by emanating an easily detectable
signal. The conformational state of the probe alters the signal
generated from the probe by regulating the interaction between the
label moieties.
[0047] Examples of donor/acceptor label pairs that may be used in
connection with the invention, making no attempt to distinguish
FRET from non-FRET pairs, include fluorescein/tetramethylrhodamine,
IAEDANS/fluorescein, EDANS/DABCYL, coumarin/DABCYL,
fluorescein/fluorescein, BODIPY FL/BODIPY FL, fluorescein/DABCYL,
lucifer yellow/DABCYL, BODIPY/DABCYL, eosine/DABCYL,
erythrosine/DABCYL, tetramethylrhodamine/DABCYL, Texas Red/DABCYL,
CY5/BH1, CY5/BH2, CY3/BH1, CY3/BH2, and fluorescein/QSY7 dye. Those
having an ordinary level of skill in the art will understand that
when donor and acceptor dyes are different, energy transfer can be
detected by the appearance of sensitized fluorescence of the
acceptor or by quenching of donor fluorescence. When the donor and
acceptor species are the same, energy can be detected by the
resulting fluorescence depolarization. Non-fluorescent acceptors
such as DABCYL and the QSY 7 dyes advantageously eliminate the
potential problem of background fluorescence resulting from direct
(i.e., non-sensitized) acceptor excitation. Preferred fluorophore
moieties that can be used as one member of a donor-acceptor pair
include fluorescein, ROX, and the CY dyes (such as CY5). Highly
preferred quencher moieties that can be used as another member of a
donor-acceptor pair include DABCYL and the BLACK HOLE QUENCHER
moieties which are available from Biosearch Technologies, Inc.
(Novato, Calif.).
[0048] Synthetic techniques and methods of bonding labels to
nucleic acids and detecting labels are well known in the art (see,
e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual,
2.sup.nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989), Chapter 10; Nelson et al., U.S. Pat. No.
5,658,737; Woodhead et al., U.S. Pat. No. 5,656,207; Hogan et al.,
U.S. Pat. No. 5,547,842; Arnold et al., U.S. Pat. No. 5,283,174;
Kourilsky et al., U.S. Pat. No. 4,581,333; and, Becker et al.,
European Patent Appl. No. EP 0 747 706).
Chemical Composition of Probes
[0049] Probes in accordance with the invention comprise
polynucleotides or polynucleotide analogs, and optionally carry a
detectable label covalently bound thereto. Nucleosides or
nucleoside analogs of the probe comprise nitrogenous heterocyclic
bases or base analogs, where the nucleosides are linked together,
for example, by phosphodiester bonds to form a polynucleotide.
Accordingly, a probe may comprise conventional ribonucleic acid
(RNA) and/or deoxyribonucleic acid (DNA), but also may comprise
chemical analogs of these molecules. The probe backbone may be made
up from a variety of linkages known in the art, including one or
more sugar-phosphodiester linkages, locked nucleic acid (LNA)
bonds, peptide-nucleic acid bonds (sometimes referred to as
"peptide nucleic acids" as described in Hyldig-Nielsen et al., PCT
Int'l Publ. No. WO 95/32305), phosphorothioate linkages,
methylphosphonate linkages, or combinations thereof. Sugar moieties
of the probe may be either ribose or deoxyribose, or similar
compounds having known substitutions, such as, for example,
2'-O-methyl ribose and 2' halide substitutions (e.g., 2'-F). The
nitrogenous bases may be conventional bases (A, G, C, T, U), known
analogs thereof (e.g., inosine or "I"; see The Biochemistry of the
Nucleic Acids 5-36, Adams et al., ed., 11.sup.th ed., 1992), known
derivatives of purine or pyrimidine bases (e.g., N.sup.4-methyl
deoxygaunosine, deaza- or aza-purines and deaza- or
aza-pyrimidines, pyrimidine bases having substituent groups at the
5 or 6 position, purine bases having an altered or a replacement
substituent at the 2, 6 or 8 positions,
2-amino-6-methylaminopurine, O.sup.6-methylguanine,
4-thio-pyrimidines, 4-amino-pyrimidines,
4-dimethylhydrazine-pyrimidines, and O.sup.4-alkyl-pyrimidines (see
Cook, PCT Int'l Publ. No. WO 93/13121)), and "abasic" residues
where the backbone includes no nitrogenous base for one or more
residues of the polymer (see Arnold et al., U.S. Pat. No.
5,585,481). A probe may comprise only conventional sugars, bases
and linkages found in RNA and DNA, or may include both conventional
components and substitutions (e.g., conventional bases linked via a
methoxy backbone, or a nucleic acid including conventional bases
and one or more base analogs).
[0050] While oligonucleotide probes of different lengths and base
composition may be used for detecting GAS nucleic acids, preferred
probes in this invention have lengths of up to 30 nucleotides, and
more preferably within the length range of 13 to 27 nucleotides.
However, the specific probe sequences described below may also be
provided in a nucleic acid cloning vector or transcript or other
longer nucleic acid and still be used for detecting GAS nucleic
acids.
Selection of GAS-Specific Amplification Primers and Detection
Probes
[0051] Useful guidelines for designing amplification primers and
probes with desired characteristics are described herein. The
optimal sites for amplifying and probing GAS nucleic acids are
three conserved regions of the GAS genome, each greater than about
20 bases in length, within about 200 bases of contiguous sequence.
The degree of amplification observed with a set of primers,
including one or more promoter-primers, depends on several factors
including the ability of the oligonucleotides to hybridize to their
complementary sequences and their ability to be extended
enzymatically. Because the extent and specificity of hybridization
reactions are affected by a number of factors, manipulation of
those factors will determine the exact sensitivity and specificity
of a particular oligonucleotide, whether perfectly complementary to
its target or not. The effects of varying assay conditions are
known to those skilled in the art, and are described in Hogan et
al., U.S. Pat. No. 5,840,488, the disclosure of which is hereby
incorporated by reference.
[0052] The length of the target nucleic acid sequence and,
accordingly, the length of the primer sequence or probe sequence
can be important. In some cases, there may be several sequences
from a particular target region, varying in location and length,
that will yield primers or probes having the desired hybridization
characteristics. While it is possible for nucleic acids that are
not perfectly complementary to hybridize, the longest stretch of
perfectly homologous base sequence will normally determine hybrid
stability.
[0053] Amplification primers and probes should be positioned to
minimize the stability of an oligonucleotide:nontarget nucleic acid
hybrid. It is preferred that the amplification primers and probes
are able to distinguish between target and non-target sequences. In
designing primers and probes, the differences in melting
temperature, represented by T.sub.m values, should be as large as
possible (e.g., at least 2.degree. C., and preferably 5.degree.
C.).
[0054] The degree of non-specific extension (primer-dimer or
non-target copying) can also affect amplification efficiency. For
this reason, primers are selected to have low self- or
cross-complementarity, particularly at the 3' ends of the sequence.
Long homopolymer tracts and high GC content are avoided to reduce
spurious primer extension. Commercially available computer software
can aid in this aspect of the design. Available computer programs
include MacDNASIS.TM. 2.0 (Hitachi Software Engineering American
Ltd.) and OLIGO ver. 6.6 (Molecular Biology Insights; Cascade,
Colo.).
[0055] Those having an ordinary level of skill in the art will
appreciate that hybridization involves the association of two
single strands of complementary nucleic acid to form a hydrogen
bonded double strand. It is implicit that if one of the two strands
is wholly or partially involved in a hybrid, then that strand will
be less able to participate in formation of a new hybrid. By
designing primers and probes so that substantial portions of the
sequences of interest are single stranded, the rate and extent of
hybridization may be greatly increased. If the target is an
integrated genomic sequence, then it will naturally occur in a
double stranded form (as is the case with the product of the
polymerase chain reaction). These double-stranded targets are
naturally inhibitory to hybridization with a probe and require
denaturation prior to the hybridization step.
[0056] The rate at which a polynucleotide hybridizes to its target
is a measure of the thermal stability of the target secondary
structure in the target binding region. The standard measurement of
hybridization rate is the C.sub.0t.sub.1/2, which is measured as
moles of nucleotide per liter multiplied by seconds. Thus, it is
the concentration of probe multiplied by the time at which 50% of
maximal hybridization occurs at that concentration. This value is
determined by hybridizing various amounts of polynucleotide to a
constant amount of target for a fixed time. The C.sub.0t.sub.1/2 is
found graphically by standard procedures familiar to those having
an ordinary level of skill in the art.
Preferred Amplification Primers
[0057] Primers useful for conducting amplification reactions can
have different lengths to accommodate the presence of extraneous
sequences that do not participate in target binding and that may
not substantially affect amplification or detection procedures. For
example, promoter-primers useful for performing amplification
reactions in accordance with the invention have at least a minimal
sequence that hybridizes to the GAS target nucleic acid and a
promoter sequence positioned upstream of that minimal sequence.
However, insertion of sequences between the target binding sequence
and the promoter sequence could change the length of the primer
without compromising its utility in the amplification reaction.
Additionally, the lengths of the amplification primers and probes
are matters of choice so long as the sequences of these
oligonucleotides conform to the minimal essential requirements for
hybridizing the desired complementary sequence.
[0058] Tables 1 and 2 present specific examples of oligonucleotide
sequences that were used as primers for amplifying GAS nucleic
acids. Table 1 presents the sequences of GAS target-complementary
primers to one strand of the GAS nucleic acid. All of the
illustrative primers presented in Table 1 have target-complementary
sequences contained within the sequence of SEQ ID NO:1.
TABLE-US-00001 TABLE 1 Oligonucleotide Sequences of Amplification
Primers Sequence SEQ ID NO: GGCGGCGTGCCTAATACATGCAAGTA SEQ ID NO: 4
CCTAATACATGCAAGTAGACGAACGG SEQ ID NO: 5 TGCAAGTAGACGAACGGGTGAGTAACG
SEQ ID NO: 6 CGAACGGGTGAGTAACGCGTAGGTAACC SEQ ID NO: 7
[0059] Table 2 presents the sequences of both the GAS
target-complementary primers and the corresponding promoter-primers
to the opposing strand of the GAS nucleic acid. As indicated above,
all promoter-primers included sequences complementary to a GAS
target sequence at their 3' ends and the T7 promoter sequence
AATTTAATACGACTCACTATAGGGAGA (SEQ ID NO:8) at their 5' ends. Primers
identified by SEQ ID NOs:14-18 in Table 2 are promoter-primers
corresponding to the GAS target-complementary primers identified as
SEQ ID NOs:9-13, respectively. All of the illustrative primers
presented in Table 2 have target-complementary sequences contained
within the sequence of SEQ ID NO:2. TABLE-US-00002 TABLE 2
Oligonucleotide Sequences of Amplification Primers Sequence SEQ ID
NO: GCGGTATTAGCTATCGTTTCC SEQ ID NO: 9 CCCUUUUAAAUUACUAACAUGCGUUAG
SEQ ID NO: 10 CAACGCAGGTCCATCTCATAGTGGAGCAATTG SEQ ID NO: 11
GGTCCATCTCATAGTGGAGC SEQ ID NO: 12
CTAATACAACGCAGGTCCATCTCATAGTGGAGC SEQ ID NO: 13
AATTTAATACGACTCACTATAGGGAGAGCGGTATT SEQ ID NO: 14 AGCTATCGTTTCC
AAUUUAAUACGACUCACUAUAGGGAGACCCUUU SEQ ID NO: 15
UAAAUUACUAACAUGCGUUAG AATTTAATACGACTCACTATAGGGAGACAACGCA SEQ ID NO:
16 GGTCCATCTCATAGTGGAGCAATTG AATTTAATACGACTCACTATAGGGAGAGGTCCATC
SEQ ID NO: 17 TCATAGTGGAGC AATTTAATACGACTCACTATAGGGAGACTAATACA SEQ
ID NO: 18 ACGCAGGTCCATCTCATAGTGGAGC
[0060] Preferred sets of primers for amplifying GAS nucleic acid
sequences include a first primer that hybridizes a GAS target
sequence, such as one of the primers listed in Table 2, and a
second primer that is complementary to the sequence of an extension
product of the first primer, such as one of the primers listed in
Table 1. In a highly preferred embodiment, the first primer is a
promoter-primer that includes a T7 promoter sequence at its 5'
end.
Preferred Detection Probes
[0061] Another aspect of the invention relates to oligonucleotides
that can be used as hybridization probes for detecting GAS nucleic
acids. Methods for amplifying a target nucleic acid sequence
present in a GAS nucleic acid can include an optional further step
for detecting amplicons. This detection procedure includes a step
for contacting a test sample with a hybridization assay probe that
preferentially hybridizes to the target nucleic acid sequence, or
the complement thereof, under stringent hybridization conditions,
thereby forming a probe:target duplex that is stable for detection.
Next there is a step for determining whether the hybrid is present
in the test sample as an indication of the presence or absence of
GAS nucleic acids in the test sample. This may involve detecting
the probe:target duplex, and preferably involves homogeneous assay
systems.
[0062] Hybridization assay probes useful for detecting GAS nucleic
acid sequences include a sequence of bases substantially
complementary to a GAS target nucleic acid sequence. Thus, probes
of the invention hybridize to one strand of a GAS target nucleic
acid sequence, or the complement thereof. These probes may
optionally have additional bases outside of the targeted nucleic
acid region, which may or may not be complementary to the GAS
nucleic acid.
[0063] Preferred probes are sufficiently homologous to the target
nucleic acid to hybridize under stringent hybridization conditions
corresponding to about 60.degree. C. and a salt concentration in
the range of 0.6-0.9 M for probes labeled with chemiluminescent
molecules and corresponding to about 42.degree. C. and a salt
concentration in the range of 20-100 mM for molecular beacon
probes. Preferred salts include lithium, magnesium and potassium
chlorides, but other salts such as sodium chloride and sodium
citrate also can be used in the hybridization solution. Example
high stringency hybridization conditions are alternatively provided
by 0.48 M sodium phosphate buffer, 0.1% sodium dodecyl sulfate and
1 mM each of EDTA and EGTA, or by 0.6 M LiCl, 1% lithium lauryl
sulfate, 60 mM lithium succinate and 10 mM each of EDTA and
EGTA.
[0064] Probes in accordance with the invention have sequences
complementary to, or corresponding to, a domain of the GAS genome.
Certain probes that are preferred for detecting GAS nucleic acid
sequences have a probe sequence, which includes the
target-complementary sequence of bases together with any base
sequences that are not complementary to the nucleic acid that is to
be detected, in the length range of from 13-24 nucleotides for
probes labeled with chemiluminescent molecules and in the length
range of from 25-27 nucleotides for molecular beacon probes.
Certain specific probes that are preferred for detecting GAS
nucleic acid sequences have target-complementary sequences in the
length range of from 13-24 nucleotides for probes labeled with
chemiluminescent molecules and in the length range of from 15-17
for molecular beacon probes. Of course, these target-complementary
sequences may be linear sequences, or may be contained in the
structure of a molecular beacon or other construct having one or
more optional nucleic acid sequences that are non-complementary to
the GAS target sequence that is to be detected. As indicated above,
probes may be made of DNA, RNA, a combination DNA and RNA, a
nucleic acid analog, or contain one or more modified nucleosides
(e.g., a ribonucleoside having a 2'-O-methyl substitution to the
ribofuranosyl moiety).
[0065] Simply stated, preferred probes for detecting target nucleic
acids of interest in connection with the present invention include
sequences that are contained within one or more of several defined
probe domains, or the complements thereof, allowing for the
presence of RNA and DNA equivalents and nucleotide analogs. For
example, preferred hybridization assay probes for detecting GAS
nucleic acids can include target-complementary sequences of bases
contained within the sequence of SEQ ID NO:3. Optional sequences
which are not complementary to the nucleic acid sequence that is to
be detected may be linked to the target-complementary sequence of
the probe.
[0066] Certain preferred probes in accordance with the present
invention include a detectable label. In one embodiment, this label
is an acridinium ester joined to the probe by means of a
non-nucleotide linker. For example, detection probes can be labeled
with chemiluminescent acridinium ester compounds that are attached
via a linker substantially as described in U.S. Pat. No. 5,585,481
and U.S. Pat. No. 5,639,604, particularly at column 10, line 6 to
column 11, line 3, and Example 8. The disclosures contained in
these patent documents are hereby incorporated by reference. In
another embodiment, this label includes a fluorophore and a second
moiety having fluorescence quenching properties.
[0067] Table 3 presents the oligonucleotide sequences of
chemiluminescent hybridization assay probes used for detecting GAS
amplicons. TABLE-US-00003 TABLE 3 Oligonucleotide Sequences of
Chemiluminescent GAS Detection Probes Sequence SEQ ID NO:
CCGCAUAAGAGAGAC SEQ ID NO: 19 CGCAUAAGAGAGACUAACGC SEQ ID NO: 20
GAGAGACUAACGC SEQ ID NO: 21 CGCAUGUUAGUAAUUUAAAAGGGG SEQ ID NO:
22
[0068] Table 4 presents the GAS target-complementary
oligonucleotide sequences contained in the loop portions of the
molecular beacon probes and the corresponding complete sequences of
the molecular beacon probes used for detecting GAS amplicons. Each
of the molecular beacons included a 5.degree. CCGAG arm sequence
and a 3.degree. CUCGG arm sequence appended to the GAS
target-complementary sequence contained in the loop portion of the
molecular beacon. Loop portions identified by SEQ ID NOs:23-25 in
Table 4 correspond to the molecular beacons identified as SEQ ID
NOs:26-28, respectively. All of the GAS-specific molecular beacons
used in the procedure had target-complementary sequences that
included 15-17 contiguous nucleotides contained within the sequence
of SEQ ID NO:3, allowing for the presence of RNA and DNA
equivalents. The target-complementary sequences presented in Table
4 were independently incorporated into the loop regions of
molecular beacons. Each of the molecular beacons used in the
procedure included a fluorescein fluorophore at its 5'-end and a
DABCYL quencher moiety at its 3'-end. TABLE-US-00004 TABLE 4
Oligonucleotide Sequences of GAS-Specific Molecular Beacons
Sequence SEQ ID NO: CCGCAUAAGAGAGAC SEQ ID NO: 23 CCGCAUAAGAGAGACU
SEQ ID NO: 24 ACCGCAUAAGAGAGACU SEQ ID NO: 25
CCGAG-CCGCAUAAGAGAGAC-CUCGG SEQ ID NO: 26
CCGAG-CCGCAUAAGAGAGACU-CUCGG SEQ ID NO: 27
CCGAG-ACCGCAUAAGAGAGACU-CUCGG SEQ ID NO: 28
[0069] Since alternative probes for detecting GAS nucleic acid
sequences can hybridize to the opposite-sense GAS strand, the
present invention also includes oligonucleotides that are
complementary to the sequences presented in Tables 3 and 4.
[0070] As indicated above, any number of different backbone
structures can be used as a scaffold for the oligonucleotide
sequences of the invented hybridization probes. In certain highly
preferred embodiments, the probe sequence used for detecting GAS
amplicons includes a methoxy backbone or at least one methoxy
linkage in the nucleic acid backbone.
Preferred Methods for Amplifying and Detecting GAS Polynucleotide
Sequences
[0071] Preferred methods of the present invention are described and
illustrated by the Examples presented below. FIG. 1 schematically
illustrates one system that may be used for detecting a target
region of the GAS nucleic acid (shown by a thick solid horizontal
line). This system includes at least three oligonucleotides (shown
by the shorter solid lines): one T7 promoter-primer which includes
a sequence that hybridizes specifically to a GAS sequence in the
target region and a T7 promoter sequence ("P") which, when
double-stranded, serves as a functional promoter for T7 RNA
polymerase; one non-T7 primer which includes a sequence that
hybridizes specifically to a first strand cDNA made from the target
region sequence using the T7 promoter-primer; and, one labeled
probe which includes a sequence that hybridizes specifically to a
portion of the target region that is amplified using the two
primers.
[0072] As indicated above, amplifying the target region using the
two primers can be accomplished by any of a variety of known
nucleic acid amplification reactions that will be familiar to those
having an ordinary level of skill in the art. In a preferred
embodiment, a transcription associated amplification reaction, such
as TMA, is employed. In such an embodiment, many strands of nucleic
acid are produced from a single copy of target nucleic acid, thus
permitting detection of the target by detecting probes that are
bound to the amplified sequences. Preferably, transcription
associated amplification uses two types of primers (one being
referred to as a promoter-primer because it contains a promoter
sequence, labeled "P" in FIG. 1, for an RNA polymerase), two
enzymes (a reverse transcriptase and an RNA polymerase), and
substrates (deoxyribonucleoside triphosphates, ribonucleoside
triphosphates) with appropriate salts and buffers in solution to
produce multiple RNA transcripts from a nucleic acid template.
[0073] Referring to FIG. 1, during transcription mediated
amplification, the target nucleic acid is hybridized to a first
primer shown as a T7 promoter-primer. Using reverse transcriptase,
a complementary DNA strand is synthesized from the T7
promoter-primer using the target RNA as a template. A second
primer, shown as a non-T7 primer, hybridizes to the newly
synthesized DNA strand and is extended by the action of a reverse
transcriptase to form a DNA duplex, thereby forming a
double-stranded T7 promoter region. T7 RNA polymerase then
generates multiple RNA transcripts by using this functional T7
promoter. The autocatalytic mechanism of TMA employs repetitive
hybridization and polymerization steps following a cDNA synthesis
step using the RNA transcripts as templates to produce additional
transcripts, thereby amplifying target region-specific nucleic acid
sequences.
[0074] The detecting step uses at least one detection probe that
binds specifically to the amplified RNA transcripts or amplicons
described above. Preferably, the detection probe is labeled with a
label that can be detected using a homogeneous detection system.
For example, the labeled probe can be labeled with an acridinium
ester compound from which a chemiluminescent signal may be produced
and detected, as described above. Alternatively, the labeled probe
may comprise a fluorophore, or fluorophore and quencher moieties. A
molecular beacon is one embodiment of such a labeled probe that may
be used in a homogeneous detection system.
Kits for Detecting GAS Nucleic Acids
[0075] The present invention also embraces kits for performing
polynucleotide amplification reactions using bacterial nucleic acid
templates. Certain preferred kits will contain a hybridization
assay probe that includes a target-complementary sequence of bases,
and optionally including primers or other ancillary
oligonucleotides for amplifying the target that is to be detected.
Other preferred kits will contain a pair of oligonucleotide primers
that may be used for amplifying target nucleic acids in an in vitro
amplification reaction. Exemplary kits include first and second
amplification oligonucleotides that are complementary to opposite
strands of a GAS nucleic acid sequence that is to be amplified. The
kits may further contain one or more oligonucleotide detection
probes. Still other kits in accordance with the invention may
additionally include capture oligonucleotides for purifying GAS
template nucleic acids away from other species prior to
amplification.
[0076] The general principles of the present invention may be more
fully appreciated by reference to the following non-limiting
Examples.
[0077] Example 1 describes procedures that identified some of the
hybridization probes which subsequently were used in assays for
detecting GAS nucleic acids. One synthetic RNA oligonucleotide
served as a target for binding the probes.
EXAMPLE 1
Oligonucleotides for Detecting GAS Nucleic Acids
AE-Labeled Oligonucleotides
[0078] Synthetic AE-labeled oligonucleotides were prepared
according to standard laboratory procedures using 2'-OMe nucleotide
analogs. The sequences of the synthetic AE-labeled oligonucleotides
are shown in Table 3.
[0079] The AE-labeled oligonucleotides listed in Table 3 were each
labeled with an AE moiety joined to the oligonucleotide structure
by an internally disposed non-nucleotide linker according to
procedures described in U.S. Pat. Nos. 5,585,481 and 5,639,604, the
disclosures of these patents having been incorporated by reference
hereinabove. The non-nucleotide linker in SEQ ID NO:19 was located
either between positions 6 and 7 or between positions 9 and 10. The
non-nucleotide linker in SEQ ID NO:20 was located either between
positions 12 and 13 or between positions 15 and 16. The
non-nucleotide linker in SEQ ID NO:21 was located either between
positions 5 and 6 or between positions 8 and 9. The non-nucleotide
linker in SEQ ID NO:22 was located between positions 11 and 12. Use
of all of these different linker positions confirmed the
versatility of this labeling technique.
[0080] Hybridization reactions included 1.times.10.sup.6
RLU/reaction of AE-labeled oligonucleotide having a specific
activity of 1-2.times.10.sup.8 RLU/pmol and 2 pmol/reaction of
synthetic GAS RNA target oligonucleotide as given in Table 5.
TABLE-US-00005 TABLE 5 Synthetic Target Sequence SEQ ID Target
Sequence NO: GCAAUUGCCCCUUUUAAAUUACUAACAUGCGUUAGUCUCUCU SEQ
UAUGCGGUAUUAGCUA ID NO: 29
[0081] Chemiluminescence due to hybridized AE-labeled
oligonucleotide in each sample was assayed using a Leader 450 HC
configured for automatic injection of 1 mM nitric acid and 0.1%
(v/v) hydrogen peroxide, followed by injection of a solution
containing 1 N sodium hydroxide. Results for the chemiluminescent
reactions were measured in relative light units (RLU).
Representative results from this procedure are summarized in Table
6. Numerical values shown in the table indicate the average
signal/noise (SIN) ratios. TABLE-US-00006 TABLE 6 AE-Labeled
Oligonucleotide Hybridization Results AE-Labeled Oligonucleotide
S/N Ratio SEQ ID NO: 19 (6, 7) 3,087 SEQ ID NO: 19 (9, 10) 200 SEQ
ID NO: 20 (12, 13) 930 SEQ ID NO: 20 (15, 16) 2,378 SEQ ID NO: 21
(5, 6) 2 SEQ ID NO: 21 (8, 9) 43 SEQ ID NO: 22 (11, 12) 1,103
[0082] The results presented in Table 6 showed that each AE-labeled
oligonucleotide tested in the procedure gave detectable SIN ratio
values following interaction with the synthetic GAS RNA target
oligonucleotide. However, all of the AE-labeled oligonucleotides
used in the procedure gave S/N value values substantially greater
than 10 except SEQ ID NO:21 (5,6). Indeed, the positioning of any
detectable label joined to any of the probes described herein can
be varied and still fall within the scope of the invention. Each of
the probes having one of the alternatively positioned labels
particularly described above represents a preferred embodiment of
the invented probe.
[0083] Hybridization assay probes having the sequences presented in
Table 3 were subsequently used for demonstrating that a range of
amplification primers could detect GAS nucleic acids in biological
samples. Probes having these sequences, or their complements,
allowing for the presence of RNA and DNA equivalents and nucleotide
analog substitutions, each represents particularly preferred
embodiments of the invention.
Molecular Beacons
[0084] Synthetic molecular beacons were prepared according to
standard laboratory procedures using 2'-OMe nucleotide analogs. The
sequences of the synthetic molecular beacons are shown in Table
4.
[0085] Hybridization reactions included 10 pmol/reaction of the
molecular beacon and 30 pmol/reaction of the synthetic GAS RNA
target oligonucleotide as given in Table 5. Hybridization reactions
of the molecular beacons in the absence or presence of the
synthetic GAS RNA target oligonucleotide were carried out at
60.degree. C. for 10 minutes, followed by an incubation at
42.degree. C. for 60 minutes in 100 .mu.l reaction volumes of a
TRIS-buffered solution that included 20 mM MgCl.sub.2.
[0086] Fluorescence was measured every 30 seconds at 42.degree. C.
using a Rotor-Gene 2000 instrument (Corbett Research, Sydney,
Australia). Results from the fluorescent reactions were measured in
relative fluorescence units (RFU). After completion of the
hybridization reactions, the reaction temperature was increased in
one degree Celsius increments, and the resulting RFUs were measured
to determine the melting temperatures (T.sub.m) of the molecular
beacons using the data analysis software provided by the Rotor-Gene
2000 instrument. Representative results for the hybridization
reactions and melting temperature measurements are summarized in
Table 7.
[0087] Numerical values shown in Table 7 indicate the average
signal/noise (S/N) ratio values calculated from the measured
endpoint RFUs in the presence of target divided by the measured
endpoint RFUs in the absence of target. The calculated melting
temperature of the molecular beacons in the absence of target is
useful to determine the stability of the stem structure of the
molecular beacon, whereas the melting temperature of the molecular
beacon hybridized to the target sequence provides information about
the stability of the hybrid. TABLE-US-00007 TABLE 7 Melting
Temperatures and Hybrid Stability of Molecular Beacons Molecular
T.sub.m w/o Target T.sub.m w/ Target Beacon (.degree. C.) (.degree.
C.) S/N Ratio SEQ ID NO: 26 78.7 73.3 13.6 SEQ ID NO: 27 76.7 73.8
16.7 SEQ ID NO: 28 81.8 74.4 17.6
[0088] The results presented in Table 7 showed that each molecular
beacon gave strong S/N ratio values following binding to the
synthetic GAS RNA target oligonucleotide. In addition, the melting
temperatures of the molecular beacons in the absence of target
demonstrated that the molecular beacons have stable stem
structures, which prevent unspecific "opening" of the molecular
beacons at lower temperatures. The high melting temperatures of the
molecular beacons in the presence of the synthetic GAS RNA target
oligonucleotide showed that a stable hybrid was formed under the
experimental conditions.
[0089] Example 2 describes the methods that identified useful
amplification primers for the GAS nucleic acids.
EXAMPLE 2
Identification of Amplification Primers
[0090] Purified ribosomal RNA served as the source of GAS target
nucleic acid in amplification reactions that employed paired sets
of primers. TMA reactions were carried out essentially as described
in Kacian et al., U.S. Pat. No. 5,399,491, the disclosure of this
patent having been incorporated by reference hereinabove.
Amplification reactions were conducted for various primer
combinations using either 0 or 50 femtograms GAS rRNA. Either water
or target rRNA was added to amplification reagent (final
concentration: 50 mM Tris HCl (pH 8.2 to 8.5), 35 mM KCl, 4 mM GTP,
4 mM ATP, 4 mM UTP, 4 mM CTP, 1 mM dATP, 1 mM dTTP, 1 mM dCTP, 1 mM
dGTP, 20 mM MgCl.sub.2, 20 mM N-Acetyl-L-Cysteine, and 5% (w/v)
glycerol) containing 3 pmol/reaction of T7 primer and 15
pmol/reaction of non-T7 primer. The mixture (15 .mu.l) was
incubated at 60.degree. C. for 10 minutes and then cooled down to
42.degree. C. for 5 minutes. Five microliters of a mixture of M-MLV
reverse transcriptase and T7 RNA polymerase were added to the
reactions, followed by vortexing. The reactions were then incubated
at 42.degree. C. for 1 hour, and 20 .mu.l of probe reagent
containing an AE-labeled oligonucleotide were added. The reactions
were then incubated for 15 minutes at 60.degree. C., followed by
the addition of 50 .mu.l of selection reagent and incubation for 10
minutes at 60.degree. C.
[0091] Chemiluminescence due to hybridized AE-labeled
oligonucleotides in each sample was assayed using a Leader 450 HC
configured for automatic injection of 1 mM nitric acid and 0.1%
(v/v) hydrogen peroxide, followed by injection of a solution
containing 1 N sodium hydroxide. Results for the chemiluminescent
reactions were measured in relative light units (RLU).
Representative results from this procedure are summarized in Table
8. TABLE-US-00008 TABLE 8 Amplification of GAS Nucleic Acids Using
Various Primer Combinations Non-T7 Primer T7 Primer # Positive/#
Tested SEQ ID NO: 4 SEQ ID NO: 10 5/5 SEQ ID NO: 11 5/5 SEQ ID NO:
12 5/5 SEQ ID NO: 13 5/5 SEQ ID NO: 5 SEQ ID NO: 10 5/5 SEQ ID NO:
11 5/5 SEQ ID NO: 12 5/5 SEQ ID NO: 13 5/5
[0092] The results presented in Table 8 showed that all of the
tested primer combinations amplified GAS nucleic acids. Amplicon
was detected using an AE-labeled oligonucleotide SEQ ID NO:19
(6,7). The results from these procedures also demonstrated that
each of the primers complementary to one strand of the GAS nucleic
acid could be paired with at least one of the primers complementary
to the opposite strand GAS nucleic acid to result in a
amplification-based assay. The results presented in Table 8 further
illustrate how the above-described primers and AE-labeled
oligonucleotide could be used in a highly sensitive assay for
detecting GAS nucleic acids at very low levels of input
template.
[0093] To further illustrate the versatility of the above-described
analyte detection systems, amplicon production was monitored as a
function of time in real-time amplification procedures.
Amplicon-specific molecular beacons that were included in the
amplification reactions provided a means for continuous monitoring
of amplicon synthesis. Fluorescent emissions that increased with
time indicated the production of amplicons that hybridized to the
molecular beacon and caused a detectable transition to the open
conformation of the molecular beacon.
[0094] Molecular beacons comprise nucleic acid molecules having a
target-complementary sequence, an affinity pair (or nucleic acid
arms) that interact to form a stem structure by complementary base
pairing in the absence of a target (i.e., the closed conformation),
and a paired set of labels that interact when the probe is in the
closed conformation. Those having an ordinary level of skill in the
art will understand that the target-complementary sequence
contained within the structure of a molecular beacon is generally
in the form of a single-stranded loop region of the probe.
Hybridization of the target nucleic acid and the
target-complementary sequence of the probe causes the members of
the affinity pair to separate, thereby shifting the probe to the
open conformation. This shift is detectable by virtue of reduced
interaction between the members of the label pair, which may be,
for example, a fluorophore and a quencher. Molecular beacons are
fully described in U.S. Pat. No. 5,925,517, the disclosure of this
patent document being incorporated by reference herein.
[0095] Commercially available software was used to analyze
time-dependent results obtained using molecular beacons that were
specific for amplicons derived from the GAS nucleic acid. Results
from these analyses indicated a substantially linear relationship
between the number of target copies included in an amplification
reaction and the time at which the fluorescent signal exceeded a
background threshold (i.e., time-of-emergence). As confirmed by the
results presented below, these procedures were useful for
quantifying analyte target amounts over a very broad range. More
particularly, when known amounts of analyte polynucleotides are
used as calibration standards, it is possible to determine the
amount of analyte present in a test sample by comparing the
measured time-of-emergence with the standard curve.
[0096] The fact that the amplification reaction used in the
below-described procedures operated at constant temperature and
without interruption for a separate detection step, so that
amplification and detection took place simultaneously, imposed
strict requirements on the molecular beacons. More specifically,
success in the procedure required that the molecular beacon bind
amplicon without inhibiting subsequent use of the amplicon as a
template in the exponential amplification mechanism. Indeed, the
finding that an amplification reaction could proceed efficiently in
the presence of a molecular beacon indicated that interaction of
the probe with its target did not irreversibly inhibit or poison
the amplification reaction.
[0097] Example 3 describes procedures wherein molecular beacon
probes, each labeled with an interactive fluorophore/quencher pair,
were used for monitoring time-dependent amplicon production in TMA
reactions. Although the molecular beacons described in Example 3
hybridized to only one strand of the amplified nucleic acid
product, complementary probe sequences also would be expected to
hybridize to the opposite nucleic acid strand, and so fall within
the scope of the invention.
EXAMPLE 3
Real-Time Monitoring of Amplicon Production
[0098] Molecular beacons having binding specificity for the GAS
amplicon were synthesized by standard solid-phase phosphite
triester chemistry using 3' quencher-linked controlled pore glass
(CPG) and 5' fluorophore-labeled phosphoramidite on a Perkin-Elmer
(Foster City, Calif.) EXPEDITE model 8909 automated synthesizer.
Fluorescein was used as the fluorophore, and DABCYL was used as the
quencher for construction of the molecular beacons. All of the
molecular beacons were constructed using 2'-OMe nucleotide analogs.
The CPG and phosphoramidite reagents were purchased from Glen
Research Corporation (Sterling, Va.). Following synthesis, the
probes were deprotected and cleaved from the solid support matrix
by treatment with concentrated ammonium hydroxide (30%) for two
hours at 60.degree. C. Next, the probes were purified using
polyacrylamide gel electrophoresis followed by HPLC using standard
procedures that will be familiar to those having an ordinary level
of skill in the art.
[0099] The nucleic acid target used in the real-time amplification
and detection procedures was purified rRNA of known concentration.
Different target concentrations were tested in triplicate.
Molecular beacons were used at a level of 0.2 pmol/.mu.l (3
pmol/reaction). Reactions for amplifying GAS nucleic acids were
conducted using from as low as 50 template copies/reaction up to as
high as 5.times.10 template copies/reaction.
[0100] Reactions containing 15 .mu.l of a buffered solution that
included salts and reagents essentially as described under Example
2, a target polynucleotide, and a molecular beacon were incubated
in a dry heat block for 10 minutes at 60.degree. C. to facilitate
primer annealing. Following the 60.degree. C. incubation step,
reactions were transferred to a 42.degree. C. heat block and then
incubated for 2 minutes. Five microliter aliquots of an enzyme
reagent that included both MMLV reverse transcriptase and T7 RNA
polymerase enzymes were added to each of the reactions using a
repeat pipettor. Tubes were vortexed briefly and then transferred
to a Rotor-Gene 2000 (Corbett Research; Sydney, Australia) rotor
that had been pre-warmed to 42.degree. C. Amplification reactions
were carried out at 42.degree. C., fluorescence readings were taken
every 30 seconds, and the results analyzed in real-time using
standard software that was bundled with the R2000 instrument.
Representative results from this procedure using different
molecular beacons and different primer combinations are summarized
in Tables 9 and 10, respectively. TABLE-US-00009 TABLE 9 Measured
Time-of-Emergence During Real-Time Detection Different Molecular
Beacons Time-of-Emergence with Primer Combination SEQ ID NOs: 4 and
18 GAS Target (minutes) (copies/rxn) SEQ ID NO: 26 SEQ ID NO: 27
SEQ ID NO: 28 5 .times. 10.sup.8 3.7 3.0 4.2 5 .times. 10.sup.7 5.1
4.6 5.7 5 .times. 10.sup.6 6.8 6.0 7.2 5 .times. 10.sup.5 8.1 7.5
8.9 5 .times. 10.sup.4 9.8 9.0 10.4 5 .times. 10.sup.3 11.4 10.8
12.2 5 .times. 10.sup.2 13.5 12.3 14.7 5 .times. 10.sup.1 17.0 15.2
18.7.sup..dagger-dbl. .sup..dagger-dbl.Only 2/3 replicates
detected
[0101] The results presented in Table 9 confirmed that the
amplification reactions containing one fixed primer combination and
different GAS-specific molecular beacons desirably produced a
fluorescent signal that increased with time until reaching a
plateau. Each of the molecular beacons used in the procedure
included a fluorescein fluorophore at its 5'-end and a DABCYL
quencher moiety at its 3'-end. All results were based on reactions
that were included in triplicate. The results presented in Table 9
also showed that each molecular beacon was able to detect
amplification product down to 50 copies/reaction. Only molecular
beacon SEQ ID NO:28 detected 2/3 replicates at the 50
copies/reaction level, whereas molecular beacons SEQ ID NO:26 and
SEQ ID NO:27 detected all three replicates at this level. The
results presented in Table 9 further illustrate how the
above-described primers and molecular beacons could be used in a
highly sensitive assay for detecting GAS nucleic acids at very low
levels of input template. TABLE-US-00010 TABLE 10 Measured
Time-of-Emergence During Real-Time Detection Different Primer
Combinations Time-of-Emergence Measured Using Molecular Beacon SEQ
ID NO: 26 and Different Primer Combinations (minutes) SEQ SEQ SEQ
SEQ SEQ SEQ SEQ SEQ SEQ GAS Target ID NOs: ID NOs: ID NOs: ID NOs:
ID NOs: ID NOs: ID NOs: ID NOs: ID NOs: (copies/rxn) 4 and 16 5 and
16 5 and 17 5 and 18 6 and 16 6 and 18 7 and 15 7 and 16 7 and 18 5
.times. 10.sup.8 9.2 10.7 8.7 7.3 6.3 7.5 3.9 6.2 7.7 5 .times.
10.sup.7 11.1 12.1 11.9 8.9 8.3 9.1 5.1 8.0 8.9 5 .times. 10.sup.6
12.6 13.7 14.5 10.4 10.2 10.6 7.0 9.6 10.5 5 .times. 10.sup.5 14.9
15.7 19.5 11.7 12.1 12.4 10.6 12.1 12.6 5 .times. 10.sup.4 16.8
18.6 ND 13.6 13.7 13.7 18.0 13.4 14.2 5 .times. 10.sup.3 19.9 25.4
ND 17.6 16.1 16.4 ND 16.2 16.6 5 .times. 10.sup.2 27.7 ND ND
23.4.sup..dagger. 19.5 21.2 ND 19.2 22.2 5 .times. 10.sup.1 ND ND
ND ND ND 28.9.sup..dagger. ND 23.7.sup..dagger-dbl. ND ND = Not
Detected .sup..dagger.Only 1/3 replicates detected
.sup..dagger-dbl.Only 2/3 replicates detected
[0102] The results shown in Table 10 confirmed that the
amplification reactions containing different primer combinations
and a fixed molecular beacon (SEQ ID NO:26) desirably produced a
fluorescent signal that increased with time until reaching a
plateau. All results were based on reactions that were included in
triplicate.
[0103] Each of the primer combinations tested gave at least some
level of time-dependent analyte detection. The different primer
combinations tested in the procedure behaved somewhat differently
in the real-time assay format. For example, reactions that included
primer combinations SEQ ID NOs:7 and 15 gave exceedingly rapid
detection of high target numbers, whereas other primer combinations
allowed very sensitive detection of GAS nucleic acids down to 50
target copies/reaction.
Sequence CWU 1
1
29 1 56 DNA Group A Streptococci 1 ggcggcgtgc ctaatacatg caagtagacg
aacgggtgag taacgcgtag gtaacc 56 2 97 DNA Group A Streptococci 2
ggaaacgata gctaataccg cataagagag actaacgcat gttagtaatt taaaaggggc
60 aattgctcca ctatgagatg gacctgcgtt gtattag 97 3 22 DNA Group A
Streptococci 3 accgcataag agagactaac gc 22 4 26 DNA Group A
Streptococci 4 ggcggcgtgc ctaatacatg caagta 26 5 26 DNA Group A
Streptococci 5 cctaatacat gcaagtagac gaacgg 26 6 27 DNA Group A
Streptococci 6 tgcaagtaga cgaacgggtg agtaacg 27 7 28 DNA Group A
Streptococci 7 cgaacgggtg agtaacgcgt aggtaacc 28 8 27 DNA Group A
Streptococci 8 aatttaatac gactcactat agggaga 27 9 21 DNA Group A
Streptococci 9 gcggtattag ctatcgtttc c 21 10 27 RNA Group A
Streptococci 10 cccuuuuaaa uuacuaacau gcguuag 27 11 32 DNA Group A
Streptococci 11 caacgcaggt ccatctcata gtggagcaat tg 32 12 20 DNA
Group A Streptococci 12 ggtccatctc atagtggagc 20 13 33 DNA Group A
Streptococci 13 ctaatacaac gcaggtccat ctcatagtgg agc 33 14 48 DNA
Group A Streptococci 14 aatttaatac gactcactat agggagagcg gtattagcta
tcgtttcc 48 15 54 RNA Group A Streptococci 15 aauuuaauac gacucacuau
agggagaccc uuuuaaauua cuaacaugcg uuag 54 16 59 DNA Group A
Streptococci 16 aatttaatac gactcactat agggagacaa cgcaggtcca
tctcatagtg gagcaattg 59 17 47 DNA Group A Streptococci 17
aatttaatac gactcactat agggagaggt ccatctcata gtggagc 47 18 60 DNA
Group A Streptococci 18 aatttaatac gactcactat agggagacta atacaacgca
ggtccatctc atagtggagc 60 19 15 RNA Group A Streptococci 19
ccgcauaaga gagac 15 20 20 RNA Group A Streptococci 20 cgcauaagag
agacuaacgc 20 21 13 RNA Group A Streptococci 21 gagagacuaa cgc 13
22 24 RNA Group A Streptococci 22 cgcauguuag uaauuuaaaa gggg 24 23
15 RNA Group A Streptococci 23 ccgcauaaga gagac 15 24 16 RNA Group
A Streptococci 24 ccgcauaaga gagacu 16 25 17 RNA Group A
Streptococci 25 accgcauaag agagacu 17 26 25 RNA Group A
Streptococci 26 ccgagccgca uaagagagac cucgg 25 27 26 RNA Group A
Streptococci 27 ccgagccgca uaagagagac ucucgg 26 28 27 RNA Group A
Streptococci 28 ccgagaccgc auaagagaga cucucgg 27 29 58 RNA Group A
Streptococci 29 gcaauugccc cuuuuaaauu acuaacaugc guuagucucu
cuuaugcggu auuagcua 58
* * * * *