U.S. patent application number 11/093587 was filed with the patent office on 2006-10-05 for methods for normalizing and for identifying small nucleic acids.
This patent application is currently assigned to Applera Corporation. Invention is credited to John W. Burns, Kai Qin Lao, Neil A. Straus.
Application Number | 20060223066 11/093587 |
Document ID | / |
Family ID | 37070970 |
Filed Date | 2006-10-05 |
United States Patent
Application |
20060223066 |
Kind Code |
A1 |
Lao; Kai Qin ; et
al. |
October 5, 2006 |
Methods for normalizing and for identifying small nucleic acids
Abstract
The present teachings are generally directed to methods for
normalizing at least one species of small nucleic acid that is
present in a population of small nucleic acid species, wherein the
relative concentration of at least one small nucleic acid species
is substantially greater than the relative concentration of at
least one other small nucleic acid species in the population. At
least one small nucleic acid species is normalized using a
multiplicity of primers comprising degenerate sequences. In some
embodiments, a small nucleic acid species is identified by
inserting at least part of an extension product from a normalized
population into a vector and subsequently sequencing the insert. In
some embodiments, a small nucleic acid species is identified by
determining the sequence of at least part of an extension
product.
Inventors: |
Lao; Kai Qin; (Pleasanton,
CA) ; Straus; Neil A.; (Emeryville, CA) ;
Burns; John W.; (Carlsbad, CA) |
Correspondence
Address: |
MILA KASAN, PATENT DEPT.;APPLIED BIOSYSTEMS
850 LINCOLN CENTRE DRIVE
FOSTER CITY
CA
94404
US
|
Assignee: |
Applera Corporation
Foster City
CA
|
Family ID: |
37070970 |
Appl. No.: |
11/093587 |
Filed: |
March 29, 2005 |
Current U.S.
Class: |
435/6.1 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6855 20130101;
C12Q 1/6851 20130101; C12Q 2525/121 20130101; C12Q 2525/121
20130101; C12Q 2535/138 20130101; C12Q 2525/301 20130101; C12Q
2535/138 20130101; C12Q 1/6851 20130101; C12Q 2525/301 20130101;
C12Q 1/6855 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Claims
1. A method for normalizing a population of different small nucleic
acid species of varying abundance comprising, ligating adapters to
at least one end of at least some of the nucleic acids in the
population to form a multiplicity of different adapter-modified
molecules; and amplifying at least some of the different
adapter-modified molecules using a multiplicity of primers, wherein
at least some of the primers comprise a degenerate sequence located
at the 3'-end of the primer to generate a normalized
population.
2. The method of claim 1, wherein the amplifying comprises a
polymerase chain reaction.
3. The method of claim 1, wherein the generating a normalized
population comprises employing a formulated relative concentration
of primers comprising a multiplicity of primer species each
comprising different degenerate sequences at their respective
3'-ends and a corresponding universal primer species, wherein the
concentration of the universal primer species is at least ten times
greater than the concentration of any one of the primer species
comprising a degenerate sequence, and wherein the concentration of
the universal primer is greater than the total concentration of the
multiplicity of primers comprising different degenerate
sequences.
4. The method of claim 1, wherein the adapters comprise a 3'
adapter comprising a first primer-binding site, a 5' adapter
comprising a second primer-binding site, or a 3' adapter comprising
a first primer-binding site and a 5' adapter comprising a second
primer-binding site.
5. The method of claim 4, wherein the 3' adapter, the 5' adapter,
or the 3' adapter and the 5' adapter further comprise a restriction
enzyme cleavage site.
6. The method of claim 4, wherein the 5' adapter, the 3' adapter,
or the 5' adapter and the 3' adapter comprise deoxyribonucleotides
and ribonucleotides, and wherein at least the terminal nucleotide
on the 3'-end of the 5' adapter comprises a ribonucleotide, at
least the terminal nucleotide on the 5'-end of the 3' adapter
comprises a ribonucleotide, or at least the terminal nucleotide on
the 3'-end of the 5' adapter comprises a ribonucleotide and at
least the terminal nucleotide on the 5'-end of the 3' adapter
comprises a ribonucleotide.
7. The method of claim 6, wherein at least the three terminal
nucleotides on the 3'-end of the 5' adapter comprise
ribonucleotides, at least the three terminal nucleotides on the
5'-end of the 3' adapter comprise ribonucleotides, or at least the
three terminal nucleotides on the 3'-end of the 5' adapter and at
least the three terminal nucleotides on the 5'-end of the 3'
adapter comprise ribonucleotides.
8. The method of claim 1, wherein the population of different small
nucleic acids comprises at least two different noncoding RNAs.
9. The method of claim 8, wherein the normalized population
comprises at least two different miRNA species.
10. The method of claim 1, further comprising degrading a small
nucleic acid.
11. The method of claim 10, wherein the degrading comprises
alkaline hydrolysis or RNase treatment.
12. The method of claim 1, wherein at least one of the degenerate
sequences comprises one, two, three, four, five, or six
nucleotides.
13. A method for identifying a species of small nucleic acid in a
population of different small nucleic acid species of varying
abundance comprising, ligating adapters to at least one end of at
least some of the small nucleic acids in the population to form a
multiplicity of different adapter-modified molecules; amplifying at
least some of the multiplicity of different adapter-modified
molecules with a multiplicity of primers, wherein at least some of
the primers comprise a degenerate sequence located at the 3'-end of
the primer to generate a normalized population; determining the
nucleotide sequence of a normalized nucleic acid; and identifying
the corresponding small nucleic acid species.
14. The method of claim 13, wherein the amplifying comprises a
polymerase chain reaction.
15. The method of claim 13, wherein the generating a normalized
population comprises employing a formulated relative concentration
of primers comprising a multiplicity of primer species each
comprising different degenerate sequences at their respective
3'-ends and a corresponding universal primer species, wherein the
concentration of the universal primer species is at least ten times
greater than the concentration of any one of the primer species
comprising a degenerate sequence, and wherein the concentration of
the universal primer is greater than the total concentration of the
multiplicity of primers comprising different degenerate
sequences.
16. The method of claim 13, wherein the adapters comprise a 3'
adapter comprising a first primer-binding site, a 5' adapter
comprising a second primer-binding site, or a 3' adapter comprising
a first primer-binding site and a 5' adapter comprising a second
primer-binding site.
17. The method of claim 16, wherein the 3' adapter, the 5' adapter,
or the 3' adapter and the 5' adapter further comprise a restriction
enzyme cleavage site.
18. The method of claim 16, wherein the 5' adapter, the 3' adapter,
or the 5' adapter and the 3' adapter comprise deoxyribonucleotides
and ribonucleotides, and wherein at least the terminal nucleotide
on the 3'-end of the 5' adapter comprises a ribonucleotide, at
least the terminal nucleotide on the 5'-end of the 3' adapter
comprises a ribonucleotide, or at least the terminal nucleotide on
the 3'-end of the 5' adapter comprises a ribonucleotide and at
least the terminal nucleotide on the 5'-end of the 3' adapter
comprises a ribonucleotide.
19. The method of claim 18, wherein at least the three terminal
nucleotides on the 3'-end of the 5' adapter comprise
ribonucleotides, at least the three terminal nucleotides on the
5'-end of the 3' adapter comprise ribonucleotides, or at least the
three terminal nucleotides on the 3'-end of the 5' adapter and at
least the three terminal nucleotides on the 5'-end of the 3'
adapter comprise ribonucleotides.
20. The method of claim 13, further comprising degrading a small
nucleic acid.
21. The method of claim 13, wherein at least one of the degenerate
sequences comprises one, two, three, four, five, or six
nucleotides.
22. The method of claim 13, wherein the determining the nucleotide
sequence comprises: inserting at least a portion of a normalized
nucleic acid into a vector; amplifying the vector comprising the
insert in a host cell; and sequencing at least part of the insert
of the amplified vector or its complement.
23. The method of claim 22, wherein the sequencing comprises primer
extension, sequencing by hybridization, chemical cleavage, or
restriction enzyme mapping.
24. The method of claim 13, wherein the determining the nucleotide
sequence comprises sequencing at least part of a normalized nucleic
acid or its complement.
25. The method of claim 24, wherein the sequencing comprises primer
extension, sequencing by hybridization, chemical cleavage, or
restriction enzyme mapping.
26. A method for identifying a miRNA species in a population of
different small nucleic acid species of varying abundance
comprising, ligating a 3' adapter and a 5' adapter to at least one
end of at least some of the small nucleic acids in the population
to form a multiplicity of double different adapter-modified
molecules, wherein the adapters comprise a 3' adapter comprising a
first primer-binding site and a restriction enzyme cleavage site, a
5' adapter comprising a second primer-binding site and a
restriction enzyme cleavage site, wherein the 5' adapter and the 3'
adapter comprise deoxyribonucleotides and ribonucleotides, and
wherein at least the terminal nucleotide on the 3'-end of the 5'
adapter comprises a ribonucleotide and at least the terminal
nucleotide on the 5'-end of the 3' adapter comprises a
ribonucleotide; amplifying at least some of the multiplicity of
different double adapter-modified molecules with a formulated
relative concentration of primers to generate a normalized
population, wherein the formulated relative concentration of
primers comprises a multiplicity of primer species each comprising
different degenerate sequences at their respective 3'-ends and a
corresponding universal primer species, wherein at least one of the
degenerate sequences comprises one, two, three, four, five, or six
nucleotides, wherein the concentration of the universal primer
species is at least ten times greater than the concentration of any
one of the primer species comprising a degenerate sequence, and
wherein the concentration of the universal primer is greater than
the total concentration of the multiplicity of primers comprising
different degenerate sequences, and wherein the amplifying
comprises a polymerase chain reaction; determining the nucleotide
sequence of a normalized nucleic acid comprising: (a) inserting at
least a portion of a normalized nucleic acid into a vector; (b)
amplifying the vector comprising the insert in a host cell; and (c)
sequencing at least part of the insert of the amplified vector or
its complement.; and identifying the corresponding miRNA species.
Description
FIELD
[0001] The present teachings relate generally to the fields of
biotechnology and molecular biology. More specifically, the present
teachings relate to methods for normalizing populations of small
nucleic acids and for identifying species of small nucleic acids
within such normalized populations.
INTRODUCTION
[0002] The recent discovery that small nucleic acid molecules play
a role in cell regulation, including without limitation gene
silencing and translational repression, has lead to a great
interest in identifying and analyzing these molecules. Small RNA
molecules, for example but not limited to small interfering RNA
(siRNA) and microRNA (miRNA), have been implicated in gene
regulation, chromatin condensation, antiviral defense, suppression
of transposon hopping, and genomic rearrangement. Many of these
small nucleic acid species were first identified by cloning size
fractionated populations of polynucleotides (see, e.g., Elbashir et
al., Genes & Development 15:188-200, 2001; Lau et al., Science
294:858-62, 2001; Ambros et al., Curr. Biol. 13:807-18, 2003; Lim
et al., Genes & Development 17:991-1008, 2003; Lai et al.,
Genome Biol. 4:R42, 2003; and Suh et al., Develop. Biol.
270:488-98, 2004). However, it is believed that some small nucleic
acid species may be difficult to isolate because of their low
abundance or cloning biases inherent in conventional cloning
procedures, including without limitation the overabundance of
certain clones relative to other clones (see, e.g., Lim et al.,
Genes & Development 17:991-1008, 2003; and Ambros et al., Curr.
Biol. 13:807-18, 2003). It has also been suggested that, at least
for miRNA, we have reached the identification limit of conventional
isolation and cloning methods (see, e.g., Lagos-Quintana et al.,
RNA 9:175-79, 2003; and Lai et al., Genome Biol. 4:R42, 2003).
Novel cloning and identification methods would, among other things,
further our knowledge of small nucleic acid species and their role
in developmental biology and disease.
SUMMARY
[0003] The present teachings are directed to methods, reagents, and
kits for normalizing a population of different small nucleic acid
species of varying abundance, e.g., a population comprising at
least one species of small nucleic acid with a relative
concentration that is substantially less than at least one other
small nucleic acid species in the population. Also disclosed are
methods for identifying at least one species of small nucleic acid
in the normalized population.
[0004] Some disclosed methods for normalizing a population of
different small nucleic acid species of varying abundance comprise
ligating adapters to one or both ends of at least some of the small
nucleic acids to form a multiplicity of adapter-modified molecules,
and amplifying the multiplicity of adapter-modified molecules with
a multiplicity of primers to generate extension products. At least
some of the primers comprise (a) a degenerate sequence at their
3'-end and (b) a portion that is complementary to or is the same as
a region of an adapter-modified molecule, an extension product, or
both. By amplifying the population of adapter-modified molecules
using appropriate concentrations of forward and reverse primers, at
least some of which comprise degenerate sequences, a normalized
population can be generated. In some embodiments, populations of
normalized small nucleic acid species are generated by (1) ligating
3' adapters and/or 5' adapters with small nucleic acids using a
ligase, typically an RNA ligase, followed by (2) RT-PCR using (a)
formulated relative concentrations of (i) forward primers and (ii)
reverse primers, and (b) strategic primer sequence design,
including the use of different degenerate sequences.
[0005] According to certain methods, the nucleotide sequence of at
least part of a normalized nucleic acid is determined and the
corresponding small nucleic acid species is identified. In some
embodiments, at least part of a normalized nucleic acid is
determined using a sequencing technique and the corresponding small
nucleic acid species is identified. In some embodiments, at least a
portion of a normalized nucleic acid is inserted into a recombinant
vector. The vector comprising the insert is transferred to an
appropriate host cell and amplified in vivo. At least a part of the
amplified insert is determined using a sequencing technique and the
corresponding nucleic acid species is identified.
[0006] These and other features of the present teachings are set
forth herein.
DRAWINGS
[0007] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only and are not
intended to limit the scope of the present teachings in any
way.
[0008] FIG. 1: depicts an illustrative embodiment of certain
disclosed methods comprising double adapter-modified molecules.
[0009] FIG. 2: depicts an illustrative embodiment of certain
disclosed methods comprising stem-loop reverse primers and single
adapter-modified molecules.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0010] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not intended to limit the scope of the
current teachings. In this application, the use of the singular
includes the plural unless specifically stated otherwise. For
example, "a primer" means that more than one primer can be present,
including without limitation, one or more copies of a particular
primer species, as well as one or more different species of a
particular primer type, including without limitation two different
species of first reverse primers. Also, the use of "comprise",
"comprises", "comprising", "contain", "contains", "containing",
"include", "includes", and "including" are not intended to be
limiting. The term and/or means that the terms before and after can
be taken together or separately. For illustration purposes, but not
as a limitation, "X and/or Y" can mean "X" or "Y" or "X and Y".
[0011] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the described
subject matter in any way. All literature and similar materials
cited in this application, including but not limited to, patents,
patent applications, articles, books, treatises, and internet web
pages are expressly incorporated by reference in their entirety for
any purpose. In the event that one or more of the incorporated
literature and similar materials contradicts this application,
including but not limited to defined terms, term usage, described
techniques, or the like, this application controls. While the
present teachings are described in conjunction with various
embodiments, it is not intended that the present teachings be
limited to such embodiments. On the contrary, the present teachings
encompass various alternatives, modifications, and equivalents, as
will be appreciated by those of skill in the art.
I. Some Definitions
[0012] An "adapter-modified molecule" results from the ligation of
at least one adapter to a small nucleic acid by a ligation agent.
In some embodiments, a "double adapter-modified molecule" is
generated when a 5' adapter is ligated to the 5'-end of a small
nucleic acid and a 3' adapter is ligated to the 3'-end of the same
small nucleic acid (see, e.g., panel A of FIG. 1). In some
embodiments, a "single adapter-modified molecule" is generated when
one adapter is ligated to the appropriate end of a small nucleic
acid (see, e.g., FIG. 2). In some embodiments a multiplicity of 5'
adapters and a multiplicity of 3' adapters are combined with a
multiplicity of different small nucleic acids and a ligation agent
and, under appropriate conditions, a multiplicity of different
adapter-modified molecules are generated, which can include both
single adapter-modified molecules and double adapter-modified
molecules. Adapter-modified molecules serve as templates for
generating first extension products, which in turn can serve as
templates for generating second extension products, and so
forth.
[0013] The term "or combinations thereof' as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof" is intended
to include at least one of: A, B, C, AB, AC, BC, or ABC, and if
order is important in a particular context, also BA, CA, CB, ACB,
CBA, BCA, BAC, or CAB. Continuing with this example, expressly
included are combinations that contain repeats of one or more item
or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and
so forth. The skilled artisan will understand that typically there
is no limit on the number of items or terms in any combination,
unless otherwise apparent from the context.
[0014] The term "corresponding" as used herein refers to at least
one specific relationship between the elements to which the term
relates. For example, a first reverse primer corresponds to an
adapter-modified molecule, a first extension product corresponds to
an adapter-modified molecule, a first forward primer corresponds to
a first extension product, and so forth. Additionally, a third
extension product species can serve as a surrogate for the
corresponding second extension product species, a second extension
product species can serve as a surrogate for the corresponding
first extension product species, which can serve as a surrogate for
the corresponding adapter-modified molecule species or at least
part of an adapter-modified molecule, which can serve as a
surrogate for the corresponding small nucleic acid species, and so
forth.
[0015] The term "extending enzyme" refers to a polypeptide that is
able to catalyze the 5'-3'extension of a hybridized primer in a
template-dependent manner under suitable reaction conditions
including without limitation, appropriate nucleotide triphosphates,
cofactors, buffer, and the like. Extending enzymes are typically
DNA polymerases or RNA polymerases, for example but not limited to,
RNA-dependent DNA polymerases, including without limitation reverse
transcriptases, and DNA-dependent DNA polymerases, including
without limitation DNA polymerases that, at least under certain
conditions, share properties of both of these classes of DNA
polymerases, and RNA-dependent RNA polymerases. In certain
embodiments, an extending enzyme is a reverse transcriptase, for
example but not limited to, retroviral reverse transcriptases such
as Avian Myeloblastosis Virus (AMV) reverse transcriptase and
Moloney Murine Leukemia Virus (MMLV) reverse transcriptase. In
certain embodiments, an extending enzyme is a DNA-dependent DNA
polymerase, including without limitation Taq DNA polymerase and the
Klenow fragment of DNA polymerase 1. Certain DNA-dependent DNA
polymerases possess reverse transcriptase activity under some
conditions, for example but not limited to, the DNA polymerase of
Thermus thermophilus (Tth DNA polymerase, E.C. 2.7.7.7) which
demonstrates reverse transcription in the presence of Mn.sup.2+,
but not Mg.sup.2+ (see also, GeneAmp.RTM. AccuRT RNA PCR Kit and
Hot Start RNA PCR Kit comprising a recombinant polymerase derived
from Thermus species Z05, both from Applied Biosystems). Likewise,
certain reverse transcriptases possess DNA polymerase activity
under certain reaction conditions, including without limitation,
AMV reverse transcriptase and MMLV reverse transcriptase. In some
embodiments, an extending enzyme is a RNA polymerase, including
without limitation T3, SP6, and T7 bacteriophage RNA polymerases.
Descriptions of extending enzymes can be found in, among other
places, Lehninger Principles of Biochemistry, 3d ed., Nelson and
Cox, Worth Publishing, New York, N.Y., 2000 ("Lehninger"),
particularly Chapters 26 and 29; Twyman, Advanced Molecular
Biology: A Concise Reference, Bios Scientific Publishers, New York,
N.Y., 1999; Ausubel et al., Current Protocols in Molecular Biology,
John Wiley & Sons, Inc., including supplements through February
2005 ("Ausubel et al."); and Enzymatic Resource Guide: Polymerases,
Promega, Madison, Wis., 1998. Expressly within the intended scope
of the term extending enzyme are enzymatically active mutants or
variants thereof, as are enzymes modified to confer different
temperature-sensitive properties (see, e.g., U.S. Pat. Nos.
5,773,258; 5,677,152; and 6,183,998; and DNA Amplification: Current
Techniques and Applications, Demidov and Broude, eds., Horizon
Bioscience, 2004, particularly in Chapter 1.1).
[0016] The term "formulated relative concentration" refers to (i)
the quantity of at least one primer comprising a degenerate
sequence compared with the quantity of the corresponding
adapter-modified molecules or (ii) the quantity of a degenerate
primer compared with the quantity of the corresponding primer of a
primer pair, wherein the number of degenerate primer molecules is
less than the number of corresponding adapter-modified molecules or
the number of the corresponding primers of the primer pair,
respectively. For illustration purposes but not as a limitation, a
primer pair comprising a multiplicity of different first reverse
primers, each comprising a different degenerate sequence and a
universal forward primer, wherein the multiplicity of different
first reverse primers are present in limiting concentration and the
universal forward primer is present in excess. In some embodiments,
each of the degenerate primer species is present in equimolar or at
least relatively similar concentration compared to the other
degenerate primer species, and the collective concentration of the
multiplicity of degenerate primer species is limiting with respect
to the concentration of the corresponding primer of the primer
pair. In some embodiments, a universal primer is used with a
multiplicity of corresponding primer species comprising different
degenerate sequences and the concentration of the universal primer
species is at least 3 times, at least 5 times, or at least 10 times
the concentration of any of the individual primer species
comprising degenerate sequences and the concentration of the
universal primer species is greater than the total concentration of
all of the corresponding primer species comprising degenerate
sequences. Those in the art will appreciate that with appropriate
design, a formulated relative concentration of primers can be used
according to the present teaching for generating a normalized
population.
[0017] The terms "hybridizing" and "annealing", including without
limitation variations of the root words hybridize and anneal, are
used interchangeably and mean the nucleotide base-pairing
interaction of one nucleic acid with another nucleic acid that
results in the formation of a duplex, triplex, or other
higher-ordered structure. The primary interaction is typically
nucleotide base specific, e.g., A:T, A:U, and G:C, by Watson-Crick
and Hoogsteen-type hydrogen bonding. In certain embodiments,
base-stacking and hydrophobic interactions may also contribute to
duplex stability. Conditions under which primers anneal to
complementary or substantially complementary sequences are well
known in the art, e.g., as described in Nucleic Acid Hybridization,
A Practical Approach, Hames and Higgins, eds., IRL Press,
Washington, D.C. (1985) and Wetmur and Davidson, Mol. Biol. 31:349,
1968. In general, whether such annealing takes place is influenced
by, among other things, the length of the complementary portion of
the primers and their corresponding binding sites in
adapter-modified molecules and/or extension products, the pH, the
temperature, the presence of mono- and divalent cations, the
proportion of G and C nucleotides in the hybridizing region, the
viscosity of the medium, and the presence of denaturants. Such
variables influence the time required for hybridization. The
presence of certain nucleotide analogs or minor groove binders in
the complementary portions of the primers, adapter-modified
molecules, and/or extension products can also influence
hybridization conditions. Thus, the preferred annealing conditions
will depend upon the particular application. Such conditions,
however, can be routinely determined by persons of ordinary skill
in the art, without undue experimentation. Typically, annealing
conditions are selected to allow the disclosed primers to
selectively hybridize with a complementary or substantially
complementary sequence in their corresponding adapter-modified
molecule and/or extension product, but not hybridize to any
significant degree to other sequences in the reaction.
[0018] The term "ligation agent" as used herein comprises any
enzymatic or non-enzymatic reagent that can effect ligation of
nucleic acids to one another, including without limitation,
ligases, chemical ligation agents, and photoligation. For example,
ligase is an enzymatic ligation agent that, under appropriate
conditions, forms phosphodiester bonds between the 3'-OH and the
5'-phosphate of adjacent nucleic acid sequences, including without
limitation between an adapter and a small nucleic acid, provided
that they are both suitable for ligation together.
[0019] Chemical ligation agents include without limitation,
activating, condensing, and reducing agents, such as carbodiimide,
cyanogen bromide (BrCN), N-cyanoimidazole, imidazole,
1-methylimidazole/carbodiimide/cystamine, dithiothreitol (DTT) and
ultraviolet light. Autoligation, i.e., spontaneous ligation in the
absence of a ligating agent, is also within the scope of the
present teachings. Protocols for chemical ligation methods and
descriptions of appropriate reactive groups can be found in, among
other places, Xu et al., Nucl. Acids Res., 27:875-81, 1999;
Gryaznov and Letsinger, Nucl. Acids Res. 21:1403-08, 1993; Gryaznov
et al., Nucleic Acid Res. 22:2366-69, 1994; Kanaya and Yanagawa,
Biochemistry 25:7423-30, 1986; Luebke and Dervan, Nucl. Acids Res.
20:3005-09,1992; Sievers and von Kiedrowski, Nature 369:221-24,
1994; Liu and Taylor, Nucl. Acids Res. 26:3300-04, 1999; Wang and
Kool, Nucl. Acids Res. 22:2326-33, 1994; Purmal et al., Nucl. Acids
Res. 20:3713-19, 1992; Ashley and Kushlan, Biochemistry 30:2927-33,
1991; Chu and Orgel, Nucl. Acids Res. 16:3671-91, 1988; Sokolova et
al., FEBS Letters 232:153-55, 1988; Naylor and Gilham, Biochemistry
5:2722-28, 1966; James and Ellington, Chem. & Biol. 4:595-605,
1997; and U.S. Pat. No. 5,476,930.
[0020] Photoligation using light of an appropriate wavelength as a
ligation agent is also within the scope of the current teachings.
In certain embodiments, photoligation comprises adapters comprising
nucleotide analogs, including but not limited to, 4-thiothymidine
(s.sup.4T), 5-vinyluracil and its derivatives, or combinations
thereof. In certain embodiments, the ligation agent comprises: (a)
light in the UV-A range (about 320 nm to about 400 nm), the UV-B
range (about 290 nm to about 320 nm), or combinations thereof, (b)
light with a wavelength between about 300 nm and about 375 nm, (c)
light with a wavelength of about 360 nm to about 370 nm; (d) light
with a wavelength of about 364 nm to about 368 nm, or (e) light
with a wavelength of about 366 nm. In certain embodiments,
photoligation is reversible. Descriptions of photoligation can be
found in, among other places, Fujimoto et al., Nucl. Acid Symp.
Ser. 42:39-40, 1999; Fujimoto et al., Nucl. Acid Res. Suppl.
1:185-86, 2001; Fujimoto et al., Nucl. Acid Suppl., 2:155-56, 2002;
Liu and Taylor, Nucl. Acid Res. 26:3300-04, 1998; and on the world
wide web at: sbchem . kyoto-u.ac.jp/saito-lab.
[0021] When used in the context of the current teachings, the term
"suitable for ligation" refers to one or more ends of a nucleic
acid molecule, including without limitation an adapter and a small
nucleic acid, comprising an appropriately reactive group for a
particular ligation agent. For example but not limited to, the 3'-
and 5'-ends of a small nucleic acid, the 5'-end of a 3' adapter,
and the 3'-end of a 5' adapter. Exemplary pairs of reactive groups
include, but are not limited to: a nucleotide 3'-hydroxyl group on
the 3' end of a 5' adapter and a nucleotide 5'-phosphate group on
the 5' end of a small nucleic acid; phosphorothioate and tosylate
or iodide; esters and hydrazide; RC(O)S.sup.-, haloalkyl, or
RCH.sub.2S and .alpha.-haloacyl; thiophosphoryl and bromoacetoamido
groups.
[0022] "population of different small nucleic acid species" is the
group or set of nucleic acids obtained from a sample, typically a
size fractionated sample, that contains or may contain small
nucleic acids of interest. Typically the different small nucleic
acid species in the population are present in varying
concentrations, i.e., the relative amount of at least one small
nucleic acid species in the sample is different from, for example
substantially less than, the relative amount of at least one other
small nucleic acid species in that population. A normalized
population comprises the group of different nucleic acid sequences,
e.g., extension products, generated by a normalizing step of the
current teachings, wherein the relative concentration of at least
two different small nucleic acid species are brought closer to
equivalency, as measured by the relative concentrations of their
corresponding extension products generated during the
normalizing.
[0023] As used herein, the term "primer-binding site" refers to a
region of a polynucleotide sequence that can serve directly, or by
virtue of its complement, as the template upon which a primer can
anneal for any of a variety of primer extension reactions known in
the art (for example, PCR). It will be appreciated by those of
skill in the art that when two primer-binding sites are present on
a single polynucleotide (for example but not limited to a first
extension product or a second extension product), the orientation
of the two primer-binding sites is generally different. For
example, one primer of a primer pair is complementary to and can
hybridize with the first primer-binding site, while the
corresponding primer of the primer pair can hybridize to the
complement of the second primer-binding site. Stated another way,
in some embodiments, the first primer-binding site can be in a
sense orientation, and the second primer-binding site can be in an
antisense orientation. In addition, "universal" primers and
primer-binding sites as used herein are generally chosen to be as
unique as possible given the particular assays and host genomes to
ensure specificity. In some embodiments, at least one of the
primer-binding sites comprise a promoter sequence, including
without limitation a sequence suitable for binding T3 RNA
polymerase, T7 RNA polymerase, or SP6 RNA polymerase.
[0024] A "small nucleic acid" as that term is used herein, refers
to a polynucleotide species that is present in a population of
small nucleic acids that is being normalized and, in some
embodiments, being identified. A small nucleic acid can comprise
either DNA or RNA and may initially be either single-stranded or
double-stranded. Those in the art will appreciate, however, that
the disclosed primers anneal with single-stranded polynucleotides,
including without limitation one strand of a double-stranded
nucleic acid molecule. A small nucleic acid of the current
teachings is typically less than 200 nucleotides or base pairs, as
appropriate and are often less than 100 nucleotides or base pairs
long. In some embodiments, a small nucleic acid is approximately 70
nucleotides or base pairs long. In some embodiments, a small
nucleic acid is less than 50 nucleotides of base pairs long, less
than 30 nucleotides or base pairs long, less than 25 nucleotides or
base pairs long, between 19 and 23 nucleotide or base pairs long,
or 21-22 nucleotides or base pairs long, and can but need not
include double-stranded molecules with single-stranded overhangs at
one or both ends. Some non-limiting examples of small nucleic acid
species include small DNA molecules and small RNA molecules,
including without limitation certain non-coding DNA (ncDNA,
sometimes referred to as non-protein-coding DNA; see, e.g., Bergman
and Kreitman, Genome Res. 11:1335-45, 2001) and certain non-coding
RNAs (ncRNAs), including without limitation, microRNA precursors
(pre-miRNAs), microRNAs (miRNAs) sometimes referred to as small
temporal RNAs (stRNAs), small interfering RNAs (siRNAs), tiny
noncoding RNAs (tncRNAs), small nucleolar RNAs (snoRNAs), small
nuclear RNAs (snRNAs), and spliceosomal RNA (see, e.g., S.
Buckingham, Horizon Symposia: Understanding the RNAissance, May
2003, pp. 1-3, Nature Publishing; and Ambros et al., Curr. Biol.
13:807-818, 2003). In some embodiments, the small nucleic acid is
present in the nucleus of the cell or in the cytoplasm of the cell,
for example but not limited to small nucleic acid species
associated with the RISC, miRNP, or ribosomes, including without
limitation polyribosomes. Expressly excluded from the term "small
nucleic acid" are messenger RNA molecules (mRNA), e.g., (a)
typically comprising poly-A tails on their 3'-end, (b) may comprise
a "cap structure" that typically includes 7-methylguanosine and can
interact with a cap-binding protein (but not always), and (c) serve
as templates for protein synthesis, i.e., can be translated by
ribosomes to produce peptides. Descriptions of mRNA can be found
in, among other places, Lehninger.
II. Techniques
[0025] The terms "amplifying" and "amplification" are used in a
broad sense and refer to any technique by which at least a part of
a adapter-modified molecule or an extension product, is reproduced
or copied (including the synthesis of a complementary copy),
typically in a template-dependent manner, including without
limitation, a broad range of techniques for amplifying nucleic acid
sequences, either linearly or exponentially. Some non-limiting
examples of amplification techniques include the polymerase chain
reaction (PCR) including without limitation RT-PCR and asymmetric
PCR, primer extension, strand displacement amplification (SDA),
multiple displacement amplification (MDA), nucleic acid
strand-based amplification (NASBA), rolling circle amplification
(RCA), transcription-mediated amplification (TMA), transcription,
and the like, including multiplex versions or combinations thereof.
Descriptions of such techniques can be found in, among other
places, Sambrook and Russell; Sambrook et al.; Ausubel et al.; PCR
Primer: A Laboratory Manual, Diffenbach, Ed., Cold Spring Harbor
Press (1995); The Electronic Protocol Book, Chang Bioscience
(2002); Msuih et al., J. Clin. Micro. 34:501-07 (1996); McPherson
and Moller, PCR The Basics, Bios Scientific Publishers, Oxford,
U.K., 2000 ("McPherson"); Rapley, The Nucleic Acid Protocols
Handbook (2000), Humana Press, Totowa, N.J. ("Rapley"); U.S. Pat.
Nos. 6,027,998 and 6,511,810; PCT Publication Nos. WO 97/31256 and
WO 01/92579; Ehrlich et al., Science 252:1643-50 (1991); Innis et
al., PCR Protocols: A Guide to Methods and Applications, Academic
Press (1990); Favis et al., Nature Biotechnology 18:561-64 (2000);
and Rabenau et al., Infection 28:97-102 (2000).
[0026] In certain embodiments, amplifying comprises a cycle of the
sequential steps of: hybridizing a primer with a complementary or
substantially complementary sequence of an adapter-modified
molecule or an extension product; synthesizing a strand of
nucleotides in a template-dependent manner using a polymerase; and
denaturing the newly-formed nucleic acid duplex to separate the
strands. The cycle may or may not be repeated, as desired.
Amplification can comprise thermocycling or can be performed
isothermally. In certain embodiments, newly-formed nucleic acid
duplexes are not initially denatured, but are used in their
double-stranded form in one or more subsequent steps and either or
both strands can, but need not, serve as a surrogate for the
corresponding extension product, the corresponding adapter-modified
molecule, or ultimately, the corresponding small nucleic acid
species. In certain embodiments, single-stranded amplicons are
generated, for example but not limited to asymmetric PCR.
[0027] Primer extension is an amplifying technique that comprises
elongating a primer that is annealed to a template in the 5'=>3'
direction using an extending enzyme such as a polymerase to form an
extension product. According to certain embodiments, with
appropriate buffers, salts, pH, temperature, and nucleotide
triphosphates, a polymerase incorporates nucleotides complementary
to the template strand starting at the 3'-end of an annealed
primer, to generate a complementary strand. In certain embodiments,
the polymerase used for primer extension lacks or substantially
lacks 5'-exonuclease activity.
[0028] A "first extension product" is generated when a first
reverse primer, annealed with the corresponding adapter-modified
molecule is extended. When the small nucleic acid consists of RNA,
the first extension step comprises reverse transcription. A "second
extension product" is generated when a first forward primer,
annealed with the corresponding first extension product, is
extended. A "third extension product" is generated when a second
reverse primer, annealed with the corresponding second extension
product, is extended. A "fourth extension product" is generated
when a third reverse primer, annealed with the corresponding second
extension product, is extended. A "fifth extension product" is
generated when a second forward primer, annealed with the
corresponding fourth extension product, is extended. See, e.g.,
FIG. 1. The generic term "extension product" refers to a first
extension product, a second extension product, a third extension
product, a fourth extension product, a fifth extension product, or
combinations thereof.
[0029] The term "cloning", also referred to as molecular cloning,
and derivatives of the root word "clone" are used in a broad sense
herein and include any technique known in the art wherein a nucleic
acid is inserted into a vector using recombinant methodology and
large quantities of the recombinant vector comprising the inserted
nucleic acid is produced. Generally such methods comprise
constructing a recombinant vector comprising a nucleic acid insert,
introducing the recombinant vector into a suitable host cell,
selective propagation of host cells containing the vector, and
extraction and purification of the cloned nucleic acid. Cloning
vectors typically comprise an origin of replication, at least one
"cloning cassette" that comprises at least one restriction enzyme
cleavage site to facilitate the incorporation of inserts, and at
least one selectable marker to facilitate vector and recombinant
selection. Some non-limiting examples of vectors include pBR322,
.phi.X174 RF, PGEM vectors, pSP72 vector, pUC vectors, M13 vectors,
TOPO vectors, and A vectors, many of which are commercially
available. In some embodiments, at least part of a second extension
product, at least part of a third extension product, at least part
of a fourth extension product, at least part of a fifth extension
product, or combinations thereof, is cloned into a vector to
facilitate identifying the corresponding small nucleic species. In
some embodiments, at least one primer species comprises a
restriction enzyme cleavage site or its complement to facilitate
insertion of at least a part of an extension product in which the
restriction enzyme cleavage site becomes incorporated into a
vector. Descriptions of cloning and associated techniques can be
found in, among other places, Sambrook and Russell, Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Press, 3d ed.,
2001 ("Sambrook and Russell"); Ausubel et al.; Twyman, Advanced
Molecular Biology, Springer-Verlag N.Y., 1999, particularly at
Chapter 24; Lau et al., Science 294:858-62, 2001; and McPherson,
particularly at Chapter 6. Those in the art will appreciate that
many well-known techniques can be useful for cloning the normalized
extension products of the current teachings and that the vector,
cloning technique, or host cells employed are typically not
limitations of the current teachings, provided that sufficient
nucleic acid is subsequently obtained for identifying the
corresponding small nucleic acid.
[0030] The terms "denaturing" or "denaturation" as used herein
refer to any process in which a double-stranded polynucleotide,
including without limitation, a duplex comprising a first extension
product annealed with a second extension product, a second
extension product annealed with a third extension product, and so
forth is converted to two single-stranded polynucleotides.
Denaturing a double-stranded polynucleotide includes without
limitation, a variety of thermal and chemical techniques for
denaturing a duplex, thereby releasing its two individual
single-stranded components. Those in the art will appreciate the
denaturing technique employed is generally not limiting unless it
inhibits a subsequent annealing or identifying step.
[0031] The term "degrading" is used in a broad sense herein and
refers to any technique in which at least one nucleotide is removed
from a nucleic acid molecule or in which at least one
internucleotide bond in a nucleic acid molecule is cleaved,
including without limitation alkaline hydrolysis and treatment by a
nuclease, such as a DNase or an RNase, for example but not limited
to exonuclease 1, mung bean nuclease, S1 nuclease, exonuclease T,
uracil N-glycosylase (UNG, also known as uracil-DNA glycosylase
(UDG)), RNase H, RNase I, RNase III, but typically excluding
restriction endonuclease cleavage. In some embodiments, a small
nucleic acid species is degraded. In some embodiments, an
adapter-modified molecule is degraded, for example but not limited
to the adapter-modified molecule duplexed with a first extension
product. Those in the art will appreciate that the method for
degrading nucleic acids is typically not limiting, provided that
the desired polynucleotides, typically extension products, are not
degraded or at least not substantially degraded, while the small
nucleic acids and/or adapter-modified molecules are degraded. In
some embodiments, a primer comprises a uracil or a deoxyuracil. In
some embodiments, unincorporated primers and/or dNTPs are removed
by enzymatic degradation, including without limitation treatment
with exonuclease I and shrimp alkaline phosphatase digestion, for
example but not limited to the ExoSAP-IT.RTM. reagent (USB
Corporation) or UNG. In some embodiments, unincorporated primers
and/or dNTPs are removed by gel or column purification,
sedimentation, filtration, beads, magnetic separation, or
hybridization-based pull out, for example but not limited to a
Wizard.RTM. MagneSil.TM. PCR Clean-Up System (Promega), a MinElute
PCR Purification Kit, a QIAquick Gel Extraction Kit, a QIAquick
Nucleotide Removal Kit, a QIAquick 96 PCR Purification Kit or
BioRobot Kit (all from Qiagen, Valencia, Calif.), or an ABI
PRISM.RTM. DupleX.TM. 384 Well F/R Sequence Capture Kit (Applied
Biosystems P/N 4308082).
[0032] Ligation according to the present teachings comprises any
enzymatic or non-enzymatic means wherein an inter-nucleotide
linkage is formed between appropriate ends of nucleic acid
sequences, including without limitation, the 5'-end of a 3' adapter
and the 3'-end of a small nucleic acid provided that they are
suitable for ligation together, and including blunt end ligation.
The internucleotide linkage can include, but is not limited to,
phosphodiester bond formation. Such bond formation can include,
without limitation, those created enzymatically by a DNA ligase or
an RNA ligase capable of catalyzing blunt-end ligation. Other
internucleotide linkages include, without limitation, covalent bond
formation between appropriate reactive groups such as between an
.alpha.-haloacyl group and a phosphothioate group to form a
thiophosphorylacetylamino group, a phosphorothioate a tosylate or
iodide group to form a 5'-phosphorothioester, and pyrophosphate
linkages.
[0033] Chemical ligation can, under appropriate conditions, occur
spontaneously such as by autoligation. Alternatively, "activating"
or reducing agents can be used. Examples of activating and reducing
agents include, without limitation, carbodiimide, cyanogen bromide
(BrCN), imidazole, 1-methylimidazole/carbodiimide/cystamine,
N-cyanoimidazole, and dithiothreitol (DTT).
[0034] According to the present teachings, the term "normalizing"
refers to a method in which (a) the relative concentration of at
least one small nucleic acid species in a group comprising a
multiplicity of different nucleic acid species (for example but not
limited to a population of different small nucleic acid species in
varying concentrations, a multiplicity of different
adapter-modified molecules, or a multiplicity of different
extension products or amplicons) is decreased relative to at least
one other nucleic acid species in the group, (b) the relative
concentration of at least one small nucleic acid in the group is
increased relative to at least one different nucleic acid species
in the group, or (c) both. The term "normalized" when used in
reference to a population of different nucleic acid species refers
to a multiplicity of different nucleic acid species that have been
subjected to at least one round of normalizing and therefore
comprises at least one nucleic acid species whose relative
concentration has been increased or decreased compared with at
least one other nucleic acid species in the original group of
different small nucleic acid species. Thus, the relative
concentrations of the different extension products are often at
least similar, if not the same after normalization. It is to be
understood that even though surrogates of the small nucleic acid
species present in the original population are being normalized
(e.g., adapter-modified molecules and/or extension products), the
resulting normalized population typically reflects the composition
of the original population qualitatively, but not quantitatively. A
"normalized nucleic acid" is a nucleic acid sequence, typically an
extension product, that is present in a normalized population.
[0035] According to the present teachings, a normalized population
can be obtained using a multiplicity of different primer species,
wherein at least some of the different primer species comprise a
degenerate sequence at the 3'-end of the primer. Thus, normalizing
is based on the nucleotide sequences that are present at the 3'-end
and/or the 5'-end of small nucleic acids (typically the last 6, 5,
4, 3, 2, or 1 nucleotides on each end) or their surrogates,
including in some embodiments, the complement of such "end"
sequences. In some embodiments, normalized populations are
generated by normalizing the 3'-ends of the small nucleic acids or
their surrogates; in some embodiments, normalized populations are
generated by normalizing the 5'-ends of the small nucleic acids or
their surrogates; in some embodiments, normalized populations are
generated by normalizing the 3'-ends and the 5'-ends of the small
nucleic acids or their surrogates.
[0036] The term "sequencing" is used in a broad sense herein and
refers to any technique known in the art that allows the order of
at least some consecutive nucleotides in at least part of a
polynucleotide to be identified, including without limitation at
least part of an extension product or a vector insert. Some
non-limiting examples of sequencing techniques include Sanger's
dideoxy terminator method and the chemical cleavage method of Maxam
and Gilbert, including variations of those methods; sequencing by
hybridization; and restriction mapping. Some sequencing methods
comprise electrophoreses, including without limitation capillary
electrophoresis and gel electrophoresis; sequencing by
hybridization including without limitation microarray
hybridization; mass spectrometry; and single molecule detection. In
some embodiments, sequencing comprises direct sequencing, duplex
sequencing, cycle sequencing, single base extension sequencing
(SBE), solid-phase sequencing, 3' exonuclease sequencing; cleavage
fragment length polymorphism sequencing; microtransponder-based
sequencing; or combinations thereof. Those in the art will
appreciate that the sequencing method employed is not typically a
limitation of the present methods. Rather any sequencing technique
that provides the order of at least some consecutive nucleotides of
at least part of the corresponding extension product or at least
part of a vector insert derived from an extension product can
typically be used with the current methods. Descriptions of
sequencing techniques can be found in, among other places,
McPherson, particularly in Chapter 5; Sambrook and Russell; Ausubel
et al.; Siuzdak, The Expanding Role of Mass Spectrometry in
Biotechnology, MCC Press, 2003, particularly in Chapter 7; Datar
and Kim, Concepts in Molecular Biology, Eaton Publishing, 2003; and
Rapley. In some embodiments, unincorporated primers and/or dNTPs
are removed prior to a sequencing step by enzymatic degradation,
including without limitation UNG or exonuclease I and shrimp
alkaline phosphatase digestion, for example but not limited to the
ExoSAP-IT.RTM. reagent (USB Corporation). In some embodiments,
unincorporated primers and/or dNTPs are removed by gel or column
purification, sedimentation, filtration, beads, magnetic
separation, or hybridization-based pull out (see, e.g., ABI
PRISM.RTM. DupleX.TM. 384 Well F/R Sequence Capture Kit, Applied
Biosystems P/N 4308082).
III. Exemplary Embodiments
[0037] Certain embodiments of the present teachings comprise
combining a multiplicity of adapters with a multiplicity of
different small nucleic acid species of varying abundance and
ligating at least one adapter to a small nucleic acid to generate a
multiplicity of different adapter-modified molecules. In some
embodiments, adapter-modified molecules are amplified to generate
first extension products before normalization. The multiplicity of
different adapter-modified molecules or corresponding extension
products are subjected to at least one round of normalization using
at least one primer species comprising a degenerate sequence,
thereby generating a normalized population. Some methods comprise
at least two rounds of normalization, typically one round of
normalization directed to the 5'-end of a nucleic acid species or
its surrogate and one round of normalization directed to the 3'-end
of a corresponding nucleic acid species or its surrogate. Those in
the art will appreciate that an adapter-modified molecule, a first
extension product, a second extension product, a third extension
product, a fourth extension product, a fifth extension product, or
combinations thereof, and including portions of any of these
extension products, can serve as a surrogate of the corresponding
small nucleic acid species.
[0038] The adapters of the present teachings comprise a
primer-binding site and in some embodiments, a blocking moiety. The
primer-binding site comprises a sequence that is the same as or is
complementary to at least a portion of a forward primer or a
reverse primer. In some embodiments, the primer-binding portion
comprises a universal priming sequence, allowing amplification of
at least some extension products with a universal primer or a
universal primer pair. According to the disclosed methods, a
ligation composition comprising a multiplicity of adapters, a
population of different nucleic acid species, and a ligation agent
is formed. In some embodiments, the ligation composition further
comprises ATP to support ATP-mediated ligation. In some
embodiments, the population of small nucleic acid species is
treated with a phosphatase, such as calf intestinal phosphatase
(CIP). In some embodiments, the multiplicity of adapters comprises
a multiplicity of 5' adapters or a multiplicity of 3' adapters, but
not both. In other embodiments, the multiplicity of adapters
comprises a multiplicity of adapter pairs, comprising a
multiplicity of 5' adapters and a multiplicity of 3' adapters.
Provided that at least some of the adapters are suitable for
ligation with the small nucleic acids and under appropriate
reaction conditions, one or two adapters are ligated with a small
nucleic acid to form an adapter-modified molecule. In some
embodiments, at least some of the adapters comprise a blocking
moiety on one end of the adapter, for example but not limited to a
dideoxy moiety or a 4-hydroxymethylbenzyl moiety on the 3'-end of
an adapter, which render those adapter ends unsuitable for
enzymatic ligation. In some embodiments, an adapter comprises a
phosphorylated 5'-end. In some embodiments, an adapter comprises a
3'-end comprising a hydroxyl group, a 5'-end comprising a hydroxyl
group, or both. In some embodiments, adapters comprise at least one
restriction enzyme cleavage site. In some embodiments, an adapter
is pre-activated with an adenylyl group. In some embodiments, an
adapter comprises deoxyribonucleotides, but not ribonucleotides. In
some embodiments, an adapter comprises ribonucleotides, but not
deoxyribonucleotides. In some embodiments, an adapter comprises
deoxyribonucleotides and ribonucleotides. In some embodiments, an
adapter comprises at least one ribonucleotide, at least two
ribonucleotides, or at least three ribonucleotides on the end to be
ligated with a small nucleic acid, e.g., the 3'-end of a 5'
adapter, the 5'-end of the 3' adapter, or both.
[0039] Some embodiments of the disclosed methods comprise a
multiplicity of different first reverse primer species, wherein at
least some of the different first reverse primer species comprise a
degenerate sequence and wherein the degenerate sequence of at least
one first reverse primer species is different from the degenerate
sequence of at least one other first reverse primer species. Some
embodiments of the present teachings comprise a multiplicity of
different second reverse primer species, wherein at least some of
the different second reverse primer species comprise a degenerate
sequence and wherein the degenerate sequence of at least one second
reverse primer species is different from the degenerate sequence of
at least one other second reverse primer species. Some embodiments
comprise a multiplicity of different third reverse primer species,
wherein at least some of the different third reverse primer species
comprise a degenerate sequence and wherein the degenerate sequence
of at least one third reverse primer species is different from the
degenerate sequence of at least one other third reverse primer
species; and so forth. Some embodiments of the present teachings
comprise a multiplicity of different first forward primer species,
wherein at least some of the different first forward primer species
comprise a degenerate sequence and wherein the degenerate sequence
of at least one first forward primer species is different from the
degenerate sequence of at least one other first forward primer
species. Some embodiments of the present teachings comprise a
multiplicity of different second forward primer species, wherein at
least some of the different second forward primer species comprise
a degenerate sequence and wherein the degenerate sequence of at
least one second forward primer species is different from the
degenerate sequence of at least one other second forward primer
species; and so forth. In some embodiments, a primer species
comprising a degenerate sequence further comprises a "stem-loop"
structure. In some embodiments, a degenerate sequence (a)
comprises, consists essentially of, or consists of (b) one, two,
three, four, five, or six nucleotides.
[0040] In some embodiments, only a subset of the possible
degenerate sequences are included in an amplification composition,
typically to avoid primer dimer formation between two different
primer species that comprise complementary or substantially
complementary degenerate sequences. For illustration purposes but
not as a limitation, assume a multiplicity of different third
forward primer species each comprising a different degenerate
sequence consisting of three nucleotides, in which case, a library
of 64 different degenerate sequences are possible (4.sup.3=64). If
64 different third forward primer species, each comprising one of
the 64 different degenerate sequences were combined in an
amplification composition, at least some primer dimers could form.
However, by employing a subset of those 64 different degenerate
sequences in the amplification composition, wherein complementary
or substantially complementary degenerate sequences are not
included, the potential for primer dimer formation is decreased.
Thus, for example, one amplification composition could comprise a
third forward primer species comprising a degenerate sequence
consisting of "GTA" but not the third forward primer species
comprising the degenerate sequences consisting of "TAC". The entire
library of different degenerate sequences can be employed in a
multiplicity of different amplification compositions, each
comprising a different subset of possible degenerate sequences. For
example but without limitation, a library of 256 different possible
degenerate sequences (4.sup.4=256) could be employed in two
different amplification compositions, each comprising a mutually
exclusive subset of 128 different degenerate sequences; in four
different amplification compositions, each comprising a mutually
exclusive subset of 64 different degenerate sequences; and so
forth. Various permutations thereof are also within the
contemplation of the current teachings, for example but not limited
to, one amplification composition comprising 128 different
degenerate sequences, one amplification composition comprising 99
different degenerate sequences, and one amplification composition
comprising 29 different degenerate sequences. Those in the art will
appreciate that the number of different subsets and the degree of
subset exclusivity required to effectively address primer dimer
formation and secondary amplicon artifacts can be determined using
routine methodology, without resort to undue experimentation. In
some embodiments, portions of the ligation composition comprising
the multiplicity of different adapter-modified molecules are
normalized in parallel amplification compositions, each comprising
a different subset of primers comprising degenerate sequences. In
some embodiments, not all possible degenerate sequences are
employed or are employed in separate reactions, e.g., not performed
in parallel.
[0041] Certain disclosed primers comprise a binding portion that is
designed to anneal with a complementary or substantially
complementary binding site in a corresponding surrogate, for
example but not limited to an adapter-modified molecule or an
extension product. These binding portions, typically comprising
nucleotides at the 5'-end of the primer, internal nucleotides, or
both, are of sufficient length to permit specific annealing to
complementary or substantially complementary sequences in
corresponding surrogates. In some embodiments, a primer comprises a
binding portion and a 5' tail sequence for incorporating additional
sequences into the corresponding extension products, for example
but not limited to a promoter sequence. The criteria for designing
sequence-specific nucleic acid primers are well known to persons of
ordinary skill in the art. Detailed descriptions of primer design
can be found in, among other places, Diffenbach and Dveksler, PCR
Primer, A Laboratory Manual, Cold Spring Harbor Press (1995);
Rapley; Schena; and Kwok et al., Nucl. Acid Res. 18:999-1005
(1990). Primer design software is also commercially available from
a variety of vendors. In some embodiments, at least part of the
binding portion of a multiplicity of different primers comprise a
universal priming sequence, which allows the potential use of
universal primers in at least one subsequent amplification step.
Universal primers/priming sequences (also known as generic
primers), including without limitation M13 universal primers and T7
universal primers, and their use are well known in the art (see,
e.g., McPherson, particularly section 4.2 of Chapter 5). In some
embodiments, a universal primer or a pair of universal primers can
be employed as sequencing primers for a subsequent sequencing step;
and either or both strands of a double-stranded molecule can be
sequenced, for example, a second extension product:third extension
product duplex or a nucleic acid insert in certain vectors (see,
e.g., McPherson, particularly section 4 of Chapter 5). In some
embodiments, a sequencing primer comprises the nucleotide sequence
present in an adapter-modified molecule that corresponds to a
junction between the ligated adapter and the small nucleic acid, or
the complement of that sequence. Typically such sequencing primers
comprise at least some nucleotides that correspond with the
appropriate end of the small nucleic acid species and at least as
many nucleotides that correspond with the adapter sequence (or the
complement of that sequence) to permit specific annealing. In some
embodiments, a sequencing primer comprises six, five, four, three,
two, or one nucleotides that correspond with the end of the small
nucleic acid sequence, i.e., either the same as or complementary to
the end of the small nucleic acid species.
[0042] It is to be understood that when a small nucleic acid
species comprises ribonucleotides, for example but not limited to a
miRNA species, a primer comprising a sequence that is the same as
or complementary to that species of small nucleic acid typically
comprises deoxyribonucleotide counterparts of the corresponding
small RNA species. In some embodiments, a sequencing primer
comprises a sequence that is the same as or is complementary to a
region of an extension product that corresponds to an adapter-small
nucleic acid molecule junction of an adapter-modified molecule and
such primers can include deoxyribonucleotide counterparts of
ribonucleotides present in either the small nucleic acid or in the
adapter, for example but not limited to a hybrid adapter comprising
both ribonucleotides and deoxyribonucleotides, or both. For the
purposes of the present teachings, however, such primers are
considered to comprise a sequence that is the same as or
complementary to at least a part of the small nucleic acid species
or the adapter-small nucleic acid junction, respectively.
[0043] Certain methods for normalizing a population of different
small nucleic acid species of varying abundance comprise forming a
ligation composition comprising a multiplicity of different small
nucleic acid sequences, a multiplicity of adapters, and a ligation
agent. In some embodiments, the multiplicity of adapters comprises
a multiplicity of 5' adapters or a multiplicity of 3' adapters, but
typically not both. In some embodiments, the multiplicity of
adapters comprises a multiplicity of adapter pairs, comprising a
multiplicity of 5' adapters and a multiplicity of 3' adapters. In
some embodiments, adapters comprise a chimeric sequence including
both deoxyribonucleotides and ribonucleotides. A multiplicity of
different adapter-modified molecules are generated in the ligation
composition when at least some of the multiplicity of adapters are
ligated to at least some of the multiplicity of small nucleic
acids. A first amplification reaction composition is formed
comprising at least some of the different adapter-modified
molecules, a first extending enzyme, and a multiplicity of reverse
primers. In some embodiments, a reverse primer can form a hairpin
or stem-loop structure. At least some of the first reverse primers
anneal with corresponding regions of at least some of the
multiplicity of different adapter-modified molecules and are
extended by the first extending enzyme to generate duplex
structures comprising the adapter-modified molecule annealed to the
corresponding first extension product.
[0044] According to certain disclosed methods, a ligation
composition is formed comprising a multiplicity of adapter pairs, a
population of different small nucleic acid species, and a ligation
agent. The concentration of at least one of the species of small
nucleic acid molecules in the population is substantially greater
than the concentration of at least one other small nucleic acid
species in the population. An adapter pair of the present teachings
comprises a 3' adapter comprising a first primer-binding site and a
5' adapter comprising a second primer-binding site. Double
adapter-modified molecules are generated in the ligation
composition when a 5' adapter is ligated to the 5'-end of a small
nucleic acid and a 3' adapter is ligated to the 3'-end of the same
small nucleic acid. In some embodiments, forming a double
adapter-modified molecule comprises two steps, first ligating a 3'
adapter with a small nucleic acid to generate a single
adapter-modified molecule, wherein the 3' adapter comprises a
blocked 3'-end and is pre-activated with an adenylyl group on the
5'-end; then ligating a 5' adapter to the 5'-end of the single
adapter-modified molecule to generate a double adapter-modified
molecule.
[0045] A first amplification composition is formed comprising at
least some of these double adapter-modified molecules, a first
extending enzyme, including without limitation an RNA-dependent DNA
polymerase such as a reverse transcriptase, and a multiplicity of
first reverse primers. The first reverse primers comprise a
sequence that is complementary with the first primer-binding site
of the double adapter-modified molecules. At least some of the
first reverse primers are annealed with at least some of the double
adapter-modified molecules. At least some of the annealed first
reverse primers are extended by the first extending enzyme to
generate a multiplicity of different first extension products, each
duplexed with the corresponding double adapter-modified molecule.
In some embodiments, the duplexes comprising the different first
extension products hybridized with the adapter-modified molecules
are denatured, including without limitation, thermal or chemical
denaturation. In some embodiments, a small nucleic acid, a primer,
an adapter-modified molecule, or combinations thereof is degraded,
for example but not limited to an adapter-modified molecule
duplexed with a first extension product or an unincorporated
primer. In some embodiments, degrading comprises subjecting the
first amplification composition comprising first extension products
to alkaline hydrolysis or nuclease digestion.
[0046] In some embodiments, a second amplification reaction
composition is formed comprising: at least some of the first
amplification composition comprising the different first extension
products, a second extending enzyme, and a formulated relative
concentration of primers comprising a multiplicity of different
first forward primer species and a second reverse primer species.
In some embodiments, the first amplification composition comprising
extension products is diluted. The first amplification composition
can be diluted in buffer, for example, and a portion of the diluted
first amplification composition added to the second amplification
composition being formed. In some embodiments, a portion of
undiluted first amplification composition is diluted when it is
added to the second amplification composition being formed. In some
embodiments, all of the first reaction composition comprising first
extension products is added to the second amplification
composition, wherein it is diluted. Each of the different first
forward primer species of the second amplification composition
comprises (a) a sequence that is complementary to the second
primer-binding site of the first extension products and (b) a
degenerate sequence that is located at the 3'-end of the first
forward primer and that comprises at least two nucleotides. The
degenerate sequence of one first forward primer species is
typically different from the degenerate sequence of the other first
forward primer species. The second reverse primer of the second
amplification composition comprises a sequence that is the same as
or substantially the same as the first primer-binding site of the
first extension product.
[0047] The second amplification composition is subjected to
denaturing conditions to separate the adapter-modified molecules
from the multiplicity of different first extension products. At
least some of the first forward primer species anneal with at least
some of the different first extension products in the second
reaction composition. At least some of the annealed first forward
primers are extended by the second extending enzyme and a
multiplicity of different second extension products, duplexed with
their first extension product templates, are generated. In some
embodiments, the first extending enzyme and the second extending
enzyme are the same, while in other embodiments, the first
extending enzyme and the second extending enzyme are different, for
example but not limited to a reverse transcriptase and a
DNA-dependent DNA polymerase, such as Taq polymerase. The second
amplification composition is subjected to denaturing conditions to
release at least some of the different second extension products
and then at least some of the second reverse primers anneal with at
least some of the second extension products. At least some of the
annealed second reverse primers are extended by the second
extending enzyme and a multiplicity of different third extension
products, duplexed with their second extension product templates
are generated. In some embodiments, the cycle of annealing and
extending additional first forward primers to generate more second
extension products and annealing and extending additional second
reverse primers to generate more third extension products, is
repeated, typically multiple times and typically comprising
thermocycling.
[0048] In some embodiments, the sequence of at least part of a
second extension product, the sequence of at least part of a third
extension product, or combinations thereof, is determined and the
corresponding small nucleic acid species is identified. In some
embodiments, the nucleotide sequence of at least part of a second
extension product and/or at least part of a third extension product
is determined by sequencing at least part of the corresponding
extension product. In some embodiments, the determining comprises
cloning.
[0049] In some embodiments, a third amplification composition is
formed comprising at least part of the second amplification
composition comprising second and third extension products, a third
extending enzyme, and a formulated relative concentration of a
second forward primer and a multiplicity of different third reverse
primers. In some embodiments, the second amplification composition
comprising extension products is diluted. The second amplification
composition can be diluted in buffer, for example, and a portion of
the diluted second amplification composition added to the third
amplification composition being formed. In some embodiments, a
portion of undiluted second amplification composition is diluted
when it is added to the third amplification composition being
formed. In some embodiments, all of the second reaction composition
comprising second and third extension products is added to the
third amplification composition, wherein it is diluted. The second
forward primer comprises a sequence that is the same as or
substantially the same as the second primer-binding site of the
second extension products. The third reverse primers comprise (a) a
sequence that is the same or substantially the same as the first
primer binding site of the third extension products and (b) a
degenerate sequence, located at the 3'-end of the third reverse
primer, comprising at least two nucleotides. The degenerate
sequence of one third reverse primer species is different from the
degenerate sequence of other third reverse primer species.
[0050] The third amplification composition is subjected to
denaturing conditions to release the duplexed second and third
extension products. At least some of the different third primers
anneal with at least some of the second extension products (i.e.,
one third primer anneals with one second extension product) in the
third amplification composition. At least some of the annealed
third reverse primers are extended by the third extending enzyme to
generate a multiplicity of different fourth extension products,
duplexed with the corresponding second extension product template.
These duplexes are denatured, releasing the second and fourth
extension products which can then serve as templates in additional
amplification reactions. At least some of the different fourth
extension products anneal with at least some of the second forward
primers. At least some of the annealed second forward primers are
extended by the third extending enzyme, generating a multiplicity
of different fifth extension products, duplexed with their
corresponding fourth extension products. In some embodiments, the
first extending enzyme and the second extending enzyme are the same
or different. In some embodiments, the second extending enzyme and
the third extending enzyme are the same or different.
[0051] In some embodiments, the sequence of at least part of a
second extension product, at least part of a third extension
product, at least part of a fourth extension product, at least part
of a fifth extension product, or combinations thereof, are
determined and the corresponding small nucleic acid is identified.
In some embodiments, identifying a small nucleic acid species
comprises cloning at least part of an extension product
corresponding to the small nucleic acid, for example but not
limited to a restriction fragment of that extension product. In
some embodiments, an extension product or at least part of an
extension product is inserted into a recombinant vector and the
vector is introduced into an appropriate host cell and amplified in
vivo. The amplified vectors are isolated from the host cells and
the nucleotide sequence of the inserts, comprising at least part of
the sequence of an extension product or its complement, are
determined using sequencing methods known in the art.
[0052] In some embodiments, a "size fractionation" or other
pre-selection procedure is performed on the sample, for example but
not limited to subjecting "total RNA" to gel electrophoresis,
excising the band or collecting the eluate from the gel that
corresponds to nucleic acids of a desired range of weight or
length; using a sample preparation kit, such as the mirvana.TM.
miRNA Isolation Kit according to the enrichment procedure for small
RNAs (Ambion, Austin, Tex.) or the PureLink.TM. miRNA Isolation Kit
(Invitrogen, Carlsbad, Calif.). In some embodiments, a population
of different small nucleic acid species of varying concentration is
obtained by copurifying the small nucleic acids with other cellular
components or organelles, including without limitation
polyribosomes, RNA induced silencing complex (RISC) or other
intracellular RNPs such as the miRNP complex, or nuclei (see, e.g.,
Elbashir et al., Genes and Development, 15:188-200, 2001; and Kim
et al., Proc. Natl. Acad. Sci. 101:360-65, 2004). In other
embodiments, crude lysates are obtained from cells according to
known methods, for example by heating at 95 C.degree. for 5
minutes, sonication, or in a lysis reagent, such as a Tris lysate
buffer (e.g., 10 mM Tris-HCl, pH 8.0, 0.02% sodium azide, and 0.03%
Tween-20) or a GuHCl lysis buffer (e.g., 2.5M GuHCl, 150 mM MES pH
6.0, 200 mM NaCl, 0.75% Tween-20), among others (see, e.g., U.S.
Provisional Patent Application Ser. No. 60/643,180, which is
expressly incorporated by reference). All pre-treated biological
materials, including without limitation, enriched fractions,
lysates, and so forth can be the source of the population of
different small nucleic acid species. Additionally, the population
of different small nucleic acid species can be derived from a human
or from a non-human species, including without limitation,
vertebrate species, for example but not limited to mouse, rat,
hamster, dog, cat, pig, or various primate species; invertebrate
species, for example but not limited to, Caenorhabditis elegans and
Drosophila melanogaster, plant species, for example but not limited
to, Arabidopsis thaliana; or viruses.
[0053] FIG. 1 schematically depicts one illustrative embodiment of
the present teachings. A multiplicity of different small nucleic
acids (1) are combined with a multiplicity of 5' adapters (2), a
multiplicity of 3' adapters (3), and a ligation agent. A
multiplicity of double adapter-modified molecules (4) is generated
by ligating the two adapters to the respective ends of the same
small nucleic acid sequence, as shown in panel A. A first
amplification composition (I) is formed comprising at least some of
the double adapter-modified molecules (4), a multiplicity of first
reverse primers (5), and a first extending enzyme, for purposes of
this illustrative embodiment, AMV reverse transcriptase. At least
some of the multiplicity of first reverse primers (5) anneal with
at least some of the double adapter-modified molecules (4), as
shown in panel B. The annealed first reverse primers (5) are
extended by the first extending enzyme to generate a multiplicity
of duplexes, each comprising a newly synthesized first extension
product (6) annealed with the corresponding adapter-modified
molecule (4), as shown in panel C. A second amplification
composition (II) is formed comprising at least some of the
multiplicity of different first extension products (6), a
multiplicity of different first forward primer species (7), each
comprising a degenerate sequence (depicted as "NNN"), a
multiplicity of second reverse primers (9), and a second extending
enzyme, for purposes of this illustrative embodiment, AmpliTaq
Gold.RTM. polymerase. At least some of the different first forward
primer species (7) anneal the corresponding first extension
products (6), as shown in panel D. Those in the art will appreciate
that the specificity of first forward primer annealing is
determined, at least in part, by the actual sequence of the first
degenerate sequence. At least some of the annealed first forward
primers (7) are extended by the second extending enzyme to generate
a multiplicity of different duplexes, each comprising a newly
synthesized second extension product (8) annealed with the
corresponding first extension product (6), as shown in panel E. The
second amplification composition comprising the multiplicity of
different second extension products is subjected to denaturing
conditions, releasing at least some of the multiplicity of
different second amplification species. At least some of the second
reverse primers (9) anneal with at least some of the different
second extension products (8), as shown in panel F, and the at
least some of the annealed primers are extended to generate a
multiplicity of duplexes, each comprising a newly synthesized third
extension product (10) hybridized with the corresponding second
extension product (8), as shown in panel G.
[0054] In some embodiments, primer pairs are employed at a
formulated relative concentration, for example but not limited to,
the concentration of each of the different first forward primer
species in a second amplification composition may initially be
equimolar or at least similar and the starting concentration of the
second reverse primer species is greater than the total
concentration of the different first primer species. For
illustration purposes but not as a limitation, consider a
multiplicity of different first forward primer species comprising a
degenerate sequence consisting of three nucleotides including 64
(4.sup.3) different first forward primer species. If all of the 64
different first forward primer species are employed in an
amplification composition with a single second reverse primer
species, an illustrative formulated relative concentration might
comprise (a) the 64 different first forward primer species at a
concentration of 1 nm each (i.e., a total first forward primer
concentration of 64 nM) and (b) a single second reverse primer
species at a concentration of at least 100 nM. Assuming that the
amplification composition is cycled until at least one first
forward primer species is depleted, the pool of different second
extension products should theoretically not contain more than 1 nM
of any individual second extension product species and may contain
less if more than one small nucleic acid species comprise the same
three nucleotide sequence at their 5'-end. Therefore, a first stage
of normalization has occurred because the group of different small
nucleic acids comprised at least one species that was present at an
initial concentration that was substantially greater than the
initial concentration of at least one other small nucleic acid
species, but none of the second extension product species should
have a concentration of greater than 1 nM and most of the second
extension product species should have a concentration of about, or
relatively close to, 1 nM, for example but not limited to, 0.5 nM,
0.333 nM, 0.25 nM, 0.2 nM, and 0.1667 nM.
[0055] Returning to FIG. 1, a third amplification composition (III)
is formed, comprising at least some of the different extension
products, a multiplicity of different third reverse primer species
(11), each comprising a degenerate sequence (shown as "NNN"), a
multiplicity of second forward primers (13), and a third extending
enzyme, for this illustrative embodiment, AmpliTaq Gold.RTM.
polymerase. The third amplification composition is subjected to
denaturing conditions to denature at least some duplexes. At least
some of the third reverse primers (11) anneal with the
corresponding second extension product (8), as shown in panel H.
Those in the art will appreciate that the specificity of third
reverse primer annealing is determined, at least in part, by the
actual sequence of the corresponding degenerate sequence. At least
some of the annealed third reverse primers (11) are extended by the
third extending enzyme to generate a multiplicity of different
duplexes, each comprising a newly synthesized fourth extension
product (12) annealed with the corresponding second extension
product (8), as shown in panel I. The third amplification
composition is subjected to denaturing conditions to denature at
least some of the duplexes. At least some of the released fourth
extension products (12) anneal with at least some of the second
forward primers (13), as shown in panel J. At least some of the
annealed second forward primers (13) are extended by the third
extending enzyme to generate a multiplicity of different duplexes,
each comprising a newly synthesized fifth extension product (14)
hybridized with the corresponding fourth extension product (12), as
shown in panel K. At least a part of a second extension product, at
least part of a third extension product, at least part of a fourth
extension product, at least part of a fifth extension product, or
combinations thereof can be sequenced to identify the corresponding
small nucleic acid sequence in the population of different small
nucleic acid species (shown in FIG. 1 as "SEQUENCE"). In some
embodiments, at least part of a second extension product, at least
part of a third extension product, at least part of a fourth
extension product, at least part of a fifth extension product, or
combinations thereof, is inserted into a cloning vector; the vector
comprising the insert is amplified in vivo; the cloned inserts are
sequenced, and the identity of the small nucleic acid sequence
corresponding to the insert is established (shown in FIG. 1 as
"CLONE.fwdarw.SEQUENCE").
[0056] Assuming that: 1) the initial concentration of a second
extension product species is different from the initial
concentration of another second extension product species, for
example but not limited to the concentration of at least one second
extension product species might be about 1 nM, while the initial
concentration of at least one other second extension product
species might be about 0.5 nM, about 0.333 nM, about 0.25 nM, and
so forth; 2) the initial concentration of each of the different
third reverse primer species in the third amplification composition
are equimolar (or at least similar) and 3) the starting
concentration of the second forward primers is in excess compared
to each of the different third reverse primer species and in excess
of the total third reverse primer concentration; a second
normalization can occur in the third amplification composition.
[0057] For illustration purposes but not as a limitation, assume a
group of three different small nucleic acid species is being
normalized and identified, wherein species 1, with the sequence
ugagguaggauguuguauaguu (SEQ ID NO:1), is present in the population
at an initial concentration of 500,000 copies; species 2, with the
sequence uaucacagccucguuugaugugc (SEQ ID NO:3), is present in the
population at an initial concentration of 8,000 copies; and species
3, with the sequence uagcagccacgaauaauuggcg (SEQ ID NO:3), is
present in the population at an initial concentration of 8,000
copies. The primers are used in a formulated relative concentration
in which (a) the multiplicity of different first forward primer
species includes 16 different first forward primer species each
with a different degenerate sequence consisting of two nucleotides
and each at an initial concentration of about 3 nM (total first
forward primer concentration of about 48 nM); and (b) the second
reverse primer species is initially present at an initial
concentration of about 80 nM. After the second amplification
composition has been cycled until at least one first forward primer
species has been depleted, the concentration of the second
extension product corresponding to small nucleic acid species 1
should theoretically be about 3 nM. The concentrations of the
second extension product corresponding to small nucleic acid
species 2 and to small nucleic acid species 3 should theoretically
be about 1.5 nM each because they both have the same two
ribonucleotides at the 5'-end (ua) and both small nucleic acid
species had the same initial copy number. Thus, normalization has
occurred in the second amplification composition since the
concentration ratio of species 1 relative to species 2 and 3 was
initially 500,000:8000:8000 (250:4:4), but the concentration ratio
of the second extension products corresponding to species 1
relative to the second extension products corresponding to species
2 and species 3 is 2:1:1, respectively. Continuing this
illustration, a second stage of normalization can be performed in a
third reaction composition comprising primers in a formulated
relative concentration, e.g., 16 different third reverse primer
species each comprising a second degenerate sequence consisting of
two nucleotides, at initial concentrations of 2 nM each and a
second forward primer species at an initial concentration of 60 nM.
After the third amplification composition has been cycled until at
least one third reverse primer species is depleted, the
concentration of each of the fourth extension products (and fifth
extension products) should theoretically be 2 nM, since the three
small nucleic acid species in the exemplary population each have
different terminal and penultimate nucleotides at their respective
3'-ends. Those in the art will appreciate that certain embodiments
of the present teachings, provide means for sequencing and
identifying, or for cloning, sequencing and identifying, small
nucleic acid species that are initially present in a population at
extremely low copy number.
[0058] Some embodiments of the present teachings employ a
multiplicity of different first reverse primer species, wherein at
least some of the first reverse primer species comprise a
degenerate sequence and a "stem-loop" or "hairpin" structure that
typically serves as at least part of a primer-binding site. In one
exemplary embodiment, shown in FIG. 2, a ligation composition is
formed comprising a population of different small nucleic acid
species of varying concentration, a multiplicity of 5' adapters,
and a ligation agent. As shown in panel A, a small nucleic acid
(21) and a 5' adapter (22) are ligated together by the ligation
agent to from a single adapter-modified molecule (23). A first
amplification composition is formed comprising a multiplicity of
different single adapter-modified molecules, a multiplicity of
different first reverse primer species, and a first extending
enzyme. As shown in panel B, a first reverse primer (24) comprising
a degenerate sequence (shown as "NNN") and a stem-loop structure
anneals with the corresponding single adapter-modified molecule
(23) and the annealed first reverse primer is extended by the first
extending enzyme to generate a duplex comprising a newly
synthesized first extension product (25) hybridized with the single
adapter-modified molecule (23), as shown in panel C. Following this
first round of normalization, the multiplicity of different first
extension product species reflects a normalized population in that
the relative concentration of at least one nucleic acid species (as
measured by the corresponding first extension product) has been
decreased, the relative concentration of at least one other nucleic
acid species (as measured by its corresponding extension product)
has been increased, or both. The duplexes are diluted in buffer and
an portion added to a second amplification composition that
comprises a second extending enzyme and a formulated relative
concentration of primers comprising a first forward primer species
(26) and a multiplicity of different second reverse primer species
(28). Each of the second reverse primer species comprises a second
degenerate sequence (also shown as "NNN") that is different from
the second degenerate sequence of the other second reverse primer
species. The concentration of the first forward primer species is
greater than the total concentration of the multiplicity of
different second reverse primer species and the concentration of
each of the different second reverse primer species is
approximately equimolar.
[0059] The second amplification composition is subjected to
denaturing conditions to separate at least some of the multiplicity
of different first extension product (25) from their corresponding
single adapter-modified molecules (23). At least some of the first
forward primers (26) anneal with at least some of the multiplicity
of different first extension products (25), as shown in panel D,
and at least some of the annealed first forward primers are
extended, generating a multiplicity of duplexes, wherein each
duplex comprises a newly-synthesized second extension product (27)
and the corresponding first extension product (25), as shown in
panel E. The second amplification composition is subjected to
denaturing conditions to separate at least some of the multiplicity
of different second extension products (27) from the corresponding
first extension products (25). At least some of the multiplicity of
different second extension products (27) anneal with the
corresponding different second reverse primers (28), as shown in
panel F, and at least some of the annealed second reverse primers
are extended to generate a multiplicity of duplexes comprising a
newly synthesized third extension product (29) annealed with the
corresponding second extension product (27), as shown in panel G.
Following this second round of normalization, the multiplicity of
different second extension product species and the multiplicity of
different third extension product species reflects a normalized
population in that the relative concentration of at least one
original nucleic acid species has been decreased, the relative
concentration of at least one other nucleic acid species has been
increased, or both.
[0060] According to certain methods, the nucleotide sequence of at
least part of a normalized nucleic acid is determined and the small
nucleic acid species that corresponds to the normalized nucleic
acid is identified. In some embodiments, a primer or a pair of
primers comprising a restriction enzyme site(s) are incorporated
into a normalized nucleic acid during amplification. The resulting
extension products, for example but not limited to a duplex
comprising two corresponding extension products, can be cut with an
appropriate restriction enzyme and inserted into a suitable cloning
vector according to any known method. In some embodiments, a
concatemer comprising a multiplicity of restriction fragments is
generated and inserted into a vector. The recombinant vector
comprising the insert is introduced into an appropriate host cell
and the vector is cloned and amplified in vivo, typically involving
at least one selection step. The amplified vectors are recovered
and the sequence of the insert or at least part of the insert is
determined using a sequencing technique and the corresponding small
nucleic acid species from the original population can be
identified.
[0061] In some embodiments, a small nucleic acid species is
identified by sequencing at least part of an extension product,
including without limitation sequencing at least part of both
strands of a duplex comprising two corresponding extension
products. For example but not as a limitation, consider a
normalized population that was generated using a multiplicity of
different reverse primers comprising a degenerate sequence
consisting of four nucleotides and that at least one round of
normalization was directed to the 3'-end of the small nucleic acid
species (as incorporated in their surrogates, including those
comprising the complementary 3'-end sequences). Assuming that one
small nucleic acid species in the original population included a
3'-end with the sequence 5'-aata-3' and that the same 3' adapter
was ligated to at least some of the small nucleic acids of this
species, the normalized population should include a multiplicity of
extension products with a 3'-end comprising the sequence
5'-atta-[universal 3' adapter sequence]-3' (for purposes of this
illustration, "Normalized Nucleic Acid X"). Thus a sequencing
primer comprising a sequence that is complementary to the
incorporated 3' adapter sequence of Normalized Nucleic Acid X and
comprises the tetranucleotide 5'-tatt-3' at its 3'-end (for
purposes of this illustration, "Sequencing Primer Y"), should
selectively hybridize only with Normalized Nucleic Acid X. The
unincorporated primers and dNTPs from the amplification step are
removed using ExoSAP-IT.RTM. reagent, according to the
manufacturer's protocol (USB Corporation P-78200A rev 03/10). A
cycle sequencing reaction is performed using Sequencing Primer Y,
at least part of the degraded amplification composition comprising
Normalized Nucleic Acid X, and an appropriate sequencing reaction
mix including suitably labeled ddNTPs, for example but not limited
to the BigDye.RTM. Terminator v 1.1 or v3.1 Cycle Sequencing Kit
(Applied Biosystems Part Nos. 4337449 and 4337454, respectively),
according to any suitable protocol, for example but not limited to
the BigDye.RTM. Terminator v3.1 Cycle Sequencing Kit Protocol
(Applied Biosystems Part No. 4337035 Rev. A September 2002) and
using any suitable detection instrument, including without
limitation, an ABI PRISM.RTM. 377 DNA Sequencer, an Applied
Biosystems 3730 DNA Analyzer, an ABI PRISM.RTM. 3100 or 3100-Avant
Genetic Analyzer, each including appropriate filters, software, and
peripherals, as appropriate; or a slab gel electrophoresis
apparatus that is appropriate for running a DNA sequencing gel.
[0062] It is to be appreciated that since the sequencing primer
includes a specific degenerate sequence or the complement of the
degenerate sequence at its 3'-end, it should, under appropriate
annealing conditions, selectively anneal with extension products
corresponding to small nucleic acid species comprising that
degenerate sequence or the complement of that degenerate sequence
at their 3'-end or 5'end, as appropriate. Thus, a sequencing
reaction using a particular sequencing primer should generate a
nucleotide sequence that corresponds to a species of small nucleic
acid. In the event that more than one small nucleic acid species in
the original population comprise the same 3'-end and/or 5'end, as
appropriate for the particular sequencing reaction, a mixed
sequence may be obtained starting with the nucleotide at which the
sequence of the different small nucleic acid species diverge. Those
in the art will appreciate that, with the use of additional
sequencing primers, the sequences of each of the related nucleic
acids being sequenced can be determined and each of the
corresponding small nucleic acid species identified. It is to be
understood that sequencing can comprise a multiplicity of different
sequencing reactions that can, but need not be, performed in
parallel or that any number of single-plex sequencing reactions can
be performed. Those in the art will appreciate that other
sequencing methods can be employed to determine the nucleotide
sequence of at least a part of an extension product and by
implication, the corresponding small nucleic acid species. In some
embodiments, sequencing comprises a tailed primer or a pair of
tailed primers comprising a sequence that includes the degenerate
sequence and at least part of the adjacent adapter sequence (or the
complement of this sequence) that becomes incorporated into an
extension product or further amplicon during amplification. In some
embodiments, at least part of the tail portion of such incorporated
tailed primers (or its complement) can serve as at least part of a
binding site for a sequencing primer. In some embodiments, a
multiplicity of different sequencing primers are employed to
determine the sequence of a multiplicity of different extension
products, typically simultaneously or nearly simultaneously. In
some embodiments, a sequencing primer comprises a label including
without limitation a fluorophore and the deoxyribonucleotides
and/or dideoxyribonucleotides being incorporated during the
sequencing are not labeled.
[0063] Although the disclosed teachings has been described with
reference to various applications, methods, and compositions, it
will be appreciated that various changes and modifications may be
made without departing from the teachings herein. The foregoing
examples are provided to better illustrate the present teachings
and are not intended to limit the scope of the teachings herein.
Certain aspects of the present teachings may be further understood
in light of the following claims.
* * * * *