U.S. patent application number 11/199903 was filed with the patent office on 2006-09-28 for induction of immune response to antigens expressed by recombinant adeno-associated virus.
Invention is credited to Dirk G. Brockstedt, Edgar G. Engelman, Gary J. Kurtzman, Greg M. Podsakoff.
Application Number | 20060216274 11/199903 |
Document ID | / |
Family ID | 32854166 |
Filed Date | 2006-09-28 |
United States Patent
Application |
20060216274 |
Kind Code |
A1 |
Kurtzman; Gary J. ; et
al. |
September 28, 2006 |
Induction of immune response to antigens expressed by recombinant
adeno-associated virus
Abstract
The present invention relates generally to immunization methods
using recombinant viral vectors. In particular, the invention
relates to methods and compositions for immunizing a subject with a
nucleic acid molecule encoding an antigen of interest, wherein the
nucleic acid molecule is delivered to the subject via a recombinant
AAV virion.
Inventors: |
Kurtzman; Gary J.;
(Valanava, PA) ; Engelman; Edgar G.; (Atherton,
CA) ; Podsakoff; Greg M.; (Fullerton, CA) ;
Brockstedt; Dirk G.; (Palo Alto, CA) |
Correspondence
Address: |
STOEL RIVES LLP
201 SOUTH MAIN STREET, SUITE 1100
SALT LAKE CITY
UT
84111
US
|
Family ID: |
32854166 |
Appl. No.: |
11/199903 |
Filed: |
August 9, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10679875 |
Oct 6, 2003 |
|
|
|
11199903 |
Aug 9, 2005 |
|
|
|
09858728 |
May 16, 2001 |
6710036 |
|
|
10679875 |
Oct 6, 2003 |
|
|
|
09121162 |
Jul 23, 1998 |
6242426 |
|
|
09858728 |
May 16, 2001 |
|
|
|
60053733 |
Jul 25, 1997 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
424/208.1 |
Current CPC
Class: |
C12N 15/86 20130101;
C12N 2840/44 20130101; A61K 2039/53 20130101; A61K 39/0008
20130101; A61K 39/0011 20130101; A61K 2039/57 20130101; C12N
2750/14143 20130101; A61K 2039/5256 20130101 |
Class at
Publication: |
424/093.2 ;
424/208.1 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 39/21 20060101 A61K039/21 |
Goverment Interests
[0002] This invention was funded in part by grants CA71725,
HL57443, and CA72103 from the National Institutes of Health. The
U.S. Government has certain rights in this invention.
Claims
1. A method of eliciting an immune response in a mammalian subject
comprising: providing a recombinant AAV virion containing a nucleic
acid molecule encoding at least one acquired immunodeficiency
syndrome (AIDS) virus antigen operably linked to control sequences
which direct the expression of said AIDS virus antigen in a
suitable recipient cell; and introducing said recombinant AAV
virion into a recipient cell of said mammalian subject under
conditions that permit the expression of said AIDS virus antigen,
wherein the expression of said AIDS virus antigen elicits an immune
response to said AIDS virus antigen.
2. The method of claim 1, wherein said AIDS virus antigen is human
immunodeficiency virus (HIV) envelope protein.
3. The method of claim 1, wherein said AIDS virus antigen is
subunit gp120 of human immunodeficiency virus (HIV) envelope
protein.
4. The method of claim 1, wherein said AIDS virus antigen is
subunit p24 of human immunodeficiency virus (HIV) envelope protein.
Description
[0001] This application claims priority benefit of U.S. patent
application Ser. No. 09/858,728, pending, which claims priority of
U.S. provisional application No. 60/053,733, filed Jul. 25, 1997,
which is hereby incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The present invention relates generally to immunization
methods using recombinant viral vectors. In particular, the
invention relates to methods and compositions for immunizing a
subject with a nucleic acid molecule encoding an antigen of
interest, wherein the nucleic acid molecule is delivered to the
subject via a recombinant AAV vector.
BACKGROUND
[0004] Ever since the first experiments in yariolation in 1721, and
Jenner's vaccination methods in 1796, methods and compositions for
disease prevention utilizing immunization have been extensively
investigated. Many methods rely upon the use of active
immunization, in which an antigen (or mixtures of antigens), such
as a modified infectious agent or toxin is administered, resulting
in active immunity. This active immunity is characterized by the
production of antibodies directed against the administered
antigen(s), and in some cases, induction of cellular responses
mediated by lymphocytes and macrophages.
[0005] Traditionally, vaccines used for active immunization have
consisted of live attenuated bacteria (e.g., Bacillus
Calmette-Guerin) or viruses (e.g., measles virus), killed
microorganisms (e.g., Vibrio cholerae), inactivated bacterial
products (e.g., tetanus toxoid), or specific single components of
bacteria (e.g., Haemophilus influenzae polysaccharide). Although
active immunization with live organisms is generally superior to
immunization with killed vaccines in producing long-lived immune
responses, care must be taken to properly store and administer
these vaccines, as serious failures of measles and smallpox
immunizations have resulted from improper refrigeration of the
vaccine preparations. In addition, pregnant women and individuals
with compromised immune systems should, in general, not receive
live vaccines, as the organisms may cause serious disease upon
vaccination. For example, live vaccines have caused serious and
fatal disease in patients receiving corticosteroids, alkylating
drugs, radiation, other immunosuppressive treatments, as well as
individuals with known or suspected congenital or acquired defects
in cell-mediated immunity (e.g., severe combined immunodeficiency
disease, leukemia, lymphoma, Hodgkin's disease, and acquired
immunodeficiency syndrome [AIDS]). Live vaccines may even cause
mild, or rarely, severe disease in immunocompetent hosts. In
addition, live vaccines may also contain undesirable components.
For example, epidemic hepatitis has resulted from the use of
vaccinia and yellow fever vaccines containing human serum.
[0006] Passive immunization using preformed immunoreactive serum or
cells is sometimes utilized, especially when active immunization is
not available or not advisable. In particular, passive immunization
finds use in individuals who cannot produce antibodies or other
immune system deficiencies, as well as in individuals who are at
risk of developing disease before active immunization would be
successful in stimulating a sufficient antibody response. Passive
immunization is also used in conjunction with vaccine
administration in the management of certain diseases (e.g., rabies
vaccination and prophylaxis following an animal bite), management
of individuals who have been exposed to certain toxins or venoms,
and as an immunosuppressant. However, passive immunization does not
produce long-term immunity and is sometimes associated with severe
reactions due to the presence of foreign proteins in the vaccine
preparation (e.g., anaphylaxis resulting from a reaction against
human or horse [or other non-human animal] proteins present in the
vaccine preparation).
[0007] More recently, vaccines comprising recombinant DNA or RNA
segments have been developed. However, use of these recombinant
vaccines has resulted in problems associated with the expression of
the desired antigen(s) in another organism (e.g., an E. coli or
yeast host). For example, in addition to the desired antigen, other
components, such as other antigens (e.g., protein and other
components) from the expression host, preservatives, etc may be
present in the preparation. In addition, adjuvants are sometimes
required in order to provide efficacious vaccination with these
vaccines. However as with passive immunization, undesirable
reactions sometimes occur in vaccinated individuals due to the
presence of these undesirable components.
[0008] Various adenovirus-based gene delivery systems have likewise
been investigated for vaccine use. Human adenoviruses are
double-stranded DNA viruses which enter cells by receptor-mediated
endocytosis. These viruses have been viewed as being particularly
well suited for gene transfer because they are easy to grow and
manipulate and they exhibit a broad host range in vivo and in
vitro. Adenovirus is easily produced at high titers and is stable
so that it can be purified and stored. Even in the
replication-competent form, adenoviruses generally cause only low
level morbidity and are not associated with human malignancies.
Various references provide reviews of adenovirus-based gene
delivery systems (See, e.g., Haj-Ahmad and Graham, J. Virol.,
57:267-274 [1986]; Bett et al., J. Virol., 67:5911-5921 [1993];
Mittereder et al, Human Gene Ther., 5:717-729 [1994]; Seth et al.,
J. Virol., 68:933-940 [1994]; Barr et al., Gene Ther., 1:51-58
[1994]; Berkner, BioTechn., 6:616-629 [1988]; and Rich et al.,
Human Gene Ther., 4:461-476 [1993]). However, despite these
advantages, adenovirus vector systems still have several drawbacks
which limit their effectiveness in gene delivery, such as
cytotoxicity. Adenovirus vectors also express viral proteins that
may elicit a strong non-specific immune response in the host. This
non-specific immune reaction may increase toxicity or preclude
subsequent treatments because of humoral and/or T cell responses
against the adenoviral particles. Thus, problems remain even with
the newer technologies for vaccine administration.
[0009] As briefly mentioned above, the major focus in the past has
been on the development of antibody responses to vaccination.
However, cell-mediated responses are of great importance in some
situations. Indeed, cell-mediated immunity is of greater importance
than the antibody-mediated response in the response to
intracellular parasites (e.g., viruses and obligately intracellular
bacteria). T-cells (T lymphocytes) play the primary roles in
cell-mediated immunity, although there is communication via
cytokines and other signalling compounds between these cells as the
antibody-producing B-cells.
[0010] Cytotoxic T-lymphocytes (CTLs) play an important role in
immune responses directed against intracellular pathogens such as
viruses and tumor-specific antigens produced by cancerous cells. In
particular, CTLs mediate cytotoxicity of virally infected cells by
recognizing viral determinants in conjunction with Class I MHC
molecules displayed by the infected cells. Cytoplasmic expression
of proteins is a prerequisite for Class I MHC processing and
presentation of antigenic peptides to CTLs. However, conventional
immunization techniques, such as those using killed or attenuated
viruses, often fail to elicit an appropriate CTL response which is
effective against an intracellular infection. Thus, there remains a
need for the development of vaccines that stimulate appropriate
responses (i.e., cell-mediated as well as antibody-mediated immune
responses), in order to prevent disease. Indeed, despite advances
in vaccine technology, there remains a need for vaccines that are
efficacious, yet avoid the problems associated with current vaccine
preparations.
SUMMARY
[0011] The present invention relates generally to immunization
methods using recombinant viral vectors. In particular, the
invention relates to methods and compositions for immunizing a
subject with a nucleic acid molecule encoding an antigen of
interest, wherein the nucleic acid molecule is delivered to the
subject via a recombinant AAV vector.
[0012] The present invention provides a method of eliciting an
immune response in a subject, comprising the steps of: providing a
recombinant AAV vector containing a nucleic acid molecule encoding
at least one antigen of interest operably linked to control
sequences which direct the expression of the antigen of interest in
a suitable recipient cell; and introducing the recombinant AAV
vector into a recipient cell of the subject under conditions that
permit the expression of the one or more antigen, thereby eliciting
an immune response to the antigen of interest. In some embodiments,
the recombinant AAV vector comprises a recombinant AAV virion.
[0013] In some embodiments of the present invention, the immune
response comprises production of cytotoxic T lymphocytes directed
against the antigen of interest. In other embodiments, the immune
response comprises production of antibodies directed against the
antigen of interest. In yet other embodiments, the immune response
comprises production of interleukin-2 and gamma interferon. In
preferred embodiments, the immune response is a T.sub.H1-like
response.
[0014] In some embodiments of the present invention, the immune
response comprises the production of one or more cytokines selected
from the group consisting of interleukin-4, interleukin-5,
interleukin-10, and interleukin-13. In preferred embodiments, the
immune response is a T.sub.H2-like response.
[0015] In other embodiments, the antigen of interest comprises at
least one antigen selected from the group consisting of tumor
antigens, viral antigens, bacterial antigens, and protozoal
antigens. In other embodiments, the antigen of interest is derived
from an intracellular pathogen. In alternative embodiments, the
antigen of interest is a self-antigen. In yet other embodiments,
the antigen of interest is an allergen.
[0016] In some embodiments, the expression of the antigen of
interest persists for approximately eight weeks after the
introducing of the antigen of interest to the recipient cell of the
subject. In preferred embodiments, the expression of the antigen of
interest persists for at least eight weeks after introducing the
antigen of interest to the recipient cell of the subject.
[0017] The present invention further provides a method for shifting
the cytokine profile of an immune response against an antigen in a
subject, comprising the steps of: providing a recombinant AAV
vector containing a nucleic acid molecule encoding at least one
antigen of interest operably linked to control sequences which
direct the expression of the antigen of interest in a suitable
recipient cell; and introducing the recombinant AAV vector into a
recipient cell of the subject under conditions that permit the
expression of the antigen, thereby eliciting a desensitizing immune
response specific for the antigen. In some embodiments, the antigen
is an allergen. In preferred embodiments, the shifting in the
immune response is characterized by a switch from a T.sub.H1-like
response to a T.sub.H2-like response.
[0018] The present invention also provides a method for treating or
preventing an autoimmune disease in a vertebrate subject, said
method comprising: providing a recombinant AAV vector containing a
nucleic acid molecule encoding an antigen against which an immune
response is mounted in the autoimmune disease, wherein the nucleic
acid molecule is operably linked to control sequences which direct
the expression thereof in a suitable recipient cell; and
introducing the AAV vector into a recipient cell of the vertebrate
subject under conditions that permit the expression of the antigen
in an amount sufficient to bring about a reduction in a cytotoxic
immune response or a desensitizing immune response against the
antigen. In some embodiments, the recombinant AAV vector comprises
a recombinant AAV virion.
[0019] The present invention further provides a method for
modulating allergic reaction in a vertebrate subject, said method
comprising: providing an AAV vector containing a nucleic acid
molecule encoding an immunogenic molecule having a first portion
derived from an IgE molecule and a second portion derived from an
immunogenic carrier molecule, wherein the nucleic acid molecule is
operably linked to control sequences which direct the expression
thereof in a suitable recipient cell; and introducing the AAV
vector into a recipient cell of the vertebrate subject under
conditions that permit the expression of the immunogenic molecule,
thereby eliciting an immune response against IgE molecules in the
vertebrate subject In some embodiments, the recombinant AAV vector
comprises a recombinant AAV virion.
[0020] The present invention also provides an in vitro target
system for monitoring an immune response to an antigen of interest
in a vertebrate sample, said system comprising a population of
target cells transduced with an AAV vector containing a nucleic
acid molecule encoding the antigen of interest operably linked to
control sequences which direct the expression thereof in the target
cell, wherein the target cell is capable of presenting the antigen
of interest associated with a MHC class I molecule.
[0021] These and other embodiments of the invention will readily
occur to those of ordinary skill in the art in view of the
disclosure herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIGS. 1A-1B depict the construction of the recombinant AAV
virions rAAV-Ova (containing the cDNA encoding ovalbumin) and
rAAV-LacZ (containing the cDNA encoding .beta.-galactosidase from
E. coli).
[0023] FIGS. 2A-2B depict ELISA results demonstrating that
administration of rAAV-Ova in vivo induces an ovalbumin-specific
humoral response.
[0024] FIGS. 3A-3E depict results from experiments in which
rAAV-Ova induced antigen-specific CTL was introduced into C57BL/6
mice injected with 3.times.10.sup.11 rAAV-Ova virions (3A, 3B, 3C,
3D) or 3.times.10.sup.11 rAAV-lacZ virions (3E).
[0025] FIGS. 4A-4C depict results showing that antigen-presenting
cells transduced with rAAV-Ova stimulate a CD8.sup.+, MHC Class
I-restricted T cell hybridoma.
GENERAL DESCRIPTION OF THE INVENTION
[0026] The present invention relates generally to immunization
methods using recombinant viral vectors. In particular, the
invention relates to methods and compositions for immunizing a
subject with a nucleic acid molecule encoding an antigen of
interest, wherein the nucleic acid molecule is delivered to the
subject via a recombinant AAV vector.
[0027] Unless otherwise indicated, the practice of the present
invention employs conventional methods of virology, microbiology,
molecular biology and recombinant DNA techniques within the skill
of the art, including those described in such references as
Sambrook et al. (eds.) Molecular Cloning: A Laboratory Manual;
Glover (ed.) DNA Cloning: A Practical Approach, Vols. I & II;
Gait (ed.) Oligonucleotide Synthesis; Hames and Higgins (eds.)
Nucleic Acid Hybridization; Hames and Higgins (eds.) Transcription
and Translation; Tijessen (ed.) CRC Handbook of Parvoviruses, Vols.
I & II; and Fields and Knipe (eds.) Fundamental Virology, 2nd
Edition, Vols. I & II.
Adeno-Associated Viruses (AAV)
[0028] Adeno-associated virus (AAV) is a non-pathogenic,
replication-defective, helper-dependent parvovirus (or
"dependovirus," or "adeno-satellite virus"). There are at least six
recognized serotypes, designated as AAV-1, AAV-2, AAV-3, and AAV-4,
AAV-5, AAV-X7, etc. Serologic evidence has indicated that AAV-1 may
have originated from rhesus monkeys, and AAV-4 probably originated
from green monkeys, while both culture and serologic evidence
indicates that human infection occurs with AAV-2 and AAV-3 (Lang,
in Principles of Animal Virology [W. K. Joklik, ed],
Appleton-Century-Crofts, New York [1980], at page 255). Although
85% of the human population is seropositive for AAV-2, the virus
has never been associated with disease in humans (Bems et al., Adv.
Virus Res., 32:243-306 [1987]). Recombinant AAV (rAAV) virions are
of interest as vectors for vaccine preparations and gene therapy
because of their broad host range, excellent safety profile, and
duration of transgene expression in infected hosts. One remarkable
feature of recombinant AAV (rAAV) virions is the prolonged
expression achieved after in vivo administration (Fisher et al.,
Nat. Med., 3:306-312 [1997]; Flotte et al., Proc. Natl. Acad Sci.
USA 90:10613-10617 [1993]; and xiao et al., J. Virol., 70:8098-8108
[1996]). Indeed, prior to the development of the present invention,
this property was thought to limit the immunotherapeutic
applications of rAAV virions. However, the present invention
provides compositions and methods for eliciting immunity to a
foreign transgene product in vivo using rAAV.
[0029] The present invention is particularly suited for use in
vaccine preparations and methods. For example, in contrast to the
prior art, the present invention provides rAAV virions encoding a
different foreign transgene (e.g., ovalbumin) that has been shown
to be capable of eliciting both cellular and immune responses upon
introduction into an animal. Although an understanding of the
mechanism is not necessary in order to use the present invention,
it is thought that perhaps the viral dose correlates with antigen
presentation and raises the possibility that there is a threshold
of transgene expression required for the induction of CTL in vivo,
a threshold that is met by the present invention.
[0030] Again, although an understanding of the mechanism is not
necessary in order to use the present invention, and it is not
intended that the present invention be limited to any particular
route of administration, it is hypothesized that the route of AAV
vaccine administration might also play an important role in
eliciting an immune response. For example, data presented in the
Examples suggest that at least in some cases, the subcutaneous (SC)
and the intravenous (IV) routes might be more efficient in inducing
antigen-specific CTL than the intramuscular (IM) route used in the
earlier studies. The lower immunogenicity of rAAV after IM
administration might contribute to the long-term expression of the
transgene product in muscle reported by several groups. Regardless
of the previous failure to elicit immunity with rAAV, the results
obtained during the development of the present invention clearly
demonstrate that rAAV-Ova transduction results in entry of
ovalbumin into the classical, TAP-2 dependent MHC Class I
processing pathway in vitro, and in the formation of
ovalbumin-specific CTL and antibodies in vivo. Since AAV has not
been associated with human disease, despite evidence of widespread
infection, and since rAAV appears to be a safe and efficient vector
in animal models, the present invention provides compositions and
methods that will find use in inducing protective immunity to viral
infections, tumors, and/or intracellular pathogens.
[0031] Accordingly, in one embodiment of the invention, methods are
provided for eliciting an immune response in a subject. The methods
include providing an AAV vector containing a nucleic acid molecule
encoding an antigen of interest operably linked to control
sequences that direct expression of the antigen in a suitable
recipient cell. The AAV vector is introduced into a recipient cell
of the subject, under conditions allowing expression of the
antigen, thereby eliciting an immune response against the antigen.
In various embodiments of the methods, the AAV vector is comprised
of a recombinant AAV (rAAV) virions. In other embodiments, the AAV
vector contains a gene that encodes a tumor-specific antigen, a
viral antigen, a bacterial antigen, a protozoal antigen, and/or any
intracellular parasite antigen. The AAV vector can be administered
to the subject in vivo using any suitable route of administration,
including but not limited to intramuscular, intravenous,
intraperitoneal, subdermal, intradermal, intraocular, or
subcutaneous injection techniques. In one embodiment, immunization
is carried out using a single injection of the AAV vector.
[0032] The present invention also provides methods for shifting the
cytokine profile of a subject's immune response against an antigen.
In one embodiment, an AAV vector containing a nucleic acid molecule
encoding the antigen is introduced into a recipient cell of the
subject, under conditions that permit the expression of the
antigen. This antigen expression elicits a desensitizing immune
response specific for the antigen. In related embodiments of the
invention, the antigen is an allergen, and/or the shift in the
immune response is characterized by a switch from a T.sub.H1-like
response to a T.sub.H2-like response.
[0033] The present invention also provides methods for treating or
preventing an autoimmune disease in a subject. In one embodiment,
the method comprises providing an AAV vector containing a nucleic
acid molecule encoding an antigen against which an immune response
is mounted in the autoimmune disease, and introducing the AAV
vector into a recipient cell of a subject, under conditions that
permit the expression of the antigen in the recipient cell. The
antigen is expressed in an amount sufficient to bring about a
reduction in a cytotoxic immune response or a desensitizing immune
response against the antigen.
[0034] The present invention also provides methods for modulating
allergic reaction(s) in a subject. In some embodiments, these
method include the steps of providing an AAV vector containing a
nucleic acid molecule encoding an immunogenic molecule having a
first portion derived from an IgE molecule and a second portion
derived from an immunogenic carrier molecule, wherein the nucleic
acid molecule is operably linked to control sequences which direct
the expression the immunogenic molecule in a suitable recipient
cell. The AAV vector is introduced into a recipient cell of a
subject under conditions that permit the expression of the
immunogenic molecule to elicit an immune response against IgE
molecules.
[0035] The present invention also provides target cell systems
useful for monitoring and/or assessing an immune response in an
AAV-immunized subject in preferred embodiments. The target systems
comprise a population of recipient cells transduced with an AAV
vector encoding an antigen of interest. The cells are capable of
processing the antigen of interest using the Class I MHC pathway,
and presenting the antigen in association with a MHC Class I
molecule. These systems provide a well-defined target system with
which to monitor or detect an antigen-specific immune response in a
subject immunized with an AAV vector using the methods of the
present invention. In addition, the transduced cells can be used in
T cell proliferation assays, CTL assays (e.g., chromium release
assays), antibody binding assays, antibody-dependent cell-mediated
cytotoxicity (ADCC) assays, and any other suitable assay
system.
Antibody Production
[0036] The present invention also provides methods for producing
antibodies directed against an antigen of interest that is
contained in an AAV vaccine preparation. In these methods, an
animal having immunocompetent cells is exposed to an immunogen
comprising at least an immunogenic portion of the antigen of
interest, under conditions such that immunocompetent cells produce
antibodies directed against the immunogenic portion(s) of the
immunogen. In one embodiment, the method further comprises the step
of harvesting the antibodies. In an alternative embodiment, the
method comprises the step of fusing the immunocompetent cells with
an immortal cell line under conditions such that an hybridoma is
produced. In other embodiments, the immunogen comprises a fusion
protein.
[0037] The present invention also provides methods for detecting
antigen or immunogen expression comprising the steps of: a)
providing a sample suspected of containing the antigen of interest
and a control containing a quantitated amount of known antigen; and
b) comparing the test antigen in the sample with the quantitated
known antigen in the control to determine the relative
concentration of the test antigen in the sample. Thus, the methods
are capable of identifying samples (e.g., patient samples) with
sufficient or insufficient quantities of antigen of interest,
providing an indication of the strength of the expected immune
response by the patient against the antigen. In addition, the
methods may be conducted using any suitable means to determine the
relative concentration of the antigen of interest in the test and
control samples, including but not limited to means selected from
the group consisting of Western blot analysis, Northern blot
analysis, Southern blot analysis, denaturing polyacrylamide gel
electrophoresis, reverse transcriptase-coupled polymerase chain
reaction, enzyme-linked immunosorbent assay, radioimmunoassay, and
fluorescent immunoassay. Thus, the methods may be conducted to
determine the presence of the antigen of interest in the genome of
the animal source of the test sample, or the expression of the
antigen of interest (mRNA or protein), as well as detect the
presence of abnormal or mutated antigen or antigen gene sequences
in the test samples.
[0038] In one preferred embodiment, the presence of the antigen of
interest is detected by immunochemical analysis. For example, the
immunochemical analysis can comprise detecting binding of an
antibody specific for an epitope of the antigen of interest. In an
another preferred embodiment of the method, the antibody comprises
polyclonal antibodies, while in another preferred embodiment, the
antibody comprises monoclonal antibodies.
[0039] The antibodies used in the methods of the present invention
may be prepared using various immunogens. In one embodiment, the
immunogen is an antigen of interest used as an immunogen to
generate antibodies that recognize the antigen of interest. Such
antibodies include, but are not limited to polyclonal, monoclonal,
chimeric, single chain, Fab fragments, and an Fab expression
library.
[0040] Various procedures known in the art may be used for the
production of polyclonal antibodies to the antigen of interest
encoded by the AAV vaccine preparation. For example, for the
production of antibody, various host animals can be immunized by
injection with a peptide corresponding to at least one epitope of
the antigen of interest, including but not limited to rabbits,
mice, rats, sheep, goats, etc. In some embodiments, the peptide is
conjugated to an immunogenic carrier (e.g., diphtheria toxoid,
bovine serum albumin [BSA], or keyhole limpet hemocyanin [KLH]).
Various adjuvants may be used to increase the immunological
response, depending on the host species, including but not limited
to Freund's (complete and incomplete), mineral gels such as
aluminum hydroxide, surface active substances such as lysolecithin,
pluronic polyols, polyanions, peptides, oil emulsions, keyhole
limpet hemocyanins, dinitrophenol, and potentially useful humnan
adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium
parvum.
[0041] For preparation of monoclonal antibodies directed toward an
antigen of interest, any technique that provides for the production
of antibody molecules by continuous cell lines in culture may be
used (See, e.g., Harlow and Lane, Antibodies: A Laboratory Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
These include but are not limited to the hybridoma technique
originally developed by Kohler and Milstein (Kohler and Milstein,
Nature 256:495-497 [1975]), as well as the trioma technique, the
human B-cell hybridoma technique (See e.g., Kozbor et al. Immunol.
Today 4:72 [1983]), and the EBV-hybridoma technique to produce
human monoclonal antibodies (Cole et al., in Monoclonal Antibodies
and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 [1985]).
[0042] In an additional embodiment of the invention, monoclonal
antibodies can be produced in germ-free animals utilizing recent
technology (See e.g., PCT/US90/02545). According to the invention,
human antibodies may be used and can be obtained by using human
hybridomas (Cote et al., Proc. Natl. Acad Sci. USA 80:2026-2030
[1983]) or by transforming human B cells with EBV virus in vitro
(Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R.
Liss, pp. 77-96 [1985]).
[0043] According to the invention, techniques described for the
production of single chain antibodies (U.S. Pat. No. 4,946,778;
herein incorporated by reference) can be adapted to produce single
chain antibodies useful in embodiments of the present invention. An
additional embodiment of the present invention utilizes the
techniques described for the construction of Fab expression
libraries (Huse et al., Science 246:1275-1281 [1989]), to allow
rapid and easy identification of monoclonal Fab fragments with the
desired specificity.
[0044] Antibody fragments which contain the idiotype (antigen
binding region) of the antibody molecule can be generated by known
techniques. For example, such fragments include but are not limited
to: the F(ab')2 fragment which can be produced by pepsin digestion
of the antibody molecule; the Fab' fragments which can be generated
by reducing the disulfide bridges of the F(ab')2 fragment, and the
Fab fragments which can be generated by treating the antibody
molecule with papain and a reducing agent.
[0045] In the production of antibodies, screening for the desired
antibody can be accomplished by techniques known in the art
including, but not limited to, radioimmunoassay, ELISA
(enzyme-linked immunosorbent assay), "sandwich" immunoassays,
immunoradiometric assays, gel diffusion precipitin reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold,
enzyme or radioisotope labels, for example), Western Blots,
precipitation reactions, agglutination assays (e.g., gel
agglutination assays, hemagglutination assays, etc.), complement
fixation assays, immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc.
[0046] In one embodiment, antibody binding is detected by detecting
a label on the primary antibody. In another embodiment, the primary
antibody is detected by detecting binding of a secondary antibody
or reagent to the primary antibody. In a further embodiment, the
secondary antibody is labeled. Many means are known in the art for
detecting binding in an immunoassay and are within the scope of the
present invention. (As is well known in the art, the immunogenic
peptide should be provided free of the carrier molecule used in any
immunization protocol. For example, if the peptide was conjugated
to KLH, it may be conjugated to BSA, or used directly, in a
screening assay.)
[0047] The foregoing antibodies can be used in methods known in the
art relating to the localization and structure of the antigen of
interest (e.g., for Western blotting), measuring levels thereof in
appropriate biological samples, etc. The antibodies can be used to
detect the antigen of interest in a biological sample from an
individual. The biological sample can be a biological fluid,
including, but not limited to, blood, serum, plasma, interstitial
fluid, urine, cerebrospinal fluid, and the like, containing cells.
In particular, the antigen can be detected from cellular sources,
including, but not limited to, platelets and fibroblasts. For
example, platelets or fibroblasts can be obtained from an
individual and lysed (e.g. by freeze-thaw cycling, or treatment
with a mild cytolytic detergent including, but not limited to,
TRITON X-100, digitonin, NONIDET P (NP)-40, saponin, and the like,
or combinations thereof; See, e.g., International Patent
Publication WO 92/08981).
[0048] The biological samples can then be tested directly for the
presence of the antigen of interest using an appropriate strategy
(e.g., ELISA or radioimmunoassay) and format (e.g., microwells,
dipstick [e.g., as described in International Patent Publication WO
93/03367], etc.). Alternatively, proteins in the sample can be size
separated (e.g., by polyacrylamide gel electrophoresis (PAGE), in
the presence or not of sodium dodecyl sulfate (SDS), and the
presence of the antigen of interest detected by immunoblotting
(e.g., Western blotting)). Immunoblotting techniques are generally
more effective with antibodies generated against a peptide
corresponding to an epitope of a protein, and hence, are
particularly suited to the present invention.
[0049] The foregoing explanations of particular assay systems are
presented herein for purposes of illustration only, in fulfillment
of the duty to present an enabling disclosure of the invention. It
is to be understood that the present invention contemplates a
variety of immunochemical assay protocols within its spirit and
scope.
DEFINITIONS
[0050] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0051] As used herein, the terms "gene transfer" and "gene
delivery" refer to methods or systems for reliably inserting a
particular nucleotide sequence (e.g., DNA) into targeted cells.
[0052] As used herein, the terms "vector," and "gene transfer
vector" refer to any genetic element, such as a plasmid, phage,
transposon, cosmid, chromosome, virus, virion, etc., which is
capable of replication when associated with the proper control
elements and/or which can transfer nucleic acid sequences between
cells. Thus, the term includes cloning and expression vehicles, as
well as viral vectors.
[0053] The term "expression vector" as used herein refers to a
recombinant DNA molecule containing a desired coding sequence and
appropriate nucleic acid sequences necessary for the expression of
the operably linked coding sequence in a particular host organism.
Nucleic acid sequences necessary for expression in prokaryotes
usually include a promoter, an operator (optional), and a ribosome
binding site, as well as other sequences. Eukaryotic cells are
known to utilize promoters, enhancers, and termination and
polyadenylation signals.
[0054] It is contemplated that gene transfer vectors constructed
using recombinant techniques that are known in the art to include a
nucleic acid sequence encoding an antigen associated with
functional AAV ITR sequences will find use in the present
invention. In addition, the present invention contemplates gene
transfer vectors that contain suitable promoter sequence positioned
upstream of a heterologous nucleotide sequence encoding an antigen
of interest.
[0055] Gene transfer vectors can also include transcription
sequences such as polyadenylation sites, as well as selectable
markers or reporter genes, enhancer sequences, and other control
elements which allow for the induction of transcription. Such
control elements are described more fully below.
[0056] As used herein, the terms "host" and "expression host" refer
to organisms and/or cells which harbor an exogenous DNA sequence
(e.g., via transfection), an expression vector or vehicle, as well
as organisms and/or cells that are suitable for use in expressing a
recombinant gene or protein. It is not intended that the present
invention be limited to any particular type of cell or organism.
Indeed, it is contemplated that any suitable organism and/or cell
will find use in the present invention as a host.
[0057] As used herein, the terms "viral replicons" and "viral
origins of replication" refer to viral DNA sequences that allow for
the extrachromosomal replication of a vector in a host cell
expressing the appropriate replication factors. In some
embodiments, vectors which contain either the SV40 or polyoma virus
origin of replication replicate to high copy number (up to 10.sup.4
copies/cell) in cells that express the appropriate viral T antigen
may be utilized, while vectors which contain the replicons from
bovine papillomavirus or Epstein-Barr virus replicate
extrachromosomally at low copy number (.about.100 copies/cell) may
be utilized in other embodiments.
[0058] As used herein, the term "AAV vector" refers to a vector
derived from an adeno-associated virus serotype, including without
limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-X7, etc. AAV
vectors can have one or more of the AAV wild-type genes deleted in
whole or part, preferably the rep and/or cap genes but retain
functional flanking ITR sequences. Functional ITR sequences are
necessary for the rescue, replication and packaging of the AAV
virion. Thus, an AAV vector is defined herein to include at least
those sequences required in cis for replication and packaging
(e.g., functional ITRs) of the virus. The ITRs need not be the
wild-type nucleotide sequences, and may be altered (e.g., by the
insertion, deletion or substitution of nucleotides), so long as the
sequences provide for functional rescue, replication and
packaging.
[0059] As used herein, the term "ITR" refers to inverted terminal
repeats. The terms "adeno-associated virus inverted terminal
repeats" or "AAV ITRs" refer to the art-recognized palindromic
regions found at each end of the AAV genome which function together
in cis as origins of DNA replication and as packaging signals for
the virus. For use in some embodiments of the present invention,
flanking AAV ITRs are positioned 5' and 3' of one or more selected
heterologous nucleotide sequences and, together with the rep coding
region or the Rep expression product, provide for the integration
of the selected sequences into the genome of a target cell. These
sequences, located at the terminal ends of the viral genome,
function in cis as origins of DNA replication and as packaging
signals for the virus.
[0060] As used herein, the term "AAV rep coding region" refers to
the art-recognized region of the AAV genome which encodes the
replication proteins Rep 78, Rep 68, Rep 52 and Rep 40. These Rep
expression products have been shown to possess many functions,
including recognition, binding and nicking of the AAV origin of DNA
replication, DNA helicase activity and modulation of transcription
from AAV (or other heterologous) promoters. The Rep expression
products are collectively required for replicating the AAV genome.
Muzyckza (Muzyczka, Curr. Top. Microbiol. Immunol., 158:97-129
[1992]) and Kotin (Kotin, Human Gene Ther., 5:793-801 [1994])
provide additional descriptions of the AAV rep coding region, as
well as the cap coding region described below. Suitable homologues
of the AAV rep coding region include the human herpesvirus 6
(HHV-6) rep gene which is also known to mediate AAV-2 DNA
replication (Thomson et al., Virol., 204:304-311 [1994]).
[0061] As used herein, the term "AAV cap coding region" refers to
the art-recognized region of the AAV genome which encodes the
capsid proteins VP1, VP2, and VP3, or functional homologues
thereof. These cap expression products supply the packaging
functions which are collectively required for packaging the viral
genome.
[0062] As used herein, the terms "accessory functions" and
"accessory factors" refer to functions and factors that are
required by AAV for replication, but are not provided by the AAV
virion (or rAAV virion) itself. Thus, these accessory functions and
factors must be provided by the host cell or another expression
vector that is co-expressed in the same cell.
[0063] As used herein, the term "wild type" ("wt") refers to a gene
or gene product which has the characteristics of that gene or gene
product when isolated from a naturally occurring source. A
wild-type gene is that which is most frequently observed in a
population and is thus arbitrarily designed the "normal" or
"wild-type" form of the gene. In contrast, the term "modified" or
"mutant" refers to a gene or gene product which displays
modifications in sequence and or functional properties (i.e.,
altered characteristics) when compared to the wild-type gene or
gene product. It is noted that naturally-occurring mutants can be
isolated; these are identified by the fact that they have altered
characteristics when compared to the wild-type gene or gene
product.
[0064] As used herein, the term "AAV virion" refers to a complete
virus particle, such as a "wild-type" (wt) AAV virus particle
(comprising a linear, single-stranded AAV nucleic acid genome
associated with an AAV capsid protein coat). In this regard,
single-stranded AAV nucleic acid molecules of either complementary
sense (e.g., "sense" or "antisense" strands), can be packaged into
any one AAV virion and both strands are equally infectious.
[0065] As used herein, the terms "recombinant AAV virion," and
"rAAV virion" refer to as an infectious viral particle containing a
heterologous DNA molecule of interest which is flanked on both
sides by AAV ITRs. In some embodiments of the present invention, an
rAAV virion is produced in a suitable host cell which has had an
AAV vector, AAV helper functions and accessory functions introduced
therein. In this manner, the host cell is rendered capable of
encoding AAV polypeptides that are required for packaging the AAV
vector (containing a recombinant nucleotide sequence of interest)
into recombinant virion particles for subsequent gene delivery.
[0066] As used herein, the term "recombinant AAV vector" refers a
composition comprising an AAV vector comprising one or more
heterologous DNA molecules of interest. As described above, AAV
vectors can have one or more of the AAV wild-type elements deleted
in whole or in part. Thus, in one embodiment, a recombinant AAV
vector comprises a heterologous DNA molecule of interest which is
flanked on both sides by AAV ITRs. In other embodiments, the
recombinant AAV vector may further comprise elements required for
viral infection (e.g., an AAV protein shell). In such embodiments,
the "recombinant AAV vector" may comprise a recombinant AAV
virion.
[0067] As used herein, the term "transfection" refers to the uptake
of foreign DNA by a cell, and a cell has been "transfected" when
exogenous DNA has been introduced inside the cell membrane. A
number of transfection techniques are generally known in the art
(See e.g., Graham et al., Virol., 52:456 [1973]; Sambrook et al.,
Molecular Cloning, a Laboratory Manual, Cold Spring Harbor
Laboratories, New York [1989]; Davis et al., Basic Methods in
Molecular Biology, Elsevier, [1986]; and Chu et al., Gene 13:197
[1981]. Such techniques can be used to introduce one or more
exogenous DNA moieties, such as a gene transfer vector and other
nucleic acid molecules, into suitable recipient cells.
[0068] As used herein, the terms "stable transfection" and "stably
transfected" refers to the introduction and integration of foreign
DNA into the genome of the transfected cell. The term "stable
transfectant" refers to a cell which has stably integrated foreign
DNA into the genomic DNA.
[0069] As used herein, the term "transient transfection" or
"transiently transfected" refers to the introduction of foreign DNA
into a cell where the foreign DNA fails to integrate into the
genome of the transfected cell. The foreign DNA persists in the
nucleus of the transfected cell for several days. During this time
the foreign DNA is subject to the regulatory controls that govern
the expression of endogenous genes in the chromosomes. The term
"transient transfectant" refers to cells which have taken up
foreign DNA but have failed to integrate this DNA.
[0070] As used herein, the term "transduction" denotes the delivery
of a DNA molecule to a recipient cell either in vivo or in vitro,
via a replication-defective viral vector, such as via a recombinant
AAV virion.
[0071] As used herein, the term "recipient cell" refers to a cell
which has been transfected or transduced, or is capable of being
transfected or transduced, by a nucleic acid construct or vector
bearing a selected nucleotide sequence of interest. The term
includes the progeny of the parent cell, whether or not the progeny
are identical in morphology or in genetic make-up to the original
parent, so long as the selected nucleotide sequence is present.
[0072] The term "heterologous" as it relates to nucleic acid
sequences such as coding sequences and control sequences, denotes
sequences that are not normally joined together, and/or are not
normally associated with a particular cell. Thus, a "heterologous"
region of a nucleic acid construct or a vector is a segment of
nucleic acid within or attached to another nucleic acid molecule
that is not found in association with the other molecule in nature.
For example, a heterologous region of a nucleic acid construct
could include a coding sequence flanked by sequences not found in
association with the coding sequence in nature. Another example of
a heterologous coding sequence is a construct where the coding
sequence itself is not found in nature (e.g., synthetic sequences
having codons different from the native gene). Similarly, a cell
transfected with a construct which is not normally present in the
cell would be considered heterologous for purposes of this
invention. Allelic variation or naturally occurring mutational
events do not give rise to heterologous DNA, as used herein.
[0073] As used herein, "coding sequence" or a sequence which
"encodes" a particular antigen, is a nucleic acid sequence which is
transcribed (in the case of DNA) and translated (in the case of
mRNA) into a polypeptide in vitro or in vivo, when placed under the
control of appropriate regulatory sequences. The boundaries of the
coding sequence are determined by a start codon at the 5' (amino)
terminus and a translation stop codon at the 3' (carboxy) terminus.
A coding sequence can include, but is not limited to, cDNA from
prokaryotic or eukaryotic mRNA, genomic DNA sequences from
prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. A
transcription termination sequence will usually be located 3' to
the coding sequence.
[0074] As used herein, the term "nucleic acid" sequence refers to a
DNA or RNA sequence. The term captures sequences that include any
of the known base analogues of DNA and RNA such as, but not limited
to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine,
aziridinylcytosine, pseudoisocytosine,
5-(carboxyhydroxylmethyl)uracil, 5-fluorouracil, 5-bromouracil,
5-carboxymethylaminomethyl-2-thiouracil,
5-carboxymethylaminomethyluracil, dihydrouracil, inosine,
N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-methyladenine, 7-methylguanine,
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
oxybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid,
pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0075] As used herein, the terms "complementary" or
"complementarity" are used in reference to polynucleotides (i.e., a
sequence of nucleotides) related by the base-pairing rules. For
example, for the sequence "A-G-T," is complementary to the sequence
"T-C-A." Complementarity may be "partial," in which only some of
the nucleic acids' bases are matched according to the base pairing
rules. Or, there may be "complete" or "total" complementarity
between the nucleic acids. The degree of complementarity between
nucleic acid strands has significant effects on the efficiency and
strength of hybridization between nucleic acid strands. This is of
particular importance in amplification reactions, as well as
detection methods which depend upon binding between nucleic
acids.
[0076] The term "homology" refers to a degree of complementarity.
There may be partial homology or complete homology (i.e.,
identity). A partially complementary sequence is one that at least
partially inhibits a completely complementary sequence from
hybridizing to a target nucleic acid is referred to using the
functional term "substantially homologous." The inhibition of
hybridization of the completely complementary sequence to the
target sequence may be examined using a hybridization assay
(Southern or Northern blot, solution hybridization and the like)
under conditions of low stringency. A substantially homologous
sequence or probe will compete for and inhibit the binding (i.e.,
the hybridization) of a completely homologous to a target under
conditions of low stringency. This is not to say that conditions of
low stringency are such that non-specific binding is permitted; low
stringency conditions require that the binding of two sequences to
one another be a specific (i.e., selective) interaction. The
absence of non-specific binding may be tested by the use of a
second target which lacks even a partial degree of complementarity
(e.g., less than about 30% identity); in the absence of
non-specific binding the probe will not hybridize to the second
non-complementary target.
[0077] As used herein, the term "T.sub.m" is used in reference to
the "melting temperature." The melting temperature is the
temperature at which a population of double-stranded nucleic acid
molecules becomes half dissociated into single strands. The
equation for calculating the T.sub.m of nucleic acids is well known
in the art. As indicated by standard references, a simple estimate
of the T.sub.m value may be calculated by the equation:
T.sub.m=81.5+0.41(% G+C), when a nucleic acid is in aqueous
solution at 1 M NaCl (See e.g., Anderson and Young, Quantitative
Filter Hybridization, in Nucleic Acid Hybridization [1985]). Other
references include more sophisticated computations which take
structural as well as sequence characteristics into account for the
calculation of T.sub.m.
[0078] As used herein the term "stringency" is used in reference to
the conditions of temperature, ionic strength, and the presence of
other compounds such as organic solvents, under which nucleic acid
hybridizations are conducted. With "high stringency" conditions,
nucleic acid base pairing will occur only between nucleic acid
fragments that have a high frequency of complementary base
sequences. Thus, conditions of "weak" or "low" stringency are often
required with nucleic acids that are derived from organisms that
are genetically diverse, as the frequency of complementary
sequences is usually less.
[0079] "Amplification" is a special case of nucleic acid
replication involving template specificity. It is to be contrasted
with non-specific template replication (ie., replication that is
template-dependent but not dependent on a specific template).
Template specificity is here distinguished from fidelity of
replication (ie., synthesis of the proper polynucleotide sequence)
and nucleotide (ribo- or deoxyribo-) specificity. Template
specificity is frequently described in terms of "target"
specificity. Target sequences are "targets" in the sense that they
are sought to be sorted out from other nucleic acid. Amplification
techniques have been designed primarily for this sorting out.
[0080] Template specificity is achieved in most amplification
techniques by the choice of enzyme. Amplification enzymes are
enzymes that, under conditions they are used, will process only
specific sequences of nucleic acid in a heterogeneous mixture of
nucleic acid. For example, in the case of Q.beta. replicase, MDV-1
RNA is the specific template for the replicase (Kacian et al.,
Proc. Natl. Acad. Sci. USA 69:3038 [1972]). Other nucleic acid will
not be replicated by this amplification enzyme. Similarly, in the
case of T7 RNA polymerase, this amplification enzyme has a
stringent specificity for its own promoters (Chamberlin et al.,
Nature 228:227 [1970]). In the case of T4 DNA ligase, the enzyme
will not ligate the two oligonucleotides or polynucleotides, where
there is a mismatch between the oligonucleotide or polynucleotide
substrate and the template at the ligation junction (Wu and
Wallace, Genomics 4:560 [1989]). Finally, Taq and Pfu polymerases,
by virtue of their ability to function at high temperature, are
found to display high specificity for the sequences bounded and
thus defined by the primers; the high temperature results in
thermodynamic conditions that favor primer hybridization with the
target sequences and not hybridization with non-target sequences
(Erlich (ed.), PCR Technology, Stockton Press [1989]).
[0081] As used herein, the term "amplifiable nucleic acid" is used
in reference to nucleic acids which may be amplified by any
amplification method. It is contemplated that "amplifiable nucleic
acid" will usually comprise "sample template."
[0082] As used herein, the term "sample template" refers to nucleic
acid originating from a sample which is analyzed for the presence
of "target" (defined below). In contrast, "background template" is
used in reference to nucleic acid other than sample template which
may or may not be present in a sample. Background template is most
often inadvertent. It may be the result of carryover, or it may be
due to the presence of nucleic acid contaminants sought to be
purified away from the sample. For example, nucleic acids from
organisms other than those to be detected may be present as
background in a test sample.
[0083] As used herein, the term "primer" refers to an
oligonucleotide, whether occurring naturally as in a purified
restriction digest or produced synthetically, which is capable of
acting as a point of initiation of synthesis when placed under
conditions in which synthesis of a primer extension product which
is complementary to a nucleic acid strand is induced, (ie., in the
presence of nucleotides and an inducing agent such as DNA
polymerase and at a suitable temperature and pH). The primer is
preferably single stranded for maximum efficiency in amplification,
but may alternatively be double stranded. If double stranded, the
primer is first treated to separate its strands before being used
to prepare extension products. Preferably, the primer is an
oligodeoxyribonucleotide. The primer must be sufficiently long to
prime the synthesis of extension products in the presence of the
inducing agent. The exact lengths of the primers will depend on
many factors, including temperature, source of primer and the use
of the method.
[0084] As used herein, the term "probe" refers to an
oligonucleotide (i.e., a sequence of nucleotides), whether
occurring naturally as in a purified restriction digest or produced
synthetically, recombinantly or by PCR amplification, which is
capable of hybridizing to another oligonucleotide of interest. A
probe may be single-stranded or double-stranded. Probes are useful
in the detection, identification and isolation of particular gene
sequences. It is contemplated that any probe used in the present
invention will be labelled with any "reporter molecule," so that is
detectable in any detection system, including, but not limited to
enzyme (e.g., ELISA, as well as enzyme-based histochemical assays),
fluorescent, radioactive, and luminescent systems. It is not
intended that the present invention be limited to any particular
detection system or label.
[0085] As used herein, the term "target," when used in reference to
the polymerase chain reaction, refers to the region of nucleic acid
bounded by the primers used for polymerase chain reaction. Thus,
the "target" is sought to be sorted out from other nucleic acid
sequences. A "segment" is defined as a region of nucleic acid
within the target sequence.
[0086] As used herein, the term "polymerase chain reaction" ("PCR")
refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195,
4,683,202, and 4,965,188, hereby incorporated by reference, which
describe a method for increasing the concentration of a segment of
a target sequence in a mixture of genomic DNA without cloning or
purification. This process for amplifying the target sequence
consists of introducing a large excess of two oligonucleotide
primers to the DNA mixture containing the desired target sequence,
followed by a precise sequence of thermal cycling in the presence
of a DNA polymerase. The two primers are complementary to their
respective strands of the double stranded target sequence. To
effect amplification, the mixture is denatured and the primers then
annealed to their complementary sequences within the target
molecule. Following annealing, the primers are extended with a
polymerase so as to form a new pair of complementary strands. The
steps of denaturation, primer annealing and polymerase extension
can be repeated many times (ie., denaturation, annealing and
extension constitute one "cycle"; there can be numerous "cycles")
to obtain a high concentration of an amplified segment of the
desired target sequence. The length of the amplified segment of the
desired target sequence is determined by the relative positions of
the primers with respect to each other, and therefore, this length
is a controllable parameter. By virtue of the repeating aspect of
the process, the method is referred to as the "polymerase chain
reaction" (hereinafter "PCR"). Because the desired amplified
segments of the target sequence become the predominant sequences
(in terms of concentration) in the mixture, they are said to be
"PCR amplified."
[0087] With PCR, it is possible to amplify a single copy of a
specific target sequence in genomic DNA to a level detectable by
several different methodologies (e.g., hybridization with a labeled
probe; incorporation of biotinylated primers followed by
avidin-enzyme conjugate detection; incorporation of
.sup.32P-labeled deoxynucleotide triphosphates, such as dCTP or
DATP, into the amplified segment). In addition to genomic DNA, any
oligonucleotide or polynucleotide sequence can be amplified with
the appropriate set of primer molecules. In particular, the
amplified segments created by the PCR process itself are,
themselves, efficient templates for subsequent PCR
amplifications.
[0088] As used herein, the terms "PCR product," "PCR fragment," and
"amplification product" refer to the resultant mixture of compounds
after two or more cycles of the PCR steps of denaturation,
annealing and extension are complete. These terms encompass the
case where there has been amplification of one or more segments of
one or more target sequences.
[0089] As used herein, the term "amplification reagents" refers to
those reagents (deoxyribonucleotide triphosphates, buffer, etc.),
needed for amplification except for primers, nucleic acid template
and the amplification enzyme. Typically, amplification reagents
along with other reaction components are placed and contained in a
reaction vessel (test tube, microwell, etc.).
[0090] As used herein, the terms "restriction endonucleases" and
"restriction enzymes" refer to bacterial enzymes, each of which cut
double-stranded DNA at or near a specific nucleotide sequence.
[0091] As used herein, the term "recombinant DNA molecule" as used
herein refers to a DNA molecule which is comprised of segments of
DNA joined together by means of molecular biological
techniques.
[0092] As used herein, the term "antisense" is used in reference to
nucleic acid strand that is complementary to the "sense" strand.
The designation (-) (i.e., "negative") is sometimes used in
reference to the antisense strand, with the designation (+)
sometimes used in reference to the sense (ie., "positive")
strand.
[0093] As used herein, the term "regulatory element" refers to a
genetic element which controls some aspect of the expression of
nucleic acid sequences. For example, a promoter is a regulatory
element which facilitates the initiation of transcription of an
operably linked coding region. Other regulatory elements are
splicing signals, polyadenylation signals, termination signals,
etc. (defined infra).
[0094] The term DNA "control sequences" refers collectively to
promoter sequences, polyadenylation signals, transcription
termination sequences, upstream regulatory domains, origins of
replication, internal ribosome entry sites ("IRES"), enhancers, and
the like, which collectively provide for the replication,
transcription and translation of a coding sequence in a recipient
cell. Not all of these control sequences need always be present so
long as the selected coding sequence is capable of being
replicated, transcribed and translated in an appropriate recipient
cell.
[0095] Transcriptional control signals in eukaryotes comprise
"promoter" and "enhancer" elements. Promoters and enhancers consist
of short arrays of DNA sequences that interact specifically with
cellular proteins involved in transcription (Maniatis et al.,
Science 236:1237 [1987]). Promoter and enhancer elements have been
isolated from a variety of eukaryotic sources including genes in
yeast, insect and mammalian cells and viruses (analogous control
elements, i.e., promoters, are also found in prokaryotes). The
selection of a particular promoter and enhancer depends on what
cell type is to be used to express the protein of interest. Some
eukaryotic promoters and enhancers have a broad host range while
others are functional in a limited subset of cell types (See e.g.,
Voss et al., Trends Biochem. Sci., 11:287 [1986]; and Maniatis et
al., supra, for reviews). For example, the SV40 early gene enhancer
is very active in a wide variety of cell types from many mammalian
species and has been widely used for the expression of proteins in
mammalian cells (Dijkema et al., EMBO J. 4:761 [1985]). Two other
examples of promoter/enhancer elements active in a broad range of
mammalian cell types are those from the human elongation factor
1.alpha. gene (Uetsuki et al., J. Biol. Chem., 264:5791 [1989]; Kim
et al., Gene 91:217 [1990]; and Mizushima and Nagata, Nuc. Acids.
Res., 18:5322 [1990]) and the long terminal repeats of the Rous
sarcoma virus (Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777
[1982)) and the human cytomegalovirus (Boshart et al., Cell 41:521
[1985]). Thus, it is not intended that the present invention be
limited to AAV-derived promoters or other control elements.
[0096] As used herein, the term "promoter/enhancer" denotes a
segment of DNA which contains sequences capable of providing both
promoter and enhancer functions (i.e., the functions provided by a
promoter element and an enhancer element, see above for a
discussion of these functions). For example, the long terminal
repeats of retroviruses contain both promoter and enhancer
functions. The enhancer/promoter may be "endogenous" or "exogenous"
or "heterologous." An "endogenous" enhancer/promoter is one which
is naturally linked with a given gene in the genome. An "exogenous"
or "heterologous" enhancer/promoter is one which is placed in
juxtaposition to a gene by means of genetic manipulation (i.e.,
molecular biological techniques) such that transcription of that
gene is directed by the linked enhancer/promoter.
[0097] The presence of "splicing signals" on an expression vector
often results in higher levels of expression of the recombinant
transcript. Splicing signals mediate the removal of introns from
the primary RNA transcript and consist of a splice donor and
acceptor site (Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York
[1989], pp. 16.7-16.8). A commonly used splice donor and acceptor
site is the splice junction from the 16S RNA of SV40.
[0098] Efficient expression of recombinant DNA sequences in
eukaryotic cells requires expression of signals directing the
efficient termination and polyadenylation of the resulting
transcript. Transcription termination signals are generally found
downstream of the polyadenylation signal and are a few hundred
nucleotides in length. The term "poly A site" or "poly A sequence"
as used herein denotes a DNA sequence which directs both the
termination and polyadenylation of the nascent RNA transcript.
Efficient polyadenylation of the recombinant transcript is
desirable as transcripts lacking a poly A tail are unstable and are
rapidly degraded. The poly A signal utilized in an expression
vector may be "heterologous" or "endogenous." An endogenous poly A
signal is one that is found naturally at the 3' end of the coding
region of a given gene in the genome. A heterologous poly A signal
is one which is one which is isolated from one gene and placed 3'
of another gene. A commonly used heterologous poly A signal is the
SV40 poly A signal. The SV40 poly A signal is contained on a 237 bp
BamHI/BclI restriction fragment and directs both termination and
polyadenylation (Sambrook et al., supra, at 16.6-16.7).
[0099] Eukaryotic expression vectors may also contain "viral
replicons" or "viral origins of replication." Viral replicons are
viral DNA sequences which allow for the extrachromosomal
replication of a vector in a host cell expressing the appropriate
replication factors. For example, vectors which contain either the
SV40 or polyoma virus origin of replication replicate to high copy
number (up to 10.sup.4 copies/cell) in cells that express the
appropriate viral T antigen. Vectors which contain the replicons
from bovine papillomavirus or Epstein-Barr virus replicate
extrachromosomally at low copy number (.about.100 copies/cell).
[0100] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, control sequences operably linked to a
coding sequence are capable of effecting the expression of the
coding sequence. The control sequences need not be contiguous with
the coding sequence, so long as they function to direct the
expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence
and the coding sequence and the promoter sequence can still be
considered "operably linked" to the coding sequence.
[0101] The term "isolated" when used in relation to a nucleic acid,
as in "an isolated oligonucleotide" or "isolated polynucleotide"
refers to a nucleic acid sequence that is identified and separated
from at least one contaminant nucleic acid with which it is
ordinarily associated in its natural source. Isolated nucleic acid
is such present in a form or setting that is different from that in
which it is found in nature. In contrast, non-isolated nucleic
acids are nucleic acids such as DNA and RNA found in the state they
exist in nature. For example, a given DNA sequence (e.g., a gene)
is found on the host cell chromosome in proximity to neighboring
genes; RNA sequences, such as a specific mRNA sequence encoding a
specific protein, are found in the cell as a mixture with numerous
other mRNAs which encode a multitude of proteins. The isolated
nucleic acid, oligonucleotide, or polynucleotide may be present in
single-stranded or double-stranded form. When an isolated nucleic
acid, oligonucleotide or polynucleotide is to be utilized to
express a protein, the oligonucleotide or polynucleotide will
contain at a minimum the sense or coding strand (i.e., the
oligonucleotide or polynucleotide may single-stranded), but may
contain both the sense and anti-sense strands (i.e., the
oligonucleotide or polynucleotide may be double-stranded).
[0102] As used herein, the term "purified" or "to purify" refers to
the removal of contaminants from a sample. For example, antibodies
may be purified by removal of contaminating non-immunoglobulin
proteins; they may also purified by the removal of immunoglobulin
that does not bind the antigen of interest. The removal of
non-immunoglobulin proteins and/or the removal of immunoglobulins
that do not bind the antigen of interest results in an increase in
the percent of desired antigen-reactive immunoglobulins in the
sample. In another example, recombinant polypeptides of interest
are expressed in bacterial host cells and the polypeptides are
purified by the removal of host cell proteins; the percent of
recombinant polypeptides is thereby increased in the sample.
[0103] An "immune response" to an antigen is the development in a
mammalian subject of a humoral and/or a cellular immune response to
the antigen of interest A "cellular immune response" is one
mediated by T lymphocytes and/or other white blood cells. One
important aspect of cellular immunity involves an antigen-specific
response by cytotoxic T lymphocytes ("CTL"s). CTLs have specificity
for peptide antigens that are presented in association with
proteins encoded by the major histocompatibility complex (MHC) and
expressed on the surfaces of cells. CTLs help induce and promote
the destruction of intracellular microbes, or the lysis of cells
infected with such microbes.
[0104] As used herein, the term "antigen" refers to any agent
(e.g., any substance, compound, molecule [including
macromolecules], or other moiety), that is recognized by an
antibody, while the term "immunogen" refers to any agent (e.g., any
substance, compound, molecule [including macromolecules], or other
moiety) that can elicit an immunological response in an individual.
These terms may be used to refer to an individual macromolecule or
to a homogeneous or heterogeneous population of antigenic
macromolecules. It is intended that the term encompasses protein
molecules or at least one portion of a protein molecule, which
contains one or more epitopes. In many cases, antigens are also
immunogens, thus the term "antigen" is often used interchangeably
with the term "immunogen." The substance may then be used as an
antigen in an assay to detect the presence of appropriate
antibodies in the serum of the immunized animal.
[0105] As used herein, the term "chimeric protein" refers to two or
more coding sequences obtained from different genes, that have been
cloned together and that, after translation, act as a single
polypeptide sequence. Chimeric proteins are also referred to as
"hybrid proteins." As used herein, the term "chimeric protein"
refers to coding sequences that are obtained from different species
of organisms, as well as coding sequences that are obtained from
the same species of organisms.
[0106] The term "monovalent" when used in reference to a vaccine
refers to a vaccine which is capable of provoking an immune
response in a host animal directed against a single type of
antigen. In contrast, a "multivalent" vaccine provokes an immune
response in a host animal directed against several (i.e., more than
one) toxins and/or enzymes associated with disease (e.g.,
glycoprotease and/or neuraminidase). It is not intended that the
vaccine be limited to any particular organism or immunogen.
[0107] The present invention further contemplates immunization with
or without adjuvant. As used herein, the term "adjuvant" is defined
as a substance known to increase the immune response to other
antigens when administered with other antigens. If adjuvant is
used, it is not intended that the present invention be limited to
any particular type of adjuvant--or that the same adjuvant, once
used, be used all the time. It is contemplated that adjuvants may
be used either separately or in combination. The present invention
contemplates all types of adjuvant, including but not limited to
agar beads, aluminum hydroxide or phosphate (alum), Incomplete
Freund's Adjuvant, as well as Quil A adjuvant commercially
available from Accurate Chemical and Scientific Corporation, Gerbu
adjuvant also commercially available (GmDP; C.C. Biotech Corp.),
and bacterin (i.e., killed preparations of bacterial cells). It is
further contemplated that the vaccine comprise at least one
"excipient" (i.e., a pharmaceutically acceptable carrier or
substance) suitable for administration to a human or other animal
subject. It is intended that the term "excipient" encompass
liquids, as well as solids, and colloidal suspensions.
[0108] As used herein the term "immunogenically-effective amount"
refers to that amount of an immunogen required to invoke the
production of protective levels of antibodies in a host upon
vaccination.
[0109] The term "protective level," when used in reference to the
level of antibodies induced upon immunization of the host with an
immunogen means a level of circulating antibodies sufficient to
protect the host from challenge with a lethal dose of the organism
or other antigenic material (e.g., toxins, etc.).
[0110] A "B cell epitope" generally refers to the site on an
antigen to which a specific antibody molecule binds. The
identification of epitopes which are able to elicit an antibody
response is readily accomplished using techniques well known in the
art (See e.g., Geysen et al. Proc. Natl. Acad. Sci. USA
81:3998-4002 [1984], for general method of rapidly synthesizing
peptides to determine the location of immunogenic epitopes in a
given antigen; U.S. Pat. No. 4,708,871 for procedures for
identifying and chemically synthesizing epitopes of antigens; and
Geysen et al., Mol. Immunol., 23:709-715 [1986] for a technique for
identifying peptides with high affinity for a given antibody).
[0111] A "T cell epitope" refers generally to those features of a
peptide structure capable of inducing a T cell response. In this
regard, it is accepted in the art that T cell epitopes comprise
linear peptide determinants that assume extended conformations
within the peptide-binding cleft of MHC molecules, (See, Unanue et
al., Science 236:551-557 [1987]). As used here, a T cell epitope is
generally a peptide having about 3-5, preferably 5-10 or more,
amino acid residues.
[0112] The term "self antigen" or "autoantigen," means an antigen
or a molecule capable of being recognized during an immune response
as self (ie., an antigen that is normally part of the individual).
This is in contrast to antigens which are foreign, or exogenous,
and are thus not normally part of the individual's antigenic
makeup.
[0113] As used herein, the term "autoimmune disease" means a set of
sustained organ-specific or systemic clinical symptoms and signs
associated with altered immune homeostasis that is manifested by
qualitative and/or quantitative defects of expressed autoimmune
repertoires. Autoimmune diseases are characterized by antibody or
cytotoxic immune responses to epitopes on self antigens found in
the diseased individual. The immune system of the individual then
activates an inflammatory cascade aimed at cells and tissues
presenting those specific self antigens. The destruction of the
antigen, tissue, cell type, or organ attacked by the individual's
own immune system gives rise to the symptoms of the disease.
Clinically significant autoimmune diseases include, for example,
rheumatoid arthritis, multiple sclerosis, juvenile-onset diabetes,
systemic lupus erythematosus (SLE), autoimmune uveoretinitis,
autoimmune vasculitis, bullous pemphigus, myasthenia gravis,
autoimmune thyroiditis or Hashimoto's disease, Sjogren's syndrome,
granulomatous orchitis, autoimmune oophoritis, Crohn's disease,
sarcoidosis, rheumatic carditis, ankylosing spondylitis, Grave's
disease, and autoimmune thrombocytopenic purpura.
[0114] As used herein, the term "anergy" means a reversible
antiproliferative state which results in decreased responsiveness
of an immune cell or cells to an antigen. "T-cell anergy" refers to
anergy of at least one T-cell population. For example, T-cell
anergy is involved in deviation of specific immunity from a
T.sub.H1-like to a T.sub.H2-like immune response, and is thus
important in the prevention and therapy of allergic disorders. The
term "antigen desensitization" refers to the process of decreasing
an immune response by delivering to a subject, over a period of
time, the antigen against which an immune response is mounted. With
repeated exposure of the immune cells to the antigen, a decrease in
the cytotoxic response is seen. Such desensitization can include,
but is not limited to, a switch from a T.sub.H1-like response to a
T.sub.H2-like response to the subject antigen. Antigen
desensitization can be used for the treatment of autoimmune and
allergic diseases.
[0115] An "allergen" is an immunogen which can initiate a state of
hypersensitivity, or which can provoke a hypersensitivity reaction
in a subject already sensitized with the allergen.
[0116] Another aspect of cellular immunity involves an
antigen-specific response by helper T lymphocytes (T.sub.H cells).
T.sub.H cells act to help stimulate the function, and focus the
activity of, nonspecific effector cells against cells displaying
peptide antigens in association with MHC molecules on their
surface. In addition, various subsets of T.sub.H cells produce
distinct cytokines in response to antigenic stimulation.
Particularly, antigenic stimulation of naive T.sub.H cells leads to
differentiation of the lymphocyte cells into subsets termed
"T.sub.H1" and "T.sub.H2" which have relatively restricted cytokine
production profiles and effector functions. T.sub.H1 cells secrete
IL-2 and IFN-.gamma., and are the principal effectors of
cell-mediated immunity against intracellular microbes and of
delayed type hypersensitivity (DTH) reactions. Antibody isotypes
stimulated by T.sub.H1 cells are effective at activating complement
and opsonizing antigens for phagocytosis. T.sub.H2 cells produce
IL-4 (which stimulates IgE antibody production), IL-5
(eosinophil-activating factor), and IL-10 and IL-13 (which suppress
cell-mediated immunity). Thus, the nature of an immune response can
be characterized by the profile of antigen-specific lymphocytes
that are stimulated by the immunogen, and can be referred to as a
"T.sub.H1-like" or a "T.sub.H2-like" immune response.
[0117] The ability of a particular antigen to stimulate a
cell-mediated immunological response may be determined by a number
of assays, such as by lymphoproliferation (lymphocyte activation)
assays, CTL cytotoxic cell assays such as chromium-release assays,
or by assaying for T lymphocytes specific for the antigen in a
sensitized subject. Such assays are well known in the art (See
e.g., Erickson et al., J Immunol., 151:4189-4199 [1993], and Doe et
al., Eur. J. Immunol., 24:2369-2376 [1994]).
[0118] As used herein, the term "selectable marker" refers to the
use of a gene which encodes an enzymatic activity that confers the
ability to grow in medium lacking what would otherwise be an
essential nutrient (e.g., the HIS3 gene in yeast cells); in
addition, a selectable marker may confer resistance to an
antibiotic or drug upon the cell in which the selectable marker is
expressed. Selectable markers may be "dominant"; a dominant
selectable marker encodes an enzymatic activity which can be
detected in any eukaryotic cell line. Examples of dominant
selectable markers include the bacterial aminoglycoside 3'
phosphotransferase gene (also referred to as the neo gene) which
confers resistance to the drug G418 in mammalian cells, the
bacterial hygromycin G phosphotransferase (hyg) gene which confers
resistance to the antibiotic hygromycin and the bacterial
xanthine-guanine phosphoribosyl transferase gene (also referred to
as the gpt gene) which confers the ability to grow in the presence
of mycophenolic acid. Other selectable markers are not dominant in
that there use must be in conjunction with a cell line that lacks
the relevant enzyme activity. Examples of non-dominant selectable
markers include the thymidine kinase (tk) gene which is used in
conjunction with tk cell lines, the CAD gene which is used in
conjunction with CAD-deficient cells and the mammalian
hypoxanthine-guanine phosphoribosyl trasferase (hprt) gene which is
used in conjunction with hprt cell lines. A review of the use of
selectable markers in mammalian cell lines is provided in Sambrook,
J. et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold
Spring Harbor Laboratory Press, New York (1989) pp. 16.9-16.15.
[0119] As used herein, the term "cell culture" refers to any in
vitro culture of cells. Included within this term are continuous
cell lines (e.g., with an immortal phenotype), primary cell
cultures, finite cell lines (e.g., non-transformed cells), and any
other cell population maintained in vitro.
[0120] The term "compound" refers to any vaccine preparation,
chemical entity, pharmaceutical, drug, and the like that can be
used to treat or prevent a disease, illness, sickness, or disorder
of bodily function. Compounds comprise both known and potential
therapeutic compounds. A compound can be determined to be
therapeutic by screening using the screening methods of the present
invention. A "known therapeutic compound" refers to a therapeutic
compound that has been shown (e.g., through animal trials or prior
experience with administration to humans) to be effective in such
treatment or prevention of disease.
[0121] A compound is said to be "in a form suitable for
administration to an animal" when the compound may be administered
to an animal by any desired route (e.g., oral, intravenous,
subcutaneous, intramuscular, etc.). Administration of a compound to
a pregnant female may result in delivery of the compound to the
fetuses of the pregnant animal.
[0122] As used herein, the term "therapeutic amount" refers to that
amount of a compound that is required to neutralize the pathologic
effects of an organism, toxin, or other detrimental effects in a
subject, or stimulate an appropriate (e.g., effective) immune
response in the subject.
[0123] A "composition comprising a given polynucleotide sequence"
as used herein refers broadly to any composition containing the
given polynucleotide sequence. The composition may comprise an
aqueous solution.
[0124] As used herein, the term "at risk" is used in references to
individuals who have been exposed to a pathogenic organism or toxin
and may suffer the symptoms associated with infection or disease
with the organism or toxin.
[0125] The term "sample" as used herein is used in its broadest
sense. A "sample suspected of containing a human chromosome or
sequences associated with a human chromosome" may comprise a cell,
chromosomes isolated from a cell (e.g., a spread of metaphase
chromosomes), genomic DNA (in solution or bound to a solid support
such as for Southern blot analysis), RNA (in solution or bound to a
solid support such as for Northern blot analysis), cDNA (in
solution or bound to a solid support) and the like. A sample
suspected of containing a protein may comprise a cell, a portion of
a tissue, an extract containing one or more proteins and the
like.
[0126] As used herein, the term "subject" refers to any animal
(i.e., vertebrates and invertebrates), while the term "vertebrate
subject" refers to any member of the subphylum Chordata. It is
intended that the term encompass any member of this subphylum,
including, but not limited to humans and other primates, rodents
(e.g., mice, rats, and guinea pigs), lagamorphs (e.g., rabbits),
bovines (e.g, cattle), ovines (e.g., sheep), caprines (e.g.,
goats), porcines (e.g., swine), equines (e.g., horses), canines
(e.g., dogs), felines (e.g., cats), domestic fowl (e.g., chickens,
turkeys, ducks, geese, other gallinaceous birds, etc.), as well as
feral or wild animals, including, but not limited to, such animals
as ungulates (e.g., deer), bear, fish, lagamorphs, rodents, birds,
etc. It is not intended that the term be limited to a particular
age or sex. Thus, adult and newborn subjects, as well as fetuses,
whether male or female, are encompassed by the term.
DETAILED DESCRIPTION OF THE INVENTION
[0127] The AAV vectors and rAAV virions of the present invention
can be produced using standard methodology, known to those of skill
in the art. The methods generally involve the steps of (1)
introducing an AAV vector into a host cell; (2) introducing an AAV
helper construct into the host cell, where the helper construct
includes AAV coding regions capable of being expressed in the host
cell to complement AAV helper functions missing from the AAV
vector; (3) introducing one or more helper viruses and/or accessory
function vectors into the host cell, wherein the helper virus
and/or accessory function vectors provide accessory functions
capable of supporting efficient recombinant AAV ("rAAV") virion
production in the host cell; and (4) culturing the host cell to
produce rAAV virions. The AAV vector, AAV helper construct and the
helper virus or accessory function vector(s) can be introduced into
the host cell either simultaneously or serially, using standard
transfection techniques.
I. AAV Vectors
[0128] AAV vectors of the present invention may be constructed
using known techniques to provide, as operatively linked components
in the direction of transcription, (a) control elements including a
transcriptional initiation and termination regions, and (b) a
nucleotide sequence encoding an antigen of interest. The control
elements are selected to be functional in a targeted recipient
cell. The resulting construct which contains the operatively linked
components is bounded (5' and 3') with functional AAV ITR
sequences.
[0129] A. Control Elements
[0130] The nucleotide sequences of AAV ITR regions are known (See
e.g., Kotin, R. M. (1994) Human Gene Ther., 5:793-801; Berns, K. I.
"Parvoviridae and Their Replication" in Fundamental Virology, 2nd
Edition, (Fields and Knipe, eds.) for the AAV-2 sequence. AAV ITRs
used in the vectors of the invention need not have a wild-type
nucleotide sequence), and may be altered (e.g., by the insertion,
deletion or substitution of nucleotides). Additionally, AAV ITRs
may be derived from any of several AAV serotypes, including without
limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
Furthermore, 5' and 3' ITRs which flank a selected nucleotide
sequence in an AAV vector need not necessarily be identical or
derived from the same AAV serotype or isolate, so long as they
function as intended, (ie., to allow for excision and replication
of the bounded nucleotide sequence of interest when AAV rep gene
products are present in the cell).
[0131] B. Antigens
[0132] Suitable nucleic acid molecules (i.e., nucleic acid encoding
at least one antigenic determinant) for use in AAV vectors will
generally be less than about 5 kilobases (Kb) in size and will
include a first nucleic acid sequence that encodes an antigen or an
allergen. If an antigen is used, it will preferably be of an
intracellular pathogen, such as a viral, bacterial or parasitic
(e.g., protozoan or helminthic) pathogen, or the antigen will be a
tumor-specific antigen. However, it is not intended that the
present invention be limited to a particular antigen, antigenic
determinant, or nucleic acid sequence. It is also not intended that
the present invention be limited to any particular size of nucleic
acid.
[0133] Tumor-specific antigens include, but are not limited to, any
of the various MAGEs (Melanoma-Associated Antigen E), including
MAGE 1 (e.g., GenBank Accession No. M77481), MAGE 2 (e.g., GenBank
Accession No. U03735), MAGE 3, MAGE 4, etc.; any of the various
tyrosinases; mutant ras; mutant p53 (e.g., GenBank Accession No.
X54156 and AA494311); and p97 melanoma antigen (e.g., GenBank
Accession No. M12154). Other tumor-specific antigens include the
Ras peptide and p53 peptide associated with advanced cancers, the
HPV 16/18 and E6/E7 antigens associated with cervical cancers,
MUC1-KLH antigen associated with breast carcinoma (e.g., GenBank
Accession No. J03651), CEA (carcinoembryonic antigen) associated
with colorectal cancer (e.g., GenBank Accession No. X98311), gp100
(e.g., GenBank Accession No. S73003) or MART1 antigens associated
with melanoma, and the PSA antigen associated with prostate cancer
(e.g., GenBank Accession No. X14810). The p53 gene sequence is
known (See e.g., Harris et al. (1986) Mol. Cell. Biol.,
6:4650-4656) and is deposited with GenBank under Accession No.
M14694. Thus, the present invention can be used as
immunotherapeutics for cancers including, but not limited to,
cervical, breast, colorectal, prostate, lung cancers, and for
melanomas.
[0134] It is contemplated that suitable viral antigens will be
derived from known causative agents responsible for diseases
including, but not limited to, measles, munps, rubella,
poliomyelitis, hepatitis A, B (e.g., GenBank Accession No. E02707),
and C (e.g., GenBank Accession No. E06890), as well as other
hepatitis viruses, influenza, adenovirus (e.g., types 4 and 7),
rabies (e.g., GenBank Accession No. M34678), yellow fever, Japanese
encephalitis (e.g., GenBank Accession No. E07883), dengue (e.g.,
GenBank Accession No. M24444), hantavirus, and AIDS (e.g., GenBank
Accession No. U18552).
[0135] It is contemplated that suitable bacterial and parasitic
antigens will be derived from known causative agents responsible
for diseases including, but not limited to, diphtheria, pertussis
(e.g., GenBank Accession No. M35274), tetanus (e.g., GenBank
Accession No. M64353), tuberculosis, bacterial and fungal
pneumonias (e.g., Haemophilus influenzae, Pneumocystis carinii,
etc.), cholera, typhoid, plague, shigellosis, salmonellosis (e.g.,
GenBank Accession No. L03833), Legionnaire's Disease, Lyme disease
(e.g., GenBank Accession No. U59487), malaria (e.g., GenBank
Accession No. X53832), hookworm, onchocerciasis (e.g., GenBank
Accession No. M27807), schistosomiasis (e.g., GenBank Accession No.
L08198), trypanosomiasis, leshmaniasis, giardiasis (e.g., GenBank
Accession No. M33641), amoebiasis, filariasis (e.g., GenBank
Accession No. J03266), borreliosis, and trichinosis.
[0136] It is also contemplated that antigens useful in the
treatment or prevention of autoimmune disorders include, but are
not limited to, those derived from nucleosomes for the treatment of
systemic lupus erythematosus (e.g., GenBank Accession No. D28394;
Bruggen et al., Ann. Med. Interne (Paris) 147:485-489 [1996]) and
from the 44,000 M(r) peptide component of ocular tissue
cross-reactive with O. volvulus antigen (McKechnie et al., Ann
Trop. Med. Parasitol., 87:649-652 [1993]) will also find use in the
present invention.
[0137] In the treatment or prevention of allergic disorders, the
antigen can be an allergen, or an antigen derived from a cell type
that will be targeted in a particular therapeutic intervention. For
example, interventions targeted against IgE molecules (e.g., to
deplete circulating and/or mast cell bound IgE; for example,
GenBank Accession No. U39546), can employ antigens derived from an
IgE molecule. One particular antigen thus comprises a chimeric
molecule containing a portion of an IgE molecule coupled to a
foreign carrier protein (Schreiber et al., Ann. Rev. Immunol. 6:465
[1988]). Suitable allergens include, but are not limited to, the
major and cryptic epitopes of the Der p I allergen (Hoyne et al.,
Immunol., 83190-195 [1994]), bee venom phospholipase A2 (PLA)
(Akdis et al., J. Clin. Invest., 98:1676-1683 [1996]), birch pollen
allergen Bet v 1 (Bauer et al., Clin. Exp. Immunol., 107:536-541
[1997]), and the multi-epitopic recombinant grass allergen rKBG8.3
(Cao et al., Immunol., 90:46-51 [1997]).
[0138] Polynucleotide sequences coding for the above-described
antigens and/or allergens can be obtained using recombinant
methods, such as by screening cDNA and genomic libraries from cells
expressing the antigen, or by deriving the sequence from a vector
known to include the same. Furthermore, the desired sequence can be
isolated directly from cells and tissues containing the same, using
standard techniques, such as phenol extraction and PCR of cDNA or
genomic DNA (See e.g., Sambrook et al., supra, for a description of
techniques used to obtain and isolate DNA). Nucleotide sequences
encoding an antigen of interest can also be produced synthetically,
rather than cloned. The complete sequence can be assembled from
overlapping oligonucleotides prepared by standard methods and
assembled into a complete coding sequence (See e.g., Edge, Nature
292:756 [1981]; Nambair et al., Science 223:1299 [1984]; and Jay et
al., J. Biol. Chem., 259:6311 [1984]).
[0139] C. Tissue-Specific Expression
[0140] It is contemplated that in some embodiments, tissue-specific
expression will be desireable. Such expression can be achieved by
coupling the coding sequence for the antigen of interest with
heterologous control elements derived from genes that are
specifically transcribed by a selected tissue type. Particularly,
the probasin (PB) gene is known to be expressed specifically in the
prostatic lobes, and is also detectable in the seminal vesicles
(See, Matusik et al., Biochem. & Cell Biol., 64:601 [1986]). A
cDNA clone which contains the complete coding region for PB has
been described (Spence et al., Proc. Natl. Acad Sci. USA 86:7843
[1989]). Further, the 5' probasin-flanking region has been shown to
contain the necessary control sequences for prostatic targeting,
and the region will thus direct prostate-specific expression of
operably linked coding regions (Greenberg et al., Endocrine Soc.,
June 9-11: Abstract 1206 [1993]). In the practice of the invention,
prostate-specific expression can be effected by coupling the
5'-flanking PB control sequences with the coding region for the
antigen of interest. Alternatively, tumor-specific expression can
be achieved using control elements obtained from genes that are
preferentially transcribed by tumors. Such control elements are
termed "tumor-specific" herein. For example, the oncofetal protein
carcinoembryonic antigen (CEA) gene is often expressed at high
levels in epithelial cancers and gastrointestinal malignancies
including colon and pancreatic tumors, but not in normal tissues
(Warshaw et al., N. Engl. J. Med., 326:455-465 [1992]). Thus,
specific gene expression can be readily achieved using the
transcriptional regulatory sequence or the promoter of CEA (CEA-P).
A number of other suitable genes which are preferentially expressed
in tumors have been described, and their promoters and/or other
control elements can be included in the present AAV vectors to
limit expression in non-tumor cells (Sikora, Gene Ther., 1:149-151
[1994]; Huber et al., Proc. Natl. Acad Sci. USA 88:8039-8043
[1991]; and Austin et al. Mol. Pharmacol., 43:380-387 [1993]).
[0141] Examples of other tumor-specific control elements which are
useful in the practice of the invention include, but are not
limited to, the alpha-fetoprotein (AFP) control sequences (e.g.,
the promoter and enhancer) to target hepatomas and germ-cell
tumors, neuron-specific enolase promoter to target small-cell lung
cancer cells, dopa decarboxylase promoter to target neuroectodermal
tumors, control sequences for glial fibro acidic protein (GFAP) to
target gliomas, prostate-specific antigen (PSA) promoter to target
prostate cancer, amylase promoter to target pancreatic cancer,
insulin promoter to target pancreatic cancers, thyroglobulin
promoter to target thyroid carcinoma, calcitonin promoter to target
cancer of the medullary thyroid, promoters for tyrosinase or
tyrosinase-related peptide to target melanomas, polymorphic
epithelial mucin promoter to target breast cancer, villin promoter
to target gastric cancer, gama-glutamyltranspeptidase promoter to
target certain hepatic tumors, dopa decarboxylase to target certain
lung tumors, c-erbB2 promoter to target breast and gastrointestinal
cancer, c-erb3 promoter to target breast cancer, and c-erb4
promoter to target breast and gastric cancer.
[0142] A number of tissue-specific promoters have been described
above which enable directed expression in selected tissue types.
However, control elements used in the present AAV vectors can also
comprise control sequences normally associated with the selected
nucleic acid sequences. Alternatively, heterologous control
sequences can be employed. Useful heterologous control sequences
generally include those derived from sequences encoding mammalian
or viral genes. Examples include, but are not limited to, the SV40
early promoter, mouse mammary tumor virus LTR promoter, adenovirus
major late promoter (Ad MLP), a herpes simplex virus (HSV)
promoter, a cytomegalovirus (CMV) promoter such as the CMV
immediate early promoter region (CMVIE), a rous sarcoma virus (RSV)
promoter, synthetic promoters, hybrid promoters, and the like. In
addition, sequences derived from nonviral genes, such as the murine
metallothionein gene, will also find use herein. Such promoter
sequences are commercially available (e.g., from Stratagene).
[0143] D. Construction of AAV Vaccine Vectors
[0144] The AAV vector which harbors the nucleotide sequence of
interest bounded by AAV ITRs (ie., AAV vaccine vectors), can be
constructed by directly inserting selected sequences into an AAV
genome with the major AAV open reading frames ("ORFs") excised.
Other portions of the AAV genome can also be deleted, so long as a
sufficient portion of the ITRs remain to allow for replication and
packaging functions. These constructs can be designed using
techniques well known in the art (See e.g., U.S. Pat. Nos.
5,173,414 and 5,139,941; International Publication Nos. WO 92/01070
and WO 93/03769; Lebkowski et al., Mol. Cell. Biol., 8:3988-3996
[1988]; Vincent et al., Vaccines 90 (Cold Spring Harbor Laboratory
Press) [1990]; Carter, Curr. Opin. Biotechnol., 3:533-539 [1992];
Muzyczka, Curr. Top. Microbiol. Immunol., 158:97-129 [1992]; Kotin,
Human Gene Ther., 5:793-801 [1994]; Shelling and Smith, Gene Ther.,
1:165-169 [1994]; and Zhou et al. J. Exp. Med., 179:1867-1875
[1994]).
[0145] Alternatively, AAV ITRs can be excised from the viral genome
or from an AAV vector containing the same and fused 5' and 3' of a
selected nucleic acid construct that is present in another vector
using standard ligation techniques, such as those described in
Sambrook et al., supra. For example, ligations can be accomplished
in 20 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM DTT, 33 .mu.g/ml
BSA, 10 mM-50 mM NaCl, and either 40 .mu.M ATP, 0.01-0.02 (Weiss)
units T4 DNA ligase at 0.degree. C. (for "sticky end" ligation) or
1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14.degree. C. (for
"blunt end" ligation). Intermolecular "sticky end" ligations are
usually performed at 30-100 .mu.g/ml total DNA concentrations
(5-100 nM total end concentration). AAV vectors which contain ITRs
have been described in (e.g., U.S. Pat. No. 5,139,941, herein
incorporated by reference). In particular, several AAV vectors are
described therein which are available from the American Type
Culture Collection ("ATCC") under Accession Numbers 53222, 53223,
53224, 53225 and 53226.
[0146] Additionally, chimeric genes can be produced synthetically
to include AAV ITR sequences arranged 5' and 3' of a selected
nucleic acid sequence. The complete chimeric sequence is assembled
from overlapping oligonucleotides prepared by standard methods (See
e.g., Edge, Nature 292:756 [1981]; Nambair et al. Science 223:1299
[1984]; and Jay et al. J. Biol. Chem., 259:6311 [1984]).
II. rAAV Virions
[0147] In order to produce rAAV virions for use as immunogens or
antigens (ie., AAV vaccine preparations), an AAV vector constructed
as described above is introduced into a suitable host cell using
known techniques (e.g., transfection). A number of transfection
techniques are generally known in the art (See e.g., Graham et al.,
Virol., 52:456 [1973], Sambrook et al. supra, Davis et al., supra,
and Chu et al., Gene 13:197 [1981]). Particularly suitable
transfection methods include calcium phosphate co-precipitation
(Graham et al., Virol., 52:456-467 [1973]), direct micro-injection
into cultured cells (Capecchi, Cell 22:479-488 [1980]),
electroporation (Shigekawa et al., BioTechn., 6:742-751 [1988]),
liposome-mediated gene transfer (Mannino et al., BioTechn.,
6:682-690 [1988]), lipid-mediated transduction (Felgner et al.,
Proc. Natl. Acad. Sc. USA 84:7413-7417 [1987]), and nucleic acid
delivery using high-velocity microprojectiles (Klein et al., Nature
327:70-73 [1987]).
[0148] For the purposes of the invention, suitable host cells for
producing rAAV virions include microorganisms, yeast cells, insect
cells, and mammalian cells, that can be, or have been, used as
recipients of a heterologous DNA molecule. The term includes the
progeny of the original cell which has been transfected. Thus, as
indicated above, a "host cell" as used herein generally refers to a
cell which has been transfected with an exogenous DNA sequence.
Cells from the stable human cell line, 293 (ATCC Accession No.
CRL1573) are preferred in the practice of the present invention.
Particularly, the human cell line 293 is a human embryonic kidney
cell line that has been transformed with adenovirus type-5 DNA
fragments (Graham et al., J. Gen. Virol., 36:59 [1977]), and
expresses the adenoviral E1a and E1b genes (Aiello et al., Virol.,
94:460 [1979]). The 293 cell line is readily transfected, and
provides a particularly convenient platform in which to produce
rAAV virions.
[0149] Host cells containing the above-described AAV vectors must
be rendered capable of providing AAV helper functions in order to
replicate and encapsidate the nucleotide sequences flanked by the
AAV ITRs to produce rAAV virions. AAV helper functions are
generally AAV-derived coding sequences which can be expressed to
provide AAV gene products that, in turn, function in trans for
productive AAV replication. AAV helper functions are used herein to
complement necessary AAV functions that are missing from the AAV
vectors. Thus, AAV helper functions include one, or both of the
major AAV ORFs, namely the rep and cap coding regions, or
functional homologues thereof.
[0150] AAV helper functions are introduced into the host cell by
transfecting the host cell with an AAV helper construct either
prior to, or concurrently with, the transfection of the AAV vector.
AAV helper constructs are thus used to provide at least transient
expression of AAV rep and/or cap genes to complement missing AAV
functions that are necessary for productive AAV infection. AAV
helper constructs lack AAV ITRs and can neither replicate nor
package themselves.
[0151] These constructs can be in the form of a plasmid, phage,
transposon, cosmid, virus, or virion. A number of AAV helper
constructs have been described, such as the commonly used plasmids
pAAV/Ad and pIM29+45 which encode both Rep and Cap expression
products (See e.g., Samulski et al., J. Virol,. 63:3822-3828
[1989]; and McCarty et al., J. Virol., 65:2936-2945 [1991]). A
number of other vectors have been described which encode Rep and/or
Cap expression products (See e.g., U.S. Pat. No. 5,139,941, herein
incorporated by reference).
[0152] Both AAV vectors and AAV helper constructs can be
constructed to contain one or more optional selectable markers.
Suitable markers include genes which confer antibiotic resistance
or sensitivity to, impart color to, or change the antigenic
characteristics of those cells which have been transfected with a
nucleic acid construct containing the selectable marker when the
cells are grown in an appropriate selective medium. Several
selectable marker genes that are useful in the practice of the
invention include the gene encoding aminoglycoside
phosphotranferase (APH) that allows selection in mammalian cells by
conferring resistance to G418 (Sigma). Other suitable markers are
known to those of skill in the arL The host cell (or packaging
cell) must also be rendered capable of providing nonAAV derived
functions, or "accessory functions," in order to produce rAAV
virions. Accessory functions are nonAAV derived viral and/or
cellular functions upon which AAV is dependent for its replication.
Thus, accessory functions include at least those nonAAV proteins
and RNAs that are required in AAV replication, including those
involved in activation of AAV gene transcription, stage specific
AAV mRNA splicing, AAV DNA replication, synthesis of rep and cap
expression products and AAV capsid assembly. Viral-based accessory
functions can be derived from any of the known helper viruses.
[0153] Particularly, accessory functions can be introduced into and
then expressed in host cells using methods known to those of skill
in the art. Commonly, accessory functions are provided by infection
of the host cells with an unrelated helper virus. A number of
suitable helper viruses are known, including adenoviruses;
herpesviruses such as herpes simplex virus types 1 and 2; and
vaccinia viruses. Nonviral accessory functions will also find use
herein, such as those provided by cell synchronization using any of
various known agents (See e.g., Buller et al., J Virol., 40:241-247
[1981]; McPherson et al., Virol., 147:217-222 [1985]; and
Schlehofer et al., Virol., 152:110-117 [1986)).
[0154] Alternatively, accessory functions can be provided using an
accessory function vector. Accessory function vectors include
nucleotide sequences that provide one or more accessory functions.
An accessory function vector is capable of being introduced into a
suitable host cell in order to support efficient AAV virion
production in the host cell. Accessory function vectors can be in
the form of a plasmid, phage, virus, transposon or cosmid.
Accessory vectors can also be in the form of one or more linearized
DNA or RNA fragments which, when associated with the appropriate
control elements and enzymes, can be transcribed or expressed in a
host cell to provide accessory functions.
[0155] Nucleic acid sequences providing the accessory functions can
be obtained from natural sources, such as from the genome of
adenovirus, or constructed using recombinant or synthetic methods
known in the art. In this regard, adenovirus-derived accessory
functions have been widely studied, and a number of adenovirus
genes involved in accessory functions have been identified and
partially characterized (See e.g., Carter, "Adeno-Associated Virus
Helper Functions," in CRC Handbook of Parvoviruses, Vol. I (P.
Tijssen, ed.) [1990], and Muzyczka, Curr. Top. Microbiol. Immun.,
158:97-129 [1992]). Specifically, early adenoviral gene regions
E1a, E2a, E4, VAI RNA and, possibly, E1b are thought to participate
in the accessory process (Janik et al., Proc. Natl. Acad Sci. USA
78:1925-1929 [1981]). Herpesvirus-derived accessory functions have
been described (See e.g., Young et al., Prog. Med. Virol., 25:113
[1979]). Vaccinia virus-derived accessory functions have also been
described (See e.g., Carter, supra., and Schlehofer et al., Virol.,
152:110-117 [1986]).
[0156] As a consequence of the infection of the host cell with a
helper virus, or transfection of the host cell with an accessory
function vector, accessory functions are expressed which
transactivate the AAV helper construct to produce AAV Rep and/or
Cap proteins. The Rep expression products direct excision of the
recombinant DNA (including the DNA of interest) from the AAV
vector. The Rep proteins also serve to duplicate the AAV genome.
The expressed Cap proteins assemble into capsids, and the
recombinant AAV genome is packaged into the capsids. Thus,
productive AAV replication ensues, and the DNA is packaged into
rAAV virions.
[0157] Following recombinant AAV replication, rAAV virions can be
purified from the host cell using a variety of conventional
purification methods, such as CsCl gradients. Further, if helper
virus infection is employed to express the accessory functions,
residual helper virus can be inactivated, using known methods. For
example, adenovirus can be inactivated by heating to temperatures
of approximately 60.degree. C. for approximately 20 minutes or
more, as appropriate. This treatment selectively inactivates the
helper adenovirus which is heat labile, while preserving the rAAV
which is heat stable.
III. Pharmaceutical Compositions
[0158] The resulting rAAV virions are then ready for use in
pharmaceutical compositions which can be delivered to a subject to
immunize against the selected antigen or antigens, to desensitize
the subject against the selected antigen or allergen, or to elicit
a shift in the profile of an immune response (e.g., a switch from a
T.sub.H1-like response to a T.sub.H2-like response). Pharmaceutical
compositions comprise sufficient genetic material to produce a
therapeutically effective amount of the antigen to elicit an immune
response. The compositions may be administered alone or in
combination with at least one other agent, such as stabilizing
compound, which may be administered in any sterile, biocompatible
pharmaceutical carrier, including, but not limited to, saline,
buffered saline, dextrose, and water. The compositions may be
administered to a patient alone, or in combination with other
agents, drugs or hormones. In preferred embodiments, the
pharmaceutical compositions also contain a pharmaceutically
acceptable excipient. Such excipients include any pharmaceutical
agent that does not itself induce an immune response harmful to the
individual receiving the composition, and which may be administered
without undue toxicity. Pharmaceutically acceptable excipients
include, but are not limited to, liquids such as water, saline,
glycerol and ethanol. Pharmaceutically acceptable salts can be
included therein, for example, mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like;
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. Additionally, auxiliary
substances, such as wetting or emulsifying agents, pH buffering
substances, and the like, may be present in such vehicles. A
thorough discussion of pharmaceutically acceptable excipients is
available in Remington's Pharmaceutical Sciences (Mack Pub. Co.,
N.J. [1991]).
[0159] Vaccine compositions for oral administration can be
formulated using pharmaceutically acceptable carriers well known in
the art in dosages suitable for oral administration. Such carriers
enable the pharmaceutical compositions to be formulated as tablets,
pills, dragees, capsules, liquids, gels, syrups, slurries,
suspensions, and the like, for ingestion by the patient. Vaccine
preparations for oral use can be provided by preparing combination
of active compounds with solid excipient, optionally grinding a
resulting mixture, and processing the mixture of granules, after
adding suitable auxiliaries, if desired, to obtain tablets or
dragee cores. Suitable excipients are carbohydrate or protein
fillers, such as sugars, including lactose, sucrose, mannitol, or
sorbitol; starch from corn, wheat, rice, potato, or other plants;
cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose,
or sodium carboxymethylcellulose; gums including arabic and
tragacanth; and proteins such as gelatin and collagen. If desired,
disintegrating or solubilizing agents may be added, such as the
cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt
thereof, such as sodium alginate.
[0160] Dragee cores may be used in conjunction with suitable
coatings, such as concentrated sugar solutions, which may also
contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel,
polyethylene glycol, and/or titanium dioxide, lacquer solutions,
and suitable organic solvents or solvent mixtures. Dyestuffs or
pigments may be added to the tablets or dragee coatings for product
identification or to characterize the quantity of active compound
(ie., dosage).
[0161] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a coating, such as glycerol or sorbitol.
Push-fit capsules may contain active ingredients mixed with a
filler or binders, such as lactose or starches, lubricants, such as
talc or magnesium stearate, and, optionally, stabilizers. In soft
capsules, the active compounds may be dissolved or suspended in
suitable liquids, such as fatty oils, liquid, or liquid
polyethylene glycol with or without stabilizers.
[0162] Pharmaceutical formulations suitable for parenteral
administration may be formulated in aqueous solutions, preferably
in physiologically compatible buffers such as Hanks's solution,
Ringer's solution, or physiologically buffered saline. Aqueous
injection suspensions may contain substances which increase the
viscosity of the suspension, such as sodium carboxymethyl
cellulose, sorbitol, or dextran. Additionally, suspensions of the
active compounds may be prepared as appropriate oily injection
suspensions. Suitable lipophilic solvents or vehicles include fatty
oils such as sesame oil, or synthetic fatty acid esters, such as
ethyl oleate or triglycerides, or liposomes. Optionally, the
suspension may also contain suitable stabilizers or agents which
increase the solubility of the compounds to allow for the
preparation of highly concentrated solutions.
[0163] For topical or nasal administration, penetrants appropriate
to the particular barrier to be permeated are used in the
formulation. Such penetrants are generally known in the art.
[0164] The pharmaceutical compositions of the present invention may
be manufactured in a manner that is known in the art (e.g., by
means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping,
or lyophilizing processes).
[0165] The pharmaceutical composition may be provided as a salt and
can be formed with many acids, including but not limited to,
hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic,
etc. Salts tend to be more soluble in aqueous or other protonic
solvents than are the corresponding free base forms. In other
cases, the preferred preparation may be a lyophilized powder which
may contain any or all of the following: 1-50 mM histidine, 0.1%-2%
sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is
combined with buffer prior to use.
[0166] After pharmaceutical compositions have been prepared, they
can be placed in an appropriate container and labeled for treatment
of an indicated condition. For administration of AAV vaccine
preparations, such labeling would include amount, frequency, and
method of administration.
[0167] Pharmaceutical compositions suitable for use in the
invention include compositions wherein the active ingredients are
contained in an effective amount to achieve the intended purpose.
The determination of an effective dose is well within the
capability of those skilled in the art.
[0168] Appropriate doses will depend, among other factors, on the
mammal being immunized (e.g., human or nonhuman primate or other
mammal), age and general condition of the subject, the severity of
the disease or cancer being treated or prevented, and the selected
antigen employed and the mode of administration. In addition, the
goal of the immunization will dictate the amount, concentration and
frequency of the dose, for example wherein desensitization and/or a
shift in the type of immune response is desired. An appropriate
effective amount can be readily determined by one of skill in the
art.
[0169] Thus, a "therapeutically effective amount" will fall in a
relatively broad range that can be determined through clinical
trials. For example, in the case of in vivo transductions (i.e.,
injection directly into tissue), a therapeutically effective dose
will be on the order of from about 10.sup.3 to 10.sup.15 of the
rAAV virions. Other effective dosages can be readily established by
one of ordinary skill in the art through routine trials
establishing dose response curves.
[0170] It is intended that the dosage treatment and regimen used
with the present invention will vary, depending upon the subject
and vaccine preparation to be used. Thus, the dosage treatment may
be a single dose schedule or a multiple dose schedule. Moreover,
the subject may be administered as many doses as appropriate. One
of skill in the art can readily determine an appropriate number of
doses based on criteria including, but not limited to the patient's
age, immune status, the antigen(s) used in the vaccine, etc. A
multiple dose schedule is one in which a primary course of
vaccination may be with 1-10 separate doses, followed by other
doses given at subsequent time intervals, chosen to maintain and/or
reinforce the immune response. In one aspect of the invention,
vaccination is achieved using a single dose. The dosage regimen
will also, at least in part, be dependent on the judgment of the
ordinarily skilled practitioner. If prevention of disease is
desired, the vaccines are generally administered prior to primary
infection with the pathogen of interest or prior to onset of the
cancerous condition. If treatment is desired (e.g., the reduction
of symptoms or recurrences), the vaccines are generally
administered subsequent to primary infection or onset of the
cancerous condition.
[0171] Direct delivery of the pharmaceutical compositions in vivo
will generally be accomplished via injection using a conventional
syringe. In this regard, the compositions can be injected either
subcutaneously, epidermally, intradermally, intrathecally,
intraorbitally, intramucosally (e.g., nasally, rectally and
vaginally), intraperitoneally, intravenously, orally, or
intramuscularly. Other modes of administration include oral and
pulmonary administration, suppositories, and transdermal
applications.
[0172] One skilled in the art will recognize that the methods and
compostions described above are also applicable to a range of other
treatment regimens known in the art. For example, the methods and
compositions of the present invention are compatible with ex vivo
therapy (e.g., where cells are removed from the body, incubated
with the recombinant AAV vector, and the treated cells are returned
to the body).
Experimental
[0173] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0174] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
[0175] In the experimental disclosure which follows, the following
abbreviations apply: N (Normal); M (Molar); mM (millimolar); .mu.M
(micromolar); g (grams); mg (milligrams); .mu.g (micrograms); ng
(nanograms); 1 or L (liters); ml (milliliters); .mu.l
(microliters); cm (centimeters); mm (millimeters); .mu.m
(micrometers); nm (nanometers); .sup.51Cr (Chromium 51); .mu.Ci
(microcurie); .degree. C. (degrees Centigrade); pH (hydrogen ion
concentration); NaCl (sodium chloride); HCl (hydrochloric acid); OD
(optical density); bp (base pair(s)); ATP (adenosine
5'-triphosphate); PCR (polymerase chain reaction); DNA
(deoxyribonucleic acid); cDNA (complementary DNA); AAV
(adeno-associated virus); rAAV (recombinant adeno-associated
virus); CMV (cytomegalovirus); MHC (major histocompatibility
complex); ITR (inverted terminal repeat); .beta.-gal
(.beta.-galactosidase); FCS (fetal calf serum); CFA (complete
Freund's adjuvant); BSA (bovine albumin); ER (endoplasmic
reticulum); ATCC (American Type Culture Collection, Rockville,
Md.); Sigma (Sigma Aldrich, St Louis, Mo.); Zymed (Zymed
Laboratories, South San Francisco, Calif.); Gemini (Gemini
Bioproducts, Calabasas, Calif.); Biohittaker (BioWhittaker,
Walkersville, MC); DuPont (DuPont, Wilmington, Del.); and
Stratagene (Stratagene Cloning Systems, La Jolla, Calif.).
Vector Constructs, Encapsidation and Cell Lines:
[0176] The AAV-Ova vector was constructed by placing the 1.8 kb
HindIII-BamHI Ova cDNA fragment from the pBSOva19 plasmid (provided
by K. Rock, see, Rock, Immunol. Today 17: 131 [1995]) into the
HindIII-BglII site of the multiple cloning sequence of pV4.1cmod.
The pV4.1cmod plasmid was constructed as follows. pV4.1c is an
expression vector that contains the CMV immediate-early promoter, a
chimeric CMV-beta-globin intron, a polylinker, and the human growth
hormone polyadenylation sequence. The pV4.1c plasmid was
constructed using a synthetic DNA encoding the restriction sites
NotI-MluI-Ecl136II-SstI-SfuI-SmaI-SfuI-ClaI-BglII-SnaBI-BstEII-PmlI-RsrII-
-NotI, and having the following nucleotide sequence:
5'-CGGCCGCACGCGTGAGCTCCGCGGTTCGAATCCCGGGATTCGAACATC
GATAAAAGATCTACGTAGGTAACCACGTGCGGACCGAGCGGCCGC-3' (SEQ ID NO.: 1),
that was cloned into the blunted KasI and EarI(partial) sites of
pUC119 to provide a 2757 bp intermediate plasmid. A 653 bp
SpeI(blunted)-SacII(blunted) fragment encoding the CMV immediate
early (CMV-IE) promoter, and a 488 bp SmaI-DraIII fragment
containing the human growth hormone polyadenylation site, were
cloned into the Ecl136II and SnaBI sites of the intermediate
plasmid. A chimeric intron having the splice donor from the first
intron of the CMV-IE gene, and the splice acceptor from the second
intron of the human .beta.-globin gene, was then inserted into the
SmaI site of the plasmid in two steps. First, a DNA fragment
encoding the CMV-IE gene first intron splice donor was produced by
PCR using isolated CMV DNA (strain ad169) as template, and the
following primers: 5'-GGCCGGGAACGGTGCATT-3' (SEQ ID NO.: 2) and
5'-GGGCAAGGGGGTGGGCCTATA-3' (SEQ ID NO.: 3). The resulting 87 bp
fragment was ligated into the SmaI site of the intermediate
plasmid. The resulting construct was cleaved with BstXI and SmaI,
blunted with T4 DNA polymerase, and a 398 bp DraI-EcoRI(blunt)
fragment encoding the human .beta.-globin second intron splice
acceptor was ligated into the construct The pV4.1c plasmid was
completed by ligation of a synthetic polylinker encoding the
restriction sites:
ClaI-EcoRI-SmaI-BamHI-XbaI-SalI-PstI-HinDIII-XhoI-Eco47III-XhoI-BglII,
having the following nucleotide sequence:
5'-ATCGATTGAATTCCCCGGGGATCCTCTAGAGTCGACCTGCAGAAGCTTGC
TCTCGAGCAGCGCTGCTCGAGAGATCT-3' (SEQ ID NO.: 4), between the ClaI
and BglII sites of the intermediate plasmid.
[0177] Then, pUC119 was digested with AflIII and EheI,
dephosphorylated, and the resulting 2591 bp fragment containing the
coli 1 origin and the amp gene was isolated. This vector was
ligated to synthetic DNA encoding a single Sse8387 I site which is
comprised of the phosphorylated oligonucleotides PVMOD1
(5'-CCCCTGCAGGA-3', SEQ ID NO.: 5) and PVMOD2
(5'-CATGTCCTGCAGGGGC-3', SEQ ID NO.: 6). The resulting plasmid was
digested with Sse8387 I and dephosphorylated. Plasmid pV4.1c was
digested with Sse8387 I, and the 1767 bp ITR-bounded, CMV-driven
expression cassette was isolated and ligated to the above-described
vector to provide the pV4.1cmod construct This construct thus
contains the CMV promoter, followed by the CMV splice donor, the
human .beta.-globin splice acceptor, the multiple cloning site and
the human growth hormone polyadenylation signal, flanked by AAV
ITRs. A 624-bp blunt-ended HpaI noncoding sequence was then cloned
into the PmlI site as a spacer fragment (FIG. 1A). FIGS. 1A and 1B
provide a schematic illustration of the construction of the
recombinant AAV virions rAAV-Ova (containing the cDNA encoding
ovalbumin) and rAAV-LacZ (containing the cDNA encoding
.beta.-galactosidase from E. coli). In these Figures, "ITR"
indicates inverted terminal repeats; "CMV" indicates the CMV
promoter; "An" indicates human growth hormone polyadenylation
signal; and "O" indicates a noncoding 624 bp fragment from the lacZ
gene.
[0178] The AAV-lacZ vector contains the Escherichia coli
.beta.-galactosidase (.beta.-gal) gene under the transcriptional
control of the CMV immediate early promoter (FIG. 1B) as previously
described (See e.g., Kessler et al. (1996) Proc. Natl. Acad Sci.
USA 24:14082-14087). The human 293 cell line was cultured in
complete DMEM (BioWhittaker) containing 4.5 g/liter glucose, 10%
heat-inactivated fetal calf serum (FCS, Gemini), 2 mM glutamine, 50
units/ml penicillin, and 50 .mu.g/ml streptomycin. The cell lines,
M05 20.10 (B16 melanoma, stably transfected with the ovalbumin
gene; provided by K. Rock (See, Falo et al., Nature Medicine 1: 649
[1995]), B3Z, RMA-S, EL-4 and the ovalbumin-transfected cell line
EG.7 Ova (obtained from ATCC), were cultured in RPMI (BioWhittaker)
containing 10% heat-inactivated FCS, 2 mM glutamine, 50 units/ml
penicillin, 50 .mu.g/ml streptomycin, and 50 mM pyruvate.
[0179] The rAAV virions were produced in the 293 cells as
previously described. Kessler et al. (1996) Proc. Natl. Acad. Sci.
USA 24:14082-14087, Colosi et al. (1995) Blood 86 no. Suppl 1:627a
(Abstr.). Subconfluent 293 cells were co-transfected by calcium
phosphate precipitation with either the AAV-Ova or AAV-LacZ
expression vectors flanked by ITRs, an adenoviral helper vector,
and a helper vector supplying AAV Rep and Cap functions. After 72
hours of culture, pelleted cells were lysed in Tris buffer (10 mM
Tris/150 mM NaCl, pH 8.0) by three cycles of freeze-thaw. The
lysate was clarified of cell debris by centrifugation at
12,000.times.g, followed by cesium chloride isopyknic gradient
centrifugation. rAAV virions were extracted from the resulting
gradient by isolating the fractions with an average density of 1.38
g/ml, followed by resuspension in Hepes buffered saline containing
50 mM Hepes (pH 7.4) and 150 mM NaCl. Viral titer was determined by
quantitative dot-blot-hybridization of DNase-treated stocks and was
routinely in the range of 10.sup.12-10.sup.13 particles/ml, with
the particle-to-transduction unit (AAV-lacZ) ratio between 10.sup.2
and 10.sup.3.
EXAMPLE 1
Immunogenicity of rAAV Virions
[0180] The following studies were carried out to assess the
immunogenicity of rAAV virions. rAAV-Ova virions (FIG. 1A)
containing the ovalbumin gene under the control of the
cytomegalovirus (CMV) promoter were constructed (as described
above) and a single dose of 3.times.10.sup.11 viral particles was
administered by different routes to groups of C57BL/6 mice. Another
rAAV virion, rAAV-lacZ (FIG. 1B), served as a control.
[0181] A. Immunization of Mice: 6-to 8-week old female C57BL/6 mice
were used in these studies. Prior to intramuscular (IM)
administration of rAAV, the mice received methoxyflurane
anesthesia. The mice received 3.times.10.sup.11 rAAV particles by
injecting 50 .mu.l of Dulbecco's phosphate buffered saline (DPBS)
containing 1.5.times.10.sup.11 rAAV particles into the quadriceps
muscle of each leg using a 27 gauge needle and a syringe. Other
groups of mice were injected with 3.times.10.sup.11 rAAV either
subcutaneously (SC) at the base of the tail, intravenously (IV)
into the lateral tail vein, or intraperitoneally (IP). Control mice
received 100 .mu.l of a mixture containing equal volumes of
ovalbumin (2 mg/ml) in DPBS and complete Freund's adjuvant (CFA)
intraperitoneally.
[0182] B. ELISA: To analyze the humoral response induced by
rAAV-Ova, the sera of treated mice were obtained 14 or 28 days
after administration of rAAV-Ova and analyzed by ELISA for the
presence of antibodies to ovalbumin (FIG. 2A) or AAV-derived
proteins (FIG. 2B).
[0183] Immulon plates (96-well) were coated overnight at 4.degree.
C. with 50 .mu.l of either 15 .mu.g/ml ovalbumin (Grade VI, Sigma)
or 1.times.10.sup.10 rAAV-LacZ virions in 0.1 M
carbonate-bicarbonate buffer, pH 9.5. The plates were washed with
50 mM TRIS buffered saline, pH 8.0, 0.05% Teen 20 (TTBS, Sigma) and
blocked with 3% BSA in TTBS for 3 hours at room temperature. Mouse
sera were diluted with TTBS, added to the plates and incubated at
room temperature for 1 hour, after which a 1:5000 dilution of
horseradish peroxidase-conjugated rabbit anti-mouse IgG (Zymed) was
added. The plates were washed and developed with the substrate TMB
(Zymed). The reaction was stopped with 1N HCl and the OD was read
at 450 nm on microplate reader (DuPont).
[0184] The ELISA results are depicted in FIGS. 2A and 2B. In these
Figures, the results for C57BL/6 mice injected with
3.times.10.sup.11 rAAV-Ova virions intramuscularly (open squares),
subcutaneously (open diamonds), intraperitoneally (open circles) or
intravenously (open triangles) are indicated. The control groups
received either 3.times.10.sup.11 rAAV-lacZ virions subcutaneously
(solid diamonds) or 100 .mu.l of Ova/CFA intraperitoneally
(crosses). Day 28 sera were analyzed for the presence of antibodies
using either ovalbumin- (FIG. 2A) or rAAV-LacZ-coated (FIG. 2B)
ELISA plates. The results represent the means of sera from 3 mice
per group. Although none of the rAAV-Ova treated groups had
detectable anti-ovalbumin antibodies at day 14, by day 28 such
antibodies were clearly demonstrated, regardless of the route of
virus administration (FIG. 2A). Interestingly, all of the mice
which received rAAV virions developed a humoral response to viral
proteins, by day 14 (FIG. 2B).
[0185] C. Assay for CTL: To assess the ability of rAAV-Ova to
elicit a CTL response, recipient spleen (and in the case of SC
administration, draining lymph node) cells were harvested 14 days
after administration of the rAAV virions and restimulated, in
vitro, with EG.7 Ova cells. More particularly, single cell
suspensions from three mice per group were pooled and the
lymphocytes were separated by density gradient centrifugation using
Lympholyte-M (Accurate Chemical). To expand CTLs, 5.times.10.sup.6
cells/ml were cultured with 5.times.10.sup.5 irradiated (6000 rad)
EG.7 Ova cells for 7 days in 24 well-plates, containing RPMI medium
supplemented with 10% FCS, 50 units/ml penicillin, 50 .mu.g/ml
streptomycin, sodium pyruvate, MEM non-essential amino acids, 50
.mu.M 2-ME, and 5 units/ml rhIL-2.
[0186] CTL activity was determined in a .sup.51Cr-release assay. In
particular, on day 7, EL-4 cells of EG.7 Ova cells were labeled
with 100 .mu.Ci .sup.51Cr for 1 hour at 37.degree. C. and used as
target cells with E:T ratios of between 100:1 and 12:1. After 4
hours at 37.degree. C., supernatants were harvested with Optiphase
scintillation fluid (Wallac Oy) and counted in a Microbeta
scintillation counter (Wallac). Percent specific lysis was
determined by the formula: 100.times.experimental
release-spontaneous release maximum release-spontaneous release
Maximum release was determined by lysis of the target cells in PBS
containing 0.5% Triton-X-100. Spontaneous release was always less
than 10% maximum release.
[0187] FIG. 3 shows that lymphocyte preparations from recipients of
rAAV-Ova, but not rAAV-lacZ, contained CTL that lyse EG.7 Ova cells
in a dose dependent manner. EL-4 cells, which do not express
ovalbumin, but are otherwise identical to EG.7 Ova cells, were not
lysed by these CTLs. The results for cytolytic activity against
.sup.51Cr-labeled EL-4 (open squares) or EG.7 Ova (solid squares)
are indicated in this Figure. The results for various routes of
administration are shown in this Figure, with the results for rAAV
particles administered subcutaneously shown in FIG. 3, Panels A and
E, the results for intraperitoneally administered rAAV particles
shown in FIG. 3, Panel B, the results for intravenously
administered rAAV particles shown in FIG. 3, Panel C, and the
results for intramuscularly administered rAAV particles shown in
FIG. 3, Panel D. The data shown are from single experiment which is
representative of three experiments conducted with similar
results.
[0188] As the results indicate, although all routes of
administration led to the induction of ovalbumin-specific CTL, the
intramuscular (IM) route was the least efficient. In other studies,
ovalbumin-specific CTLs were also obtained from mice 6 weeks after
a single administration of rAAV-Ova, although again the IM route
was the least efficient.
EXAMPLE 2
In Vivo Protection Study
[0189] To determine if rAAV virions can be used to elicit
protective anti-tumor immunity, a tumor model based on the
ovalbumin-transfected murine melanoma cell line B16 (MO5 20.10) was
used, which expresses a H-2K.sup.b-restricted ovalbumin specific
CTL epitope (Falo el al. (1995) Nat. Med., 1:649-653; Condon (1996)
Nat. Med., 2:1122-1128).
[0190] C57BL/6 (n=5) mice were injected once with either
3.times.10.sup.11 rAAV-Ova virions, 3.times.10.sup.11 rAAV-lacZ
virions, or DPBS intraperitoneally on day 0. After 14 days, mice
were challenged subcutaneously with 1.times.10.sup.5 M05 20.10
cells in the left flank, after which they were monitored daily for
the appearance of tumors at the injection site. Tumors >3 mm in
diameter were scored positive. Mice with tumors >2 cm in
diameter were sacrificed. TABLE-US-00001 TABLE I Development of
Protective Anti-Tumor Immunity Following a Single Injection of
AAV-Ova in C57BL/6 mice Immunization* No. of Tumor-Bearing Mice
DPBS 5/5 AAV-lacZ 4/5 AAV-Ova 1/5 *C57BL/6 mice were injected
intraperitoneally with 3 .times. 10.sup.11 rAAV particles and 14
days later challenged subcutaneously with 1 .times. 10.sup.5 MO5
20.10 cells in the left flank. After tumor challenge, mice were
monitored daily. Tumors > 3 mm in diameter were scored positive.
Mice with tumors > 2 cm in diameter were sacrificed.
[0191] As shown in Table 1, 100% (5 of 5) mice injected with
phosphate buffered saline (DPBS) and 4 of 5 mice injected with
rAAV-lacZ developed easily visible tumors within 12 days of tumor
challenge. By contrast, only one 1 of 5 mice injected with rAAV-Ova
developed a tumor, which delayed in appearance by comparison to the
other experimental groups.
EXAMPLE 3
Ability of rAAV-Ova to Deliver Transgene Product into the MHC Class
I Pathway
[0192] Peptides presented in the context of MHC Class I are usually
derived from proteins which are expressed endogenously in the cell.
Virus-encoded proteins expressed by the cell are typically
processed in the cytosol, transported into the ER and presented on
the cell surface in association with MHC Class I determinants
(Monaco, J. (1992) Immunol. Today 13:173-178; Rock, K. (1995)
Immunol. Today 17:131-137). To investigate if rAAV-Ova delivers the
transgene product into the class I pathway, irradiated EL-4 cells
were co-cultured for 18-24 hours with various doses of rAAV virions
(rAAV-Ova or rAAV-lacZ), after which they were tested for the
ability to stimulate IL-2 secretion of an MHC class I restricted
CD8.sup.+ T cell hybridoma B3Z (Karttunen et al. (1992) Proc. Natl.
Acad Sci. USA 89:6020-6024), specific for residues 257-264 of
ovalburnin.
[0193] CTL Proliferation Assay: Stimulation of the CD8.sup.+ T cell
hybridoma (B3Z,H-2K.sup.b) was measured by incubating the hybridoma
(5.times.10.sup.5) with variable numbers of histocompatible EL-4
cells (C57BL/6, H-2K.sup.b, thymoma), which had been contacted for
18 to 24 hours with rAAV-Ova or rAAV-lacZ virions. IL-2
concentration in supernatants (50 .mu.l) taken after 24 hours was
measured as previously described using the IL-2 dependent cell
line, HT-2 (Kim et al., J. Immunol., 156:2737-2742 [1996]) which
had been pulsed with 1 .mu.Ci of [.sup.3H]-thymidine for 4 hours.
Incorporation of [.sup.3H]-thymidine was determined in a Microbeta
scintillation counter (Wallac).
[0194] The results from these experiments are shown in FIG. 4. FIG.
4A, shows the results for the H-2K.sup.b T cell line, EL-4
(irradiated at 3000 rad) incubated overnight with either: 10.sup.9
(solid squares), 10.sup.10 (solid circles) or 10.sup.11 (solid
triangles) rAAV-Ova virions; the immunodominant K.sup.b-restricted
ovalbumin peptide SIINFEKL (residues 257-264) (open circles); or
1.times.10.sup.11 rAAV-lacZ virions (open squares). These cells
were washed and various numbers incubated with 50,000 cells of the
CD8.sup.+ ovalbumin-specific T cell hybridoma, B3Z, for 24 hours
and the amount of IL-2 secreted was determined by
[.sup.3H]-thymidine incorporation by HT-2 cells.
[0195] FIG. 4B shows the results of experiments in which a MHC
class I-restricted, ovalbumin-specific CTL line was used to
evaluate the susceptibility to lysis of rAAV-transduced target
cells in a .sup.51Cr release assay. In this Figure, the results are
shown for irradiated EL-4 cells transduced either with rAAV-Ova
(solid circles) or rAAV-lacZ (open circles) overnight and used as
target cells. In FIG. 4C, results are shown for the TAP-2 deficient
cell line RMA-S (irradiated at 3000 rad) incubated overnight with
either: 10.sup.11 rAAV-Ova virions (solid triangles); the
immunodominant K.sup.b restricted ovalbumin peptide SIINFEKL
(residues 257-264) (open circles); or 1.times.10.sup.11 rAAV-lacZ
virions (open squares). The secreted IL-2 was determined as
previously described.
[0196] As seen in FIG. 4A, EL-4 cells receiving rAAV-Ova, but not
rAAV-lacZ, stimulated the ovalbumin-specific T cell hybridoma in a
dose dependent manner. Further, use of a higher number of
transducing particles led to an increased stimulation of the T cell
hybridoma. EL-4 cells transduced with rAAV-Ova were also
susceptible to lysis by an ovalbumin-specific, Class I MHC
restricted CTL line (FIG. 4B). The level of killing of these
targets was comparable to that of EG.7 Ova cells, which are stably
transfected with the ovalbumin gene.
[0197] To confirm that cytosolic degradation of the transgene
product is required for loading of MHC class I molecules in rAAV
infected cells, TAP-2 deficient RMA-S cells (Attaya et al. (1992)
Nature 355:647-649) were infected with rAAV-Ova for 18 hours and
the ability of these cells to present ova-derived peptides was
analyzed in the hybridoma assay (FIG. 4C). Although expression of
ovalbumin in the transduced RMA-S cells was confirmed by
immunoblot, no stimulation of the B3Z cell line could be detected,
presumably due to the inability of the cell line to transport
peptides from the cytosol into the ER By contrast, peptide-pulsed
RMA-S cells were perfectly capable of stimulating the ova-specific
hybridoma (FIG. 4C).
[0198] Thus, the present invention clearly provides novel methods
for eliciting an immune response in a vertebrate subject using AAV
vectors, as well as methods of making and using AAV vectors, and
recombinant AAV virions.
[0199] All publications and patents mentioned in the above
specification are herein incorporated by reference. Various
modifications and variations of the described method and system of
the invention will be apparent to those skilled in the art without
departing from the scope and spirit of the invention. Although the
invention has been described in connection with specific preferred
embodiments, it should be understood that the invention as claimed
should not be unduly limited to such specific embodiments. Indeed,
various modifications of the described modes for carrying out the
invention which are obvious to those skilled in molecular biology,
vaccine design, or related fields are intended to be within the
scope of the following claims.
Sequence CWU 1
1
6 1 94 DNA Artificial Sequence Description of Artificial Sequence
Synthetic 1 gcggccgcac gcgtgagctc cgcggttcga atcccgggat tcgaacatcg
ataaaagatc 60 tacgtaggta accacgtgcg gaccgagcgg ccgc 94 2 18 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 2
ggccgggaac ggtgcatt 18 3 21 DNA Artificial Sequence Description of
Artificial Sequence Synthetic 3 gggcaagggg gtgggcctat a 21 4 77 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 4
atcgattgaa ttccccgggg atcctctaga gtcgacctgc agaagcttgc tctcgagcag
60 cgctgctcga gagatct 77 5 12 DNA Artificial Sequence Description
of Artificial Sequence Synthetic 5 gcccctgcag ga 12 6 16 DNA
Artificial Sequence Description of Artificial Sequence Synthetic 6
catgtcctgc aggggc 16
* * * * *