U.S. patent application number 11/130922 was filed with the patent office on 2006-09-21 for use of phenylmethimazoles, methimazole derivatives, and tautomeric cyclic thiones for the treatment of autoimmune/inflammatory diseases associated with toll-like receptor overexpression.
Invention is credited to Uruguaysito Benavides-Peralta, Cesidio Giuliani, Douglas J. Goetz, Mariana Gonzalez-Murguiondo, Norikazu Harii, Leonard D. Kohn, Christopher J. Lewis, Ramiro Malgor, Giorgio Napolitano.
Application Number | 20060211752 11/130922 |
Document ID | / |
Family ID | 36923891 |
Filed Date | 2006-09-21 |
United States Patent
Application |
20060211752 |
Kind Code |
A1 |
Kohn; Leonard D. ; et
al. |
September 21, 2006 |
Use of phenylmethimazoles, methimazole derivatives, and tautomeric
cyclic thiones for the treatment of autoimmune/inflammatory
diseases associated with toll-like receptor overexpression
Abstract
The present invention relates to the treatment of autoimmune
and/or inflammatory diseases associated with overexpression of
Toll-like receptor 3 (TLR3) as well as Toll-like receptor 4 (TLR4)
and/or TLR3/TLR4 signaling in nonimmune cells, monocytes,
macrophages, and/or dendritic cells in association with related
pathologies. This invention also relates to the use of
phenylmethimazoles, methimazole derivatives, and tautomeric cyclic
thiones for the treatment of autoimmune and inflammatory diseases
associated with Toll-like receptor 3 (TLR3) as well as Toll-like
receptor 4 (TLR4) and/or TLR3/TLR4 signaling in nonimmune cells,
monocytes, macrophages, and/or dendritic cells in association with
related pathologies. This invention also relates to treating a
subject having a disease or condition associated with abnormal
Toll-like receptor 3 as well as Toll-like receptor 4 and/or
TLR3/TLR4 signaling in nonimmune cells, monocytes, macrophages,
and/or dendritic cells in association with related pathologies. The
present invention also relates to the treatment of
autoimmune-inflammatory pathologies and chemokine and
cytokine-mediated diseases associated with TLR overexpression and
signaling. This invention also relates to pharmaceutical
formulations capable of inhibiting the IRF-3/Type 1
IFN/STAT/ISRE/IRF-1 pathway associated with Toll-like receptor
overexpression or signaling.
Inventors: |
Kohn; Leonard D.; (Athens,
OH) ; Harii; Norikazu; (Yaminashi, JP) ;
Benavides-Peralta; Uruguaysito; (Montevideo, UY) ;
Gonzalez-Murguiondo; Mariana; (Montevideo, UY) ;
Lewis; Christopher J.; (Athens, OH) ; Napolitano;
Giorgio; (Pescara, IT) ; Giuliani; Cesidio;
(Roccamonce, IT) ; Malgor; Ramiro; (Athens,
OH) ; Goetz; Douglas J.; (Athens, OH) |
Correspondence
Address: |
FROST BROWN TODD, LLC
2200 PNC CENTER
201 E. FIFTH STREET
CINCINNATI
OH
45202
US
|
Family ID: |
36923891 |
Appl. No.: |
11/130922 |
Filed: |
May 17, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10912948 |
Aug 6, 2004 |
|
|
|
11130922 |
May 17, 2005 |
|
|
|
10801986 |
Mar 16, 2004 |
|
|
|
11130922 |
May 17, 2005 |
|
|
|
Current U.S.
Class: |
514/389 |
Current CPC
Class: |
A61P 21/04 20180101;
A61P 31/06 20180101; A61P 31/22 20180101; Y02A 50/411 20180101;
A61P 29/00 20180101; A61P 9/00 20180101; A61P 11/06 20180101; A61P
19/02 20180101; A61K 31/4164 20130101; A61P 43/00 20180101; A61K
45/06 20130101; A61P 17/00 20180101; A61P 37/02 20180101; A61P 9/12
20180101; A61P 25/08 20180101; A61P 31/00 20180101; A61P 3/10
20180101; A61P 7/02 20180101; A61P 35/00 20180101; A61P 31/18
20180101; A61P 1/04 20180101; A61P 37/08 20180101; A61P 5/14
20180101; A61P 21/00 20180101; A61P 9/14 20180101; A61P 33/00
20180101; A61P 1/02 20180101; A61P 31/14 20180101; A61P 19/10
20180101; A61P 31/10 20180101; A61P 17/06 20180101; A61P 3/06
20180101; A61P 1/16 20180101; A61P 25/00 20180101; A61P 7/00
20180101; A61P 31/04 20180101; A61K 31/4166 20130101; A61P 31/16
20180101; A61P 35/02 20180101; A61P 17/04 20180101; A61P 9/10
20180101; A61P 19/04 20180101; A61P 33/06 20180101; A61P 25/28
20180101; A61K 31/56 20130101; A61P 37/06 20180101; A61P 11/00
20180101; A61P 31/12 20180101; A61P 17/02 20180101; A61P 27/16
20180101; A61P 27/02 20180101 |
Class at
Publication: |
514/389 |
International
Class: |
A61K 31/4166 20060101
A61K031/4166 |
Claims
1-138. (canceled)
139. A method of treating a TLR-mediated disease or disorder in a
subject in need thereof comprising administering to the subject a
therapeutically effective amount of one or more methimazole
derivatives and/or cyclic thione derivatives.
140. The method of claim 139 wherein the methimazole derivatives
and/or cyclic thione derivatives are selected from the group
consisting of tautomeric methimazole derivatives, non-tautomeric
methimazole derivatives, and non-tautomeric cyclic thione
derivatives, and combinations thereof.
141. The method according to claim 140, wherein the TLR-mediated
disease involves cells selected from the group consisting of
nonimmune cells, monocytes, macrophages, and dendritic cells.
142. The method according to claim 141, wherein the disease is a
TLR-mediated autoimmune/inflammatory disease or disorder.
143. The method according to claim 142, TLR-mediated
autoimmune/inflammatory disease or disorder involves TLR-3 or
TLR-4.
144. The method according to claim 143, wherein the disease or
disorder is a TLR-mediated autoimmune/inflammatory disease or
disorder associated with immune cell infiltration and destruction
of the nonimmune cells.
145. The method according to claim 144, wherein the disease or
disorder is a TLR-mediated disease or disorder involving a
pathologic innate immune response.
146. The method according to claim 145, wherein the disease or
disorder is a pathological condition resulting from abnormal cell
proliferation; transplantation rejections, autoimmune,
inflammatory, proliferative, hyperproliferative, or cardiovascular
diseases.
147. The method according to claim 146, wherein the disease or
disorder is a cardiovascular disease.
148. The method according to claim 147, wherein the cardiovascular
disease or disorder is restenosis, coronary artery disease,
atherosclerosis, atherogenesis, cerebrovascular diseases or events,
coronary events, angina, ischemic disease, congestive heart
failure, pulmonary edema associated with acute myocardial
infarction, thrombosis, high or elevated blood pressure in
hypertension, platelet aggregation, platelet adhesion, smooth
muscle cell proliferation, a vascular or non-vascular complication
associated with the use of a medical device, a wound associated
with the use of a medical device, vascular or non-vascular wall
damage, peripheral vascular disease or neoinitimal hyperplasia
following percutaneous transluminal coronary angiograph.
149. The method according to claim 147, wherein the disease or
disorder is a cerebrovascular disease or event.
150. The method according to claim 149, wherein the cerebrovascular
disease or event is a cerebral infarction or stroke (caused by
vessel blockage or hemorrhage), or transient ischemia attack (TIA),
syncope, or atherosclerosis of the intracranial and/or extracranial
arteries, and the like.
151. The method according to claim 147, wherein the cardiovascular
disease or disorder is a myocardial infarction, myocardial
revascularization procedures, angina, cardiovascular death or acute
coronary syndrome.
152. The method according to claim 139, wherein the TLR-mediated
disease or disorder is selected from the group consisting of septic
shock, sepsis, endotoxic shock, hemodynamic shock and sepsis
syndrome, post ischemic reperfusion injury, malaria, mycobacterial
infection, meningitis, psoriasis, congestive heart failure,
fibrotic disease, cachexia, graft rejection, cancer, autoimmune
disease, opportunistic infections in AIDS, rheumatoid arthritis,
rheumatoid spondylitis, osteoarthritis, other arthritic conditions,
Crohn's disease, ulcerative colitis, multiple sclerosis, systemic
lupus erythrematosis, ENL in leprosy, radiation damage, asthma, and
hyperoxic alveolar injury.
153. A method of ameliorating one or more symptoms of
atherosclerosis in a subject, comprising administering to the
subject a methimazole derivative and/or cyclic thione derivative
selected from the group consisting of tautomeric methimazole
derivatives, non-tautomeric methimazole derivatives, and
non-tautomeric cyclic thione derivatives, and combinations thereof,
in an amount sufficient to ameliorate one or more symptoms of
atherosclerosis.
154. The method according to claim 139, wherein the atherosclerotic
disease has inflammatory and immunological properties.
155. The method according to claim 154, wherein the inflammatory
and immunological properties are associated with expression of an
innate immune response.
156. A method of ameliorating one or more symptoms of myocardial
disease in a subject, the method comprising administering to the
subject a methimazole derivative and/or cyclic thione derivative
selected from the group consisting of tautomeric methimazole
derivatives, non-tautomeric methimazole derivatives, and
non-tautomeric cyclic thione derivatives, and combinations thereof,
in an amount sufficient to ameliorate one or more symptoms of
myocardial diseases.
157. The method according to claim 156, wherein the myocardial
disease has inflammatory and immunological properties.
158. The method according to claim 157, wherein the inflammatory
and immunological properties are associated with expression of an
innate immune response.
159. The method according to claim 158, wherein the myocardial
disease is coronary heart disease, reversible or irreversible
myocardial ischemialreperfusion damage, acute or chronic heart
failure and restenosis.
160. A method of mitigating or preventing a coronary complication
associated with an acute phase response to an inflammation in a
subject, wherein the coronary complication is a symptom of
atherosclerosis, the method comprising administering to a subject
having the acute phase response, or at risk for the acute phase
response, a methimazole derivative and/or cyclic thione derivative
selected from the group consisting of tautomeric methimazole
derivatives, non-tautomeric methimazole derivatives, and
non-tautomeric cyclic thione derivatives, and combinations thereof,
in an amount sufficient to mitigate or prevent the coronary
complication.
161. The method according to claim 157, wherein the method
comprises mitigating or preventing an acute phase response.
162. The method according to claim 161, wherein the acute phase
response is an inflammatory response associated with a recurrent
inflammatory disease.
163. The method according to claim 161, wherein the acute phase
response is an inflammatory response associated with a recurrent
inflammatory disease and an innate immune response.
164. The method according to claim 161, wherein the acute phase
response is associated with a disease selected from the group
consisting of leprosy, tuberculosis, systemic lupus erythematosus,
polymyalgia rheumatica, polyarteritis nodosa, scleroderma,
idiopathic pulmonary fibrosis, chronic obstructive pulmonary
disease, Alzheimer's Disease AIDS, coronary calcification, calcific
aortic stenosis, osteoporosis, and rheumatoid arthritis.
165. The method according to claim 161, wherein the acute phase
response is an inflammatory response associated with a condition
selected from the group consisting of a bacterial infection, a
viral infection, a fimgal infection, an organ transplant, a wound,
an implanted prosthesis, parasitic infection, sepsis, endotoxic
shock syndrome, and biofilm formation.
166. A method of ameliorating one or more symptoms of a TLR3 or
TLR4-mediated autoimmune/inflammatory disease or disorder
associated with immune cell infiltration and destruction of the
nonimmune cells in a subject in need thereof, the method comprising
administering to the subject a methimazole derivative and/or cyclic
thione derivative selected from the group consisting of tautomeric
methimazole derivatives, non-tautomeric methimazole derivatives,
and non-tautomeric cyclic thione derivatives, and combinations
thereof, in an amount sufficient to ameliorate one or more symptoms
of TLR-mediated autoimmune/inflammatory disease or disorder
associated with immune cell infiltration and destruction of the
nonimmune cells.
167. The method according to claim 166, wherein the TLR-mediated
autoimmune/inflammatory disease or disorder is an acute
inflammatory disease selected from the group consisting of: (a)
endotoxemia; (b) septicemia; (c) toxic shock syndrome; and (d)
infectious disease.
168. The method according to claim 167, wherein the TLR-mediated
autoimmune/inflammatory disease or disorder is TLR-4 mediated.
169. The method according to claim 167, wherein the TLR-mediated
autoimmune/inflammatory disease or disorder is selected from septic
shock of whatever type, etiology, or pathogenesis; or septic shock
that is a member selected from the group consisting of renal
failure; acute renal failure; cachexia; malarial cachexia;
hypophysial cachexia; uremic cachexia; cardiac cachexia; cachexia
suprarenalis or Addison's disease; cancerous cachexia; and cachexia
as a consequence of infection by the human immunodeficiency virus
(HIV).
170. The method according to claim 167, wherein the TLR-mediated
autoimmune/inflammatory disease or disorder is endotoxic shock.
171. The method according to claim 170, wherein endotoxic shock is
induced by gram-negative bacteria.
172. The method according to claim 170, wherein the endotoxic shock
is induced by gram-positive bacteria.
173. The method according to claim 170, wherein the septic shock is
LPS-induced shock.
174. The method according to claim 170, the method further
comprises administering an antibiotic to the subject.
175. A method of treating a TLR3 or TLR4-mediated pathological
condition resulting from or in abnormal cell proliferation, a
transplant rejection, an autoimmune, inflammatory, proliferative,
hyperproliferative or vascular disease, for reducing scar tissue or
for inhibiting wound contraction in a subject in need thereof, the
method comprising administering a therapeutically effective amount
of a methimazole derivative and/or cyclic thione derivative
selected from the group consisting of tautomeric methimazole
derivatives, non-tautomeric methimazole derivatives, and
non-tautomeric cyclic thione derivatives, and combinations thereof,
to a subject in need of such therapy.
176. The method according to claim 175, wherein the pathological
condition resulting from abnormal cell proliferation is a cancer, a
Karposi's sarcoma, a cholangiocarcinoma, a choriocarcinoma, a
neoblastoma, a Wilm's tumor, Hodgkin's disease, a melanoma,
multiple myelomas, a chronic lymphocytic leukemia or an acute or
chronic granulocytic lymphoma.
177. The method according to claim 175, wherein the autoimmune,
inflammatory, proliferative, hyperproliferative or vascular disease
is selected from the group consisting of rheumatoid arthritis,
restenosis, lupus erythematosus, systemic lupus erythematosus,
Hashimoto's thyroiditis, myasthenia gravis, diabetes mellitus,
uveitis, nephritic syndrome, multiple sclerosis, an inflammatory
skin disease, an inflammatory lung disease, an inflammatory bowel
disease, an inflammatory disease that affects or causes obstruction
of a body passageway, an inflammation of the eye, nose or throat, a
fungal infection and a food related allergy.
178. A method of ameliorating one or more symptoms of a
TLR3-mediated pathological condition resulting from an allergen in
a subject in need thereof, the method comprising administering to
the subject a methimazole derivative and/or tautomeric cyclic
thione in an amount sufficient to ameliorate one or more symptoms
resulting from an allergen.
179. A method of ameliorating one or more symptoms of a
TLR3-mediated pathological condition resulting from an allergy in a
subject in need thereof, the method comprising administering to the
subject a methimazole derivative and/or cyclic thione derivative
selected from the group consisting of tautomeric methimazole
derivatives, non-tautomeric methimazole derivatives, and
non-tautomeric cyclic thione derivatives, and combinations thereof,
in an amount sufficient to ameliorate one or more symptoms
resulting from an allergy.
180. The method according to claim 140, wherein the TLR-mediated
disease is a TLR3 or TLR4-mediated disease, disorder or condition
caused by one or more conditions selected from the group consisting
of asthma, chronic bronchoconstriction, acute bronchoconstriction,
bronchitis, small airways obstruction, emphysema, obstructive
airways disease, inflammatory airways disease, acute lung injury or
bronchiectasis.
181. The method according to claim 180, wherein the asthma is
atopic asthma; non-atopic asthma; allergic asthma; atopic bronchial
IgE-mediated asthma; bronchial asthma; essential asthma; true
asthma; intrinsic asthma caused by pathophysiologic disturbances;
extrinsic asthma caused by environmental factors; essential asthma
of unknown or unapparent cause; bronchitic asthma; emphysematous
asthma; exercise-induced asthma; allergen induced asthma; cold air
induced asthma; occupational asthma; infective asthma caused by
bacterial, fingal, protozoal or viral infection; non-allergic
asthma; incipient asthma; wheezy infant syndrome; and
bronchiolytis.
182. The method according to claim 140, wherein the TLR-mediated
disease is a TLR3-mediated pathological condition results from an
obstructive airways disease or inflammatory airways disease.
183. The method according to claim 182, wherein the obstructive
airways disease or inflammatory airways disease is selected from
the group consisting of chronic eosinophilic pneumonia, chronic
obstructive pulmonary disease (COPD), COPD that includes chronic
bronchitis, pulmonary emphysema or dyspnea associated or not
associated with COPD, COPD that is characterized by irreversible,
progressive airways obstruction, adult respiratory distress
syndrome (ARDS), exacerbation of airways hyper-reactivity
consequent to other drug therapy or airways disease that is
associated with pulmonary hypertension.
184. The method according to claim 183, wherein the obstructive
airways disease or inflammatory airways disease is bronchitis.
185. The method according to claim 184, wherein the bronchitis is
chronic bronchitis, acute bronchitis, acute laryngotracheal
bronchitis, arachidic bronchitis, catarrhal bronchitis, croupus
bronchitis, dry bronchitis, infectious asthmatic bronchitis,
productive bronchitis, staphylococcus bronchitis, streptococcal
bronchitis or vesicular bronchitis.
186. The method according to claim 180, wherein the bronchiectasis
is cylindric bronchiectasis, sacculated bronchiectasis, fusiform
bronchiectasis, capillary bronchiectasis, cystic bronchiectasis,
dry bronchiectasis or follicular bronchiectasis.
187. The method according to claim 175, wherein the autoimmune or
inflammatory disease associated with Toll-like receptor 3 or 4
overexpression results from other inflammation inducing conditions
that may be treated to ameliorate symptoms associated with
inflammation or to diminish the existing inflammation.
188. The method according to claim 187, wherein the other
inflammation or irritation associated therewith is selected from
the group consisting of insect bites or stings, contact with a
particular type plant, radiation, non-infectious conjunctivitis,
hemorrhoids, abrasions, ingrown finger or toenail (granulation),
skin graft donor sites, vaginitis, psoriasis, herpes simplex,
pruritis ani/cruri, chemical inflammation.
189. The method according to claim 175, wherein the autoimmune or
inflammatory disease associated with Toll-like receptor 3 or 4
overexpression results from other inflammation inducing conditions
that may be treated to ameliorate symptoms associated with
inflammation or to diminish the existing inflammation wherein the
inflammation is the result of extraneously induced damage to cells
or tissue.
190. The method according to claim 189, wherein the other
inflammation or irritation is a chemical and/or physical influence
upon the skin or mucus membranes of the subject.
191. The method according to claim 189, wherein the other
inflammation or irritation associated therewith is induced by
microorganisms acting on the skin or body.
192. The method according to claim 191, wherein the inflammatory
responses that may be ameliorated is on the skin or a mucus
membrane of a subject and is selected from the group consisting of
inflammation around erupting wisdom teeth, following extraction of
teeth, periodontal abscesses, prosthesis induced pressure sores on
the mucosa, fimgal infections, for treating exposed bone surface in
alveolitis sicca dolorosa, which is a painful condition which may
arise following extraction of teeth, chronic and acute inflammatory
diseases, pancreatitis, rheumatoid arthritis, osteoarthritis,
asthma, inflammatory bowel disease, psoriasis and in certain
neurological disorders such as Alzheimer's disease.
193. The method according to claim 191, wherein the other
inflammation or irritation associated therewith is induced by
environmental factors selected from the group consisting of sun or
wind exposure, trauma or wounds, cuts, bums or abrasions, exposure
to chemicals such as alkaline soaps, detergents, liquid solvents,
oils, preservatives, and disease.
194. A method of ameliorating one or more symptoms of a TLR3- or
TLR4-linked disease resulting from pathogen or pathogen molecular
signals in a subject in need thereof, the method comprising
administering to the subject a methimazole derivative and/or cyclic
thione derivative selected from the group consisting of tautomeric
methimazole derivatives, non-tautomeric methimazole derivatives,
and non-tautomeric cyclic thione derivatives, and combinations
thereof, in an amount sufficient to ameliorate one or more symptoms
resulting from pathogen or pathogen molecular signals by inhibiting
the increased IMF-3 signal pathway, but not the NF-kappa B signal
pathway.
195. The method according to claim 194, wherein the pathogen
related agent or product is a virus, bacteria, dsRNA, Type 1 IFN,
or environmental induction event.
196. The method according to claim 195, wherein the bacteria is
exemplified by, but not limited to, Chlamidia or
enterobacteria.
197. The method according to claim 195, wherein the bacteria are
gram negative bacteria.
198. The method according to claim 195 , wherein the virus is an
RNA virus, enterovirus, Chlamydia, or coxacki virus.
199. The method according to claim 195 wherein the virus is a
single strand RNA virus.
200. The method according to claim 195, wherein the virus is
Influenza A.
201. The method according to claim 194, wherein the TLR3- or
TLR4-linked disease involves a pathogen or pathogen molecular
signal which increases Type 1 interferon gene expression.
202. The method according to claim 201, wherein the pathogen
related agent or product is a virus, bacteria, dsRNA, Type 1 IFN,
or environmental induction event.
203. The method according to claim 201, wherein the bacteria are
gram-negative bacteria.
204. The method according to claim 201, wherein the virus is an RNA
virus, enterovirus, or coxacki virus.
205. The method according to claim 201, wherein the virus is a
single strand RNA virus.
206. The method according to claim 201, wherein the virus is
Influenza A.
207. The method according to claim 194, wherein the TLR3- or
TLR4-linked disease involves a pathogen or pathogen molecular
signal which increases STAT-1 activation.
208. The method according to claim 207, wherein the pathogen
related agent or product is a virus, bacteria, dsRNA, Type 1 IFN,
or environmental induction event.
209. The method according to claim 208, wherein the bacteria re a
gram negative bacteria.
210. The method according to claim 208, wherein the virus is an RNA
virus, enterovirus, or coxacki virus.
211. The method according to claim 208, wherein the virus is a
single strand RNA virus.
212. The method according to claim 208, wherein the virus is
Influenza A.
213. The method according to claim 194, wherein the TLR3- or
TLR4-linked disease involves a pathogen or pathogen molecular
signal which increases interferon sensitive response element (ISRE)
activation.
214. The method according to claim 213, wherein the pathogen
related agent or product is a virus, bacteria, dsRNA, Type 1 IFN,
or environmental induction event.
215. The method according to claim 214, wherein the bacteria are
gram negative bacteria.
216. The method according to claim 214, wherein the virus is an RNA
virus, enterovirus, or coxacki virus.
217. The method according to claim 214, wherein the virus is a
single strand RNA virus.
218. The method according to claim 214, wherein the virus is
Influenza A.
219. The method according to claim 194, wherein the TLR3- or
TLR4-linked diseases involves increased activation of interferon
sensitive response element.
220. The method according to claim 219, wherein the pathogen
related agent or product is lypopolysaccharide, Type 1 IFN, or
environmental induction event, hyperlipidemia.
221. The method according to claim 220, wherein the pathogen is
bacteria.
222. The method according to claim 221, wherein the bacteria are
gram-negative bacteria.
223. The method according to claim 220, wherein the pathogen is a
virus.
224. The method according to claim 223, wherein the virus is an
enterovirus.
225. method for treating a TLR-mediated disease or disorder in a
subject in need thereof comprising administering to the subject a
therapeutically effective amount of one or more methimazole
derivative and/or cyclic thione derivative selected from the group
consisting of tautomeric methimazole derivatives, non-tautomeric
methimazole derivatives, and non-tautomeric cyclic thione
derivatives, and combinations thereof, that decreases that
decreases the endogenous amount of intracellular or extracellular
cytokine in the subject suffering from the disease.
226. The method according to claim 225, wherein the cytokine is
TNF.alpha..
227. The method according to claim 225, wherein the disease
selected from the group consisting of graft versus host disease,
acute respiratory distress syndrome, granulomatous disease,
transplant rejection, cachexia, parasitic infections, fungal
infections, trauma, and bacterial infections.
228. The method according to claim 225, wherein the disorder is an
autoimmune or inflammatory disease associated with toll-like
receptor 3 or 4 overexpression.
229. The method according to claim 225, wherein the disorder is an
autoimmune or inflammatory disease associated with toll-like
receptor 3 overexpression in a cell selected from nonimmune cells,
monocytes, macrophages, and dendritic cells.
230. The method according to claim 225, wherein the disorder is a
TLR3-mediated inflammatory disease involving activation of, or
pathologic signaling of, IRF-3.
231. The method according to claim 225, wherein the disorder is a
TLR3-mediated inflammatory disease involving overexpression or
pathologic signaling by Type 1 interferons.
232. The method according to claim 225, wherein the disorder is a
TLR3-mediated inflammatory disease involving overexpression or
pathologic signaling of ISRE containing genes.
233. The method according to claim 225, wherein the disorder is a
TLR3-mediated inflammatory disease involving activation of, or
pathologic signaling by, STAT1.
234. The method according to claim 225, wherein the disorder is a
TLR3-mediated inflammatory disease involving a pathological
condition resulting from abnormal cell proliferation;
transplantation rejection, autoimmune, inflammatory, proliferative,
hyperproliferative, or cardiovascular disease.
235. The method according to claim 225, wherein the disorder is
Hashimoto's hyroiditis.
236. The method according to claim 225, wherein the disorder is
inflammatory lung disease.
237. The method according to claim 225 wherein the disorder is Type
1 diabetes.
238. The method according to claim 225, wherein the disorder is
Insulin-dependent Diabetes.
239. The method according to claim 225, wherein the disorder is a
TLR-mediated autoimmune disease.
240. The method according to claim 225, wherein the TLR-mediated
autoimmune disease is Alopecia, Areata, Ankylosing Spondylitis,
Antiphospholipid Syndrome, Autoimmune Addison's Disease, Autoimmune
Hemolytic Anemia, Autoimmune Hepatitis, Behcet's Disease, Bullous
Pemphigoid, Cardiomyopathy, Celiac Sprue-Dermatitis, Chronic
Fatigue Immune Dysfimction Syndrome (CFIDS), Chronic Inflammatory
Demyelinating Polyneuropathy, Churg-Strauss Syndrome, Cicatricial
Pemphigoid, CREST Syndrome, Cold Agglutinin Disease, Crohn's
Disease, Discoid Lupus, Essential Mixed Cryoglobulinemia,
Fibromyalgia-Fibromyositis, Graves' Disease, Guillain-Barre,
Hashimoto's Thyroiditis, Post partum thyroiditis, Hypothyroidism,
Idiopathic Puhnonary Fibrosis, Idiopathic Thrombocytopenia Purpura
(ITP), IgA Nephropathy, Insulin dependent Diabetes, Type 2
Diabetes, Complications of Type 1 or 2 diabetes, Juvenile
Arthritis, Lichen Planus, Systemic Lupus, Meniere's Disease, Mixed
Connective Tissue Disease, Multiple Sclerosis, Myasthenia Gravis,
Pemphigus Vulgaris, Pernicious Anemia, Polyarteritis Nodosa,
Polychondritis, Polyglandular Syndromes, Polymyalgia Rheumatica,
Polymyositis and Dermatomyositis, Primary Agammaglobulinemia,
Primary Biliary Cirrhosis, Psoriasis, Raynaud's Phenomenon,
Reiter's Syndrome, Rheumatic Fever, Rheumatoid Arthritis,
Sarcoidosis, Scleroderma, Sjogren's Syndrome, Stiffinan Syndrome,
Iakayasu Arteritis, Temporal Arteritis/Giant Cell Arteritis,
Ulcerative Colitis, Uveitis, Vasculitis, Vitiligo, Wegener's
Granulomatosis, or myasthenia gravis.
241. A method for the treatment of diseases, disorders, conditions
or symptoms mediated by TLR3 in a subject, which comprises
administering to the subject a pharmaceutical composition
comprising a methimazole derivative and/or cyclic thione derivative
selected from the group consisting of tautomeric methimazole
derivatives, non-tautomeric methimazole derivatives, and
non-tautomeric cyclic thione derivatives, and combinations thereof,
in an amount effective for prevention, inhibition or suppression of
diseases, disorders, conditions or symptoms mediated by TLR3,
wherein the disease or condition is one or more of the following:
graft versus host disease, acute respiratory distress syndrome,
granulomatous disease, transplant rejection, cachexia, parasitic
infections, fingal infections, trauma, and bacterial
infections.
242. The method according to claim 140, wherein the compounds of
the present invention are administered in conjunction with one or
more drugs, agents or therapeutics selected from the group
consisting of: glucocorticoids, 5-lipoxygenase inhibitors, .beta.-2
adrenoceptor agonists, muscarinic M1 and M3 antagonists, muscarinic
M2 agonists, NK3 antagonists, LTB4 antagonists, cysteinyl
leukotriene antagonists, bronchodilators, PDE4 inhibitors, PDE
inhibitors, elastase inhibitors, MMP inhibitors, phospholipase A2
inhibitors, phospholipase D inhibitors, histamine HI antagonists,
histamine H3 antagonists, dopamine agonists, adenosine A2 agonists,
NK1 and NK2 antagonists, GABA-b agonists, nociceptin agonists,
expectorants, mucolytic agents, decongestants, antioxidants,
anti-IL-8 anti-bodies, anti-IL-5 antibodies, anti-IgE antibodies,
anti-TNF antibodies, IL-10, adhesion molecule inhibitors, and
growth hormones.
243. The method according to claim 141, wherein the compounds of
the present invention are administered in conjunction with one or
more therapeutic steroids.
244. The method according to claim 243, wherein the one or more
therapeutic teroids are selected from the group consisting of
corticoids, glucocorticoids, dexamethasone, prednisone,
prednisolone, and betamethasone.
245. The method according to claim 141, wherein the Toll-like
receptor 3 induced disease is one or more diseases or pathologies
selected from the group consisting of a metabolic related disorder
and a weight related disorder.
246. The method according to claim 245, wherein the TLR-mediated
disease is a Toll-like receptor 3 induced inflammatory disease and
related pathologies.
247. The method according to claim 245, wherein the Toll-like
receptor 3 induced inflammatory disease is selected from the group
consisting of type I diabetes, type II diabetes, inadequate glucose
tolerance, insulin resistance, hyperglycemia, hyperlipidemia,
hypertriglyceridemia, hypercholesterolemia, dyslipidemia and
syndrome X.
248. The method according to claim 245, wherein the Toll-like
receptor 3 induced disease is one or more vascular diseases.
249. The method according to claim 248, wherein the Toll-like
receptor 3 induced disease is one or more diseases or pathologies
selected from the group consisting of atherosclerosis, transplant
atherosclerosis, vein-graft atherosclerosis, stent restenosis, and
angioplasty restenosis.
250. The method according to claim 249, wherein the compounds of
the present invention are administered in conjunction with one or
more compounds selected from the group consisting of steroids,
cyclooxygenase-2 inhibitors, NSAIDs, DMARDS, antibiotics,
immunosuppressive agents, 5-lipoxygenase inhibitors, LTB.sub.4
antagonists and LTA.sub.4 hydrolase inhibitors and anti-cell
adhesion molecules.
251. The method according to claim 140, wherein the methods are
used prophylactically to treat a subject at risk of developing an
inflammatory condition.
252. The method according to claim 140, wherein the pharmaceutical
composition is in prodrug form.
253. The method according to claim 140, wherein the pharmaceutical
composition comprises from about 0.01% to about 25% of the active
compound and from about 75% to about 99.99% of the
pharmaceutically-acceptable carrier.
254. A method of prophylaxis or treatment of a disease, disorder,
condition or complication thereof as described herein, comprising
administering to an individual in need of such prophylaxis or
treatment a therapeutically effective amount or dose of one or more
methimazole derivatives and/or cyclic thione derivatives selected
from the group consisting of tautomeric methimazole derivatives,
non-tautomeric methimazole derivatives, and non-tautomeric cyclic
thione derivatives, and combinations thereof, in combination with
at least one additional active agent.
255. The method according to claim 254, wherein the additional
active agent comprises one or more agent selected from the group
consisting of: sulfonylureas, meglitinides, biguanides,
alpha-glucosidase inhibitors, peroxisome proliferators-activated
receptor-gamma agonists, insulin, insulin analogues, HMG-CoA
reductase inhibitors, cholesterol-lowering drugs, anti-platelet
agents, angiotensin-converting enzyme inhibitors, angiotensin II
receptor antagonists and adiponectin.
256. The method according to claim 254, wherein the additional
active agent or agents is a lipid modifying compound or agent.
257. The method according to claim 254, wherein the additional
active agent comprises one or more HMG-CoA synthase inhibitors;
squalene epoxidase inhibitors; squalene synthetase inhibitors (also
known as squalene synthase inhibitors), acyl-coenzyme cholesterol
acyltransferase (ACAT) inhibitors; microsomal triglyceride transfer
protein (MTP) inhibitors; probucol; niacin; bile acid sequestrants;
LDL (low density lipoprotein) receptor inducers; platelet
aggregation inhibitors, for example glycoprotein Ilb/IIla
fibrinogen receptor antagonists and aspirin; human peroxisome
proliferator activated receptor gamma (PPARO) agonists, PPAR
agonists; PPAR alpha/gamma dual agonists, vitamin B6 (also known as
pyridoxine) and the pharmaceutically acceptable salts thereof such
as the HCl salt; vitamin B12 (also known as cyanocobalamin); folic
acid or a pharmaceutically acceptable salt or ester thereof such as
the sodium salt and the methylglucamine salt; anti-oxidant vitamins
such as vitamin C and E and beta carotene; beta-blockers;
angiotensin II antagonists such as losartan; angiotensin converting
enzyme inhibitors such as enalapril and captopril; calcium channel
blockers such as nifedipine and diltiazam; endothelian antagonists;
agents that enhance ABCA1 gene expression; FXR ligands including
both inhibitors and agonists; bisphosphonate compounds such as
alendronate sodium; and cyclooxygenase-2 inhibitors such as
rofecoxib and celecoxib.
258. The method according to claim 254, wherein the additional
active agent comprises one or more antidiabetics, hypoglycemic
active ingredients, HMG-CoA reductase inhibitors, cholesterol
absorption inhibitors, PPAR gamma agonists, PPAR alpha agonists,
PPAR alpha/gamma agonists, fibrates, MTP inhibitors, bile acid
absorption inhibitors, CETP inhibitors, polymeric bile acid
adsorbents, LDL receptor inducers, ACAT inhibitors, antioxidants,
lipoprotein lipase inhibitors, ATP-citrate lyase inhibitors,
squalene synthetase inhibitors, lipoprotein(a) antagonists, lipase
inhibitors, insulins, sulfonylureas, biguanides, meglitinides,
thiazolidinediones, alpha-glucosidase inhibitors, active
ingredients which act on the ATP-dependent potassium channel of the
beta cells, CART agonists, NPY agonists, MC4 agonists, orexin
agonists, cannabinoid 1 receptor antagonists, H3 agonists, TNF
agonists, CRF agonists, CRF BP antagonists, urocortin agonists,
beta-3 agonists, MSH (melanocyte-stimulating hormone) agonists, CCK
agonists, serotonin reuptake inhibitors, mixed sertoninergic and
noradrenergic compounds, 5HT agonists, bombesin agonists, galanin
antagonists, growth hormones, growth hormone-releasing compounds,
TRH agonists, uncoupling protein 2 or 3 modulators, leptin
agonists, DA agonists (bromocriptine, Doprexin), lipase/amylase
inhibitors, PPAR modulators, cannabinoid 1 receptor antagonists,
RXR modulators or TR-beta agonists or amphetamines.
259. The method according to claim 254, wherein the additional
active agent or agents is a statin.
260. The method according to claim 254, wherein the statin is
selected from the group consisting of lovastatin, simvastatin,
dihydroxy open-acid simvastatin, pravastatin, fluvastatin,
atorvastatin, cerivastatin, and pitavastatin.
261. A method for the diagnosis, early diagnosis, differential
diagnosis, assessment of the severity and therapy-accompanying
monitoring and prognosis of an inflammatory or autoimmune disease
comprising testing a biological fluid or cell sample of a subject
in whom disease is present or suspected for the activation or
expression of TLR 3 and/or TLR4, wherein the activation or
expression of TLR 3 and/or TLR4 is indicative of the presence, the
expected cause, the severity and/or the success of initiated
measures for the therapy of the disease.
262. The method according to claim 261, wherein the inflammatory or
autoimmune disease is is selected from septic shock of whatever
type, etiology, or pathogenesis; or septic shock that is a
associated with renal failure; acute renal failure; cachexia;
malarial cachexia; hypophysial cachexia; uremic cachexia; cardiac
cachexia; cachexia suprarenalis or Addison's disease; cancerous
cachexia; and cachexia as a consequence of infection by the human
immunodeficiency virus (HIV).
263. The method according to claim 261, wherein the inflammatory or
autoimmune disease is selected from the group consisting of Type 1
diabetes, colitis, autoimmune thyroiditis, atherosclerosis, and
vascular complications of diabetes.
264. The method according to claim 261, wherein the levels of
expression of TLR3 in thyrocytes is measured as a method for
diagnosis for Hashimoto's thyroiditis.
265. The method according to claim 261, wherein the level of
expression of TLR3 in pancreatic islet cells is measured as a
method for diagnosis of insulinitis or Type 1 diabetes.
266. The method according to claim 261, wherein the levels of
expression of TLR4 in monocytes, vascular endothelial cells, or
intestinal epithelial cells, is measured as a method for diagnosis
of a an autoimmune or inflammatory disease.
267. The method according to claim 261, wherein the disease is
vascular disease or colitis.
268. A method of diagnosing a TLR3 or TLR4 mediated related disease
in a subject, the method comprising detecting the level of
expression of TLR3 (a) in a test sample of nonimmune tissue cells
obtained from the subject, and (b) in a control sample of known
normal nonimmune tissue cells of the same cell type, wherein a
higher or lower level of expression of TLR3 or TLR4 in the test
sample as compared to the control sample is indicative of the
presence of an TLR3 related disease in the subject from which the
test tissue cells were obtained.
269. A method of diagnosing, in a subject, an autoimmune or
inflammatory disease associated with toll-like receptor 3 or TLR4
overexpression in nonimmune cells, the method comprising detecting
the level of expression of TLR3 or TLR4 (a) in a test sample of
nonimmune cells obtained from the subject, and (b) in a control
sample of known normal nonimmune cells of the same cell type,
wherein a higher or lower level of expression of TLR3 or TLR4 in
the test sample as compared to the control sample is indicative of
the presence of an autoimmune or inflammatory disease associated
with toll-like receptor 3 or TLR4 overexpression in the subject
from which the test tissue cells were obtained.
270. A method of identifying a compound that inhibits the
expression of TLR3 or TLR4, the method comprising contacting cells
which normally exhibit TLR3 or TLR4 expression or activity with an
enhancer of this expression or activity, e. g. LPS, Type I IFN,
dsRNA transfection, a virus, IL-1.beta., TNF-.alpha., together
with, preceded, or followed by a candidate compound, and
determining the responsiveness or lack responsiveness by the cell
to the test compound.
271. A method of identifying a compound that inhibits toll-like
receptor 3 or TLR4 overexpression in a nonimmune cell, the method
comprising contacting nonimmune cells which overexpress TLR3 or
TLR4 with a candidate compound, and determining the activity or
expression of TLR3 or TLR4.
272. A method for screening a test compound for the potential to
prevent, ameliorate, stabilize, or treat an autoimmune or
inflammatory disease associated with toll-like receptor 3 or TLR4
overexpression in the subject comprising the steps of first
contacting a nonimmune cell sample from a subject that has, or is
at risk for developing, an autoimmune or inflammatory disease
associated with toll-like receptor 3 or TLR4 overexpression in the
subject with the test compound; b) contacting a second nonimmune
cell sample from the subject with a known standard compound,
wherein the first and second nonimmune cell samples are contacted
with the test compound in the same manner; and c) measuring TLR3 or
TLR4 expression or activity in the first and second samples,
wherein the compound is determined to have the potential if the
TLR3 or TLR4 expression or activity in the first sample is
decreased relative to the second sample.
273. A method for screening a test compound for the potential to
prevent, ameliorate, stabilize, or treat an autoimmune or
inflammatory disease associated with toll-like receptor 3 or TLR4
overexpression in the subject comprising the steps of: a) first
contacting a nonimmune cell sample from a first subject that has,
or is at risk for developing, an autoimmune or inflammatory disease
associated with toll-like receptor 3 or TLR4 overexpression or
signaling in the subject with the test compound; b) contacting a
second nonimmune cell sample from a second subject that does not
have, or is not predisposed to developing, an autoimmune or
inflammatory disease associated with toll-like receptor 3 or TLR4
overexpression or signaling with the test compound, wherein the
first and second nonimmune cell samples are contacted with the test
compound in the same manner; and c) measuring TLR3 or TLR4
expression or activity in the first and second samples, wherein the
compound is determined to have the potential if the TLR3 or TLR4
expression or activity in the first sample is decreased relative to
the second sample.
274. A pharmaceutical combination, comprising: a methimazole
derivative and/or cyclic thione derivative selected from the group
consisting of tautomeric methimazole derivatives, non-tautomeric
methimazole derivatives, and non-tautomeric cyclic thione
derivatives, and combinations thereof; at least one additional
therapeutic agent selected from the group consisting of
anti-obesity agents; appetite suppressants; anti-diabetic agents;
anti-hyperlipidemia agents; hypolipidemic agents;
hypocholesterolemic agents; lipid-modulating agents;
cholesterol-lowering agents; lipid-lowering agents;
anti-hypertensive agents; agents used to treat sleep disorders;
agents used to treat substance abuse and addictive disorders;
anti-anxiety agents; anti-depressants; anti-psychotic agents;
cognition enhancing agents; agents used to treat cognitive
disorders; agents used to treat Alzheimer's disease; agents used to
treat Parkinson's disease; anti-inflammatory agents; agents used to
treat neurodegeneration; agents used to treat arteriosclerosis;
agents used to treat respiratory conditions; agents used to treat
bowel disorders; cardiac glycosides; and anti-tumor agents; and at
least one pharmaceutically acceptable carrier or diluent.
275. The pharmaceutical combination according to claim 274, wherein
the anti-obesity agent is selected from melanocortin receptor
(MC4R) agonists; melanin-concentrating hormone receptor (MCHR)
antagonists; growth hormone secretagogue receptor (GHSR)
antagonists; orexin antagonists; CCK agonists; GLP-1 agonists and
other Pre-proglucagon-derived peptides; NPY1 or NPY5 antagonists;
NPY2 and NPY4 modulators; corticotropin releasing factor agonists;
histamine receptor-3 (H3) modulators; aP2 inhibitors; PPAR gamma
modulators; PPAR delta modulators; acetyl-CoA carboxylase (ACC)
inhibitors, adiponectin receptor modulators, beta 3 adrenergic
agonists, including AJ9677, L750355 and CP331648 or other known
beta 3 agonists; thyroid receptor beta modulator; lipase
inhibitors, including orlistat and ATL-962; serotonin receptor
agonists, including BVT-933; monoamine reuptake inhibitors or
releasing agents, including fenfluramine, dexfenfluramine,
fluvoxamine, fluoxetine, paroxetine, sertraline, chlorphentermine,
cloforex, clortermine, picilorex, sibutramine, dexamphetamine,
phentermine, phenylpropanolamine and mazindol; anorectic agents,
including topiramate; ciliary neurotrophic factor, including
Axokine; brain-derived neurotrophic factor; leptin and other
cannabinoid-1 receptor antagonists, including SR-141716 and
SLV-319.
276. The pharmaceutical combination according to claim 274, wherein
the anti-diabetic agent is selected from insulin secretagogues;
insulin sensitizers; anti-hyperglycemic agents; biguanides;
sulfonyl ureas; glucosidase inhibitors; aldose reductase
inhibitors; PPAR gamma agonists including thiazolidinediones;
PPAR-alpha agonists, including fibric acid derivatives; PPAR-delta
antagonists or agonists; PPAR alpha/gamma dual agonists; dipeptidyl
peptidase IV inhibitors; SGLT2 inhibitors; glycogen phosphorylase
inhibitors; meglitinides; insulin; glucagon-like peptide-1;
glucagon-like peptide 1 agonists; and protein tyrosine
phosphatase-1B inhibitor.
277. The pharmaceutical combination according to claim 274, wherein
the anti-inflammatory agent is selected from prednisone;
dexamethasone; cyclooxygenase inhibitors including COX-1 and COX-2
inhibitors selected from NSAID's, aspirin, indomethacin, ibuprofen,
piroxicam, Naproxen, Celebrex and Vioxx; CTLA4-Ig agonists and
antagonists; CD40 ligand antagonists; IMPDH inhibitors including
mycophenolate; integrin antagonists; alpha-4 beta-7 integrin
antagonists; cell adhesion inhibitors; interferon gamma
antagonists; ICAM-1; tumor necrosis factor antagonists selected
from infliximab, OR1384, TNF-alpha inhibitors including tenidap,
anti-TNF antibodies or soluble TNF receptors including etanercept;
rapamycin selected from sirolimus and Rapamune; eflunomide;
prostaglandin synthesis inhibitors; budesonide; clofazimine;
CNI-1493; CD4 antagonists including priliximab; p38
mitogen-activated protein kinase inhibitors; protein tyrosine
kinase inhibitors; IKK inhibitors; agents for treatment of
irritable bowel syndrome selected from Zelnorm and Maxi-K
openers.
278. The method according to claim 140, 153, 156, 160, 166, 175,
194, 225, 241, 254 or 274, wherein the pharmaceutical composition
comprises a safe and effective amount of the tautomeric methimazole
derivative, ##STR24## wherein Y is selected from the group
consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted
alkyl, --NO.sub.2, and the phenyl moiety: ##STR25## and wherein no
more than one Y group in said active compound may be the phenyl
moiety; R.sup.1 is selected from the group consisting of H, --OH,
halogens, C.sub.1-C.sub.4 alkyl, and C.sub.1-C.sub.4 substituted
alkyl; R.sup.2 is selected from the group consisting of H,
C.sub.1-C.sub.4 alkyl, C.sub.1-C4 substituted alkyl, and a phenyl
moiety; R.sup.3is H ; R.sup.4 is selected from the group consisting
of H, C.sub.1-C.sub.4 alkyl, and Cl-C.sub.4 substituted alkyl; and
Z is selected from --SR.sup.3 and --OR.sup.3 ; and wherein said
compound is C.sub.1-C.sub.4 alkyl when Y is not a phenyl moiety,
and a pharmaceutically-acceptable carrier.
279. The method according to claim 140, 153, 156, 160, 166, 175,
194, 225, 241, 254 or 274, wherein the pharmaceutical composition
comprises a safe and effective mount of the non-tautomeric
methimazole derivative ##STR26## wherein Y is selected from the
group consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl, --NO.sub.2, and the phenyl moiety: ##STR27## and
wherein no more than one Y group in said active compound may be the
phenyl moiety; R.sup.1 is selected from the group consisting of H,
--OH, halogens, C.sub.1-C.sub.4 alkyl, and C.sub.1-C.sub.4
substituted alkyl; R.sup.2 is selected from the group consisting of
H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl, and a
phenyl moiety; R.sup.3 is selected from the group consisting of
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl, and
--CH.sub.2Ph; R.sup.4 is selected from the group consisting of H,
C.sub.1-C.sub.4 alkyl, and C.sub.1-C.sub.4 substituted alkyl; and Z
is selected from --SR.sup.3, S(O)R.sup.3, --OR.sup.3 and
C.sub.1-C.sub.4 alkyl; and wherein at least two of the R.sup.2 and
R.sup.3 groups in said compound are C.sub.1-C.sub.4 alkyl when Y is
not a phenyl moiety, and at least one Y is --NO.sub.2 when Z is
alkyl; and a pharmaceutically-acceptable carrier.
280. The method according to claim 140, 153, 156, 160, 166, 175,
194, 225, 241, 254 or 274, wherein the pharmaceutical composition
comprises a safe and effective amount of the non-tautomeric cyclic
thione derivative ##STR28## wherein Y is selected from the group
consisting of H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted
alkyl, --NO.sub.2, and the phenyl moiety: ##STR29## and wherein no
more than one Y group in said active compound may be the phenyl
moiety; R.sup.1 is selected from the group consisting of H, --OH,
halogens, C.sub.1-C.sub.4 alkyl, and C.sub.1-C.sub.4 substituted
alkyl; R.sup.2 is selected from the group consisting of
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl, and a
phenyl moiety; R.sup.4 is selected from the group consisting of H,
C.sub.1-C.sub.4 alkyl, and C.sub.1-C.sub.4 substituted alkyl; X is
S; and a pharmaceutically-acceptable carrier.
281. The method according to claims 278 or 279, wherein Z is
SR.sup.3 and Y is H.
282. The method according to claim 281, wherein R.sup.3 is
C.sub.1-C.sub.4 alkyl.
283. The method according to claim 282, wherein R.sup.3 is
methyl.
284. The method according to claim 283, wherein at least one
R.sup.2 group is methyl.
285. The method according to claim 280, wherein both R.sup.2 groups
are methyl.
286. The method according to claim 279, wherein the active compound
has the formula N.
287. The method according to claim 279, wherein the active compound
has the formula ##STR30##
288. The method according to claim 280, wherein the active compound
has the formula: ##STR31##
289. The method according to claim 280, wherein the active compound
has the formula: ##STR32##
290. The method according to claim 279, wherein the active compound
has the formula: ##STR33##
291. The method according to claims 278 or 279, wherein Z is
SR.sup.3 and one of the Y groups is the phenyl moiety.
292. The method according to claim 291, wherein R.sup.1 and R.sup.4
are H.
293. The method according to claim 279, wherein Z is SR.sup.3 and
R.sup.3 is a methyl, and one of the Y groups is the phenyl moiety
wherein R.sup.1 and R.sup.4 are H, and the R.sup.2 group is
methyl.
294. The method according to claim 278, wherein Z is SR.sup.3 and
R.sup.3 is H, and one of the Y groups is the phenyl moiety wherein
R.sup.1 and R.sup.4 are H, and the R.sup.2 group is methyl.
295. The method according to claim 280, wherein one of the Y groups
is the phenyl moiety, wherein R.sup.1 and R.sup.4 are H, and both
R.sup.2 groups are methyl.
296. The method according to claim 278, wherein the active compound
is: ##STR34##
297. The method according to claim 279, wherein the active compound
is ##STR35##
298. The method according to claim 280, wherein the active compound
is ##STR36##
299. The method according to claims 278, 279 or 280, wherein the
pharmaceutical composition is in prodrug form.
300. The method according to claims 278, 279 or 280, wherein the
pharmaceutical composition comprises from about 0.01% to about 25%
of the active compound and from about 75% to about 99.99% of the
pharmaceutically-acceptable carrier.
301. The method according to claim 280, wherein the pharmaceutical
composition comprises a safe and effective amount of an active
compound having the formula: ##STR37##
302. The method according to claim 140, 153, 156, 160, 166, 175,
194, 225, 241, 254 or 274, wherein the pharmaceutical composition
comprises a safe and effective amount of ##STR38## wherein Y is
selected form the group consisting of H, C.sub.1-C.sub.4 alkyl,
C.sub.1-C.sub.4 substituted alkyl, --NO.sub.2, and the phenyl
moiety: ##STR39## R.sup.1 is selected from the group consisting H,
--OH, halogens, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted
alkyl, C.sub.1-C.sub.4 ester and C.sub.1-C.sub.4 substituted ester;
R.sup.2 is selected from the group consisting of H, C.sub.1-C.sub.4
alkyl and C.sub.1-C.sub.4 substituted alkyl; R.sup.4 is selected
from the group consisting of H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl; X is S; and wherein the R.sup.2
groups in said compound are C.sub.1-C.sub.4 alkyl when Y is not a
phenyl moiety, and a harmaceutically acceptable carrier.
303. The method according to claims 140, 153, 156, 160, 166, 175,
194, 225, 241, 254 or 274, wherein the active compound is selected
from the group consisting of ##STR40## wherein R9 is selected from
the group consisting of --OH, -M and --OOCCH.sub.2M; wherein M is
selected from F, Cl, Br and I.
304. The method according to claims 140, 153, 156, 160, 166, 175,
194, 225, 241, 254 or 274, wherein the active compound is selected
from the group consisting of ##STR41## wherein R.sup.10 is selected
from the group consisting of H, --NO.sub.2, Ph, 4-HOPh and 4-MPh,
wherein M is selected from F, Cl, Br and I.
Description
[0001] The present application is a continuation-in-part of U.S.
patent application Ser. No. 10/912,948, filed Aug. 6, 2004, and
U.S. patent application Ser. No. 10/801,986, filed Mar. 16, 2004,
both of which are incorporated by reference in their entirety.
TECHNICAL FIELD
[0002] The present invention relates to the treatment of autoimmune
and/or inflammatory diseases associated with overexpression of
Toll-like receptor 3 (TLR3) as well as Toll-like receptor 4 (TLR4)
and/or TLR3/TLR4 signaling in nonimmune cells, monocytes,
macrophages, and/or dendritic cells in association with related
pathologies. This invention also relates to the use of
phenylmethimazoles, methimazole (MMI) derivatives, and tautomeric
cyclic thiones for the treatment of autoimmune and inflammatory
diseases associated with Toll-like receptor 3 (TLR3) as well as
Toll-like receptor 4 (TLR4) and/or TLR3/TLR4 signaling in nonimmune
cells, monocytes, macrophages, and/or dendritic cells in
association with related pathologies. This invention also relates
to treating a subject having a disease or condition associated with
abnormal Toll-like receptor 3 (TLR3) as well as Toll-like receptor
4 (TLR4) and/or TLR3/TLR4 signaling in nonimmune cells, monocytes,
macrophages, and/or dendritic cells in association with related
pathologies. This invention also relates to treating a subject
having a disease or condition associated with abnormal Toll-like
receptor expression or signaling involving activation of Type I
interferons in nonimmune cells, monocytes, macrophages, and/or
dendritic cells in association with related pathologies.
BACKGROUND OF THE INVENTION
[0003] A. Innate and Adaptive Immunity
[0004] Autoimmune diseases, are currently clinically defined by (i)
humoral or autoantibody response to a self antigen, e.g. Graves'
primary hyperthyroidism with antibodies to the TSH receptor, or
(ii) cellular response wherein immune cells destroy nonimmune cells
from which the self-antigen is derived, e.g. the thyrocyte
(Hashimoto's thyroiditis) or pancreatic .beta.-islet cell (Type 1
diabetes) (I. Roitt, Essential Immunology, 7th ed., 312-346
(1991)). Many autoimmune diseases are in fact a combination of both
phenomena (I. Roitt, Essential Immunology, 7th ed., 312-346
(1991)); thus, Hashimoto's and Type 1 diabetes also have
auto-antibodies, anti-thyroid peroxidase (TPO) or anti-glutamic
acid decarboxylase (GAD)/Islet Cell. Additionally, autoimmune
diseases often have a significant inflammatory component including
increases in adhesion molecules, e.g. vascular cell adhesion
molecule-1 (VCAM-1), and altered leukocyte adhesion to the
vasculature, e. g., colitis, systemic lupus, systemic sclerosis,
and the vascular complications of diabetes (I. Roitt, Essential
Immunology, 7th ed., 312-346 (1991); S. A. Jimenez, et al., Ann
Intern Med, 140:37-50 (2004)).
[0005] Recent studies demonstrate a formidable link between the
Toll-like receptor (TLR) signaling pathway of innate immunity and
the slower, more deliberate adaptive immune system that
characterizes humoral and cellular autoimmunity (K. S. Michelsen,
et al., Proc Natl Acad Sci USA, 101:10679-84 (2004); G. Pasterkamp,
et al., Eur J Clin Invest, 34:328-34 (2004); K. Takeda, et al.,
Annu Rev Immunol, 21:335-76 (2003); K. Takeda, et al., Cell
Microbiol, 5:143-53 (2003); R. J. Ulevitch, J Infect Dis, 187 Suppl
2:S351-5 (2003); L. Steinman, Science, 305:212-6 (2004); L. D.
Kohn, et al., Research Ohio, In press, (2005); N. Harii, et al.,
Mol Endocrinol, 19:1231-50 (2005); D. Devendra, et al., Clin
Immunol, 111:225-33 (2004); L. Wen, et al., J Immunol, 172:3173-80
(2004); H. Oshiumi, et al., Nat Immunol, 4:161-7 (2003); M.
Yamamoto, et al., J Immunol, 169:6668-72 (2002); M. Miettinen, et
al., Genes Immun, 2:349-55 (2001); L. Alexopoulou, et al., Nature,
413:732-8 (2001); G. Andonegui, et al., J Clin Invest, 111:1011 -
1020 (2003); C. Fiocchi, Gastroenterology, 115:182-205 (1998); E.
Cario, et al., Infect Immun, 68:7010-7 (2000)). Innate immunity is
a protective immune cell response that functions rapidly to fight
environmental insults including, but not limited to, bacterial or
viral agents. Adaptive immunity is a slower response, which
involves differentiation and activation of naive T lymphocytes into
T helper 1 (Th1) or T helper 2 (Th2) cell types (I. Roitt,
Essential Immunology, 7th ed., 312-346, (1991)). Th1 cells mainly
promote cellular immunity, whereas Th2 cells mainly promote humoral
immunity. Though primarily a host protective system, pathologic
expression of the innate immunity signals emanating from the TLR
pathway are now implicated in initiating autoimmune-inflammatory
diseases.
[0006] Therapies for autoimmune-inflammatory endocrine or
non-endocrine diseases are largely aimed at treating the symptoms
of the disease. For the most part, the underlying genetic
susceptibilities are poorly defined, are multiple, are often not
disease specific, and are largely not readily amenable to therapy.
Immunosuppressive agents that are used to treat
autoimmune-inflammatory diseases largely target the immune cell
response or the cytokines they produce. They are only partially
effective in inducing remission (methimazole in Graves'), toxic
(cyclosporin for Type 1 diabetes), or simply palliative
(anti-inflammatory corticosteroids for colitis or systemic lupus).
The involvement of TLR in autoimmune-inflammatory diseases raises
the possibility that diagnosis and treatment must undergo a
re-alignment (K. S. Michelsen, et al., Proc Natl Acad Sci USA, 101:
10679-84 (2004); G. Pasterkamp, et al., Eur J Clin Invest,
34:328-34 (2004); L. D. Kohn, et al., Research Ohio, In press,
(2005); N. Harii, et al., Mol Endocrinol, 19:1231-50 (2005); D.
Devendra, et al., Clin Immunol, 111:225-33 (2004); L. Wen, et al.,
J Immunol, 172:3173-80 (2004); H. Oshiumi, et al., Nat Immunol,
4:161-7 (2003); M. Yamamoto, et al., J Immunol, 169:6668-72 (2002);
M. Miettinen, et al., Genes Immun, 2:349-55 (2001); L. Alexopoulou,
et al., Nature, 413:732-8 (2001); G. Andonegui, et al., J Clin
Invest, 111:1011-1020 (2003); C. Fiocchi, Gastroenterology,
115:182-205 (1998); E. Cario, et al., Infect Immun, 68:7010-7
(2000)).
[0007] Thus, despite our knowledge that many
autoimmune-inflammatory diseases were induced or worsened by an
environmental agent, e. g. smoking or viral infections, little was
known of the details by which this induction-signal process worked,
nor was there a therapy to block this induction-signal process (I.
Roitt, Essential Immunology, 7th ed., 312-346, (1991); J. George,
et al., Scand J Immunol, 45:1-6 (1997); C. Nagata, et al., Int J
Dermatol, 34:333-7 (1995)).
[0008] Thus, the recent description of TLR and the TLR signal
mechanism of innate immunity, upon which adaptive (humoral or
cell-mediated) immunity depends has created an opportunity to
develop of a new class of drugs as well as new diagnostic paradigms
(L. D. Kohn, et al., Research Ohio, In press, (2005); N. Harii, et
al., Mol Endocrinol, 19:1231-50 (2005); D. Devendra, et al., Clin
Immunol, 111:225-33 (2004); L. D. Kohn, et al., U.S. patent
application Ser. No. 10/801,986 (2004); L. D. Kohn, et al., U.S.
patent application Ser. No. 10/912,948 (2004)).
[0009] By attacking the innate immune induction event of
autoimmune/inflammatory disease, early identification of the
induction signal event or environmental insult in a person at risk
and initiation of therapy post induction or during the latency
period of disease onset could allow therapy to be more effective,
prevent or retard cell destruction, avoid long term inflammatory
complications, enhance quality of life, and decrease associated
medical costs. Since, there is increasing evidence that the
atherosclerotic process and cardiovascular disease, i.e. the
vascular complications of type 2 and type 1 diabetes, exhibit
similar mechanisms involving TLR and a pathologic innate immune
response, they too can benefit from the same treatment paradigm,
despite being currently considered late stage phenomena (K. S.
Michelsen, et al., Proc Natl Acad Sci USA, 101:10679-84 (2004); G.
Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004); H. M.
Dansky, et al., Arterioscler Thromb Vasc Biol, 21:1662-7 (2001); P.
E. Szmitko, et al., Circulation, 108:2041-8 (2003); P. E. Szmitko,
et al., Circulation, 108:1917-23 (2003); M. I. Cybulsky, et al.,
Can J Cardiol, 20 Suppl B:24B-8B (2004); P. M. Ridker, et al.,
Circulation, 109:IV6-19,(2004)). No such method exists although it
is considered important.
[0010] B. Toll-Like Receptors and Signaling
[0011] At the end of the 20th century, Toll-like receptors (TLRs)
were shown to be essential to induce expression of genes involved
in inflammatory responses. Since their description, there has been
rapid progress in our understanding that TLRs and the innate immune
system is a critical step in the development of antigen-specific
acquired immunity. This is recently reviewed by several groups (K.
Takeda, et al., Int Immunol, 17:1-14 (2005); B. Beutler, Nature,
430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7
(2004)); the material following is largely derived from one (K.
Takeda, et al., Int Immunol, 17:1-14 (2005)) but is common to all
(B. Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J
Immunol, 173:5901-7 (2004)) and represents only the current
thoughts in a rapidly developing area.
[0012] The TLR Family. Mammalian TLRs comprise a large family
consisting of at least 10 functional members such as TLR1-9 which
are conserved between the human and mouse. The cytoplasmic portion
of TLRs shows high similarity to that of the IL-I receptor family
and is termed a Toll/IL-1 receptor (TIR) domain. Despite this
similarity, the extracellular portions of TLR are structurally
unrelated. The IL-1 receptors possess an immunoglobulin-like
domain, whereas TLRs bear leucine-rich repeats (LRRs) in the
extracellular domain. TLRs play important roles in recognizing
specific signature molecules derived from pathogens including
bacteria, fungi, protozoa and viruses, derived from their invasion
of cells, or resultant from the effects of noxious environmental
stimuli which cause cell damage.
[0013] Toll-like Receptors 1, 2, and 6 (TLR1, TLR2 and TLR6). TLR2
recognizes a variety of lipoproteins/lipopeptides from various
pathogens, e.g. Gram-positive bacteria, mycobacteria, Trypanosoma
cruzi, fungi and Treponema (K. Takeda, et al., Annu Rev Immunol,
21:335-76 (2003)). In addition, TLR2 reportedly recognizes LPS
preparations from non-enterobacteria such as Leptospira
interrogans, Porphyromonas gingivalis and Helicobacter pylori.
These LPS structurally differ from the typical LPS of Gram-negative
bacteria recognized by TLR4 in the number of acyl chains in the
lipid A component, which presumably confers differential
recognition; thus, LPS from P. gingivalis only poorly activates
TLR4 (M. Hashimoto, et al., Int Immunol, 16:1431-7 (2004)).
[0014] There are two proposed explanations that could explain why
TLR2 recognizes a wide spectrum of microbial components. The first
is that TLR2 forms heterophilic dimers with other TLRs such as TLR1
and TLR6, both of which are structurally related to TLR2. The
second involves interactions (B. N. Gantner, et al., J Exp Med,
197:1107-17 (2003)) with distinct types of receptors such as
dectin-1, a lectin family receptor for the fungal cell wall
component beta-glucan. Thus, TLR2 recognizes a wide range of
microbial products through functional cooperation with several
proteins that are either structurally related or unrelated to
TLR.
[0015] Toll-like receptor 3 (TLR3). Expression of human TLR3 in
non-responsive cells confers enhanced activation of NF-.kappa.B in
response to dsRNA. In addition, TLR3-deficient mice are impaired in
their response to dsRNA (L. Alexopoulou, et al., Nature, 413:732-8
(2001)) which is produced by most viruses during their replication
and which induces the synthesis of type I interferons
(IFN-.alpha./.beta.). Type I IFNs induce anti-viral and
immunostimulatory activities in the cells. Thus, TLR3 is implicated
in the recognition of dsRNA and viruses and the antiviral gene
response thereto.
[0016] Toll-like Receptor 4 (TLR4). TLR4 is an essential receptor
for LPS recognition (A. Poltorak, et al., Science, 282:2085-8
(1998); K. Hoshino, et al., J Immunol, 162:3749-52 (1999)). In
addition, TLR4 is implicated in the recognition of endogenous
ligands, such as heat shock proteins (HSP60 and HSP70), domain A of
fibronectins, as well as oligosaccharides of hyaluronic acid,
heparan sulfate and fibrinogen. However, since these endogenous
ligands require very high concentrations to activate TLR4,
contamination by LPS is suspected.
[0017] Toll-like Receptor 5 (TLR5). Expression of human TLR5 in CHO
cells confers response to flagellin, a monomeric constituent of
bacterial flagella (F. Hayashi, et al., Nature, 410:1099-103
(2001)). TLR5 is expressed on the basolateral side of intestinal
epithelial cells and intestinal endothelial cells of the
subepithelial compartment. Further, flagellin activates lung
epithelial cells to induce inflammatory cytokine production and a
stop codon polymorphism in TLR5 has been associated with
susceptibility to pneumonia caused by the flagellated bacterium
Legionella pneumophila. These findings indicate the important role
of TLR5 in microbial recognition at the mucosal surface of
mammalian cells.
[0018] Toll-like Receptors 7 and 8 (TLR7 and TLR8). TLR7 and TLR8
are structurally highly conserved proteins, which recognize
guanosine- or uridine-rich, single-stranded RNA (ssRNA) from
viruses such as human immunodeficiency virus, vesicular stomatitis
virus and influenza virus (F. Heil, et al., Science, 303:1526-9
(2004); S. S. Diebold, et al., Science, 303:1529-31 (2004); J. M.
Lund, et al., Proc Natl Acad Sci USA, 101:5598-603 (2004)). ssRNA
is abundant in the host, but usually the host-derived ssRNA is not
detected by TLR7 or TLR8. This might be due to the fact that TLR7
and TLR8 are expressed in the endosome, and host-derived ssRNA is
not delivered to the endosome (see below).
[0019] Toll-like Receptor 9 (TLR9). TLR9 is a receptor for CpG DNA
(H. Hemmi, et al., Nature, 408:740-5 (2000)). Bacterial and viral
DNA contains unmethylated CpG motifs, which confer its
immunostimulatory activity. In vertebrates, the frequency of CpG
motifs is severely reduced and the cytosine residues of CpG motifs
are highly methylated, leading to abrogation of the
immunostimulatory activity. Structurally, there are at least two
types of CpG DNA: B/K-type CpG DNA is a potent inducer of
inflammatory cytokines such as IL-12 and TNF-.alpha.; A/D-type CpG
DNA has a greater ability to induce IFN-.alpha. production from
plasmacytoid dendritic cells (PDC), In addition to recognizing
bacterial and viral CpG DNA, TLR9 is involved in pathogenesis of
autoimmune disorders. Thus it may be important in Graves'
autoimmune hyperthyroidism and mediates production of rheumatoid
factor by auto-reactive B cells (G. A. Viglianti, et al., Immunity,
19:837-47 (2003)). Similarly, internalization by the Fc receptor
can cause TLR9 mediated PDC induction of IFN-.alpha. by immune
complexes containing IgG and chromatin, which are implicated in the
pathogenesis of systemic lupus erythematosus (SLE) (M. W. Boule, et
al., J Exp Med, 199:1631-40 (2004)). Thus, TLR9 appears to be
involved in the pathogenesis of several autoimmune diseases through
recognition of the chromatin structure. Chloroquine, which is
clinically used for treatment of rheumatoid arthritis and SLE, is
currently presumed to block TLR9-dependent signaling through
inhibition of the pH-dependent maturation of endosomes by
neutralizing acidification in the vesicle (H. Hacker, et al., Embo
J, 17:6230-40 (1998)),
[0020] Toll-like Receptor 11 (TLR11). The most recently identified
TLR11 has been shown to be expressed in bladder epithelial cells
and mediate resistance to infection by uropathogenic bacteria in
mouse (D. Zhang, et al., Science, 303:1522-6 (2004)).
[0021] Subcellular Localization of Some TLRs. Individual TLRs are
differentially distributed within the cell. TLR1, TLR2, TLR3 and
TLR4 are expressed on the cell surface; in contrast, TLR3, TLR7,
TLR8 and TLR9 have been shown to be expressed in intracellular
compartments such as endosomes. TLR3-, TLR7- or TLR9-mediated
recognition of their ligands has been shown to require endosomal
maturation and processing. Thus, for example, TLR9 is recruited
from the endoplasmic reticulum upon non-specific uptake of CpG DNA
(H. Hacker, et al., Embo J, 17:6230-40 (1998); E. Latz, et al., Nat
Immunol, 5:190-8 (2004); C. A. Leifer, et al., J Immunol,
173:1179-83 (2004)). When either nonimmune cells that become
antigen presenting cells, macrophages, monocytes, or dendritic
cells engulf bacteria by phagocytosis, they degrade the bacteria
and release CpG DNA in phagosomes-lysosomes or in
endosomes-lysosomes where they can interact TLR9
[0022] Similarly, as another example, when viruses invade cells by
receptor-mediated endocytosis, the viral contents are exposed to
the cytoplasm by fusion of the viral membrane with the endosomal
membrane. This results in exposure of TLR ligands such as dsRNA,
ssRNA and CpG DNA to TLR9 in the phagosomal/lysosomal or
endosomal/lysosomal compartments.
[0023] TLR-independent Recognition of Micro-organisms--dsRNA
Transfection De Novo or RNA/DNA Introduction By viruses--Can
Nevertheless Activate TLR Signaling Pathways. Although TLR3 is
involved in the recognition of viral-derived dsRNA, the impairment
observed in TLR3-deficient mice is only partial (L. Alexopoulou, et
al., Nature, 413:732-8 (2001); M. Yamamoto, et al., Science,
301:640-3 (2003)). Thus, introduction of dsRNA into the cytoplasm
of dendritic cells leads to the induction of type I IFNs
independent of TLR3 (S. S. Diebold, et al., Nature, 424:324-8
(2003)). Although PKR is implicated in dsRNA recognition, it is
still controversial if it plays a critical role in dsRNA-induced
type I IFN expression (E. J. Smith, et al., J Biol Chem, 276:8951-7
(2001)).
[0024] Recently, one key molecule that mediates TLR3-independent
dsRNA recognition was shown to be Retinoic acid-inducible gene I
(RIG-I). RIG-1 encodes a DExD/H box RNA helicase containing a
caspase recruitment domain that augments dsRNA-dependent activation
of the IRF-3-dependent promoter.
[0025] The nucleotide-binding oligomerization domain (NOD) family
of proteins also plays an important role in the TLR-independent
recognition of intracellular bacteria.
[0026] NOD1 contains a caspase-recruitment domain (CARD), a NOD
domain and a C-terminal LRR domain. Overexpression of NOD1 enables
cells to respond to peptidoglycans (PGN) which are recognized by
TLR2 (O. Takeuchi, et al., Immunity, 11:443-51, (1999));
c-D-glutamyl-meso diaminopimelic acid (iE-DAP) is the minimal PGN
structure required. NOD2 shows structural similarity to NOD1, but
possesses two CARD domains and the essential structure recognized
by NOD2 is a muramyl dipeptide MurNAc-L-Ala-D-isoGln (MDP) derived
from PGN. MDP is found in almost all bacteria, whereas iE-DAP is
restricted to Gram-negative bacteria.
[0027] Mutations in the NOD2 gene have been shown to be associated
with Crohn's disease (Y. Ogura, et al., Nature, 411:603-6 (2001);
J. P. Hugot, et al., Nature, 411:599-603 (2001)), result in
enhanced NF-.kappa.B activation and may contribute to enhanced
NF-.kappa.B activity and Th1 responses in Crohn's disease patients
(T. Watanabe, et al., Nat Immunol, 5:800-8 (2004)). NOD2 mutations
also lead to an increase in NF-.kappa.B activity and are associated
with Blau syndrome, a disease characterized by granulomatous
arthritis, uveitis and skin rash (C. Miceli-Richard, et al., Nat
Genet, 29:19-20 (2001)).
[0028] Rip2/RICK, a serine/threonine kinase, has a CARD domain in
its C-terminal portion and an N-terminal catalytic domain that
shares sequence similarity with Rip, a factor essential for
NF-.kappa.B activation through the TNF receptor. NODs and Rip2/RICK
interact via their respective CARD domains, and induce recruitment
of the IKK complex to the central region of Rip2/RICK. This in turn
leads to activation of NF-.kappa.B.
[0029] TLR Signaling Pathways--MyD88 Pathway and NF-.kappa.B/MAP
Kinase Signals. In the signaling pathways downstream of the TIR
domain, a TIR domain-containing adaptor, MyD88, was the first shown
to be essential for induction of inflammatory cytokines such as
TNF-.alpha. and IL-12 through all TLRs (F. Hayashi, et al., Nature,
410:1099-103 (2001); H. Hemmi, et al., Nat Immunol, 3:196-200
(2002); O. Takeuchi, et al., Int Immunol, 12:113-7, (2000); T.
Kawai, et al., Immunity 11:115-22, (1999); M. Schnare, et al., Curr
Biol, 10:1139-42 (2000); H. Hacker, et al., J Exp Med, 192:595-600
(2000)). However, activation of specific TLRs led to slightly
different patterns of gene expression profiles. For example,
activation of TLR3 and TLR4 signaling pathways resulted in
induction of type I interferons (IFNs), but activation of TLR2-and
TLR5-mediated pathways did not (V. Toshchakov, et al., J Endotoxin
Res, 9:169-75 (2003); K. Hoshino, et al., Int Immunol, 14:1225-31
(2002); S. Doyle, et al., Immunity, 17:251-63 (2002)). TLR7, TLR8
and TLR9 signaling pathways also lead to induction of Type I IFNs
through mechanisms distinct from TLR3/4-mediated induction (H.
Hemmi, et al., J Immunol, 170:3059-64 (2003); T. Ito, et al., J Exp
Med, 195:1507-12 (2002)). Thus, individual TLR signaling pathways
are divergent, although MyD88 is common to all TLRs. It has thus
become clear that there are MyD88-dependent and MyD88-independent
pathways.
[0030] The MyD88-dependent pathway is analogous to signaling by the
IL-1 receptors. As currently perceived, MyD88, harboring a
C-terminal TIR domain and an N-terminal death domain, associates
with the TIR domain of TLRs. Upon stimulation, MyD88 recruits
IRAK-4 to TLRs through interaction of the death domains of both
molecules, and facilitates IRAK-4-mediated phosphorylation of
IRAK-1. Activated IRAK-1 then associates with TRAF6, leading to the
activation of two distinct signaling pathways. One pathway leads to
activation of AP-1 transcription factors through activation of MAP
kinases. Another pathway activates the TAK1/TAB complex, which
enhances activity of the I.kappa.B kinase (IKK) complex. Once
activated, the IKK complex induces phosphorylation and subsequent
degradation of I.kappa.B, which leads to nuclear translocation of
transcription factor NF-.kappa.B. The MyD88-dependent pathway plays
a crucial role and is essential for inflammatory cytokine
production through all TLRs. Thus, MyD88-deficient mice do not show
production of inflammatory cytokines such as TNF-.alpha. and
IL-12p40 in response to all TLR ligands (F. Hayashi, et al.,
Nature, 410:1099-103, (2001); H. Hemmi, et al., Nat Immunol,
3:196-200 (2002); O. Takeuchi, et al., Int Immunol, 12:113-7
(2000); T. Kawai, et al., Immunity, 11:115-22 (1999); M. Schnare,
et al., Curr Biol, 10:1139-42 (2000); H. Hacker, et al., J Exp Med,
192:595-600 (2000)).
[0031] A MyD88 related TIR domain-containing molecule: TIRAP (TIR
domain-containing adaptor protein)/Mal (MyD88-adaptor-like) (T.
Horng, et al., Nat Immunol, 2:835-41 (2001); K. A. Fitzgerald, et
al., Nature, 413:78-83 (2001)) has been shown to be essential for
the MyD88-dependent signaling pathway via TLR2 and TLR4. Thus,
TIRAP/Mal-deficient macrophages show impaired inflammatory cytokine
production in response to TLR4 and TLR2 ligands (T. Horng, et al.,
Nature, 420:329-33 (2002); M. Yamamoto, et al., Nature, 420:324-9
(2002)) but are not impaired in their response to TLR3, TLR5, TLR7
and TLR9 ligands,
[0032] MyD88-independent/TRIF-dependent Pathway and IRF-3/Type 1
IFN Signaling. TLR4 ligand-induced production of inflammatory
cytokines is not observed in MyD88-deficient macrophages, however
activation of NF-.kappa.B is observed with delayed kinetics (T.
Kawai, et al., J Immunol, 167:5887-94 (2001)). Thus, a
MyD88-independent component exists
[0033] In TLR3-and TLR4-mediated signaling pathways, activation of
IRF-3 and induction of IFN-.beta. are observed in a
MyD88-independent manner. The TIR domain-containing adaptor, TRIF,
is essential for the MyD88-independent pathway; however, in the
case of TLR4, but not TLR3, the TIR domain-containing adaptor,
TRAM, is also involved in the TRIF-dependent activation of IRF-3
and induction of IFN-.beta.-and IFN-inducible genes pathway as
evidenced in TRAM-deficient mice or by RNAi-mediated knockdown (K.
A. Fitzgerald, et al., J Exp Med, 198:1043-55 (2003); M. Yamamoto,
et al., Nat Immunol, 4:1144-50 (2003); H. Oshiumi, et al., J Biol
Chem, 278:49751-62 (2003)).
[0034] Non-typical IKKs, IKKi/IKKe and TBK1, mediate activation of
IRF-3 downstream of TRIF as well as the late phase of NF-.kappa.B
activation in a MyD88-independent manner (T. Kawai, et al., J
Immunol, 167:5887-94 (2001)). Activation of IRF-3 leads to
production of IFN-.beta.. IFN-.beta. in turn activates Stat1 and
induces several IFN-inducible genes (V. Toshchakov, et al., J
Endotoxin Res, 9:169-75 (2003); K. Hoshino, et al., Int Immunol,
14:1225-31 (2002); S. Doyle, et al., Immunit, 17:251-63, (2002)).
The physiological role of TRIF was demonstrated by generation of
TRIF-deficient or TRIF-mutant mice which showed no activation of
IRF-3 and had impaired expression of IFN-.beta.-and IFN-inducible
genes in response to TLR3 and TLR4 ligands (S. S. Diebold, et al.,
Nature, 424:324-8 (2003)).
[0035] In TRIF-and TRAM-deficient mice, inflammatory cytokine
production induced by TLR2, TLR7 and TLR9 ligands was observed, as
well as TLR4 ligand-induced phosphorylation of IRAK-1 (S. S.
Diebold, et al., Nature, 424:324-8 (2003); M. Yamamoto, et al., Nat
Immunol, 4:1144-50 (2003)). These findings indicate that the
MyD88-dependent pathway is not impaired in these mice. However,
TLR4 ligand-induced inflammatory cytokine production was also not
observed in TRIF-and TRAM-deficient mice. Therefore, activation of
both the MyD88-dependent and MyD88-independent/TRIF-dependent
components is believed to be required for the TLR3/4-induced
inflammatory cytokine production.
[0036] Key molecules that mediate IRF-3 activation have been
revealed to be non-canonical IKKs, TBK1 and IKKi/IKKe. Thus,
introduction of TBK1 or IKKi/IKKe, but not IKKb, resulted in
phosphorylation and nuclear translocation of IRF-3. Also,
RNAi-mediated inhibition of TBK1 or IKKi/IKKe expression led to
impaired induction of IFN-.beta. in response to viruses and dsRNA
(S. Sharma, et al., Science, 300:1148-51, (2003)).
[0037] The Mechanisms of MyD88-independent TLR Signaling of Both
IRF-3 and NF-.kappa.B Pathways by TLR3: The TIR domain of TRIF is
located in the middle portion of this molecule, flanked by the
N-terminal and C-terminal portions. Both N-terminal and C-terminal
portions of TRIF mediate activation of the NF-.kappa.B-dependent
promoter, whereas only the N-terminal portion is involved in
IFN-.beta. promoter activation (M. Yamamoto, et al., J Immunol,
169:6668-72 (2002)). Accordingly, the N-terminal portion of TRIF
was shown to associate with IKKi/IKKe and TBK1, which mediate
IRF-3-dependent IFN-.beta. induction (K. A. Fitzgerald, et al., Nat
Immunol, 4:491-6 (2003); S. Sato, et al., J Immunol, 171:4304- 10
(2003)). The N-terminal portion of TRIF was also shown to associate
with TRAF6 (S. Sato, et al., J Immunol, 171:4304-10 (2003); Z.
Jiang, et al., Proc Natl Acad Sci USA, 101:3533-8 (2004)); TRAF6 is
critically involved in TLR-mediated NF-.kappa.B activation (J.
Gohda, et al., J Immunol, 173:2913-7 (2004)), The C-terminal
portion of TRIF was shown to associate with RIP1 (E. Meylan, et
al., Nat Immunol, 5:503-7 (2004)); thus, RIP1 was shown to be
responsible for NF-.kappa.B activation that originates from the
C-terminal portion of TRIF.
[0038] Negative Regulation of TLR Signaling. Stimulation of TLRs by
microbial components triggers the induction of inflammatory
cytokines such as TNF-.alpha., IL-6 and IL-12. When all these
cytokines are produced in excess, they induce serious systemic
disorders with a high mortality rate in the host. It is therefore
not surprising that organisms have evolved mechanisms for
modulating their TLR-mediated responses. TLR signaling pathways are
negatively regulated by several molecules. IRAK-M inhibits
dissociation of IRAK-1/IRAK-4 complex from the receptor. MyD88s
blocks association of IRAK-4 with MyD88. SOCS1 is likely to
associate with IRAK-1 and inhibits its activity. TRIAD3A induces
ubiquitination-mediated degradation of TLR4 and TLR9. TIR
domain-containing receptors SIGIRR and T1/ST2 are also shown to
negatively modulate TLR signaling. Thus, several molecules are
postulated to negatively modulate TLR signaling pathways and in
combination may normally finely coordinate the TLR signaling
pathway to limit exaggerated innate responses causing harmful
disorders.
[0039] Exposure to microbial components such as LPS results in a
severely reduced response to a subsequent challenge by LPS, termed
endotoxin or LPS tolerance. Several negative regulation mechanisms
are also shown to be involved in LPS tolerance (H. Fan, et al., J
Endotoxin Res, 10:71-84 (2004)).
[0040] C. IRF-1 Signaling Induced by Overexpressed TLR3 or TLR4
Signaling is Critical in Autoimmune Inflammatory Disease
[0041] The regulatory effect of IRF-1 has been reported in several
in vitro and in vivo models of autoimmune-inflammatory diseases:
Arthritis (A. Shiraishi, et al., J Immunol, 159:3549-54 (1997); T.
Inoue, et al., J Rheumatol, 28:1229-37 (2001); S. John, et al., J
Rheumatol, 28:1752-5 (2001)), colitis (M. Clavell, et al., J
Pediatr Gastroenterol Nutr, 30:43-7 (2000)); (M. Kennedy, et al.,
Int J Mol Med, 4:437-43 (1999)), neurological inflammation (M.
Delgado, et al., J Immunol, 162:4685-96 (1999); U. Schlomann, et
al., J Neurosci, 20:7964-71 (2000)), cerebral ischemia (C.
ladecola, et al., J Exp Med, 189:719-27 (1999); W. Paschen, et al.,
Neuroreport, 9:3147-51 (1998)); V. L. Raghavendra Rao, et al., J
Neurochem, 83:1072-86 (2002)), lung injury (V. R. Sunil, et al., Am
J Physiol Lung Cell Mol Physiol, 282:L872-80 (2002)), myositis (S.
Matsubara, et al., J Neuroimmunol, 119:223-30 (2001)), myocarditis
(K. Azzam-Smoak, et al., Virology, 298:20-9 (2002); S. Kawamoto, et
al., J Virol, 77:9622-31 (2003); R. Kamijo, et al., Science,
263:1612-5 (1994); J. R. Allport, et al., J Exp Med, 186:517-527
(1997)), endotoxic shock (G. Andonegui, et al., J Clin Invest,
111:1011-1020 (2003); V. L. Raghavendra Rao, et al., J Neurochem,
83:1072-86 (2002); S. Heinz, et al., J Biol Chem, 278:21502-9
(2003); C. W. Wieland, et al., Infect Immun, 70:1352-8 (2002); Y.
Pang, et al., Brain Res, 914:15-22 (2001); O. Kobayashi, et al., Am
J Physiol Gastrointest Liver Physiol, 281:688-96, (2001)), diabetes
(A. Akabane, et al., Biochem Biophys Res Commun, 215:524-30 (1995);
M. S. Baker, et al., Surgery, 134:134-41 (2003); C. A. Gysemans, et
al., Diabetologia, 44:567-74 (2001); A. E. Karlsen, et al., J Clin
Endocrinol Metab, 85:830-6 (2000); T. Nakazawa, et al., J Autoimmun
17:119-25, (2001)), hepatitis (B. Jaruga, et al., Am J Physiol
Gastrointest Liver Physiol, 287:G1044-52 (2004); P. M. Pitha, et
al., Biochimie, 80:651-8 (1998)), systemic lupus erythematosus
(SLE), (K. M. Pollard, et al., Ann N Y Acad Sci, 987:236-9 (2003)),
and a multifocal inflammatory model with autoimmune components (N.
L. Mccartney-Francis, et al., J Immunol, 169:5941-7 (2002)). IRF-1
is implicated in patients with, autoimmune myocarditis associated
with viral infection in human and in rodent models (K. Bachmaier,
et al., Circulation, 96:585-91 (1997)).
[0042] IRF-1 can up-regulate the inflammatory immune response at
the innate and adaptive level by increasing the inflammatory gene
expression in macrophages, dendritic cells and CD-4 T cells. Thus,
upregulation of IRF-1 gene expression can increase the expression
of inflammatory mediators such as arachidonic acid signaling, COX-1
and, COX-2 enzymes (X. Teng, et al., Am J Physiol Cell Physiol,
282:C144-52, (2002)), chemokines (M. S. Baker, et al., Surgery,
134:134-41 (2003); Y. Ohmori, et al., J Leukoc Biol, 69:598-604
(2001)), iNOS (M. Delgado, et al., J Immunol, 162:4685-96 (1999);
M. S. Baker, et al., Surgery, 134:134-41 (2003); X. Teng, et al.,
Am J Physiol Cell Physiol, 282:C144-52 (2002); Y. Ohmori, et al., J
Leukoc Biol, 69:598-604 (2001)), IL-12 p40 (M. Clavell, et al., J
Pediatr Gastroenterol Nutr, 30:43-7 (2000); C. Feng, et al., Int
Immunol, 11:1185-94 (1999)) Type 1 IFN-.alpha. and-.beta. (L. A.
Eader, et al., Cell Immunol, 157:211-22 (1994); S. Kirchhoff, et
al., Eur J Biochem, 261:546-54 (1999)), as well as the
pro-inflammatory cytokines TNF-.alpha., IL1-.beta., IL-6, IL-12 and
INF-.gamma.. IRF-1 gene overexpression may thus induce
autoimmune-inflammatory diseases by its effects on macrophages,
dendritic cells and CD4.+-.Th1 cell lymphocytic cells.
[0043] Despite information implicating the importance of IRF-1
signaling in macrophages, dendritic cells and CD4.+-.Th1 cell
lymphocytic cells, comparable effects, after TLR3 or TLR4 mediated
increases of IRF-1 in nonimmune cells, have been less clear.
However, studies of the effects of methimazole, methimazole
derivatives, and tautomeric cyclic thiones, particularly
phenylmethimazole (C10) related to Hashimoto's thyroiditis,
Colitis, toxic shock, and atherosclerosis summarized herein
establish the importance of its overexpression in nonimmune cells
associated with or caused by TLR3 or TLR4 signal
overexpression.
[0044] D. IRF-1 Signalling Induced by Overexpressed TLR4 Signaling
is Critical in Atherosclerosis
[0045] Leukocyte adhesion is central to atherosclerosis, an
autoimmune-inflammatory disease. One of the earliest steps in the
development of atherosclerotic lesions is the adhesion of
leukocytes (monocytes and lymphocytes) to the apical surface of the
endothelium and subsequent migration across the endothelium into
the subendothelial space at select anatomical sites in the arterial
tree. This process occurs through a cascade of adhesive events.
This adhesion cascade is mediated, in part, by binding of molecules
present on the surface of the leukocyte (e.g. .beta..sub.1
integrins) to adhesion molecules on the surface of the endothelium
(e.g VCAM-1). Subsequent to migrating into the extravascular space,
the monocyte-derived macrophages ingest lipids and become foam
cells. Activation of the recruited leukocytes is believed to induce
release of important mediators of inflammation (e.g.
pro-inflammatory cytokines) that serve to continue the process of
lesion development. Smooth muscle cells are recruited to the fatty
spot and, together with the foam cells and lymphocytes, form the
fatty streak (intermediate lesion). This entire process can
continue leading to a fibrofatty lesion and ultimately to a fibrous
plaque. Throughout plaque development, the vascular endothelium
remains intact. Since the mechanisms of atherogenesis are similar
to those present in "general" pathological inflammation,
atherosclerosis is often considered a disease of pathological
inflammation. Indeed, it has recently been shown that inhibition of
the potent pro-inflammatory cytokine TNF-.alpha. reduces
atherosclerosis in a murine model (L. Branen, et al., Arterioscler
Thromb Vasc Biol, 24:2137-42 (2004)).
[0046] Endothelial cell adhesion molecules (ECAMs), which are known
to participate in leukocyte recruitment during pathological
inflammation, (e.g VCAM-1, E-selectin and ICAM-1), have been shown
to be up-regulated at sites of inflammation and to contribute to
disease progression and/or tissue damage by virtue of their role in
leukocyte adhesion (F. W. Luscinskas, et al., Annu. Rev. Med.,
47:413-421 (1996)). VCAM-1 has received the most interest in the
context of atherosclerosis. VCAM-1 has been observed in a localized
fashion on aortic endothelium that overlies early foam cell lesions
(M. I. Cybulsky, et al., Science, 251:788-791 (1991)) and has been
shown to play an important role in monocyte and lymphocyte adhesion
to and migration across the endothelium (F. W. Luscinskas, et al.,
J. Cell Biol., 125:1417-27 (1994); C. L. Ramos, et al., Circ. Res.,
84:1237-44 (1999)). Studies with the Apolipoprotein E-deficient
(ApoE.sup.-/-) mouse, a well-accepted model of human
atherosclerosis, revealed that VCAM-1 is present on endothelium at
lesion-prone sites (as early as 5 weeks) and developed lesions (Y.
Nakashima, et al., Arterioscler. Thromb. Vasc. Biol.,
18:842-51(1998)). Monocytes exhibit greatly increased adhesion to
carotid arteries isolated from ApoE.sup.-/- mice compared to
carotid arteries isolated from wild-type mice and this increased
adhesion is mediated, in part, by VCAM-1 (C. L. Ramos, et al.,
Circ. Res., 84:1237-44 (1999)).
[0047] The expression of ECAMs is regulated, in part, by
pro-inflammatory cytokines (e.g. TNF-.alpha.) which increase the
activity of certain transcription factors (e.g. NF-.kappa.B) (M. J.
May, et al., Immunol. Today, 19:80-88 (1998)) and IRF-1 (A. S.
Neish, et al., Mol. Cell Biol., 15:2558-2569 (1995)). The activated
or increased transcription factors bind to promoter elements on the
ECAM genes. Several current or potential therapeutics for
pathological inflammation work, at least in part, by modulating the
activity of transcription factors to inhibit leukocyte adhesion to
the endothelium and reduce inflammation in animal models (E. M.
Conner, et al., J Pharmacol. Exp. Ther., 282:1615-1622 (1997); J.
W. Pierce, et al., J. Immunol., 156:3961-3969 (1996); N. M. Dagia,
et al., Am. J Phys., 285:C813-C822 (2003); C. Weber, et al.,
Circulation, 91:1914-1917 (1995))
[0048] One such group includes methimazole, methimazole
derivatives, and tautomeric cyclic thiones (Kohn, L. D., et al.,
U.S. Pat. No. 6,365,616 Apr. 2, (2002.); Kohn, L. D., et al., U.S.
patent application Ser. No. 10/801,986, (2004)). When tested
phenylmethimazole (C10), reduced pro-inflammatory (e.g
TNF-.alpha.)-induced ECAM expression and consequent leukocyte
adhesion to endothelial cells (N. M. Dagia, et al., J Immunol,
173:2041-9 (2004)), C10 (i) inhibits monocytic cell adhesion to
cytokine inflamed human aortic endothelial cells (HAEC) under in
vitro flow conditions that mimic conditions present in vivo; (ii)
strongly inhibits cytokine-induced HAEC expression of VCAM-1 at the
protein and mRNA level; (iii) has a modest effect on E-selectin
expression; and (iv) has very little effect on ICAM-1
expression.
[0049] The VCAM-1 promoter contains several cis elements known to
play a role in TNF-.alpha. induced human VCAM-1 expression:
NF-.kappa.B, AP-1, SP-1, IRF-1 and GATA. TNF-.alpha. stimulation of
endothelial cells activates NF-.kappa.B (M. J. May, et al.,
Immunol. Today, 19:80-88 (1998)); however, C10 does not appear to
have any effect on NF-.kappa.B translocation to the nucleus or
binding to the VCAM-1 promoter (N. M. Dagia, et al., J Immunol,
173:2041-9 (2004)). IRF-1 is present at a very low level in resting
endothelial cells; however, upon stimulation with TNF-.alpha.,
IRF-1 is induced, binds to the VCAM-1 promoter, and is necessary
for full cytokine-induced transcriptional activation (A. S. Neish,
et al., Mol. Cell Biol., 15:2558-2569 (1995); N. M. Dagia, et al.,
J Immunol, 173:2041-9 (2004)). C10 inhibits TNF-.alpha. induced
IRF-1 expression at the protein and mRNA level. While several
inhibitors of VCAM-1 are known, very few, if any, have been shown
to selectively suppress VCAM-1, to act via IRF-1, and to inhibit
monocytic cell adhesion to cytokine inflamed endothelium under
fluid shear.
[0050] The mechanism of TNF-.alpha. induction of IRF-1 in
endothelial cells involves Stat1. The IRF-1 promoter region
contains two NF-.kappa.B binding sites and an activated Stat1-GAS
binding sequence (Y. Ohmori, et al., J Biol Chem, 272:14899-907
(1997); H. Ochi, et al., Eur J Immunol, 32:1821-31 (2002)).
Although TNF-.alpha.-activated NF-.kappa.B is directly involved in
the activation of IRF-1 gene transcription, NF-.kappa.B is,
insufficient for full expression and requires Stat1 occupation of
the GAS site. Stat1 could be increased by indirect or direct means.
Thus, TNF-.alpha. could induce IRF-1 promoter activity by its
effect on NF-.kappa.B, an increase in type I IFN, and the
autocrine/paracrine activation of Type I IFN on Stat1 (O. Tliba, et
al., J Biol Chem, 278:50615-23 (2003)) Alternatively, TNF-.alpha.
may directly activate Stat1 since (H. Ochi, et al., Eur J Immunol,
32:1821-31 (2002)), cycloheximide, a protein synthesis inhibitor,
does not affect TNF-.alpha. induced IRF-1 expression in human
umbilical vein endothelial cells (HUVEC), suggesting that
TNF-.alpha. can induce increased IRF-1 expression without protein
synthesis, i.e., without de novo synthesis of IFN.
[0051] E. Overexpression of Toll-Life Receptors and Signalling in
Autoimmune Inflammatory Disease
[0052] Several lines of evidence have emerged in the past several
years, which implicate TLRs in inflammatory-autoimmune disorders.
For example, constitutive activation of immune cells caused by
defective IL-10 signaling results in development of chronic
enterocolitis (K. Takeda, et al., Immunity, 10:39-49 (1999)).
Introduction of TLR4 deficiency into these mutant mice results in
improvement of intestinal inflammation (M. Kobayashi, et al., J
Clin Invest, 111:1297-308 (2003)). Development of atherosclerosis
observed in apolipoprotein E-deficient mice is rescued by
introduction of MyD88 deficiency, implicating the TLR-mediated
pathway in the development of atherosclerosis (K. S. Michelsen, et
al., Proc Natl Acad Sci USA, 101:10679-84 (2004)). Involvement of
the TLR9-MyD88-dependent pathway in the induction of
auto-antibodies in SLE and rheumatoid arthritis is described
above.
[0053] Overexpressed TLR3/TLR4 and TLR3/TLR4 Signals in Nonimmune
Cells as well as Monocytes, Macrophages, and Dendritic Cells Are
Associated with Autoimmune-inflammatory Diseases. Multiple
autoimmune inflammatory diseases are now associated with
overexpressed TLR3 and TLR4 and or their signals in nonimmune
cells, monocytes, macrophages, and dendritic cells. In the case of
TLR3/TLR3 signaling, these include Hashimoto's thyroiditis and Type
1 diabetes; in the case of TLR4/TLR4 signaling these include
ulcerative colitis, Crohn's, atherosclerosis, and toxic shock.
Overexpressed TLR3/4 or TLR3/4 signaling is not limited to these
disorders and includes any disease where TLR signaling is activated
and increases type I IFNs or cytokine-increased ECAM expression and
leukocyte adhesion, e.g., systemic lupus, rheumatoid arthritis, or
any autoimmune-inflammatory disease.
[0054] Hashimoto's Thyroiditis. It is well recognized that TLR3 on
dendritic cells recognize dsRNA, then signal increases in cytokines
and recognition molecules important for immune cell interactions.
TLR3 mRNA and protein are now recognized to be expressed on
thyrocytes and associated with Hashimoto's thyroiditis (N. Harii,
et al., Mol Endocrinol, 19:1231-50 (2005)). TLR3 are functional,
since incubating thyroid cells with Poly (I:C) causes (i)
transcriptional activation of both the NF-.kappa.B/Elk1 and
IRF-3/IFN-.beta. signal paths, (ii) post transcriptional activation
of NF-.kappa.B and ERK1/2, and (iii) increased IFN-.beta. mRNA.
TLR3 can be overexpressed, along with PKR, major histocompatibility
complex (MHC)-I or II, and IRF-1, by transfecting dsRNA into the
cells, infection with Influenza A virus, or incubation with
IFN-.beta., but not by incubation with dsRNA or IFN-gamma, or by
dsDNA transfection. Methimazole (MMI) and derivatives e.g.,
phenylmethimazole (C10), significantly prevents overexpression by
inhibiting increased transcriptional activation of IRF-3 and ISREs,
STAT phosphorylation, but not NF-6.beta. activation. TLR3 can be
functionally overexpressed in cultured human thyrocytes by dsRNA
transfection or IFN-.beta. treatment. Immunohistochemical studies
show TLR3 protein is overexpressed in human thyrocytes surrounded
by immune cells in 100% of patients with Hashimoto's thyroiditis
examined, but not in normal or Graves' thyrocytes. Without wishing
to be bound by theory in any way, it can be concluded that
functional TLR3 are present on thyrocytes; TLR3 downstream signals
can be overexpressed by pathogen-related stimuli; overexpression
can be reversed by C10>>MMI by inhibiting only the
IRF-3/IFN-.beta./STAT arm of the TLR3 signal system; and TLR3
overexpression can induce an innate immune response in thyrocytes
which may be important in the pathogenesis of Hashimoto's
thyroiditis and in the immune cell infiltrates.
[0055] Hashimoto's thyroiditis, the most frequent tissue-specific
autoimmune disease in humans, is characterized by infiltration of
the thyroid gland by B and T lymphocytes, cellular and humoral
autoimmunity, and autoimmune destruction of the thyroid (C. M.
Dayan, et al., N Engl J Med, 335:99-107 (1996)). Thyrocytes of
patients with Hashimoto's thyroiditis, express ICAM-1, B7-1,
essential co-stimulatory molecules important for immune cell
interactions, major histocompatibility complex (MHC) class I,
interferon (IFN) inducible protein IP-10, a CXCL chemokine that
exerts a chemotactic activity on lymphoid cells, and Fas gene, a
member of the closely linked group of tumor necrosis factor genes
(G. Pesce, et al., J Endocrinol Invest, 25:289-95 (2002); M. A.
Garcia-Lopez, et al., J Clin Endocrinol Metab, 86:5008-16
(2001)).
[0056] Infectious agents have been implicated in the induction of
autoimmune disease (J. Guardiola, et al., Crit Rev Immunol,
13:247-68 (1993); R. Gianani, et al., Proc Natl Acad Sci USA,
93:2257-9 (1996); M. S. Horwitz, et al., Nat Med, 4:781-5 (1998);
H. Wekerle, Nat Med, 4:770-1 (1998); C. Benoist, et al., Nature,
394:227-8 (1998)) including thyroiditis (Y. Tomer, et al., Endocr
Rev, 14:107-20 (1993)). In the 1990's it was suggested that viral
triggering of autoimmunity might result from local infection of
tissues, induction of abnormal or increased expression of MHC
genes, presentation of self-antigens to immune cells, and bystander
activation of T cells (M. S. Horwitz, et al., Nat Med, 4:781-5,
(1998); H. Wekerle, Nat Med, 4:770-1, (1998); C. Benoist, et al.,
Nature, 394:227-8, (1998)).
[0057] Endotoxic Shock. A variety of studies have implicated TLR4
in endotoxic shock. For example, C3H/HeJ mice have a point mutation
in the Tlr4 gene that results in defects in TLR4 signaling and
hypo-responsiveness to challenge with LPS (K. Hoshino, et al., J
Immunol, 162:3749-52 (1999)). Recent work (G. Andonegui, et al., J
Clin Invest, 111:1011-1020 (2003)) found strong evidence that
endothelial TLR4, as opposed to leukocyte TLR4, is a critical
player in endotoxic shock. Thus, mice deficient in endothelial
TLR4, but not leukocyte TLR4, had significantly attenuated
leukocyte sequestration in the lungs subsequent to challenge with
LPS
[0058] Cultured murine macrophages, for example RAW 264.7 cells,
when treated with LPS display a rapid induction of many genes,
which are regulators of the inflammatory response and are
considered an in vitro model of changes in endotoxic shock (M. A.
Dobrovolskaia, et al., Microbes Infect, 4:903-14 (2002)). LPS
stimulated genes in cultured murine macrophages include genes
coding for proinflammatory cytokines (IFN-.beta. IL-1.beta.,
TNF-.alpha., IL-6, and IL-12), which act on either the
macrophages/monocytes themselves or on other target cells to
regulate the inflammatory process, which occurs in septic shock.
Upon stimulation with LPS, macrophages can also produce CXC
chemokines such as IP-10, which serve to further attract immune
cells to a site of inflammation (K. M. Kopydlowski, et al., J
Immunol, 163:1537-44 (1999)). Macrophages stimulated with LPS can
also produce nitric oxide (NO) as a result of expression of the
inducible nitric oxide synthase enzyme (iNOS) (C. Bogdan, Nat
Immunol, 2:907-16 (2001)). Each of these factors considered to be
important in the pathogenesis of septic shock are typically absent
or found at extremely low levels in unstimulated macrophages.
[0059] Binding of IFN-.beta. to the type I interferon receptor
results in phosphorylation of Stat I as a key component for the
transduction of a signal to the nucleus to induce expression of
iNOS and IP-10 in the mouse macrophage (Y. Ohmori, et al., J Leukoc
Biol, 69:598-604 (2001)). Stat1 null animals show an approximately
50% enhanced survival rate when challenged with a lethal dose of
LPS (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)) whereas
IFN-.beta. null mice challenged with a lethal LPS dose showed a
100% enhancement of survival (M. Karaghiosoff, et al., Nat Immunol,
4:471-7 (2003)) Therefore, blocking parts of the IFN-.beta. signal
pathway is not as effective as blocking the pathway completely.
[0060] LPS treatment of macrophage/monocytes increases levels of
Interferon Response factor (IRF)-1 (M. A. Dobrovolskaia, et al.,
Microbes Infect, 4:903-14 (2002)). IRF-1 acts as a transcription
factor to directly bind to DNA to enhance transcription of other
genes such as iNOS (R. Kamijo, et al., Science, 263:1612-5 (1994)).
In macrophages treated with LPS IRF-1 is required for the
transcriptional control of the iNOS gene (R. Kamijo, et al.,
Science, 263:1612-5 (1994)). Several other IRF-1 target genes exist
such as the interferon inducible MX gene which codes for the
antiviral Mx protein (D. Danino, et al., Curr Opin Cell Biol,
13:454-60 (2001)). The MX promoter has been shown to contain strong
IRF- 1 binding elements (C. E. Grant, et al., Nucleic Acids Res,
28:4790-9 (2000)).
[0061] The proinflammatory cytokines IL-1.beta., TNF-.alpha., IL-6,
and IL-12 can be induced by LPS signaling through TLR4 (M. A.
Dobrovolskaia, et al., Microbes Infect, 4:903-14 (2002)) and play a
role in endotoxic shock (N. C. Riedemann, et al., J Clin Invest,
112:460-7 (2003)). However, a recent report identified IFN-.beta.
as a critical secondary effector, which is induced upon LPS
activation of TLR4 signaling and contributes to mortality in a
murine septic shock model (M. Karaghiosoff, et al., Nat Immunol,
4:471-7 (2003)).
[0062] Inflammatory Bowel Disease (IBD). TLR4 and components of
normal gastrointestinal gram-negative bacteria appear to play a key
role in the pathogenesis of colitis (C. Fiocchi, Gastroenterology,
115:182-205 (1998); E. Cario, et al., Infect Immun, 68:7010-7
(2000)). The disease is associated with severe inflammation, edema,
and leukocyte infiltration in the colonic tissues(C. Fiocchi,
Gastroenterology, 115:182-205 (1998); E. Cario, et al., Infect
Immun, 68:7010-7 (2000); U. P. Singh, et al., J Immunol, 171:1401-6
(2003); M. B. Grisham, et al., Inflammatory Bowel Disease, 55-64
(1999)). There is increased interferon (IFN) production and
secretion and increased levels of cytokines, including TNF-.alpha.
and IL-1, that up-regulate endothelial cell adhesion molecules
(ECAMs), in particular VCAM-1, which are associated with leukocyte
adhesion. There are increased chemokine levels such as IP-10 which
is known to be colitis related (U. P. Singh, et al., J Immunol,
171:1401-6 (2003)).
[0063] Cario et al. (E. Cario, et al., Infect Immun, 68:7010-7
(2000)), reported that TLR4 was upregulated in intestinal
epithelial cell lines isolated from patients with IBD. Using the
dextran sodium sulfate (DSS)--induced murine model of colitis
related to Crohn's and ulcerative colitis, Ortega-Cava et al. (C.
F. Ortega-Cava, et al., J Immunol, 170:3977-85 (2003)) found that
TLR4 is upregulated in the colon of colitic mice relative to normal
mice. Enterocolitis was reported to be significantly improved in
TLR4/Stat3-deficient mice, whereas TNF-.alpha./Stat3 deficient mice
still had severe enterocolitis, also indicating the importance of
TLR4 in mouse models of enterocolitis (M. Kobayashi, et al., J Clin
Invest, 111:1297-308 (2003)).
[0064] Atherosclerosis and the Vascular Complications of Types 1
and 2 Diabetes, Obesity, and Hypertension: Recent studies have
demonstrated the importance of TLR4 in the initiation and
progression of atherosclerosis (K. S. Michelsen, et al., Proc Natl
Acad Sci USA, 101:10679-84 (2004); G. Pasterkamp, et al., Eur J
Clin Invest, 34:328-34 (2004); G. Andonegui, et al., J Clin Invest,
111:1011-1020 (2003)). Thus, mouse knockout studies and studies of
human TLR4 polymorphisms have demonstrated that TLR4 plays a role
in the initiation and progression of atherosclerosis and vascular
disease. Further, (K. S. Michelsen, et al., Proc Natl Acad Sci USA,
101:10679-84 (2004)) mice deficient in endothelial cell TLR4 had a
significant reduction in aortic plaque development in
atherosclerosis-prone apolipoprotein E-deficient (ApoE-/-) mice and
the lack of TLR4 signaling can result in reduced monocyte adhesion
to TLR4 .sup.-/-endothelium.
[0065] The model that has emerged is that oxidized LDL,
enteroviruses or enterobacteria act as noxious injurious events to
increase TLR expression in areas of turbulent blood flow. The
increase in the MyD88 pathway, NF-.kappa.B, and the cytokine,
TNF.alpha., increase VCAM-1 and attract leukocytes. Thus, it is
already suggested that it is important to not only block high
lipids and or high blood pressure that induce damage at the lesion
foci, but also to block pathologic TLR4 induction and signaling
causing immune cell attraction and leukocyte adhesion (G.
Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004)).
[0066] Type 1 Diabetes: A recent report has associated
overexpressed TLR3 in pancreatic .beta. cells and destructive
changes in Type 1 diabetes (L. Wen, et al., J Immunol, 172:3173-80
(2004)). Moreover, the report showed dsRNA could induce insulinitis
and type 1 diabetes in animals, consistent with the known animal
model wherein coxsacki virus induces Type 1 diabetes in NOD mice.
Devendra and Eisenbarth (D. Devendra, et al., Clin Immunol,
111:225-33 (2004)) point out that a wide variety of studies have
implicated enteroviruses as a potential agent in the pathogenesis
of type 1 diabetes suggesting that the mechanism of viral infection
leading to .beta. cell destruction involves the cytokine interferon
alpha (IFN-.alpha.) [a Type I IFN like IFN.beta.], and hypothesize
that activation of TLR by dsRNA and induction of IFN-.alpha., may
activate or accelerate immune-mediated beta cell destruction. They
conclude (D. Devendra, et al., Clin Immunol, 111:225-33 (2004))
that, "therapeutic agents targeting IFN-.alpha. may potentially be
beneficial in the prevention of type 1 diabetes and
autoimmunity."
[0067] Type I diabetes appears to require a permissive genetic
background and an external factor which may be viral. Islet cell
antibodies are common in the first months of the disease. They
probably arise in part due to .beta. cell injury and represent a
primary autoimmune disease. The preeminent metabolic abnormality in
Type 1 diabetes is hyperglycemia and glucosuria. Late complications
of diabetes are numerous and include increased atherosclerosis with
attendant stroke and heart complications, kidney disease and
failure, and neuropathy that can be totally debilitating. The link
to HLA antigens has been known since 1970. Certain HLA alleles are
associated with increased frequency of disease, others with
decreased frequency. Increased MHC class I and aberrant MHC class
II expression in islet cells has been described (G. F. Bottazzo, et
al., N Engl J Med, 313:353-60 (1985); A. K. Foulis, et al.,
Diabetes, 35:1215-24 (1986)). A definitive link to MHC class I has
been made in a genetic animal model of the disease. Thus MHC class
I deficiency results in resistance to the development of diabetes
in the NOD mouse (D. V. Serreze, et al., Diabetes, 43:505-9 (1994);
L. S. Wicker, et al., Diabetes, 43:500-4 (1994)). Combined with
recent TLR3 data, and data from Coxsackie virus mouse models, it is
hypothesized that infection or environmental induction of Type 1
diabetes occurs in a genetically susceptible mammal, that GAD and
anti-islet cell antibodies are abnormal for a prolonged latent
phase before total islet cell destruction, and that TLR-induced
changes in MHC genes are important in disease expression.
[0068] Environmental Inducers of Autoimmune-Inflammatory Disease:
The TLR signaling pathway and its pathologic expression in
nonimmune cells represents an intriguing link between viral agents
and autoimmune-inflammatory disease. For example, multiple viruses
have been linked to type 1 diabetes, (e.g., Coxsackie B4 virus) (J.
Guardiola, et al., Crit Rev Immunol, 13:247-68 (1993); R. Gianani,
et al., Proc Natl Acad Sci USA, 93:2257-9 (1996); M. S. Horwitz, et
al., Nat Med, 4:781-5 (1998); H. Wekerle, Nat Med, 4:770-1 (1998);
C. Benoist, et al., Nature, 394:227-8 (1998); Y. Tomer, et al.,
Endocr Rev, 14:107-20 (1993); M. F. Prummel, et al., Thyroid,
13:547-51 (2003); G. S. Cooper, et al., J Rheumatol, 28:2653-6
(2001); M. M. Ward, et al., Arch Intern Med, 152:2082-8 (1992)).
The involvement of other "noxious" environmental events is also
suspected.
[0069] One example of a noxious environmental induction process is
tobacco and smoking. Many epidemiologic studies have found a
positive association between smoking and autoimmune-inflammatory
conditions including rheumatoid arthritis, autoantibodies, Raynaud
phenomenon, Goodpasture syndrome, and Graves' disease (I. Roitt,
Essential Immunology, 7th ed., 312-346 (1991); S. A. Jimenez, et
al., Ann Intern Med, 140:37-50 (2004); C. Nagata, et al., Int J
Dermatol, 34:333-7 (1995)). A significant increase in the risk of
systemic lupus erythematosus (SLE) has been indicated, as well as
rapid development of end-stage renal disease in these patients (G.
S. Cooper, et al., J Rheumatol, 28:2653-6 (2001); M. M. Ward, et
al., Arch Intern Med, 152:2082-8 (1992)) Smoking is an independent
risk factor for diabetes and aggravates the risk of serious disease
and premature death (E. B. Rimm, et al., Am J Public Health,
83:211-4 (1993); E. B. Rimm, et al., BMJ, 310:555-9 (1995); N.
Kawakami, et al., Am J Epidemiol, 145:103-9 (1997); D. Haire-Joshu,
et al., Diabetes Care, 22:1887-98 (1999); J. C. Will, et al., Int J
Epidemiol, 30:540-6 (2001)). Results from both cross-sectional and
prospective studies show enhanced risk for micro- and macrovascular
disease, as well as premature mortality from the combination of
smoking and diabetes. On the molecular and cellular levels, a
potentially important pathogenic mechanism is the production of
chemically altered DNA by reactive elements in cigarette smoke,
resulting in the production of autoantibodies specifically against
altered DNA (B. H. Hahn, N Engl J Med, 338:1359-68 (1998); J. B.
Winfield, et al., J Clin Invest, 59:90-6 (1977)). Additionally,
smoking enhances the ability of high glucose levels to affect the
walls of the arteries, making them more likely to develop fatty
deposits. Smoking enhances a diabetic's chance of having high blood
pressure, high levels of lipids such as triglycerides, and lower
levels of the protective HDL cholesterol. Cigarette smoking may
thus act in concert with other environmental triggers, such as
oobesity or infectious agents, and can be construed as a major and
related environmental factor in the development of diabetes and its
complications.
[0070] Therefore, it is evident that Hashimoto's thyroiditis may be
grouped with insulinitis and Type 1 diabetes, colitis, toxic shock,
and atherosclerosis as an autoimmune/inflammatory disease
associated with TLR3 or TLR4 overexpression and signaling in
nonimmune cells, monocytes, macrophages, and dendritic cells by an
induction process involving molecular signatures of environmental
pathogens (K. S. Michelsen, et al., Proc Natl Acad Sci USA,
101:10679-84 (2004); G. Pasterkamp, et al., Eur J Clin Invest,
34:328-34 (2004); D. Devendra, et al., Clin Immunol, 111:225-33
(2004); L. Wen, et al., J Immunol, 172:3173-80 (2004); G.
Andonegui, et al., J Clin Invest, 111:1011-1020 (2003); C. Fiocchi,
Gastroenterology, 115:182-205 (1998); B. Beutler, Nature,
430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7
(2004)). The present invention provides for the use of
phenylmethimazoles, methimazole derivatives, and tautomeric cyclic
thiones for the treatment of autoimmune/inflammatory diseases
associated with TLR3 or TLR4 overexpression and signaling in
nonimmune cells as well as monocytes, macrophages, and dendritic
cells. It additionally provides for the use of phenylmethimazoles,
methimazole derivatives, and tautomeric cyclic thiones for the
treatment of autoimmune/inflammatory diseases associated with
pathologic activation of TLR signaling involving activation of
IRF-3, synthesis of Type 1 IFN, activation of STATs, increased
IRF-1 gene expression, and activation of proteins with ISRE
elements.
SUMMARY OF THE INVENTION
[0071] The present invention relates to the treatment of autoimmune
and/or inflammatory diseases associated with overexpression of
toll-like receptor 3 as well as toll-like receptor 4, and or their
signals, in nonimmune cells, as well as monocytes, macrophages, or
dendritic cells, and related pathologies. This invention also
relates to the use of phenylmethimazoles, methimazole derivatives,
and tautomeric cyclic thiones for the treatment of autoimmune and
inflammatory diseases associated with overexpression of toll-like
receptor 3 as well as toll-like receptor 4, and or their signals,
in nonimmune cells, as well as monocytes, macrophages, or dendritic
cells, and related pathologies. This invention also relates to
treating a subject having a disease or condition associated with
abnormal toll-like receptor 3 as well as toll-like receptor 4, and
or their signals, in nonimmune cells, as well as in monocytes,
macrophages, or dendritic cells.
[0072] In another embodiment, the present invention provides for
methods of treating a TLR mediated disease involving activation of,
or pathologic signaling of, IRF-3. In another embodiment, the
present invention provides for methods of treating a disease
involving overexpression or pathologic signaling Type 1
interferons. In another embodiment, the present invention provides
for methods of treating a TLR mediated disease involving
overexpression or pathologic signaling of ISRE containing genes. In
another embodiment, the present invention provides for methods of
treating a TLR mediated disease involving overexpression or
pathologic signaling of IRF-1. In another embodiment, the present
invention provides for methods of treating a TLR mediated disease
involving activation of, or pathologic signaling by Stat1 or
Stat3.
[0073] In another embodiment, the present invention provides for
methods of treating a disease involving activation of, or
pathologic expression, of the TLR signal pathway resulting in
activation of IRF-3. In another embodiment, the present invention
provides for methods of treating a disease involving overexpression
or pathologic expression of the TLR signal pathway resulting in the
synthesis of Type 1 interferons. In another embodiment, the present
invention provides for methods of treating a disease involving
overexpression or pathologic signaling of the TLR signal pathway
resulting in the activation of ISRE containing genes. In another
embodiment, the present invention provides for methods of treating
a disease involving pathologic expression of the TLR signal pathway
resulting in overexpression of IRF-1. In another embodiment, the
present invention provides for methods of treating a disease
involving activation of, or pathologic expression of the TLR signal
pathway resulting in activation of Stat1 or Stat3.
[0074] In another embodiment, the present invention provides for
methods of treating a TLR-mediated disease or disorder in a patient
in need thereof comprising administering a therapeutically
effective amount of phenylmethimazoles, methimazole derivatives,
and/or tautomeric cyclic thiones.
[0075] In another embodiment, the present invention provides for
methods of treating a TLR-mediated disease or disorder involving a
pathological condition resulting from abnormal cell proliferation;
transplantation rejection, autoimmune, inflammatory, proliferative,
hyperproliferative, or cardiovascular disease in a patient in need
thereof comprising administering a therapeutically effective amount
of phenylmethimazoles, methimazole derivatives, and/or tautomeric
cyclic thiones.
[0076] In another embodiment, the present invention provides for
methods of treating a subject having a TLR-mediated
autoimmune-inflammatory disease, or a predisposition to a
TLR-mediated autoimmune-inflammatory disease, comprising
administering to the subject a therapeutically effective amount of
a composition of the present invention.
[0077] In one embodiment, the TLR-mediated autoimmune-inflammatory
disease is Alopecia, Areata, Ankylosing Spondylitis,
Antiphospholipid Syndrome, Autoimmune Addison's Disease, Autoimmune
Hemolytic Anemia, Autoimmune Hepatitis, autoimmune blepharitis,
Behcet's Disease, Bullous Pemphigoid, Cardiomyopathy, Celiac
Sprue-Dermatitis, Chronic Fatigue Immune Dysfunction Syndrome
(CFIDS), Chronic Inflammatory Demyelinating Polyneuropathy,
Churg-Strauss Syndrome, Cicatricial Pemphigoid, CREST Syndrome,
Cold Agglutinin Disease, Crohn's Disease, Discoid Lupus, Essential
Mixed Cryoglobulinemia, Fibromyalgia-Fibromyositis, Graves'
Disease, Guillain-Barre, Hashimoto's Thyroiditis, Post partum
thyroiditis, Idiopathic Pulmonary Fibrosis, Idiopathic
Thrombocytopenia Purpura (ITP), IgA Nephropathy, Insulin dependent
Diabetes, Type 2 Diabetes, Complications of Type 1 or 2 diabetes,
Juvenile Arthritis, Lichen Planus, Systemic Lupus, Meniere's
Disease, Mixed Connective Tissue Disease, Neural inflammation, Lung
Injury, Myositis, Myocarditis, Hepatitis, Granulomatous Arthritis,
Multiple Sclerosis, Myasthenia Gravis, Pemphigus Vulgaris,
Pernicious Anemia, Polyarteritis Nodosa, Polychondritis,
Polyglandular Syndromes, Polymyalgia Rheumatica, Polymyositis and
Dermatomyositis, Primary Agammaglobulinemia, Primary Biliary
Cirrhosis, Psoriasis, Raynaud's Phenomenon, Reiter's Syndrome,
Rheumatic Fever, Rheumatoid Arthritis, Sarcoidosis, Scleroderma,
Sjogren's Syndrome, Stiffman Syndrome, Takayasu Arteritis, Temporal
Arteritis/Giant Cell Arteritis, Ulcerative Colitis, Uveitis,
Vasculitis, Vitiligo, Wegener's Granulomatosis, or myasthenia
gravis.
[0078] In another embodiment, the TLR-3 mediated
autoimmune-inflammatory disease is Insulin-dependent Diabetes.
[0079] In another embodiment, the present invention provides for
methods of treating a TLR-mediated disease in nonimmune cells or
disorder in a patient in need thereof.
[0080] In another embodiment, the present invention provides for
methods of treating a TLR-mediated autoimmune-inflammatory disease
or disorder in a patient in need thereof comprising administering a
therapeutically effective amount of phenylmethimazoles, methimazole
derivatives, and/or tautomeric cyclic thiones.
[0081] In another embodiment, the present invention provides for
methods of treating a TLR-mediated autoimmune-inflammatory disease
or disorder involving nonimmune cells in a patient in need thereof
comprising administering a therapeutically effective amount of
phenylmethimazoles, methimazole derivatives, and/or tautomeric
cyclic thiones.
[0082] In another embodiment, the present invention provides for
methods of treating a TLR-mediated autoimmune-inflammatory disease
or disorder associated with immune cell infiltration and
destruction of the nonimmune cells in a patient in need thereof
comprising administering a therapeutically effective amount of
phenylmethimazoles, methimazole derivatives, and/or tautomeric
cyclic thiones.
[0083] In another embodiment, the present invention provides for
methods of treating a TLR-mediated disease or disorder involving a
pathologic innate immune response in a patient in need thereof
comprising administering a therapeutically effective amount of
phenylmethimazoles, methimazole derivatives, and/or tautomeric
cyclic thiones.
[0084] In one embodiment, the TLR-mediated disease or disorder is a
pathological condition resulting from abnormal cell proliferation;
transplantation rejections, autoimmune, inflammatory,
proliferative, hyperproliferative, or cardiovascular diseases.
[0085] In another embodiment, the cardiovascular disease or
disorder is restenosis, coronary artery disease, atherosclerosis,
atherogenesis, cerebrovascular diseases or events, coronary events,
angina, ischemic disease, congestive heart failure, pulmonary edema
associated with acute myocardial infarction, thrombosis, high or
elevated blood pressure in hypertension, platelet aggregation,
platelet adhesion, smooth muscle cell proliferation, a vascular or
non-vascular complication associated with the use of a medical
device, a wound associated with the use of a medical device,
vascular or non-vascular wall damage, peripheral vascular disease
or neoinitimal hyperplasia following percutaneous transluminal
coronary angiograph.
[0086] In one embodiment, the cerebrovascular disease or event is a
cerebral infarction or stroke (caused by vessel blockage or
hemorrhage), or transient ischemia attack (TIA), syncope, or
atherosclerosis of the intracranial and/or extracranial arteries,
and the like. In one embodiment, the coronary event is a myocardial
infarction, myocardial revascularization procedures, angina,
cardiovascular death or acute coronary syndrome.
[0087] In another embodiment, the present invention provides for a
method of ameliorating one or more symptoms of atherosclerosis in a
mammal, said method comprising administering to said mammal a
methimazole derivative and/or tautomeric cyclic thione in an amount
sufficient to ameliorate one or more symptoms of
atherosclerosis.
[0088] In another embodiment, the present invention provides for a
method of ameliorating one or more symptoms of myocardial diseases
in a mammal, said method comprising administering to said mammal a
methimazole derivative and/or tautomeric cyclic thione in an amount
sufficient to ameliorate one or more symptoms of myocardial
diseases. In another embodiment, the myocardial diseases have
inflammatory and immunological properties. In another embodiment,
the myocardial disease is coronary heart disease, reversible or
irreversible myocardial ischemia/reperfusion damage, acute or
chronic heart failure and restenosis.
[0089] In another embodiment, the present invention provides for a
method of mitigating or preventing a coronary complication
associated with an acute phase response to an inflammation in a
mammal, wherein said coronary complication is a symptom of
atherosclerosis, said method comprising administering to a mammal
having said acute phase response, or at risk for said acute phase
response, a methimazole derivative and/or tautomeric cyclic thione
in an amount sufficient to mitigate or prevent said coronary
complication.
[0090] In another embodiment, the present invention provides for a
method of mitigating or preventing an acute phase response. In
another embodiment, the acute phase response is an inflammatory
response associated with a recurrent inflammatory disease.
[0091] In another embodiment, the acute phase response is
associated with a disease selected from the group consisting of
leprosy, tuberculosis, systemic lupus erythematosus, polymyalgia
rheumatica, polyarteritis nodosa, scleroderma, idiopathic pulmonary
fibrosis, chronic obstructive pulmonary disease, Alzheimer's
Disease AIDS, coronary calcification, calcific aortic stenosis,
osteoporosis, and rheumatoid arthritis.
[0092] In another embodiment, the acute phase response is an
inflammatory response associated with a condition selected from the
group consisting of a bacterial infection, a viral infection, a
fungal infection, an organ transplant, a wound, an implanted
prosthesis, parasitic infection, sepsis, endotoxic shock syndrome,
and biofilm formation.
[0093] In another embodiment, the present invention provides for
methods of treating a TLR-mediated autoimmune-inflammatory disease
or disorder associated with immune cell infiltration and
destruction of the nonimmune cells in a patient in need thereof,
the method comprising administering a therapeutically effective
amount of phenylmethimazoles, methimazole derivatives, and/or
tautomeric cyclic thiones to a mammal in an amount or mixture
effective for treating one or more conditions selected from the
group consisting of septic shock, sepsis, endotoxic shock,
hemodynamic shock and sepsis syndrome, post ischemic reperfusion
injury, malaria, mycobacterial infection, meningitis, psoriasis,
congestive heart failure, fibrotic disease, cachexia, graft
rejection, cancer, autoimmune disease, opportunistic infections in
AIDS, rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis,
other arthritic conditions, Crohn's disease, ulcerative colitis,
inflammatory bowel disease, regional enteritis, multiple sclerosis,
systemic lupus erythrematosis, ENL in leprosy, radiation damage,
asthma, and hyperoxic alveolar injury.
[0094] In one embodiment, the TLR-mediated autoimmune/inflammatory
disease or disorder is an acute inflammatory disease. In another
embodiment, the TLR-mediated autoimmune/inflammatory disease or
disorder is an acute inflammatory disease selected from the group
consisting of: (a) endotoxemia or (b) toxic shock syndrome
associated with (c) septicemia; and (d) infectious disease.
[0095] In another embodiment, the TLR-mediated
autoimmune/inflammatory disease or disorder is selected from septic
shock of whatever type, etiology, or pathogenesis; or septic shock
that is a associated with renal failure; acute renal failure;
cachexia; malarial cachexia; hypophysial cachexia; uremic cachexia;
cardiac cachexia; cachexia suprarenalis or Addison's disease;
cancerous cachexia; and cachexia as a consequence of infection by
the human immunodeficiency virus (HIV). In another embodiment, the
septic shock is endotoxic shock. In another embodiment, the
endotoxic shock is induced by gram negative bacteria. In yet
another embodiment, the endotoxic shock is induced by gram positive
bacteria. In another embodiment, the septic shock is LPS-induced
shock. In another embodiment, the toxic shock, septic shock,
endotoxemia, endotoxic shock or LPS-induced toxic shock syndrome is
associated with a disease wherein an antibiotic is being
administered to the subject.
[0096] In another embodiment, the present invention provides for
methods of treating a TLR3-mediated pathological condition
resulting from or in abnormal cell proliferation, a transplant
rejection, an autoimmune, inflammatory, proliferative,
hyperproliferative or vascular disease, for reducing scar tissue or
for inhibiting wound contraction in a patient in need thereof
comprising administering a therapeutically effective amount of
phenylmethimazoles, methimazole derivatives, and/or tautomeric
cyclic thiones to a subject in need of such therapy.
[0097] In another embodiment, the pathological condition resulting
from abnormal cell proliferation is a cancer, a Karposi's sarcoma,
a cholangiocarcinoma, a choriocarcinoma, a neoblastoma, a Wilm's
tumor, Hodgkin's disease, a melanoma, multiple myelomas, a chronic
lymphocytic leukemia or an acute or chronic granulocytic
lymphoma.
[0098] In another embodiment, the autoimmune, inflammatory,
proliferative, hyperproliferative or vascular disease is rheumatoid
arthritis, restenosis, lupus erythematosus, systemic lupus
erythematosus, Hashimoto's thyroiditis, myasthenia gravis, diabetes
mellitus, uveitis, nephritic syndrome, multiple sclerosis, an
inflammatory skin disease, an inflammatory lung disease, an
inflammatory bowel disease, an inflammatory disease that affects or
causes obstruction of a body passageway, an inflammation of the
eye, nose or throat, a fungal infection or a food related
allergy.
[0099] In another embodiment, the present invention provides for
methods of treating a TLR3-mediated pathological condition
resulting from an allergen. In another embodiment, the present
invention provides for methods of treating a TLR3-mediated
pathological condition resulting in an allergy.
[0100] In another embodiment, the present invention provides for
methods of treating a TLR3/4-mediated disease, disorder or
condition caused by is asthma, chronic bronchoconstriction, acute
bronchoconstriction, bronchitis, small airways obstruction,
emphysema, obstructive airways disease, inflammatory airways
disease, acute lung injury or bronchiectasis. In another
embodiment, the asthma is atopic asthma; non-atopic asthma;
allergic asthma; atopic bronchial IgE-mediated asthma; bronchial
asthma; essential asthma; true asthma; intrinsic asthma caused by
pathophysiologic disturbances; extrinsic asthma caused by
environmental factors; essential asthma of unknown or unapparent
cause; bronchitic asthma; emphysematous asthma; exercise-induced
asthma; allergen induced asthma; cold air induced asthma;
occupational asthma; infective asthma caused by bacterial, fungal,
protozoal or viral infection; non-allergic asthma; incipient
asthma; wheezy infant syndrome; or bronchiolytis.
[0101] In another embodiment, the present invention provides for
methods of treating a TLR3-mediated pathological condition
resulting from an obstructive airways disease or inflammatory
airways disease. In one embodiment, the obstructive airways disease
or inflammatory airways disease is chronic eosinophilic pneumonia,
chronic obstructive pulmonary disease (COPD), COPD that includes
chronic bronchitis, pulmonary emphysema or dyspnea associated or
not associated with COPD, COPD that is characterized by
irreversible, progressive airways obstruction, adult respiratory
distress syndrome (ARDS), exacerbation of airways hyper-reactivity
consequent to other drug therapy or airways disease that is
associated with pulmonary hypertension. In another embodiment, the
obstructive airways disease or inflammatory airways disease is
bronchitis. In one embodiment, the bronchitis is chronic
bronchitis, acute bronchitis, acute laryngotracheal bronchitis,
arachidic bronchitis, catarrhal bronchitis, croupus bronchitis, dry
bronchitis, infectious asthmatic bronchitis, productive bronchitis,
staphylococcus bronchitis, streptococcal bronchitis or vesicular
bronchitis. In one embodiment, the bronchiectasis is cylindric
bronchiectasis, sacculated bronchiectasis, fusiform bronchiectasis,
capillary bronchiectasis, cystic bronchiectasis, dry bronchiectasis
or follicular bronchiectasis.
[0102] In one embodiment, the present invention provides for
methods of treating an autoimmune or inflammatory disease
associated with Toll-like receptor 3 overexpression resulting from
other inflammation inducing conditions that may be treated to
ameliorate symptoms associated with inflammation or to diminish the
existing inflammation. In one embodiment, the other inflammation or
irritation associated therewith may be from a variety of sources
either physical or chemical and may include: insect bites or
stings, contact with a particular type plant (e.g., poison oak,
etc.), radiation (e.g., U.V.), non-infectious conjunctivitis,
hemorrhoids (acute), abrasions, ingrown finger or toenail
(granulation), skin graft donor sites, vaginitis, psoriasis, herpes
simplex (cold sores, aphthous ulcers), pruritis ani/cruri, chemical
inflammation, and the like.
[0103] In one embodiment, the present invention provides for
methods of treating an autoimmune or inflammatory disease
associated with Toll-like receptor 3/4 overexpression resulting
from other inflammation inducing conditions that may be treated to
ameliorate symptoms associated with inflammation or to diminish the
existing inflammation wherein the inflammation is the result of
extraneously induced damage to cells or tissue. Such damage may be
induced by chemical and/or physical influences upon the skin or
mucus membranes of humans and animals. Examples of physical
influences are infarction, heat, cold, radiation and electrical
shock, and examples of chemical influences are contact with acids,
bases and allergens. Inflammation may be induced by microorganisms
or their molecular signature molecules acting on the skin, as well
as being the result of microorganisms invading the human or animal
body.
[0104] In another embodiment, the inflammatory responses that may
be ameliorated may be on the skin or a mucus membrane of a subject
and includes, but is not limited to, conditions such as
inflammation around erupting wisdom teeth, following extraction of
teeth, periodontal abscesses, prosthesis induced pressure sores on
the mucosa, fungal infections, for treating exposed bone surface in
alveolitis sicca dolorosa, which is a painful condition which may
arise following extraction of teeth, chronic and acute inflammatory
diseases including, but not limited to, pancreatitis, rheumatoid
arthritis, osteoarthritis, asthma, inflammatory bowel disease,
psoriasis and in certain neurological disorders such as Alzheimer's
disease. Among other conditions are environmental, e.g., sun or
wind exposure, trauma or wounds, e.g., cuts, bums or abrasions,
exposure to chemicals such as alkaline soaps, heavy metals, e.g.
lead or mercury, detergents, liquid solvents, oils, preservatives,
and disease, e.g., eczema, psoriasis, seborrheic dermatitis.
[0105] In one embodiment, the present invention provides for
methods of treating an autoimmune or inflammatory disease
associated with Toll-like receptor 3 overexpression, e.g.,
Hashimoto's thyroiditis, inflammatory lung disease, and Type 1
diabetes).
[0106] In another embodiment, the present invention provides for
methods of treating TLR3- or TLR4-linked diseases involving
pathogen or pathogen molecular signals by inhibiting the increased
IRF-3 signal pathway, but not the NF-kappa B signal pathway. In one
embodiment, the pathogen related agent or product is a virus,
bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g
tobacco. In another embodiment the bacteria is exemplified by, but
not limited to, Chlamydia or an enterobacteria. In still another
embodiment, the bacteria are gram negative bacteria. In still
another embodiment, the virus is an RNA virus, enterovirus,
Chlamydia, or Coxsackie virus. In another embodiment, the virus is
a single strand RNA virus. In another embodiment, the virus is
Influenza A.
[0107] In another embodiment, the present invention provides for
methods of treating TLR3- or TLR4-linked diseases involving
pathogen or pathogen molecular signal increased Type 1 interferon
gene expression. In one embodiment, the pathogen related agent or
product is a virus, bacteria, dsRNA, Type 1 IFN, or environmental
induction event, e.g. tobacco. In another embodiment the bacteria
are exemplified by, but not limited to, Chlamydia or
enterobacteria. In still another embodiment, the bacteria are
gram-negative bacteria. In still another embodiment, the virus is
an RNA virus, enterovirus, or Coxsackie virus. In another
embodiment, the virus is a single strand RNA virus. In another
embodiment, the virus is Influenza A.
[0108] In another embodiment, the present invention provides for
methods of inhibiting TLR3- or TLR4-linked, pathogen or pathogen
molecular signal increased Stat1 or Stat3 activation. In one
embodiment, the pathogen related agent or product is a virus,
bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g.
tobacco. In another embodiment the bacteria are exemplified by, but
not limited to, Chlamydia or enterobacteria. In still another
embodiment, the bacteria re a gram negative bacteria. In still
another embodiment, the virus is an RNA virus, enterovirus, or
Coxsackie virus. In another embodiment, the virus is a single
strand RNA virus. In another embodiment, the virus is Influenza
A.
[0109] In another embodiment, the present invention provides for
methods of inhibiting TLR3- or TLR4-linked, pathogen increased
activation of interferon sensitive response element (ISRE). In one
embodiment, the pathogen related agent or product is a virus,
bacteria, dsRNA, Type 1 IFN, or environmental induction event, e.g.
tobacco. In another embodiment the bacteria are exemplified by, but
not limited to, Chlamydia or enterobacteria. In still another
embodiment, the bacteria re a gram negative bacteria. In still
another embodiment, the virus is an RNA virus, enterovirus, or
Coxsackie virus. In another embodiment, the virus is a single
strand RNA virus. In another embodiment, the virus is Influenza
A.
[0110] In another embodiment, the present invention provides for
methods of inhibiting TLR3- or TLR4-linked, pathogen or pathogen
molecular signal increased Stat1 or Stat3 activation. In one
embodiment, the pathogen related agent or product is
lypopolysaccharide, Type 1 IFN, or environmental induction event,
e.g. tobacco, hyperlipidemia. In another embodiment, the pathogen
is bacteria. In another embodiment the bacteria are exemplified by,
but not limited to, Chlamydia or enterobacteria. In still another
embodiment, the bacteria are gram-negative bacteria. In still
another embodiment, the bacteria are gram-negative bacteria. In
another embodiment, the pathogen is a virus. In another embodiment,
the virus is an enterovirus.
[0111] In another embodiment, the present invention provides for
methods of inhibiting TLR3 or TLR4-linked, pathogen or pathogen
molecular signal increased activation of genes with interferon
sensitive response elements (ISREs). In one embodiment, the
pathogen related agent or product is lypopolysaccharide, Type 1
IFN, or environmental induction event, e.g. tobacco,
hyperlipidemia. In another embodiment, the pathogen is bacteria. In
another embodiment, the bacteria are gram-negative bacteria. In
another embodiment, the pathogen is a virus. In another embodiment,
the virus is an enterovirus.
[0112] In another embodiment, the present invention provides for
methods of inhibiting cytokine increased activation of interferon
sensitive response element (ISRE). In one embodiment, the cytokine
is IL-1. In another embodiment, the cytokine is TNF-alpha. In
another embodiment, the cytokine is gamma interferon. In another
embodiment the cytokine is a proinflammatory cytokine including but
not limited to IL-6, IL-12, IFN-.alpha., or IFN-.beta..
[0113] In another embodiment, the present invention provides for
methods which measure therapeutic efficacy of an agent that reduces
pathologic TLR3 or TLR4 expression and TLR3 or TLR4 mediated signal
molecules in nonimmune cells, monocytes, macrophages or serum as
well of a pathology such as an autoimmune or inflammatory disease
(e.g Type 1 diabetes, colitis, autoimmune thyroiditis,
atherosclerosis, and vascular complications of diabetes). In one
embodiment, the levels of expression of TLR3 or TLR4 and TLR3-sor
TLR4 signaling molecules in nonimmune cells, monocytes, or
macrophages, or serum is a diagnostic measure to predict
therapeutic efficacy of an agent that reduces pathologic TLR3 or
TLR4 expression and TLR3 or TLR4 mediated signal molecules in an
autoimmune-inflammatory diseases.
[0114] In another embodiment, the level of expression of TLR3 in
thyrocytes or pancreatic islet cells is measured as a method not
only for diagnosis of Hashimoto's disease, insulinitis or Type 1
diabetes but as a measure of therapy by an agent that reduces
pathologic TLR3 expression and TLR3 mediated signal molecules
altered in these autoimmune-inflammatory diseases. In still another
embodiment the levels of expression of TLR4 and TLR4 mediated
signal molecules in monocytes, macrophages, vascular endothelial
cells, intestinal epithelial cells, is measured as a method not
only for diagnosis but also as a measure of therapy by an agent
that reduces pathologic TLR4 expression and TLR4 mediated signal
molecules in a pathologic state such as an autoimmune or
inflammatory disease, e.g. vascular disease, colitis, or toxic
shock.
[0115] In another embodiment, the present invention provides for
methods which measure diagnosis as well as therapeutic efficacy of
an agent that reduces pathologic expression of TLR and TLR-mediated
signal molecules in an autoimmune or inflammatory disease (e.g.
systemic lupus, uveitis, rheumatoid arthritis, Graves' disease). In
one embodiment, the levels of expression of TLR or TLR-signaling
molecules is measured in nonimmune cells, monocytes, macrophages or
serum in order to measure therapeutic efficacy of an agent that
reduces pathologic TLR expression and TLR mediated signal molecules
in an autoimmune-inflammatory disease.
[0116] In another embodiment, the present invention provides for
methods which measure diagnosis as well as therapeutic efficacy of
an agent that reduces pathologic expression of IRF-3/Type 1 IFN,
STAT, IRF-3, or ISRE regulated molecules in the nonMyD88-related
pathway of TLR involved autoimmune or inflammatory disease. In one
embodiment, the levels of expression of IRF-3/Type 1 IFN, STAT,
IRF-3, or ISRE regulated molecules in the nonMyD88-related pathway
is measured in nonimmune cells, monocytes, macrophages or serum in
order to measure therapeutic efficacy of an agent that reduces
pathologic expression of an autoimmune-inflammatory disease.
[0117] In another aspect, the invention is concerned with a method
for treating an inflammatory or infectious condition or disease by
administering a therapeutically effective amount of an agent that
decreases the endogenous amount of intracellular or extracellular
cytokine or proinflammatory cytokine to a patient suffering from
the inflammatory condition or disease. One skilled in the art will
recognize that the term "an inflammatory or infectious condition or
disease" includes, but is not limited to: autoimmune or
inflammatory diseases such as multiple sclerosis, inflammatory
bowel disease, insulin dependent diabetes mellitus, and rheumatoid
arthritis, trauma, chemotherapy reactions, transplant rejections
the generalized Schwartzman reaction, system inflammatory response
syndrome, sepsis, severe sepsis, or septic shock.
[0118] In a further aspect, the invention concerns a method for
treating a disease such as graft versus host disease, acute
respiratory distress syndrome, granulomatous disease, transplant
rejection, cachexia, parasitic infections, fungal infections,
trauma, and bacterial infections by administering a therapeutically
effective amount of an agent that decreases the endogenous amount
of intracellular or extracellular TNF.alpha. to a patient suffering
from the disease.
[0119] The present invention also provides for methods of treating
a TLR3 or TLR4-mediated disease or disorder wherein the treatment
is curative therapy, prophylactic therapy, ameliorative therapy or
preventative therapy for a subject.
[0120] The present compounds may also be used in co-therapies,
partially or completely, in place of other conventional
anti-inflammatory agents, such as together with steroids,
cyclooxygenase-2 inhibitors, NSAIDs, DMARDS, antibiotics,
immunosuppressive agents, 5-lipoxygenase inhibitors, LTB.sub.4
antagonists and LTA.sub.4 hydrolase inhibitors and anti-cell
adhesion molecules, such as anti E-selectin.
[0121] In another embodiment, the present invention contemplates a
method of relieving symptoms utilizing a combination comprising
methimazole derivatives and tautomeric cyclic thiones in
combination with salicylates (including sulfasalazine, olsalazine,
and mesalamine), corticosteroids, immunosuppressants (including
azathioprine and 6-mercaptopurine), antibiotics, anti adhesion
molecules such as anti E-selectin, and a vitamin D compound (e.g.,
1-alpha, 25-dihydroxyvitamin D.sub.3).
[0122] In one embodiment, the present invention provides for the
use of methimazole (1-methyl-2-mercaptoimidazole) and its
derivatives. In another embodiment, the present invention provides
for the use of a prodrug form of methimazole, known as carbimazole
(neomercazole) and its derivatives.
[0123] In another embodiment, the present invention provides for
the use of a composition containing one or more of the compounds
selected from the group consisting of: methimazole, metronidazole,
2-mercaptoimidazole, 2-mercaptobenzimidazole,
2-mercapto-5-nitrobenzimidazole, 2-mercapto-5-methylbenzimidazole,
s-methylmethimazole, n-methylmethimazole, 5-methylmethimazole,
5-phenylmethimazole, and 1-methyl-2-thiomethyl-5 (4)nitroimidazole.
Preferably, 5-phenylmethimazole is used.
[0124] In another embodiment, the present invention provides for
the use of phenyl methimazole (compound 10; C-10; C10) and its
derivatives for the treatment of autoimmune or inflammatory disease
associated with toll-like receptor 3 or TLR4 overexpression and/or
overexpressed signals derived therefrom and related
pathologies.
[0125] Compounds of this invention may be synthesized using any
conventional technique. Preferably, these compounds are chemically
synthesized from readily available starting materials.
[0126] The compounds of this invention may also be modified by
appending appropriate functionalities to enhance selective
biological properties. Such modifications are known in the art and
include those which increase biological penetration into a given
biological system (e.g., blood, lymphatic system, central nervous
system), increase oral availability, increase solubility to allow
administration by injection, alter metabolism and alter rate of
excretion.
[0127] Once synthesized, the activities and specificities of the
compounds according to this invention may be determined using in
vitro and in vivo assays.
[0128] These methods may employ the compounds of this invention in
a monotherapy or in combination with an anti-inflammatory or
immunosuppressive agent. Such combination therapies include
administration of the agents in a single dosage form or in multiple
dosage forms administered at the same time or at different
times.
[0129] Some embodiments of the present invention include methods of
prophylaxis or treatment of a disease, disorder, condition or
complication thereof as described herein, comprising administering
to an individual in need of such prophylaxis or treatment a
therapeutically effective amount or dose of a compound of the
present invention in combination with at least one pharmaceutical
agent selected from the group consisting of: sulfonylureas,
meglitinides, biguanides, alpha-glucosidase inhibitors, peroxisome
proliferators-activated receptor-gamma (i.e., PPAR-gamma) agonists,
insulin, insulin analogues, HMG-CoA reductase inhibitors,
cholesterol-lowering drugs (for example, fibrates that include:
fenofibrate, bezafibrate, gemfibrozil, clofibrate and the like;
bile acid sequestrants which include: cholestyramine, colestipol
and the like; and niacin), anti-platelet agents (for example,
aspirin and adenosine diphosphate receptor antagonists that
include: clopidogrel, ticlopidine and the like),
angiotensin-converting enzyme inhibitors, angiotensin II receptor
antagonists and adiponectin. In some embodiments, methods of the
present invention include compounds of the present invention and
the pharmaceutical agents are administered separately. In further
embodiments, compounds of the present invention and the
pharmaceutical agents are administered together.
[0130] The additional active agent or agents can be lipid modifying
compounds or agents having other pharmaceutical activities, or
agents that have both lipid-modifying effects and other
pharmaceutical activities. Examples of additional active agents
which may be employed include but are not limited to HMG-CoA
reductase inhibitors, which include statins in their lactonized or
dihydroxy open acid forms and pharmaceutically acceptable salts and
esters thereof, including but not limited to lovastatin (see U.S.
Pat. No. 4,342,767), simvastatin (see U.S. Pat. No. 4,444,784),
dihydroxy open-acid simvastatin, particularly the ammonium or
calcium salts thereof, pravastatin, particularly the sodium salt
thereof (see U.S. Pat. No. 4,346,227), fluvastatin particularly the
sodium salt thereof (see U.S. Pat. No. 5,354,772), atorvastatin,
particularly the calcium salt thereof (see U.S. Pat. No.
5,273,995), cerivastatin, particularly the sodium salt thereof (see
U.S. Pat. No. 5,177,080), pitavastatin also referred to as NK-104
(see PCT international publication number WO 97/23200) and ZD4522;
HMG-CoA synthase inhibitors; squalene epoxidase inhibitors;
squalene synthetase inhibitors (also known as squalene synthase
inhibitors), acyl-coenzyme A: cholesterol acyltransferase (ACAT)
inhibitors including selective inhibitors of ACAT-1 or ACAT-2 as
well as dual inhibitors of ACAT- I and -2; microsomal triglyceride
transfer protein (MTP) inhibitors; probucol; niacin; bile acid
sequestrants; LDL (low density lipoprotein) receptor inducers;
platelet aggregation inhibitors, for example glycoprotein IIb/IIIa
fibrinogen receptor antagonists and aspirin; human peroxisome
proliferator activated receptor gamma (PPAR.gamma.) agonists
including the compounds commonly referred to as glitazones for
example troglitazone, pioglitazone and rosiglitazone and, including
those compounds included within the structural class known as
thiazolidinediones as well as those PPAR-alpha agonists outside the
thiazolidinedione structural class; PPAR delta agonists such as
clofibrate, fenofibrate including micronized fenofibrate, and
gemfibrozil; PPAR dual alpha/gamma agonists, vitamin B6 (also known
as pyridoxine) and the pharmaceutically acceptable salts thereof
such as the HCl salt; vitamin B12 (also known as cyanocobalamin);
folic acid or a pharmaceutically acceptable salt or ester thereof
such as the sodium salt and the methylglucamine salt; anti-oxidant
vitamins such as vitamin C and E and beta carotene; beta-blockers;
angiotensin II antagonists such as losartan; angiotensin converting
enzyme inhibitors such as enalapril and captopril; calcium channel
blockers such as nifedipine and diltiazam; endothelian antagonists;
agents that enhance ABCA1 gene expression; FXR ligands including
both inhibitors and agonists; bisphosphonate compounds such as
alendronate sodium; and cyclooxygenase-2 inhibitors such as
rofecoxib and celecoxib. Additionally, the compounds of this
invention, may be used in combination with anti-retroviral therapy
in AIDS infected patients to treat lipid abnormalities associated
with such treatment, for example but not limited to their use in
combination with HIV protease inhibitors such as indinavir,
nelfinavir, ritonavir and saquinavir.
[0131] Still another type of agent that can be used in combination
with the compounds of this invention is cholesterol absorption
inhibitors including plant sterols. Cholesterol absorption
inhibitors block the movement of cholesterol from the intestinal
lumen into enterocytes of the small intestinal wall. This blockade
is their primary mode of action in reducing serum cholesterol
levels. These compounds are distinct from compounds that reduce
serum cholesterol levels primarily by mechanisms of action such as
acyl coenzyme A--cholesterol acyl transferase (ACAT) inhibition,
inhibition of triglyceride synthesis, MTP inhibition, bile acid
sequestration, and transcription modulation such as agonists or
antagonists of nuclear hormones. Cholesterol absorption inhibitors
are described in U.S. Pat. No. 5,846,966, U.S. Pat. No. 5,631,365,
U.S. Pat. No. 5,767,115, U.S. Pat. No. 6,133,001, U.S. Pat. No.
5,886,171, U.S. Pat. No. 5,856,473, U.S. Pat. No. 5,756,470, U.S.
Pat. No. 5,739,321, U.S. Pat. No. 5,919,672, WO 00/63703,
WO/0060107, WO 00/38725, WO 00/34240, WO 00/20623, WO 97/45406, WO
97/16424, WO 97/16455, and WO 95/08532, the entire contents of all
of which are hereby incorporated by reference.
[0132] It will be understood that the scope of combination-therapy
of the compounds of the present invention with other pharmaceutical
agents is not limited to those listed herein, supra or infra, but
includes in principle any combination with any pharmaceutical agent
or pharmaceutical composition useful for the prophylaxis or
treatment of diseases, conditions or disorders that are linked to
metabolic related disorders.
[0133] In one embodiment, the present invention provides for a
method of diagnosing and following therapeutic efficacy of an agent
inhibiting a TLR3 or TLR4 mediated and related disease in a
subject, the method comprising detecting the level of expression of
TLR3/TLR4 or TLR3/TLR4 signaled molecules (a) in a test sample of
nonimmune tissue cells or serum obtained from the subject, and (b)
in a control sample of known normal nonimmune tissue cells of the
same cell type or serum, wherein a higher or lower level of
expression of TLR3 or TLR4 or their signature signal molecules in
the test sample as compared to the control sample is indicative of
the presence of an TLR3/4 related disease or efficacy of therapy in
the subject from which the test tissue cells were obtained.
[0134] In another embodiment, the present invention provides for a
method of diagnosing, in a subject, an autoimmune or inflammatory
disease associated with toll-like receptor overexpression in
nonimmune cells, monocytes, macrophages, or dendritic cells, the
method comprising detecting the level of expression of TLR or TLR
signaled molecules (a) in a test sample of nonimmune cells
monocytes, macrophages, or dendritic cells, or serum obtained from
the subject, and (b) in a control sample of known normal nonimmune
cells monocytes, macrophages, or dendritic cells of the same cell
type, or in serum wherein a higher or lower level of expression of
TLR or TLR-signaled molecules in the test sample as compared to the
control sample is indicative of the presence or the efficacy of
therapy of an autoimmune or inflammatory disease associated with
toll-like receptor overexpression or overexpressed signaling in the
subject from which the test tissue cells were obtained.
[0135] In another embodiment, the present invention provides for a
method of diagnosing, in a subject, an autoimmune or inflammatory
disease associated with overexpression of genes or gene products
induced by pathologic activation of the nonMyD88 induced IRF-3/Type
1 IFN/STAT, IRF-1/ISRE signal system of TLR in nonimmune cells,
monocytes, macrophages, or dendritic cells, or serum the method
comprising detecting the level of expression of molecules altered
by overexpression of the nonMyD88 induced IRF-3/Type 1 IFN/STAT,
IRF-1/ISRE signal system of TLR (a) in a test sample of nonimmune
cells monocytes, macrophages, or dendritic cells, or serum obtained
from the subject, and (b) in a control sample of known normal
nonimmune cells monocytes, macrophages, or dendritic cells, of the
same cell type, or in serum wherein a higher or lower level of
expression of TLR or TLR-signaled molecules in the test sample as
compared to the control sample is indicative of the presence or the
efficacy of therapy of an autoimmune or inflammatory disease
associated with overexpressed signaling in the subject from which
the test tissue cells were obtained.
[0136] In another embodiment, the present invention provides for a
method of identifying a compound that inhibits the expression of
toll-like receptor 3 or TLR4 or their signals, the method
comprising contacting cells which normally exhibit TLR3 or TLR4
expression or activity with an enhancer of this expression or
activity, e. g. LPS, Type I IFN, dsRNA transfection, a virus,
IL-1.beta., TNF-.alpha., together with, preceded, or followed by a
candidate compound, and determining the responsiveness or lack of
responsiveness by the cell to the test compound.
[0137] In another embodiment, the present invention provides for a
method of identifying a compound that inhibits toll-like receptor 3
or TLR4 overexpression or overexpressed signaling in a nonimmune
cell, the method comprising contacting nonimmune cells which
overexpress TLR3 or TLR4 or TLR3/4 activity with a candidate
compound, and determining the activity or expression of TLR3 or
TLR4 or their signal molecules.
[0138] In another embodiment, the present invention provides for
methods for screening a test compound for the potential to prevent,
ameliorate, stabilize, or treat an autoimmune or inflammatory
disease associated with toll-like receptor 3 or TLR4 overexpression
and/or signaling in the subject comprising the steps of first
contacting a nonimmune cell sample, monocyte, macrophage, or
dendritic cell from a subject that has, or is at risk for
developing, an autoimmune or inflammatory disease associated with
toll-like receptor 3 or TLR4 overexpression and/or signaling in the
subject with the test compound; b) contacting a second nonimmune
cell sample, monocyte, macrophage, or dendritic cell from the
subject with a known standard compound, wherein the first and
second nonimmune cell samples are contacted with the test compound
in the same manner; and c) measuring TLR3 or TLR4 expression or
activity in the first and second samples, wherein the compound is
determined to have the potential if the TLR3 or TLR4 expression or
activity in the first sample is decreased relative to the second
sample.
[0139] In another embodiment, the present invention provides for
methods for screening a test compound for the potential to prevent,
ameliorate, stabilize, or treat an autoimmune or inflammatory
disease associated with toll-like receptor overexpression or
signaling in the subject comprising the steps of: a) first
contacting a nonimmune cell sample, monocyte, macrophage, or
dendritic cell from a first subject that has, or is at risk for
developing, an autoimmune or inflammatory disease associated with
toll-like receptor overexpression or signaling in the subject with
the test compound; b) contacting a second nonimmune cell, monocyte,
macrophage, or dendritic cell sample from a second subject that
does not have, or is not predisposed to developing, an autoimmune
or inflammatory disease associated with toll-like receptor 3 or
TLR4 overexpression or signaling with the test compound, wherein
the first and second nonimmune cell samples, monocyte, macrophage,
or dendritic cell are contacted with the test compound in the same
manner; and c) measuring TLR3 or TLR4 expression or activity in the
first and second samples, wherein the compound is determined to
have the potential if the TLR3 or TLR4 expression or activity in
the first sample is decreased relative to the second sample.
[0140] In another embodiment, the present invention provides for
methods for screening a test compound for the potential to prevent,
ameliorate, stabilize, or treat an autoimmune or inflammatory
disease associated with increased nonMyD88 induced IRF-3/Type 1
IFN/STAT, IRF-1/ISRE signaling in the subject comprising the steps
of: a) first contacting a nonimmune cell, monocyte, macrophage, or
dendritic cell sample from a first subject that has, or is at risk
for developing, an autoimmune or inflammatory disease associated
with overexpressed nonMyD88 induced IRF-3/Type 1 IFN/STAT,
IRF-1/ISRE signaling in the subject with the test compound; b)
contacting a second nonimmune cell, monocyte, macrophage, or
dendritic cell sample from a second subject that does not have, or
is not predisposed to developing, an autoimmune or inflammatory
disease associated with overexpressed nonMyD88 induced IRF-3/Type 1
IFN/STAT, IRF-1/ISRE signaling with the test compound, wherein the
first and second nonimmune cell samples, monocyte, macrophage, or
dendritic cells are contacted with the test compound in the same
manner; and c) measuring nonMyD88 induced IRF-3/Type 1 IFN/STAT,
IRF-1/ISRE signaled gene or gene product expression or activity in
the first and second samples, wherein the compound is determined to
have therapeutic potential if the expression or activity in the
first sample is decreased relative to the second sample.
[0141] In another embodiment, the present invention provides for
methods for screening a test compound for the potential to prevent,
ameliorate, stabilize, or treat an autoimmune or inflammatory
disease associated with increased TLR3, TLR4, or TLR expression in
or increased nonMyD88 induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE
signaling in the subject comprising the steps of: a) first
contacting a nonimmune cell, monocyte, macrophage, or dendritic
cell sample with an inducer of expression of TLR3, TLR4, or TLR
expression or increased nonMyD88 induced IRF-3/Type 1 IFN/STAT,
IRF-1/ISRE signaling b) contacting a second nonimmune cell,
monocyte, macrophage, or dendritic cell sample with an inducer of
expression of TLR3, TLR4, or TLR expression or increased nonMyD88
induced IRF-3/Type 1 IFN/STAT, IRF-1/ISRE signaling in the same
manner but before or after a test compound, c) contacting a third
nonimmune cell, monocyte, macrophage, or dendritic cell sample in
the same manner with an inducer of expression of TLR3, TLR4, or TLR
expression or increased nonMyD88 induced IRF-3/Type 1 IFN/STAT,
IRF-1/ISRE signaling before or after a vehicle used with the test
compound, wherein the first, second, and third nonimmune cell
samples, monocyte, macrophage, or dendritic cells are contacted
with the test compounds in the same manner; and d) measuring TLR3,
TLR4, or TLR expression in or increased nonMyD88 induced IRF-3/Type
1 IFN/STAT, IRF-1/ISRE signaled gene or gene product expression or
activity in the first, second, and third samples, wherein the
compound is determined to have therapeutic potential if the
expression or activity in the second sample is decreased relative
to the first and third.
[0142] The above summary of the present invention is not intended
to describe each embodiment or every implementation of the present
invention. Advantages and attainments, together with a more
complete understanding of the invention, will become apparent and
appreciated by referring to the following detailed description and
claims taken in conjunction with the accompanying drawings.
[0143] Throughout this document, all temperatures are given in
degrees Celsius, and all percentages are weight percentages unless
otherwise stated. All publications mentioned herein are
incorporated herein by reference for the purpose of describing and
disclosing the compositions and methodologies, which are described
in the publications, which might be used in connection with the
presently described invention. The publications discussed herein
are provided solely for their disclosure prior to the filing date
of the present application. Nothing herein is to be construed as an
admission that the invention is not entitled to antedate such a
disclosure by virtue of prior invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0144] This invention, as defined in the claims, can be better
understood with reference to the following drawings:
[0145] FIG. 1. TLR3 are present and functional on thyrocytes
exhibiting both increased MyD88 related (NF-.kappa.B/MAP Kinase)
and NonMyD88 (IRF-3/IFN-.beta.) signaling. To understand the
significance of FIG. 1 with respect to the present invention, it
must be understood that TLR3 RNA is found at basal levels in the
FRTL-5 thyrocyte. The RNA was detected by Northern analysis in
FRTL-5 thyrocytes and various mouse thyroids but not in other cell
lines. In these experiments, 20 .mu.g (cell lines) and 7.5 .mu.g
(mouse tissues) of total RNA were used. Both 293 and CHO cells were
used as negative controls and mouse spleen were used as positive
controls. Blots were hybridized with radiolabeled mouse TLR3 cDNA.
TLR3 protein expression was also detected in FRTL-5 cells by first
immunoprecipitating cell lysates with (IP+) or without (IP-) 10
.mu.g/ml of anti-TLR3 monoclonal antibody. The immunoprecipitated
fractions were then blotted together with whole cell lysates (20
.mu.g) from CHO-K1 cells transiently transfected with 20 .mu.g of
indicated TLR expression vector and analyzed by western blot with
anti-TLR3 antibody (4 .mu.g/ml).
[0146] Poly (I:C) (the dsRNA ligand commonly used as a test
compound) activates the TLR3 mediated NF-.kappa..beta./Map kinase
signal pathway in FRTL-5 thyrocytes. FRTL-5 cells were transiently
transfected with 100 ng of luciferase reporter pNF-.kappa.B Luc and
2 ng of internal control phRL-Tk. After 36 h, cells were incubated
with 100 .mu.g/ml poly (I:C) or endotoxin-free E. coli DNA for 6 h.
Measurements were made with the Dual Luciferase Assay System
(Promega). Poly (I:C) increased TLR3 mediated NF-.kappa.B mediated
luciferase activity (gene expression) 6 fold; dsDNA had no effect.
Further support came from electrophoretic mobility shift analyses
(EMSA). When FRTL-5 thyrocytes were incubated with 100 .mu.g/ml
poly (I:C), IL-1.beta., TNF-.alpha. or TPA, cells lysed after 1 h,
and nuclear translocation of NF-.kappa.B measured. The poly (I:C)
induced p50/p65 complex formation as measured by the presence of a
specific new protein/DNA complex and its inhibition by anti-p50 and
p65 antibodies, but not by anti-p52, c-rel and Rel B antibodies;
the complex was also supershifted by anti-p50. Poly (I:C) also
increased TLR3-mediated ERK1/2 and MAKK activity. FRTL-5 cells were
maintained in medium (4 hormone or 4H) that does not contain
insulin and TSH, and then were stimulated with 100 .mu.g/ml of poly
(I:C) or 10 .mu.M insulin. After whole cell lysates (20 .mu.g) were
subjected to SDS-PAGE, Western blot analysis using an antibody
against phosphorylation-specific ERK1/2 MAPK showed that Poly (I:C)
as well as insulin increased ERK1/2 MAPK protein levels 2 to 4
fold. Additionally, when FRTL-5 cells were co-transfected with
pCMV-BD-Elk 1 and pFR-luc, then incubated with 100 .mu.g/ml poly
(I:C) or IL-1.beta. for 6 hrs, ELK1 transactivation was increased
2-fold by both Poly (I:C) and IL-1.beta. when measured with the
Dual Luciferase Assay System (Promega). NF-.kappa.B/MAP Kinase
signals evoked by TLR3 binding dsRNA are only one portion of TLR3
functional expression. FIG. 1 shows signaling by the more important
path, which is relevant to therapy with methimazole, methimazole
derivatives, and tautomeric cyclic thiones as evidenced in the
additional Figures below.
[0147] In FIG. 1A, FRTL-5 cells were transiently transfected with
100 ng of luciferase reporter IFN-.beta.-promoter-luc and 2 ng of
internal control phRL-Tk-Int. HEK293cells were transfected with
IFN-.beta.-promoter-luc and phRL-Tk in the presence (hTLR3) or
absence (mock) of co-transfection of human TLR3 expression plasmid.
After 36 h, cells were incubated with the indicated dose of poly
(I:C) or with endotoxin-free E. coli DNA for 6 h. Data was obtained
with the Dual Luciferase Assay System (Promega). TLR3 activation
thus increased IFN-.beta. gene expression. In FIG. 1B, FRTL-5 cells
were incubated with 100 .mu.g/ml of poly (I:C). After the indicated
time points, total RNA was isolated and IFN-.beta. and GAPDH were
determined by RT-PCR using gene specific primers (S. Yokoyama, et
al., Biochem Biophys Res Commun, 232:698-701, (1997)). In FIG. 1C,
cells were co-transfected with pCMV-BD-hIRF-3 and pFR-luc, then
incubated with poly (I:C) or IL-1.beta. for 6 hours. TLR3
activation in thyrocytes increased the activity of IRF-3 whose
binding to the IFN-.beta. promoter results in the increased
IFN-.beta. gene expression. In FIG. 1D, cells were transiently
transfected with 200 ng of IFN-.beta.-promoter-luc, the indicated
dose of TRIF/TICAM-1, wild type MyD88 or dominant negative MyD88
and 2 ng of internal control phRL-Tk. After 36 h, cells were
incubated with indicated dose of poly (I:C) or IL-1.beta. for 6 h.
Data was obtained with the Dual Luciferase Assay System (Promega).
TRIF/TICAM is thus functional in thyrocytes. In sum, the TLR3
receptor on thyrocytes, when activated, can increase the TRIF
coupled signal to increase IRF-3/IFN-.beta. as well apparently
increase the NF-.kappa.B signal system.
[0148] FIG. 2. Poly (I:C) incubation does not upregulate TLR 3 mRNA
in FRTL-5 thyrocytes; in contrast, Poly (I:C) transfection
increases TLR 3 expression independently of PKR. In FIG. 2A, the
effect on mRNA levels of TLR3 and several other genes was measured
after incubating FRTL-5 thyrocytes with 100 .mu.g/ml of Poly (I:C)
or 10 ng/ml of IL-1.beta. for the indicated hours. After total RNA
purification, 20 .mu.g of total RNA were analyzed with indicated
radiolabeled cDNA probes. Poly IC incubation did not increase TLR3,
Major histocompatibility Class I, or PKR which are implicated in
autoimmune-inflammatory diseases despite the increase in IP-10. In
(B), the effect of transfection, rather than incubation, of double
strand nucleotide on mRNA levels of TLR3 and several other genes
was evaluated. Cells were transfected Lipofectamine 2000 alone (L)
or with the indicated amount of Poly (I:C) (RNA) or endotoxin-free
E. coli DNA. After 12 and 24 hours, 20 .mu.g of total RNA was
analyzed with the indicated radiolabeled cDNA probes. Poly IC (RNA)
transfection did increase TLR3, Major histocompatibility Class I,
and PKR which are implicated in autoimmune-inflammatory diseases;
DNA transfection was much less effective. In (C), the effect of
2-aminopurine (a PKR inhibitor) on transfected dsRNA-induced TLR3
mRNA levels was measured. Again cells were transfected with
Lipofectamine 2000 alone or Lipofectamine with the indicated amount
of Poly (I:C) or endotoxin-free E. coli DNA in the presence or
absence of 10 mM 2-aminopurine. After the indicated incubation
time, cells were harvested and 20 .mu.g of total RNA was analyzed
with the indicated radiolabeled cDNA probes. A PKR inhibitor
significantly reduced the ability of dsDNA to slightly increase
PKR, MHC class I, and TLR3 mRNA levels but had no effect on dsRNA
transfection in this regard. In the bottom of Panel C, the effect
of 2-AP on IFN-.beta. gene expression was measured by RT-PCR using
gene specific primers (S. Yokoyama, et al., Biochem Biophys Res
Commun, 232:698-701, (1997)); and the effect of 2-AP on dsRNA
induced NF-.kappa..beta. activation was measured by EMSA. 2-AP
strongly reduced the dsRNA induced NF-.kappa..beta. complex but had
no effect on IFN-.beta. mRNA levels. Data are representative of
multiple experiments. In sum, dsRNA transfection is needed to
increase gene expression of signals implicated in
autoimmune-inflammatory diseases such as MHC genes and high levels
of Type I interferons, not simply activation of TLR by incubating
thyrocytes with dsRNA by dsRNA binding to TLR3 receptors. Moreover,
despite increased PKR, the critical signal involved in TLR3/Type I
IFN signaling by dsRNA transfection is not PKR mediated.
[0149] FIG. 3. Influenza A virus infection of FRTL-5 cells causes
overexpression of TLR3, IRF-1, MHC class II, and IFN-.beta. RNA
levels similar to the action of dsRNA transfection. (A) Cells were
infected for 24 hours with Influenza A (+) or were noninfected (-).
Separately, cells were transfected with dsRNA (+) or exposed to a
mock transfection (-). Total RNA, 20 ug, was isolated and Northern
blotted to detect TLR3, IRF-1, and MHC II using radiolabeled cDNA
probes. Ribosomal bands are shown as control for loading and
integrity of samples. Influenza A infection mimicked the ability of
dsRNA transfection to increase TLR3, IRF-1 and MHC Class II mRNA
levels. In (B), cDNA was synthesized from total RNA and used as the
template to amplify IFN-.beta. or GAPDH by PCR. Influenza A and
dsRNA transfection significantly increased IFN-.beta. mRNA levels
with no change in GAPDH, the housekeeping gene control. Thus,
whether total RNA was used for Northern blot (A) or PCR (B),
results were similar: Influenza A and dsRNA transfection had
largely the same effects on TLR3 expression and signaling in
thyrocytes. Data are representative of multiple experiments.
[0150] FIG. 4. Phenylmethimazole (C10) and Methimazole (MMI)
inhibit the ability of IFN-.beta. to increase TLR3, PKR, and MHC
class I RNA levels in FRTL-5 thyrocytes. Cells were incubated with
or without 100 U/ml of IFN-.beta. for 3 hours in the presence of
dimethyl sulfoxide (DMSO), C10, or MMI. DMSO is the vehicle
control. Northern blots were performed with 20 ug of total RNA to
detect TLR 3, PKR, MHC I, and GAPDH using radiolabeled cDNA probes.
Data are representative of multiple experiments. As was the case
for Poly (I:C) transfection in FIG. 2B, IFN-.beta. increased TLR3.
The increase in TLR3 induced by both poly(I:C) transfection (data
not shown) and IFN-.beta. was totally prevented by the action of
C10 whether measured by PCR (A) or Northern analysis (B). The
IFN-.beta. increased MHC class I levels and PKR mRNA levels in (B)
were also significantly decreased by C10 and C10 was more effective
than methimazole (MMI).
[0151] FIG. 5. Phenylmethimazole (CIO) and Methimazole (MMI)
inhibit the ability of Poly (I:C), lipopolysaccharide (LPS) and
IL-1.beta. to increase IFN-.beta. gene expression (Top Left) and
IRF-3 transactivation (Top Right) in FRTL-5 thyrocytes. (Top Left)
Cells were co-transfected with IFN.beta.-Luc and control vector
(pRLTk-Int), then treated with or without (-) Poly (I:C) (100
.mu.g/ml), LPS (100 ng/ml), or IL-1.beta. (10 ng/ml) in the
presence of the vehicle (DMSO) alone (-), C10, or MMI for 6 hours.
Data was obtained with the Dual Luciferase Assay system. (Top
Right) Cells were co-transfected with Gal4DBD/IRF-3 and Gal4-Luc
then treated with nothing (-), poly (I:C), LPS, or IL-1.beta. as in
(Top Left) in the presence of DMSO or C10 for 6 hours. Data was
obtained by Luciferase assay. Also shown is a graphic depiction
(Bottom) of how the cis reporting system is working. Data are
representative of multiple experiments. C10 significantly
attenuates the effects of Poly (I:C) (100 .mu.g/ml), LPS (100
ng/ml), or IL-1.beta. (10 ng/ml) on IRF-3 transactivation and
IFN-.beta. gene expression; its effect is much better than MMI.
[0152] FIG. 6. Phenylmethimazole (C10) has no effect on the ability
of Poly (I:C) or LPS to increase formation of the p50/p65
heterodimer complex of NF-6B (A), but can inhibit the Influenza A
induced activation of Stat1 phosphorylation in FRTL-5 thyrocytes
(B). In (A), EMSA were performed using nuclear extracts from cells
which were treated with nothing (none), Poly (I:C) (100 .mu.g/ml),
LPS (100 ng/ml), in the presence of DMSO, C10, or MMI for 6 hours.
Probe was the NF-.kappa..beta. consensus oligonucleotide. The
p65/p50 and p50/p50 complexes are indicated and were identified as
in FIG. 2B by antibody inhibition or supershifts of the p50 or p65
components of the induced complexes. In (B), cells were infected
with Influenza A for 24 hours and then DMSO or C10 were added to
the medium for 6 hours. In each, 25 .mu.g of nuclear extracts were
used in Western blots performed to detect Stat1 PY701. Blots were
then stripped and reprobed for unphosporylated Stat1. The first
lane is a non infected control (-). Duplicate effects were seen
with serine phosphorylation of Stat1 and with phosphorylated Stat3
(see below).
[0153] FIG. 7. C-10 inhibits LPS induced MCP-1, IRF-1, and IP-10
expression in different tissues, reputed products of both the TLR4
increased MyD88 dependent or MyD88 independent signaling pathways.
Northern analysis (M. Saji, et al., J Clin Endocrinol Metab,
75:871-8 (1992); D. S. Singer, et al., U.S. Pat. No. 5,556,754
(1996); V. Montani, et al., Endocrinology, 139:290-302 (1998)) of
RNA from various organs of control mice or mice treated with LPS,
LPS+C10, LPS+DMSO (vehicle control), all from Table 5). Ribosomal
bands are shown as control for loading and integrity of samples.
The Northern blots demonstrate that LPS induced expression of
products from both the NF-.kappa.B (MCP-1) and IRF-3/IFN-.beta.
(IP-10, IRF-1) signal pathways that are activated by TLR4 are
significantly increased by LPS but attenuated by C10 treatment.
[0154] FIG. 8. Mice protected from Endotoxic shock by C10 have
reduced tissue levels of activated Stat1. In order to determine if
LPS-induced IFN-.beta. signaling and LPS-induced increases in IRF-1
in vivo might be attenuated by an effect of C10 treatment on Stat1
activation, protein phosphorylation levels of Stat1 in whole tissue
lysates was examined. Both kidney and lung tissues displayed
detectable levels of activated Stat1 protein in mice treated with
LPS plus control solvent (DMSO) and not protected from shock (lanes
2 and 5 respectively) by comparison to controls (Lanes 1 and 4).
These levels were reduced to basal in mice that were protected from
LPS induced shock by treatment with C10 (lanes 3 and 6
respectively). Similar results were evident using an antibody
measuring phosphoserine activated Stat1, i.e., C10 inhibited both
transcriptional activation and dimerization needed for full
expression of IRF-1 as a representative gene. Control mice and mice
treated with LPS, LPS+C10, or LPS+DMSO (solvent control) were all
from Table 5).
[0155] FIG. 9. Proinflammatory cytokines induced by endotoxic shock
are suppressed by C10. The pro-inflammatory cytokines TNF .alpha.,
IL-1.beta., IL-6, IL-12 and IFN .gamma. are reported to be secreted
by the activation of LPS-TLR-4-MyD88 dependent pathway but involve
also the MyD88 independent signals. Expression of these
pro-inflammatory cytokine genes in spleen, liver, lung, kidney and
heart of LPS injected and mice at 24 hours, was strongly induced by
endotoxic shock and suppressed by C10 as determined by Northern
analyses. These results were confirmed by determination of cytokine
concentrations in blood using an ELISA technique (Table 6). Most of
the cytokine levels increased in mice LPS and LPS plus DMSO treated
mice increased as much as 1000 fold compared to mice treated with
C10. Phenylmethimazole (C-10) normalized these cytokines to levels
approaching those in normal control mice. Blood was collected from
the inner canthus of the eye under anesthesia and serum was taken
and kept at -20 degree centigrade until use. ELISA kits from
R&D System were used and the results were expressed in
picograms per ml of serum.
[0156] FIG. 10. C10 decreases LPS/toxic shock increased COX-2, and
iNOs expression but decreases COX-1 expression in mice. LPS and C10
oppositely affect COX-1, COX-2 and iNOS expression as analyzed by
PCR. LPS injection in mice from the Experiment in Table 5 decreased
COX-1 expression at 24 hours compared to normal levels, in heart,
kidney and liver. C10 treatment attenuated this LPS effect on COX-1
in these organs, causing expression to revert to normal levels. No
variation on COX-1 expression due to LPS injection was observed in
spleen. COX-2 and iNOS were over-expressed in all five organs after
LPS injection; C10 treatment reversed the overexpression to normal
levels.
[0157] FIG. 11. C10 ameliorates the pathological inflammatory
effects of LPS-induced endotoxic shock in the lungs of mice.
Hematoxylin and eosin staining of lung showed inflammatory changes
at the microvascular level and inflammatory cell infiltration
induced by endotoxic shock at 20.times. magnification. LPS treated
mice from Table 5 showed an increase of inflammatory cells in the
as a function of time (Panels B and C by comparison to Panel A at
same magnification). There was an increase in inflammatory cells in
the lumen of the vessel (indicated by V in all Panels). This was
particularly evidenced by the margination or stickiness of the
cells to the vessel wall which suggesting rolling and adhesion of
the inflammatory cells (Panel C bold arrow). In Panel B and C, the
thickening of the septum was increased in the LPS-treated group
because of the infiltration of inflammatory cells (indicated by
small arrows in Panels B and C vs small arrows in A). The decreased
number of inflammatory cells in the lumen of vessels in the lung of
mice treated with C10 (phenylmethimazole) was evident (Panel D, V)
as were decreases in the thickness of the septum resultant from the
marked decrease in inflammatory cells and inflammatory changes
(Panel D, small arrows). When the LPS, and LPS plus C10 tissue
sections are compared with normal lung (Panel A), it is clearly
evident that the inflammatory process was significantly ameliorated
by the C10 treatment. All this suggests that C10 blocks the
increase in the inflammatory cells and their increase in
margination, stickiness to the wall, diapedesis and movement from
the lumen to the septum. C10 thus ameliorates the microcirculatory
damage and inflammatory cell infiltration to the lung of LPS
treated mice. The same results of C10 treatment in LPS-induced
toxic shock changes in the lung inflammatory response were noted at
40.times. magnification. These experiments utilized tissues from
the mice whose survival curves are detailed in Table 5.-Attraction
of inflammatory cells to the vessels of the lung and the tissues
should be associated with increases in adhesion molecule expression
in the vascular cells. In addition to decreasing inflammation in
the lungs, C10 decreased the expression of adhesion molecules
ICAM-1 and VCAM-1 in lung as evidenced when comparing lung tissues
from different groups of mice treated with LPS (Panels B and C) or
LPS+C10 (Panel D) with normal mice as a control (Panel A). The
expression of the adhesion molecules was marked by the intensity of
the brown color within the tissue. ICAM-1 and VCAM-1 molecule
expression was clearly increased and localized to the vascular
endothelium. C10 clearly decreased VCAM-1 expression compared with
the LPS treated group, reverting changes toward normal levels.
These data establish the effect of C10 to decrease leukocyte
infiltration, vascular changes, and increased adhesion molecules
induced by over-expression of the LPS-TLR-4 pathway in the lung
endothelial cells. The ability of C10 to decrease inflammatory
changes and adhesion molecule increases were not restricted to
lung. Thus, ICAM-1 and VCAM-1 were up-regulated on the endothelial
cells of the (centrolobular) vein and in the liver sinusoids in the
LPS treated group and C10 suppressed the ICAM-1 VCAM-1 increase.
Expression of both was returned toward normal by C10 treatment.
These data establish the ability of C10 to decreases adhesion
molecule over-expression induced by activation of the LPS-TLR-4
pathway in hepatic as well as lung vascular endothelial cells. Both
tissues are sites of organ failure in endotoxic shock.
[0158] FIG. 12. C10 decreases LPS-increased IFN-.beta., IL-1.beta.,
TNF-.alpha., IP-10, and IL-6 in RAW macrophages. RAW mouse
macrophages were stimulated with LPS (1 .mu.g/mL) for different
times and RNA extracted for Northern analyses (A) or for real time
quantitative polymerase chain reaction (PCR) (B). In (A), Northern
analysis compared mRNA expression profiles in the presence of C10
or the vehicle control (DMSO). In the case of IFN-.beta.,
IL-1.beta., IP-10, and IL-6 there was a significant decrease
evident in LPS-treated macrophages exposed to C10 by comparison to
the DMSO control. This affect was less pronounced for TNF-.alpha.
and may be attributed to a different TLR4 signaling mechanism of
activation or insensitivity of the assay. In (B), using real-time
PCR, mRNA levels were quantified by normalizing to an endogenous
control (GAPDH) and comparing C10 treatment to the untreated (DMSO
control). LPS-increased IFN-.beta. gene expression was strongly
decreased by C10 at the one hour time point (8 fold) and was
subsequently maintained at a low level throughout the time course
by C10. IL-6 was maximally decreased (16-fold) at the 3 hour time
point; IL-1.beta. was maximally decreased (11-fold) at 1 hr; and
IL-12 p40 was not detectable until 4.5 hours but was strongly
reduced at 6 hours (16 fold). TNF-.alpha. reduction was evident (4
fold) at 3 hours but showed no reduction at 1 or 6 hours. Taken
together these data show that C10 effectively reduces the LPS
dependent production of a broad range of proinflammatory cytokines
in RAW macrophages and that the results in large measure duplicate
those in the in vivo experiments depicted in FIG. 10 and Table
4.
[0159] FIG. 13. C10 decreases LPS-increased iNOS mRNA and Stat1
activation in RAW macrophages. In (A), the RAW 264.7 cells were
treated with LPS in the presence of C10 or control DMSO or another
vehicle (Vehicle B) for 3 hours. In the LPS treatment with the DMSO
control (lane 4) or with vehicle B only (lane 5), little or no iNOS
reduction was detected when compared to LPS only (lane 3). In
contrast, cells treated with C10 showed a strong reduction of LPS
induced iNOS mRNA (lanes 6 and 7 vs. lanes 4 and 5). C10 had a
strong inhibitory effect regardless of the vehicle used to dissolve
the compound. Cyclohexamide treatment was performed to confirm that
new protein synthesis is required for the LPS induction of iNOS
mRNA and thus confirm that interferon signaling was responsible for
the increase in iNOS not direct TLR4 signaling. This is consistent
with the ability of C10 to reduce the LPS induced increase in
IFN-.beta. mRNA (FIG. 12). Phosphorylation of Stat1 is a key
component for the transduction of the IFN-.beta. signal to the
nucleus to induce expression of iNOS and IP-10 in the mouse
macrophage (Y. Ohmori, et al., J Leukoc Biol, 69:598-604 (2001)).
In (B), C10 was able to reduce the level of LPS induced Stat1
phosphorylation in both cytoplasmic and nuclear fractions (lanes 5
and 9). No apparent affect was observed with DMSO control only
(lanes 4 and 8). The cyclohexamide control (lane 10) indicates that
LPS induced Stat 1 phosphorylation requires new protein synthesis,
presumably IFN-.beta. (V. Toshchakov, et al., J Endotoxin Res,
9:169-75 (2003)). Since C10 has a similar affect as does
cyclohexamide (lanes 9 vs. 10), albeit by different mechanisms, C10
may be acting as an inhibitor of IFN-.beta. synthesis as well. It
would appear that C10 can reduce signal transduction through the
IFN-.beta. signal pathway by reducing LPS induced
autocrine/paracrine increases of IFN-.beta. available to initiate
Stat1 activation.
[0160] FIG. 14. C10 down regulates LPS-increased IRF-1 RNA levels
and IRF-1 DNA binding to ISRE elements in RAW macrophages. (A) LPS
increased IRF-1 mRNA levels, as measured by northern analysis when
macrophages were treated with LPS (1 .mu.g/mL) for periods of 1, 2,
or 3 hour. C10 caused a strong reduction in IRF-1mRNA at 2 and 3
hour. Methimazole (MMI) has a significantly less impressive effect
but also decreases IRF-1 mRNA levels. In order for IRF-1 to enhance
gene transcription it must bind to cis-DNA elements located on the
target gene. Using the Mx ISRE (IRF-1 binding site) and EMSA (B),
the effect of C10 on LPS induced IRF-1 binding to the MxISRE
element was measured. Two complexes were induced upon LPS
stimulation (1 .mu.g/mL) for 2 hours when compared to extracts from
untreated cells (lane 2, 5, 8 vs. lane 1). A concentration
dependent reduction was observed with both C10 (lanes 3 and 4) and
methimazole (MMI) treatment (lanes 6 and 7). Specificity was
observed upon incubation of extracts with unlabeled MxISRE probe
(self, lane 9). Complexes were identified using super shift studies
in which nuclear extract was incubated with antibody directed
toward either IRF-1 (lane 11) or IRF-3 (lane 12). When incubated
with IRF-1 antibody there was a supershift that identified the
complex as an IRF-1 containing complex (lane 11). No supershift was
observed using two different IRF-3 antibodies (lane 12 Ab.#1; data
not shown for Ab. #2). Interestingly, when the extracts were
preincubated with unlabeled probe against the human IFN-.beta.
IRF-1 binding site, IRF-1 binding to the MxISRE probe was also
eliminated (lane 10), indicating that LPS induced IRF-1 in these
extracts would also bind to the human IFN-.beta. IRF-1/ISRE binding
element.
[0161] FIG. 15. C10 reduces vascular inflammation in ApoE-/- mice
fed a high fat diet. C10 was given orally (1 mg/kg) every other day
to mice for 8 weeks. Control mice received DMSO alone. Mice were
sacrificed at 8 weeks and histopathology examined in different
tissues as determined by hematoxylin and eosin staining. Sections
of the base of the aorta in C10 treated (Panel A) and untreated
mice (Panel B) are presented as well as sections of the coronary
artery vasculature in C10 treated (Panel C) and untreated mice
(Panel D). Significant improvement in both is evident by the
decrease in the extent of lesion and vessel patency in Panel A vs.
B at the base of the aorta and the patency vs. occlusion in
coronary arteries in Panel C vs. D. In Panel B, the arrows show the
severity of lesions in the base of the aorta is markedly greater in
untreated mice by comparison to C10 treated mice (Panel A).
Similarly in Panel D, the picture is representative of long
sections of the coronary arteries which were nearly fully occluded
with lesions containing foam cells in untreated mice whereas in C10
treated mice (shown in Panel C), coronary arteries were largely
unobstructed. In short, C10 clearly reduced extent of disease in
multiple sections as illustrated here. Even more dramatic effects
were seen in vessels in the myocardium when they are compared in
C10 treated and untreated mice. First, even where lesions were
evident the lumens of vessels remained patent. Moreover, vessels
within the myocardium were obstructed by lesions containing foam
cells in the absence of C10 but patent and nearly free of lesions
containing foam cells in the mice treated with C10. Sections of the
coronary arteries from untreated mice were immunstained with
anti-TLR4 anti-VCAM-1, anti-ICAM-1. VCAM-1 was overexpressed in the
lesion but also in the endothelial layer opposite the lesion area.
TLR4 was more expressed in the area opposite the lesion and,
surprisingly, throughout the smooth muscle layer surrounding the
vessel, particularly opposite the plaque. TLR4 was also expressed
in the myocardial musculature. The expression suggests a widespread
inflammatory response wherein TLR4 positive cells abound in the
macrophages infiltrating the area or in other cells, i.e.
interstitial cells around the myocardial sheaths. These data were
similar in human disease illustrated below. C10 attenuated
expression of both as noted in Table 15. Data are representative of
multiple slides taken from multiple animals.
[0162] FIG. 16. Atherosclerotic lesions in human tissues are
associated with overexpressed TLR4 and VCAM-1. Sections of the
coronary arteries from surgically removed plaques were immunstained
with anti-TLR4 (Bottom Right Panel), anti-VCAM-1 (Top Right Panel),
anti-ICAM-1 (Bottom Left Panel) in sequential slices from the
paraffin imbedded block. An H &E stain (Top Left Panel) shows
the occluded vessel with a foam cell, lipid laden "plaque"
surrounded by a muscle wall and myocardial tissue. VCAM-1 (dark
color) is overexpressed in the lesion but also in the endothelial
layer opposite the lesion area. TLR4 (dark color) is more expressed
in the area opposite the lesion and, surprisingly, throughout the
smooth muscle layer surrounding the vessel, particularly opposite
the plaque. TLR4 is also expressed in the myocardial musculature.
The expression suggests a widespread inflammatory response wherein
TLR4 positive cells abound be they macrophages infiltrating the
area or other cells. In all respects these data duplicate those in
the ApoE-/- mice and thus should be, like the lesions in the
ApoE-/- mice (Table 15), sensitive to C10 therapy.
[0163] FIG. 17. C10 decreases IFN-.beta. induction of
phosphorylation of Stat1 and the activation of IRF-1 in human
aortic endothelial cells (HAEC); C10 also decreases Stat1 serine
phosphorylation in HAEC as well as rat thyrocytes and RAW cells. In
(A), IFN-.beta. induction of IRF-1 protein was strongly decreased
by C10 but not the DMSO vehicle control (noted as D). The same
blot, stripped and reprobed for an activated form of Stat1
(phosphorylated at Y701), showed a decrease of IFN-.beta. induced
Stat1 phosphorylation. Therefore the C10 ability to decrease TLR3/4
increased IFN-.beta. dependent induction of IRF-1 gene expression
may be due to a decrease in activated Stat1. HAEC were treated for
2 hours in the absence or presence of C10 (1 mM) or DMSO (D)
carrier control. A non infected/non treated sample was included as
a control (far left lane). Twenty five (25) mg of whole cell lysate
were resolved by SDS-PAGE and then blotted onto nitrocellulose
membranes. In (B), the affect of C10 was also observed on Stat1
serine phosphorylation at residue 727 in rat thyrocytes, HAEC
cells, and RAW cells by western blot using a phosphoserine specific
Stat1 antibody. Rat thyrocytes (FRTL-5) were (lane 2) or were not
infected (lane 1) with Influenza A virus for 24 hours and then
treated with either DMSO (1%) (lane 3) or 1 mM C10 (lane 4). Human
aortic endothelial cells (HAEC) were incubated with 100 U/mL of
hIFN-.beta. for 2 hours in the presence of either DMSO (1%) (lane
5) or 1 mM C10 (lane 6). Mouse macrophages (RAW 264.7) were
incubated for 3 hours with E. coli LPS at a concentration of 500
ng/ml either alone (lane 7), in the presence of DMSO (0.5%) (lane
8), or with 0.5 mM C10 (lane 9). As in Panel A, 25 .mu.g of each
whole cell lysate was resolved by SDS-PAGE, blotted onto a
nitrocellulose membrane and then probed with the indicated
antibodies. Loading was controlled by stripping and reprobing with
an antibody directed against non phosphorylated Stat1. C10 inhibits
Stat1 serine phosphorylation independent of cell type [nonimmune
cell (thyrocyte, HAEC cell) or macrophage] or stimulus (IFN-.beta.,
Influenza A, or LPS). Stat3 phosphorylation was similarly
inhibited.
[0164] In the following description of the illustrated embodiments,
references are made to the accompanying drawings, which form a part
hereof, and in which is shown by way of illustration various
embodiments in which the invention may be practiced. It is to be
understood that other embodiments may be utilized, and structural
and functional changes may be made without departing from the scope
of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
[0165] Before the present compositions, devices and methods are
described, it is to be understood that this invention is not
limited to the specific methodology, devices, formulations, and
compositions described as such may, of course, vary.
[0166] As used throughout the disclosure, the following terms,
unless otherwise indicated, shall be understood to have the
following meanings.
[0167] The term "administration" of the pharmaceutically active
compounds and the pharmaceutical compositions defined herein
includes systemic use, as by injection (especially parenterally),
intravenous infusion, suppositories and oral administration
thereof, as well as topical application of the compounds and
compositions. Oral administration is particularly preferred in the
present invention.
[0168] An "allergen" refers to a substance that can induce an
allergic or asthmatic response in a susceptible subject. The list
of allergens is enormous and can include pollens, insect venoms,
animal dander, dust, fungal spores and drugs (e.g penicillin).
Examples of natural, animal and plant allergens include proteins
specific to the following genera: Canine (Canis familiaris);
Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis
domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium
perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica);
Altemaria (Alternaria alternata); Alder; Alnus (Alnus gultinosa);
Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea
europa); Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago
lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria
judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis
multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus
arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus
sabinoides, Juniperus virginiana, Juniperus communis and Juniperus
ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g.
Chamaecyparis obtusa); Periplaneta (e.g Periplaneta americana);
Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis
glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis
or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus
lanatus); Anthoxanthum (e.g Anthoxanthum odoratum); Arrhenatherum
(e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum
(e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea);
Paspalum (e.g Paspalum notatum); Sorghum (e.g Sorghum halepensis);
and Bromus (e.g Bromus inermis).
[0169] An "allergy" refers to acquired hypersensitivity to a
substance (allergen). Allergic conditions include eczema, allergic
rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives)
and food allergies, and other atopic conditions.
[0170] "Ameliorate" or "amelioration" means a lessening of the
detrimental effect or severity of the disorder in the subject
receiving therapy, the severity of the response being determined by
means that are well known in the art.
[0171] "Asthma" refers to a disorder of the respiratory system
characterized by inflammation, narrowing of the airways and
increased reactivity of the airways to inhaled agents. Asthma is
frequently, although not exclusively associated with atopic or
allergic symptoms.
[0172] "Atherosclerosis" is a form of chronic vascular injury in
which some of the normal vascular smooth muscle cells in the artery
wall, which ordinarily control vascular tone regulating blood flow,
change their nature and develop "cancer-like" behavior. These
vascular smooth muscle cells become abnormally proliferative and
responsive to inflammatory growth factors, then secrete
tissue-degradation enzymes and other proteins, which enable them to
invade and spread into the inner vessel lining where they engulf
fat and inflammatory debris, lyse, and repetitively cycle, thereby
expanding the inner inflamed lining of the blood vessels. This
process reduces vascular diameter, blocking blood flow, and making
that vessel abnormally susceptible to being completely blocked by
leukocytes and platelets, which adhere to adhesion molecules
overexpressed on the vascular endothelium. Local blood clotting
ensues, resulting in the death of the tissue served by that
artery.
[0173] "Autoimmune, inflammatory, proliferative, hyperproliferative
or vascular diseases" refers to any autoimmune, inflammatory,
proliferative or hyperproliferative disease or disorder known in
the art whether of a chronic or acute nature, including, but not
limited to, rheumatoid arthritis, restenosis, lupus erythematosus,
systemic lupus erythematosus, Hashimoto's thyroiditis, myasthenia
gravis, diabetes mellitus, uveitis, nephritic syndrome, multiple
sclerosis; inflammatory skin diseases, such as, for example,
psoriasis, dermatitis, contact dermatitis, eczema and seborrhea;
surgical adhesion; tuberculosis; inflammatory lung diseases, such
as, asthma, pneumoconiosis, chronic obstructive pulmonary disease,
emphysema, bronchitis, nasal polyps and pulmonary fibrosis;
inflammatory bowel disease, such as, Crohn's disease and ulcerative
colitis; graft rejections; inflammatory diseases that affect or
cause obstruction of a body passageway, such as, vasculitis,
Wegener's granulomatosis and Kawasaki disease; inflammation of the
eye, nose or throat, such as, neovascular diseases of the eye
including neovascular glaucoma, proliferative diabetic retinopathy,
retrolental fibroblasia, macular degeneration, corneal
neovascularization, such as, comeal infections; immunological
processes, such as, graft rejection and Steven-Johnson's syndrome,
alkali bums, trauma and inflammation (of any cause); fungal
infections, such as, for example, infections caused by Candida,
Trichophyton, Microsporum, Eepidermophyton, Cryptococcus,
Aspergillus, Coccidiodes, Paracocciciodes, Histoplasma or
Blastomyces; food related allergies, such as, for example,
migraine, rhinitis and eczema; vascular diseases, such as, aortic
aneurysm. A description of inflammatory diseases can also be found
in WO 92/05179, WO 98/09972, WO 98/24427, WO 99/62510 and U.S. Pat.
No. 5,886,026, the disclosures of each of which are incorporated
herein in their entirety.
[0174] "Blood" includes blood products, blood components and the
like.
[0175] "Cardiovascular disease or disorder" refers to any
cardiovascular disease or disorder known in the art, including, but
not limited to, restenosis, coronary artery disease,
atherosclerosis, atherogenesis, cerebrovascular disease, angina,
(particularly chronic, stable angina pectoris), ischemic disease,
congestive heart failure or pulmonary edema associated with acute
myocardial infarction, thrombosis, high or elevated blood pressure
in hypertension (especially hypertension associated with
cardiovascular surgical procedures), platelet aggregation, platelet
adhesion, smooth muscle cell proliferation, vascular or
non-vascular complications associated with the use of medical
devices, wounds associated with the use of medical devices,
vascular or non-vascular wall damage, peripheral vascular disease,
neoinitimal hyperplasia following percutaneous transluminal
coronary angiograph, and the like. Complications associated with
the use of medical devices may occur as a result of increased
platelet deposition, activation, thrombus formation or consumption
of platelets and coagulation proteins. Such complications, which
are within the definition of "cardiovascular disease or disorder,"
include, for example, myocardial infarction, pulmonary
thromboembolism, cerebral thromboembolism, thrombophlebitis,
thrombocytopenia, bleeding disorders and/or any other complications
which occur either directly or indirectly as a result of the
foregoing disorders.
[0176] The term "cerebrovascular diseases or events" as employed
herein refers to cerebral infarction or stroke (caused by vessel
blockage or hemorrhage), or transient ischemia attack (TIA),
syncope, atherosclerosis of the intracranial and/or extracranial
arteries, and the like.
[0177] "Chemokines" are chemotactic cytokines that are released by
a wide variety of cells to attract macrophages, T-cells,
eosinophils, basophils, neutrophils and endothelial cells to sites
of inflammation and tumor growth. There are two main classes of
chemokines, the CXC-chemokines and the CC-chemokines. The class
depends on whether the first two cysteines are separated by a
single amino acid (CXC-chemokines) or are adjacent (CC-chemokines).
The CXC-chemokines include interleukin-8 (IL-8),
neutrophil-activating protein-1 (NAP-1), neutrophil-activating
protein-2 (NAP-2), GRO.alpha., GRO.beta., GRO.gamma., ENA-78,
GCP-2, IP-10, MIG and PF4. CC chemokines include RANTES,
MIP-1.alpha., MIP-2.beta., monocyte chemotactic protein-1 (MCP-1),
MCP-2, MCP-3 and eotaxin.
[0178] By "compatible" herein is meant that the components of the
compositions which comprise the present invention are capable of
being commingled without interacting in a manner which would
substantially decrease the efficacy of the pharmaceutically active
compound under ordinary use conditions.
[0179] The term "coronary events" as employed herein refers to
myocardial infarction, myocardial revascularization procedures,
angina, cardiovascular death and acute coronary syndrome.
[0180] By "corticosteroid" is meant any naturally occurring or
synthetic steroid hormone, which can be derived from cholesterol
and is characterized by a hydrogenated
cyclopentanoperhydrophenanthrene ring system. Naturally occurring
corticosteroids are generally produced by the adrenal cortex.
Synthetic corticosteroids may be halogenated. Functional groups
required for activity include a double bond at .DELTA.4, a C3
ketone, and a C20 ketone. Corticosteroids may have glucocorticoid
and/or mineralocorticoid activity.
[0181] The term "endotoxic shock" or "septic shock" includes
without limitation a physical or mental disturbance induced by the
release of endotoxin from Gram-negative bacteria or by the release
of super antigens from Gram-positive bacteria. The term "septic
shock" or "sepsis" refers to a clinical disorder whose symptoms may
include well defined abnormalities in body temperature, heart rate,
breathing rate, white blood cell count, hypertension then
hypotension, organ perfusion abnormalities, and multiple organ
dysfunction. It may be caused by or associated with bacterial
(either gram negative or gram positive), fungal, viral or other
infection, as well as by non-infective stimuli such as multiple
trauma, severe bums, organ transplantation and pancreatitis. Septic
shock is commonly caused by "gram-negative" endotoxin- (LPS)
producing aerobic rods--Escherichia coli, Klebsiella pneumoniae,
Proteus species, Pseudomonas aeruginosa and Salmonella. Septic
shock involved with gram negative bacteria is referred to as
"endotoxic shock".
[0182] Exemplary corticosteroids include, for example,
dexamethasone, betamethasone, triamcinolone, triamcinolone
acetonide, triamcinolone diacetate, triamcinolone hexacetonide,
beclomethasone, dipropionate, beclomethasone dipropionate
monohydrate, flumethasone pivalate, diflorasone diacetate,
fluocinolone acetonide, fluorometholone, fluorometholone acetate,
clobetasol propionate, desoximethasone, fluoxymesterone,
fluprednisolone, hydrocortisone, hydrocortisone acetate,
hydrocortisone butyrate, hydrocortisone sodium phosphate,
hydrocortisone sodium succinate, hydrocortisone cypionate,
hydrocortisone probutate, hydrocortisone valerate, cortisone
acetate, paramethasone acetate, methylprednisolone,
methylprednisolone acetate, methylprednisolone sodium succinate,
prednisolone, prednisolone acetate, prednisolone sodium phosphate,
prednisolone tebutate, clocortolone pivalate, dexamethasone
21-acetate, betamethasone 17-valerate, isoflupredone,
9-fluorocortisone, 6-hydroxydexamethasone, dichlorisone,
meclorisone, flupredidene, doxibetasol, halopredone, halometasone,
clobetasone, diflucortolone, isoflupredone acetate,
fluorohydroxyandrostenedione, flumethasone, diflorasone,
fluocinolone, clobetasol, cortisone, paramethasone, clocortolone,
prednisolone 21-hemisuccinate free acid, prednisolone
metasulphobenzoate, and triamcinolone acetonide 21-palmitate. By
"low dose corticosteroid" is meant a dose that is less than a dose
that would typically be given to a patient for treatment of
inflammation. Exemplary low doses of corticosteroids are as
follows: cortisol: 12 mg/day; cortisone: 15 mg/day; prednisone: 3
mg/day; methylprednisolone: 2.5 mg/day; triameinolone: 2.5 mg/day;
betamethasone: 250 .mu.g/day; dexamethasone: 450 .mu.g/day;
hydrocortisone: 9 mg/day.
[0183] "Cyclooxygenase-2 (COX-2) inhibitor" refers to a compound
that selectively inhibits the cyclooxygenase-2 enzyme by comparison
to the cyclooxygenase-1 enzyme. Preferably, the compound has a
cyclooxygenase-2 IC.sub.50 of less than about 0.5 .mu.M, and also
has a selectivity ratio of cyclooxygenase-2 inhibition over
cyclooxygenase-1 inhibition of at least 50, and more preferably of
at least 100. Even more preferably, the compound has a
cyclooxygenase-1 IC.sub.50 of greater than about 1 .mu.M, and more
preferably of greater than 20 .mu.M. The compound can also inhibit
the enzyme, lipoxygenase and/or phosphodiestase. Such preferred
selectivity may indicate an ability to reduce the incidence of
common NSAID-induced side effects.
[0184] "HMG-CoA reductase inhibitor" where used in the
specification and the appendant claims, is synonymous with the
terms "3-hydroxy-3-methylglutary-1-Coenzyme A reductase inhibitor",
"HMG-CoA inhibitor" and "statins." These three terms are used
interchangeably throughout the specification and appendant claims.
As the synonyms suggest, statins are inhibitors of
3-hydroxy-3-methylglutaryl-Coenzyme A reductase and, as such, are
effective in lowering the level of blood plasma cholesterol.
Statins and pharmaceutically acceptable salts thereof are
particularly useful in lowering low-density lipoprotein cholesterol
(LDL-C) levels in mammals and particularly in humans. The HMG-CoA
reductase inhibitors suitable for use herein include, but are not
limited to, simvastatin, pravastatin, rivastatin, mevastatin,
fluindostatin, cerivastatin, velostatin, fluvastatin, dalvastatin,
dihydrocompactin, compactin, or lovastatin; or a pharmaceutically
acceptable salt of simvastatin, pravastatin, rivastatin,
cerivastatin, mevastatin, fluindostatin, velostatin, fluvastatin,
dalvastatin, dihydrocompactin, compactin, lovastatin, or
pharmaceutically acceptable salts thereof. However, it is to be
noted that atorvastatin calcium is a particularly preferred statin
to be employed in the present combination. See U.S. Pat. No.
5,273,995 incorporated herein by reference. The statins disclosed
herein are prepared by methods well-known to those skilled in the
art. Specifically, simvastatin may be prepared according to the
method disclosed in U.S. Pat. No. 4,444,784, which is incorporated
herein by reference. Pravastatin may be prepared according to the
method disclosed in U.S. Pat. No. 4,346,227, which is incorporated
herein by reference. Cerivastatin may be prepared according to the
method disclosed in U.S. Pat. No. 5,502,199, which is incorporated
herein by reference. Cerivastatin may alternatively be prepared
according to the method disclosed in European Patent Application
Publication No. EP617019. Mevastatin may be prepared according to
the method disclosed in U.S. Pat. No. 3,983,140, which is
incorporated herein by reference. Velostatin may be prepared
according to the methods disclosed in U.S. Pat. No. 4,448,784 and
U.S. Pat. No. 4,450,171, both of which are incorporated herein by
reference. Fluvastatin may be prepared according to the method
disclosed in U.S. Pat. No. 4,739,073, which is incorporated herein
by reference. Compactin may be prepared according to the method
disclosed in U.S. Pat. No. 4,804,770, which is incorporated herein
by reference. Lovastatin may be prepared according to the method
disclosed in U.S. Pat. No. 4,231,938, which is incorporated herein
by reference. Dalvastatin maybe prepared according to the method
disclosed in European Patent Application Publication No. 738510 A2.
Fluindostatin may be prepared according to the method disclosed in
European Patent Application Publication No. 363934 A1.
Dihydrocompactin may be prepared according to the method disclosed
in U.S. Pat. No. 4,450,171, which is incorporated herein by
reference. It will be recognized that certain of the above statins
contain either a free carboxylic acid or a free amine group as part
of the chemical structure. Further, certain statins within the
scope of this invention contain lactone moieties, which exist in
equilibrium with the free carboxylic acid form. These lactones can
be maintained as carboxylates by preparing pharmaceutically
acceptable salts of the lactone. Thus, this invention includes
pharmaceutically acceptable salts of those carboxylic acids or
amine groups. The expression "pharmaceutically acceptable salts"
includes both pharmaceutically acceptable acid addition salts and
pharmaceutically acceptable cationic salts. The expression
"pharmaceutically acceptable cationic salts" is intended to define
but is not limited to such salts as the alkali metal salts, (e.g.,
sodium and potassium), alkaline earth metal salts (e.g., calcium
and magnesium), aluminum salts, ammonium salts, and salts with
organic amines such as benzathine (N,N'-dibenzylethylenediamine),
choline, diethanolamine, ethylenediamine, meglumine
(N-methylglucamine), benethamine (N-benzylphenethylamine),
diethylamine, piperazine, tromethamine
(2-amino-2-hydroxymethyl-1,3-propanediol) and procaine. The
expression "pharmaceutically acceptable acid addition salts" is
intended to define but is not limited to such salts as the
hydrochloride, hydrobromide, sulfate, hydrogen sulfate, phosphate,
hydrogen phosphate, dihydrogenphosphate, acetate, succinate,
citrate, methanesulfonate (mesylate) and p-toluenesulfonate
(tosylate) salts. The pharmaceutically acceptable cationic salts of
statins containing free carboxylic acids may be readily prepared by
reacting the free acid form of the statin with an appropriate base,
usually one equivalent, in a co-solvent. Typical bases are sodium
hydroxide, sodium methoxide, sodium ethoxide, sodium hydride,
potassium methoxide, magnesium hydroxide, calcium hydroxide,
benzathine, choline, diethanolamine, piperazine, and tromethamine.
The salt is isolated by concentration to dryness or by addition of
a non-solvent. In many cases, salts are preferably prepared by
mixing a solution of the acid with a solution of a different salt
of the cation (sodium or potassium ethylhexanoate, magnesium
oleate), employing a solvent (e.g., ethyl acetate) from which the
desired cationic salt precipitates, or can be otherwise isolated by
concentration and/or addition of a non-solvent.
[0185] The pharmaceutically acceptable acid addition salts of
statins containing free amine groups may be readily prepared by
reacting the free base form of the statin with the appropriate
acid. When the salt is of a monobasic acid (e.g., the
hydrochloride, the hydrobromide, the p-toluenesulfonate, the
acetate), the hydrogen form of a dibasic acid (e.g., the hydrogen
sulfate, the succinate), or the dihydrogen form of a tribasic acid
(e.g., the dihydrogen phosphate, the citrate), at least one molar
equivalent and usually a molar excess of the acid is employed.
However, when such salts as the sulfate, the hemisuccinate, the
hydrogen phosphate, or the phosphate are desired, the appropriate
and exact chemical equivalents of acid will generally be used. The
free base and the acid are usually combined in a co-solvent from
which the desired salt precipitates, or can be otherwise isolated
by concentration and/or addition of a non-solvent.
[0186] The term "infectious disease" as used herein, includes, but
is not limited to any disease that is caused by an infectious agent
or organism. Infectious organisms may comprise viruses, (e.g.,
single stranded RNA viruses, double strand DNA viruses, single
stranded DNA viruses, human immunodeficiency virus (HIV), hepatitis
A, B, and C virus, herpes simplex virus (HSV), cytomegalovirus
(CMV) Epstein-Barr virus (EBV), human papilloma virus (HPV)),
parasites (e.g., protozoan and metazoan pathogens such as Plasmodia
species, Leishmania species, Schistosoma species, Trypanosoma
species), bacteria (e.g., Mycobacteria, in particular, M.
tuberculosis, Salmonella, Streptococci, E. coli, Staphylococci),
fungi (e.g., Candida species, Aspergillus species), Pneumocystis
carinii, and prions.
[0187] Examples of infectious virus include: Retroviridae (e.g.,
human immunodeficiency viruses, such as HIV-1 (also referred to as
HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such
as HIV-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus;
enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses);
Calciviridae (e.g., strains that cause gastroenteritis);
Togaviridae (e.g., equine encephalitis viruses, rubella viruses);
Flaviridae (e.g., dengue viruses, encephalitis viruses, yellow
fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae
(e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae
(e.g., Ebola viruses); Paramnyxoviridae (e.g., parainfluenza
viruses, mumps virus, measles virus, respiratory syncytial virus);
Orthomyxoviridae (e.g., influenza viruses); Bungaviridae (e.g.,
Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses);
Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g.,
reoviruses, orbiviurses and rotaviruses); Birnaviridae;
Hepadnaviridae (Hepatitis B virus); Parvoviridae (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae
(most adenoviruses); Herpesviridae (herpes simplx virus (HSV) 1 and
2, varicella zoster virus, cytomegalovirus (CMV), herpes viruses');
Poxviridae (variola viruses, vaccinia viruses, pox viruses); and
Iridoviridae (e.g., African swine fever virus); and unclassified
viruses (e.g, the etiological agents of Spongiform
encephalopathies, the agent of delta hepatitis (thought to be a
defective satellite of hepatitis B yirus), the agents of non-A,
non-B hepatitis (class 1=internally transmitted; class
2=parenterally transmitted (i.e., Hepatitis C); Nor-walk and
related viruses, and astroviruses).
[0188] Examples of infectious bacteria include: Helicobacter
pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria
spp. (e.g., M. tuberculosis, M. avium, M. intracellulare, M.
kansasii, M. gordonae), Staphylococcus aureus, Neisseria
gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes,
Streptococcus pyogenes (Group A Streptococcus), Streptococcus
agalactiae (Group B Streptococcus), Streptococcus (viridans group),
Streptococcus faecalis, Streptococcus bovis, Streptococcus
(anaerobic spp.), Streptococcus pneumoniae, pathogenic
Campylobacter sp., Enterococcus sp., Haemophilus influenzae,
Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium
sp., Erysipelothrix rhusiopathiae, Clostridium perfringens,
Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae,
Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum,
Streptobacillus moniliformis, Treponema pallidum, Treponema
pertenue, Leptospira, and Actinomyces israelli.
[0189] Examples of infectious fungi include: Cryptococcus
neoformans, Histoplasma capsulatum, Coccidioides immitis,
Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
Other infectious organisms (i.e., protists) include: Plasmodium
falciparum and Toxoplasma gondii.
[0190] "Inflammatory disease or disorder" refers to reperfusion
injury to an ischemic organ, myocardial infarction, inflammatory
bowel disease, rheumatoid arthritis, osteoarthritis, hypertension,
psoriasis, organ transplant rejection, organ preservation, a female
or male sexual dysfunction, radiation-induced injury, asthma,
atherosclerosis, thrombosis, platelet aggregation, restenosis,
metastasis, influenza, incontinence, stroke, burn, trauma, acute
pancreatitis, pyelonephritis, hepatitis, an autoimmune disease, an
immunological disorder, senile dementia, insulin-dependent diabetes
mellitus, disseminated intravascular coagulation, fatty embolism,
Alzheimer's disease, adult or infantile respiratory disease,
carcinogenesis or a hemorrhage in a neonate.
[0191] "Inflammatory response" as used herein is characterized by
redness, heat, swelling and pain (i.e., inflammation) and typically
involves tissue injury or destruction. An inflammatory response is
usually a localized, protective response elicited by injury or
destruction of tissues, which serves to destroy, dilute or wall off
(sequester) both the injurious agent and the injured tissue.
Inflammatory responses are notably associated with the influx of
leukocytes and/or leukocyte (e.g., neutrophil) chemotaxis.
Inflammatory responses may result from infection with pathogenic
organisms and viruses, noninfectious means such as trauma or
reperfusion following myocardial infarction or stroke, immune
responses to foreign antigens, and autoimmune diseases.
Inflammatory responses amenable to treatment with the methods and
compounds according to the invention encompass conditions
associated with reactions of the specific defense system as well as
conditions associated with reactions of the non-specific defense
system.
[0192] "Niacin" includes such drugs as derivatives of niacinamide,
niacin, and niacin esters. Such examples include but not limited to
niacinamide salicylate, niacinamide lipoate, niacinamide mandelate,
niacinamide lactate, niacinamide glycolate, niacinamide malate,
niacinamide adenosine phosphate, niacinamide adenosine
triphosphate, niacinamide ascorbate, niacinamide folate,
niacinamide hydroxycitrate, niacinamide hydroxytetronate,
niacinamide pantothenate, niacin salicylate, niacin lipoate, niacin
mandelate, niacin lactate, niacin glycolate, niacin malate, niacin
adenosine phosphate, niacin adenosine triphosphate, niacin
ascorbate, niacin folate, niacin hydroxycitrate, niacin
pantothenate, niacin hydroxytetronate, benzyl nicotinate lipoate
(benzyl niacin lipoate), methyl nicotinate lipoate (methyl niacin
lipoate), benzyl niacin ascorbate, methyl niacin ascorbate, benzyl
niacin salicylate, methyl niacin salicylate, benzyl niacin
pantothenate, methyl niacin pantothenate, benzyl niacin lactate,
methyl niacin lactate, benzyl niacin malate, methyl niacin malate,
lauryl niacin lipoate, lauryl niacin ascorbate, lauryl niacin
salicylate, lauryl niacin lactate, methyl niacin glycyrrhetinate,
niacinamide glycyrrhetinate, niacinamide glycyrrhizinate,
niacinamide hyaluronate, niacinamide pyrrolidone carboxylate,
benzyl niacin hyaluronate, benzyl niacin pyrrolidone carboxylate,
niacinamide hydroquinone carboxylate, niacin hydroquinone
carboxylate, methyl niacin hydroquinone carboxylate, benzyl niacin
hydroquinone carboxylate, lauryl niacin hydroquinone carboxylate,
methyl niacin ursolate, lauryl niacin ursolate, benzyl niacin
ursolate, niacinamide ellagate, niacinamide rosmarinate,
niacinamide chloroginate, methyl niacin ellagate, methyl niacin
chloroginate, lauryl ellagate, lauryl chloginate, lauryl
rosmarinate, and methyl niacin rosmarinate.
[0193] "NSAID" refers to a nonsteroidal anti-inflammatory compound
or a nonsteroidal anti-inflammatory drug. NSAIDs inhibit
cyclooxygenase, the enzyme responsible for the biosyntheses of the
prostaglandins and certain autocoid inhibitors, including
inhibitors of the various isozymes of cyclooxygenase (including but
not limited to cyclooxygenase-1 and -2), and as inhibitors of both
cyclooxygenase and lipoxygenase.
[0194] The term "patient", as used herein, is intended to encompass
any mammal, animal or human subject, which may benefit from
treatment with the compounds, compositions and methods of the
present invention, and includes children and adults.
[0195] "Pharmaceutically-acceptable" shall mean that the
pharmaceutically active compound and other ingredients used in the
pharmaceutical compositions and methods defined herein are suitable
for use in contact with the tissues of humans and lower animals
without undue toxicity, irritation, allergic response, and the
like, commensurate with a reasonable benefit/risk ratio.
[0196] "Phosphodiesterase inhibitor" or "PDE inhibitor" refers to
any compound that inhibits the enzyme phosphodiesterase. The term
refers to selective or non-selective inhibitors of cyclic guanosine
3',5'-monophosphate phosphodiesterases (cGMP-PDE) and cyclic
adenosine 3',5'-monophosphate phosphodiesterases (cAMP-PDE).
[0197] "Alpha-adrenergic receptor antagonist" refers to any
compound that reversibly or irreversibly blocks the activation of
any alpha-adrenergic receptor.
[0198] "Phosphokinase inhibitor" refers to any compound that
inhibits a phosphokinase, which includes but is not limited to
kinases phosphorylating Stats, viral activated kinases, tamoxifen,
dinitro-fluorobenzene (DNFB), and inhibitors of a serine kinase
including isopentenyladenine, 6-dimethylaminopurine, olomoucine,
roscovitine, CVT-313, purvanol, butyrolactone-I, flavopiridols,
staurosporine, indirubins, hymenialdesine, and paullones.
[0199] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions.
[0200] "Respiratory disease or disorder" refers to any pulmonary
dysfunction including, for example, acute pulmonary
vasoconstriction, pneumonia, traumatic injury, aspiration or
inhalation injury, fat embolism in the lung, acidosis, inflammation
of the lung, adult respiratory distress syndrome, acute pulmonary
edema, acute mountain sickness, asthma, post cardiac surgery acute
pulmonary hypertension, persistent pulmonary hypertension of the
newborn, perinatal aspiration syndrome, hyaline membrane disease,
acute pulmonary thromboembolism, heparin-protamine reactions,
sepsis, asthma, status asthmaticus, or hypoxia (including that
which may occur during one-lung anesthesia), chronic pulmonary
vasoconstriction, chronic pulmonary hypertension, bronchopulmonary
dysplasia, chronic pulmonary thromboembolism, idiopathic or primary
pulmonary hypertension, or chronic hypoxia.
[0201] As used herein, a "safe and effective amount" means a
sufficient amount of a pharmaceutically active compound to effect
the inhibition of TLR-mediated disease expression and related
pathologies. In one embodiment, a a "safe and effective amount"
means a sufficient amount of a pharmaceutically active compound to
effect the inhibition of TLR3, TLR4, or TLR mediated disease
expression and related pathologies involving abnormal
MyD88-dependent and MyD88 independent signaling, most preferably
TLR3, TLR4, or TLR mediated disease expression and related
pathologies involving abnormal MyD88 independent signaling that
increases IRF-3, Type 1 IFN, STAT, IRF-1, and ISRE increase or
activation. Within the scope of sound medical judgment,
therapeutically effective amounts of a pharmaceutically active
agent or of the pharmaceutical composition containing that active
agent will vary with the severity of the condition being treated,
the duration of the treatment, the nature of adjunct treatment, the
age and physical condition of the patient, the specific active
compound employed, and like considerations discussed more fully
hereinafter. In arriving at the "safe and effective amount" for a
particular compound, these risks must be taken into
consideration.
[0202] "Therapeutic agent" as used herein refers to those agents
effective in the prevention or treatment of a disorder or
pathologic physiological condition. Therapeutic agent includes the
pro-drugs and pharmaceutical derivatives thereof including but not
limited to the corresponding nitrosated and/or nitrosylated
derivatives.
[0203] "Therapeutically effective amount" refers to the amount of
the compound and/or composition that is effective to achieve its
intended purpose.
[0204] "Toll-like receptors" or "TLRs" are type I transmembrane
proteins containing repeated leucine-rich motifs in their
extracellular domains and a cytoplasmic tail that contains a
conserved region called the Toll/IL1 receptor (TIR) domain. At
least 10 mammalian TLR proteins have been identified, Toll-like
receptors 1-10. TLRs play a critical role in early innate immunity
to invading pathogens by sensing microorganisms or noxious
environmental agents. These evolutionarily conserved receptors,
homologues of the Drosophila Toll gene, recognize highly conserved
structural motifs expressed by microbial pathogens, called
pathogen-associated microbial patterns (PAMPs) and sense products
of tissue damage by noxious agents or tissue injury, for example
dsRNA. PAMPs include various bacterial cell wall components such as
lipopolysaccharide (LPS), peptidoglycan (PGN) and lipopeptides, as
well as flagellin, bacterial DNA and viral double-stranded RNA. TLR
thus protect mammals from pathogenic organisms, such as viruses,
bacteria, parasitic agents, or fungi, and from tissue injury, by
generating an "innate immune" response to products of the
pathogenic organism. They thus may additionally protect animals
from noxious environmental agents that destroy cells and release
dsRNA or other PAMPs that can interact with the TLR. The innate
immune response results in increases in genes encoding several
inflammatory cytokines, chemokines, as well as co-stimulatory
molecules, and is critical for the development of antigen-specific
adaptive immunity. Stimulation of TLRs by PAMPs initiates a
signaling cascade that involves a number of proteins, such as MyD88
and IRAK1. This signaling cascade leads to the activation of the
transcription factor NF-kB which induces the secretion of
pro-inflammatory cytokines (such as TNF .alpha. and IL-1.beta.) and
effector cytokines that direct the adaptive immune response. The
signaling cascade additionally involves adaptors such as
TRIF/TICAM- 1 which can signal the IRF-3 pathway to increase Type 1
IFN production, activate Stats, increase IRF-1 gene expression, and
activate ISRE's, interferon response factor (IRF) elements. In the
case of virus, injection of dsRNA or single strand RNA with its
replication can activate viral kinases, bypass TLR, activate PKR
and IRF-3, and initiate the NF-.kappa.B and Type 1 IFN cascades,
which, by the autocrine/paracrine action of type 1 IFNs, the
cytokines and the chemokines can initiate the innate
immune-adaptive immune response sequence.
[0205] "Transplantation rejection" refers to the transplant of any
organ or body part resulting in organ or tissue graft rejection,
allograft rejection, and graft-versus-host disease, including but
not limited to, heart, kidney, liver, lung, bone marrow, cornea and
skin transplants.
[0206] "Treat," "treating," "treatment," and "therapy" as used
herein refer to any curative therapy, prophylactic therapy,
ameliorative therapy and preventative therapy for a subject.
[0207] "Vasoactive agent" refers to any therapeutic agent capable
of relaxing vascular and/or nonvascular smooth muscle. Suitable
vasoactive agents include, but are not limited to, potassium
channel activators, calcium channel blockers, beta-blockers, long
and short acting alpha-adrenergic receptor antagonists,
prostaglandins, phosphodiesterase inhibitors, adenosine, ergot
alkaloids, vasoactive intestinal peptides, dopamine agonists,
opioid antagonists, endothelin antagonists, thromboxane inhibitors
and the like.
[0208] "Viral infection" refers to both RNA and DNA viral
infections. The RNA viral infections include, but are not limited
to, orthomyxoviridae, paramyxoviridae, picornaviridae,
rhabdoviridae, coronavaridae, togaviridae, bunyaviridae,
arenaviridae and reteroviridae. The DNA viral infections include,
but are not limited to, adenoviridae, proxviridae, papovaviridae,
herpetoviridae and herpesviridae. In one specific embodiment, the
viral infections include, but are not limited to, double or single
strand RNA viruses such as flu viruses, hepatitis virus,
enteroviruses, and Coxsackie viruses, viruses of the herpetoviridae
family, such as, for example, herpes simplex viruses HSV- 1 and
HSV-2, cytomegalovirus (CMV), herpes varicella-zoster (VZV),
Epstein-Barr (EBV), HHV6, HHV7, pseudorabies and rhinotracheitis,
and the like.
[0209] It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to limit the scope of the present invention, which
will be limited only by the appended claims.
[0210] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and", and "the" include plural
referents unless the context clearly dictates otherwise. Unless
defined otherwise, all technical and scientific terms used herein
have the same meaning as commonly understood to one of ordinary
skill in the art to which this invention belongs. Although any
methods, devices and materials similar or equivalent to those
described herein can be used in the practice or testing of the
invention, the preferred methods, devices and materials are now
described.
[0211] The present invention relates to the treatment of TLR3 as
well as TLR4 mediated diseases and related pathologies. This
invention relates to the treatment of TLR3-mediated diseases,
including Hashimoto's thyroiditis, Type I diabetes, and insulinitis
but is not limited to these. This invention relates to the
treatment of TLR4-mediated diseases, including toxic shock,
atherosclerosis, vascular diseases associated with hyperlipidemia,
ulcerative colitis, and Crohn's disease, but is not limited to
these. The present invention also relates to the treatment of TLR
mediated diseases and related pathologies, e.g. TLR9, which involve
pathologic expression of MyD88-independent signaling involving
activation of the IRF-3/Type I IFN signal pathway as in diseases
including but not limited to systemic lupus and rheumatoid
arthritis.
[0212] The present invention relates to the treatment of TLR3 as
well as TLR4 mediated diseases in nonimmune cells, monocytes,
macrophages, or dendritic cells and related pathologies. This
invention relates to the treatment of TLR3-mediated diseases in
nonimmune cells, monocytes, macrophages, or dendritic cells,
including Hashimoto's thyroiditis, Type I diabetes, and insulinitis
but is not limited to these. This invention relates to the
treatment of TLR4-mediated diseases in nonimmune cells, monocytes,
macrophages, or dendritic cells including toxic shock,
atherosclerosis, vascular diseases associated with hyperlipidemia,
ulcerative colitis, and Crohn's disease, but is not limited to
these.
[0213] The present invention relates to the treatment of TLR
mediated diseases with abnormal IRF-3, Type-1 IFN, STAT, and IRF-1
signaling and related pathologies. This invention thus relates to
the treatment of TLR-mediated diseases, including Graves' disease,
systemic lupus, rheumatoid arthritis, autoimmune uveitis,
autoimmune blepharitis, and psoriasis, wherein there is abnormal
TLR signaling through this pathway, but is but is not limited to
these.
[0214] The present invention relates to the treatment of TLR
mediated diseases with abnormal IRF-3, Type-1 IFN, STAT, and IRF-1
signaling in nonimmune cells, monocytes, macrophages, or dendritic
cells and related pathologies. This invention thus relates to the
treatment of TLR-mediated diseases in nonimmune cells, monocytes,
macrophages, or dendritic cells, including Graves' disease,
systemic lupus, rheumatoid arthritis, autoimmune uveitis,
autoimmune blepharitis, and psoriasis, wherein there is abnormal
TLR signaling in nonimmune cells, monocytes, macrophages, or
dendritic cells through this pathway, but is not limited to
these.
[0215] This invention also relates to treating a subject having a
disease or condition associated with an autoimmune inflammatory
disease induced by abnormal Toll-like receptor 3 or TLR4 expression
or signaling induced by viruses are noxious agents that enter the
cell and cause abnormal NF-.kappa.B and IRF-3, Type-1 IFN, STAT,
and IRF-1 signaling and related pathologies as exemplified by
diseases with increased Type 1 IFN levels in the serum.
[0216] This invention also relates to treating a subject having a
disease or condition associated with an autoimmune inflammatory
disease induced by abnormal Toll-like receptor expression or
signaling caused by phagocytosis of infectious or noxious agents
that enter the cell and cause abnormal TLR-mediated expression of
IRF-3, Type-1 IFN, STAT, and IRF-1 signaling and related
pathologies as exemplified by diseases with increased Type 1 IFN
levels in the serum.
[0217] This invention also relates to treating a subject having a
disease or condition associated with an autoimmune inflammatory
disease induced by abnormal Toll-like receptor 3 or TLR4 expression
or signaling in a nonimmune cell, monocyte, macrophage, or
dendritic cell induced by viruses or noxious agents that enter the
cell and cause abnormal NF-.kappa.B and IRF-3, Type-1 IFN, STAT,
and IRF-1 signaling and related pathologies as exemplified by
diseases with increased Type 1 IFN levels in the serum.
[0218] This invention also relates to treating a subject having a
disease or condition associated with an autoimmune inflammatory
disease induced by abnormal Toll-like receptor expression or
signaling in a nonimmune cell, monocyte, macrophage, or dendritic
cell caused by phagocytosis of infectious or noxious agents that
enter the cell and cause abnormal NF-.kappa.B and IRF-3, Type-1
IFN, STAT, and IRF-1 signaling and related pathologies as
exemplified by diseases with increased Type 1 IFN levels in the
serum.
[0219] This invention also relates to treating a subject having a
disease or condition associated with an autoimmune inflammatory
disease induced by abnormal Toll-like receptor 3 or TLR4 expression
or signaling induced by viruses or noxious agents that enter the
cell and cause abnormal IRF-3, Type-1 IFN, STAT, and IRF-1
signaling and related pathologies as exemplified by diseases with
increased Type 1 IFN levels in the serum.
[0220] The present invention also provides for methods of treating
such disease comprising administering to a patient in need of such
treatment a therapeutically effective amount of one or more
compound selected from methimazole (MMI), phenylmethimazole, and
tautomeric cyclic thione compounds and active derivatives thereof
of the present invention capable of preventing, ameliorating or
inhibiting pathologies that are mediated or associated with
Toll-like receptor 3 or Toll-like receptor 4 overexpression,
activation, and signaling or both together.
[0221] The invention provides methods of inhibiting a TLR3-or TLR4
mediated autoimmune-inflammatory response comprising administering
an amount of a therapeutically effective amount of a
phenylmethimazole, methimazole derivative, and/or tautomeric cyclic
thione compound. The immune response may be an inflammatory
response. The immune response may be a leukocyte response. More
specifically, the immune response may include one or more of:
directed leukocyte migration; leukocyte superoxide production;
leukocyte degranulation including but not limited to neutrophil
elastase exocytosis; and, leukocyte transmigration and/or leukocyte
extravasation. Leukocytes can be selected from the group consisting
of neutrophils, eosinophils, basophils, T-lymphocytes,
B-lymphocytes, monocytes, macrophages, dendritic cells, Langerhans
cells, and mast cells. As used herein, an "endogenous factor" is
defined as a product which is synthesized by host cells, e.g.,
cells of the individual being treated. Representative endogenous
factors include but are not limited to tumor necrosis
factor-.alpha. (TNF-.alpha.), complement factor C3a, complement
factor C5a, chemokine CXCL1, chemokine CXCL2, chemokine CXCL3,
chemokine CXCL4, chemokine CXCL5, chemokine CXCL6, chemokine CXCL7,
interleukin 1.alpha.(IL-1.alpha.), interleukin 1.beta.
(IL-1.beta.), interleukin 3 (IL-3), interleukin 6 (IL-6),
interleukin 7 (IL-7), interleukin 8 (IL-8), interleukin 10 (IL-10),
interleukin 11 (IL-11), interleukin 12 (IL-12), interleukin
(IL-15), interleukin 17 (IL-17), interleukin 18 (IL-18),
prostaglandins, monocyte chemo-attractant protein-1 (MCP-1),
chemokine CCL5 (RANTES), macrophage inflammatory protein-1-.alpha.
(MIP-1-.alpha.), stromal cell-derived factor-1 (SDF- 1), eotaxins,
granulocyte-macrophage colony-stimulating factor (GM-CSF),
transforming growth factor-.beta. (TGF-.beta.), .gamma.-interferon
(IFN-.gamma.), leukotriene B4 (LTB4), leukotriene C4 (LTC4),
leukotriene D4 (LTD4), leukotriene E4 (LTE4), lipoxins,
platelet-activating factor (PAF), and lysophospholipids.
[0222] The therapeutic methods of the invention include methods for
the amelioration of conditions associated with inflammatory cell
activation. "Inflammatory cell activation" refers to the induction
by a stimulus (including but not limited to, cytokines, antigens or
auto-antibodies) of a proliferative cellular response, the
production of soluble mediators (including but not limited to
cytokines, oxygen radicals, enzymes, prostanoids, growth factors,
or vasoactive amines), or cell surface expression of new or
increased numbers of mediators (including but not limited to, major
histocompatibility antigens or cell adhesion molecules) in
inflammatory cells (including but not limited to monocytes,
macrophages, T lymphocytes, B lymphocytes, granulocytes
(polymorphonuclear leukocytes including neutrophils, basophils, and
eosinophils) mast cells, dendritic cells, Langerhans cells, or
nonimmune cells that become antigen presenting cells (including but
not limited to smooth muscle cells, endothelial cells, or
epithelial cells). It will be appreciated by persons skilled in the
art that the activation of one or a combination of these phenotypes
in these cells can contribute to the initiation, perpetuation, or
exacerbation of an inflammatory condition.
[0223] Thus, in various embodiments, the invention provides methods
of treating various inflammatory conditions including but not
limited to arthritic diseases such as rheumatoid arthritis (RA),
osteoarthritis, gouty arthritis, spondylitis, and reactive
arthritis; Behcet's syndrome; sepsis; septic shock; endotoxic
shock; gram negative sepsis; gram positive sepsis; toxic shock
syndrome; multiple organ injury syndrome secondary to septicemia,
trauma, or hemorrhage; ophthalmic disorders including but not
limited to allergic conjunctivitis, vernal conjunctivitis, uveitis,
blepharitis, and thyroid-associated ophthalmopathy; eosinophilic
granuloma; pulmonary or respiratory conditions including but not
limited to asthma, chronic bronchitis, allergic rhinitis, adult
respiratory distress syndrome (ARDS), severe acute respiratory
syndrome (SARS), chronic pulmonary inflammatory diseases (e.g.,
chronic obstructive pulmonary disease), silicosis, pulmonary
sarcoidosis, pleurisy, alveolitis, vasculitis, pneumonia,
bronchiectasis, hereditary emphysema, and pulmonary oxygen
toxicity; ischemic-reperfusion injury, e.g., of the myocardium,
brain, or extremities; inflammation leading to fibrosis including
but not limited to cystic fibrosis; inflammation leading to keloid
formation or scar tissue formation; inflammation leading to
atherosclerosis; autoimmune-inflammatory diseases including but not
limited to systemic lupus erythematosus (SLE), lupus nephritis,
autoimmune thyroiditis, multiple sclerosis, some forms of diabetes,
and Reynaud's syndrome; tissue or organ transplant rejection
disorders including but not limited to graft versus host disease
(GVHD) and allograft rejection; chronic or acute
glomerulonephritis; inflammatory bowel diseases including but not
limited to Crohn's disease, ulcerative colitis necrotizing
enterocolitis, and regional enteritis; inflammatory dermatitis
including but not limited to contact dermatitis, atopic dermatitis,
psoriasis, and urticaria; fever and myalgias due to infection;
central or peripheral nervous system inflammatory conditions
including but not limited to meningitis (e.g., acute purulent
meningitis), encephalitis, and brain or spinal cord injury due to
minor trauma; Sjorgren's syndrome; diseases involving leukocyte
diapedesis; alcoholic hepatitis; bacterial pneumonia; community
acquired pneumonia (CAP); neumocystis carinii pneumonia (PCP);
antigen-antibody complex mediated diseases; hypovolemic shock; Type
I diabetes mellitus; acute and delayed hypersensitivity; disease
states due to leukocyte dyscrasia and metastasis; thermal injury;
granulocyte transfusion associated syndromes; cytokine-induced
toxicity; stroke; pancreatitis; myocardial infarction, respiratory
syncytial virus (RSV) infection; spinal cord injury; cardiovascular
complications of type 1 and 2 diabetes, hyperlipidemia, and
hypertension; and macro- or microvascular complications of diabetes
including, but not limited to, nephropathy, neuropathy,
retinopathy.
[0224] The invention provides methods for the use of the
methimazole derivatives and tautomeric cyclic thione compounds of
the present invention for the preparation of a medicament for the
treatment or prevention of one or more of the following diseases,
pathological disorders or conditions from the group consisting of:
asthma of whatever type, etiology or pathogenesis, or asthma
selected from the group consisting of atopic asthma, non-atopic
asthma, allergic asthma, atopic, bronchial, IgE-mediated asthma,
bronchial asthma, essential asthma, true asthma, intrinsic asthma
caused by patho-physiological disturbances, extrinsic asthma caused
by environmental factors, essential asthma of unknown or unapparent
cause, non-atopic asthma, bronchitic asthma, emphysematous asthma,
exercise-induced asthma, occupational asthma, infective asthma
caused by bacterial, fungal, protozoal, or viral infection,
non-allergic asthma, incipient asthma and wheezy infant syndrome;
chronic or acute bronchoconstriction, chronic bronchitis, small
airway obstruction and emphysema; obstructive or inflammatory
airway diseases of whatever type, etiology or pathogenesis, or an
obstructive or inflammatory airway disease selected from the group
consisting of asthma, pneumoconiosis, chronic eosinophilic
pneumonia, chronic obstructive pulmonary disease (COPD), COPD
including chronic bronchitis, pulmonary emphysema or dyspnea
associated therewith, COPD that is characterized by irreversible,
progressive airway obstruction, adult respiratory distress syndrome
(ARDS), and exacerbation of airway hyper-reactivity consequent to
other medicament therapy; pneumoconiosis of whatever type, etiology
or pathogenesis, or pneumoconiosis selected from the group
consisting of aluminosis or bauxite workers' disease, anthracosis
or miners' asthma, asbestosis or steam-fitters' asthma, chalicosis
or flint disease, ptilosis caused by inhaling the dust from ostrich
feathers, siderosis caused by the inhalation of iron particles,
silicosis or grinders' disease, byssinosis or cotton-dust asthma
and talc pneumoconiosis; bronchitis of whatever type, etiology or
pathogenesis, or bronchitis selected from the group consisting of
acute bronchitis, acute laryngotracheal bronchitis, arachidic
bronchitis, catarrhal bronchitis, croupus bronchitis, dry
bronchitis, infectious asthmatic bronchitis, productive bronchitis,
staphylococcus or streptococcal bronchitis and vesicular
bronchitis; bronchiectasis of whatever type, etiology or
pathogenesis, or bronchiectasis selected from the group consisting
of cylindric bronchiectasis, sacculated bronchiectasis, fusiform
bronchiectasis, capillary bronchiectasis, cystic bronchiectasis,
dry bronchiectasis and follicular bronchiectasis; seasonal allergic
rhinitis, or perennial allergic rhinitis, or sinusitis of whatever
type, etiology or pathogenesis, or sinusitis selected from the
group consisting of purulent or nonpurulent sinusitis, acute or
chronic sinusitis and ethmoid, frontal, maxillary, or sphenoid
sinusitis; rheumatoid arthritis of whatever type, etiology or
pathogenesis, or rheumatoid arthritis selected from the group
consisting of acute arthritis, acute gouty arthritis, chronic
inflammatory arthritis, degenerative arthritis, infectious
arthritis, Lyme arthritis, proliferative arthritis, psoriatic
arthritis and vertebral arthritis; gout, and fever and pain
associated with inflammation; an eosinophil-related pathological
disorder of whatever type, etiology or pathogenesis, or an
eosinophil-related pathological disorder selected from the group
consisting of eosinophilia, pulmonary infiltration eosinophilia,
Loffier's syndrome, chronic eosinophilic pneumonia, tropical
pulmonary eosinophilia, bronchopneumonic aspergillosis,
aspergilloma, granulomas containing eosinophils, allergic
granulornatous angijtis or Churg-Strauss syndrome, polyarteritis
nodosa (PAN) and systemic necrotising vasculitis; atopic
dermatitis, allergic dermatitis or allergic or atopic eczema;
urticaria of whatever type, etiology or pathogenesis, or urticaria
selected from the group consisting of immune-mediated urticaria,
complement-mediated urticaria, urticariogenic material-induced
urticaria, physical stimulus-induced urticaria, stress induced
urticaria, idiopathic urticaria, acute urticaria, chronic
urticaria, angioedema, cholinergic urticaria, cold urticaria in the
autosomal dominant form or in the acquired form, contact urticaria,
giant urticaria and papular urticaria; conjunctivitis of whatever
type, etiology or pathogenesis, or conjunctivitis selected from the
group consisting of actinic conjunctivitis, acute catarrhal
conjunctivitis, acute contagious conjunctivitis, allergic
conjunctivitis, atopic conjunctivitis, chronic catarrhal
conjunctivitis, purulent conjunctivitis and vernal conjunctivitis;
uveitis of whatever type, etiology or pathogenesis, or uveitis
selected from the group consisting of inflammation of all or part
of the uvea, anterior uveitis, iritis, cyclitis, iridocyclitis,
granulornatous uveitis, nongranulornatous uveitis, phacoantigenic
uveitis, posterior uveitis, choroiditis and chorioretinitis;
psoriasis; multiple sclerosis of whatever type, etiology or
pathogenesis, or multiple sclerosis selected from the group
consisting of primary progressive multiple sclerosis and relapsing
remitting multiple sclerosis; autoimmune/inflammatory diseases of
whatever type, etiology or pathogenesis, or an
autoimmune/inflammatory disease selected from the group consisting
of autoimmune hematological disorders, hemolytic anaemia, aplastic
anaemia, pure red cell anaemia, idiopathic thrombo-cytopenic
purpura, systemic lupus erythematosus, polychondritis, sclerorma,
Wegner's granulomatosis, dermatomyositis, chronic active hepatitis,
myasthenia gravis, Stevens-Johnson syndrome, idiopathic sprue,
autoimmune inflammatory bowel diseases, ulcerative colitis, Crohn's
disease, endocrin opthamopathy, Grave's disease, sarcoidosis,
alveolitis, chronic hypersensitivity pneumonitis, primary biliary
cirrhosis, juvenile diabetes or diabetes mellitus type 1, anterior
uveitis, granulornatous or posterior uveitis, keratoconjunctivitis
sicca, epidemic kerato-conjunctivitis, diffuse interstitial
pulmonary fibrosis or interstitial lung fibrosis, idiopathic
pulmonary fibrosis, cystic fibrosis, psoriatic arthritis,
glomerulonephritis with and without nephrotic syndrome, acute
glomerulo-nephritis, idiopathic nephrotic syndrome, minimal change
nephropathy, inflammatory/hyperproliferative skin diseases,
psoriasis, atopic dermatitis, contact dermatitis, allergic contact
dermatitis, benign familial pemphigus, pemphigus erythematosus,
pemphigus foliaceus and pemphigus vulgaris; prevention of foreign
transplant rejection following organ transplantation; inflammatory
bowel disease (IBD) of whatever type, etiology or pathogenesis, or
inflammatory bowel disease selected from the group consisting of
ulcerative colitis (UC), collagenous colitis, colitis polyposa,
transmural colitis and Crohn's disease (CD); septic shock of
whatever type, etiology or pathogenesis, or septic shock selected
from the group consisting of renal failure, acute renal failure,
cachexia, malarial cachexia, hypophysial cachexia, uremic cachexia,
cardiac cachexia, cachexia suprarenalis or Addison's disease,
cancerous cachexia, and cachexia as a consequence of infection by
the human immunodeficiency virus (HIV); liver damage; pulmonary
hypertension and hypoxia-induced pulmonary hyper-tension; bone loss
diseases, primary osteoporosis and secondary osteoporosis;
pathological disorders of the central nervous system of whatever
type, etiology or pathogenesis, or a pathological disorder of the
central nervous system selected from the group consisting of
depression, Parkinson's disease, learning and memory impairment,
tardive dyskinesia, drug dependence, arteriosclerotic dementia, and
dementias that accompany Huntington's chorea, Wilson's disease,
paralysis agitans and thalamic atrophies; infections, especially
viral infections, where these viruses increase the production of
TNF-.alpha. in their host and where these viruses are sensitive to
up-regulation of TNF-.alpha. in their host so that their
replication or other vital activities are adversely affected,
including viruses selected from the group consisting of HIV-1,
HIV-2 and HIV-3, cytornegalovirus, CMV, influenza, adenoviruses and
Herpes viruses, including Herpes zoster and Herpes simplex; yeast
and fungus infections, where these yeasts and fungi are sensitive
to up-regulation by TNF-.alpha. or elicit TNF-.alpha. production in
their host, for example fungal meningitis, particularly when
administered in conjunction with other medicaments of choice for
the treatment of systemic yeast and fungus infections, including,
but are not limited to, polymycins, for example polymycin B,
imidazoles, for example clotrimazole, econazole, miconazole and
ketoconazole, triazoles, for example fluconazole and itranazole and
amphotericins, for example amphotericin B and liposomal
amphotericin B; ischemia-reperfusion damage, autoimmune diabetes,
retinal autoimmunity, chronic lymphocytic leukemia, HIV infections,
lupus erythematosus, kidney and ureter disease, urogenital and
gastrointestinal disorders and prostate diseases; and any disease
induced by an infectious agent or noxious environmental agent which
elicits Type I IFN production in their host.
[0225] In particular, methimazole derivatives and tautomeric cyclic
thione compounds of the present invention are suitable for the
treatment of (1) inflammatory diseases and conditions, including
joint inflammation, rheumatoid arthritis, rheumatoid spondylitis,
osteoarthritis, inflammatory bowel disease, ulcerative colitis,
chronic glomerulonephritis, dermatitis, atherosclerosis, the
vascular complications of Type 2 diabetes, and Crohn's disease, (2)
respiratory diseases and conditions, including asthma, acute
respiratory distress syndrome, chronic pulmonary inflammatory
disease, bronchitis, chronic obstructive airway disease and
silicosis, (3) infectious diseases and conditions, including
sepsis, septic shock, endotoxic shock, Gram-negative sepsis, toxic
shock syndrome, fever and myalgias due to bacterial, viral or
fungal infection, and influenza, (4) immune diseases and
conditions, including autoimmune diabetes, systemic lupus
erythematosis, GvH reaction, rejection of foreign transplants,
multiple sclerosis, psoriasis and allergic rhinitis, and (5) other
diseases and conditions, including bone absorption diseases,
reperfusion damage, cachexia secondary to infection or malignancy,
cachexia secondary to human acquired immune deficiency syndrome
(AIDS), human immunodeficiency virus (HIV) infection, or AIDS
related complex (ARC), keloid formation, scar tissue formation,
type 1 diabetes mellitus and leukemia.
[0226] It will be appreciated that the treatment methods of the
invention are useful in the fields of human medicine and veterinary
medicine. Thus, the individual to be treated may be a mammal,
preferably human, or other animals. For veterinary purposes,
individuals include but are not limited to farm animals including
cows, sheep, pigs, horses, and goats; companion animals such as
dogs and cats; exotic and/or zoo animals; laboratory animals
including mice, rats, rabbits, guinea pigs, and hamsters; and
poultry such as chickens, turkeys, ducks, and geese. For example,
the present invention relates to, but is not limited to, pre- or
postoperative intervention in animals such as horses to prevent or
treat toxic shock syndromes.
[0227] The pharmaceutical compositions of the present invention
comprise specifically defined methimazole derivatives and
tautomeric cyclic thiones, used in a safe and effective amount,
together with a pharmaceutically acceptable carrier.
[0228] The methimazole derivatives used in the compositions of the
present invention are those having the following structural
formulae: ##STR1##
[0229] In these formulae, Y is selected from H, C.sub.1-C.sub.4
alkyl C.sub.1-C.sub.4 substituted alkyl, --NO.sub.2, and the phenyl
moiety: ##STR2##
[0230] wherein no more than one Y group in said active compound may
be the phenyl moiety; R.sup.1 is selected from H, --OH, halogens
(F, Cl, Br or I), C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl, C.sub.1-C.sub.4 ester or C.sub.1-C.sub.4
substituted ester; R.sup.2 is selected from H, C.sub.1-C.sub.4
alkyl or C.sub.1-C.sub.4 substituted alkyl; R.sup.3 is selected
from H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl or
--CH.sub.2Ph (wherein Ph is phenyl); R.sup.4 is selected from H,
C.sub.1-C.sub.4 alkyl or C.sub.1-C.sub.4 substituted alkyl; X is
selected from S or O; Z is selected from --SR.sup.3, --OR.sup.3,
S(O)R.sup.3 or C.sub.1-C.sub.4 alkyl; and wherein at least two of
the R.sup.2 and R.sup.3 groups on said compound are C.sub.1-C.sub.4
alkyl when Y is not a phenyl moiety, and at least one Y is
--NO.sub.2 when Z is alkyl; together with a
pharmaceutically-acceptable carrier.
[0231] Y is preferably H, the phenyl moiety or --NO.sub.2, and is
most preferably H or the phenyl moiety ##STR3##
[0232] In the defined compounds, no more than one Y group may be
the phenyl moiety. R.sup.1 is selected from H, --OH, halogens (F,
Cl, Br and I), C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted
alkyl, C.sub.1-C.sub.4 ester and C.sub.1-C.sub.4 substituted ester;
preferably R.sup.1 is H, --OH, halogen, --OOCCH.sub.2M (where M is
H or a halogen); and is most preferably H. R.sup.2 is selected from
H, C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 substituted alkyl;
preferably one or both of the R.sup.2 groups is methyl. As used
herein, "substituted alkyl" or "substituted ester" is intended to
include alkyl, aryl or ester groups which are substituted in one or
more places with hydroxyl or alkoxyl groups, carboxyl groups,
halogens, nitro groups, amino or acylamino groups, and mixtures of
those moieties. Preferred "substituted alkyl" groups are
C.sub.1-C.sub.4 hydroxyl or alkoxyl groups, as well as groups
substituted with halogens. The R.sup.3 groups in the above formulae
are selected from H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl and --CH.sub.2Ph (wherein Ph is phenyl); in
preferred compounds, R.sup.3 is H or C.sub.1-C.sub.4 alkyl; most
preferably R.sup.3 is C.sub.1-C.sub.4 alkyl, particularly methyl.
R.sup.4 is selected from H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl, and preferably is H. X may be S
or O, and is preferably S. Finally, Z is selected from
C.sub.1-C.sub.4 alkyl, --SR.sup.3, --S(O)R.sup.3 and --OR.sup.3, is
preferably --SR.sup.3, --OR.sup.3, and --S(O)R.sup.3; most
preferably --SR.sup.3 and --OR.sup.3; and particularly --SR.sup.3.
In the above formulae, at least two of the R.sup.2 and R.sup.3
groups on the compound must be C.sub.1-C.sub.4 alkyl when Y is not
a phenyl moiety. Further, at least one of the Y groups should be
--NO.sub.2,, when Z is C.sub.1-C.sub.4 alkyl.
[0233] Compounds useful in the present invention include the
tautomeric cyclic thiones, disclosed in Kjellin and Sandstrom, Acta
Chemica Scandanavica 23: 2879-2887 (1969), incorporated herein by
reference, having the formulae ##STR4##
[0234] wherein R.sup.5, R.sup.6.dbd.CH.sub.3, CH.sub.3; Ph, H; H,
Ph
[0235] R.sup.7.dbd.H, CH.sub.3
[0236] R.sup.8.dbd.O, S, NH, NCH.sub.3
[0237] Preferred compounds for use in the compositions of the
present invention include those having the formulae: ##STR5##
[0238] Another group of preferred compositions include those having
the formulae: ##STR6##
[0239] wherein R.sup.10 is selected from H. NO.sub.2, Ph, 4-HOPh
and 4-m-Ph (wherein m is F, Cl, Br, or I).
[0240] A particularly preferred subset of the pharmaceutical
compounds defined herein are those wherein one of the Y groups is
the phenyl moiety defined above. These compounds have the following
formulae: ##STR7##
[0241] In these compounds, Y is selected from H, C.sub.1-C.sub.4
alkyl and C.sub.1-C.sub.4 substituted alkyl, and is preferably H.
R.sup.1is selected from H, --OH, halogens (F, Cl, Br and I),
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 substituted alkyl,
C.sub.1-C.sub.4 ester, and C.sub.1-C.sub.4 substituted ester, and
is preferably H, --OH, halogen, --OOCCH.sub.2M (where) M is H or a
halogen), and is not preferably H. R.sup.2 is selected from H,
C.sub.1-C.sub.4 alkyl and C.sub.1-C.sub.4 substituted alkyl, and it
is preferred that at least one of the R.sup.2 groups be methyl.
R.sup.3 is selected from H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4
substituted alkyl, and --CH.sub.2Ph; preferred R.sup.3 moieties are
H and methyl. R.sup.4 is selected from H, C.sub.1-C.sub.4 alkyl and
C.sub.1-C.sub.4 substituted alkyl, and is preferably H. X is
selected from S and O, and is preferably S. Finally, the Z moiety
is selected from --SR.sup.3 and --OR.sup.3, and is preferably
--SR.sup.3. Particularly preferred compounds are those having the
structural formulae: ##STR8##
[0242] Other preferred compounds include: ##STR9##
[0243] wherein R.sup.9 is selected from --OH, --M and
--OOCCH.sub.2M; and M is selected from F, Cl, Br and I.
[0244] Most preferred is the compound having the structure given
below. ##STR10##
[0245] Mixtures of the pharmaceutically active compounds defined
herein may also be used. The methimazole derivatives and tautomeric
cyclic thiones described above can be synthesized using techniques
well known to those skilled in the art. For example, the synthesis
of several tautomeric cyclic thiones is described in Kjellin and
Sandstrom, (G. Kjellin, et al., Acta Chem Scand, 23:2879-2887
(1969)), incorporated herein by reference.
[0246] A representative methimazole derivative may be synthesized
using the following procedure. Appropriately substituted analogs of
acetaldehyde are brominated in the 2-position by treatment with
bromine and UV light, followed by formation of the corresponding
diethylacetal using absolute ethanol. The bromine is then displaced
from this compound by treatment with anhydrous methylamine, or
other suitable amine, in a sealed tube at about 120.degree. for up
to about 16 hours. Reaction of the resulting aminoacetal with
potassium thiocyanate in the presence of hydrochloric acid, at
steam bath temperatures overnight, provides the methimazole
analogs.
[0247] Representative methimazole derivative compounds of the
present invention are shown in Table 16. TABLE-US-00001 TABLE 16
Structure of Compounds. Com- pounds Imidazole ##STR11## #1
1-Methylimidazole-2-thiol (Methimazole) C.sub.4H.sub.6N.sub.2S;
1-Methyl-2- mercaptoimidazole (MMI) ##STR12## #2
2-Methyl-5-nitro-1- imidazole ethanol (Metronidazole)
C.sub.6H.sub.9N.sub.3O.sub.3; MW: 171.16 ##STR13## #3
2-Mercaptoimidazole MW: 100.14 ##STR14## #4 2-Mercaptobenzimidazole
MW: 150.20 ##STR15## #5 2-Mercapto-5- nitrobenzimidazole MW: 195.20
##STR16## #6 2-Mercapto-5- methylbenzimidazole MW: 164.23 ##STR17##
#7 S-Methylmethimazole C.sub.5H.sub.8N.sub.2S; MW: 128.20 B. P.
48.degree. @ 100 u (liq.) ##STR18## #8 N-Methylmethimazole
C.sub.5H.sub.8N.sub.2S; MW: 128.20 B. P. 188.degree.-194.degree.
##STR19## #9 5-Methylmethimazole C.sub.5H.sub.8N.sub.2S; MW: 128.20
B. P. 254.degree.-255.degree. ##STR20## #10 5-Phenylmethimazole
C.sub.10H.sub.10N.sub.2S; MW: 190.27 B. P. 168.degree.-173.degree.
##STR21## #11 1-Methyl-2-Thiomethyl- 5(4)nitroimidazole
##STR22##
[0248] The pharmaceutical compositions of the present invention
comprise a safe and effective amount of one or more of the
methimazole derivatives or tautomeric cyclic thione compounds
(i.e., the active compounds). Preferred compositions contain from
about 0.01% to about 25% of the active compounds, with most
preferred compositions containing from about 0.1% to about 10% of
the active compounds. The pharmaceutical compositions of the
present invention may be administered in any way conventionally
known, for example, intraperitoneally, intravenously,
intramuscularly, or topically, although oral administration is
preferred. Preferred compositions are in unit dosage form, i.e.,
pharmaceutical compositions, which are available in a pre-measured
form suitable for single dosage administration without requiring
that the individual dosage be measured out by the user, for
example, pills, tablets or ampules.
[0249] The pharmaceutical compositions of the present invention
additionally include a pharmaceutically-acceptable carrier
compatible with the methimazole derivatives or tautomeric cyclic
thiones described above. In addition to the
pharmaceutically-acceptable carrier, the pharmaceutical
compositions may contain, at their art accepted levels, additional
compatible ingredients, such as additional pharmaceutical actives,
excipients, formulational aids (e.g., tabletting aids), colorants,
flavorants, preservatives, solubilizing or dispersing agents, and
other materials well known to those skilled in the art.
[0250] As used herein, the term "pharmaceutical carrier" denotes a
solid or liquid filler, diluent or encapsulating substance. These
materials are well known to those skilled in the pharmaceutical
arts. Some examples of the substances which can serve as
pharmaceutical carriers are sugars, such as lactose, glucose, and
sucrose; starches, such as corn starch and potato starch; cellulose
and its derivatives, such as sodium carboxymethyl cellulose, ethyl
cellulose, and cellulose acetate; powdered tragacanth; malt;
gelatin; talc; stearic acid; magnesium stearate; calcium sulfate;
vegetable oils, such as peanut oil, cottonseed oil, sesame oil,
olive oil, corn oil and oil of theobroma; polyols, such as
propylene glycol, glycerin, sorbitol, mannitol, and polyethylene
glycol; agar; alginic acid; pyrogen-free water; isotonic saline;
and phosphate buffer solutions, as well as other non-toxic
compatible substances used in pharmaceutical formulations. They may
comprise liposomes or drug carriers made lipids or polymeric
particles, including biodegradable polymers, or targeted delivery
applications, e.g., coupling to antibodies. Wetting agents and
lubricants, such as sodium lauryl sulfate, as well as coloring
agents, flavoring agents, tableting agents, and preservatives, can
also be present. They may include excipients such as cyclodextrins
to improve aqueous solubilization. Formulation of the components
into pharmaceutical compositions is done using conventional
techniques.
[0251] The pharmaceutical carrier employed in conjunction with the
pharmaceutical compositions of the present invention is used at a
concentration sufficient to provide a practical size-to-dosage
relationship. Preferably, the pharmaceutical carrier comprises from
about 25% to about 99.99%, preferably from about 50% to about
99.9%, by weight of the total pharmaceutical composition.
[0252] The conditions treated with the pharmaceutical compositions
of this invention generally include any autoimmune-inflammatory
disease mediated by or associated with TLR3 or TLR4 overexpression
or signaling, particularly in, but not limited to nonimmune cells,
monocytes, macrophages, or dendritic cells, or both TLR3 or TLR4
overexpression or signaling, for example, but not limited to,
Hashimoto's thyroiditis, insulinitis, Type 1 diabetes,
atherosclerosis, vascular complications of type 1 or 2 diabetes,
vascular complications associated with obesity or hyperlipidemias,
toxic shock, colitis, or IBD and the various symptoms that fall
within a definition of IBD. The formulations are administered to
achieve a therapeutic effect. For those compounds that exhibit a
long residency in the body, a once-a-day regimen is possible.
Alternatively, multiple doses, such as up to three doses per day,
typically, may offer more effective therapy. Thus, a single dose or
a multidose regimen may be used.
[0253] The conditions treated with the pharmaceutical compositions
of this invention generally include any autoimmune-inflammatory
disease mediated by or associated with TLR overexpression or
signaling, particularly in, but not limited to nonimmune cells,
monocytes, macrophages, or dendritic cells which phagocytose
infectious or noxious environmental agents inducing TLR
overexpression or signaling, for example, but not limited to,
systemic lupus erythematosis, Graves' disease, autoimmune
blepharitis. The formulations are administered to achieve a
therapeutic effect. For those compounds that exhibit a long
residency in the body, a once-a-day regimen is possible.
Alternatively, multiple doses, such as up to three doses per day,
typically, may offer more effective therapy. Thus, a single dose or
a multidose regimen may be used
[0254] The present invention also provides for methods of
diagnosing, treating, and following therapeutic intervention in any
autoimmune-inflammatory disease mediated by or associated with TLR3
or TLR4 overexpression or signaling, particularly in, but not
limited to nonimmune cells, monocytes, macrophages, or dendritic
cells, or both TLR3 or TLR4 overexpression or signaling, for
example, but not limited to, Hashimoto's thyroiditis, insulinitis,
Type 1 diabetes, atherosclerosis, vascular complications of type 1
or 2 diabetes, vascular complications associated with obesity or
hyperlipidemias, toxic shock, colitis, or IBD and the various
symptoms that fall within a definition of IBD. For example,
ulcerative colitis, which is a disease of the large intestine
characterized by overexpressed TLR4 and TLR4 signaling in
intestinal epithelial cells, monocytes, macrophages, and dendritic
cells involves chronic diarrhea with cramping abdominal pain,
rectal bleeding, and loose discharges of blood, pus and mucus. The
manifestations of this disease vary widely. A pattern of
exacerbations and remissions typifies the clinical course of most
ulcerative colitis patients (70%), although continuous symptoms
without remission are present in some patients with ulcerative
colitis. Systemic complications of ulcerative colitis include
arthritis, eye inflammation such as uveitis, skin ulcers and liver
disease. In addition, ulcerative colitis and especially
long-standing, extensive disease is associated with an increased
risk of colon carcinoma. Similarly, Type I diabetes is an
autoimmune inflammatory disease of the pancreas characterized by
overexpressed TLR3 and TLR3 signaling in pancreatic P cells,
monocytes, macrophages, and dendritic cells, characterized by a
prolonged inflammatory state or insulinitis, a honeymoon period or
lag phase with islet cell and GAD auto-antibodies, a destructive
phase resulting in loss of insulin secretion, hyperglycemia,
hyperlipidemia, and tissue complications such as macro- and
microvascular diseases including atherosclerosis, strokes,
myocardial infarcts, nephropathy, neuropathy, retinopathy, and
higher incidences of autoimmune thyroid disease and cancer.
[0255] In any event, the pharmaceutical composition is administered
in such a manner so that compound is delivered into the patient's
bloodstream. One excellent mode for accomplishing this is
intravenous administration. Intravenous dose levels range from
about 0.01 mg/kg/hour of active amide compound to about 100
mg/kg/hour, all for from about 1 to about 120 hours and especially
1 to 96 hours. A preloading bolus of from about 0.001 to about 500
mg may also be administered to achieve adequate steady state
levels. Other forms of parenteral administration, such as
intramuscular or intraperitoneal injection can be used, as well. In
this case, similar dose levels are employed.
[0256] With oral dosing, one to three oral doses per day, each from
about 0.001 to about 150 mg/kg of active compound are employed,
with preferred doses being from about 0.05 to about 100 mg/kg. With
rectal dosing, one to three rectal doses per day, each from about 1
to about 150 mg/kg of active compound are employed, with preferred
doses being from about 1 to about 100 mg/kg.
[0257] In any treatment regimen, the health care professional
should assess the patient's condition and determine whether or not
the patient would benefit from treatment. Some degree of routine
dose optimization may be required to determine an optimal doing
level and pattern. A positive dose-response relationship has been
observed. As such and bearing in mind the severity of the side
effects and the advantages of providing maximum possible
amelioration of symptoms, it may be desired in some settings to
administer large amounts of active compound, such as those
described above.
[0258] The pharmaceutical compositions of the present invention are
administered such that appropriate levels of pharmaceutical active
are achieved in the bloodstream. The precise dosage level required
in a given case will depend upon, for example, the particular
methimazole derivative used, the nature of the disease being
treated, and the size, weight, age and physical condition of the
patient.
[0259] The term "pharmaceutically acceptable salts" refers to salts
prepared from pharmaceutically acceptable non-toxic bases or acids
including inorganic or organic bases and inorganic or organic
acids. Salts derived from inorganic bases include: aluminum,
ammonium, calcium, copper, ferric, ferrous, lithium, magnesium,
manganic salts, manganous, potassium, sodium, zinc, and the like.
Particularly preferred are the ammonium, calcium, magnesium,
potassium, and sodium salts. Salts derived from pharmaceutically
acceptable organic non-toxic bases include: salts of primary,
secondary, and tertiary amines, substituted amines including
naturally occurring substituted amines, cyclic amines, and basic
ion exchange resins, such as arginine, betaine, caffeine, choline,
N,N'-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol,
2-dimethylaminoethanol, ethanolamine, ethylenediamine,
N-ethyl-morpholine, N-ethylpiperidine, glucamine, glucosamine,
histidine, hydrabamine, isopropylamine, lysine, methylglucamine,
morpholine, piperazine, piperidine, polyamine resins, procaine,
purines, theobromine, triethylamine, trimethylamine,
tripropylamine, tromethamine, and the like. When the compound of
the present invention is basic, salts may be prepared from
pharmaceutically acceptable non-toxic acids, including inorganic
and organic acids. Such acids include: acetic, benzenesulfonic,
benzoic, camphorsulfonic, citric, ethanesulfonic, fumaric,
gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic,
maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic,
pantothenic, phosphoric, succinic, sulfuric, tartaric,
p-toluenesulfonic acid, and the like. Particularly preferred are
citric, hydrobromic, hydrochloric, maleic, phosphoric, sulfuric,
and tartaric acids. It will be understood that, as used herein, the
compounds referred to herein are meant to also include the
pharmaceutically acceptable salts.
[0260] The magnitude of prophylactic or therapeutic dose of the
therapeutic compound of the present invention will, of course, vary
with the nature of the severity of the condition to be treated and
with the particular therapeutic compound of the present invention
and its route of administration. It will also vary according to the
age, weight and response of the individual patient. In general, the
daily dose range lie within the range of from about 0.001 mg to
about 100 mg per kg body weight of a mammal, preferably 0.01 mg to
about 50 mg per kg, and most preferably 0.1 to 10 mg per kg, in
single or divided doses. On the other hand, it may be necessary to
use dosages outside these limits in some cases.
[0261] For use where a composition for intravenous or
intraperitoneal administration is employed, a suitable dosage range
is from about 0.001 mg to about 25 mg (in another embodiment from
0.01 mg to about 1 mg) of a therapeutic compound of the present
invention per kg of body weight per day and for cytoprotective use
from about 0.01 mg to about 100 mg (in another embodiment from
about 0.1 mg to about 100 mg and in another embodiment from about 1
mg to about 10 mg) of the therapeutic compound of the present
invention per kg of body weight per day.
[0262] In the case where an oral composition is employed, a
suitable dosage range is, e.g. from about 0.01 mg to about 100 mg
of the therapeutic compound of the present invention per kg of body
weight per day, in another embodiment from about 0.1 mg to about 10
mg per kg and for cytoprotective use from 0.1 mg to about 100 mg
(in another embodiment from about 1 mg to about 100 mg and in
another embodiment from about 10 mg to about 100 mg) of a
therapeutic compound of the present invention per kg of body weight
per day.
[0263] The present invention utilizes pharmaceutical formulation
techniques to provide compositions of a methimazole derivatives and
tautomeric cyclic thiones for treating the inflammatory and/or
autoimmune diseases or autoimmune-inflammatory disease mediated by
or associated with overexpression of TLR3 or TLR3 signaling, TLR4
or TLR4 signaling, or both in nonimmune cells, monocytes,
macrophages, or dendritic cells including but not limited to
Hashimoto's thyroiditis, insulinitis, Type 1 diabetes,
atherosclerosis, vascular complications of diabetes, obesity, or
hyperlipidemias, toxic shock, colitis, IBD, autoimmune uveitis,
autoimmune blepharitis, psoriasis, as hereinbefore defined. It
utilizes pharmaceutical formulation techniques to provide
compositions of a methimazole derivatives and tautomeric cyclic
thiones for treating the inflammatory and/or autoimmune diseases or
autoimmune-inflammatory disease mediated by or associated with
overexpression of TLR signaling involving over expressed IRF-3/Type
1 IFN/STAT/IRF-1/and genes with ISREs in nonimmune cells,
monocytes, macrophages, or dendritic cells including but not
limited to systemic lupus and rheumatoid arthritis.
[0264] The dosage and dose rate of the compounds of this invention
effective to prevent, suppress or inhibit diseases will depend on a
variety of factors, such as the nature of the inhibitor, the size
of the patient, the goal of the treatment, the nature of the
pathology to be treated, the specific pharmaceutical composition
used, and the judgment of the treating physician.
[0265] The transit time through the gastro-intestinal canal for
different dosage forms are rather well known. When the dosage form
has been emptied from the stomach the transit through the small
intestine takes 3 to 5 hours. The residence time in the large
intestine is considerably longer, 25 to 50 hours. Ideally, for
local effects, as long as the dosage form remains in the stomach no
release should occur. If colitis in the small intestine is going to
be treated the release should continue during about 5 hours after
the dosage form has left the stomach. If the large intestine is
going to be treated, the local release should ideally start at
caecum, and continue for up to 50 hours.
[0266] The term "composition", as in pharmaceutical composition, is
intended to encompass a product comprising the active ingredient
(s), and the inert ingredient (s) (pharmaceutically acceptable
excipients) that make up the carrier, as well as any product which
results, directly or indirectly, from combination, complexation or
aggregation of any two or more of the ingredients, or from
dissociation of one or more of the ingredients, or from other types
of reactions or interactions of one or more of the ingredients.
Accordingly, the pharmaceutical compositions of the present
invention encompass any composition made by mixing a compound of
the present invention, additional active ingredient (s), and
pharmaceutically acceptable excipients.
[0267] Any suitable route of administration may be employed for
providing a mammal, especially a human with an effective dosage of
a compound of the present invention. For example, oral, rectal,
topical, parenteral, ocular, pulmonary, nasal, and the like may be
employed. Dosage forms include tablets, troches, dispersions,
suspensions, solutions, capsules, creams, ointments, aerosols, and
the like. They may be conveniently presented in unit dosage form
and prepared by any of the methods well-known in the art of
pharmacy.
[0268] For administration by inhalation, the compounds of the
present invention are conveniently delivered in the form of an
aerosol spray presentation from pressurized packs or nebulizers.
The compounds may also be delivered as powders, which may be
formulated and the powder composition may be inhaled with the aid
of an insufflation powder inhaler device. The preferred delivery
systems for inhalation are metered dose inhalation (MDI) aerosol,
which may be formulated as a suspension or solution of a compound
of the present invention in suitable propellants, such as
fluorocarbons or hydrocarbons and dry powder inhalation (DPI)
aerosol, which may be formulated as a dry powder of a compound of
the present invention with or without additional excipients.
Suitable topical formulations include transdermal devices,
aerosols, creams, ointments, lotions, dusting powders, and the
like.
[0269] In practical use, the compounds of the present invention can
be combined as the active ingredient in intimate admixture with a
pharmaceutical carrier according to conventional pharmaceutical
compounding techniques. Because of their ease of administration,
tablets and capsules represent the most advantageous oral dosage
unit form in which case solid pharmaceutical carriers are obviously
employed. If desired, tablets may be coated by standard aqueous or
nonaqueous techniques. In addition to the common dosage forms set
out above, the therapeutic compound of the present invention may
also be administered by controlled release means and/or delivery
devices such as those described in U.S. Pat. Nos. 3,845,770;
3,916,899; 3,536,809; 3,598,123; 3,630,200 and 4,008,719.
[0270] Pharmaceutical compositions of the present invention
suitable for oral administration may be presented as discrete units
such as capsules, cachets or tablets each containing a
predetermined amount of the active ingredient, as a powder or
granules or as a solution or a suspension in an aqueous liquid, a
non-aqueous liquid, an oil-in-water emulsion or a water-in-oil
liquid emulsion. Such compositions may be prepared by any of the
methods of pharmacy but all methods include the step of bringing
into association the active ingredient with the carrier, which
constitutes one or more necessary ingredients. In general, the
compositions are prepared by uniformly and intimately admixing the
active ingredient with liquid carriers or finely divided solid
carriers or both, and then, if necessary, shaping the product into
the desired presentation. For example, a tablet may be prepared by
compression or molding, optionally with one or more accessory
ingredients. Compressed tablets may be prepared by compressing in a
suitable machine, the active ingredient in a free-flowing form such
as powder or granules, optionally mixed with a binder, lubricant,
inert diluent, surface active or dispersing agent. Molded tablets
may be made by molding in a suitable machine, a mixture of the
powdered compound moistened with an inert liquid diluent.
Desirably, each tablet contains from about 1 mg to about 500 mg of
the active ingredient and each cachet or capsule contains from
about 1 to about 500 mg of the active ingredient.
[0271] Combination Therapy--Prophylaxis and Treatment
[0272] In the context of the present invention, a compound as
described herein or pharmaceutical composition thereof can be
utilized for modulating the activity of TLR3/4 mediated diseases,
conditions and/or disorders as described herein. Examples of
modulating the activity of TLR3/4 mediated diseases include the
prophylaxis or treatment of metabolic related disorders such as,
but not limited to, type I diabetes, type II diabetes, inadequate
glucose tolerance, insulin resistance, hyperglycemia,
hyperlipidemia, hypertriglyceridemia, hypercholesterolemia,
dyslipidemia and syndrome X. Other examples of modulating the
activity of TLR3/4 mediated diseases include the prophylaxis or
treatment of obesity and/or overweight by decreasing food intake,
inducing satiation (i.e., the feeling of fullness), controlling
weight gain, decreasing body weight and/or affecting metabolism
such that the recipient loses weight and/or maintains weight. Also
in the context of the present invention, a compound as described
herein or pharmaceutical composition thereof can be utilized for
modulating the activity of TLR mediated diseases, conditions and/or
disorders as described herein with increased signaling involving
IRF-3/Type 1 IFN/STAT/IRF-1/and ISRE containing genes. Examples of
modulating the activity of these TLR mediated diseases include the
prophylaxis or treatment of such disorders as, but not limited to,
systemic lupus, rheumatoid arthritis, coliutis, Crohn's disease, or
other inflammatory disorders.
[0273] While the compounds of the invention can be administered as
the sole active pharmaceutical agent (i.e., mono-therapy), they can
also be used in combination with other pharmaceutical agents (i.e.,
combination-therapy) for the treatment of the
diseases/conditions/disorders described herein. Therefore, another
aspect of the present invention includes methods of prophylaxis
and/or treatment of a metabolic related disorder or a weight
related disorder, such as obesity, comprising administering to an
individual in need of prophylaxis and/or treatment a
therapeutically effective amount of a compound of the present
invention, in combination with one or more additional
pharmaceutical agent as described herein.
[0274] Suitable pharmaceutical agents that can be used in
combination with the compounds of the present invention include
anti-obesity agents such as apolipoprotein-B secretion/microsomal
triglyceride transfer protein (apo-B/MTP) inhibitors, MCR-4
agonists, cholescystokinin-A (CCK-A) agonists, serotonin and
norepinephrine reuptake inhibitors (for example, sibutramine),
sympathomimetic agents, beta-3 adrenergic receptor agonists,
dopamine agonists (for example, bromocriptine),
melanocyte-stimulating hormone receptor analogs, cannabinoid 1
receptor antagonists [for example, SR141716:
N-(piperidin-1-yl)-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H--
pyrazole-3-carboxamide], melanin concentrating hormone antagonists,
leptons (the OB protein), leptin analogues, leptin receptor
agonists, galanin antagonists, lipase inhibitors (such as
tetrahydrolipstatin, i.e., Orlistat), anorectic agents (such as a
bombesin agonist), Neuropeptide-Y antagonists, thyromimetic agents,
dehydroepiandrosterone or an analogue thereof, glucocorticoid
receptor agonists or antagonists, orexin receptor antagonists,
urocortin binding protein antagonists, glucagon-like peptide-1
receptor agonists, ciliary neutrotrophic factors (such as Axokine
available from Regeneron Pharmaceuticals, Inc., Tarrytown, N.Y. and
Procter & Gamble Company, Cincinnati, Ohio), human
agouti-related proteins (AGRP), ghrelin receptor antagonists,
histamine 3 receptor antagonists or reverse agonists, neuromedin U
receptor agonists, noradrenergic anorectic agents (for example,
phentermine, mazindol and the like) and appetite suppressants (for
example, bupropion).
[0275] In some embodiments, anti-obesity agents are used in
conjunction with the present methods, selected from the group
consisting of orlistat, sibutramine, bromocriptine, ephedrine,
leptin, and pseudoephedrine. In a further embodiment, compounds of
the present invention and combination therapies are administered in
conjunction with exercise and/or a sensible diet.
[0276] More specifically, and without limitation, the methods of
the invention may comprise administering a therapeutically
effective amount of phenylmethimazoles, methimazole derivatives,
and/or tautomeric cyclic thiones with one or more of TNF, IL-1,
IL-2, IL-3, IL4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-I, IL-11, IL-12,
IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IFN, G-CSF, Meg-CSF,
GM-CSF, thrombopoietin, stem cell factor, and erythropoietin or
antibodies thereto. Compositions in accordance with the invention
may also include other known angiopoietins such as Ang-2, Ang-4,
and Ang-Y, growth factors such as bone morphogenic protein-1, bone
morphogenic protein-2, bone morphogenic protein-3, bone morphogenic
protein-4, bone morphogenic protein-5, bone morphogenic protein-6,
bone morphogenic protein-7, bone morphogenic protein-8, bone
morphogenic protein-9, bone morphogenic protein-10, bone
morphogenic protein-11, bone morphogenic protein-12, bone
morphogenic protein-13, bone morphogenic protein-14, bone
morphogenic protein-15, bone morphogenic protein receptor IA, bone
morphogenic protein receptor IB, brain derived neurotrophic factor,
ciliary neutrophic factor, ciliary neutrophic factor receptor a,
cytokine-induced neutrophil chemotactic factor 1, cytokine-induced
neutrophil chemotactic factor 2.alpha., cytokine-induced neutrophil
chemotactic factor 2.beta., .beta. endothelial cell growth factor,
endothelin 1, epidermal growth factor, epithelial-derived
neutrophil attractant, fibroblast growth factor 4, fibroblast
growth factor 5, fibroblast growth factor 6, fibroblast growth
factor 7, fibroblast growth factor 8, fibroblast growth factor 8b,
fibroblast growth factor 8c, fibroblast growth factor 9, fibroblast
growth factor 10, fibroblast growth factor acidic, fibroblast
growth factor basic, glial cell line-derived neutrophic factor
receptor .alpha.-1, glial cell line-derived neutrophic factor
receptor a2, growth related protein, growth related protein a,
growth related protein .beta., growth related protein .gamma.,
heparin binding epidermal growth factor, hepatocyte growth factor,
hepatocyte growth factor receptor, insulin-like growth factor I,
insulin-like growth factor receptor, insulin-like growth factor II,
insulin-like growth factor binding protein, keratinocyte growth
factor, leukemia inhibitory factor, leukemia inhibitory factor
receptor .alpha., nerve growth factor, nerve growth factor
receptor, neurotrophin-3, neurptrophin-4, placenta growth factor,
placenta growth factor 2, platelet derived endothelial cell growth
factor, platelet derived growth factor, platelet derived growth
factor A chain, platelet derived growth factor AA, platelet derived
growth factor AB, platelet derived growth factor B chain, platelet
derived growth factor BB, platelet derived growth factor receptor
.alpha., platelet derived growth factor receptors, pre-B cell
growth stimulating factor, stem cell factor, stem cell factor
receptor, transforming growth factor .alpha., transforming growth
factor .beta., transforming growth factor .beta.-1, transforming
growth factor .beta.-1, transforming growth factor .beta.-2,
transforming growth factor .beta.-3, transforming growth factor
.beta.-5, latent transforming growth factor .beta.-1, transforming
growth factor .beta. binding protein I, transforming growth factor
.beta. binding protein II, transforming growth factor .beta.
binding protein III, tumor necrosis factor receptor type I, tumor
necrosis factor receptor type II, urokinase-type plasminogen
activator receptor, chimeric proteins and biologically or
immunologically active fragments thereof, or antibodies
thereto.
[0277] Compounds of the present invention may be used in
combination with other drugs that are used in the
treatment/prevention/suppression or amelioration of the diseases or
conditions for which compounds of the present invention are useful.
Such other drugs may be administered, by a route and in an amount
commonly used therefore, contemporaneously or sequentially with a
compound of the present invention, such as methimazole derivatives
and tautomeric cyclic thiones. When a compound of the present
invention is used contemporaneously with one or more drugs, a
pharmaceutical composition containing such other drugs in addition
to the compound of the present invention is preferred. Accordingly,
the pharmaceutical compositions of the present invention include
those that also contain one or more other active ingredients, in
addition to a compound of the present invention. Examples of other
active ingredients that may be combined with a compound of the
present invention, either administered separately or in the same
pharmaceutical compositions, include, but are not limited to: (a)
VCAM-1, ICAM-1, or E-selectin antagonists; (b) steroids such as
beclomethasone, methylprednisolone, betamethasone, prednisone,
dexamethasone, and hydrocortisone; (c) immunosuppressants such as
cyclosporin, tacrolimus, rapamycin and other FK-506 type
immunosuppressants; (d) antihistamines (HI-histamine antagonists)
such as brompheniramine, chlorpheniramine, dexchlorpheniramine,
triprolidine, clemastine, diphenhydramine, diphenylpyraline,
tripelennamine, hydroxyzine, methdilazine, promethazine,
trimeprazine, azatadine, cyproheptadine, antazoline, pheniramine
pyrilamine, astemizole, terfenadine, loratadine, cetirizine,
fexofenadine, descarboethoxyloratadine, and the like; (e)
non-steroidal anti-asthmatics such as .beta.2-agonists
(terbutaline, metaproterenol, fenoterol, isoetharine, albuterol,
bitolterol, salmeterol and pirbuterol), theophylline, cromolyn
sodium, atropine, ipratropium bromide, leukotriene antagonists
(zafirlukast, montelukast, pranlukast, iralukast, pobilukast,
SKB-106,203), leukotriene biosynthesis inhibitors (zileuton,
BAY-1005); (f) non-steroidal antiinflammatory agents (NSAIDs) such
as propionic acid derivatives (alminoprofen, benoxaprofen, bucloxic
acid, carprofen, fenbufen, fenoprofen, fluprofen, flurbiprofen,
ibuprofen, indoprofen, ketoprofen, miroprofen, naproxen, oxaprozin,
pirprofen, pranoprofen, suprofen, tiaprofenic acid, and
tioxaprofen), acetic acid derivatives (indomethacin, acemetacin,
alclofenac, clidanac, diclofenac, fenclofenac, fenclozic acid,
fentiazac, furofenac, ibufenac, isoxepac, oxpinac, sulindac,
tiopinac, tolmetin, zidometacin, and zomepirac), fenamic acid
derivatives (flufenamic acid, meclofenamic acid, mefenamic acid,
niflumic acid and tolfenamic acid), biphenylcarboxylic acid
derivatives (diflunisal and flufenisal), oxicams (isoxicam,
piroxicam, sudoxicam and tenoxican), salicylates (acetyl salicylic
acid, sulfasalazine) and the pyrazolones (apazone, bezpiperylon,
feprazone, mofebutazone, oxyphenbutazone, phenylbutazone); (g)
cyclooxygenase-2 (COX-2) inhibitors such as celecoxib; (h)
inhibitors of phosphodiesterase type IV (PDE-IV); (i) antagonists
of the chemokine receptors, especially CCR-1, CCR-2, CCR-3, and
CXCR4; (j) cholesterol lowering agents such as HMG-CoA reductase
inhibitors (lovastatin, simvastatin and pravastatin, fluvastatin,
atorvastatin, and other statins), sequestrants (cholestyramine and
colestipol), nicotinic acid, fenofibric acid derivatives
(gemfibrozil, clofibrat, fenofibrate and benzafibrate), and
probucol; (k) anti-diabetic agents such as insulin, sulfonylureas,
biguanides (metformin), .alpha.-glucosidase inhibitors (acarbose)
and glitazones (troglitazone, pioglitazone, englitazone, MCC-555,
BRL49653 and the like); (1) preparations of type1 interferon (e.g.,
.beta.-interferon and .alpha.-interferon); (m) anticholinergic
agents such as muscarinic antagonists (ipratropium bromide); (n)
other compounds such as 5-aminosalicylic acid and prodrugs thereof,
antimetabolites such as azathioprine and 6-mercaptopurine, and
cytotoxic cancer chemotherapeutic agents; (o) antibiotics; (p)
antibodies which block cytokine or chemokine activity, e.g.
anti-TNF.alpha., or block leukocyte adhesion, e.g. anti-VCAM-1 or
anti-E-selectin; antihypertensives agents, which inhibit platelet
or leukocyte adhesion such as plaxel, etc.
[0278] Other suitable pharmaceutical agents that can be used in
combination with the compounds of the present invention include
agents useful in the treatment of metabolic related disorders
and/or concomitant diseases thereof. For example, but not limited
to, congestive heart failure, type I diabetes, type II diabetes,
inadequate glucose tolerance, insulin resistance, hyperglycemia,
hyperlipidemia, hypertriglyceridemia, hypercholesterolemia,
dyslipidemia, syndrome X, retinopathy, nephropathy and neuropathy.
Prophylaxis or treatment of one or more of the diseases cited
herein include the use of one or more pharmaceutical agents known
in the art belonging to the classes of drugs referred to, but not
limited to, the following: sulfonylureas, meglitinides, biguanides,
.alpha.-glucosidase inhibitors, peroxisome proliferators-activated
receptor-.gamma. (i.e., PPAR-.gamma.) agonists, insulin, insulin
analogues, HMG-CoA reductase inhibitors, cholesterol-lowering drugs
(for example, fibrates that include: fenofibrate, bezafibrate,
gemfibrozil, clofibrate and the like; bile acid sequestrants which
include: cholestyramine, colestipol and the like; and niacin),
antiplatelet agents (for example, aspirin and adenosine diphosphate
receptor antagonists that include: clopidogrel, ticlopidine and the
like), angiotensin-converting enzyme inhibitors, angiotensin II
receptor antagonists, adiponectin and the like. In accordance to
one aspect of the present invention, a compound of the present can
be used in combination with a pharmaceutical agent or agents
belonging to one or more of the classes of drugs cited herein.
[0279] Moreover, the compounds of the present invention can be used
alone or in combination with one or more additional agents
depending on the indication and the desired therapeutic effect. For
example, in the case of diabetes, insulin resistance and associated
conditions or complications, including obesity and hyperlipidemia,
such additional agent (s) may be selected from the group consisting
of: insulin or an insulin mimetic, a sulfonylurea (such as
acetohexamide, chlorpropamide, glimepiride, glipizide, glyburide,
tolbutamide and the like) or other insulin secretagogue (such as
nateglinide, repaglinide and the like), a thiazolidinedione (such
as pioglitazone, rosiglitazone and the like) or other peroxisome
proliferator-activated receptor (PPAR)-.gamma. agonist, a fibrate
(such as bezafibrate, clofibrate, fenofibrate, gemfibrozol and the
like) or other PPAR-.alpha. agonist, a PPAR-.DELTA. agonist, a
biguanide (such as metformin), a statin (such as fluvastatin,
lovastatin, pravastatin, simvastatin and the like) or other
hydroxymethylglutaryl (HMG) CoA reductase inhibitor, an
.alpha.-glucosidase inhibitor (such as acarbose, miglitol,
voglibose and the like), a bile acid-binding resin (such as
cholestyramine, celestipol and the like), a high density
lipoprotein (HDL)-lowering agent such as apolipoprotein A-I
(apoA1), niacin and the like, probucol and nicotinic acid,
Preferred additional agents include, for example, sulfonylurea,
thiazolidinedione, fibrate or statin, preferably sulfonylurea.
[0280] In the case of inflammation, inflammatory diseases,
autoimmune disease and other such cytokine mediated disorders, the
additional agent (s) may be selected from the group consisting of:
a nonsteroidal anti-inflammatory drug (NSAID) (such as diclofenac,
diflunisal, ibuprofen, naproxen and the like), a cyclooxygenase-2
inhibitor (such as celecoxib, rofecoxib and the like), a
corticosteroid (such as prednisone, methylprednisone and the like)
or other immunosuppressive agent (such as methotrexate,
leflunomide, cyclophosphamide, azathioprine and the like), a
disease-modifying anti-rheumatic drug (DMARD) (such as injectable
gold, penicilliamine, hydroxychloroquine, sulfasalazine and the
like), a TNF-.alpha. inhibitor (such as etanercept, infliximab and
the like), other cytokine inhibitor (such as soluble cytokine
receptor, anti-cytokine antibody and the like), other immune
modulating agent (such as cyclosporin, tacrolimus, rapamycin and
the like, and immunostimulatory oligonucleotides and/or immunomers)
and a narcotic agent (such as hydrocodone, morphine, codeine,
tramadol and the like).
[0281] Preferred diseases that may be treated by the preferred
methods include inflammatory or immunological disease, for example,
rheumatoid arthritis, osteoarthritis, ankylosing spondylitis,
psoriasis, psoriatic arthritis, asthma, acute respiratory distress
syndrome, chronic obstructive pulmonary disease, or multiple
sclerosis. Additional preferred diseases that may be treated by the
preferred methods include diabetes, hyperlipidemia, includes
coronary heart disease, cancer or proliferative disease.
[0282] Another aspect of the invention is a method of treating
diabetes and related diseases comprising the step of administering
to a subject suffering from a diabetic or related condition a
therapeutically effective amount of a methimazole derivative and/or
tautomeric cyclic thione compound described herein. Additionally,
the invention provides a method of treating inflammation or
inflammatory diseases or diseases mediated by cytokines, PDE4,
PDE3, p44/42 MAP kinase, iNOS and/or COX-2 by administering to a
subject in need of such treatment an effective amount of a
methimazole derivative and/or tautomeric cyclic thione compound
described herein. Further, pharmaceutical compositions containing a
therapeutically effective amount of one or more methimazole
derivative and/or tautomeric cyclic thione compounds described
herein together with a pharmaceutically or physiologically
acceptable carrier, for use in the treatments contemplated herein,
are also provided.
[0283] The compounds of the invention are useful for the treatment
of diabetes, characterized by the presence of elevated blood
glucose levels, that is, hyperglycemic disorders such as diabetes
mellitus, including both type 1 and 2 diabetes, as well as other
hyperglycemic related disorders such as obesity, increased
cholesterol, hyperlipidemia such as hypertriglyceridemia, kidney
related disorders and the like. The compounds are also useful for
the treatment of disorders linked to insulin resistance and/or
hyperinsulinemia, which include, in addition to diabetes,
hyperandrogenic conditions such as polycystic ovary syndrome
(Ibanez et al., J. Clin Endocrinol Metab, 85:3526-30, (2000);
Taylor A. E., Obstet Gynecol Clin North Am, 27:583-95, (2000)),
coronary artery disease such as atherosclerosis and vascular
restenosis, and peripheral vascular disease. Additionally, the
compounds of the present invention are also useful for the
treatment of inflammation and immunological diseases that include
those mediated by signaling pathways linked to pro-inflammatory
cytokines, such as rheumatoid arthritis, ankylosing spondylitis,
multiple sclerosis, inflammatory bowel disease, psoriasis, and
contact and atopic dermatitis.
[0284] In some embodiments, the immunostimulatory oligonucleotide
and/or immunomer used in the method according to the invention
comprises an immunostimulatory dinucleotide selected from the group
consisting of CpG, C*pG, CpG*, and C*pG*, wherein C is cytidine or
2'-deoxycytidine, C* is 2'-deoxythymidine. arabinocytidine,
2'-deoxy-2'-substituted arabinocytidine,
2'-O-substitutedarabinocytidine, 2'-deoxy-5-hydroxycytidine,
2'-deoxy-N-4-alkyl-cytidine, 2'-deoxy-4-thiouridine, other
non-natural pyrimidine nucleosides, or 1-
(2'-deoxy-beta-D-ribofuranosyl-)-2-oxo-7-deaza-8-methyl-purine; G
is guanosine or 2'-deoxyguanosine, G* is 2' deoxy-7-deazaguanosine,
2'-deoxy-6-thioguanosine, arabinoguanosine,
2'-deoxy-2'-substituted-arabinoguanosine,
2'-O-substituted-arabinoguanosin-e, or other non-natural purine
nucleoside, and p is an internucleoside linkage selected from the
group consisting of phosphodiester, phosphorothioate, and
phosphorodithioate. In certain preferred embodiments, the
immunostimulatory dinucleotide is not CpG.
[0285] .beta.-adrenergic receptor antagonists block the action of
the sympathetic nervous system and a portion of the involuntary
nervous system. By blocking the action of these nerves, they reduce
the heart rate and are useful in treating abnormally rapid heart
rhythms. These drugs also reduce the force of heart muscle
contractions and lower blood pressure. By reducing the heart rate
and the force of muscle contraction, .beta.-blockers reduce heart
muscle oxygen demand. Useful .beta.-adrenergic blocking agents are
selected from a group including atenolol, betaxolol, acebutolol,
bisoprolol, carteolol, labetalol, metoprolol, nadolol, oxprenolol,
penbutolol, pindolol, propranolol, sotalol, and timolol. Atenolol
is a presently preferred beta-adrenergic blocking agent.
[0286] This invention employs any effective cholesterol-lowering
agent or combination of such agents in combination with the present
methods. Useful cholesterol-lowering agents include HMG CoA
reductase inhibitors, bile acid sequestrants, probucol, and fibric
acid agents. Also useful is the selective inhibitor of intestinal
cholesterol absorption having the adopted name "ezetimibe," and the
chemical name
1-(4-fluorophenyl)-3(R)-[3-(4-fluorophenyl)-3(S)-hydroxypropyl]-4(S)-(4-h-
ydroxyphenyl)-2-azetidinone. Ezetimibe is particularly effective
when administered together with a statin.
[0287] Preferred are the HMG CoA reductase inhibitors. These agents
are competitive inhibitors of HMG CoA reductase, the rate-limiting
step in cholesterol biosynthesis. They occupy a portion of the
binding site of HMG CoA, blocking access of this substrate to the
active site on the enzyme. HMG CoA reductase inhibitors comprise
atorvastatin, cerivistatin, fluindostatin, fluvastatin, lovastatin,
mevastatin, pravastatin, simvastatin, and velostatin; the most
preferred agents are lovastatin and pravastatin, particularly
lovastatin.
[0288] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include
inhibitors of the renin-angiotensin system. The renin-angiotensin
system plays a major role in regulating blood pressure. Renin, an
enzyme, functions by acting on angiotensinogen to form the
decapeptide angiotensin I. Angiotensin I is rapidly converted to
the octapeptide angiotensin II by angiotensin converting enzyme
(ACE). Angiotensin II acts by numerous mechanisms to raise blood
pressure, including raising total peripheral resistance. Inhibitors
of the renin-angiotensin system are classified as angiotensin
converting enzyme (ACE) inhibitors and angiotensin II receptor
antagonists (ARBs). Examples of angiotensin converting enzyme (ACE)
inhibitors are captopril, cilazapril, delapril, enalapril,
fentiapril, fosinopril, indolapril, lisinopril, perindopril,
pivopril, quinapril, ramipril, spirapril, trandolapril, and
zofenopril; preferred for use in this invention are captopril,
enalapril, fosinopril, lisinopril, quinapril, ramipril, and
trandolapril, and more preferred is enalapril. Useful angiotensin
II receptor antagonists include losartan, irbesartan, eprosartan,
candesartan, valsartan, telmisartan, zolasartin, and tasosartan.
Preferred is losartan. In this invention, angiotensin converting
enzyme (ACE) inhibitors are more preferred over angiotensin II
receptor antagonists.
[0289] Cyclooxygenase inhibitors are useful in the present
invention, due to their ability to affect platelets; the most
widely used and studied cyclooxygenase inhibitor is aspirin, which
has been shown to prevent myocardial infarction and strokes due to
thrombosis, when administered in low daily doses over a long term
to patients at risk for cardiovascular events. When sufficient
aspirin is present in the circulatory system, platelets that are
being formed have an impaired ability to aggregate over their
entire 7-10 day lifetimes.
[0290] Diuretics increase the rate of urine flow and sodium
excretion and are used to adjust the volume and/or composition of
body fluids in a variety of clinical situations, including
hypertension, congestive heart failure, renal failure, nephritic
syndrome and cirrhosis. Diuretics can be selected from variety of
classes such as inhibitors of carbonic anhydrase, loop diuretics,
thiazides and thiazide-like diuretics, K+ sparing diuretics, and
antagonists of mineralocorticoid receptors.
[0291] In an embodiment of this invention thiazides and
thiazide-like derivatives are preferred diuretics, including
bendroflumethazide, chlorothiazide, hydrochlorothiazide,
hydroflumethazide, methyclothazide, polythiazide,
trichlormethazide, chlorthalidone, indapamide, metolazone, and
qiunethazone. Presently, the most preferred diuretic is
hydrochlorothiazide, which acts by blocking salt and fluid
reabsorption in the kidneys, causing increased urine output
(diuresis). It has also been widely used in treating mild
hypertension.
[0292] Further, a combination product can include at least one
antidiabetic agent, such as the oral hypoglycemic agents metformin,
the sulfonylurea drugs glibenclamide, tolbutamide, tolazamide,
glyburide, glipizide, and glimipiride, and the thiazolidinedione
drugs troglitazone, rosiglitazone, and pioglitazone. These
generally act to improve insulin utilization by the cells, and (in
some instances) stimulate insulin production by the pancreas or
decrease hepatic glucose production. An anti-diabetic agent can be
included in a product that is intended for use by persons having
non-insulin dependent diabetes mellitus.
[0293] Elevated serum levels of homocysteine are highly correlated
with atherosclerosis, heart disease, stroke, and peripheral
vascular disease. Vitamin B6, vitamin B12, and folic acid act to
lower homocysteine levels and reduce the incidence of these disease
states. Vitamin B6 may be included in amounts between about 2 mg
and 2 grams. Vitamin B12 may be included in amounts between about 3
.mu.g and 2 mg. Folic acid may generally be included in amounts up
to about 5 mg, such as about 400 to 800 g, about 500 .mu.g to 2 mg,
or about 1 mg to 5 mg.
[0294] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include
sulfonylureas. The sulfonyiureas (SU) are drugs which promote
secretion of insulin from pancreatic beta cells by transmitting
signals of insulin secretion via SU receptors in the cell
membranes. Examples of the sulfonylureas include glyburide,
glipizide, glimepiride and other sulfonylureas known in the
art.
[0295] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
meglitinides. The meglitinides are benzoic acid derivatives
represent a novel class of insulin secretagogues. These agents
target postprandial hyperglycemia and show comparable efficacy to
sulfonylureas in reducing HbAlc. Examples of meglitinides include
repaglinide, nateglinide and other meglitinides known in the
art.
[0296] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
biguanides. The biguanides represent a class of drugs that
stimulate anaerobic glycolysis, increase the sensitivity to insulin
in the peripheral tissues, inhibit glucose absorption from the
intestine, suppress of hepatic gluconeogenesis, and inhibit fatty
acid oxidation. Examples of biguanides include phenformin,
metformin, buformin, and biguanides known in the art.
[0297] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
alpha-glucosidase inhibitors. The alpha-glucosidase inhibitors
competitively inhibit digestive enzymes such as alpha-amylase,
maltase, alpha-dextrinase, sucrase, etc. in the pancreas and or
small intestine. The reversible inhibition by alpha-glucosidase
inhibitors retard, diminish or otherwise reduce blood glucose
levels by delaying the digestion of starch and sugars. Examples of
alpha-glucosidase inhibitors include acarbose,
N-(1,3-dihydroxy-2-propyl)valiolamine (generic name; voglibose),
miglitol, and alpha-glucosidase inhibitors known in the art.
[0298] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
peroxisome proliferators-activated receptors (i.e., PPAR-Y)
agonists. The peroxisome proliferators-activated receptor-.gamma.
agonists represent a class of compounds that activates the nuclear
receptor PPAR-.gamma. and therefore regulate the transcription of
insulin-responsive genes involved in the control of glucose
production, transport and utilization. Agents in the class also
facilitate the regulation of fatty acid metabolism. Examples of
PPAR-.gamma. agonists include rosiglitazone, pioglitazone,
tesaglitazar, netoglitazone, GW-409544, GW-501516 and PPAR-.gamma.
agonists known in the art.
[0299] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
HMG-CoA reductase inhibitors. The HMG-CoA reductase inhibitors are
agents also referred to as Statin compounds that belong to a class
of drugs that lower blood cholesterol levels by inhibiting
hydroxymethylglutalyl CoA (HMG-CoA) reductase. HMG-CoA reductase is
the rate-limiting enzyme in cholesterol biosynthesis. The statins
lower serum LDL concentrations by upregulating the activity of LDL
receptors and are responsible for clearing LDL from the blood. Some
representative examples the statin compounds include rosuvastatin,
pravastatin and its sodium salt, simvastatin, lovastatin,
atorvastatin, fluvastatin, cerivastatin, rosuvastatin,
pitavastatin, BMS's "superstatin", and HMG-CoA reductase inhibitors
known in the art.
[0300] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
Fibrates. Fibrate compounds belong to a class of drugs that lower
blood cholesterol levels by inhibiting synthesis and secretion of
triglycerides in the liver and activating a lipoprotein lipase.
Fibrates have been known to activate peroxisome
proliferators-activated receptors and induce lipoprotein lipase
expression. Examples of fibrate compounds include bezafibrate,
beclobrate, binifibrate, ciplofibrate, clinofibrate, clofibrate,
clofibric acid, etofibrate, fenofibrate, gemfibrozil, nicofibrate,
pirifibrate, ronifibrate, simfibrate, theofibrate, and fibrates
known in the art.
[0301] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
angiotensin converting enzyme (ACE) inhibitors. The angiotensin
converting enzyme inhibitors belong to the class of drugs that
partially lower blood glucose levels as well as lowering blood
pressure by inhibiting angiotensin converting enzymes. Examples of
the angiotensin converting enzyme inhibitors include captopril,
enalapril, alacepril, delapril; ramipril, lisinopril, imidapril,
benazepril, ceronapril, cilazapril, enalaprilat, fosinopril,
moveltopril, perindopril, quinapril, spirapril, temocapril,
trandolapril, and angiotensin converting enzyme inhibitors known in
the art.
[0302] Suitable pharmaceutical agents that can be used in
conjunction with compounds of the present invention include the
angiotensin II receptor antagonists. Angiotensin II receptor
antagonists target the angiotensin II receptor subtype 1 (i.e.,
ATI) and demonstrate a beneficial effect on hypertension. Examples
of angiotensin II receptor antagonists include losartan (and the
potassium salt form), and angiotensin II receptor antagonists known
in the art.
[0303] Other treatments for one or more of the diseases cited
herein include the use of pharmaceutical agents known in the art
belonging to the classes of drugs referred to, but not limited to,
the following: amylin agonists (for example, pramlintide), insulin
secretagogues (for example, GLP-1 agonists; exendin-4;
insulinotropin (NN22 11); dipeptyl peptidase inhibitors (for
example, NVP-DPP-728), acyl CoA cholesterol acetyltransferase
inhibitors (for example, Ezetimibe, eflucimibe, and like
compounds), cholesterol absorption inhibitors (for example,
ezetimibe, pamaqueside and like compounds), cholesterol ester
transfer protein inhibitors (for example, CP-529414, JTT-705,
CETi-1, and like compounds), microsomal triglyceride transfer
protein inhibitors (for example, implitapide, and like compounds),
cholesterol modulators (for example, NO-1886, and like compounds),
bile acid modulators (for example, GT103-279 and like compounds)
and squalene synthase inhibitors.
[0304] Squalene synthesis inhibitors belong to a class of drugs
that lower blood cholesterol levels by inhibiting synthesis of
squalene. Examples of the squalene synthesis inhibitors include
(S)-alpha-[Bis[2,2-dimethyl-1-oxopropoxy)methoxy]phosphinyl]-3-phenoxyben-
zenebutanesulfonic acid, mono potassium salt (BMS-188494) and
squalene synthesis inhibitors known in the art.
[0305] Combination therapy according to the invention may be
performed alone or in conjunction with another therapy and may be
provided at home, the doctor's office, a clinic, a hospital's
outpatient department, or a hospital. Treatment generally begins at
a hospital so that the doctor can observe the therapy's effects
closely and make any adjustments that are needed. The duration of
the combination therapy depends on the type of disorder being
treated, the age and condition of the patient, the stage and type
of the patient's disease, and how the patient responds to the
treatment. Additionally, a person having a greater risk of
developing a disorder (e.g., a person who is genetically
predisposed or previously had a disease or disorder) may receive
prophylactic treatment to inhibit or delay a response. Similarly,
the duration of the combination therapy depends on the type of
autoimmune-inflammatory disorder associated with overexpressed
TLR3, TLR4, TLR3 or TLR4 signaled events, overexpressed cytokines,
chemokines, or interferons, the age and condition of the patient,
the stage and type of the patient's disease, and how the patient
responds to the treatment. Additionally, a person having a greater
risk of developing a disease or a related autoimmune-inflammatory
disease, i.e. thyroiditis in a diabetic, or a person who is
genetically predisposed or previously had a disease or disorder may
receive prophylactic treatment to inhibit or delay a response.
[0306] Combination therapy according to the invention may be
performed alone or in conjunction with another therapy and may be
provided at home, the doctor's office, a clinic, a hospital's
outpatient department, or a hospital. Treatment generally begins at
a hospital so that the doctor can observe the therapy's effects
closely and make any adjustments that are needed. The duration of
the combination therapy depends on the type of disease caused by or
associated with TLR, TLR3, TLR4, or all overexpression and
signaling in nonimmune cells, monocytes, macrophages or dendritic
cells, including, but not limited to, Hashimoto's thyroiditis, type
1, insulinitis, Type 1 diabetes, atherosclerosis, vascular
complications of diabetes, obesity, or hyperlipidemias, toxic
shock, or autoimmune inflammatory disorder being treated, the age
and condition of the patient, the stage and type of the patient's
disease, and how the patient responds to the treatment.
Additionally, a person having a greater risk of developing an
autoimmune inflammatory disorder caused by or associated with TLR,
TLR3, TLR4, or all overexpression and signaling in nonimmune cells,
monocytes, macrophages or dendritic cells, including, but not
limited to, Hashimoto's thyroiditis, type 1, insulinitis, Type 1
diabetes, atherosclerosis, vascular complications of diabetes,
obesity, or hyperlipidemias, toxic shock, or autoimmune
inflammatory disorder (e.g., a person who is genetically
predisposed or previously had a disease or disorder) may receive
prophylactic treatment to inhibit or delay a response.
[0307] The dosage, frequency and mode of administration of each
component of the combination can be controlled independently. For
example, one compound may be administered orally three times per
day, while the second compound may be administered intramuscularly
once per day. Combination therapy may be given in on-and-off cycles
that include rest periods. The compounds may also be formulated
together such that one administration delivers both compounds.
[0308] The relative efficacies of compounds can be established by
determining the concentrations at which each compound inhibits the
activity to a predefined extent and then comparing the results.
Typically, the preferred determination is the concentration that
inhibits 50% of the activity in a biochemical assay, i.e., the 50%
inhibitory concentration or "IC.sub.50." IC.sub.50 determinations
can be accomplished using conventional techniques known in the art.
In general, an IC.sub.50 can be determined by measuring the
activity of a given enzyme in the presence of a range of
concentrations of the inhibitor under study. The experimentally
obtained values of activity then are plotted against the inhibitor
concentrations used. The concentration of the inhibitor that shows
50% activity (as compared to the activity in the absence of any
inhibitor) is taken as the IC.sub.50 value. Analogously, other
inhibitory concentrations can be defined through appropriate
determinations of activity. For example, in some settings it can be
desirable to establish a 90% inhibitory concentration, i.e.,
IC.sub.90, etc. A methimazole derivative and/or tautomeric cyclic
thione compound is typically administered in an amount such that it
selectively inhibits TLR3 or TLR4 expression or activity, as
described above.
[0309] An optionally rate-limiting layer on the compositions
comprises a water insoluble polymer or a mixture of water insoluble
polymers or a mixture of water soluble and water insoluble
polymers.
[0310] In one embodiment, the composition comprises the compounds
of the present invention and a water-soluble or water-insoluble
polymer that acts both as binder for the therapeutic compounds and
as a rate-limiting layer for release of the compounds. Such
polymers may be selected from cellulose derivatives, acrylic
polymers and copolymers, vinyl polymers and other high molecular
polymer derivatives or synthetic polymers such as methylcellulose,
hydroxypropylcellulose, hydroxypropylmethylcellulose,
ethylcellulose, cellulose acetate, polyvinyl pyrrolidone,
polyvidone acetate, polyvinyl acetate, polymethacrylates and
ethylene-vinyl acetate copolymer or a combination thereof Preferred
film-forming polymers are ethylcellulose or copolymers of acrylic
and methacrylic acid esters in aqueous dispersion form.
[0311] In another embodiment, the composition comprises
homogeneously distributed methimazole derivatives and tautomeric
cyclic thiones contained in a water insoluble polymer or a mixture
of water insoluble polymers or a mixture of water soluble and water
insoluble polymers mentioned above.
[0312] In another embodiment, the composition comprises a second
rate-limiting layer. The polymers in the second layer may be
selected from the group of anionic carboxylic polymers suitable for
pharmaceutical purposes and being soluble with difficulty at a low
pH but being soluble at a higher pH, the pH limit for solubility
being in the interval of pH 4 to pH 7.5, said group comprising
cellulose acetate phthalate, cellulose acetate trimellitate,
hydroxypropylmethylcellulose phthalate, polyvinyl acetate phthalate
and acrylic acid polymers, e.g., partly asterified methacrylic
acid-polymers. These polymers may be used alone or in combination
with each other or in combination with water insoluble polymers
mentioned before.
[0313] The coatings may optionally comprise other pharmaceutically
acceptable materials that improve the properties of the
film-forming polymers such as plasticizers, anti-adhesives,
surfactants, and diffusion-accelerating or diffusion-retarding
substances. Suitable plasticizers comprise phthalic acid esters,
triacetin, dibutylsebacate, monoglycerides, citric acid esters and
polyethyleneglycols. Preferred plasticizers are acetyltributyl
citrate and triethyl citrate. Suitable anti-adhesives comprise talc
and metal stearates.
[0314] The amount of the first coating applied on the units is
normally in the range between 0.5% and 30% by weight, preferably
between 1% and 15%. This amount includes in the relevant case the
weight of the adjunct therapeutic, for example the steroid, or
statin, as well. The amount of the second coating applied on the
units is normally in the range between 1% and 50% by weight,
preferably between 2% and 25%, calculated on the weight of the
coated units. The remainder constitutes the weight of the
dosage.
[0315] The weight ratio of the therapeutic compound of the present
invention to the second or third active ingredient may be varied
and will depend upon the effective dose of each ingredient.
Generally, an effective dose of each will be used. Thus, for
example, when a therapeutic is combined with an NSAID the weight
ratio of the compound of the therapeutic compound of the present
invention to the NSAID will generally range from about 1000:1 to
about 1 :1000, preferably about 200:1 to about 1:200. Combinations
of a therapeutic and other active ingredients will generally also
be within the aforementioned range, but in each case, an effective
dose of each active ingredient should be used.
[0316] Pharmaceutical Compositions of the Present Invention
[0317] For the treatment of autoimmune/inflammatory diseases
associated with toll-like receptor 3 and 4 over-expression and
pathologic signaling in nonimmune cells, macrophages, monocytes, or
dendritic cells, pharmaceutical compositions in dosage unit form
comprise an amount of composition that provides from about 0.05 to
about 600 milligrams. In another embodiment, the composition
provides from about 0.05 to about 200 milligrams of active compound
per day. Useful pharmaceutical formulations for administration of
the active compounds of this invention may be illustrated below.
They are made using conventional techniques.
[0318] Capsules
[0319] Active ingredient 0.05 to 200 mg
[0320] Lactose 20-100 mg
[0321] Corn Starch U.S.P. 20-100 mg
[0322] Aerosolized silica gel 2-4 mg
[0323] Magnesium stearate 1-2 mg
Tablets
[0324] Active ingredient 0.05 to 200 mg
[0325] Microcrystalline cellulose 50 mg
[0326] Corn Starch U.S.P. 80 mg
[0327] Lactose U.S.P. 50 mg
[0328] Magnesium stearate U.S.P. 1-2 mg
[0329] This tablet can be sugar coated according to conventional
art practices. Colors may be added to the coating.
Chewable Tablets
[0330] Active ingredient 0.05 to 200 mg
[0331] Mannitol, N.F. 100 mg
[0332] Flavor 1 mg
[0333] Magnesium stearate U.S.P. 2 mg
Suppositories
[0334] Active ingredient 0.05 to 200 mg
[0335] Suppository base 1900 mg
[0336] Dimethyl sulfoxide 0.1 to 3%
Liquid
[0337] Active ingredient 2.0 percent
[0338] Polyethylene glycol 300, N.F. 10.0 percent
[0339] Glycerin 5.0 percent
[0340] Sodium bisulfite 0.02 percent
[0341] Sorbitol solution 70%, U.S.P. 50 percent
[0342] Methylparaben, U.S.P. 0.1 percent
[0343] Propylparaben, U.S.P. 0.2 percent
[0344] Distilled water, U.S.P. (q.s.) 100.0 cc
[0345] Dimethyl sulfoxide 0.1 to 3%
Injectable
[0346] Active ingredient 0.02 to 200 mg
[0347] Polyethylene glycol 600 1.0 cc
[0348] Sodium bisulfite, U.S.P. 0.4 mg
[0349] Water for injection, U.S.P. (q.s.) 2.0 cc
[0350] Dimethyl sulfoxide 0.1 to 3%
[0351] In addition, information regarding procedural or other
details supplementary to those set forth herein is described in
cited references specifically incorporated herein by reference.
[0352] It would be obvious to those skilled in the art that
modifications or variations may be made to the preferred embodiment
described herein without departing from the novel teachings of the
present invention. All such modifications and variations are
intended to be incorporated herein and within the scope of the
claims.
[0353] The following examples are intended to illustrate the
pharmaceutically active compounds, pharmaceutical compositions and
methods of treatment of the present invention, but are not intended
to be limiting thereof.
EXAMPLES
Example 1
[0354] TLR3 is expressed in thyrocytes, is functional, can be
pathologically overexpressed by viruses, is associated with
Hashimoto's thyroiditis, and its pathological overexpressed state
or signaling can be reversed by methimazole, methimazole
derivatives, and tautomeric cyclic thiones.
[0355] TLR3 is present and functional in thyrocytes.
[0356] TLR3 is present in thyrocytes. Using Northern blotting, we
showed that rat FRTL-5 thyrocytes contained detectable levels of a
single 5.8 kb mRNA that hybridizes with a .sup.32P-labeled mouse
TLR3 cDNA probe and is present in mouse spleen (positive control).
The presence of TLR3 on FRTL-5 thyrocytes grown in continuous
culture was duplicated in intact mouse thyroids, which had a
similarly sized RNA. Specificity was indicated since neither human
embryonic kidney (HEK293), Chinese hamster ovary (CHO-K1) cell, or
mouse liver exhibited significant levels of a similar sized
hybridizing band. Further evidence of specificity was the
observation that TLR9 mRNA, which is involved in the recognition of
specific unmethylated CpG-ODN sequences that distinguish bacterial
DNA from mammalian DNA, was not expressed basally in FRTL-5 cells
despite its prominent appearance in spleen cells. The low level of
TLR3 mRNA which we detected in mRNA from mouse heart is consistent
with a previous report studying TLR3 expression in mouse heart,
lung, brain and kidney (L. Alexopoulou, et al., Nature, 413:732-8,
(2001)).
[0357] These data demonstrate for the first time that TLR3 mRNA is
present basally in mouse thyroid tissue and rat thyroid cells. We
could, however, also show TLR3 protein was expressed by Western
blotting. Lysates of FRTL-5 cells were immunoprecipitated with a
monoclonal TLR3 antibody and resolved by SDS-PAGE. An approximately
120 kDa protein was detected in FRTL-5 cell lysates
immuno-precipitated by the TLR3 MAb. As a positive control, we
showed that the TLR3 MAb detected a similarly sized TLR3 protein in
CHO-K1 cells transiently transfected, with a human TLR3 expression
vector or one from mouse. This was not the case when the CHO-K1
cells were transfected with a human TLR4 expression vector,
demonstrating specificity of the protein identification and
measurement procedure. These data established that TLR3 was
expressed basally in thyrocytes; the following experiments
established the TLR3 was functional.
[0358] TLR3 is Functional in thyrocytes. Poly (I:C), a chemically
synthesized dsRNA that is a specific ligand for TLR3 (K. Takeda, et
al., Annu Rev Immunol, 21:335-76 (2003); K. Takeda, et al., Cell
Microbiol, 5:143-53 (2003); L. Alexopoulou, et al., Nature,
413:732-8 (2001)) was added to the culture medium to stimulate TLR3
signaling. Extracellular dsRNA is known to be specifically
recognized by TLR3 as evidenced by the lack of response to
extracellular dsRNA in TLR3-/- mouse-derived fibroblasts (L.
Alexopoulou, et al., Nature, 413:732-8 (2001)) TLR3 activation of
the NF-.kappa.B/p38MAPK and IRF-3/IFN-.beta. signals bifurcate at
TRIF (K. Takeda, et al., Annu Rev Immunol, 21:335-76 (2003); K. S.
Michelsen, et al., J Immunol, 173:5901-7 (2004)) (K. Takeda, et
al., Cell Microbiol, 5:143-53 (2003); H. Oshiumi, et al., Nat
Immunol, 4:161-7 (2003); M. Yamamoto, et al., J Immunol,
169:6668-72 (2002); M. Miettinen, et al., Genes Immun, 2:349-55
(2001); Z. Jiang, et al., Proc Natl Acad Sci USA, 101:3533-8
(2004)) We asked if both of these pathways were activated in FRTL-5
thyroid cells.
[0359] The presence of the NF-6B pathway was evaluated by
incubating extracellular dsRNA, [Poly (I:C)] with
pNF-.kappa.B-luc-transfected FRTL-5 cells and measuring reporter
gene activity and by EMSA in nontransfected cells, using an
NF-.kappa.B consensus oligonucleotide probe. Poly (I:C) increased
NF-.kappa.B Luc activity by comparison to non treated cells or
cells incubated with E. coli dsDNA. Poly (I:C) incubation also
increased formation of a p65/p50 NF-.kappa.B complex as evidenced
by the appearance of a major complex whose formation was inhibited
by incubations containing the nuclear extracts from treated cells
with anti-p50 or anti-p65 , but not by incubations with anti c-rel,
anti-p52, or anti-relB, which served as negative antibody
controls.
[0360] In the case of incubation with anti p50 and anti p65, the
data were similar to results in studies of p50/p65 binding to the
MHC class I (G. Pasterkamp, et al., Eur J Clin Invest, 34:328-34
(2004); C. Giuliani, et al., J Biol Chem, 270:11453-62 (1995); S.
I. Taniguchi, et al., Mol Endocrinol, 12:19-3, (1998)) or VCAM-1
promoter (N. M. Dagia, et al., J Immunol, 173:2041-9 (2004)). Cells
treated with IL-1.beta., TNF-.alpha., or the phorbol ester, TPA,
served as positive controls for formation of the p65/p50 complex in
the FRTL-5 cells.
[0361] Poly (I:C) incubation was also able to activate ERK1/2 MAPK
within 15 min as detected by measuring phosphorylated ERK1/2 in
immunoblots. Lysates from insulin-treated FRTL-5 cells were used as
a positive control. Elk1 was also transactivated by Poly (I:C)
treatment of reporter gene-coupled ELK-1 in FRTL-5 cell
transfectants, as measured by luciferase activity. IL-1.beta.
treatment, which can activate ELK-1 (K. Takeda, et al., Annu Rev
Immunol, 21:335-76 (2003)) served as a positive control.
[0362] Most importantly and most relevant to the effect of
methimazole, methimazole derivatives, and tautomeric cyclic thiones
on TLR3 activity, we could show that the
TLR3-IRF-3/IFN-.beta.-coupled signal system was also expressed in
FRTL-5 thyroid cells. Poly (I:C) incubations increased both
IFN-.beta. promoter activity (FIG. 1A) and IFN-.beta. mRNA levels
(FIG. 1B). IFN-.beta. promoter activity was measured by incubating
Poly (I:C) with FRTL-5 cells transfected with pIFN-.beta.-luc
constructs. Poly (I:C) incubation strongly increased IFN-.beta.
promoter activity, whereas E. coli dsDNA had no effect (FIG. 1A,
left panel). As a control, it was demonstrated that
pIFN-.beta.-luc-transfected HEK293 cells, which do not have
endogenous TLR3, failed to respond to Poly (I:C) incubation unless
they were first transfected with a human TLR3 expression plasmid
(FIG. 1A, right panel). Although Northern analysis did not detect
significant levels of IFN-.beta. mRNA, RT-PCR analysis using gene
specific primers (S. Yokoyama, et al., Biochem Biophys Res Commun,
232:698-701 (1997)) demonstrated that IFN-.beta. mRNA was increased
in FRTL-5 cells by the addition of Poly (I:C) (FIG. 1B).
[0363] Since IRF-3 must be activated as an intermediate to increase
IFN-.beta. gene expression in the TRIF pathway coupled to TLR3 (K.
Takeda, et al., Cell Microbiol, 5:143-53 (2003); H. Oshiumi, et
al., Nat Immunol, 4:161-7 (2003); M. Yamamoto, et al., J Immunol,
169:6668-72 (2002); Z. Jiang, et al., Proc Natl Acad Sci USA,
101:3533-8 (2004)), we additionally showed that Poly (I:C)
incubation increased IRF-3 transactivation activity in FRTL-5
thyrocytes (FIG. 1C). Incubation with IL-1.beta. again served as a
positive control.
[0364] To see if the TRIF adaptor protein could couple TLR3 and
signal generation in FRTL-5 cells, we asked whether co-transfection
of wild-type TIR domain-containing molecule adapter inducing
IFN-.beta./TIR-containing adapter molecule (TRIF/TICAM)-1 would
enhance Poly (I:C)-induced IFN-.beta. gene activation. Exogenous
expression of TRIF/TICAM-1 in FRTL-5 cells enhanced the Poly
(I:C)-induced IFN-.beta. promoter activity in a dose-dependent
manner but did not enhance IL-1.beta.-increased IFN-.beta. promoter
activity (FIG. 1D). IL-1.beta. (negative control) does not activate
IRF-3 and IFN-.beta. by a TRIF coupling mechanism (D. Devendra, et
al., Clin Immunol, 111:225-33 (2004); L. Wen, et al., J Immunol,
172:3173-80 (2004); E. Cario, et al., Infect Immun, 68:7010-7
(2000); K. S. Michelsen, et al., J Immunol, 173:5901-7 (2004); Z.
Jiang, et al., Proc Natl Acad Sci USA, 101:3533-8 (2004); M. Muzio,
et al., J Immunol, 164:5998-6004 (2000)). Overexpression of
wild-type or dominant negative (DN) MyD88 (negative controls) did
not result in any significant Poly (I:C)-induced IFN-.beta.
promoter activation or inhibition (FIG. 1D), nor did they
significantly activate or inhibit Poly (I:C)-increased NF-6B
luciferase activity (data not shown).
[0365] In sum, FRTL-5 cells not only express the TLR3 receptor,
they seem to signal through both the NF-6B and IRF-3/IFN-.beta.
pathways when incubated with extracellular Poly (I:C), similar to
immune cells. Their dual activation results in gene responses
characteristic of an innate immune response (K. Takeda, et al.,
Annu Rev Immunol, 21:335-76 (2003); K. Takeda, et al., Cell
Microbiol, 5:143-53 (2003); B. Beutler, Nature, 430:257-63 (2004);
K. S. Michelsen, et al., J Immunol, 173:5901-7 (2004)).
[0366] Overexpression of TLR3 and TLR signaling in thyroid cells by
dsRNA transfection or viral infection: Type I IFN is an important
intermediate.
[0367] dsRNA transfection and IFN-.beta. induce overexpression of
TLR and TLR3 signaling: Incubating FRTL-5 thyroid cells with Poly
(I:C) did not increase TLR3, PKR or MHC Class I mRNA levels over a
24 hour period, although Poly (I:C) incubation significantly
increased IP-10 mRNA and slightly increased ICAM-1 mRNA levels,
demonstrating the functional activity of the Poly (I:C) in this
experiment (FIG. 2A). IL-1.beta. (the positive control) also caused
an increase in IP-10 and ICAM-1 mRNA levels but did not change
TLR3, Class I, or PKR mRNA levels (FIG. 2A). This suggested that
dsRNA incubation with TLR3 was not an effective means of increasing
TLR3 expression in FRTL-5 cells nor induce changes in genes
important in the expression of autoimmune-inflammatory
diseases.
[0368] In sharp contrast to the Poly (I:C) incubation data,
transfection of Poly (I:C) into the cytoplasm of FRTL-5 cells
strongly increased TLR3 mRNA, as well as MHC Class I, PKR, ICAM-I,
and IP-10 mRNA levels, both 12 and 24 hrs after transfection, by
comparison to control cells (C) or a mock transfection (L) without
dsRNA (FIG. 2B, lanes 3 and 7). Unlike dsRNA, dsDNA transfection
was only weakly effective in increasing TLR3 mRNA and at 12 hrs
only (FIG. 2B, lanes 4 and 8), but, as previously reported (K.
Suzuki, et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)), was
effective in increasing PKR and MHC Class I, as well as ICAM-1, and
IP-10 mRNA levels 12 hrs after transfection, by comparison to
control cells (C) or a mock transfection (L) (FIG. 2B, lanes 1, 2,
5, and 6). These results suggest that the transfected dsRNA action
to increase TLR 3 is different from the ability of dsRNA to bind to
TLR3 during incubations and to induce signaling by a
receptor-ligand interaction. They also showed dsRNA transfection
appeared to be different from the action of dsDNA transfection.
These results further indicated that overexpression of TLR3 in
nonimmune cells requires a pathogenic stimulus not simply binding
of dsRNA to the TLR3.
[0369] As reported (K. Suzuki, et al., Proc Natl Acad Sci USA,
96:2285-90 (1999)), dsRNA transfection and dsDNA transfection
differ primarily in the induction of IFN-.beta. but not PKR.
Nevertheless, to evaluate a possible role of PKR activation in TLR3
overexpression by transfected dsRNA, we treated cells with
2-aminopurine (2-AP) (FIG. 2C), a PKR inhibitor (L. J. Mundschau,
et al., J Biol Chem, 270:3100-6 (1995)). TLR3 mRNA was still
increased by dsRNA transfection by comparison to control cells (C)
or a mock transfection (L) in the presence of 2-AP (FIG. 2C, lane 7
vs 3). Like the case for TLR3 expression, 2-AP did not inhibit the
dsRNA-transfection-induced increase in IFN-.beta. mRNA levels (FIG.
2C, lane 7 vs 3), however, 2-AP strongly inhibited the ability of
dsRNA-transfection to increase NF-.kappa.B p65/p50 complex
formation in EMSA (FIG. 2C, bottom). Moreover, whereas the dsRNA
transfection-induced increase in PKR and MHC Class I was only
slightly decreased by 10 mM 2-AP (FIG. 2C, lane 7 vs 3), the dsDNA
transfection-induced increase in PKR was eliminated and the
increase in MHC I was reduced to near control levels (FIG. 2C, lane
8 vs 4). This suggested a different mechanism of upregulation of
PKR and MHC class I by the two transfecting agents, the dsDNA
effect possibly linked to NF-6B activation whereas the dsRNA
transfection effect potentially more linked to IRF-3/IFN-.beta.
signaling. We have reported that dsDNA transfection together with
the TSHR in fibroblasts can result in Graves' disease if the
fibroblasts are killed with mitomycin and injected
intraperitoneally over the course of six weeks ((L. D. Kohn, et
al., Research Ohio, In press, (2005); K. Suzuki, et al., Proc Natl
Acad Sci USA, 96:2285-90 (1999); L. D. Kohn, et al., Int Rev
Immunol, 19:633-64 (2000); N. Shimojo, et al., Int Rev Immunol,
19:619-31 (2000); K. Suzuki, et al., Clin Exp Immunol, 127:234-42
(2002)). The dsDNA effect may be consistent with the activity of
TLR9, which is not present basally, but could be expressed in the
lysosomal-endosomal fractions of thyrocytes after transfection and
phagocytosis.
[0370] The possibility that Type I interferon produced by dsRNA
transfection might be an autocrine/paracrine activator of
thyrocytes post dsRNA transfection was considered and confirmed.
Like mouse macrophages (M. Miettinen, et al., Genes Immun, 2:349-55
(2001)), exogenously added Type I IFN, in our case IFN-.beta.,
increased TLR3 mRNA levels in FRTL-5 thyrocytes in a time- and
dose-dependent manner (Table 1). The increases were not duplicated
by a Type II IFN, IFN-.gamma., even if a high dose (1000 Units/ml)
of IFN-.gamma. was used (Table 1). IFN-.beta. also increased MHC I,
PKR, and IP-10 mRNA levels, concurrent with the increase in TLR3
mRNA levels. TABLE-US-00002 TABLE 1 IFN-.beta. not IFN-.gamma. (100
U/ml each) can mimic dsRNA transfection effect on RNA levels of
genes important in autoimmune-inflammatory diseases. % of Control
at 0 Time (.+-. 15%) mRNA 3 hr 6 hr 12 hr IFN-.beta. 1 hr TLR3 100
550 450 250 MHC Class I 100 300 400 425 PKR 100 500 450 450 IP-10
100 580 300 200 GAPDH 100 100 100 100 IFN-.gamma. 1 hr TLR3 100 100
100 100 MHC Class I 100 100 100 100 PKR 100 100 100 100 IP-10 100
100 100 100 GAPDH 100 100 100 100
[0371] Data are representative of multiple experiments.
[0372] In Table 1, the effect of IFN-.beta. or IFN-.gamma. on mRNA
levels of TLR3 and several other genes was measured as a function
of time. FRTL-5 cells were incubated with 100 U/ml of IFN-.beta. or
IFN-.gamma. for between 1 and 12 hours. IFN-.beta. duplicated the
effect of dsRNA transfection by increasing TLR3, PKR, MHC Class I,
and IP-10 RNA levels whereas IFN-.gamma. had no effect. Similarly
when cells were stimulated with between 10 and 1000 units of
IFN-.beta. or IFN-.gamma. for 3 hours, total RNA purified, and 20
.mu.g of total RNA analyzed by Northern analysis using the
radiolabeled cDNA probes of FIG. 2, only IFN-.beta. increased TLR3,
PKR, MHC Class I, and IP-10 RNA levels.
[0373] In sum, these experiments support the data that the
mechanism of action of transfected dsRNA is distinct from that of
transfected dsDNA(K. Suzuki, et al., Proc Natl Acad Sci USA,
96:2285-90., (1999)). The data support the possibility that
IFN-.beta. may be a mediator or autocrine/paracrine intermediate in
the ability of dsRNA transfection to increase TLR3. It
additionally, appears that the action of dsDNA, but not dsRNA
transfection, is entirely PKR dependent and coupled solely to the
NF-6B signal pathway. In contrast, the dsRNA transfection-induced
increases in IFN-.beta., PKR, and MHC I mRNA probably result from
activation of a signal by the IRF-3-related signal path linked to a
viral activated kinase, VAK, now known to involve 16B-related
kinases (IKK)-IKKepsilon/TANK binding kinase 1 (TBK1) (S. Sharma,
et al., Science, 300:1148-51 (2003); K. A. Fitzgerald, et al., Nat
Immunol, 4:491-6 (2003); Z. Jiang, et al., Proc Natl Acad Sci USA,
101:3533-8 (2004); M. J. Servant, et al., J Biol Chem, 276:355-63
(2001); M. J. Servant, et al., J Interferon Cytokine Res, 22:49-58
(2002); M. J. Servant, et al., J Biol Chem, 278:9441-7 (2003); J.
Hiscott, et al., Ann NY Acad Sci, 1010:237-48 (2003); H. Hemmi, et
al., J Exp Med, 199:1641-50 (2004)).
[0374] Influenza A virus mimics the action of dsRNA transfection
and IFN-.beta. to induce overexpression of TLR and TLR3 signaling:
The ability of dsRNA transfection, but not dsRNA incubation, to
increase TLR3 levels is presumed to mimic the action of a virus to
inject RNA into the cell as previously suggested (M. Yamamoto, et
al., J Immunol, 169:6668-72 (2002); M. Miettinen, et al., Genes
Immun, 2:349-55 (2001); L. Alexopoulou, et al., Nature, 413:732-8
(2001); S. Sharma, et al., Science, 300:1148-51 (2003); K. A.
Fitzgerald, et al., Nat Immunol, 4:491-6 (2003); Z. Jiang, et al.,
Proc Natl Acad Sci USA, 101:3533-8 (2004); J. Guardiola, et al.,
Crit Rev Immunol, 13:247-68 (1993); R. Gianani, et al., Proc Natl
Acad Sci USA, 93:2257-9 (1996); M. S. Horwitz, et al., Nat Med,
4:781-5 (1998); H. Wekerle, Nat Med, 4:770-1 (1998); C. Benoist, et
al., Nature, 394:227-8 (1998); Y. Tomer, et al., Endocr Rev,
14:107-20 (1993); K. Suzuki, et al., Proc Natl Acad Sci USA,
96:2285-90 (1999); J. Hiscott, et al., Ann NY Acad Sci, 1010:237-48
(2003); H. Hemmi, et al., J Exp Med, 199:1641-50 (2004)). To test
this possibility we infected FRTL-5 cells with influenza A virus, a
single strand RNA virus.
[0375] Treatment of FRTL-5 cells with influenza A for 24 hours
mimicked the ability of dsRNA transfection to overexpress TLR3 mRNA
as measured by Northern analysis (FIG. 3A) and increase IFN-.beta.
mRNA as measured by PCR (FIG. 3B). Of note, both dsRNA transfection
and influenza A infection also caused increases in IRF-1 and MHC
class II mRNA levels (FIG. 3A); the less impressive MHC II complex
induced by dsRNA transfection is consistent with our previous
results indicating a greater response of MHC I than II(K: Suzuki,
et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)). The data were
obtained at an MOI of 1 and were not duplicated by Coxsackie or
Herpes simplex infection at the same or 10-fold higher MOIs (data
not shown). Viral specificity remains to be further investigated as
will be discussed below.
[0376] The increase in MHC class II compliments the increase in
class I by dsRNA transfection already demonstrated (FIG. 2; K.
Suzuki, et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)). The
increase in IRF-1 is interesting since IRF-1 gene overexpression is
required for optimal TNF-.alpha.-increased VCAM-1 gene expression
and leukocyte adhesion as well as NF-.beta.B (N. M. Dagia, et al.,
J Immunol, 173:2041-9 (2004)) The present data would suggest that
IRF-1 gene overexpression results from the same pathogenic stimuli
that cause TLR3 overexpression. In the following experiments, we
demonstrate that phenylmethimazole (C10) and MMI, i.e. methimazole,
methimazole derivatives, or tautomeric cyclic thiones, inhibit
Stat1 phosphorylation which regulates IRF-1 gene expression (R.
Pine, et al., Embo J, 13:158-67 (1994)) and that this effect
reflects an action to inhibit the TRIF-couples IRF-3/IFN-.beta. not
the TRIF-coupled NF-6B signal pathway.
[0377] Phenylmethimazole (C-10), a tautomeric cyclic thione and
methimazole derivative, inhibits TLR3 signaling through the
IRF-3/ISRE/STAT pathway in thyrocytes
[0378] C10 and MMI inhibit TLR3 expression and signaling.
Methimazole (MMI) is used to treat autoimmune Graves' disease and
is effective, in part, because it inhibits thyroid hormone
formation (D. S. Cooper, N. Engl. J. Med., 311:1353-62 (1984)).
However, MMI contributes to long-term remission of
autoimmune/inflammatory diseases by functioning as a broadly active
immunomodulator. Thus, MMI has been used as an immunosuppressive in
treating psoriasis in humans (A. N. Elias, et al., Int. J
Dermatol., 34:280-3 (1995)) and in treating murine models of
systemic lupus, autoimmune blepharitis, autoimmune uveitis,
thyroiditis, and diabetes (L. D. Kohn, et al., U.S. Pat. No.
6,365,616, April:(2002); C. C. Chan, et al., J Immunol, 154:4830-5
(1995); T. F. Davies, et al., J Clin Invest, 73:397-404 (1984); P.
Wang, et al., J Leukoc Biol, 73:57-64 (2003)). It is a
transcriptional inhibitor of abnormally increased MHC Class I and
II gene expression in FRTL-5 cells and has been suggested to mimic
the effect of a Class I knockout in preventing autoimmune disease
(M. Saji, et al., J Clin Endocrinol Metab, 75:871-8 (1992); V.
Montani, et al., Endocrinology, 139:290-302 (1998); L. D. Kohn et
al., U.S. Pat. No. 6,365,616 (2002); E. Mozes, et al., Science,
261:91-3 (1993); D. S. Singer, et al., J Immunol, 153:873-80
(1994)). Phenylmethimazole (C10) is a derivative that is
50-100-fold more potent in suppressing MHC gene expression (L. D.
Kohn et al., U.S. Pat. No. 6,365,616 (2002)).
[0379] We evaluated the ability of C10 and MMI to inhibit TLR3
expression and signaling. C10 prevented the ability of dsRNA
transfection and incubation with IFN-.beta. to increase TLR3 RNA
levels in FRTL-5 cells, as measured by PCR (FIG. 4A). Additionally
it prevented the ability of both IFN-.beta. (FIG. 4B) and dsRNA
transfection (data not shown) to increase TLR3 by Northern analysis
and was significantly better than MMI in this respect, even at
10-fold lower concentrations (0.5 vs 5 mM). DMSO is the vehicle for
C10 because of the hydrophobicity of C10; it had no significant
effect on basal activity and was used as the control value in all
experiments described herein.
[0380] The C-10 and MMI reduced the ability of IFN-.beta. to
increase PKR and MHC class I RNA levels, albeit relatively less
than TLR3 (FIG. 4B). C10 slightly reduced the basal level of TLR 3
mRNA, without affecting control PKR or class I RNA levels (FIG. 4B,
lane 2 vs 1). The Northern data thus suggested C10, to a far
greater extent than MMI, could block pathogenic expression of the
TLR3 induced innate immune response in FRTL-5 thyrocytes. We
questioned the C10 mechanism of action.
[0381] C10, at 0.5 mM, inhibited the ability of poly (I:C) to
increase IFN-.beta. promoter activity (luciferase luminescence;
P<0.01) when incubated with FRTL-5 thyrocytes transfected with
pIFN-.beta.-luc constructs (FIG. 5 Top Left, Poly (I:C) vs
untreated (-)). Even at the concentrations used, which are maximal
for MMI (data not shown), the C-10 was significantly better than
MMI (P<0.05 or better) (FIG. 5 Top Left, Poly (I:C) treated, MMI
vs C10 and vs untreated (-)). Lipopolysaccharide (LPS) incubation,
as well as treatment with IL-1.beta., also increased IFN-.beta.
luciferase activity in FRTL-5 cells (FIG. 5 Top Left) and in both
cases 0.5 mM C-10 and 5 mM MMI significantly (P<0.05 or better)
inhibited the increase [FIG. 5 Top Left, LPS or IL-1.beta. plus
C-10 or MMI vs untreated (-)]. Again, C-10 was significantly better
than MMI (P<0.05 or better) (FIG. 5 Top Left), bringing values
to basal levels.
[0382] These data confirm that FRTL-5 thyrocytes have functional
IL-1 receptors (see also FIG. 1C). IL-1 receptors are reported to
activate IRF-3 and IFN-.beta. by a non TRIF coupling mechanism (D.
Devendra, et al., Clin Immunol, 111:225-33 (2004); L. Wen, et al.,
J Immunol, 172:3173-80 (2004); E. Cario, et al., Infect Immun,
68:7010-7 (2000); B. Beutler, Nature, 430:257-63 (2004); K. S.
Michelsen, et al., J Immunol, 173:5901-7 (2004); M. Muzio, et al.,
J Immunol, 164:5998-6004 (2000); S. E. Doyle, et al., J Immunol,
170:3565-71 (2003)). The predominant target of LPS is TLR4; we
could demonstrate TLR4 mRNA on FRTL-5 cells, but no ability of LPS
or poly (I:C) to increase TLR4 mRNA (data not shown). These data
would suggest that C10, and to a significantly lesser degree MMI,
can inhibit the increase IFN-.beta. luciferase activity independent
of the specific receptor activated (TLR3, TLR4, or IL-1) or the
coupling protein utilized (TRIF or non TRIF) (FIG. 5, Top Left).
These data suggested that a common denominator by which C10 might
act was downstream, i.e. it might inhibit IRF-3
transactivation.
[0383] We measured the ability of C10 to inhibit IRF-3
transactivation activity in FRTL-5 thyrocytes, using the IRF-3 cis
reporter system (FIG. 5, bottom). We, could show that incubation
with 0.5 mM C-10 significantly (P<0.05 or better) inhibited
IRF-3 transactivation by poly (I:C), LPS, or IL-1.beta. (FIG. 5,
Top Right). MMI was significantly less effective (data not
sown).
[0384] A key to activation of other IFN-inducible genes by the
autocrine/paracrine action of IFN-.beta. is its action to regulate
downstream genes with ISREs, in part by phosphorylation of STATS,
which are important activators of interferon-stimulated response
elements (ISRE) and interferon-.gamma.-activated sites (GAS). Using
an ISRE sequence coupled to luciferase as a reporter gene
(ISRE-Luc) we could show that C-10 was an effective inhibitor of
ISRE activation by poly (I:C), LPS, IL-1.beta., TNF-.alpha.,
IFN-.beta. and IFN-.gamma. (Table 2). Despite the similarity in
sequence between ISRE and NF-6B binding sites and despite the
ability of Poly (I:C) to activate NF-6B-luc in FRTL-5 cells, both
0.5 mM C10 or 5 mM MMI had a minimal effect on Poly (I:C)-increased
NF-6B-luciferase activity (Table 2). Additionally, they did not
have any significant effect on Poly (I:C)- or LPS-increased p65/p50
complex formation (FIG. 6A) TABLE-US-00003 TABLE 2
Phenylmethimazole (C10) inhibits the ability of Poly (I:C), LPS,
IL-1 .beta., TNF-.alpha., IFN-.beta., and IFN-.gamma. to activate
an ISRE [ISRE(TAGTTTCACTTTCCC).sub.5-Luc (SEQ ID NO: 1)] but not an
NF-.kappa.B [NF-.kappa.B (TGGGGACTTTCCGC).sub.5-Luc (SEQ ID NO: 2)]
reporter gene in FRTL-5 thyrocytes. Relative Luciferase Activity %
of Control (.+-. 15%) ISRE-Luc NF-.kappa.B Luc Ligand +DMSO +C10
+DMSO +C10 Poly (I:C) 300 300 300 LPS 250 250 250 IL-1.beta. 350
350 350 TNF-.alpha. 225 225 225 IFN-.beta., 150 150 150 IFN-.gamma.
180 180 180 None 100 100 100 100 *Values in bold and italics
decreased significantly (P < 0.05 or better)
[0385] As shown in Table 2, phenylmethimazole (C10) inhibits the
ability of Poly (I:C), LPS, IL-1.beta., TNF-.alpha., IFN-.beta.,
and IFN-.gamma. to activate an ISRE reporter gene in FRTL-5
thyrocytes. Cells were co-transfected with ISRE-Luc and pRLTk-Int
and then treated without (none) or with Poly I:C (100 .mu.g/ml),
LPS (100 ng/ml), IL-1.beta. (10 ng/ml)TNF-.alpha. (25 ng/ml),
IFN-.beta. (100 U/ml) or IFN-.gamma. (1000 U/ml) in the presence of
DMSO (-) or C10 for 6 hours. Data were obtained using the Dual
Luciferase Assay system. The effect on the ISRE element is not
duplicated by an NF-.kappa.B reporter plasmid despite the
similarity of the two elements: (TAGTTTCACTTTCCC).sub.5 (SEQ ID
NO:3) vs. (TGGGGACTTTCCGC).sub.5 (SEQ ID NO:4), respectively. Data
are representative of multiple experiments. C10 significantly
inhibits the action of Poly I:C, LPS, IL-1.beta., TNF-.alpha.,
IFN-.beta. or IFN-.gamma. to increase expression of genes
containing ISREs not NF-.kappa.B elements.
[0386] Additionally, C10 was a profound inhibitor of virus (FIG.
6B) or IFN-.beta.-stimulated (data not shown) Stat1 phosphorylation
without a change in Stat1 total protein (FIG. 6B). D in this
experiment was the vehicle (DMSO) control.
[0387] TLR3 Expression in Hashimoto's Disease: A prototype of Type
1 diabetes
[0388] TLR3 expression and regulation in humans can be very
different from that in rats or mice. To address this, we first
asked if TLR3 RNA was expressed in human thyroid tissue using
commercial tissue blots from Clontech. We detected TLR3 RNA
expression in thyroid tissue by comparison with the spleen positive
control; results were thus similar to our observations in mouse
tissues.
[0389] In order to confirm the presence and functionality of TLR3
in human thyrocytes, we evaluated TLR3 expression in cultured NPA
human thyrocytes. NPA thyrocytes are from a papillary carcinoma but
are known to retain functional properties of normal thyrocytes.
Transfection with dsRNA [Poly (I:C)], but not transfection by dsDNA
or incubation with Poly (I:C), was able to increase TLR3 mRNA
levels in Northern blots. The dsRNA, but not the dsDNA
transfection, could also increase IFN-.beta. mRNA levels, measured
as before with PCR. Additionally, as was the case for FRTL-5 cells
and dsRNA transfection, IFN-.beta. increased PKR mRNA levels as
well as TLR3 RNA levels. Finally, as was again the case for FRTL-5
cells, we could show that 0.5 mM C10 decreased the ability of dsRNA
transfection or IFN-.beta. to increase TLR3 mRNA levels.
[0390] A fundamental question posed by the sum of data thus far,
was whether TLR3 was overexpressed in autoimmune/inflammatory
disease in vivo not only human thyrocytes in culture. We evaluated
TLR3 protein levels in human thyroid tissues by
immunohistochemistry. Immunohistochemistry of thyroid tissues was
performed using TLR3 antibody (1:100). In normal thyroid and in
tissues from Graves' disease, no immunoreactive TLR3 was detected.
In chronic lymphocytic thyroiditis (Hashimoto's), TLR3 was detected
in epithelial cells (as indicated by brown deposit in cytoplasm) in
100% of patients tested (Table 3). The intensity of staining was
highest in metaplastic oxyphilic epithelium in the regions of
lympho-plasmacytic infiltration. TABLE-US-00004 TABLE 3 TLR3
protein is present in thyrocytes of 100% of patients examined with
Hashimoto's thyroiditis but not in thyrocytes from normal thyroids
or thyroids from patients with Graves' disease: there is coincident
expression of Type 1 IFN not PKR signaling. TLR3 Present/ Tissue
Number IFN-.beta. Present/Number PKR/Number Source patients Tested
patients Tested patients Tested Hashimoto's 21 of 21 20 of 21 10 of
21 Graves' 0 of 20 16 of 20 8 of 20 Normal 0 of 20 0 of 20 0 of 20
Bold Values represent statistically significant correlation P <
0.01.
[0391] TLR3 and IFN-.beta. are jointly upregulated in 95% of
thyroids from patients with Hashimoto's thyroiditis (Table 3),
whereas PKR is upregulated in less than 50% of Hashimoto's
thyroiditis patients (Table 3). Positive thyrocytes in these
experiments appear brown and the absence of brown staining in
lymphocytes in the IFN-.beta. analyses was striking relative to the
thyrocytes. The increase in TLR-3 signaled IRF-3/IFN-.beta. in the
Hashimoto's thyrocytes correlated with TLR3 overexpression in a
statistically significant manner by comparison to the TLR3 and PKR
association in Hashimoto's and when compared with the presence of
IRF-3/IFN-.beta. signaling in Graves' vs TLR3 expression, which was
zero.
[0392] The presence of increased IRF-3/IFN-.beta. signaling in
Graves' is consistent with the ability of dsDNA transfection and
overexpressed TSHR to induce Graves' (L. D Kohn et al., US.
Application Publication US2005/0036993 A1 Feb. 17, 2005). It is
equally consistent with the expression of TLR9 activity in the case
of Graves' since TLR9 recognizes dsDNA and also signals through
IRF-3/IFN-.beta..
[0393] The sum of these data are consistent with, but not limited
to, the interpretation that TLR3 can be overexpressed in nonimmune
cells and can produce an innate immune gene response that leads to
an adaptive immune cell (TH1) response. A critical signal system
involved is Type I IFN. Methimazole, methimazole derivatives, and
tautomeric cyclic thiones, exemplified by C10, can prevent this by
inhibiting predominantly the IRF-3/Type I IFN signal system
activated when dsRNA or viruses overexpress TLR3 signals.
[0394] Materials and Methods
[0395] Materials. Poly (I:C) [a synthetic dsRNA], endotoxin free E.
coli DNA, the mouse TRIF/TICAM-1, the mouse and human TLR3
expression vectors were purchased from (Invivogen, San Diego,
Calif.). TNF-.alpha., IFN-.beta., IFN-.gamma., and IL-162 were from
(Biosource International, Camarillo, Calif.). Insulin and
2-Aminopurine were from Sigma (St. Louis, Mo.). The antibodies used
in this study were anti-TLR3 (IMGENEX, San Diego, Calif.),
anti-IFN-.beta. (Chemicon International, Temecula, Calif.),
anti-Stat1PY701 (Cell Signaling Technologies, Beverley, Mass.),
anti-Stat1p84/p91 E-23 (Santa Cruz Biotechnology Inc., Santa Cruz,
Calif.), anti-PKR (Cell Signaling Technology, Beverly, Mass.), and
anti-phosphospecific ERK 1/2 (Biosource International, Camarillo,
Calif.). Vectastain Universal Quick kit (Vector Laboratories,
Burlingame, Calif.) antigen unmasking solution and DAB substrate
kit were used. C-10 was synthesized as described by Ricerca
(Cleveland, Ohio) (L. D. Kohn et al., U.S. Pat. No. 6,365,616
(2002)). C-10 was prepared as 200 mM stock solution in DMSO. MMI
was from Sigma. The source of all other materials was the same as
previously reported (K. Suzuki, et al., Proc Natl Acad Sci USA,
96:2285-90 (1999)).
[0396] Cells. The F1 subclone of FRTL-5 thyrocytes (Interthyr
Research Foundation, Baltimore, Md. [ATCC CRL 8305]) was grown in
Coon's modified Ham's F-12 medium supplemented with 5% calf serum,
2 mM glutamine and 1 mM nonessential amino acids, plus a
six-hormone mixture (6H medium), containing bovine TSH
(1.times.10.sup.-10 M), insulin (10 .mu.g/ml), cortisol (0.4
ng/ml), transferrin (5 .mu.g/ml), glycyl-L-histidyl-L-lysine
acetate (10 ng/ml), and somatostatin (10 ng/ml). HEK293H cells
(Invitrogen, Carlsbad, Calif.) were maintained in DMEM with 10%
fetal calf serum. CHO-K1 cells (ATCC CCL-61) were maintained in
Ham's F-12 medium with 10% fetal calf serum.
[0397] NPA-87 cells are a continuous line of human thyrocytes
derived from papillary carcinoma cells. They retain several
functional responses including TSH-increased cAMP signaling (J. Xu,
et al., J Clin Endocrinol Metab, 88:4990-6 (2003)). They were
kindly provided by Dr. Guy Julliard (University of California, Los
Angeles, Calif.) and grown in RPMI 1640 medium supplemented with 2
g/liter sodium bicarbonate, 0.14 mM nonessential amino acids, 1.4
mM sodium pyruvate, and 10% fetal bovine serum, pH 7.2.
[0398] RNA Isolation and Northern Analysis. RNA was prepared using
the RNeasy Mini Kit (Qiagen Inc., Valencia, Calif.) and the method
described by the manufacturer. For Northern, 15 to 20 .mu.g total
RNA were run on denatured agarose gels, capillary blotted on Nytran
membranes (Schleicher & Schuell, Keene, N.H.), UV cross-linked,
and subjected to hybridization. Probes were labeled with
[.alpha.-.sup.32P] dCTP using a Ladderman Labeling Kit (Takara,
Madison, Wis.). The probes for MHC Class I, ICAM-1, IRF-1, PKR and
GAPDH have been described (K. Suzuki, et al., Proc Natl Acad Sci
USA, 96:2285-90 (1999)). The probes for IFN-.beta. were obtained
using gene specific primers that have also been described (S.
Yokoyama, et al., Biochem Biophys Res Commun, 232:698-701 (1997)).
The probes for TLR3 were mouse or human whole cDNAs obtained from
the Invivogen expression vectors. The IP-1 0 probe was a partial
mouse IP-10 cDNA (469bp) prepared by RT-PCR from mouse macrophage
total RNA with the following primers: mIP-10 (5'):
5'-CCATCAGCACCATGAACCCAAGTCCTGCCG-3' (SEQ ID NO:5) and mIP-10 (3'):
5'-GGACGTCCTCCTCATCGTCGACTACACTGG-3'. (SEQ ID NO:6) Membranes were
hybridized and washed as described previously (K. Suzuki, et al.,
Proc Natl Acad Sci USA, 96:2285-90 (1999)).
[0399] RT-PCR. DNA was removed from total RNA using the DNA-free
Kit (Ambion) according to the manufacturer's instructions. One
.mu.g of RNA was used to synthesize cDNA using the Advantage
RT-for-PCR Kit (BD Biosciences) according to the manufacturer's
protocol. Fifty ng of cDNA was subsequently used for PCR of TLR-3,
and .beta.-Actin; 250 ng of cDNA was used for PCR of IFN-.beta..
The primers used for amplification of human TLR-3 and .beta.-Actin
have been previously described (K. U. Saikh, et al., Clin Diagn Lab
Immunol, 10:1065-73 (2003)). The gene-specific primers for rat
IFN-.beta. and GAPDH and PCR conditions have been described (S.
Yokoyama, et al., Biochem Biophys Res Commun, 232:698-701 (1997);
K. Suzuki, et al., Proc Natl Acad Sci USA, 96:2285-90 (1999)) Human
IFN-.beta. primers are as follows: (5' primer)
5'-TGGCAATTGAATGGGAGGCTTG-3' (SEQ ID NO:7) and (3' primer)
5'-TCCTTGGCCTTCAGGTAATGCAGA-3'. (SEQ ID NO:8) PCR reaction
conditions for humanTLR-3 and .beta.-Actin are as follows:
94.degree. C. for 5 min. followed by 35 cycles of 94.degree. C. for
30 sec., 55.degree. C. for 30 sec., 72.degree. C. for 1 min., and a
final cycle of 72.degree. C. for 7 min. Human IFN-.beta. PCR
reaction conditions are: 94.degree. C. for 3 min., followed by 35
cycles of 94.degree. C. for 10 sec., 58.degree. C. for 30 sec.,
72.degree. C. for 1 min., and a final cycle of 72.degree. C. for 10
min.
[0400] Plasmids for Reporter Gene Assays. Human IRF-3 was amplified
from human cDNA and cloned into pCR 2.1 by the TOPO/TA (Invitrogen,
Carlsbad, Calif.) cloning method, and then sequenced. IRF-3 was
then excised by EcoRI digestion and subcloned into pCMV-BD
(Stratagene, La Jolla, Calif.) for use in transactivation assays.
To construct IFN-.beta.-luc the human IFN-.beta. promoter sequence
was amplified from human genomic DNA (Clontech, Palo Alto, Calif.))
using Ex Taq.TM. Polymerase (Takara, Madison, Wis.). The PCR
fragment contained human IFN-.beta. promoter sequence from -125 to
+34 relative to the transcription start site (+1) and incorporated
KpnI and XhoI restriction sites at the 5' and 3' ends,
respectively. The primers were as follows: hIFN-.beta. (-125) KpnI
(5'-CAGGGTACCGAGTTTTAGAAACTACTAAAATG-3') (SEQ ID NO:9) and
hIFN-.beta. (+34) XhoI (5'-GTACTCGAGCAAAGGCTTCGAAAGG-3'). (SEQ ID
NO: 10) The fragment was digested with KpnI and XhoI then ligated
into a similarly digested pGL3 Basic (Promega, Madison, Wis.)
vector. The human MyD88 wild and dominant negative expression
vectors were kindly donated by Dr. P. E. Auron. pFR-luc
(5.times.Gal4 DNA binding domains and minimal TATA box), ISRE-Luc,
NF-.kappa.B-luc and the Elk1 trans-Reporting System were purchased
from Stratagene. pRL TK-Int was purchased from Promega.
[0401] Transient Expression Analysis. A DEAE procedure was used to
transfect promoter-luciferase gene constructs and expression
plasmids into FRTL-5 cells. Briefly, FRTL-5 cells were grown in
24-well plates to about 70% confluence, washed with 0.5 ml of
serum-free culture medium (6H0 medium), then exposed to 125 .mu.l
of premade plasmid-DEAE mixture per well for 15 min at room
temperature. The plasmid-DEAE mixture was prepared by incubating
100 ng of plasmid DNA, unless otherwise noted in individual
experiments, with 3.125 .mu.l of DEAE-Dextran (10 mg/ml) (Promega,
Madison Wis.). FRTL-5 cells were incubated with this mixture for 2
hr at 37.degree. C. in a CO.sub.2 incubator, before 2 ml of 6H5
medium was added. CHO-K1 and FRTL-5 cells for transfecting
expression vectors were subjected to the lipofection method. Cells
were grown in 10 cm dishes to about 80% confluence and then exposed
to the plasmid-Lipofectamine2000 mixture as described by the
manufacturer (Invitrogen, Calif.).
[0402] Immunoprecipitation and Western Blot Analysis. Whole cell
lysates were prepared in lysis buffer (10 mM Tris-HCl (pH 7.5), 150
mM NaCl, 1% NP-40) containing protease inhibitors. Nuclear extracts
were prepared using the NE-PER extraction reagents with protease
inhibitors stated below (Pierce Chemical Co., Rockford, Ill.).
Twenty-five (25) .mu.g of either whole cell lysate or nuclear
extract was resolved on denaturing gels using the Nu-PAGE System
(Invitrogen, Carlsbad, Calif.). All proteins were transferred to
nitrocellulose membranes and subsequent antibody binding was
revealed using ECL Plus reagents (Amersham Pharmacia Biotech,
Piscataway, N.J.). For immunoprecipitation, lysates were incubated
with anti-TLR3 antibody (Imgenex, San Diego, Calif.) (10 .mu.g/ml)
at 4.degree. C. for 6 hours, followed by adsorption to protein
G-Sepharose beads (Amersham Pharmacia Biotech). Precipitates were
washed and resolved as stated above. CHO-K1 cells were transiently
transfected with 20 .mu.g of expression vector.
[0403] Nuclear Extracts and DNA Mobility Shift Assays (EMSA).
FRTL-5 cells were harvested by scraping into PBS (pH 7.4) and
washing twice with PBS. Nuclear extracts were then prepared using
NE-PER extraction reagents (Pierce Chemical Co., Rockford, Ill.).
The protocol was as per manufacturer instructions and involved the
presence of protease inhibitor cocktail III (AEBSF hydrochloride,
aprotinin, bestatin, E-64 protease inhibitor, leupeptin, pepstatin)
(Calbiochem). Oligonucleotides (NF-.kappa.B sense 5'-AGT TGA GGG
GAC TTT CCC AGG C-3' (SEQ ID NO:11); NF-.kappa.B anti sense 5'-GCC
TGG GAA AGT CCC CTC AAC T-3' (SEQ ID NO: 12)) were annealed and
labeled with [.gamma..sup.32P]-ATP using T4 polynucleotide kinase.
EMSA was performed using 3 .mu.g of nuclear extracts. In
competition studies 50-fold molar excess of unlabeled
oligonucleotide or 2 .mu.g of antibody was added to the mixtures. A
.sup.32P-labeled oligonucleotide probe (100,000 cpm) was added and
the incubation was continued for 20 min at room temperature.
Mixtures were analyzed on 5% native polyacrylamide gels and
autoradiographed.
[0404] Virus Infections. Influenza A A/Victoria/3/75 was obtained
from Diagnostic Hybrids Inc. (Athens, Ohio). FRTL-5 cells were
grown in 6H growth media until 60% confluence and then maintained
in 5H (-TSH) media for 7 days before infections. Ten (10) cm dishes
were 95-100% % confluent at the time of infection. Seven (7)
million viral particles were added to each 10 cm dish of cells in
5H media. Fresh 5H media was added 24 hours prior to infection.
Cells were incubated with virus for 24 hours at which point C10 was
added directly to the media and incubated for 6 hours before cells
were harvested.
[0405] Patients and Tissue Samples. Tissue specimens were obtained
from 30 individuals treated at the Ukrainian Center of Endocrine
Surgery in Kiev. Thyroid lesions were classified as Hashimoto's
thyroiditis in 21 cases, hyperplasia associated with Graves'
disease in 20 cases. Normal thyroid tissue was from the
contralteral glands of 20 patients undergoing thyroid surgery for
adenomas or tumors. After fixation in 10% formalin and embedding in
paraffin, 5-.mu.m-thick serial sections were made for each
specimen. The 5-.mu.m sections were stained with hematoxylin and
eosin.
[0406] Immunohistochemical Staining. Sections were dewaxed, soaked
in alcohol and after microwave treatment in antigen unmasking
solution for 10 min incubated in 3% hydrogen peroxide for 15 min to
inactivate endogenous peroxidase activity. Then sections were
incubated at 4.degree. C. overnight with anti-TLR3 antibody (1:100
dilution). Immunostaining was performed by use of the Vectastain
Universal Quick kit according to the manufactured instruction.
Peroxidase staining was revealed in 3,3-diaminobenzidine. Negative
control was applied by omission of antiserum.
Example 2
[0407] Phenylmethimazole (C10) protects mice from TLR3 mediated
Type 1 diabetes and improves survival.
[0408] In Example 1 we show that TLR3 and IFN-.beta. protein are
expressed in situ in thyrocytes from patients with Hashimoto's
thyroiditis which are surrounded by immune cells but not in
thyrocytes from normal individuals or Graves' autoimmune
hyperthyroidism, a novel finding never previously demonstrated. The
results from human thyrocytes in culture indicate that TLR3
activation and functional increases in signaling can occur in human
as well as rat thyrocytes in culture and this can occur in the
absence of lymphocytes or a lymphocyte-produced IFN, since
lymphocytes primarily produce type II interferon (T. Taniguchi, et
al., Annu Rev Immunol, 19:623-55 (2001)). Consistent with this, the
immunocytochemistry study shows that the intense brown stain for
IFN-.beta. is localized in the thyrocytes and is not significant in
the immune cells. The results thus raise the possibility that
thyrocytes are affected by a primary insult, which activates the
TLR3 system to produce an innate immune response mimicking that of
a dendritic cell. The resultant cytokine and co-stimulatory
molecule changes in the thyrocyte may then contribute to attracting
lymphocytes to the gland, since unlike dendritic cells, the
thyrocytes cannot migrate to the lymphoid organ.
[0409] The results herein are startlingly similar to studies of
another disease with TLR3 involvement and overexpression, a role
for pathogen induction and dsRNA, involvement of a Type 1 IFN as an
apparent autocrine/paracrine factor, immune cell infiltrates, and
cell specific destruction causing hypofunction, i. e., insulinitis
and type 1 diabetes (D. Devendra, et al., Clin Immunol, 111:225-33
(2004); L. Wen, et al., J Immunol, 172:3173-80 (2004)). Wen, et al.
(L. Wen, et al., J Immunol, 172:3173-80 (2004)) show that dsRNA
could induce insulinitis and type 1 diabetes in animals, consistent
with the known animal model wherein Coxsackie's virus induces Type
1 diabetes in NOD mice. Devendra and Eisenbarth (D. Devendra, et
al., Clin Immunol, 111:225-33 (2004)) emphasize human relevance and
note that enteroviruses have been the focus of many research
studies as a potential agent in the pathogenesis of type-1
diabetes. They note that the mechanism of viral infection leading
to .beta. cell destruction involves IFN-.alpha. [a Type I IFN like
IFN.beta.]. They hypothesize that activation of TLR by double
stranded RNA or Poly-IC (a viral mimic), through induction of
IFN-.alpha., may activate or accelerate immune-mediated .beta. cell
destruction. They note that numerous clinical case reports have
implicated IFN-.alpha. therapy with autoimmune diseases
[thyroiditis, in particular (see below)] and that elevated serum
IFN-.alpha. levels have been associated with Type 1 diabetes as
well as thyroid autoimmune/inflammatory disease (M. F. Prummel, et
al., Thyroid, 13:547-51 (2003)). Taken together with data in the
present report, we considered the possibility of an important
mechanistic association relevant to disease pathogenesis.
Hashimoto's and Type 1 diabetes may have immune cell infiltrates
and destructive thyrocyte or .beta.-cell changes because of a
primary insult to the specific tissue cell that activates TLR3 and
an innate immune response in the tissue cells; this may be an early
event in the pathogenic mechanism (D. Devendra, et al., Clin
Immunol, 111:225-33 (2004); L. Wen, et al., J Immunol, 172:3173-80
(2004); B. Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et
al., J Immunol, 173:5901-7 (2004)).
[0410] Devendra and Eisenbarth suggest (D. Devendra, et al., Clin
Immunol, 111:225-33 (2004)) that therapeutic agents targeting
IFN-.alpha. [over production or activity] may potentially be
beneficial in the prevention of type 1 diabetes and autoimmunity.
Example 1 looked at whether TLR3 overexpression/signaling leading
to increased Type I IFN levels might be sensitive to the
immunomodulatory actions of methimazole (MMI) or its more potent
derivative, phenylmethimazole (C10) (M. Saji, et al., J Clin
Endocrinol Metab, 75:871-8 (1992); V. Montani, et al.,
Endocrinology, 139:290-302 (1998); L. D. Kohn et al., U.S. Pat. No.
6,365,616 (2002); E. Mozes, et al., Science, 261:91-3 (1993); D. S.
Singer, et al., J Immunol, 153:873-80 (1994)) and how the data
indicate that C10, to a significantly greater extent than MMI,
blocks overexpression of TLR/TLR signaling by inhibition of the
TLR3 regulated IRF-3/IFN-.beta./ISRE/STAT signal path not the NF-6B
signal path. It acts more broadly than just inhibition of IRF-3
transactivation and, therefore, may inhibit activation of a broad
range of ISRE sequences on other genes. In this respect, it is
notable that, in addition to an NF-6B site, IRF-1 has a GAS, which
binds Stat1. It is reasonable to suggest that the ability of C10 to
block IRF-1 gene expression, both herein and in our studies of C10
inhibition of TNF-.A-inverted.-induced VCAM-1 and leukocyte
adhesion, is related to its action on components of the TLR3
regulated IRF-3/IFN-.beta./ISRE/STAT signal path. In short, C10 may
be an example of an agent that meets the new therapeutic paradigm
requested by Davendra and Eisenbath in their review (D. Devendra,
et al., Clin Immunol, 111:225-33 (2004)).
[0411] The NOD mouse is a prototypical example of type 1 diabetes.
In experiments in a "nonclean" animal facility, C10 was effective
in retarding the development of glucosuria in the NOD mice (Table
4). When this was repeated in a "clean" laboratory, no effect of
C10 was noted. What was noted, however, was the onset of glucosuria
in the mice was much earlier in the animals maintained in
"nonclean" as opposed to "clean" mouse facilities (Table 4).
Enteroviruses are associated with expression of Type 1 diabetes and
there is a well-described Coxsackie's virus mouse model of type 1
diabetes. We thus hypothesized that our results might be explained
by viral induction of disease in the nonclean facility; and we
tested whether C10 was effective in the Coxsackie's virus induced
NOD mouse model of diabetes. In experiments to test this hypothesis
(Table 4), C10 was effective in retarding glucosuria and death in
this model. We thus can conclude that C10, as a representative lead
compound of the MMI derivative, tautomeric cyclic thione family,
can reverse a TLR3/TLR3 signaling disease in vivo and very likely
can prevent it if disease expression is induced by environmental
pathogens as in the Coxsackie model of diabetes in NOD mice. The
MMI, MMI derivative, tautomeric cyclic thione family family of
drugs are likely to prevent both the initial insult and repeated
insults during the lag phase. Further intermittent therapy may be
useful to extend the life of the lag phase, if not to totally
prevent disease. This would be applicable to Hashimoto's autoimmune
thyroiditis, as well as Type 1 diabetes in humans, since the NOD
model is broadly used for evaluating mechanisms and therapies
applicable to inducing an autoimmune-inflammatory human disease and
has been shown to be associated with iodide induced thyroiditis as
well as Type I diabetes. TABLE-US-00005 TABLE 4 C10 protects NOD
mice from infection-induced Type 1 Diabetes Week 1 Week 4 Week 8
Week 12 Week 16 Week 20 Glucosuria Glucosuria Glucosuria Glucosuria
Glucosuria Glucosuria Rx % of Total % of Total % of Total % of
Total % of Total % of Total Faci None 0 0 15 100 NA NA Dirt C10 0 0
0 0 NA NA Dirt None 0 0 0 10 50 100 Clea C10 0 0 0 20 40 100 Clea
None + virus 10 70 100 NA NA NA Dirt C10 + virus 0 0 20 30 NA NA
Dirt NA: Not Assayed.
[0412] Table 4 shows the ability of C10 to attenuate Coxsackie
virus-induced Glucosuria in NOD mice. Mice were housed in germ free
facilities, termed clean, or normal facilities where viral
infections can occur, termed dirty. Animals showing urine Tes-Tape
positivity greater than 1+ are considered positive and to have
diabetes (L. S. Wicker, et al., Diabetes, 35:855-60 (1986)). In
experiments in a "dirty" animal facility, C10 was effective in
retarding the development of glucosuria in the NOD mice. When this
was repeated in a "clean" or germ free laboratory, no effect of C10
was noted. What was noted, however, was the onset of glucosuria in
the mice was much earlier in the animals maintained in "dirty" as
opposed to "clean" mouse facilities. Further, in experiments with 8
mice in each group, even in a dirty facility, the injection of CVB4
Edwards Coxsackie virus advanced the expression of glucosuria (last
two rows). These results suggest C10 inhibits environmental or
virus induced expression of Type 1 diabetes in genetically
susceptible NOD mice.
[0413] In animals with diabetes, glucosuria was confirmed by
measuring blood levels, viral titers in the pancreas were
determined to be positive, and insulinitis 2+ to 4+ was observed
microscopically in diabetic but not C10 treated animals.
[0414] Materials and Methods
[0415] Induction of Diabetes and treatment with drugs. NOD/Lt
female mice were from the Jackson Laboratory (Bar Harbor, Me.). All
experiments were carried out in accordance with "Guide for Care and
Use of Laboratory Animals" (NIH Publication No. 85-23, revised
1985). Mice were injected with 200 .mu.l PBS or 5.times.10.sup.5
PFU of the CVB4 Edwards Coxsackie virus strain ip (D. V. Serreze,
et al., J Virol, 79:1045-52 (2005)). Mice were treated daily with
i/p injections of C-10, MMI, 2.5% DMSO (C10 carrier control), or
PBS (MMI carrier control). After injections, blood and urinary
glucose levels were monitored weekly using Chemstrips (Boehringer
Mannheim). Consecutive values of >240 mg/dl on two occasions
>24 h apart were considered diagnostic of diabetes. Experiments
used 8 mice/group in up to 3 experiments.
[0416] Assessment of viral titer. Pancreases from euthanized mice
were weighed, placed in PBS, minced, sonicated, and subjected to 3
freeze-thaw cycles followed by a low-speed centrifugation (D. V.
Serreze, et al., J Virol, 79:1045-52 (2005)) to isolate islets for
analyses as above. Serial dilutions of the cleared lysates were
made in PBS and 200 .mu.l aliquots added to 35 mm wells of
confluent BSC40 cells (American Type Culture Collection). After
overlaying with 1% methylcellulose medium and incubation for 72 h
at 37.degree. C., the overlay was removed and monolayers fixed with
methanol-oxaloacetate, then stained with crystal violet. Plaques
were counted and titers calculated as follows: number of
plaques/volume of inoculate)/dilution factor.
[0417] Assessment of insulinitis. Pancreases were fixed in Bouin's
solution and sectioned at three nonoverlapping levels (D. V.
Serreze, et al., J Virol, 79:1045-52 (2005)). Granulated 13 cells
were stained with aldehyde fuchsin and leukocytes stained with a
hematoxylin-and-eosin counterstain. Islets (at least 20 per mouse)
were scored as: 0, no lesions; 1, pen-insular leukocytic aggregates
and periductal infiltrates; 2, <25% islet destruction; 3,
>25% islet destruction; and 4, complete islet destruction. An
insulitis score for each mouse was obtained by dividing the total
score for each pancreas by the number of islets examined. Data were
determined as mean insulitis scores i standard errors of the mean
for the experimental groups.
Example 3:
[0418] Phenyl Methimazole protects mice from LPS-induced endotoxic
shock mediated by TLR4 signals and improves survival
[0419] The LPS that causes endotoxic shock binds to TLR-4 receptors
on nonimmune cells, monocytes, macrophages, and dendritic cells,
then activates two signal pathways, (S. Sato, et al., Int Immunol,
14:783-91 (2002)), MyD88-dependent (M. Yamamoto, et al., J Immunol,
169:6668-72 (2002); T. Ogawa, et al., Int Immunol, 14:1325-32
(2002); K. Ruckdeschel, et al., J Immunol, 168:4601-11 (2002)) and
MyD88-independent (M. Yamamoto, et al., Nature, 430:218-22 (2004))
Both pathways contribute to the fatal consequences of the syndrome.
The MyD88-dependent pathway activate the NF-.kappa.B signal and MAP
Kinase signal systems. After phosphorylation and degradation of
I.kappa.B and after the release of the p50 and p65 subunits from
I.kappa.B, p50 and p60 enter the nucleus to interact with a
multiplicity of gene promoters, causing the synthesis and secretion
of proinflammatory cytokines TNF-.alpha., IL-1, IL-6, and IL12, as
well as the synthesis of the adhesion molecules ICAM-1 and VCAM-1,
cytokines such as IFN-.gamma., and chemokines such as MCP-1 (S.
Uematsu, et al., J Immunol, 168:5811-6 (2002); K. A. Ryan, et al.,
Infect Immun, 72:2123-30 (2004)). These gene products are only some
of the mediators that contribute to the inflammatory syndrome in
all organs, to the acute systemic failure of all organs, and to the
hypotension, hypothermia, and shock. Additionally, the MyD88
independent pathway activates the interferon regulatory factor
(IRF) gene promoter, IRF-3, which causes the up-regulation,
synthesis and secretion of INF-.beta., the activation of Stat1, the
activation of a multiplicity of genes with ISREs (Interferon
sensitive response elements), and increases in the expression of
IRF-1 and the chemokine IP-10 (V. Toshchakov, et al., J Endotoxin
Res, 9:169-75 (2003); K. Hoshino, et al., Int Immunol, 14:1225-31
(2002); T. Kawai, et al., J Immunol, 167:5887-94 (2001); K. A.
Fitzgerald, et al., Nat Immunol, 4:491-6 (2003); K. Hoebe, et al.,
Nature, 424:743-8 (2003); D. D. Bannerman, et al., J Biol Chem,
276:14924-14932 (2001)). Thus, both TLR4 and TLR4 adaptor
molecules, with their respective signals, are involved in the toxic
shock syndrome and the associated cellular inflammatory
infiltration at the organ levels.
[0420] Methimazole (MMI) has been largely used for the treatment of
Graves' disease as well as in lupus eritematosus systemic (D. S.
Singer, et al., J Immunol, 153:873-80 (1994); E. Mozes, et al., Isr
J Med Sci, 32:19-21 (1996)), spontaneous autoimmune disease (E.
Mozes, et al., J Clin Immunol, 18:106-13 (1998)) and periocular
inflammation in mice with experimental systemic lupus erythematosus
(C. C. Chan, et al., J Immunol, 154:4830-5 (1995)). The
anti-inflammatory property of MMI has been attributed to
anti-oxidant and immunomodulatory effects including effects on
IFN-.gamma. signaling (L. D. Kohn, et al., U.S. Pat. No. 6,365,616
(2002)). A more potent methimazole derivative in the family of
tautomeric cyclic thiones, phenylmethimazole (C10 or pMMI) was
developed based on its ability to suppress MHC gene expression (L.
D. Kohn et al., U.S. Pat. No. 6,365,616 (2002)) but has now been
shown to inhibit transcription of TNF-.alpha.-increased venular
cell adhesion molecule-1 (VCAM-1) on human aortic endothelial cells
(HAEC) and human umbilical venous endothelial cells (HUVEC)(N. M.
Dagia, et al., J Immunol, 173:2041-9 (2004)). It was shown that C10
acts by inhibiting of TNF-.alpha.-induced overexpression of
interferon regulatory factor 1 (IRF-1) gene not by inhibiting
TNF-.alpha. activation of NF-.kappa.B promoter element on the
VCAM-1 promoter (N. M. Dagia, et al., J Immunol, 173:2041-9
(2004)). IRF-1 binds to an element closer to the transcriptional
start site on the VCAM-1 promoter than the NF-.kappa.B elements and
is required for optimal TNF-.alpha. activation of the VCAM-1
promoter (N. M. Dagia, et al., _i J Immunol, 173:2041-9
(2004)).
[0421] Additionally, phenylmethimazole (C10) but not Methimazole
(MMI) has been shown to suppress the inflammatory response and
improve survival in DSS induced colitis by its down regulatory
effects on TLR4 overexpression in intestinal epithelial cells and
by its effects to decrease pathologically expressed TLR4 signals
including TNF-.alpha., IL-1, IL-6, interferon protein-10 (IP-10),
and VCAM-1 gene transcription (L. D. Kohn, et al., Research Ohio,
In press (2005)). In the following studies we focused on the
ability of phenylmethimazole (C10 or pMMI) to reverse the
pathologic signaling of the LPS-induced TLR4 mediated toxic shock
syndrome in a rodent and a horse model of endotoxic shock.
[0422] In studies of C57BL/6J mice injected with 20 mg/kg LPS, the
mice developed a toxic shock syndrome (hypotension, hypothermia,
collapse) between 6 and 12 hours post injection and were dead by 12
to 36 hours (Table 5A). Phenylmethimazole (C10 or pMMI) protected
the mice from death after LPS injection in 100% of animals examined
(Table 5A) in this experiment and in 3 separate replicate
experiments. This protection was due to C10 (PMMI) and not to the
solvent used for C10, DMSO (Table 5A). When clinical symptoms were
checked 12 hours after LPS injection, we observed that mice treated
with pMMI or C10 showed mild symptoms, i.e. mild decreases of body
temperature, but maintained normal feeding and drinking habits, as
well as mobility (Table 5B). In stark contrast, all other mice
developed profound hypothermia, hypotension, and shock (Table 5B).
They were depressed, hypothermic, and stopped feeding and drinking
(Table 5B). Moreover, all mice that developed severe shock died
within 36 hours (Table 5A and 5B)).
[0423] Table 5. C10 dramatically increases viability and signs of
shock in mice challenged with LPS. (A) C57BL/6J mice injected with
20 mg/kg LPS develop symptoms of shock within 12 hours and die
within 36 hours. 100% of C57BL/6J mice injected intra-peritoneally
(i/p) with C10 (1 mg/kg) 30 minutes before injection with LPS
survive at 36 hours, whereas all mice treated with methimazole
(MMI), which is less effective than CO (L. D. Kohn, et al., U.S.
Pat. No. 6,365,616 (2002)), or prednisolone, and flunixin of
meglumine, which are currently in use clinically to treat LPS shock
in humans and animals, respectively, die. The mice treated with C10
survived for as long as they were observed (4 weeks). (B)
Additionally, mice treated with C10 had only a slight decrease in
body temperature 12 hrs after LPS and no signs of shock. (C) C10
administered in daily doses of 0.1 or 1 mg/kg 12 hours after
challenge with LPS also results in 100% survival compared to 0%
survival for control mice. TABLE-US-00006 TABLE 5 C10 dramatically
increases viability and signs of shock in mice challenged with LPS.
A. Number of surviving mice in each group of a representative
experiment Treatment 6 hrs 12 hrs 18 hrs 36 hrs 1 week None 8 8 8 8
8 LPS 8 8 4 0 0 LPS + DMSO 8 8 3 0 0 LPS + C10 8 8 LPS + MMI 8 8 6
0 0 LPS + prednisolone 8 8 3 0 0 LPS + flunixin of 8 8 4 0 0
meglumine Bold Italicized Values reveal statistically significant
improvement in survival, P < 0.01) Experiment replicated three
times. B. Signs of shock measured at 12 hours in a representative
experiment % of Treatment 12 hrs Animals None None 100 LPS ++++ 100
LPS + DMSO ++++ 100 LPS + C10 + 100 LPS + MMI +++ 100 LPS +
prednisolone ++++ 100 LPS + flunixin of meglumine ++++ 100 Bold
Italicized Values reveal statistically significant improvement in
parameters of shock, P < 0.01) Experiment replicated three
times. Shock was evaluated by such signs as immobility,
prostration, hypothermia, dyspnea, etc. as noted below. C. A.
Number of surviving mice in each group of a representative
experiment wherein mice were challenged with LPS first then treated
with C10 after 12 hours at which time shock had appeared Treatment
18 hrs 36 hrs 1 week None 8 8 8 LPS 4 0 0 LPS + DMSO 2 0 0 LPS +
C10 LPS + MMI 4 0 0 LPS + prednisolone 1 0 0 LPS + flunixin of 0 0
0 meglumine Bold Italicized Values reveal statistically significant
improvemed survival, P < 0.01)
[0424] Even when we compared the effects of pMMI (C10) with
Methimazole (MMI), Predsnisolone (PSL), and Flunixin of Meglumine
(FM), we observed that only pMMI (C10) protected against shock
(Table 5B). Today, prednisolone is commonly used as therapy in
humans, Flunixin of Meglumine is used as treatment in animals. Mice
injected with LPS and treated with drugs other than C10 (PMMI)
showed signs of shock at 12 hours and were dead within 36 hours
post LPS injection. (Table 5A and 5B), a novel result with
important clinical implications.
[0425] In these experiments C10 was administered 30 min before LPS
injection at 1 mg/kg. C10, 0.1 to 1 mg/kg administered 30 min to 12
hours after lethal LPS injection, also survived in 100% of cases
(Table 5C). Some mild signs of shock such as hypothermia and slight
hypotension did develop in these mice, depending on the treatment
time post LPS injection and the C10 dose, 0.1 to 1 mg/kg.
Nevertheless, taken together, these results show that C10 can both
protect from endotoxic shock and death in LPS induced endotoxic
shock in mice and can reverse the toxic shock syndrome post LPS
treatment in a dose-dependent manner despite the onset of toxic
shock symptoms and signs.
[0426] IRF-1, MCP-1, and IP-10 as well as downstream genes such as
pro-inflammatory cytokine genes, COX genes, and INOS are altered by
LPS-induced endotoxic shock in mice and reversed to normal levels
by C10 (PMMI) in association with successful therapy.
[0427] Whereas the interferon inducible genes, IRF-1 and IP-10, are
the main reported inducible genes after LPS activation of the MyD88
independent, IRF-3/IFN-.beta. pathway, MCP-1 is a gene activated
primarily by the MyD88-dependent, NF-.kappa.B-linked pathway. Given
the action of C10 to block the IRF-3, IFN-.beta., Stat1, ISRE,
IRF-1 pathway, but not the NF-.kappa.B path (N. Harii, et al., Mol
Endocrinol, 19:1231-50 (2005); (N. M. Dagia, et al., J Immunol,
173:2041-9 (2004)) and above, we anticipated C10 would only inhibit
IRF-1 and IP-10 and not MCP-1 in vivo. As illustrated, however, the
over-expression of all three of these genes was suppressed by C10
(PMMI) to normal levels in most organs (FIG. 7). Thus,
LPS-treatment profoundly increased IRF-1 RNA levels in most organs,
albeit less in liver, and C10 (PMMI) reverted mRNA levels to those
in normal tissues under normal conditions. IP-10 gene expression
followed the IRF-1 pattern in all organs, except in liver where
IP-10 was expressed more than IRF-1. Similarly, the MCP-1 pattern
with LPS and LPS plus C10 (pMMI) replicated the profound ability of
this agent to decrease RNA increases induced by LPS activation of
the NF-.kappa.B pathway. In short, C10 (pMMI) was an effective
suppressor of LPS-increased mRNA levels of genes reported to be
important in both MyD88-independent and dependent pathways. Thus,
despite the in vitro evidence for primary pathway selectivity,
pathologic expression of genes downstream of both the TLR4-mediated
NF-.kappa.B as well as the IRF-3/IFN-.beta. signal paths were
suppressed. It is suggested in the literature that the NF-.kappa.B
activation of the MCP-1 can be the result of a delayed signal
secondary to IFN-.beta. activity. Also, it is possible that there
is pathway cross-over in vivo, in part because of mixed cell
populations, i.e. the presence of vascular endothelial cells in
every tissue. In sum, in vivo, these data thus suggested that C10
inhibited expression of genes in the IRF-3/IFN-.beta.-inducible
pathway and even possibly secondary IFN-.beta. effects on the
NF-.kappa.B pathway in vivo.
[0428] In order to more definitively determine if LPS-induced
IFN-.beta. signaling and LPS-induced increases in IRF-1 and IP-10
in vivo might be attenuated by an effect of C10 treatment on Stat1
activation, protein phosphorylation levels of Stat1 in whole tissue
lysates were examined in mice from Table 5. Both kidney and lung
tissues displayed detectable levels of activated Stat1 protein
measured using a specific antibody to phosphorylated phenylalanine
701 in mice treated with LPS plus control solvent (DMSO) and not
protected from shock (FIG. 8, lanes 2 and 5 respectively) by
comparison to controls who were never exposed to exogenous LPS
injections (FIG. 8, Lanes 1 and 4). These levels were reduced to
basal in mice, which were protected from LPS induced shock by
treatment with C10 (FIG. 8, lanes 3 and 6, kidney and lung,
respectively). In contrast neither LPS nor C10 had any effect on
total Stat1 in these tissues (FIG. 8, bottom blots). These data
establish that C10 inhibits Stat1 as well as IRF-1 gene expression
in vivo in toxic shock. Based on literature studies described in
immune cells and results we have described in nonimmune cells
(FIGS. 4-6; Tables 2, 3), it is reasonable to state that C10 blocks
Stat1/IRF-1 signals in vivo as well as in vitro, this is important
in the therapy of toxic shock where these genes are not only
involved but critical to disease expression. C10 therapy is thus
important in reducing pathologic changes in multiple tissues whose
organ failure is known to contribute to the signs and symptoms of
toxic shock.
[0429] The pro-inflammatory cytokines TNF-.alpha., IL-1.beta.,
IL-6, IL-12 and IFN-.gamma. are reported to be synthesized and
secreted by the activation of the LPS-TLR-4-MyD88 dependent pathway
through NF-.kappa.B gene activation. These pro-inflammatory
cytokine genes, as determined by histochemistry in multiple tissues
from the animals in Table 5, were strongly increased by inducing
endotoxic shock with LPS at 24 hours. Induction was suppressed,
however, by C10 (PMMI) treatment. This was evidenced for IL-6 and
TNF-.alpha. in all tissues examined by Northern analyses (FIG. 9).
In the case of IFN-.gamma., this phenomenon was true in most
tissues examined (FIG. 9). These results were additionally
confirmed by determination of the cytokine concentrations in blood
(Table 6). Thus, using an ELISA technique, many of the cytokine
levels that were increased in LPS and LPS plus DMSO treated mice
were elevated more than 1000 fold by comparison to control or C10
(pMMI)-treated mice who received LPS (Table 6). Very clearly,
phenylmethimazole C10 (PMMI) reduced these cytokine levels to
levels in normal control mice in association with efficacious
effects on disease expression in toxic shock. TABLE-US-00007 TABLE
6 C10 decreases the serum level of cytokines increased by C10 in
mice evaluated 1 hour after initiation of the experiment of Table
5. Cytokine Level (% of Control .+-. 12%) Cytokine Control LPS LPS
+ DMSO LPS + C IL-1.beta. 100 6000 5900 IL-6 100 2800 2600
TNF-.alpha. 100 4000 4200 IFN-.gamma. 100 4500 1900 IL-12p70p 100
200 260 Bold values with LPS or LPS + DMSO Vehicle control are
statistically increased (p < 0.001). Bold and italicized values
in mice treated with C10 were statistically lower than LPS or LPS
plus vehicle control (P < 0.001). Experiments were
representative of three separate replicated groups.
[0430] In sum, C10 (PMMI) suppressed pro-inflammatory cytokine
production induced by the LPS-TLR-4-MyD88 dependent and independent
pathways in vivo consistent with its effects to prevent or reverse
toxic shock (Table 5). The data are consistent with previous data
in vitro, that C10 (PMMI) down regulates the
IRF3/IFN-.beta./Stat1/ISRE/IRF-1 signal transduction pathway (N.
Harii, et al., Mol Endocrinol, 19:1231-50 (2005); N. M. Dagia, et
al., J Immunol, 173:2041-9 (2004)). However, the data additionally
suggest that in vivo, in nonimmune organs with cell heterogeneity,
C10 (PMMI) also regulated genes linked to the NF-.kappa.B
activation pathway, possibly by a secondary effect on IFN-.beta.
autocrine/paracrine effects on nonimmune cells, rather than a
direct block of the MyD88-linked signal system.
[0431] The cyclooxygenase (COX) enzyme system catalyzes the
synthesis of prostaglandins and regulates their tissue levels.
Prostaglandins are well described as important in the induction of
hypotension in endotoxic shock. COX-2 is over-expressed in toxic
shock and in autoimmune-inflammatory diseases related to toxic
shock, as well as in cancer progression. It is responsible for
catalyzing the formation of PGE2 which is the prostaglandin
responsible for blood pressure decreases and hypotension in septic
shock. In contrast to COX-2, COX-1 is the "house-keeping" enzyme
with a protective role. C10 selectively suppressed the expression
of COX-2, which is increased in tissues by LPS-induced endotoxic
shock and increased COX-1 gene expression, which is decreased in
tissues by LPS-induced endotoxic shock, to the normal level. The
ratio of COX-2/COX-1 is considered important both to disease
expression and therapeutic efficacy.
[0432] Thus, when expression of COX-1 and COX-2 RNA levels were
evaluated by RT-PCR in the organs of different groups of mice
described in Table 5, the COX-1 RNA levels were down-regulated in
most examined organs of LPS treated mice except spleen and heart,
while the C10 returned RNA levels to the normal levels (FIG. 10).
These data indicate that C10 protects cells from damage induced by
LPS, since COX-1 is a protective enzyme in the inflammatory
process. Moreover, the absence of an LPS effect on spleen, which is
dominated by immune cells, but a significant effect of LPS and C10
in lung, kidney, and liver indicates that the dominant increase and
significant action of C10 was on the nonimmune cells in these
tissues, since they dominate those organs unlike the case in
spleen.
[0433] In contrast to COX-1, the COX-2 RNA levels were up-regulated
in kidney, liver, lung, spleen, and heart of mice suffering from
endotoxic shock (FIG. 10) establishing that all organs suffer a
strong inflammatory process. Further elevated COX-2 RNA levels were
completely suppressed and returned to normal by C10 in kidney,
liver and lung and also suppressed in spleen and heart, albeit less
dramatically. These data establish that C10 is a selective COX-2
inhibitor compared to COX-1 and acts as a more physiologic
regulator by reversing both the increased COX-2 and decreased COX-1
toward normal levels. The changes in spleen indicate that the COX-2
enzyme changes in immune cells are an important component of
disease expression in immune as well as nonimmune cells.
Nevertheless, the absence of COX-1 changes in the spleen emphasize
that the LPS-induced, and C10 decreased, COX-2 changes in nonimmune
cells are also important in toxic shock and its effective therapy
by C10.
[0434] INOS is only one of the several terminal mediators of shock
and inflammation. The overproduction of nitric oxide (NO) in
endotoxic shock has been well documented, as it has been in
autoimmune-inflammatory diseases and atherosclerosis. Similarly,
the tissue damage induced by peroxinitrites from multiple pathways
is documented. The data (FIG. 10) show that iNOS mRNA gene
expression is undetectable or poorly expressed as measured by
RT-PCR in normal tissue (FIG. 10, non treated mice). This gene is
clearly induced by LPS in the organs of mice (FIG. 10, iNOS in
spleen, liver, lung, kidney, heart). C10 suppressed iNOS RNA levels
increased by LPS, returning them toward normal. These data support
the idea that C10 can ameliorate peroxinitrites formation and
tissue damage induced in tissues by toxic shock and autoimmune
inflammatory disorders.
[0435] IRF-1 regulates the expression of several genes involved in
autoimmunity and inflammation. Genes regulated by IRF-1 include
among others, the Type 1 IFN cytokines (IFN-.alpha. and
IFN-.beta.), the type 2 IFNS (IFN-.gamma.), Interleukin-12 (IL-12)
and IL-15 as well as nitric oxide, COX-2, MHC-I and .beta.-2
microglobulins. Thus, IRF-1 seems to be positioned at the
intersection of multiple different downstream paths leading to a
Th1 response and to host defense again microorganisms and
environmental insults--moreover it is critically positioned to
affect TLR3 and TLR4 signals.
[0436] It is reasonable to presume from the sum of the data in
FIGS. 1-10 and Tables 3-6, plus our previous work (L. D. Kohn et
al., U.S. Pat. No. 6,365,616, April:(2002)) that C10 is a lead
compound representative of a group of agents which blocks
autoimmune-inflammatory disease in vivo and that it acts by a
critical effect on pathological increases in IRF-1 gene expression
not evident in normal tissues. This has two important consequences.
First, because of the absence of high IRF-1 gene expression in
normal tissues, C10 (pMMI) will have no significant effect in
normal tissues or normal individuals. Second, pathologic increases
in IRF-1 gene expression can be mediated by pathologic expression
of TLR3/TLR4 in nonimmune tissues, macrophages, monocytes, and
dendritic cells. Thus, C10 is a lead compound that blocks
pathologic expression of multiple genes important in pathologic
autoimmune-inflammatory disorders by blocking the IRF-3/Type 1
IFN/STAT/ISRE/IRF1 signal path. Further, because of
autocrine/paracrine actions of type 1 IFNs which secondarily can
increase NF-.kappa.B signaled genes, or perhaps because of the cell
heterogeneity of an organ and the different effects of C10 on
different cells as the signals progress (vascular vs nonvascular),
as will be evident below, the C10 family of compounds can act in
vivo to attenuate the NF-.kappa.B signaled increases in downstream
genes or gene products. The bottom line is that C10 and its family
members block the pathological innate immune response in nonimmune
tissues that are associated with TLR4 as well as TLR3-associated
autoimmune-inflammatory disorders, as evidenced for TLR4 associated
diseases in the colitis and toxic shock models and in TLR3 mediated
disease, as evidenced for insulinitis and Type I diabetes model,
but likely in its related disease, Hashimoto's thyroiditis.
[0437] Phenylmethimazole (pMMI or C10) ameliorates the
microvasculature damage, decreases inflammatory cellular
infiltration, and decreases adhesion molecule expression on the
vascular endothelial cells of tissues affected by endotoxic
shock.
[0438] Decreases in inflammatory infiltrates: The
histo-pathological observation of sections stained with H.& E.
from animals at 18 hours after LPS injection showed the
inflammatory changes already described by other authors. These
changes were evident on the microcirculation of the different
tissues evaluated. In lung all these changes are usually most
severe and both TLR3 and TLR4 related (L. Guillot, et al., J Biol
Chem, 280:5571-80 and 279:2712-8 (2004)). We thus evaluated the
effect of C10 (pMMI) on the inflammatory changes induced by LPS in
lung sections. In LPS treated mice the lumen of microvasculature
was full of blood cells and there was an increased number of acute
inflammatory cells, due to the slowing of the blood flow seen at
both 20.times.magnification, and 40.times. magnification (FIG. 11).
Margination, i.e. moving to the edge of the dynamic flow or
movement process, of granulocytes along the vascular endothelium
and stacking on the vessel endothelia was more evident in the LPS
group. In some animals, where the histopathological picture was
more severe, microemboli in the lumina of small vessels was
observed. The septa of alveoli are thicker than normal, due to the
infiltration and migration of acute inflammatory cells, making them
more dense in the pulmonary tissue of LPS-treated mice.
Microcirculatory damage as well as inflammatory cellular
infiltration was ameliorated by C10 (pMMI) (FIG. 11). In other
organs where the inflammatory process induced by LPS was evident,
e.g liver, heart, or kidney, the same results were found. Taken
together, these data indicated that the systemic inflammation
induced by endotoxic shock was suppressed by C10 (pMMI).
[0439] Adhesion molecules that are up-regulated in the vascular
endothelium of organs suffering from endotoxic shock are suppressed
by C10 (pMMI): Sections from different organs were study by
immunohistochemistry in order to evaluate the effect of pMMI on
ICAM-1 and VCAM-1 adhesion molecules in endotoxic shock. Both
ICAM-1 and VCAM-1 are the ligands for systemic inflammatory cells
to bind to the endothelium and infiltrate tissues in septic shock.
Moreover, organ infiltration by inflammatory cells has been largely
associated to the systemic organ failure. The data showed that
ICAM-1 and VCAM-1 adhesion molecules were strongly up-regulated in
mice treated with LPS and suffering from endotoxic shock. ICAM-1 is
over-expressed in lung and liver. ICAM-1 specific staining on the
endothelial cells of lung capillaries is decreased by C10 (pMMI) as
well as in endothelial cells of vein and reticulooendothelial space
of the liver. VCAM-1 is specifically up-regulated in the large
veins and C10 (pMMI) suppress the VCAM-1 levels.
[0440] These results thus showed that in mice injected with LPS,
ICAM-1 and VCAM-1 staining were clearly increased and stronger than
in normal and C10 (pMMI) treated mice. The results were the same
comparing results from C10 treated mice with results from LPS plus
DMSO treated mice or those treated with LPS alone. These data
showed that C10 (p-MMI) suppressed both ICAM-1 and VCAM-1
over-expression that is induced by LPS-TLR4 activation on
endothelial cells.
[0441] Materials and Methods
[0442] Experimental design: In order to determine the survival
curve of C57BL/6J mice, they were injected intra-peritoneally (i/p)
with different drugs and solvents (See Table 7 below) 30 minutes
before LPS injection (See Scheme 1, below). Twenty (20) mg/Kg LPS
from E. coli was then injected intra-peritoneally (i/p) into each
mouse. The experiment was performed using at least 8 mice in each
of 3 experiments. After LPS injection, the survival curve was
determined at 6, 12, 18, 36 hours and 1 week. The result is
expressed as a percentage of survival without LPS treatment.
TABLE-US-00008 TABLE 7 Drugs and vehicles Treatment Dose Solvent
Methimazole 1 mg/kg PBS (MMI) C10 1 mg/kg 10% DMSO (pMMI)
Prednisolone 5 mg/kg PBS Flunixin 1 mg/kg Commercial of Meglumine
DMSO 10% (v/v) PBS PBS Phosphate Water buffered Saline pH
7.2-7.4
[0443] Mice were evaluated 18 hours after the induction of
endotoxic shock by intra-peritoneal LPS injection. Samples were
collected for mRNA isolation, Histology and Immunohistochemistry
(see Scheme 1). C10 (pMMI) effects on LPS-TLR4-increased
TNF-.alpha., IL-1.beta., IL-6,IL-12, IFN-.gamma., COX-2, iNOs, and
MCP-1 gene expression were measured by Northern analysis and RT-PCR
in spleen, lung, liver, heart and kidney. Results were confirmed by
protein studies using ELISA and by immunohistochemistry. The
LPS-TLR4- MyD88 independent, IFN-.beta.-signaled genes including
IRF-1, IP-10, COX-2 and iNOS were similarly studied. The results of
the gene and protein expression were correlated with histological
studies. Tissues obtained at 18 hrs were also used to measure the
systemic inflammatory response at the organ level. The expression
of adhesion molecules ICAM-1 and VCAM-1 was correlated with
immunohistochemistry markers of inflammation and TLR4 signaled
changes. Lung was used as a reference organ for inflammatory
histological studies and lung and liver for adhesion molecule
studies. ##STR23##
[0444] Histology: Tissue from liver, lung, kidney and heart from
normal, LPS and LPS plus C-10 treated mice (experiment in Table 5),
were fixed in 4% -PBS- formalin overnight. They then were
dehydrated serially in alcohols 50%-70%-90%-100%, clarified in
chloroform, and embedded in paraffin. Five (5) .mu.m sections were
obtained and mounted on Vectabond.TM. (Vector Laboratories, Inc.
Burlingame, Calif.) pretreated slides. The sections were incubated
twice (10 minutes each) in xylol and re-hydrated by serial alcohol
treatments, 100%-90-70-50, followed by distilled water. Tissues
were stained with Hematoxylin-Eosin using standard protocols,
mounted, and observed by optical microscopy in a double blind
manner.
[0445] Immunohistochemistry (IHC): C10 (pMMI) effects on the
over-expression of adhesion molecules induced by LPS were studied
in different organs. These results focus lung and liver. At 18 h
after LPS injection, mice were sacrificed and the heart, lung,
liver spleen and kidney were removed and fixed in 4% formalin in
PBS. The tissue was then dehydrated in serial alcohols (50% v/v,
twice; 70% v/v, twice; 80% v/v, twice; 95% v/v, twice; and 100%
v/v, twice), cleared in pure chloroform, embedded in paraffin and
sectioned (5 prm thickness) and mounted on Vectabond.TM. (Vector
Laboratories, Inc. Burlingame, Calif.) pre-treated slides. The
section were then cleared of paraffin by exposure to xylol twice
(10 minutes each) and rehydrated using serial alcohol treatments,
100%-90-70-50. After endogenous peroxidase inhibition with 3%
H.sub.2O.sub.2 in methanol and nonspecific protein blocking using
5% BSA (Sigma Aldrich), the tissue sections were incubated
overnight at 4.degree. C. with 5 ul/ml of anti-mouse VCAM-1
polyclonal goat IgG or 3 ul/ml of anti-mouse ICAM-1 extracellular
domain specific goat IgG as primary antibodies (R&D System,
Inc. Minneapolis, Minn.). The samples were extensively rinsed with
PBS and subsequently incubated (1 hr) with biotinylated anti-goat
IgG diluted 1/20 using the Goat Extravidin Staining Kit
(Sigma-Aldrich St. Louis, Mo.). After extensive washing, the
sections were incubated with streptavidin-peroxidase diluted 1/20
from the same kit. The sections were then washed three times and
incubated (10 minutes) with DAB Chromogen reagent (Sigma-Aldrich).
The slides were washed and were subsequently counterstained with
methyl green (Vector Laboratories, Inc. Burlingame, Calif.), then
dehydrated in ethanol followed by pure xylene. Slides were mounted
and examined under a light microscope at 40.times. (Nikon
Eclipse-E600).
[0446] Quantification of pro-inflammatory cytokines in blood: The
cytokines TNF-.alpha., IL-1.beta., IL-6, IFN-.gamma. and IL-12 were
quantified in serum using ELISA techniques. Blood was collected
from the inner canthus of the eye under anesthesia and serum saved
at -20.degree. C. until use. The ELISA kits were from R&D
System and the results were expressed in pg/ml serum.
[0447] RNA isolation and Northern Blot analysis of gene expression:
RNA used to measure expression of TNF-.alpha., IL-1.beta., IL-6,
IFN-.gamma., IRF-1, IP-10 and MCP-1 genes was extracted using
Trizol (Invitrogen, Carlsbad, Calif.) and subjected to Northern
blot analysis in a similar manner to that described previously (V.
Toshchakov, et al., J Endotoxin Res, 9:169-75 (2003)). The GAPDH
cDNA was from Clontech (Palo Alto, Calif.). TNF-.alpha. cDNA was
excised from pORF9-mTNF vectors (Invivogen, San Diego, Calif.).
Other probe sequences were synthesized by RT-PCR (ibid) using the
following cDNA specific primers: TABLE-US-00009 (SEQ ID NO: 13)
mIP-10: 5'CCATCAGCACCATGAACCCAAGTCCTGCCG 3' and (SEQ ID NO: 14)
5'GGACGTCCTCCTCATCGTCGACTACACTGG 3' (469bp); mIL-1.beta.): (SEQ ID
NO: 15) CTCATCTGGGATCCTCTCCAGCCAAGCTTC 3' and (SEQ ID NO: 16)
5'CCATGGTTTCTTGTGACCCTGAGCGACCTG 3' (1006bp).
[0448] RNA isolation and RT-PCR analysis of gene expression.
Expression of COX-1, COX-2 and iNOs were studied in different
organs. Tissues were isolated from different groups of mice and
washed with sterile Phosphate Buffered saline (PBS), pH 7.2-7.4.
After tissues were homogenized in 0.5 ml of Trizol (Invitrogen,
Carlsbad, Calif.), the RNA was extracted by chloroform-isopropanol,
washed in alcohol 70%, dried and redissolved in RNase free water.
Total RNA was treated in order to remove any DNA contamination
using the DNase Free Kit (Ambion cat# 1906). cDNA was obtained
using the Clontech RT for PCR kit (Clontech cat # K 1402-2). PCR
was performed using the Takara kit for PCR (Takara BIO, Inc, by
Fisher Scientific # R001A) after optimizing conditions for each set
of primers. Primers were designed using standard procedure and
obtained from BIO Synthesis Inc. After specific DNA amplification,
the samples were run in a 2% agars gel in TAE buffer with 4% of
Ethidium Bromide. The samples were analyzed by fluorescence
intensity. Relative quantities of RNA for Cox-1, Cox-2, iNOs and
the "housekeeping gene," GAPDH, were determined by coupled reverse
transcription (RT)-PCR. The primers used in each case were as
follows: Cox-1 sense primer 5' CCCAGAGTCATGAGTCGAAGGAG-3' (SEQ ID
NO:17), antisense 5'-CAGGCGCATGAGTACTTCTCGG-3' (SEQ ID NO:18);
Cox-2 sense primer 5'-GCAAATCCTTGCTGTTCCAATC-3' (SEQ ID NO:19),
antisense primer 5'-GCAGAAGGCTTCCCAGCTTTTG-3' (SEQ ID NO:20); iNOS
sense primer 5'-CCCTTCCGAAGTTTCTGGCGACAGCGGC-3' (SEQ ID NO:21),
antisense primer 5'-GGCTGTCAGAGCCTCGTGGCTTTGG-3' (SEQ ID
NO:22).
Example 4
[0449] Phenylmethimazole (C10) decreases LPS induced TLR4 signaling
in Macrophages.
[0450] Macrophages in animals treated with LPS display a rapid
induction of many genes which are regulators of the inflammatory
response (M. A. Dobrovolskaia, et al., Microbes Infect, 4:903-14
(2002)). Cultured murine macrophages themselves, when treated with
LPS, also display a rapid induction of many genes which are
regulators of the inflammatory response (M. A. Dobrovolskaia, et
al., Microbes Infect, 4:903-14 (2002)). In order to obtain a more
complete understanding of how C10 may be preventing endotoxic shock
in our animal model we chose to examine the affect of C10 on LPS
stimulated genes in cultured murine macrophages in particular the
murine macrophage cell line RAW 264.7. RAW 264.7 cells are a
transformed functional macrophage cell line (W. C. Raschke, et al.,
Cell, 15:261-7 (1978)). The RAW 264.7 cell line has been a common
and well accepted tool in the scientific literature used to further
understand the affects of LPS on macrophages (V. Toshchakov, et
al., J Endotoxin Res, 9:169-75 (2003); T. Horng, et al., Nat
Immunol, 2:835-41 (2001); D. Schilling, et al., J Immunol,
169:5874-80 (2002); B. W. Jones, et al., Ann Rheum Dis, 60 Suppl
3:iii6-12 (2001)).
[0451] We studied the expression profile of genes which were deemed
relevant in the current body of literature. Thus, we examined the
effect of C10 on a multi functional and complex array of factors
which included proinflammatory cytokines (IFN-.beta., IL-1.beta.,
TNF-.alpha., IL-6, and IL-12), a CXC chemokine (IP-10), an enzyme
which catalyzes the production of nitric oxide (iNOS), and a
transcription factor (IRF-1), each of which have been reported to
play a role in endotoxic shock (M. A. Dobrovolskaia, et al.,
Microbes Infect, 4:903-14, (2002)). Although the proinflammatory
cytokines, IL-1.beta., TNF-.alpha., IL-6, and IL-12, can be
directly or indirectly induced by LPS signaling through TLR4 (M. A.
Dobrovolskaia, et al., Microbes Infect, 4:903-14, (2002)) and
certainly play a role in endotoxic shock (N. C. Riedemann, et al.,
J Clin Invest, 112:460-7, (2003)), a recent report identified
IFN-.beta. as a critical secondary effector, which is induced upon
LPS activation of TLR4 signaling and contributes to mortality in a
murine septic shock model (M. Karaghiosoff, et al., Nat Immunol,
4:471-7, (2003)). Due to evidence that IFN-.beta. plays a critical
role in the mortality of animals in the murine model of endotoxic
shock (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)), we
examined the effects of C10 on LPS stimulation of IFN-.beta.
dependent mechanisms in greater detail.
[0452] Results
[0453] LPS induced genes are down regulated in cultured mouse
macrophages: LPS can activate monocytes and macrophages to produce
cytokines such as IFN-.beta., IL-10, TNF-.alpha., IL-6, and IL-1.2
(M. A. Dobrovolskaia, et al., Microbes Infect, 4:903-14, (2002))
which act on either the macrophages/monocytes themselves or other
target cells to regulate the inflammatory process which occurs in
septic shock. Upon stimulation with LPS, macrophages can also
produce CXC chemokines such as IP-10 which serve to further attract
immune cells to a site of inflammation (K. M. Kopydlowski, et al.,
J Immunol, 163:1537-44 (1999)). Macrophages stimulated with LPS can
also produce nitric oxide (NO) as a result of expression of the
inducible nitric oxide synthase enzyme (iNOS) (C. Bogdan, Nat
Immunol, 2:907-16 (2001)).
[0454] Each of these factors that are considered to be important in
the pathogenesis of septic shock are typically absent or found at
extremely low levels in unstimulated RAW 264.7 macrophages as
confirmed by northern analyses (FIG. 12A, lane 1) or by RT-PCR for
iNOS (see FIG. 13A). Upon stimulation of mouse macrophages with LPS
(1 ug/mL) for 1, 3, or 6 hours northern blot analysis revealed an
mRNA expression profile in the presence of C10 or the vehicle
control (DMSO) for IFN-.beta., IL-1.beta., TNF-.alpha., IP-10, and
IL-6 (FIG. 12A). In the case of each mRNA measured there was a
difference between the DMSO lane and the C10 lane. This affect was
less pronounced for TNF-.alpha. and may be attributed to the
ability of LPS to increase TNF-.alpha. directly through the
NF-.kappa.B signaling mechanism.
[0455] While northern blotting provides a reliable method for
qualitative determination of gene expression levels, a more
quantitative and sensitive method was required to accurately
determine the affect of C10 on LPS induced cytokine gene expression
in macrophages. Real time polymerase chain reaction (real-time PCR)
was employed to obtain a quantitative profile of mRNA expression
inhibition by C10. We measured IFN-.beta., TNF-.alpha., IL-6,
IL-1.beta., and IL12p40 gene expression after 1, 2, 3, 4.5, or 6
hour treatments with LPS (1 ug/mL) in the presence of DMSO control
or C10 drug treatment (FIG. 12B). Gene expression levels were
quantified by normalizing to an endogenous control (GAPDH) and
normalizing to the untreated (DMSO control), which allowed the
comparison of mRNA levels in C10 treated versus DMSO control
treated, LPS stimulated macrophages (FIG. 12B).
[0456] The fold decrease in induced IFN-.beta. gene expression was
most strongly decreased at the one hour time point (8 fold) and was
maintained at a low level throughout the time course (FIG. 12B).
The reduction in the TNF-.alpha. increase induced by LPS was at a
maximum at 3 hours (4 fold) (FIG. 12B) but showed no reduction at 1
or 6 hours when LPS-increased TNF-.alpha. levels were low. The
LPS-induced increase in IL-6 was maximally reduced at the 3 hour
time point at greater than a 16 fold reduction (FIG. 12B). LPS
induced IL-1.beta. was maximally decreased at 1 hour (11 fold)
(FIG. 12B). IL-12 p40 was not detectable until4 to 5 hours but was
strongly reduced at 6 hours (16 fold) (FIG. 12B). Taken together
these real time PCR data show that C10 effectively reduces the LPS
dependant production of a broad range of proinflammatory cytokines
in monocyte/macrophages classically used to study LPS action.
[0457] In macrophages NO production occurs as a result of LPS
induction of iNOS (C. Bogdan, Nat Immunol, 2:907-16 (2001)) and is
a process that depends on autocrine signaling by IFN-.beta.. We
used standard reverse transcriptase polymerase chain reaction to
detect the inhibition of LPS induced iNOS transcription in the
presence of C10 (FIG. 13A). The RAW 264.7 cells were treated with
LPS in the presence of C10, its vehicle control, DMSO, or another
excipient vehicle (compound B; see Table 8) for 3 hours. Table 8
establishes that C10 is effective in vivo in the mouse toxic shock
model and in FRTL-5 cell assays in vitro when solubilized in water
in the presence of the compound B excipient, i.e., water soluble
forms of C10 are effective in both in vivo and in vitro just as C10
in DMSO. In the presence of DMSO control (FIG. 13A, lane 4) or
vehicle B only (FIG. 13A, lane 5) little or no iNOS reduction was
detected respectively when compared to LPS only (FIG. 13A lane 3).
Cells treated with C10 showed a strong reduction of LPS induced
iNOS mRNA (FIG. 13A lanes 6 and 7 vs. lanes 4 and 5). Because a
modest affect was observed in the presence of DMSO control only
(FIG. 13A lane 4) C10 was dissolved in another vehicle called
Solution B, which had no affect alone (FIG. 13A lane 5). In sum,
C10 had a strong inhibitory effect on iNOS RNA levels regardless of
the vehicle used to dissolve the compound. TABLE-US-00010 TABLE 8
C10 can improve toxic shock whether in DMSO or solubilized in
excipient (Compound B) making it water soluble; excipient is also
effective in C-10 Use in DMSO or Excipient in Mouse Models and in
vitro Assays Survival C10 % of Experiment Animals Dosage Route of
Admin #days Control Colitis model 10 0.1 mg/kg Ip freshly diluted
in DMSO 14 100% Colitis model 10 0.1 mg/kg Oral stored in excipient
1 week 14 100% Toxic Shock model 10 1 mg/kg Ip freshly diluted in
DMSO 1.5 100% Toxic Shock model 10 1 mg/kg Oral stored in excipient
1 week 1.5 100% Toxic Shock model 10 1 mg/kg Oral diluted &
stored in 1.5 100% excipient 6 wks Toxic Shock model 10 1 mg/kg Ip
diluted & stored in DMSO 1 wk 1.5 0% Assay Replicates C10 Conc.
% TLR3 Inhibition vs Control dsRNA increased TLR3 3 0.1 mM in DMSO
90% RNA. IFN-.beta. increased TLR3 3 0.1 mM in Excip. 90% RNA
[0458] Table 8 shows that C10 in excipient is as good as C10 in
DMSO in vitro and in vivo. In the studies described in Table 5, C10
was formulated in DMSO and administered i.p. DMSO was used due to
the low solubility of C10 in aqueous environments but can have well
documented independent effects (M. S. Ivanovic, et al., Toxicology
Letters, 147:153-159 (2004))]. In addition, C10 solubilized in DMSO
and diluted to a working concentration is not stable for prolonged
periods of time. To circumvent these issues, we used a proprietary
cyclodextrin (CD) excipient that is approved by the FDA for use in
humans to make an aqueous formulation of C10. C10 stored in the
aqueous preparation for 6 weeks prior to use was equally effective
in decreasing TLR3 and IFN-.beta.-mRNA levels in thyrocytes by
comparison to solutions with DMSO. In a test using LPS-induced
toxic shock, oral excipient-solubilized C10, stored in diluted form
at 4.degree. C. for 8 weeks, was as effective in preventing death
as was freshly made C10 i.p. in DMSO at the same 1 mg/kg dose.
Solutions of C10 diluted in DMSO and stored in diluted form at
either 4.degree. C. or -70.degree. C. were inactive in vitro or in
vivo.
[0459] A cyclohexamide treatment was done (FIG. 13A, CHX) to
confirm that new protein synthesis is required for the LPS
induction of iNOS mRNA and support that Type 1 interferon signaling
might be responsible for the increase in iNOS, rather than direct
effects of TLR4 signaling. Effectively we considered whether C10
might be acting via a mechanism that required new protein
synthesis, i.e. the synthesis of IFN-.beta.. This is the case as
shown by a loss of LPS increased iNOS equivalent to that of C10 in
the presence of cyclohexamide (FIG. 13A, CHX) We have already seen
that C10 can reduce the LPS induced transcription of IFN-.beta.
mRNA (FIG. 12A and B). Previous reports have found that LPS
induction of iNOS in mouse macrophages can occur via binding of
autocrine IFN-.beta. to its receptor and subsequent StatI
activation (D. Schilling, et al., J Immunol, 169:5874-80,
(2002)).
[0460] C10 inhibits the LPS induced activation of Stat1 in cultured
macrophages: The important role of type I interferons in LPS
induced septic shock was recently demonstrated in mouse models (M.
Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)). We have already
shown in FIGS. 12A and 12B that LPS induced increases of IFN-.beta.
(a type I interferon) mRNA levels are strongly inhibited by C10. It
is has been shown that binding of IFN-.beta. to the type I
interferon receptor results in phosphorylation of Stat1 as a key
component for the transduction of a signal to the nucleus to induce
expression of iNOS and IP-10 in the mouse macrophage (Y. Ohmori, et
al., J Leukoc Biol, 69:598-604 (2001)). C10 was able to reduce the
level of LPS induced Statl phosphorylation in both cytoplasmic and
nuclear fractions (FIG. 13B lanes 5 and 9). No apparent affect was
observed with the DMSO control only (FIG. 13B lanes 4 and 8). The
cyclohexamide control (FIG. 13B, lane 10) indicates that LPS
induced Stat1 phosphorylation requires new protein synthesis,
presumably IFN-.beta. (V. Toshchakov, et al., J Endotoxin Res,
9:169-75, (2003)). C10 had a similar affect as cyclohexamide (FIG.
13B, lanes 9 vs. 10) indicating that C10 may be acting as an
inhibitor of IFN-.beta. synthesis as well. When the data in FIGS.
12A and 12B, showing reduced IFN-.beta. mRNA and protein, are taken
in combination with the data in FIG. 13B showing reduced Stat I
phosphorylation the following hypothesis can be stated. C10 can
reduce signal transduction through the IFN-.beta. signal pathway by
reducing the LPS induced autocrine/paracrine action of IFN-.beta.,
thereby decreasing Statl activation.
[0461] C10 down regulates IRF-1 and IRF-1 DNA binding in LPS
treated macrophages: IRF-1 is a transcription factor which is
induced upon LPS stimulation of macrophages through a Stat1
dependent mechanism (Y. Ohmori, et al., J Leukoc Biol, 69:598-604
(2001)). Therefore IRF-1 provides another example of a response
that may be affected by an inhibitor of LPS induced IFN-.beta.
signaling. Unlike other molecules studied thus far, IRF-1 acts as a
transcription factor to directly bind to DNA to enhance
transcription of other genes such as iNOS (R. Kamijo, et al.,
Science, 263:1612-5, (1994)). In macrophages treated with LPS,
IRF-1 is required for the transcriptional control of the iNOS gene
(R. Kamijo, et al., Science, 263:1612-5 (1994)). Macrophages were
treated with LPS (1 ug/mL) for 1, 2, or 3 hours and longer in the
presence of C10, a DMSO control, or a commercially available
derivative of C10 (MMI) (FIG. 14A). Typical LPS induction for each
time point is observed in each LPS plus DMSO lane (FIG. 14A, lanes
2, 5, 8). LPS increased IRF-1 RNA is small at 1 hr but becomes
maximal by 3 in the presence of DMSO, the C10 solvent (FIG. 14A,
lane 8). A strong reduction in LPS-increased IRF-1 mRNA is still
observed upon treatment with C10 at 2 and 3 hours (FIG. 14A, lanes
6 and 9 vs 5 and 8, respectively). The decrease by C10 is much
greater than by MMI (FIG. 14A, lanes 6 and 9 vs 7 and 10,
respectively).
[0462] In order for IRF-1 to enhance gene transcription it must
bind to cis-DNA elements located on the target gene. iNOS is an
example of a target gene that contains an IRF-1 cis-binding element
(R. Kamijo, et al., Science, 263:1612-5 (1994)). Several other
IRF-1 target genes exist such as the interferon inducible MX gene
which codes for the antiviral Mx protein (D. Danino, et al., Curr
Opin Cell Biol, 13:454-60 (2001)). The MX promoter has been shown
to contain strong IRF-1 binding elements (C. E. Grant, et al.,
Nucleic Acids Res, 28:4790-9 (2000)). We used the Mx ISRE (IRF-1
binding site) and EMSA to measure the effect of C10 on LPS induced
IRF-1 binding to the MxISRE element.
[0463] Two complexes were induced upon LPS stimulation (1 ug/mL)
for 2 hours when compared to untreated (FIG. 14B, lanes2, 5, and 8
vs 1). A dose dependent reduction was observed in samples from both
C10 (FIG. 14B, lanes 3 and 4) and MMI (FIG. 14B, lanes 6 and 7)
treated cells. Specificity was observed upon incubation of extracts
with unlabeled MxISRE probe (FIG. 14B, lane 9). Complexes were
identified using super shift studies in which nuclear extract was
incubated with antibody directed toward either IRF-1 or IRF-3 (FIG.
14B, lanes 11 and 12, respectively). When incubated with IRF-1
antibody there was an observed supershift identifying that complex
as an IRF-1 containing complex (FIG. 14B, lane 11) No supershift
was observed using two different IRF-3 antibodies (FIG. 14B, lane
12 Ab#1; the Ab#2 data are not shown) indicating no IRF-3 in the
complex. Interestingly when the extracts were preincubated with
unlabeled probe against the human IFN-.beta. IRF-1 binding element,
which acts as a competitive inhibitor, the IRF-1 complex was also
eliminated (FIG. 14, lane 10). These last data indicated that LPS
induced IRF-1 in these extracts would also bind to the human
IFN-.beta. IRF-1 binding element.
[0464] Relevance to Endotoxic shock in Example 3: Endotoxic shock
protected mice have reduced tissue levels of activated Stat1
[0465] It was recently demonstrated that Stat1 null animals show an
approximately 50% enhanced survival rate when challenged with a
lethal dose of LPS (M. Karaghiosoff, et al., Nat Immunol, 4:471-7
(2003)). In the same study IFN-.beta. null mice which were
challenged with a lethal LPS dose showed a 100% enhancement of
survival (M. Karaghiosoff, et al., Nat Immunol, 4:471-7 (2003)).
Therefore blocking parts of the IFN-.beta. signal pathway is not as
effective as blocking the pathway completely, i.e., by preventing
the ligand receptor interaction or blocking the initial signal
induced by the ligand-receptor interaction. In order to determine
if LPS induced IFN-.beta. signaling in vivo might be attenuated by
C10 treatment, we examined protein phosphorylation levels of Stat1
in whole tissue lysates from mice in the experiments of Table 5.
Both kidney and lung tissues, as well as mouse macrophages,
displayed detectable levels of activated Stat1 protein in mice
which were not protected from shock (FIG. 8 lanes 2 and 5
respectively) these levels were reduced to basal in mice which were
protected from LPS induced shock by treatment with C10 (FIG. 8,
lanes 3 and 6 respectively).
[0466] In summary these data in RAW 264.7 indicate that C10 has a
strong inhibitory effect on multiple factors that have been shown
to be involved in endotoxic shock. These data are important to
understand the mechanisms of C10 protection in the murine model of
endotoxic shock. C10 appears to be suppressing the induction of
very early genes such as IFN-.beta. and IL-1.beta., whose induction
is a direct result of LPS dependent TLR4 signaling. TNF-.alpha. is
also rapidly induced by direct TLR4 signaling, however the effect
of C10 on TNF-.alpha. is negligible at 1 hour, indicating that C10
does not affect all aspects of TLR 4 signaling equally. This is
particularly interesting to contrast with the in vivo data of
Example 3. Thus, in vivo, C10 did decrease TNF-.alpha. RNA levels
and protein but it seemed possible this reflected a secondary
action through IFN-.beta. or the possibility that multiple
interacting cell types were affected by the C10 primary action on
nonimmune cells. It is nevertheless evident that LPS induced
IFN-.beta. is an attractive therapeutic target due to its multiple
down stream affects which stem from the activation of Stat1 which
is required in macrophages for the transcriptional upregulation of
IRF-1, iNOS, and IP-10. The Stat1 reduction in the macrophages and
in nonimmune cells in tissues can partially explain the reduction
of the genes in the mouse tissues of Example 3.
[0467] Materials and Methods
[0468] Cell culture: The mouse macrophage cell line RAW 264.7
(TIB-71) was obtained from the American Type Culture Collection
(Manassas, Va.). RAW 264.7 were cultured in DMEM supplemented with
glutamine and 10% FBS.
[0469] RNA isolation and Northern blot analysis: Northern blot
analysis was used to characterize the mRNA levels of key
inflammatory mediators involved in endotoxic shock (M. A.
Dobrovolskaia, et al., Microbes Infect 4:903-14, (2002)). RNA was
extracted using Trizol.RTM. (Invitrogen, Carlsbad, Calif.) and
subjected to Northern blot analysis in a manner similar to that
described previously (K. Suzuki, et al., Proc Natl Acad Sci USA,
96:2285-90 (1999)). The G3PDH cDNA was from Clontech (Palo Alto,
Calif.). The mTNF-.alpha. probe was excised from pORF9-mTNF-.alpha.
(Invivogen, San Diego, Calif.). Other probe sequences were
synthesized by RT-PCR (K. Suzuki, et al., Proc Natl Acad Sci USA,
96:2285-90 (1999)) using the following cDNA specific primers:
mIP-10, 5'CCATCAGCACCATGAACCCAAGTCCTGCCG3' (SEQ ID NO:23) and
5'GGACGTCCTCCTCATCGTCGACTACACTGG3' (469 bp) (SEQ ID NO:24);
mIL-1.beta.5'CTCATCTGGGATCCTCTCCAGCCAAGCTTC3' (SEQ ID NO:25) and
5'CCATGGTTTCTTGTGACCCTGAGCGACCTG 3' (1006 bp) (SEQ ID NO:26);
mIL-6, 5' CCAGTTGCCTTCTTGGGACTGATGCTGGTG 3' (SEQ ID NO:27) and
5'GTCCTTAGCCACTCCTTCTGTGACTCCAGC 3' (530bp) (SEQ ID NO:28);
mIFN-.beta., 5' AAGATCATTCTCACTGCAGCC 3' (SEQ ID NO:29) and 5'
TGAAGACTTCTGCTCGGACC 3' (586 bp) (SEQ ID NO:30). The IRF-1 probe
was prepared as described previously (K. Suzuki, et al., Proc Natl
Acad Sci USA, 96:2285-90 (1999)).
[0470] Real time PCR: Total RNA was isolated using Trizol.RTM.
(Invitrogen, Carlsbad, Calif.). In order to eliminate any carry
over of genomic DNA, total RNA was treated with DNAse using the
DNA-free.TM. kit (Ambion, Austin, Tex.). cDNA was synthesized from
total RNA using the Advantage.RTM. RT for PCR (BD Biosciences, Palo
Alto, Calif.). Briefly, 1 .mu.g of total RNA was used in a 50 .mu.l
reaction mixture with the random hexamer primer. Real time primers
and FRET probes for TNF-.alpha. IL-6, IL-12p40, and GAPDH, were
purchased from (Biosource, Camarillo, Calif.) and were used
according to the manufacturer's instructions. Briefly, 2.5 .mu.l of
cDNA template was used in a 25 .mu.l real time PCR reaction with
ABI Taqman.RTM. Universal Master Mix (Applied Biosystems,
Branchburg, N.J.). The IFN-.beta. reactions were done with
Sybr.RTM. green dye using the Quantitect Sybr.RTM. Green kit
according to the manufacturer's instructions using 1 .mu.l of cDNA
template in a 25 .mu.l reaction volume. Primers used for IFN-.beta.
were as follows 5' ATGAGTGGTGGTTGCAGGC 3' (SEQ ID NO:31) and 5'
TGACCTTTCAAATGCAGTAGATTCA 3' (SEQ ID NO:32). Thermal cycling
conditions consisted of 10 min at 95.degree. C. followed by 40
cycles of 15 s at 95.degree. C. and 1 min at 60.degree. C. in a
Bio-Rad iCycler iQ Real-Time PCR Detection System (Bio-Rad,
Hercules, Calif.).
[0471] Threshold cycle (Ct) values were calculated with the iCycler
iQ software (Bio-Rad, Hercules, Calif.). A standard curve for each
gene was prepared from a 10-fold dilution series of the
corresponding cDNA. The standard curves were plotted in terms of
number of cDNA molecules (copy number) vs. threshold cycle (Ct).
The software was then used to calculate copy number of starting
cDNA in each sample based on the standard curve for the gene of
interest. Copy number for each gene was then normalized against
GAPDH. We determined the affect of C10 on LPS induced mRNA level,
given as the n-fold decrease in transcription for the gene of
interest by normalization to the RNA level determined from the
standard curve for GAPDH and relative to expression levels before
LPS stimulation (basal levels).
[0472] Standard reverse transcriptase PCR for INOS: RNA was
isolated as described above and treated with DNAse a described
above. One fig of DNA free RNA was then reverse transcribed with
the Advantage.RTM. RT-for PCR kit (BD Biosciences, Palo Alto,
Calif.) in a total volume of 20 .mu.l. Five .mu.l of cDNA was then
amplified using ExTaq.TM. DNA polymerase (Takara, Madison, Wis.) in
a reaction volume of 25 .mu.l. Thermal cycling conditions consisted
of 94.degree. C. for 3 min followed by 35 cycles of 94.degree. C.
10s, 58.degree. C. 30s, and 72.degree. C. for 45s. Primer sequences
were the same as in example 3. Twenty .mu.l of each reaction was
resolved on a 2% agarose gel and ethidium bromide stained.
[0473] Immunoblot analysis of RAW 264.7 and mouse tissues: Nuclear
and cytoplasmic extracts for RAW cells were prepared using
NE-PER.RTM. extraction reagents (Pierce, Rockford, Ill.) in the
presence of a protease inhibitor mixture (PMSF, leupeptin, and
pepstatin A). Mouse tissues were homogenized in 1.times.PBS,
homogenate was pelleted by centrifugation and PBS removed prior to
lysis in lysis buffer (150 mM NaCl, 1% IGE-PAL CA 630, and 50 mM
Tris-HCl, pH 8.0) in the presence of a protease inhibitor mixture
(PMSF, leupeptin, and pepstatin A). Twenty five .mu.g of nuclear
cytoplasmic, or whole tissue lysate were resolved on 3-8%
Tris-Acetate PAGE gels under denaturing conditions using the NuPAGE
Bis-Tris System (Invitrogen Life Technologies, Carlsbad, Calif.),
then transferred to nitrocellulose membranes, which were probed
with rabbit anti-human phospho-Stat1 (Tyr 701) Ab (9171; Cell
Signaling Technology, Beverly, Mass.) for detection of activated
Stat-1 then stripped and reprobed with rabbit anti-human Stat1
p84/p91 (E-23)X Ab (sc-346X; Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.) for detection of unactivated Stat1 as a loading
control. Binding of HRP-conjugated goat anti-rabbit Ab (sc-2054;
Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) was detected
using the ECLplus Western Blotting Detection System (Amersham
Biosciences, Piscataway, N.J.).
[0474] EMSA in RAW 264.7 cells: Nuclear extracts were prepared
using NE-PER.RTM. extraction reagents (Pierce Chemical Co.;
Rockford, Ill.) in the presence of a protease inhibitor cocktail
(PMSF, Leupeptin, Pepstatin-A). Oligonucleotide sense strand probe
sequences were as follows MxISRE probe: 5' CGGAGAAACGAAACTAAGATC-3'
(SEQ ID NO:33) and. the IFN-.beta.-IRF site probe:
5'-GACATAGGAAAACTGAAAGGGAGAAGTGAAAGTGGGAA-3' (SEQ ID NO:34).
Oligonucleotides (sense and antisense strands) (Biosynthesis Inc.;
Lewisville, Tex.) were annealed and the resultant double stranded
oligonucleotides precipitated, then end-labeled with .sup.32P-ATP
using T4 polynucleotide kinase enzyme. Binding reactions (20 min.,
room temperature) included .sup.32P-labeled probe (activity 100,000
cpm), 5 .mu.g RAW nuclear extract, 1 .mu.g poly (dI-dC), 1 mM DTT,
10% glycerol and 1.times. binding buffer. Binding buffer
(10.times.) for EMSA was 100 mM Tris-HCL (pH 7.5), 500 mM NaCl, 50
mM MgCl.sub.2, 10 mM EDTA (pH 8.0). In competition studies, nuclear
extracts were incubated with 100 fold molar excess of unlabeled
double stranded oligonucleotide. In supershift studies, nuclear
extracts were incubated with 2 .mu.g of appropriate antibodies to
IRF-1 (H-205; Santa Cruz Biotechnology, Santa Cruz, Calif.) or
IRF-3 (Active Motif, Carlsbad, Calif.). After the incubations,
reaction mixtures were electrophoresed (160V, room temperature) on
5% non-denaturing polyacrylamide gels containing 5% glycerol in
1.times. TBE (50 mM Tris, 50 mM boric acid, and 1 mM EDTA). Gels
were dried and autoradiographed.
Example 5
[0475] C10 protects horses from Endotoxic shock induced by LPS or
peritonitis.
[0476] Studies in mice can be argued to be nonrelevant to humans.
Often large animals with more close phylogenetic relationships to
humans and with diseases similar to those in humans are desired as
experimental models. Endotoxemia in horses is one such model of
endotoxic shock in humans. Endotoxemia in horses is caused by the
biological consequences of endotoxins in blood. Endotoxins are
structural components of the walls of gram negative bacteria, the
main representative molecule being lipopolysaccharide (LPS). LPS
can be released from the gut to its surrounding environment, i.e.
the peritoneal cavity and bloodstream. Once LPS reaches either, it
can interact with mononuclear phagocytic cells. This interaction
increases the sensitivity of those cells to endotoxins by 1000-fold
and induces an excessive response of an inflammatory cascade
including activation of arachidonic acid, activation of the TLR4
signal pathway, and activation of a coagulation cascade. The end
result is the production of pro-inflammatory mediators with
development of circulatory shock, e.g., TNF-.alpha..
[0477] The TNF-.alpha. synthesis and release, mediated through the
TLR4 signal, is associated with the synthesis of other inflammatory
mediators, including Interleukins 1, (IL-1) Interleukin 6 (IL-6),
prostaglandins and tissue factors such as acute phase protein (D.
D. Morris, J Vet Intern Med, 5:167-81 (1991); D. L. Hawkins, et
al., Vet Immunol Immunopathol, 66:1 -10 (1998); H. Kato, et al.,
Vet Immunol Immunopathol, 48:221-31 (1995)). Serum concentration of
IL-6 activity begins to increase approximately 1 hour after serum
TNF-.alpha. and peaks between 3 to 6 hours after onset of
endotoxemia. IL-6 and IL-1 mediate the endotoxin-induced febrile
response and are responsible for the inflammatory cascade, which
constitutes the acute phase response.
[0478] Superoxide radicals can react with endogenous nitric oxide
(NO), resulting in the production of peroxynitrite anions, which
are potent oxidizing agents (C. Gonzalez, et al., Biochem Biophys
Res Commun, 186:150-6 (1992); B. Zingarelli, et al., Br J
Pharmacol, 120:259-67 (1997); C. Gagnon, et al., FEBS Lett,
431:107-10, (1998)). Additionally, nitric oxide, is a well known
mediator of endotoxic shock tissue injury in animal and human (A.
Petros, et al., Cardiovasc Res, 28:34-9 (1994); P. Wang, et al.,
Arch Surg, 129:1137-43 (1994); J. A. Avontuur, et al., Circ Res,
76:418-25 (1995); C. Szabo, et al., Proc Biol Sci, 253:233-8
(1993); C. Szabo, Ann N Y Acad Sci, 851:422-5 (1998)). LPS is a
potent inducer of inducible nitric oxide synthase (iNOS) (P. P.
Wolkow, Inflamm Res, 47:152-66 (1998)) which catalyzes the
synthesis of large amounts of NO and peroxynitrite, which, among
other factors, are responsible for the late phase of hypotension,
vasospasm, cellular suffocation, apoptosis, lactic acidosis and
multi-organ failure in endotoxic shock in horses as well as another
animals and humans (P. P. Wolkow, Inflamm Res, 47:152-66 (1998)).
Indeed, experimental and clinical use of NOS inhibitors, which do
not differentiate clearly between constitutive endothelial NOS
(ceNOS) and iNOS, prevents LPS-induced hypotension (P. P. Wolkow,
Inflamm Res, 47:152-66 (1998)).
[0479] The intestinal lumen of the horse usually contains large
amount of endotoxins. It has been estimated that ceacum and ventral
colon of a normal horse contains more than 2 grams of endotoxin,
which is restricted to the intestinal lumen by an efficient mucosal
barrier. Thus, any pathology that damages the mucosal barrier will
allow the endotoxins to reach the peritoneal cavity and the blood
(D. D. Morris, J Vet Intern Med, 5:167-81 (1991); J. N. Moore, et
al., Can J Comp Med, 45:330-2 (1981); D. Chakravortty, et al.,
Microbiol Immunol, 43:527-33 (1999); J. Drabkova, Cesk Epidemiol
Mikrobiol Imunol 42:102-5, (1992)). Consequently, horses with
ischemic intestines experience the deleterious effects of
endotoxins before surgery and several days after the ischemic
intestine has been removed. The most common clinical findings in
affected animals include: alteration in mucous membrane color with
the presence of a "toxic line," prolongation of the capillary
refill time, increased heart and respiratory rates, reduced
borborygmi, fever, hemoconcentration, neutropenia, collapse and
abdominal pain.
[0480] Using a mouse model of inflammatory bowel disease and
colitis as well as endotoxic shock, C-10 exhibited suppressive
action on interferon inducibles genes, IP-10, IRF-1, and MCP-1, a
multiplicity of pro-inflammatory cytokine genes (TNF-.alpha., IL-1,
IL-6) as well as IRF-1 dependent genes (COX-2, iNOS).
[0481] C-10 inhibits IFN-.beta. and IRF-1 gene expression and/or
secretion in vitro in multiple cell systems (thyrocytes,
macrophages, human aortic vascular endothelial cells) and in vivo
in mouse models of colitis and toxic shock. Further, our results in
mice showed (Table 5) that mice were 100% protected against
LPS-induced toxic shock and death when C10 was administered as one
single dose before LPS injection. In Example 3, C-10 was able to
inhibit pro-inflammatory cytokines, adhesion molecules,
chemoattractant proteins, IRF-1, IFN-.beta., iNOS and COX-2 in the
target organs, as well as circulating inflammatory mediators in the
LPS-treated animals associated with the signs and symptoms of
endotoxic shock, i.e. the hypotension, multi-systemic failure and
disseminated intravascular coagulation.
[0482] Based on the foregoing data and background, we examined the
ability of C-10 to act as an effective therapeutic (i) on toxic
shock in a LPS induced horse model of endotoxic-shock and (ii) in a
horse model of peritonitis induced either by injecting foreign
endotoxin-laden caecal material from the gut into the peritoneal
cavity or by abdominal operative procedures to correct lesions
causing peritonitis.
[0483] Results
[0484] Establishment of clinical parameters of endotoxemia in
horses: We classified endotoxemia clinically, based on analyses of
symptoms and signs in the LPS treated group. Further, we took into
account symptoms at different stages: early symptoms, the collapse
or shock stage, and the normalization stage. In the early stage of
endbtoxemia (0:15, 0:30 to 1:00 hr after LPS injection), we
observed abundant sweating, excitation, weak muscular tone,
abdominal pain, diarrhea with watery deposits. We also observed
nasal discharge, significant respiratory distress (dyspnea),
increased respiratory rate (tachypnea), and increased cardiac rate
(tachycardia). The pulse was weak and undetectable and the
capillary refill time increased. Thirty (30) minutes after
endotoxin injection, all horses showed progressive decreases in
blood pressure until the animal developed a systolic pressure under
100 mmHg and a diastolic pressure under 70 mmHg. At this time all
horses became hypotensive and hypoxemic with strong cyanosis. The
increase of capillary refill time reached a peak but was still
significant during the time of circulatory shock, from 1 to 6
hours.
[0485] Oxygen saturation in blood (% sPO.sub.2) was decreased
coincident with the shock, causing the mucosal membranes to become
strongly cyanotic; total collapse followed shortly. At the time of
shock the digestive system was characterized by suppression of
borborygmi, suppression of intestinal ileocecal activity, abdominal
pain, colic, intestinal obstruction, strangulation and alteration
of the mucosal barrier. Temperature increased at 6 hours and was
normalized at 24 hours.
[0486] Laboratory studies detected hyperglycemia at 3 hours that
was normalized at 24 hours. Leucopenia developed at 3 hours and
normalized at 6 hours. Creatinine and urea in the blood were
increased several fold at 24 hours and normalized at 1 week post
LPS inoculation. These results showed that endotoxic shock induced
transient acute renal failure. An increased red cell concentration
was measured, likely due to the loss of water from blood and its
presence as edema in some organs.
[0487] Finally, 24 hours after LPS injection, there was
normalization of the blood pressure and normal sPO.sub.2, although
mucosal membranes remained hyperemic and cyanotic, suggesting that
hypoxemia and tissue perfusion had not recovered.
[0488] These changes are illustrated in Tables 9-13 which show
effects of LPS to cause increased respiratory distress, diarrhea,
and collapse as well as the ability of C10 to prevent these very
nearly in entirety.
[0489] As shown in Tables 9 and 10, C10 protects horses from
Endotoxic shock induced by LPS. Horses were treated with a
sub-lethal dose of LPS (10 .mu.g/kg) after pretreatment with pure
DMSO (10 ml) or C10 (2 mg/kg) dissolved in 10 ml pure DMSO injected
intravenously (iv). Horses with LPS developed toxic shock over a 24
hour period with hypotension, hypothermia, tachypnea, rapid pulse,
abnormal cardiograms, and, finally, collapse, whereas C10 treated
animals had none of these changes. The results in Tables 9 and 10
are from a typical experiment with LPS or LPS+DMSO vs. LPS+C10
treated animals studied at early time points and up to 24 hrs, with
1 week follow up, wherein cardiovascular parameters of circulatory
shock were measured: toxemia, congestion, and cyanosis.
TABLE-US-00011 TABLE 9 C10 protects horses from LPS-induced shock
as measured by Toxemia and Vascular Congestion Time (hours) LPS
Group LPS + DMSO Group LPS + c10 Group 0.00 Normal Normal Normal
0.15 0.3 Toxemic Toxemic + Weak Congestion 1.0 Toxemic ++ 3 Toxemic
+ Toxemic ++++ Weak Congestion 6 Toxemic ++ Toxemic ++++ 24 Toxemic
Toxemic ++ Normal 1 week Normal Normal Normal
[0490] TABLE-US-00012 TABLE 10 C10 protects horses from LPS-induced
shock as measured by Toxemia, Vascular Congestion, Cyanosis Time
(hours) LPS Group LPS + DMSO Group LPS + c10 Group 0.00 Normal
Normal Normal 0.15 Toxemic Toxemic Normal 0.3 Toxemic Toxemic Weak
Congestion 1.0 Toxic Line Toxic Line 3 Cyanotic Cyanotic +++
Cyanotic Weak Congestion +++ +++ 6 Cyanotic +++ 24 Toxemic Toxemic
Normal Toxic Line Toxic Line 1 week Normal Normal Normal
[0491] The ability of C10 to protect horses from Endotoxic shock
induced by LPS is also evidenced in Tables 11 and 12. Horses were
treated with a sub-lethal dose of LPS (10 .mu.g/kg) after
pretreatment with pure DMSO (10 ml) or C10 (2 mg/kg) in 10 ml pure
DMSO injected iv. Horses with LPS developed toxic shock over a 24
hour period with decreased blood pressure, hypothermia, rapid
respiration, rapid pulse, abnormal cardiograms, and, ultimately,
collapse, whereas C10 treated animals had none of these changes.
Tables 11 and 12 depict a typical experiment comparing LPS or
LPS+DMSO vs. LPS+C10 treated animals studied at early time points
and up to 24 hrs, with 1 week follow up, wherein fluid in the lungs
was measured by auscultation, as well as tachypnea, and dyspnea.
They demonstrate that C10 suppresses the signs of pulmonary
distress suffered during toxic shock. TABLE-US-00013 TABLE 11 C10
protects horses from LPS-induced toxic shock as measured by Lung
Auscultation. Time LPS + DMSO (hours) LPS Group Group LPS + c10
Group 0.00 Normal Normal Normal 0.15 0.3 Crackles Crackles Normal
1.0 3 Crackles Crackles Normal 6 Wheezes Wheezes 24 Crackles
Crackles Normal Wheezes Wheezes 1 week Normal Normal Normal
[0492] TABLE-US-00014 TABLE 12 C10 protects horses from LPS-induced
toxic shock as measured by Dyspnea and Tachypnea. Time LPS + DMSO
(hours) LPS Group Group LPS + c10 Group 0.00 Normal Normal Normal
0.15 Dyspnea Dyspnea Normal Tachypnea Tachypnea 0.3 Dyspnea Dyspnea
Normal 1.0 Tachypnea Tachypnea 3 Dyspnea Dyspnea Normal 6 Tachypnea
Tachypnea 24 Dyspnea Dyspnea Normal 1 week Normal Dyspnea
Normal
[0493] As seen in Table 13, C10 also protects horses from Endotoxic
shock induced by LPS as measured by abdominal pain, diarrhea,
increased number of stools, and collapse or prostration to a lying
rather than standing state. Horses were treated with a sublethal
dose of LPS (10 .mu.g/kg) after pretreatment with 10 ml of pure
DMSO or C10 (1 mg/kg) in 10 ml of pure DMSO injected iv. Horses
with LPS developed toxic shock over a 24 hour period with decreased
blood pressure, hypothermia, rapid respiration, rapid pulse,
abnormal cardiograms, and total prostration or collapse, whereas
C10 treated animals had none of these changes. Table 13 depicts
typical LPS or LPS+DMSO vs. LPS+C 10 treated animals studied at
early time points and up to 24 hrs, with 1 week follow up, wherein
abdominal pain, watery diarrhea, number of stools, and collapse to
a lying state vs. normal gastrointestinal function and disposition
were measured. The severe abdominal pain, diarrhea, and increased
frequency of stools were evident in a typical LPS or LPS+DMSO
treated animal by 3 hours as was the collapse and shock response of
LPS treated animals. None of this occurred in animals treated with
LPS plus C10. These data are representative of all animals in each
group. TABLE-US-00015 TABLE 13 C10 protects horses from Endotoxic
shock induced by LPS as measured by abdominal pain, diarrhea,
increased number of stools, and collapse or prostration to a lying
rather than standing state Time (Hours) LPS Group LPS + DMSO LPS +
C10 0 normal normal normal 0.15-6 Abdominal pain Abdominal pain
Normal Diarrhea Diarrhea 1 stool 10 .+-. 2 stools 10 .+-. 2 stools
Collapsed and Collapsed and prostrate prostrate 24 normal Weak but
upright normal 1 week normal normal normal
[0494] Phenylmethimazole (C10) protects horses form LPS-induced
endotoxemia and endotoxic shock: In sum, C-10 clearly blocked
symptoms of endotoxemia including hypotension and hypoxemia, as
well as endotoxic shock collapse, cardiac anoxia, acute renal
failure, and loses of water from blood in all respects (Tables
9-13). In contrast the DMSO vehicle had no protection from
hypotension, hypoxemia, shock, collapse and organ failure after
endotoxin (LPS) inoculation (Tables 9-13).
[0495] Phenylmethimazole (C10) protects horses form
peritonitis--induced endotoxemia and endotoxic shock: C10 protected
horses from endotoxic shock and death by septic peritonitis induced
by intestinal fluid. After intestinal (caecal) fluid was inoculated
intraperitoneally into normal horses, the animals rapidly exhibited
clear symptoms of endotoxemia, presumably because the fluid had
free endotoxin. C10 protected in the first stage of endotoxemia due
to free lipopolysaccharide present in the intestinal lumen (Table
14). Clinical evaluation of the animal at 0:30, 1, 3, 6, showed
clinical signs of endotoxemia in non C10 treated animal but not in
the C10 treated animal that were clinically protected from
endotoxemia.
[0496] At 12 hours, all animals began to develop clinical
peritonitis with abdominal pain and fever (Table 14). At this time
all animals started to be treated with antibiotics
(penicillin-streptomycin) in order to avoid clinical progression of
the bacterial infection and further release of LPS by bacterial
death. At 12 hours, one group of two animals was inoculated with
C10 (2 mg/kg) given intravenously in a bolus, whereas two other
horses remained without treatment, i.e. only with antibiotics. At
24 hours the non C10 treated animals were dead (Table 14), whereas
those animals treated with C10 survived with only a slight
depression and mild signs of endotoxemia (Table 14). After the C-10
bolus, the animals immediately got better, ate and drank water.
Signs of any collapse or depression disappeared within 15 minutes.
The survivors showed no signs of organ failure at 24 hours or even
1 week after the end of the experiment (Table 14), showing that
C-10 protected from organ failure (respiratory distress, acute
renal failure, hypotension, cardiac anoxia, and hypoxemia).
TABLE-US-00016 TABLE 14 C10 protects horses from death after
peritonitis induced by intraperitoneal injection of intestinal
(Caecal) fluid. Toxic Shock Symptoms (% of horses and severity %
survival measured as +, ++, etc.) Antibiotic C10 plus Antibiotic
C10 plus Time (Hours) Therapy Antibiotics Therapy Antibiotics 0.0
100 100 0 0 0.15 100 100 0 0 0.3 100 100 0 0 1 100 100 0 0 3 100
100 0 0 6 100 100 50 (+) 12 100 100 50 (++) 24 100 100 100 (+++) 36
0 ND 1 week 0 ND Bold and Italicized Values are statistically
significant from control group with antibiotics only. ND is not
determined. Toxic shock symptoms were measured as described
above.
[0497] As shown in Table 14, C10 protects horses from death after
peritonitis induced by intraperitoneal injection of intestinal
(Caecal) fluid. Animals were injected intraperitoneally with 100 ml
of caecal fluid containing bacteria and free endotoxin. One group
received an intravenous dose of 2 mg/kg C10 in 10 ml of 100% DMSO
30 min. before caecal fluid injection; the other group got 10 ml of
100% DMSO alone 30 min. before caecal fluid injection. Between the
time of caecal fluid injection and 12 hours post injection, C10
treated animals had minimal symptoms of endotoxemia by comparison
to DMSO control animals. At 12 hours all animals began to exhibit
signs of peritonitis. Horses treated with antibiotics only and who
had progressive signs of peritonitis, developed toxic shock over a
24 hour period with decreased blood pressure, hypothermia, rapid
respiration, rapid pulse, abnormal cardiograms, and collapse,
whereas C10 treated animals had none of these changes. Animals
pretreated with C10 received a second dose of 2 mg/kg C10 in 10 ml
of 100% DMSO at 12 hours whereas the other group got 10 ml of 100%
DMSO alone. Both groups were also given therapeutic doses of
penicillin and streptomycin at 12 hours. Animal plus C10 were
walking and eating, within 24 hours and had a full recovery in all
cases, whereas the others developed toxic shock in all cases and
died. This experiment combines several groups of two horses in each
group. These results indicate C10 is effective to prevent toxic
shock in horses subjected to peritonitis and endotoxic shock. The
treatment was 100% effective in 10 animals so treated, and was
effective even in repeat treatment of the same animals.
[0498] Effect of Phenylmethimazole (C10) on horses subjected to
operative procedures to repair necrotic bowels: A group of animals
were also subjected to an operative procedure that clamped vessels
in a small portion of bowel. Within 2 days, bowel necrosis and
peritonitis ensued. At that point animals were re-operated to
remove the necrotic bowel and treated with 2 mg/kg C10 or DMSO
alone pre-op and post-op for three days. Animals treated with C10
were walking and eating within 24 hours and had full recovery in
all cases, whereas those without C10 developed toxic shock in most
cases, were severely ill, and died. Both groups had the same
antibiotic therapy as used above. These results indicate C10 is
effective to prevent toxic shock in horses subjected to surgical
procedures or endotoxin administration.
[0499] In sum, endotoxemia and endotoxic shock are the leading
causes of death in horses, being intimately related to the
pathogenesis of gastrointestinal disorders that cause colic and
neonatal foal septicemia. Phenylmethimazole (C10) is a methimazole
derivative and lead compound of a family of tautomeric cyclic
thione drugs that block pathologic activation of TLR3/TLR4
signaling in nonimmune tissues, monocytes, macrophages, and
dendritic cells. They suppress the expression type I interferon
genes (e.g. INF-.beta.), interferon inducible genes (IP-10, IRF-1),
pro-inflammatory cytokines TNF-.alpha., IL-1.beta., IL-6,
chemokines such as MCP-1, COX-2 and iNOS. Endotoxemia and endotoxic
shock in horses are associated by the up-regulation of several
mediators, COX-2 dependent mediators such as prostaglandins,
TNF-.alpha., IL-1, IL-6 and iNOS. The Endotoxic shock survival rate
is strongly dependent on type I interferon transcription genes in
knock out rodent models. Using an endotoxemia horse model we
carried out clinical studies showing that phenylmethimazole (C10)
protects horses from clinical signs of endotoxemia and endotoxic
shock induced by E. coli lipopolysaccharide: hypotension,
hypoxemia, tachypnea, tachycardia, hypoxemia, respiratory distress,
abdominal pain and colic, watery diarrhea, intestinal hypomotility
and anus relaxation, acute renal failure, hyperglycemia and
circulatory shock or collapse. When we induced endotoxemia and
shock due to septic peritonitis using intraperitoneal inoculation
of intestinal flora, the C10 survival rate was 100% compared with
0% of survival in non-treated animal..
[0500] Material and Methods
[0501] Endotoxemia protection experiment: In order to determine the
effect of C-10 on experimental endotoxemia induced by E. coli LPS,
we used 3 groups of horses. In Group 1 (LPS group), horses were
injected with 10 .mu.g/kg of E. coli (055 LPS from Sigma, St.
Louis) by intravenous bolus injection as recommended by others (J.
N. Moore, et al., Equine Vet J, 13:95-8 (1981); G. E. Burrows, Am J
Vet Res, 40:991-8 (1979)). Group 2 horses (LPS+DMSO) were injected
with the same dose of vehicle (100% DMSO) and the effect of DMSO
alone was analyzed. Group 3 (LPS+C-10) horses were injected with
LPS plus 100% DMSO used as the vehicle. Horses from the different
groups were studied clinically at different time points. In the
groups LPS+C-10 and LPS+DMSO, C-10 and DMSO were injected 30
minutes before LPS.
[0502] Time 0 was defined as a normal horse before injection of
LPS. After LPS injection, we evaluated the animals at 15 minutes,
30 minutes, 1 hour, 3 hours, 6 hours, 24 hours and 1 week. We
evaluated changes in the following biological systems targeted by
LPS: cardiovascular, circulatory, abdominal, and pulmonary. Time of
capillary flow, integrity of the vessels and other vessel
alterations were evaluated clinically. Maximum venous blood
pressure (NIBP max.), minimum venous blood pressure (NIBP min.),
electrocardiogram (ECG), and oxygen saturation in blood
(PsO.sub.2), expressed by %, were determined using a Cardell
Monitor 9403. Study of normal abdominal intestinal activity,
ileocecal sphincter activity, number of depositions (stools) and
their characteristic (diarrhea), as well as anus muscular tone were
also evaluated clinically. Respiratory rate, dyspnea, pulmonary
auscultation, presence of fluid in the respiratory tract and
pulmonary congestion were evaluated clinically. Glucose, GOT
(glutamic oxalacetic transaminase enzyme), GPT (glutamic pyruvate
transaminase enzyme), creatinine, urea, hemogram, hemoglobin (Hb),
hematocrit (Ht), red cell number, PMN number (neutrophils,
eosinophils, basophils), monocyte number and lymphocyte number were
determined at different time points. Clinical observations were
recorded by skilled veterinarians who were unaware of which animal
received C10, i.e. results were evaluated in a blinded fashion.
[0503] Endotoxic shock survival experiments: The ceacum and ventral
colon of normal horses contain more than 2 g of free endotoxin as
well as gram-negative bacteria which are restricted to the
intestinal lumen by an intact intestinal barrier. The pathologies
that damage the mucosal barrier allow the endotoxins to reach the
peritoneal cavity as well as the blood. To evaluate the protective
effect of C-10 on horse endotoxic shock survival rate we injected
100 ml of ceacum fluid intraperitoneally to induce peritonitis and
endotoxic shock. Ceacal fluid was extracted from horse under
anesthesia. The group of horses that were inoculated
intraperitoneally with intestinal fluid developed clinical
peritonitis and symptoms of endotoxemia 12 hours after
intraperitoneal fluid inoculation.
[0504] All animals were treated with therapeutic doses of
penicillin and streptomycin. One group of horses was inoculated
with same dose of ceacal fluid and also treated with antibiotic 12
hours after fluid inoculation, but received C-10, 2 mg/kg,30
minutes before and 12 hours after the injection of caecal fluid. We
evaluated survival at 0-15-30 minutes, 1, 3, 6, 12, 18 and 24 hours
as well as 1 week later.
Example 6
[0505] Phenylmethimazole (C10) decreases TLR4-mediated inflammation
associated with atherosclerosis.
[0506] Atherosclerosis is a systemic disease of the circulation
involving abnormal TLR4 expression and signaling causing increases
in genes downstream, such as VCAM-1. Increased VCAM-1 on vascular
endothelial cells is important to attract leukocytes to the
inflammatory region. Atherosclerosis is more advanced in patients
with diabetes, hypertension, and hyperlipidemia. The epidemic of
obesity is associated with the epidemic of cardiovascular
complications broadly considered as atherosclerosis complications:
myocardial infarcts, strokes, etc. A drug that might attenuate the
inflammatory response has been suggested as potentially effective
by TLR4 knockouts. This does not eliminate lesions, because the
damaging insult, hyperlipidemia, remains. The oxidized lipids can
be construed as environmental signature molecules that elicit
inflammation when they penetrate the endothelial layer. An
important point, however, to recall is that lesions can be
selective--located primarily in one or another vascular bed.
Further they may be influenced by the inflammatory response that
causes swelling of the vessel wall and diminished size of the
lumen. That decrease in lumen, plus leukocyte/platelet binding
which further decreases the lumenal opening, results in occlusive
disease.
[0507] A critical component of many physiological and pathological
inflammatory processes is thus the adhesion of leukocytes to the
endothelium in the fluid dynamic environment of the circulation.
Leukocyte adhesion to the endothelium occurs through a cascade of
adhesive events involving tethering (i.e. attachment) to the
endothelium from the free stream, rolling on the apical surface of
the endothelium, cessation of rolling termed "arrest", spreading to
more pleomorphic shapes, and migration between adjacent endothelial
cells to reach the extravascular space. This adhesion cascade is
mediated, in part, by non-covalent bonds that form between
molecules present on the surface of the leukocyte (ligands such as
integrins) and cognate molecules present on the surface of the
endothelium (receptors; e.g. E-selectin, ICAM-1, VCAM-1).
[0508] The endothelial receptors for the leukocyte ligands are
commonly referred to as endothelial cell adhesion molecules
(ECAMs). Certain ECAMs known to play a role in leukocyte
recruitment are increased at sites of pathological inflammation.
For example, VCAM-1 is present in a localized fashion on aortic
endothelium that overlies early foam cell lesions in
atherosclerosis. The increased expression of ECAMs mediates, in
part, the selective recruitment of leukocytes to a site of
inflammation (T. A. Springer, Cell, 76:301-314, (1994)). The
up-regulated expression of ECAMs at sites of pathological
inflammation contributes to aberrant leukocyte adhesion and
infiltration of tissue that is a key component of inflammation and
disease progression and/or tissue damage [e.g VCAM-1 is
up-regulated at sites of developing and developed atherosclerotic
lesions (M. I. Cybulsky, et al., Science, 251:788-791 (1991)) and
participates in monocyte adhesion to the endothelium during
atherogenesis (F. W. Luscinskas, et al., J. Cell Biol., 125:1417-27
(1994); C. L. Ramos, et al., Circ. Res., 84:1237-44 (1999)). Thus,
a promising therapeutic approach for treating pathological
inflammation is to reduce aberrant leukocyte adhesion to the
endothelium via suppression of ECAMs (J. Panes, et al., Br. J.
Pharmacol., 126:537-550 (1999)).
[0509] ECAM expression is regulated at the gene level by the
activity of transcription factors. Pro-inflammatory cytokine (e.g.
TNF-.alpha.) treatment of endothelial cells stimulates the activity
of certain transcription factors (e.g. NF-.kappa.B) (M. J. May, et
al., Immunol. Today, 19:80-88 (1998)) and also induces the
expression of other transcription factors (e.g. IRF-1) (A. S.
Neish, et al., Mol. Cell Biol., 15:2558-2569 (1995)). The
active/induced transcription factors ligate to their respective
binding sites leading to ECAM gene transcription and ultimately
protein expression. Several therapeutics for pathological
inflammation work, at least in part, by modulating the activity of
transcription factors (E. M. Conner, et al., J. Pharmacol. Exp.
Ther., 282:1615-1622 (1997); J. W. Pierce, et al., J. Immunol.,
156:3961-3969 (1996); C. Weber, et al., Circulation, 91:1914-1917
(1995); J. W. Pierce, et al., J. Biol. Chem., 272:21096-21103
(1997); M. Umetani, et al., Biochem. Biophys. Res. Commun.,
272:370-4 (2000)). Indeed, compounds that block cytokine induced
ECAM expression at the transcription level have been shown to
inhibit leukocyte adhesion to the endothelium (J. W. Pierce, et
al., J. Immunol., 156:3961-3969 (1996); N. M. Dagia, et al., Am. J.
Phys., 285:C813-C822 (2003); C. Weber, et al., Circulation,
91:1914-1917 (1995); J. W. Pierce, et al., J. Biol. Chem.,
272:21096-21103 (1997)) and to reduce inflammation in animal models
(E. M. Conner, et al., J. Pharmacol. Exp. Ther., 282:1615-1622
(1997); J. W. Pierce, et al., J. Biol. Chem., 272:21096-21103
(1997)).
[0510] Phenyl methimazole (C10) could potentially serve this
purpose (N. M. Dagia, et al., J Immunol, 173:2041-9 (2004)). C10
(i) inhibits monocytic cell adhesion to cytokine inflamed human
aortic endothelial cells (HAEC) under in vitro flow conditions that
mimic conditions present in vivo, (ii) strongly inhibits
cytokine-induced HAEC expression of VCAM-1 via suppression of the
transcription factor IRF-1, and not NF-.kappa.B, (iii) has a more
modest effect on E-selectin expression and (iv) has very little
effect on ICAM-1 expression. While several other transcription
inhibitors are known, very few, if any, have been shown to
selectively suppress VCAM-1, to act via IRF-1, and to inhibit
monocytic cell adhesion to cytokine inflamed endothelium under
fluid shear. Use of C10 in atherosclerosis is thus a reasonable
consideration.
[0511] Previous work with the Apolipoprotein E-deficient
(ApoE.sup.-/-) mouse, a well-accepted model of human
atherosclerosis, revealed that VCAM-1 is present on endothelium at
lesion-prone sites (as early as 5 weeks) and developed lesions (Y.
Nakashima, et al., Arterioscler. Thromb. Vasc. Biol., 18:842-51
(1998)). Elegant studies by Ley's group (C. L. Ramos, et al., Circ.
Res., 84:1237-44 (1999)) demonstrated that monocytes exhibit
greatly increased adhesion to carotid arteries isolated from
ApoE.sup.-/- mice compared to carotid arteries isolated from
wild-type mice. This increased adhesion is mediated, in part, by
VCAM-1 (C. L. Ramos, et al., Circ. Res., 84:1237-44 (1999); M.
Kobayashi, et al., J Clin Invest, 111:1297-308 (2003)). Michelsen
et al.(K. S. Michelsen, et al., Proc Natl Acad Sci USA,
101:10679-84 (2004)) found that mice deficient in TLR4 had a
significant reduction in aortic plaque development in
atherosclerosis-prone apolipoprotein E-deficient (ApoE-/-) mice
suggesting an important role for TLR4 in atherosclerosis.
[0512] Results
[0513] The well-accepted ApoE.sup.-/- murine model (Y. Nakashima,
et al., Arterioscler. Thromb. Vasc. Biol., 18:842-51 (1998)) was
our animal model of atherosclerosis. In initial experiments, these
mice were fed a high fat diet and received injections of C10
intraperitoneally every other day or orally every other day. Mice
were sacrificed at 8 weeks and lesions characterized, including
VCAM-1 and TLR4 expression in accord with literature based studies
(Y. Nakashima, et al., Arterioscler. Thromb. Vasc. Biol., 18:842-51
(1998)). The heart, aorta and carotid artery were removed for
gross, microscopic and molecular analyses. This included
determination of lesion size and sectioning of tissue with
subsequent staining for presence and cell localization of ECAMs and
TLR4 at the protein level as well as assessment of
leukocyte/macrophage infiltration. Results from mice treated with
C10 were compared to controls to determine if C10 has a statistical
effect on lesions in the carotid arteries.
[0514] C10 reduced vascular inflammation in ApoE-/- mice fed a high
fat diet: C10 was given i.p. (1 mg/kg) every other day to mice for
8 weeks. Control mice received DMSO alone. Mice were sacrificed at
8 weeks and histopathology examined in different tissues as
determined by hematoxylin and eosin staining. In FIG. 15, sections
from the base of the aorta in C10 treated (FIG. 15, Panel A) and
untreated mice (FIG. 15, Panel B) are presented as well as sections
of the coronary artery vasculature in C10 treated (FIG. 15, Panel
C) and untreated mice (FIG. 15, Panel D). Vessels in the myocardium
were also compared in C10 treated and untreated mice. In Panel B,
the arrows show that the severity of the lesions in the base of the
aorta is markedly greater in untreated mice by comparison to C10
treated mice (Panel A). Similarly in Panel D, the picture is
representative of long sections of the coronary arteries that were
nearly fully occluded with plaque in untreated mice whereas in C10
treated mice (Panel C), coronary arteries were largely
unobstructed. Further, even where lesions were evident the lumens
of vessels remained patent. Vessels within the myocardium were
obstructed by plaque in the absence of C10 but patent and nearly
free of plaque in the mice treated with C10. Data are
representative of multiple slides taken from multiple animals.
[0515] When lesions were qualitatively evaluated, C10 reduced
disease severity and progression (Table 15) in association with
decreases in TLR4 mediated inflammatory markers (Table 15).
TABLE-US-00017 TABLE 15 Effect of C10 on Severity of Inflammation
and TLR4/VCAM-1 Staining CORONARY AND MYOCARDIAL VESSELS AORTIC
GROUP INFLAMMATION INFLAMMATION C10 +* +* No C10 ++++ +++
*Significant Decrease by C10 compared to No C10.
[0516] As shown in Table 15, atherosclerotic lesions are decreased
in C10 treated mice. Sections of the coronary arteries and
myocardium as well as the base of the aorta were compared in
untreated mice vs. C10 treated mice both for extent of lesion,
quality of lesion, overexpressed TLR4, overexpressed VCAM-1, and
extent of inflammation and plaque. Lesions and observations were
qualitatively evaluated using ++++ for severe to + for very mild.
C10 treated animals were clearly improved. The results indicated
that C10 decreased the widespread inflammatory response wherein
TLR4 positive cells abound and there are macrophages infiltrating
the area. Evaluation was double blinded.
[0517] The ApoE-/- model in mice is representative of changes in
human atherosclerotic plaques. Atherosclerotic lesions in human
tissues are associated with overexpressed TLR4 and VCAM-1. Sections
of the coronary arteries from surgically removed plaques were
immunstained with anti-TLR4 (FIG. 16, Bottom Right Panel),
anti-VCAM-1 (FIG. 16, Top Right Panel), anti-ICAM-1 (FIG. 16,
Bottom Left Panel) in sequential slices from the paraffin imbedded
block. An H &E stain (FIG. 16, Top Left Panel) shows the
occluded vessel with a foam cell, lipid laden "plaque" surrounded
by a muscle wall and myocardial tissue. VCAM-1 (dark grey color) is
overexpressed in the lesion but also in the endothelial layer
opposite the lesion area. TLR4 (dark grey color) is more expressed
in the area opposite the lesion and, surprisingly, throughout the
smooth muscle layer surrounding the vessel, particularly opposite
the plaque. TLR4 is also expressed in the myocardial musculature.
The expression suggests a widespread inflammatory response wherein
TLR4 positive cells abound be they macrophages infiltrating the
area or other cells. In all respects these data duplicate those in
the ApoE-/- mice and thus should be, like the lesions in the
ApoE-/- mice (Table 15), sensitive to C10 therapy.
[0518] C10 decreases IFN-.beta. induction of phosphorylation of
Stat1 and the activation of IRF-1 in human aortic endothelial cells
(HAEC): To evaluate vascular endothelial cells directly, we used
human aortic endothelial cells in culture. Fundamental to C10
action in vivo appeared to be its ability to inhibit the
IRF-3/IFN-.beta./Stat-1/IRF-1 signal pathway in vitro. Thus,
IFN-.beta. induction of IRF-1 protein was decreased by C10 (FIG.
17A, bottom, lanes 4 vs lane 2) and was not mimicked by the vehicle
alone (DMSO or D in FIG. 17A lane 3). In the same blot, stripped
and reprobed for an activated form of Stat1 (phosphorylated at
Y701), there was also a decrease of IFN-.beta. induced Stat1
phosphorylation (FIG. 17A, top, lanes 4 vs lane 2) and was not
mimicked by the vehicle alone (DMSO or D in FIG. 17A lane 3).
[0519] Tyrosine phosphorylation of Stat1 is one requirement for its
activation of downstream genes; tyrosine phosphorylation is
important in the dimerization process necessary for Stat binding to
promoter elements on sensitive genes. Another requirement is serine
phosphorylation, which contributes to full Stat1 transcriptional
activation. To evaluate effects on serine phosphorylation of Stat1
the following experiments were performed: (i) Rat thyrocytes
(FRTL-5) were infected (FIG. 17B, lane 2) or not (FIG. 17B, lane 1)
with Influenza A virus for 24 hours and then treated with either
DMSO (1%) (FIG. 17B, lane 3) or 1 mM C10 (FIG. 17B, lane 4); (ii)
Human aortic endothelial cells (HAEC) were incubated with 100U/mL
of hIFN-.beta. (Biosource, Camarillo, Calif.) for 2 hours in the
presence of either DMSO (1%) (FIG. 17B, lane 5) or 1 mM C10 (FIG.
17B, lane 6); and (iii) mouse macrophages (RAW 264.7) were
incubated for 3 hours with E. coli LPS serotype 0111 :B4 (Sigma,
Milwaukee, Wis.) at a concentration of 500 ng/mL either alone (FIG.
17B, lane 7) or in the presence of DMSO (0.5%) (FIG. 17B, lane 8)
or 0.5 mM C10 (FIG. 17B, lane 9). As can be seen in FIG. 17B,
IFN-.beta. given with vehicle control DMSO also increases serine
phosphorylation in HAEC (FIG. 17B lane 5) and this is decreased by
C10 (FIG. 17B, lane 6). The effect of C10 to reduce pathologically
induced serine phosphorylation of Stat1 is not limited to HAEC but
is also seen in FRTL-5 cells (FIG. 17B. lane 4 vs lanes 2 and 3)
and RAW cells (FIG. 17B, lane 9 vs lanes 7 and 8). Additionally, it
is not limited to pathologic induction by IFN-.beta. (FIG. 17B,
lane 6 vs 5), but also is effective in pathologic induction
mimicked with FluA infection (FIG. 17B lane 4 vs lanes 2 and 3) and
by pathologic induction mimicked by treatment of cells with LPS
(FIG. 17B, lane 9 vs lanes 7 and 8). In sum, C10 is a inhibitor of
IRF-3/IFN-.beta./Stat/IRF-1/ISRE activation pathways and blocks
pathologically increased effects on Stat1 tyrosine and serine
phosphorylation induced by TLR3/TLR4 pathologic signals in
nonimmune cells, monocytes, macrophages, and dendritic cells.
[0520] Compound 10 is an effective agent in a mouse model of
atherosclerosis even given every other day and evaluated 8 weeks
after insult onset (high fat feeding). However, it is also
effective at earlier time points. Thus, when we compared the effect
of C10 on mice at 4 weeks, given both orally and ip, there were
significant effects on weight. This strain of mice is the same as
used in obese animal studies related to the rapid onset of Type 2
diabetes (M. Fujimoto, et al., Diabetes, 54:1340-8, (2005)). In
this regard, chronic inflammation has been postulated to play an
important role in the pathogenesis of insulin resistance and linked
to overexpression of iNOS (M. Fujimoto, et al., Diabetes, 54:1340-8
(2005)). C10 decreased weight gain evident before the 4 week time
period and also reduced the inflammatory TLR4 mediated
response.
[0521] Materials and Methods
[0522] Experimental animals: Twenty female Apo E-/- mice (Jackson
Laboratory), 5 weeks old and weighing 14.5 g (average weight), were
divided in 4 groups: (1) animals treated with 10% DMSO; (2) animals
treated orally with C-10 in DMSO (1 mg/kg body weight); (3) animals
treated I/P with C-10 in DMSO (same dose); and (4) control animals
without treatment.
[0523] The treatment was done every other day (8 week expt) or
every day. The animals were fed on a Western-type diet (TD 88137
from Harlan, Teklan). The experiment was terminated after 4 or 8
weeks.
[0524] Tissue preparation: At the end of the experiment, the
animals were anesthetized by IP injection of Avertin 0.1 ml/5 g of
body weight. In situ perfusion-fixation was performed with PBS for
10 min followed by PBS/4% formaldehyde at 37.degree. C. Heart and
aorta were removed; the arch, thoracic and abdominal portions of
the aorta were dissected; and the surrounding tissues were
carefully removed. The tissues were post fixed by immersion in
PBS/4% formaldehyde over night at 4.degree. C. Tissue samples were
then washed 10 minutes with PBS; after dehydration they were
embedded in paraffin and sectioned (7 .mu.m thick). Sections were
stained with Hematoxylin-eosin and examined under a light
microscope.
[0525] Immunoblot analysis in HAEC: To determine if C10 blocks
IFN-.beta. mediated activation of tyrosine phosphorylation of Stat1
in HAEC we treated confluent HAEC with 100U/ml IFN-.beta. in the
absence or presence of C10 (1.0 mM), 0.25% DMSO (carrier control
for C10) for 2 hours. Whole cell lysates were prepared in lysis
buffer (150 mM NaCl, 1% IGE-PAL CA 630, and 50 mM Tris-HCl, pH 8.0)
in the presence of a protease inhibitor mixture (PMSF, leupeptin,
and pepstatin A). Twenty five .mu.g of lysate was resolved on 3-8%
Tri-Acetate PAGE gels under denaturing conditions using the NuPAGE
Bis-Tris System (Invitrogen Life Technologies, Carlsbad, Calif.),
then transferred to nitrocellulose membranes, which were probed
first with rabbit anti-human IRF-1 (H-205) Ab (sc-13041; Santa Cruz
Biotechnology, Inc., Santa Cruz, Calif.), membranes were then
stripped and reprobed with rabbit anti-human phospho-Stat-1 (Tyr
701) Ab (9171; Cell Signaling Technology, Beverly, Mass.) for
detection of activated Stat1. Binding of secondary HRP-conjugated
goat anti-rabbit Ab (sc-2054; Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.) was detected using the ECLplus Western Blotting
Detection System (Amersham Biosciences, Piscataway, N.J.).
[0526] The affect of C10 on Stat1 serine phosphorylation at residue
727 was observed by Western blot using a phophoserine specific
Stat1 antibody (Biosource, Camarillo, Calif.). Three different cell
types were stimulated as follows: (i) Rat thyrocytes (FRTL-5) were
infected with Influenza A virus for 24 hours and then treated with
either DMSO (1%) or 1 mM C10. (ii) Human aortic endothelial cells
(HAEC) were incubated with 100 U/mL of hIFN-.beta. (Biosource,
Camarillo, Calif.) for 2 hours in the presence of either DMSO (1%)
or 1 mM C10; (iii) Mouse macrophages (RAW 264.7) were incubated for
3 hours with E. coli LPS serotype 0111:B4 (Sigma, Milwaukee, Wis.)
at a concentration of 500 ng/mL either alone or in the presence of
DMSO (0.5%) or 0.5 mM C10. Twenty-five .mu.g of each whole cell
lysate was resolved by SDS-PAGE, blotted on nitrocellulose
membranes, then probed with the indicated antibodies. Loading was
controlled by stripping and re-probing with an antibody directed
against non phosphorylated Stat1 (Santa Cruz Biotechnology Inc.,
Santa Cruz, Calif.).
[0527] Discussion
[0528] We have demonstrated that phenylmethimazole (C10), a lead
compound of the methimazole, methimazole derivative, tautomeric
cyclic thione family is effective to reduce pathologic TLR3/TLR4
overexpression and/or signaling in nonimmune cells, monocytes,
macrophages, and dendritic cells. We have demonstrated this both in
vitro and in vivo and shown this action has efficacy in diseases
representative of each: Type 1 diabetes (TLR3) and Endotoxic shock,
colitis, and atherosclerosis (TLR4). We have demonstrated efficacy
not only in mice but also in horses afflicted with a disease
mimicking a human disease state. By analogy, this drug should be
effective in any disease with pathologic TLR expression and
signaling causing autoimmune-inflammatory diseases.
[0529] We demonstrate that nonimmune cells as well as macrophages
in continuous culture express basal levels of TLR3 or TLR4, that
the TLR3 or TLR4 are functional, and that their activation causes
increases or decreases in genes and gene products of two signal
paths which have been linked to TLR3 or TLR4 signaling via its
MyD88 and/or its TRIF adaptor protein: (i) the NF-.kappa.B and
ERK1/2 MAPK path reputed to emanate from TRAF6 interactions and
(ii) the IRF-3 and IFN-.beta. signal path. These observations are
relevant not only to mouse or rat cells (FRTL-5 thyrocytes, RAW
macrophages) but human as well (HAEC, NPA thyrocytes, HUVEC). The
C10 effect is shown to be applicable to multiple pathologic stimuli
from infectious agents to dsRNA and to noxious environmental
insults such as hyperlipidemias linked to overeating high lipid
containing diets.
[0530] We have demonstrated that TLR3/4 overexpression and
signaling, with its downstream cytokine-mediated inflammatory
response, can be blocked by C10 and this family of compounds in
vitro and in vivo. We show that disease caused by transfection by
dsRNA mimics infection by a virus (Influenza A), which is a single
strand RNA virus whose replication and activity after infection is
likely to be mimicked by the dsRNA transfection. Reports in
pancreatic cell systems associated with insulinitis and diabetes as
well as lung epithelial cells associated with pulmonary autoimmune
inflammatory disorders also link virus infection, dsRNA
transfection, and TLR3 overexpression, indicating this phenomenon
and the action of C10 is applicable to nonimmune cells in multiple
tissues.
[0531] We show that TLR3 and IFN-.beta. protein are expressed in
situ in thyrocytes from patients with Hashimoto's thyroiditis which
are surrounded by immune cells but not in thyrocytes from normal
individuals or Graves' autoimmune hyperthyroidism, a novel finding
never previously demonstrated. The results from human thyrocytes in
culture indicate that TLR3 activation and increases can occur in a
human as well as rat thyrocyte in culture and this can occur in the
absence of lymphocytes or a lymphocyte-produced IFN, since
lymphocytes primarily produce type II interferon (63). The results
thus raise the possibility that thyrocytes are affected by a
primary insult that activates the TLR3 system to produce an innate
immune response mimicking that of a dendritic cell. The resultant
cytokine and co-stimulatory molecule changes in the thyrocyte may
then contribute to attracting lymphocytes to the gland, since
unlike dendritic cells, the thyrocytes cannot migrate to the
lymphoid organ.
[0532] The results in thyrocytes are startlingly similar to studies
of another disease with TLR3 involvement and overexpression, a role
for pathogen induction and dsRNA, involvement of a Type 1 IFN as an
apparent autocrine/paracrine factor, immune cell infiltrates, and
cell specific destruction causing hypofunction: insulinitis and
type 1 diabetes (D. Devendra, et al., Clin Immunol, 111:225-33
(2004); L. Wen, et al., J Immunol, 172:3173-80 (2004)). Wen, et al.
(L. Wen, et al., J Immunol, 172:3173-80 (2004)) show that dsRNA
could induce insulinitis and type 1 diabetes in animals, consistent
with the known animal model wherein Coxsackie virus induces Type 1
diabetes in NOD mice. Devendra and Eisenbarth (D. Devendra, et al.,
Clin Immunol, 111:225-33 (2004)) emphasize human relevance and note
that enteroviruses have been the focus of many research studies as
a potential agent in the pathogenesis of type 1 diabetes. They note
that the mechanism of viral infection leading to .beta. cell
destruction involves IFN-.alpha. [a Type I IFN like IFN-.beta.].
They hypothesize that activation of TLR by double stranded RNA or
Poly-IC (a viral mimic), through induction of IFN-.alpha., may
activate or accelerate immune-mediated .beta. cell destruction.
They note that numerous clinical case reports have associated
IFN-.alpha. therapy with autoimmune diseases [thyroiditis, in
particular (see below)] and that elevated serum IFN-.alpha. levels
have been associated with Type 1 diabetes as well as thyroid
autoimmune/inflammatory disease (M. F. Prummel, et al., Thyroid,
13:547-51 (2003)). Taken together with data in the present report,
the possibility is raised of an important mechanistic association
relevant to disease pathogenesis. Hashimoto's and Type 1 diabetes
may have immune cell infiltrates and destructive thyrocyte or
.beta.-cell changes because of a primary insult to the specific
tissue cell that activates TLR3 and an innate immune response in
the tissue cells; this may be an early event in the pathogenic
mechanism (D. Devendra, et al., Clin Immunol, 111:225-33 (2004); L.
Wen, et al., J Immunol, 172:3173-80 (2004); B. Beutler, Nature,
430:257-63 (2004); K. S. Michelsen, et al., J Immunol, 173:5901-7
(2004)).
[0533] Devendra and Eisenbarth suggest (D. Devendra, et al., Clin
Immunol, 111:225-33 (2004)) that therapeutic agents targeting
IFN-.alpha. [over production or activity] may potentially be
beneficial in the prevention of type 1 diabetes and autoimmunity.
We show a better effect would be suppression of the TLR-signaling
event increasing the type 1 IFN, rather than a partial action on
type 1 IFN only. Thus, we had asked whether TLR3
overexpression/signaling might be sensitive to the immunomodulatory
actions of methimazole (MMI) or its more potent derivative,
phenylmethimazole (C10) (M. Saji, et al., J Clin Endocrinol Metab,
75:871-8 (1992); V. Montani, et al., Endocrinology, 139:290-302
(1998); L. D. Kohn et al., U.S. Pat. No. 6,365,616 (2002); E.
Mozes, et al., Science, 261:91-3 (19.93); D. S. Singer, et al., J
Immunol, 153:873-80 (1994)) and show that C10, to a significantly
greater extent than MMI, blocks overexpression of TLR/TLR signaling
by inhibition of the TLR3 regulated IRF-3/IFN-.beta./ISRE/STAT
signal path not the TLR-MyD88-coupled NF-6B signal path. It acts
more broadly than just inhibition of IRF-3 transactivation and,
therefore, may inhibit activation of a broad range of ISRE
sequences on other genes. In this respect, it is notable that, in
addition to an NF-6B site, IRF-1 has a GAS, which binds Stat1. It
is reasonable to suggest that the ability of C10 to block IRF-1
gene expression, both herein and in our studies of C10 inhibition
of TNF-.A-inverted.-induced VCAM-1 and leukocyte adhesion, is
related to its action on components of the TLR3 regulated
IRF-3/IFN-.beta./ISRE/STAT signal path. In short, C10 may be an
example of an agent that meets the new therapeutic paradigm
requested by Davendra and Eisenbath in their review (D. Devendra,
et al., Clin Immunol, 111:225-33 (2004)) not by its effect solely
on Type 1 IFN, but by blocking the entire TLR3/4 mediated signal
path involving IRF-3/IRF-3/IFN-.beta./ISRE/STAT signal signaling.
We show C10 is particularly effective since it can block tyrosine
and serine phosphorylation important both in Stat1 dimerization and
full transcriptional activation, respectively. It is recognized
that these different phosphorylation events can effect gene
activation differently, emphasizing the selectivity of C10 along
with its inability to directly inhibit NF-.kappa.B signaling. The
activation of NF-.kappa.B signaled genes is a normal process
controlling many genes in the absence of a disease state. Super
activation of the IRF-3/IFN-.beta./ISRE/STAT signal for example by
VAK kinases is a pathologic event induced, for example, by viral
infection. It is this that C10 inhibits. IRF-1 is normally not
expressed, is increased only in pathologic states, and is
effectively blocked by C10 therapy.
[0534] TLR signaling remains complex with many unknowns. The role
of PI3 kinase and Akt involvement in phosphorylation of IRF-3 has
recently emerged (S. N. Sarkar, et al., Nat Struct Mol Biol,
11:1060-7 (2004)); full phosphorylation of IRF-3 requires TBK-1 and
Akt. Reactive oxygen species involvement in virus-induced
activation of STATs is recognized (T. Liu, et al., J Biol Chem,
279:2461-9 (2004)). The P38alphaMap kinase pathway is important in
downstream effectors that participate in Type I IFN-dependent gene
transcription and involvement (Y. Li, et al., J Biol Chem,
279:970-9 (2004)). Transcriptional activation of the IFN-.beta.
gene requires assembly of an enhanceosome containing transcription
factors ATF-2/c-Jun, IRF-3/IRF-7, NF-.kappa.B, and HMGI (Y) (D.
Panne, et al., Embo J, 23:4384-93 (2004))and thus indicates the two
signal paths are intertwined both at the earliest level of
IRF-3/IFN-.beta. activation as well as at downstream molecules such
as VCAM-1 gene expression. Nevertheless, our data are important
mechanistic steps and demonstrate at the very least C10 is a novel
agent both to help dissect the complexity of the TLR3/4 signal
pathway but more importantly to treat autoimmune-inflammatory
diseases induced by pathologic TLR3/TLR4 expression and signaling
in nonimmune cells, macrophages, monocytes, and dendritic
cells.
[0535] Our previous description of C10 efficacy in inhibiting
TNF-.A-inverted.-induced VCAM-1 gene expression and leukocyte
adhesion is highly relevant to atherosclerosis and colitis, two
other diseases where TLR4 overexpression or signaling in nonimmune
cells is linked to autoimmune/inflammatory disease (K. S.
Michelsen, et al., Proc Natl AcadSci USA, 101: 10679-84 (2004); G.
Pasterkamp, et al., Eur J Clin Invest, 34:328-34 (2004); G.
Andonegui, et al., J Clin Invest, 111: 1011 -1020 (2003); B.
Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J
Immunol, 173:5901-7 (2004); N. M. Dagia, et al., J Immunol,
173:2041-9 (2004); C. Fiocchi, Am J Physiol, 273:G769-75, (1997);
N. Harii, et al., Mol Endocrinol,19:1231-50 (2005))..
[0536] It is reasonable to conclude that Hashimoto's may,
therefore, not only be grouped with insulinitis and Type 1
diabetes, but also with colitis and atherosclerosis as
autoimmune/inflammatory diseases associated with TLR3/4
overexpression and signaling in nonimmune cells, whose
overexpression involves induction by molecular signatures of
environmental pathogens (K. S. Michelsen, et al., Proc Natl Acad
Sci US A, 101:10679-84 (2004); G. Pasterkamp, et al., Eur J Clin
Invest, 34:328-34 (2004); D. Devendra, et al., Clin Immunol,
111:225-33 (2004); L. Wen, et al., J Immunol, 172:3173-80 (2004);
G. Andonegui, et al., J Clin Invest, 111: 1011-1020 (2003); B.
Beutler, Nature, 430:257-63 (2004); K. S. Michelsen, et al., J
Immunol, 173:5901-7 (2004); C. Fiocchi, Am J Physiol, 273:G769-75
(1997); N. Harii, et al., Mol Endocrinol,19:1231-50 (2005)).
[0537] The DSS model is used to study ulcerative colitis and
Crohn's disease. Recent work indicates that TLR4 is strongly
up-regulated in both (E. Cario, et al., Infect Immun, 68:7010-7
(2000)) and that enterocolitis in another mouse enterocolitis model
is significantly improved in TLR4-deficient mice. These data
indicate the importance of innate immunity and TLR4 in
Th1-dependent enterocolitis (M. Kobayashi, et al., J Clin Invest,
111:1297-308 (2003)) and thus the importance of C10 in blocking
TLR4 overexpression in vitro and in vivo in colonic epithelial
cells in the DSS model.
[0538] Without wishing to be bound be theory in any way herein, it
is reasonable to speculate that Hashimoto's and Type 1 diabetes may
be prototypes of each other and that studies in FRTL-5 thyrocytes
are a relevant model for studies in pancreatic .beta. islet cells
and diabetes. High glucose levels can transcriptionally increase
MHC I expression and amplify interferon-(action in FRTL-5 thyroid
cells (G. Napolitano, et al., Endocrinology, 143:1008-17 (2002)).
In retrospect, this is applicable to the islet cell changes induced
by high glucose levels.
[0539] We(N. Harii, et al., Mol Endocrinol,19:1231-50 (2005)), as
well as others (K. S. Michelsen, et al., Proc Natl AcadSci USA,
101:10679-84, (2004); G. Pasterkamp, et al., Eur J Clin Invest,
34:328-34, (2004); D. Devendra, et al., Clin Immunol, 111:225-33,
(2004); L. Wen, et al., J Immunol, 172:3173-80, (2004); G.
Andonegui, et al., J Clin Invest, 111:1011-1020 (2003); B. Beutler,
Nature, 430:257-63 (2004); K. S. Michelsen, et al., J Immunol,
173:5901-7 (2004); C. Fiocchi, Am J Physiol, 273:G769-75 (1997); L.
Guillot, et al., J Biol Chem, 279:2712-8 (2004)), show that Type I
IFN (IFN-.alpha. or .beta.) is an important factor in the innate
viral immune response. We suggest, an increase in Type I IFN gene
expression in nonimmune cells can result in an autocrine/paracrine
manner to further upregulate TLR3 by activation of IRFs. Type I
IFNs act as potent extracellular mediators of host defense and
homeostasis and lead to the synthesis of proteins that mediate
antiviral, growth inhibitory, and immunomodulatory responses. The
secreted Type I IFN can sensitize the same or adjacent cells to
dsRNA or dsDNA by increasing expression of dsRNA recognition
molecules such as TLR3 and PKR or dsDNA recognition by PKR. A
similar model invoking TLR3 and Type I IFN in the innate immune
response of nonimmune cells has been invoked in Influenza A
infected lung tissue (L. Guillot, et al., J Biol Chem, 279:2712-8
(2004)).
[0540] Because it is a protective cytokine, Type I IFNs have been
used in the clinical setting to treat hepatitis C and B, chronic
myelogenous leukemias, melanoma, and renal cancer (C. E. Samuel,
Clin Microbiol Rev, 14:778-809 (2001)). One side effect of Type I
IFN therapy is, however, a higher incidence of autoimmune disease.
The risk of Hashimoto's thyroiditis is increased with type I IFN
treatment in HCV hepatitis patients. Thyroid auto antibodies are
found in up to 20% of patients who receive treatment with type I
IFNs and approximately 5% of these patients develop clinical
hypothyroidism (P. Burman, et al., J Clin Endocrinol Metab,
63:1086-90 (1986); H. Gisslinger, et al., Clin Exp Immunol,
90:363-7 (1992); A. Imagawa, et al., J Clin Endocrinol Metab,
80:922-6 (1995)). Consistent with the possible autoimmune-inducing
activity of type I IFNs, upregulation of Type I IFNs was observed
in some patients with psoriasis, systemic lupus erythematosus and
insulin dependent diabetes mellitus (P. Schmid, et al., J
Interferon Res, 14:229-34 (1994); X. Huang, et al., Diabetes,
44:658-64 (1995); A. A. Bengtsson, et al., Lupus, 9:664-71 (2000);
L. Farkas, et al., Am J Pathol, 159:237-43 (2001)). Thus, C10
therapy supplants that of Type I Interferon since the latter is
only a partial therapy that can cause as well as cure disease,
whereas C10, methimazole, methimazole derivatives, and tautomeric
cyclic thiones offer a means to block total pathologic expression
of the autoimmune-inflammatory response.
[0541] Several last points are worth noting. The dsRNA transfection
was used to activate PKR-dependent NF-.kappa.B activation or a
separate kinase system leading to IFN-.beta. gene expression
through IRF-3 activation. The upstream mechanism resulting in IRF-3
activation following dsRNA transfection or viral infection in vitro
has been clarified. Pharmacological and molecular studies suggested
that a novel viral-activated serine/threonine kinase (VAK), instead
of PKR, might activate IRF-3 in response to cytosolic dsRNA (M. J.
Servant, et al., J Biol Chem, 276:355-63 (2001); M. J. Servant, et
al., J Interferon Cytokine Res, 22:49-58 (2002); M. J. Servant, et
al., J Biol Chem, 278:9441-7 (2003)).We now know this is a complex
phenomenon involving P13 kinase/Akt and 16B-related kinases
(IKK)-IKKepsilon/TANK binding kinase 1 (TBK1) (M. J. Servant, et
al., J Biol Chem, 276:355-63 (2001); M. J. Servant, et al., J
Interferon Cytokine Res, 22:49-58 (2002); M. J. Servant, et al., J
Biol Chem, 278:9441-7 (2003)). Consistent with these observations,
PKR-/- mice are physically normal and the induction of type I IFNs
by Poly (I:C) and virus is unimpaired, despite the evidence that
PKR is a major intracellular RNA-recognition molecule, leading to
an anti-viral cellular response.
[0542] Second, the sum of data suggests that the presence of
TLR3/TLR4 upregulation and signaling by dsRNA transfection or LPS
can account for the data in our previous study (K. Suzuki, et al.,
Proc Natl Acad Sci USA, 96:2285-90 (1999)) which showed that viral
infection, plasmid transfection, transfection of dsDNA, or
transfection of dsRNA into the cytoplasm of the cell could increase
expression of MHC class I, cause aberrant expression of MHC class
II, and cause the expression of other genes necessary for antigen
presentation (APC generation). The action of the dsRNA or dsDNA
transfection appeared to involve NF-.kappa.B activation but only
the dsRNA transfection, increased IFN-.beta. RNA levels (K. Suzuki,
et al., Proc Natl AcadSci USA, 96:2285-90 (1999)). These phenomena
were evidenced in other cells including monocytes and macrophages
and were associated with an immune-inflammatory response in animals
(K. J. Ishii, et al., J Immunol, 167:2602-7 (2001)). C10 by
blocking the TLR signal events, blocks these downstream
epiphenomena.
[0543] Last, the C10 family is effective on nonimmune cells,
macrophages, monocytes and dendritic cells but has been shown to be
minimally active on other immune cells. Further, the C10 family is
restrictive in its action on the IRF-3/Type 1 IFN/STAT/ISRE/IRF-1
signal; its effect on direct activities of the NF-.kappa.B signal
system is minimal. If IRF-1 is not expressed in the normal cell,
but only induced after pathologic induction, i.e. by virus
infection, LPS, dsRNA transfection, or noxious environmental
insult, this family of compounds is clearly selective in affecting
only pathologic overexpression leading to disease and not normal
host immune defenses. They appear to be selective agents.
[0544] In sum, these last four points emphasize the novelty and
usefulness of the present invention. They defy current thoughts
regarding therapy directed at immune cells by instead attacking
nonimmune cell events. They defy current concepts of attacking
genes causing disease susceptibility as the sole true therapeutic
approach, but rather attacks the common set of inciting
environmental events even in genetically susceptible animals. They
can thus prevent by blocking recurrent environmental events both as
causative agents (Type 1 diabetes, Hashimoto's, toxic shock) and
also remediate complications in chronic recurrent diseases such as
colitis and atherosclerosis.
Sequence CWU 1
1
34 1 15 DNA Artificial Sequence ISRE-Luc NF- kB-Luc reporter
element 1 tagtttcact ttccc 15 2 14 DNA Artificial Sequence ISRE-Luc
NF- kB-Luc reporter element 2 tggggacttt ccgc 14 3 15 DNA
Artificial Sequence NF- kB reporter element 3 tagtttcact ttccc 15 4
14 DNA Artificial Sequence NF- kB reporter element 4 tggggacttt
ccgc 14 5 30 DNA Artificial Sequence TLR3 primer 5 ccatcagcac
catgaaccca agtcctgccg 30 6 30 DNA Artificial Sequence TLR3 primer 6
ggacgtcctc ctcatcgtcg actacactgg 30 7 22 DNA Artificial Sequence
Human IFN-beta primer 7 tggcaattga atgggaggct tg 22 8 24 DNA
Artificial Sequence Human IFN-beta primer 8 tccttggcct tcaggtaatg
caga 24 9 32 DNA Artificial Sequence human IFN-beta promoter
sequence primer 9 cagggtaccg agttttagaa actactaaaa tg 32 10 25 DNA
Artificial Sequence human IFN-beta promoter sequence primer 10
gtactcgagc aaaggcttcg aaagg 25 11 22 DNA Artificial Sequence NF- kB
probe 11 agttgagggg actttcccag gc 22 12 22 DNA Artificial Sequence
NF- kB probe 12 gcctgggaaa gtcccctcaa ct 22 13 30 DNA Artificial
Sequence TNF-alpha primer 13 ccatcagcac catgaaccca agtcctgccg 30 14
30 DNA Artificial Sequence TNF-alpha primer 14 ggacgtcctc
ctcatcgtcg actacactgg 30 15 30 DNA Artificial Sequence Primer 15
ctcatctggg atcctctcca gccaagcttc 30 16 30 DNA Artificial Sequence
Primer 16 ccatggtttc ttgtgaccct gagcgacctg 30 17 23 DNA Artificial
Sequence Cox-1 primer 17 cccagagtca tgagtcgaag gag 23 18 22 DNA
Artificial Sequence Cox-1 primer 18 caggcgcatg agtacttctc gg 22 19
22 DNA Artificial Sequence Cox-2 primer 19 gcaaatcctt gctgttccaa tc
22 20 22 DNA Artificial Sequence Cox-2 primer 20 gcagaaggct
tcccagcttt tg 22 21 28 DNA Artificial Sequence iNOS primer 21
cccttccgaa gtttctggcg acagcggc 28 22 25 DNA Artificial Sequence
iNOS primer 22 ggctgtcaga gcctcgtggc tttgg 25 23 30 DNA Artificial
Sequence pORF9-mTNF-alpha primer 23 ccatcagcac catgaaccca
agtcctgccg 30 24 30 DNA Artificial Sequence pORF9-mTNF-alpha primer
24 ggacgtcctc ctcatcgtcg actacactgg 30 25 30 DNA Artificial
Sequence mIL-1beta primer 25 ctcatctggg atcctctcca gccaagcttc 30 26
30 DNA Artificial Sequence mIL-1beta primer 26 ccatggtttc
ttgtgaccct gagcgacctg 30 27 30 DNA Artificial Sequence mIL-6 primer
27 ccagttgcct tcttgggact gatgctggtg 30 28 30 DNA Artificial
Sequence mIL-6 primer 28 gtccttagcc actccttctg tgactccagc 30 29 21
DNA Artificial Sequence mIFN-beta primer 29 aagatcattc tcactgcagc c
21 30 20 DNA Artificial Sequence mIFN-beta primer 30 tgaagacttc
tgctcggacc 20 31 19 DNA Artificial Sequence IFN-beta primer 31
atgagtggtg gttgcaggc 19 32 25 DNA Artificial Sequence IFN-beta
primer 32 tgacctttca aatgcagtag attca 25 33 21 DNA Artificial
Sequence MxISRE probe 33 cggagaaacg aaactaagat c 21 34 38 DNA
Artificial Sequence IFN-beta-IRF site probe 34 gacataggaa
aactgaaagg gagaagtgaa agtgggaa 38
* * * * *