U.S. patent application number 11/368233 was filed with the patent office on 2006-09-14 for compositions for use in identification of adventitious viruses.
Invention is credited to Rangarajan Sampath.
Application Number | 20060205040 11/368233 |
Document ID | / |
Family ID | 36763115 |
Filed Date | 2006-09-14 |
United States Patent
Application |
20060205040 |
Kind Code |
A1 |
Sampath; Rangarajan |
September 14, 2006 |
Compositions for use in identification of adventitious viruses
Abstract
The present invention provides compositions, kits and methods
for rapid identification and quantification of adventitious
contaminant viruses by molecular mass and base composition
analysis.
Inventors: |
Sampath; Rangarajan; (San
Diego, CA) |
Correspondence
Address: |
MEDLEN & CARROLL LLP
101 HOWARD STREET
SUITE 350
SAN FRANCISCO
CA
94105
US
|
Family ID: |
36763115 |
Appl. No.: |
11/368233 |
Filed: |
March 3, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60658248 |
Mar 3, 2005 |
|
|
|
60705631 |
Aug 3, 2005 |
|
|
|
60732539 |
Nov 1, 2005 |
|
|
|
Current U.S.
Class: |
435/91.1 ; 435/5;
435/6.12; 435/6.17 |
Current CPC
Class: |
C12Q 1/6851 20130101;
C12Q 1/701 20130101 |
Class at
Publication: |
435/091.1 ;
435/006 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with United States Government
support under NIH contract N01 AI40100. The United States
Government may have certain rights in the invention.
Claims
1. An oligonucleotide primer 14 to 35 nucleobases in length
comprising at least 70% sequence identity with SEQ ID NO: 47.
2. An oligonucleotide primer 14 to 35 nucleobases in length
comprising at least 70% sequence identity with SEQ ID NO: 286.
3. A composition comprising the primer of claim 1.
4. The composition of claim 3 further comprising an oligonucleotide
primer 14 to 35 nucleobases in length comprising at least 70%
sequence identity with SEQ ID NO: 286.
5. The composition of claim 4 wherein either or both of said
primers comprises at least one modified nucleobase.
6. The composition of claim 5 wherein said modified nucleobase is
5-propynyluracil or 5-propynylcytosine.
7. The composition of claim 4 wherein either or both of said
primers comprises at least one universal nucleobase.
8. The composition of claim 7 wherein said universal nucleobase is
inosine.
9. The composition of claim 4 wherein either or both of said
primers further comprises a non-templated T residue on the
5'-end.
10. The composition of claim 4 wherein either or both of said
primers comprises at least one non-template tag.
11. The composition of claim 4 wherein either or both of said
primers comprises at least one molecular mass modifying tag.
12. A kit comprising the composition of claim 4.
13. The kit of claim 12 further comprising one or more primer pairs
wherein each member of said one or more primer pairs is of a length
of 14 to 35 nucleobases and has 70% to 100% sequence identity with
the corresponding member from the group of primer pairs represented
by SEQ ID NOs: 70:286, 165:286, 122:275, 100:336, and 61:324.
14. The kit of claim 12 further comprising at least one calibration
polynucleotide.
15. The kit of claim 12 further comprising at least one anion
exchange functional group linked to a magnetic bead.
16. A method for identification of a polyomavirus in a sample
comprising: amplifying nucleic acid from said polyomavirus using
the composition of claim 4 to obtain an amplification product;
determining the molecular mass of said amplification product;
optionally, determining the base composition of said amplification
product from said molecular mass; and comparing said molecular mass
or base composition with a plurality of molecular masses or base
compositions of known polyomavirus identifying amplicons, wherein a
match between said molecular mass or base composition and a member
of said plurality of molecular masses or base compositions
identifies said polyomavirus.
17. The method of claim 16 wherein said sample is a biological
product.
18. A method of determining the presence or absence of a
polyomavirus in a sample comprising: amplifying nucleic acid from
said sample using the composition of claim 4 to obtain an
amplification product; determining the molecular mass of said
amplification product; optionally, determining the base composition
of said amplification product from said molecular mass; and
comparing said molecular mass or base composition of said
amplification product with the known molecular masses or base
compositions of one or more known polyomavirus identifying
amplicons, wherein a match between said molecular mass or base
composition of said amplification product and the molecular mass or
base composition of one or more known polyomavirus identifying
amplicons indicates the presence of said polyomavirus in said
sample.
19. The method of claim 18 wherein said sample comprises a
biological product.
20. A method for determination of the quantity of an unknown
polyomavirus in a sample comprising: contacting said sample with
the composition of claim 4 and a known quantity of a calibration
polynucleotide comprising a calibration sequence; concurrently
amplifying nucleic acid from said unknown polyomavirus and nucleic
acid from said calibration polynucleotide in said sample with the
composition of claim 4 to obtain a first amplification product
comprising a polyomavirus identifying amplicon and a second
amplification product comprising a calibration amplicon;
determining the molecular mass and abundance for said polyomavirus
identifying amplicon and said calibration amplicon; and
distinguishing said polyomavirus identifying amplicon from said
calibration amplicon based on molecular mass, wherein comparison of
polyomavirus identifying amplicon abundance and calibration
amplicon abundance indicates the quantity of polyomavirus in said
sample.
Description
RELATED APPLICATIONS
[0001] The present application 1) claims the benefit of priority to
U.S. Provisional Application Ser. No. 60/658,248, filed Mar. 3,
2005; 2) claims the benefit of priority to U.S. Provisional
Application Ser. No. 60/705,631, filed Aug. 3, 2005; 3) claims the
benefit of priority to U.S. Provisional Application Ser. No.
60/732,539, filed Nov. 1, 2005 and 4) claims the benefit of
priority to U.S. Provisional Application Ser. No. 60/740,617, filed
Nov. 28, 2005. Each of the above listed U.S. Provisional
Applications is incorporated herein by reference in entirety.
Methods disclosed in U.S. application Ser. Nos. 10/156,608,
09/891,793, 10/418,514, 10/660,997, 10/660,122, 10,660,996,
10/660,998, 10/728,486, 10/405,756, 11/060,135, and 11/073,362, are
commonly owned and incorporated herein by reference in their
entirety for any purpose.
FIELD OF THE INVENTION
[0003] The present invention provides compositions, kits and
methods for rapid identification and quantification of adventitious
contaminant viruses by molecular mass and base composition
analysis.
BACKGROUND OF THE INVENTION
A. Adventitious Viruses
[0004] Adventitious viruses represent a major risk associated with
the use of cell-substrate derived biologicals, including vaccines
and antibodies, for human use. The possibility for viral
contamination exists in primary cultures and established cultures,
as well as Master Cell Banks, end-of-production cells, and bulk
harvest fluids. This is a major obstacle to the use of
neoplastic-immortalized cells for which the mechanism of
transformation is unknown is that these could have a higher risk of
containing oncogenic viruses. Extensive testing for the presence of
potential extraneous agents is therefore required to ensure the
safety of the vaccines. Among the methods used for this purpose are
animal inoculations, electron microscopy and in vitro molecular and
antibody assays that provide a screen for viral agents. Another
critical consideration for assessing the safety concerns associated
with viral vaccines is the detection of endogenous retroviral
sequences while using avian, murine, non-human primate, and human
cell lines. Endogenous retroviral sequences are an integral part of
eukaryotic genomes, and while the majority of these sequences are
defective, a few can produce infectious virus, either spontaneously
upon long-term culture. These can also be induced upon treatment
with various chemical or other agents that may be part of the
normal production system. The activation of an endogenous,
infectious retrovirus in a cell substrate that is used for the
production of biologics is an important safety concern, especially
in the case of live, viral vaccines, where minimal purification and
inactivation steps are used in order to preserve high vaccine
potency.
[0005] The currently established methods for measuring RT-activity
include the highly sensitive, product-enhanced reverse
transcriptase assays (PERT) that can detect 1-10 virions and
transmission electron microscopy (TEM) to analyze infective
retroviruses particles. However, the above techniques are not
specific and do not provide any information regarding the source of
the RT activity. PCR-based detection of retroviruses can be used in
combination with other assays such as reverse transcriptase,
electron microscopy infectivity or co-cultivation to increase the
sensitivity of detection or to identify a particular adventitious
agent present in the test sample. Further, while some studies
demonstrate that a low level of RT activity is not generally
associated with a replicating agent; major concerns remain
regarding the consequences of the presence of such non-productive,
non-replicating defective infections in the vaccine, as there is
the potential for integration into the host genome.
[0006] Retrovirus-induced tumorigenesis can involve the generation
of a novel pathogenic virus by recombination between
replication-competent and -defective sequences and/or activation of
a cellular oncogene by a long terminal repeat (LTR) due to upstream
or downstream insertion of retrovirus sequences. To address the
possible integration of extraneous retroviral sequences in human
cells by RT-containing particles, multiple PCR strategies have been
used. These include direct PCR of DNase-treated inoculum using
primers from the highly conserved pol region and Alu PCR using LTR
primers in conjunction with Alu primers that specifically amplify
viral-cellular DNA junctions of integrants.
[0007] Future strategies to detect adventitious agents must address
three fundamental problems. First, there are large numbers of known
viral agents that are potential contaminants, each with a large
number of potential strain variants. Second, history has shown that
not all adventitious agents fall into anticipated families of
viruses, so unanticipated virus families must also be considered.
Third, the test must be practical to perform on a large number of
samples in a standardized, high-throughput, quality-controlled
fashion. The premise of this proposal is that we can leverage
recently developed and validated methods using mass spectrometry
analysis of broad-range PCR reactions for rapid, sensitive,
cost-effective detection of broad ranges of adventitious agents,
including previously unknown/uncharacterized viruses and endogenous
retroviruses.
B. Drug Resistance
[0008] Drug resistance in bacteria and viruses is frequently
mediated by point mutations in key genes whose gene products
interact directly or indirectly with the drug. While there are
several methods available for identification of single nucleotide
polymorphisms (SNPs) in nucleic acid sequences, the functional unit
that encodes each amino acid is the codon, where three successive
nucleotides are responsible for encoding each amino acid. Mutations
in any of the three nucleotides may or may not result in a mutation
in the encoded amino acid, depending upon the particular amino acid
and the rules of the genetic code. Because the genetic code is
deciphered as a sequence, both the identity and the order of the
nucleotides are important in determining the encoded amino acid.
Thus, DNA sequencing has become the method of choice for analysis
of mutations that result in amino acid changes. DNA sequencing has
significant disadvantages as an analysis method for routine use a
clinical laboratory setting. It is still relatively expensive and
labor intensive, and thus is used only for very important analyses.
An example of this is determination of drug resistance in viruses
such as HIV and in bacteria such as methicillin-resistant
Staphylococcus aureus (MRSA). Drug resistance in HIV has now
emerged as a significant problem in both untreated and drug-treated
patient populations. The decision to select a particular
drug-treatment regimen that the virus will respond to is critical
to success of therapy. Drug resistance testing has been shown to
improve the clinical outcome in HIV-infected individuals and thus
is now recommended for new infections or for patients infected as
long as two years or more prior to initiating therapy, in the case
of antiretroviral failures and during pregnancy. Thus, despite the
costs, DNA sequencing is currently being used for determination of
viral drug resistance. Typically, a serum sample is analyzed by PCR
amplification of the reverse transcriptase and protease genes,
followed by sequencing of approximately 900 nucleotides of the
reverse transcriptase gene and 300 nucleotides of the protease
gene. The DNA sequence is then used to determine the optimal drug
regimen. A drawback of sequencing is that DNA sequencing technology
for identification of drug-resistant viruses is that it is not
easily able to identify the components present in a mixed sample,
particularly in a scenario where a fraction of the virus population
has mutated. DNA sequencing was developed on the assumption that
the sample being analyzed is homogeneous. However, the HIV
populations that infect humans are not homogeneous, and RNA viruses
such as HIV are known to rapidly mutate, creating a population of
mixed sequences in each infected individual. In the presence of
drug selection, mutations that mediate drug resistance that occur
at low frequency grow with a selective advantage and eventually can
dominate the population, causing treatment failure. In this
scenario, the mutant virus starts out as an undetectable fraction
of the population which increases to a higher percentage over time.
It would be valuable to identify drug resistant virus populations
early, before they have a chance to increase the viral load. DNA
sequencing methods can identify mixed populations, but do so
poorly. In a recent publication using the ABI PRISM 3100 genetic
analyzer, it was reported that a viral mixture containing
approximately 40% of the mutant viral population can be detected
with 95% confidence. However, 40% of a typical viral load (1,800 to
10,500 HIV copies/ml) means a blood burden (assuming 5 liters of
blood) of up to 21 million drug-resistant viral copies. Other
analytical methods are capable of identifying mutations with more
sensitivity than sequencing, but these methods are time consuming,
laborious and not amenable to high throughput processes.
[0009] Thus, there is a need for rapid and cost effective methods
that can be applied as alternatives to sequencing in genomic
analysis for variations that mediate amino acid changes. The
present invention satisfies this need. The present invention
provides, inter alia, methods of identifying adventitious
contaminant viruses. Also provided are oligonucleotide primers,
compositions and kits containing the oligonucleotide primers, which
produce amplification products whose molecular masses provide the
means to identify adventitious contaminant viruses at the
sub-species level.
SUMMARY OF THE INVENTION
[0010] The present invention provides compositions, kits and
methods for rapid identification and quantification of adventitious
contaminant viruses by molecular mass and base composition
analysis.
[0011] One embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 47.
[0012] Another embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 286.
[0013] Another embodiment is a composition of is an oligonucleotide
primer pair including an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 47 and an oligonucleotide primer 14 to 35 nucleobases in
length having at least 70% sequence identity with SEQ ID NO:
286.
[0014] One embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 70.
[0015] Another embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 286.
[0016] Another embodiment is a composition of is an oligonucleotide
primer pair including an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 70 and an oligonucleotide primer 14 to 35 nucleobases in
length having at least 70% sequence identity with SEQ ID NO:
286.
[0017] One embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 165.
[0018] Another embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 286.
[0019] Another embodiment is a composition of is an oligonucleotide
primer pair including an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 165 and an oligonucleotide primer 14 to 35 nucleobases
in length having at least 70% sequence identity with SEQ ID NO:
286.
[0020] One embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 122.
[0021] Another embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 275.
[0022] Another embodiment is a composition of is an oligonucleotide
primer pair including an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 122 and an oligonucleotide primer 14 to 35 nucleobases
in length having at least 70% sequence identity with SEQ ID NO:
275.
[0023] One embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 100.
[0024] Another embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 336.
[0025] Another embodiment is a composition of is an oligonucleotide
primer pair including an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 100 and an oligonucleotide primer 14 to 35 nucleobases
in length having at least 70% sequence identity with SEQ ID NO:
336.
[0026] One embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 61.
[0027] Another embodiment is an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 324.
[0028] Another embodiment is a composition of is an oligonucleotide
primer pair including an oligonucleotide primer 14 to 35
nucleobases in length having at least 70% sequence identity with
SEQ ID NO: 61 and an oligonucleotide primer 14 to 35 nucleobases in
length having at least 70% sequence identity with SEQ ID NO:
324.
[0029] In some embodiments, either or both of the primers of the
primer pair contain at least one modified nucleobase such as
5-propynyluracil or 5-propynylcytosine for example.
[0030] In some embodiments, either or both of the primers of the
primer pair comprises at least one universal nucleobase such as
inosine for example.
[0031] In some embodiments, either or both of the primers of the
primer pair comprises at least one non-templated T residue on the
5'-end.
[0032] In some embodiments, either or both of the primers of the
primer pair comprises at least one non-template tag.
[0033] In some embodiments, either or both of the primers of the
primer pair comprises at least one molecular mass modifying
tag.
[0034] Some embodiments are kits that contain the primer pair
compositions. In some embodiments, each member of the one or more
primer pairs of the kit is of a length of 14 to 35 nucleobases and
has 70% to 100% sequence identity with the corresponding member
from the group of primer pairs represented by SEQ ID NOs: 70:286,
165:286, 122:275, 100:336, and 61:324.
[0035] Some embodiments of the kits contain at least one
calibration polynucleotide.
[0036] Some embodiments of the kits contain at least one anion
exchange functional group linked to a magnetic bead.
[0037] In some embodiments, the present invention provides primers
and compositions comprising pairs of primers, and kits containing
the same, and methods for use in identification of adventitious
contaminant viruses. The primers are designed to produce
amplification products of DNA encoding genes that have conserved
and variable regions across a given viral family. The invention
further provides compositions comprising pairs of primers and kits
containing the same, which are designed to provide species and
sub-species characterization of adventitious contaminant
viruses.
[0038] In some embodiments, the present invention also provides
methods for identification of adventitious contaminant viruses.
Nucleic acid from the virus is amplified using the primers
described above to obtain an amplification product. The molecular
mass of the amplification product is measured. Optionally, the base
composition of the amplification product is determined from the
molecular mass. The molecular mass or base composition is compared
with a plurality of molecular masses or base compositions of known
adventitious contaminant virus identifying amplicons, wherein a
match between the molecular mass or base composition and a member
of the plurality of molecular masses or base compositions
identifies the adventitious contaminant virus. In some embodiments,
the molecular mass is measured by mass spectrometry.
[0039] In some embodiments, the present invention is also directed
to a method for determining the presence or absence of an
adventitious contaminant virus in a sample. Nucleic acid from the
sample is amplified using the composition described above to obtain
an amplification product. The molecular mass of the amplification
product is determined. Optionally, the base composition of the
amplification product is determined from the molecular mass. The
molecular mass or base composition of the amplification product is
compared with the known molecular masses or base compositions of
one or more known adventitious contaminant virus identifying
amplicons, wherein a match between the molecular mass or base
composition of the amplification product and the molecular mass or
base composition of one or more known adventitious contaminant
virus identifying amplicons indicates the presence of the
adventitious contaminant virus in the sample. In some embodiments,
the molecular mass is measured by mass spectrometry.
[0040] In some embodiments, the present invention also provides
methods for determination of the quantity of an unknown
adventitious contaminant virus in a sample. The sample is contacted
with the composition described above and a known quantity of a
calibration polynucleotide comprising a calibration sequence.
Nucleic acid from the unknown adventitious contaminant virus in the
sample is concurrently amplified with the composition described
above and nucleic acid from the calibration polynucleotide in the
sample is concurrently amplified with the composition described
above to obtain a first amplification product comprising an
adventitious contaminant virus identifying amplicon and a second
amplification product comprising a calibration amplicon. The
molecular mass and abundance for the adventitious contaminant virus
identifying amplicon and the calibration amplicon is determined.
The adventitious contaminant virus identifying amplicon is
distinguished from the calibration amplicon based on molecular
mass, wherein comparison of adventitious contaminant virus
identifying amplicon abundance and calibration amplicon abundance
indicates the quantity of adventitious contaminant virus in the
sample. In some embodiments, the base composition of the
adventitious contaminant virus identifying amplicon is
determined.
[0041] In some embodiments, the present invention provides methods
for detecting or quantifying adventitious contaminant virus by
combining a nucleic acid amplification process with a mass
determination process. In some embodiments, such methods identify
or otherwise analyze the adventitious contaminant virus by
comparing mass information from an amplification product with a
calibration or control product. Such methods can be carried out in
a highly multiplexed and/or parallel manner allowing for the
analysis of as many as 300 samples per 24 hours on a single mass
measurement platform. The accuracy of the mass determination
methods in some embodiments of the present invention permits allows
for the ability to discriminate between different adventitious
viruses such as members of the following families: p\
[0042] Papillomaviridae, Polyomaviridae, Retroviridae,
Parvoviridae, Herpesviridae (Human herpesviruses 1 through 8,
Bovine herpesvirus, Canine herpesvirus and Simian cytomegalovirus),
Hepadnaviridae (Hepatitis B virus), Hepeviridae (Hepatitis E
virus), Deltavirus (Hepatitis delta virus), Adenoviridae (Human
adenoviruses A-F and murine adenovirus), Flaviviridae (Bovine viral
diarrhea virus, TBE, Yellow fever virus, Dengue viruses 1-4, WNV
and hepatitis C virus), Paramyxoviridae (Pneumonia virus of mice,
Sendai virus, and Simian parainfluenza virus 5), Togaviridae
(Western equine encephalomyelitis virus), Picornaviridae (Polio
(types 1-13), Human hepatitis A, Human coxsackievirus, Human
cardiovirus, Human rhinovirus and Bovine rhinovirus), Reoviridae
(Mouse rotavirus, reovirus type 3 and Colorado tick fever virus),
and Rhabdoviridae (vesicular stomatitis virus).
BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The foregoing summary of the invention, as well as the
following detailed description of the invention, is better
understood when read in conjunction with the accompanying drawings
which are included by way of example and not by way of
limitation.
[0044] FIG. 1: process diagram illustrating a representative primer
pair selection process.
[0045] FIG. 2 is a process diagram illustrating an embodiment of
the calibration method.
DEFINITIONS
[0046] As used herein, the term "abundance" refers to an amount.
The amount may be described in terms of concentration which are
common in molecular biology such as "copy number," "pfu or
plate-forming unit" which are well known to those with ordinary
skill. Concentration may be relative to a known standard or may be
absolute.
[0047] As used herein an "adventitious virus" or "adventitious
viral agent" refers to a virus contaminant present within a
biological product, including, for example, vaccines, cell lines
and other cell-derived products. In some cases, the biological
product may provide a favorable environment for the survival of the
virus. In some embodiments, the biological products are those
useful in various experimental conditions for research in
biotechnology and clinical diagnosis or treatment in
pharmacology.
[0048] As used herein, the term "amplifiable nucleic acid" is used
in reference to nucleic acids that may be amplified by any
amplification method. It is contemplated that "amplifiable nucleic
acid" also comprises "sample template."
[0049] As used herein the term "amplification" refers to a special
case of nucleic acid replication involving template specificity. It
is to be contrasted with non-specific template replication (i.e.,
replication that is template-dependent but not dependent on a
specific template). Template specificity is here distinguished from
fidelity of replication (i.e., synthesis of the proper
polynucleotide sequence) and nucleotide (ribo- or deoxyribo-)
specificity. Template specificity is frequently described in terms
of "target" specificity. Target sequences are "targets" in the
sense that they are sought to be sorted out from other nucleic
acid. Amplification techniques have been designed primarily for
this sorting out. Template specificity is achieved in most
amplification techniques by the choice of enzyme. Amplification
enzymes are enzymes that, under conditions they are used, will
process only specific sequences of nucleic acid in a heterogeneous
mixture of nucleic acid. For example, in the case of Q.beta.
replicase, MDV-1 RNA is the specific template for the replicase (D.
L. Kacian et al., Proc. Natl. Acad. Sci. USA 69:3038 [1972]). Other
nucleic acid will not be replicated by this amplification enzyme.
Similarly, in the case of T7 RNA polymerase, this amplification
enzyme has a stringent specificity for its own promoters
(Chamberlin et al., Nature 228:227 [1970]). In the case of T4 DNA
ligase, the enzyme will not ligate the two oligonucleotides or
polynucleotides, where there is a mismatch between the
oligonucleotide or polynucleotide substrate and the template at the
ligation junction (D. Y. Wu and R. B. Wallace, Genomics 4:560
[1989]). Finally, Taq and Pfu polymerases, by virtue of their
ability to function at high temperature, are found to display high
specificity for the sequences bounded and thus defined by the
primers; the high temperature results in thermodynamic conditions
that favor primer hybridization with the target sequences and not
hybridization with non-target sequences (H. A. Erlich (ed.), PCR
Technology, Stockton Press [1989]).
[0050] As used herein, the term "amplification reagents" refers to
those reagents (deoxyribonucleotide triphosphates, buffer, etc.),
needed for amplification, excluding primers, nucleic acid template,
and the amplification enzyme. Typically, amplification reagents
along with other reaction components are placed and contained in a
reaction vessel (test tube, microwell, etc.).
[0051] As used herein, the term "anion exchange functional group"
refers to a positively charged functional group capable of binding
an anion through an electrostatic interaction. The most well known
anion exchange functional groups are the amines, including primary,
secondary, tertiary and quaternary amines.
[0052] The term "bacteria" or "bacterium" refers to any member of
the groups of eubacteria and archaebacteria.
[0053] As used herein, a "base composition" is the exact number of
each nucleobase (for example, A, T, C and G). For example,
amplification of nucleic acid of Neisseria meningitidis with a
primer pair that produces an amplification product from nucleic
acid of 23S rRNA that has a molecular mass (sense strand) of
28480.75124, from which a base composition of A25 G27 C22 T18 is
assigned from a list of possible base compositions calculated from
the molecular mass using standard known molecular masses of each of
the four nucleobases.
[0054] As used herein, a "base composition probability cloud" is a
representation of the diversity in base composition resulting from
a variation in sequence that occurs among different isolates of a
given species. The "base composition probability cloud" represents
the base composition constraints for each species and is typically
visualized using a pseudo four-dimensional plot.
[0055] In the context of this invention, a "bioagent" is any
organism, cell, or virus, living or dead, or a nucleic acid derived
from such an organism, cell or virus. Examples of bioagents
include, but are not limited, to cells, (including but not limited
to human clinical samples, bacterial cells and other pathogens),
viruses, fungi, protists, parasites, and pathogenicity markers
(including but not limited to: pathogenicity islands, antibiotic
resistance genes, virulence factors, toxin genes and other
bioregulating compounds). Samples may be alive or dead or in a
vegetative state (for example, vegetative bacteria or spores) and
may be encapsulated or bioengineered. In the context of this
invention, a "pathogen" is a bioagent which causes a disease or
disorder.
[0056] As used herein, a "bioagent division" is defined as group of
bioagents above the species level and includes but is not limited
to, orders, families, classes, clades, genera or other such
groupings of bioagents above the species level.
[0057] As used herein, the term "bioagent identifying amplicon"
refers to a polynucleotide that is amplified from a bioagent in an
amplification reaction and which 1) provides sufficient variability
to distinguish each individual bioagent and 2) whose molecular mass
is amenable to molecular mass determination.
[0058] As used herein, the term "biological product" refers to any
product originating from an organism. Biological products are often
products of processes of biotechnology. Examples of biological
products include, but are not limited to: cultured cell lines,
cellular components, antibodies, proteins and other cell-derived
biomolecules, growth media, growth harvest fluids, natural products
and bio-pharmaceutical products.
[0059] The terms 'biowarfare agent" and "bioweapon" are synonymous
and refer to a bacterium, virus, fungus or protozoan that could be
deployed as a weapon to cause bodily harm to individuals by
military or terrorist groups.
[0060] In context of this invention, the term "broad range survey
primer pair" refers to a primer pair designed to produce bioagent
identifying amplicons across different broad groupings of
bioagents. For example, the ribosomal RNA-targeted primer pairs are
broad range survey primer pairs.
[0061] The term "calibration amplicon" refers to a nucleic acid
segment representing an amplification product obtained by
amplification of a calibration sequence with a pair of primers
designed to produce a bioagent identifying amplicon.
[0062] The term "calibration sequence" refers to a polynucleotide
sequence to which a given pair of primers hybridizes for the
purpose of producing an internal (i.e: included in the reaction)
calibration standard amplification product for use in determining
the quantity of a bioagent in a sample. The calibration sequence
may be expressly added to an amplification reaction, or may already
be present in the sample prior to analysis.
[0063] The term "clade primer pair" refers to a primer pair
designed to produce bioagent identifying amplicons for species
belonging to a clade group. A clade primer pair may also be
considered as a speciating primer pair.
[0064] The term "codon" refers to a set of three adjoined
nucleotides (triplet) that codes for an amino acid or a termination
signal.
[0065] In context of this invention, the term "codon base
composition analysis," refers to determination of the base
composition of an individual codon by obtaining a bioagent
identifying amplicon that includes the codon. The bioagent
identifying amplicon will at least include regions of the target
nucleic acid sequence to which the primers hybridize for generation
of the bioagent identifying amplicon as well as the codon being
analyzed, located between the two primer hybridization regions.
[0066] As used herein, the terms "complementary" or
"complementarity" are used in reference to polynucleotides (i.e., a
sequence of nucleotides such as an oligonucleotide or a target
nucleic acid) related by the base-pairing rules. For example, for
the sequence "5'-A-G-T-3'," is complementary to the sequence
"3'-T-C-A-5'." Complementarity may be "partial," in which only some
of the nucleic acids' bases are matched according to the base
pairing rules. Or, there may be "complete" or "total"
complementarity between the nucleic acids. The degree of
complementarity between nucleic acid strands has significant
effects on the efficiency and strength of hybridization between
nucleic acid strands. This is of particular importance in
amplification reactions, as well as detection methods that depend
upon binding between nucleic acids. Either term may also be used in
reference to individual nucleotides, especially within the context
of polynucleotides. For example, a particular nucleotide within an
oligonucleotide may be noted for its complementarity, or lack
thereof, to a nucleotide within another nucleic acid strand, in
contrast or comparison to the complementarity between the rest of
the oligonucleotide and the nucleic acid strand.
[0067] The term "complement of a nucleic acid sequence" as used
herein refers to an oligonucleotide which, when aligned with the
nucleic acid sequence such that the 5' end of one sequence is
paired with the 3' end of the other, is in "antiparallel
association." Certain bases not commonly found in natural nucleic
acids may be included in the nucleic acids of the present invention
and include, for example, inosine and 7-deazaguanine.
Complementarity need not be perfect; stable duplexes may contain
mismatched base pairs or unmatched bases. Those skilled in the art
of nucleic acid technology can determine duplex stability
empirically considering a number of variables including, for
example, the length of the oligonucleotide, base composition and
sequence of the oligonucleotide, ionic strength and incidence of
mismatched base pairs. Where a first oligonucleotide is
complementary to a region of a target nucleic acid and a second
oligonucleotide has complementary to the same region (or a portion
of this region) a "region of overlap" exists along the target
nucleic acid. The degree of overlap will vary depending upon the
extent of the complementarity
[0068] In context of this invention, the term "division-wide primer
pair" refers to a primer pair designed to produce bioagent
identifying amplicons within sections of a broad spectrum of
bioagents For example, primer pair number 367, a division-wide
primer pair, is designed to produce bioagent identifying amplicons
for the beta-proteobacteria division of bacteria.
[0069] As used herein, the term "concurrently amplifying" used with
respect to more than one amplification reaction refers to the act
of simultaneously amplifying more than one nucleic acid in a single
reaction mixture.
[0070] As used herein, the term "drill down primer pair" refers to
a primer pair designed to produce bioagent identifying amplicons
for identification of sub-species characteristics.
[0071] The term "duplex" refers to the state of nucleic acids in
which the base portions of the nucleotides on one strand are bound
through hydrogen bonding the their complementary bases arrayed on a
second strand. The condition of being in a duplex form reflects on
the state of the bases of a nucleic acid. By virtue of base
pairing, the strands of nucleic acid also generally assume the
tertiary structure of a double helix, having a major and a minor
groove. The assumption of the helical form is implicit in the act
of becoming duplexed.
[0072] As used herein, the term "etiology" refers to the causes or
origins, of diseases or abnormal physiological conditions.
[0073] The term "gene" refers to a DNA sequence that comprises
control and coding sequences necessary for the production of an RNA
having a non-coding function (e.g., a ribosomal or transfer RNA), a
polypeptide or a precursor. The RNA or polypeptide can be encoded
by a full length coding sequence or by any portion of the coding
sequence so long as the desired activity or function is
retained.
[0074] The terms "homology," "homologous" and "sequence identity"
refer to a degree of identity. There may be partial homology or
complete homology. A partially homologous sequence is one that is
less than 100% identical to another sequence. Determination of
sequence identity is described in the following example: a primer
20 nucleobases in length which is otherwise identical to another 20
nucleobase primer but having two non-identical residues has 18 of
20 identical residues ( 18/20=0.9 or 90% sequence identity). In
another example, a primer 15 nucleobases in length having all
residues identical to a 15 nucleobase segment of a primer 20
nucleobases in length would have 15/20=0.75 or 75% sequence
identity with the 20 nucleobase primer. In context of the present
invention, sequence identity is meant to be properly determined
when the query sequence and the subject sequence are both described
and aligned in the 5' to 3' direction. Sequence alignment
algorithms such as BLAST, will return results in two different
alignment orientations. In the Plus/Plus orientation, both the
query sequence and the subject sequence are aligned in the 5' to 3'
direction. On the other hand, in the Plus/Minus orientation, the
query sequence is in the 5' to 3' direction while the subject
sequence is in the 3' to 5' direction. It should be understood that
with respect to the primers of the present invention, sequence
identity is properly determined when the alignment is designated
Plus/Plus. Sequence identity may also encompass alternate or
modified nucleobases that perform in a functionally similar manner
to the regular nucleobases adenine, thymine, guanine and cytosine
with respect to hybridization and primer extension in amplification
reactions. In a non-limiting example, if the 5-propynyl pyrimidines
propyne C and/or propyne T replace one or more C or T residues in
one primer which is otherwise identical to another primer in
sequence and length, the two primers will have 100% sequence
identity with each other. In another non-limiting example, Inosine
(I) may be used as a replacement for G or T and effectively
hybridize to C, A or U (uracil). Thus, if inosine replaces one or
more C, A or U residues in one primer which is otherwise identical
to another primer in sequence and length, the two primers will have
100% sequence identity with each other. Other such modified or
universal bases may exist which would perform in a functionally
similar manner for hybridization and amplification reactions and
will be understood to fall within this definition of sequence
identity.
[0075] As used herein, "housekeeping gene" refers to a gene
encoding a protein or RNA involved in basic functions required for
survival and reproduction of a bioagent. Housekeeping genes
include, but are not limited to genes encoding RNA or proteins
involved in translation, replication, recombination and repair,
transcription, nucleotide metabolism, amino acid metabolism, lipid
metabolism, energy generation, uptake, secretion and the like.
[0076] As used herein, the term "hybridization" is used in
reference to the pairing of complementary nucleic acids.
Hybridization and the strength of hybridization (i.e., the strength
of the association between the nucleic acids) is influenced by such
factors as the degree of complementary between the nucleic acids,
stringency of the conditions involved, and the T.sub.m of the
formed hybrid. "Hybridization" methods involve the annealing of one
nucleic acid to another, complementary nucleic acid, i.e., a
nucleic acid having a complementary nucleotide sequence. The
ability of two polymers of nucleic acid containing complementary
sequences to find each other and anneal through base pairing
interaction is a well-recognized phenomenon. The initial
observations of the "hybridization" process by Marmur and Lane,
Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc.
Natl. Acad. Sci. USA 46:461 (1960) have been followed by the
refinement of this process into an essential tool of modern
biology.
[0077] The term "in silico" refers to processes taking place via
computer calculations. For example, electronic PCR (ePCR) is a
process analogous to ordinary PCR except that it is carried out
using nucleic acid sequences and primer pair sequences stored on a
computer formatted medium.
[0078] As used herein, "intelligent primers" are primers that are
designed to bind to highly conserved sequence regions of a bioagent
identifying amplicon that flank an intervening variable region and,
upon amplification, yield amplification products which ideally
provide enough variability to distinguish individual bioagents, and
which are amenable to molecular mass analysis. By the term "highly
conserved," it is meant that the sequence regions exhibit between
about 80-100%, or between about 90-100%, or between about 95-100%
identity among all, or at least 70%, at least 80%, at least 90%, at
least 95%, or at least 99% of species or strains.
[0079] The "ligase chain reaction" (LCR; sometimes referred to as
"Ligase Amplification Reaction" (LAR) described by Barany, Proc.
Natl. Acad. Sci., 88:189 (1991); Barany, PCR Methods and Applic.,
1:5 (1991); and Wu and Wallace, Genomics 4:560 (1989) has developed
into a well-recognized alternative method for amplifying nucleic
acids. In LCR, four oligonucleotides, two adjacent oligonucleotides
which uniquely hybridize to one strand of target DNA, and a
complementary set of adjacent oligonucleotides, that hybridize to
the opposite strand are mixed and DNA ligase is added to the
mixture. Provided that there is complete complementarity at the
junction, ligase will covalently link each set of hybridized
molecules. Importantly, in LCR, two probes are ligated together
only when they base-pair with sequences in the target sample,
without gaps or mismatches. Repeated cycles of denaturation,
hybridization and ligation amplify a short segment of DNA. LCR has
also been used in combination with PCR to achieve enhanced
detection of single-base changes. However, because the four
oligonucleotides used in this assay can pair to form two short
ligatable fragments, there is the potential for the generation of
target-independent background signal. The use of LCR for mutant
screening is limited to the examination of specific nucleic acid
positions.
[0080] The term "locked nucleic acid" or "LNA" refers to a nucleic
acid analogue containing one or more 2'-O,
4'-C-methylene-.beta.-D-riboftiranosyl nucleotide monomers in an
RNA mimicking sugar conformation. LNA oligonucleotides display
unprecedented hybridization affinity toward complementary
single-stranded RNA and complementary single- or double-stranded
DNA. LNA oligonucleotides induce A-type (RNA-like) duplex
conformations.
[0081] As used herein, the term "mass-modifying tag" refers to any
modification to a given nucleotide which results in an increase in
mass relative to the analogous non-mass modified nucleotide.
Mass-modifying tags can include heavy isotopes of one or more
elements included in the nucleotide such as carbon-13 for example.
Other possible modifications include addition of substituents such
as iodine or bromine at the 5 position of the nucleobase for
example.
[0082] The term "mass spectrometry" refers to measurement of the
mass of atoms or molecules. The molecules are first converted to
ions, which are separated using electric or magnetic fields
according to the ratio of their mass to electric charge. The
measured masses are used to identity the molecules.
[0083] The term "microorganism" as used herein means an organism
too small to be observed with the unaided eye and includes, but is
not limited to bacteria, virus, protozoans, fungi; and
ciliates.
[0084] The term "multi-drug resistant" or multiple-drug resistant"
refers to a microorganism which is resistant to more than one of
the antibiotics or antimicrobial agents used in the treatment of
said microorganism.
[0085] The term "multiplex PCR" refers to a PCR reaction where more
than one primer set is included in the reaction pool allowing 2 or
more different DNA targets to be amplified by PCR in a single
reaction tube.
[0086] The term "non-template tag" refers to a stretch of at least
three guanine or cytosine nucleobases of a primer used to produce a
bioagent identifying amplicon which are not complementary to the
template. A non-template tag is incorporated into a primer for the
purpose of increasing the primer-duplex stability of later cycles
of amplification by incorporation of extra G-C pairs which each
have one additional hydrogen bond relative to an A-T pair.
[0087] The term "nucleic acid sequence" as used herein refers to
the linear composition of the nucleic acid residues A, T, C or G or
any modifications thereof, within an oligonucleotide, nucleotide or
polynucleotide, and fragments or portions thereof, and to DNA or
RNA of genomic or synthetic origin which may be single or double
stranded, and represent the sense or antisense strand
[0088] As used herein, the term "nucleobase" is synonymous with
other terms in use in the art including "nucleotide,"
"deoxynucleotide," "nucleotide residue," "deoxynucleotide residue,"
"nucleotide triphosphate (NTP)," or deoxynucleotide triphosphate
(dNTP).
[0089] The term "nucleotide analog" as used herein refers to
modified or non-naturally occurring nucleotides such as 5-propynyl
pyrimidines (i.e., 5-propynyl-dTTP and 5-propynyl-dTCP), 7-deaza
purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs
include base analogs and comprise modified forms of
deoxyribonucleotides as well as ribonucleotides.
[0090] The term "oligonucleotide" as used herein is defined as a
molecule comprising two or more deoxyribonucleotides or
ribonucleotides, preferably at least 5 nucleotides, more preferably
at least about 13 to 35 nucleotides. The exact size will depend on
many factors, which in turn depend on the ultimate function or use
of the oligonucleotide. The oligonucleotide may be generated in any
manner, including chemical synthesis, DNA replication, reverse
transcription, PCR, or a combination thereof. Because
mononucleotides are reacted to make oligonucleotides in a manner
such that the 5' phosphate of one mononucleotide pentose ring is
attached to the 3' oxygen of its neighbor in one direction via a
phosphodiester linkage, an end of an oligonucleotide is referred to
as the "5'-end" if its 5' phosphate is not linked to the 3' oxygen
of a mononucleotide pentose ring and as the "3'-end" if its 3'
oxygen is not linked to a 5' phosphate of a subsequent
mononucleotide pentose ring. As used herein, a nucleic acid
sequence, even if internal to a larger oligonucleotide, also may be
said to have 5' and 3' ends. A first region along a nucleic acid
strand is said to be upstream of another region if the 3' end of
the first region is before the 5' end of the second region when
moving along a strand of nucleic acid in a 5' to 3' direction. All
oligonucleotide primers disclosed herein are understood to be
presented in the 5' to 3' direction when reading left to right.
When two different, non-overlapping oligonucleotides anneal to
different regions of the same linear complementary nucleic acid
sequence, and the 3' end of one oligonucleotide points towards the
5' end of the other, the former may be called the "upstream"
oligonucleotide and the latter the "downstream" oligonucleotide.
Similarly, when two overlapping oligonucleotides are hybridized to
the same linear complementary nucleic acid sequence, with the first
oligonucleotide positioned such that its 5' end is upstream of the
5' end of the second oligonucleotide, and the 340 end of the first
oligonucleotide is upstream of the 3' end of the second
oligonucleotide, the first oligonucleotide may be called the
"upstream" oligonucleotide and the second oligonucleotide may be
called the "downstream" oligonucleotide.
[0091] In the context of this invention, a "pathogen" is a bioagent
which causes a disease or disorder.
[0092] As used herein, the terms "PCR product," "PCR fragment," and
"amplification product" refer to the resultant mixture of compounds
after two or more cycles of the PCR steps of denaturation,
annealing and extension are complete. These terms encompass the
case where there has been amplification of one or more segments of
one or more target sequences.
[0093] The term "peptide nucleic acid" ("PNA") as used herein
refers to a molecule comprising bases or base analogs such as would
be found in natural nucleic acid, but attached to a peptide
backbone rather than the sugar-phosphate backbone typical of
nucleic acids. The attachment of the bases to the peptide is such
as to allow the bases to base pair with complementary bases of
nucleic acid in a manner similar to that of an oligonucleotide.
These small molecules, also designated anti gene agents, stop
transcript elongation by binding to their complementary strand of
nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63).
[0094] The term "polymerase" refers to an enzyme having the ability
to synthesize a complementary strand of nucleic acid from a
starting template nucleic acid strand and free dNTPs.
[0095] As used herein, the term "polymerase chain reaction" ("PCR")
refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195,
4,683,202, and 4,965,188, hereby incorporated by reference, that
describe a method for increasing the concentration of a segment of
a target sequence in a mixture of genomic DNA without cloning or
purification. This process for amplifying the target sequence
consists of introducing a large excess of two oligonucleotide
primers to the DNA mixture containing the desired target sequence,
followed by a precise sequence of thermal cycling in the presence
of a DNA polymerase. The two primers are complementary to their
respective strands of the double stranded target sequence. To
effect amplification, the mixture is denatured and the primers then
annealed to their complementary sequences within the target
molecule. Following annealing, the primers are extended with a
polymerase so as to form a new pair of complementary strands. The
steps of denaturation, primer annealing, and polymerase extension
can be repeated many times (i.e., denaturation, annealing and
extension constitute one "cycle"; there can be numerous "cycles")
to obtain a high concentration of an amplified segment of the
desired target sequence. The length of the amplified segment of the
desired target sequence is determined by the relative positions of
the primers with respect to each other, and therefore, this length
is a controllable parameter. By virtue of the repeating aspect of
the process, the method is referred to as the "polymerase chain
reaction" (hereinafter "PCR"). Because the desired amplified
segments of the target sequence become the predominant sequences
(in terms of concentration) in the mixture, they are said to be
"PCR amplified." With PCR, it is possible to amplify a single copy
of a specific target sequence in genomic DNA to a level detectable
by several different methodologies (e.g., hybridization with a
labeled probe; incorporation of biotinylated primers followed by
avidin-enzyme conjugate detection; incorporation of 32P-labeled
deoxynucleotide triphosphates, such as dCTP or DATP, into the
amplified segment). In addition to genomic DNA, any oligonucleotide
or polynucleotide sequence can be amplified with the appropriate
set of primer molecules. In particular, the amplified segments
created by the PCR process itself are, themselves, efficient
templates for subsequent PCR amplifications.
[0096] The term "polymerization means" or "polymerization agent"
refers to any agent capable of facilitating the addition of
nucleoside triphosphates to an oligonucleotide. Preferred
polymerization means comprise DNA and RNA polymerases.
[0097] As used herein, the terms "pair of primers," or "primer
pair" are synonymous. A primer pair is used for amplification of a
nucleic acid sequence. A pair of primers comprises a forward primer
and a reverse primer. The forward primer hybridizes to a sense
strand of a target gene sequence to be amplified and primes
synthesis of an antisense strand (complementary to the sense
strand) using the target sequence as a template. A reverse primer
hybridizes to the antisense strand of a target gene sequence to be
amplified and primes synthesis of a sense strand (complementary to
the antisense strand) using the target sequence as a template.
[0098] The primers are designed to bind to highly conserved
sequence regions of a bioagent identifying amplicon that flank an
intervening variable region and yield amplification products which
ideally provide enough variability to distinguish each individual
bioagent, and which are amenable to molecular mass analysis. In
some embodiments, the highly conserved sequence regions exhibit
between about 80-100%, or between about 90-100%, or between about
95-100% identity, or between about 99-100% identity. The molecular
mass of a given amplification product provides a means of
identifying the bioagent from which it was obtained, due to the
variability of the variable region. Thus design of the primers
requires selection of a variable region with appropriate
variability to resolve the identity of a given bioagent. Bioagent
identifying amplicons are ideally specific to the identity of the
bioagent.
[0099] Properties of the primers may include any number of
properties related to structure including, but not limited to:
nucleobase length which may be contiguous (linked together) or
non-contiguous (for example, two or more contiguous segments which
are joined by a linker or loop moiety), modified or universal
nucleobases (used for specific purposes such as for example,
increasing hybridization affinity, preventing non-templated
adenylation and modifying molecular mass) percent complementarity
to a given target sequences.
[0100] Properties of the primers also include functional features
including, but not limited to, orientation of hybridization
(forward or reverse) relative to a nucleic acid template. The
coding or sense strand is the strand to which the forward priming
primer hybridizes (forward priming orientation) while the reverse
priming primer hybridizes to the non-coding or antisense strand
(reverse priming orientation). The functional properties of a given
primer pair also include the generic template nucleic acid to which
the primer pair hybridizes. For example, identification of
bioagents can be accomplished at different levels using primers
suited to resolution of each individual level of identification.
Broad range survey primers are designed with the objective of
identifying a bioagent as a member of a particular division (e.g.,
an order, family, genus or other such grouping of bioagents above
the species level of bioagents). In some embodiments, broad range
survey intelligent primers are capable of identification of
bioagents at the species or sub-species level. Other primers may
have the functionality of producing bioagent identifying amplicons
for members of a given taxonomic genus, clade, species, sub-species
or genotype (including genetic variants which may include presence
of virulence genes or antibiotic resistance genes or mutations).
Additional functional properties of primer pairs include the
functionality of performing amplification either singly (single
primer pair per amplification reaction vessel) or in a multiplex
fashion (multiple primer pairs and multiple amplification reactions
within a single reaction vessel).
[0101] As used herein, the terms "purified" or "substantially
purified" refer to molecules, either nucleic or amino acid
sequences, that are removed from their natural environment,
isolated or separated, and are at least 60% free, preferably 75%
free, and most preferably 90% free from other components with which
they are naturally associated. An "isolated polynucleotide" or
"isolated oligonucleotide" is therefore a substantially purified
polynucleotide.
[0102] The term "reverse transcriptase" refers to an enzyme having
the ability to transcribe DNA from an RNA template. This enzymatic
activity is known as reverse transcriptase activity. Reverse
transcriptase activity is desirable in order to obtain DNA from RNA
viruses which can then be amplified and analyzed by the methods of
the present invention
[0103] The term "Ribosomal RNA" or "rRNA" refers to the primary
ribonucleic acid constituent of ribosomes. Ribosomes are the
protein-manufacturing organelles of cells and exist in the
cytoplasm. Ribosomal RNAs are transcribed from the DNA genes
encoding them.
[0104] The term "sample" in the present specification and claims is
used in its broadest sense. On the one hand it is meant to include
a specimen or culture (e.g., microbiological cultures). On the
other hand, it is meant to include both biological and
environmental samples. A sample may include a specimen of synthetic
origin. Biological samples may be animal, including human, fluid,
solid (e.g., stool) or tissue, as well as liquid and solid food and
feed products and ingredients such as dairy items, vegetables, meat
and meat by-products, and waste. Biological samples may be obtained
from all of the various families of domestic animals, as well as
feral or wild animals, including, but not limited to, such animals
as ungulates, bear, fish, lagamorphs, rodents, etc. Environmental
samples include environmental material such as surface matter,
soil, water and industrial samples, as well as samples obtained
from food and dairy processing instrunents, apparatus, equipment,
utensils, disposable and non-disposable items. These examples are
not to be construed as limiting the sample types applicable to the
present invention. The term "source of target nucleic acid" refers
to any sample that contains nucleic acids (RNA or DNA).
Particularly preferred sources of target nucleic acids are
biological samples including, but not limited to blood, saliva,
cerebral spinal fluid, pleural fluid, milk, lymph, sputum and
semen.
[0105] As used herein, the term "sample template" refers to nucleic
acid originating from a sample that is analyzed for the presence of
"target" (defined below). In contrast, "background template" is
used in reference to nucleic acid other than sample template that
may or may not be present in a sample. Background template is often
a contaminant. It may be the result of carryover, or it may be due
to the presence of nucleic acid contaminants sought to be purified
away from the sample. For example, nucleic acids from organisms
other than those to be detected may be present as background in a
test sample.
[0106] A "segment" is defined herein as a region of nucleic acid
within a target sequence.
[0107] The "self-sustained sequence replication reaction" (3SR)
(Guatelli et al., Proc. Natl. Acad. Sci., 87:1874-1878 [1990], with
an erratum at Proc. Natl. Acad. Sci., 87:7797 [1990]) is a
transcription-based in vitro amplification system (Kwok et al.,
Proc. Natl. Acad. Sci., 86:1173-1177 [1989]) that can exponentially
amplify RNA sequences at a uniform temperature. The amplified RNA
can then be utilized for mutation detection (Fahy et al., PCR Meth.
Appl., 1:25-33 [1991]). In this method, an oligonucleotide primer
is used to add a phage RNA polymerase promoter to the 5' end of the
sequence of interest. In a cocktail of enzymes and substrates that
includes a second primer, reverse transcriptase, RNase H, RNA
polymerase and ribo- and deoxyribonucleoside triphosphates, the
target sequence undergoes repeated rounds of transcription, cDNA
synthesis and second-strand synthesis to amplify the area of
interest. The use of 3SR to detect mutations is kinetically limited
to screening small segments of DNA (e.g., 200-300 base pairs).
[0108] As used herein, the term ""sequence alignment"" refers to a
listing of multiple DNA or amino acid sequences and aligns them to
highlight their similarities. The listings can be made using
bioinformatics computer programs.
[0109] In context of this invention, the term "speciating primer
pair" refers to a primer pair designed to produce a bioagent
identifying amplicon with the diagnostic capability of identifying
species members of a group of genera or a particular genus of
bioagents. Primer pair number 2922, for example, is a speciating
primer pair used to identify species members of the bacterial genus
Acinetobacter. Primer pair number 352 is a speciating primer pair
used to identify species members of the bacterial genera
Streptococcus, Enterococcus, Staphylococcus and Bacillus.
[0110] In context of this invention, the term "species confirmation
primer pair" refers to a primer pair designed to produce a bioagent
identifying amplicon with the diagnostic capability to
unambiguously produce a unique base composition to identify a
particular species of bioagent.
[0111] As used herein, a "sub-species characteristic" is a genetic
characteristic that provides the means to distinguish two members
of the same bioagent species. For example, one viral strain could
be distinguished from another viral strain of the same species by
possessing a genetic change (e.g., for example, a nucleotide
deletion, addition or substitution) in one of the viral genes, such
as the RNA-dependent RNA polymerase.
[0112] As used herein, the term "target," refers to a nucleic acid
sequence or structure to be detected or characterized. Thus, the
"target" is sought to be sorted out from other nucleic acid
sequences and contains a sequence that has at least partial
complementarity with an oligonucleotide primer. The target nucleic
acid may comprise single- or double-stranded DNA or RNA. A
"segment" is defined as a region of nucleic acid within the target
sequence.
[0113] The term "template" refers to a strand of nucleic acid on
which a complementary copy is built from nucleoside triphosphates
through the activity of a templatedependent nucleic acid
polymerase. Within a duplex the template strand is, by convention,
depicted and described as the "bottom" strand. Similarly, the
non-template strand is often depicted and described as the "top"
strand.
[0114] As used herein, the term "T.sub.m" is used in reference to
the "melting temperature." The melting temperature is the
temperature at which a population of double-stranded nucleic acid
molecules becomes half dissociated into single strands. Several
equations for calculating the T.sub.m of nucleic acids are well
known in the art. As indicated by standard references, a simple
estimate of the T.sub.m value may be calculated by the equation:
T.sub.m=81.5+0.41 (% G+C), when a nucleic acid is in aqueous
solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative
Filter Hybridization, in Nucleic Acid Hybridization (1985). Other
references (e.g., Allawi, H. T. & SantaLucia, J., Jr.
Thermodynamics and NMR of internal G.T mismatches in DNA.
Biochemistry 36, 10581-94 (1997) include more sophisticated
computations which take structural and environmental, as well as
sequence characteristics into account for the calculation of
T.sub.m.
[0115] The term "triangulation genotyping analysis" refers to a
method of genotyping a bioagent by measurement of molecular masses
or base compositions of amplification products, corresponding to
bioagent identifying amplicons, obtained by amplification of
regions of more than one gene. In this sense, the term
"triangulation" refers to a method of establishing the accuracy of
information by comparing three or more types of independent points
of view bearing on the same findings. Triangulation genotyping
analysis carried out with a plurality of triangulation genotyping
analysis primers yields a plurality of base compositions that then
provide a pattern or "barcode" from which a species type can be
assigned. The species type may represent a previously known
sub-species or strain, or may be a previously unknown strain having
a specific and previously unobserved base composition barcode
indicating the existence of a previously unknown genotype.
[0116] As used herein, the term "triangulation genotyping analysis
primer pair" is a primer pair designed to produce bioagent
identifying amplicons for determining species types in a
triangulation genotyping analysis.
[0117] The employment of more than one bioagent identifying
amplicon for identification of a bioagent is herein referred to as
"triangulation identification." Triangulation identification is
pursued by analyzing a plurality of bioagent identifying amplicons
selected within multiple core genes. This process is used to reduce
false negative and false positive signals, and enable
reconstruction of the origin of hybrid or otherwise engineered
bioagents. For example, identification of the three part toxin
genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol.,
1999, 87, 270-278) in the absence of the expected signatures from
the B. anthracis genome would suggest a genetic engineering
event.
[0118] In the context of this invention, the term "unknown
bioagent" may mean either: (i) a bioagent whose existence is known
(such as the well known bacterial species Staphylococcus aureus for
example) but which is not known to be in a sample to be analyzed,
or (ii) a bioagent whose existence is not known (for example, the
SARS coronavirus was unknown prior to Apr. 2003). For example, if
the method for identification of coronaviruses disclosed in
commonly owned U.S. patent Ser. No. 10/829,826 (incorporated herein
by reference in its entirety) was to be employed prior to April
2003 to identify the SARS coronavirus in a clinical sample, both
meanings of "unknown" bioagent are applicable since the SARS
coronavirus was unknown to science prior to April, 2003 and since
it was not known what bioagent (in this case a coronavirus) was
present in the sample. On the other hand, if the method of U.S.
patent Ser. No. 10/829,826 was to be employed subsequent to April
2003 to identify the SARS coronavirus in a clinical sample, only
the first meaning (i) of "unknown" bioagent would apply since the
SARS coronavirus became known to science subsequent to April 2003
and since it was not known what bioagent was present in the
sample.
[0119] The term "variable sequence" as used herein refers to
differences in nucleic acid sequence between two nucleic acids. For
example, the genes of two different bacterial species may vary in
sequence by the presence of single base substitutions and/or
deletions or insertions of one or more nucleotides. These two forms
of the structural gene are said to vary in sequence from one
another. In the context of the present invention, "viral nucleic
acid" includes, but is not limited to, DNA, RNA, or DNA that has
been obtained from viral RNA, such as, for example, by performing a
reverse transcription reaction. Viral RNA can either be
single-stranded (of positive or negative polarity) or
double-stranded.
[0120] The term "virus" refers to obligate, ultramicroscopic,
parasites incapable of autonomous replication (i.e., replication
requires the use of the host cell's machinery). Viruses can survive
outside of a host cell but cannon replicate.
[0121] The term "wild-type" refers to a gene or a gene product that
has the characteristics of that gene or gene product when isolated
from a naturally occurring source. A wild-type gene is that which
is most frequently observed in a population and is thus arbitrarily
designated the "normal" or "wild-type" form of the gene. In
contrast, the term "modified", "mutant" or "polymorphic" refers to
a gene or gene product that displays modifications in sequence and
or functional properties (i.e., altered characteristics) when
compared to the wild-type gene or gene product. It is noted that
naturally-occurring mutants can be isolated; these are identified
by the fact that they have altered characteristics when compared to
the wild-type gene or gene product.
[0122] As used herein, a "wobble base" is a variation in a codon
found at the third nucleotide position of a DNA triplet. Variations
in conserved regions of sequence are often found at the third
nucleotide position due to redundancy in the amino acid code.
DETAILED DESCRIPTION OF EMBODIMENTS
A. Bioagent Identifying Amplicons
[0123] The present invention provides methods for detection and
identification of unknown bioagents using bioagent identifying
amplicons. Primers are selected to hybridize to conserved sequence
regions of nucleic acids derived from a bioagent, and which bracket
variable sequence regions to yield a bioagent identifying amplicon,
which can be amplified and which is amenable to molecular mass
determination. The molecular mass then provides a means to uniquely
identify the bioagent without a requirement for prior knowledge of
the possible identity of the bioagent. The molecular mass or
corresponding base composition signature of the amplification
product is then matched against a database of molecular masses or
base composition signatures. A match is obtained when an
experimentally-determined molecular mass or base composition of an
analyzed amplification product is compared with known molecular
masses or base compositions of known bioagent identifying amplicons
and the experimentally determined molecular mass or base
composition is the same as the molecular mass or base composition
of one of the known bioagent identifying amplicons. Alternatively,
the experimentally-determined molecular mass or base composition
may be within experimental error of the molecular mass or base
composition of a known bioagent identifying amplicon and still be
classified as a match. In some cases, the match may also be
classified using a probability of match model such as the models
described in U.S. Ser. No. 11/073,362, which is commonly owned and
incorporated herein by reference in entirety. Furthermore, the
method can be applied to rapid parallel multiplex analyses, the
results of which can be employed in a triangulation identification
strategy. The present method provides rapid throughput and does not
require nucleic acid sequencing of the amplified target sequence
for bioagent detection and identification.
[0124] Despite enormous biological diversity, all forms of life on
earth share sets of essential, common features in their genomes.
Since genetic data provide the underlying basis for identification
of bioagents by the methods of the present invention, it is
necessary to select segments of nucleic acids which ideally provide
enough variability to distinguish each individual bioagent and
whose molecular mass is amenable to molecular mass
determination.
[0125] Unlike bacterial genomes, which exhibit conversation of
numerous genes (i.e. housekeeping genes) across all organisms,
viruses do not share a gene that is essential and conserved among
all virus families. Therefore, viral identification is achieved
within smaller groups of related viruses, such as members of a
particular virus family or genus. For example, RNA-dependent RNA
polymerase is present in all single-stranded RNA viruses and can be
used for broad priming as well as resolution within the virus
family.
[0126] In some embodiments of the present invention, at least one
viral nucleic acid segment is amplified in the process of
identifying the bioagent. Thus, the nucleic acid segments that can
be amplified by the primers disclosed herein and that provide
enough variability to distinguish each individual bioagent and
whose molecular masses are amenable to molecular mass determination
are herein described as bioagent identifying amplicons.
[0127] In some embodiments of the present invention, bioagent
identifying amplicons comprise from about 45 to about 200
nucleobases (i.e. from about 45 to about 200 linked nucleosides),
although both longer and short regions may be used. One of ordinary
skill in the art will appreciate that the invention embodies
compounds of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106,
107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119,
120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132,
133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,
146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158,
159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171,
172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184,
185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197,
198, 199, and 200 nucleobases in length, or any range
therewithin.
[0128] It is the combination of the portions of the bioagent
nucleic acid segment to which the primers hybridize (hybridization
sites) and the variable region between the primer hybridization
sites that comprises the bioagent identifying amplicon.
[0129] In some embodiments, bioagent identifying amplicons amenable
to molecular mass determination which are produced by the primers
described herein are either of a length, size or mass compatible
with the particular mode of molecular mass determination or
compatible with a means of providing a predictable fragmentation
pattern in order to obtain predictable fragments of a length
compatible with the particular mode of molecular mass
determination. Such means of providing a predictable fragmentation
pattern of an amplification product include, but are not limited
to, cleavage with restriction enzymes or cleavage primers, for
example. Thus, in some embodiments, bioagent identifying amplicons
are larger than 200 nucleobases and are amenable to molecular mass
determination following restriction digestion. Methods of using
restriction enzymes and cleavage primers are well known to those
with ordinary skill in the art.
[0130] In some embodiments, amplification products corresponding to
bioagent identifying amplicons are obtained using the polymerase
chain reaction (PCR) that is a routine method to those with
ordinary skill in the molecular biology arts. Other amplification
methods may be used such as ligase chain reaction (LCR),
low-stringency single primer PCR, and multiple strand displacement
amplification (MDA). These methods are also known to those with
ordinary skill.
B. Primers and Primer Pairs
[0131] In some embodiments the primers are designed to bind to
conserved sequence regions of a bioagent identifying amplicon that
flank an intervening variable region and yield amplification
products which provide variability sufficient to distinguish each
individual bioagent, and which are amenable to molecular mass
analysis. In some embodiments, the highly conserved sequence
regions exhibit between about 80-100%, or between about 90-100%, or
between about 95-100% identity, or between about 99-100% identity.
The molecular mass of a given amplification product provides a
means of identifying the bioagent from which it was obtained, due
to the variability of the variable region. Thus, design of the
primers involves selection of a variable region with sufficient
variability to resolve the identity of a given bioagent. In some
embodiments, bioagent identifying amplicons are specific to the
identity of the bioagent.
[0132] In some embodiments, identification of bioagents is
accomplished at different levels using primers suited to resolution
of each individual level of identification. Broad range survey
primers are designed with the objective of identifying a bioagent
as a member of a particular division (e.g., an order, family, genus
or other such grouping of bioagents above the species level of
bioagents). In some embodiments, broad range survey intelligent
primers are capable of identification of bioagents at the species
or sub-species level.
[0133] In some embodiments, drill-down primers are designed with
the objective of identifying a bioagent at the sub-species level
(including strains, subtypes, variants and isolates) based on
sub-species characteristics. Drill-down intelligent primers are not
always required for identification at the sub-species level because
broad range survey intelligent primers may, in some cases provide
sufficient identification resolution to accomplishing this
identification objective.
[0134] A representative process flow diagram used for primer
selection and validation process is outlined in FIG. 1. For each
group of organisms, candidate target sequences are identified (200)
from which nucleotide alignments are created (210) and analyzed
(220). Primers are then designed by selecting appropriate priming
regions (230) to facilitate the selection of candidate primer pairs
(240). The primer pairs are then subjected to in silico analysis by
electronic PCR (ePCR) (300) wherein bioagent identifying amplicons
are obtained from sequence databases such as GenBank or other
sequence collections (310) and checked for specificity in silico
(320). Bioagent identifying amplicons obtained from GenBank
sequences (310) can also be analyzed by a probability model which
predicts the capability of a given amplicon to identify unknown
bioagents such that the base compositions of amplicons with
favorable probability scores are then stored in a base composition
database (325). Alternatively, base compositions of the bioagent
identifying amplicons obtained from the primers and GenBank
sequences can be directly entered into the base composition
database (330). Candidate primer pairs (240) are validated by
testing their ability to hybridize to target nucleic acid by an in
vitro amplification by a method such as PCR analysis (400) of
nucleic acid from a collection of organisms (410). Amplification
products thus obtained are analyzed by gel electrophoresis or by
mass spectrometry to confirm the sensitivity, specificity and
reproducibility of the primers used to obtain the amplification
products (420).
[0135] Many of the important pathogens, including the organisms of
greatest concern as biowarfare agents, have been completely
sequenced. This effort has greatly facilitated the design of
primers for the detection of unknown bioagents. The combination of
broad-range priming with division-wide and drill-down priming has
been used very successfully in several applications of the
technology, including environmental surveillance for biowarfare
threat agents and clinical sample analysis for medically important
pathogens.
[0136] Synthesis of primers is well known and routine in the art.
The primers may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed.
[0137] In some embodiments primers are employed as compositions for
use in methods for identification of viral bioagents as follows: a
primer pair composition is contacted with nucleic acid (such as,
for example, DNA from a DNA virus, or DNA reverse transcribed from
the RNA of an RNA virus) of an unknown viral bioagent. The nucleic
acid is then amplified by a nucleic acid amplification technique,
such as PCR for example, to obtain an amplification product that
represents a bioagent identifying amplicon. The molecular mass of
each strand of the double-stranded amplification product is
determined by a molecular mass measurement technique such as mass
spectrometry for example, wherein the two strands of the
double-stranded amplification product are separated during the
ionization process. In some embodiments, the mass spectrometry is
electrospray Fourier transform ion cyclotron resonance mass
spectrometry (ESI-FTICR-MS) or electrospray time of flight mass
spectrometry (ESI-TOF-MS). A list of possible base compositions can
be generated for the molecular mass value obtained for each strand
and the choice of the correct base composition from the list is
facilitated by matching the base composition of one strand with a
complementary base composition of the other strand. The molecular
mass or base composition thus determined is then compared with a
database of molecular masses or base compositions of analogous
bioagent identifying amplicons for known viral bioagents. A match
between the molecular mass or base composition of the amplification
product and the molecular mass or base composition of an analogous
bioagent identifying amplicon for a known viral bioagent indicates
the identity of the unknown bioagent. In some embodiments, the
primer pair used is one of the primer pairs of Table 3. In some
embodiments, the method is repeated using a different primer pair
to resolve possible ambiguities in the identification process or to
improve the confidence level for the identification assignment.
[0138] In some embodiments, a bioagent identifying amplicon may be
produced using only a single primer (either the forward or reverse
primer of any given primer pair), provided an appropriate
amplification method is chosen, such as, for example, low
stringency single primer PCR (LSSP-PCR). Adaptation of this
amplification method in order to produce bioagent identifying
amplicons can be accomplished by one with ordinary skill in the art
without undue experimentation.
[0139] In some embodiments, the oligonucleotide primers are broad
range survey primers which hybridize to conserved regions of
nucleic acid encoding the PB 1 gene or the NUC gene, gene of all
(or between 80% and 100%, between 85% and 100%, between 90% and
100% or between 95% and 100%) known adventitious contaminant
viruses and produce bioagent identifying amplicons.
[0140] In some cases, the molecular mass or base composition of a
viral bioagent identifying amplicon defined by a broad range survey
primer pair does not provide enough resolution to unambiguously
identify a viral bioagent at or below the species level. These
cases benefit from further analysis of one or more viral bioagent
identifying amplicons generated from at least one additional broad
range survey primer pair or from at least one additional
division-wide primer pair. The employment of more than one bioagent
identifying amplicon for identification of a bioagent is herein
referred to as triangulation identification.
[0141] In other embodiments, the oligonucleotide primers are
division-wide primers which hybridize to nucleic acid encoding
genes of species within a genus of viruses. In other embodiments,
the oligonucleotide primers are drill-down primers which enable the
identification of sub-species characteristics. Drill down primers
provide the functionality of producing bioagent identifying
amplicons for drill-down analyses such as strain typing when
contacted with nucleic acid under amplification conditions.
Identification of such sub-species characteristics is often
critical for determining proper clinical treatment of viral
infections. In some embodiments, sub-species characteristics are
identified using only broad range survey primers and division-wide
and drill-down primers are not used.
[0142] In some embodiments, the primers used for amplification
hybridize to and amplify genomic DNA, DNA of bacterial plasmids,
DNA of DNA viruses or DNA reverse transcribed from RNA of an RNA
virus.
[0143] In some embodiments, the primers used for amplification
hybridize directly to viral RNA and act as reverse transcription
primers for obtaining DNA from direct amplification of viral RNA.
Methods of amplifying RNA to produce cDNA using reverse
transcriptase are well known to those with ordinary skill in the
art and can be routinely established without undue experimentation.
[1431 In some embodiments, various computer software programs may
be used to aid in design of primers for amplification reactions
such as Primer Premier 5 (Premier Biosoft, Palo Alto, Calif.) or
OLIGO Primer Analysis Software (Molecular Biology Insights,
Cascade, Colo.). These programs allow the user to input desired
hybridization conditions such as melting temperature of a
primer-template duplex for example. In some embodiments, an in
silico PCR search algorithm, such as (ePCR) is used to analyze
primer specificity across a plurality of template sequences which
can be readily obtained from public sequence databases such as
GenBank for example. An existing RNA structure search algorithm
(Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is
incorporated herein by reference in its entirety) has been modified
to include PCR parameters such as hybridization conditions,
mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl.
Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated
herein by reference in its entirety). This also provides
information on primer specificity of the selected primer pairs. In
some embodiments, the hybridization conditions applied to the
algorithm can limit the results of primer specificity obtained from
the algorithm. In some embodiments, the melting temperature
threshold for the primer template duplex is specified to be
35.degree. C. or a higher temperature. In some embodiments the
number of acceptable mismatches is specified to be seven mismatches
or less. In some embodiments, the buffer components and
concentrations and primer concentrations may be specified and
incorporated into the algorithm, for example, an appropriate primer
concentration is about 250 nM and appropriate buffer components are
50 mM sodium or potassium and 1.5 mM Mg.sup.2+.
[0144] One with ordinary skill in the art of design of
amplification primers will recognize that a given primer need not
hybridize with 100% complementarity in order to effectively prime
the synthesis of a complementary nucleic acid strand in an
amplification reaction. Moreover, a primer may hybridize over one
or more segments such that intervening or adjacent segments are not
involved in the hybridization event. (e.g., for example, a loop
structure or a hairpin structure). The primers of the present
invention may comprise at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95% or at least 99% sequence
identity with any of the primers listed in Table 3. Thus, in some
embodiments of the present invention, an extent of variation of 70%
to 100%, or any range therewithin, of the sequence identity is
possible relative to the specific primer sequences disclosed
herein. Determination of sequence identity is described in the
following example: a primer 20 nucleobases in length which is
identical to another 20 nucleobase primer having two non-identical
residues has 18 of 20 identical residues ( 18/20=0.9 or 90%
sequence identity). In another example, a primer 15 nucleobases in
length having all residues identical to a 15 nucleobase segment of
primer 20 nucleobases in length would have 15/20=0.75 or 75%
sequence identity with the 20 nucleobase primer.
[0145] Percent homology, sequence identity or complementarity, can
be determined by, for example, the Gap program (Wisconsin Sequence
Analysis Package, Version 8 for UNIX, Genetics Computer Group,
University Research Park, Madison Wis.), using default settings,
which uses the algorithm of Smith and Waterman (Adv. Appl. Math.,
1981, 2, 482-489). In some embodiments, complementarity of primers
with respect to the conserved priming regions of viral nucleic acid
is between about 70% and about 75% 80%. In other embodiments,
homology, sequence identity or complementarity, is between about
75% and about 80%. In yet other embodiments, homology, sequence
identity or complementarity, is at least 85%, at least 90%, at
least 92%, at least 94%, at least 95%, at least 96%, at least 97%,
at least 98%, at least 99% or is 100%.
[0146] In some embodiments, the primers described herein comprise
at least 70%, at least 75%, at least 80%, at least 85%, at least
90%, at least 92%, at least 94%, at least 95%, at least 96%, at
least 98%, or at least 99%, or 100% (or any range therewithin)
sequence identity with the primer sequences specifically disclosed
herein.
[0147] One with ordinary skill is able to calculate percent
sequence identity or percent sequence homology and able to
determine, without undue experimentation, the effects of variation
of primer sequence identity on the fimction of the primer in its
role in priming synthesis of a complementary strand of nucleic acid
for production of an amplification product of a corresponding
bioagent identifying amplicon.
[0148] In one embodiment, the primers are at least 13 nucleobases
in length. In another embodiment, the primers are less than 36
nucleobases in length.
[0149] In some embodiments of the present invention, the
oligonucleotide primers are 13 to 35 nucleobases in length (13 to
35 linked nucleotide residues). These embodiments comprise
oligonucleotide primers 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleobases in
length, or any range therewithin. The present invention
contemplates using both longer and shorter primers. Furthermore,
the primers may also be linked to one or more other desired
moieties, including, but not limited to, affinity groups, ligands,
regions of nucleic acid that are not complementary to the nucleic
acid to be amplified, labels, etc. Primers may also form hairpin
structures. For example, hairpin primers may be used to amplify
short target nucleic acid molecules. The presence of the hairpin
may stabilize the amplification complex (see e.g., TAQMAN MicroRNA
Assays, Applied Biosystems, Foster City, Calif.).
[0150] In some embodiments, any oligonucleotide primer pair may
have one or both primers with less then 70% sequence homology with
a corresponding member of any of the primer pairs of Table 3 if the
primer pair has the capability of producing an amplification
product corresponding to a bioagent identifying amplicon. In other
embodiments, any oligonucleotide primer pair may have one or both
primers with a length greater than 35 nucleobases if the primer
pair has the capability of producing an amplification product
corresponding to a bioagent identifying amplicon.
[0151] In some embodiments, the function of a given primer may be
substituted by a combination of two or more primers segments that
hybridize adjacent to each other or that are linked by a nucleic
acid loop structure or linker which allows a polymerase to extend
the two or more primers in an amplification reaction.
[0152] In some embodiments, the primer pairs used for obtaining
bioagent identifying amplicons are the primer pairs of Table 3. In
other embodiments, other combinations of primer pairs are possible
by combining certain members of the forward primers with certain
members of the reverse primers. An example can be seen in Table 3
for three primer pair combinations of forward primer
POL_NC003461.sub.--2253.sub.--2279_F (SEQ ID NO: 45), with the
reverse primers POL_NC003461.sub.--2302.sub.--2329_R (SEQ ID NO:
315), POL_NC003461.sub.--2320.sub.--2349_R, or (SEQ ID NO: 200),
POL_NC003461.sub.--2320.sub.--2352_R (SEQ ID NO: 326). Arriving at
a favorable alternate combination of primers in a primer pair
depends upon the properties of the primer pair, most notably the
size of the bioagent identifying amplicon that would be produced by
the primer pair, which should be between about 45 to about 150
nucleobases in length. Alternatively, a bioagent identifying
amplicon longer than 150 nucleobases in length could be cleaved
into smaller segments by cleavage reagents such as chemical
reagents, or restriction enzymes, for example.
[0153] In some embodiments, the primers are configured to amplify
nucleic acid of a bioagent to produce amplification products that
can be measured by mass spectrometry and from whose molecular
masses candidate base compositions can be readily calculated.
[0154] In some embodiments, any given primer comprises a
modification comprising the addition of a non-templated T residue
to the 5' end of the primer (i.e., the added T residue does not
necessarily hybridize to the nucleic acid being amplified). The
addition of a non-templated T residue has an effect of minimizing
the addition of non-templated adenosine residues as a result of the
non-specific enzyme activity of Taq polymerase (Magnuson et al.,
Biotechniques, 1996, 21, 700-709), an occurrence which may lead to
ambiguous results arising from molecular mass analysis.
[0155] In some embodiments of the present invention, primers may
contain one or more universal bases. Because any variation (due to
codon wobble in the 3.sup.rd position) in the conserved regions
among species is likely to occur in the third position of a DNA (or
RNA) triplet, oligonucleotide primers can be designed such that the
nucleotide corresponding to this position is a base which can bind
to more than one nucleotide, referred to herein as a "universal
nucleobase." For example, under this "wobble" pairing, inosine (I)
binds to U, C or A; guanine (G) binds to U or C, and uridine (U)
binds to U or C. Other examples of universal nucleobases include
nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et
al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the
degenerate nucleotides dP or dK (Hill et al.), an acyclic
nucleoside analog containing 5-nitroindazole (Van Aerschot et al.,
Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine
analog 1-(2-deoxy-.beta.-D-ribofuranosyl)-imidazole-4-carboxamide
(Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).
[0156] In some embodiments, to compensate for the somewhat weaker
binding by the wobble base, the oligonucleotide primers are
designed such that the first and second positions of each triplet
are occupied by nucleotide analogs that bind with greater affinity
than the unmodified nucleotide. Examples of these analogs include,
but are not limited to, 2,6-diaminopurine which binds to thymine,
5-propynyluracil which binds to adenine and 5-propynylcytosine and
phenoxazines, including G-clamp, which binds to G. Propynylated
pyrimidines are described in U.S. Pat. Nos. 5,645,985, 5,830,653
and 5,484,908, each of which is commonly owned and incorporated
herein by reference in its entirety. Propynylated primers are
described in U.S Pre-Grant Publication No. 2003-0170682, which is
also commonly owned and incorporated herein by reference in its
entirety. Phenoxazines are described in U.S. Pat. Nos. 5,502,177,
5,763,588, and 6,005,096, each of which is incorporated herein by
reference in its entirety. G-clamps are described in U.S. Pat. Nos.
6,007,992 and 6,028,183, each of which is incorporated herein by
reference in its entirety.
[0157] In some embodiments, for broad priming of rapidly evolving
RNA viruses, primer hybridization is enhanced using primers
containing 5-propynyl deoxy-cytidine and deoxy-thymidine
nucleotides. These modified primers offer increased affinity and
base pairing selectivity.
[0158] In some embodiments, non-template primer tags are used to
increase the melting temperature (T.sub.m) of a primer-template
duplex in order to improve amplification efficiency. A non-template
tag is at least three consecutive A or T nucleotide residues on a
primer which are not complementary to the template. In any given
non-template tag, A can be replaced by C or G and T can also be
replaced by C or G. Although Watson-Crick hybridization is not
expected to occur for a non-template tag relative to the template,
the extra hydrogen bond in a G-C pair relative to an A-T pair
confers increased stability of the primer-template duplex and
improves amplification efficiency for subsequent cycles of
amplification when the primers hybridize to strands synthesized in
previous cycles.
[0159] In other embodiments, propynylated tags may be used in a
manner similar to that of the non-template tag, wherein two or more
5-propynylcytidine or 5-propynyluridine residues replace template
matching residues on a primer. In other embodiments, a primer
contains a modified internucleoside linkage such as a
phosphorothioate linkage, for example.
[0160] In some embodiments, the primers contain mass-modifying
tags. Reducing the total number of possible base compositions of a
nucleic acid of specific molecular weight provides a means of
avoiding a persistent source of ambiguity in determination of base
composition of amplification products. Addition of mass-modifying
tags to certain nucleobases of a given primer will result in
simplification of de novo determination of base composition of a
given bioagent identifying amplicon from its molecular mass.
[0161] In some embodiments of the present invention, the mass
modified nucleobase comprises one or more of the following: for
example, 7-deaza-2'-deoxyadenosine-5-triphosphate,
5-iodo-2'-deoxyuridine-5'-triphosphate,
5-bromo-2'-deoxyuridine-5'-triphosphate,
5-bromo-2'-deoxycytidine-5'-triphosphate,
5-iodo-2'-deoxycytidine-5'-triphosphate,
5-hydroxy-2'-deoxyuridine-5'-triphosphate,
4-thiothymidine-5'-triphosphate,
5-aza-2'-deoxyuridine-5'-triphosphate,
5-fluoro-2'-deoxyuridine-5'-triphosphate,
O6-methyl-2'-deoxyguanosine-5'-triphosphate,
N2-methyl-2'-deoxyguanosine-5'-triphosphate,
8-oxo-2'-deoxyguanosine-5'-triphosphate or
thiothymidine-5.alpha.-triphosphate. In some embodiments, the
mass-modified nucleobase comprises .sup.15N or .sup.13C or both
.sup.15N and .sup.13C.
[0162] In some embodiments, multiplex amplification is performed
where multiple bioagent identifying amplicons are amplified with a
plurality of primer pairs. The advantages of multiplexing are that
fewer reaction containers (for example, wells of a 96- or 384-well
plate) are needed for each molecular mass measurement, providing
time, resource and cost savings because additional bioagent
identification data can be obtained within a single analysis.
Multiplex amplification methods are well known to those with
ordinary skill and can be developed without undue experimentation.
However, in some embodiments, one useful and non-obvious step in
selecting a plurality candidate bioagent identifying amplicons for
multiplex amplification is to ensure that each strand of each
amplification product will be sufficiently different in molecular
mass that mass spectral signals will not overlap and lead to
ambiguous analysis results. In some embodiments, a 10 Da difference
in mass of two strands of one or more amplification products is
sufficient to avoid overlap of mass spectral peaks.
[0163] In some embodiments, as an alternative to multiplex
amplification, single amplification reactions can be pooled before
analysis by mass spectrometry. In these embodiments, as for
multiplex amplification embodiments, it is useful to select a
plurality of candidate bioagent identifying amplicons to ensure
that each strand of each amplification product will be sufficiently
different in molecular mass that mass spectral signals will not
overlap and lead to ambiguous analysis results.
C Determination of Molecular Mass of Bioagent Identifying
Amplicons
[0164] In some embodiments, the molecular mass of a given bioagent
identifying amplicon is determined by mass spectrometry. Mass
spectrometry has several advantages, not the least of which is high
bandwidth characterized by the ability to separate (and isolate)
many molecular peaks across a broad range of mass to charge ratio
(m/z). Thus mass spectrometry is intrinsically a parallel detection
scheme without the need for radioactive or fluorescent labels,
since every amplification product is identified by its molecular
mass. The current state of the art in mass spectrometry is such
that less than femtomole quantities of material can be readily
analyzed to afford information about the molecular contents of the
sample. An accurate assessment of the molecular mass of the
material can be quickly obtained, irrespective of whether the
molecular weight of the sample is several hundred, or in excess of
one hundred thousand atomic mass units (amu) or Daltons.
[0165] In some embodiments, intact molecular ions are generated
from amplification products using one of a variety of ionization
techniques to convert the sample to gas phase. These ionization
methods include, but are not limited to, electrospray ionization
(ES), matrix-assisted laser desorption ionization (MALDI) and fast
atom bombardment (FAB). Upon ionization, several peaks are observed
from one sample due to the formation of ions with different
charges. Averaging the multiple readings of molecular mass obtained
from a single mass spectrum affords an estimate of molecular mass
of the bioagent identifying amplicon. Electrospray ionization mass
spectrometry (ESI-MS) is particularly useful for very high
molecular weight polymers such as proteins and nucleic acids having
molecular weights greater than 10 kDa, since it yields a
distribution of multiply-charged molecules of the sample without
causing a significant amount of fragmentation.
[0166] The mass detectors used in the methods of the present
invention include, but are not limited to, Fourier transform ion
cyclotron resonance mass spectrometry (FT-ICR-MS), time of flight
(TOF), ion trap, quadrupole, magnetic sector, Q-TOF, and triple
quadrupole.
D. Base Compositions of Bioagent Identifying Amplicons
[0167] Although the molecular mass of amplification products
obtained using intelligent primers provides a means for
identification of bioagents, conversion of molecular mass data to a
base composition signature is useful for certain analyses. As used
herein, "base composition" is the exact number of each nucleobase
(A, T, C and G) determined from the molecular mass of a bioagent
identifying amplicon. In some embodiments, a base composition
provides an index of a specific organism. Base compositions can be
calculated from known sequences of known bioagent identifying
amplicons and can be experimentally determined by measuring the
molecular mass of a given bioagent identifying amplicon, followed
by determination of all possible base compositions which are
consistent with the measured molecular mass within acceptable
experimental error. The following example illustrates determination
of base composition from an experimentally obtained molecular mass
of a 46-mer amplification product originating at position 1337 of
the 16S rRNA of Bacillus anthracis. The forward and reverse strands
of the amplification product have measured molecular masses of
14208 and 14079 Da, respectively. The possible base compositions
derived from the molecular masses of the forward and reverse
strands for the B. anthracis products are listed in Table 1.
TABLE-US-00001 TABLE 1 Possible Base Compositions for B. anthracis
46mer Amplification Product Calc. Mass Mass Error Base Calc. Mass
Mass Error Base Forward Forward Composition of Reverse Reverse
Composition of Strand Strand Forward Strand Strand Strand Reverse
Strand 14208.2935 0.079520 A1 G17 C10 T18 14079.2624 0.080600 A0
G14 C13 T19 14208.3160 0.056980 A1 G20 C15 T10 14079.2849 0.058060
A0 G17 C18 T11 14208.3386 0.034440 A1 G23 C20 T2 14079.3075
0.035520 A0 G20 C23 T3 14208.3074 0.065560 A6 G11 C3 T26 14079.2538
0.089180 A5 G5 C1 T35 14208.3300 0.043020 A6 G14 C8 T18 14079.2764
0.066640 A5 G8 C6 T27 14208.3525 0.020480 A6 G17 C13 T10 14079.2989
0.044100 A5 G11 C11 T19 14208.3751 0.002060 A6 G20 C18 T2
14079.3214 0.021560 A5 G14 C16 T11 14208.3439 0.029060 A11 G8 C1
T26 14079.3440 0.000980 A5 G17 C21 T3 14208.3665 0.006520 A11 G11
C6 T18 14079.3129 0.030140 A10 G5 C4 T27 14208.3890 0.016020 A11
G14 C11 T10 14079.3354 0.007600 A10 G8 C9 T19 14208.4116 0.038560
A11 G17 C16 T2 14079.3579 0.014940 A10 G11 C14 T11 14208.4030
0.029980 A16 G8 C4 T18 14079.3805 0.037480 A10 G14 C19 T3
14208.4255 0.052520 A16 G11 C9 T10 14079.3494 0.006360 A15 G2 C2
T27 14208.4481 0.075060 A16 G14 C14 T2 14079.3719 0.028900 A15 G5
C7 T19 14208.4395 0.066480 A21 G5 C2 T18 14079.3944 0.051440 A15 G8
C12 T11 14208.4620 0.089020 A21 G8 C7 T10 14079.4170 0.073980 A15
G11 C17 T3 -- -- -- 14079.4084 0.065400 A20 G2 C5 T19 -- -- --
14079.4309 0.087940 A20 G5 C10 T13
[0168] Among the 16 possible base compositions for the forward
strand and the 18 possible base compositions for the reverse strand
that were calculated, only one pair (shown in bold) are
complementary base compositions, which indicates the true base
composition of the amplification product. It should be recognized
that this logic is applicable for determination of base
compositions of any bioagent identifying amplicon, regardless of
the class of bioagent from which the corresponding amplification
product was obtained.
[0169] In some embodiments, assignment of previously unobserved
base compositions (also known as "true unknown base compositions")
to a given phylogeny can be accomplished via the use of pattern
classifier model algorithms. Base compositions, like sequences,
vary slightly from strain to strain within species, for example. In
some embodiments, the pattern classifier model is the mutational
probability model. On other embodiments, the pattern classifier is
the polytope model. The mutational probability model and polytope
model are both commonly owned and described in U.S. patent
application Ser. No. 11/073,362 which is incorporated herein by
reference in entirety.
[0170] In one embodiment, it is possible to manage this diversity
by building "base composition probability clouds" around the
composition constraints for each species. This permits
identification of organisms in a fashion similar to sequence
analysis. A "pseudo four-dimensional plot" can be used to visualize
the concept of base composition probability clouds. Optimal primer
design requires optimal choice of bioagent identifying amplicons
and maximizes the separation between the base composition
signatures of individual bioagents. Areas where clouds overlap
indicate regions that may result in a misclassification, a problem
which is overcome by a triangulation identification process using
bioagent identifying amplicons not affected by overlap of base
composition probability clouds.
[0171] In some embodiments, base composition probability clouds
provide the means for screening potential primer pairs in order to
avoid potential misclassifications of base compositions. In other
embodiments, base composition probability clouds provide the means
for predicting the identity of a bioagent whose assigned base
composition was not previously observed and/or indexed in a
bioagent identifying amplicon base composition database due to
evolutionary transitions in its nucleic acid sequence. Thus, in
contrast to probe-based techniques, mass spectrometry determination
of base composition does not require prior knowledge of the
composition or sequence in order to make the measurement.
[0172] The present invention provides bioagent classifying
information similar to DNA sequencing and phylogenetic analysis at
a level sufficient to identify a given bioagent. Furthermore, the
process of determination of a previously unknown base composition
for a given bioagent (for example, in a case where sequence
information is unavailable) has downstream utility by providing
additional bioagent indexing information with which to populate
base composition databases. The process of future bioagent
identification is thus greatly improved as more BCS indexes become
available in base composition databases.
E. Triangulation Identification
[0173] In some cases, a molecular mass of a single bioagent
identifying amplicon alone does not provide enough resolution to
unambiguously identify a given bioagent. The employment of more
than one bioagent identifying amplicon for identification of a
bioagent is herein referred to as "triangulation identification."
Triangulation identification is pursued by determining the
molecular masses of a plurality of bioagent identifying amplicons
selected within a plurality of housekeeping genes. This process is
used to reduce false negative and false positive signals, and
enable reconstruction of the origin of hybrid or otherwise
engineered bioagents. For example, identification of the three part
toxin genes typical of B. anthracis (Bowen et al., J. Appl.
Microbiol., 1999, 87, 270-278) in the absence of the expected
signatures from the B. anthracis genome would suggest a genetic
engineering event.
[0174] In some embodiments, the triangulation identification
process can be pursued by characterization of bioagent identifying
amplicons in a massively parallel fashion using the polymerase
chain reaction (PCR), such as multiplex PCR where multiple primers
are employed in the same amplification reaction mixture, or PCR in
multi-well plate format wherein a different and unique pair of
primers is used in multiple wells containing otherwise identical
reaction mixtures. Such multiplex and multi-well PCR methods are
well known to those with ordinary skill in the arts of rapid
throughput amplification of nucleic acids. In other related
embodiments, one PCR reaction per well or container may be carried
out, followed by an amplicon pooling step wherein the amplification
products of different wells are combined in a single well or
container which is then subjected to molecular mass analysis. The
combination of pooled amplicons can be chosen such that the
expected ranges of molecular masses of individual amplicons are not
overlapping and thus will not complicate identification of
signals.
F. Codon Base Composition Analysis
[0175] In some embodiments of the present invention, one or more
nucleotide substitutions within a codon of a gene of an infectious
organism confer drug resistance upon an organism which can be
determined by codon base composition analysis. The organism can be
a bacterium, virus, fungus or protozoan.
[0176] In some embodiments, the amplification product containing
the codon being analyzed is of a length of about 35 to about 150
nucleobases. The primers employed in obtaining the amplification
product can hybridize to upstream and downstream sequences directly
adjacent to the codon, or can hybridize to upstream and downstream
sequences one or more sequence positions away from the codon. The
primers may have between about 70% to 100% sequence complementarity
with the sequence of the gene containing the codon being
analyzed.
[0177] In some embodiments, the codon base composition analysis is
undertaken
[0178] In some embodiments, the codon analysis is undertaken for
the purpose of investigating genetic disease in an individual. In
other embodiments, the codon analysis is undertaken for the purpose
of investigating a drug resistance mutation or any other
deleterious mutation in an infectious organism such as a bacterium,
virus, fungus or protozoan. In some embodiments, the virus is an
adventitious virus identified in a biological product.
[0179] In some embodiments, the molecular mass of an amplification
product containing the codon being analyzed is measured by mass
spectrometry. The mass spectrometry can be either electrospray
(ESI) mass spectrometry or matrix-assisted laser desorption
ionization (MALDI) mass spectrometry. Time-of-flight (TOF) is an
example of one mode of mass spectrometry compatible with the
analyses of the present invention.
[0180] The methods of the present invention can also be employed to
determine the relative abundance of drug resistant strains of the
organism being analyzed. Relative abundances can be calculated from
amplitudes of mass spectral signals with relation to internal
calibrants. In some embodiments, known quantities of internal
amplification calibrants can be included in the amplification
reactions and abundances of analyte amplification product estimated
in relation to the known quantities of the calibrants.
[0181] In some embodiments, upon identification of one or more
drug-resistant strains of an infectious organism infecting an
individual, one or more alternative treatments can be devised to
treat the individual.
G. Determination of the Quantity of a Bioagent
[0182] In some embodiments, the identity and quantity of an unknown
bioagent can be determined using the process illustrated in FIG. 2.
Primers (500) and a known quantity of a calibration polynucleotide
(505) are added to a sample containing nucleic acid of an unknown
bioagent. The total nucleic acid in the sample is then subjected to
an amplification reaction (510) to obtain amplification products.
The molecular masses of amplification products are determined (515)
from which are obtained molecular mass and abundance data. The
molecular mass of the bioagent identifying amplicon (520) provides
the means for its identification (525) and the molecular mass of
the calibration amplicon obtained from the calibration
polynucleotide (530) provides the means for its identification
(535). The abundance data of the bioagent identifying amplicon is
recorded (540) and the abundance data for the calibration data is
recorded (545), both of which are used in a calculation (550) which
determines the quantity of unknown bioagent in the sample.
[0183] A sample comprising an unknown bioagent is contacted with a
pair of primers that provide the means for amplification of nucleic
acid from the bioagent, and a known quantity of a polynucleotide
that comprises a calibration sequence. The nucleic acids of the
bioagent and of the calibration sequence are amplified and the rate
of amplification is reasonably assumed to be similar for the
nucleic acid of the bioagent and of the calibration sequence. The
amplification reaction then produces two amplification products: a
bioagent identifying amplicon and a calibration amplicon. The
bioagent identifying amplicon and the calibration amplicon should
be distinguishable by molecular mass while being amplified at
essentially the same rate. Effecting differential molecular masses
can be accomplished by choosing as a calibration sequence, a
representative bioagent identifying amplicon (from a specific
species of bioagent) and performing, for example, a 2-8 nucleobase
deletion or insertion within the variable region between the two
priming sites. The amplified sample containing the bioagent
identifying amplicon and the calibration amplicon is then subjected
to molecular mass analysis by mass spectrometry, for example. The
resulting molecular mass analysis of the nucleic acid of the
bioagent and of the calibration sequence provides molecular mass
data and abundance data for the nucleic acid of the bioagent and of
the calibration sequence. The molecular mass data obtained for the
nucleic acid of the bioagent enables identification of the unknown
bioagent and the abundance data enables calculation of the quantity
of the bioagent, based on the knowledge of the quantity of
calibration polynucleotide contacted with the sample.
[0184] In some embodiments, construction of a standard curve where
the amount of calibration polynucleotide spiked into the sample is
varied provides additional resolution and improved confidence for
the determination of the quantity of bioagent in the sample. The
use of standard curves for analytical determination of molecular
quantities is well known to one with ordinary skill and can be
performed without undue experimentation.
[0185] In some embodiments, multiplex amplification is performed
where multiple bioagent identifying amplicons are amplified with
multiple primer pairs which also amplify the corresponding standard
calibration sequences. In this or other embodiments, the standard
calibration sequences are optionally included within a single
vector which functions as the calibration polynucleotide. Multiplex
amplification methods are well known to those with ordinary skill
and can be performed without undue experimentation.
[0186] In some embodiments, the calibrant polynucleotide is used as
an internal positive control to confirm that amplification
conditions and subsequent analysis steps are successful in
producing a measurable amplicon. Even in the absence of copies of
the genome of a bioagent, the calibration polynucleotide should
give rise to a calibration amplicon. Failure to produce a
measurable calibration amplicon indicates a failure of
amplification or subsequent analysis step such as amplicon
purification or molecular mass determination. Reaching a conclusion
that such failures have occurred is in itself, a useful event.
[0187] In some embodiments, the calibration sequence is comprised
of DNA. In some embodiments, the calibration sequence is comprised
of RNA.
[0188] In some embodiments, the calibration sequence is inserted
into a vector that itself functions as the calibration
polynucleotide. In some embodiments, more than one calibration
sequence is inserted into the vector that functions as the
calibration polynucleotide. Such a calibration polynucleotide is
herein termed a "combination calibration polynucleotide." The
process of inserting polynucleotides into vectors is routine to
those skilled in the art and can be accomplished without undue
experimentation. Thus, it should be recognized that the calibration
method should not be limited to the embodiments described herein.
The calibration method can be applied for determination of the
quantity of any bioagent identifying amplicon when an appropriate
standard calibrant polynucleotide sequence is designed and used.
The process of choosing an appropriate vector for insertion of a
calibrant is also a routine operation that can be accomplished by
one with ordinary skill without undue experimentation.
H. Identification of Adventitious Viruses
[0189] In other embodiments of the present invention, the primer
pairs produce bioagent identifying amplicons within stable and
highly conserved regions of adventitious contaminant viruses. The
advantage to characterization of an amplicon in a highly conserved
region is that there is a low probability that the region will
evolve past the point of primer recognition, in which case, the
amplification step would fail. Such a primer set is thus useful as
a broad range survey-type primer. In another embodiment of the
present invention, the intelligent primers produce bioagent
identifying amplicons in a region which evolves more quickly than
the stable region described above. The advantage of
characterization bioagent identifying amplicon corresponding to an
evolving genomic region is that it is useful for distinguishing
emerging strain variants.
[0190] The present invention also has significant advantages as a
platform for identification of diseases caused by emerging viruses.
The present invention eliminates the need for prior knowledge of
bioagent sequence to generate hybridization probes. Thus, in
another embodiment, the present invention provides a means of
determining the etiology of a virus infection when the process of
identification of viruses is carried out in a clinical setting and,
even when the virus is a new species never observed before. This is
possible because the methods are not confounded by naturally
occurring evolutionary variations (a major concern for
characterization of viruses which evolve rapidly) occurring in the
sequence acting as the template for production of the bioagent
identifying amplicon. Measurement of molecular mass and
determination of base composition is accomplished in an unbiased
manner without sequence prejudice.
[0191] Another embodiment of the present invention also provides a
means of tracking the spread of any species or strain of virus when
a plurality of samples obtained from different locations are
analyzed by the methods described above in an epidemiological
setting. In one embodiment, a plurality of samples from a plurality
of different locations is analyzed with primer pairs which produce
bioagent identifying amplicons, a subset of which contains a
specific virus. The corresponding locations of the members of the
virus-containing subset indicate the spread of the specific virus
to the corresponding locations.
[0192] Members of the Parvoviridae family are small single stranded
DNA viruses with genomes of about 4-5 kilobases long. They can be
divided into (i) Dependovirus genus that includes the human
helper-dependent adeno-associated virus (AAV) serotypes 1 to 8 and
the autonomous avian parvoviruses; the adeno associated viruses
(AAV 1-8); (ii) Erythrovirus genus that includes the bovine,
chipmunk, and autonomous primate parvoviruses, including human
viruses B19 and V9; and (iii) Parvovirus genus that include
parvoviruses of other animals and rodents (except for chipmunks),
carnivores, and pigs, including murine minute virus (MMV). These
parvoviruses can infect several cell types and have been described
in clinical samples. AAVs in particular, have been implicated in
decreased replication, propagation, and growth of other virus.
[0193] Exogenous retroviruses are known to cause various malignant
and non-malignant diseases in animals over a wide range of species.
These viruses infect most known animals and rodents. Examples
include, but are not limited to: Deltaretroidvirus (HTLV 1-4, STLV
1-3), Gammaretrovirus (Murine leukemia virus, PERV),
Alpharetrovirus: (Avian leucosis virus and Avian endogenous virus)
and Human immunodeficiency viruses 1 and 2).
[0194] Polyomaviruses are small double-stranded DNA viruses that
can infect several species including humans, primates, rodents,
rabbits and birds. Because of their tumorigenic and oncogenic
potential, it is important to test for these viruses in cell
substrates used for vaccine production.
[0195] The Papillomaviridae family of viruses contains more that
150 known species representing varying host-specificity and
sequence homology. They have been identified in mammals (humans,
simians, bovines, canines, ovines) and in birds. Majority of the
human Papillomaviruses (HPVs), including all HPV types
traditionally called genital and mucosal HPVs belong to supergroup
A. Within supergroup A, there are 11 groups; the most medically
important of these are the human Papillomaviruses HPV 16, HPV 18,
HPV 31, HPV 45, HPV 11, HPV 6 and HPV 2. Each of these has been
reported as "high risk" viruses in the medical literature.
[0196] Other viral families which are potential adventitious
contaminants include, but are not limited to: Herpesviridae (Human
herpesviruses 1 through 8, Bovine herpesvirus, Canine herpesvirus
and Simian cytomegalovirus), Hepadnaviridae (Hepatitis B virus),
Hepeviridae (Hepatitis E virus), Deltavirus (Hepatitis delta
virus), Adenoviridae (Human adenoviruses A-F and murine
adenovirus), Flaviviridae (Bovine viral diarrhea virus, TBE, Yellow
fever virus, Dengue viruses 14, WNV and hepatitis C virus),
Paramyxoviridae (Pneumonia virus of mice, Sendai virus, and Simian
parainfluenza virus 5), Togaviridae (Western equine
encephalomyelitis virus), Picornaviridae (Polio (types 1-13), Human
hepatitis A, Human coxsackievirus, Human cardiovirus, Human
rhinovirus and Bovine rhinovirus), Reoviridae (Mouse rotavirus,
reovirus type 3 and Colorado tick fever virus), and Rhabdoviridae
(vesicular stomatitis virus).
I. Kits
[0197] The present invention also provides kits for carrying out
the methods described herein. In some embodiments, the kit may
comprise a sufficient quantity of one or more primer pairs to
perform an amplification reaction on a target polynucleotide from a
bioagent to form a bioagent identifying amplicon. In some
embodiments, the kit may comprise from one to fifty primer pairs,
from one to twenty primer pairs, from one to ten primer pairs, or
from two to five primer pairs. In some embodiments, the kit may
comprise one or more primer pairs recited in Table 3.
[0198] In some embodiments, the kit comprises one or more broad
range survey primer(s), division wide primer(s), or drill-down
primer(s), or any combination thereof. If a given problem involves
identification of a specific bioagent, the solution to the problem
may require the selection of a particular combination of primers to
provide the solution to the problem. A kit may be designed so as to
comprise particular primer pairs for identification of a particular
bioagent. A drill-down kit may be used, for example, to distinguish
different sub-species types of adventitious contaminant viruses or
genetically engineered adventitious contaminant viruses. In some
embodiments, the primer pair components of any of these kits may be
additionally combined to comprise additional combinations of broad
range survey primers and division-wide primers so as to be able to
identify the adventitious contaminant virus.
[0199] In some embodiments, the kit contains standardized
calibration polynucleotides for use as internal amplification
calibrants. Internal calibrants are described in commonly owned
U.S. patent application Ser. No: 60/545,425 which is incorporated
herein by reference in its entirety.
[0200] In some embodiments, the kit comprises a sufficient quantity
of reverse transcriptase (if an RNA virus is to be identified for
example), a DNA polymerase, suitable nucleoside triphosphates
(including alternative dNTPs such as inosine or modified dNTPs such
as the 5-propynyl pyrimidines or any dNTP containing molecular
mass-modifing tags such as those described above), a DNA ligase,
and/or reaction buffer, or any combination thereof, for the
amplification processes described above. A kit may further include
instructions pertinent for the particular embodiment of the kit,
such instructions describing the primer pairs and amplification
conditions for operation of the method. A kit may also comprise
amplification reaction containers such as microcentrifuge tubes and
the like. A kit may also comprise reagents or other materials for
isolating bioagent nucleic acid or bioagent identifying amplicons
from amplification, including, for example, detergents, solvents,
or ion exchange resins which may be linked to magnetic beads. A kit
may also comprise a table of measured or calculated molecular
masses and/or base compositions of bioagents using the primer pairs
of the kit.
[0201] In some embodiments, the kit includes a computer program
stored on a computer formatted medium (such as a compact disk or
portable USB disk drive, for example) comprising instructions which
direct a processor to analyze data obtained from the use of the
primer pairs of the present invention. The instructions of the
software transform data related to amplification products into a
molecular mass or base composition which is a useful concrete and
tangible result used in identification and/or classification of
bioagents. In some embodiments, the kits of the present invention
contain all of the reagents sufficient to carry out one or more of
the methods described herein.
[0202] While the present invention has been described with
specificity in accordance with certain of its embodiments, the
following examples serve only to illustrate the invention and are
not intended to limit the same. In order that the invention
disclosed herein may be more efficiently understood, examples are
provided below. It should be understood that these examples are for
illustrative purposes only and are not to be construed as limiting
the invention in any manner.
EXAMPLES
Example 1
Design and Validation of Primers that Define Bioagent Identifying
Amplicons for Adventitious Contaminant Viruses
A. General Process of Primer Design
[0203] For design of primers that define adventitious contaminant
virus identifying amplicons, a series of adventitious contaminant
virus genome segment sequences were obtained, aligned and scanned
for regions where pairs of PCR primers would amplify products of
about 45 to about 150 nucleotides in length and distinguish species
and/or individual strains from each other by their molecular masses
or base compositions. A typical process shown in FIG. 1 is employed
for this type of analysis.
[0204] A database of expected base compositions for each primer
region was generated using an in silico PCR search algorithm, such
as (ePCR). An existing RNA structure search algorithm (Macke et
al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated
herein by reference in its entirety) has been modified to include
PCR parameters such as hybridization conditions, mismatches, and
thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci.
U.S.A., 1998, 95, 1460-1465, which is incorporated herein by
reference in its entirety). This also provides information on
primer specificity of the selected primer pairs.
B. Design of Primers for Identification of Parvoviruses
[0205] Primer pairs were designed which broadly target the various
genera/species of the Parvovirinae family. Parvoviruses of the most
medical concern are: B19, AAV-5 and murine minute virus.
Approximately 500 complete Parvovirus genome sequences were
obtained from GenBank. These genome sequences (each approximately 5
kilobases long) were aligned and scanned for conserved target
regions. Initial survey of the genome alignments revealed very
little homology across the three major genera described above.
However, regions were identified with significant homologies within
each genus that were the target for primer design. In all three
genera, the regions of conservation were within two major nodes,
one in the rep gene, encoding NS1 protein, and the other in the
capsid, cap gene, encoding glycoprotein VP1 protein. This ability
to prime across all known instances of species within each of these
groups will enable surveillance for known parvoviruses and
detection of previously unknown parvoviruses in cell lines.
C. Design of Primers for Identification of Retroviruses
[0206] The objective of primer design for this viral family was to
obtain primer pairs that would prime and produce retrovirus
identifying amplicons for all known members of each of the genus
groups and as yet unknown variants. The T-lymphotropic viruses,
members of the deltaretrovirus genus, infect primates and cause
leukemia and neurologic diseases. These 9 kilobase single stranded
RNA viruses are highly transmissible. Primer pairs targeting the
transcription activator (tax) gene were designed to broadly prime
and resolve all known primate T-lymphotropic viruses including
human T-lymphotropic viruses (HTLV-1 and -2 and the newly
discovered HTLV-3 and -4), and simian T-lymphotropic viruses
(STLV-1, -2 and -3). These primer pairs produce retrovirus
identifying amplicons of simian and human T-lymphotropic virus
species with distinct base compositions indicating that the primer
pairs can yield amplification products which are distinguishable
from each other on the basis of molecular masses and base
compositions.
D. Design of Primers for Identification of Polyomaviruses
[0207] Approximately 200 complete Polyomavirus genome sequences
were obtained from GenBank. These genome sequences (approximately
5.3 kilobases long) were aligned to each other using bioinformatics
tools built in-house, and scanned for conserved target regions.
Initial survey of the genome alignments revealed a high degree of
homology between the primate (SV40) and the human viruses (BK and
JC), whereas the rest of the species were highly divergent and did
not share much sequence homology with these above species. For
primer design purposes, SV40, BK and JC viral species were
classified as a group. Nine different primer pairs (primer pairs
2549-2557) were designed to this cluster (See Table 3) and are
expected to provide redundant detection and resolution of the three
important Polyomavirus species. Most of these primers were targeted
to the large T antigen gene of Polyomavirus. Three additional
primer pairs (primer pair numbers 2559-2561) were designed to
include Lymphotropic papovavirus (LPV, the African green monkey
papovavirus). While these new primers were less conserved across
any one species, they would nonetheless provide broader coverage of
viral detection within this family. Additional primer pairs (RS
10-14) targeting the rest of the viral species (murine, avian,
bovine, etc.) were also designed. Taken together, these primers
would provide complete coverage of all known Polyomaviruses.
[0208] All of the polyomavirus primer pairs were tested against
multiple target species for performance and sensitivity. To test
the performance of these primers, plasmid clones containing full
length SV40 (ATCC: VRMC-4) and JC virus (ATCC: VRMC-1) DNA were
obtained from ATCC. Plasmid concentrations were determined by
optical density measurements and used as an approximate estimate of
the amount of input viral DNA template. Serial 10-fold dilutions of
the plasmid were used for estimating limits of detection. These
were tested against the entire panel of 12 primer pairs (primer
pair numbers 2549-2561). The primer pairs were initially tested at
10.sup.-7 and 10.sup.-8 fold dilutions of each of the plasmids and
showed reliable detections, with the exception of primer 2555.
Additional testing of a subset of these primer pairs showed that
while several primer pairs were able to detect additional, lower
dilutions, some of the primer pairs were unsuccessful at producing
polyomavirus identifying amplicons below the 10.sup.-9 dilution.
Based on this initial test, a panel of six primers (primer pair
numbers 2550, 2551, 2553, 2554, 2557 and 2559) was chosen for use
in cell-line characterization. These primers will be tested against
known cell lines containing SV-40 and other Polyomaviruses.
[0209] For routine screening of cell lines, it is anticipated that
as few as two of the primer pairs described above along with the
four primers targeting non-human Polyomavirus can provide complete
coverage of all known and potentially novel Polyomaviruses. A
nucleic acid segment within the large tumor antigen gene provides
opportunities for broad priming across human and simian species due
to a codon deletion at position 32 of the simian virus 40, which is
exemplified by primer pair number 2555 (SEQ ID NO: 112:207). Murine
pneumonotropic virus, African green monkey PyV virus, SV40 virus,
BK virus, JC virus, hamster PyV and murine PyV virus can be
distinguished from each other on the basis of base compositions of
amplification products produced with primer pair number 2560 (SEQ
ID NOs: 12:260).
E. Design of Primers for Identification of Papillomaviruses
[0210] Broad primer pairs covering a set of important human
Papillomaviruses (HPV 16, 18, 31, 45, 11, 6, 2) were designed
(primer pair numbers 2533-2536). These belong to different groups,
but have all been reported in literature to be "high risk" Covering
all of these species broadly combined with group-specific primer
pairs described above would be of great value. Additionally,
several primer pairs were designed to cover broadly within a single
group or across multiple groups of Papillomaviruses to increase
robustness of detection.
[0211] All of the primer pairs were tested against a panel of
Papillomaviruses obtained from ATCC. The following viruses were
obtained as full-length plasmid clones: ATCC 45150D (HPV-6b); ATCC
45151D (HPV-11); ATCC 45152D (HPV-18); and ATCC 45113D (HPV-16).
Two of the broad primer pairs (numbers 2534 and 2536) amplified all
four viruses tested at two different dilutions of the plasmids.
Primer pair number 2535 (SEQ ID NOs: 28:253) amplified only two of
the test isolates, while primer pair 2533 (30:268) did not amplify
any of the viruses tested. Based on these initial results, Primer
pair numbers 2534 (SEQ ID NOs: 30:267) and 2536 (SEQ ID NOs:
19:267) were selected for further optimization. A series of primer
modifications, including, for example, inosine substitutions to
overcome potential sequence mismatches were introduced into the
forward and reverse primer pairs. Most of the modified primers
tested showed improved performance across the test isolates. In
addition to the primers broadly targeting the major species, a
series of primers targeting Papillomavirus groups, A7, A9 and A10
that account for over 30 different Papillomaviruses were also
tested. Table 2 provides the primer pairs used for Papillomavirus
identification and indicates isolates tested, target virus groups
and major species covered. TABLE-US-00002 TABLE 2 Primer Pairs
Targeting Human Papillomaviruses Primer Pair Isolates Target Virus
Major Species Number Tested Group Covered 2537 HPV-16 Group A9
HPV-16, HPV-31, 2539 HPV-33, HPV-35, 2540 HPV-52, HPV-58, HPV-67,
and RhPV 2543 HPV-18 Group A7 HPV-18, HPV-39, 2544 HPV-45, HPV-59,
2545 HPV-68, and HPV-70 2546 HPV-6, HPV-11 Group A10 HPV-6, HPV-11,
2547 HPV-13, HPV-44, 2548 HPV-55, and PCPV 2541 HPV-6, HPV-11,
Groups A1, >30 different 2542 HPV-18 A7, A8, A10 Papilloma and
A11 viruses
F. Validation of Primer Pairs Designed for Identification of
Papillomaviruses
[0212] For additional testing and validation, two different HeLa
cell lines infected with HPV-18 were obtained from ATCC (CCL-2 and
CCL-2.2). These were tested at limiting dilutions using a subset of
the primers listed above. Results are shown below. The primer pairs
used for this test included the major human PaV primer pairs, 2534
(SEQ ID NOs: 30:267), 2536 (SEQ ID NOs: 19:267) and 2685 (SEQ ID
NOs: 18:272), the multi-group primer 2542 (SEQ ID NOs: 49:218), the
Group A7 targeted primers 2544 (SEQ ID NOs: 8:294) and 2545 SEQ ID
NOs: 98:193) and the Group A10 primer 2546 (SEQ ID NOs:
64:302).
[0213] In addition to testing the performance of the primers on the
cell lines, plasmid DNA containing HPV-6b was spiked into the CCL-2
cell line to determine the dynamic range of detection of the two
viruses, cell line derived HPV-18 and the plasmid-derived HPV-6b,
simultaneously, In all the tests done, the broad primers as well as
the Group A7 primers showed detection of HPV-1 8 in both cell lines
at input levels between 1-10 cells per well. At an estimated copy
number of approximately 20 HPV-18 genomes per cell, this
corresponds to detection sensitivities between 20-200 genomes from
cell lines containing papillomavirus sequences. In experiments done
with a co-spike of HPV-6b plasmid into these cell lines, the
detection ranges were comparable. HPV-6b was spiked in at two
different, fixed concentrations of 200 copies and 2000 copies per
well and amplified with the broad primer pair number 2534.
Simultaneous detection of HPV-6b and HPV-18 was observed when the
plasmid DNA was spiked in at 2000 copies into a range of CCL-2 cell
concentration from 1000 to 0 per well. HPV-18 was detected in all
wells with the exception of the lowest input level (10 cells/well),
in the presence of 2000 copies of HPV-6b. HPV-6b (2000 copies) was
detected in the presence of HeLa cell loads up to 600 cells/well,
with an effective HPV-18 concentration of approximately 12000
genomes/well. In another experiment, a plasmid spike of
approximately 200 copies per well was used. In this case, HPV-18
was detected at all test concentrations, including the lowest cell
concentration of 10 cells per well. The dynamic range for detection
of the two viruses simultaneously is between 5-10 fold at the lower
and higher ends, giving an overall dynamic range of .about.25 fold
for the detection of competing templates in the presence of each
other. These experiments indicate that two or more viruses can be
simultaneously detected using the same assay.
G. Primer Pair Compositions for Identification of Adventitious
Viruses
[0214] A total of 224 primer pairs were designed. Table 3 which
represents a collection of primers (sorted by primer pair number)
designed to identify adventitious contaminant viruses using the
methods described herein. "I" represents inosine. Tp represents
propynylated T and Cp represents propynylated CP, wherein the
propynyl substituent is located at the 5-position of the pyrimidine
nucleobase. The primer pair number is an in-house database index
number. The forward or reverse primer name shown in Table 3
indicates the gene region of the viral genome to which the primer
hybridizes relative to a reference sequence. The forward primer
name RVL_X03614.sub.--2256.sub.--2279_F indicates that the forward
primer (_F) hybridizes to residues 2256-2279 of a respirovirus
(Paramyxoviridae) sequence (GenBank Accession r X03614).
TABLE-US-00003 TABLE 3 Primer Pairs for Identification of
Adventitious Contaminant Viruses Primer Forward Reverse Pair SEQ ID
SEQ ID Number Forward Primer Name Forward Sequence NO: Reverse
Primer Name Reverse Sequence NO: 377 RVL_X03614_2256.sub.--
TAGTGCAATCCATCTAGCAGCTGT 39 RVL_X03614_2302.sub.--
TGATTGTCGCCTTGAACCATT 293 2279_F 2324_R GC 378
RVL_X03614_2239.sub.-- TGGACATTCATCTCTATCAGTGC 132
RVL_X03614_2302.sub.-- TGATTGTCGCCTTGAACCATT 293 2261_F 2324_R GC
379 PVL_U50363_3176.sub.-- TAGATCCACAAGCTTTAGGGTCTG 22
PVL_U50363_3272.sub.-- TGTTGTGCACTTTTGGAGAAT 350 3199_F 3296_R ATTT
380 PVL_U50363_3153.sub.-- TGCTGAATTCGTAACATTGATGA 130
PVL_U50363_3265.sub.-- TTTTGGCGAATATTTTGTTTG 371 3175_F 3286_R G
381 MVL_AF266286.sub.-- TAGGGAGACTTTTTGCTAAAATGAC 33
MVL_AF266286.sub.-- TCCTTTGCCATCCCATTGTC 248 1625_1649_F
1720_1739_R 382 MVL_AF266286.sub.-- TGTTTGCACAGAGGCTAAATGA 170
MVL_AF266286.sub.-- TGGGCAATGAGGGTCACT 318 2033_2054_F 2122_2139_R
383 MVL_AF266286.sub.-- TGCCTTAATTGGAGATATGAGAC 126
MVL_AF266286.sub.-- TCATTTAGCCTCTGTGCAAA 234 2002_2024_F
2035_2054_R 384 MSVL_AF266286.sub.-- TGTGTCATCTGCGAGTGTGG 168
MSVL_AF266286.sub.-- TTGTCAATATCATCCAGTTGG 366 3529_3548_F
3587_3608_R C 385 PNVL_U50363.sub.-- TTTGGACACCCAATGGT 185
PNVL_U50363.sub.-- TACTCTAACAGCATCCAT 199 1285_1301_F 1318_1335_R
386 PNVL_U50363.sub.-- TAGAATGTTTGCTATGCAACC 20 PNVL_U50363.sub.--
TTCTCAGCTAACAATTTCTCA 357 1878_1898_F 1927_1949_R GC 387
PNVL_U50363.sub.-- TATGTTTGCTATGCAACC 51 PNVL_U50363.sub.--
TGCTAACAATTTCTCAGC 304 1881_1898_F 1927_1944_R 388
PNVL_U50363.sub.-- TAGGACCGTGGATAAACAC 27 PNVL_U50363.sub.--
TCTTTCCCCTCTGTATTCTAA 278 2669_2687_F 2743_2763_R 389
MNVL_NC004148.sub.-- TGTTAATGTCTATCTTCCTGACTC 169
MNVL_NC004148.sub.-- TGAACCAATTGCATTAGTCTC 280 24_47_F 73_96_R ACT
390 MNVL_NC004148.sub.-- TGTCTATCTTCCTGACTC 157
MNVL_NC004148.sub.-- TAATTGCATTAGTCTCACT 190 30_47_F 73_91_R 391
MNVL_NC004148.sub.-- TAAGTAAGTTCAACCAAGCCTTTAG 5
MNVL_NC004148.sub.-- TGTAACCAGCAGAATAGGCTT 332 1907_1931_F
1984_2006_R TG 392 MNVL_NC004148.sub.-- TAACCAAGCCTTTAG 3
MNVL_NC004148.sub.-- TACAGAATAGGCTTTG 191 1917_1931_F 1984_1999_R
393 MNVL_NC004148.sub.-- TCAAGAGATCTTCAGTTTATGAGTAA 55
MNVL_NC004148.sub.-- TGTTTATCCATGGTCCCACTC 354 2389_2414_F
2468_2488_R 394 MNVL_NC004148.sub.-- TCAAGAGATCTTCAGTTTAT 54
MNVL_NC004148.sub.-- TCTAATATTGTGTTTATCCA 261 2389_2408_F
2479_2498_R 395 MNVL_NC004148.sub.-- TGAACATACCAATGCAGTT 104
MNVL_NC004148.sub.-- TCAGGGGTCCTTCTATA 230 2738_2756_F 2794_2810_R
409 CRVCP_AY219836.sub.-- TGACGTAGCCAAGGAGGCGTT 109
CRVCP_AY219836.sub.-- TGAGGATGTGTCCAAGATGGC 287 2_22_F 46_70_R TGCG
410 CRVCP_AY219836.sub.-- TCGCAGCCATCTTGGCAACATCCTC 95
CRVCP_AY219836.sub.-- TGCGGGAAAGGCGGGAGTTGA 303 45_69_F 136_160_R
AGAT 411 CRVCP_AY219836.sub.-- TCCAGGTACTTCACCCCCAAACCTG 73
CRVCP_AY219836.sub.-- TGCCGAGGCCTATGTGGTCGA 301 475_499_F 577_601_R
CATT 412 CRVRP_AY219836.sub.-- TCAACCACATAAGAGGTGGCTGTTC 52
CRVRP_AY219836.sub.-- TAGGGAGATTGGGAGCTCCCG 209 24_48_F 84_108_R
TATT 413 CRVRP_AY219836.sub.-- TGGCTGAACTTTTGAAAGTGAGCGG 139
CRVRP_AY219836.sub.-- TCGGGCCCACTATGACGTGTA 255 440_464_F 495_517_R
CA 414 CRVRP_AY219836.sub.-- TGGGATGATCTACTGAGACTGTGTGA 141
CRVRP_AY219836.sub.-- TGGTAATCAAAATACTGCGGG 325 658_683_F 730_754_R
CCAA 415 CRVRP_AY219836.sub.-- TGGTACTCCTCAACTGCTGTCC 146
CRVRP_AY219836.sub.-- TCCGTGGATTGTTCTGTAGCA 244 775_796_F 843_869_R
GTCTTC 990 HIV1_NC001802.sub.-- TAGCAGGAAGCACTATGGGCG 25
HIV1_NC001802.sub.-- TCAGCAAATTGTTCTGCTGCT 224 7344_7364_F
7413_7439_R GCACTA 991 HIV1_NC001802.sub.-- TGAGCAGCAGGAAGCACTATGG
111 HIV1_NC001802.sub.-- TAGCAAATTGCTTTGCTGTTG 205 7340_7361_F
7413_7438_R CACTA 992 HIV1_NC001802.sub.--
TGTGAATATCAAGCAGGACATAACAA 163 HIV1_NC001802.sub.--
TGGTCTTCTGGGGCTTGTTCC 330 4983_5014_F GGTAGG 5104_5127_R ATC 993
HIV1_NC001802.sub.-- TATAATCCACCTATCCCAGTAGGAGA 40
HIV1_NC001802.sub.-- TTTGGTCCTTGTCTTATGTCC 370 1089_1117_F AAT
1178_1204_R AGAATG 994 HIV2_NC001722.sub.--
TCGAAAAACCTCCAGGCAAGAGTCAC 93 HIV2_NC001722.sub.--
TCTAAACGCACATCCCCATGA 259 8414_8439_F 8476_8500_R ATTT 995
HIV2_NC001722.sub.-- TCAGGCAAGAGTCACTGCTATCGAGA 65
HIV2_NC001722.sub.-- TGTCTAAACCCACATCCCCAT 341 8425_8450_F
8476_8502_R GAATTT 996 HIV2_NC001722.sub.--
TGCCAGGGAGTAGTAGAAGCAATGAA 121 HIV2_NC001722.sub.--
TGTCATATCCCCTATTCCTCC 337 5050_5075_F 5169_5196_R CCTTCTT 997
HIV2_NC001722.sub.-- TGCCAGGGAGTAGTAGAAGCAATGAA 121
HIV2_NC001722.sub.-- TCCTATTCCTCCCCTTCTTTT 245 5050_5075_F
5156_5187_R AAAATTCATGC 998 HTLV1_NC001436.sub.--
TGCCAATCACTCATACAACCCCCAA 118 HTLV1_NC001436.sub.--
TGGTCTGGAAAAGACAGGGTT 329 7221_7245_F 7330_7353_R GGG 999
HTLV1_NC001436.sub.-- TCAGAGCATCAGATCACCTGGGACC 63
HTLV1_NC001436.sub.-- TGAGGGGAGTCGAGGGATAAG 289 7094_7118_F
7153_7177_R GAAC 1000 HTLV1_NC001436.sub.-- GGAGGCTCCGTTGTCTGCATGTA
2 HTLV1_NC001436.sub.-- TCGTTTGTAGCGAACATTGGT 257 7388_7410_F
7489_7516_R GAGGAAG 1001 HTLV1_NC001436.sub.--
TACTCTCACACGGCCTCATACAGTAC 15 HTLV1_NC001436.sub.--
TGGGGCTCATGGTCATTGTCA 322 7818_7843_F 7925_7947_R TC 1002
HTLV1_NC001436.sub.-- TCTTTTCCAGACCCCGGACTCC 103
HTLV1_NC001436.sub.-- TGGGAAAGCTGGTAGAGGTAC 316 7340_7361_F
7404_7428_R ATGC 1003 HTLV1_NC001436.sub.--
TCGTTATCGGCTCAGCTCTACAGTTC 99 HTLV1_NC001436.sub.--
TGAGTGATTGGCGGGGTAAGG 291 7131_7156_F 7211_7233_R AC 1004
HTLV2_NC001488.sub.-- TAGAGGCGGATGACAATGGCG 21
HTLV2_NC001488.sub.-- TACTTGGGATTGTTTGTGTGA 203 8180_8200_F
8254_8279_R GACGG 1005 HTLV2_NC001488.sub.--
TCACCAAGGTGCCTCTAAAACGA 58 HTLV2_NC001488.sub.--
TCATTGTGGTGGGTAGGTCGT 233 7757_7779_F 7840_7861_R C 1006
HTLV2_NC001488.sub.-- TGGACCATCATTGGAAGGGACG 133
HTLV2_NC001488.sub.-- TGGTGTTTGGAGTGGCTATTG 331 2435_2456_F
2516_2540_R GCAG 1007 HTLV2_NC001488.sub.--
TTATGTCCTTGGGGTCACCTACTGG 172 HTLV2_NC001488.sub.--
TCTTGCTTTGACATGTTGTGG 277 3592_3616_F 3680_3704_R TGGA 1008
HTLV2_NC001488.sub.-- TCCATACTTCGCCTTCACCATTCCC 74
HTLV2_NC001488.sub.-- TGTTGAGGACGGCTGCTAATT 348 2880_2904_F
2989_3013_R GTTG 1009 HTLV2_NC001488.sub.--
TTTCGTTGTGGCAAGGTAGGACAC 184 HTLV2_NC001488.sub.--
TTTGAGTTGTGGGCAGTCCCT 369 1896_1919_F 1993_2015_R TT 1010
HTLV2_NC001488.sub.-- TCACCACGCAATGCTTCCCTATCTT 59
HTLV2_NC001488.sub.-- TCCTGCTTGATGGCCTGTAAG 247 1198_1222_F
1268_1291_R TCT 1011 HTLV2_NC001488.sub.-- TTGGTCCATGACTCCGACCTTGAA
183 HTLV2_NC001488.sub.-- TGAGGCTGGATCTATCCACGC 288 5735_5758_F
5847_5870_R AAA 1012 HTLV2_NC001488.sub.--
TCCGATGCACATTCACGGTTGGTAT 80 HTLV2_NC001488.sub.--
TAGTCGTTGGTCCGTTGTTAG 215 5241_5265_F 5332_5356_R GGAA 1013
HCV_NC001433_66.sub.-- TCTAGCCATGGCGTTAGTATGAGTGT 101
HCV_NC001433.sub.-- TGTTCCGCAGACTACTATGGC 372 91_F 121_145_R TCTC
1014 HCV_NC001433_66.sub.-- TCTAGCCATGGCGTTACTATGAGTGT 101
HCV_NC001433.sub.-- TGGCAATTCCGGTGTACTCAC 311 91_F 146_167_R C 1015
HCV_NC001433_66.sub.-- TCTAGCCATGGCGTTAGTATGAGTGT 101
HCV_NC001433.sub.-- TACTCACCGGTTCCGCAGACC 197 91_F 128_153_R ACTAT
1016 HCV_NC001433_51.sub.-- TTCACGCAGAAAGCGTCTAGCCAT 175
HCV_NC001433.sub.-- TGTTCCGCAGACCACTATGGC 346 74_F 121_145_2_R TCTC
1017 HCV_NC001433_51.sub.-- TTCACGCAGAAAGCGTCTAGCCA 174
HCV_NC001433.sub.-- TGGCAATTCCGGTGTACTCAC 311 73_F 146_167_R C 1018
HCV_NC001433_51.sub.-- TCACGCAGAAAGCGTCTAGCCA 174
HCV_NC001433.sub.-- TACTCACCGGTTCCGCAGACC 197 73_F 128_153_R ACTAT
1019 HCV_NC001433_62.sub.-- AGCGTCTAGCCATGGCGTTAGTAT 1
HCV_NC001433.sub.-- TACTCACCGGTTCCGCAGACC 197 85_F 128_153_R ACTAT
1020 HCV_NC001433.sub.-- TCGCAAGACTGCTAGCCGAGTA 94
HCV_NC001433.sub.-- TCGCAAGCACCCTATCAGGCA 251 227_248_F 277_298_R G
1021 HCV_NC001433.sub.-- TAGGTCGCGTAATTTGGGTAAGGTCA 37
HCV_NC001433.sub.--
TGAATGTACCCCATGAGGTCG 284 671_698_F TC 720_742_R GC 1022
HCV_NC001433.sub.-- TCCTTCACGGAGGCTATGACTAGGTA 92
HCV_NC001433.sub.-- TCGACACATTGGAGGAGCATG 249 8598_8623_F
8674_8700_R ATGTTA 1023 WN_NC001563.sub.--
TCAGTGAATATCACTAGCCAGGTGCT 66 WN_NC001563.sub.--
TGTTCCACTTCCCAAGTTTAC 345 8365_8390_F 8434_8463_R ATCTTCCTC 1024
WN_NC001563.sub.-- TGCTCCTCTCAAAACCATGGGACAC 129 WN_NC001563.sub.--
TCAGGAGCTTTCGTGTCCACC 227 8654_8678_F 8749_8771_R TT 1025
WN_NC001563.sub.-- TCATCTACAACATGATGGGAAAGAGA 69 WN_NC001563.sub.--
TAGCTCCGAGCCACATGAACC 206 9026_9055_F GAGA 9101_9121_R 1026
WN_NC001563.sub.-- TGGATAGAGGAGAATGAATGGATGGA 135
WN_NC001563.sub.-- TCAGGCTGCCACACCAGATGT 229 10135_10164_F AGAC
10216_10237_R C 1027 WN_NC001563.sub.-- TGTCACACTTGCATTTACAACATGAT
155 WN_NC001563.sub.-- TCCACATGAACCAAATGGCTC 235 9016_9043_F GG
9088_9112_R TGCT 1028 WN_NC001563.sub.-- TCAAGATGGGGAATGAGATTGCCCTT
56 WN_NC001563.sub.-- TACTCCGTCTCGTACGACTT 198 5696_5721_F
5758_5783_R TCTGTT 1029 WN_NC001563.sub.--
TGCCTAGTGTGAAGATGGGGAATGAG 124 WN_NC001563.sub.--
TGTTGTGATAACAAAGTCCCA 349 5687_5714_F AT 5796_5826_R ATCATCGTTC
1030 WN_NC001563.sub.-- TCCGGGCTGTCAATATGCTAAAACG 83
WN_NC001563.sub.-- TCGATCAGGCTCAACATAGCC 250 128_152_F 187_212_R
CTCTT 1031 WN_NC001563.sub.-- TCCGTCGCAAGTTGGTGATGAGTA 84
WN_NC001563.sub.-- TGCATGTTGATGTTGTCCAGC 300 5994_6017_F
6079_6104_R ATGAT 1032 WN_NC001563.sub.--
TGATTGACCCTTTTCAGTTGGGCCTT 115 WN_NC001563.sub.--
TGCTGATCTTGGCTGTCCACC 307 3527_3552_F 3591_3613_R TC 1245
HBV_X51970_320.sub.-- TCAACCTCCAATCACTCACCAAC 53
HBV_X51970_379.sub.-- TATATGATAAAACGCCGCAGA 216 342_F 402_R CAC
1246 HBV_X51970_317.sub.-- TCCCCAATCTCCAATCACTCACCAA 76
HBV_X51970_379.sub.-- TAGGAATATGATAAAACGCCG 208 341_F 406_R CAGACAC
1247 HBV_X51970_311.sub.-- TCGCAGTCCCCAATCTCCAATCACT 96
HBV_X51970_382.sub.-- TGAAGAGGAATATGATAAAAC 281 335_F 410_R
GCCGCAGA 1248 HBV_X51970_1375.sub.-- TGGCTGCTAGGCTGTGCTGCCAACT 140
HBV_X51970_1412.sub.-- TACGGGACGTAAACAAAGGAC 195 1399_F 1436_R GTCC
1249 HBV_X51970_1777.sub.-- TACTAGGAGGCTGTAGGCATAAATTG 13
HBV_X51970_1868.sub.-- TCAGGCACAGCTTGGAGGC 228 1798_F GT 1886_R
1250 HBV_X51970_183.sub.-- TACCCCTGCTCGTGTTACAGG 11
HBV_X51970_228.sub.-- TGTCTAGACTCTGTGGTATTG 342 203_F 254_R TGAGGA
1251 HBV_X51970_180.sub.-- TAGGACCCCTGCTCGTGTTACAG 26
HBV_X51970_262.sub.-- TGCTCCCCCTAGAAAATTGAG 306 202_F 289_R AGAAGTC
1252 HBV_X51970_374.sub.-- TGGATGTGTCTGCGGCGTT 136
HBV_X51970_423.sub.-- TCCAGAAGAACCAACAAGAAG 236 392_F 450_R ATGAGGC
1253 HBV_X51970_368.sub.-- TATCGCTGGATGTGTCTGCGG 46
HBV_X51970_424.sub.-- TAATCCAGAAGAACCAACAAG 189 388_F 453_R
AAGATGAGG 1254 HBV_X51970_312.sub.-- TGCAGTCCCCAATCTCCAATCACT 117
HBV_X51970_376.sub.-- TGATAAAACGCCGCAGACACA 292 335_F 398_R TC 2293
HTLV_TAX_GENE.sub.-- TCACCTGGGACCCCATCGATGGAC 60
HTLV_TAX_GENE.sub.-- TCTCTGGGTGGGGAAGGAGGG 264
NC_001436_7107.sub.-- NC_001436_7169.sub.-- GAG 7130_F 7192_R 2294
HTLV_TAX_GENE.sub.-- TCAGAGCATCAGATCACCTGGGACC 63
HTLV_TAX_GENE.sub.-- TTGGCGGGGTGAGGACCTTGA 365
NC_001436_7094.sub.-- NC_001436_7203.sub.-- GGG 7118_F 7226_R 2295
HTLV_TAX_GENE.sub.-- TACCCAGTCTACGTGTTTGGCGACTG 9
HTLV_TAX_GENE.sub.-- TCCATCGATGGGGTCCCAGGT 240
NC_001436_6989.sub.-- TGT NC_001436_7109.sub.-- 7017_F 7129_R 2408
ARENAS_NC004296.sub.-- TGGTGTGGTGAGAGTTTGGGA 149
ARENAS_NC004296.sub.-- TGGCATGGTGCCAAACTGATT 313 474_494_F
520_540_R 2409 ARENAS_NC004296.sub.-- TGGIGTGGTGAGAGTTTGGGA 145
ARENAS_NC004296.sub.-- TGGCATIGTGCCAAACTGATT 314 474_494_2_F
520_540_2_R 2410 ARENAS_NC004296.sub.-- TGTCTTTCAGGAGATGGATGGCC 160
ARENAS_NC004296.sub.-- TGTGTTTTCCCAAGCTCTTCC 344 931_953_F
982_1002_R 2411 ARENAS_NC004296.sub.-- TGTCTTTCAGGIGAIGGATGGCC 161
ARENAS_NC004296.sub.-- TGTTTTCCCAIGCCCTCCC 355 931_953_2_F
982_1000_R 2412 ARENAS_NC004293.sub.-- TGGTGTTGTGAGGGTCTGGGA 150
ARENAS_NC004293.sub.-- TGCTGGCATGAACCAAACTGA 308 459_479_F
505_527_R TT 2413 ARENAS_NC004293.sub.-- TGGTGTTGTGAGGGTCTGGGA 150
ARENAS_NC004293.sub.-- TGGTCAAAGCTGGCATGAACC 327 459_479_F
511_534_R AAA 2414 ARENAS_NC004293.sub.-- TGGTGTTGTGAGGGTCTGGGA 150
ARENAS_NC004293.sub.-- TGGTCAIAGCIGGCATGAACC 328 459_479_F
511_534_2_R AAA 2415 ARENAS_NC004293.sub.-- TGGTGTTGTGAGGGTCTGGGA
150 ARENAS_NC004293.sub.-- TGGTCAIAGCIGGCATGAACp 328 459_479_F
511_534P_R CpAAA 2416 ARENAS_NC004293.sub.--
TGTCTCTCTGGAGATGGGTGGCC 159 ARENAS_NC004293.sub.--
TCAACACTGGTGTTGTCCCA 221 915_937_F 975_994_R 2417
ARENAS_NC004293.sub.-- TGTCTCTCTGGAGATGGGTGGCC 159
ARENAS_NC004293.sub.-- TCAACACTGGTGTpTpGTCpC 221 915_937_F
975_994P_R pCA 2418 ARENAS_NC004293.sub.-- TGTCTCTCIGGIGATGGITGGCC
158 ARENAS_NC004293.sub.-- TCAACACTGGTGTTGTCCCA 221 915_937_2_F
975_994_R 2419 ARENAS_NC004293.sub.-- TGTCTCTCIGGIGATGGITGGCC 158
ARENAS_NC004293.sub.-- TCAACACTGGTGTpTpGTCpC 221 915_937_2_F
975_994P_R pCA 2420 ARENAS_NC004293.sub.--
TGTCTCTCIGGIGATGGITpGGCpCp 158 ARENAS_NC004293.sub.--
TCAACACTGGTGTpTpGTCpC 221 915_937P_F 975_994P_R pCA 2423
POL_NC003461.sub.-- TAGTCTCAAAGAGAAAGAGATCAAAC 38
POL_NC003461.sub.-- TCAATCTCTCCCTTAACCATC 222 1620_1649_F AAGA
1747_1772_R CCATT 2424 POL_NC003461.sub.--
TGTACAATCTATGTAGGAGATCCTTA 152 POL_NC003461.sub.--
TGTCCATAATTTCTGGCAATA 340 2107_2138_F CTGTCC 2215_2244_R ACCTTCTAT
2425 POL_NC003461.sub.-- TATCAGTGCAATCCATCTAGCAGCTG 45
POL_NC003461.sub.-- TGGCTTGATTGTCTCCTTGAA 315 2253_2279_F T
2302_2329_R CCATTGC 2426 POL_NC003461.sub.--
TATCAGTGCAATCCATCTAGCAGCTG 45 POL_NC003461.sub.--
TACTCTTGTTGTCACAGCTAT 200 2253_2279_F T 2320_2349_R AGCTTGATT 2427
POL_NC003461.sub.-- TATCAGTGCAATCCATCTAGCAGCTG 45
POL_NC003461.sub.-- TGGTACTCTTGATGTCACAGC 326 2253_2279_F T
2320_2352_R TATAGCTTGATT 2428 POL_NC003461.sub.--
TAGTGCAATCCATCTAGCAGCTGT 39 POL_NC003461.sub.--
TGATTGTCGCCTTGAACCATT 293 2256_2279_F 2302_2324_R GC 2429
POL_NC003461.sub.-- TGAGACCATCATAAGTAGCAAGATGT 110
POL_NC003461.sub.-- TCTCCCATCATAGTATATCCT 263 2463_2488_F
2497_2523_R TTTGCT 2430 POL_NC003461.sub.--
TATAGGGTCATGAATCAAGAACCCGG 41 POL_NC003461.sub.--
TGCATGAATAAGGGTCTGAAG 299 2935_2960_F 2980_3004_R CCCA 2431
POL_NC003461.sub.-- TATAGGGTCATGAATCAAGAACCIGG 42
POL_NC003461.sub.-- TGCATGAATAAGGGTCTGAAG 299 2935_2960_2_F
2980_3004_R CCCA 2432 POL_NC003461.sub.-- TTGGATCAGCCACTGATGAAAGATC
182 POL_NC003461.sub.-- TGCTTCCATCCACGATATCTC 309 3644_3668_F
3760_3783_R ATC 2433 POL_NC003461.sub.-- TGATGACATATCGTGGATGGAAGC
114 POL_NC003461.sub.-- TGCACTAGAAAACTTCATCTG 295 3759_3782_F
3880_3912_R GGTTGCAGTATC 2434 POL_NC003461.sub.--
TGATGAAATATCGTGGATGGAAGC 113 POL_NC003461.sub.--
TGCACTAGAGAATTTCATCTG 296 3759_3782_2_F 3880_3912_2_R GGTTGCAGTATC
2435 RUBPOL_NC003443.sub.-- TGTGCATCTTACTCACTAAAGGAGAA 164
RUBPOL_NC003443.sub.-- TTCTGCAATTACTTGACACG 358 1636_1661_F
1708_1734_R ACCTCAT 2436 RUBPOL_NC003443.sub.--
TCAGTTGATGGGCCTACCTCATTTCT 68 RUBPOL_NC003443.sub.--
TAGGGTCACTTGGAGGATTGA 210 2067_2093_F T 2143_2167_R AAGG 2437
RUBPOL_NC003443.sub.-- TGTAGGTGATCCCTTCAATCCTCC 154
RUBPOL_NC003443.sub.-- TTGCAGAGATGGAGATCATTG 359 2133_2156_F
2251_2275_R TCCA 2438 RUBPOL_NC003443.sub.--
TATGTCAAAAGCTGTpGGACpAATpG 50 RUBPOL_NC003443.sub.--
TTGCTTGGTTATpCpACpCpC 360 2237_2261P_F AT 2318_2341P_R TGAACpCA
2439 RUBPOL_NC003443.sub.-- TGTGGACAATCATCTCCATTGCTGCA 167
RUBPOL_NC003443.sub.-- TGGACCATACAGGCAACCCGA 310 2249_2276_F AT
2301_2324_R CAA 2440 RUBPOL_NC003443.sub.--
TTGCGTCAATGGCTTATATCAAAGG 181 RUBPOL_NC003443.sub.--
TATCCCCGAAAGCCCAGATAT 217 3689_3713_F 3754_3778_R ATAC 2441
PNVL_U50363.sub.-- TACAGATTTCAGCAAGTTCAATCAAG 7 PNVL_U50363.sub.--
TTGTGCACCATGCAGTTCATC 367 2094_2120_F C 2161_2181_R 2442
PNVL_U50363.sub.-- TTCAATCAAGCATTTCGGTATGAAAC 173
PNVL_U50363.sub.-- TTGTGCACCATGCAGTTCATC 367 2110_2135_F
2161_2181_R 2443 PNVL_U50363.sub.-- TCACGAGATCTGCAGTTTATGAGTAA 62
PNVL_U50363.sub.-- TGAAGTCATCCAGTATAGTGT 283 2587_2612_F
2677_2704_R TTATCCA 2444 PNVL_U50363.sub.--
TATATATCACGAGATCTGCAGTTTAT 43 PNVL_U50363.sub.--
TGTTTATCCACGGTCCCACTC 353 2581_2612_F GAGTAA 2666_2686_R 2445
PNVL_U50363.sub.-- TATATCACGTGATCTGCAGTTTATGA 44 PNVL_U50363.sub.--
TGAAGTCATCCAGTATAGTGT 283 2583_2609_F G 2677_2704_R TTATCCA 2446
PNVL_U50363.sub.-- TCCTAAGAGTGGGACCATGGATAAAC 86 PNVL_U50363.sub.--
TAATAGACTTTCCCCTCTATA 187 2660_2687_F AC 2740_2769_R TTCTAATTC 2447
PNVL_U50363.sub.-- TCCTAAGAGTGGGACCATGGATAAA 85
PNVL_U50363.sub.--
TAATAGACTTTCCCCTCTATA 187 2660_2684_F 2740_2769_R TTCTAATTC 2448
PNVL_U50363.sub.-- TCCTAAGAGTGGGACCATGGATAAA 85 PNVL_U50363.sub.--
TACTGCATAATAGGCTTTCCC 202 2660_2684_F 2743_2776_R CTCTAAATTCTAA
2449 PNVL_U50363.sub.-- TAAGAGTGGGACCATGGATAAACAC 4
PNVL_U350363.sub.-- TAATAGGCTTTCCCCTCTATA 188 2663_2687_F
2740_2769_2_R TTCTAATTC 2450 PNVL_U50363.sub.--
TCAGTGTAGGTAGAATGTTTGCAATG 67 PNVL_U50363.sub.--
TCAGCTATCAATTTCTCTGCC 225 1868_1894_F C 1918_1946_R AATATTTG 2451
PNVL_U50363.sub.-- TAGGTAGAATGTTTGCAATGCAACC 36 PNVL_U350363.sub.--
TCAGCTATCAATTTCTCTGCC 225 1874_1898_F 1918_1946_R AATATTTG 2452
PNVL_U50363.sub.-- TGTAGGTAGAATGTTTGCAATGC 153 PNVL_U50363.sub.--
TCAGCTATCATTTTCTCAGCC 226 1872_1894_F 1918_1946_2_R AAGATTTG 2453
MVL_AF266286.sub.-- TGCCTTAATTGGAGATATGAGACCAT 127
MVL_AF266286.sub.-- TAGATTTCATTTAGCCTCTGT 204 2002_2027_F
2035_2060_R GCAAA 2454 MVL_AF266286.sub.--
TGCCTGAATTGGAGATATGAGACCAT 125 MVL_AF266286.sub.--
TCGGGAGGGCAATGAGGGTC 254 2002_2027_2_F 2125_2144_R 2467
PNVL_U50363.sub.-- TCCTAAGAGTGGGACCATGGATAAA 85 PNVL_U50363.sub.--
TACTGCATAATAGACTTTCCC 201 2660_2684_1F 2743_2776_1R CTCTATATTCTAA
2533 PAV_IMP.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP.sub.--
TCTGCAACCATTTGCAAATAA 268 NC001526_6222.sub.-- CTTTGG
NC001526_6321.sub.-- TCTGGATATTTGCA 6253_F 6355_R 2534
PAV_IMP.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP.sub.--
TCTGCAACCATTTGCAAATAA 267 NC001526_6222.sub.-- CTTTGG
NC001526_6324.sub.-- TCTGGATATTT 6253_F 6355_R 2535 PAV_IMP.sub.--
TAGGATGGCGATATGGTTGACACAGG 28 PAV_IMP.sub.-- TCGGCAGCCATTTGCAAATAA
253 NC001526_6222.sub.-- CTTTGG NC001526_6324.sub.-- TCAGGATATTT
6253_2_F 6355_2_R 2536 PAV_IMP.sub.-- TACTGTTATTCAGGATGGTGATATGG 19
PAV_IMP.sub.-- TCTGCAACCATTTGCAAATAA 267 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_F 6355_R 2537
PAV_A9_NC001526.sub.-- TTCAGATGTCTGTGTGGCGGCCTA 176
PAV_A9_NC001526.sub.-- TACATATTCATCCGTGCTTAC 192 5632_5655_F
5691_5720_R AACCTTAGA 2538 PAV_A9_NC001526.sub.--
TTCAGATGTCTGTGTGGCGGCCTA 176 PAV_A9_NC001526.sub.--
TACATATTCATCCGTGCTTAC 192 5632_5655_F 5691_5720_R AACCTTAGA 2539
PAV_A9_NC001526.sub.-- TGGAAATCCTTTTTCTCAAGGACGTG 131
PAV_A9_NC001526.sub.-- TAGTATTTTGTCCTGCCACGC 211 2688_2715_F GT
2773_2802_R ATTTAAACG 2540 PAV_A9_NC001526.sub.--
TAGATGATAGTGACATTGCATATAAA 23 PAV_A9_NC001526.sub.--
TTTCTGCTCGTTTATAATGTC 368 1972_2003_F TATGCA 2085_2112_R TACACAT
2541 PAV_A7_NC001357.sub.-- TATGGTGCAGTGGGCATTTGATAATG 49
PAV_A7_NC001357.sub.-- TTGCTTTTTAAAAATGCAGCT 361 2011_2036_F
2096_2121_R GCATT 2542 PAV_A7_NC001357.sub.--
TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_NC001357.sub.--
TATTTGCCTGCCAATTGCTTT 218 2011_2036_F 2108_2135_R TTAAAAA 2543
PAV_A7_NC001357.sub.-- TCCACCTGTGGTTATTGAACCTGT 72
PAV_A7_NC001357.sub.-- TCAAACCCAGAGGTGCCTGTA 220 4507_4530_F
4607_4629_R AA 2544 PAV_A7_NC001357.sub.-- TGACGAACCACAGCGTCACA 108
PAV_A7_NC001357.sub.-- TGCACACAACGGACACACAAA 294 748_767_F
875_895_R 2545 PAV_A7_NC001357.sub.-- TCGGGATGTAATGGCTGGTT 98
PAV_A7_NC001357.sub.-- TACCATGTCCGAACCTGTATC 193 947_966_F
1034_1057_R TGT 2546 PAV_A10.sub.-- TCAGGATGGTTTTTGGTAGAGGCTAT 64
PAV_A10_NC000904.sub.-- TGCCTGTGCTTCCAAGGAATT 302
NC000904_875.sub.-- AGT 997_1027_R GTGTGTAATA 903_F 2547
PAV_A10.sub.-- TACACACAATTCCTTGGAAGCACAGG 6 PAV_A10_NC000904.sub.--
TTAGGTCCTGCACAGCCGCAT 356 NC000904_1000.sub.-- CA 1055_1079_R AATG
1027_F 2548 PAV_A10.sub.-- TGAACTAACGGACAGTGGATATGGC 105
PAV_A10_NC000904.sub.-- TCGCCATGTCTCTCTACCTGC 252
NC000904_1222.sub.-- 1275_1296_R G 1246_F 2549 POLYOMA.sub.--
TCAATGTATCTTATCATGTCTGGGTC 57 POLYOMA_NC001669.sub.--
TGAGAGTGGATGGGCAGCCTA 286 NC001669_2685.sub.-- CCC 2774_2796_R TG
2713_F 2550 POLYOMA.sub.-- TATCTTATCATGTCTGGGTCCCCAGG 47
POLYOMA_NC001669.sub.-- TGAGAGTGGATGGGCAGCCTA 286
NC001669_2691.sub.-- AAG 2774_2796_R TG 2719_F 2551 POLYOMA.sub.--
TCATGTCTGGGTCCCCTGGAAG 70 POLYOMA_NC001669.sub.--
TGAGAGTGGATGGGCAGCCTA 286 NC001669_2698.sub.-- 2774_2796_R TG
2719_F 2552 POLYOMA.sub.-- TGTGCCCTCAAAAACCCTGACCTC 166
POLYOMA_NC001669.sub.-- TGAGAGTGGATGGGCAGCCTA 286
NC001669_2726.sub.-- 2774_2796_R TG 2749_F 2553 POLYOMA.sub.--
TGTGCCCTCAAAAACCCTAACCTC 165 POLYOMA_NC001669.sub.--
TGAGAGTGGATGGGCAGCCTA 286 NC001669_2726.sub.-- 2774_2796_R TG
2749_2_F 2554 POLYOMA.sub.-- TGCCATTCATAGGCTGCCCATC 122
POLYOMA_NC001669.sub.-- TCTGGAACCCAGCAGTGGA 275
NC001669_2767.sub.-- 2899_2917_R 2788_F 2555 POLYOMA.sub.--
TGAGGCCTATAGCAGCTATAGCCTC 112 POLYOMA.sub.-- TAGCTGAAATTGCTGCTGGAG
207 NC001669_4496.sub.-- NC001669_4583.sub.-- AGG 4520_F 4606_R
2556 POLYOMA.sub.-- TCCCTCTACAGTAGCAACGGATGCAA 79 POLYOMA.sub.--
TGGGGGACCTAATTGCTACTG 323 NC001669_4533.sub.-- NC001669_4633.sub.--
TATCTGA 4558_F 4660_R 2557 POLYOMA.sub.-- TCTACAGTAGCAACGGATGCAA
100 POLYOMA.sub.-- TGTATCTGAAGCTGCTGCTGC 336 NC001669_4537.sub.--
NC001669_4621.sub.-- 4558_F 4641_R 2558 POLYOMA.sub.--
TAGGGGCCCAACCCCATTTTCAT 35 POLYOMA.sub.-- TCCAGACCCTGCAAAAAATGA 238
NC001669_2978.sub.-- NC001669_3084.sub.-- GAACAC 3000_F 3110_R 2559
POLYOMA.sub.-- TCACCTTTGCAAAGGGGCCC 61 POLYOMA.sub.--
TGGGTCCCTGATCCAACTAGA 324 NC001669.sub.-- NC001669_3087.sub.--
AATGAAAA 2967_2986_F 3115_R 2560 POLYOMA.sub.--
TACGGTCACAGCTTCCCACAT 12 POLYOMA.sub.-- TCTAAATGAGGACCTGACCTG 260
NC001669_3392.sub.-- NC001669_3424.sub.-- TG 3412_F 3446_R 2561
POLYOMA.sub.-- TCCTAGAAGTAGAGGCAGCATCCA 87 POLYOMA.sub.--
TGCTCCAGGAGGTGCAAATCA 305 NC001669_3780.sub.-- NC001669_3816.sub.--
AAGA 3803_F 3840_R 2643 HTLV1_NC001436.sub.--
TGGAGGCTCCGTTGTCTGCATGTA 134 HTLV1_NC001436.sub.--
TCGTTTGTAGGGAACATTGGT 258 9387_7410_F 7489_7516_R GAGGAAG 2670
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATTTGCAAATAA 269 NC001526_6222.sub.-- CTTTGG
NC001526_6321.sub.-- TCTGGATATTTICA 6253_F 6355_R 2671
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATTTGIAAATAA 271 NC001526_6222.sub.-- CTTTGG
NC001526_6321.sub.-- TCTGGATATTTICA 6253_F 6355_2_R 2672
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAAATAA 273 NC001526_6222.sub.-- CTTTGG
NC001526_6321.sub.-- TCTGGATATTTICA 6253_F 6355_3_R 2673
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATpTpTpGAAAA 265 NC001526_6222.sub.-- CTTTGG
NC001526_6324.sub.-- TAATCTGGATATTT 6253_F 6355P_R 2674
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATTTGAAAATAA 266 NC001526_6222.sub.-- CTTTGG
NC001526_6324.sub.-- TCTGGATATTT 6253_F 6355_R 2675
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTTGATACAGG 30
PAV_IMP_MOD.sub.-- TCTGCAACCATTTGIAAATAA 270 NC001526_6222.sub.--
CTTTGG NC001526_6324.sub.-- TCTGGATATTT 6253_F 6355_2_R 2676
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAAATAA 272 NC001526_6222.sub.-- CTTTGG
NC001526_6324.sub.-- TCTGGATATTT 6253_F 6355_3_R 2677 PAV_IMP_MOD
TAGGATGGTGATATGGTTGATACAGG 30 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAIATAA 274 NC001526_6222.sub.-- CTTTGG
NC001526_6324.sub.-- TCTGGATATTT 6253_F 6355_4_R 2678
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 29 PAV_IMP_MOD.sub.--
TCTGCAACCATTTGIAAATAA 270 NC001526_6324.sub.-- CTITGG
NC001526_6324.sub.-- TCTGGATATTT 6222_6253_2_F 6355_2_R 2679
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACAGG 31 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAAATAA 272 NC001526_6222.sub.-- ITITGG
NC001526_6324.sub.-- TCTGGATATTT 6253_3_F 6355_3_R 2680
PAV_IMP_MOD.sub.-- TAGGATGGTGATATGGTTGATACIGG 32 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAIATAA 274 NC001526_6222.sub.-- ITITGG
NC001526_6324.sub.-- TCTGGATATTT 6253_4_F 6355_4_R 2681
PAV_IMP_MOD.sub.-- TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP_MOD.sub.--
TCTGCAACCATTTGIAAATAA 270 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_F 6355_2_R 2682
PAV_IMP_MOD.sub.-- TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAAATAA 272 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_F 6355_3_R 2683
PAV_IMP_MOD.sub.-- TACTGTTATTCAGGATGGTGATATGG 19 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAIATAA 271 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_F 6355_4_R 2684
PAV_IMP_MOD.sub.-- TACTGTTATICAGGATGGTGATATGG 17 PAV_IMP_MOD.sub.--
TCTGCAACCATTTGIAAATAA 270 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_2_F 6355_2_R 2685
PAV_IMP_MOD.sub.-- TACTGTTATTCAGGATGGIGATATGG 18
PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAAATAA 272 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_3_F 6355_3_R 2686
PAV_IMP_MOD.sub.-- TACTGTTATICAGGATGGIGATATGG 16 PAV_IMP_MOD.sub.--
TCTGCAACCATTTIIAIATAA 274 NC001526_6212.sub.-- T
NC001526_6324.sub.-- TCTGGATATTT 6238_4_F 6355_4_R 2687
PAV_A9_MOD.sub.-- TTCAGATGTCTGTGTGGCIGCCTA 177 PAV_A9_MOD.sub.--
TACATATTCATCCGTGCTTAC 192 NC001526_5632.sub.-- NC001526_5691.sub.--
AACCTTAGA 5655_F 5720_R 2688 PAV_A9_MOD.sub.--
TTCAGATGTCTITGTGGCIGCCTA 178 PAV_A9_MOD.sub.--
TACATATTCATCCGTGCTTAC 192 NC001526_5632.sub.-- NC001526_5691.sub.--
AACCTTAGA 5655_2_F 5720_R 2689 PAV_A9_MOD.sub.--
TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_MOD.sub.--
TAGTATTTTGTCCTGCCACIC 212 NC001526_2688.sub.-- GT
NC001526_2773.sub.-- ATTTAAACG 2715_F 2802_R 2690 PAV_A9_MOD.sub.--
TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_MOD.sub.--
TAGTATTTTGTCCTGCCAIIC 213 NC001526_2688.sub.-- GT
NC001526_2773.sub.-- ATTTAAACG 2715_F 2802_2_R 2691
PAV_A9_MOD.sub.-- TGGAAATCCTTTTTCTCAAGGACGTG 131 PAV_A9_MOD.sub.--
TAGTATTTTGTCCTGCCIIIC 214 NC001526_2688.sub.-- GT
NC001526_2773.sub.-- ATTTAAACG 2715_F 2802_3_R 2692
PAV_A9_MOD.sub.-- TAGATGATAGTGAIATIGCATATIAA 24 PAV_A9_MOD.sub.--
TTTCTGCTCGTTTATAATGTC 368 NC001526_1972 TATGCA NC001526_2085.sub.--
TACACAT 2003_F 2112_R 2693 PAV_A7_A10.sub.--
TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_A10.sub.--
TTGCTTTTTAAAAATGCAGII 363 NC000904_1912.sub.-- NC000904_1997.sub.--
GCATT 1937_F 2022_R 2694 PAV_A7_A10.sub.--
TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_A10.sub.--
TTGCTTTTTAAAAATGCIIII 364 NC000904_1912.sub.-- NC000904_1997.sub.--
GCATT 1937_F 2022_2_R 2695 PAV_A7_A10.sub.--
TATGGTGCAGTGGGCATITGATAATG 48 PAV_A7_A10.sub.--
TTGCTTTTTAAAAATGCAGII 362 NC000904_1912.sub.-- NC000904_1997.sub.--
GCATT 1937_2_F 2022_R 2696 PAV_A7_A10.sub.--
TATGGTGCAGTGGGCATTTGATAATG 49 PAV_A7_A10.sub.--
TATTTGCCTGCIIATTGCTIT 219 NC000904_1912.sub.-- NC000904_2009.sub.--
TTAAAAA 1937_F 2036_R 2807 PYV_NO_MAMMAL.sub.--
TAGGGATTTTTGACCCATCTTTTTCT 34 PYV_NO_MAMMAL.sub.--
TGGGCCTCTCTGCAAAGGAGA 319 NC001663_3132.sub.-- CA
NC001663_3261.sub.-- 3159_F 3281_R 2808 PYV_NO_MAMMAL.sub.--
TTACAAAGAGGCCCAACGCCATTCTC 171 PYV_NO_MAMMAL.sub.--
TGAAAACACAAGATACTTTGG 279 NC001663_3267.sub.-- ATC
NC001663_3350.sub.-- AACATACACAGGAGGT 3295_F 3386_R 2809
PYV_NO_MAMMAL.sub.-- TCCTCCCACAGCAAACATGTG 88 PYV_NO_MAMMAL.sub.--
TGTGTCTGTAAAGACTGAAGT 343 NC001663_3578.sub.-- NC001663_3689.sub.--
TGTTGGA 3598_F 3716_R 2810 PYV_NO_MAMMAL.sub.--
TGTAAATCTAGTGGCTCTCCTCCCAC 151 PYV_NO_MAMMAL.sub.--
TGTAACTGTTAAAACTGAGGT 333 NC001663_3561.sub.-- NC001663_3686.sub.--
TGTTGGAGTG 3586_F 3716_R 2811 PYV_NO_MAMMAL.sub.--
TTGCAAAGAGGCCCAACCCCATTCTC 179 PYV_NO_MAMMAL.sub.--
TGAGAACACAAGATACTITGG 285 NC001663_3267.sub.-- AT
NC001663_3351.sub.-- AAACTICACAGGIGG 3294_F 3386_R 2812
PYV_NO_MAMMAL.sub.-- TTGCAAAGAGGCCCAACCCCATTITC 180
PYV_NO_MAMMAL.sub.-- TGAGAACACAAGATACTITGG 285 NC001663_3267.sub.--
AT NC001663_3351.sub.-- AAACTICACAGGIGG 3294_2_F 3386_R 2813
PYV_NO_MAMMAL.sub.-- TTGCAAAGAGGCCCAACCCCATTCTC 179
PYV_NO_MAMMAL.sub.-- TCCAGACCCAICCAAGAATGA 237 NC001663_3267.sub.--
AT NC001663_3372.sub.-- GAACACAAGATA 3294_F 3404_R 2814
PYV_NO_MAMMAL.sub.-- TTGCAAAGAGGCCCAACCCCATTITC 180
PYV_NO_MAMMAL.sub.-- TCCAGACCCAICCAAGAATGA 237 NC001663_3267.sub.--
AT NC001663_3372.sub.-- GAACACAAGATA 3294_2_F 3404_R 2864
AAV_NS1.sub.-- TGCCACGACCGGCAAGACCAACAT 119 AAV_NS1.sub.--
TGTCATCTTGCCCTCCTCCCA 338 NC002077_1005.sub.-- NC002077_1126.sub.--
CCA 1028_F 1149_R 2865 AAV_NS1.sub.-- TGCGTTAACTGGACCAATGAGAACTT
128 AAV_NS1.sub.-- TGTCATTTTGCCCTCCTCCCA 339 NC002077_1066.sub.--
TCC NC002077_1126.sub.-- CCA 1094_F 1149_2_R 2866 AAV_NS1.sub.--
TACCAACATCGCGGAGGCTATIGCCC 8 AAV_NS1.sub.-- TGTCATTTTGCCCTCCTCCCA
339 NC002077_1020.sub.-- A NC002077_1126.sub.-- CCA 1046_F 1149_2_R
2867 AAV_NS1.sub.-- TACCAACATCGCGGAGGCTATIGCCC 8 AAV_NS1.sub.--
TGAAGGGAAAGTTCTCATTGG 282 NC002077_1020.sub.-- A
NC002077_1072.sub.-- TCCAGTT 1046_F 1099_R 2868 AAV_VP1.sub.--
TGGGTCCTGCCCACCTACAACAACCA 144 AAV_VP1.sub.-- TGTTGAAGTCAAAATACCCCC
347 NC002077_739.sub.-- NC002077_832.sub.-- AGGGGGT 764_F 859_R
2869 AAV_VP1.sub.-- TCCTGCCCACCTACAACAACCA 91 AAV_VP1.sub.--
TGGCAGTGGAATCGGTTGAAG 312 NC002077_743.sub.-- NC002077_847.sub.--
TCAAA 764_F 872_R 2870 AAV_VP1.sub.-- TGGTGCCGATGGAGTGGG 148
AAV_VP1.sub.-- TCCATTTGGAATCGCAATGCC 242 NC002077_648.sub.--
NC002077_680.sub.-- AAT 665_F 703_R 2871 AAV_VP1.sub.--
TGGTGCCGACGGAGTGGG 147 AAV_VP1.sub.-- TCCATGGGGAATCGCAATGCC 241
NC002077_648.sub.-- NC002077_680.sub.-- AAT 665_2_F 703_2_R 2872
AAV_VP1.sub.-- TACCCCCTGGGGGTACTTTGA 10 AAV_VP1.sub.--
TGTTGTTGATGAGTCTCTGCC 352 NC002077_831.sub.-- NC002077_886.sub.--
AGTC 851_F 910_R 2873 AAV_VP1.sub.-- TGGGGGTATTTTGACTTCAACCGATT 142
AAV_VP1.sub.-- TGTTGTTGAPGAGTCTCTGCC 352 NC002077_838.sub.-- CCAC
NC002077_886.sub.-- AGTC 867_F 910_R 2874 AAV_VP1.sub.--
TGGGGGTATTTTGACTTCAACIGITT 143 AAV_VP1.sub.-- TGTTGTTGATGAGTCICTGCC
351 NC002077_838.sub.-- CCAC NC002077_886.sub.-- AGTC 867_2_F
910_2_R 2875 AAV_VP1.sub.-- TCCTCGGGAAATTGGCATTGCGAT 89
AAV_VP1.sub.-- TGTAGAGGTGGTTGTTGTAGG 335 NC002077_670.sub.--
NC002077_748.sub.-- TGGG 693_F 772_R 2974 EBNA-2_NC007605-
TCCTCTCACTCATCAGAGCACCCC 90 EBNA-2_NC007605- TGAGGGGGATAATGGCATAGG
290 36216_37679_780.sub.-- 36216-37679_853.sub.-- AGGAAT 803_F
879_R 2975 EBNA-2_NC007605- TGCCTACATTCTATCTTGCGTTACAT 123
EBNA-2NC007605- TACGGAGAGTGACGGGTTTCC 194 36216-37679_2.sub.-- GG
36216-37679_70.sub.-- 29_F 90_R 2976 EBNA-2_NC007605-
TACTCACCAACTCCTGGCCC 14 EBNA-2_NC007605- TGGGACTCTGGTTCATGTATT 317
36216-37679.sub.-- 36216-37679.sub.-- GG 1195_1214_F 1270_1292_R
2977 EBNA-2_NC007605- TCCCCGGTGATTGGTATCCTCC 78 EBNA-2_NC007605-
TCTTCATCAGAGCTAGGAGAT 276 36216-37679.sub.-- 36216-37679.sub.--
TCTGTTGT 1319_1340_F 1390_1418_R 2978 EBNA-3A_NC007605-
TCCGGCCCTGGATGACAA 82 EBNA-3A.sub.-- TCTATGAGGACATTTTCCCAA 262
79955-82877_24.sub.-- NC007605-79955- TCTCC 41_F 82877_94_119_R
2979 EBNA-3A_NC007605- TCGGCGCAAGTCCCAGAACC 97 EBNA-3A.sub.--
TACGGGGCCATGCCGTGTTG 196 79955-82877.sub.-- NC007605-79955-
1318_1337_F 82877_1387.sub.-- 1406_R 2980 EBNA-3A_NC007605-
TGGCCCCGTGTCTGGTAGC 137 EBNA-3A.sub.-- TCGGGTACTGGTGCACACGC 256
79955-82877.sub.-- NC007605-79955- 1397_1415_F 82877_1492.sub.--
1511_R 2981 EBNA-3A.sub.-- TGTCCCGACTGTGGCACTTGA 156 EBNA-3A.sub.--
TGCATAGCAATCTCAGGAGGT 298 NC007605-79955- NC007605-79955- GC
82877_1617_1637.sub.-- 82877_1669.sub.-- F 1691_R 2982
EBNA-3B.sub.-- TCCCCATCAGACACCTCAGGTGGA 77 EBNA-3B.sub.--
TGGGCTGATATGGAATGTGCC 320 NC007605-83065- NC007605-83065- CTATCTG
85959_1950_1973.sub.-- 85959_2002.sub.-- F 2029_R 2983
EBNA-3B.sub.-- TGAATGGTTCCGCCAGTGCAC 106 EBNA-3B.sub.--
TAAGGAACGGCGACAGGATGC 186 NC007605-83065- NC007605-83065- GC
85959_891.sub.-- 85959_946_968_R 911_F 2984 EBNA-3B.sub.--
TGCCAGATGATCCTATAATTGTTGAG 120 EBNA-3B.sub.-- TGTACGGCAGTGTTTGCGGTA
334 NC007605-83065- GA NC007605-83065- T 85959_1046_1073.sub.--
85959_1150_1171.sub.-- F R 2985 EBNA-3B.sub.--
TGACACAGGCACCCACGGAATA 107 EBNA-3B.sub.-- TCACTCGTTTAGACGGCGGAA 223
NC007605-83065- NC007605-83065- TATC 85959_2531_2552.sub.--
85959_2593.sub.-- F 2617_R 2986 EBNA-3C.sub.--
TGTGAAGCGCACAATTGTTAAGAC 162 EBNA-3C.sub.-- TCAGGGGTGCTTTGTGCTTC
231 NC007605-86083- NC007605-86083- 89135_1284_1307.sub.--
89135_1330.sub.-- F 1349_R 2987 EBNA-3C.sub.--
TCCCACATCTGCAATCGGAGACAGG 75 EBNA-3C.sub.-- TGGGGAGATGACCATGATGGT
321 NC007605-86083- NC007605-86083- GC 89135_2549_2573.sub.--
89135_2620.sub.-- F 2642_R 2988 EBNA-3C.sub.--
TGATTGATGTTGAAACCACCGAAGA 116 EBNA-3C.sub.-- TCCGATGTGGCTTATTTGGCT
243 NC007605-86083- NC007605-86083- G 89135_1538_1562.sub.--
89135_1579.sub.-- F 1600_R 2989 EBNA-1_NC007605-
TGGCTAGGTGTCACGTAGAAAGGACT 138 EBNA-1_NC007605-
TCCATATACGAACACACCGGC 239 95662-97587.sub.-- AC 95662-97587.sub.--
GAC 1466_1493_F 1510_1533_R 2990 EBNA-1_NC007605-
TCCAACCAGAAATTTGAGAACATTGC 71 EBNA-1_NC007605-
TCCTCGGTAGTCCTTTCTACG 246
95662-97587 AGA 95662-97587.sub.-- TG 1420_1448_F 1477_1499_R 2991
LMP1_S75235-1- TCCGCCTTCGATGACACACGG 81 LMP1_S75235-1-
TGCAGCGTAGGAAGGTGTGG 297 1149_1023_1043_F 1149_1057_1076.sub.-- R
2992 LMP1_S75235-1- TCTCCCGCACCCTCAACAAGC 102 LMP1_S75235-1-
TCAGGTGGTGTCTGCCCTCGT 232 1149_600_620_F 1149_658_679_R T
[0215] Table 4 indicates the primer pair name virus identifier for
the primer pairs disclosed herein. TABLE-US-00004 TABLE 4 Primer
Pair Name Identifiers for Selected Viruses Primer Pair GenBank Name
Virus Accession Virus Species Virus Family Identifier Numbers
Arenavirus Arenaviridae ARENAS NC_004296 Circovirus Circoviridae
CRVCP AY219836 Hepatitis C virus Flaviviridae HCV NC_001433 West
Nile virus Flaviviridae WN NC_001563 Hepatitis B virus
Hepadnaviridae HBV X51970 Papillomavirus Papillomaviridae PAV_IMP
NC_001526 Papillomavirus Papillomaviridae PAV_A9 NC_001526
Papillomavirus Papillomaviridae PAV_A7 NC_001357 Papillomavirus
Papillomaviridae PAV_A10 NC_000904 Respirovirus Paramyxoviridae RVL
X03614 Pneumovirus Paramyxoviridae PVL U50363 Pneumovirus
Paramyxoviridae PVNL U50363 Morbillivirus Paramyxoviridae MVL
AF266286 Morbillivirus Paramyxoviridae MSVL AF266286
Metapneumovirus Paramyxoviridae MNVL NC_004148 Respirovirus
Paramyxoviridae POL NC_003461 Rubulavirus Paramyxoviridae RUBPOL
NC_003443 Human Immunodeficiency Retroviridae HIV1 NC_001802 virus
1 Human Immunodeficiency Retroviridae HIV-2 NC_001722 virus 2 Human
T-lymphotropic Retroviridae HTLV1 NC_001436 virus 1 Human
T-lymphotropic Retroviridae HTLV2 NC_001488 virus 2 Human T-cell
Retroviridae HTLV_TAX_GENE NC_001436 Lymphotropic Virus
Polyomavirus Polyomaviridae POLYOMA NC_001669 Non-mammalian
Polyomaviridae PYV_NO_MAMMAL NC_001663 Polyomavirus Dependovirus
Parvoviridae AAV_NS1 NC_002077 Dependovirus Parvoviridae AAV_VP1
NC_002077
Example 2
Sample Preparation and PCR
[0216] Samples were processed to obtain viral genomic material
using a Qiagen QIAamp Virus BioRobot MDx Kit. Resulting genomic
material was amplified using an Eppendorf thermal cycler and the
amplicons were characterized on a Bruker Daltonics MicroTOF
instrument. The resulting data was analyzed using GenX software
(SAIC, San Diego, Calif. and Ibis, Carlsbad, Calif.).
[0217] All PCR reactions were assembled in 50 .mu.L reaction
volumes in a 96-well microtiter plate format using a Packard MPII
liquid handling robotic platform and M.J. Dyad thermocyclers (MJ
research, Waltham, Mass.). The PCR reaction mixture consisted of 4
units of Amplitaq Gold, 1.times. buffer II (Applied Biosystems,
Foster City, Calif.), 1.5 mM MgCl.sub.2, 0.4 M betaine, 800 .mu.M
dNTP mixture and 250 nM of each primer. The following typical PCR
conditions were used: 95.degree. C. for 10 min followed by 8 cycles
of 95.degree. C. for 30 seconds, 48.degree. C. for 30 seconds, and
72.degree. C. 30 seconds with the 48.degree. C. annealing
temperature. increasing 0.9.degree. C. with each of the eight
cycles. The PCR was then continued for 37 additional cycles of
95.degree. C. for 15 seconds, 56.degree. C. for 20 seconds, and
72.degree. C. 20 seconds.
Example 3
Solution Capture Purification of PCR Products for Mass Spectrometry
with Ion Exchange Resin-Magnetic Beads
[0218] For solution capture of nucleic acids with ion exchange
resin linked to magnetic beads, 25 .mu.l of a 2.5 mg/mL suspension
of BioClone amine terminated superparamagnetic beads were added to
25 to 50 .mu.l of a PCR (or RT-PCR) reaction containing
approximately 10 pM of a typical PCR amplification product. The
above suspension was mixed for approximately 5 minutes by vortexing
or pipetting, after which the liquid was removed after using a
magnetic separator. The beads containing bound PCR amplification
product were then washed three times with 50 mM ammonium
bicarbonate/50% MeOH or 100 mM ammonium bicarbonate/50% MeOH,
followed by three more washes with 50% MeOH. The bound PCR amplicon
was eluted with a solution of 25 mM piperidine, 25 mM imidazole,
35% MeOH which included peptide calibration standards.
Example 4
Mass Spectrometry and Base Composition Analysis
[0219] The ESI-FTICR mass spectrometer is based on a Bruker
Daltonics (Billerica, Mass.) Apex II 70e electrospray ionization
Fourier transform ion cyclotron resonance mass spectrometer that
employs an actively shielded 7 Tesla superconducting magnet. The
active shielding constrains the majority of the fringing magnetic
field from the superconducting magnet to a relatively small volume.
Thus, components that might be adversely affected by stray magnetic
fields, such as CRT monitors, robotic components, and other
electronics, can operate in close proximity to the FTICR
spectrometer. All aspects of pulse sequence control and data
acquisition were performed on a 600 MHz Pentium II data station
running Bruker's Xmass software under Windows NT 4.0 operating
system. Sample aliquots, typically 15 .mu.l were extracted directly
from 96-well microtiter plates using a CTC HTS PAL autosampler
(LEAP Technologies, Carrboro, N.C.) triggered by the FTICR data
station. Samples were injected directly into a 10 .mu.l sample loop
integrated with a fluidics handling system that supplies the 100
.mu.l/hr flow rate to the ESI source. Ions were formed via
electrospray ionization in a modified Analytica (Branford, Conn.)
source employing an off axis, grounded electrospray probe
positioned approximately 1.5 cm from the metalized terminus of a
glass desolvation capillary. The atmospheric pressure end of the
glass capillary was biased at 6000 V relative to the ESI needle
during data acquisition. A counter-current flow of dry N.sub.2 was
employed to assist in the desolvation process. Ions were
accumulated in an external ion reservoir comprised of an rf-only
hexapole, a skimmer cone, and an auxiliary gate electrode, prior to
injection into the trapped ion cell where they were mass analyzed.
Ionization duty cycles greater than 99% were achieved by
simultaneously accumulating ions in the external ion reservoir
during ion detection. Each detection event consisted of 1 M data
points digitized over 2.3 s. To improve the signal-to-noise ratio
(S/N), 32 scans were co-added for a total data acquisition time of
74 s.
[0220] The ESI-TOF mass spectrometer is based on a Bruker Daltonics
MicroTOF.TM.. Ions from the ESI source undergo orthogonal ion
extraction and are focused in a reflectron prior to detection. The
TOF and FTICR are equipped with the same automated sample handling
and fluidics described above. Ions are formed in the standard
MicroTOF.TM. ESI source that is equipped with the same off-axis
sprayer and glass capillary as the FTICR ESI source. Consequently,
source conditions were the same as those described above. External
ion accumulation was also employed to improve ionization duty cycle
during data acquisition. Each detection event on the TOF was
comprised of 75,000 data points digitized over 75 .mu.s.
[0221] The sample delivery scheme allows sample aliquots to be
rapidly injected into the electrospray source at high flow rate and
subsequently be electrosprayed at a much lower flow rate for
improved ESI sensitivity. Prior to injecting a sample, a bolus of
buffer was injected at a high flow rate to rinse the transfer line
and spray needle to avoid sample contamination/carryover. Following
the rinse step, the autosampler injected the next sample and the
flow rate was switched to low flow. Following a brief equilibration
delay, data acquisition commenced. As spectra were co-added, the
autosampler continued rinsing the syringe and picking up buffer to
rinse the injector and sample transfer line. In general, two
syringe rinses and one injector rinse were required to minimize
sample carryover. During a routine screening protocol a new sample
mixture was injected every 106 seconds. More recently a fast wash
station for the syringe needle has been implemented which, when
combined with shorter acquisition times, facilitates the
acquisition of mass spectra at a rate of just under one
spectrum/minute.
[0222] Raw mass spectra were post-calibrated with an internal mass
standard and deconvoluted to monoisotopic molecular masses.
Unambiguous base compositions were derived from the exact mass
measurements of the complementary single-stranded oligonucleotides.
Quantitative results are obtained by comparing the peak heights
with an internal PCR calibration standard present in every PCR well
at 500 molecules per well. Calibration methods are commonly owned
and disclosed in U.S. Provisional Patent Application Ser. No.
60/545,425 which is incorporated herein by reference in
entirety.
Example 5
De Novo Determination of Base Composition of Amplification Products
Using Molecular Mass Modified Deoxynucleotide Triphosphates
[0223] Because the molecular masses of the four natural nucleobases
have a relatively narrow molecular mass range (A=313.058,
G=329.052, C=289.046, T=304.046--See Table 5), a persistent source
of ambiguity in assignment of base composition can occur as
follows: two nucleic acid strands having different base composition
may have a difference of about 1 Da when the base composition
difference between the two strands is G.revreaction.A (-15.994)
combined with C.revreaction.T (+15.000). For example, one 99-mer
nucleic acid strand having a base composition of
A.sub.27G.sub.30C.sub.21T.sub.21 has a theoretical molecular mass
of 30779.058 while another 99-mer nucleic acid strand having a base
composition of A.sub.26G.sub.31C.sub.22T.sub.20 has a theoretical
molecular mass of 30780.052. A 1 Da difference in molecular mass
may be within the experimental error of a molecular mass
measurement and thus, the relatively narrow molecular mass range of
the four natural nucleobases imposes an uncertainty factor.
[0224] The present invention provides for a means for removing this
theoretical 1 Da uncertainty factor through amplification of a
nucleic acid with one mass-tagged nucleobase and three natural
nucleobases. The term "nucleobase" as used herein is synonymous
with other terms in use in the art including "nucleotide,"
"deoxynucleotide," "nucleotide residue," "deoxynucleotide residue,"
"nucleotide triphosphate (NTP)," or deoxynucleotide triphosphate
(dNTP).
[0225] Addition of significant mass to one of the 4 nucleobases
(dNTPs) in an amplification reaction, or in the primers themselves,
will result in a significant difference in mass of the resulting
amplification product (significantly greater than 1 Da) arising
from ambiguities arising from the G.revreaction.A combined with
C.revreaction.T event (Table 5). Thus, the same the G.revreaction.A
(-15.994) event combined with 5-Iodo-C.revreaction.T (-110.900)
event would result in a molecular mass difference of 126.894. If
the molecular mass of the base composition A.sub.27G.sub.30
5-Iodo-C.sub.21T.sub.21 (33422.958) is compared with
A.sub.26G.sub.315-Iodo-C.sub.22T.sub.20, (33549.852) the
theoretical molecular mass difference is +126.894. The experimental
error of a molecular mass measurement is not significant with
regard to this molecular mass difference. Furthermore, the only
base composition consistent with a measured molecular mass of the
99-mer nucleic acid is A.sub.27G.sub.305-Iodo-C.sub.21T.sub.21. In
contrast, the analogous amplification without the mass tag has 18
possible base compositions. TABLE-US-00005 TABLE 5 Molecular Masses
of Natural Nucleobases and the Mass-Modified Nucleobase 5-Iodo-C
and Molecular Mass Differences Resulting from Transitions
Nucleobase Molecular Mass Transition Molecular Mass A 313.058
A-->T -9.012 A 313.058 A-->C -24.012 A 313.058
A-->5-Iodo-C 101.888 A 313.058 A-->G 15.994 T 304.046
T-->A 9.012 T 304.046 T-->C -15.000 T 304.046 T-->5-Iodo-C
110.900 T 304.046 T-->G 25.006 C 289.046 C-->A 24.012 C
289.046 C-->T 15.000 C 289.046 C-->G 40.006 5-Iodo-C 414.946
5-Iodo-C-->A -101.888 5-Iodo-C 414.946 5-Iodo-C-->T -110.900
5-Iodo-C 414.946 5-Iodo-C-->G -85.894 G 329.052 G-->A -15.994
G 329.052 G-->T -25.006 G 329.052 G-->C -40.006 G 329.052
G-->5-Iodo-C 85.894
[0226] Mass spectra of bioagent-identifying amplicons were analyzed
independently using a maximum-likelihood processor, such as is
widely used in radar signal processing. This processor, referred to
as GenX, first makes maximum likelihood estimates of the input to
the mass spectrometer for each primer by running matched filters
for each base composition aggregate on the input data. This
includes the GenX response to a calibrant for each primer.
[0227] The algorithm emphasizes performance predictions culminating
in probability-of-detection versus probability-of-false-alarm plots
for conditions involving complex backgrounds of naturally occurring
organisms and environmental contaminants. Matched filters consist
of a priori expectations of signal values given the set of primers
used for each of the bioagents. A genomic sequence database is used
to define the mass base count matched filters. The database
contains the sequences of known bacterial bioagents and includes
threat organisms as well as benign background organisms. The latter
is used to estimate and subtract the spectral signature produced by
the background organisms. A maximum likelihood detection of known
background organisms is implemented using matched filters and a
running-sum estimate of the noise covariance. Background signal
strengths are estimated and used along with the matched filters to
form signatures which are then subtracted. The maximum likelihood
process is applied to this "cleaned up" data in a similar manner
employing matched filters for the organisms and a running-sum
estimate of the noise-covariance for the cleaned up data.
[0228] The amplitudes of all base compositions of
bioagent-identifying amplicons for each primer are calibrated and a
final maximum likelihood amplitude estimate per organism is made
based upon the multiple single primer estimates. Models of all
system noise are factored into this two-stage maximum likelihood
calculation. The processor reports the number of molecules of each
base composition contained in the spectra. The quantity of
amplification product corresponding to the appropriate primer set
is reported as well as the quantities of primers remaining upon
completion of the amplification reaction.
[0229] Base count blurring can be carried out as follows.
"Electronic PCR" can be conducted on nucleotide sequences of the
desired bioagents to obtain the different expected base counts that
could be obtained for each primer pair. See for example,
ncbi.nlm.nih.gov/sutils/e-pcr/; Schuler, Genome Res. 7:541-50,
1997. In one illustrative embodiment, one or more spreadsheets,
such as Microsoft Excel workbooks contain a plurality of
worksheets. First in this example, there is a worksheet with a name
similar to the workbook name; this worksheet contains the raw
electronic PCR data. Second, there is a worksheet named "filtered
bioagents base count" that contains bioagent name and base count;
there is a separate record for each strain after removing sequences
that are not identified with a genus and species and removing all
sequences for bioagents with less than 10 strains. Third, there is
a worksheet, "Sheet1" that contains the frequency of substitutions,
insertions, or deletions for this primer pair. This data is
generated by first creating a pivot table from the data in the
"filtered bioagents base count" worksheet and then executing an
Excel VBA macro. The macro creates a table of differences in base
counts for bioagents of the same species, but different strains.
One of ordinary skill in the art may understand additional pathways
for obtaining similar table differences without undo
experimentation.
[0230] Application of an exemplary script, involves the user
defining a threshold that specifies the fraction of the strains
that are represented by the reference set of base counts for each
bioagent. The reference set of base counts for each bioagent may
contain as many different base counts as are needed to meet or
exceed the threshold. The set of reference base counts is defined
by taking the most abundant strain's base type composition and
adding it to the reference set and then the next most abundant
strain's base type composition is added until the threshold is met
or exceeded. The current set of data was obtained using a threshold
of 55%, which was obtained empirically.
[0231] For each base count not included in the reference base count
set for that bioagent, the script then proceeds to determine the
manner in which the current base count differs from each of the
base counts in the reference set. This difference may be
represented as a combination of substitutions, Si=Xi, and
insertions, Ii=Yi, or deletions, Di=Zi. If there is more than one
reference base count, then the reported difference is chosen using
rules that aim to minimize the number of changes and, in instances
with the same number of changes, minimize the number of insertions
or deletions. Therefore, the primary rule is to identify the
difference with the minimum sum (Xi+Yi) or (Xi+Zi), e.g., one
insertion rather than two substitutions. If there are two or more
differences with the minimum sum, then the one that will be
reported is the one that contains the most substitutions.
[0232] Differences between a base count and a reference composition
are categorized as one, two, or more substitutions, one, two, or
more insertions, one, two, or more deletions, and combinations of
substitutions and insertions or deletions. The different classes of
nucleobase changes and their probabilities of occurrence have been
delineated in U.S. Patent Application Publication No. 2004209260
(U.S. application Ser. No. 10/418,514) which is incorporated herein
by reference in entirety.
Example 6
Codon Base Composition Analysis--Assay Development
[0233] The information obtained by the codon analysis method of the
present invention is base composition. While base composition is
not as information-rich as sequence, it can have the same practical
utility in many situations. The genetic code uses all 64 possible
permutations of four different nucleotides in a sequence of three,
where each amino acid can be assigned to as few as one and as many
as six codons. Since base composition analysis can only identify
unique combinations, without determining the order, one might think
that it would not be useful in genetic analysis. However, many
problems of genetic analysis start with information that constrains
the problem. For example, if there is prior knowledge of the
biological bounds of a particular genetic analysis, the base
composition may provide all the necessary and useful information.
If one starts with prior knowledge of the starting sequence, and is
interested in identifying variants from it, the utility of base
composition depends upon the codons used an the amino acids of
interest.
[0234] Analysis of the genetic code reveals three situations,
illustrated in Tables 6A-C. In Table 6A, where the leucine codon
CTA is comprised of three different nucleotides, each of the nine
possible single mutations are always identifiable using base
composition alone, and result in either a "silent" mutation, where
the amino acid is not changed, or an unambiguous change to another
specific amino acid. Irregardless, the resulting encoded amino acid
is known, which is equivalent to the information obtained from
sequencing. In Table 6B, where two of the three nucleotides of the
original codon are the same, there is a loss of information from a
base composition measurement compared to sequencing. In this case,
three of the nine possible single mutations produce unambiguous
amino acid choices, while the other six each produce two
indistinguishable options. For example, if starting with the
phenylalanine codon TTC, then either one of the two Ts could change
to A, and base composition analysis could not distinguish a first
position change from a second position change. A first position
change of T to A would encode an isoleucine and a second position
change of T to A would encode a tyrosine. However no other options
are possible and the value of the information would depend upon
whether distinguishing an encoded isoleucine from a tyrosine was
biologically important. In Table 6C, all three positions have the
same nucleotide, and therefore the ambiguity in amino acid identity
is increased to three possibilities. Out of 64 codon choices, 20
have three unique nucleotides (as in Table 6A), 40 have two of the
same and one different nucleotide (as in Table 6B) and 4 have the
same nucleotide in all three positions (as in Table 6C).
TABLE-US-00006 TABLE 6A Wild Type Codon with Three Unique
Nucleobases Codon Codon Base Description Codon(s) Composition Amino
Acid Coded WILD TYPE CODON CTA A1C1T1 Leu Single Mutation ATA A2T1
Ile Single Mutation GTA A1G1T1 Val Single Mutation TTA A1T2 Leu
Single Mutation CAA A1C2 Gln Single Mutation CGA A1G1C1 Arg Single
Mutation CCA A1C2 Pro Single Mutation CTG G1C1T1 Leu Single
Mutation CTC C2T1 Leu Single Mutation CTT C1T2 Leu
[0235] TABLE-US-00007 TABLE 6B Wild Type Codon with Two Unique
Nucleobases Codon Codon Base Description Codon(s) Composition Amino
Acid Coded WILD TYPE CODON TTC C1T2 Phe Single Mutations ATC, TAC
A1C1T1 Ile, Tyr Single Mutations GTC, TGC G1C1T1 Val, Cys Single
Mutations CTC, TCC C2T1 Leu, Ser Single Mutation TTA A1T2 Leu
Single Mutation TTG G1T2 Leu Single Mutation TTT T3 Phe
[0236] TABLE-US-00008 TABLE 6C Wild Type Codon Having Three of the
Same Nucleobase Codon Codon Base Amino Description Codon(s)
Composition Acid Coded WILD TYPE CODON TTT T3 Phe Single Mutations
ATT, TAT, TTA A1T2 Ile, Tyr, Leu Single Mutations GTT, TGT, TTG
G1T2 Val, Cys, Leu Single Mutations CTT, TCT, TTC C1T2 Leu, Ser,
Phe
Example 7
Testing of HIV Strains for Drug Resistance by Codon Analysis
[0237] Upon determination of an HIV positive test, drug resistance
testing can be done by conventional sequencing methods to establish
the nucleotide sequence of the major HIV strain infecting the
patient followed by analysis of the codons most important in
mediating drug resistance. The patient would then be monitored
while on antiretroviral therapy by codon analysis methods according
to the present invention for the appearance of emerging viral
mutations. The advantages of monitoring by these methods for rapid
codon analysis are: (i) it is much more sensitive to identifying
low abundance mutations in a population, (ii) it can be done on a
much lower viral titer and (iii) it is less expensive than
sequencing. Based upon previous data on the sensitivity and dynamic
range of the mass spectrometer, the ability is anticipated to
identify a low-abundance mutation present in as little as 0.1% of
the viral population in a 10 to 100-fold lower titer of virus than
can be analyzed by sequencing.
[0238] According to the 2005 update of drug resistance mutations in
HIV there are 28 major and minor mutations in HIV reverse
transcriptase and 21 major and minor mutations in HIV protease
(Johnson, V. A. et al. 2005, Top. HV Med. 13, 51-57). A smaller
subset of these mutations is currently used in making decisions
regarding the drug regimen of choice for a particular virus strain.
All 49 positions where mutations occur which are related to
antiretroviral therapy were examined both with respect to the amino
acid changes that mediate resistance and sequences present in
isolates of the virus which included HIV-1 subtype B sequences from
persons with well-characterized histories of antiretroviral
treatment (Rhee, S. Y. et al. 2005, J. Infect. Dis. 192, 456-65).
Sequences were obtained from the Stanford HIV Reverse Transcriptase
and Protease Sequence Database and included sequences from
published studies and previously unpublished sequences generated at
Stanford University from patients living in northern California
(GenBank accession numbers AY796421-AY798497 and
AY800656-AY802758). For the present example, sequences were aligned
using an alignment editor and the relevant codons of the reverse
transcriptase gene in 2,102 sequences were analyzed. An example of
this analysis is illustrated in Table 7. Out of 2,102 HIV
sequences, the majority have a wild type codon encoding methionine
in position 41 of reverse transcriptase. Deviations from wild type
observed were all changes that encode leucine, which is a thymidine
nucleotide-associated mutation (TAM) associated with drug
resistance. TABLE-US-00009 TABLE 7 Mutations of Codon 41 in HIV
Reverse Transcriptase Codon Base Distinguishable Codon Total
Fraction Amino Acid Composition Phenotype from Wild Type ATG 1224
0.58 Met[M] A.sub.1G.sub.1T.sub.1 Wild type -- TTG 429 0.20 Leu[L]
G.sub.1T.sub.2 TAM yes CTG 284 0.14 Leu[L] G.sub.1C.sub.1T.sub.1
TAM yes TTA 16 0.01 Leu[L] A.sub.1T.sub.2 TAM yes CTA 7 0.00 Leu[L]
A.sub.1C.sub.1T.sub.1 TAM yes CTT 1 0.00 Leu[L] C.sub.1T.sub.2 TAM
yes Subtotal 1961 0.93 Mixtures 141 0.07 Total 2102
[0239] From codon analysis of this dataset, several observations
can be made. First, the wild type codon is the most frequently
observed (in this case 58%). Second, the next most abundant codons
are single point mutations from wild type, and encode a documented
mutation which causes drug-resistance. Third, a significant
fraction of the sequences (in this case 7%) contain ambiguities
with respect to the correct nucleotide in the sequencing reaction
(in Tables 6B and 6C, all sequences with more than one codon per
base composition are grouped together). These may be derived from
the presence of a mixed population of virus sequences in the
original patient samples. Codon 41 of reverse transcriptase
exemplifies the situation in Table 6A where the codon is comprised
of three different nucleotides ATG, and all mutations are
unambiguously identifiable with respect to the amino acid that they
encode.
[0240] The reverse transcriptase codon leucine 210 (Table 8)
provides an example of the wild type codon base composition
situation illustrated in Table 6B. Leucine is the most extreme
example of degeneracy in the genetic code, and six different codons
encode leucine. Nevertheless, mutation of the wild type codon TTG
to TGG (tryptophan), which causes drug resistance, is unambiguously
distinguishable from all six wild type leucine codons present, and
no other codon in the dataset contains the composition base
composition G.sub.2T. Therefore, base composition analysis may be
sufficient to distinguish a drug-resistant strain from the wild
type strain, even in the absence of prior knowledge of the
particular codon used to encode leucine. TABLE-US-00010 TABLE 8
Mutations of Codon 210 in HIV Reverse Transcriptase Distinguishable
Codon Base from Major or Codon Total Fraction Amino Acid
Composition Phenotype Minor Wild Type TTG 1223 0.58 Leu[L] G1T2
Major -- wild type TGG 497 0.24 Trp[W] G2T1 TAM yes TTA 168 0.08
Leu[L] A1T2 Minor -- Wild type CTG 17 0.01 Leu[L] G1C1T1 Minor --
Wild type TTC 9 0.00 Phe[F] C1T2 TCA 5 0.00 Ser[S] A1C1T1 CTC 4
0.00 Leu[L] C2T1 Minor -- Wild type CTT 2 0.00 Leu[L] C1T2 Minor --
Wild type TCG 2 0.00 Ser[S] G1C1T1 CTA 1 0.00 Leu[L] A1C1T1 Minor
-- Wild type GAG 1 0.00 Glu[E] A1G2 ATG 2 0.00 Met[M] A1G1T1
Subtotal 1931 0.92 Mixtures 170 0.08 Total 2101
[0241] Not all mutations are unambiguously identifiable by base
composition in the absence of knowledge of the starting sequence.
For example, reverse transcriptase lysine 65 can mutate to
arginine, which mediates drug resistance. Lysine is an example of
the situation in FIG. 2C, where one of the two codons that encode
lysine have all three positions comprised of the same nucleotide
(AAA), and the second lysine codon has two of the same and one
different nucleotide (AAG). A mutation that encodes arginine AGA is
not distinguishable from the minor wild type codon, which does not
allow unambiguous assignment of drug resistance using base
composition. However, if the starting virus wild type sequence is
known (either AAA or AAG), then any mutation to arginine would be
distinguishable. TABLE-US-00011 TABLE 9 Mutations of Codon 65 in
HIV Reverse Transcriptase Distinguishable Codon Base from Major or
Codon Total Fraction Amino Acid Composition Phenotype Minor Wild
Type AAA 1782 0.85 Lys[L] A3 Wild type AAG 196 0.09 Lys[L] A2G1
Minor wild type AGA 46 0.02 Arg[R] A2G1 NNRTI* Not distinguishable
from minor wild type AGG 1 0.00 Arg[R] A1G1 NNRTI* Yes subtotal
2025 Mixtures 77 0.04 total 2102 *NNRTI = nucleoside and nucleotide
reverse transcriptase inhibitor resistant
[0242] Thus, for most of the 49 mutations cited in the 2005 update
of drug resistance mutation in HIV (Johnson, V. A. et al. 2005,
Top. HIV Med. 13, 51-57), base composition analysis is sufficient
to determine whether a drug-resistant mutation is present, simply
based upon the measured composition, the known biological
constraints of the HIV virus and the rules of the genetic code. For
a minority of the mutations, prior knowledge of the sequence of the
particular virus strain is needed to distinguish mutations that
mediate drug-resistance mutations from minor wild type codons
variations.
[0243] The advantages of monitoring codon base compositions
include: sensitivity to identification of low abundance mutations
in a population, it can be done on a much lower viral titer and is
less expensive than sequencing. Based upon previous data on the
sensitivity and dynamic range of electrospray mass spectrometry, we
would anticipate the ability to identify a low-abundance mutation
present in as little as 0.1% of the viral population in a 10 to
100-fold lower titer of virus than can be analyzed by sequencing.
If a drug-resistant mutation should arise as a small fraction of
the population in a patient that currently has a low viral titer,
it could be valuable to change drugs sooner rather than later to
keep the viral titer low. Lower virus titers mean there are fewer
viruses available to mutate, and drug resistance would be
suppressed.
[0244] The present invention includes any combination of the
various species and subgeneric groupings falling within the generic
disclosure. This invention therefore includes the generic
description of the invention with a proviso or negative limitation
removing any subject matter from the genus, regardless of whether
or not the excised material is specifically recited herein.
[0245] While in accordance with the patent statutes, description of
the various embodiments and examples have been provided, the scope
of the invention is not to be limited thereto or thereby.
Modifications and alterations of the present invention will be
apparent to those skilled in the art without departing from the
scope and spirit of the present invention.
[0246] Therefore, it will be appreciated that the scope of this
invention is to be defined by the appended claims, rather than by
the specific examples which have been presented by way of
example.
[0247] Each reference (including, but not limited to, journal
articles, U.S. and non-U.S. patents, patent application
publications, international patent application publications, gene
bank accession numbers, internet web sites, and the like) cited in
the present application is incorporated herein by reference in its
entirety.
Sequence CWU 1
1
372 1 24 DNA Artificial Sequence Primer 1 agcgtctagc catggcgtta
gtat 24 2 23 DNA Artificial Sequence Primer 2 ggaggctccg ttgtctgcat
gta 23 3 15 DNA Artificial Sequence Primer 3 taaccaagcc tttag 15 4
25 DNA Artificial Sequence Primer 4 taagagtggg accatggata aacac 25
5 25 DNA Artificial Sequence Primer 5 taagtaagtt caaccaagcc tttag
25 6 28 DNA Artificial Sequence Primer 6 tacacacaat tccttggaag
cacaggca 28 7 27 DNA Artificial Sequence Primer 7 tacagatttc
agcaagttca atcaagc 27 8 27 DNA Artificial Sequence modified_base
(22)...(22) I 8 taccaacatc gcggaggcta ttgccca 27 9 29 DNA
Artificial Sequence Primer 9 tacccagtct acgtgtttgg cgactgtgt 29 10
21 DNA Artificial Sequence Primer 10 taccccctgg gggtactttg a 21 11
21 DNA Artificial Sequence Primer 11 tacccctgct cgtgttacag g 21 12
21 DNA Artificial Sequence Primer 12 tacggtcaca gcttcccaca t 21 13
28 DNA Artificial Sequence Primer 13 tactaggagg ctgtaggcat aaattggt
28 14 20 DNA Artificial Sequence Primer 14 tactcaccaa ctcctggccc 20
15 26 DNA Artificial Sequence Primer 15 tactctcaca cggcctcata
cagtac 26 16 27 DNA Artificial Sequence Primer 16 tactgttatt
caggatggtg atatggt 27 17 27 DNA Artificial Sequence Primer 17
tactgttatt caggatggtg atatggt 27 18 27 DNA Artificial Sequence
Primer 18 tactgttatt caggatggtg atatggt 27 19 27 DNA Artificial
Sequence Primer 19 tactgttatt caggatggtg atatggt 27 20 21 DNA
Artificial Sequence Primer 20 tagaatgttt gctatgcaac c 21 21 21 DNA
Artificial Sequence Primer 21 tagaggcgga tgacaatggc g 21 22 24 DNA
Artificial Sequence Primer 22 tagatccaca agctttaggg tctg 24 23 32
DNA Artificial Sequence Primer 23 tagatgatag tgacattgca tataaatatg
ca 32 24 32 DNA Artificial Sequence Primer 24 tagatgatag tgacattgca
tataaatatg ca 32 25 21 DNA Artificial Sequence Primer 25 tagcaggaag
cactatgggc g 21 26 23 DNA Artificial Sequence Primer 26 taggacccct
gctcgtgtta cag 23 27 19 DNA Artificial Sequence Primer 27
taggaccgtg gataaacac 19 28 32 DNA Artificial Sequence Primer 28
taggatggcg atatggttga cacaggcttt gg 32 29 32 DNA Artificial
Sequence Primer 29 taggatggtg atatggttga tacaggcttt gg 32 30 32 DNA
Artificial Sequence Primer 30 taggatggtg atatggttga tacaggcttt gg
32 31 32 DNA Artificial Sequence Primer 31 taggatggtg atatggttga
tacaggcttt gg 32 32 32 DNA Artificial Sequence Primer 32 taggatggtg
atatggttga tacaggcttt gg 32 33 25 DNA Artificial Sequence Primer 33
tagggagact ttttgctaaa atgac 25 34 28 DNA Artificial Sequence Primer
34 tagggatttt tgacccatct ttttctca 28 35 23 DNA Artificial Sequence
Primer 35 taggggccca accccatttt cat 23 36 25 DNA Artificial
Sequence Primer 36 taggtagaat gtttgcaatg caacc 25 37 28 DNA
Artificial Sequence Primer 37 taggtcgcgt aatttgggta aggtcatc 28 38
30 DNA Artificial Sequence Primer 38 tagtctcaaa gagaaagaga
tcaaacaaga 30 39 24 DNA Artificial Sequence Primer 39 tagtgcaatc
catctagcag ctgt 24 40 29 DNA Artificial Sequence Primer 40
tataatccac ctatcccagt aggagaaat 29 41 26 DNA Artificial Sequence
Primer 41 tatagggtca tgaatcaaga acccgg 26 42 26 DNA Artificial
Sequence Primer 42 tatagggtca tgaatcaaga acccgg 26 43 32 DNA
Artificial Sequence Primer 43 tatatatcac gagatctgca gtttatgagt aa
32 44 27 DNA Artificial Sequence Primer 44 tatatcacgt gatctgcagt
ttatgag 27 45 27 DNA Artificial Sequence Primer 45 tatcagtgca
atccatctag cagctgt 27 46 21 DNA Artificial Sequence Primer 46
tatcgctgga tgtgtctgcg g 21 47 29 DNA Artificial Sequence Primer 47
tatcttatca tgtctgggtc cccaggaag 29 48 26 DNA Artificial Sequence
Primer 48 tatggtgcag tgggcatttg ataatg 26 49 26 DNA Artificial
Sequence Primer 49 tatggtgcag tgggcatttg ataatg 26 50 25 DNA
Artificial Sequence Primer 50 tatgtcaaaa gctgtggaca atgat 25 51 18
DNA Artificial Sequence Primer 51 tatgtttgct atgcaacc 18 52 25 DNA
Artificial Sequence Primer 52 tcaaccacat aagaggtggg tgttc 25 53 23
DNA Artificial Sequence Primer 53 tcaacctcca atcactcacc aac 23 54
20 DNA Artificial Sequence Primer 54 tcaagagatc ttcagtttat 20 55 26
DNA Artificial Sequence Primer 55 tcaagagatc ttcagtttat gagtaa 26
56 26 DNA Artificial Sequence Primer 56 tcaagatggg gaatgagatt
gccctt 26 57 29 DNA Artificial Sequence Primer 57 tcaatgtatc
ttatcatgtc tgggtcccc 29 58 23 DNA Artificial Sequence Primer 58
tcaccaaggt gcctctaaaa cga 23 59 25 DNA Artificial Sequence Primer
59 tcaccacgca atgcttccct atctt 25 60 24 DNA Artificial Sequence
Primer 60 tcacctggga ccccatcgat ggac 24 61 20 DNA Artificial
Sequence Primer 61 tcacctttgc aaaggggccc 20 62 26 DNA Artificial
Sequence Primer 62 tcacgagatc tgcagtttat gagtaa 26 63 25 DNA
Artificial Sequence Primer 63 tcagagcatc agatcacctg ggacc 25 64 29
DNA Artificial Sequence Primer 64 tcaggatggt ttttggtaga ggctatagt
29 65 26 DNA Artificial Sequence Primer 65 tcaggcaaga gtcactgcta
tcgaga 26 66 26 DNA Artificial Sequence Primer 66 tcagtgaata
tgactagcca ggtgct 26 67 27 DNA Artificial Sequence Primer 67
tcagtgtagg tagaatgttt gcaatgc 27 68 27 DNA Artificial Sequence
Primer 68 tcagttgatg ggcctacctc atttctt 27 69 30 DNA Artificial
Sequence Primer 69 tcatctacaa catgatggga aagagagaga 30 70 22 DNA
Artificial Sequence Primer 70 tcatgtctgg gtcccctgga ag 22 71 29 DNA
Artificial Sequence Primer 71 tccaaccaga aatttgagaa cattgcaga 29 72
24 DNA Artificial Sequence Primer 72 tccacctgtg gttattgaac ctgt 24
73 25 DNA Artificial Sequence Primer 73 tccaggtact tcacccccaa acctg
25 74 25 DNA Artificial Sequence Primer 74 tccatacttc gccttcacca
ttccc 25 75 25 DNA Artificial Sequence Primer 75 tcccacatct
gcaatcggag acagg 25 76 25 DNA Artificial Sequence Primer 76
tccccaatct ccaatcactc accaa 25 77 24 DNA Artificial Sequence Primer
77 tccccatcag acacctcagg tgga 24 78 22 DNA Artificial Sequence
Primer 78 tccccggtga ttggtatcct cc 22 79 26 DNA Artificial Sequence
Primer 79 tccctctaca gtagcaacgg atgcaa 26 80 25 DNA Artificial
Sequence Primer 80 tccgatgcac attcacggtt ggtat 25 81 21 DNA
Artificial Sequence Primer 81 tccgccttcg atgacagacg g 21 82 18 DNA
Artificial Sequence Primer 82 tccggccctg gatgacaa 18 83 25 DNA
Artificial Sequence Primer 83 tccgggctgt caatatgcta aaacg 25 84 24
DNA Artificial Sequence Primer 84 tccgtcgcaa gttggtgatg agta 24 85
25 DNA Artificial Sequence Primer 85 tcctaagagt gggaccatgg ataaa 25
86 28 DNA Artificial Sequence Primer 86 tcctaagagt gggaccatgg
ataaacac 28 87 24 DNA Artificial Sequence Primer 87 tcctagaagt
agaggcagca tcca 24 88 21 DNA Artificial Sequence Primer 88
tcctcccaca gcaaacatgt g 21 89 24 DNA Artificial Sequence Primer 89
tcctcgggaa attggcattg cgat 24 90 24 DNA Artificial Sequence Primer
90 tcctctcact catcagagca cccc 24 91 22 DNA Artificial Sequence
Primer 91 tcctgcccac ctacaacaac ca 22 92 26 DNA Artificial Sequence
Primer 92 tccttcacgg aggctatgac taggta 26 93 26 DNA Artificial
Sequence Primer 93 tcgaaaaacc tccaggcaag agtcac 26 94 22 DNA
Artificial Sequence Primer 94 tcgcaagact gctagccgag ta 22 95 25 DNA
Artificial Sequence Primer 95 tcgcagccat cttggcaaca tcctc 25 96 25
DNA Artificial Sequence Primer 96 tcgcagtccc caatctccaa tcact 25 97
20 DNA Artificial Sequence Primer 97 tcggcgcaag tcccagaacc 20 98 20
DNA Artificial Sequence Primer 98 tcgggatgta atggctggtt 20 99 26
DNA Artificial Sequence Primer 99 tcgttatcgg ctcagctcta cagttc 26
100 22 DNA Artificial Sequence Primer 100 tctacagtag caacggatgc aa
22 101 26 DNA Artificial Sequence Primer 101 tctagccatg gcgttagtat
gagtgt 26 102 21 DNA Artificial Sequence Primer 102 tctcccgcac
cctcaacaag c 21 103 22 DNA Artificial Sequence Primer 103
tcttttccag accccggact cc 22 104 19 DNA Artificial Sequence Primer
104 tgaacatacc aatgcagtt 19 105 25 DNA Artificial Sequence Primer
105 tgaactaacg gacagtggat atggc 25 106 21 DNA Artificial Sequence
Primer 106 tgaatggttc cgccagtgca c 21 107 22 DNA Artificial
Sequence Primer 107 tgacacaggc acccacggaa ta 22 108 20 DNA
Artificial Sequence Primer 108 tgacgaacca cagcgtcaca 20 109 21 DNA
Artificial Sequence Primer 109 tgacgtagcc aaggaggcgt t 21 110 26
DNA Artificial Sequence Primer 110 tgagaccatc ataagtagca agatgt 26
111 22 DNA Artificial Sequence Primer 111 tgagcagcag gaagcactat gg
22 112 25 DNA Artificial Sequence Primer 112 tgaggcctat agcagctata
gcctc 25 113 24 DNA Artificial Sequence Primer 113 tgatgaaata
tcgtggatgg aagc 24 114 24 DNA Artificial Sequence Primer 114
tgatgagata tcgtggatgg aagc 24 115 26 DNA Artificial Sequence Primer
115 tgattgaccc ttttcagttg ggcctt 26 116 25 DNA Artificial Sequence
Primer 116 tgattgatgt tgaaaccacc gaaga 25 117 24 DNA Artificial
Sequence Primer 117 tgcagtcccc aatctccaat cact 24 118 25 DNA
Artificial Sequence Primer 118 tgccaatcac tcatacaacc cccaa 25 119
24 DNA Artificial Sequence Primer 119 tgccacgacc ggcaagacca acat 24
120 28 DNA Artificial Sequence Primer 120 tgccagatga tcctataatt
gttgagga 28 121 26 DNA Artificial Sequence Primer 121 tgccagggag
tagtagaagc aatgaa 26 122 22 DNA Artificial Sequence Primer 122
tgccattcat aggctgccca tc 22 123 28 DNA Artificial Sequence Primer
123 tgcctacatt ctatcttgcg ttacatgg 28 124 28 DNA Artificial
Sequence Primer 124 tgcctagtgt gaagatgggg aatgagat 28 125 26 DNA
Artificial Sequence Primer 125 tgcctgaatt ggagatatga gaccat 26 126
23 DNA Artificial Sequence Primer 126 tgccttaatt ggagatatga gac 23
127 26 DNA Artificial Sequence Primer 127 tgccttaatt ggagatatga
gaccat 26 128 29 DNA Artificial Sequence Primer 128 tgcgttaact
ggaccaatga gaactttcc 29 129 25 DNA Artificial Sequence Primer 129
tgctcctctc aaaaccatgg gacac 25 130 23 DNA Artificial Sequence
Primer 130 tgctgaattc gtaacattga tga 23 131 28 DNA Artificial
Sequence Primer 131 tggaaatcct ttttctcaag gacgtggt 28 132 23 DNA
Artificial Sequence Primer 132 tggacattca tctctatcag tgc 23 133 22
DNA Artificial Sequence Primer 133 tggaccatca ttggaaggga cg 22 134
24 DNA Artificial Sequence Primer 134 tggaggctcc gttgtctgca tgta 24
135 30 DNA Artificial Sequence Primer 135 tggatagagg agaatgaatg
gatggaagac 30 136 19 DNA Artificial Sequence Primer 136 tggatgtgtc
tgcggcgtt 19 137 19 DNA Artificial Sequence Primer 137 tggccccgtg
tctggtagc 19 138 28 DNA Artificial Sequence Primer 138 tggctaggtg
tcacgtagaa aggactac 28 139 25 DNA Artificial Sequence Primer 139
tggctgaact tttgaaagtg agcgg 25 140 25 DNA Artificial Sequence
Primer 140 tggctgctag gctgtgctgc caact 25 141 26 DNA Artificial
Sequence Primer 141 tgggatgatc tactgagact gtgtga 26 142 30 DNA
Artificial Sequence Primer 142 tgggggtatt ttgacttcaa ccgattccac 30
143 30 DNA Artificial Sequence Primer 143 tgggggtatt ttgacttcaa
ccgattccac 30 144 26 DNA Artificial Sequence Primer 144 tgggtcctgc
ccacctacaa caacca 26 145 21 DNA Artificial Sequence Primer 145
tggggtggtg agagtttggg a 21 146 22 DNA Artificial Sequence Primer
146 tggtactcct caactgctgt cc 22 147 18 DNA Artificial Sequence
Primer 147 tggtgccgac ggagtggg 18 148 18 DNA Artificial Sequence
Primer 148 tggtgccgat ggagtggg 18 149 21 DNA Artificial Sequence
Primer 149 tggtgtggtg agagtttggg a 21 150 21 DNA Artificial
Sequence Primer 150 tggtgttgtg agggtctggg a 21 151 26 DNA
Artificial Sequence Primer 151 tgtaaatcta gtggctctcc tcccac 26 152
32 DNA Artificial Sequence Primer 152 tgtacaatct atgtaggaga
tccttactgt cc 32 153 23 DNA Artificial Sequence Primer 153
tgtaggtaga atgtttgcaa tgc 23 154 24 DNA Artificial Sequence Primer
154 tgtaggtgat cccttcaatc ctcc 24 155 28 DNA Artificial Sequence
Primer 155 tgtcacactt gcatttacaa catgatgg 28 156 21 DNA Artificial
Sequence Primer 156 tgtcccgact gtggcacttg a 21 157 18 DNA
Artificial Sequence Primer 157 tgtctatctt cctgactc 18 158 23 DNA
Artificial Sequence Primer 158 tgtctctctg gcgatgggtg gcc 23 159 23
DNA Artificial Sequence Primer 159 tgtctctctg
gagatgggtg gcc 23 160 23 DNA Artificial Sequence Primer 160
tgtctttcag gagatggatg gcc 23 161 23 DNA Artificial Sequence Primer
161 tgtctttcag gagatggatg gcc 23 162 24 DNA Artificial Sequence
Primer 162 tgtgaagcgc acaattgtta agac 24 163 32 DNA Artificial
Sequence Primer 163 tgtgaatatc aagcaggaca taacaaggta gg 32 164 26
DNA Artificial Sequence Primer 164 tgtgcatctt actcactaaa ggagaa 26
165 24 DNA Artificial Sequence Primer 165 tgtgccctca aaaaccctaa
cctc 24 166 24 DNA Artificial Sequence Primer 166 tgtgccctca
aaaaccctga cctc 24 167 28 DNA Artificial Sequence Primer 167
tgtggacaat gatctccatt gctgcaat 28 168 20 DNA Artificial Sequence
Primer 168 tgtgtcatct gcgagtgtgg 20 169 24 DNA Artificial Sequence
Primer 169 tgttaatgtc tatcttcctg actc 24 170 22 DNA Artificial
Sequence Primer 170 tgtttgcaca gaggctaaat ga 22 171 29 DNA
Artificial Sequence Primer 171 ttacaaagag ggccaacgcc attctcatc 29
172 25 DNA Artificial Sequence Primer 172 ttatgtcctt ggggtcacct
actgg 25 173 26 DNA Artificial Sequence Primer 173 ttcaatcaag
catttcggta tgaaac 26 174 23 DNA Artificial Sequence Primer 174
ttcacgcaga aagcgtctag cca 23 175 24 DNA Artificial Sequence Primer
175 ttcacgcaga aagcgtctag ccat 24 176 24 DNA Artificial Sequence
Primer 176 ttcagatgtc tgtgtggcgg ccta 24 177 24 DNA Artificial
Sequence Primer 177 ttcagatgtc tgtgtggcgg ccta 24 178 24 DNA
Artificial Sequence Primer 178 ttcagatgtc tgtgtggcgg ccta 24 179 28
DNA Artificial Sequence Primer 179 ttgcaaagag gcccaacccc attctcat
28 180 28 DNA Artificial Sequence Primer 180 ttgcaaagag gcccaacccc
attctcat 28 181 25 DNA Artificial Sequence Primer 181 ttgcgtcaat
ggcttatatc aaagg 25 182 25 DNA Artificial Sequence Primer 182
ttggatcagc cactgatgaa agatc 25 183 24 DNA Artificial Sequence
Primer 183 ttggtccatg actccgacct tgaa 24 184 24 DNA Artificial
Sequence Primer 184 tttcgttgtg gcaaggtagg acac 24 185 17 DNA
Artificial Sequence Primer 185 tttggacacc caatggt 17 186 23 DNA
Artificial Sequence Primer 186 taaggaacgg cgacaggatg cgc 23 187 30
DNA Artificial Sequence Primer 187 taatagactt tcccctctat attctaattc
30 188 30 DNA Artificial Sequence Primer 188 taataggctt tcccctctat
attctaattc 30 189 30 DNA Artificial Sequence Primer 189 taatccagaa
gaaccaacaa gaagatgagg 30 190 19 DNA Artificial Sequence Primer 190
taattgcatt agtctcact 19 191 16 DNA Artificial Sequence Primer 191
tacagaatag gctttg 16 192 30 DNA Artificial Sequence Primer 192
tacatattca tccgtgctta caaccttaga 30 193 24 DNA Artificial Sequence
Primer 193 taccatgtcc gaacctgtat ctgt 24 194 21 DNA Artificial
Sequence Primer 194 tacggagagt gacgggtttc c 21 195 25 DNA
Artificial Sequence Primer 195 tacgggacgt aaacaaagga cgtcc 25 196
20 DNA Artificial Sequence Primer 196 tacggggcca tgccgtgttg 20 197
26 DNA Artificial Sequence Primer 197 tactcaccgg ttccgcagac cactat
26 198 26 DNA Artificial Sequence Primer 198 tactccgtct cgtacgactt
tctgtt 26 199 18 DNA Artificial Sequence Primer 199 tactctaaca
gcatccat 18 200 30 DNA Artificial Sequence Primer 200 tactcttgtt
gtcacagcta tagcttgatt 30 201 34 DNA Artificial Sequence Primer 201
tactgcataa tagactttcc cctctatatt ctaa 34 202 34 DNA Artificial
Sequence Primer 202 tactgcataa taggctttcc cctctaaatt ctaa 34 203 26
DNA Artificial Sequence Primer 203 tacttgggat tgtttgtgtg agacgg 26
204 26 DNA Artificial Sequence Primer 204 tagatttcat ttagcctctg
tgcaaa 26 205 26 DNA Artificial Sequence Primer 205 tagcaaattg
ctttgctgtt gcacta 26 206 21 DNA Artificial Sequence Primer 206
tagctccgag ccacatgaac c 21 207 24 DNA Artificial Sequence Primer
207 tagctgaaat tgctgctgga gagg 24 208 28 DNA Artificial Sequence
Primer 208 taggaatatg ataaaacgcc gcagacac 28 209 25 DNA Artificial
Sequence Primer 209 tagggagatt gggagctccc gtatt 25 210 25 DNA
Artificial Sequence Primer 210 tagggtcact tggaggattg aaagg 25 211
30 DNA Artificial Sequence Primer 211 tagtattttg tcctgccacg
catttaaacg 30 212 30 DNA Artificial Sequence Primer 212 tagtattttg
tcctgccacg catttaaacg 30 213 30 DNA Artificial Sequence Primer 213
tagtattttg tcctgccacg catttaaacg 30 214 30 DNA Artificial Sequence
Primer 214 tagtattttg tcctgccacg catttaaacg 30 215 25 DNA
Artificial Sequence Primer 215 tagtcgttgg tccgttgtta gggaa 25 216
24 DNA Artificial Sequence Primer 216 tatatgataa aacgccgcag acac 24
217 25 DNA Artificial Sequence Primer 217 tatccccgaa agcccagata
tatac 25 218 28 DNA Artificial Sequence Primer 218 tatttgcctg
ccaattgctt tttaaaaa 28 219 28 DNA Artificial Sequence Primer 219
tatttgcctg ccaattgctt tttaaaaa 28 220 23 DNA Artificial Sequence
Primer 220 tcaaacccag aggtgcctgt aaa 23 221 20 DNA Artificial
Sequence Primer 221 tcaacactgg tgttgtccca 20 222 26 DNA Artificial
Sequence Primer 222 tcaatctctc ccttaaccat cccatt 26 223 25 DNA
Artificial Sequence Primer 223 tcactcgttt agacggcgga atatc 25 224
27 DNA Artificial Sequence Primer 224 tcagcaaatt gttctgctgc tgcacta
27 225 29 DNA Artificial Sequence Primer 225 tcagctatca atttctctgc
caatatttg 29 226 29 DNA Artificial Sequence Primer 226 tcagctatca
ttttctcagc caagatttg 29 227 23 DNA Artificial Sequence Primer 227
tcaggagctt tcgtgtccac ctt 23 228 19 DNA Artificial Sequence Primer
228 tcaggcacag cttggaggc 19 229 22 DNA Artificial Sequence Primer
229 tcaggctgcc acaccagatg tc 22 230 17 DNA Artificial Sequence
Primer 230 tcaggggtcc ttctata 17 231 20 DNA Artificial Sequence
Primer 231 tcaggggtgc tttgtgcttc 20 232 22 DNA Artificial Sequence
Primer 232 tcaggtggtg tctgccctcg tt 22 233 22 DNA Artificial
Sequence Primer 233 tcattgtggt gggtaggtcg tc 22 234 20 DNA
Artificial Sequence Primer 234 tcatttagcc tctgtgcaaa 20 235 25 DNA
Artificial Sequence Primer 235 tccacatgaa ccaaatggct ctgct 25 236
28 DNA Artificial Sequence Primer 236 tccagaagaa ccaacaagaa
gatgaggc 28 237 33 DNA Artificial Sequence Primer 237 tccagaccca
cccaagaatg agaacacaag ata 33 238 27 DNA Artificial Sequence Primer
238 tccagaccct gcaaaaaatg agaacac 27 239 24 DNA Artificial Sequence
Primer 239 tccatatacg aacacaccgg cgac 24 240 21 DNA Artificial
Sequence Primer 240 tccatcgatg gggtcccagg t 21 241 24 DNA
Artificial Sequence Primer 241 tccatgggga atcgcaatgc caat 24 242 24
DNA Artificial Sequence Primer 242 tccatttgga atcgcaatgc caat 24
243 22 DNA Artificial Sequence Primer 243 tccgatgtgg cttatttggc tg
22 244 27 DNA Artificial Sequence Primer 244 tccgtggatt gttctgtagc
agtcttc 27 245 32 DNA Artificial Sequence Primer 245 tcctattcct
ccccttcttt taaaattcat gc 32 246 23 DNA Artificial Sequence Primer
246 tcctcggtag tcctttctac gtg 23 247 24 DNA Artificial Sequence
Primer 247 tcctgcttga tggcctgtaa gtct 24 248 20 DNA Artificial
Sequence Primer 248 tcctttgcca tcccattgtc 20 249 27 DNA Artificial
Sequence Primer 249 tcgacacatt ggaggagcat gatgtta 27 250 26 DNA
Artificial Sequence Primer 250 tcgatcaggc tcaacatagc cctctt 26 251
22 DNA Artificial Sequence Primer 251 tcgcaagcac cctatcaggc ag 22
252 22 DNA Artificial Sequence Primer 252 tcgccatgtc tctctacctg cg
22 253 32 DNA Artificial Sequence Primer 253 tcggcagcca tttgcaaata
atcaggatat tt 32 254 20 DNA Artificial Sequence Primer 254
tcgggagggc aatgagggtc 20 255 23 DNA Artificial Sequence Primer 255
tcgggcccac tatgacgtgt aca 23 256 20 DNA Artificial Sequence Primer
256 tcgggtactg gtgcacacgc 20 257 28 DNA Artificial Sequence Primer
257 tcgtttgtag ggaacattgg tgaggaag 28 258 28 DNA Artificial
Sequence Primer 258 tcgtttgtag ggaacattgg tgaggaag 28 259 25 DNA
Artificial Sequence Primer 259 tctaaacgca catccccatg aattt 25 260
23 DNA Artificial Sequence Primer 260 tctaaatgag gacctgacct gtg 23
261 20 DNA Artificial Sequence Primer 261 tctaatattg tgtttatcca 20
262 26 DNA Artificial Sequence Primer 262 tctatgagga cattttccca
atctcc 26 263 27 DNA Artificial Sequence Primer 263 tctcccatca
tagtatatcc ttttgct 27 264 24 DNA Artificial Sequence Primer 264
tctctgggtg gggaaggagg ggag 24 265 32 DNA Artificial Sequence Primer
265 tctgcaacca tttgaaaata atctggatat tt 32 266 32 DNA Artificial
Sequence Primer 266 tctgcaacca tttgaaaata atctggatat tt 32 267 32
DNA Artificial Sequence Primer 267 tctgcaacca tttgcaaata atctggatat
tt 32 268 35 DNA Artificial Sequence Primer 268 tctgcaacca
tttgcaaata atctggatat ttgca 35 269 35 DNA Artificial Sequence
Primer 269 tctgcaacca tttgcaaata atctggatat ttgca 35 270 32 DNA
Artificial Sequence Primer 270 tctgcaacca tttgcaaata atctggatat tt
32 271 35 DNA Artificial Sequence Primer 271 tctgcaacca tttgcaaata
atctggatat ttgca 35 272 32 DNA Artificial Sequence Primer 272
tctgcaacca tttgcaaata atctggatat tt 32 273 35 DNA Artificial
Sequence Primer 273 tctgcaacca tttgcaaata atctggatat ttgca 35 274
32 DNA Artificial Sequence Primer 274 tctgcaacca tttgcaaata
atctggatat tt 32 275 19 DNA Artificial Sequence Primer 275
tctggaaccc agcagtgga 19 276 29 DNA Artificial Sequence Primer 276
tcttcatcag agctaggaga ttctgttgt 29 277 25 DNA Artificial Sequence
Primer 277 tcttgctttg acatgttgtg gtgga 25 278 21 DNA Artificial
Sequence Primer 278 tctttcccct ctgtattcta a 21 279 37 DNA
Artificial Sequence Primer 279 tgaaaacaca agatactttg gaacatacac
aggaggt 37 280 24 DNA Artificial Sequence Primer 280 tgaaccaatt
gcattagtct cact 24 281 29 DNA Artificial Sequence Primer 281
tgaagaggaa tatgataaaa cgccgcaga 29 282 28 DNA Artificial Sequence
Primer 282 tgaagggaaa gttctcattg gtccagtt 28 283 28 DNA Artificial
Sequence Primer 283 tgaagtcatc cagtatagtg tttatcca 28 284 23 DNA
Artificial Sequence Primer 284 tgaatgtacc ccatgaggtc ggc 23 285 37
DNA Artificial Sequence Primer 285 tgagaacaca agatactttg gaaactttca
caggtgg 37 286 23 DNA Artificial Sequence Primer 286 tgagagtgga
tgggcagcct atg 23 287 25 DNA Artificial Sequence Primer 287
tgaggatgtg tccaagatgg ctgcg 25 288 24 DNA Artificial Sequence
Primer 288 tgaggctgga tctatccacg caaa 24 289 25 DNA Artificial
Sequence Primer 289 tgaggggagt cgagggataa ggaac 25 290 27 DNA
Artificial Sequence Primer 290 tgagggggat aatggcatag gaggaat 27 291
23 DNA Artificial Sequence Primer 291 tgagtgattg gcggggtaag gac 23
292 23 DNA Artificial Sequence Primer 292 tgataaaacg ccgcagacac atc
23 293 23 DNA Artificial Sequence Primer 293 tgattgtcgc cttgaaccat
tgc 23 294 21 DNA Artificial Sequence Primer 294 tgcacacaac
ggacacacaa a 21 295 33 DNA Artificial Sequence Primer 295
tgcactagaa aacttcatct gggttgcagt atc 33 296 33 DNA Artificial
Sequence Primer 296 tgcactagag aatttcatct gggttgcagt atc 33 297 20
DNA Artificial Sequence Primer 297 tgcagcgtag gaaggtgtgg 20 298 23
DNA Artificial Sequence Primer 298 tgcatagcaa tctcaggagg tgc 23 299
25 DNA Artificial Sequence Primer 299 tgcatgaata agggtctgaa gccca
25 300 26 DNA Artificial Sequence Primer 300 tgcatgttga tgttgtccag
catgat 26 301 25 DNA Artificial Sequence Primer 301 tgccgaggcc
tatgtggtcg acatt 25 302 31 DNA Artificial Sequence Primer 302
tgcctgtgct tccaaggaat tgtgtgtaat a 31 303 25 DNA Artificial
Sequence Primer 303 tgcgggaaag gcgggagttg aagat 25 304 18 DNA
Artificial Sequence Primer 304 tgctaacaat ttctcagc 18 305 25 DNA
Artificial Sequence Primer 305 tgctccagga ggtgcaaatc aaaga 25 306
28 DNA Artificial Sequence Primer 306 tgctccccct agaaaattga
gagaagtc 28 307 23 DNA Artificial Sequence Primer 307 tgctgatctt
ggctgtccac ctc 23 308 23 DNA Artificial Sequence Primer 308
tgctggcatg aaccaaactg att 23 309 24 DNA Artificial Sequence Primer
309 tgcttccatc cacgatatct catc 24 310 24 DNA Artificial Sequence
Primer 310 tggaccatac aggcaacccg acaa 24 311 22 DNA Artificial
Sequence Primer 311 tggcaattcc ggtgtactca cc 22 312 26 DNA
Artificial Sequence Primer 312 tggcagtgga atcggttgaa gtcaaa 26 313
21 DNA Artificial Sequence Primer 313 tggcatggtg ccaaactgat t 21
314 21 DNA Artificial Sequence Primer 314 tggcatggtg ccaaactgat t
21 315 28 DNA Artificial Sequence Primer 315 tggcttgatt gtctccttga
accattgc 28 316 25 DNA Artificial Sequence Primer 316
tgggaaagct ggtagaggta catgc 25 317 23 DNA Artificial Sequence
Primer 317 tgggactctg gttcatgtat tgg 23 318 18 DNA Artificial
Sequence Primer 318 tgggcaatga gggtcact 18 319 21 DNA Artificial
Sequence Primer 319 tgggcctctc tgcaaaggag a 21 320 28 DNA
Artificial Sequence Primer 320 tgggctgata tggaatgtgc cctatctg 28
321 23 DNA Artificial Sequence Primer 321 tggggagatg accatgatgg tgc
23 322 23 DNA Artificial Sequence Primer 322 tggggctcat ggtcattgtc
atc 23 323 28 DNA Artificial Sequence Primer 323 tgggggacct
aattgctact gtatctga 28 324 29 DNA Artificial Sequence Primer 324
tgggtccctg atccaactag aaatgaaaa 29 325 25 DNA Artificial Sequence
Primer 325 tggtaatcaa aatactgcgg gccaa 25 326 33 DNA Artificial
Sequence Primer 326 tggtactctt gatgtcacag ctatagcttg att 33 327 24
DNA Artificial Sequence Primer 327 tggtcaaagc tggcatgaac caaa 24
328 24 DNA Artificial Sequence Primer 328 tggtcaaagc tggcatgaac
caaa 24 329 24 DNA Artificial Sequence Primer 329 tggtctggaa
aagacagggt tggg 24 330 24 DNA Artificial Sequence Primer 330
tggtcttctg gggcttgttc catc 24 331 25 DNA Artificial Sequence Primer
331 tggtgtttgg agtggctatt ggcag 25 332 23 DNA Artificial Sequence
Primer 332 tgtaaccagc agaataggct ttg 23 333 31 DNA Artificial
Sequence Primer 333 tgtaactgtt aaaactgagg ttgttggagt g 31 334 22
DNA Artificial Sequence Primer 334 tgtacggcag tgtttgcggt at 22 335
25 DNA Artificial Sequence Primer 335 tgtagaggtg gttgttgtag gtggg
25 336 21 DNA Artificial Sequence Primer 336 tgtatctgaa gctgctgctg
c 21 337 28 DNA Artificial Sequence Primer 337 tgtcatatcc
cctattcctc cccttctt 28 338 24 DNA Artificial Sequence Primer 338
tgtcatcttg ccctcctccc acca 24 339 24 DNA Artificial Sequence Primer
339 tgtcattttg ccctcctccc acca 24 340 30 DNA Artificial Sequence
Primer 340 tgtccataat ttctggcaat aaccttctat 30 341 27 DNA
Artificial Sequence Primer 341 tgtctaaacg cacatcccca tgaattt 27 342
27 DNA Artificial Sequence Primer 342 tgtctagact ctgtggtatt gtgagga
27 343 28 DNA Artificial Sequence Primer 343 tgtgtctgta aagactgaag
ttgttgga 28 344 21 DNA Artificial Sequence Primer 344 tgtgttttcc
caagctcttc c 21 345 30 DNA Artificial Sequence Primer 345
tgttccactt cccaagttta catcttcctc 30 346 25 DNA Artificial Sequence
Primer 346 tgttccgcag actactatgg ctctc 25 347 28 DNA Artificial
Sequence Primer 347 tgttgaagtc aaaatacccc cagggggt 28 348 25 DNA
Artificial Sequence Primer 348 tgttgaggac ggctgctaat tgttg 25 349
31 DNA Artificial Sequence Primer 349 tgttgtgata acaaagtccc
aatcatcgtt c 31 350 25 DNA Artificial Sequence Primer 350
tgttgtgcac ttttggagaa tattt 25 351 25 DNA Artificial Sequence
Primer 351 tgttgttgat gagtctctgc cagtc 25 352 25 DNA Artificial
Sequence Primer 352 tgttgttgat gagtctctgc cagtc 25 353 21 DNA
Artificial Sequence Primer 353 tgtttatcca cggtcccact c 21 354 21
DNA Artificial Sequence Primer 354 tgtttatcca tggtcccact c 21 355
19 DNA Artificial Sequence Primer 355 tgttttccca tgccctccc 19 356
25 DNA Artificial Sequence Primer 356 ttaggtcctg cacagccgca taatg
25 357 23 DNA Artificial Sequence Primer 357 ttctcagcta acaatttctc
agc 23 358 27 DNA Artificial Sequence Primer 358 ttctgcaatt
acttgacacg acctcat 27 359 25 DNA Artificial Sequence Primer 359
ttgcagagat ggagatcatt gtcca 25 360 24 DNA Artificial Sequence
Primer 360 ttgcttggtt atcaccctga acca 24 361 26 DNA Artificial
Sequence Primer 361 ttgcttttta aaaatgcagc tgcatt 26 362 26 DNA
Artificial Sequence Primer 362 ttgcttttta aaaatgcagc tgcatt 26 363
26 DNA Artificial Sequence Primer 363 ttgcttttta aaaatgcagc tgcatt
26 364 26 DNA Artificial Sequence Primer 364 ttgcttttta aaaatgcagc
tgcatt 26 365 24 DNA Artificial Sequence Primer 365 ttggcggggt
gaggaccttg aggg 24 366 22 DNA Artificial Sequence Primer 366
ttgtcaatat catccagttg gc 22 367 21 DNA Artificial Sequence Primer
367 ttgtgcacca tgcagttcat c 21 368 28 DNA Artificial Sequence
Primer 368 tttctgctcg tttataatgt ctacacat 28 369 23 DNA Artificial
Sequence Primer 369 tttgagttgt gggcagtccc ttt 23 370 27 DNA
Artificial Sequence Primer 370 tttggtcctt gtcttatgtc cagaatg 27 371
22 DNA Artificial Sequence Primer 371 ttttggcgaa tattttgttt gg 22
372 25 DNA Artificial Sequence Primer 372 tgttccgcag accactatgg
ctctc 25
* * * * *