U.S. patent application number 11/325270 was filed with the patent office on 2006-08-24 for primer for nucleic acid detection.
This patent application is currently assigned to The Gov. of the USA as represented by the Secretary of the Dept. of Health and Human, The Gov. of the USA as represented by the Secretary of the Dept. of Health and Human. Invention is credited to Vincent Hill, Jothikumar Narayanan.
Application Number | 20060188902 11/325270 |
Document ID | / |
Family ID | 36648137 |
Filed Date | 2006-08-24 |
United States Patent
Application |
20060188902 |
Kind Code |
A1 |
Narayanan; Jothikumar ; et
al. |
August 24, 2006 |
Primer for nucleic acid detection
Abstract
This application provides universal labeled primers for
detection and amplification of nucleic acid molecules. These
universal primers can be attached to the 5'-end of a target
sequence-specific primer. In particular examples, the universal
primer includes a labeled nucleotide flanked on both sides a
nucleotide whose complement nucleotides changes a detectable signal
from the label when the universal primer hybridizes with its
complementary nucleic acid molecule. Also disclosed are methods of
using the universal primer in nucleic acid amplification, such as
real-time PCR.
Inventors: |
Narayanan; Jothikumar;
(Lawrenceville, GA) ; Hill; Vincent; (Decatur,
GA) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 S.W. SALMON STREET
SUITE 1600
PORTLAND
OR
97204
US
|
Assignee: |
The Gov. of the USA as represented
by the Secretary of the Dept. of Health and Human
Services, Centers for Disease Control and Prevention
|
Family ID: |
36648137 |
Appl. No.: |
11/325270 |
Filed: |
January 3, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60641303 |
Jan 3, 2005 |
|
|
|
Current U.S.
Class: |
435/6.1 ;
435/287.2; 536/25.32 |
Current CPC
Class: |
C12Q 1/6818 20130101;
C12Q 1/6818 20130101; C12Q 1/6851 20130101; C12Q 2565/107 20130101;
C12Q 2525/161 20130101; C12Q 2525/185 20130101; C12Q 2565/113
20130101; C12Q 2525/161 20130101; C12Q 2565/107 20130101; C12Q
2565/107 20130101; C12Q 2565/101 20130101; C12Q 2525/161 20130101;
C12Q 2525/185 20130101; C12Q 2525/185 20130101; C12Q 2525/185
20130101; C12Q 2565/101 20130101; C12Q 2565/107 20130101; C12Q
2565/107 20130101; C12Q 1/6818 20130101; C12Q 1/6816 20130101; C12Q
1/6816 20130101; C12Q 1/6816 20130101; C12Q 1/6851 20130101 |
Class at
Publication: |
435/006 ;
435/287.2; 536/025.32 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12M 1/34 20060101 C12M001/34; C07H 21/04 20060101
C07H021/04 |
Claims
1. An isolated nucleic acid molecule comprising: a 5' end; a 3'
end; and a label on a nucleotide, wherein the labeled nucleotide is
flanked by two nucleotides whose complement nucleotides change a
detectable signal from the label when said isolated nucleic acid
molecule is hybridized with its complementary nucleic acid
molecule.
2. The isolated nucleic acid molecule of claim 1, wherein the
isolated molecule comprises the sequence
5'-X.sub.1(n)X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is
the labeled nucleotide, wherein X.sub.2 and X.sub.4 are the two
nucleotides flanking the labeled nucleotide, and wherein n is zero
or more nucleotides.
3. The isolated nucleic acid molecule of claim 1, wherein the
isolated molecule comprises the sequence
5'-X.sub.1(n)X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is
the labeled nucleotide, wherein X.sub.2 and X.sub.4 are the two
nucleotides flanking the labeled nucleotide, and wherein n is one
or more nucleotides.
4.-5. (canceled)
6. The isolated nucleic acid molecule of claim 2, wherein the
isolated molecule comprises the sequence
5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is the
labeled nucleotide, wherein X.sub.2 and X.sub.4 are the two
nucleotides flanking the labeled nucleotide, and wherein n is one
or more nucleotides.
7. The isolated nucleic acid molecule of claim 6, wherein the
isolated molecule comprises the sequence
5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.2 and X.sub.4
are "C".
8. The isolated nucleic acid molecule of claim 6, wherein the
isolated molecule comprises the sequence
5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is "T".
9. The isolated nucleic acid molecule of claim 6, wherein the
isolated molecule comprises the sequence
5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is "T" and
wherein X.sub.2 and X.sub.4 are "C".
10. The isolated nucleic acid molecule of claim 3 wherein the
isolated molecule comprises the sequence 5'-CTCSX.sub.(n)-3 (SEQ ID
NO: 20), wherein X.sub.(n) is any number of nucleotides, wherein S
is G or C, and wherein T is the labeled nucleotide.
11.-16. (canceled)
17. The isolated nucleic acid molecule of claim 10, wherein the
isolated nucleic acid molecule comprises the sequence 5'-CTCSXXX-3'
(SEQ ID NO: 21), wherein X is any nucleotide, wherein S is G or C,
and wherein T is the labeled nucleotide.
18. The isolated nucleic acid molecule of claim 10, wherein the
isolated nucleic acid molecule comprises the nucleic acid sequence
shown in SEQ ID NO: 1, 6, 8, 14, 18, 19, 21, 22, 29,31, or 32.
19. An isolated nucleic acid molecule comprising
5'-CTCSXXX.sub.(n)-3' (SEQ ID NO: 22), wherein a fluorophore is
attached to "T" and n comprises 0-11 nucleotides.
20.-28. (canceled)
29. The isolated nucleic acid molecule of claim 10, wherein the
isolated nucleic acid molecule comprises a target-specific probe
sequence.
30. The isolated nucleic acid molecule of claim 29, wherein the
isolated nucleic acid molecule comprises the sequence
5'-CTCSSSSX.sub.(n)RRRRGAG-3' (SEQ ID NO: 31), wherein X.sub.(n) is
any number of nucleotides comprising a target-specific probe,
wherein S is G or C, wherein R is the complementary nucleotide to
S, and wherein T is the labeled nucleotide.
31. The isolated nucleic acid molecule of claim 30, wherein the
isolated nucleic acid molecule comprises the sequence
5'-CTCSSSSX.sub.(n)RRRRGAG(Z.sub.(n))X.sub.(n)-3' (SEQ ID NO: 32),
wherein X.sub.(n) is any number of nucleotides comprising a
target-specific nucleotide sequence, wherein Z(n) is a carbon
spacer arm and n is a spacer phophoramidite containing at least 3
carbons.
32. The isolated nucleic acid molecule of claim 31, wherein
Z.sub.(n) is a blocking moiety that can reduce or prevent copying
of the 5' tail sequence.
33. The nucleic acid molecule of claim 31, wherein the fluorophore
signal is emitted upon hybridization of the probe to the target
nucleic acid in the primer extension product.
34. A kit comprising: the isolated nucleic acid molecule of claim
1; and a ligase.
35. An array comprising the isolated nucleic acid molecule of claim
1.
36. A method of detecting a target nucleic acid molecule
comprising: incubating a sample comprising the target nucleic acid
molecule with a forward primer and a reverse primer, wherein the
forward primer or the reverse primer is linked at its 5' end to the
3' end of the isolated nucleic acid molecule of claim 1 under
conditions sufficient to allow amplification of the target nucleic
acid molecule, thereby generating a labeled amplicon; and detecting
a change in signal from the label during or after amplification
relative to signal from the label before the amplification, wherein
a change in signal indicates that the target nucleic acid molecule
is present in the sample and wherein no significant change in
signal indicates that the target nucleic acid molecule is not
present in the sample.
37. (canceled)
38. The method of claim 36, further comprising: incubating the
labeled amplicon with an array comprising the target nucleic acid
molecule under conditions that permit hybridization between the
labeled amplicon and the target nucleic acid; and detecting a
signal from the fluorophore, wherein an increase in signal
indicates that the target nucleic acid molecule is present in the
sample and wherein no significant increase in signal indicates that
the target nucleic acid molecule is not present in the sample.
39.-46. (canceled)
47. A method of detecting a target nucleic acid molecule
comprising: incubating a sample comprising the target nucleic acid
molecule with a forward primer and a reverse primer, wherein the
forward primer or the reverse primer is linked at its 5' end to the
3' end of the isolated nucleic acid molecule of claim 1 under
conditions sufficient to allow amplification of the target nucleic
acid molecule, thereby generating a labeled amplicon; exposing the
labeled amplicon to conditions that permit denaturation of the
amplicon into single strand nucleic acid molecules; exposing the
single strand nucleic acid molecules to conditions that permit
annealing between the single strand nucleic acid molecules and the
forward primer or the reverse primer linked at its 5' end to the 3'
end of the isolated nucleic acid molecule of claim 1; and detecting
a change in signal from the label during denaturation relative to
signal from the label before the denaturation, wherein a change in
signal indicates that the target nucleic acid molecule is present
in the sample and wherein no significant change in signal indicates
that the target nucleic acid molecule is not present in the
sample.
48. A method of detecting a target nucleic acid molecule
comprising: incubating a sample comprising the target nucleic acid
molecule with a forward primer and a reverse primer, wherein the
forward primer or the reverse primer is linked at its 5' end to the
3' end of the isolated nucleic acid molecule of claim 31 under
conditions sufficient to allow amplification of the target nucleic
acid molecule, thereby generating a labeled amplicon; and detecting
a change in signal from the label during or after amplification
relative to signal from the label before the amplification, wherein
a change in signal indicates that the target nucleic acid molecule
is present in the sample and wherein no significant change in
signal indicates that the target nucleic acid molecule is not
present in the sample.
49. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional
Application No. 60/641,303 filed Jan. 3, 2005, herein incorporated
by reference.
FIELD
[0002] The present disclosure relates to labeled nucleic acid
sequences and methods of their use, for example to detect or
amplify a nucleic acid molecule.
BACKGROUND
[0003] The real-time polymerase chain reaction (PCR) is currently
used as a diagnostic tool in clinical applications. The real-time
PCR assay is carried out in the closed-tube format and can be used
to obtain quantitative results. The chemistry of real-time PCR is
based on monitoring fluorescence at every cycle at a set
temperature that facilitates calculating the kinetics of the
product formed and performing melting curve analysis to identify
formation of the specific product. Fluorescence is usually
monitored using an optical device to collect the data at specific
excitation and emission wavelengths for the particular fluorescent
dye present in the sample.
[0004] One method used to monitor nucleic acid amplification is the
addition of SYBR Green I dye (Ririe et al., Anal. Biochem.
245:154-60, 1997) and LCGreen (Wittwer et al., Clin. Chem.
49:853-60, 2003) during PCR. During amplification, these
fluorophores are excited with the appropriate wavelength of light,
inducing fluorescence when the dye intercalates into a DNA double
helix. However, this method lacks specificity and the primer-dimer
can also fluoresce.
[0005] Specificity can be increased by using a labeled
sequence-specific probe. Several of such methods are currently
available for performing real-time PCR, such as TaqMan.RTM. probes
(Lee et al., Nucleic Acids Res. 21:3761-6, 1993); molecular beacons
(Tyagi and Kramer, Nat. Biotechnol. 14:303-8, 1996); self-probing
amplicons (scorpions) (Whitcombe et al., Nat. Biotechnol. 17:804-7,
1999); Amplisensor (Chen et al., Appl. Environ. Microbiol.
64:4210-6, 1998); Amplifluor (Nazarenko et al., Nucleic Acids Res.
25:2516-21, 1997 and U.S. Pat. No. 6,117,635); displacement
hybridization probes (Li et al., Nucleic Acids Res. 30:E5, 2002);
DzyNA-PCR (Todd et al., Clin. Chem. 46:625-30, 2000); fluorescent
restriction enzyme detection (Cairns et al. Biochem. Biophys. Res.
Commun. 318:684-90, 2004); and adjacent hybridization probes
(Wittwer et al., Biotechniques 22:130-1, 134-8, 1997).
[0006] Currently available labeled primers can have a secondary
structure that is complex and in some instances must be synthesized
using specialized procedures. For example LUX.TM. primers
(Invitrogen Corp.) are fluorescently labeled on the 3'-end and have
a stem-loop structure that must be denatured for the primer to work
efficiently (especially for reverse transcription). The design of
the LUX.TM. primer is also a time-consuming step, which requires
specific software.
[0007] Several publications disclose probes that contain only one
fluorophore for use in detecting the presence of a particular
nucleic acid (for example see U.S. Pat. No. 6,699,661; U.S. Pat.
No. 6,495,326; and U.S. Pat. No. 6,492,121 (all to Kurane et al.);
U.S. Pat. No. 6,635,427 (Wittwer et al.); Kurata et al. (Nucl.
Acids Res. 29:e34, 2001); Torimura et al. (Analyt. Sci. 17:155-60,
2001); and Crockett et al. (Analyt. Biochem. 290:89-97, 2001)). In
these examples, the fluorophore is present on the very end of the
probe and the fluorescent signal is either enhanced or quenched in
the presence of the target nucleic acid sequence, depending on the
particular design of the probe. In most cases, the labeled primer
specifically hybridizes to the target nucleic acid sequence. Guo
and Milewicz (Biotech. Lett. 25:2079-83, 2003) disclose universal
fluorescent tag primers labeled on the 5' end that are not sequence
specific. The labeled fluorescent tag universal primer, in
combination with two sequence-specific primers, are use to amplify
a target nucleic acid sequence.
[0008] Yamane (Nucl. Acids Res. 30:e97, 2002) discloses a
MagniProbe that has an internal fluorophore and an internal
intercalator. The fluorescence is quenched by the intercalator in
the absence of a target sequence. Upon hybridization with the
target sequence, the probe emits fluorescence due to the
interference in quenching by intercalation.
[0009] Nazarenko et al. (Nucl. Acids Res. 30:e37, 2002) disclose a
probe with a single fluorophore near the 3' end (but no quencher),
and addition of 5-7 base pairs to the 5' end of the
sequence-specific probe, wherein the signal from the fluorophore is
increased in the presence of the target sequence.
SUMMARY
[0010] The present application relates to novel universal sequences
(also referred to herein as universal primers or tags) as well as
their use, for example in assessing the progress of a PCR reaction,
such as real time PCR, or for assessing the progress of melting
duplex DNA, such as an amplicon. The novel universal tags include a
label with a detectable signal that is altered by one or more
nucleotides in its complement sequence when the universal tag
hybridizes to its complement sequence.
[0011] The disclosed universal nucleic acid sequences include a
5'-end, a 3'-end, and a labeled nucleotide, wherein the labeled
nucleotide is flanked by two nucleotides whose complement
nucleotides change a detectable signal from the label when the
universal tag hybridizes with its complementary sequence. For
example, if the labeled nucleotide is "T", and the universal tag
includes the sequence CTC, the C's are the two nucleotides that
flank the labeled nucleotide, and a signal from the detectable
label on the "T" changes when the CTC sequence hybridizes to its
complementary sequence GAG.
[0012] In particular examples, a universal tag includes the
sequence 5'-X.sub.1(n)X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein
X.sub.3 is a labeled nucleotide that that emits a detectable
signal, wherein X.sub.2 and X.sub.4 are the two flanking
nucleotides that hybridize to complementary nucleotides that alter
the detectable signal in a predictable manner, and n is zero, one,
two or more nucleotides. In some examples, the nucleotide that
includes the label is X.sub.2 or X.sub.4, wherein X.sub.1 and
X.sub.3 or X.sub.3 and X.sub.5, respectively, are nucleotides that
hybridize to nucleotides that alter the detectable signal in a
predictable manner, and X.sub.4 and X.sub.5 or X.sub.1 and X.sub.2
are zero, one, two or more nucleotides, respectively.
[0013] In a specific example, a universal tag includes the sequence
5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is a
nucleotide that includes a label that emits a detectable signal,
wherein X.sub.2 and X.sub.4 are the flanking nucleotides that
hybridize to complementary nucleotides that alter the detectable
signal in a predictable manner, and X.sub.5(n) is one or more
nucleotides (and X.sub.1 which is not present in this example is
zero nucleotides).
[0014] In specific examples, the nucleotide containing a label is
"T". In some examples, the flanking nucleotides that hybridize to
complementary nucleotides that alter the detectable signal are "C".
For example, in the sequence 5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3',
X.sub.3 can be a "T" that includes a fluorophore whose signal is
decreased upon hybridization to a complementary sequence, X.sub.2
and X.sub.4 are "C" that hybridize to "G" in a complementary
sequence wherein "G" decreases fluorescence emitted from the
fluorophore, and X.sub.5 is a "C" (or any other nucleotide such as
a "G") followed by at least one additional nucleotide, such as at
least 2 nucleotides, at least 5 nucleotides, at least 10
nucleotides, or 1-50 nucleotides, such as 1-10 nucleotides.
However, one skilled in the art will appreciate that the labeled
nucleotide can be another nucleotide such as A, C, G, U, or a
modified nucleotide such as inosine. Similarly, the nucleotides
that hybridize to nucleotides that alter the detectable signal in a
predictable manner can be other nucleotides, such as nucleotides
that are capable of quenching a fluorescent-labeled nucleotide, for
example the synthetic nucleotide isoC.
[0015] In particular examples, the label on the universal tag is
present on a nucleotide that is the second nucleotide from the
5'-end. This position can also be referred to as the 0 position,
and the flanking nucleotides referred to as the -1 and +1
positions. For example, the nucleotide that is two nucleotides from
the 5' end (or the 0 position) of the universal sequence
5'-X.sub.1X.sub.2X.sub.3X.sub.4X.sub.5-3' is X.sub.2, and the
flanking nucleotides X.sub.1 and X.sub.2 (or the -1 and +1
positions, respectively). Similarly, the nucleotide that is two
nucleotides from the 5' end (or the 0 position) of the universal
sequence 5'-CTCCX.sub.(n) (SEQ ID NO: 18) or 5'-CTCGX.sub.(n) (SEQ
ID NO: 19) is the "T". Although particular exemplary universal
primers are disclosed herein (for example SEQ ID NOS: 1, 6, 7, 14,
and 18-22), the present application is not limited to these
particular sequences.
[0016] The signal from the label changes when the universal nucleic
acid sequence is hybridized to its complementary sequence. The
change in the signal can be an increase or a decrease. The
resulting change in detectable signal is proportional to the amount
of amplicon produced and therefore occurs only when a complimentary
stand is synthesized. The signal can be detected by a variety of
devices, such as fluorescent microtiter plate readers,
spectrofluorometers, fluorescent imaging systems, and real-time PCR
instruments.
[0017] Any label whose signal is changed in response to
hybridization to a nucleic acid molecule can be used, such as a
fluorophore, for example 6-carboxyfluorescein (6-FAM). In
particular examples, the change in signal is a decrease in
fluorescence, such as a quenching of fluorescence. For example, the
nucleotide guanosine can quench a variety of fluorophores, such as
6-FAM.
[0018] Ideally, a universal nucleic acid sequence does not
recognize and hybridize to a target nucleic acid sequence. For
example, if the target nucleic acid sequence is a human p53
sequence, the universal nucleic acid sequence does not
substantially hybridize to the p53 sequence. In particular
examples, the universal nucleic acid sequence alone does not
hybridize with a target nucleic acid sequence under moderately
stringent or highly stringent hybridization conditions.
[0019] The disclosed universal sequences can be used to label any
sequence-specific primer without significantly affecting the
sensitivity of the amplification reaction. Ideally, a
sequence-specific primer specifically recognizes a target nucleic
acid sequence. For example, if the target sequence is a human p53
sequence, the sequence specific primer can substantially hybridize
to the p53, sequence. In some examples, a sequence specific primer
can hybridize with a target nucleic acid sequence under moderately
stringent or highly stringent hybridization conditions.
[0020] A universal tag can be attached via its 3'-end to a 5'-end
of a forward primer or a reverse primer specific for the target
nucleic acid sequence of interest, thereby generating a labeled
forward or labeled reverse primer. The resulting labeled forward or
labeled reverse primer can be used to amplify the appropriate
target nucleic acid, for example using real-time PCR, resulting in
the formation of amplicon products. The method can further include
quantifying an amount of target nucleic acid sequence present in a
sample.
[0021] Also provided by the present disclosure are kits that
include one or more universal nucleic acid sequences of the present
disclosure. The kits can further include a ligase to permit joining
of the 3'-end of a universal nucleic acid tag to a 5'-end of a
sequence-specific forward or reverse primer. In some examples, the
kit also includes one or more sequence-specific forward or reverse
primers, such as primers that recognize and can be used to amplify
a target sequence of interest. In a specific example, the
sequence-specific forward or reverse primer hybridizes specifically
to a pathogen's nucleic acid sequence, such as a viral, bacterial,
parasitic, or fungal nucleic acid sequence. In another specific
example, the sequence-specific forward or reverse primer hybridizes
specifically to a human nucleic acid sequence.
[0022] Arrays, such as a DNA microarray, that include one or more
of the disclosed universal tags are encompassed by this disclosure.
Such arrays can be used to determine whether a desired target
sequence is present, such as in a sample. The disclosed universal
tags can be hybridized to a target nucleic acid sequence attached
to the array (for example resulting in fluorescence).
[0023] The disclosed universal tags provide an approach to detect,
and in some examples further quantify, a target nucleic acid. Use
of the universal tags is shown herein to provide a highly sensitive
detection method, which permits detected of small quantities of
target nucleic acid molecule, such as DNA. For example, the present
disclosure provides methods of detecting a target nucleic acid
molecule. The method includes incubating a sample containing
nucleic acids (such as DNA or RNA) with a universal tag which is
linked to a forward or a reverse target sequence specific primer,
and with the corresponding forward or reverse target sequence
specific primer not containing the universal tag. The sample and
labeled forward primer and reverse primer not containing the
universal tag, or forward primer not containing the universal tag
and labeled reverse primers are incubated under conditions
sufficient to permit amplification of the target nucleic acid. A
change in signal from the label on the universal tag is monitored,
wherein a change in signal indicates the presence of the target
nucleic acid sequence. In particular examples, both the forward and
reverse target sequence specific primers contain a universal
tag.
[0024] In some examples, the change in signal is monitored during
the amplification reaction, for example in real time as the
amplicons are formed. In other or additional examples, the change
in signal is monitored after the amplification, for example by
exposing the resulting amplicons to increased temperature to
generate a melting curve. Melting curve analysis can be used to
confirm the presence of a target nucleic acid, and can also be used
to distinguish polymorphisms in amplicons.
[0025] Those skilled in the art will appreciate that the disclosed
nucleic acid molecules and methods can be used to amplify two or
more different target nucleic acid molecules (such as at least 2,
at least 3, at least 4, or even at least 5 different nucleic acid
sequences) in the same amplification reaction. In particular
examples, two or more different primers, each containing a
different label, are used. In other examples, the same universal
tag sequence and label are ligated to at least two different
sequence-specific primers, wherein the resulting amplicons are
differentiated, for example by using melting curve analysis. In yet
other examples, combinations of the same universal tag sequence and
label or different universal tag sequences and labels are used.
BRIEF SUMMARY OF THE DRAWINGS
[0026] FIGS. 1A and 1B are schematic drawings showing (A) an
exemplary fluorescently labeled universal primer (SEQ ID NO: 1) and
(B) a stable hybrid that results when the amplicon is formed in the
region of the universal primer and the sequence-specific primer.
Labeling position is shown with a letter F* and the Tag region is
capitalized. Forward primer with universal primer is shown in SEQ
ID NO: 2 and the reverse primer is shown in SEQ ID NO: 3.
[0027] FIG. 2A is a graph showing the concurrent fluorescence
visualization of Adenovirus 40 PCR product formation using
TaqMan.RTM. probe (fluorescence amplification) and the exemplary
universal primer of SEQ ID NO: 1 (fluorescence quenching).
[0028] FIG. 2B is a graph showing the melting curve analysis using
the exemplary universal primer 5'-C"T"CCGGC (SEQ ID NO: 1).
[0029] FIG. 2C is a standard curve of hexon based TaqMan.RTM. PCR
assay of serially diluted adenovirus 40 (FIG. 2A) expressed as
cycle number crossing point (CP) versus log concentration of
genomic equivalents (GE) per assay (5.times.10.sup.4 to 10.sup.0
GE/assay corresponds to the serial dilution 1 though 5, which are
also shown in FIGS. 2A and 2B).
[0030] FIG. 3A is a graph showing the fluorescence quenching of an
exemplary universal primer (SEQ ID NO: 1) during PCR amplification
of 10-fold dilutions of adenovirus 40 GE copies.
[0031] FIG. 3B is a graph showing the melting curve analysis of PCR
amplicons generated from the assays shown in FIG. 3A.
[0032] FIG. 4A is a graph comparing the fluorescence quenching
curves using a 5'-terminal labeled primer
(5'-"c"ATGACGGGTAACGGGGAAT; SEQ ID NO: 24), a universal tagged
primer (5'-c"t"ccggcATGACGGGTAACGGGGAAT; SEQ ID NO: 10); and the
increase in fluorescence for a TaqMan.RTM. probe (SEQ ID NO:
27).
[0033] FIG. 4B is a graph showing the melting curve analysis of a
Cryptosporidium parvum sequence using a 5'-terminal labeled primer
(5'-"c"ATGACGGGTAACGGGGAAT; SEQ ID NO: 24) compared to a universal
tagged primer (SEQ ID NO: 10).
[0034] FIG. 5 is a graph showing fluorescence quenching curves
obtained by real-time quantitative PCR amplification of GE copies
of adenovirus 40 using 5'-C"T"CGGCCCGCCGAG-3' (SEQ ID NO: 6) as an
exemplary universal tag.
[0035] FIG. 6A is a graph showing fluorescence quenching curves
obtained by real-time PCR amplification of a Cryptosporidium parvum
sequence using 5'-CTCCX.sub.(0-11)-3' (SEQ ID NO: 7) as exemplary
universal tags as shown in the figure.
[0036] FIG. 6B is a graph showing the melting curve analysis using
5'-CTCCX.sub.(0-11)-3' (SEQ ID NO: 7) as exemplary universal
tags.
[0037] FIG. 7A is a graph showing fluorescence quenching curves
obtained by real-time PCR amplification of an adenovirus and a
Salmonella sequence using 5'-C"T"CCGGC -3' (SEQ ID NO: 14) as an
exemplary universal tag.
[0038] FIG. 7B is a graph showing the melting curve analysis using
5'-C"T"CCGGC-3' (SEQ ID NO: 14) as an exemplary universal tag.
[0039] FIG. 8A is a graph showing fluorescence quenching curves
obtained by real-time RT-PCR amplification of three Hepatitis E
Virus genotypes from clinical specimens using 5'-C"T"CCGGC -3' (SEQ
ID NO: 14) as an exemplary universal tag.
[0040] FIG. 8B is a graph showing the melting curve analysis using
5'-C"T"CCGGC-3' (SEQ ID NO: 14) as an exemplary universal tag.
[0041] FIG. 9A is a graph showing the increase in fluorescence
during melting curve analysis of an adenovirus 40 PCR product
produced using 5'-C"T"CCGGC-3' (SEQ ID NO: 14) as an exemplary
universal tag.
[0042] FIG. 9B is a graph showing the melting curve analysis of an
adenovirus 40 sequence using 5'-C"T"CCGGC-3' (SEQ ID NO: 14) as an
exemplary universal tag. Plotting melting peaks were derived based
on the R.A.P.I.D. System software (Idaho Technology, Inc.; Salt
Lake City, Utah) by plotting the negative derivative of
fluorescence over change in temperature versus temperature (-dF/dT
vs. T).
[0043] FIG. 10A shows the use of an exemplary fluorescently labeled
UniFluor probe (SEQ ID: 29) having arms (shown in small letters) on
either side of the probe region to interact to form a duplex and a
single fluorophore (F) attached internally at "t" near the 5' arm.
A chemical linker (X) C3 spacer amidite is attached at the end of
other side of the arm, which in turn is attached to the forward
primer at the 5' end. FIG. 10B shows that in the absence of the
target, the arms interact to form a duplex; the fluorophore in one
of the arms (cctc) is quenched by the complimentary arm containing
guanosines (ggag) resulting in no fluorescence emission. FIG. 10C
shows how the primer part of the UniFluor probe hybridizes to the
target binding region of an exemplary complimentary sequence during
primer extension. FIG. 1 OD shows how the UniFluor probe is
incorporated into the forward sense strand amplicon and hybridizes
with the target binding region of the exemplary complimentary
sequence.
[0044] FIG. 11 is a graph showing the increase in fluorescence
during amplification of C. parvum using SEQ ID NO: 29 and SEQ ID
NO: 13.
SEQUENCE LISTING
[0045] The nucleotide sequences of the nucleic acids described
herein are shown using standard letter abbreviations for nucleotide
bases. Only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood as included by any reference
to the displayed strand.
[0046] SEQ ID NO: 1 is the nucleic acid sequence of the exemplary
universal primer 5'-C"T"CCGGC-3', wherein the "T" is labeled with a
detectable label that is altered by hybridization to a
complementary sequence.
[0047] SEQ ID NOS: 2 and 3 are a forward and a reverse primer for
amplification of the hexon protein region of adenovirus,
respectively, wherein the forward primer includes the universal
primer shown in SEQ ID NO: 1.
[0048] SEQ ID NOS: 4 and 5 are a forward and a reverse primer for
TaqMan amplification of the hexon protein region of adenovirus,
respectively.
[0049] SEQ ID NO: 6 is the nucleic acid sequence of the exemplary
universal primer 5'-C"T"CGGCCCGCCGAG-3', wherein the "T" is labeled
with a detectable label that is altered by hybridization to a
complementary sequence.
[0050] SEQ ID NO: 7 is the nucleic acid sequence of the exemplary
universal primer 5'-C"T"CCX.sub.(0-11)-3', wherein the "T" is
labeled with a detectable label that is altered by hybridization to
a complementary sequence.
[0051] SEQ ID NOS: 8-12 are forward primers for amplification of a
Cryptosporidium parvum sequence, wherein the forward primer
includes the universal primer shown in SEQ ID NO: 7.
[0052] SEQ ID NO: 13 is a reverse primer for amplification of a C.
parvum sequence.
[0053] SEQ ID NO: 14 is the nucleic acid sequence of the exemplary
universal primer 5'-C"T"CCGGC-3', wherein the "T" is labeled with a
detectable label that is altered by hybridization to a
complementary sequence.
[0054] SEQ ID NO: 15 is a forward primer for amplification of the
hexon protein region of Adenovirus, wherein the forward primer
includes the universal primer shown in SEQ ID NO: 14.
[0055] SEQ ID NOS: 16 and 17 are a forward and a reverse primer for
amplification of a Salmonella typhimurium sequence, respectively,
wherein the forward primer includes the universal primer shown in
SEQ ID NO: 14.
[0056] SEQ ID NOS: 18-22 are exemplary universal primers.
[0057] SEQ ID NO: 23 is the complementary sequence to the universal
primer shown in SEQ ID NO: 1.
[0058] SEQ ID NO: 24 is a forward primer labeled at its 5'-terminal
nucleotide for amplification of the 18s region of C. parvum.
[0059] SEQ ID NO: 25 is a TaqMan.RTM. probe for amplification of
the 18s region of C. parvum.
[0060] SEQ ID NOS: 26 and 27 are a forward and a reverse primer for
amplification of a Hepatitis E Virus sequence, respectively,
wherein the forward primer includes the universal primer shown in
SEQ ID NO: 14.
[0061] SEQ ID NO: 28 is an exemplary universal sequence having less
than 50% GC content.
[0062] SEQ ID NO: 29 is an exemplary "UniFluor" probe for
amplification of the 18s region of C. parvum, wherein the probe has
a stem and loop structure, a single fluorophore, and a PCR blocker,
with the probe being attached to the 5' end of a target-specific
primer.
[0063] SEQ ID NO: 30 is a sequence complementary to nucleotides 1-8
of SEQ ID NO: 29.
[0064] SEQ ID NOS: 31-32 are exemplary universal primers.
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
Abbreviations and Terms
[0065] The following explanations of terms and methods are provided
to better describe the present disclosure and to guide those of
ordinary skill in the art in the practice of the present
disclosure. The singular forms "a," "an," and "the" refer to one or
more than one, unless the context clearly dictates otherwise. For
example, the term "comprising a nucleic acid molecule" includes
single or plural nucleic acid molecules and is considered
equivalent to the phrase "comprising at least one nucleic acid
molecule." The term "or" refers to a single element of stated
alternative elements or a combination of two or more elements,
unless the context clearly indicates otherwise. As used herein,
"comprises" means "includes." Thus, "comprising A or B," means
"including A, B, or A and B," without excluding additional
elements.
[0066] Unless explained otherwise, all technical and scientific
terms used herein have the same meaning as commonly understood to
one of ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
present disclosure, suitable methods and materials are described
below. The materials, methods, and examples are illustrative only
and not intended to be limiting.
[0067] 3' end: The end of a nucleic acid molecule that does not
have a nucleotide bound to it 3' of the terminal residue.
[0068] 5' end: The end of a nucleic acid sequence where the 5'
position of the terminal residue is not bound by a nucleotide.
[0069] Amplifying a nucleic acid molecule. To increase the number
of copies of a nucleic acid molecule. The resulting amplification
products are called "amplicons."
[0070] Array. An arrangement of biological molecules, such as an
arrangement of tissues, cells, or nucleic acid molecules, in
addressable locations on or in a substrate. The arrangement of
molecules within the array can be regular, such as being arranged
in uniform rows and columns, or irregular. The number of
addressable locations within the array can vary, for example from a
few (such as two or three) to more than 50, 100, 200, 500, 1000,
10,000, or more. In certain examples, the array includes one or
more molecules or samples occurring on the array a plurality of
times (twice or more) to provide an added feature to the array,
such as redundant activity or to provide internal controls. A
"microarray" is an array that is miniaturized and can in some
examples be evaluated or analyzed using microscopy.
[0071] Within an array, each arrayed sample or molecule is
addressable, such that its location can be reliably and
consistently determined within the at least two dimensions of the
array. The location or address of each sample or molecule can be
assigned when it is applied to the array, and a key or guide can be
provided in order to correlate each location with the appropriate
target sample or molecule position. Ordered arrays can be arranged
in a symmetrical grid pattern or other patterns, for example, in
radially distributed lines, spiral lines, or ordered clusters.
Addressable arrays can be computer readable; a computer can be
programmed to correlate a particular address on the array with
information about the sample at that position, such as
hybridization or binding data, including signal intensity. In some
exemplary computer readable formats, the individual samples or
molecules in the array are arranged regularly (for example, in a
Cartesian grid pattern), which can be correlated to address
information by a computer.
[0072] The sample or molecule addresses on an array can assume many
different shapes. For example, substantially square regions can be
used as addresses within arrays, but addresses can be differently
shaped, for example, substantially rectangular, triangular, oval,
irregular, or another shape. The term "spot" refers generally to a
localized placement of molecules, tissue or cells, and is not
limited to a round or substantially round region or address.
[0073] Change: To become different in some way, for example to be
altered, such as increased or decreased. A detectable change is one
that can be detected, such as a change in the intensity, frequency
or presence of an electromagnetic signal, such as fluorescence. In
particular examples, the detectable change is a reduction in
fluorescence intensity.
[0074] Complementary. Complementary binding occurs when the base of
one nucleic acid molecule forms a hydrogen bond to the base of
another nucleic acid molecule. Normally, the base adenine (A) is
complementary to thymidine (T) and uracil (U), while cytosine (C)
is complementary to guanine (G). For example, the sequence
5'-ATCG-3' of one ssDNA molecule can bond to 3'-TAGC-5' of another
ssDNA to form a dsDNA. In this example, the sequence 5'-ATCG-3' is
the reverse complement of 3'-TAGC-5'.
[0075] Nucleic acid molecules can be complementary to each other
even without complete hydrogen-bonding of all bases of each
molecule. For example, hybridization with a complementary nucleic
acid sequence can occur under conditions of differing stringency in
which a complement will bind at some but not all nucleotide
positions. In particular examples disclosed herein, the
complementary sequence is complementary at a labeled nucleotide,
and at each nucleotide immediately flanking the labeled
nucleotide.
[0076] Fluorophore: A chemical compound, which when excited by
exposure to a particular wavelength of light, emits light
(fluoresces), for example at a different wavelength of light.
Exemplary fluorophores include, but are not limited to:
6-carboxyfluorescein; 5-carboxyfluorescein (5-FAM); boron
dipyrromethene difluoride (BODIPY);
N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); acridine,
stilbene, -6-carboxy-fluorescein (HEX), TET (Tetramethyl
fluorescein), 6-carboxy-X-rhodamine (ROX), Texas Red,
2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE), Cy3,
Cy5, VIC.RTM. (Applied Biosystems), LC Red 640, LC Red 705, Yakima
yellow, as well as derivatives thereof.
[0077] Also encompassed by the term "fluorophore" are luminescent
molecules, which are chemical compounds which do not require
exposure to a particular wavelength of light to fluoresce;
luminescent compounds naturally fluoresce. Therefore, the use of
luminescent signals can eliminate the need for an external source
of electromagnetic radiation, such as a laser.
[0078] A particular type of fluorophore is one whose fluorescence
is quenched in the presence of guanine. In one example,
fluorescence is quenched by at least 25% in the presence of
guanine, such as at least 50%, at least 75%, at least 80%, or at
least 90%, as compared to an amount of fluorescence in the absence
of guanine (wherein both are in the presence of the appropriate
excitation wavelength of light).
[0079] Hybridization: Hybridization of a nucleic acid occurs when
two complementary nucleic acid molecules undergo an amount of
hydrogen bonding to each other. The stringency of hybridization can
vary according to the environmental conditions surrounding the
nucleic acids, the nature of the hybridization method, and the
composition and length of the nucleic acids used. Calculations
regarding hybridization conditions required for attaining
particular degrees of stringency are discussed in Sambrook et al.,
Molecular Cloning: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 2001); and Tijssen,
Laboratory Techniques in Biochemistry and Molecular
Biology--Hybridization with Nucleic Acid Probes Part I, Chapter 2
(Elsevier, N.Y., 1993). The T.sub.m is the temperature at which 50%
of a given strand of nucleic acid is hybridized to its
complementary strand.
[0080] For purposes of this disclosure, "stringent conditions"
encompass conditions under which hybridization only will occur if
there is less than 25% mismatch between the hybridization molecule
and the target sequence. "Moderate stringency" conditions are those
under which molecules with more than 25% sequence mismatch will not
hybridize; conditions of"medium stringency" are those under which
molecules with more than 15% mismatch will not hybridize, and
conditions of "high stringency" are those under which sequences
with more than 10% mismatch will not hybridize. Conditions of "very
high stringency" are those under which sequences with more than 5%
mismatch will not hybridize.
[0081] Moderately stringent hybridization conditions are when the
hybridization is performed at about 42.degree. C. in a
hybridization solution containing 25 mM KPO.sub.4 (pH 7.4),
5.times.SSC, 5.times. Denhart's solution, 50 .mu.g/mL denatured,
sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and
1-15 ng/mL probe (about 5.times.10.sup.7 cpm/.mu.g), while the
washes are performed at about 50.degree. C. with a wash solution
containing 2.times.SSC and 0.1% sodium dodecyl sulfate.
[0082] Highly stringent hybridization conditions are when the
hybridization is performed at about 42.degree. C. in a
hybridization solution containing 25 mM KPO.sub.4 (pH 7.4),
5.times.SSC, 5.times. Denhart's solution, 50 .mu.g/mL denatured,
sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and
1-15 ng/mL probe (about 5.times.10.sup.7 cpm/.mu.g), while the
washes are performed at about 65.degree. C. with a wash solution
containing 0.2.times.SSC and 0.1% sodium dodecyl sulfate.
[0083] The complementary nucleic acid sequences disclosed herein
can hybridize under stringent, moderately stringent, and highly
stringent conditions.
[0084] Isolated: An "isolated" biological component (such as a
nucleic acid molecule) has been substantially separated, produced
apart from, or purified away from other biological components.
Nucleic acid molecules which have been "isolated" include nucleic
acids molecules purified by standard purification methods, as well
as those chemically synthesized. Isolated does not require absolute
purity, and can include nucleic acid molecules that are at least
50% isolated, such as at least 75%, 80%, 90%, 95%, 98%, 99% or even
100% isolated.
[0085] Label: An agent capable of detection, for example by
spectrophotometry, flow cytometry, or microscopy. For example, a
label can be attached to a nucleotide, thereby permitting detection
of the nucleotide, such as detection of the nucleic acid molecule
of which the nucleotide is a part of. Examples of labels include,
but are not limited to, radioactive isotopes, enzyme substrates,
co-factors, ligands, chemiluminescent agents, fluorophores,
haptens, enzymes, and combinations thereof. Methods for labeling
and guidance in the choice of labels appropriate for various
purposes are discussed for example in Sambrook et al. (Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 1989) and
Ausubel et al. (In Current Protocols in Molecular Biology, John
Wiley & Sons, New York, 1998).
[0086] Ligase: An enzyme that can catalyse the joining of two
molecules ("ligation") by forming a new chemical bond. An exemplary
ligase is DNA ligase, which can link two nucleic acid molecules by
forming a phosphodiester bond between the two molecules.
[0087] Nucleic acid molecule: A deoxyribonucleotide or
ribonucleotide polymer, which can include analogues of natural
nucleotides that hybridize to nucleic acid molecules in a manner
similar to naturally occurring nucleotides. In a particular
example, a nucleic acid molecule is a single stranded (ss) DNA or
RNA molecule, such as a primer. In another particular example, a
nucleic acid molecule is a double stranded (ds) nucleic acid, such
as a target nucleic acid.
[0088] Nucleotide: The fundamental unit of nucleic acid molecules.
A nucleotide includes a nitrogen-containing base attached to a
pentose monosaccharide with one, two, or three phosphate groups
attached by ester linkages to the saccharide moiety.
[0089] The major nucleotides of DNA are deoxyadenosine
5'-triphosphate (dATP or A), deoxyguanosine 5'-triphosphate (dGTP
or G), deoxycytidine 5'-triphosphate (dCTP or C) and deoxythymidine
5'-triphosphate (dTTP or T). The major nucleotides of RNA are
adenosine 5'-triphosphate (ATP or A), guanosine 5'-triphosphate
(GTP or G), cytidine 5'-triphosphate (CTP or C) and uridine
5'-triphosphate (UTP or U).
[0090] Nucleotides include those nucleotides containing modified
bases, modified sugar moieties and modified phosphate backbones,
for example as described in U.S. Pat. No. 5,866,336 to Nazarenko et
al. (herein incorporated by reference).
[0091] Examples of modified base moieties which can be used to
modify nucleotides at any position on its structure include, but
are not limited to: 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthine, xanthine, acetylcytosine,
5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N-6-sopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine,
5-methylaminomethyluracil, methoxyarninomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil,
uracil-5-oxyacetic acid methylester, uracil-S-oxyacetic acid,
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and
2,6-diaminopurine.
[0092] Examples of modified sugar moieties which may be used to
modify nucleotides at any position on its structure include, but
are not limited to: arabinose, 2-fluoroarabinose, xylose, and
hexose, or a modified component of the phosphate backbone, such as
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, or a formacetal or analog thereof.
[0093] Ideally, such modifications allow for incorporation of the
nucleotide into a growing nucleic acid chain. That is, they do not
terminate nucleic acid synthesis.
[0094] The choice of nucleotide precursors is dependent on the
nucleic acid to be sequenced. If the template is a single-stranded
DNA molecule, deoxyribonucleotide precursors (dNTPs) are used in
the presence of a DNA-directed DNA polymerase. Alternatively,
ribonucleotide precursors (NTPs) are used in the presence of a
DNA-directed RNA polymerase. However, if the nucleic acid to be
sequenced is RNA, then dNTPs and an RNA-directed DNA polymerase are
used.
[0095] Primer. A short nucleic acid molecule, such as a DNA
oligonucleotide 9 nucleotides or more in length, which in some
examples is used to initiate the synthesis of a longer nucleic acid
sequence. Longer primers can be about 10, 12, 15, 20, 25, 30 or 50
nucleotides or more in length. Primers can be annealed to a
complementary target DNA strand by nucleic acid hybridization to
form a hybrid between the primer and the target DNA strand, and
then the primer extended along the target DNA strand by a DNA
polymerase enzyme. Primer pairs can be used for amplification of a
nucleic acid sequence, for example by PCR or other nucleic-acid
amplification methods.
[0096] The specificity of primer increases with its length. Thus,
for example, a primer that includes 30 consecutive nucleotides will
anneal to a target sequence with a higher specificity than a
corresponding primer of only 15 nucleotides. Thus, to obtain
greater specificity, probes and primers can be selected that
include at least 20, 25, 30, 35, 40, 45, 50 or more consecutive
nucleotides.
[0097] In one example, a primer includes a label.
[0098] Quantitating a nucleic acid molecule: Determining or
measuring a quantity (such as a relative quantity) of nucleic acid
molecule present, such as the number of amplicons or the number of
nucleic acid molecules present in a sample. In particular examples,
it is determining the relative amount or actual number of nucleic
acid molecules present in a sample.
[0099] Quenching of fluorescence: A reduction of fluorescence. For
example, quenching of a fluorophore's fluorescence on a universal
sequence (or tag or primer) occurs when a quencher molecule (such
as guanosine) is present in sufficient proximity to the fluorophore
that it reduces the fluorescence signal of the reporter molecule
during complimentary strand synthesis.
[0100] Real-time quantitative PCR: A method for detecting and
measuring products generated during each cycle of a PCR, which are
proportionate to the amount of template nucleic acid prior to the
start of PCR. The information obtained, such as an amplification
curve, can be used to quantitate the initial amounts of template
nucleic acid sequence.
[0101] Recombinant. A recombinant nucleic acid molecule is one that
has a sequence that is not naturally occurring or has a sequence
that is made by an artificial combination of two otherwise
separated segments of sequence. This artificial combination can be
accomplished, for example, by chemical synthesis or by the
artificial manipulation of isolated segments of nucleic acid
molecules, for example, by genetic engineering techniques.
[0102] Sample: Biological samples such as samples containing
nucleic acid molecules, such as genomic DNA, cDNA, RNA, mRNA, or
combinations thereof. Samples can be obtained from the cells of a
subject, such as those present in peripheral blood, urine, saliva,
tissue biopsy, surgical specimen, fine needle aspirates,
amniocentesis samples and autopsy material.
[0103] Sequence specific primer: A nucleic acid sequence that can
substantially hybridize with a target nucleic acid molecule, such
as under moderately stringent or highly stringent conditions. In
particular examples, such primers are at least nine nucleotides
long.
[0104] Signal: An indicator, such as a detectable physical quantity
from which information can be obtained. In one example, a label
emits a signal capable of detection, such as a fluorescent
signal.
[0105] Subject: Living multi-cellular vertebrate organisms,
including human and veterinary subjects, such as cows, pigs,
horses, dogs, cats, birds, reptiles, and fish.
[0106] Synthesis of a nucleic acid molecule: Building up a molecule
from its component parts, for example by replicating a nucleic acid
molecule. Examples include, but are not limited to, DNA synthesis
and RNA-dependent DNA synthesis using reverse transcriptase.
[0107] Target nucleic acid molecule: A nucleic acid molecule whose
detection, quantitation, qualitative detection, or a combination
thereof, is intended. The nucleic acid molecule need not be in a
purified form. Various other nucleic acid molecules can also be
present with the target nucleic acid molecule. For example, the
target nucleic acid molecule can be a specific nucleic acid
molecule in a cell (which can include host RNAs (such as mRNA) and
DNAs (such as genomic or cDNA), as well as other nucleic acid
molecules such as viral, bacterial or fungal nucleic acid
molecules), the amplification of which is intended. Purification or
isolation of the target nucleic acid molecule, if needed, can be
conducted by methods known to those in the art, such as by using a
commercially available purification kit or the like.
[0108] Universal sequence (or primer or tag): A sequence of
nucleotides that do not significantly hybridize to a target nucleic
acid molecule and includes a label on the second nucleotide from
the 5'-end. In a particular example, a universal tag does not
hybridize to a target nucleic acid sequence under moderately or
highly stringent conditions. Particular examples of universal tags
include, but are not limited to, the sequences shown in SEQ ID NOS:
1, 6, 7, 14, 18-22, and 31-32. In particular examples, universal
tags are at least 4 nucleotides in length, such as at least 5, at
least 6, at least 7, at least 8, at least 9, at least 10, at least
12, at least 15or even at least 20 nucleotides. In particular
examples, universal tags are 4-100 nucleotides, such as 4-80
nucleotides, 4-60 nucleotides, 5-60 nucleotides, or 5-50
nucleotides.
Nucleic Acid Molecules
[0109] Disclosed herein are universal nucleic acid molecules (also
referred to herein as universal primers or tags) that can be used
in nucleic acid amplification. Although particular universal
nucleic acid sequences are provided herein, the disclosure is not
limited to these specific examples. The universal tags include a
5'-end, a 3'-end, and a labeled nucleotide. The labeled nucleotide
is flanked on both sides by a nucleotide whose complement
nucleotides change a detectable signal from the label when the
universal tag hybridizes with its complementary nucleic acid
molecule. For example, the complementary nucleic acid sequence can
contain two or more nucleotides capable of increasing or decreasing
a detectable signal from the label in a predictable way. For
example, the label on the "T" in the universal sequence
5'-CTCCGGC-3' (SEQ ID NO: 1) is changed when the universal sequence
hybridizes to its complementary sequence 3'-GAGGCCG-5' (SEQ ID NO:
23). In particular examples, the universal tag can hybridize to its
complementary sequence under high stringency conditions. In other
examples the universal sequence is 100% complementary at the
labeled nucleotide (such as a "T") and its immediate 3' and 5'
nucleotides (such as "C" and "C" or C" and "G"). In particular
disclosed embodiments, the label on the universal sequence is
quenched by the complementary sequence, for example particularly
effectively quenched by the nucleotides that flank the labeled
nucleotide. For example, when the label is a fluorophore (such as
6-FAM) that can be quenched by the G's that hybridize to the C's at
the +1 and -1 positions from the labeled nucleotide, the presence
of the quenching complements flanking the labeled nucleotide has
been found to be particularly effective in quenching the
fluorescence signal from the label.
[0110] In particular examples, a universal tag includes the
sequence 5'-X.sub.1(n)X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein
X.sub.3 is the labeled nucleotide, wherein X.sub.2 and X.sub.4 are
the nucleotides flanking the labeled nucleotide. X.sub.1(n) and
X.sub.5(n) can be any number of nucleotides, such as zero
nucleotides, at least one nucleotide, at least two nucleotides, or
0-15 nucleotides. In particular examples, X.sub.1(n) is at least
one nucleotide, such as one or more nucleotides, such as 1-20
nucleotides, such as 1-5 nucleotides, and X.sub.5(n) is at least
two nucleotides, such as at least five nucleotides, at least 10
nucleotides, such as 2-20 nucleotides or 2-15 nucleotides. In other
examples, X.sub.1(n) is zero nucleotides, and X.sub.5(n) is at
least four nucleotides, such as at least five nucleotides, at least
10 nucleotides, or 4-25 nucleotides, such as 4-10 nucleotides.
[0111] The labeled nucleotide can be at any position in the
universal tag, as long as it is flanked on each side by at least
one nucleotide whose complement nucleotides change a detectable
signal from the label when the universal tag is hybridized with its
complementary nucleic acid sequence. In specific examples, the
labeled nucleotide in the universal tag is the second nucleotide
from the 5'-end. This position can also be referred to as the 0
position. For example, X.sub.2 is the nucleotide that is two
nucleotides from the 5' end (or the 0 position) in the universal
sequence 5'-X.sub.1X.sub.2X.sub.3X.sub.4X.sub.5-3'. Similarly, the
0 position of the universal sequences 5'-CTCCX.sub.(n) (SEQ ID NO:
18) and 5'-CTCGX.sub.(n) (SEQ ID NO: 19) is the "T". Although these
examples show the nucleotide containing the label is a thymidine,
other nucleotides (for example A, C, G, U, or modified nucleotides
such as inosine) can also be labeled using methods known in the
art. In particular examples, the labeled nucleotide is a thymidine.
In specific examples, the flanking nucleotides are "C", wherein
hybridization of the universal tag to the complement nucleotides
"G" change the detectable signal.
[0112] In a particular example where the labeled nucleotide in the
universal tag is the second nucleotide from the 5'-end, the
universal tag includes the sequence
5'-X.sub.2X.sub.3X.sub.4X.sub.5(n)-3', wherein X.sub.3 is the
labeled nucleotide, wherein X.sub.2 and X.sub.4 are the two
nucleotides flanking the labeled nucleotide, and wherein n is one
or more nucleotides, such as at least 2 nucleotides, at least four
nucleotides, at least five nucleotides, at least 10 nucleotides, at
least 15 nucleotides, such as 1-25 nucleotides, 4-25 nucleotides,
4-15 nucleotides, or 4-12 nucleotides. In particular examples,
X.sub.2 and X.sub.4 are "C". In some examples, X.sub.3 is "T". In
further examples, X.sub.3 is "T" and X.sub.2 and X.sub.4 are
"C".
[0113] In one example, a universal nucleic acid sequence includes
the sequence 5'-CTCSX.sub.(n)-3' (SEQ ID NO: 20), wherein X.sub.(n)
is any number of nucleotides, wherein S is G or C (for example C),
and wherein T is labeled. In particular examples, X.sub.(n) is 3-50
nucleotides, such as 3-20 nucleotides, or 3-11 nucleotides. In more
particular examples X.sub.(n) is at least 3 nucleotides, such as 3
nucleotides, such as no more than 50 nucleotides. In another
example, a universal nucleic acid sequence includes the sequence
5'-CTCSXXX-3' (SEQ ID NO: 21), wherein X is any nucleotide, wherein
S is G or C, and wherein T is labeled. For example, the universal
nucleic acid sequence can include the sequence 5'-CTCCGGC-3' (SEQ
ID NO: 14), as well as the sequences shown in SEQ ID NO: 1, 6, 7,
18, 19, or 22. wherein T is the labeled nucleotide. Another
exemplary universal tag includes the sequence
5'-CTCSXXX.sub.(n)-3.sup.1 (SEQ ID NO: 22), wherein a fluorophore
is attached to "T" and n is 0-11 nucleotides, such as 1-11
nucleotides, such as at least one nucleotide.
[0114] The change in the detectable signal from the label upon
hybridization of the universal tag with its complementary sequence
can be an increase or a decrease in the detectable signal, such as
an increase or decrease of at least 10%, such as at least 20%, at
least 50%, at least 75%, or at least 90%, as compared to a control,
such as an amount of signal when the universal tag is not
hybridized to its complementary sequence (for example when it is
unbound in solution). In examples in which the label is a
fluorescent label, the intensity of the fluorescence emitted by the
label changes in a predictable way (for example by decreasing or
dissipating when the universal sequence hybridizes to its
complementary sequence). In particular examples, the change in
signal is a decrease in fluorescence, such as a quenching of
fluorescence. For example, the fluorescence can decrease by at
least 10%, such as at least 20%, at least 50%, at least 75%, or at
least 90%, when the universal tag is hybridized to its
complementary sequence, as compared to a control, such as an amount
of fluorescence when the universal tag is not hybridized to its
complementary sequence.
[0115] In particular examples, when the universal tag hybridizes to
its complementary sequence, a guanosine (G) on the complementary
strand decreases the signal from the fluorophore, such as decrease
fluorescence of at least 10%, such as at least 50% or at least 90%.
Guanosine serves as an electron donor and therefore can be used to
quench a fluorophore.
[0116] In particular examples, the label is a fluorophore, such as
a fluorophore whose signal is increased or decreased in the
presence of a particular nucleotide or combination of nucleotides.
In a specific example, the fluorophore signal is decreased or
quenched in the presence of a nucleotide, such as a nucleotide with
fluorescent quenching abilities (such as G or isoG). In one
example, the fluorophore is one that is decreased in the presence
of G or isoG. The signal can be decreased by any detectable amount,
such as at least 10%, at least 30%, at least 50%, at least 90%, and
so on. Particular examples of fluorophores that can be used to
label a nucleotide in the universal tags of the present
application, include, but are not limited to, 6-FAM; 5-FAM; BODIPY;
TAMRA; acridine; stilbene; HEX; TET; ROX; Texas Red; JOE; Cy3; Cy5;
VIC; LC Red 640; LC Red 705; Yakima yellow; as well as derivatives
thereof.
[0117] The disclosed universal tags can be any length that permits
detection of a change in signal from the label on the tag, when the
universal tag hybridizes with its complementary sequence. In
particular examples, the universal nucleic acid sequence is at
least 4 nucleotides, at least 5 nucleotides, at least 7
nucleotides, at least 10 nucleotides, at least 11 nucleotides, at
least 12 nucleotides, at least 15 nucleotides, such as 4-25
nucleotides, 5-25 nucleotides, 7-25 nucleotides, 11-25 nucleotides,
15-25 nucleotides, 4-15 nucleotides, 5-15 nucleotides, or 7-15
nucleotides.
[0118] In particular examples the disclosed universal tags include
primarily "C" and "G" nucleotides. In some examples, at least 50%
of the nucleotides present in a universal tag can be "C" or "G"
nucleotides (that is, they have at least a 50% GC content), such as
at least 60%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at least 98% or even at least 99% GC content.
For example, the universal sequence 5'-CTCCGGC-3' (SEQ ID NO: 14)
has about an 86% GC content (6 of 7 nucleotides) and the universal
sequence 5'-C"T"CGGCCCGCCGAG-3' (SEQ ID NO: 6) has about an 87% GC
content (13 of 15 nucleotides). In addition, universal tags with GC
content of less than 50% can also be used (such as the universal
sequence 5'-C"T"CCATA; SEQ ID NO: 28).
[0119] The disclosed universal tags can be linked to a
sequence-specific primer sequence, thereby labeling the
sequence-specific primer sequence. For example, the 3'-end of the
universal tag can be ligated to the 5'-end of a forward or a
reverse sequence-specific primer. The labeled sequence-specific
primer can then be used in an amplification reaction, such as an
RT-PCR reaction. The sequence-specific primer can recognize a
target nucleic acid of interest, such as a pathogen nucleic acid
sequence, for example a viral, fungal, bacterial, or parasitic DNA
or RNA sequence. In another example, a target nucleic acid
sequence, such as a DNA or RNA sequence, is a nucleic acid sequence
whose expression is altered in response to a disease, such as
cancer. The sequence-specific primer can be any length that permits
amplification of the desired nucleic acid molecule. In particular
examples, a sequence-specific primer is at least six nucleotides,
such as at least 9, at least 10, at least 12, at least 15, at least
20, at least 25, at least 30, at least 35, at least 40 or even at
least 50 nucleotides.
Methods of Nucleic Acid Amplification
[0120] The disclosed universal tags can be used in any nucleic acid
amplification reaction to determine whether a particular target
nucleic acid sequence is present, such as a DNA or RNA molecule.
For example, methods are disclosed for detecting a target nucleic
acid molecule. In particular examples, the method includes
incubating a sample containing nucleic acids with a universal tag
linked to a forward or a reverse target sequence specific primer,
and with a corresponding forward or reverse target sequence
specific primer not containing the universal tag. In other
examples, both the forward and the reverse target sequence contain
a universal tag. As described above, the 3'-end of the universal
primer can be ligated to the 5'-end of the sequence specific
primer.
[0121] The sample and labeled forward and a reverse primer not
containing the universal tag, or a forward primer not containing
the universal tag and a labeled reverse primer, are incubated under
conditions sufficient to permit amplification of the target nucleic
acid. For example, the reaction can include dNTPs, a polymerase,
and MgCl.sub.2.
[0122] Any primer extension amplification method can be used.
Particular examples include, but are not limited to: real-time PCR
(for example see Mackay, Clin. Microbiol. Infect. 10(3):190-212,
2004), Strand Displacement Amplification (SDA) (for example see
Jolley and Nasir, Comb. Chem. High Throughput Screen. 6(3):235-44,
2003), self-sustained sequence replication reaction (3 SR) (for
example see Mueller et al., Histochem. Cell. Biol. 108(4-5):431-7,
1997), ligase chain reaction (LCR) (for example see Laffler et al.,
Ann. Biol. Clin. (Paris).51(9):821-6, 1993), transcription mediated
amplification (TMA) (for example see Prince et al., J. Viral Hepat.
11(3):236-42, 2004), or nucleic acid sequence based amplification
(NASBA) (for example see Romano et al., Clin. Lab. Med.
16(1):89-103, 1996). For example, NASBA can be performed using the
universal tags disclosed herein by substituting one NASBA primer
with a universal tag while the other primer contains the RNA
polymerase promoter. The promoter sequence, located on the 5' tail
of the second primer, generates RNA copies complementary to the
universal tag. This sequence will hybridize to the universal tag
and RNA transcriptase will extend the universal tag extension
product. This universal tag RNA is degraded by RNase H, releasing
the fluorescence (similar to hydrolysis of TaqMan probes). As the
production of more RNA proceeds, this process will increase of the
fluorescence signal due to the activity of RNase H.
[0123] A change in detectable signal from the label on the
universal tag is monitored, wherein a change in signal indicates
the presence of the target nucleic acid sequence, and wherein no
significant change in signal indicates that the target nucleic acid
molecule is not present in the sample. The change in signal can be
compared to a signal present earlier, such as prior to nucleic acid
amplification. The detectable signal changes in a predictable
manner that permits determination of whether or not a target
nucleic acid sequence is present in a sample, and in some examples,
quantitation of an amount of target nucleic acid sequence is
present in a sample. For example, when the label is a fluorophore
that can be quenched by guanosine, and the two flanking nucleotides
are "C", the "Gs" present on the complementary strand will quench
the fluorophore in a predictable manner, wherein a reduction in
fluorescent signal during nucleic acid amplification indicates that
the target nucleic acid sequence is present in a sample, while no
substantial reduction in fluorescent signal during nucleic acid
amplification indicates that the target nucleic acid sequence is
not present in a sample.
[0124] In some examples, the change in signal is monitored during
the amplification reaction, for example in real time as the
amplicons are formed. For example, the label present on the
universal tag will generate a significant signal or not, when the
primers are freely floating in the nucleic acid amplification
reaction mixture. During nucleic acid amplification, when
polymerase creates nucleic acid amplicons, the primer, including
the labeled universal tag, is incorporated into the amplicon. The
signal from the label will increase or decrease due to its
incorporation into the double-stranded amplicon molecule. As more
amplicons are produced during nucleic acid amplification, the
overall signal of the reaction mixture will increase or decrease.
The change in signal can be monitored using any commercially
available system. This change in signal permits detection of a
target nucleic acid sequence in the reaction.
[0125] In one example where the label is a fluorophore, the change
in signal monitored during the amplification reaction is a decrease
in fluorescence. The fluorescence of the dye is only slightly
quenched (or not quenched at all) when the primers are freely
floating in the nucleic acid amplification reaction mixture. During
nucleic acid amplification, when polymerase creates nucleic acid
amplicons, the primer, including the fluorescently labeled
universal tag, is incorporated into the amplicon. The fluorescence
of the incorporated primer decreases several fold due to quenching
of the dye signal by its incorporation into the double-stranded
amplicon molecule and proximity to guanosine (or other quenching
molecule, such as isoG) on the complementary strand. As more
amplicons are produced during nucleic acid amplification, the
overall fluorescence of the reaction mixture decreases. The
decrease in fluorescence can be measured and observed, for example
by using a commercially available nucleic acid amplification system
capable of measuring fluorescence (such as real-time PCR
thermocyclers). A decrease in fluorescent signal indicates the
presence of a target nucleic acid sequence in the reaction.
[0126] In other or additional examples, the change in signal is
monitored after the amplification, for example by exposing the
resulting amplicons to a melting procedure to denature the
double-stranded amplicons. During the denaturation, a change in
signal is detected. The resulting signal peaks, such as
fluorescence peaks, can differentiate polymorphisms in the nucleic
acid amplicons. Therefore, melting curve analysis can be used to
confirm the presence of a target nucleic acid sequence, and can
also be used to distinguish polymorphisms in amplicons.
[0127] In other examples, the change in signal that is monitored
during the amplification reaction is an increase in fluorescence.
In this example, the probe includes a stem and loop structure,
wherein the stem represents the non-target nucleic acid sequence
(which contains a single internal fluorescent label that remains
quenched with its complimentary stem part). However, during
target-dependent synthesis, a complimentary strand is synthesized
and the probe hybridizes to the amplicon.
[0128] In other examples, the probe oligonucleotides are structured
such that the fluorophore is quenched by another quenching
fluorophore and emits fluorescence upon oligonucleotide probe
hybridization to a target nucleic acid. Examples of these types of
probe structures include: Scorpion probes (for example see
Whitcombe et al., Nature Biotech. 17:804-7, 1999; U.S. Pat. No.
6,326,145, the disclosure of which is herein incorporated by
reference), Sunrise probes (for example see Nazarenko et al., Nuc.
Acids Res. 25:2516-21, 1997; U.S. Pat. No. 6,117,635, the
disclosure of which is herein incorporated by reference), and
Molecular Beacons (Tyagi et al., Nature Biotech. 14:303-8, 1996;
U.S. Pat. No. 5,989,823, the disclosure of which is incorporated
herein by reference). In many of these probe structures, the stem
part is not internally labeled with 6-carboxyfluorescein and uses
an additional quenching fluorophore in the complimentary stem
portion.
[0129] In other or additional examples, the change in signal
monitored during the amplification reaction is an increase in
fluorescence. In this example, the universal primer remains
single-stranded in the absence of the target nucleic acid molecule,
and is not acted upon by a restriction endonuclease, such as BstI.
However, during target-dependent synthesis, a complementary strand
is synthesized and becomes nickable by the restriction
endonuclease. The cleavage cuts the fluorescent-labeled primer,
thereby separating it from the complimentary quencher, such as
guanosine. This results in an increase in fluorescence signal.
[0130] Methods of detecting a target nucleic acid molecule
following nucleic acid amplification are provided. The methods
include incubating a sample containing or thought to contain the
target nucleic acid molecule with a forward primer and a reverse
primer that are specific for the target nucleic acid molecule.
Either the forward primer or the reverse primer is linked at its 5'
end to the 3' end of a universal tag, under conditions sufficient
to allow amplification of the target nucleic acid molecule (such as
real-time PCR conditions). However, in some examples, both the
forward and the reverse primer are linked at their 5' ends to the
3' end of a universal tag. The amplification results in the
generation of a labeled amplicon. The amplicon is exposed to
conditions that permit denaturation of the amplicon into single
strand nucleic acid molecules, and then exposed to conditions that
permit rehybridization of the strands. During the annealing step,
the universal primer is incorporated into a double stranded nucleic
acid molecule, incorporating quencher nucleotides (such as Gs) in a
region complimentary to the label on the universal tag sequence.
This results in a change in detectable signal, for example relative
to the detectable signal from the label before the formation of
double stranded DNA. A change in signal indicates that the target
nucleic acid molecule is present in the sample, and no significant
change in signal indicates that the target nucleic acid molecule is
not present in the sample.
[0131] In addition to determining whether a particular target
nucleic acid molecule is present, the method can further include
quantifying the target nucleic acid molecule. In one example
quantitation includes comparing a signal to an amount of signal
from a known amount of nucleic acid.
[0132] Samples containing nucleic acid molecules can be obtained
from any appropriate specimen, for instance blood or
blood-fractions (such as serum). Techniques for acquisition of such
samples are well known in the art (for example see Schluger et al.
J. Exp. Med. 176:1327-33, 1992, for the collection of serum
samples). Serum or other blood fractions can be prepared in the
conventional manner. For example, about 200 .mu.L of serum can be
used for the extraction of DNA for use in amplification
reactions.
[0133] Once a sample has been obtained, the sample can be used
directly, concentrated (for example by centrifugation or
filtration), purified, or combinations thereof. In one example, DNA
is prepared from the sample, yielding a nucleotide preparation that
is accessible to, and amenable to, nucleic acid amplification.
Similarly, RNA can be prepared using a commercially available kit
(such as the RNeasy Mini Kit, Qiagen, Valencia, Calif.).
Kits
[0134] The present disclosure provides kits that include one or
more disclosed universal tags. The kits can further include ligase,
to permit ligation of the universal tag to the 5'-end of a forward
or a reverse target sequence-specific primer.
[0135] In some examples, the kit also includes one or more forward
or reverse target sequence-specific primers, such as forward and
reverse primers that recognize a specific pathogen or a specific
nucleic acid sequence whose expression is changed in response to a
disorder. For example, the kit can include forward and reverse
primers that can be used to amplify the nucleic acid sequence of a
particular pathogen, such as a viral, bacterial, parasitic, or
fungal target nucleic acid sequence. In one example, the forward
and reverse primers can be used to amplify a particular human
nucleic acid sequence, such target nucleic acid sequence associated
with a disease, such as cancer. In particular examples, forward and
reverse primers hybridize to a target sequence under highly
stringent hybridization conditions. In some examples, the universal
tag in the kit is already attached to the 5'-end of the forward or
reverse primer. In other examples, the universal tag in the kit is
separate from the forward or reverse primer, and can be ligated to
the forward or reverse primer by a user.
Arrays
[0136] The present disclosure provides arrays that include one or
more of the disclosed universal tags. Such arrays can be used to
detect the presence or absence of one or more target nucleic acid
sequences, or to detect a change in expression of one or more
target nucleic acid sequences.
[0137] Such arrays can include nucleic acid molecules, such as DNA
or RNA molecules. The nucleic acid sequences attached to the array
can be directly linked to the support. Alternatively, the nucleic
acid sequences can be attached to the support by other nucleotide
sequences, such as sequences or other molecules that serve as
spacers or linkers to the solid support. The length of each nucleic
acid molecule attached to an array can be selected to optimize
binding of target nucleic acid sequences. An optimum length for use
with a particular nucleic acid sequence can be determined
empirically. In one example, nucleic acid molecules attached to an
array are at least 15 nucleotides, such as at least 20 nucleotides,
such as from about 20 to about 35 nucleotides in length or about 25
to about 40 nucleotides in length. The nucleic acid molecules can
be bound to a support by either the 3' end of the nucleic acid
molecule or by the 5' end of the nucleic acid molecules. In
general, the internal complementarity of an oligonucleotide probe
in the region of the 3' end and the 5' end determines binding to
the support.
[0138] In one example, the amino group of one or more target
nucleic acid sequences, such as a nucleic acid sequence found in a
pathogen or associated with a particular disease, is attached via
its 5' end to the surface of a solid support. Ideally, such target
nucleic acid sequences can hybridize to an amplicon containing a
universal tag. The array can also include one or more control
nucleic acid sequences (such as a housekeeping gene) attached to
the surface of a solid support.
[0139] The methods and apparatus in accordance with the present
disclosure takes advantage of the fact that under appropriate
conditions nucleic acid molecules attached to an array can form
base-paired duplexes with nucleic acid molecules exposed to the
array that have a complementary base sequence. The stability of the
duplex is dependent on a number of factors, including the length of
the nucleic acid molecules attached to an array, the base
composition, and the composition of the solution in which
hybridization is effected. The effects of base composition on
duplex stability can be reduced by carrying out the hybridization
in particular solutions, for example in the presence of high
concentrations of tertiary or quaternary amines.
[0140] The thermal stability of the duplex is also dependent on the
degree of sequence similarity between the sequences attached to the
array and the sequences incubated with the array. By carrying out
the hybridization at temperatures close to the expected T.sub.m's
of the type of duplexes expected to be formed between the target
sequences and the oligonucleotides bound to the array, the rate of
formation of mismatched duplexes can be reduced.
[0141] The solid support can be formed from an organic polymer.
Suitable materials for the solid support include, but are not
limited to: polypropylene, polyethylene, polybutylene,
polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine,
polytetrafluroethylene, polyvinylidene difluroide,
polyfluoroethylene-propylene, polyethylenevinyl alcohol,
polymethylpentene, polycholorotrifluoroethylene, polysulfomes,
hydroxylated biaxially oriented polypropylene, aminated biaxially
oriented polypropylene, thiolated biaxially oriented polypropylene,
etyleneacrylic acid, thylene methacrylic acid, and blends of
copolymers thereof (see U.S. Pat. No. 5,985,567, herein
incorporated by reference).
[0142] In general, suitable characteristics of the material that
can be used to form the solid support surface include: being
amenable to surface activation such that upon activation, the
surface of the support is capable of covalently attaching a
biomolecule such as a nucleic acid sequence thereto; amenability to
"in situ" synthesis of biomolecules; being chemically inert such
that at the areas on the support not occupied by nucleic acid
sequences are not amenable to non-specific binding, or when
non-specific binding occurs, such materials can be readily removed
from the surface without removing the nucleic acid sequences.
[0143] In one example, the solid support surface is polypropylene.
Polypropylene is chemically inert and hydrophobic. Non-specific
binding is generally avoidable, and detection sensitivity is
improved. Polypropylene has good chemical resistance to a variety
of organic acids (such as formic acid), organic agents (such as
acetone or ethanol), bases (such as sodium hydroxide), salts (such
as sodium chloride), oxidizing agents (such as peracetic acid), and
mineral acids (such as hydrochloric acid). Polypropylene also
provides a low fluorescence background, which minimizes background
interference and increases the sensitivity of the signal of
interest.
[0144] In another example, a surface activated organic polymer is
used as the solid support surface. One example of a surface
activated organic polymer is a polypropylene material aminated via
radio frequency plasma discharge. Such materials are easily
utilized for the attachment of nucleotide molecules. The amine
groups on the activated organic polymers are reactive with
nucleotide molecules such that the nucleotide molecules can be
bound to the polymers. Other reactive groups can also be used, such
as carboxylated, hydroxylated, thiolated, or active ester
groups.
[0145] A wide variety of array formats can be employed in
accordance with the present disclosure. One example includes a
linear array of nucleic acid sequence bands, generally referred to
in the art as a dipstick. Another suitable format includes a
two-dimensional pattern of discrete cells (such as 4096 squares in
a 64 by 64 array). As is appreciated by those skilled in the art,
other array formats including, but not limited to slot
(rectangular) and circular arrays are equally suitable for use (see
U.S. Pat. No. 5,981,185, herein incorporated by reference). In one
example, the array is formed on a polymer medium, which is a
thread, membrane or film. An example of an organic polymer medium
is a polypropylene sheet having a thickness on the order of about 1
mil. (0.001 inch) to about 20 mil., although the thickness of the
film is not critical and can be varied over a fairly broad range.
Biaxially oriented polypropylene (BOPP) films can also be used, for
example to reduce background fluorescence.
[0146] The array formats of the present disclosure can be included
in a variety of different types of formats. A "format" includes any
format to which the solid support can be affixed, such as
microtiter plates, test tubes, inorganic sheets, dipsticks, and so
forth. For example, when the solid support is a polypropylene
thread, one or more polypropylene threads can be affixed to a
plastic dipstick-type device; polypropylene membranes can be
affixed to glass slides. The particular format is, in and of
itself, unimportant. All that is needed is a solid support to which
nucleic acid molecules can be affixed thereto without affecting the
functional behavior of the solid support or any nucleic acid
molecule absorbed thereon, and that the format (such as the
dipstick or slide) is stable to any materials into which the device
is introduced (such as clinical samples and hybridization
solutions).
[0147] Arrays can be prepared by a variety of approaches. In one
example, nucleic acid sequences are synthesized separately and then
attached to a solid support (see U.S. Pat. No. 6,013,789, herein
incorporated by reference). In another example, nucleic acid
sequences are synthesized directly onto the support to provide the
desired array (see U.S. Pat. No. 5,554,501, herein incorporated by
reference). Suitable methods for covalently coupling nucleic acid
sequences (such as oligonucleotides) to a solid support and for
directly synthesizing nucleic acid sequences onto the support are
known to those in the art (for example see Matson et al., Anal.
Biochem. 217:306-10, 1994). In one example, nucleic acid sequences
are synthesized onto the support using conventional chemical
techniques for preparing nucleic acid sequences on solid supports
(such as see PCT applications WO 85/01051 and WO 89/10977, or U.S.
Pat. No. 5,554,501, herein incorporated by reference).
Detection of Nucleic Acid Molecules
[0148] The presence of a target nucleic acid in a sample can be
determined. In addition, changes in expression of one or more
target nucleic acids can also be determined. The present disclosure
is not limited to particular methods of detection. Any method of
detecting a nucleic acid molecule can be used, such as physical or
functional assays.
[0149] In one example, the disclosed method includes amplifying a
target nucleic acid molecule using the universal tags disclosed.
For example, a target nucleic acid molecule can be amplified using
a forward primer containing a universal tag, and a reverse primer
containing a label, such as a fluorophore, such as Cy5 or Cy3, for
example using the methods described above. Methods for labeling
nucleic acid molecules such as primers are well known. If the
target nucleic acid molecule is present, a labeled amplicon
containing the label from the forward and reverse primers will be
generated. In a particular example, labeled forward and labeled
reverse primers are used to amplify a target nucleic acid sequence
obtained from a subject, such as a subject having or suspected of
having an infection or a disease. Those skilled in the art will
appreciate that amplification can directly be performed on an
array, for example by using a universal primer attached to the
array. The anchored universal primer permits simultaneous capture,
amplification and detection when the microarray is incubated with
sample nucleic acid molecules (such as DNA or RNA) and the
appropriate primer (for example see U.S. Pat. No. 6,531,302, herein
incorporated by reference).
[0150] The resulting labeled amplicon can be incubated with an
array containing target nucleic acid molecules attached thereto
under conditions that permit hybridization of the amplicon with the
target nucleic acid molecules on the array. In one example, a
pre-treatment solution of organic compounds, solutions that include
organic compounds, or hot water, can be applied before
hybridization (see U.S. Pat. No. 5,985,567, herein incorporated by
reference). Hybridization conditions for a given combination of
nucleic acid molecules can be optimized routinely in an empirical
manner close to the T.sub.m of the expected duplexes, thereby
increasing sensitivity of the method. Identification of the
location in the array, such as a cell, in which binding occurs,
permits a rapid and accurate identification of target nucleic acid
sequences present in the amplified material. Detection of the
signal from the amplicon on the array indicates that the target
nucleic acid sequence is present in the sample, and can be used to
confirm results obtained during the amplification reaction. In
contrast, when no significant increase is detected, this indicates
that the target nucleic acid molecule is not present in the
sample.
[0151] Detecting a hybridized complex on an array has been
previously described (see U.S. Pat. No. 5,985,567, herein
incorporated by reference). In one example, detection includes
detecting one or more labels present on the amplicon hybridized to
the target nucleic acid molecule. In particular examples, the
method further includes quantification, for instance by determining
the amount of hybridization, for example relative to a control
(such as a known amount of nucleic acid molecule).
EXAMPLE 1
Comparison to TaqMan.RTM. Assay
[0152] This example describes methods used to compare the
TaqMan.RTM. assay to the method of the present disclosure which
uses the disclosed universal primers. Adenovirus 40 was used as a
model system; however one skilled in the art will appreciate that
similar methods can be used to amplify any target nucleic acid
molecule of interest using the disclosed universal nucleic acid
molecules.
[0153] The primers were prepared as follows. The universal sequence
5'-C"T"CCGGC-3' (SEQ ID NO: 1) (a universal primer that does not
specifically bind to a target sequence, such as adenovirus
sequences.) was synthesized and attached to the 5'-end of an
adenovirus-specific primer as follows. "T" refers to the position
where 6-carboxyfluorescein was incorporated. Fluorescent
oligodeoxyribonucleotides were synthesized on a Biosystems DNA
synthesizer through the direct incorporation of the
C5-fluorescein-dT phosphoramidite to the "T". The modified forward
primer 5'-C"T"C CGG C GGA CGC CTC GGA GTA CCT GAG (AdJVF; SEQ ID
NO: 2) which includes the labeled hairpin oligonucleotide (SEQ ID
NO: 1), and reverse primer 5'-AC IGT GGG GTT TCT GAA CTT GTT
(AdJVR; SEQ ID NO: 3) were designed to amplify the hexon protein
region to a 96-bp fragment to specifically detect adenovirus
species. The oligonucleotides were synthesized and used without
further purification.
[0154] The real-time PCR assay was performed using the
QuantiTect.TM. Probe PCR kit (Qiagen, USA) and a R.A.P.I.D. System
real-time PCR thermal cycler (Idaho Technology, Salt Lake City,
Utah). Amplification reactions contained 2 .mu.L template DNA, 0.25
mM primers (SEQ ID NOS: 2 and 3), in a final reaction volume of 20
.mu.L. The protocol took approximately 90 minutes to complete with
the following PCR conditions: hot-start denaturation step at
95.degree. C. for 15 minutes, followed by 45 cycles with a
95.degree. C. denaturation for 10 seconds, 55.degree. C. annealing
for 45 seconds and 72.degree. C. elongation for 15 seconds.
Following the amplification, a melting curve was acquired by
heating the product at 20.degree. C./second to 95.degree. C.,
cooling it at 20.degree. C./second to 45.degree. C., keeping it at
45.degree. C. for 20 seconds, and then slowly heating it at 0.
1.degree. C./second to 95.degree. C. Fluorescence signal (F) was
measured through the slow heating phase (T). During melting curve
analysis, the fluorescence increases upon separation of the PCR
product strands, with a maximum peak at the characteristic T.sub.m
of the product (FIG. 9A). As the software for all
commercially-available real-time PCR systems visualizes melting
curve data using the negative derivative of fluorescence over
change in temperature versus temperature (-dF/dT vs. T), the
melting curve data generated when using the exemplary universal
primer is shown as a "dip" at the characteristic T.sub.m of the
product (FIG. 9B). All amplifications reactions were carried out in
duplicate. Amplicons were visualized by agarose gel electrophoresis
and ethidium bromide staining to confirm the specificity of PCR
products.
[0155] As shown in FIGS. 1A and 1B, use of these primers to amplify
an Adenovirus sequence results in the addition of a 3'-GAGGCCG-5'
(SEQ ID NO: 23) sequence to the amplified sequence. This sequence
is the reverse complement of the universal primer sequence, and
will reduce the fluorescence of the fluorophore on the "T" of the
universal primer when the two strands hybridize. This reduction of
fluorescence can be monitored, wherein the presence of reduced
fluorescence indicates that the target sequence of interest (here
the gene for adenovirus hexon protein) is present.
[0156] The sensitivity of the TaqMan.RTM. assay for adenovirus 40
(AdV40) was determined using genomic equivalent (GE) copies.
Specified regions of the genome were amplified and cloned, and the
plasmids used as GE copies. Amplification of the hexon region of
AdV40 was carried out with the forward primer
5'-TGGCCACCCCCTCGATGA-3' (position #2-19; SEQ ID NO: 4) and reverse
primer 5'-TTTGGGGGCCAGGGAGTTGTA-3' (position #381-361; SEQ ID NO:
5) of GenBank Accession No. X.sub.51782. The PCR products were
cloned into a pDrive cloning vector using a Qiagen PCR
Cloning.sup.plus Kit (Qiagen, Valencia, Calif.). DNA sequences of
the cloned products were determined with the BigDye terminator
cycle sequence kit and ABI 377A sequencer (Applied Biosystems).
Plasmids were purified using the Nucleobond 100 kit (Promega).
[0157] As shown in FIG. 2A, a comparison of using the TaqMan.RTM.
assay to amplification using the disclosed universal primers
demonstrates that both assays produce similar crossing thresholds
over 5 log.sub.10 dilutions (50 000, 5000, 500, 50 and 5 GE copies
per reaction). In addition, comparison of the TaqMan.RTM. assay
with the universal primer shows that quantitation can be performed
because the quenching rate corresponds to the initial starting copy
numbers of the template DNA. As shown in FIG. 2B, the universal
primer permits detection at as low as 5 copies of a nucleic acid
molecule per reaction.
[0158] The quantitative TaqMan.RTM. assay, currently the "gold
standard" for real-time PCR, was used to determine the sensitivity
of detection for AdV40. The quantitative assay presented in FIG. 2C
shows the detection limit of AdV40 to five GE copies. This same
level of sensitivity was achieved using the disclosed universal
primers. Therefore, the disclosed methods and universal primers
provide the same detection sensitivity of the TaqMan.RTM.
assay.
[0159] The unknown concentration of a nucleic acid molecule can be
quantified through a quantitative analysis of the method using a
10-fold serial dilution of a known amount of initial DNA template
sample (FIG. 3A) and corresponding the quenching rate at each cycle
can be calculated. No fluorescence decline in the negative samples
were observed even after 45 cycles (FIG. 3A) and negative samples
showed no peak in melting curve analysis (FIG. 3B).
[0160] Those skilled in the art will understand that the amount of
target nucleic acid present can be quantitated, for example using
software that calculates crossing points similar to the
fluorescence increase. It is also possible to quantitate an amount
of target nucleic acid present, for example by calculating the
crossing points and fluorescence followed by regression analysis to
determine the quantity.
EXAMPLE 2
Comparison of Universal Tags to Primers Labeled at the Terminal
5'-End
[0161] This example describes methods used to compare the effects
of using a primer labeled at its very 5'-end, to the disclosed
universal primers. The protozoan parasite, Cryptosporidium parvum,
was used as a model system; however one skilled in the art will
appreciate that similar methods can be used to amplify any target
nucleic acid molecule of interest using the disclosed universal
nucleic acid molecules.
[0162] The primers were prepared as follows. The universal sequence
5'-C"T"CCGGC-3' (SEQ ID NO: 1) (a universal primer that does not
specifically bind to a target sequence, such as Cryptosporidium
sequences) was synthesized and attached to the 5'-end of a
Cryptosporidium-specific primer as described in Example 1. The
modified forward primer which includes SEQ ID NO: 1
(5'-C"T"CCGGCATGACGGGTAACGGGGAAT, SEQ ID NO: 10) and the reverse
primer (5'-CCAATTACAAAACCAAAAAGTCC-3'; SEQ ID NO: 13) were designed
to amplify the conserved partial sequence of the 18S ribosomal RNA
to a 159-bp fragment to specifically detect Cryptosporidium
species. The oligonucleotides were synthesized and used without
further purification.
[0163] The real-time PCR assay was performed using SEQ ID NOS: 10
and 13 using the methods described in Example 1. Following the
amplification, a melting curve was acquired using the methods
described in Example 1.
[0164] Use of SEQ ID NO: 10 to amplify Cryptosporidium sequence
results in the addition of a 3'-GAGGCCG-5' (SEQ ID NO: 23) sequence
to the amplified sequence. This sequence is the reverse complement
of the universal primer sequence, and will reduce the fluorescence
of the fluorophore on the "T" of the universal primer when the two
strands hybridize. This reduction of fluorescence can be monitored,
wherein the presence of reduced fluorescence indicates that the
target sequence of interest (here the Cryptosporidium 18S sequence)
is present.
[0165] The results obtained using the disclosed universal primer
were compared to use of a sequence-specific forward primer directly
labeled on its 5' nucleotide using the same amount of DNA.
Amplification of the 18S region of Cryptosporidium was performed
with the forward primer 5'-"C"ATGACGGGTAACGGGGAAT-3' (SEQ ID NO:
24) wherein the "C" included a fluorophore, and reverse primer (SEQ
ID NO: 10) was performed as described in Example 1.
[0166] As shown in FIG. 4A, a comparison of using the 5'-end
fluorescent labeling primer to amplification using the disclosed
universal primers demonstrates that the universal primer results in
quenching that corresponds to the same crossing point as observed
for the TaqMan.RTM. assay. However, the fluorescent primer labeled
at the very terminal 5'-end (SEQ ID NO: 24) produced no detectable
signal during amplification (FIG. 4A) or during melting curve
analysis (FIG. 4B) that indicated the presence of the target
sequence.
EXAMPLE 3
Amplification of Pathogen Sequences Using CTCGX.sub.(10)
[0167] This example describes methods using the disclosed universal
primers to amplify and detect pathogens. Although this example
describes amplification of adenovirus sequences using another
exemplary universal tag with the sequence 5'-C"T"CGGCCCGCCGAG-3'
(SEQ ID NO: 6), the disclosed methods and universal primers can be
used to amplify any nucleic acid molecule of interest.
[0168] The primers shown in Table 1 were generated as described in
Example 1. The "T" two nucleotides from the 5'-end of the primer
(shown in quotation marks in Table 1) was labeled with 6-carboxy
fluorescein as described in Example 1. TABLE-US-00001 TABLE 1
Forward primers including a universal primer CTCGX.sub.(10).
Microbe Forward primer (SEQ ID NO:)* Reverse primer (SEQ ID NO:)
Adenovirus c"t"cggcccgccgagGACGCCTCGGA 5'-ACIGTGGGGTTTCTGAACTTGTT
GTACCTGAG (5) (3) Norovirus c"t"cggcccgccgagTGAGCACTTCT
GCCTCAAACAGAACGCTACCTGT ACCAAGAAGCAGC (7) (8) *Universal primer
sequence shown in lowercase; sequence-specific primer shown in
uppercase. "t" includes 6-carboxy fluorescein.
[0169] The adenovirus hexon protein region sequence was amplified
using PCR with SEQ ID NOS: 5 and 3 as follows. The real-time PCR
assay and melting curve analysis was performed as described in
Example 1.
[0170] As shown in FIG. 5, as the concentration of the plasmid
copies increase, the quenching of the fluorescence signal occurs at
progressively earlier PCR cycles, and is directly proportional to
the copy numbers. The detection limit shown (8 copies of adenovirus
DNA) demonstrates the sensitivity of the assay using the disclosed
universal primers.
EXAMPLE 4
Amplification of Pathogenic Sequences using CTCCX.sub.(0-11)
[0171] This example describes methods used to amplify a C. parvum
18S rRNA gene sequence using exemplary universal tags with the
sequence 5'-C"T"CCX.sub.(0-11) (SEQ ID NO: 7) attached to the
5'-end of an appropriate target sequence-specific primer.
[0172] The primers shown in Table 2 were generated as described in
Example 1. The "T" two nucleotides from the 5'-end of the primer
(shown in quotation marks in Table 2) was labeled with 6-carboxy
fluorescein as described in Example 1. TABLE-US-00002 TABLE 2
Various Universal tag lengths (CTCCX; X = 0-11 bp)* Reaction
Forward primer (SEQ ID NO:) Universal Tag Length 1
5'-c"t"ccggcccgccgagATGACGGGTAACGGGGAAT (8) 15 mer 2
5'-c"t"ccggcccgcATGACGGGTAACGGGGAAT (9) 11 mer 3
5'-c"t"ccggcATGACGGGTAACGGGGAAT (10) 7 mer 4
5'-c"t"ccgATGACGGGTAACGGGGAAT (11) 5 mer 5
5'-c"t"ccATGACGGGTAACGGGGAAT (12) 4 mer *The reverse primer for all
reactions was 5'-CCAATTACAAAACCAAAAAGTCC. (SEQ ID NO:13) *Universal
primer sequence shown in lowercase; sequence-specific primer shown
in uppercase. "t" includes 6-carboxy fluorescein.
[0173] The C. parvum 18S sequence was amplified using real-time
PCR, and a melting curve obtained, as described in Example 1.
[0174] As shown in FIG. 6A, different universal tag lengths
resulted in different rates of quenching; however all worked.
Therefore, the rate of fluorescence quenching can be controlled by
varying the length of the universal tag. The melting curve analysis
of the product produced in these reactions is shown in FIG. 6B.
EXAMPLE 5
Amplification of Pathogen Sequences using CTCCGGC
[0175] This example describes methods used to amplify AdV40,
Salmonella choleraesuis serovar Typhimurium (S. typhimurium), C.
parvum, and Hepatitis E Virus sequences using an exemplary 7-mer
universal tag with the sequence 5'-C"T"CCGGC-3' (SEQ ID NO: 14),
attached to the 5'-end of an appropriate sequence-specific
primer.
[0176] The primers shown in Table 3 were generated as described in
Example 1. The "T" two nucleotides from the 5'-end of the primer
(shown in quotation marks in Table 3) was labeled with 6-carboxy
fluorescein as described in Example 1. TABLE-US-00003 TABLE 3
Seven-mer UniFluor tag (CTCCXXX)* Forward primer Reverse primer
Microbe (SEQ ID NO:) (SEQ ID NO:) Adenovirus
c"t"ccggcGGACGCCTCGGAGTAC ACIGTGGGGTTTCTGAACTT CTGAG (15) GTT (3)
Salmonella c"t"ccggcGCCTTTCTCCATCGTCC TGGTGTTATCTGCCTGACC TGA (16)
(17) Ctyptosporidium c"t"ccggcAT GAC GGG TAA CGG
CCAATTACAAAACCAAAAA GGAAT(10) GTCC (13) Hepatitis E Virus
c"t"ccggcGGTGGTTTCTGGGGTG AGGGGTTGGTTGGATGAA AC (26) (27)
*Universal primer sequence shown in lowercase; sequence-specific
primer shown in uppercase. "t" includes 6-carboxy fluorescein.
[0177] The adenovirus hexon protein region sequence was amplified
using real-time PCR using SEQ ID NOS: 15 and 3, the S. typhimurium
fimA sequence was amplified using PCR using SEQ ID NOS: 16 and 17,
and the C. parvum 18S sequence was amplified by PCR using SEQ ID
NOS: 10 and 13, using the methods described in Example 1.
[0178] Hepatitis E Virus ORF3 region was amplified using RT-PCR
with SEQ ID NOS: 26 and 27 as described in Example 3.
[0179] As shown in FIGS. 7A and 9A, fluorescence-quenching curves
were obtained by real-time PCR for the detection of AdV40 and S.
typhimurium using universal primers of 7-bp in length. The melting
curve analysis of the product produced in these reactions is shown
in FIG. 7B. Similar results were obtained for C. parvum (see FIGS.
6A and 7B).
EXAMPLE 6
Use of Thermostable Restriction Enzyme to Cleave the Universal
Fluorescent Primer
[0180] This example describes methods that can be used to detect
the presence of a nucleic acid molecule through increase in
fluorescence.
[0181] In one example, the method includes amplification of a
target nucleic acid sequence using a universal fluorescent primer
CC"T"GG. The PCR reaction can be performed in the presence of the
thermostable restriction enzyme BstNI that cleaves the fluorescent
tag when double stranded DNA and the universal fluorescent sequence
forms a cleavable substrate for thermostable endonuclease such as
BstNI. The universal primer remains single-stranded in the absence
of target nucleic acid molecule, and is not acted upon by BstNI.
However, during target-dependent synthesis a complementary strand
is synthesized and becomes nickable by the restriction
endonuclease. The cleavage cuts the fluorescent-labeled primer,
thereby separating it from the complimentary guanosine quencher.
This leads to increase in fluorescence intensity.
[0182] In another example, the method includes amplification of a
target nucleic acid sequence using a universal fluorescent primer
CC"T"GG under isothermal conditions. For example, NASBA, 3SR, TMA,
and so on, can be performed using the universal tags disclosed
herein by substituting one primer with a universal tag while the
other primer contains the RNA polymerase promoter. The promoter
sequence, located on the 5' end of the second primer, generates RNA
copies complementary to the universal tag. This sequence will
hybridize to the universal tag and RNA transcriptase will extend
the universal tag extension product. However, during
target-dependent synthesis a complementary strand is synthesized
and becomes nickable by the restriction endonuclease. The cleavage
cuts the fluorescent-labeled primer, thereby separating it from the
complimentary guanosine quencher. This leads to increase in
fluorescence intensity.
EXAMPLE 7
Use of Universal Tags with an Array
[0183] This example describes methods that can be used to detect
the presence of a nucleic acid molecule using the disclosed
universal tags in combination with an array, such as a
microarray.
[0184] In one example, the method includes amplification of a
target nucleic acid sequence using a universal tag attached to the
forward or reverse primer. The primer not containing a universal
tag can include another label, such as a fluorophore, such as Cy3
or Cy5. For example, real-time PCR can be performed using a forward
primer labeled with a universal tag using the methods disclosed
herein, and a labeled reverse primer (for example labeled with Cy3
or Cy5). The resulting amplicons can be analyzed using the methods
disclosed herein to determine if the sample analyzed is positive or
negative for the target nucleic acid of interest.
[0185] The resulting PCR products (amplicons) from the positive
reactions can be denatured at 100.degree. C. for 2 minutes and
chilled on ice immediately prior to hybridization to an array
containing one or more nucleic acid sequence targets of interest. A
particular example of such a microarray is a DNA chip. In one
example, the amino group of the target nucleic acid molecule can be
linked at its 5' end to the surface of the array. If the target
nucleic acid sequence is present on the array, the amplicons
previously generated (which contain at least one detectable label,
such as 2 detectable labels) will hybridize to the target nucleic
acid one the array. The resulting hybridization will produce an
increase in signal due to the present of the detectable label on
the amplicon. For example, if one of the primers included Cy3 or
Cy5, the resulting Cy3 or Cy5 labeled product will produce an
increase in fluorescence intensity, which can be detected and in
some examples further quantitated.
[0186] Such a method can be used to confirm the positive or
negative results obtained with amplification using a universal tag
disclosed herein.
EXAMPLE 8
Use of Universal Tags with Pyrosequencing
[0187] This example describes methods that can be used to sequence
a nucleic acid molecule using the disclosed universal tags in
combination with pyrosequencing.
[0188] In one example, the method includes amplification of a
target nucleic acid sequence using a universal tag attached to the
5' end of a forward or reverse primer. The primer not containing a
universal tag can include biotin at its 5' end. The labeled forward
and reverse primers are used to amplify a target nucleic acid
sequence, for example by using real-time PCR methods disclosed
herein. The resulting amplicons can be analyzed using the methods
disclosed herein to determine if the sample analyzed is positive or
negative for the target nucleic acid of interest. The resulting
amplicons would contain a detectable biotin label.
[0189] The biotin labeled amplicon is separated after denaturation
and adhesion of the amplicons to streptavidin-coated magnetic
beads. The separated strands are then sequenced using
pyrosequencing with an appropriate sequencing primer, using methods
known in the art (for a review of pyrosequencing see Franca et al.,
Q. Rev. Biophys. 35(2):169-200, 2002).
EXAMPLE 9
Detection of a Nucleic Acid Molecule in a Subject
[0190] This example describes methods to determine if a particular
nucleic acid molecule is present, for example present in a sample
obtained from a subject.
[0191] In one example, the method includes amplification of a
target nucleic acid sequence from a sample using a universal tag
attached to the forward or reverse primer. In one example, the
sample is obtained from a subject infected or suspected of being
infected with a pathogen, such as a virus, bacterium, parasite,
fungi, or combinations thereof. In this example, the target nucleic
acid sequence can be a sequence specific to the pathogen of
interest, or a nucleic acid molecule of the subject whose
expression is altered (such as increased or decreased) in response
to the infection, or combinations thereof.
[0192] In another example, the sample is obtained from a subject
having or suspected of having a disease, such as cancer. In
particular examples, the subject is being treated or has been
treated for the disease, and the method is used to determine the
subject's response to the treatment. In this example, the target
nucleic acid sequence can be a nucleic acid molecule of the subject
whose expression is altered (such as increased or decreased) due to
the disease, a control sequence (such as a sequence that detects
expression of a housekeeping gene), or combinations thereof.
Housekeeping genes are known in the art (for example see Janssens
et al., Mol. Diagn. 8(2):107-13, 2004), and can include
porphobilinogen deaminase (PBGD); mitochondrial ATP synthase 6
(mATPsy6); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Ideally, a housekeeping gene has expression levels that remain
relatively constant in different experimental conditions.
[0193] The primer not containing a universal tag can include
another label, such as a fluorophore, such as Cy3 or Cy5. For
example, real-time PCR can be performed using a forward primer
labeled with a universal tag using the methods disclosed herein,
and an unlabeled or labeled reverse primer (for example labeled
with Cy3 or Cy5). The resulting amplicons can be analyzed using the
methods disclosed herein to determine if the sample analyzed is
positive or negative for the target nucleic acid of interest. If
desired, the amplicons can be further analyzed, for example using
an array, to confirm the amplification results. In some examples,
quantitation of the target nucleic acid is performed.
EXAMPLE 10
Single-Labeled Probe that Includes Stem and Loop Structure Attached
to Forward Primer
[0194] In particular examples, a UniFluor probe does not include a
quenching fluorophore. Fro example, a UniFluor probe can include a
specific probe sequence that is held in a hairpin loop
configuration by complimentary stem sequences on the 5' and 3'
sides of the probe. The internal labeling with 6-carboxy
fluorescein of a "T" that is the second nucleotide (5'-C"T"CCGCCC;
nucleotides 1-8 of SEQ ID NO: 29) from the 5'-end is quenched by a
complimentary arm sequence of 3'-GAGGCGGG (SEQ ID NO: 30) joined to
the 3'-end of the loop. The probe is attached to the primer via a
PCR blocker (X) in order to reduce or prevent the extension of the
primer so that the probe can hybridize to its own strand upon
extension of the primer. In a particular example, the blocker is a
C3 or C5 spacer, such as the C3 spacer amidite. When the probe
hybridizes within the same strand, the hairpin loop opens to an
extent such that there is no more quenching due to the guanosine
nucleotides on the complementary arm.
[0195] This example describes methods to amplify C. parvum
sequences using the primers as follows. Although this example
describes amplification and detection of C. parvum using this
primer, the disclosed method and primers can be used to amplify any
nucleic acid molecule of interest. The forward primer is attached
with the exemplary probe at the 5' end, with the probe consisting
of stem and loop sequences. The stem portion does not bind to a
target sequence, such as
5'-c"t"ccgccCGCGCCTGCTGCCTTCCTTAGATGggcggag(X)ATGACGGGTAACGGG
GAAT-3' (SEQ ID NO: 29) and reverse primer SEQ ID NO: 13. During
target-dependent synthesis the probe part hybridizes to its target
only when the target site has been incorporated into the same
molecule by extension of the tailed primer. The hybridization of
the probe to its target separates the complementary guanosine
quencher stem. This results in the emission of fluorescence.
[0196] This method was demonstrated in a real-time PCR assay using
SEQ ID NOS: 29 and 13 using the methods described in Example 1. As
shown in FIG. 11, the UniFluor probe results in fluorescence during
amplification of the target sequence. However, in the negative
samples no increase in signal was detected during amplification,
thus demonstrating the specificity of the UniFluor probe.
[0197] The real-time PCR assay was performed using the
QuantiTect.TM. Probe PCR kit (Qiagen, USA) and an iCycler iQ
Real-Time PCR detection system (Bio-Rad laboratories, Hercules,
Calif.). Amplification reactions contained 2 .mu.L template DNA,
0.25 mM primers (SEQ ID NOS: 29 and 13), in a final reaction volume
of 20 .mu.L. The protocol took approximately 90 minutes to complete
with the following PCR conditions: hot-start denaturation step at
95.degree. C. for 15 minutes, followed by 45 cycles with a
95.degree. C. denaturation for 10 seconds and 60.degree. C.
annealing for 60 seconds and collecting the fluorescence signal (F)
at the end of this step (FIG. 11).
[0198] In another example, the method includes the use of a probe
made of a stem and loop structure and hybridization of the probe to
its complementary sequences during the amplification of the target
nucleic acid sequence. The loop consists of a nucleic acid sequence
that specifically hybridizes to a target complementary sequence.
The stem portion of the probe is labeled internally with 6-carboxy
fluorescein at "t" that is the second nucleotide from the 5'-end
(c"t"ccgccCGCGCCTGCTGCCTTCCTTAGATGggcggag; nucleotides 1-38 of SEQ
ID NO: 29) and is quenched by complementary arm sequence of
5'GGCGGAG joined to the 3'-end of the loop. During target-dependent
synthesis, the stem part of the probe separates and the loop part
of the probe hybridizes to its specific complimentary strand. This
functions as an oligonucleotide probe having a single fluorescent
label.
[0199] In view of the many possible embodiments to which the
principles of the disclosure can be applied, it should be
recognized that the illustrated embodiments are only examples of
the disclosure and should not be taken as limiting the scope of the
disclosure. Rather, the scope of the disclosure is defined by the
following claims. We therefore claim as our invention all that
comes within the scope and spirit of these claims.
Sequence CWU 1
1
32 1 7 DNA Artificial Exemplary universal primer 1 ctccggc 7 2 28
DNA Artificial Forward primer for amplification of hexon protein of
adenovirus. 2 ctccggcgga cgcctcggag tacctgag 28 3 23 DNA Artificial
Reverse primer for amplifying hexon protein region of adenovirus. 3
acngtggggt ttctgaactt gtt 23 4 18 DNA Artificial Forward primer for
TaqMan amplificaiton of the hexon protein region of adenovirus. 4
tggccacccc ctcgatga 18 5 21 DNA Artificial Reverse primer for
TaqMan amplificaiton of the hexon protein region of adenovirus. 5
tttgggggcc agggagttgt a 21 6 14 DNA Artificial Exemplary universal
primer 6 ctcggcccgc cgag 14 7 5 DNA Artificial Exemplary universal
primer 7 ctccn 5 8 34 DNA Artificial Forward primer for amplication
of a C. parvum sequence. 8 ctccggcccg ccgagatgac gggtaacggg gaat 34
9 30 DNA Artificial Forward primer for amplificaito of a C. parvum
sequence. 9 ctccggcccg catgacgggt aacggggaat 30 10 26 DNA
Artificial Exemplary forward primer for amplification of a C.
parvum sequence. 10 ctccggcatg acgggtaacg gggaat 26 11 24 DNA
Artificial Forward primer for amplification of a C. parvum
sequence. 11 ctccgatgac gggtaacggg gaat 24 12 23 DNA Artificial
Forward primer for amplification of a C. parvum sequence. 12
ctccatgacg ggtaacgggg aat 23 13 23 DNA Artificial Reverse primer
for amplification of a C. parvum sequence. 13 ccaattacaa aaccaaaaag
tcc 23 14 7 DNA Artificial Exemplary universal sequence. 14 ctccggc
7 15 28 DNA Artificial Forward primer for amplification of the
hexon protein region of Adenovirus. 15 ctccggcgga cgcctcggag
tacctgag 28 16 27 DNA Artificial Forward primer for amplification
of a S. typhimurium sequence. 16 ctccggcgcc tttctccatc gtcctga 27
17 19 DNA Artificial Reverse primer for amplication of a S.
typhimurium sequence. 17 tggtgttatc tgcctgacc 19 18 5 DNA
Artificial Exemplary universal primer 18 ctccn 5 19 5 DNA
Artificial Exemplary universal primer. 19 ctcgn 5 20 5 DNA
Artificial Exemplary universal primer. 20 ctcsn 5 21 7 DNA
Artificial T at position 2 includes a detectablel label; X is any
nucleotide; and S is a G or a C. 21 ctcsnnn 7 22 7 DNA Artificial
Exemplary universal primer. 22 ctcsnnn 7 23 7 DNA Artificial
Complementary sequence to the universal primer of SEQ ID NO 1. 23
gaggccg 7 24 20 DNA Artificial Forward primer for amplification of
18s region of C. parvum. 24 catgacgggt aacggggaat 20 25 19 DNA
Artificial TaqMan probe for amplification of 18s region of C.
parvum. 25 atgacgggta acggggaat 19 26 25 DNA Artificial Forward
primer for amplification of Hepatitis E. 26 ctccggcggt ggtttctggg
gtgac 25 27 18 DNA Artificial Reverse primer for amplification of
Hepatitis E. 27 aggggttggt tggatgaa 18 28 7 DNA Artificial
Exemplary universal primer. 28 ctccata 7 29 58 DNA Artificial
Primer for amplification of the 18s region of C. parvum. 29
ctccgcccgc gcctgctgcc ttccttagat gggcggagna tgacgggtaa cggggaat 58
30 8 DNA Artificial Complementary to nucleotides 1-8 of SEQ ID NO
29. 30 gaggcggg 8 31 15 DNA Artificial Exemplary universal primer
31 ctcssssnrr rrgag 15 32 17 DNA Artificial Exemplary universal
primer 32 ctcssssnrr rrgagnn 17
* * * * *