U.S. patent application number 11/130545 was filed with the patent office on 2006-08-24 for novel post-transcriptional regulatory elements and uses thereof.
This patent application is currently assigned to The Gov. of the USA as Represented by the Secretary Dept. of Health and Human Services. Invention is credited to Filomena Nappi, George N. Pavlakis.
Application Number | 20060188872 11/130545 |
Document ID | / |
Family ID | 34742595 |
Filed Date | 2006-08-24 |
United States Patent
Application |
20060188872 |
Kind Code |
A1 |
Pavlakis; George N. ; et
al. |
August 24, 2006 |
Novel post-transcriptional regulatory elements and uses thereof
Abstract
The invention provides a novel post-transcriptional regulatory
element that can function as an RNA nucleo-cytoplasmic transport
element. The invention also provides for an attenuated HIV-1 hybrid
virus for use as a vaccine and a kit incorporating the hybrid
virus. The kit also includes instructional material teaching the
use of the vaccine, where the instructional material indicates that
the vaccine is used for the prophylaxis or amelioration of HIV-1
infection in a mammal; that the vaccine is to be administered to a
mammal in a therapeutically effective amount sufficient to express
a viral protein; where the vaccine will not cause clinically
significant CD4.sup.+ cell depletion; and, the expression of the
viral protein elicits an immune response to the attenuated HIV-1
virus. The invention further provides for a method for screening
for post-transcriptional RNA nucleo-cytoplasmic transport element
(NCTE) binding proteins.
Inventors: |
Pavlakis; George N.;
(Rockville, MD) ; Nappi; Filomena; (Rome,
IT) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER
8TH FLOOR
SAN FRANCISCO
CA
94111
US
|
Assignee: |
The Gov. of the USA as Represented
by the Secretary Dept. of Health and Human Services
Rockville
MD
|
Family ID: |
34742595 |
Appl. No.: |
11/130545 |
Filed: |
May 16, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09673716 |
Feb 26, 2001 |
6919442 |
|
|
PCT/US99/11082 |
May 18, 1999 |
|
|
|
11130545 |
May 16, 2005 |
|
|
|
60086487 |
May 22, 1998 |
|
|
|
Current U.S.
Class: |
435/5 ; 435/325;
435/456; 435/69.3; 530/350; 536/23.72 |
Current CPC
Class: |
A61K 39/12 20130101;
A61K 2039/5254 20130101; A61K 2039/522 20130101; C12N 7/00
20130101; C12N 2740/16061 20130101; C12N 2740/16034 20130101; A61K
39/21 20130101 |
Class at
Publication: |
435/005 ;
435/069.3; 435/456; 435/325; 530/350; 536/023.72 |
International
Class: |
C12Q 1/70 20060101
C12Q001/70; C07H 21/04 20060101 C07H021/04; C07K 14/16 20060101
C07K014/16; C12N 15/867 20060101 C12N015/867 |
Claims
1-30. (canceled)
31. A method of identifying functional PREs, the method comprising,
(i) providing a PRE-deficient virus unable to replicate in a cell
line; (ii) ligating nucleic acid fragments into a genome of the
virus, thereby constructing a recombinant viral clone; (iii)
inserting the recombinant viral clone into the cell line; and (iv)
isolating a nucleic acid comprising a functional PRE from the
recombinant viral clone that is propagated in the cell line.
Description
FIELD OF THE INVENTION
[0001] This invention pertains to the field of virology and vaccine
development. In particular, this invention pertains to the
discovery of a novel post-transcriptional regulatory element (PRE)
that can function as a post-transcriptional RNA nucleo-cytoplasmic
transport element (NCTE). This novel nucleic acid sequence can be
used to construct an attenuated retrovirus.
BACKGROUND OF THE INVENTION
[0002] Infection with human immunodeficiency virus type 1 (HIV-1)
is typically characterized by a progressive disintegration of the
immune system, acquired immune deficiency syndrome (AIDS), and
death. However, some individuals infected HIV-1 virus do not
develop disabled immune systems or AIDS. Because a cure or vaccine
for AIDS has eluded researchers for years, these individuals and
the virus they harbor may provide essential clues toward the
development of vaccines or treatments against HIV.
[0003] Some of these asymptomatic HIV-1 infected individuals have
variant strains that affected the virus' ability to grow. Viral
gene mutations were causing the HIV-1 to grow at a relatively slow
rate (growth attenuation). The resultant low levels of virus
created a non-lethal, asymptomatic infection (Iversen (1995) J. of
Virology 69:5743-5753; Hua (1996) Virology 222:423-429).
[0004] Differences between the deadly form of the virus and the
non-lethal variants were found in portions of the viral genome able
to regulate how fast the virus and grows and multiplies. This
creates an exciting new way to design an effective vaccine against
HIV-1. Slow-growing, non-lethal (attenuated) viral mutants can be
designed as vaccines to protect against AIDS. Thus, there exists a
great need for new ways to attenuate retroviruses, such as HIV-1.
The present invention fulfills this and other needs.
SUMMARY OF THE INVENTION
[0005] The invention provides a novel post-transcriptional
regulatory element (PRE) that can function as a
post-transcriptional RNA nucleo-cytoplasmic transport element
(NCTE). The sequence was initially derived from a mouse genomic
nucleotide sequence. Sequence analysis found that the novel PRE has
significant homology to intracisternal A-type particle (IAP)
sequences.
[0006] The invention provides a novel family of isolated nucleic
acids consisting of a post-transcriptional regulatory element (PRE)
nucleic acid defined as having the following properties: the PRE
nucleic acid, when inserted in a recombinant, hybrid HIV-1, is
capable of functioning as a post-transcriptional RNA
nucleo-cytoplasmic transport element (NCTE) in place of wild-type
NCTE in the hybrid HIV-1, and when the PRE-containing hybrid HIV-1
virus infects activated human peripheral blood mononuclear cells
(huPBMCs), the level of expression of HIV-1 p24.sup.gag is between
about 5 fold and about 200 fold less than levels of p24.sup.gag
expression when HIV-1 wild type virus, utilizing wild-type NCTE,
infects activated huPBMCs; and, the PRE has at least 80% nucleic
acid sequence identity to the sequence as set forth in SEQ ID NO:1.
In other embodiments, the isolated PRE nucleic acid can have at
least 90% nucleic acid sequence identity to the sequence as set
forth in SEQ ID NO:1, and can comprise a sequence as set forth in
SEQ ID NO:1. In another embodiment, when a PRE-containing hybrid
HIV-1 virus infects activated huPBMCs, the level of expression of
HIV-1 p24.sup.gag is between about 10 fold and about 50 fold less
than levels of p24.sup.gag expression when HIV-1 wild type virus
infects activated huPBMCs.
[0007] The invention also provides an isolated transcription
product of a PRE nucleic acid of the invention. The isolated
transcription product can have at least 90% nucleic acid sequence
identity to the sequence as set forth in SEQ ID NO:1, and can
comprise a sequence as set forth in SEQ ID NO:1.
[0008] The invention provides an expression cassette comprising a
nucleic acid encoding a PRE nucleic acid of the invention, wherein
the PRE nucleic acid is operably linked to a promoter. The
expression cassette, as defined below, can be an expression vector.
The PRE of the expression cassette can have at least 90% nucleic
acid sequence identity to the sequence as set forth in SEQ ID NO:1,
and can comprise a sequence as set forth in SEQ ID NO:1. In one
embodiment, the invention provides a transfected cell comprising a
polynucleotide encoding a PRE nucleic acid of the invention and a
non-naturally occurring nucleic acid sequence.
[0009] The invention provides a recombinant retrovirus, wherein the
retrovirus either lacks or has non-functional endogenous
post-transcriptional RNA nucleo-cytoplasmic transport elements
(NCTEs), further comprising a PRE of the invention operatively
inserted into the retrovirus, the PRE capable of acting as an
exogenous functional NCTE to reconstitute the lacking or
non-functional endogeous NCTE and to reconstitute the infectivity
of the retrovirus in a mammalian cell. The PRE inserted in the
recombinant retrovirus can have at least 90% nucleic acid sequence
identity to the sequence as set forth in SEQ ID NO:1, or can
comprises a sequence as set forth in SEQ ID NO:1. The recombinant
retrovirus, when infecting activated huPBMCs, has a level of
expression between about 10 fold and about 50 fold less than when
HIV-1 wild type virus infects activated huPBMCs.
[0010] The recombinant virus of the invention can be HIV-1 and the
NCTE can be RRE. In various embodiments, the insertion of the PRE
in the retrovirus is in the 3' untranslated region of the virus, or
is in or flanking the Nef region of an HIV-1 virus. The HIV-1 can
further lack a functional Nef.
[0011] The invention provides a vaccine for the prophylaxis or
amelioration of a viral infection in a mammal comprising an
attenuated retrovirus, wherein the attenuated retrovirus, when
administered as a vaccine in sufficient amounts is capable of
eliciting an immune response to the retrovirus in a mammal with a
functional immune system, wherein the attenuated retrovirus lacks
an endogenous functional post-transcriptional RNA
nucleo-cytoplasmic transport element (NCTE) and/or the ability to
express an endogenous functional NCTE binding protein, and the
attenuated retrovirus further comprises a PRE nucleic acid of the
invention. The attenuated retrovirus of the vaccine can be HIV-1.
The PRE can be inserted in the 3' untranslated region of the virus
or can be inserted in or flanking the Nef region of an HIV-1 virus.
The attenuated HIV-1 can further lack a functional Nef. The NCTE
can be RRE and the NCTE binding protein can be Rev.
[0012] The invention provides a kit for the prophylaxis or
amelioration of a virus infection in a mammal, the kit comprising a
vaccine and a pharmacologically acceptable carrier, wherein the
vaccine comprises an attenuated retrovirus, wherein the attenuated
retrovirus, when administered as a vaccine in sufficient amounts is
capable of eliciting an immune response to the retrovirus in a
mammal with a functional immune system, wherein the attenuated
retrovirus lacks an endogenous functional post-transcriptional RNA
nucleo-cytoplasmic transport element (NCTE) and/or the ability to
express an endogenous functional NCTE binding protein, and the
attenuated retrovirus further comprises a PRE nucleic acid of the
invention. The kit can further comprise an instructional material
teaching the use of the vaccine, wherein the instructional material
indicates that the vaccine is used for the prophylaxis or
amelioration of HIV-1 infection in a mammal; that the vaccine is to
be administered to a mammal in a therapeutically effective amount
sufficient to express a viral protein; wherein the vaccine will not
cause clinically significant CD4.sup.+ cell depletion; and, the
expression of the viral protein elicits an immune response to the
attenuated HIV-1 virus.
[0013] The invention provides use of a PRE of the invention in the
manufacture of a medicament for the prophylaxis or amelioration of
a viral infection. The viral infection can be a HIV-1
infection.
[0014] The invention provides a method for eliciting an immune
response to a virus in a mammal, comprising administering to a
mammal a therapeutically effective amount of an attenuated
recombinant virus, wherein the virus comprises a PRE of the
invention.
[0015] The invention provides a method for screening for a
post-transcriptional RNA nucleocytoplasmic transport element (NCTE)
binding protein comprising the following steps: providing a
composition comprising a PRE of the invention; contacting the
composition with a test compound; and, measuring the ability of the
test compound to bind the NCTE.
[0016] A further understanding of the nature and advantages of the
present invention may be realized by reference to the remaining
portions of the specification and claims.
[0017] All publications, Genbank sequences, patents and patent
applications cited herein are hereby expressly incorporated by
reference for all purposes.
DETAILED DESCRIPTION OF THE INVENTION
[0018] The present invention provides a novel family of
post-transcriptional regulatory elements, or PRE. Specifically, the
PREs of the invention can function as RNA nucleo-cytoplasmic
transport elements (NCTE). The exemplary PRE of the invention (SEQ
ID NO:1) was initially derived from a mouse genomic nucleic acid.
Sequence comparison analysis shows that PRE sequences are highly
homologous to intracisternal A particle (IAP) sequences.
[0019] In retroviruses, including HIV type 1 (HIV-1), simian
retrovirus type 1 (SRV-1), SRV-2, and Mason-Pfizer monkey virus
(MPMV) (the later three are type D simian retroviruses), the rate
of viral growth can be controlled by changing the rate of
expression of their RNA message. This strategy is a
"post-transcriptional" means to regulate gene expression and viral
growth. Specifically, these retroviruses need a special sequence on
their RNA to effect nuclear transport of unspliced mRNA encoding
structural proteins. This sequence, called a "post-transcriptional
regulatory element" (PRE), typically acts by internally
base-pairing, allowing the RNA molecule to fold into a unique,
secondary structure (a "cis-acting element"). The folding patterns
are highly structured and are commonly stem-loop, or hairpin
structures. A soluble protein binds specifically to this RNA
structure to aid in the transport of the message from the nucleus
to the cytoplasm (in addition to other functions, including aiding
in the splicing of the transcript).
[0020] Some retroviruses, such as Simian type D retroviruses,
including SRV-1, do not encode their own trans-acting, NCTE-binding
proteins and instead utilize cellular NCTE binding proteins. Other
retroviruses, such as HIV-1, utilize a retrovirally-encoded NCTE
RNA binding protein, called "Rev." HIV-1 regulates the expression
of its structural proteins encoded by the gag/pol- and env-encoding
transcript using this NCTE system. HIV-1's NCTE binding protein
"Rev" interacts with a specific NCTE sequence, designated the
"Rev-responsive element," or "RRE," contained in its gag/pol and
env encoding transcript. HIV-1's RRE does not bind cellular
NCTE-binding proteins. Rev interacts directly with RRE as part of
the RNA export machinery which transports RRE-containing
transcripts to the cytoplasm from the nucleus. As a result, Rev and
RRE are needed to produce infectious virus.
[0021] HIV-1 lacking a functional Rev/RRE control system, while
uninfectious, can be reconstituted with exogenous control elements.
For example, when simian retroviral CTE (e.g., CTE from SRV-1,
SRV-2, MPMV) is used to reconstitute HIV-1's NCTE, the hybrid
produces transcripts and infectious virions (Bray (1994) Proc.
Natl. Acad. Sci. USA 91:1256-1260; Tabernero (1996) J. Virol.
70:5998-6011; Zolotukhin (1994) J. Virol. 68:7944-7952).
Significantly, these hybrids produce lower levels of transcript and
productive virion than seen with wild-type HIV-1.
[0022] It was surprisingly found that the novel PRE of the
invention can functionally replace the NCTE of HIV-1, or "RRE." It
was discovered that when PRE is used in place of RRE to construct
an HIV-1 hybrid clone, a slower growing virus results.
Significantly, while capable of producing infectious virions in
vivo, this HIV-1 hybrid (a PRE-containing RRE-negative recombinant
virus) has lower replicative activity than wild-type virus,
resulting in an attenuated HIV-1 strain. The level of attenuation
can be quantitated using in vitro or in vivo assays, such as
determining the amount of HIV-1 p24.sup.gag synthesized by hybrid
viruses. For example, PRE-containing HIV-1 hybrids can be used to
infect tissue culture cells or activated human peripheral blood
mononuclear cells (huPBMCs) in vitro. When the PRE-containing
hybrid HIV-1 virus infects activated huPBMCs, the level of
expression of HIV-1 p24.sup.gag is between about 50 fold and about
200 fold less than levels of p24.sup.gag expression when HIV-1 wild
type virus, utilizing wild-type NCTE (i.e., RRE), infects activated
huPBMCs.
[0023] The efficacy of the PRE-recombinant hybrid as an attenuating
agent in HIV-1 infection and AIDS pathogenesis can be demonstrated
using functionally analogous NCTEs, such as the SRV-1 CTE.
Recombinant, hybrid HIV-1 in which NCTE from SRV-1 (termed "CTE")
functionally replaces wild-type HIV-1 NCTE ("RRE") are functionally
analogous to hybrid HIV-1 clones whose RRE is replaced by the PRE
of the invention. PRE-hybrid and SRV-1 CTE-hybrid HIV-1 clones have
approximately the same rate of propagation and infectivity, as
demonstrated by the in vitro experiments discussed in Example 1.
Thus, CTE attenuated HIV-1 clones can be used to demonstrate the
replicative, yet non-cytopathic, effect of CTE-attenuated HIV-1 in
the SCID-hu mouse model, as discussed in Example 3.
[0024] CTE(+)/RRE(-) HIV-1 clones were used to infect Thy/Liv
implants, which are human thymus and liver cells transplanted in
SCID-hu mice (see, e.g., Kollmann (1995) J. Immunol. 154:907-921).
Significantly, these viruses propagated slower than both wild-type
and Nef-negative HIV-1 clones. This demonstrates that they have
lower replicative capacity in human lymphocytes. Furthermore, the
CTE(+)/RRE(-) attenuated HIV-1 clones were not lymphocytopathic, no
depletion of CD4.sup.+-bearing cells was observed. This
demonstrates that slow growing HIV-1 hybrid clones utilizing
exogenous NCTEs, as CTE (of SRV-1) or PRE, have an attenuated
phenotype for cytotoxicity.
[0025] Analogously, when the PRE-attenuated HIV-1 of the invention
infect activated human lymphocytes in vivo, they will also produce
low levels of infectious virions without any lymphocytotoxic
effects, i.e., levels of CD4.sup.+ T cells will not decline.
Importantly, this CTE.sub.IAP-attenuated virus will elicit an
immune response in the infected, yet asymptomatic, individual.
[0026] The finding that an IAP element can be utilized in the
attenuation of a retrovirus whose productive infection does not
lead to loss of CD4.sup.+ cells is especially unexpected in view of
past-findings that a human IAP has been found to be associated with
CD4.sup.+ T-cell immunodeficiency and dysfunction. The presence of
IAP sequence has also been associated with the occurrence of
carcinogenesis.
[0027] This invention also provides for a vaccine in the form of a
pharmacological compositions and a kit. The pharmacological
compositions can comprise a pharmaceutically acceptable carrier and
the attenuated virus of the invention. The kit can comprise a
container containing a vaccine formulation.
Definitions
[0028] The term "PRE" refers to post-transcriptional regulatory
elements which are cis-acting nucleic acid sequences involved in
the transport, stability, and translation of RNA transcripts. When
PREs are functioning as part of the RNA export machinery to
transport transcripts from the nucleus to the cytoplasm they are
also referred to as nucleocytoplasmic transport elements, or
"NCTEs." The PRE of the invention specifically refers to a family,
or genus of nucleic acid sequences defined as having the following
structural and functional properties: the PRE, when inserted in an
HIV-1 is capable of functioning as an NCTE in place of wild-type
HIV-1 NCTE (i.e., RRE). When the PRE-containing hybrid HIV-1 virus
infects activated huPBMCs, the level of expression of HIV-1
p24.sup.gag is between about 5 fold to about 200 fold less than
levels of p24.sup.gag expression when HIV-1 wild type virus,
utilizing wild-type NCTE, infects activated huPBMCs. The PRE of the
invention has at least 80% nucleic acid sequence identity to the
sequence set forth in SEQ ID NO:1. In another embodiment, the PRE
of the invention has at least 90% sequence identity to the sequence
set forth in SEQ ID NO:1. The nucleic acid of SEQ ID NO:1 is an
exemplary specie of the PRE family of the invention.
[0029] The term "nucleocytoplasmic transport element" or "NCTE"
refers to cis-acting PREs which act as post-transcriptional RNA
nucleo-cytoplasmic transport elements. Simian retrovirus NCTE is
also referred to as "CTE." These RNA sequences typically have a
high degree of secondary structure in the form of stem-loop
structures, which can interact with trans-acting NCTE-binding
proteins, hairpin turns, and the like. Some retroviruses, including
HIV and simian retroviruses, regulate their growth through
expression of their RNA using NCTEs and corresponding NCTE-binding
proteins. NCTE binding with viral or cellular trans-acting
NCTE-binding proteins stabilizes unspliced viral transcripts and
allows interaction with cellular machinery to transport the message
from the nucleus to the cytoplasm. HIV-1's NCTE is designated the
"Rev-responsive element," or "RRE," (Felber (1989) Proc. Natl.
Acad. Sci. USA 86:1495-1499); Hadzopoulou-Cladaras (1989) J. Virol.
63:1265-1274; Malim (1989) Nature 338:254-257). RRE is contained in
HIV-1's gag/pol and env encoding transcript. NCTEs are further
described, e.g., by Bray (1994) supra; Tabernero (1996) supra;
Zolotukhin (1994) supra; Hua (1996) supra; Grate (1997) Structure
5:7-11.
[0030] The term "NCTE-binding protein" refers to a trans-acting
polypeptide which binds to RNA NCTE sequences, typically
interacting with specific secondary structures. This RNA binding
protein functions with other cellular proteins in the cellular
nuclear export machinery to constitutively transport message
nucleic acid (mRNA) from the nucleus to the cytoplasm. An
NCTE-binding protein can be encoded by endogenous cellular
(eukaryotic) gene or a viral gene. HIV-1 encodes for its own
specific, trans-acting NCTE-binding polypeptide, termed "Rev." Rev
is further described; e.g., Hua (1996) supra; Iversen (1995)
supra.
[0031] The term "HIV" refers to a lentivirus usually called "human
immunodeficiency virus" which is believed to the causal agent of
acquired immune deficiency syndrome, or AIDS. There are several
known subtypes of HIV, including HIV-1 and HIV-2. HIV and AIDS are
well described in the literature and, e.g., are further described
by Gottfredsson (1997) Front Biosci. 2: D619-D634; Burton (1997)
Proc. Natl. Acad. Sci. USA 94:10018-10023; Barnadas (1997) J.
Cutan. Pathol. 24:507-510; Doms (1997) Virology 235:179-190;
Cossarizza (1997) AIDS 11:1075-1088; Carpenter (1997) JAMA
277:1962-1969; Klein (1995) Trends Microbiol. 3:386-391.
[0032] The term "p24.sup.gag antigen" or "p24.sup.gag" refers to
the 24 kd HIV-1 polypeptide found associated with the virus' RNA
genome in the core of the virion, as described. e.g., by Jones
(1996) Nat. Struct. Biol. 3:818-820 (1996); Doe (1996) AIDS
10:793-794; Klenerman (1996) AIDS 10:348-350; Klenerman (1994)
Nature 369:403-407. Levels of p24.sup.gag can be measured using any
technique, such as antibody based methodologies, as described
herein.
[0033] The term "Nef" refers to a 27-34 kD myristoylated protein
unique to primate lentiviruses. A functional Nef gene is important
for development of high viremia and AIDS. For a description of Nef,
see discussion infra and, e.g., Saksela (1997) Front Biosci. 2:
D606-D618; Greenberg (1997) EMBO J. 16:6964-6976; Luo (1997) J.
Virol. 71:9531-9537; Luo (1997) J. Virol. 71:9524-9530; Okada
(1997) FEBS Lett. 417:61-64.
[0034] The term "capable of functioning as a post-transcriptional.
RNA nucleo-cytoplasmic transport element (NCTE) in place of
wild-type NCTE in a hybrid HIV-1" means that the NCTE, such as the
claimed PRE, when inserted into (is part of the sequence of) an
HIV-1 messenger RNA, is capable of interacting with the appropriate
trans-acting polypeptides to effect the splicing and subsequent
transfer of the mRNA from the nucleus to the cytoplasm. An NCTE is
still considered "capable of functioning as an NCTE in place of
wild-type NCTE in a hybrid HIV-1" even if it is less efficient,
less accurate, or less capable, of splicing and/or transferring
mRNA (of which it is a part) from the nucleus to the cytoplasm. For
example, the PRE of the invention, when inserted in HIV-1, is
considered capable of functioning as an NCTE in place of wild-type
NCTE (RRE) in the hybrid HIV-1 even though it is less efficient
than RRE; i.e., when the CTE.sub.IAP-containing hybrid HIV-1 virus
infects activated human peripheral blood mononuclear cells
(huPBMCs), the level of expression of HIV-1 p24.sup.gag is between
about 5 fold and about 200 fold less than levels of p24.sup.gag
expression when HIV-1 wild type virus, utilizing wild-type NCTE
(RRE), infects activated huPBMCs.
[0035] The term "activated" refers to a non-dormant cellular state,
for example, as when a lymphocyte has been activated by an antigen,
cytokine(s) or other mitogen.
[0036] The term "wild-type" refers to any form (e.g., tertiary
structure), structure (e.g., secondary structure) or sequence
(e.g., primary structure) of a composition, as a nucleic acid or
polypeptide, as found in nature, versus structures or sequences
which have been manipulated by the hand of man, i.e., recombinant
nucleic acids or polypeptides.
[0037] The term "peripheral blood mononuclear cell" refers to any
peripheral mononuclear white blood cell.
[0038] The term "expression cassette" refers to any recombinant
expression system for the purpose of expressing a nucleic acid
sequence of the invention in vitro or in vivo, constitutively or
inducibly, in any cell, including prokaryotic, yeast, fungal,
plant, insect or mammalian cell. The term includes linear or
circular expression systems. The term includes expression systems
that remain episomal or integrate into the host cell genome. The
expression systems can have the ability to self-replicate or not,
i.e., drive only transient expression in a cell. The term includes
recombinant expression cassettes which contain only the minimum
elements needed for transcription of the recombinant nucleic acid.
The term also includes expression vectors.
[0039] The term "isolated," when referring to a molecule or
composition, such as, for example, a polypeptide or nucleic acid,
means that the molecule or composition is separated from at least
one other compound, such as a protein, other nucleic acids (e.g.,
RNAs), or other contaminants with which it is associated in vivo or
in its naturally occurring state. Thus, a polypeptide or nucleic
acid is considered isolated when it has been isolated from any
other component with which it is naturally associated, e.g., cell
membrane, as in a cell extract. An isolated composition can,
however, also be substantially pure. An isolated composition can be
in a homogeneous state and can be in a dry or an aqueous solution.
Purity and homogeneity can be determined, for example, using
analytical chemistry techniques such as polyacrylamide gel
electrophoresis (SDS-PAGE) or high performance liquid
chromatography (HPLC).
[0040] The term "polynucleotide," "nucleic acid molecule" or
"nucleic acid sequence" refers to a deoxyribonucleotide or
ribonucleotide oligonucleotide in either single- or double-stranded
form. The term encompasses nucleic acids, i.e., oligonucleotides,
containing known analogues of natural nucleotides which have
similar or improved binding properties, for the purposes desired,
as the reference nucleic acid. The term also includes nucleic acids
which are metabolized in a manner similar to naturally occurring
nucleotides or at rates that are improved thereover for the
purposes desired. The term also encompasses nucleic-acid-like
structures with synthetic backbones. DNA backbone analogues
provided by the invention include phosphodiester, phosphorothioate,
phosphorodithioate, methylphosphonate, phosphoramidate, alkyl
phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino),
3'-N-carbamate, morpholino carbamate, and peptide nucleic acids
(PNAs, which contain non-ionic backbones, such as
N-(2-aminoethyl)glycine units); see Oligonucleotides and Analogues,
A Practical Approach, edited by F. Eckstein, IRL Press at Oxford
University Press (1991); Antisense Strategies, Annals of the New
York Academy of Sciences, Volume 600, Eds. Baserga and Denhardt
(NYAS 1992); Milligan (1993) J. Med. Chem. 36:1923-1937; Antisense
Research and Applications (1993, CRC Press) in its entirety and
specifically Chapter 15, by Sanghvi. Phosphorothioate linkages are
described in WO 97/03211; WO 96/39154; Mata (1997) Toxicol Appl
Pharmacol 144:189-197. Other synthetic backbones encompasses by the
term include methylphosphonate linkages or alternating
methylphosphonate and phosphodiester linkages (Strauss-Soukup
(1997) Biochemistry 36:8692-8698), and benzylphosphonate linkages
(Samstag (1996) Antisense Nucleic Acid Drug Dev. 6:153-156). The
term nucleic acid is used interchangeably with gene, DNA, cDNA,
RNA, mRNA, oligonucleotide primer, probe and amplification
product.
[0041] The term "exogenous" as in "exogenous nucleic acid" refers
to a molecule (e.g., nucleic acid or polypeptide) that has been
isolated, synthesized, and/or cloned, in a manner that is not found
in nature, and/or introduced into and/or expressed in a cell or
cellular environment other than or at levels or forms different
than the cell or cellular environment in which said nucleic acid or
protein can be found in nature. The term encompasses both nucleic
acids originally obtained from a different organism or cell type
than the cell type in which it is expressed, and also nucleic acids
that are obtained from the same organism, cell, or cell line as the
cell or organism in which it is expressed.
[0042] The term "endogenous" refers to a molecule, e.g., a nucleic
acid or polypeptide, in a form, structure and/or sequence found in
nature.
[0043] "Sequence identity" in the context of two nucleic acid or
polypeptide sequences includes reference to the nucleotides (or
residues) in the two sequences which are the same when aligned for
maximum correspondence over a specified "comparison window."
Sequence identity analysis is used to determine whether a nucleic
acid is within scope of the invention. For example, to identify a
specie of the PRE family of the invention, a nucleic acid must have
at least 80% nucleic acid sequence identity to a sequence set forth
in SEQ ID NO:1. "Sequence identity" can be analyzed by optimal
alignment of sequences for comparison using any means to analyze
sequence identity (homology) known in the art, e.g., by the
progressive alignment method of termed "PILEUP"; by the local
homology algorithm of Smith & Waterman (1981) Adv. Appl. Math.
2: 482; by the homology alignment algorithm of Needleman &
Wunsch (1970) J. Mol. Biol 48:443; by the search for similarity
method of Pearson (1988) Proc. Natl. Acad. Sci. USA 85: 2444; by
computerized implementations of these algorithms, e.g. BLAST, GAP,
BESTFIT, FASTA, and TFASTA in, e.g., the Wisconsin Genetics
Software Package, Genetics Computer Group, 575 Science Dr.,
Madison, Wis.; or, by inspection. See also Morrison (1997) Mol.
Biol. Evol. 14:428-441, as an example of the use of PileUp,
ClustalW, TreeAlign, MALIGN, and SAM sequence alignment computer
programs. PILEUP uses a simplification of the progressive alignment
method of Feng & Doolittle (1987) J. Mol. Evol. 35:351-360, and
is similar to the method described by Higgins & Sharp (1989)
CABIOS 5:151-153. The BLAST algorithm is described in Altschul
(1990) J. Mol. Biol. 215: 403-410, and BLAST software for analyses
is publicly available, e.g., see National Center for Biotechnology
Information at http://www.ncbi.nlm.nih.gov/. See also Corpet (1988)
Nucleic Acids Res. 16:10881-90; Huang (1992) Computer Applications
in the Biosciences 8:155-65; Pearson (1994) Methods in Molec. Biol.
24:307-31.
[0044] The term "recombinant," when used with reference to, e.g., a
cell, nucleic acid, polypeptide, expression cassette or vector,
refers to a material, or a material corresponding to the natural or
native form of the material that has been modified by the
introduction of a new moiety or alteration of an existing moiety,
or is identical thereto but produced or derived from synthetic
materials. For example, recombinant cells express genes that are
not found within the native (non-recombinant) form of the cell
(i.e., "exogenous nucleic acids") or express native genes that are
otherwise expressed at a different level, typically,
under-expressed or not expressed at all. The term "recombinant
means" refers to techniques where, e.g., a recombinant nucleic acid
such as a cDNA encoding a protein or an antisense sequence, is
inserted into an expression cassette, such as an expression vector,
the resultant construct is introduced into a cell, and the cell
expresses the nucleic acid, and the protein, if appropriate.
"Recombinant means" also encompass the ligation of nucleic acids to
coding or promoter sequences from different sources into one
expression cassette or vector for expression of a fusion protein,
constitutive expression of a protein, or inducible expression of a
protein.
[0045] The term "test compound" refers to any synthetic or natural
compound or composition. The term includes all organic and
inorganic compounds; including, for example, small molecules,
peptides, proteins, sugars, nucleic acids, fatty acids and the
like.
[0046] The term "motif" or "domain" refers to a nucleic acid or
amino acid sequence pattern, or structure, which is shared between
related molecules.
[0047] The term "ameliorating" or "ameliorate" refers to any
indicia of success in the treatment of a pathology or condition,
including any objective or subjective parameter such as abatement,
remission or diminishing of symptoms or an improvement in a
patient's physical or mental well-being. Amelioration of symptoms
can be based on objective or subjective parameters; including the
results of a physical examination and/or a psychiatric
evaluation.
[0048] The term "prophylaxis" refers to any form of prevention,
delay or abatement a pathology or condition or symptom thereof,
including any objective or subjective parameter.
[0049] The term "attenuated" refers to a state wherein an
infectious agent, i.e., a pathogen, such as a microbial or viral
agent, has a phenotype manifested by a lessened ability to grow,
proliferate, or cause pathogenesis, in a host, i.e., the non-wild
type, attenuated phenotype is less virulent. An infectious agent is
also attenuated if its non-wild type phenotype causes a delay in
the onset of symptoms or pathology in its host. For example, a
PRE-attenuated HIV-1 virus is capable of replication, infection and
production of infectious virions without causing clinically
significant pathology in its host.
[0050] The term "immune response" in a host refers to both cellular
and humoral (antibody) mediated responses to an immunogen, i.e., a
compound or composition capable of eliciting an immune response.
The immune response can be elicited by a foreign substance or a
pathogen, and the immunogen can be a carbohydrate, a nucleic acid,
a polypeptide, a lipid, or a combination of these elements.
[0051] The term "vaccine" is used in its ordinary sense, meaning an
agent which is capable of eliciting a humoral and/or cell-mediated
immunoprotective immune response when administered to an individual
with an at least partially functioning immune system.
I. Characterization and Isolation of Nucleic Acids Encoding PRE
[0052] This invention provides for the characterization, cloning
and expression of a novel NCTE, the PRE of the invention. Initially
derived from murine genomic sequence, it is homologous to
intracisternal A particles (IAPs). The invention also provides for
novel means of expressing the PRE of the invention in vitro and in
vivo. In a further embodiment, these expression systems provide a
means to screen for novel NCTEs.
[0053] The invention can be practiced in conjunction with any
method or protocol known in the art, which are well described in
the scientific and patent literature. Therefore, only a few general
techniques will be described prior to discussing specific
methodologies and examples relative to the novel reagents and
methods of the invention.
[0054] A. General Techniques
[0055] Methods of isolating total DNA or RNA encoding the nucleic
acids of the invention are well known to those of skill in the art.
Techniques for isolation, purification and manipulation of nucleic
acids, genes and CTE.sub.IAP sequences, such as generating
libraries, subcloning into expression vectors, labeling probes, DNA
hybridization, and the like are described, e.g., in Sambrook,
MOLECULAR CLONING: A LABORATORY MANUAL (2ND ED.), Vols. 1-3, Cold
Spring Harbor Laboratory, (1989) ("Sambrook"); CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY, Ausubel, ed. John Wiley & Sons, Inc., New
York (1997) ("Ausubel"); LABORATORY TECHNIQUES IN BIOCHEMISTRY AND
MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I.
Theory and Nucleic Acid Preparation, P. Tijssen, ed. Elsevier, N.Y.
(1993) ("Tijssen").
[0056] The nucleic acids of this invention, whether RNA, mRNA, DNA,
cDNA, genomic DNA, or a hybrid of the genetic recombinations, may
be isolated from a variety of sources or may be synthesized in
vitro. Nucleic acids of the invention can be expressed in
transgenic animals, transformed cells, in a transformed cell
lysate, or in a partially purified or a substantially pure form.
Sequencing methods typically use dideoxy sequencing (Sequenase,
U.S. Biochemical), however, other kits and methods are available
and well known to those of skill in the art.
[0057] Nucleic acids and proteins are detected and quantified in
accordance with the teachings and methods of the invention
described herein by any of a number of general means well known to
those of skill in the art. These include, for example, analytical
biochemical methods such as spectrophotometry, radiography,
electrophoresis, capillary electrophoresis, high performance liquid
chromatography (HPLC), thin layer chromatography (TLC), and
hyperdiffusion chromatography, various immunological methods, such
as fluid or gel precipitin reactions, immunodiffusion (single or
double), immunoelectrophoresis, radioimmunoassays (RIAs),
enzyme-linked immunosorbent assays (ELISAs), immuno-fluorescent
assays, and the like, Southern analysis, Northern analysis,
Dot-blot analysis, gel electrophoresis, RT-PCR, quantitative PCR,
other nucleic acid or target or signal amplification methods,
radiolabeling, scintillation counting, and affinity chromatography,
to name only a few.
[0058] B. Identification, Synthesis and Purification of PRE Nucleic
Acids
[0059] The invention provides means to identify, synthesize and
purify PRE of the invention and its alleles, isoforms and
polymorphisms.
[0060] 1. Preparation and Screening of DNA Libraries
[0061] There are numerous methods for isolating the DNA sequences
encoding the PRE of the invention. For example, DNA can be isolated
from a genomic or cDNA library using labeled oligonucleotide probes
having sequences complementary to the sequences or subsequences
disclosed herein, such as SEQ ID NO:1. Such probes can be used
directly in hybridization assays to isolate DNA encoding PRE
isoforms and polymorphisms. Alternatively, probes can be designed
for use in amplification techniques, such as, e.g., PCR. PRE
nucleic acid can be identified and produced using such
amplification methods, as described herein.
[0062] To prepare a cDNA library; mRNA is isolated, reverse
transcribed from the mRNA according to procedures well known in the
art. The cDNA can be inserted into any expression cassette or
vector. The cassettes or vectors are transfected into a recombinant
host for propagation, screening and cloning. Methods for making and
screening cDNA libraries are well known. See, e.g., Gubler (1983)
Gene 25:263-269, Sambrook, Ausubel.
[0063] To make a genomic library, total DNA is extracted and
purified by well-known methods (see, e.g., Sambrook). DNA of
appropriate size is produced by known methods, such as mechanical
shearing or enzymatic digestion, to yield DNA fragments, e.g., of
about 12 to 20 kb. The fragments are then separated, as for
example, by gradient centrifugation, or gel electrophoresis, from
undesired sizes. Selected fragments can be inserted in
bacteriophage, expression cassettes, or other vectors. Recombinant
phage can be analyzed by plaque hybridization described, e.g., in
Benton (1977) Science 196:180; Chen (1997) Methods Mol Biol
62:199-206. Colony hybridization is generally described in, e.g.,
Grunstein (1975) Proc. Natl. Acad. Sci. USA 72:3961-3965; Yoshioka
(1997) J. Immunol Methods 201:145-155; Palkova (1996) Biotechniques
21:982.
[0064] DNA encoding an PRE can be identified in either cDNA or
genomic libraries by hybridization with nucleic acid probes of the
invention. For example, a probe containing 10 to 20 to 50 or more
contiguous nucleotides of SEQ ID NO:1 is used in Southern blots to
identify a PRE of the invention. Once identified, these DNA regions
are isolated by standard methods familiar to those of skill in the
art. Alternatively, RNA may be identified by hybridization to
nucleic acid probes in Northern blots or other formats; see, e.g.,
Sambrook, Ausubel, for general procedures.
[0065] Oligonucleotides for use as, e.g., probes, templates for
further amplification, and the like, can be chemically synthesized,
as described below. Synthetic nucleic acids, including
oligonucleotide probes and primers, PRE sequences, and the like,
can be prepared by a variety of solution or solid phase methods.
Detailed descriptions of the procedures for solid phase synthesis
of nucleic acids by phosphite-triester, phosphotriester, and
H-phosphonate chemistries are widely available. For example, the
solid phase phosphoramidite triester method of Beaucage and
Carruthers using an automated synthesizer is described in Itakura,
U.S. Pat. No. 4,401,796; Carruthers, U.S. Pat. Nos. 4,458,066 and
4,500,707; Carruthers (1982) Genetic Engineering 4:1-17. See also
Needham-Vanbevanter (1984) Nucleic Acids Res. 12:6159-6168;
Beigelman (1995) Nucleic Acids Res 23: 3989-3994; OLIGONUCLEONDE
SYNTHESIS: A PRACTICAL APPROACH, Gait (ed.), IRL Press, Washington
D.C. (1984), see Jones, chapt 2, Atkinson, chapt 3, and Sproat,
chapt 4; Froehler (1986) Tetrahedron Lett. 27:469-472; Froehler,
Nucleic Acids Res. 14:5399-5407 (1986); Sinha (1983) Tetrahedron
Lett. 24:5843-5846; and Sinha (1984) Nucl. Acids Res. 12:4539-4557.
Methods to purify oligonucleotides include native acrylamide gel
electrophoresis, anion-exchange HPLC, as described in Pearson
(1983) J. Chrom. 255:137-149. The sequence of the synthetic
oligonucleotide can be verified using any chemical degradation
method, e.g., Maxam (1980) Methods in Enzymology 65:499-560, Xiao
(1996) Antisense Nucleic Acid Drug Dev 6:247-258; for solid-phase
chemical degradation, Rosenthal (1987) Nucleic Acids Symp Ser
18:249-252.
[0066] 2. Amplification of Nucleic Acids
[0067] The present invention provides oligonucleotide primers and
probes that can hybridize specifically to and amplify nucleic acids
having PRE sequences. Such reagents can be used to identify further
PRE species, such as polymorphisms alleles and other variations.
For, illustrative purposes, exemplary PCR primers and amplification
methods are described herein.
[0068] For amplification of PRE, nucleic acid conserved amongst
different PRE species are preferred reagents for use as
hybridization and amplification probes to identify and isolate
additional species from various organisms. Oligonucleotides can be
used to identify and detect additional PRE species using a variety
of hybridization techniques and conditions. Suitable amplification
methods include, e.g., polymerase chain reaction, PCR (PCR
PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. Innis, Academic
Press, N.Y. (1990) and PCR STRATEGIES (1995), ed. Innis, Academic
Press, Inc., N.Y. (Innis)), ligase chain reaction (LCR) (Wu (1989)
Genomics 4:560; Landegren (1988) Science 241:1077; Barringer (1990)
Gene 89:117); transcription amplification (Kwoh (1989) Proc. Natl.
Acad. Sci. USA 86:1173); self-sustained sequence replication
(Guatelli (1990) Proc. Natl. Acad. Sci. USA, 87:1874); Q Beta
replicase amplification and other RNA polymerase mediated
techniques (e.g., NASBA, Cangene, Mississauga, Ontario). See Berger
(1987) Methods Enzymol. 152:307-316, Sambrook, Ausubel, Mullis
(1987) U.S. Pat. Nos. 4,683,195 and 4,683,202; Arnheim (1990)
C&EN 3647; Lomell J. Clin. Chem., 35:1826 (1989); Van Brunt,
Biotechnology, 8:291-294 (1990); Wu (1989) Gene 4:560; Sooknanan
(1995) Biotechnology 13:563-564. Methods for cloning in vitro
amplified nucleic acids are described in Wallace, U.S. Pat. No.
5,426,039.
[0069] The invention provides for amplification and manipulation or
detection of the products from each of the above methods to prepare
DNA encoding PRE nucleic acid. In PCR techniques, oligonucleotide
primers complementary to the two borders of the DNA region to be
amplified are synthesized and used (see, Innis). PCR can be used in
a variety of protocols to amplify, identify, quantify, isolate and
manipulate nucleic acids encoding PRE. In these protocols, primers
and probes for amplification and hybridization are generated that
comprise all or any portion of the DNA sequences listed herein
[0070] An illustrative primer pair that can amplify the PRE of the
invention under appropriate conditions includes an oligonucleotide
incorporating about the first twenty or thirty nucleic acids of the
exemplary PRE of the invention, i.e., 5'-GTGGGGTGCG AGGCTAAGCA
CTGCACAGAG-3', the 5' thirty nucleotides of SEQ ID NO:1; and, an
oligonucleotide complementary to the 3' twenty to thirty nucleic
acids, i.e., 5'-AAGCAAGCCT CATGGGTGAA GGTAGAGGAC-3' (SEQ ID
NO:2).
[0071] PCR-amplified sequences can also be labeled and used as
detectable oligonucleotide probes, but such nucleic acid probes can
be generated using any synthetic or other technique well known in
the art, as described above. The labeled amplified DNA or other
oligonucleotide or nucleic acid of the invention can be used as
probes to further identify and isolate PRE species from various
cDNA or genomic libraries.
[0072] Another useful means of obtaining nucleic acids of the
invention, such as large genomic clones, is to screen YAC, BAC or
P1 genomic libraries. BACs, bacterial artificial chromosomes, are
vectors that can contain 120(+) Kb inserts. BACs are based on the
E. coli F factor plasmid system and simple to manipulate and purify
in microgram quantities. Because BAC plasmids are kept at one to
two copies per cell, the problems of rearrangement observed with
YACs, which can also be employed in the present methods, are
eliminated. BAC vectors can include marker genes for luciferase and
green-fluorescent protein (GFP). (Baker (1997) Nucleic Acids Res
25:1950-1956). Yeast artificial chromosomes, or YACS, can also be
used for contain inserts ranging in size from 80 to 700 kb, see,
e.g., Tucker (1997) Gene 199:25-30; Adam (1997) Plant J.
1:1349-1358. P1 is a bacteriophage that infects E. coli that can
contain 75-100 Kb DNA inserts (Mejia (1997) Genome Res 7:179-186;
Ioannou (1994) Nat Genet 6:84-89), and are screened in much the
same way as lambda libraries.
[0073] 3. Cloning PRE-Encoding Inserts
[0074] The invention also provides PRE-encoding expression
cassettes and vectors to produce large quantities of full or
partial length PRE nucleic acid. The expression vectors and
cassettes include, e.g., those used in bacterial, yeast, plant,
insect, in vitro, or mammalian systems. For example, generation of
PRE in this manner is useful for assaying for PRE activity
modulators, analysis of the activity of newly isolated species of
PRE, identifying and isolating compounds which specifically
associate with PRE, such as binding proteins, or analysis of the
activity of PRE which has been site-specifically mutated. The
nucleic acids of the invention can also be used as immunogens, as a
few examples, see, e.g., Radic (1994) Annu. Rev. Immunol.
12:487-520; Cabral (1997) Curr. Opin. Rheumatol. 9:387-392;
Pisetsky (1997) Methods 11:55-61; Marion (1997) Methods 11:3-11,
for general discussion on anti-DNA antibodies; for discussion on
generation of anti-RNA antibodies using combinatorial phage display
libraries see Marchbank (1995) Nucleic Acids Symp. Ser.
33:120-122.
[0075] There are several well-known methods of introducing nucleic
acids into bacterial and other cells, a process often called
"transforming," any of which may be used in the methods of the
present invention (see, e.g., Sambrook). Techniques for
transforming a wide variety of animal and plant cells are well
known and described in the technical and scientific literature.
See, e.g., Weising (1988) Ann. Rev. Genet. 22:421-477, for plant
cells and Sambrook for animal and bacterial cells.
[0076] 4. Sequencing of PRE-Encoding Nucleic Acid
[0077] Sequencing of newly isolated DNA will identify and
characterize PRE-encoding nucleic acid of the invention. Sequencing
of isolated PRE-encoding nucleic acid can be used to identify, in
addition to functional criteria, new PRE-encoding species or
allelic variations. Secondary structures can be identified. For
example, in terms of primary sequence criteria, a nucleic acid is a
PRE specie within the scope of the claimed invention if its
sequence has least 80% nucleic acid sequence identity to SEQ ID
NO:1.
[0078] PRE-encoding nucleic acid sequences can be sequenced as
inserts in vectors, as inserts released and isolated from the
vectors or in any of a variety of other forms (i.e., as
amplification products). PRE-encoding inserts can be released from
the vectors by restriction enzymes or amplified by PCR or
transcribed by a polymerase. For sequencing of the inserts to
identify full length PRE coding sequences, primers based on the N-
or C-terminus, or based on insertion points in the original phage
or other vector, can be used. Additional primers can be synthesized
to provide overlapping sequences.
[0079] A variety of nucleic acid sequencing techniques are well
known and described in the scientific and patent literature, e.g.,
see Rosenthal (1987) supra; Arlinghaus (1997) Anal. Chem.
69:3747-3753, for use of biosensor chips for sequencing; Pastinen
(1996) Clin. Chem. 42:1391-1397; Nyren (1993) Anal Biochem.
208:171-175.
[0080] 5. Nucleic Acid Hybridization Techniques
[0081] The hybridization techniques disclosed herein can be
utilized to identify, isolate and characterize amplicon-encoding
nucleic acid of the invention, including different isoforms,
alleles and polymorphisms of such sequences. A variety of methods
for specific DNA and RNA measurement using nucleic acid
hybridization techniques are known to those of skill in the art.
See. e.g., NUCLEIC ACID HYBRIDIZATION, A PRACTICAL APPROACH, Ed.
Hames, B. D. and Higgins, S. J., IRL Press, 1985; Sambrook.
[0082] One method for evaluating the presence or absence, of DNA
encoding PRE of the invention in a sample involves a Southern
transfer. Briefly, the digested bacterial genomic DNA is run on
agarose slab gels in buffer and transferred to membranes.
Hybridization is carried out using nucleic acid probes. The nucleic
acid probes can be designed based on conserved nucleic acid
sequences. Preferably nucleic acid probes are 20 bases or longer in
length (see, e.g., Sambrook for methods of selecting nucleic acid
probe sequences for use in nucleic acid hybridization).
Visualization of the hybridized portions allows the qualitative
determination of the presence or absence of PRE DNA.
[0083] Similarly, a Northern transfer can be used for the detection
of RNA containing PRE sequences. For example, RNA is isolated from
a given cell sample using an acid guanidinium-phenol-chloroform
extraction method. The RNA is then electrophoresed to separate
different species and transferred from the gel to a nitrocellulose
membrane. As with the Southern transfers, labeled probes or PCR can
be used to identify the presence or absence of PRE nucleic
acid.
[0084] Sandwich assays are commercially useful hybridization assays
for detecting or isolating protein or nucleic acid. Such assays
utilize a "capture" nucleic acid or protein that is often
covalently immobilized to a solid support and a labeled "signal"
nucleic acid, typically in solution. A clinical or other sample
provides the target nucleic acid or protein. The "capture" nucleic
acid or protein and "signal" nucleic acid or protein hybridize with
or bind to the target nucleic acid or protein to form a "sandwich"
hybridization complex. To be effective, the signal nucleic acid or
protein cannot hybridize or bind substantially with the capture
nucleic acid or protein.
[0085] Typically, oligonucleotide probes are labeled signal nucleic
acids that are used to detect hybridization. Complementary probe
nucleic acids or signal nucleic acids may be labeled by any one of
several methods typically used to detect the presence of hybridized
polynucleotides. Methods of detection can use labels for
autoradiography or autofluorography, such as .sup.3H, .sup.125I,
.sup.35S, .sup.14C, or .sup.32P-labeled probes or the like (see
definition of label, above). Other labels include ligands which
bind to labeled antibodies, fluorophores, chemiluminescent agents,
enzymes, and antibodies which can serve as specific binding pair
members for a labeled ligand.
[0086] Detection of a hybridization complex may require the binding
of a signal generating complex to a duplex of target and
probe-polynucleotides or nucleic acids. Typically, such binding
occurs through ligand and anti-ligand interactions as between a
ligand-conjugated probe and an anti-ligand conjugated with a
signal, i.e., antibody-antigen or complementary nucleic acid
binding. The label may also allow indirect detection of the
hybridization complex. For example, where the label is a hapten or
antigen, the sample can be detected by using antibodies. In these
systems, a signal is generated by attaching fluorescent or
enzymatic molecules to the antibodies or, in some cases, by
attachment of a radioactive label. The sensitivity of the
hybridization assays may be enhanced through use of a target
nucleic acid or signal amplification system which multiplies the
target nucleic acid or signal being detected. These systems can be
used to directly identify PRE variations, polymorphisms, or mutated
sequences. Alternatively, the specific sequences can be amplified
using, e.g., generic PCR primers, and the amplified target region
later probed or sequenced to identify a specific sequence
indicative of the variant, polymorphism or mutation.
[0087] Nucleic acid hybridization assays for the detection of
isoforms, mutations and for sequencing can also be performed in an
array-based format. Arrays are a multiplicity of different "probe"
or "target" nucleic acids (or other compounds) are hybridized
against a target nucleic acid. In this manner a large number of
different hybridization reactions can be run essentially "in
parallel". This provides rapid, essentially simultaneous,
evaluation of a wide number of reactants. Methods of performing
hybridization reactions for detection and sequencing in array based
formats are well known, e.g. Pastinen (1997) Genome Res. 7:606-614;
Jackson (1996) Nature Biotechnology 14:1685; Chee (1995) Science
274:610.
[0088] An alternative means for determining the level of expression
of a gene is in situ hybridization. In situ hybridization assays
are well known (e.g., Angerer (1987) Methods Enzymol 152:649). In a
typical in situ hybridization assay, cells are fixed to a solid
support, typically a glass slide. If a nucleic acid is to be
probed, the cells are typically denatured with heat or alkali. The
cells are then contacted with a hybridization solution at a
moderate temperature to permit annealing of labeled probes specific
to the nucleic acid sequence. The probes are typically labeled,
i.e., with radioisotopes or fluorescent reporters. Another
well-known in situ hybridization technique is the so-called
fluorescence in situ hybridization (FISH), see, e.g., Macechko
(1997) J. Histochem. Cytochem. 45:359-363; Raap (1995) Hum. Mol.
Genet. 4:529-534.
[0089] The sensitivity of the hybridization assays may be enhanced
through use of a nucleic acid amplification system which multiplies
the target nucleic acid being detected. Alternatively, the select
sequences can be generally amplified using nonspecific PCR primers
and the amplified target region later probed for a specific
sequence indicative of a mutation.
[0090] Oligonucleotides for use as probes, e.g., in vitro
amplification methods, as gene probes in diagnostic methods, or as
inhibitor components (see below) are typically synthesized
chemically; e.g., such as by the solid phase phosphoramidite
triester method described by Beaucage and Caruthers, supra, or,
using an automated synthesizer, as described in
Needham-VanDevanter, supra. Purification of oligonucleotides, where
necessary, is typically performed by native acrylamide gel
electrophoresis or by anion-exchange HPLC as described in Pearson
and Regnier. The sequence of the synthetic oligonucleotides can be
verified using the chemical degradation method of Maxam and Gilbert
(Maxam (1980) supra).
[0091] It will be appreciated that nucleic acid hybridization
assays can also be performed in an array-based format. In this
approach, arrays bearing a multiplicity of different "probe"
nucleic acids are hybridized against a target nucleic acid. In this
manner a large number of different hybridization reactions can be
run essentially "in parallel". This provides rapid, essentially
simultaneous, evaluation of a wide number of reactants. Methods of
performing hybridization reactions in array based formats are well
known to those of skill in the art (see, e.g., Jackson (1996)
Nature Biotechnol. 14:1685, and Chee (1995) Science 274:610).
[0092] 6. Sequence Comparison Analysis
[0093] PRE-encoding nucleic acid sequences of the invention include
both genes and gene transcription products (mRNA) identified and
characterized by analysis of PRE sequences. Optimal alignment of
sequences for comparison can be conducted as described herein (see
definitions). Sequence identity analysis can also supplement
functional analysis to determine whether a nucleic acid is within
scope of the invention. For example, in other embodiments, a PRE
sequence of the invention has at least 80% nucleic-acid sequence
identity to SEQ ID NO:1, has at least 90% nucleic acid sequence
identity to the sequence as set forth in SEQ ID NO:1, or can
comprise a sequence as set forth in SEQ ID NO:1. Publicly available
nucleic acid databanks can be searched for sequence identity
(homology) to the exemplary SEQ ID NO:1 PRE of the invention to
identify additional members of the PRE family of the invention. Any
of the programs described herein (see definitions) can be used to
identify PRE family members.
[0094] For example, the program PileUp was used to identify a PRE
of the invention. PILEUP creates a multiple sequence alignment from
a group of related sequences using progressive, pairwise alignments
to show relationship and percent sequence identity. It also plots a
tree or dendogram showing the clustering relationships used to
create the alignment. PILEUP uses a simplification of the
progressive alignment method of Feng & Doolittle (1987) supra;
see also the method of Higgins & Sharp (1989) supra. The
program can align up to 300 sequences, each of a maximum length of
5,000 nucleotides or amino acids. The multiple alignment procedure
begins with the pairwise alignment of the two most similar
sequences, producing a cluster of two aligned sequences. This
cluster is then aligned to the next most related sequence or
cluster of aligned sequences. Two clusters of sequences are aligned
by a simple extension of the pairwise alignment of two individual
sequences. The final alignment is achieved by a series of
progressive, pairwise alignments. The program is run by designating
specific sequences and their amino acid or nucleotide coordinates
for regions of sequence comparison and by designating the program
parameters. For example, a reference sequence can be compared to
other test sequences to determine the percent sequence identity
relationship using the following parameters: default gap weight
(3.00), default gap length weight (0.10), and weighted end gaps.
See also Morrison (1997) supra, for the use of PILEUP.
[0095] PileUP was used with the parameters: symbol comparison
table: GenRunData:pileupdna.cmp, GapWeight:2, GapLength Weight:1
(see Example 1) to identify a PRE of the invention. The following
PRE sequence thus identified is within the scope of the invention,
having about 83% sequence identity to SEQ ID NO:1: AGGAGTTGCA
AGGCTAAGC X ACTGCACAGG AGAGG X TCTG CGG XX TATAA CGACTTTCTC
CTGGGAGATA AGTCATCTTG CATGAAGGTT CTATG X TCAT, where X is any
nucleotide (SEQ ID NO:6).
[0096] The BLAST program can also be used to identify a PRE family
member by sequence identity. For example, BLAST can uses as
defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix (see
Henikoff (1992) Proc. Natl. Acad. Sci. USA 89:10915-10919)
alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a
comparison of both strands. The term BLAST refers to the BLAST
algorithm which performs a statistical analysis of the similarity
between two sequences; see, e.g., Karlin (1993) Proc. Natl. Acad.
Sci. USA 90:5873-5787. One measure of similarity provided by the
BLAST algorithm is the smallest sum probability (P(N)), which
provides an indication of the probability by which a match between
two nucleotide or amino acid sequences would occur by chance.
II. Functional Analyses: Measuring Levels of Viral Expression
[0097] Functional analysis can supplement sequence identity
analysis to determine whether a nucleic acid is within scope of the
invention and to characterize the level of attenuation effected by
the PRE. For example, cell cultures or activated PMBCs can be
infected in vitro with PRE-containing recombinant viruses of the
invention. The level of attenuation can be determined by measuring
the amounts of total virion or virus product produced. Viral
products include polypeptides (e.g., p24.sup.gag) and transcription
products (mRNA message). Viral polypeptides can can be quantitated
by e.g., antibody based assays, enzymatic assays, and the like. A
variety of standard protocols for detecting and measuring the
expression of proteins using either polyclonal or monoclonal
antibodies specific for the protein are known in the art. Examples
include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay
(RIA) and fluorescent activated cell sorting (FACS). These and
other assays are described, e.g., in Hampton et al., Serological
Methods a Laboratory Manual, APS Press, St Paul Minn., 1990);
Maddox (1983) J. Exp. Med. 158:1211); Coligan, CURRENT PROTOCOLS IN
IMMUNOLOGY, Wiley/Greene, NY (1991); Stites (eds.) BASIC AND
CLINICAL IMMUNOLOGY (7th ed.) Lange Medical Publications, Los
Altos, Calif.; Goding, MONOCLONAL ANTIBODIES: PRINCIPLES AND
PRACTICE (2d ed.) Academic Press, New York, N.Y. (1986).
Polypeptides can be isolated and then quantitated. Protein
concentrations can be determined using any technique, e.g., as in
Bradford (1976) Anal. Biochem. 72:248-257. Nucleic acid products
can be quantitated by, e.g., hybridization, PCR, and the like, as
described herein.
[0098] When the PRE-containing hybrid HIV-1 virus infects activated
huPBMCs, the level of expression of HIV-1 p24.sup.gag is between
about 5 fold and about 200 fold less than levels of p24.sup.gag
expression when HIV-1 wild type virus infects activated huPBMCs.
Levels of p24.sup.gag expression can be measured by any means known
in the art, such as, e.g., antibody based assays, as ELISA assays.
For example, virus propagation can be monitored over time using a
p24.sup.gag antigen capture ELISA assay. A commercial ELISA assay
(Cellular Products, Buffalo, N.Y.) used according to manufacturer's
instructions or any p24.sup.gag antigen capture assay using
techniques well known in the art can be used (see, e.g., Zolotukhin
(1994) supra; Van Doornum (1998) J. Med. Virol. 54:285-290; Hashida
(1998) J. Clin. Lab. Anal. 12:115-120; Palenzuela (1997) J.
Immunol. Methods 208:43-48).
III. Mutagenesis of PRE Nucleic Acid
[0099] The invention also provides for PRE nucleic acid that have
been modified in a site-specific manner to modify, add to, or
delete some or all functions. For example, specific base pairs can
be modified to alter, increase or decrease the affinity of NCTE
binding proteins, thus modifying the relative level of attenuation.
Alternatively, modifications can change the stability of the
secondary structure of the nucleic acid. Base pair changes can
augment expression of the nucleic acid in a cell, such as a
bacteria.
[0100] Site-specific mutations can be introduced into PRE-encoding
nucleic acid by a variety of conventional techniques, well
described in the scientific and patent literature. Illustrative
examples include: site-directed mutagenesis by overlap extension
polymerase chain reaction (OE-PCR), as in Urban (1997) Nucleic
Acids Res. 25:2227-2228; Ke (1997) Nucleic Acids Res 25:3371-3372;
Chattopadhyay (1997) Biotechniques 22:1054-1056, describing
PCR-based site-directed mutagenesis "megaprimer" method; Bohnsack
(1997) Mol. Biotechnol. 7:181-188; Ailenberg (1997) Biotechniques
22:624-626, describing site-directed mutagenesis using a PCR-based
staggered re-annealing method without restriction enzymes; and
Nicolas (1997) Biotechniques 22:430-434, describing site-directed
mutagenesis using long primer-unique site elimination and
exonuclease III.
[0101] Modified PRE of the invention can be further produced by
chemical modification methods, see, e.g., Belousov (1997) Nucleic
Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med.
19:373-380; Blommers (1994) Biochemistry 33:7886-7896.
IV. Expression of PRE Nucleic Acid
[0102] The invention provides for methods and reagents the
expression of novel PRE nucleic of the invention in any
prokaryotic, eukaryotic, yeast, fungal, plant, insect, human or
animal cell. Antisense, in addition to sense, sequences are
provided. To create cell-based and in vitro assay systems to screen
for novel NCTEs using PRE of the invention, a variety of in vivo
and in vitro expression systems are provided.
[0103] A. Vectors and Transcriptional Control Elements
[0104] The invention provides for methods and reagents for
expressing the novel PRE of the invention as sense or antisense
coding sequences, or in other constructs, such as ribozymes. Other
embodiments of the invention provide methods and reagents for
identifying, isolating and using PRE to identify and isolate
trans-acting NCTE binding proteins. After the coding region of a
PRE has been identified, it can be expressed by operably linking
the coding region to transcriptional regulatory elements, such as
promoters and enhancers. These sequences have characteristic
subsequences, for instance, promoter sequence elements typically
include the TATA box consensus sequence (TATAAT), which is usually
20 to 30 base pairs upstream of the transcription start site.
Promoters can be tissue-specific or not, constitutive or inducible.
Promoters that drive expression continuously under physiological
conditions are referred to herein as "constitutive" promoters and
are active under most environmental conditions and states of
development or cell differentiation. Typical expression systems,
such as expression cassettes and vectors, also contain
transcription and translation terminators, transcription and
translation initiation sequences. Generic expression cassettes
typically contain at least one independent terminator sequence,
sequences permitting replication of the cassette in eukaryotes, or
prokaryotes, or both, (e.g., shuttle vectors) and selection markers
for both prokaryotic and eukaryotic systems. See, e.g., Roberts
(1987) Nature 328:731; Berger ((1987) supra; Schneider (1995)
Protein Expr. Purif. 6435:1.0; Sambrook and Ausubel. Product
information from manufacturers of biological reagents and
experimental equipment also provide biological methodologies, such
as, e.g., the SIGMA Chemical Company (Saint Louis, Mo.), Pharmacia
Biotech (Piscataway, N.J.), Clontech Laboratories, Inc. (Palo Alto,
Calif.), Aldrich Chemical Company (Milwaukee, Wis.), GIBCO BRL Life
Technologies, Inc. (Gaithersburg, Md.), Fluka Chemica-Biochemika
Analytika (Fluka Chemie A G, Buchs, Switzerland). The promoters and
vectors used in this invention can be isolated from natural
sources, obtained from such sources as ATCC or GenBank libraries,
or prepared by synthetic methods, as described herein.
[0105] The PRE sequences of the invention can be expressed in
cassettes or vectors which are transiently expressed in cells
using, e.g., episomal vectors such as, vaccinia virus, see Cooper
(1997) Proc Natl Acad Sci USA 94:6450-6455. They can include
sequences coding for episomal maintenance and replication such that
integration into the host genome is not required. Alternatively,
PRE coding sequences can be inserted into the host cell genome
becoming an integral part of the host chromosomal DNA, using, e.g.,
retroviral vectors such as SIV or HIV, see e.g., Naldini (1996)
Science 272:263-267. Expression vectors can contain selection
markers that confer a selectable phenotype on transformed cells.
For example, a marker may encode antibiotic resistance, as to
chloramphenicol, kanamycin, G418, bleomycin or hygromycin, to
permit selection of those cells transformed with the desired DNA
sequences, see, e.g., Blondelet-Rouault (1997) Gene 190:315-317.
Because selectable marker genes conferring resistance to substrates
like neomycin or hygromycin can only be utilized in tissue culture,
chemoresistance genes are also used as selectable markers in vitro
and in vivo. Various target cells are rendered resistant to
anticancer drugs by transfer of chemoresistance genes encoding,
e.g., P-glycoprotein, multidrug resistance-associated
protein-transporter, dihydrofolate reductase,
glutathione-S-transferase, O 6-alkylguanine DNA alkyltransferase,
or aldehyde reductase (Licht (1997) Stem Cells 15:104-111).
Illustrative vectors incorporating PRE of the invention include,
e.g., adenovirus-based vectors (Cantwell (1996) Blood 88:4676-4683;
Ohashi (1997) Proc Natl Acad Sci USA 94:1287-1292), Epstein-Barr
virus-based vectors (Mazda (1997) J Immunol Methods 204:143-151),
adenovirus-associated virus vectors, Sindbis virus vectors (Strong
(1997) Gene Ther. 4: 624-627), Herpes simplex virus vectors
(Kennedy (1997) Brain 120: 1245-1259) and retroviral vectors
(Schubert (1997) Curr Eye Res 16:656-662). Epstein-Barr virus
episomal vectors (Horlick (1997) Protein Expr. Purif. 9:301-308,
and plasmid DNA (Lowrie (1997) Vaccine 15: 834-838); all of which
can be used to express the nucleic-acids of the invention in vivo
or ex vivo
V. Inhibiting Expression of PRE Nucleic Acid
[0106] The invention further provides for nucleic acids which can
inhibit the expression or function of PRE nucleic acids. These
inhibitory nucleic acids are typically complementary to, i.e., are
antisense sequences to, the PRE of the invention. Expression of
inhibitory nucleic acid sequences can be used to completely inhibit
or further depress the replicative potential of an attenuated
virus. For example, a hybrid HIV-1 virus can be designed to express
inhibitory nucleic acid sequence under the control of an inducible
promoter. Thus, if desired, after administration of a
PRE-attenuated viral vaccine, the expression and function of the
sense PRE, and thus the replicative potential of the virus, can be
down-regulated or turned off.
[0107] The inhibition can be effected through the targeting of
genomic DNA or messenger RNA. The transcription or function of
targeted nucleic acid can be inhibited, for example, by
hybridization and/or cleavage. One particularly useful set of
inhibitors provided by the present invention includes
oligonucleotides which are able to either bind PRE gene or message,
in either case preventing or inhibiting the production, splicing,
transport, or function of viral message. The association can be
though sequence specific hybridization. Another useful class of
inhibitors includes oligonucleotides which cause inactivation or
cleavage of PRE-containing message. The oligonucleotide can have
enzyme activity which causes such cleavage, such as ribozymes. The
oligonucleotide can be chemically modified or conjugated to an
enzyme or composition capable of cleaving the complementary nucleic
acid. One may screen a pool of many different such oligonucleotides
for those with the desired activity.
[0108] 1. Antisense Oligonucleotides
[0109] The invention provides for with antisense oligonucleotides
capable of binding PRE-containing message to inhibit or further
depress the replicative potential of a PRE containing attenuated
virus. Strategies for designing antisense oligonucleotides are well
described in the scientific and patent literature, and the skilled
artisan can design such PRE complementary oligonucleotides using
the novel reagents of the invention. In some situations, naturally
occurring nucleic acids used as antisense oligonucleotides may need
to be relatively long (18 to 40 nucleotides) and present at high
concentrations. A wide variety of synthetic, non-naturally
occurring nucleotide and nucleic acid analogues are known which can
address this potential problem. For example, peptide nucleic acids
(PNAs) containing non-ionic backbones, such as
N-(2-aminoethyl)glycine units can be used. Antisense
oligonucleotides having phosphorothioate linkages can also be used,
as described in WO 97/03211; WO 96/39154; Mata (1997) Toxicol Appl
Pharmacol 144:189-197; Antisense Therapeutics, ed. Agrawal (Humana
Press, Totowa, N.J., 1996). Antisense oligonucleotides having
synthetic DNA backbone analogues provided by the invention can also
include phosphoro-dithioate, methylphosphonate, phosphoramidate,
alkyl phosphotriester, sulfamate, 3'-thioacetal,
methylene(methylimino), 3'-N-carbamate, and morpholino carbamate
nucleic acids, as described above.
[0110] Combinatorial chemistry methodology can be used to create
vast numbers of oligonucleotides that can be rapidly screened for
specific oligonucleotides that have appropriate binding affinities
and specificities toward any target, such as the sense and
antisense PRE sequences of the invention (for general background
information, see, e.g., Gold (1995) J. of Biol. Chem.
270:13581-13584).
[0111] 2. Inhibitory Ribozymes
[0112] The invention provides for with ribozymes capable of
targeting PRE-containing message to inhibit, e.g., the splicing,
transport, protein-binding capacity, or translation of viral mRNA,
for further attenuating a PRE-containing hybrid virus. Strategies
for designing ribozymes and selecting PRE antisense sequence for
targeting are well described in the scientific and patent
literature, and the skilled artisan can design such ribozymes using
the novel reagents of the invention. Ribozymes act by binding to a
target RNA through the target RNA binding portion of a ribozyme
which is held in close proximity to an enzymatic portion of the RNA
that cleaves the target RNA. Thus, the ribozyme recognizes and
binds a target RNA through complementary base-pairing, and once
bound to the correct site, acts enzymatically to cleave and
inactivate the target RNA. For example, ribozyme cleavage of
PRE-containing message would prevent binding to NCTE binding
protein, thus preventing subsequent transport of the message to the
cytoplasm. After a ribozyme has bound and cleaved its RNA target,
it is typically released from that RNA and so can bind and cleave
new targets repeatedly.
[0113] The effective concentration of ribozyme necessary to effect
a therapeutic treatment can be lower than that of an antisense
oligonucleotide. This potential advantage reflects the ability of
the ribozyme to act enzymatically. Thus, a single ribozyme molecule
is able to cleave many molecules of target RNA. In addition, a
ribozyme is typically a highly specific inhibitor, with the
specificity of inhibition depending not only on the base pairing
mechanism of binding, but also on the mechanism by which the
molecule inhibits the expression of the RNA to which it binds. That
is, the inhibition is caused by cleavage of the RNA target and so
specificity is defined as the ratio of the rate of cleavage of the
targeted RNA over the rate of cleavage of non-targeted RNA. This
cleavage mechanism is dependent upon factors additional to those
involved in base pairing. Thus, the specificity of action of a
ribozyme can be greater than that of antisense oligonucleotide
binding the same RNA site.
[0114] The enzymatic ribozyme RNA molecule can be formed in a
hammerhead motif, but may also be formed in the motif of a hairpin,
hepatitis delta virus, group I intron or RNaseP-like RNA (in
association with an RNA guide sequence). Examples of such
hammerhead motifs are described by Rossi (1992) Aids Research and
Human Retroviruses 8:183; hairpin motifs by Hampel (1989)
Biochemistry 28:4929, and Hampel (1990) Nuc. Acids Res. 18:299; the
hepatitis delta virus motif by Perrotta (1992) Biochemistry 31:16;
the RNaseP motif by Guerrier-Takada (1983) Cell 35:849; and the
group I intron by Cech U.S. Pat. No. 4,987,071. The recitation of
these specific motifs is not intended to be limiting; those skilled
in the art will recognize that an enzymatic RNA molecule of this
invention has a specific substrate binding site complementary to
one or more of the target gene RNA regions, and has nucleotide
sequence within or surrounding that substrate binding site which
imparts an RNA cleaving activity to the molecule.
VI. Construction of Attenuated Virus and Viral Vaccine
[0115] The invention provides for an attenuated retrovirus and
vaccine comprising the PRE of the invention. One means to
genetically engineer a wild-type, virulent virus to a hybrid,
attenuated virus involves constructing a virus which either lacks
or has a non-functional endogenous post-transcriptional RNA
nucleo-cytoplasmic transport elements (NCTEs). The endogenous NCTE
is subsequently replaced by the exogenous NCTE of the invention
which functions less efficiently in vivo than its wild-type
counterpart, thus effecting the attenuation. For example, insertion
of the PRE of the invention in a RRE(-) and/or Rev(-) HIV-1 creates
a slower growing, "attenuated" hybrid virus. This level of
attenuation can be measured. When the PRE-containing hybrid HIV-1
virus infects activated huPBMCs, the level of expression of HIV-1
p24.sup.gag is between about 5-fold and about 200 fold less than
levels of p24.sup.gag expression when HIV-1 wild type virus,
utilizing wild-type NCTE, infects activated huPBMCs. Furthermore,
in constructing the attenuated retrovirus of the invention,
additional elements of the retrovirus which are essential for its
replication and/or pathogenicity can also be disabled or
eliminated, such as Nef, as explained below.
[0116] In normal mammalian cells, message RNA, present in the cell
as ribonucleoprotein (RNP) complexes, is only exported from the
nucleus to the cytoplasm after splicing is completed. To circumvent
the requirement of splicing prior to export from the nucleus, all
retroviruses have evolved a mechanism that allows the nuclear
export of unspliced form of viral RNAs which are necessary for the
production of structural proteins and essential for viral
replication. This mechanism involves the highly structured NCTE
cis-acting RNA element and its corresponding trans-acting RNA
binding proteins, as discussed above. In simian type retroviruses,
the NCTE is termed "CTE" (see Bray (1994) supra; Zolotukhin (1994)
supra), and binds to endogenous cellular RNA binding proteins. In
contrast, HIV-1's NCTE does not bind cellular NCTE-binding
proteins. It encodes its own NCTE binding protein, called "Rev."
Rev interacts with a specific HIV-1 NCTE sequence, designated the
"Rev-responsive element," or "RRE," contained in its gag/pol and
env encoding transcript. Rev interacts directly with RRE as part of
the RNA export machinery which transports RRE-containing
transcripts to the cytoplasm from the nucleus. As a result, HIV-1
needs both RRE and Rev to produce infectious virus. Disabling
either produces a non-replicative, non-virulent virus. Replacing
(i.e., reconstituting) HIV-1's RRE/Rev RNA transport mechanism with
a less efficient NCTE, such as the PRE of the invention, produces
an attenuated and avirulent hybrid virus.
[0117] To engineer a non-functional RRE and/or Rev, the skilled
artisan can delete and or mutate any portion of the RRE or Rev
coding sequence. Means to delete or mutate nucleic acid sequence
are described herein, and are well known in the art. Construction
of exemplary, attenuated retroviruses are also discussed in the
Examples, below. RRE and Rev sequences are well known in the art,
e.g., see databases, such as the NCBI database at
http://www.ncbi.nim.nih.gov/Entrez/nucleotide.html or
http://www.ncbi.nlm.nih.gov/Entrez/protein.html. Further
description and sequence of HIV-1 Rev can be found in, e.g.,
Salminen (1997) J. Virol. 71:2647-2655, Accession U86770; Theodore
(1996) AIDS Res. Hum. Retroviruses 12:191-194, Accession AF004394;
Fang, et al., Accession AF003887; Howard (1996) AIDS Res. Hum.
Retroviruses 12:1413-1425, Accession L39106; to name only a few.
Further description and sequence of HIV-1 RRE can be found in,
e.g., Salminen (1996) JOURNAL AIDS Res. Hum. Retroviruses
12:1329-1339, Accession U46016; WO 9202228-A5 20 Feb. 1992,
Accession A20711; Battiste (1994) Biochemistry 33:2741-2747;
Battiste (1.995) J. Biomol. NMR 6:375-389; Battiste (1996) Science
273:1547-1551; to name just a few.
[0118] The PRE of the invention can be inserted at any position in
the disabled (lacking an endogenous NCTE) retroviral genome as long
as the insertion does not inactivate the virus. The point of
insertion can be designed or altered to modify the level of
attenuation for a given PRE. In one embodiment of the invention,
the PRE is inserted in the 3' untranslated region of a disabled
retrovirus. In alternative embodiments, the PRE is inserted in the
region of the disabled NCTE sequence (e.g., RRE in HIV-1) or the
Nef region. Each potential point of insertion must be investigated
individually for efficacy and level of attenuation. For example, as
described in Example 1, the PRE of SEQ ID NO:1 has been inserted in
the Nef region of a disabled HIV-1 construct, at nucleotide (nt)
8887 of pNL4-3 (as described in Example 1) to successfully generate
a PRE-attenuated virus. However, when the site of insertion was at
nt 8786, located between the env and nef genes, the hybrid failed
to generate infectious virus. Thus, each insertion site must be
individually tested for its ability to accept a PRE sequence to
generate an infectious and non-pathogenic hybrid.
[0119] To further engineer and modify a desired levels of
nucleo-cytoplasmic transport, message stability, rate of virion
growth, levels of attenuation, and the like, more that one PRE, or
different PREs, or both, can be inserted into a given retroviral
construct.
[0120] In constructing the attenuated retroviruses and vaccines of
the invention, in addition to endogenous. NCTE, other elements
essential for the virus' replication and/or pathogenicity can also
be disabled or eliminated. For example, genetic engineering of a
Nef-negative retrovirus may produce a recombinant hybrid with a
greater degree of attenuation. In the case of HIV-1, a functional
Nef gene is important for development of high viremia and AIDS.
Animals infected with Nef-deleted attenuated viruses are resistant
to subsequent challenge with pathogenic wild-type viruses. Some
individuals with long-term nonprogressive HIV-1 infection (no
clinical or immunological signs of immuno-deficiency despite being
HIV seropositive for over a decade) are infected with viruses
having naturally occurring Nef deletions. To engineer a
non-functional Nef, the skilled artisan can delete and or mutate
any portion of the Nef coding sequence. Nef sequences are well
known in the art, e.g., see databases, such as the NCBI databases
described above. For examples of HIV-1 Nef nucleic acid and
polypeptide sequences, see, e.g., Accession Nos. Y15123, U88826,
Y15121, Y15120, Y15116, to name only a few. For a further
description of Nef, see, e.g., Saksela (1997) supra; Greenberg
(1997) supra; Luo (1997) J. Virol. 71:9531-9537; Luo (1997) J.
Virol. 71:9524-9530; Okada (1997) supra.
VII. Delivery of Nucleotides into Cells
[0121] The nucleic acids and oligonucleotides of the invention,
including expression cassettes and vectors expressing PRE, can be
delivered into cells in culture, tissues and organisms for
synthesis, mutation, screening and the like. For example, the
invention provides for a method for screening for a
post-transcriptional RNA nucleo-cytoplasmic transport element
(NCTE) binding protein. The method involves contacting a PRE of the
invention with a test compound and measuring the ability of the
test compound to bind the NCTE. This screening technique can be
used in intact cells. Inhibitory oligonucleotides of the invention,
and vectors capable of expressing these sequences, are also
transferred into intact cells in cell culture, tissues or intact
organisms.
[0122] The nucleic acids and oligonucleotides of the invention can
be transferred into a cell using a variety of techniques well known
in the art. For example, oligonucleotides can be delivered into the
cytoplasm spontaneously, without specific modification.
Alternatively, they can be delivered by the use of liposomes which
fuse with the cellular membrane or are endocytosed, i.e., by
employing ligands attached to the liposome, or attached directly to
the oligonucleotide, that bind to surface membrane protein
receptors of the cell resulting in endocytosis. For example, a DNA
binding protein, e.g., HBGF-1, is known to transport
oligonucleotides into a cell. See, e.g., Tseng (1997) J. Biol.
Chem. 272:25641-25647; Satoh (1997) Biochem. Biophys. Res. Commun.
238:795-799, describing efficient gene transduction by
Epstein-Barr-virus-based vectors coupled with cationic liposome and
HVJ-liposome. Displaying ligands specific for target cells on the
surface of a liposome targets the construct to a specific cell or
organ in vivo. See, e.g., Huwyler (1997) J. Pharmacol. Exp. Ther.
282:1541-1546, describing receptor mediated delivery using
immunoliposomes.
[0123] Cells can also be permeabilized to enhance transport of
oligonucleotides into the cell, without injuring the host cells.
See, e.g., Verspohl (1997) Cell. Biochem. Funct. 15:127-134; Kang
(1997) Pharm. Res. 14:706-712; Bashford (1994) Methods Mol. Biol.
27, 295-305, describing use of bacterial toxins for membrane
permeabilization; and for general principles of membrane
permeabilization, see, e.g., Hapala (1997) Crit. Rev. Biotechnol.
17:105-122.
VIII. Preparation, Formulation and Administration of Attenuated
Viral Vaccines
[0124] Live PRE-attenuated retrovirus, such as HIV-1, can be grown
and harvested from activated human peripheral mononuclear cells or
from a variety of tissue culture cells, such as human 293 cell
line, as described herein; see also, e.g., Eberlein (1991) Virus
Res. 19:153-161; Parente (1996) Gene Ther. 3:756-760; Margolis
(1997) AIDS Res. Hum. Retroviruses 13:1411-1420. Virion-containing
supernatants are collected, and, typically, filtered. PRE sequences
in the harvested, attenuated virus for use in vaccine formulations
can be confirmed by conventional sequencing. The attenuated virus
can be further purified, e.g., by ultrafiltration or
ultra-centrifugation. The live, attenuated virus can be stored,
e.g., by refrigeration, or on a long-term basis, by freezing in
liquid nitrogen.
[0125] A formulation for administering the virus as a vaccine is
prepared using, e.g., any physiologically acceptable buffer, such
as saline or phosphate buffered saline (PBS). This can be stored in
a frozen state. The formulation can also be freeze-dried, stored at
room temperature, and reconstituted by adding appropriate volume of
buffer. The vaccine pharmaceutical formulation can be in the form
of a sterile injectable preparation, such as a sterile injectable
aqueous or oleaginous suspension. This suspension can be formulated
according to the known art using those suitable dispersing or
wetting agents and suspending agents which have been mentioned
above. The sterile injectable preparation can also be a solution or
suspension in a nontoxic parenterally-acceptable diluent or
solvent, such as a solution of 1,3-butanediol. Among the acceptable
vehicles and solvents that can be employed are water and Ringer's
solution, an isotonic sodium chloride. In addition, sterile fixed
oils can conventionally be employed as a solvent or suspending
medium. For this purpose any bland fixed oil can be employed
including synthetic mono- or diglycerides. In addition, fatty acids
such as oleic acid can likewise be used in the preparation of
injectables.
[0126] The PRE-containing attenuated virus and vaccine formulations
can also be co-administered with other reagents to boost or
otherwise augment the anti-viral immune response. For example, they
can be administered with an adjuvant, e.g., oil-in-water
microemulsions or polymeric microparticles. Oil-in-water
microemulsions are potent and safe adjuvants in humans and have
been used with HSV-2, HIV-1 and influenza virus vaccines.
Microparticles can be prepared from the biodegradable polymers,
e.g., poly(lactide-co-glycolides). See, e.g., O'Hagan (1998) J.
Pharm Pharmacol. 50:1-10.
[0127] The live attenuated viral vaccine of the invention can be
administered using any acceptable route, as, e.g., by application
to a mucosal surface, by injection, by inhalation (such as by
aerosol) or other intranasal route, or by ingestion. For examples
of inhalants, see Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193;
Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111; Femandez-de
Castro (1997) Salud Publica Mex 39:53-60. Injection of vaccine can
be intravenous or intramuscular; see, e.g., Groswasser (1997)
Pediatrics 100:400-403, as example of injection techniques for
efficient intramuscular vaccine delivery. Administration by
application to any mucosal surface, including, e.g., intraoral
(sublingual, buccal, and the like), intranasal, intrarectal,
intravaginal, or ocular. For examples of mucosal administration
methods, see, e.g., Staats (1997) AIDS Res Hum Retroviruses
13:945-952; Okada (1997) J. Immunol. 159:3638-3647; Wu (1997) AIDS
Res Hum Retroviruses 13:1187-1194.
[0128] The amount of virus (number of virions) per dose will vary
depending on results of different titrations used in clinical
trials. The range can range, e.g., from only a few infectious
units, to about 10.sup.4 to 10.sup.10 infectious units (i.e.,
virions) per dose. Protocols and means to determine safety and
efficacy used for other attenuated vaccines can be adapted and used
with the novel reagents provided by the invention; see, e.g.,
Belshe (1998) N. Engl. J. Med. 338:1405-1412; Gruber (1997) Vaccine
15:1379-1384; Tingle (1997) Lancet 349:1277-1281; Varis (1996) J.
Infect. Dis. 174:S330-S334; Gruber (1996) J. Infect. Dis.
173:1313-1319.
[0129] After the vaccine has formulated in an acceptable carrier,
it can be placed in an appropriate container and labeled. For
administration of the vaccine, such labeling would include, e.g.,
instructions concerning the amount, frequency and method of
administration. In one embodiment, the invention provides for a kit
and instructional material teaching the indications, dosage and
schedule of administration of the vaccine.
[0130] Selection of individuals who would benefit from receiving
the live, attenuated vaccine of the invention include, but are not
limited to, individuals who have a high risk of being exposed to
HIV, such as intravenous drug users, individuals who may been
exposed, as through a needle stick or transfusion, and individuals
whose exposure to the virus has been confirmed, e.g., by a positive
blood test.
[0131] The vaccine can be administered in conjunction with other
treatment regimens, e.g., it can be coadininistered or administered
before or after any anti-viral pharmaceutical (see, e.g., Moyle
(1998) Drugs 55:383-404) or a killed (completely inactivated)
anti-HIV vaccine. The vaccine can be administered in any form of
schedule regimen, e.g., in a single dose, or, using several doses
(e.g., boosters) at dosages and time intervals to be determined by
clinical trials.
[0132] The attenuated vaccine of the invention is considered
efficacious, i.e., immunoprotective, if it elicits any protective
or ameliorative humoral or cell-mediated anti-HIV response.
Preferably, the vaccine of the invention will cause no side
effects, clinically significant pathology, acceleration of onset of
symptoms, further dissemination of virus in the body, and the like.
The anti-HIV response can be assessed by any parameter, e.g., by
measuring the levels of anti-viral antibodies or HIV-specific T
cells, the amount of HIV virion or nucleic acid in the blood or
lymph nodes (see, e.g., Brown (1997) Transfusion 37:926-929), the
levels of circulating helper (CD4.sup.+) T cells, and the like. See
also, O'Brien (1997) "Changes in plasma HIV RNA levels and
CD4.sup.+ lymphocyte counts predict both response to antiretroviral
therapy and therapeutic failure," Ann. Intern. Med. 126:939-945;
Hughes (1997) "Monitoring plasma HIV-1 RNA levels in addition to
CD4.sup.+ lymphocyte count improves assessment of antiretroviral
therapeutic response," Ann. Intern. Med. 126:929-938; Burgisser
(1997) "Monitoring responses to antiretroviral treatment in human
immunodeficiency virus type 1 (HIV-1)-infected patients by serial
lymph node aspiration," J. Infect. Dis. 175:1202-1205.
IX. Screening for NCTE Binding Proteins Using PRE
[0133] The invention provides for cell-based and in vitro assay
systems to screen for novel NCTE-binding proteins using the PRE of
the invention. The full-length PRE can be utilized, or,
alternatively, a portion of a PRE can be used to assay for NCTE
binding proteins. One embodiment of the invention provides for a
method of screening for an NCTE binding protein by contacting a PRE
of the invention with a test compound and measuring the ability of
the test compound to bind the NCTE. Many assays are available that
screen for nucleic acid binding proteins and all can be adapted and
used with the novel reagents provided for by the invention. A few
illustrative example are set forth below.
[0134] A variety of well-known techniques can be used to identify
polypeptides which specifically bind to nucleic acids, such as PRE.
For example, mobility shift DNA-binding assays, methylation and
uracil interference assays, DNase and hydroxy radical footprinting
analysis, fluorescence polarization, and UV crosslinking or
chemical cross-linkers, can be used. For a general overview of
protein-nucleic acid binding assays, see, e.g., Ausubel (chapter
12, DNA-Protein Interactions).
[0135] One technique for isolating co-associating proteins,
including nucleic acid and DNA/RNA binding proteins, includes use
of UV crosslinking or chemical cross-linkers, including, e.g.,
cleavable cross-linkers dithiobis (succinimidylpropionate) and
3,3'-dithiobis (sulfosuccinimidyl-propionate); see, e.g.,
McLaughlin (1996) Am. J. Hum. Genet. 59:561-569; Tang (1996)
Biochemistry 35:8216-8225; Lingner (1.996) Proc. Natl. Aca. Sci.
U.S.A. 93:10712; Chodosh (1986) Mol. Cell. Biol 6:4723-4733. If a
specific protein is believed to bind to PRE, and an antibody is
available or can be generated for that protein,
co-immunoprecipitation analysis can be used. Alternatively,
PRE-affinity columns can be generated to screen for potential
PRE-binding proteins. In a variation of this assay, PRE-containing
nucleic acid is biotinylated, reacted with a solution suspected of
containing a PRE-binding protein, and then reacted with a
strepavidin affinity column to isolate the PRE-containing nucleic
acid/binding protein complex (see, e.g., Grabowski (1986) Science
233:1294-1299; Chodosh (1986) supra). The protein can then be
conventionally eluted and isolated.
[0136] Mobility shift DNA-protein binding assay using nondenaturing
polyacrylamide gel electrophoresis is an extremely rapid and
sensitive method for detecting polypeptides binding to DNA (see,
e.g., Chodosh (1986) supra, Carthew (1985) Cell 43:439-448; Trejo
(1997) J. Biol. Chem. 272:27411-27421; Bayliss (1997) Nucleic Acids
Res. 25:3984-3990). Interference assays and DNase and hydroxy
radical footprinting can be used to identify specific residues in
the nucleic acid protein-binding site, see, e.g., Bi (1997) J.
Biol. Chem. 272:26562-26572; Karaoglu (1991) Nucleic Acids Res.
19:5293-5360. Fluorescence polarization is a powerful technique for
characterizing macromolecular associations and can provide
equilibrium determinations of protein-DNA and protein-protein
interactions. This technique is particularly useful to study low
affinity protein-protein interactions, see, e.g., Lundblad (1996)
Mol. Endocrinol. 10:607-612.
[0137] Proteins identified in by these techniques can be further
separated on the basis of their size, net surface charge,
hydrophobicity and affinity for ligands. In addition, antibodies
raised against such proteins can be conjugated to column matrices
and the proteins immunopurified. All of these general methods are
well known in the art. See, e.g., Scopes, R. K., Protein
Purification: Principles and Practice, 2nd ed., Springer Verlag,
(1987). Chromatographic techniques can be performed at any scale
and using equipment from many different manufacturers (e.g.,
Pharmacia Biotech).
[0138] It is understood that the examples and embodiments described
herein are for illustrative purposes only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended
claims.
EXAMPLES
[0139] The following examples are offered to illustrate, but not to
limit the claimed invention.
Example 1
Identification, Isolation and Characterization of PRE of the
Invention
[0140] The following example details the identification, isolation
and characterization of PRE nucleic acids of the invention and
their efficacy as attenuating agents in live HIV-1 vaccines.
[0141] Introduction
[0142] A Rev(-)/RRE(-) deficient HIV-1 hybrid was constructed and
used to characterize a new cis-acting post-transcriptional
regulatory element (PRE). This novel nucleic acid sequence
functions as a nucleo-cytoplasmic transport element (NCTE), i.e.,
an RNA sequence participating in the cellular mechanism that
transports transcripts from the nucleus to the cytoplasm. When PRE
is used to replace the NCTE system of HIV-1 (Rev/RRE), the
resultant hybrid virus is slower-growing and non-pathogenic. Most
significantly, the PRE-attenuated construct is not cytopathic. The
novel PRE sequence was initially isolated from a mouse genome.
Computer analysis showed that the identified PRE has strong
homology with some IAP sequences. Thus, the invention encompasses a
novel family of PRE having different primary sequences and
predicted RNA secondary structure from any previously identified
NCTEs, including type D retrovirus CTEs, such as SRV-1. Thus, it is
expected that the PRE of the invention specifically interact with
novel PRE-specific binding proteins. The invention provides the
novel reagents and methods for identifying such new RNA binding
proteins. These results also demonstrate that defective HIV-1
hybrids are useful tools in identifying cellular genomic and RNA
sequences that participate in post-transcriptional regulation.
[0143] Several viruses carry cis-acting sequences which regulate
post-transcriptional steps of gene expression in a positive or
negative fashion. HIV-1's NCTE, designated the "Rev responsive
element," or "RRE," was identified within the env coding region of
HIV-1 (Felber (1989) supra; Hadzopoulou-Cladaras (1989) supra;
Malim (1989) supra). Additional NCTEs have been identified in type
D retroviruses, in some type C retroviruses, in intracisternal A
retroelements (IAPs), and in Hepatitis B virus. The type D
retroviruses simian retrovirus-1 (SRV-1), SRV-2, and MPMV contain
an NCTE located between the end of env and the 3' LTR. These NCTEs
can replace HIV-1's NCTE (RRE), and produce an infectious,
attenuated virus. Structure/function analysis of SRV-1, SRV-2, and
MPMV NCTEs (termed "CTE" in type D retroviruses) revealed the
importance of both primary and secondary structure for function.
The predicted structures of type D CTEs show a strong conservation
of secondary structure. Common features (i.e., loops, hairpins) are
located in similar positions in different type D CTEs. In Tabernero
(1997) J. Virol. 71:95-101, data-bank searching for NCTE-like
elements sharing nucleotide sequences and secondary structure with
the type-D CTEs found a similar NCTE in a type-A retrovirus.
[0144] Rev/RRE-deficient hybrid HIV-1 viruses containing the type-D
or type-A NCTEs have been propagated successfully after cell free
infection in human PBMCs over long periods of time maintaining a
stable Rev(-)/RRE(-) genotype (Zolotukhin (1994) supra). This
demonstrated that NCTE-containing HIV-1 hybrids are relatively
stable.
[0145] Identification of a Novel PRE
[0146] To identify new PREs in the mammalian genome, random
fragments of heterologous genomic DNA were inserted in a
Rev(-)RRE(-) hybrid HIV-1 virus (the defective virus constructed as
described below, see Zolotukhin (1994) supra). These
insert-containing hybrids were tested for the ability to replicate
in human cell lines. Only nucleic acid segments that can
functionally replace HIV-1's RRE and promote post-transcriptional
activation result in virus propagation. Analysis of the functional
genomic DNA, described below, identified a new family of PRE whose
both primary sequence and computer predicted secondary structure is
different from the previously identified NCTEs. "Core" PRE
sequences are identified in SEQ ID NO:1 and SEQ ID NO:5. Data bank
analysis revealed a very strong similarity of the PRE family of the
invention with the genome of some defective endogenous retroviruses
that belong to the murine intracisternal A particle (IAP)
family.
[0147] As a first step, an NCTE (Rev/RRE)-deficient recombinant
clone of HIV-1 was constructed. Briefly, an infectious HIV-1
(pNL4-3, Adachi (1986) J. Virol. 59:284-291) was disabled to lack
functional Rev protein and RRE, as described in Nasioulas (1994) J.
Virol. 68:2986-2993, and Zolotukhin (1994) supra, respectively. 37
point mutations were introduced into the RRE that did not affect
the overlapping env reading frame (Nasioulas (1994) supra). Two
mutations that eliminated Rev were constructed. The first mutation
eliminated the Rev initiation codon. The second mutation introduced
a stop codon in the 23rd amino acid of the Rev protein (Zolotukhin
(1994) supra). This virus was designated NL43Rev(-)R(-). It is
non-infectious. NL43Rev(-)R(-) does not produce detectable levels
of viral structural proteins after transfection in HIV-susceptible
cell lines. In addition, it cannot revert to wild type.
[0148] Using the same strategy as Zolotukhin (1994) supra, a unique
Xho I site in the Nef region of NL43Rev(-)R(-) (at nucleotide 8887
of NIA-3) was exploited to insert putative PREs. Random genomic
fragments were generated by partial restriction enzyme digestion of
DNA extracted from mouse embryonic stem cells with Alu I and Rsa I
(both blunt end cutters). Fragments of 1.5 to 0.4 kb in size were
isolated by agarose gel electrophoresis and ligated into Xho I
digested and filled-in (blunt-ended) NL43Rev(-)R(-) vector. The
ligation mixtures were directly transfected into human 293 cells by
standard calcium phosphate coprecipitation technique. Two
additional hybrid HIV-1 clones were transfected in parallel; an
NL43Rev(-)R(-) hybrid into which a SRV-1-derived CTE was inserted
("pR(-)Rev(-).S," described in Zolotukhin (1994) supra; and the
starting disabled HIV-1 NL43Rev(-)R(-).
[0149] One day later, the 293 cells were co-cultivated with a
CD4(+)-expressing, HIV-permissive Jurkat cell line to test for cell
to cell virus transmission and propagation. At day 14
post-transfection, syncytia formation was detected and p24.sup.gag
was expressed (detected by p24.sup.gag antigen assay) in some of
the cells transfected with mouse genomic DNA. Virus from the
positive clones was isolated for further analysis. Cells infected
with R(-)Rev(-).S, containing the SRV-1 CTE, also formed syncytia
and expressed p24.sup.gag. Mock-transfected and starting vector
NL43Rev(-)R(-)-transfected cells did not show any virus
production.
[0150] Hybrid mouse DNA-containing HIV-1 from cell cultures
positive for virus propagation were isolated and studied by PCR to
identify the genomic inserts capable of "rescuing" the
PRE-defective NL43Rev(-)R(-). PCR primers flanking the Xho I
cloning site (Nef region sequences) were used to amplify and detect
the presence of the genomic inserts. Agarose electrophoresis
isolated different sized inserts in multiple bands of approximately
700 to 1100 base pair (bp) lengths.
[0151] It was next demonstrated that the PRE-rescued HIV-1 hybrids
were able to be transmitted by cell free infection. Virus stocks
were produced by 0.45 um membrane filtration from the supernatants
of the Jurkat cultures at 24 days after transfection. The filtered
supernatants were used to infect human peripheral blood mononuclear
cells (PBMCs). PBMC cell cultures were obtained and activated as
described in Zolotukhin (1994) supra. Briefly, PBMC cell cultures
were obtained from healthy, HIV-seronegative blood donors, isolated
by density centrifugation. They were stimulated for three days with
phytohemagglutinin (PHA) at 5 to 10 micrograms (ug) per ml. Equal
amounts of each of the viruses from the filtered 293 supernatants
were used to infect 5.times.10.sup.5 activated PBMCs. Virus
propagation was monitored over time using a p24.sup.gag antigen
capture ELISA assay. Both a commercial ELISA assay (Cellular
Products, Buffalo, N.Y.) (used according to manufacturer's
instructions) and an in-house p24.sup.gag antigen capture assay
(using standard techniques) was used. Virus was detected (by
p24.sup.gag antigen assay) in the PBMCs. Because some of the hybrid
viruses were infectious via cell to cell contact (293 cell to
Jurkat cell) and cell-free transmission (by filtered supernatant
infecting PBMCs), PRE-containing genomic sequences can act as PREs,
insofar as infectivity is restored. However, as described below,
although infectious, the PRE of the invention produces a
slow-growing, non-pathogenic retroviral hybrid.
[0152] Characterization of the Mouse PRE-Containing Sequence
[0153] To characterize the nucleic acid sequences able to "rescue"
the disabled HIV-1, DNA inserts from mouse DNA-containing
infectious hybrid viruses were amplified, cloned, and sequenced (as
described above). Fourteen clones were analyzed. Sequence analysis
revealed that most of the genomic inserts were similar in
nucleotide sequence. Several sequenced inserts were 1086
nucleotides (nt) in length, while some others varied between 690
and 807 nt.
[0154] To verify that these mouse genomic fragments were able to
function as "rescuing" PREs, they were individually inserted into
Xho I linearized NL43Rev(-)R(-) (as had been done with the initial
fragmented mouse genomic DNA). Each viral construct was transfected
into 293 cells and co-cultivated with Jurkat cells, as described
above. Supernatants were obtained from these co-cultivations,
filtered and used to infect Jurkat cells. Successful infection of
the Jurkat cells by virus-containing supernatant demonstrated that
some of the PRE-rescued hybrids can infect Jurkat cells in a
cell-free manner. Inserts from these infectious hybrids were
isolated and sequenced. Analysis and comparison of these sequences
revealed a novel nucleic acid sequence present in all of the
"rescuing" inserts, designated "PRE7": TABLE-US-00001
5'-CTTTCGCCATGGTAGCATAGGCTTTTGCTGCAGT (SEQ ID NO:4)
GGAGGCGGGACAATCTCCTCAGATTCGGTTTGCCGCT
CTAAAAGAAATTATGCTGCGTTATGCCGTGGGGTGCG
AGGCTAAGCACTGCACAGAGGATAGCTTGCTGTTGGC
ATCCTGTGGAAGGCACGTCTGATTGCATGAAGGTTCA
GTGTCCTAGTTCCCTTCCCCCAGGAAAAACGACACGG
GAGCTGGCCAAGACCTCTCTGGGTGATGAGCCTAAGG
GATGGTTTTGTGTAGGGCCCCTATGCTTGCACACTGG
GGATCAGACCTCTACCTTCACCCATGAGGCTTGCTTG
CAGCAATTAAGATCTGGCCATAGGTTAATTAACATCC
TGGCCTTTTGATGCACCTGCCACAAG-3'
[0155] To verify that this "PRE7" sequence is a functional PRE,
inserts from these infectious HIV-1 hybrid clones were amplified by
PCR. Again, as described above, each fragment was ligated to the
NL43Rev(-)R(-) HIV-1 clone linearized by Xho I. The ligation was
transfected in 293 cells. Co-cultivations with Jurkat cells were
started one day post-transfection. Two of the PRE7-containing
hybrids were able to propagate in the co-cultivation assay. The
infectivity of these clones was confirmed by subsequent cell free
infections in Jurkat cells. Isolation, sequencing and analysis of
their genomic inserts identified a core PRE region of 231
nucleotides (designated "fragment B"): TABLE-US-00002 5'-GTGGGGTGCG
AGGCTAAGCA CTGCACAGAG (SEQ ID NO:1) GATAGCTTGC TGTTGGCATC
CTGTGGAAGG CACGTCTGAT TGCATGAAGG TTCAGTGTCC TAGTTCCCTT CCCCCAGGAA
AAACGACACG GGAGCTGGCC AAGACCTCTC TGGGTGATGA GCCTAAGGGA TGGTTTTGTG
TAGGGCCCCT ATGCTTGCAC ACTGGGGATC AGACCTCTAC CTTCACCCAT GAGGCTTGCT
T-3'
[0156] SEQ ID NO:1 is located within the PRE7 (SEQ ID NO:4)
fragment, as identified by the underlined nucleic acid residues in
the above-described PRE7 sequence.
[0157] To demonstrate that the 231 bp fragment B is sufficient to
rescue replication of the NL43Rev(-)R(-) hybrid, it was spliced
into NL43Rev(-)R(-) and introduced into 293 and Jurkat cells by
transfection/co-cultivation, as described above. Two independent
fragment B-containing NL43Rev(-)R(-) hybrids produced infectious
virus. Fragment B inserted in antisense orientation and the
starting vector without any insert were uninfectious. Fragment
3-containing NL43Rev(-)R(-) was able to propagate in Jurkat cells
after cell-free infection.
[0158] Further experimentation with the PRE7 (SEQ ID NO:4) sequence
demonstrated another functional fragment (named "M4") 226 nt in
length. It is very similar to the core fragment B (SEQ ID NO:1),
having 7 additional nucleotides at the 3' end and and 2 fewer
nucleotides at the 5' end: TABLE-US-00003
CCGTGGGGTGCGAGGCTAAGCACTGCACAGAGGATAG (SEQ ID NO:5)
CTTGCTGTTGGCATCCTGTGGAAGGCACGTCTGATTG
CATGAAGGTTCAGTGTCCTAGTTCCCTTCCCCCAGGA
AAAACGACACGGGAGCTGGCCAAGACCTCTCTGGGTG
ATGAGCCTAAGGGATGGTTTTGTGTAGGGCCCCTATG
CTTGCACACTGGGGATCAGACCTCTACCTTCACCCAT GAGG.
[0159] PRE of the Invention Produce Attenuated Hybrid
Retrovirus
[0160] The PRE of the invention, when inserted in RRE(-)Rev(-)
HIV-1, are capable of functioning as NCTEs to "rescue" the disabled
virus. When the PRE-containing hybrid HIV-1 virus infects activated
human PBMCs, the level of expression of HIV-1 p24.sup.gag is
between about 5 fold and about 200 fold less than levels of
p24.sup.gag expression when HIV-1 wild type virus, utilizing
wild-type NCTE, infects activated huPBMCs. The infectivity of
PRE-containing RRE(-)Rev(-) hybrids were also compared to
RRE(-)Rev(-) HIV-1 containing SRV-1 CTE (these clones are
designated "R(-)Rev(-).S", as described in Zolotukhin (1994)
supra). SEQ ID NO:1 (in the sense orientation)-containing hybrids;
SEQ ID NO:1 (in the antisense orientation)-containing hybrids;
SRV-1 CTE-containing hybrids, and starting vector RRE(-)Rev(-) were
tested in parallel. Jurkat cells were infected by cell-free virus
preparations. Virus production was monitored for the next ten days
by measuring levels of p24.sup.gag expression in each cell culture.
In one set of experiments, the level of attenuation of SEQ ID
NO:1-containing hybrids was approximately equivalent to SRV-1
CTE-containing hybrids. p24.sup.gag expression peaked between five
and seven days after cell-free infection. These results indicate a
level of attenuation between about 10 fold and about 50 fold less
(based on p24.sup.gag expression) as compared to comparable
infection by HIV-1 wild type virus.
[0161] Sequence Analysis and Secondary Structure
[0162] Sequence identity comparisons of the PRE of the invention
(SEQ ID NO:1), the "core" PRE identified within fragment 3B, was
performed. Homologous sequences were identified by this computer
search revealing a very strong similarity with the genome of some
defective endogenous retroviruses belonging to the murine
intracisternal A particle (IAP) family of retrotransposons. The
homologous sequences were endogenous retroelements from mouse and
hamster. In most cases, they contain a 3' LTR in a fixed position
downstream of the region homologous to the PRE of SEQ ID NO:1.
Secondary structure predictions were made using MFOLD (University
of Wisconsin Genetics Computer Group package). MFold is an
adaptation of the MFold package by Zuker and Jaeger, see Zuker
(1989) Science 244:48-52; Jaeger (1989) Proc. Natl. Acad. Sci. USA
86:7706-7710. It showed that nucleotides within the 231 bp core
element (SEQ ID NO:1) could be folded into a base-paired, double
stranded region, a so-called "hairpin," forming a strong secondary
structure. This secondary structure is conserved in all IAP
elements identified in the database by sequence homology. The
double stranded region is similar in all of the homologous
sequences. However, the loop of the hairpin was not conserved.
Significantly, the PRE of the invention have sufficiently different
primary sequences from these IAP elements to predict a unique RNA
secondary structure distinct from any previously identified NCTEs,
including those from type D retrovirus CTEs, such as SRV-1. One or
several of the functions of PRE of the invention may utilize this
secondary structure. For example, the secondary structure may
interact with trans-acting cellular factors, or be necessary for
nucleo-cytoplasmic transport, transcript stability or expression,
and the like. However, the ability of the PRE of the invention to
act as an NCTE and an attenuating agent when inserted in disabled
retroviruses is not limited by its ability to form any secondary
structure or any form of secondary structure.
[0163] Sequence Identity Analysis to Identify PRE of the
Invention
[0164] Sequence identity analysis is used to determine whether a
nucleic acid is within scope of the invention. To identify a specie
of the PRE family of the invention, a nucleic acid must have at
least 80% nucleic acid sequence identity to a sequence set forth in
SEQ ID NO:1. Publicly available nucleic acid databanks were
searched for sequence identity (homology) to the exemplary SEQ ID
NO:1 PRE of the invention. Specifically, the program PileUp was
used, with the parameters: symbol comparison table:
GenRunData:pileupdna.cmp, GapWeight:2, GapLengthWeight: 1. The
following PRE sequence, having about 83% sequence identity to SEQ
ID NO:1, was identified: AGGAGTTGCA AGGCTAAGC X ACTGCACAGG AGAGG X
TCTG CGG XX TATAA CGACTTTCTC CTGGGAGATA AGTCATCTTG CATGAAGGTT CTATG
X TCAT, where X is any nucleotide (SEQ ID NO:6).
[0165] SEQ ID NO:6 is a subsequence of a 7951 base pair long
sequence submitted as Genbank Accession Nos. M10134, K02288, and
K02289; described by Ono (1985) J. Virol. 55:387-394; Ono (1983)
Nucleic Acids Res. 11:7169-7179. The sequence was isolated from a
Syrian hamster and is homologous to intracisternal A-particle (IAP)
genes.
Example 2
CTE-Containing HIV-1 are Attenuated In Vivo
[0166] The following example details use of post-transcriptional
regulatory elements (PREs) as attenuating agents in HIV-1 infection
and AIDS pathogenesis. To effect this attenuation, the exogenous
PREs act in place of HIV-1's wild-type Rev/RRE post-transcriptional
regulatory system. The efficacy the PRE of the invention as an
HIV-1 attenuating agent in vivo can be demonstrated using
functionally analogous NCTEs, such as the SRV-1 CTE. Hybrid HIV-1
clones were used in which the post-transcriptional regulatory
element, or more specifically, the NCTE, from SRV-1 ("CTE") was
inserted to replace the wild type HIV-1 NCTE (RRE). The
"R(-)Rev(-).S" hybrid clones, described above (from Zolotukhin
(1994) supra) were used. These hybrids were used in a SCID-hu mouse
model to demonstrate the attenuating effect of the PRE of the
invention ("PRE(+)") in RRE(-)Rev(-) HIV-1. Specifically, viral
replication and cytopathic effects on lymphocytes were measured in
vivo using art-recognized animal models.
[0167] R(-)Rev(-).S infect a Thy/Liv implant (Kollmann (1995)
supra) in SCID-hu mice. Significantly, these PRE-attenuated viruses
propagated slower than wild-type and Nef-negative (otherwise NCTE
wild-type) HIV-1 clones. Levels of circulating CD4.sup.+
lymphocytes were monitored for 6 weeks after initial infection. No
depletion of CD4.sup.+ cells was observed. This demonstrates an
attenuated phenotype for cytotoxicity of the PRE-containing
R(-)Rev(-).S HIV-1 clones. Direct comparison to a Nef-negative
HIV-1 clone showed that the PRE attenuated viruses are less
cytotoxic, independent of the absence or presence of Nef.
Therefore, the replacement of HIV-1's wild-type NCTE (RRE) with
SRV-1 NCTE is responsible for the distinct, non-cytotoxic
(non-CD4.sup.+ lymphocyte depleting) phenotype of the slowly
replicating hybrid HIV-1.
[0168] The attenuation of the PRE-attenuated HIV-1, R(-)Rev(-).S,
was further demonstrated by measuring its lower replicative
capacity in vivo in an art-recognized animal model, the SCID-hu
mouse (see Aldrovandi (1993) Nature 363:732-736; Bonyhaki (1993)
Nature 363:728-732). The SCID-hu mice are produced by surgical
implantation of human fetal liver and thymus under the kidney
capsule of severe combined immunodeficient (SCID) mice. Normal
T-cell differentiation has been shown to occur in the Thy/Liv
implant. This is an art-recognized system for the study of HIV-1
infection and viral cytotoxicity in human lymphopoietic tissue.
Normally, infection by wild type (wt) HIV-1 results in depletion of
CD4.sup.+ T cells. Significantly, infection with HIV-1, resulting
in low levels of viral replication, did not cause CD4.sup.+ cell
depletion in vivo.
[0169] To further assess the attenuation of R(-)Rev(-).S, virus
load and cytotoxicity after infection in SCID-hu mice was measured.
Four different HIV-1 hybrids were tested: wt HIV-1 (NL4-3,
described above); wt HIV-1 (NL4-3)/Nef negative; PRE(SRV-1
CTE)(+)/Nef(+), i.e., R(-)Rev(-).S; and PRE(SRV-1 CTE)(+)/Nef(-),
i.e., R(-)Rev(-).S lacking Nef). 1000 infectious units per mouse
are typically used to establish good SCID-hu infection (i.e., at
least 50% to 90% infected) by attenuated strains of HIV-1, see
Aldrovandi (1996) J. Virol. 70:1505-1511. Since the infectivity and
replicative capacity of the PRE (SRV-1 CTE)-attenuated hybrids is
reduced (as demonstrated by the experiments described above), the
amount of input virus was increased. The SCID-hu mice were infected
by injection of virus into the Thy/Liv implant at 500 to 850
TCID.sub.50 in a final volume of 100 .mu.l. Sequential biopsies of
the implants were performed 3 and 6 weeks postinfection, and the
samples were analyzed for virus replication by quantitative DNA-PCR
and for the number of CD4.sup.+ thymocytes by flow cytometry (PCR
and cytometry as described in Aldrovandi (1996) supra). All 7 mice
infected by wt HIV-1 scored positive for HIV proviral sequences at
3 weeks postinfection. Depletion of CD4.sup.+ thymocytes (defined
as measurement of less than 55% CD4.sup.+ cells in the thymocyte
population) was detected in 2 of 7 mice at this time point, and in
another 2 of 2 mice analyzed after 6 weeks. None of the
mock-infected mice showed any sign of HIV infection or CD4.sup.+
thymocyte depletion. Replication of the NL4-3/Nef-negative hybrid
was detectable in 2 of 10 mice after 3 weeks and in 8 of 9 mice at
6 weeks post-infection. Depletion of CD4.sup.+ thymocytes was found
in 3 of 9 mice infected with NL4-3/Nef-negative recombinants at 6
weeks postinfection (which is typical, as reported in Aldrovandi
(1996) supra, and Jamieson (1994) J. Virol. 68:3478-3485).
[0170] In contrast, after infection with the PRE(SRV-1 CTE)(+)
Nef(-) and PRE (SRV-1 CTE)(+) Nef(+) hybrids, provirus DNA was
detectable only at the 6 week time point in 4 of 8 and 1 of 5 mice,
respectively. The viral loads in the mice infected by the CTE(+)
viruses were significantly lower than that of the
RRE(+)/Nef-negative hybrids (i.e., wt except for lack of Nef).
While implants infected by the RRE(+)/Nef-negative hybrids showed
3,000 to 28,000 provirus copies per 10.sup.5 cells, the PRE(+)
Nef(-) virus contained about 500 to 2,400 copies per 10.sup.5
cells, resulting in about a 20-fold decrease in average provirus
copies in the PRE(+)-attenuated virus-infected mice. In PRE(+)
Nef(+) virus only 1 of 5 mice was provirus positive after 6 weeks.
Analysis of the implants of all the mice infected by PRE(SRV-1
CTE)(+) viruses showed normal thymocyte profiles, i.e., no
cytotoxicity. The virus' ability to produce Nef did not affect
pathogenicity. These findings demonstrate that replacement of wt
HIV-1 RRE with an exogenous PRE, in this case NCTE (CTE) from
SRV-1, is primarily responsible for the slower growing, attenuated
non-cytotoxic phenotype in the SCID-hu mouse model.
[0171] To address the question whether the lower virus load is
responsible for the lower cytotoxicity of the PRE(SRV-1
CTE)-attenuated hybrids, the experiments were repeated using about
5-fold higher amounts of input viruses (approximately 2500
infectious units/mouse). Infection with these larger amounts of
virus also does not lead to CD4' thymocyte depletion. New stocks
for PRE(SRV-1 CTE)(+)/Nef(-) and PRE(SRV-1 CTE)(+)/Nef(+) HIV
clones with higher titers were generated yielding 5.times.10.sup.4
and 4.7.times.10.sup.4 TCID.sub.50/ml, respectively. The Thy/Liv
implants in SCID-hu mice were injected with 100 .mu.l of these high
titer stocks. Biopsies were analyzed at 3 and 6 weeks
postinfection. At 3 weeks postinfection, no virus could be detected
in the 6 mice infected with the either of the PRE(+)-attenuated
HIV-1 hybrids. At 6 weeks postinfection, in all 4 mice infected by
the PRE(SRV-1 CTE)(+)/Nef(-) hybrid and in all 7 mice infected by
the PRE(SRV-1 CTE)(+)/Nef(+) hybrid, HIV-1 replication was
detectable. Although the time necessary to detect the PRE(+) hybrid
was still 6 weeks, the viral loads were clearly elevated, due to
the higher amount of input viruses. The average proviral copies per
10.sup.5 cells was 15,000 in the case of CTE(+)/Nef(-) hybrid,
which is similar to that obtained from mice infected with 5-fold
lower amount of RRE(+)/Nef-negative clone. The virus load in the
implants infected by the PRE(SRV-1 CTE)(+)/Nef(+) variant was at
least ten-fold lower than that of the PRE(SRV-1 CTE)(+)/Nef(-)
counterpart.
[0172] Interestingly, even with these differences in viral load, no
significant changes were observed in the thymocyte profiles (within
the time frame of the experiment 6 weeks). Therefore, no depletion
of CD4.sup.+ thymocytes by PRE(+) hybrids was observed. Parallel
infections using wt HIV-1 resulted in high levels of virus load
accompanied by loss of CD4.sup.- cells. In conclusion, increasing
the virus inocula did not increase the low cytotoxicity of the
PRE(SRV-1 CTE)(+)-attenuated viruses in vivo, as observed in this
SCID-hu mice model. Therefore, replacement of wt HIV-1 RRE with a
PRE (SRV-1 CTE) produced HIV-1 hybrids that are less cytotoxic and
more attenuated than Nef-negative (otherwise wt) HIV-1.
[0173] In conclusion, experiments using a PRE (SRV-1 CTE)
functionally analogous to the PRE of the invention demonstrate the
efficacy of PRE as attenuating agents in HIV-1 infection and AIDS
pathogenesis in vivo. While PRE(SRV-1 CTE)(+) HIV-1 hybrids can
infect a Thy/Liv implant in SCID-hu mice, they propagate slower
than wt HIV-1 and NL4-3/Nef-negative hybrids. No depletion of
CD4.sup.+ cells was observed in the PRE(+) hybrids, demonstrating
an attenuated phenotype for cytotoxicity. Direct comparison to
RRE(+)/Nef-negative HIV-1 showed that the exogenous PRE is
responsible for attenuation independent of the absence or presence
of Nef. Thus, these experiments demonstrate that PREs, such as the
PRE of the invention exemplified by SEQ ID NO:1, can produce a
slow-growing, attenuated HIV-1 hybrid in vivo.
[0174] It is understood that the examples and embodiments described
herein are for illustrative purposes-only and that various
modifications or changes in light thereof will be suggested to
persons skilled in the art and are to be included within the spirit
and purview of this application and scope of the appended claims.
All publications, patents, and patent applications cited herein are
hereby incorporated by reference for all purposes.
Sequence CWU 1
1
6 1 231 DNA Artificial Sequence Description of Artificial
Sequencecore post-transcriptional regulatory element (PRE)
designated "fragment B" 1 gtggggtgcg aggctaagca ctgcacagag
gatagcttgc tgttggcatc ctgtggaagg 60 cacgtctgat tgcatgaagg
ttcagtgtcc tagttccctt cccccaggaa aaacgacacg 120 ggagctggcc
aagacctctc tgggtgatga gcctaaggga tggttttgtg tagggcccct 180
atgcttgcac actggggatc agacctctac cttcacccat gaggcttgct t 231 2 30
DNA Artificial Sequence Description of Artificial
Sequenceillustrative primer oligonucleotide complementary to 3'
thirty nucleic acids of SEQ ID NO1 2 aagcaagcct catgggtgaa
ggtagaggac 30 3 30 DNA Artificial Sequence Description of
Artificial Sequenceillustrative primer oligonucleotide
incorporating the 5' thirty nucleic acids of SEQ ID NO1 3
gtggggtgcg aggctaagca ctgcacagag 30 4 391 DNA Artificial Sequence
Description of Artificial Sequence"rescuing" post-transcriptional
regulatory element (PRE) insert designated "PRE7" 4 ctttcgccat
ggtagcatag gcttttgctg cagtggaggc gggacaatct cctcagattc 60
ggtttgccgc tctaaaagaa attatgctgc gttatgccgt ggggtgcgag gctaagcact
120 gcacagagga tagcttgctg ttggcatcct gtggaaggca cgtctgattg
catgaaggtt 180 cagtgtccta gttcccttcc cccaggaaaa acgacacggg
agctggccaa gacctctctg 240 ggtgatgagc ctaagggatg gttttgtgta
gggcccctat gcttgcacac tggggatcag 300 acctctacct tcacccatga
ggcttgcttg cagcaattaa gatctggcca taggttaatt 360 aacatcctgg
ccttttgatg cacctgccac a 391 5 226 DNA Artificial Sequence
Description of Artificial Sequencefunctional fragment named "M4" 5
ccgtggggtg cgaggctaag cactgcacag aggatagctt gctgttggca tcctgtggaa
60 ggcacgtctg attgcatgaa ggttcagtgt cctagttccc ttcccccagg
aaaaacgaca 120 cgggagctgg ccaagacctc tctgggtgat gagcctaagg
gatggttttg tgtagggccc 180 ctatgcttgc acactgggga tcagacctct
accttcaccc atgagg 226 6 100 DNA Artificial Sequence Description of
Artificial SequencePRE sequence having about 83% sequence identity
to SEQ ID NO1 6 aggagttgca aggctaagcn actgcacagg agaggntctg
cggnntataa cgactttctc 60 ctgggagata agtcatcttg catgaaggtt
ctatgntcat 100
* * * * *
References