U.S. patent application number 11/409706 was filed with the patent office on 2006-08-17 for method to inhibit cell growth using oligonucleotides.
Invention is credited to Mark S. Eller, Barbara A. Gilchrest, Mina Yaar.
Application Number | 20060183704 11/409706 |
Document ID | / |
Family ID | 24157158 |
Filed Date | 2006-08-17 |
United States Patent
Application |
20060183704 |
Kind Code |
A1 |
Gilchrest; Barbara A. ; et
al. |
August 17, 2006 |
Method to inhibit cell growth using oligonucleotides
Abstract
Described are methods for treating hyperproliferative disorders,
including cancers, by administering to the affected mammal (e.g.,
human) an effective amount of a composition comprising pTT or a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with the human telomere
overhang repeat. Methods of treatment or prevention of
hyperproliferative diseases or pre-cancerous conditions affecting
epithelial cells, such as psoriasis, atopic dermatitis, or
hyperproliferative or UV-responsive dermatoses, hyperproliferative
diseases of other epithelia and methods for reducing photoaging, or
oxidative stress or for prophylaxis against or reduction in the
likelihood of the development of skin cancer, are also
disclosed.
Inventors: |
Gilchrest; Barbara A.;
(Boston, MA) ; Eller; Mark S.; (Boston, MA)
; Yaar; Mina; (Sharon, MA) |
Correspondence
Address: |
HOWREY LLP
C/O IP DOCKETING DEPARTMENT
2941 FAIRVIEW PARK DR, SUITE 200
FALLS CHURCH
VA
22042-2924
US
|
Family ID: |
24157158 |
Appl. No.: |
11/409706 |
Filed: |
April 24, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10122633 |
Apr 12, 2002 |
7033829 |
|
|
11409706 |
Apr 24, 2006 |
|
|
|
PCT/US01/10162 |
Mar 30, 2001 |
|
|
|
10122633 |
Apr 12, 2002 |
|
|
|
09540843 |
Mar 31, 2000 |
|
|
|
PCT/US01/10162 |
Mar 30, 2001 |
|
|
|
Current U.S.
Class: |
514/44R |
Current CPC
Class: |
C12N 2830/001 20130101;
A61K 48/00 20130101; A61K 48/005 20130101; A61K 31/711 20130101;
A61K 31/7125 20130101; C12N 15/85 20130101; A61K 41/0057 20130101;
A61P 35/00 20180101; A61P 37/08 20180101; A61P 17/00 20180101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 48/00 20060101
A61K048/00 |
Claims
1. A method for treating a hyperproliferative disorder in a mammal,
said method comprising administering to the human an effective
amount of a composition comprising one or more oligonucleotides
which share at least 50% nucleotide sequence identity with
(TTAGGG).sub.n.
2. The method of claim 1, wherein the mammal is a human.
3. The method of claim 1, wherein the composition comprises one or
more oligonucleotides selected from the group consisting of: a)
oligonucleotides 2-200 nucleotides long; b) oligonucleotides 2-20
nucleotides long; c) oligonucleotides 5-11 nucleotides long; and d)
oligonucleotides 2-5 nucleotides long.
4. The method of claim 1 wherein the composition comprises an
oligonucleotide having nucleotide sequence pGAGTATGAG (SEQ ID
NO:1), pGTTAGGGTTAG (SEQ ID NO:5), pGGGTTAGGGTT (SEQ ID NO:13),
pTAGATGTGGTG (SEQ ID NO:14), or pTT.
5. A method for inhibiting the growth of cancer cells in a human,
comprising administering to the human an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with the human telomere
overhang repeat.
6. The method of claim 5 wherein the disorder is selected from the
group consisting of lymphoma, osteosarcoma, melanoma, leukemia,
cervical cancer, and squamous cell carcinoma.
7. A method for promoting differentiation of malignant cells in a
mammal, said method comprising administering to the mammal an
effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with (TTAGGG).sub.n.
8. A method for enhancing the expression of one or more surface
antigens indicative of differentiation of cancer cells in a human,
said method comprising administering to the human an effective
amount of a composition comprising one or more oligonucleotides
which share at least 50% nucleotide sequence identity with
(TTAGGG).sub.n.
9. The method of claim 8 wherein the cancer cells are melanoma
cells.
10. The method of claim 8 wherein the antigen is MART-1,
tyrosinase, TRP-1 or gp-100.
11. The method of claim 8 wherein the composition comprises
pTT.
12. The method of claim 8 wherein the cancer cells are melanoma
cells.
13. A method for inducing apoptosis in cancer cells in a human,
said method comprising administering to the human an effective
amount of a composition comprising one or more oligonucleotides
which share at least 50% nucleotide sequence identity with the
human telomere overhang repeat.
14. The method of claim 13 wherein the cancer cells are melanoma
cells.
15. A method for inhibiting the growth of cancer cells in a mammal,
said method being independent of the presence or activity of
telomerase in said cells, said method comprising administering to
the human an effective amount of a composition comprising one or
more oligonucleotides which share at least 50% nucleotide sequence
identity with (TTAGGG).sub.n.
16. A method for inhibiting the growth of cancer cells in a mammal,
said method not requiring the presence or activity of p53 normal
function in said cells, said method comprising administering to the
human an effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with (TTAGGG).sub.n,.
17. A method for inhibiting the growth of cancer cells in a mammal,
said method resulting in S-phase arrest in said cells, said method
comprising administering to the human an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with (TTAGGG).sub.n.
18. The method of claim 17 wherein the composition comprises
oligonucleotides less than 6 nucleotides long.
19. A method for preventing spongiosis, blistering or dyskeratosis
in the skin of a mammal, following exposure to ultraviolet light,
said method comprising applying to the skin an effective amount of
a composition comprising one or more oligonucleotides which share
at least 50% nucleotide sequence identity with (TTAGGG).sub.n.
20. The method of claim 19 wherein the composition comprises
pGAGTATGAG (SEQ ID NO:1).
21. The method of claim 19 wherein the composition comprises
pTT.
22. A method for reducing the occurrence of skin cancer in a human,
said method comprising applying to the skin an effective amount of
a composition comprising one or more oligonucleotides which share
at least 50% nucleotide sequence identity with the human telomere
overhang repeat.
23. The method of claim 22 wherein the composition comprises
pGAGTATGAG (SEQ ID NO:1).
24. The method of claim 22 wherein the composition comprises
pTT.
25. A method for reducing the occurrence of skin cancer in a human
with xeroderma pigmentosum or other genetic predisposition to skin
cancer, said method comprising administering to the skin an
effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat.
26. The method of claim 25 wherein the composition comprises
pGAGTATGAG (SEQ ID NO:1).
27. The method of claim 25 wherein the composition comprises
pTT.
28. A method for enhancing repair of ultraviolet
irradiation-induced damage to skin in a human, said method
comprising applying to the skin an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with the human telomere
overhang repeat.
29. The method of claim 28 wherein the composition comprises
pGAGTATGAG (SEQ ID NO:1).
30. The method of claim 28 wherein the composition comprises
pTT.
31. A method for reducing oxidative damage in a mammal, said method
comprising administering to the mammal an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with (TTAGGG).sub.n.
32. The method of claim 31 wherein the composition is administered
to the skin.
33. The method of claim 31 wherein the composition comprises
pGTTAGGGTTAG (SEQ ID NO:5).
34. The method of claim 31 wherein the composition comprises
pTT.
35. A method for treating melanoma in a mammal, comprising
administering to the mammal an effective amount of a composition
comprising one or more oligonucleotides that share at least 50%
nucleotide sequence identity with (TTAGGG).sub.n.
36. The method of claim 35 wherein the mammal is a human.
37. The method of claim 35 wherein the composition comprises
pGTTAGGGTTAG (SEQ ID NO:5).
38. The method of claim 35 wherein the composition comprises
pTT.
39. A method for reducing proliferation of keratinocytes in the
skin of a human, said method comprising administering to the skin
an effective amount of a composition comprising one or more
oligonucleotides that share at least 50% nucleotide sequence
identity with the human telomere overhang repeat.
40. The method of claim 39, wherein the human has seborrheic
keratosis, actinic keratosis, Bowen's disease, squamous cell
carcinoma, or basal cell carcinoma.
41. The method of claim 39, wherein the composition comprises
pGTTAGGGTTAG (SEQ ID NO:5).
42. The method of claim 39, wherein the composition comprises
pTT.
43. A composition comprising an oligonucleotide and a
physiologically acceptable carrier, wherein the oligonucleotide is
pGAGTATGAG (SEQ ID NO:1), pCATAC (SEQ ID NO:6), pGTTAGGGTTAG (SEQ
ID NO:5), pGGGTTAGGGTT (SEQ ID NO:13), orpTAGATGTGGTG (SEQ ID
NO:14).
44. A method of inhibiting proliferation of epithelial cells in a
mammal, comprising administering to the epithelial cells an
effective amount of a composition comprising at least one
oligonucleotide, wherein the oligonucleotide comprises a base
sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, and a
contiguous portion of any of the foregoing sequences.
45. The method of claim 44, wherein the oligonucleotide is
single-stranded.
46. The method of claim 44, wherein the oligonucleotide comprises a
5' phosphate.
47. The method of claim 44, wherein the composition comprises
oligonucleotide is at a concentration of about 1 .mu.M to about 500
.mu.M.
48. The method of claim 44, wherein said oligonucleotide is
ultraviolet-irradiated.
49. The method of claim 44, wherein the composition comprises
oligonucleotide in liposomes.
50. The method of claim 44, wherein the composition comprises
propylene glycol.
51. The method of claim 44, wherein the composition is administered
orally.
52. The method of claim 44, wherein the composition is administered
by aerosol.
53. The method of claim 44, wherein the mammal is a human.
54. The method of claim 44, wherein the epithelial cells are
carcinoma cells.
55. A method of preventing or reducing DNA damage in cells of a
mammal, wherein said DNA damage is caused by radiation or
DNA-damaging chemicals, comprising contacting said cells with an
effective amount of a composition comprising at least one
oligonucleotide, wherein the oligonucleotide comprises a base
sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQED NO: 5, SEQ ID NO: 6, SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, and a
contiguous portion of any of the foregoing sequences.
56. The method of claim 55, wherein the cells are epithelial
cells.
57. The method of claim 55, wherein said oligonucleotide is
single-stranded.
58. The method of claim 55, wherein the oligonucleotide comprises a
5' phosphate.
59. The method of claim 55, wherein the composition comprises the
oligonucleotide at a concentration of about 1 .mu.M to about 500
.mu.M.
60. The method of claim 55, wherein the composition comprises a
physiologically acceptable carrier.
61. A composition comprising an oligonucleotide and a
physiologically acceptable carrier, wherein the oligonucleotide
comprises a base sequence selected from the group consisting of:
SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:
5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID
NO: 12.
62. The composition of claim 61, wherein the oligonucleotide
comprises a 5' phosphate.
63. The composition of claim 61 which comprises more than one
oligonucleotide.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of International
Application No. PCT/US01/10162, which designated the United States
and was filed on Mar. 30, 2001, published in English, which is a
continuation-in-part of application Ser. No. 09/540,843 filed Mar.
31, 2000. The entire teachings of the above applications are
incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Mammalian cells have a complex response to DNA damage, as
well as a tightly regulated program of replicative senescence, all
suggested to be fundamental defenses against cancer [Campisi, J.
(1996). Cell 84, 497-500]. In mammals, cell senescence is
precipitated by critical shortening of telomeres, tandem repeats of
the DNA sequence TTAGGG that cap the ends of chromosomes [Greider,
C. W. (1996) Annu Rev Biochem 65, 337-365] and become shorter with
each round of DNA replication. In germline cells and most cancer
cells, immortality is associated with maintenance of telomere
length by telomerase, an enzyme complex that adds TTAGGG repeats
dues to the 3' terminus at the chromosome ends [Feng, J., et al.
Science 269, 1236-1241; Harrington, L., et al., (1997) Science 275,
973-977; Nakamura, T. M., et al., (1997) Science 277, 955-957]. The
catalytic subunit of telomerase is generally not expressed in
normal somatic cells [Greider, C. W. (1996) Annu Rev Biochem 65,
337-365], and after multiple rounds of cell division critically
shortened telomeres trigger either replicative senescence or death
by apoptosis, largely dependent on cell type [de Lange, T. (1998)
Science 279, 334-335], although the detailed mechanism is unknown.
The mechanism by which telomeres participate in DNA damage
responses has been less clear.
[0003] The frequency of cancer in humans has increased in the
developed world as the population has aged. Melanoma and other skin
cancers have increased greatly among aging populations with
significant accumulated exposure to sunlight. For some types of
cancers and stages of disease at diagnosis, morbidity and mortality
rates have not improved significantly in recent years in spite of
extensive research. Cancers are currently often treated with highly
toxic therapies. Alternative therapies are needed that could take
advantage of the natural mechanisms of the cells to repair
environmental damage.
SUMMARY OF THE INVENTION
[0004] One embodiment of the invention is a method for treating a
hyperproliferative disorder in a human, the method comprising
administering to the human an effective amount of a composition
comprising one or more oligonucleotides which share at least 50%
nucleotide sequence identity with the human telomere overhang
repeat. Herein, where it is said that an oligonucleotide is
homologous to the telomere overhang repeat, it is meant that the
oligonucleotide shares at least 50% nucleotide sequence identity
with the human telomere overhang repeat. In this method, the
oligonucleotides can be at least 2 nucleotides long, for example
2-200 nucleotides long, or at least 3 nucleotides long, for
example, 3-20 oligonucleotides long, and preferably can be 2-20
nucleotides long, and more preferably are 5-11 nucleotides long.
Oligonucleotides having a 5' phosphate group are preferred. Where
the 5' phosphate is a part of the oligonucleotide, it is indicated,
where the sequence is given, by preceding the 5' to 3' nucleotide
sequence with a "p." Preferred oligonucleotides in the treatment of
hyperproliferative disorders are pTT, pGAGTATGAG (SEQ ID NO:1),
pGTTAGGGTTAG (SEQ ID NO:5), pGGGTTAGGTT (SEQ ID NO:13), and
pTAGATGTGGTG (SEQ ID NO:14).
[0005] A part of the above method is a method for inhibiting the
growth of cancer cells in a human, comprising administering to the
human an effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. The cancer cells
can be derived from any cell type, but in particular embodiments
are lymphoma, osteosarcoma, melanoma, leukemia or carcinomas.
[0006] Another part of the invention is a method for promoting
differentiation of malignant cells in a mammal, the method
comprising administering to the mammal an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with (TTAGGG).sub.n.
[0007] A further method, useful in the treatment of cancers, is a
method for enhancing the expression of one or more surface antigens
indicative of differentiation of cancer cells in a human, the
method comprising administering to the human an effective amount of
one or more oligonucleotides which share at least 50% nucleotide
sequence identity with the human telomere overhang repeat. The
cells in this method can be, for example, melanoma, and the antigen
can be, for example, MART-1, tyrosinase, TRP-1 or gp-100. Another
oligonucleotide to be used in this method is pTT; a combination of
one or more telomere-homologous oligonucleotides and pTT can also
be used. pGTTAGGGTTAG (SEQ ID NO:5) is one oligonucleotide
applicable in this method.
[0008] Further, the invention is a method for inducing apoptosis in
cancer cells in a human, said method comprising administering to
the human an effective amount of a composition comprising one or
more oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. This method can
be applied, for example, to melanoma and lymphoma.
[0009] Also a part of the invention is a method for inhibiting the
growth of cancer cells in a human, the method being independent of
the presence or activity of telomerase in the cancer cells, in
which the method includes the step of administering to the human an
effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat.
[0010] A further aspect of the invention is a method to inhibit the
growth of cancer cells in a human, the method not requiring the
presence or activity of p53 gene product in the cancer cells, the
method comprising administering to the human an effective amount of
a composition comprising one or more oligonucleotides which share
at least 50% nucleotide sequence identity with the human telomere
overhang repeat.
[0011] A further aspect of the invention is a method to inhibit the
growth of cancer cells in a human, the method resulting in S-phase
arrest in said cells, the method comprising administering to the
human an effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. The
oligonucleotide to be used can be various lengths, but in one
embodiment the oligonucleotide can be less than 6 nucleotides
long.
[0012] Herein is also described a method for preventing spongiosis,
blistering or dyskeratosis in the skin of a mammal, following
exposure to ultraviolet light, the method comprising applying to
the skin an effective amount of a composition comprising one or
more oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. The method can
employ, for example, pGAGTATGAG (SEQ ID NO:1), or the
oligonucleotide pTT, or a combination of oligonucleotides.
[0013] Also described herein is a method for reducing the
occurrence of skin cancer in a human, the method comprising
applying to the skin an effective amount of a composition
comprising one or more oligonucleotides which share at least 50%
nucleotide sequence identity with the human telomere overhang
repeat. Such oligonucleotide can be, for example, pGAGTATGAG (SEQ
ID NO:1). pTT can also be used in the method, or a combination of
oligonucleotides can be used.
[0014] A special aspect of the above methods to reduce the
occurrence of skin cancer in a human is a method for reducing the
occurrence of skin cancer in a human with xeroderma pigmentosum, or
other genetically determined cancer predisposition, the method
comprising applying to the skin an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with the human telomere
overhang repeat. In one aspect, the oligonucleotide is pGAGTATGAG
(SEQ ID NO:1).
[0015] Another particular aspect of the invention is a method for
reducing the occurrence of skin cancer in a human with xeroderma
pigmentosum or other genetically determined predisposition, the
method comprises applying to the skin an effective amount of a
composition comprising pTT.
[0016] Also included in the invention is a method for enhancing
repair of ultraviolet irradiation-induced damage to skin in a
human, in which the method includes applying to the skin an
effective amount of a composition comprising one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. A particular
oligonucleotide that can be used is pGAGTATGAG (SEQ ID NO:1).
Another that can be used in the method is pTT.
[0017] Also included as an aspect of the invention is a method for
reducing oxidative damage in a mammal, the method comprising
administering to the mammal an effective amount of a composition
comprising one or more oligonucleotides which share at least 50%
nucleotide sequence identity with the human telomere overhang
repeat. One such oligonucleotide is pGTTAGGGTTAG (SEQ ID NO:5). pTT
can also be used in the method. In a particular aspect of this
method, the composition can be administered to the skin.
[0018] It is also an object of the invention to provide a method
for treating melanoma in a mammal, comprising administering to the
mammal an effective amount of a composition comprising one or more
oligonucleotides that share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. The method is
applicable to humans. Oligonucleotides to be used in the method
include the telomere-homologous oligonucleotide pGTTAGGGTTAG (SEQ
ID NO:5). pTT can also be used. Various combinations of
oligonucleotides can also be used in the method.
[0019] It is also an object of the invention to provide a method
for reducing proliferation of keratinocytes in the skin of a human,
the method comprising applying to the skin an effective amount of a
composition comprising one or more oligonucleotides that share at
least 50% nucleotide sequence identity with the human telomere
overhang repeat. In particular applications of the method, the
human to be treated has seborrheic keratosis, actinic keratosis,
Bowen's disease, squamous cell carcinoma, or basal cell carcinoma.
In a particular aspect of the method, the composition comprises
pGTTAGGGTTAG (SEQ ID NO:5). A related method is a method for
reducing proliferation of keratinocytes in the skin of a human,
said method comprising applying to the skin an effective amount of
a composition comprising pTT.
[0020] Another embodiment comprises increasing DNA repair in
epithelial cells, comprising contacting said cells with an
effective amount of a composition comprising at least one
oligonucleotide, wherein the oligonucleotide comprises a base
sequence selected from the group consisting of SEQ ID NO:1, SEQ ID
NO:2, SEQ BD NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ D NO:6, SEQ ID
NO:7, SEQ ID NO:8, SEQ ID NO:11, SEQ ID NO:12, and a contiguous
portion of any of the foregoing sequences. Another embodiment
comprises inhibiting proliferation of epithelial cells, comprising
contacting said cells with an effective amount of a composition
comprising at least one oligonucleotide, wherein the
oligonucleotide comprises a base sequence selected from the group
consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:
4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO: 7, SEQ ID NO:8, SEQ ID NO:
11, SEQ ID NO: 12, and a contiguous portion of any of the foregoing
sequences.
[0021] Also a part of the invention are compositions comprising one
or more oligonucleotides in a physiologically acceptable carrier,
wherein the oligonucleotide comprises base sequence SEQ ID NO:1, 2,
3, 4, 5, 6, 7, 8, 11, or 12. Further, the invention can be a
composition comprising one or more oligonucleotides in a
physiologically acceptable carrier, wherein the oligonucleotide
consists of base sequence SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 11 or
12.
[0022] Preferred for applications in which it is desired to inhibit
cell proliferation are oligonucleotides comprising SEQ ID NO: 1 or
SEQ ID NO: 6, or oligonucleotides consisting of SEQ ID NO: 1 or SEQ
ID NO: 6. Preferred in applications in which apoptosis is desired
are oligonucleotides comprising base sequence SEQ ID NO: 5, or the
oligonucleotide consisting of base sequence SEQ ID NO: 5.
[0023] Also provided as part of the invention is a composition
comprising an oligonucleotide and a physiologically acceptable
carrier, wherein the oligonucleotide is TABLE-US-00001 pGAGTATGAG,
(SEQ ID NO:1) pCATAC, (SEQ ID NO:6) pGTTAGGGTTAG, (SEQ ID NO:5)
pGGGTTAGGTT, (SEQ ID NO:13) or pTAGATGTGGTG. (SEQ ID NO:14)
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 is a graphic representation of the cell growth rate
of human squamous carcinoma cells dosed with water (diluent), 100
.mu.M pTpT (T.sub.2) or 100 .mu.M pdApdA (A.sub.2), where day 0 is
before dosage and days 1, 3, 4 and 5 are days after dosage.
[0025] FIG. 2 is a graphic representation of the cell growth rate
of normal human fibroblasts dosed with water (diluent) or 100 .mu.M
pTpT (T.sub.2), where day 0 is before dosage and days 1, 3, 4 and 5
are days after dosage, and where values represent
averages.+-.standard deviations of duplicate cultures.
[0026] FIG. 3 is a graphic representation of the cell growth rate
of human cervical carcinoma cells dosed with either water (diluent)
or 100 .mu.M pTpT (T.sub.2), where day 0 is before dosage and days
1, 4 and 6 are days after dosage.
[0027] FIG. 4 is a graphic representation of the cell yield of
human melanoma cell lines dosed with either diluent or 100 .mu.M
pTpT (T.sub.2).
[0028] FIG. 5 is a graphic representation of the cell growth rate
of normal human keratinocytes dosed with water (diluent) or 100
.mu.M pTpT (T.sub.2), where day 0 is before dosage and 8, 24, 48
and 72 are hours after dosage and where values represent
averages.+-.standard deviations of duplicate cultures.
[0029] FIG. 6 is a graphic representation of the average cell
number of human neonatal fibroblasts dosed with either water,
T.sub.2 or A.sub.2.
[0030] FIG. 7 is a graphic representation of the average cell
number of human neonatal fibroblasts dosed with either water,
T.sub.2 or A.sub.2.
[0031] FIG. 8 is a graphic representation of the cell growth rate
of normal human fibroblasts dosed with water (diluent) or 100 .mu.M
pTpT (T.sub.2), where day 0 is before dosage and where values
represent averages.+-.standard deviations of duplicate
cultures.
[0032] FIG. 9 is a graphic representation of the cell growth rate
of p53-null H1299 lung carcinoma cells dosed with water (diluent)
or 100 .mu.M pTpT (T.sub.2), where day 0 is before dosage and 1, 2,
3 and 4 are days after dosage, and where values represent
averages.+-.standard deviations of duplicate cultures.
[0033] FIG. 10 is a graphic representation of enhancement of DNA
repair of a reporter plasmid in human keratinocytes treated with
pTpT, where open boxes represent sham-irradiated control plasmid
and filled boxes represent UV-irradiated plasmid.
[0034] FIG. 11 is a graphic representation of enhancement of DNA
repair of a reporter plasmid in human fibroblasts treated with pTpT
where open boxes represent sham-irradiated control plasmid and
filled boxes represent UV-irradiated plasmid.
[0035] FIG. 12 is melanin content of Cloudman S91 cells treated
with 100 .mu.M of the indicated oligonucleotide or an equal volume
of diluent for 5 days, where data are shown as averages of
duplicate cultures calculated as a percentage of diluent-treated
controls.
[0036] FIG. 13 shows a densitometric analysis of p21 expression
detected by Northern blot analysis of SCC12F cells treated with 100
.mu.M of the indicated oligonucleotide or an equal volume of
diluent for 48 hours.
[0037] FIG. 14 shows cell yields of the samples in FIG. 13, as
mean.+-.standard deviation.
[0038] FIG. 15 shows melanin content of Cloudman S91 cells treated
with 100 .mu.M of the indicated oligonucleotide or an equal volume
of diluent for 5 days as a percent of diluent-treated controls
(mean.+-.standard deviation) for 3 independent experiments.
[0039] FIG. 16 shows melanin content of Cloudman S91 cells treated
with 100 .mu.M of the indicated oligonucleotide or an equal volume
of diluent as described for FIG. 12, where the values represent
three independent experiments and where *=p<0.004, **=p<0.03,
two-tailed Student's t-test.
[0040] FIG. 17 shows melanin content of Cloudman S91 cells treated
with the indicated oligonucleotide.
[0041] FIG. 18 shows melanin content of Cloudman S91 cells treated
with the indicated oligonucleotide.
[0042] FIGS. 19A-19H show FACS analysis of propidium iodide stained
Jurkat cells (immortalized T lymphocytes), treated with diluent
(FIGS. 19A and 19E); 40 .mu.M 11mer-1 pGTTAGGGTTAG (SEQ ID NO:5)
(FIGS. 19B and 19F); 40 .mu.M 11mer-2 pCTAACCCTAAC (SEQ ID NO:9)
(FIGS. 19C and 19G); 40 .mu.M 11mer-3 pGATCGATCGAT (SEQ ID NO:10)
(FIGS. 19D and 19H). Jurkat cells were treated with the stated
reagents for 48 hours before analysis (FIGS. 19A-19D) or 72 hours
(FIGS. 19E-19H).
[0043] FIGS. 20A-20F are profiles showing the results of
fluorescence activated cell sorting, for the following additions to
the cells: FIG. 20A, diluent; FIG. 20B, 0.4 .mu.M 11mer-1; FIG.
20C, 0.4 .mu.M 11mer-1-S; FIG. 20D, diluent; FIG. 20E, 40 .mu.M
11mer-1; FIG. 20F, 40 .mu.M 11mer-1-S.
[0044] FIGS. 21A-21G are profiles showing the results of
fluorescence activated cell sorting, for the following additions to
the cells: FIG. 21A, diluent; FIG. 21B, 10 .mu.M 11mer-1; FIG. 21C,
10 .mu.M 11mer-1 and 1 .mu.M 11mer-1-S; FIG. 21D, 10.mu.M 11mer-1
and 5.mu.M 11mer-1-S;FIG. 21E, 10.mu.M 11mer-1 and 10 .mu.M
11mer-1-S; FIG. 21F, 20 .mu.M 11mer-1-S; FIG. 21G, 10 .mu.M
11mer-1-S.
[0045] FIG. 22 is a bar graph showing the melanin content (in
pg/cell) of cells treated with diluent, pTpT or pTspT.
[0046] FIG. 23 is a bar graph showing the melanin content (in
pg/cell) of cells treated with diluent, 11mer-1 or 11mer-1-S.
[0047] FIG. 24 is a bar graph showing the melanin content (in
pg/cell) of cells that have been sham-treated (no irradiation, no
oligonucleotides), or treated with ultraviolet light (UV), or
unirradiated but given pTspT, or irradiated with UV and given
pTspT.
[0048] FIG. 25 is a graph in which viable cell count, as a percent
of the cell count for the respective sham-irradiated control, is
shown as a function of time after ultraviolet irradiation for
diluent-treated (squares) or pTpT-treated (diamonds) cells of
squamous carcinoma cell line SCC12F.
[0049] FIG. 26 is a bar graph in which the repair capacity of
normal human fibroblasts, after UVA-induced damage and treatment
with pTpT, is shown as the luciferase activity generated from
expression of a gene in the non-replicating vector pCMV-Luc.
Luciferase activity, as a percent of a sham-irradiated control, is
plotted for diluent-treated (black bars) and pTpT-treated (white
bars) for fibroblasts irradiated for 10 or 20 minutes. See Example
24.
[0050] FIG. 27 is a bar graph showing the results of an assay for
caspase-3 activity in Jurkat cells treated with (bars, as shown
left to right): diluent, oligonucleotide homologous to telomere
sequence, oligonucleotide complementary to telomere sequence, or an
unrelated oligonucleotide. Caspase-3 activity (in pmol pNA/hr/.mu.g
protein resulting from the assay) is plotted for 48, 72 and 96
hours of incubation of the cells with the oligonucleotides.
[0051] FIG. 28 is a bar graph depicting the average volume of
primary tumors that resulted in SCID (severe combined
immunodeficiency) mice injected with MM-AN cells pre-treated with
diluent, "complement" oligonucleotide with sequence pCTAACCCTAAC
(SEQ ID NO:9), or "T-oligo" with sequence pGTTAGGGTTAG (SEQ ID
NO:5).
[0052] FIG. 29 is a bar graph depicting the average volume of
metastatic tumors that resulted in SCID mice injected with MM-AN
cells pre-treated with diluent, "complement" oligonucleotide, or
"T-oligo." See Example 30.
[0053] FIGS. 30A-30H are profiles of fluorescence intensity as
determined by fluorescence activated cell sorting, for the
following additions to Jurkat cells: FIGS. 30A and 30E, diluent;
FIGS. 30B and 30F, 10 .mu.M pGGGTTAGGGTT (SEQ ID NO:13); FIGS. 30C
and 30G, 10 .mu.M pTAGATGTGGTG (SEQ ID NO:14); FIGS. 30D and 30H,
10 .mu.M pCGGGCTTATTG (SEQ ID NO:15). Cells were collected and
processed for FACS 72 hours after addition of oligonucleotides
(FIGS. 30A 30B, 30C and 30D) or 96 hours after addition of
oligonucleotides (FIGS. 30E, 30F, 30G and 30H). See Example 31.
[0054] FIGS. 31A-31E are profiles of fluorescence intensity as
determined by fluorescence activated cell sorting, for the
following additions to Jurkat cells: FIG. 31A, diluent; FIGS. 31B
and 31D, pTT at 20 .mu.M and 5 .mu.M, respectively; FIGS. 31C and
31E, pGTTAGGGTTAG (SEQ ID NO:5) at 20 .mu.M and 5 .mu.M,
respectively. See Example 31.
[0055] FIGS. 32A-32D are profiles of fluorescence intensity as
determined by fluorescence activated cell sorting, for the
following additions to preconfluent normal neonatal human
fibroblasts: FIG. 32A, diluent; FIG. 32B, pGTTAGGGTTAG (SEQ ID
NO:5) at 40 .mu.M; FIG. 32C, pCTAACCCTAAC (SEQ ID NO:9) at 40
.mu.M; FIG. 32D, pGATCGATCGAT (SEQ ID NO:10) at 40 .mu.M. Cells
were analyzed by FACS 24 hours after addition of oligonucleotides
or diluent.
[0056] FIGS. 33A-33H are profiles of fluorescence intensity as
determined by fluorescence activated cell sorting, for the
following additions to (FIGS. 33A-33D) SCC12F cells or (FIGS.
33E-33H) Saos-2 cells: FIGS. 33A and 33E, diluent; FIGS. 33B and
33F, pGTTAGGGTTAG (SEQ ID NO:5); FIGS. 33C and 33G, pCTAACCCTAAC
(SEQ ID NO:9); FIGS. 33D and 33H, pGATCGATCGAT (SEQ ID NO: 10).
Cells were analyzed by FACS 48 hours after addition of 40 .mu.M
oligonucleotides.
[0057] FIGS. 34A-34H are profiles of fluorescence intensity as
determined by fluorescence activated cell sorting, for the
following additions to (FIGS. 34A-34D) normal control fibroblasts
or (FIGS. 34E-34H) NBS fibroblasts: FIGS. 34A and 34E, diluent;
FIGS. 34B and 34F, pGTTAGGGTTAG (SEQ ID NO:5); FIGS. 34C and 34G,
pCTAACCCTAAC (SEQ ID NO:9); FIGS. 34D and 34H, pGATCGATCGAT (SEQ ID
NO:10). Cells were analyzed by FACS 48 hours after addition of 40
.mu.M oligonucleotides or diluent.
[0058] FIG. 35 is a diagram of a proposed mechanism for induction
of senescence, cell cycle arrest, adaptive differentiation or
apoptosis by exposures of the single-stranded telomere DNA
sequence. The 3' telomere overhang is normally sequestered within a
loop structure stabilized by TRF2, forming a "capped" or silent
telomere. Destabilization of this loop structure by DNA damage due
to UV irradiation or chemical adducts, expression of TRF.sub.2DN,
or gradual erosion during aging is hypothesized to expose this
single-stranded DNA (repeats of TTAGGG; SEQ ID NO:11), "uncapping"
the telomere. Displacement of the TRF2 protein might or might not
accompany loop disruption under physiological conditions. This
single-stranded DNA is then detected by an as yet unidentified
sensor molecule. Interaction of this sensor with the 3' overhang
initiates a cascade of events that includes ATM activation,
followed by p53 activation and p95/Nbs1 modification leading to
cell cycle arrest. Depending on cell type and/or intensity and
duration of the signal, these events might lead to the eventual
induction of senescence, adaptive differentiation or apoptosis. DNA
oligonucleotides homologous to the overhang sequence could be
recognized by the same sensor molecule, triggering the cascade in
the absence of telomere disruption.
[0059] FIG. 36 is a bar graph representing averages of cell
population doublings after additions, with standard error of mean,
for duplicate cultures of Saos-2 cells treated with
oligonucleotides for 36 hours, as described in Example 40.
DETAILED DESCRIPTION OF THE INVENTION
[0060] The present invention is based on the discovery that
treatment of cells with DNA fragments, oligonucleotides or similar
compounds can inhibit cell proliferation, or induce DNA repair or
elicit a protective response to subsequent exposure to
UV-irradiation or carcinogenic chemicals. pTpT evokes a melanogenic
(tanning) response in skin (U.S. Pat. No. 5,643,556, the teachings
of which are incorporated herein in their entirety), a protective
response to UV irradiation.
[0061] More specifically, the invention pertains to the use of
compounds such as DNA fragments, polynucleotides, oligonucleotides,
deoxynucleotides, dinucleotides, or dinucleotide dimers, or similar
compounds, for the inhibition of cell proliferation or induction of
DNA repair. As used herein, inhibition of cell proliferation
includes complete abrogation of cell division, partial inhibition
of cell division and transient inhibition of cell division as
measured by standard tests in the art and as described in the
Examples. The invention also pertains to the prevention and/or
treatment of hyperproliferative diseases, including, but not
limited to, cancer and pre-cancerous conditions, wherein the
hyperproliferative disease affects cells of any organ and any
embryonic origin. Tumors of metastasis, and cells of regrowth and
relapse after treatment, as well as primary tumors, can be treated
by the methods of the invention. In particular embodiments, the
diseases and conditions to be treated include skin diseases such as
psoriasis and hyperproliferative, pre-cancerous or UV-induced
dermatoses in mammals, particularly in humans.
[0062] The invention further pertains to use of the compounds of
the present invention to reduce photoaging (a process due in part
to cumulative DNA damage), and to reduce oxidative stress and
oxidative damage. The invention also pertains to prophylaxis
against, or reduction in the likelihood of, the development of skin
cancer in a mammal. In addition, the compounds of the present
invention can be used to induce apoptosis in cells such as cells
that have sustained genetic mutation, such as malignant or cancer
cells or cells from an actinic keratosis. The invention further
provides compositions comprising said compounds.
[0063] All types of cells, and in particular embodiments,
epithelial cells, are expected to respond to the methods of the
present invention as demonstrated by the representative in vitro
and in vivo examples provided herein. Epithelial cells suitable for
the method of the present invention include epidermal cells,
respiratory epithelial cells, nasal epithelial cells, oral cavity
cells, aural epithelial cells, ocular epithelial cells,
genitourinary tract cells and esophageal cells, for example.
Gastrointestinal cells are also contemplated in methods of the
invention as described herein.
[0064] Cells that contain damaged or mutated DNA include, for
example, actinic keratosis cells, cancer cells, cells that have
been irradiated, as with UV, and cells that have been exposed to
DNA damaging chemicals or conditions. As described herein,
allergically mediated inflammation includes conditions such as
atopic dermatitis, contact dermatitis, allergic rhinitis and
allergic conjunctivitis.
[0065] In one embodiment, the compositions of the present invention
comprise DNA oligonucleotides approximately 2-200 bases in length,
which can be administered to a mammal (e.g., human) in an
appropriate vehicle. In another embodiment, the DNA
oligonucleotides are about 2 to about 20 nucleotides in length. In
still another embodiment, the oligonucleotides are about 5 to about
11 nucleotides in length. In yet another embodiment, the DNA
oligonucleotides are about 2-5 nucleotides in length. As used
herein, "DNA fragments" refers to single-stranded DNA fragments,
double-stranded DNA fragments, or a mixture of both single- and
double-stranded DNA fragments.
[0066] It is understood that other base-containing sequences can
also be used in the present invention, where bases are, for
example, adenine, thymine, cytosine, guanine or uracil. In one
embodiment, the oligonucleotides of the present invention comprise
a 5' phosphate. A combination of one or more of oligonucleotides of
the present invention can also be used.
[0067] As shown in the Examples, certain DNA fragments,
oligonucleotides and dinucleotides of the present invention caused
inhibition of proliferation, melanogenesis, TNF.alpha. production
and induction of apoptosis in cells, when the cells were contacted
with the DNA fragments, oligonucleotides and nucleotides of the
present invention. For example, thymidine dinucleotide (pTpT)
inhibits proliferation of several human cell types including
squamous cell carcinoma, cervical carcinoma, melanoma, neonatal
keratinocytes and normal neonatal fibroblasts (Examples 1-5,
respectively). pTpT also reduced epidermal proliferation in vivo in
a guinea pig model (Example 6). Furthermore, pTpT treatment of
cells resulted in the nuclear localization of p53 (Example 7) and
the induction of p53-regulated genes (Example 8) such as genes
involved in DNA repair. Pretreatment of cells with pTpT enhanced
their ability to repair DNA damaged by UV irradiation and by the
chemical carcinogen benzo[a]pyrene (Examples 8 and 9). pTpT
up-regulated the levels of p53, PCNA and the XPA protein 2 to
3-fold within 2 days of treatment (Example 9). Of note XPA is known
not to be p53 regulated, demonstrating that some enhancement of DNA
repair capacity may also occur in cells lacking p53. Pretreatment
of mouse skin with pTpT also resulted in a reduced level of
UV-induced DNA damage (thymine dimers) in vivo (Example 14).
[0068] Thymidine dinucleotide, pTpT, mimics some effects of UV
light, including inducing melanogenesis and stimulating
keratinocyte production of TNF.alpha. (Example 4). pTpT also
induces TNF.alpha. and reduces contact hypersensitivity in vivo
(Example 10). UVB radiation is a potent inhibitor of the inductive
phase of contact hypersensitivity (CH), and TNFA is a mediator of
this suppressive effect. Thymidine dinucleotides (pTpT), a
substrate for UV-induced thymine dimer formation, stimulate several
effects, including increased tyrosinase expression and melanin
content in cultured melanocytes and skin tanning in guinea pigs. As
shown in Example 10, the compounds of the present invention also
mimic the suppressive effect of UVB on contact hypersensitivity in
a mouse model. As demonstrated by the present invention,
intracutaneous injection or topical application of pTpT can inhibit
the induction of contact hypersensitivity and can activate the
TNF.alpha. gene in vivo.
[0069] Example 10 also demonstrates that pTpT induces production of
IL-10 mRNA and protein which is active in inhibiting T cell
proliferation in allogenic mixed lymphocyte assay. In human skin,
IL-10 as well as TNF.alpha. induces specific tolerance for contact
hypersensitivity and delayed-type hypersensitivity reactions.
Therefore, the DNA fragments, oligonucleotides, deoxynucleotides,
dinucleotides and dinucleotide dimers of the present invention are
reasonably expected to have immunosuppressive effects in vivo,
e.g., to inhibit contact hypersensitivity and delayed-type
hypersensitivity.
[0070] In further examples, a nine-nucleotide oligomer, GAGTATGAG
(SEQ ID NO: 1) stimulated melanogenesis in human melanocytes and
induced the expression of p21/Waf/Cip 1, a growth inhibitory gene
product, in a squamous cell carcinoma cell line. Furthermore, a
scrambled version of the 9-mer, TAGGAGGAT (SEQ ID NO: 2), and
truncated versions of the original 9-mer, AGTATGA (SEQ ID NO: 3),
and GTATG (SEQ ID NO: 4), also stimulated melanogenesis in human
melanocytes (Example 11). In addition, the sequence pGTTAGGGTTAG
(SEQ ID NO: 5) stimulated pigmentation in Cloudman S91 melanoma
cells (Example 12) and induced apoptosis in a human T-cell line
(Example 13). As demonstrated herein, pGTTAGGGTTAG (SEQ ID NO: 5)
induced human T cells to undergo apoptosis, while SEQ ID NOs: 9 and
10 (PCTAACCCTAAC and pGATCGATCGAT) did not significantly increase
apoptosis in these cells (Example 13). Oligonucleotides with
sequences SEQ ID NOs: 6-12 demonstrated at least some ability to
induce melanogenesis (Examples 11-13).
[0071] As demonstrated herein, oligonucleotides as small as
dinucleotides (e.g. pTpT) and oligonucleotides of about 20
nucleotides in length can also be used, as it has been demonstrated
that oligonucleotides of these lengths are taken up into the cells.
In another embodiment, oligonucleotides of about 11 nucleotides can
be used. In still another embodiment, oligonucleotides of 5
nucleotides in length can be used to penetrate the skin barrier and
effectively induce melanogenesis, inhibit cell growth and induce
immunosuppression. These results demonstrate that the in vitro
effects of these compounds also occur in vivo upon contacting the
cells or tissue of interest with the compounds of the present
invention. For example, as demonstrated herein, for the effect of
inhibition of cell proliferation, TNF-a production and melanin
production, in vitro induction of these activities by the compounds
of the present invention is predictive of the ability of these
compounds to produce the same effects in vivo. Any suitable method
of administering the compounds of the present invention to the
organism, such that the compound contacts the cells or tissues of
interest, is reasonably expected to be effective. The effects can
be optimized using routine optimization protocols.
[0072] The compounds of the present invention are therefore useful
in methods of inhibiting cell proliferation, preventing cancer,
photoaging and oxidative stress by enhancing DNA repair, and, in
the skin, by enhancing pigmentation through increased melanin
production. Melanin is known to absorb photons in the UV range and
therefore its presence reduces the risk of cancer and
photoaging.
[0073] The DNA fragments, oligonucleotides, deoxynucleotides,
dinucleotides, and dinucleotide dimers can be obtained from any
appropriate source, or can be synthetically produced. To make DNA
fragments, for example, salmon sperm DNA can be dissolved in water,
and then the mixture can be autoclaved to fragment the DNA. In one
embodiment, the DNA fragments, oligonucleotides, deoxynucleotides,
dinucleotides or dinucleotide dimers contain a 5' phosphate.
[0074] The compounds of the present invention also play a
protective role in UVA-induced oxidative damage to the cell
(Example 15). As described in Example 15, primary newborn
fibroblasts treated with 10 .mu.M pTpT for 3 days and then
stimulated with 5.times.10.sup.-5 or 5.times.10.sup.-4
H.sub.2O.sub.2 had higher cell yields compared to diluent treated
controls. Analysis of mRNA and protein revealed that in pTpT
treated cells, Cu/Zn superoxide dismutase was elevated. This enzyme
participates in the process of oxygen radical quenching. Thus, in
one embodiment of the present invention, the compounds of the
present invention are administered to cells to protect against
oxidative damage. In one embodiment, these compounds are topically
administered to the epidermis of an individual.
[0075] An "agent that increases activity of p53 protein," as used
herein, is an agent (e.g., a drug, molecule, nucleic acid fragment,
oligonucleotide, or nucleotide) that increases the activity of p53
protein and therefore results in increase in an DNA repair
mechanisms, such as nucleotide excision repair, by the induction of
proteins involved in DNA repair, such as PCNA, XPB and p21
proteins. The activity of p53 protein can be increased by directly
stimulating transcription of p53-encoding DNA or translation of
p53-specific MRNA, by increasing expression or production of p53
protein, by increasing the stability of p53 protein, by increasing
the resistance of p53 mRNA or protein to degradation, by causing
p53 to accumulate in the nucleus of a cell, by increasing the
amount of p53 present, by phosphorylating the serine 15 residue in
p53, or by otherwise enhancing the activity of p53. The p53 protein
itself is also an agent that increases the activity of p53 protein.
A combination of more than one agent that increases the activity of
p53 can be used. Alternatively or in addition, the agent that
increases the activity of p53 can be used in combination with DNA
fragments, deoxynucleotides, or dinucleotides, as described
above.
[0076] Ultraviolet irradiation produces DNA photoproducts that when
not promptly removed, can cause mutations and skin cancer. Repair
of UV-induced DNA damage requires efficient removal of the
photoproducts to avoid errors during DNA replication.
Age-associated decrease in DNA repair capacity is associated with
decreased constitutive levels of p53 and other nuclear excision
repair (NER) proteins required for removing UV-induced
photoproducts. As demonstrated herein, compounds of the present
invention induced NER proteins in human dermal cells when these
cells were treated with these compounds before UV irradiation
(Example 16). While there were age related decreases in NER
proteins, NER proteins in cells from donors of all ages from
newborn to 90 years were induced by 200-400%. A significant
decrease in the rate of repair of thymine dimers and photoproducts
occurs with increased age of the cell sample; however, cells that
were pre-treated with compounds of the present invention, then UV
irradiated, removed photoproducts 30 to 60 percent more
efficiently. Thus, the treatment of cells with small DNA
oligonucleotides partially compensates for age-associated decreases
in DNA repair capacity. In light of the in vivo efficacy of the
compounds of the present invention, it is reasonable to expect that
treatment of human skin with the compounds of the present invention
enhances endogenous DNA repair capacity and reduces the
carcinogenic risk from solar UV irradiation. This method is
especially useful in older individuals who likely have reduced
cellular DNA repair capacity.
[0077] DNA fragments, oligonucleotides, deoxynucleotides,
dinucleotides or dinucleotide dimers, to be applied to the skin in
methods to prevent the sequelae of UV exposure or to reduce the
occurrence of skin cancer, to reduce oxidative damage, or to
enhance repair of UV-induced damage, can be administered alone, or
in combination with physiologically acceptable carriers, including
solvents, perfumes or colorants, stabilizers, sunscreens or other
ingredients, for medical or cosmetic use. They can be administered
in a vehicle, such as water, saline, or in another appropriate
delivery vehicle. The delivery vehicle can be any appropriate
vehicle which delivers the DNA fragments, oligonucleotides,
deoxynucleotides, dinucleotides, or dinucleotide dimers.
[0078] To allow access of the active ingredients of the composition
to deeper-lying skin cells, vehicles which improve penetration
through outer layers of the skin, e.g., the stratum comeum, are
useful. Vehicle constituents for this purpose include, but are not
limited to, ethanol, isopropanol, diethylene glycol ethers such as
diethylene glycol monoethyl ether, azone
(1-dodecylazacycloheptan-2-one), oleic acid, linoleic acid,
propylene glycol, hypertonic concentrations of glycerol, lactic
acid, glycolic acid, citric acid, and malic acid. In one
embodiment, propylene glycol is used as a delivery vehicle. In a
preferred embodiment, a mixture of propylene
glycol:ethanol:isopropyl myristate (1:2.7:1) containing 3%
benzylsulfonic acid and 5% oleyl alcohol is used.
[0079] In another embodiment, a liposome preparation can be used.
The liposome preparation can comprise liposomes which penetrate the
cells of interest or the stratum comeum, and fuse with the cell
membrane, resulting in delivery of the contents of the liposome
into the cell. For example, liposomes such as those described in
U.S. Pat. No. 5,077,211 of Yarosh, U.S. Pat. No. 4,621,023 of
Redziniak et al. or U.S. Pat. No. 4,508,703 of Redziniak et al. can
be used. The compositions of the invention intended to target skin
conditions can be administered before, during, or after exposure of
the skin of the mammal to UV or agents causing oxidative damage.
Other suitable formulations can employ niosomes. Niosomes are lipid
vesicles similar to liposomes, with membranes consisting largely of
non-ionic lipids, some forms of which are effective for
transporting compounds across the stratum comeum.
[0080] Other suitable delivery methods intended primarily for skin
include use of a hydrogel formulation, comprising an aqueous or
aqueous-alcoholic medium and a gelling agent in addition to the
oligonucleotide(s). Suitable gelling agents include
methylcellulose, carboxymethylcellulose,
hydroxypropylmethylcellulose, carbomer (carbopol), hypan,
polyacrylate, and glycerol polyacrylate.
[0081] In one embodiment, the DNA fragments, oligonucleotides,
deoxynucleotides, dinucleotides, dinucleotide dimers, agent to
inhibit apoptosis, or composition comprising one or more of the
foregoing, is applied topically to the skin surface. In other
embodiments, the DNA fragments, oligonucleotides, deoxynucleotides,
dinucleotides, dinucleotide dimers, agent that inhibits apoptosis,
or composition comprising one or more of the foregoing, is
delivered to other cells or tissues of the body such as epithelial
cells. Cells of tissue that is recognized to have a lesser barrier
to entry of such substances than does the skin can be treated,
e.g., orally to the oral cavity; by aerosol to the respiratory
epithelium; by instillation to the bladder epithelium; by
instillation or suppository to intestinal (epithelium) or by other
topical or surface application means to other cells or tissues in
the body, including eye drops, nose drops and application using
angioplasty, for example. Furthermore, the oligonucleotides of the
present invention can be administered intravenously or injected
directly into the tissue of interest intracutaneously,
subcutaneously, intramuscularly or intraperitoneally. In addition,
for the treatment of blood cells, the compounds of the present
invention can be administered intravenously or during
extracorporeal circulation of the cells, such as through a
photophoresis device, for example. As demonstrated herein, all that
is needed is contacting the cells of interest with the
oligonucleotide compositions of the present invention, wherein the
oligonucleotides contacting the cells can be as small as
dinucleotides.
[0082] The DNA fragments, oligonucleotides, deoxynucleotides,
dinucleotides, dinucleotide dimers, agent that promotes
differentiation, agent that increases p53 activity, or composition
comprising one or more of the foregoing, is administered to
(introduced into or contacted with) the cells of interest in an
appropriate manner. The "cells of interest," as used herein, are
those cells which may become affected or are affected by the
hyperproliferative disease or precancerous condition, or cells
which are affected by oxidative stress, DNA-damaging conditions
such as UV irradiation or exposure to DNA damaging chemicals such
as benzo[a]pyrene. Specifically encompassed by the present
invention are epithelial cells, including melanocytes and
keratinocytes, as well as other epithelial cells such as oral,
respiratory, bladder and cervical epithelial cells. As demonstrated
herein, methods and compositions of the present invention can
inhibit growth, induce melanogenesis and induce TNFA production in
epithelial cells from numerous sources.
[0083] The oligonucleotides, DNA fragments, deoxynucleotides,
dinucleotides, dinucleotide dimers, agent that promotes
differentiation, agent that increases p53 activity, agent that
inhibits apoptosis, or composition comprising one or more of the
foregoing, is applied at an appropriate time, in an effective
amount. The "appropriate time" will vary, depending on the type and
molecular weight of the oligonucleotides, DNA fragments,
deoxynucleotides, dinucleotides, dinucleotide dimers, or other
agent employed, the condition to be treated or prevented, the
results sought, and the individual patient. An "effective amount,"
as used herein, is a quantity or concentration sufficient to
achieve a measurable desired result. The effective amount will
depend on the type and molecular weight of the oligonucleotides,
DNA fragments, deoxynucleotides, dinucleotides, dinucleotide
dimers, or agent employed, the condition to be treated or
prevented, the results sought, and the individual patient. For
example, for the treatment or prevention of psoriasis, or for
hyperproliferative, cancerous, or pre-cancerous conditions, or
UV-induced dermatoses, the effective amount is the amount necessary
to reduce or relieve any one of the symptoms of the disease, to
reduce the volume, area or number of cells affected by the disease,
to prevent the formation of affected areas, or to reduce the rate
of growth of the cells affected by a hyperproliferative disorder.
The concentration can be approximately 2-300 .mu.M. In a another
embodiment, the concentration of agent (e.g., oligonucleotide) is
about 50-200 .mu.M; in another embodiment, the concentration is
about 75-150 .mu.M.
[0084] In one embodiment of the present invention,
oligonucleotides, DNA fragments, such as single-stranded DNA
fragments, deoxynucleotides, dinucleotides, or dinucleotide dimers,
agent that increases p53 activity, agent that promotes
differentiation, or a composition that can comprise one or more of
the foregoing, is administered, in an appropriate delivery vehicle,
to the cells of interest in the mammal in order to treat or prevent
a hyperproliferative disease affecting epithelial cells. The DNA
fragments, oligonucleotides, deoxynucleotides, dinucleotides,
dinucleotide dimers, agent that promotes differentiation, agent
that increases p53 activity, agent that inhibits apoptosis, or
composition comprising one or more of the foregoing, can be
administered systemically, can be administered directly to affected
areas, or can be applied prophylactically to regions commonly
affected by the hyperproliferative disease.
[0085] In another embodiment, the DNA fragments, oligonucleotides,
deoxynucleotides, dinucleotides, dinucleotide dimers, agent that
increases p53 activity, agent that promotes differentiation, or
composition comprising one or more of the foregoing, is
administered to the epidermis for the treatment or prevention of
oxidative stress or for the treatment or prevention of
hyperproliferative, cancerous, or pre-cancerous conditions, or
UV-responsive dermatoses.
[0086] In still another embodiment, DNA fragments,
oligonucleotides, deoxynucleotides, dinucleotides, dinucleotide
dimers, agent that promotes differentiation, agent that increases
p53 activity, or a composition comprising one or more of the
foregoing, can be administered, either alone or in an appropriate
delivery vehicle, to the epidermis for reduction of photoaging, or
prophylaxis against or reduction in the likelihood of development
of skin cancer. The DNA fragments, oligonucleotides,
deoxynucleotides, dinucleotides, dinucleotide dimers, agent that
promotes differentiation, agent that increases p53 activity, or
composition comprising one or more of the foregoing, can be
administered topically or by intracutaneous injection at an
appropriate time (i.e., prior to exposure of the skin to UV
irradiation). The DNA fragments, oligonucleotides,
deoxynucleotides, dinucleotides, dinucleotide dimers, agent that
promotes differentiation, agent that increases p53 activity, or
composition comprising one or more of the foregoing, can be applied
before, during or after exposure to a carcinogen such as UV
irradiation. They can be applied daily or at regular or
intermittent intervals. In one embodiment, the DNA fragments,
oligonucleotides, deoxynucleotides, dinucleotides, dinucleotide
dimers, agent that promotes differentiation, agent that increases
p53 activity, or composition comprising one or more of the
foregoing, can be administered on a daily basis to skin which may
be exposed to sunlight during the course of the day.
[0087] In a further embodiment of the invention, the DNA fragments,
oligonucleotides, deoxynucleotides, dinucleotides, dinucleotide
dimers, agent that promotes differentiation, agent that increases
p53 activity, or composition comprising one or more of the
foregoing, is administered, in an appropriate delivery vehicle, to
an individual (e.g., epithelial cells or other cells of an
individual) for the treatment or prevention of hyperproliferative,
cancerous or pre-cancerous conditions, or to repair or prevent DNA
damage caused by DNA damaging chemicals, such as
benzo[a]pyrene.
[0088] As demonstrated herein, the compounds of the present
invention are active in vitro and in vivo in their unmodified form,
e.g., sequences of unmodified oligonucleotides linked by
phosphodiester bonds. As used herein, the terms "oligonucleotide,"
"dinucleotide," "DNA fragment," etc., refer to molecules having
deoxyribose as the sugar, and having phosphodiester linkages
("phosphate backbone") as occur naturally, unless a different
linkage or backbone is specified.
[0089] Furthermore, although not necessary for the ability to
elicit the UV-mimetic effects of the present invention, the
compounds of the present invention can be modified, derivative or
otherwise combined with other reagents to increase the half life of
the compound in the organism and/or increase the uptake of these
compounds by the cells of interest. Modification reagents include,
for example, lipids or cationic lipids. In one embodiment, the
compounds of the present invention are covalently modified with a
lipophilic group, an adamancy moiety. The compounds of the present
invention can be modified to target specific tissues in the body.
For example, brain tissue can be targeted by conjugating the
compounds with biotin and using the conjugated compounds with an
agent that facilitates delivery across the blood-brain barrier,
such as anti-transferring receptor antibody coupled to
streptavidin.
[0090] From the results of experiments described in Examples 17-20,
it can be concluded that the activity of pTpT and the activity of
the telomere overhang repeat homolog oligonucleotide 11mer-1 (SEQ
ID NO: 5) require that they be hydrolyzable to induce apoptosis,
cell cycle arrest, and melanogenesis. The non-hydrolyzable
phosphorothioate form of these oligonucleotides has the ability to
inhibit the activity of the hydrolyzable molecules and can be used
to block the intracellular responses in vivo as well as in
vitro.
[0091] The Examples, especially Example 31, demonstrate that
telomere homolog oligonucleotides but not complementary or
unrelated DNA sequences of the same length induce an S-phase arrest
and apoptosis in an established human lymphocyte line and in a
human melanoma cell line. The effects are not due to selective
uptake of the telomere homolog, as the control sequences are taken
up comparably in the present study. Oligonucleotides partially
homologous to the 3' overhang sequence produce qualitatively the
same responses but to a lesser degree or at a higher concentration.
Thus, an 11 base oligonucleotide with 55% identity with the
telomere overhang repeat sequence telomere is intermediate between
the 11mer-1 (100% nucleotide sequence identity with telomere
repeat) and 11mer-2 (complementary to telomere repeat) or 11mer-3
(unrelated to telomere repeat) in producing apoptosis. pTT,
corresponding to one-third of the TTAGGG (SEQ ID NO:11) repeat
sequence, duplicates the 11mer-1 effect on cell cycle arrest but at
a 4-fold higher concentration. In work comparing pTT to a 9 base
oligonucleotide with 56% sequence identity with (TTAGGG).sub.n, the
oligonucleotide having 56% sequence identity was found to have an
ability comparable to pTT to induce p53 and p53-regulated genes at
40% the concentration, at 40 .mu.M versus 100 .mu.M pTT.
[0092] The oligonucleotide pTT has been shown to induce and
activate p53 and to transcriptionally upregulate a number of genes,
many but not all of which are known to be p53 regulated.
Experiments with the 11mer-1 complete homolog demonstrate that the
S-phase arrest induces results from phosphorylation of the p95/Nbs1
protein, which also mediates S-phase arrest following ionizing
radiation. Of note, this decreases proliferation of cells lacking
functional p53. Furthermore, as anticipated from the fact that
p95/Nbs1 is phosphorylated by the ATM kinase (Gatei, M., et al.,
(2000), Nat Genet 25, 115-119; Wu, X.,et al., (2000), Nature 25,
477-482; Lim, D. S., et al., (2000), Nature 404, 613-617; Zhao, S.,
et al. (2000), Nature 405, 473-477), the oligonucleotide effects
also require ATM and are not observed in cells from patients with
ataxia telangiectasia in whom the ATM kinase is mutated.
[0093] Experimental telomere disruption [Karlseder, J., et al.,
1999, Science 283: 1321-1325] and cellular manipulations that
precipitate premature senescence, such as transfection with the ras
oncogene or exposure to oxidative stress, are known to digest the
3' telomere overhang and/or to shorten overall telomere length. In
contrast, exposure of cells to telomere homolog oligonucleotides in
the present studies increases mean telomere length (MTL). While not
wishing to be bound by a single mechanism, these data strongly
suggest that the oligonucleotides can activate telomerase,
presumably by inducing TERT, and imply that transient activation of
telomerase may be a part of the physiologic telomere-based DNA
damage response that also includes activation of the ATM kinase
with subsequent signaling through p53 and p95/Nbs1. The apparent
ability of oligonucleotides to induce this response in the absence
of DNA damage and telomere disruption offers the possibility of
"rejuvenating" cells through telomere elongation, as recently
reported in human skin equivalent constructs containing fibroblasts
transfected with TERT, without the enhanced risk of carcinogenesis
observed even in even normal cells that ectopically express
telomerase. Equally, the phenomenon suggests that the advantages of
robust DNA damage responses of the type observed in p53
over-expressing mice could be separated from the premature
senescence also observed in the transgenic animals (Tyner, S. D.,
et al., 2002, Nature 415: 45-523). Such "rejuvenation" or delay in
acquiring the senescent phenotype associated with critical telomere
shortening would be in addition to other benefits that might accrue
from treatment with oligonucleotides partially or completely
homologous to the TTAGGG (SEQ ID NO:11) repeated sequence. Based on
extensive work in vivo as well as in vitro, these are understood to
include sunless tanning and related photoprotection, enhanced DNA
repair capacity, cancer prevention and treatment, and
immunomodulation.
[0094] Under normal conditions, the 3' telomere overhang DNA
sequence is believed to be folded back and concealed in a loop
structure stabilized by TRF2 [Griffith, J. D., et al., (1999), Cell
97, 503-514]. However, this sequence might be exposed if the
telomere were distorted, for example by ultraviolet (UV)-induced
thyrnine dimers or carcinogen adducts involving guanine residues
(as with cisplatin or benzo[a]pyrene) that could render the
loop-back configuration unstable. Exposure of the TTAGGG (SEQ ID
NO:11) repeat sequence could be the initial signal leading to a
variety of DNA damage responses, dependent on cell type as well as
intensity and/or duration of the signal. These responses include
cell cycle arrest, apoptosis, and a more differentiated sometimes
adaptive phenotype, for example, increased melanin production
(tanning). See FIG. 35.
[0095] The proposed model predicts that inability to repair damage
to telomeric DNA would lead to exaggerated damage responses, such
as p53 induction and apoptosis, as has been reported for
UV-irradiated xeroderma pigmentosum cells that cannot efficiently
remove DNA photoproducts (Dumaz, N., et al., 1998, Carcinogenesis
19: 1701-1704). This model is further consistent with the recent
finding that transgenic mice with supra-nonnal p53 activity are
highly resistant to tumors, yet age prematurely (Tyner, S. D., et
al., 2002, Nature 415: 45-523). A DNA damage recognition mechanism
might have evolved to contain predominantly thymidine and guanine
bases. The TTAGGG (SEQ ID NO:11) repeat sequence is an excellent
target for DNA damage, as dithymidine sites most commonly
participate in formation of UV photoproducts (Setlow, R. B. and W.
L. Carrier. 1966, J Mol Biol 17: 237-254) and guanine is both the
principal site of oxidative damage, forming 8-oxoguanine [Kasai, H.
and S. Nishimura, 1991. "Oxidative Stress: Oxidants and
Antioxidants," pp. 99-116 In H. Sies (ed.) (London, Academic Press,
Ltd.)], as well as the base to which most carcinogens form adducts
[Friedberg, E. C., et al., 1995, pp. 1-58 In E. C. Friedberg, G. C.
Walker and W. Siede, eds. (Washington, D.C., ASM Press)].
[0096] The postulated telomere-initiated signal transduction
pathway would provide a single evolutionary point of departure for
several distinct defenses against carcinogenesis in higher
organisms: permanent loss of proliferative capacity (senescence) in
cells expected on a statistical basis alone to have accumulated
multiple mutations throughout the genome during prolonged
environmental exposure and serial rounds of DNA replication and
cell division; transient cell cycle arrest to increase the time
available for repair before resuming DNA replication; activation of
a cell suicide program to remove cells from the tissue if damage
exceeds the repair capacity, since acute telomeric damage would be
expected to reflect the degree of DNA damage throughout the genome;
and induction over several days of adaptive responses, such as
tanning, to reduce DNA photoproduct formation and/or enhanced DNA
repair capacity to prevent damage from similar insults in the
future.
[0097] The invention includes methods for treating a
hyperproliferative disorder in a mammal, in which the therapy
includes administering to the mammal an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with the vertebrate telomere
overhang repeat. These methods can be applied especially to human
subjects. Hyperproliferative disorders can be characterized by
benign growth of cells beyond a normal range, and which sometimes
may result in a benign tumor or widespread epidermal thickening, as
in psoriasis. Also among the various hyperproliferative disorders
to be treated by these methods are cancer as it is manifested in
various forms and arising in various cell types and organs of the
body, for example, cervical cancer, lymphoma, osteosarcoma,
melanoma and other cancers arising in the skin, and leukemia. Also
among the types of cancer cells to which the therapies are directed
are breast, lung, liver, prostate, pancreatic, ovarian, bladder,
uterine, colon, brain, esophagus, stomach, and thyroid.
[0098] The oligonucleotides can be administered in the methods of
treatment described herein as a single type of oligonucleotide or
in a combination comprising with one or more different
oligonucleotides. Oligonucleotides without a 5' phosphate can be
used in any of the methods of therapy for treatment, or for the
reduction of incidence of a disease or disorder described herein.
However, oligonucleotides having a 5' phosphate are preferred, as
it has been shown that the 5' phosphate improves uptake of the
oligonucleotide into cells. The oligonucleotides can be at least 2
nucleotides in length, preferably 2-200 nucleotides, and more
preferably from 2 to 20 nucleotides in length. Oligonucleotides
5-11 nucleotides are more preferred.
[0099] The telomere overhang repeat sequence of vertebrates is
(TTAGGG)n. The invention encompasses methods in which the
oligonucleotides administered for therapy have at least 50%
nucleotide sequence identity to the telomere repeat sequence.
Preferred are oligonucleotides having at least 60% nucleotide
sequence identity. More preferred are oligonucleotides having at
least 70% nucleotide sequence identity. Still more preferred are
those oligonucleotides having at least 80% nucleotide sequence
identity. More highly preferred are oligonucleotides having at
least 90% nucleotide sequence identity. Most preferred are
oligonucleotides having 100% nucleotide sequence identity to
(TTAGGG)n. The particular telomere repeat homologs pGAGTATGAG (SEQ
ID NO:1), pGTTAGGGTTAG (SEQ ID NO:5; also called "11mer-1" and
"T-oligo" herein), pGGGTTAGGGTT (SEQ ID NO:13) and pTAGATGTGGTG
(SEQ ID NO:14) are especially preferred where it is desired to use
an oligonucleotide sharing at least 50% nucleotide sequence
identity with the telomere repeat sequence. Other oligonucleotides
having at least 50% nucleotide sequence identity with the telomere
overhang repeat sequence can be used as anti-proliferative agents,
for example TABLE-US-00002 pTAGGAGGAT, (SEQ ID NO:2) pAGTATGA, (SEQ
ID NO:3) and pGTATG. (SEQ ID NO:4)
[0100] Oligonucleotides are relatively short polynucleotides.
Polynucleotides are linear polymers of nucleotide monomers in which
the nucleotides are linked by phosphodiester bonds between the 3'
position of one nucleotide and the 5' position of the adjacent
nucleotide. Unless otherwise indicated, the "oligonucleotides" of
the invention as described herein have a phosphodiester
backbone.
[0101] Sequence identity is determined by a best fit alignment of
the oligonucleotide in question with (TTAGGG).sub.n. The sequences
are compared at each position, and a determination of "match" or
"no match" is made at each nucleotide position, and the percent of
matches, without resorting to deletion or insertion in either
sequence, is the percent identity of the sequences as counted along
the oligonucleotides in question. Thus, by illustration, SEQ ID
NO:5 shares 100% sequence identity with (TTAGGG).sub.n. SEQ ID NO:1
shares 5/9 sequence identity with (TTAGGG).sub.n. SEQ ID NO:4
shares 3/5 sequence identity with (TTAGGG).sub.n. pTT shares 100%
sequence homology with (TTAGGG).sub.n.
[0102] Particular molecules found to have an anti-proliferative
effect, and thus appropriate for use in methods to reduce
proliferation of cells in a mammal, are the oligonucleotides
thymidine dinucleotide ("pTpT" or "pTT" or "T.sub.2") and pCATAC
(SEQ ID NO:6).
[0103] Another part of the invention is a method for promoting
differentiation of malignant cells in a mammal, the method
comprising administering to the mammal an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with (TTAGGG).sub.n. A
differentiated state, can in many ways, be considered the opposite
of a malignant state. Depending on the cell type, differentiation
can involve the regulation of expression of a number of different
genes to result in an increase or decrease in certain enzymatic
activities, or cell surface proteins, for example. For example,
melanocytes respond to oligonucleotides with an increase in
tyrosinase expression.
[0104] Herein, an association has been found between the inhibition
of growth of cancer cells, caused by the cells taking up
oligonucleotides with sequence identity to the telomere repeat
sequence, and an increase in the appearance on the cell surface of
antigens typical of differentiated cells, rather than cancer cells.
Thus, a further method of the invention is to enhance the
expression of one or more surface antigens indicative of
differentiation of cancer cells in a mammal, said method comprising
administering to the mammal an effective amount of one or more
oligonucleotides as described herein, for example, one or more
oligonucleotides which share at least 50% nucleotide sequence
identity with the vertebrate telomere overhang repeat.
[0105] This inducement of the cells to a more differentiated state,
or to take on one or more characteristics of differentiation, can
be exploited in immunotherapy methods. The surface antigens
associated with a differentiated state, fragments thereof, or
synthetic peptides derived from the studies of the externally
exposed loops of the surface antigens, can be incorporated into a
vaccine to induce a cancer patient to produce cytotoxic T
lymphocytes against the cells displaying the cell surface antigen.
For example, in melanoma cells, the cell surface antigens MART-1,
tyrosinase, TRP-1 or gp-100, or combinations thereof, can be made
to increase on the cell surface when the cells take up
oligonucleotides sharing at least 50% nucleotide sequence identity
with the telomere overhang repeat. See Example 29. These cell
surface antigens can become targets for immunotherapy, for example
by vaccinations with the isolated cell surface antigen or peptides
having amino acid sequences derived from the surface loops of the
antigens. See, for example, Jager, E. et al., Int. J. Cancer
66:470-476, 1996; Kawakami, Y. et al., J. Immunol. 154:3961-3968,
1995; and de Vries, T. J. et al., J. Pathol. 193:13-20, 2001.
[0106] Telomerase has been a target for antiproliferative methods
based on theories of using antisense oligonucleotides to bind to
the RNA portion of the enzyme. However, the therapeutic methods
described herein can be used independently of the presence or
function of telomerase in the target cells. The telomere repeat
overhang homolog pGTTAGGGTTAG (SEQ ID NO:5) was seen to bring about
S-phase cell cycle arrest in normal fibroblasts and in cells of the
osteosarcoma cell line Saos-2, neither of which have telomerase
activity. See Examples 32 and 34. Thus, for cancer cells, most of
which have telomerase activity, but some of which do not, the
present method can be used regardless of telomerase activity. The
inhibition of growth of the cancer cells is characterized by cell
cycle arrest, apoptosis, and/or differentiation to a more
differentiated state. A method for inhibiting the growth of cancer
cells in a mammal (e.g., human), operational independent of the
telomerase (+) or telomerase (-) state of the cancer cells, is to
administer to the mammal an effective amount of a composition
comprising one or more oligonucleotides which share at least 50%
nucleotide sequence identity with the telomere overhang repeat.
[0107] The experiments described in Example 34 demonstrate that the
function of a wild type p53 protein is also not necessary to bring
about the S-phase cell cycle arrest in tumors or tumor cells
treated with an oligonucleotide with at least 50% sequence identity
to the telomere repeat sequence. A p53-null osteosarcoma cell line
was shown to respond to the addition of pGTTAGGGTTAG (SEQ ID NO:5)
by arresting in S-phase. Thus, the method for inhibiting the growth
of cancer cells in a mammal, the method including administering to
the human an effective amount of a composition comprising one or
more oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat, can be carried
out whether or not the target cells have normal p53 function.
[0108] The invention further comprises a method for preventing the
sequelae of exposure of the skin of a mammal to ultraviolet
light--spongiosis, blistering or dyskeratosis, or any combination
of these--by administering to the skin an effective amount of a
composition comprising one or more oligonucleotides which share at
least 50% nucleotide sequence identity with the telomere overhang
repeat. The steps or steps of this method can also be used in the
reduction in the incidence of skin cancer in a human, and is
particularly applicable to reduce the occurrence of skin cancer in
patients with xeroderma pigmentosum or other genetic predisposition
to skin cancer. The method of applying to the skin an effective
amount of a composition comprising one or more oligonucleotides
which share at least 50% nucleotide sequence identity with the
telomere overhang repeat is also a method for enhancing repair of
ultraviolet irradiation-induced damage to skin. Any of the
oligonucleotides described herein and characterized by having at
least 50% sequence identity to the telomere repeat sequence found
in humans--the oligonucleotides pGAGTATGAG (SEQ ID NO:1), pCATAC
(SEQ ID NO:6), pGTTAGGGTTAG (SEQ ID NO:5), pGGGTTAGGGTT (SEQ ID
NO:13), or pTAGATGTGGTG (SEQ ID NO:14), for example, can be used in
the methods. Further, the oligonucleotides pTT and pGAGTATGAG (SEQ
ID NO: 1) can also be used in the methods.
[0109] Oxidative damage is characterized by the reaction products
of reactions of molecules found in the cells with reactive oxygen
species (ROS), such as hydrogen peroxide, hydroxyl radicals, and
superoxide. Oxidative damage can result, for instance, from normal
cellular metabolism, UVA irradiation, ionizing radiation, or
exposure to a variety of chemicals. Reactive oxygen species can be
measured in a number of ways. One assay employs a probe
dichlorofluorescin diacetate (Molecular Probes, Inc.), a colorless
reagent that is taken up by the cells and becomes fluorescent upon
oxidation by ROS. The level of fluorescence correlates with the
intracellular ROS level.
[0110] Applicants have also described a method for reducing
oxidative damage in a mammal, the method having a step of
administering to the mammal an effective amount of a composition
comprising administering to the mammal, especially to the skin of
the mammal, an effective amount of a composition comprising one or
more oligonucleotides which share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. Preferred are
embodiments in which the oligonucleotide is pGAGTATGAG (SEQ ID
NO:1). Also effective in the method is pTT. See results in Examples
15, 21, 22 and 23 suggesting that oligonucleotide treatment should
enhance the ability of cells to repair oxidative DNA damage.
[0111] Applicants have further described a method for treating
melanoma in a mammal, comprising administering to the human an
effective amount of a composition comprising one or more
oligonucleotides that share at least 50% nucleotide sequence
identity with the human telomere overhang repeat. In particular
cases, the oligonucleotide can be pGTTAGGGTTAG (SEQ ID NO:5); pTT
can also be used in the method. Applicants have shown the
effectiveness of oligonucleotide therapy using human melanoma cells
in a mouse model. See Example 30.
[0112] Another aspect of the invention concerns a method for
reducing proliferation of keratinocytes in the skin of a human, in
which the method comprises applying to the skin an effective amount
of a composition comprising one or more oligonucleotides that share
at least 50% nucleotide sequence identity with the human telomere
overhang repeat. The method is applicable to disorders of the skin
characterized by proliferation of keratinocytes in the skin, such
as seborrheic keratosis, actinic keratosis, Bowen's disease,
squamous cell carcinoma or basal cell carcinoma. Also effective in
the method is pTT.
[0113] The present invention includes the method of treating a
disease or disorder in a mammal, wherein the disease or disorder is
characterized by abnormal proliferation of cells, including, but
not limited to, cancers, solid tumors, blood-born tumors (e.g.,
leukemias), tumor metastases, benign tumors (e.g., hemangiomas,
acoustic neuromas, neurofibromas, trachomas, and pyogenic
granulomas), and psoriasis. Hyperproliferative disorders can also
be those characterized by excessive or abnormal stimulation of
fibroblasts, such as scleroderma, and hypertrophic scars (i.e.,
keloids).
[0114] The oligonucleotide or oligonucleotides to be used in
therapies to alleviate hyperproliferative disorders such as cancer
can be used in a composition in combination with a pharmaceutically
or physiologically acceptable carrier. Such a composition may also
contain in addition, diluents, fillers, salts, buffers,
stabilizers, solubilizers, and other materials well known in the
art. Cationic lipids such as DOTAP
[N-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium salts may be
used with oligonucleotides to enhance stability. Oligonucleotides
may be complexed with PLGA/PLA copolymers, chitosan or fumaric
acid/sebacic acid copolymers for improved bioavailability {where
PLGA is [poly(lactide-co-glycolide)]; PLA is poly(L-lactide)}. The
terms "pharmaceutically acceptable" and "physiologically
acceptable" mean a non-toxic material that does not interfere with
the effectiveness of the biological activity of the active
ingredient(s). The characteristics of the carrier will depend on
the route of administration.
[0115] A composition to be used as an antiproliferative agent may
further contain other agents which either enhance the activity of
the oligonucleotide(s) or compliment its activity or use in
treatment, such as chemotherapeutic or radioactive agents. Such
additional factors and/or agents may be included in the composition
to produce a synergistic effect with the oligonucleotide(s), or to
minimize side effects. Additionally, administration of the
composition of the present invention may be administered
concurrently with other therapies, e.g., administered in
conjunction with a chemotherapy or radiation therapy regimen.
[0116] The oligonucleotides as described herein can be used in
combination with other compositions and procedures for the
treatment of diseases. For example, a tumor may be treated
conventionally with surgery, radiation, chemotherapy, or
immunotherapy, combined with oligonucleotide therapy, and then
oligonucleotides may be subsequently administered to the patient to
extend the dormancy of micrometastases and to stabilize and inhibit
the growth of any residual primary tumor.
[0117] The compositions of the present invention can be in the form
of a liposome in which oligonucleotide(s) of the present invention
are combined, in addition to other pharmaceutically acceptable
carriers, with amphipathic agents such as lipids which exist in
aggregated form as micelles, insoluble monolayers, liquid crystals,
or lamellar layers in aqueous solution. Suitable lipids for
liposomal formulation include, without limitation, monoglycerides,
diglycerides, sulfatides, lysolecithin, phospholipids, saponin,
bile acids, and the like.
[0118] Pharmaceutical compositions can be made containing
oligonucleotides to be used in antiproliferative therapy.
Administration of such pharmaceutical compositions can be carried
out in a variety of conventional ways known to those of ordinary
skill in the art, such as oral ingestion, inhalation, for example,
of an aerosol, topical or transdermal application, or intracranial,
intracerebroventricular, intracerebral, intravaginal, intrauterine,
oral, rectal or parenteral (e.g., intravenous, intraspinal,
subcutaneous or intramuscular) route, or cutaneous, subcutaneous,
intraperitoneal, parenteral or intravenous injection. The route of
administration can be determined according to the site of the
tumor, growth or lesion to be targeted.
[0119] To deliver a composition comprising an effective amount of
one or more oligonucleotides to the site of a growth or tumor,
direct injection into the site can be used. Alternatively, for
accessible mucosal sites, ballistic delivery, by coating the
oligonucleotides onto beads of micometer diameter, or by intraoral
jet injection device, can be used.
[0120] Viral vectors for the delivery of DNA in gene therapy have
been the subject of investigation for a number of years.
Retrovirus, adenovirus, adeno-associated virus, vaccinia virus and
plant-specific viruses can be used as systems to package and
deliver oligonucleotides for the treatment of cancer or other
growths. Adeno-associated virus vectors have been developed that
cannot replicate, but retain the ability to infect cells. An
advantage is low immunogenicity, allowing repeated administration.
Delivery systems have been reviewed, for example, in Page, D. T.
and S. Cudmore, Drug Discovery Today 6:92-1010, 2001.
[0121] Studies carried out using oligonucleotides on the theory of
their inhibiting the function of a target nucleic acid (antisense
oligonucleotides), most of these studies carried out with
phosphorothioate oligonucleotides, have found delivery to target
cells to not be a major problem. Antisense oligonucleotides in
clinical trials have been administered in saline solutions without
special delivery vehicles (reviewed in Hogrefe, R. I., Antisense
and Nucleic Acid Drug Development 9:351-357, 1999).
[0122] Formulations suitable for parenteral administration include
aqueous and non-aqueous sterile injection solutions which may
contain anti-oxidants, buffers, bacteriostats and solutes which
render the formulation isotonic with the fluids of the intended
recipient; and aqueous and non-aqueous sterile suspensions which
may include suspending agents and thickening agents. The
formulations may be presented in unit-dose dose or multi-dose
containers, for example, sealed ampules and vials, and may be
stored in a freeze-dried (lyophilized) condition requiring only the
addition of the sterile liquid carrier, for example, water for
injections, immediately prior to use. Extemporaneous injection
solutions and suspensions may be prepared from sterile powders,
granules and tablets of the kind previously described. A preferred
pharmaceutical composition for intravenous, cutaneous, or
subcutaneous injection should contain, in addition to
oligonucleotide(s) of the present invention, an isotonic vehicle
such as Sodium Chloride Injection, Ringer's Injection, Dextrose
Injection, Dextrose and Sodium Chloride Injection, Lactated
Ringer's Injection, or other vehicle as known in the art. The
pharmaceutical composition of the present invention may also
contain stabilizers, preservatives, buffers, antioxidants, or other
additives known to those of skill in the art.
[0123] Use of timed release or sustained release delivery systems
are also included in the invention. Such systems are highly
desirable in situations where surgery is difficult or impossible,
e.g., patients debilitated by age or the disease course itself, or
where the risk-benefit analysis dictates control over cure. One
method is to use an implantable pump to deliver measured doses of
the formulation over a period of time, for example, at the site of
a tumor.
[0124] A sustained-release matrix can be used as a method of
delivery of a pharmaceutical composition comprising
oligonucleotides, especiall for local treatment of a growth or
tumor. It is a matrix made of materials, usually polymers, which
are degradable by enzymatic or acid/base hydrolysis or by
dissolution. Once inserted into the body, the matrix is acted upon
by enzymes and body fluids. The sustained-release matrix desirably
is chosen from biocompatible materials such as liposomes,
polylactides (polylactic acid), polyglycolide (polymer of glycolic
acid), polylactide co-glycolide (co-polymers of lactic acid and
glycolic acid) polyanhydrides, poly(ortho)esters, polyproteins,
hyaluronic acid, collagen, chondroitin sulfate, carboxylic acids,
fatty acids, phospholipids, polysaccharides, nucleic acids,
polyamino acids, amino acids such as phenylalanine, tyrosine,
isoleucine, polynucleotides, polyvinyl propylene,
polyvinylpyrrolidone and silicone. A preferred biodegradable matrix
is a matrix of one of either polylactide, polyglycolide, or
polylactide co-glycolide (co-polymers of lactic acid and glycolic
acid).
[0125] The amount of oligonucleotide of the present invention in
the pharmaceutical composition of the present invention will depend
upon the nature and severity of the condition being treated, and on
the nature of prior treatments which the patient has undergone. For
a human patient, the attending physician will decide the dose of
oligonucleotide of the present invention with which to treat each
individual patient. Initially, the attending physician can
administer low doses and observe the patient's response. Larger
doses may be administered until the optimal therapeutic effect is
obtained for the patient, and at that point the dosage is not
increased further. The duration of therapy using the pharmaceutical
composition of the present invention will vary, depending on the
severity of the disease being treated and the condition and
potential idiosyncratic response of each individual patient.
[0126] The invention is further illustrated by the following
non-limiting Examples.
EXAMPLES
Example 1
Application to Human Squamous Carcinoma Cells
[0127] Human squamous carcinoma cell line SCC12F cells were
maintained in primary keratinocyte medium (300 ml DME, 100 ml F-12
nutrient supplement, 50 ml 10.times. adenine, 50 ml fetal bovine
serum, 5 ml penicillin/streptomycin stock, and 0.5 ml of 10
.mu.g/ml epidermal growth factor and hydrocortisone to final
concentration of 1.4 .mu.g/ml) and dosed with either water
(diluent), 100 .mu.M pTpT (T.sub.2, Midland Certified Reagent
Company, Midland, Tex.) or 100 .mu.M pdApdA (A.sub.2). Cells were
harvested before dosing (day 0), and 1, 3, 4, and 5 days after
dosage, and were counted by Coulterm counter. After harvesting, the
cells were processed for total RNA isolation and were analyzed by
Northern blot. Addition of pTpT to human squamous carcinoma cells
resulted in marked decreases in cell growth rate, as shown in FIG.
1. Addition of a control deoxyadenine dinucleotide (pdApdA), a
compound very similar to pTpT but not readily dimerized by UV
irradiation, and therefore rarely excised during the course of
UV-induced DNA repair, has no effect.
[0128] In a second experiment, SCC12F cells were cultured as
described above. Two or three days after seeding, the preconfluent
cultures were given fresh medium supplemented with either 100 .mu.M
T.sub.2 or diluent as a control. Cells were collected daily by
trypsinization and counted by Coulter.TM. counter. The cell yield
in cultures treated with T.sub.2 was reduced by 75% compared to
that of paired control cultures after five days (FIG. 2). This
corresponds to 2.3 population doublings in this time for control
cells, compared with 1 doubling for T.sub.2-treated cells. These
results further demonstrate that application of T.sub.2 DNA
fragments inhibits cell proliferation, including proliferation of
cancerous cells.
[0129] In a third experiment, it was demonstrated that addition of
T.sub.2 to human squamous carcinoma cells for 24-72 hours resulted
in upregulation of at least three genes: growth arrest and DNA
damage (GADD 45), senescence-derived inhibitor (Sdi I), and
excision repair cross-complementing (ERCC-3). Paired cultures of
SCC12F cells were maintained in a Dulbecco's modified Eagle's
Medium-based keratinocyte growth medium (DMEM; GIBCO/BRL,
Gaithersburg, Md.) supplemented with 10% fetal calf serum (Hyclone
Labs, Logan, Utah) and epidermal growth factor as described
(Hollander, M. C. et al., J. Biol. Chem. 268:328-336 (1992)).
Pre-confluent cultures were given fresh medium supplemented with
either 100 .mu.M T.sub.2, or an equal volume of diluent. Cells were
collected daily after additions, and processed for total RNA
isolation using the Tri-Reagent extraction method (Molecular
Research Center, Cincinnati, Ohio) following the protocol of the
manufacturer. Ten micrograms of RNA from each sample was gel
electrophoresed, transferred to a nylon filter and probed as
described previously (Nada, A. et al., Exp. Cell Res. 211:90-98
(1994)). The cDNA for GADD 45 was generated by PCR using primers
based on the human GADD 45 gene sequence (Mitsudomi, T. et al.,
Oncogene 7:171-180 (1992)). The cDNA for ERCC 3 was purchased from
the American Type Culture Collection (ATCC, Rockville, Md.). The
SDI 1 cDNA was a gift of Dr. J. Smith and has been described
previously (Walworth, N.C. and Bemards, R., Science 271:353-356
(1996)).
[0130] Compared to the diluent control, the mRNAs for GADD 45, ERCC
3 and SDI 1 were up-regulated in T.sub.2-treated cells as early as
24 hours, and remained elevated for several days. Addition of the
control A.sub.2 was less effective or ineffective in inducing these
genes. Comparable data have been obtained in experiments with S91
melanoma cells, and normal human fibroblasts.
[0131] The time course of induction is similar to that observed
after UV irradiation for the two genes for which this has been
studied [GADD 45 and p21 (also called Sdi I)] and also similar to
the time course of induction of the tyrosinase gene by T.sub.2 in
melanocytes and melanoma cells. Sdi I is known to be involved in
cell cycle regulation and specifically in blocking cell division.
GADD 45 and ERCC-3, a human DNA repair enzyme, are known to be
involved in repair of UV-induced DNA damage. The response toT.sub.2
is identical to that observed after UV irradiation of these cell
lines, and is also similar to the response to various
antimetabolites, such as methotrexate, that are clinically
effective in the treatment of hyperproliferative skin
disorders.
Example 2
Application to Human Cervical Carcinoma Cells
[0132] Human cervical carcinoma cells (HeLa cells) were maintained
in DME+10% calf serum and dosed with either water (diluent) or 100
.mu.M T.sub.2. Cells were collected 1, 4 and 6 days after dosage
and counted by Coulter.TM. m counter.
[0133] Addition of T.sub.2 to the human cervical carcinoma cells
resulted in marked decreases in cell growth rate, as shown in FIG.
3.
Example 3
Application to Human Melanoma Cells
[0134] Human melanoma cell lines CRL 1424, Malma, Sk Mel 2, and Sk
Mel 28 were obtained from the American Type Culture Collection
(ATCC). The cell lines were maintained in DME+2% calf serum, and
dosed with either water (diluent) with DME, or 100 .mu.M T.sub.2 in
DME. One week after dosage, cells were collected and counted by
Coulter.TM. counter.
[0135] Addition of T.sub.2 to any of the four different human
melanoma cell lines results in marked decreases in cell yields, as
shown in FIG. 4.
Example 4
Application to Human Keratinocytes
[0136] Normal human neonatal keratinocyte cells were cultured as
described above in Example 1 for SCC12F cells, and treated with
either 100 .mu.M T.sub.2 or diluent as a control. Cells were
harvested for cell counts. The cell yield in cultures treated with
T.sub.2 was reduced by 63% compared to that of paired control
cultures after three days (FIG. 5). This corresponds to one
population doubling in this time for control cells, while the
number of T.sub.2-treated cells remained the same. These results
demonstrate that application of the DNA fragments inhibits cell
proliferation.
[0137] Northern blot analysis of the normal human keratinocytes
treated with T.sub.2 for 24-72 hours that showed induction of the
tumor necrosis factor alpha gene (TNFA) . This immunomodulatory
cytokine, known to be induced by UV irradiation, may thus be
induced by T.sub.2. Use of locally applied DNA fragments,
deoxynucleotides, dinucleotides, or dinucleotide dimers is useful
in immunomodulation of cutaneous reactions and in treatment or
prevention of diseases or conditions involving immune
mediators.
Example 5
Inhibition of Cell Growth of Normal Neonatal Fibroblasts by DNA
Fragments
[0138] Normal human neonatal fibroblasts were plated in Falcon P35
culture dishes at a density of 9.times.10.sup.4 cells/dish. The
culture medium was DME+10% calf serum, 2 ml per plate. One day
after plating, cultures were supplemented with either 100 .mu.M
T.sub.2 in DME or 100 .mu.M A.sub.2 in DME, or water (control). Two
plates were collected and counted before the additions to give a
starting, or "day 0," reading. Duplicate plates of each condition
were harvested through five days after addition of the supplements
and cell number determined. All cell counts were done by CoulterTm
Counter. Results of two experiments, are shown in FIGS. 6 and 7.
The results indicate that application of the DNA fragments inhibits
cell proliferation.
[0139] In a second experiment, normal human neonatal fibroblasts
were plated and cultured, as described above in Example 1 for
SCC12F cells. Cultures were supplemented with either 100 .mu.M
T.sub.2 or water (control), and cells were harvested for cell
counts. The cell yield in fibroblast cultures treated with T.sub.2
was reduced by 40% compared to that of paired control cultures
after three days (FIG. 8). This corresponds to 4 population
doublings in this time for control cells, compared with 3.6
doublings for T.sub.2-treated cells. These results further
demonstrate that contacting cells of interest with the DNA
fragments of the present invention inhibits cell proliferation.
Example 6
Effect of pTpT Applications on Epidermal Cell Proliferation
[0140] Guinea pigs received one or two daily topical applications
of 100 .mu.M pTpT, or vehicle alone as control, for three days. On
the fourth day, punch biopsies were obtained and maintained for 7
or 8 hours in primary keratinocyte medium supplemented with 10
.mu.Ci/ml .sup.3H-thymidine (specific activity 9.0 Ci/m mole, NEN).
Proliferating cells are expected to incorporate the
.sup.3H-thymidine into newly synthesized DNA. Tissues were then
rinsed with cold medium and fixed in 10% phosphate buffered
formalin. After a series of dehydration steps, tissues were
embedded in paraffin. 6 .mu.m sections were cut and mounted onto
glass slides, dipped in NTB-2 Nuclear Track emulsion and kept in
the dark at 4.degree. C. for 7 days. Sections were developed in
Kodak D-19 developer and stained with hematoxylin and eosin.
Labeling index, a measure of DNA replication and therefore cell
proliferation, was measured by calculating the percentage of
labeled nuclei among 100 basal keratinocytes. Results are shown in
Table 1. TABLE-US-00003 TABLE 1 Labeling Index Vehicle control pTpT
2 daily applications 4 .+-. 1.4 1.5 .+-. 0.7 1 daily application
4.5 .+-. 2.1 2 .+-. 0
Mean values.+-.SD are shown. Labeling index (a measure of epidermal
cell proliferation) is less in pTpT-treated skin than in
vehicle-treated skin, (p<0.03 paired T test) in both
experiments. These results demonstrate that contacting cells of
interest with the DNA fragments of the present invention inhibits
cell proliferation.
Example 7
Role of p53 in DNA Repair
[0141] Both the GADD 45 and SDI 1 genes are known to be
transcriptionally regulated by the tumor suppressor protein p53.
After UV- and .gamma.-irradiation, as well as treatment of cells
with DNA-damaging chemical agents, there is a rapid stabilization,
phosphorylation and nuclear accumulation of p53 after which this
protein binds to specific promoter consensus sequences and
modulates the transcription of regulated genes. Recent data suggest
that p53 can also be activated by the binding of small
single-stranded DNAs, as well as certain peptides and antibodies,
to a carboxyl terminal domain of this protein. In order to
determine whether the inhibitory effect of the dinucleotide pTpT on
cell proliferation is mediated in part through p53, the growth
response of a p53 null cell line, H1299 lung carcinoma cells, was
examined. The p53-null H1299 cells (Sanchez, Y. et al., Science
271:357-360 (1996)) were maintained in DMEM with 10% calf serum.
Preconfluent cultures were given fresh medium supplemented with
either 100 .mu.M pTpT or diluent. Cells were collected on
consecutive days by trypsinization, and counted by Coulter.TM.
counter. As shown in FIG. 9, there was no inhibition of
proliferation of pTpT-treated H1299 cells compared to
diluent-treated controls.
[0142] In another experiment, pTpT was found to induce the
expression of SDI 1 MRNA in a p53-dependent manner. Preconfluent
cultures of H1299 cells were transfected with an expression vector
containing the wild type human p53 cDNA under the control of the
human cytomegalovirus promoter/enhancer (Dr. Bert Vogelstein, Johns
Hopkins Oncology Center). Control transfections were performed
using the vector from which the p53 cDNA was removed. Transfections
were carried out using the Lipofectin Reagent Kit (GIBCO/BRL). One
day after transfection, cells were collected for Western blot
analysis using 20 .mu.g total protein as described (Yaar, M. et
al., J. Clin. Invest. 94:1550-1562 (1994)). p53 was detected using
mAb 421, anti-mouse Ig linked to horseradish peroxidase (Amersham,
Arlington Heights, Ill.) and an ECL-kit (Amersham), following the
directions of the manufacturer. At the time of protein collection,
duplicate cultures of H1299 cells transfected with the p53
expression vector (designated "p53") or control vector ("Ctrl")
were given either diluent (DMEM) or 100 .mu.M pTpT. After 24 hours,
the cells were collected, processed for RNA isolation and Northern
blot analysis with an SDI 1 cDNA probe. The autoradiograph was
scanned using a Macintosh IIsi computer and Macintosh One Scanner,
and the brightness and contrast were adjusted to display
differences in autoradiographic signals maximally. The results
indicated that p53-null H1299 cells express a very low level of the
SDI 1 transcript and this level is not affected by addition of
pTpT. Transfection of these cells with a wild-type p53 expression
vector increased the level of SDI 1 and rendered this transcript
inducible by addition of pTpT. Western analysis confirmed that
H1299 cells normally express no p53 and that transfected H1299
cells expressed high levels of p53. These data indicate that pTpT
increases the transcriptional activity of p53.
[0143] The effect of pTpT on the level and intracellular
distribution of p53 in normal neonatal fibroblasts was examined by
immunoperoxidase staining using a p53-specific monoclonal antibody
(mAb 421, Oncogene, Cambridge, Mass.). Preconfluent cultures were
treated with either 100 .mu.M pTpT or diluent for 24 hours before
cell staining. Cells were first fixed for one minute in Histochoice
fixative (Amresco, Solon, Ohio) followed by a five-minute rinse in
PBS. p53 was detected using the Vectastain Elite ABC kit (Vector
Laboratories, Burlingame, Calif.) and the p53-specific monoclonal
antibody mAb 421. Within 24 hours, an increase in intranuclear p53
was detected in pTpT-treated cells compared to diluent-treated
cells, as has been reported after UV-irradiation. These results are
consistent with the induction of the p53-regulated genes GADD 45
and SDI1 (p21) in fibroblasts as well as in SCC12F cells, by
pTpT.
Example 8
Enhancement of DNA Repair
[0144] Expression of a UV-damaged reporter plasmid containing the
bacterial chloramphenicol acetyltransferase (CAT) gene under the
control of SV40 promoter and enhancer sequences was previously
shown to detect decreased DNA repair capacity in human lymphocytes
associated with aging and early-onset skin cancers. This reporter
plasmid was used to measure the DNA repair capacity of normal
neonatal human skin-derived fibroblasts and keratinocytes.
[0145] Keratinocytes from newborns were established as described
(Stanulis-Praeger, B. M. and Gilchrest, B. A., J. Cell. Physiol.
139:116-124 (1989)) using a modification of the method of Rheinwald
and Green (Gilchrest, B. A. et al., J. Invest. Dermatol.
101:666-672 (1993)). First-passage keratinocytes were maintained in
a non-differentiating low Ca.sup.2+medium (K-Stim, Collaborative
Biomedical Products, Bedford, Mass.). Fibroblasts were established
from dermal explants as described (Rheinwald, J. G. and Green, J.,
Cell 6:331-343 (1975)) and maintained in DMEM supplemented with 10%
bovine serum. Cells were treated with either 100 .mu.M pTpT or an
equal volume of diluent (DMEM) for five days prior to transfection.
Duplicate cultures kept under each condition were transfected using
the Lipofectin Reagent Kit (GIBCO/BRL) and 5 .mu.g reporter DNA,
pCAT-control vector (Promega, Madison, Wis.). Before transfection,
the vector DNA was either sham irradiated or exposed to 100
mJ/cm.sup.2 UVB radiation from a 1 KW Xenon arc solar simulator
(XMN 1000-21, Optical Radiation, Azuza, Calif.) metered at 285.+-.5
nm using a research radiometer (model IL 1700A, International
Light, Newburyport, Mass.), as described (Yaar, M. et al, J.
Invest. Dermatol. 85:70-74 (1985)). Cells were collected 24 hours
after transfection in a lysis buffer provided in the CAT Enzyme
Assay System (Promega, Madison, Wis.) using a protocol provided by
the manufacturer. CAT enzyme activity was determined using the
liquid scintillation counting protocol and components of the assay
system kit. Labeled chloramphenicol [50-60 mCl (1.85-2.22 GBq)
mmol] was purchased from New England Nuclear (Boston, Mass.).
Protein concentration in the cell extracts was determined by the
method of Bradford (Anal. Biochem. 72:248 (1986)). CAT activity was
expressed as c.p.m./100 .mu.g protein and is represented as percent
activity of cells transfected with sham-irradiated, non-damaged,
plasmid.
[0146] In preliminary experiments, exposure of the plasmid to a
dose of solar-simulated irradiation (100 mJ/cm.sup.2, metered at
285 nm) prior to transfection was identified as resulting in
approximately 75% reduction in CAT activity assayed in cell
lysates. 16-24 hours after transfection, compared to that of
sham-irradiated plasmid transfected into paired cultures. However,
keratinocytes (FIG. 10) and fibroblasts (FIG. 11) pretreated with
100 .mu.M pTpT for five days before transfection displayed CAT
activity more than 50% that of sham-irradiated transfected
controls. Because the reporter plasmid was nonreplicating, the
level of CAT activity directly reflects the degree of DNA repair of
the UV-damaged CAT gene restoring its biological activity. These
data indicate that pTpT treatment of normal human fibroblasts and
keratinocytes more than doubles the capacity of cells to repair
UV-induced DNA damage over a 24 hour period. The enhanced
expression of UV-irradiated plasmid in pTpT-treated cells did not
result from a general increase in plasmid transcription in these
cells, because the expression of the sham-irradiated plasmid was
not higher in non-pTpT-treated cells.
Example 9
Activation of p53 and Repair of Benzo[a]pyrene DNA Adducts
[0147] Cell Culture.
[0148] Newborn human keratinocytes were established using a
modification (Stanislus et al. J. Invest. Dermatol. 90:749-754
(1998)) of the method of Rheinwald and Green (Cell 6:331-343
(1975)). First-passage keratinocytes were maintained in a
non-differentiating medium containing a low concentration of
calcium ion (K-Stim, Collaborative Biomedical Products, Bedford,
Mass.).
[0149] The p53-null H1299 lung carcinoma cell line (American Type
Culture Collection, ATCC, Rockville, Md.) was maintained in
Dulbecco's modified Eagle's medium (DMEM; GIBCO/BRL, Gaithersburg,
Md.) supplemented with 10% bovine serum (Hyclone Labs, Logan,
Utah).
[0150] Transfection of H1299 cells with a p53 expression
vector.
[0151] Preconfluent cultures of H1299 cells were transfected with
an expression vector containing the wild type human p53 cDNA under
the control of the human cytomegalovirus promoter/enhancer (Dr.
Bert Vogelstein, Johns Hopkins Oncology Center). Control
transfections were performed using the same vector lacking the p53
cDNA. Transfections were carried out as described previously. One
day after transfection, cells were collected for western blot using
20 .mu.g total protein as described. p53 was detected using the
monoclonal antibody DO-1 (Ab-6) known to detect both active and
inactive forms of the protein (Oncogene, Cambridge, Mass.),
anti-mouse Ig linked to horseradish peroxidase (Amershamn,
Arlington Heights, Ill.) and an ECL-kit (Amersham) following the
direction of the manufacturer.
[0152] p53 assay using hGH reporter plasmid.
[0153] Normal human keratinocytes were transfected with the human
growth hormone (hGH) reporter plasmid (pPG-GH) using the
Lipofectamine Reagent Kit (GIBCO/BRL) as suggested by the
manufacturer and 0.5 .mu.g pPG-GH added to each p35 culture dish.
pPG-GH contains the hGH coding region under the control of the
thymidine kinase (TK) promoter and p53 consensus sequence, and hGH
protein production is known to be proportional to p53 activity
(Kern et al., 1992). Transfection was performed in the presence of
100 .mu.M pTpT (Midland Certified Reagent Company, Midland, Tex.)
or an equal volume of diluent. At the same time, the
PSV-.beta.-galactosidase control vector (Promega, Madison, Wis.)
was co-transfected to determine the transfection efficiency (Norton
and Coffin, 1985). Four hours after transfection, the medium was
removed and replaced with K-Stim medium with or without 100 .mu.M
pTpT. Twenty-four hours after transfection and pTpT treatment, 400
.mu.l of the medium was harvested from each 35 mm culture dish, and
100 .mu.l of .sup.125I-hGH antibody solution (Nichols Institute
Diagnostics, San Juan Capistrano, Calif.) was added to detect
secreted hGH as described below. The cells were harvested in a
Reporter Lysis Buffer (Promega) using a protocol provided by the
manufacturer, and 150 .mu.L of this lysate was used for the
.beta.-galactosidase assay using a .beta.-galactosidase assay kit
(Promega). Samples from each of triplicate culture dishes were
evaluated for hGH and .beta.-galactosidase synthesis.
[0154] H1299 cells were similarly transfected with p53 expression
vector or control vector. Two days after the transfection these
cells were cotransfected with pPG-GH and PSV-p-galactosidase
control vector, and treated with 100 .mu.M pTpT. Twenty-four hours
later, 250 .mu.l of the medium and the cell lysate were harvested
and processed as described above.
[0155] CAT Assay.
[0156] The pCAT vector (Promega) was treated with
benzo[a]pyrene-7,8-diol-9,10-epoxide (BP) as described (Athas et
al. Cancer Res 1991) to produce less damaged and more damaged
plasmids, previously shown to be instructive in studies examining
different repair capacities in human cells. Based on the
incorporation of .sup.3H-BPDE into the DNA, the less damaged
plasmid contained 25 adducts per 5 kb plasmid and the more damaged
plasmid contained 50 adducts. This non-replicating vector contains
the chloramphenicol acetyltransferase gene under control of SV40
promoter and enhancer sequences. Human keratinocytes and
p53-transfected H1299 cells were pre-treated with either 100 .mu.M
pTpT or an equal volume of diluent (DMEM) alone for 48 hours, then
transfected with either BP-modified pCAT-control vector (0.5
.mu.g/ml) or unmodified vector (0.5 .mu.g/ml) together with
PSV-.beta.-galactosidase control vector (0.5 .mu.g/ml). Cells were
collected in a reporter lysis buffer (Promega) 24 hours after
transfection. CAT enzyme activity was determined using the liquid
scintillation counting protocol and components of the assay system
kit (Promega). .sup.14C-labeled chloramphenicol[50-60
mCi(1.85-2.22GBq)/mmol] was purchased from New England Nuclear
(Boston, Mass.). CAT activity was normalized with
.beta.-galactosidase activity.
[0157] Western Blot Analysis.
[0158] Cells were treated with 100 .mu.M pTpT or an equal volume of
diluent alone for 48 hours. Total cellular proteins were collected
in a buffer consisting of 0.25 M Tris HCl (pH 7.5), 0.375 M NaCl,
2.5% sodium deoxycholate, 1% Triton X-100, 25 mM MgCl.sub.2, 1 mM
phenylmethyl sulfonyl fluoride, and 0.1 mg ml aprotinin. Proteins
(100 .mu.g per sample) were separated by 7.5-15% SDS-PAGE and
transferred to a nitrocellulose membrane (Schleicher & Schuell,
Keene, N.H.). After transfer, the gel was stained with Coomassie
Blue to verify even loading as visualized by the residual high
molecular weight proteins. Membranes were blocked in 0.05%
Tween-20/PBS with 5% milk, (Bio-Rad Laboratories, Hercules,
Calif.). Antibody reactions were performed with the following
antibodies: anti p53 (AB-6), anti PCNA (Ab-2) (Oncogene Science),
and anti XPA (FL-273) (Santa Cruz Biotechnology). Sheep anti-mouse
Ig linked to horseradish peroxidase (Amersham, Arlington Heights,
Ill.) (for p53 and PCNA) and goat anti-rabbit IgG (Bio-Rad)(for
XPA) were used as the secondary antibodies. Binding was detected by
the ECL detection kit (Amersham).
[0159] To measure the repair of BP DNA adducts, non-replicating
BP-damaged reporter plasmid system containing the bacterial
chloramphenicol acetyltransferase (CAT) gene was used as described
in Example 8. With first passage human keratinocytes, the
transfection efficiency, as measured by the cotransfected
.beta.-galactosidase expression vector, was 40-70%. Compared to
diluent-treated cells, pTpT-treated human keratinocytes showed an
approximate doubling of CAT expression relative to paired cultures
transfected with undamaged control CAT vector, when transfected
with either the less BP-damaged (.about.25 adducts/plasmid) or the
more BP-damaged (.about.50 adducts/plasmid) vector.
[0160] To confirm the activation of p53 by pTpT in a second assay,
a reporter plasmid expressing the human growth hormone (hGH) gene
under the influence of a p53 inducible promoter was employed.
Activation of p53 increases its binding to the consensus sequence
in the plasmid, leading to transcription of the hGH coding sequence
and ultimately to secretion of hGH into the medium. pTpT-treated
human keratinocytes showed a 45%+25% increase in hGH secretion
compared to diluent-treated cells. These data indicate that pTpT
activates p53 in normal human keratinocytes as well as in
p53-transfected H1299 cells.
[0161] To confirm that pTpT enhances repair of BP-DNA adducts, at
least in part, through p53 activation, p53-null H1299 cells were
transfected with the p53 expression vector, and p53 protein
expression was then confirmed by western blot analysis 48 hours
after transfection. In p53+H1299 cells, repair was comparable to
that observed in normal keratinocytes; and the plasmid containing a
low level of BP damage was repaired 80%+50% more efficiently in
pTpT-pre-treated cells than in diluent pre-treated cells; and the
plasmid containing a high level of BP damage was repaired more than
three times as efficiently. In p53-H1299 cells, however, the repair
capacity was the same as in both treatment groups. These data
demonstrate that enhanced repair of BP-DNA adducts by pTpT involves
p53.
[0162] pTpT activation of p53 in H1299 cells transiently
transfected with the p53-responsive-hGH resulted in a 40% increase
in hGH secretion compared to diluent-treated cells. These data
further demonstrate that pTpT enhances p53 transcriptional activity
through enhanced binding to its DNA consensus sequence.
[0163] Western blot analysis was used to examine the effect of pTpT
treatment on the expression of selected genes known to be involved
in DNA repair. Normal human keratinocytes were treated with pTpT
for 2 days before harvesting cellular protein. pTpT up-regulated
the levels of p53, PCNA and the XPA protein 2 to 3-fold within 2
days of treatment.
Example 10
Immunosuppression and Inhibition of Contact Hypersensitivity in a
Murine Model
[0164] C57B16 mice were subjected to the following treatment prior
to sensitization with the allergen DNFB, by topical administration
to abdominal skin; no pretreatment, UVB irradiation (200
J/m.sup.2/dx4d), pTpT, pApA, or vehicle alone (30 .mu.l of 100
.mu.M BID.times.5d). Mice pretreated with UVB or pTpT showed
markedly suppressed ear swelling responses to DNFB challenge
(0.6.+-.0.2 and 0.9.+-.0.3) compared to untreated or vehicle
treated animals (4.3.+-.0.6 and 3.3.+-.0.2), whereas pApA-treated
mice exhibited intermediate responses (2.5.+-.0.6).
[0165] The immunomodulatory effect of pTpT was tested in vitro
using human keratinocytes. Duplicate cultures of primary human
keratinocytes were treated with pTpT, diluent or UVB irradiation
(200 J/m.sup.2) or sham irradiation. Cells were collected at
various times after treatment and analyzed for IL-10 protein by
ELISA and for IL-10 mRNA by RT-PCR. An increase in IL-10 mRNA was
detected after 6 hours in irradiated cells and after 48 hours in
pTpT treated cells. An increase in IL-10 protein of 18 pg/ml was
detected 24 hours after irradiation and 15.+-.2 pg/ml 72 hours
after treatment with pTpT. Previous work has demonstrated
functional inhibition of the allogenic mixed lymphocyte reaction
(MLR) assay by IL-10. In the allogenic MLR, T cell activation is
measured as lymphocyte proliferation, measured by .sup.3H-thymidine
incorporation. IL-10 activity of culture medium from the 72 hour
pTpT sample was measured by addition of the >10 kD components
(containing the 18 kD IL-10 protein). Reduction in T cell
proliferation by 80.+-.5% was demonstrated, compared to 8%.+-.3
inhibition from diluent-treated control cultures. Thus, like UVB
irradiation, pTpT induces IL-10 in human keratinocytes which is
likely to cooperate with TNF.alpha. to inhibit contact
hypersensitivity in pTpT treated skin.
[0166] In another experiment, TNF.alpha. gene activation was
measured by utilizing mice carrying a CAT reporter transgene
bearing the entire TNF.alpha. promoter and 3'-untranslated region.
Transgenic mice were subjected to the following treatment prior to
skin assay for CAT expression: UVB irradiation (200-700 J/m.sup.2),
intracutaneous injection of pTpT (100 .mu.M); lipopolysaccharide
(LPS 1 .mu.g/ml) as positive control, or vehicle alone. CAT
activity was detected in skin treated with UVB, LPS, or pTpT (but
not with vehicle alone).
Example 11
Oligonucleotide Dependent UV-Mimetic Activity: Melanogenesis and
p21/Waf1/Cip1 Expression
[0167] The induction of melanogenesis in Cloudman S91 mouse
melanoma cells by a five-nucleotide oligomer CATAC (SEQ ID NO: 6)
and a nine-nucleotide oligomer, GAGTATGAG (SEQ ID NO: 1) was
examined. Duplicates of Cloudman S91 murine melanoma cells were
incubated with either 100 .mu.M oligo or an equal volume of diluent
(H20) for 5 days. The cells were then collected, counted, and an
equal number of cells were pelleted for melanin analysis. In three
experiments, the pigment content after incubation with the 9-mer,
5-mer and pTpT increased 418%.+-.267%, 61%.+-.60% and 155%.+-.60%
of control levels, respectively. The 9-mer, but not the 5-mer, also
stimulated melanogenesis in human melanocytes, producing a 51-62%
increase after one week in culture. Variations of this
oligonucleotide were evaluated: a scrambled 9-mer (TAGGAGGAT; SEQ
ID NO: 2) and two truncated versions, a 7-mer (AGTATGA; SEQ ID NO:
3) and second 5-mer (GTATG; SEQ ID NO: 4). Both 9-mers were equally
active, inducing a 800% increase in melanin content. The truncated
versions. (SEQ ID NOs: 3 and 4) were also active, inducing 640% and
670% increases, respectively. As with pTpT, SEQ ID NO: 1 (9-mer)
oligonucleotide, but not SEQ ID NO: 6 (5-mer) induced the
expression of the p21/Waf 1/Cip 1 gene within 48 hours in a
squamous cell carcinoma line, increasing the level of this mRNA
200-300%, compared to a 100-150% increase from pTpT.
[0168] Together, these data show that the UV-mimetic activity of
pTpT can be duplicated quite dramatically by other
oligonucleotides.
Example 12
[0169] Melanogenesis
[0170] Cultures of Cloudman S91 murine melanoma cells were treated
for 5 days with SEQ ID NO: 1, SEQ ID NO: 6, pTpT as a positive
control, or an equal volume of diluent as a negative control.
Spectrophotometric analysis of S91 cell pellets after
oligonucleotide treatment showed the melanin content of
pTpT-treated cells to be 255.+-.60% that of control cells (FIG.
12). SEQ ID NO: 6 produced a slight increase in melanin, to
165.+-.77% of control levels. SEQ ID NO: 1 stimulated melanin
content to an average of 600.+-.260% of control levels.
[0171] Oligonucleotides 5'pGTTAGGGTTAG3' (SEQ ID NO: 5),
5'pCTAACCCTAAC3' (SEQ ID NO: 9), or 5'pGATCGATCGAT3' (SEQ ID NO
10), each comprising a 5' phosphate were added to cultures of
Cloudman S91 melanoma cells as described in Example 11.
[0172] pTpT, shown previously to stimulate pigmentation in these
cells, was used as a reference treatment, and diluent alone was
used as a negative control. After five days of treatment with the
oligonucleotides, the cells were collected, counted, and an equal
number of cells were pelleted for melanin analysis. The data shown
in FIG. 17 demonstrate that 10 .mu.m pTpT increased melanin content
to 3 times that of control diluent-treated cells. SEQ ID NO: 5,
representing the telomere over-hang sequence, also at 10 .mu.M,
increased the melanin level to 10 times that of control cells. SEQ
ID NO: 9 (telomere over-hang complement) and SEQ ID NO: 10
(unrelated sequence) did not produce significant change in pigment
content at concentration up to 10 .mu.M. A truncated version of SEQ
ID NO: 5, comprising TTAGGG (SEQ ID NO: 11) was also highly
melanogenic, while the reverse complimentary sequence CCCTAA (SEQ
ID NO: 12) was less active (FIG. 18), where both oligonucleotides
contained a 5' phosphate.
[0173] The compounds of the present invention were tested for skin
penetration and in vivo melanogenic activity. Mice were treated (on
their ears) with fluorescently-labeled pTpT or SEQ ID NO: 1
(comprising a 5' phosphate) in propylene glycol for 4 hours, then
ear skin was sectioned and examined by confocal microscopy.
Treatment with either oligonucleotide resulted in brightly stained
epidermis and hair follicles. Thus pTpT and SEQ ID NO: 1 comparably
penetrate the skin barrier.
[0174] In another experiment, mice were treated once daily with
either 100 .mu.M pTpT or SEQ ID NO: 1 containing a 5' phosphate in
propylene glycol on one ear, or vehicle alone on the other ear.
After 15 days, when the ears were sectioned and stained with
Fontana Masson to detect melanin compared to vehicle controls,
there was a 70% increase in pigmentation in pTpT-treated ears and a
250% increase with SEQ ID NO: 1. Thus, both compounds comprising as
few as 2 and as many as 9 nucleotides are effective at producing
the in vitro UV-mimetic effects in vivo.
[0175] p53 Activation and Cell Proliferation
[0176] pTpT was previously found to inhibit cell cycle progression,
at least in part through activation of p53 and subsequent
upregulation of the cyclin dependent kinase inhibitor p21. Cultures
of the human keratinocyte line SCC12F were treated with pTpT, SEQ
ID NO: 1, SEQ ID NO: 6 or diluent alone as a negative control,
collected and counted 48 hours later and processed for northern
blot analysis of p21 MRNA expression. SEQ ID NO: 1 was found to
increase the level of p21 mRNA to almost 3-fold that of diluent
control levels while pTpT-treated cells showed p21 MRNA levels
twice that of control cells (FIG. 13). Cells treated with SEQ ID
NO: 6 showed a 10-20% increase in p21 mRNA level. In these paired
dishes, SEQ ID NO: 1 also reduced cell number by approximately 50%
after 2 days, while pTpT and SEQ ID NO: 6 caused 40% and 25%
reductions, respectively (FIG. 14). Thus, the sequences of the
present invention activate p53 and inhibit cell proliferation
similar to the effect of pTpT.
[0177] Effect of Size and Sequence
[0178] S91 cells were cultured in the presence of diluent alone,
pTpT p9mer (SEQ ID NO: 1), p7mer (AGTATGA; SEQ ID NO: 7) or p5mer
#2 (SEQ ID NO: 4). After 5 days, the cells were collected, counted
and an equal number of cells were pelleted for melanin analysis
(FIG. 15). pTpT produced a moderate increase in melanin content and
SEQ ID NO: 1, a larger increase. In addition, SEQ ID NOS: 4 and 7
also strongly stimulated melanogenesis. Both SEQ ID NOS: 4 and 7
stimulated a 7-8 fold increase in melanin. Because one p5mer was
much more effective at inducing melanin production (compare results
for SEQ ID NO: 4 and 6), these data suggest that oligonucleotide
sequence plays a role in determining its melanogenic activity.
[0179] A p20mer was synthesized (PGCATGCATGCATTACGTACG; SEQ ID NO:
8), with 3 repeats of the 4-base sequence GCAT, followed by two
repeats TACG, an oligonucleotide with an internal pTpT that
resembles the 27-29 base fragment excised during excision repair of
thymine dimers in eukaryotic cells. This oligonucleotide stimulated
pigmentation to twice the level of control cells (FIG. 16).
[0180] Effect of 5' phosphorylation
[0181] S91 cells were cultured for 5 days in the presence of the
thymidine dinucleotides or SEQ ID NO: 1 with or without a 5'
phosphate or diluent alone as a negative control. Removal of the 5'
phosphate significantly reduced the melanogenic activity of pTpT by
80% and of the 9mer by 60% (p<0.04 and p<0.03, respectively,
two-tailed Student's T-test, FIG. 16. These data are consistent
with an intracellular site of action of these oligonucleotides and
with the reported requirement of a 5' phosphate for efficient
cellular uptake. 5' phosphorylation increases oligonucleotide
uptake.
[0182] Fluorescein phosphoramidite (FAM) labeled oligonucleotides
were added to cultures of S91 cells for 4 hours and the cells were
then prepared for confocal microscopy. Nuclei, identified by
staining with propidium iodide, appeared red and FAM-labeled
oligonucleotides appeared green. Co-localization of red and green
signals was assigned a yellow color by the computer.
Oligonucleotides with a 5' phosphate showed greater cellular uptake
than those lacking this moiety. Confocal microscopy failed to
detect uptake of TpT and fluorescence-activated cell sorting (FACS)
analysis of these cells and gave a profile similar to that seen
with untreated cells. pTpT-treated cells showed strong green
fluorescence in the cytoplasm, but only a small amount of nuclear
localization. FACS analysis showed a shift in the peak fluorescence
intensity, compared to TpT-treated cells, indicating more intensely
stained cells. Similarly, the presence of the phosphate at the 5'
end of SEQ ID NO: 1 greatly enhanced its uptake into the S91 cells.
SEQ ID NO: 1 without 5' phosphorylation showed only moderate uptake
and was localized predominantly in the cytoplasm, with faint
nuclear staining in only some cells, whereas SEQ ID NO: 1 with 5'
phosphorylation showed intense staining that strongly localized to
the nucleus. FACS analysis of SEQ ID NO: 1 without 5'
phosphorylation showed a broad range of staining intensities with
essentially two populations of cells, consistent with the confocal
images. The phosphorylated SEQ ID NO: 1 containing cells also
showed a range of staining intensities, but with more cells showing
higher fluorescent intensity. Cells treated with phosphorylated SEQ
ID NO: 8 showed a pattern of fluorescence very similar to that seen
with phosphorylated SEQ ID NO: 1, both by confocal microscopy and
FACS analysis, indicating that its lower activity in the
melanogenesis assay cannot be ascribed to poor uptake. These data
show that uptake of these oligonucleotides by S91 cells is greatly
facilitated by the presence of 5' phosphate and that melanogenic
activity, while consistent with a nuclear site of action, is not
solely dependent on nuclear localization. Also, although the total
intracellular fluorescence did not increase appreciably with
increasing oligonucleotide length among the DNAs tested, the larger
oligonucleotides more readily accumulated in the cell nucleus.
There was no change in the profile of oligonucleotide uptake after
6 and 24 hours.
Example 13
Oligonucleotides Can Induce Apoptosis
[0183] Oligonucleotides homologous to the telomere overhang repeat
sequence (TTAGGG; SEQ ID NO: 11), sequence (11mer-1: pGTTAGGGTTAG;
SEQ ID NO: 5), complementary to this sequence
(11mer-2:pCTAACCCTAAC; SEQ ID NO: 9) and unrelated to the telomere
sequence (11mer-3:PGATCGATCGAT; SEQ ID NO: 10) were added to
cultures of Jurkat cells, a line of human T cells, one of the cell
types reported to undergo apoptosis in response to telomere
disruption. Within 48 hours, 50% of the cells treated with 40 .mu.M
of SEQ ID NO: 5 had accumulated in the S phase, compared to 25-30%
for control cells (p<0.0003, non-paired t-test; see FIGS.
19A-19D), and by 72 hours, 13% of these cells were apoptotic as
determined by a sub-G.sub.0/G.sub.1 DNA content, compared to 2-3%
of controls (p<0.007, non-paired t-test; see FIGS. 19E-19H). At
96 hours, 20.+-.3% of the 11mer-1 treated cells were apoptotic
compared with 3-5% of controls (p<0.0001, non-paired t-test). To
exclude preferential uptake of the 11mer-1 as an explanation of its
singular effects, Jurkat cells were treated with oligonucleotides
labeled on the 3' end with fluorescein phosphoramidite, then
subjected to confocal microscopy and FACS analysis. The
fluorescence intensity of the cells was the same after all
treatments at 4 hours and 24 hours. Western analysis showed an
increase in p53 by 24 hours after addition of 11mer-1, but not
11mer-2 or -3, with a concomitant increase in the level of the E2F1
transcription factor, known to cooperate with p53 in induction of
apoptosis and to induce a senescent phenotype in human fibroblasts
in a p53-dependent manner as well as to regulate an S phase
checkpoint.
Example 14
The Effect of DNA Fragments on DNA Mutation Frequency In vivo
[0184] Transgenic mice carrying multiple genomic copies of a LacZ
reporter plasmid were used. One hundred .mu.M pTpT in
polypropyleneglycol was applied to one ear and vehicle alone to the
other ear, daily for four days. On the fifth day, both ears were
exposed to 100 mJ/cm.sup.2 UVB light. This procedure was repeated
weekly for 3, 5 or 7 weeks (3 mice/group). One week after the final
irradiation, LacZ plasmids were harvested from the ear epidermis.
Using methods well known in the art, the plasmids were recovered
from genomic DNA by restriction enzyme digestion and specific
binding to the LacI protein. Mutant LacZ plasmids were positively
selected by transfection into bacteria and growth on selective
medium and the mutation frequency was determined. After 3, 5, and 7
weeks, pTpT-treated skin exhibited a 20-30% lower mutation
frequency than diluent treated skin (200 vs 293, 155 vs 216, and
261 vs 322, respectively). These data showed that pTpT-enhanced DNA
repair reduces UV-induced mutations in vivo and suggest that
topical application could be used to lower the mutation rate in
carcinogen-exposed human skin.
Example 15
DNA Fragment Protect Against Oxidative Damage
[0185] Primary newborn fibroblasts were treated for 3 days with 10
.mu.M pTpT or diluent as control and then treated with
5.times.10.sup.-5 or 5.times.10.sup.-4 M H.sub.2O.sub.2. Within 72
hours of H.sub.2O.sub.2 exposure, cell yields of pTpT pre-treated
cultures were 45.+-.1% and 139.+-.5% higher, respectively, compared
to diluent pre-treated control samples. 72 hours after exposure of
the low H.sub.2O.sub.2 dose, only 9.6.+-.2.4% of the diluent
pre-treated cells survived. In contrast, pTpT pre-treatment
increased cell survival by 2-9 fold at 5.times.10.sup.-4 M
H.sub.2O.sub.2 and conferred complete protection at the low dose.
mRNA levels of Cu/Zn superoxide dismutase, an enzyme that
participates in the process of oxygen radical quenching, were
increased by greater than 3 fold 48 and 72 hours after pTpT
treatment and remained elevated at least 24 hours after pTpT
withdrawal (when the experiment was terminated).
Example 16
Age Related Decline in DNA Repair Capacity Is Reversed by
Oligonucleotides
[0186] Human dermal fibroblasts (fb), derived from newborn, young
adult (25-35y), and older adult (65-90y) donors were pre-treated
with 10 .mu.M pTpT or SEQ ID NO: 1 containing a 5' phosphate or
diluent as a control for 24 hours. The samples were then UV
irradiated with 5, 10 and 30 m/cm.sup.2. DNA and proteins were
collected at time 0 and up to 24 hours post-UV. There were
age-associated decreases in the constitutive and UV-induced protein
levels of p53, p21, XPA, RPA ERCC/PF and PCNA. However, in all age
groups, pre-treatment with oligonucleotides resulted in
up-regulated constitutive and UV-induced levels of these proteins
by 200-400%. Furthermore, slot blot analysis specific for thymine
dimers and (6-4) photoproducts showed a significant decrease with
aging in the DNA repair states in the first 16 hours post-UV.
Pre-treatment with oligonucleotides increased the removal of
photoproducts by 30-60 percent.
Example 17
Phosphorothioate Version of the Telomere Overhang Homolog 11mer-1
Does Not Induce Apoptosis
[0187] Cultures of Jurkat human T cells were treated with either
diluent, 11mer-1 (SEQ ID NO:5) or the phosphorothioate 11mer-1
(11mer-1-S) for 96 hours, then collected and processed for FACS
analysis. Two concentrations of the oligonucleotides were tested,
0.4 .mu.M (FIGS. 20A-20C) and 40 .mu.M (FIGS. 20D-20F). At the 0.4
.mu.M concentration, neither of the oligonucleotides affected the
expected exponentially growing cell cycle profile of the Jurkat
cells. At 40 .mu.M, the 11-mer-1 induced extensive apoptosis in
these cells, indicated by a sub-G.sub.0/G.sub.1 peak, while the
11mer-1-S had no effect.
Example 18
Phosphorothioate Version of 11mer-1 Blocks Induction of S-Phase
Arrest by the Phosphate Backbone 11mer-1
[0188] Cultures of a keratinocyte cell line (SSC12F, 100,000
cells/38 cm.sup.2) were treated for 48 hours with only the 11mer-1
(SEQ ID NO:5) or with the 11mer-1 in the presence of increasing
concentrations of the 11mer-1-S. As shown previously in Example 13,
the 11mer-1 induced an S-phase arrest as demonstrated by FACS
(Becton-Dickinson FacScan). Forty-three precent of the cells were
in the S phase, compared to 26% of the control, diluent-treated
cells. However, when increasing concentrations of the
phosphorothioate 11mer-1 were also added to these cultures, fewer
cells became arrested (FIGS. 21A-21G). Complete inhibition of this
arrest was seen with a ratio of 11mer-1: 11mer-1-S of 2:1. The
11mer-1-S by itself did not induce the S-phase arrest.
Example 19
Phosphorothioate Forms of the Telomere Oligonucleotides Reduce
Constitutive and UV-Induced Pigmentation and Do Not Stimulate
Melanogenesis
[0189] Cultures of S91 mouse melanoma cells (100,000 cells/38
cm.sup.2) were treated with 100 .mu.M pTpT or phosphorothioate pTpT
(pTspT) (FIG. 22) or 40 .mu.M 11mer-1 or the phosphorothioate
11mer-1 (11mer-1-S) (FIG. 23) for 6 days and were then collected,
counted and assayed for melanin content. While the pTpT and 11mer-1
(FIG. 22 and FIG. 23, respectively) stimulated melanogenesis in
these cells, pTspT and 11mer-1-S did not (FIG. 22 and FIG. 23,
respectively). Furthermore, both pTspT (FIG. 22) and 11mer-1-S
(FIG. 23) reduced the constitutive pigmentation in these cells,
suggesting that chronic exposure of this sequence during telomere
repair/replication may provide a constant, low level signal for
melanogenesis and this signal is blocked by pTspT and
11mer-1-S.
Example 20
Phosphorothioate pTspT Inhibits UV-Induced Melanogenesis
[0190] Duplicate cultures of S91 cells (100,000 cells/39 cm.sup.2)
were either sham-irradiated or irradiated with 5 mJ/cm.sup.2
solar-simulated light from a 1 kW xenon arc solar-simulator (XMN
1000-21, Optical Radiation, Azuza, Calif.) metered at 285.+-.5 nm
using a research radiometer (model IL1700A, International Light,
Newburyport, Mass.). Two sham-irradiated plates were then
supplemented with 100 .mu.M pTspT and two irradiated cultures were
similarly treated with pTspT. After one week, cells were collected,
counted and analyzed for melanin content by dissolving the cell
pellets in 1 N NaOH and measuring the optical density at 475 nm. UV
irradiation resulted in a doubling of melanin content in these
cells. However, this response was blocked by the addition of pTspT
(FIG. 24). In addition, the constitutive pigmentation of these
cells was reduced by the pTspT in the sham-irradiated cultures,
similar to the data presented in FIGS. 22 and 23.
Example 21
pTpT Induces SOD2 Protein Level in Fibroblasts
[0191] Fibroblasts (newborn human) were maintained in Dulbecco's
Modified Eagle Medium (DMEM) supplemented with 10% calf serum (CS)
and 100 .mu.M pTpT or diluent as control. Total cellular proteins
were harvested at different intervals after stimulation and
processed for western blot analysis. The blot was reacted with anti
SOD2 antibodies (The Binding Site, Inc. San Diego, Calif.). While
fresh medium supplementation transiently induced the 37 kDa SOD2 in
diluent treated control cultures, in pTpT treated cultures SOD2
induction was sustained at least through 32 hours when the
experiment was terminated. Coomassie blue-stained residual bands on
the gel confirmed uniform loading of the different lanes.
Example 22
Pretreatment With pTpT Protects Against Oxidative Damage
[0192] Cells from the well differentiated squamous carcinoma line
SCC12F (gift of Dr. James Rheinwald, Harvard University) were
treated with 100 .mu.M pTpT or diluent as control for 3 days. Then
cells were re-plated in medium lacking pTpT and were sham- or
UV-irradiated with 10 J/cm.sup.2 UVA (Sellas Sunlight UVA lamp).
Cell yields were determined at different intervals after UV
irradiation. FIG. 25 represents yields of UVA treated cells that
were either pretreated with pTpT or pretreated with diluent, each
as a percent of its own sham irradiated control. pTpT pretreatment
increased the yields of UVA irradiated cells.
Example 23
pTpT Induces Apurinic Endonuclease-1 (APE-1) Protein in
Fibroblasts
[0193] Fibroblasts (human newborn) were maintained in 10%
CS-supplemented DMEM containing 100 .mu.M pTpT, 10 .mu.M or 60
.mu.M oligonucleotide pGTTAGGGTTAG (SEQ ID NO:5), or diluent as
control. Total cellular proteins were harvested at different
intervals after supplementation and processed for western blot
analysis. Expression of APE-1, the rate-limiting enzyme in repair
of 8-oxoguanine (the principal form of oxidative DNA damage) was
studied. The blot was incubated with anti APE-1 antibodies
(APE/Ref-1 monoclonal IgG2b, Novus Biologicals, Inc. Littleton,
Colo.). Within 24 hours of supplementation with pTpT or the 11mer
oligonucleotide having nucleotide sequence SEQ ID NO:5, the 37 kDa
APE-1 protein was induced in samples stimulated with the
oligonucleotides as compared to diluent control. The induction was
sustained for at least 48 hours, when the experiment was
terminated. Coomassie blue-stained residual bands on the gel
confirmed uniform loading of the different lanes.
Example 24
pTpT Induces Repair of UVA Damage to pCMV-Luc Plasmid
[0194] The plasmid pCMV-Luc is a non-replicating vector containing
a reporter gene, luciferase, under the control of a strong
constitutive cytomegalovirus promoter (gift of Dr. Hedayati, Johns
Hopkins University). Singlet oxygen-induced DNA damage of the
plasmid was generated by irradiating the plasmid with visible light
for different time intervals (0 min, 10 min and 20 min), in the
presence of the photosensitizer methylene blue. Fibroblasts (human
newborn), pretreated for 48 hours with 100 .mu.M pTpT or with
diluent alone, were transfected with 0.5 .mu.g of pCMV-Luc using
Lipofect Amine.TM. (Promega, Madison, Wis.). After two days,
plasmid-encoded luciferase activity was determined in cell extracts
(Promega luciferase assay). Pretreatment with pTpT enhanced the
repair of singlet oxygen-induced DNA damage after 10 mJ/cm.sup.2
and 20 mJ/cm.sup.2 UVA irradiation by 179% and 228% respectively.
FIG. 26 represents luciferase activity as a percent of luciferase
activity assayed in fibroblasts transfected with sham irradiated
plasmid.
Example 25
DNA Oligonucleotides Protect Murine Skin From Photodamage
[0195] Patients with a mutated xeroderma pigmentosum group A (XPA)
gene have a greater than 1000 fold increased risk of UV-induced
skin cancer. XPA.sup.-/- mice mimic the human syndrome [Kraemer, K.
et al., pp. 256-261 In: Molecular Biology of Aging (Bohr, V. A., et
al., eds.) Munksgaard, Copenhagen, 1999]. We have previously shown
that oligonucleotides, particularly thymidine dinucleotide (pTT)
and pGAGTATGAG (SEQ ID NO:1) that are partial homologs of the
telomere overhang tandem repeat TTAGGG (SEQ ID NO: 1), increase
levels of proteins involved in nucleotide excision repair and
enhance the DNA repair rate. To determine the effect of
oligonucleotides in vivo, XPA.sup.+/+ and XPA.sup.-/- mice were
treated with 100 .mu.M pTT, 40 .mu.M pGAGTATGAG (SEQ ID NO: 1), or
diluent alone, daily for 4 days. A 30 .mu.l volume of
oligonucleotides or diluent in 90% propylene glycol/10% DMSO was
applied to a 3 cm.sup.2 area of skin along the spinal ridge of the
mice. The mice were UV irradiated on day 5 with a previously
determined erythemogenic UVB dose. The course of treatment--4 days
of oligonucleotide (or diluent) applications, starting with
oligonucleotide on day 1 of each week, with UV irradiation on day
5--was repeated for a total of 4 weeks. Seventy-two hours after the
last dose of UV irradiation, the mouse skin was processed
histologically to assess general morphology, proliferation (Ki-67)
[Ohike N. and T Morohoshi, Pathol Int (2001), 51:770-777; Billgren,
A. M. et al., Breast Cancer Res Treat (2002), 71:161-170],
cyclobutane pyrimidine dimers (CPDs) determined by specific
antibody binding, and on-going DNA repair [proliferating cell
nuclear antigen (PCNA); see Savio, M. et al., Carcinogenesis (1998)
19:591-596; Rudolph, P. et al., Hum. Pathol (1998)
29:1480-1487].
[0196] Diluent treated XPA.sup.+/+ and XPA.sup.-/- skin showed
spongiosis, blistering, and dyskeratosis, whereas
oligonucleotide-treated samples lacked these features. After 72
hours, only XPA.sup.-/- diluent-treated samples contained CPDs:
15.+-.5 (+) cells per 400.times. microscopic field vs. none in
samples from mice treated with pTT or SEQ ID NO:1 (p<0.0001). No
XPA.sup.+/+ samples contained CPDs. Ki67 (+) cells were more
numerous in diluent-treated than in oligonucleotide-treated XPA
skin, consistent with a hyperproliferative "rebound" after UVB
damage: 14.+-.4 vs. 5.+-.2 (p<0.005). However, PCNA (+) cells
were more numerous in both XPA.sup.+/+ and XPA.sup.-/-
oligonucleotide-treated skin: 38.+-.2 vs. 52.+-.6 (p<0.01) and
125.+-.8 vs. 89.+-.11 (p <0.001), consistent with the role of
PCNA in on-going DNA repair, and with previously reported
up-regulation of PCNA by oligonucleotides in vitro.
[0197] These data demonstrate that topical application of telomere
homolog oligonucleotides enhances the skin's ability to repair
repeated UVB damage, in large part through increased DNA repair
capacity. The photoprotective effects were observed in both
repair-proficient and severely repair-deficient animals, suggesting
a therapeutic role in cancer prevention.
Example 27
Single-Stranded DNA Homologous to the 3' Overhang Telomere Sequence
Mimics UV Effects on Mitochondrial Gene Expression
[0198] Exposure of keratinocytes to UVB irradiation affects the
expression of genes involved in cell cycle arrest, DNA repair and
cytokine production. Single-stranded oligonucleotides sharing
sequence homology with the telomere 3' overhang, when introduced
into cells, mimic these UV effects. To identify other genes that
may be similarly modulated, cells of keratinocyte origin (SCC12F; a
human epidermal squamous cell carcinoma line provided by Dr. James
Rheinwald of Harvard University) were exposed to solar simulated
irradiation (SSR) (20 mJ/cm.sup.2, measured at 285.+-.5 nm), to an
11-base oligonucleotide (PGTTAGGGTTAG; SEQ ID NO:5) homologous to
the telomere overhang (T-oligo), or to a complementary sequence as
control [pCTAACCCTAAC; (SEQ ID NO:9) control oligonucleotide].
Similar to SSR, T-oligo substantially inhibited cellular
proliferation and arrested>43% of cells in the S-phase of the
cell cycle, compared to <23% of control cells. Using DNA
microarray chips containing >700 genes known to be modulated by
aging and stress conditions, we identified 8 genes that were
downregulated by >50% with SSR and T-oligo treatment, but not
with sham irradiation or control oligo treatment. Specifically, the
modulated genes encode subunits of the mitochondrial enzymes ATPase
and cytochrome c oxidase, known to be transcriptionally
downregulated by UV, and NADH dehydrogenase. These are
mitochondrial-transcribed genes whose encoded proteins participate
in cellular respiration. Semi-quantitative RT-PCR and northern blot
analysis confirmed the above data and showed that the genes were
comparably downregulated by SSR and T-oligo treatment as early as
24 hours and 48 hours, respectively. Using microarray chips that
provide a rapid means for analyzing expression of many genes
simultaneously, it was demonstrated that mitochondrial-encoded gene
products involved in respiration are similarly modulated by UV
irradiation and DNA homologous to the telomere 3' overhang. The
data suggest that DNA damage responses mimicked by telomere homolog
DNA include temporary reduction of energy consumption by cells.
Example 28
Induction of S-phase Arrest and Apoptosis by Telomere Overhang
Oligonucleotide
Materials and Methods Applying to Examples 28-37
Oligonucleotides
[0199] Three DNA oligonucleotides were designed initially: one
homologous to the telomere overhang (11mer-1: pGTTAGGGTTAG; SEQ ID
NO:5), one complementary to this sequence (11mer-2: pCTAACCCTAAC;
SEQ ID NO:9) and one unrelated (11mer-3: pGATCGATCGAT; SEQ ID
NO:10). For later experiments, additional 11 base oligonucleotides
were designed: one a simple permutation of 11mer-1 (PGGGTTAGGGTT;
SEQ ID NO:13), one with the same number of G residues but roughly
50% rather than 100% homology to the overhang (pTAGATGTGGTG; SEQ ID
NO: 14), and one with roughly 50% overhang homology but also
containing cytosine bases (PCGGGCTTATTG; SEQ ID NO: 15) (Midland
Certified Reagent Company, Midland, Tex.).
Cell Sources and Culture
[0200] Human neonatal fibroblasts were established and cultured as
previously described (Eller, M. S., et al., 1997, Proc Natl Acad
Sci USA 94: 12627-12632). Fibroblasts from a Nijmegen breakage
syndrome (NBS) patient (#GM07166) and an age-matched control
(GM03399) were purchased from the NIGMS Human Cell Repository,
Coriell Institute for Medical Research, Camden, N.J.) and cultured
in DMEM/15% FBS. Saos-2 cells were purchased from the American Type
Culture Collection (ATCC; Manassas, Va.). SCC12F cells were the
kind gift of Dr. James Rheinwald, Harvard University.
Cell Cycle Analysis
[0201] The established line of human T lymphocytes, termed Jurkat
cells (180,000 cells /ml) were plated in RPMI medium 1640
supplemented with 3% FBS (both from GIBCO/BRL, Gaithersburg, Md.).
Duplicate cultures were treated with a final concentration of 40
.mu.M oligonucleotide or an equal volume of diluent (water) as a
control. Cells were collected up to 96 hours after treatment,
stained with propidium iodide and analyzed by FACS using a
Becton-Dickinson FacsScan and CellQuest software.
Caspase Activity
[0202] Duplicate cultures of Jurkat cells were cultured and treated
with oligonucleotides as described above. At 48, 72 and 96 hours of
treatment, cells were collected by centrifugation, washed and then
the pellet lysed by repeated cycles of freeze-thawing. The lysate
was then clarified by centrifugation and the supematant used for
protein analysis and Caspase-3 activity assay using the components
and instructions of the Colorimetric CaspACE Assay System from
Promega (Madison, Wis.). The assay uses the substrate Ac-DEVD-pNA
and calorimetrically measures release of free pNA. Caspase activity
is expressed as pmol of pNA produced/hour/.mu.g protein.
TUNEL Analysis
[0203] Cells were plated at a density of 180,000 cells/ml in RPMI
1640 medium supplemented with 3% FBS. Cells were treated with 40
.mu.M of either of the oligonucleotides for 72 hours. Cells were
then collected, washed and fixed for 30 minutes in 4%
paraformaldehyde and then permeabilized with 0. 1% Triton X-100 for
2 minutes. The TUNEL assay was carried out with components and
instructions of the In Situ Cell Death Detection Kit using
fluorescein-labeled dUTP from Boehringer Mannheim. TUNEL-positive
cells were detected by FACS analysis and confocal microscopy.
Cellular Uptake of Oligonucleotides
[0204] For confocal analysis, Jurkat cells were plated on Permanox
chamber slides (Lab-Tek, Naperville, Ill.) and treated for 4 hours
with fluorescein phosphoramidite (FAM)-labeled oligonucleotides
(Research Genetics, Inc., Huntsville, Ala.). Adherent cells were
fixed in 4% paraformaldehyde in PBS, stained with propidiurn iodide
(PI) to identify nuclei, mounted with Slowfade reagent (Molecular
Probes, Eugene, Oreg.), covered with a coverslip and stored at
4.degree. C. in the dark. Uptake of the oligonucleotides was
assessed in 5-10 .mu.m sections with a Carl Zeiss LSM 510 confocal
laser microscope. Computer images assign green to the
FAM-oligonucleotides, red to PI, and yellow to co-localization of
the signals. FACS analysis was performed on Jurkat cells
identically treated with the FAM-oligonucleotides for 4 hours, then
fixed in 0.5 ml of 4% paraformaldehyde overnight at 4.degree. C.
Fluorescence was measured on the FL-I channel.
Western Blot Analysis and Antibodies
[0205] Western blot analysis was performed as previously described
[Eller, M. S., et al., (1996), Proc Natl Acad Sci USA 93,
1087-1092]. Antibody Ab-6 (DO-1 clone, Oncogene Research Products,
Cambridge, Mass.) detected p53; antibody KH95 (Santa Cruz
Biotechnology, Inc., Santa Cruz, Calif.) detected E2F1; antibody
Ab-4 (Oncogene Research products) detected p73. Phospho-p53 (serine
15) was detected using the #9284 polyclonal antibody and
phospho-p95/Nbs1 (serine 343) was detected by a
phospho-p95/Nbs1-specific polyclonal antibody, both antibodies from
Cell Signaling Technology (Beverly, Mass.). p95/Nbs1 antibody
(#NB-100-143, Novus Biologicals, Littleton, Colo.) and an actin
antibody (I-19, Santa Cruz Biotechnology, Santa Cruz, Calif.) were
also used.
Modification of p95/Nbs1
[0206] Jurkat and SCC12F cells were cultured and treated with the
oligonucleotides as described above. After the indicated times,
total protein was collected and analyzed by 8% PAGE and western
blot using a polyclonal antibody to p95/Nbs 1 (#NB-100-143, Novus
Biologicals, Littleton, Colo.). Immunoprecipitation and treatment
with a serine/threonine phosphatase was performed as described by
Lim et al. [Lim, D. S. et al., Nature 404:613-617, 2000].
Transient Transfection and Expression of TRF.sub.2DN
[0207] The Ad TRF.sub.2DN expression vector was the kind gift of
Dr. Titia deLange (Rockefeller University). The control vector,
pCMV LUC was the gift of Dr. M. Hedayati, Johns Hopkins University.
Cells were plated at a density of 3.5.times.10.sup.3
cells/cm.sup.2. One day later, the cultures were transfected with 1
.mu.g plasmid DNA/35 mm culture dish, using the Fugene 6
Transfection Reagent (Roche Molecular Biochemicals, Indianapolis,
Ind.), following the protocol supplied by the manufacturer. Cells
were collected at the indicated times after transfection and
p95/Nbs1 was examined by western blot as described.
Telomere Length
[0208] Normal human fibroblasts were cultured for 5 days in the
presence of either diluent or 40 .mu.M 11mer-1, -2 or -3. The cells
were then collected and the genomic DNA isolated using the DNeasy
Tissue Kit (Qiagen, Valencia, Calif.). Telomere length was
determined essentially as described by van Steensel and de Lange
(van Steensel, B. and T. de Lange. 1997, Nature 385: 740-743) using
the Telo TAGGG Telomere Length Assay from Roche Molecular
Biochenicals (Indianapolis, Ind.) and the protocol supplied by the
manufacturer. The mean telomere length (MTL) was calculated by
densitometry and using the method of Harley et al. (Harley, C. B.,
et al., 1990, Nature 345: 458-460).
3' Overhang Assay
[0209] Normal human fibroblasts were cultured in the presence of 40
.mu.M 11mer-1 for up to 7 days. Cells were collected before
treatment (time 0) and at 3, 5 and 7 days of treatment. The genomic
DNA was isolated using the DNeasy kit. Detection of the 3' overhang
was carried out as described by van Steensel, Smogorzewska and de
Lange (van Steensel, B., et al., 1998, Cell 92: 401-413). A probe
([TTAGGG].sub.4) was hybridized to the genomic DNA to control for
hybridization to telomeric double-stranded DNA. The test primer
([CCCTAA].sub.4) was used to detect the overhang.
[0210] Oligonucleotides homologous to the 3' overhang sequence
(11mer-1: pGTTAGGGTTAG; SEQ ID NO:5), complementary to this
sequence (11mer-2: pCTAACCCTAAC; SEQ ID NO:9) and unrelated to the
telomere sequence (11mer-3: pGATCGATCGAT; SEQ ID NO: 10) were
synthesized. The three 11-mer oligonucleotides were added to
cultures of Jurkat cells, an established line of human T
lymphocytes, a cell type reported to undergo apoptosis in response
to telomere disruption [Karlseder, J., et al., (1999) Science 283,
1321-1325] and DNA damaging ionizing radiation (IR) [Vigorito, E.,
et al, (1999), Hematol Cell Ther 41, 153-161]. Duplicate cultures
of Jurkat cells were treated with a final concentration of 40 .mu.M
11mer-1, -2 or -3, oligonucleotides, or an equal volume of diluent
(water) as a control. Cells were collected up to 96 hours after
treatment, stained with propidium iodide and analyzed by FACS. See
also Example 13 and FIGS. 19A-19H.
[0211] Apoptosis was also detected by the DNA end-labeling TTJNEL
assay. Jurkat cells were treated with 40 .mu.M oligonucleotides for
72 hours. Cells were then collected and the TUNEL assay was carried
out. Only Jurkat cells treated with the overhang homolog SEQ ID
NO:5 displayed an increase in fluorescence due to end-label
incorporation as seen by FACS analysis and confocal microscopy. The
activation of caspase-3, another marker of apoptosis, was also
examined. Duplicate cultures of Jurkat cells were cultured and
treated with oligonucleotides as described above for 48, 72 and 96
hours and caspase-3 activity was measured. The activity of
caspase-3 was 50% higher after 48 hours of treatment with the
telomere overhang homolog, compared to controls, and 3-4 fold
higher in these cells at 72 and 96 hours (FIG. 27). Thus, the
oligonucleotide homologous to the telomere 3' overhang specifically
induces an S phase arrest and apoptosis in these cells.
Example 29
Demonstration of a Role for p73 in Apoptosis
[0212] The p53 transcription factor and tumor suppression protein
was specifically implicated in the apoptosis following telomere
loop disruption [Karlseder, J., et al., (1999), Science 283,
1321-1325]. However, although a role for p53 in apoptosis of murine
embryonic fibroblasts after telomere loop disruption was
demonstrated experimentally, the implied role for p53 in apoptosis
of cells with presumptively compromised p53 in the same studies was
not addressed [Karlseder, J., et al., (1999), Science 283,
1321-1325]. Because the p53 homolog p73 has also been shown to
mediate apoptosis in several cell types [Lissy, N.A., et al.,
(2000), Nature 407: 642-644, Irwin, M., et al., (1997), Nature 407:
645-648], and because the telomere homolog DNA induced both
proteins, experiments were designed to explore the contribution of
this protein to oligonucleotide-induced cell death.
[0213] Because HTLV-l infection has been shown to impair the p73
pathway [Lemasson, I. and Nyborg, J. K. (2001, J Biol Chem 276,
15720-15727, Kaida, A., et al., (2000), Oncogene 19, 827-830] as
well as that of p53 [Akagi, T., et al., (1997), FEBS Lett 406,
263-266], a human melanoma line MM-AN known to express wild type
p53 was selected for study. Matched cultures of human melanoma cell
line MN-AN (obtained from H. R. Beyers, Boston University) were
grown in DMEM with 5% FBS and treated with 40 .mu.M 11mer-1,
11mer-2 or diluent alone for 24-48 hours and harvested at intervals
for FACS analysis and western blotting.
[0214] Like the Jurkat cells, the MM-AN cells first entered an
S-phase arrest, and by 72 hours a substantial portion of the cells
were undergoing apoptosis, as indicated by their
sub-G.sub.0/G.sub.1 DNA content. Proteins were analyzed by
denaturing polyacrylamide gel electrophoresis (SDS-PAGE), using 10%
polyacrylamide, and western blot analysis was done with an
E2F1-specific monoclonal antibody (KH95 Santa Cruz Biotechnology,
Santa Cruz, Calif.), and p73 analyzed using a polyclonal antibody
(AB-4 from Oncogene Research Products, San Diego, Calif.). Western
blot analysis revealed the same pattern of induction for E2F1 and
p73 as observed for Jurkat cells, consistent with a causal role for
these proteins in the observed apoptosis. In order to determine the
contribution of p73 to cell death, MM-AN melanoma cells were stably
transfected with a dominant negative p73 (p.sub.73.sup.DN) (Irwin
et al., Nature 402:645-648) construct or empty vector as a control
(p73.sup.DN-containing vector a gift from Dr. William Kaelin, Dana
Farber Institute, Boston) and paired cultures were supplemented
with 40 .mu.M 11mer-1 or diluent alone, then harvested at 72 hours
for FACS analysis. Cells expressing p73DN underwent apoptosis at
half the rate of control cells, confirming a substantial, but not
exclusive role for the p73 protein in the process. Furthermore, by
western blot, the differentiation markers Mart-1, tyrosinase, TRP-1
and gp-100 were upregulated 48-72 hours after T-oligo treatment of
MM-AN melanoma cells. The above-mentioned differentiation markers
are expressed in normal human melanocytes. It appears that the loss
of expression of these antigens is a mechanism that a subset of
human melanomas uses to escape immunosurveillance defenses. Several
peptides from these antigens are targets of tumor infiltrating
cytotoxic lymphocytes. Encouraging results have been obtained in
vivo with different vaccination strategies using antigenic peptides
from the above antigens.
Example 30
Effect of the T-oligo on Tumorigenicity of MM-AN Cells in SCID
Mice
[0215] To study the effect of T-oligo on the tumorigenicity of
MM-AN cells, cells were grown in DMEM with 5% fetal bovine serum
(FBS) and treated with 40 .mu.M of T-oligo, complement, or diluent
alone for 48 hours. The cells were then harvested with trypsin/EDTA
and the percent viability determined by trypan blue exclusion. All
cell populations at the time of injection had a viability of
greater than 90%. The tumorigenicity of these melanoma cells was
determined by injecting 1.times.10.sup.6 viable cells in balanced
salt solution subcutaneously over the right scapular region of SCID
mice (3 groups of 5 mice) to produce tumors. The animals were
sacrificed by CO.sub.2 inhalation 18 days after treatment and the
tumor size evaluated with calipers. Tumors were processed for
hematoxylin and eosin staining and the melanocytic origin of the
tumors was confirmed by immunohistochemical staining of the lesion
using HMB-45 monoclonal antibody, which recognizes gp-100, a
conventional marker for human melanoma.
[0216] Tumors were palpable at the site injected with cells
pretreated with diluent by day 10 and day 12 in the other groups.
On day 18, animals were sacrificed and all tumors removed and
measured. Mean tumor volume in the diluent-treated group was
322.+-.45 mm3 vs. 56.+-.13 mM3 in the T-oligo treated group
(p=0.04). The animals treated with the control oligonucleotide had
a tumor volume of 238.+-.50 mM , not statistically less than the
diluent control (FIG. 28). Hematoxylin and eosin staining revealed
large tumors present within the subcutis composed of large
epitheloid cells with abundant pigmented cytoplasm and large
irregular nuclei demonstrating hyperchromasia and large nucleoli.
The tumors were identified as melanoma by positive
immunohistochemical staining with HMB-45, confirming their
melanocytic origin.
[0217] To study the effect of T-oligo on the metastatic potential
of melanoma cells, cultures of MM-AN cells were treated for 48
hours with T-oligo, complement or diluent alone and harvested as
described above. 1.times.10.sup.6 cells in balanced salt solution
were injected into the lateral tail vein of 5-week old SCID mice (3
groups of 5 mice). After 40 days, mice were sacrificed by CO.sub.2
inhalation, an autopsy performed and organs examined
macroscopically for visible metastatic lesions.
[0218] All five animals treated with diluent alone or control
oligonucleotide developed multiple metastases in comparison to one
of five animals in the T-oligo-treated group. Metastases were seen
in the adrenal gland, bone, brain, brown fat, kidney, liver, lung,
pancreas and additional sites of the control animals. The average
number of visible tumors per animal was 0.8 in the T-oligo
pretreated group compared to 15.8 (p=0.003) and 9.6 (p=0.05) in the
diluent and control oligo pretreated groups, respectively. The
average volume of the macroscopic metastastic tumors was also found
to be significantly reduced in the T-oligo treated animals by about
85% and 80% compared to the diluent treated and complement treated
animals, respectively (FIG. 29). TABLE-US-00004 TABLE 2 Effect of
T-oligo on Macroscopic Metastasis Animals with Total tumors:
Animals with tumors: Total tumors: Animals with Total: Site tumors:
Diluent Diluent Control oligo Control oligo tumors: T-oligo T-oligo
Adrenal 1/5 3 2/5 3 1/5 2 Bone 4/5 10 1/5 3 0/5 0 Brain 3/5 8 3/5 3
1/5 2 Brown fat 5/5 21 3/5 8 0/5 0 Kidney 3/5 13 4/5 7 0/5 0 Liver
1/5 9 2/5 4 0/5 0 Lung 1/5 3 3/5 6 0/5 0 Pancreas 3/5 4 4/5 7 0/5 0
Miscellaneous 3/5 8 1/5 7 0/5 0 Total Tumor Load 79 48 4 (5
animals) Average tumors 15.8 9.6 0.8 per animal METASTASIS FREE 0/5
0/5 4/5
Example 31
Activity Depends on Homology to Telomere Overhang Sequence
[0219] To further confirm the specificity of these responses to the
telomere overhang sequence, three variations were tested. Like
11mer-1, its permutation pGGGTTAGGGTT (SEQ ID NO: 13) is an exact
homolog of the overhang and hence, predicted to be equally active.
A second oligonucleotide, pTAGATGTGGTG (SEQ ID NO: 14) is equally
as G-rich (5 of 11 bases) as 11mer-1 and has 55% homology to the
overhang, similar to the 9-mer oligonucleotide, pGAGTATGAG (SEQ ID
NO:1), recently shown to induce p53 and pigmentation, and to
enhance DNA repair capacity (see Example 12). A third
oligonucleotide, pCGGGCTTATTG (SEQ ID NO: 15), also has 55%
homology to the overhang, but differs from the other
oligonucleotides in that it contains 18% cytosine bases that are
not present in the overhang sequence. These oligonucleotides were
added individually to cultures of Jurkat cells at a final
concentration of 10 .mu.M. Cells were collected after 72 hours and
processed for FACS analysis. Each experimental condition was done
in triplicate. The data shown in FIGS. 30A-30H are from one
representative experiment of two. By 72 hours, 2% of the
diluent-treated cells and cells treated with cytosine-containing
oligonucleotide were apoptotic by FACS analysis. However, 13% of
the homolog-treated and 10% of the partial homolog-treated cells
were apoptotic. After 96 hours, 28% of the homolog-treated cells
were apoptotic, compared to 16% of the partial homolog-treated
cells, and 2 -4% of cells in cultures treated with the
cytosine-containing oligonucleotide or diluent alone. In separate
paired cultures, the two complete telomere overhang homologs
[pGTTAGGGTTAG (SEQ ID NO:5) and pGGGTTAGGGTT (SEQ ID NO:13)] were
shown to be equal in activity. The data suggest that
oligonucleotide activity is a function of telomere homology rather
than, for example, G content primarily. Furthermore, the presence
of cytosine in the oligonucleotide greatly diminishes its activity
independent of degree homology. Although pTAGATGTGGTG (SEQ ID
NO:14) and pCGGGCTTATTG (SEQ ID NO:15) share comparable homology
with the telomere overhang, the latter oligonucleotide failed to
induce apoptosis and only induced a moderate S-phase arrest. This
is consistent with work described in Example 12 comparing 2-20 base
oligonucleotides in their ability to induce other UV-mimetic DNA
damage responses.
[0220] To determine if pTT, representing 33% of the 6 base telomere
tandem repeat sequence, induces an S-phase arrest in Jurkat cells
in the same way as the full telomere repeat sequence, we compared
the effects of pTT and 11mer-1 on Jurkat cells. In order to
determine relative efficacy of pTT and 11mer-1, cultures of Jurkat
cells were treated with diluent, 20 .mu.M or 5 .mu.M pTT or 11mer-1
for 72 hours and collected for FACS analysis. Each experimental
condition was performed in triplicate. The percentage of cells in
each phase of the cell cycle, indicated as an average and standard
deviation, was deterrnined from the triplicate results. One
representative experiment of three is shown in FIGS. 31A-31E. At a
concentration of 20 .mu.M, the cell cycle profiles of pTT- and
11mer-1-treated Jurkat cells were nearly identical, with 53.+-.1%
and 58.+-.1%, respectively, of the treated cells in the S-phase at
72 hours. However, at 5 .mu.M, 61% of the 11mer-1 treated cells had
accumulated in the S-phase within 72 hours, compared to 45% of the
pTT-treated cells and 36% of the diluent-treated cells. Although
Jurkat cells treated with a higher 11mer-1 dose (40 .mu.M, FIG.
19F) also showed a comparable percentage of cells in S phase at 72
hours (38%), these cultures additionally contained 13% apoptotic
(<G.sub.0) cells. No apoptosis was detected in Jurkat cultures
treated with 20 .mu.M pTT even at 96 hours. Thus, pTT and the
telomere overhang homolog have similar effects on the cell cycle in
Jurkat cells, although higher concentrations of the incomplete
sequence are needed. These data, together with those in FIG. 30, as
well as other data for other oligonucleotides 2-20 bases in length
(Example 12) further suggest that the ability of these
oligonucleotides to induce DNA damage responses is directly related
to their degree of homology to the telomere repeat sequence,
although many sequences with only partial homology also have useful
effects.
Example 32
Induction of S-phase Arrest, E2F1, and p53 Protein Levels, and
Phosphorylation of p53 in Normal Human Fibroblasts
[0221] Preconfluent cultures of normal neonatal human fibroblasts
were treated with the oligonucleotides (40 .mu.M) or diluent alone
and collected 24 hours later for FACS analysis (FIGS. 32A-32D) or
western blot. The averages and standard deviations presented in
FIGS. 32A-32D were determined from triplicate samples. One
representative experiment of three is presented. Normal neonatal
human fibroblasts respond within 24 hours to the telomere overhang
homolog oligonucleotide, 11mer-1, by activation of an S-phase
checkpoint, but no apoptotic cells were detected up to 72 hours
after treatment. Control 11-base oligonucleotides complementary
(11mer-2) or unrelated (11mer-3) to the telomere overhang had no
effect on the cells. The selective effect of the telomere homolog
oligonucleotide cannot be attributed to selective uptake, as
comparable uptake has been shown among same length oligonucleotides
regardless of sequence.
[0222] Activation of p53 as indicated by phosphorylation on
serine-15 was determined by western blot analysis, using the
phospho-p53 (ser-15) specific antibody 16G8. The blot was then
stripped and re-probed with the pantropic p53 DO-1. Lanes of the
gel contained protein from fibroblasts treated with diluent alone,
11mer-1 or 11mer-2, collected at 24, 48 or 72 hours. As a positive
control, fibroblasts from another donor were either sham- or
X-irradiated (10 Gy) and collected after 3 hours. Densitometric
analysis showed a 170-250 % increase in E2F1 in 11mer-1 treated
fibroblasts compared to diluent or 11mer-2 treated controls at 24
hours. p53 increased by 60-300% at 48 hours and 240-380% at 72
hours after 11mer-1 treatment compared to diluent or 11mer-2
treated controls. All values were normalized to P-actin and are
based on two independent experiments. Western analysis of the
treated fibroblasts showed that p53 and E2F1 are selectively
induced by the telomere overhang homolog.
[0223] An increase in E2F1 was seen as early as 4 hours after
addition of the 11-mer-1, peaked 12-24 hours after, and
subsequently returned to control levels. The E2F1 transcription
factor is known to cooperate with p53 in induction of apoptosis
(Kowalik, T. F., et al., 1995, J Virol 69: 2491-2500, Kowalik, T.
F., et al., 1998, Cell Growth Differentiation 9: 113-118) and to
induce a senescent phenotype in human fibroblasts in a
p53-dependent manner (Dimri, G. P., et al., 2000, Mol Cell Biol 20:
273-285). Furthermore, E2F1 is induced by DNA damage from IR in a
manner dependent on the ATM kinase (Lin, W. C., et al., 2001, Genes
and Dev. 15: 1833-1844). To determine whether 11mer-1, like pTT
(Eller, M.S., et al., 1997, Proc Natl Acad Sci USA 94: 12627-12632,
Maeda, T., et al., 1999, Mutat Res 433: 137-145), activates as well
as induces p53, we also examined p53 phosphorylation, a marker of
transcriptional activation of p53 after various forms of DNA damage
(Lambert, P. F., et al., 1998, J Biol Chem 273: 33048-33053,
Durnaz, N. and D.W. Meek. 1999. EMBO J 18: 7002-7010, Tibbetts, R.
S., et al., 1999, Genes Dev 13: 152-157, Caspari, T., 2000, Curr
Biol 10: 315-317, Unger, T., et al., 1999, Oncogene 18: 3205-3212).
There was a striking and selective increase in p53 protein
phosphorylated at serine 15 in response to the 11mer, first
detected at 4 hours and sustained through at least 48 hours.
Example 33
p53 Phosphorylation and E2F1 Induction Are Dependent on ATM
[0224] Because the serine 15 site on p53 is known to be
phosphorylated in an ATM-dependent manner after exposure to
ionizing radiation (IR), we wished to examine the role of ATM in
E2F1 induction and p53 serine 15 phosphorylation in response to the
11mer-1. Fibroblasts from a patient with ataxia telangiectasia (AT)
known to lack functional ATM protein, and age-matched normal
control fibroblasts (N) were treated with either diluent, 40 .mu.M
11mer-1, sham irradiation or IR (10 Gy). Cells were collected 3
hours (sham or IR) or 48 hours (diluent, 11mer-1) for western blot
analysis to detect serine 15-phosphorylated p53 and total p53. In
normal fibroblasts, the 11mer-1 induced a 10-15 fold increase in
the level p53 phosphorylation on serine 15 compared to
diluent-treated controls. In contrast, treatment of AT fibroblasts
with the 11mer-1 resulted in less than a 50% increase. The 11mer-1
minimally induced the level of total p53 in these normal
fibroblasts from a young adult donor, in contrast to the induction
of p53 in newborn fibroblasts, consistent with the previously
described reduced response to UV-induced DNA damage for adult
versus newborn cells. As expected, AT fibroblasts showed only
minimal phosphorylation of p53 serine 15 in response to IR. The
11mer-1 also induced E2F1 levels in normal control fibroblasts, but
not in AT fibroblasts. These data demonstrate a requirement for the
ATM kinase in these responses to telomere overhang DNA and are
consistent with ATM-dependent p53 induction by TRF.sub.2DN
(Karlseder, J. et al., 1999, Science 283: 1321-1325).
Example 34
Cell Cycle Arrest Is Not Dependent On p53
[0225] In order to determine whether these oligonucleotides
similarly affect other human cell types and to investigate the role
of p53, we treated a squamous cell carcinoma line (SCC12F)
(Rheinwald, J. G., et al., 1983, Human carcinogenesis. pp. 86-96.
Academic Press (New York)) that over-expresses a presumptively
mutated p53 (Eller, M. S. and B. A. Gilchrest. 2000, Pigment Cell
Res. 13: 94-97) and a p53-null osteosarcoma cell line (Saos-2)
(Wang, L. H., et al., 1998, Anticancer Res 18: 321-325) with either
diluent alone, 11mer-1, 11mer-2 or 11mer-3. Cultures were analyzed
by FACS after 48 hours (FIGS. 33A-33H). As with the Jurkat cells
and normal fibroblasts, the telomere overhang homolog selectively
induced an S-phase arrest in both of these cell types within 48
hours. Although the percentage of cells in the S-phase in
11mer-1-treated SCC12F and Saos-2 cells was virtually identical
(53.+-.6% and 52.+-.1%, respectively), the G.sub.0/G.sub.1 and
G.sub.2/M content of the two cell types were somewhat different.
This may reflect differential uptake of the oligonucleotide leading
to dose-dependent differences, and/or different pathways acting in
these cells to control the cell cycle. No apoptotic response to the
oligonucleotides was detected in either cell type within 72 hours.
These data demonstrate that the 11mer-1 affects cells of both
epithelial and mesenchymal origin and that the S-phase arrest in
response to 11mer-1 is not dependent on p53. However, because many
cell types with wild type p53 are relatively resistant to apoptosis
after DNA damage (Sionov, R. V. and Y. Haupt. 1999. Oncogene 18:
6145-6157), the data do not address the role of p53 in the
apoptotic response to 11mer-1, which notably occurs in Jurkat cells
that express a presumptively compromised p53 (Akagi, T., et al.,
1997, FEBS 406: 263-266).
Example 35
Cells Lacking Functional p95/Nbs1 Do Not Activate the S-phase
Checkpoint In Response to the Telomere Overhang Homolog
[0226] Because of the demonstrated role of p95/Nbs1 in the S-phase
arrest in response to IR and its known association with telomeric
DNA, we next examined its role in the S-phase arrest seen in
response to the telomere overhang homolog. Fibroblasts were
obtained from an NBS (Nijmegen breakage syndrome) patient, in which
p95/Nbs1 was below the level of detection. Preconfluent cultures or
normal (control) fibroblasts and NBS fibroblasts were treated with
40 .mu.M of the oligonucleotides and collected after 48 hours for
FACS analysis (FIGS. 34A-34H). The averages and standard deviations
were calculated from triplicate cultures of each condition. FACS
profiles from one representative experiment of three are shown. As
expected, 11mer-1-treated normal cells exhibit an S phase growth
arrest within 24 hours, while the same cells treated with diluent
alone, 11mer-2 or 11mer-3 are unaffected.
[0227] Unrelated oligonucleotide-treated and diluent-treated NBS
cells display an FACS profile similar to that of the normal cells
arrested in the S phase and, compared to the diluent-treated NBS
cells, their proliferation is minimally affected by the 11mer-1.
These data suggest that p95/Nbs1 has a previously unidentified role
in normal progression of the S phase and that DNA synthesis is
protracted in the absence of functional p95/Nbs1. Also of interest,
the 8% increase in the number of S-phase cells in 11mer-1-treated
NBS cultures compared to diluent-treated cells, although not
statistically significant (p<0.08), suggests that factors other
than p95/Nbs1 may contribute to the arrest following DNA damage or
11mer-1 treatment. For example, unscheduled E2F1 activity during
the S-phase has been shown to lead to activation of an S-phase
checkpoint (Krek, W., et al., 1995, Cell 83: 1149-1158).
[0228] Phosphorylation of p95/Nbs1 by ATM, causally related to
activation of the S-phase checkpoint after DNA damage, can be
detected by PAGE as a subtle slowing of the protein migration in
the gel (Lim, D. S., et al., 2000, Nature 404: 613-617, Zhao, S.,
et al., 2000, Nature 405:473-477, Wu, X., et al., 2000, Nature 405:
477-482). Western blot analysis detects such a shift in p95/Nbs1
migration in protein harvested from Jurkat cells 48, 72 and 96
hours after addition of the 11mer-1 but not 11mer-2 or 11mer-3.
This change in apparent molecular weight of p95/Nbs1, presumably
from covalent modification of the protein, coincides with the
S-phase arrest as determined by FACS analysis. This shift in
p95/Nbs1 migration also occurs in these cells after IR, as
previously reported and ascribed to protein phosphorylation (Lim,
D. S., et al., 2000, Nature 404: 613-617, Zhao, S., et al., 2000,
Nature 405: 473-477, Wu, X., et al., 2000, Nature 405: 477-482).
SCC12F cells respond identically to addition of the 11mer-1, again
in a time frame in agreement with their activation of the S-phase
checkpoint. The shift in SCC12F cells is more apparent with
immunoprecipitated p95/Nbs1 from 11mer-1-treated and irradiated
cells and is eliminated by treatment of the immunoprecipitated
protein with a serine/threonine phosphatase as was reported for
p95/Nbs1 phosphorylated in response to IR (Lim, D. S., et al.,
2000, Nature 404: 613-617). Probing a western blot of proteins from
diluent- and oligonucleotide-treated fibroblasts with a
phospho-p95/Nbs 1 -specific antibody further demonstrates that
phosphorylation of p95/Nbs 1 is induced by the telomere overhang
homolog oligonucleotide 11mer-1.
Example 36
Telomere Disruption by TRF2DN Leads to Modification of p95/Nbs1
[0229] Karlseder et al. (Karlseder, J., 1999, Science 283:
1321-1325) previously demonstrated that ectopic expression of
TRF2.sup.DN, which disrupts the telomere loop and exposes the 3'
overhang, induces an increase in p53 and apoptosis in certain cell
types. In order to see if p95/Nbs1 modification is also induced by
telomere disruption, neonatal human fibroblasts were transiently
transfected with the TRF.sub.2DN expression vector or a (control)
vector without the TRFDN insert. Cells were collected up to 40
hours after transfection and p95/Nbs1 was analyzed by Western blot
using a phospho-p95-specific antibody. By 24 hours post
transfection, a distinct shift in p95/Nbs1 mobility is detected,
similar to that seen after exposure to IR (10 Gy). This shift to a
higher molecular weight is still apparent after 40 hours. These
data demonstrate that both telomere disruption and treatment with a
homolog of the telomere 3' overhang induce modification of p95/Nbs1
and hence, support our hypothesis that exposure of the 3' overhang
is the primary signal for the DNA damage responses observed after
various manipulations of the telomere.
Example 37
Telomere Overhang Oligonucleotide Does Not Decrease Telomere Length
or Alter the 3' Overhang
[0230] To eliminate the possibility that the 11mer-1
oligonucleotide acts indirectly by disrupting the telomere loop
structure, leading to critical telomere shortening and/or
degradation of the 3' overhang as reported after TRF.sub.2DN
transfection (Karlseder, J., 1999, Science 283: 1321-1325), we
analyzed mean telomere length after treatment of normal human
fibroblasts with the oligonucleotides for 5 days, longer than
necessary to induce p53 and the S phase checkpoint. Normal human
fibroblasts were treated with either diluent alone, 40 .mu.M
11mer-1, 11mer-2 or 11mer-3 for 5 days. The fibroblasts were
harvested and the genomic DNA was isolated. Telomere length
analysis was performed for diluent-treated cells, 11mer-1-treated
cells, 11mer-2-treated cells, 11mer-3 -treated cells, and late
passage fibroblasts (population doubling >50), and compared with
high molecular weight and low molecular weight telomere markers.
The MTL values (in kilobases) for each experimental condition,
calculated as described by Harley, et al. (Harley, C. B. et al.,
Nature 345:458-460, 1990), were as follows: 10.59 (diluent), 12.25
(11mer-1), 10.45 (11mer-2), 10.22 (11mer-3), 8.86 (senescent),
10.19 (high molecular weight standard), 4.04 (low molecular weight
standard). The 3' overhang assay was carried out on newborn
fibroblasts treated for 3, 5, or 7 days with 40 .mu.M 11mer-1.
[0231] None of the oligonucleotides reduced mean telomere length
(MTL). Indeed, 11mer-1-treated cells showed a modest increase in
MTL of approximately 20% during the 5-day experiment. Furthermore,
treatment of fibroblasts with the 11mer-1 oligonucleotide for up to
7 days did not result in degradation of the telomere 3' overhang as
was observed following telomere disruption by TRF2DN (Karlseder,
J., 1999, Science 283:1321-1325). These data strongly suggest that
the 1 mer-1 does not affect telomere integrity, but likely mimics
the signal created by this process. Similarly, the 11mer-1 effects
cannot be attributed to inhibition of telomerase, for example by
acting as a pseudosubstrate and hence preventing telomere
elongation, because normal human fibroblasts, cells in which the
effects are readily observed, do not express the catalytic subunit
TERT (Greider, C. W. 1996, Annu Rev Biochem 65: 337-365).
Furthermore, telomere erosion due to telomerase inhibition would be
expected to exert effects only after an extended period of time,
more than 50 population doublings in previous reports (Naka, K., et
al., 1999, Biochem Biophys Res Comm 255: 753-758, Marusic, L., et
al., 1997, Mol Cell Biol 17: 6394-6401, Hande, M. P., et al., 1999,
J Cell Bio 144: 589-601), far greater than the 24-48 hours reported
here, and is in any case not observed.
Example 38
Oligonucleotide Treatment of in Situ Melanoma in SCID Mice by
Various Delivery Methods (Hypothetical)
[0232] MM-AN cells will be grown in DMEM with 5% FBS, the cells
will then be harvested with trypsin/EDTA, and the percent viability
will be determined by trypan blue exclusion. Only cell populations
with 90% or greater viability will be used for the experiments. The
tumorigenicity of these melanoma cells will be determined by
subcutaneously injecting 1.times.10.sup.6 viable cells in balanced
salt solution into the hind limb of SCID mice to produce
subcutaneous tumors. For these studies, 3 groups of mice (5
mice/group) will be used. Group 1 will be given IP injections of
200 .mu.g T-oligo five times weekly, starting 24 hours after
injection of cells group 2 will be given IP injections with 200
.mu.g of the control oligonucleotide five times weekly and group 3
will be injected with diluent. Oligonucleotides delivered IP have
been found to be effective in reducing the size of subcutaneous
melanoma in mice (Massod, R., et al., Blood 96:1904-1913, 2001).
The size of the tumors will be monitored by twice weekly
examination of the mice and measurement of the tumors with
calipers. The mice will be killed 4 weeks after injection and the
tumors will be processed for hematoxylin and eosin staining.
[0233] MM-AN melanoma cells will be treated and harvested as
described above. Instead of delivering the oligonucleotide IP it
will be delivered by an Alzet pump. 500 .mu.g/per day of T-oligo or
control oligo or diluent will be infused for 4 weeks. The size of
the tumor will be evaluated as described above. Alzet pumps have
been found effective in treating subcutaneous melanoma tumors in
mice (Hijiya, N., et al. Proc. Natl. Acad. Sci. USA 91:4499-4503,
1994).
[0234] MM-AN melanoma cells will be treated and harvested as
described above. Group 1 will be given IV injections of 200 jig
T-oligo three times weekly, group 2 will be given IV injections
with 200 .mu.g of control oligonucleotide three times weekly, and
group 3 will be injected with diluent. Mice will be killed 4 weeks
after injection and the size of the tumors will be evaluated as
described above.
Example 39
Oligonucleotide Effect on Melanoma Metastasis and Tumorigenicity
(Hypothetical)
[0235] The pilot experiment protocol which results in maximum tumor
regression will be selected. MM-AN melanoma cells will be treated
and harvested as described above. 1.times.10.sup.6 cells in
balanced salt solution will be injected into the lateral tail vein
of 4 week old SCID mice. There will be 3 groups of 25 mice for each
of the above treatment groups. Group 1 will be injected with
T-oligo; group 2 will be injected with the control oligonucleotide
and group 3 will be injected with diluent. All treatments will
begin 24 hours after injecting the cells. After 6 weeks, the mice
will be killed by CO.sub.2 inhalation, an autopsy will be performed
and organs will be examined macroscopically for visible lesions.
Particular emphasis will be given to liver, pancreas and brain
because these organs have been shown to be the primary sites of
metastasis of MM-AN cells. For examination and sectioning, organs
will be rinsed in PBS and fixed in 10% formalin for 48 hours.
Organs will be examined under a dissecting microscope and the
number of tumor nodules counted. The histological characteristics
of tumors will be examined with hematoxylin and eosin-stained
sections of tissue fixed in formalin and embedded in paraffin.
[0236] MM-AN melanoma cells will be treated and harvested as
described above. The pilot experiment protocol which resulted in
maximum tumor regression will be selected. The tumorigenicity of
these melanoma cells will be determined by intradermally injecting
1.times.10.sup.6 viable cells in balanced salt solution into the
hind limb region of SCID mice to produce subcutaneous tumors. The
size of the tumor will be monitored by twice weekly examination of
the mice and measurement of tumors with calipers. The mice will be
killed 4 weeks after injection and the tumors will be removed,
measured and processed for hematoxylin and eosin staining. Three
groups of mice will be used. Group 1 will be treated with T-oligo,
group 2 will be treated with control oligonucleotide, and group 3
will be treated with diluent. Apoptosis will be determined in
tumors by TUNEL in the groups of mice discussed above. The
expression of differentiation markers gp-100, TRP-1 and Mart-1 will
also be studied in tumors from the three groups of mice studied
above.
Example 40
Telomere Homolog Oligonucleotides Less Than 6 Nucleotides in Length
Inhibit Proliferation of a Human Osteosarcoma Cell Line
[0237] Human Saos-2 cells were plated in DME with 10% fetal bovine
serum in p35 culture dishes, and dosed with 40 .mu.M Smer (TTAGG),
3mer (TTA) 11mer-1 (GTTAGGGTTAG; SEQ ID NO:5) or diluent alone as
control, and cultured for an additional 36 hours after addition of
oligonucleotides or diluent. Cells were then collected by
trypsinization and counted by Coulter Counter. The FIG. 36 graph
represents averages of cell population doublings after additions,
with standard error of mean, for duplicate cultures.
EQUIVALENTS
[0238] While this invention has been particularly shown and
described with references to preferred embodiments thereof, it will
be understood by those skilled in the art that various changes in
form and details may be made therein without departing from the
scope of the invention encompassed by the appended claims.
Sequence CWU 1
1
15 1 9 DNA Artificial Syntehtic DNA Fragment 1 gagtatgag 9 2 9 DNA
Artificial Synthetic DNA Fragment 2 taggaggat 9 3 7 DNA Artificial
Synthetic DNA Fragment 3 agtatga 7 4 5 DNA Artificial Synthetic DNA
Fragment 4 gtatg 5 5 11 DNA Artificial Synthetic DNA Fragment 5
gttagggtta g 11 6 5 DNA Artificial Synthetic DNA Fragment 6 catac 5
7 7 DNA Artificial Synthetic DNA Fragment 7 agtatga 7 8 20 DNA
Artificial Synthetic DNA Fragment 8 gcatgcatgc attacgtacg 20 9 11
DNA Artificial Synthetic DNA Fragment 9 ctaaccctaa c 11 10 11 DNA
Artificial Synthetic DNA Fragment 10 gatcgatcga t 11 11 6 DNA
Artificial Synthetic DNA Fragment 11 ttaggg 6 12 6 DNA Artificial
Synthetic DNA Fragment 12 ccctaa 6 13 11 DNA Artificial Synthetic
DNA Fragment 13 gggttagggt t 11 14 11 DNA Artificial Synthetic DNA
Fragment 14 tagatgtggt g 11 15 11 DNA Artificial Synthetic DNA
Fragment 15 cgggcttatt g 11
* * * * *