U.S. patent application number 11/347833 was filed with the patent office on 2006-08-10 for double-stranded and single-stranded rna molecules with 5 ' triphosphates and their use for inducing interferon.
This patent application is currently assigned to City of Hope. Invention is credited to Dongho Kim, John J. Rossi.
Application Number | 20060178334 11/347833 |
Document ID | / |
Family ID | 36780693 |
Filed Date | 2006-08-10 |
United States Patent
Application |
20060178334 |
Kind Code |
A1 |
Rossi; John J. ; et
al. |
August 10, 2006 |
Double-stranded and single-stranded RNA molecules with 5 '
triphosphates and their use for inducing interferon
Abstract
Double-stranded and single-stranded RNA molecules, and their use
in methods for inducing interferon are provided. The interferon
induction provides anti-viral and other medically useful effects,
such as anti-cancer effects. Also provided are methods for reducing
or inhibiting interferon induction exhibited by such molecules,
particularly siRNA and shRNA molecules produced in vitro.
Inventors: |
Rossi; John J.; (Alta Loma,
CA) ; Kim; Dongho; (Los Angeles, CA) |
Correspondence
Address: |
ROTHWELL, FIGG, ERNST & MANBECK, P.C.
1425 K STREET, N.W.
SUITE 800
WASHINGTON
DC
20005
US
|
Assignee: |
City of Hope
Duarte
CA
|
Family ID: |
36780693 |
Appl. No.: |
11/347833 |
Filed: |
February 6, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60649537 |
Feb 4, 2005 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/91.2; 536/25.3 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 15/1135 20130101; C12N 2310/53 20130101; C12N 2310/18
20130101; C12N 15/1131 20130101; C12N 2330/30 20130101; C12N
2310/17 20130101; C12N 2320/30 20130101; C12N 15/117 20130101; C12N
2330/50 20130101; C12N 2310/14 20130101; C12N 15/111 20130101 |
Class at
Publication: |
514/044 ;
536/025.3; 435/091.2 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12P 19/34 20060101 C12P019/34; C07H 21/04 20060101
C07H021/04; C07H 21/00 20060101 C07H021/00; C07H 21/02 20060101
C07H021/02 |
Goverment Interests
[0002] The invention described herein was made with Government
support under grant number HL074704 from NHLBI of the National
Institutes of Health. Accordingly, the United States Government may
have certain rights in this invention.
Claims
1. A method for inducing interferon in a cell, comprising:
introducing into said cell an effective amount of an RNAi molecule
having a 5'-triphosphate, wherein said RNAi molecule induces said
interferon.
2. The method of claim 1, wherein said RNAi molecule induces one or
both of interferon .alpha. and .beta..
3. The method of claim 1, wherein said RNAi molecule is produced in
vitro by a phage polymerase.
4. The method of claim 3, wherein said polymerase is T7 RNA
polymerase.
5. The method of claim 1, wherein said RNAi molecule is chemically
synthesized.
6. The method of claim 1, wherein said RNAi molecule is an siRNA or
an shRNA.
7. The method of claim 1, wherein said RNAi molecule also has an
anti-viral effect.
8. The method of claim 7, wherein said RNAi molecule is introduced
into said cell prior to viral infection.
9. The method of claim 8, wherein said RNAi molecule inhibits viral
infection.
10. A composition for inducing interferon in a cell comprising: an
effective amount of an RNAi molecule having a 5'-triphosphate,
wherein said RNAi molecule induces said interferon, and a
physiologically acceptable carrier.
11. The composition of claim 10, wherein said RNAi molecule is
produced in vitro by a phage polymerase.
12. The composition of claim 11, wherein said polymerase is T7 RNA
polymerase.
13. The composition of claim 10, wherein said RNAi molecule is an
siRNA or an shRNA molecule.
14. The composition of claim 10, wherein said RNAi molecule also
has an anti-viral effect.
15. An anti-viral reagent comprising an effective amount of an RNAi
molecule having a 5'-triphosphate, wherein said RNAi molecule
induces interferon and elicits an anti-viral response mediated by
said interferon induction.
16. The reagent of claim 15, wherein the anti-viral response is
elicited by a synergistic effect between an RNAi effect and an
immune response mediated by said interferon induction.
17. The reagent of claim 15, wherein said RNAi molecule is produced
in vitro by a phage polymerase.
18. The reagent of claim 17, wherein said polymerase is T7 RNA
polymerase.
19. The reagent of claim 17, wherein said RNAi molecule is an siRNA
or an shRNA molecule.
20. The reagent of claim 16, wherein said RNAi molecule is produced
in vitro by a phage polymerase.
21. The reagent of claim 20, wherein said polymerase is T7 RNA
polymerase.
22. The reagent of claim 20, wherein said RNAi molecule is an siRNA
or an shRNA molecule.
23. A method for inducing an anti-viral response in a cell,
comprising introducing into a cell an effective amount of an RNAi
molecule having a 5'-triphosphate, wherein said RNAi molecule
induces interferon and elicits an anti-viral response mediated by
said interferon induction.
24. The method of claim 23, wherein the anti-viral response is
elicited by a synergistic effect between an RNAi effect and an
immune response mediated by said interferon induction.
25. The method of claim 23, wherein said RNAi molecule is produced
in vitro by a phage polymerase.
26. The method of claim 25, wherein said polymerase is T7 RNA
polymerase.
27. The method of claim 25, wherein said RNAi molecule is an siRNA
or an shRNA molecule.
28. The method of claim 24, wherein said RNAi molecule is produced
in vitro by a phage polymerase.
29. The method of claim 28, wherein said polymerase is T7 RNA
polymerase.
30. The method of claim 28, wherein said RNAi molecule is an siRNA
or an shRNA molecule.
31. A method for inducing interferon in a cell, comprising:
introducing into said cell an effective amount of a short
single-stranded RNA (ssRNA) having a 5'-triphosphate, wherein said
ssRNA molecule induces said interferon.
31. The method of claim 31, wherein said ssRNA molecule induces one
or both of interferon .alpha. and .beta..
33. The method of claim 31, wherein said ssRNA molecule is produced
in vitro by a phage polymerase.
34. The method of claim 33, wherein said polymerase is T7 RNA
polymerase.
35. The method of claim 33, wherein said polymerase is T3 RNA
polymerase.
36. The method of claim 33, wherein said polymerase is Sp6 RNA
polymerase.
37. An in vitro method for producing an RNAi molecule which reduces
interferon induction while maintaining the efficacy of said RNAi
molecule, comprising: removing one or more 5'-triphosphates from an
RNAi molecule produced in vitro, wherein said removal reduces
interferon induction while maintaining the efficacy of said RNAi
molecule.
38. The method of claim 37, wherein said removal occurs by cleaving
said one or more 5'-triphosphates from said RNAi molecule with one
or both of a ribonuclease and a phosphatase.
39. The method of claim 38, wherein said ribonuclease is a T1
ribonuclease.
40. The method of claim 38, wherein said phosphatase is a calf
intestine phosphatase (CIP).
41. The method of claim 37, wherein said RNAi molecule contains at
least two bases at the 3' terminus which prevent base pairing with
a 5' guanine of said RNAi molecule prior to said removal of one or
more 5'-triphosphates.
42. The method of claim 41, wherein the two bases are adenosines.
Description
CROSS-REFERNCE TO RELATED APPLICATION
[0001] The present application is related to and claims priority
under 35 U.S.C. .sctn. 119(e) to U.S. provisional patent
application Ser. No. 60/649,537 filed on 4 Feb. 2005, incorporated
herein by reference.
FIELD OF THE INVENTION
[0003] The publications and other materials used herein to
illuminate the background of the invention, and in particular,
cases to provide additional details respecting the practice, are
incorporated by reference, and for convenience are referenced in
the following text by author and date and are listed alphabetically
by author in the appended bibliography.
[0004] The present invention relates to RNA molecules, including
double-stranded and single-stranded RNA molecules, and their use
for inducing interferon. The present invention also relates to
methods for controlling interferon induction by such molecules.
BACKGROUND OF THE INVENTION
[0005] Small interfering RNAs (siRNA) are potent reagents for
directed post-transcriptional gene silencing (Hannon, G. J., 2002).
siRNAs are double-stranded molecules typically 21 to 25 nucleotides
(nt) in length, which trigger RNA interference (RNAi), resulting in
post-transcriptional message degradation (Elbashir, S. M., et al.,
2001) and inhibition of viral propagation (Andino, R., 2003). RNAi
has emerged as an immensely important and popular method to elicit
post-transcriptional, sequence-specific silencing of gene
expression and is a major new genetic tool for investigating
mammalian cells. RNAi is initiated by exposing cells to dsRNA
either via transfection or endogenous expression. Long
double-stranded (ds) RNAs are processed into siRNAs by dicer, a
ribonuclease of the Rnase III family. These siRNAs form a complex
known as the RNA Induced Silencing Complex or RISC, which functions
in homologous target RNA destruction (Montgomery, M. K., 2004).
[0006] The use of exogenously supplied siRNAs for targeted RNA
knockdowns has become widespread (Elbashir, S. M., et al., 2001).
The exogenous RNAs can be manufactured synthetically. However, when
synthetic siRNAs are used for gene silencing, the costs can be
substantial because of variations in siRNA efficacies. An
alternative to chemically synthesized siRNAs are siRNAs produced by
bacteriophage T7 RNA polymerase. These siRNAs are made by in vitro
transcription mediated by bacteriophage promoters from linearized
DNA templates. In vitro transcription using bacteriophage T7 RNA
polymerase has been shown to produce highly active siRNAs (Sohail,
M., et al., 2003; Donze, O. and Picard, D., 2002).
[0007] The interferon (IFN) system is one of the body's first lines
of defense against viruses (Samuel, C. E., 2004). IFN was
discovered as an antiviral agent by Isaacs and Lindenmann during
studies on virus interference, where they observed that cells
infected with influenza virus secrete a factor that mediates the
transfer of a virus-resistant state active against both the
inducing virus and other viruses as well (Samuel, C. E., 2004).
Double-stranded RNA (dsRNA) is known to play an important role in
the IFN system (Samuel, C. E., 2001). It is known that synthetic
dsRNAs and RNAs with double-stranded character produced during
viral infections have the capacity to be potent inducers of IFN
(Stewart, W. E., 1979; Marcus, P. I., 1983).
[0008] The early recognition of invasive pathogens by innate
sensing is the most important defense mechanism of the immune
system (Beutler, B., 2004a; Boehme, K. W. and Compton, T., 2004).
Viral infection of mammalian cells results in activation of an
innate immune response which is mediated by interferons and
cytokines that concomitantly inhibit viral replication (Malmgaard,
L., 2004). Several Toll-Like Receptors (TLRs) have been identified
in humans and mice and are known to be expressed predominantly on
cell types which are first to encounter intracellular pathogens
(Boehme, K. W. and Compton, T., 2004). Double stranded RNA (dsRNA),
including the synthetic analog poly inosine-poly cytosine (Poly
IC), is known to activate TLR3, a cellular receptor that recognizes
and initiates a potent anti-viral response by producing interferons
(Alexopoulou, L., et al., 2001). Similarly, single stranded RNA
(ssRNA), which includes the genomes of several viral RNA species,
has been shown to interact with and activate TLR7 and TLR8 (Lund,
J. M., et al., 2004; Diebold, S. S., et al., 2004; Heil, F., et
al., 2004; Hornung, V., et al., 2005). dsRNAs can be easily
distinguished intracellularly as viral replication intermediates,
however, it remains elusive how a simple ssRNA motif recognized by
TLR7 and 8 is discerned by the cell to be either viral (exogenous)
or endogenous in origin (Boehme, K. W. and Compton, T., 2004).
Considering that TLRs are cell type specific and are present within
unique localized intracellular compartments, recognition of dsRNA
and/or ssRNA offers an important innate defense mechanism against
viral infection along with the recognition of CpG DNA motifs and/or
envelope glycoproteins (Boehme, K. W. and Compton, T., 2004;
Beutler, B., 2004b)
[0009] RNAi-mediated gene silencing in mammalian cells requires
siRNAs of sufficiently small size to circumvent potential
sequence-independent, nonspecific changes in gene expression
attributable to the induction or action of interferons. Sledz, C.
A., et al. (2003) found that transfection of siRNAs results in
interferon (IFN)-mediated activation of the Jak-Stat pathway and
global upregulation of IFN-stimulated genes. The authors showed
that by using cell lines deficient in specific components mediating
IFN action that the RNAi mechanism itself is independent of the
interferon system. The authors characterized their finding as
showing the "broad and complicating effects" of siRNAs beyond the
selective silencing of target genes when introduced into cells.
Similarly, Bridge, A. J., et al. (2003) reported that although
siRNAs were thought to be too short to induce interferon
expression, a commonly used shRNA construct was found to induce an
interferon response. The authors advise as a "simple precaution to
limit the risk of inducing an interferon response" to use the
lowest effective dose of shRNA vector.
[0010] Although the anti-viral activities of interferons are well
studied (Samuel, C. E., 2001), nobody has recognized in connection
with RNAi the uses and advantages, as opposed to the risks, of
interferon induction by RNAi molecules, independent of the RNAi
effect, to provide anti-viral and other effects, such as
anti-cancer effects. Moreover, until now, nobody is believed to
have discovered the role of the triphosphate, in particular the
5-triphosphate produced on RNAi molecules in vitro, for inducing
interferon and eliciting anti-viral and other medically useful
responses.
SUMMARY OF THE INVENTION
[0011] The present invention is believed to be first to show that
the presence of an initiating triphosphate on in vitro
transcribed-RNAs can potently induce interferon .alpha. and .beta.,
as well as elicit a strong, non-sequence-specific antiviral
response to viral challenge.
[0012] The present invention relates in one aspect to
double-stranded RNA molecules, including RNAi molecules, and in
another aspect to single-stranded RNA molecules, on which one or
more triphosphates, preferably one or more 5'-triphosphates, are
maintained in order to exploit the interferon induction properties
of such molecules, in order to provide anti-viral and other
medically useful (e.g., anti-cancer) effects.
[0013] The present invention relates in one embodiment to a method
for inducing interferon in a cell, comprising exposing or
introducing into the cell an effective amount of an RNAi molecule
having one or more triphosphates, preferably a 5'-triphosphate,
wherein said RNAi molecule induces said interferon. The RNAi
molecule also can have an anti-viral effect, and preferably, is
introduced into the cell prior to viral infection, wherein the RNAi
molecule inhibits or prevents viral infection. The RNAi molecule
also can have other medically useful effects, such as an
anti-cancer effect.
[0014] In another embodiment, the invention provides a composition
for inducing interferon in a cell comprising an effective amount of
an RNAi molecule having one or more triphosphates, preferably a
5'-triphosphate, wherein the RNAi molecule can induce interferon in
the cell. In a preferred embodiment, the RNAi molecule can also
have an anti-viral or anti-cancer effect.
[0015] In another embodiment, the invention provides an anti-viral
reagent comprising an effective amount of an RNAi molecule having
one or more triphosphates, preferably a 5'-triphosphate, wherein
the RNAi molecule in addition to inducing interferon also has an
anti-viral effect. In one embodiment, the anti-viral effect is the
result of interferon induced by the RNAi molecule in a non-sequence
dependent manner. In another embodiment, the anti-viral effect is
the result of a synergy between an RNAi effect mediated by the RNAi
molecule (i.e., as a result of homology between the RNAi molecule
and its target molecule) and an immune response mediated by
interferon induction.
[0016] In another embodiment, the invention provides a method for
inducing an anti-viral response in a cell, comprising introducing
into a cell an effective amount of an RNAi molecule having one or
more triphosphates, preferably a 5'-triphosphate, and which
exhibits one of the above anti-viral effects.
[0017] The cell can be any cell and is preferably a eukaryotic or
vertebrate cell, more preferably a mammalian cell, and most
preferably a human cell.
[0018] In a preferred embodiment, the RNAi molecule is an siRNA or
an shRNA.
[0019] In another aspect, the present invention provides a method
for inducing interferon in a cell, comprising introducing into the
cell an effective amount of a short single-stranded RNA (ssRNA)
having one or more triphosphates, preferably a 5'-triphosphate,
wherein the ssRNA molecule induces interferon, and preferably also
has an anti-viral or other medically useful (e.g., anti-cancer)
effect, as described above.
[0020] In a more preferred embodiment of each of the above
embodiments, the RNAi molecule and ssRNA molecule are produced in
vitro by a phage polymerase. In a preferred embodiment, the phage
polymerase is T7 RNA polymerase, T3 RNA polymerase or Sp6 RNA
polymerase. In an even more preferred embodiment, the polymerase is
T7 RNA polymerase.
[0021] In the present invention, the 5'-triphosphate of an RNAi or
ssRNA molecule produced in vitro has been discovered to be an
active inducer of interferon, as well as a potent anti-viral agent.
On the other hand, the present invention also recognizes advantages
of removing the 5'-triphosphate from in vitro transcribed RNAi
molecules, and thus reducing or inhibiting interferon induction.
This additional aspect of the invention should be useful for
controlling, reducing or inhibiting interferon induced during gene
silencing using such RNAi molecules.
[0022] In yet another aspect, the present invention thus provides
an in vitro method for producing or synthesizing an RNAi molecule
which reduces or alleviates the interferon response exhibited by a
double-stranded, preferably an RNAi, molecule or ssRNA molecule
produced in vitro, while maintaining the efficacy of the molecule.
In one embodiment, the method comprises removing one or more
5'-triphosphates from the molecule, wherein the removal reduces or
alleviates the interferon response while maintaining the efficacy
of the molecule.
BRIEF DESCRIPTION OF THE FIGURES
[0023] FIG. 1A are photographs showing anti-HSV-1 activities of T7
transcribed siRNAs. The siRNA transfected HEK-293 cells were
infected with HSV-1-EGFP. Top panel, mock or chemically synthesized
siRNA transfected samples (anti-La#2 and anti-Ro #1); middle panel,
T7 siRNA transfected samples; lower panel, the anti-La #2 siRNAs
were prepared by T7 RNA polymerase using the Silencer siRNA
Construction Kit (Ambion).
[0024] FIG. 1B are photographs showing the cytotoxic effect of T7
transcribed siRNAs. HEK-293 cells were transfected with 20 nM of
synthetic or T7 transcribed siRNA and monitored microscopically on
day 5 post transfection.
[0025] FIGS. 2A-2D show interferon induction by transcribed
siRNAs.
[0026] FIG. 2A is a graph showing that the anti-HSV-1 activity is
mediated by induction of interferon .alpha. and .beta.. The
anti-HSV-1 activity was assayed using the medium from
siRNA-transfected cells. Either a single (col. 3 or 4) or both
neutralizing antibodies (col. 5) were tested.
[0027] FIG. 2B is a graph showing anti-HSV-1 activity of
T7-transcribed siRNAs in HEK-293, HeLa and CV1 cell lines. 20 nM of
T7-transcribed siRNA was transfected into the three different cell
lines and HSV-1 infection was monitored.
[0028] FIG. 2C are graphs showing that RNAi and interferon
induction are independent phenomena. Two different siRNAs, one
targeting a susceptible site and the other a nonsusceptible site in
EGFP, were synthesized chemically or transcribed by T7RNA
polymerase and tested for RNAi efficacy (top) and interferon
induction (bottom). The RNAi assay represents the average of three
independent assays. The interferon results are the average of two
independent experiments.
[0029] FIG. 2D is a graph showing the potency of the RNA-mediated
anti-HSV-1 activity. The inhibition of HSV-1 infection was tested
after transfection using the indicated amounts of synthetic or
T7-transcribed siRNAs. The average of two independent experiments
is presented.
[0030] FIG. 3A are photographs showing the anti-EMCV activities of
T7 transcribed siRNAs, produced in accordance with the present
invention, compared with the anti-EMCV activities of Poly IC. Top
panel, cells; Second panel from top, Cells infected with EMCV;
Third panel from top, T7 siRNA transfected cells infected with EMCV
(triphosphate containing anti-EMCV T7 siRNAs stimulate interferon,
thus, protecting cells from EMCV infection); Bottom panel, Poly IC
transfected cells infected with EMCV (poly IC is toxic and cells
are expressing EGFP, so toxicity results in cell death and loss of
EGFP signal.)
[0031] FIG. 3B are photographs showing anti-EMCV activities of T7
transcribed siRNAs, produced in accordance with the present
invention, compared with the anti-EMCV activities of various
endoribonuclease prepared siRNAs (EsiRNA I, II, and III).
[0032] FIG. 3C are photographs showing anti-EMCV3 activities of T7
transcribed siRNAs, produced in accordance with the present
invention. Top panel, irrelevant T7 siRNA; Middle panel, EMCV3 T7
siRNA; Bottom panel, EMCV3 T7 siRNA in the presence of CIP.
[0033] FIG. 4 is a schematic showing a T7 siRNA having a
5'-triphosphate produced in accordance with the present invention.
The schematic shows the non-base paired nucleotide (G) to which the
5'triphosphate is attached. The schematic also shows the
synergistic effects of the 5'-triphosphate mediated innate immune
response and the siRNA mediated RNAi effect.
[0034] FIG. 5A is a graph showing the synergistic effect of siRNAs
and triphosphates in protecting cells from cytopathic effects of
EMCV infection at a MOI of 3.
[0035] FIG. 5B is a graph showing the synergistic effect of siRNAs
and triphosphates in protecting cells from cytopathic effects of
EMCV infection at a MOI of 10.
[0036] FIG. 6 is a schematic of the 5'UTR of a EMCV viral genome
(SEQ ID NO:1). Also shown are the regions where siRNAs, produced in
accordance with the present invention, bind the EMCV viral
genome.
[0037] FIGS. 7A-7C show the role of the initiating triphosphate in
interferon induction.
[0038] FIG. 7A shows siRNAs synthesized in accordance with the
invention. (i) The EGFP #2 synthetic I (SEQ ID NOs:2 and 3),
chemically synthesized siRNA against the EGFP #2 site, EGFP #2
synthetic II; (ii) the EGFP #2 synthetic II (SEQ ID NOs:4 and 5)
with 5' OH-GGG; (iii) the EGFP #2 T7 (SEQ ID NOs:4 and 5), T7 RNA
polymerase-transcribed siRNA against EGFP #2 containing 5' pppgGG;
(iv) the EGFP #2 T7 (19-AA) (SEQ ID NOs:6 and 7), the same as EGFP
#2 T7 RNA polymerase-transcribed siRNA except for replacing the 3'
UU with 3' AA; (v) the EGFP #2 T7 (21-AA) (SEQ ID NOs:8 and 9), T7
RNA polymerase-transcribed siRNA with 21 nt complementary to the
EGFP #2 site but including the 3' AA. The potential cleavage site
for RNAse T1 is boldface. The 3' AA replacing the 3' UU is in
italics. The AA complementary to UU is underlined.
[0039] FIG. 7B are a graph and gel photograph showing
triphosphate-mediated interferon induction. [.gamma.-.sup.32P]
GTP-labeled siRNAs were treated using each of the conditions
described below and electrophoresed in a native gel (top). RNAs (1
.mu.g) were electrophoresed in a 15% polyacrylamide gel and stained
with ethidium bromide (middle). 20 nM of siRNAs was transfected
into HEK-293 cells and assayed for interferon .beta. (bottom
panel). Column 1, the EGFP #2 T7 siRNA without T1 treatment; column
2, with T1 treatment; column 3, with T1 and CIP treatment. Column
4, EGFP #2 T7 (19-AA) siRNA without T1 treatment; column 5, with T1
digestion; column 6, with T1 and CIP treatment.
[0040] FIG. 7C is a graph showing that T7 siRNAs (21-AA) in
accordance with the invention are effective in RNAi. HEK-293 cells
were cotransfected with the EGFP reporter plasmid and each of the
siRNAs. The percentages of EGFP expression relative to the
non-siRNA-treated controls were used as the assay for RNAi. Each
value is the average of two independent assays.
[0041] FIGS. 8A-8C show induction of interferon by in vitro
transcribed ssRNAs.
[0042] FIG. 8A is a graph showing that ssRNAs transcribed in vitro
elicit the anti-HSV-1 effect. Mock 1: before transfection, the RNA
sample was mixed with 1 .mu.g of RNase A. Mock 2: transfection of
RNA containing triphosphate done in the absence of a transfection
reagent. T7 siRNA1 and 2 are the T7 siRNAs for HSV #1 and
anti-SF3A3 #1, respectively. The T7 ssRNA is the sense RNA strand
of HSV#1. The T7 EGFP was RNA-transcribed from an EGFP-encoding DNA
template. T7 (CUG).sub.130 is a T7-transcribed RNA harboring 130
repeats of CUG. All RNAs were used at a concentration of 20 nM.
[0043] FIG. 8B is a graph showing the anti-HSV-1 activities of
ssRNAs transcribed from T7, T3 and Sp6 polymerases. The templates
of T3 ssRNA 1 and 2 were created from the pBluecript II SK vector
digested with EcoRI and BamHI, respectively. The templates of SP6
ssRNA 1 and 2 were created by the EcoRI and SalI digestion of the
pGEM 9Df(-) vector. The T7 ssRNA is the sense sequence of HSV
#1.
[0044] FIG. 8C is a graph and gel photographs showing that the 540
triphosphate of the transcribed ssRNA is essential for the
induction of interferon. The EGFP RNA was transcribed in the
presence of [.gamma.-.sup.32P]GTP and transfected into cells
without any further modification (col. 2 and 3), after gel
purification (col. 4 and 5), and after gel purification and CIP
treatment (col. 6 and 7). The induced levels of interferon .beta.
were determined by an ELISA (top). Transcribed RNAs used for
transfection reactions were analyzed in a nondenaturing agarose gel
(middle). Removal of the triphosphate by CIP was monitored on the
bottom gel. The ELISA determinations represent the average of two
independent experiments.
[0045] FIG. 9 is a graph showing induction of interferon .alpha. in
4 mice samples which were injected with 70 uM triphosphate T7
siRNAs produced in accordance with the present invention.
Interferon .alpha. induction is shown in mice using mouse ELISA kit
at day 1, day 3 and day 7 following injection of T7 siRNA.
[0046] FIGS. 10A-10D show that the 5' triphosphate label of RNA is
a novel motif for stimulating the innate immune response.
[0047] FIG. 10A shows total RNA that was purified from influenza
viral RNA and treated without (-CIP) or with (+CIP) calf intestinal
phosphatase.
[0048] FIG. 10B shows HEK293 cells that were transfected with no
RNA (mock), influenza viral RNA without CIP treatment (Flu RNA
-CIP), or the RNA with CIP treatment (Flu RNA +CIP) and
sequentially challenged by EGFP-labeled HSV. The infection of virus
was monitored by florescence microscopy.
[0049] FIG. 10C shows HEK293 cells that were transfected with
influenza viral RNAs without CIP pretreatmen (second column) or
with pretreatment at 10 (third) and 60 minutes (fourth column).
[0050] FIG. 10D shows NIH3T3 cells stably expressing EGFP that were
treated with no RNA (mock), 1 nM of T7 RNA (T7 RNA), 0.5 ug of
influenza viral RNA without CIP pre-treatment (Flu RNA -CIP), and
the viral RNA with CIP pre-treatment (Flu RNA +CIP). The next day
(24 hours), cells were challenged with EMCV infection. On day 3,
the viral infection mediated cytotoxic effect was monitored under
light (the first panel) or fluorescence microscopy (the second
panel).
[0051] FIGS. 11A-11C shows that the nuclear derived nascent RNAs
indicate the dependence of the the 5' triphosphate motif for
antiviral activity.
[0052] FIG. 11A shows cytoplasmic and nuclear extracts that were
prepared from HEK293 cells and tested by Western blot for the
cytoplasmic protein enolase or nuclear protein hnRNP H.
[0053] FIG. 11B shows cytoplasmic (the first lane) and nuclear RNAs
(second and third lanes) that were purified from each extract and
analyzed on a 1% agarose gel in the absence (second lane) or
presence of CIP pre-treatment (third lane).
[0054] FIG. 11C shows HEK293 cells that were transfected with each
indicated RNAs and sequentially infected with EGFP-labeled HSV. The
pictures were taken under florescence microscopy on day 3.
[0055] FIGS. 12A-12C show that the T7 RNA and poly IC activate the
TLR3 receptor and share similar expression profiles.
[0056] FIG. 12A shows total cDNA from NIH3T3 cells transfected by
the T7 RNA or poly IC that were detected and quantitated by
microarray analysis. The expression profiles were compared between
mock treated vs. T7 RNA (the first column), mock vs. poly IC (the
second column), and T7 RNA vs. poly IC (the third column). The bar
represents the total number of genes where were up or
down-regulated by more than three-fold using a total of 16,281
elopements and an average of two independent trials.
[0057] FIG. 12B shows that TLR3 is upregulated by poly IC as well
as by T7 RNA. Total RNA of NIH3T3 cells were harvested after
transfection with no RNA, T7 RNA, and poly IC. Based on the
microarray data in FIGS. 14A-14D, the expression level of TLR3 was
compared. TLR7 and beta-actin were used as internal controls.
[0058] FIG. 12C shows that TLR3 is required for the T7 RNA mediated
innate immune response. MRC-5 cells were pre-incubated in the
presence of anti-TLR2 or TLR3 antibodies and incubated in the
presence of the indicated RNAs. The secreted interferon beta in the
media was determined by ELISA in three independent assays.
[0059] FIGS. 13A-13B show that all 86 genes upregulated by the T7
transcribed RNA were also upregulated by poly IC.
[0060] FIGS. 14A-14D show that poly IC activated a large number of
additional genes in comparison to genes activated by T7 transcribed
RNA.
DETAILED DESCRIPTION OF THE INVENTION
[0061] The ability to detect pathogenic invasion is the first line
of defense in a cell and represents the most important task of the
innate immune response. As shown herein, siRNAs transcribed by T7
RNA polymerase display a potent anti-viral effect that is dependent
on the presence of a 5' triphosphate motif. We suggest that the
innate immune response is activated by the recognition of this RNA
motif. It is also shown herein that Influenza A viral RNA induces
5' triphophate dependent anti-viral activity through the activation
of the interferon response pathway when transfected directly into
cells. Nuclear-derived RNAs which include many uncapped small RNAs
and ribosomal RNAs harboring a 5' triphosphate label also activate
a strong interferon induction when transfected into cells. Alkaline
phosphatase treatment of these RNAs eliminates this stimulation and
cytoplasmic-derived RNAs, which are largely devoid of triphosphate,
also fail to induce an interferon response. The 5' triphosphate
containing RNAs appear to be recognized by and activate Toll Like
Receptor 3 (TLR3). Microarray and functional analyses indicate that
5' triphophate containing RNAs constitute a novel immunostimulatory
motif which is highly effective at inducing IFN responses in
leading to potent antiviral activity in a variety of cell
lines.
[0062] An embodiment of the present invention provides a method for
inducing an interferon response in a cell comprising introducing
into the cell an effective amount of a double-stranded RNA
molecule, preferably an interfering RNA (RNAi) molecule, having a
triphosphate, preferably a 5'-triphosphate. The presence of the
5'-triphosphate was found to induce the interferon response. The
invention also encompasses variations of the triphosphate which
enable induction of effective amounts of interferon. In a preferred
embodiment, the RNAi molecule having a triphosphate, and preferably
a 5'-triphosphate, induces one or more of interferon .alpha. and
.beta.. It is understood that the expressions "having a
triphosphate" or "having a 5'-triphosphate" encompass having one or
more triphosphates or 5'-triphosphates.
[0063] In a preferred embodiment, the double-stranded RNA, and
preferably RNAi, molecule having a triphosphate, preferably a
5'-triphosphate, is produced in vitro by a phage polymerase,
preferably a bacteriophage RNA polymerase. Preferably the
nucleotide to which the triphosphate is attached is not base-paired
to the opposite strand of the double-stranded molecule (FIG. 4).
Preferably the RNAi molecule having a 5'-triphosphate is produced
in vitro by a bacteriophage T7 RNA polymerase. In further
embodiments of the invention, the RNAi molecule having a
5'-triphosphate may be produced by other phage polymerases,
including a bacteriophage T3 RNA polymerase or a bacteriophage Sp6
RNA polymerase.
[0064] In another embodiment the double-stranded RNA, preferably
RNAi, molecule having a triphosphate is synthetic or chemically
synthesized.
[0065] The RNA molecules of the invention also can be purified
using acceptable methods known in the art.
[0066] In a preferred embodiment, the RNAi molecule having a
5'-triphosphate is a small interfering RNA (siRNA). In another
preferred embodiment, the RNAi molecule having a 5'-triphosphate is
a short hairpin RNA (shRNA) molecule. The double-stranded RNA
preferably has two triphosphates, and most preferably two
5'-triphosphates. The double-stranded RNA, preferably RNAi, and
more preferably siRNA, molecule also is preferably about 10 to
about 25 nucleotides in length, and more preferably about 20
nucleotides in length, while the shRNA, which can be used to
produce a preferred siRNA, is preferably about 21 to about 29
nucleotides in length. In particular, it was found that
triphosphate-containing double-stranded RNA as short as 10
nucleotides induced an interferon response. Longer RNA molecules
were found to induce interferon as well, but the total
concentration of the 5'-triphosphate is reduced. Therefore, the
longer the RNA molecule, the more of the molecule is preferred,
since the triphosphate is believed to effect interferon
induction.
[0067] In another embodiment, the invention provides a composition
for inducing an interferon response comprising an effective amount
of an RNAi molecule having a triphosphate, preferably a
5'-triphosphate, wherein the presence of the 5'-triphosphate has
been found to induce the interferon response.
[0068] In other embodiments, the invention provides an anti-viral
reagent and a method for inducing an antiviral response, comprising
introducing into a cell an effective amount of an RNAi molecule
having a triphosphate, preferably a 5'-triphosphate, wherein the
presence of the 5'-triphosphate induces an interferon response, and
provides an anti-viral response. The anti-viral response can be
mediated by interferons, or alternatively by both interferons and a
sequence-dependent RNAi effect. The anti-viral response is not
limited to mediation by interferons, but may include other
cytokines or signaling pathways. In a preferred embodiment, the
RNAi molecule having a 5'-triphosphate can be introduced into a
cell prior to viral infection, thereby, inhibiting viral infection.
The present invention is useful against any virus, including but
not limited to, herpes simplex virus 1 (HSV-1),
encephalomyocarditis virus (EMCV) or Influenza A virus.
[0069] The present invention can be practiced in vitro or in vivo.
The invention also can be used as a therapeutic or preventative
agent, preferably for therapy or prevention of a disease or
condition.
[0070] An effective amount refers to that amount of RNA effective
to produce the intended result, including the intended
pharmacological, therapeutic or preventive result. In cell culture,
an effective amount for initiating an antiviral effect can be as
low as 1 nM, and can range up to 20 nM or more. However, it is
understood that higher dosages can be toxic to cells, due to
unregulated induction, resulting in undesired levels of expression
of several cytokines, including interferon. A pharmaceutically
effective amount or dose is that amount or dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective amount or dose depends on the type
of disease, the composition use, the route of administration, the
type of mammal being treated, the physical characteristics of the
specific mammal under consideration, concurrent medication, and
other factors which those skilled in the medical arts will
recognize. Generally, an effective amount or dose of dsRNA or ssRNA
for human use is known in the art and/or can be determined by
standard methods, and can be administered, for example, in the
ranges of about 0.001 mg/kg to 100 mg/kg body weight/day or about
0.01 mg/kg to 10 mg/kg body weight/day.
[0071] Fire, A. et al. (2003), which is incorporated herein by
reference, refers to introducing RNA in an amount which delivers at
least one copy per cell, as well as administering higher dosages
(e.g., 5, 10, 100, 500, 1000, etc., copies per cell) of
double-stranded RNA to yield better results. Ackermann, E. J. et
al. (1999), which is incorporated herein by reference, describes as
follows: "The formulation of therapeutic compositions and their
subsequent administration is believed to be within the skill of
those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50's found to be
effective in in vitro and in vivo animal models. In general, dosage
is from 0.01 .mu.g to 100 g per kg of body weight, and may be given
once or more daily, weekly, monthly or yearly, or even once every 2
to 20 years. Persons of ordinary skill in the art can easily
estimate repetition rates for dosing based on measured residence
times and concentrations of the drug in bodily fluids or tissues.
Following successful treatment, it may be desirable to have the
patient undergo maintenance therapy to prevent the recurrence of
the disease state, wherein the oligonucleotide is administered in
maintenance doses, ranging from 0.01 .mu.g to 100 g per kg of body
weight, once or more daily, to once every 20 years."
[0072] Methods for formulating compositions and reagents in
accordance with the invention, as well as modes of administration,
are known in the art and are described, for example, in Agrawal, S.
et al. (2003) and Ackermann, E. J. et al. (1999), which are fully
incorporated herein by reference. Formulations can include a
pharmaceutically or physiologically acceptable carrier, such as an
inert diluent or an assimilable edible carrier. The pharmaceutical
compositions of the present invention may be administered in a
number of ways depending upon whether local or systemic treatment
is desired and upon the area to be treated. Administration may be
topical (including ophthalmic and to mucous membranes including
vaginal and rectal delivery), pulmonary, e.g., by inhalation or
insufflation of powders or aerosols, including by nebulizer;
intratracheal, intranasal, epidermal and transdermal), oral or
parenteral. Parenteral administration includes intravenous,
intraarterial, subcutaneous, intraperitoneal or intramuscular
injection or infusion; or intracranial, e.g., intrathecal or
intraventricular, administration. Pharmaceutical compositions and
formulations for topical administration may include transdermal
patches, ointments, lotions, creams, gels, drops, suppositories,
sprays, liquids and powders. Conventional pharmaceutical carriers,
aqueous, powder or oily bases, thickeners and the like may be
necessary or desirable. Coated condoms, gloves and the like may
also be useful. Compositions and formulations for oral
administration include powders or granules, suspensions or
solutions in water or non-aqueous media, capsules, sachets or
tablets. Thickeners, flavoring agents, diluents, emulsifiers,
dispersing aids or binders may be desirable.
[0073] Methods for delivering the RNA molecules of the invention
into cells also are well known in the art. See Thompson, J. et al.
(2004) and Fire, A. et al. (2003), which are fully incorporated
herein by reference. RNA may be directly introduced into the cell
(i.e., intracellularly); or introduced extracellularly into a
cavity, interstitial space, into the circulation of an organism,
introduced orally, or may be introduced by bathing an organism in a
solution containing the RNA. Methods for oral introduction include
direct mixing of the RNA with food of the organism, as well as
engineered approaches in which a species that is used as food is
engineered to express the RNA, then fed to the organism to be
affected. Physical methods of introducing nucleic acids, for
example, injection directly into the cell or extracellular
injection into the organism, may also be used. Vascular or
extravascular circulation, the blood or lymph system, the phloem,
the roots, and the cerebrospinal fluid are sites where the RNA may
be introduced.
[0074] Physical methods of introducing nucleic acids include
injection of a solution containing the RNA, bombardment by
particles covered by the RNA, soaking the cell or organism in a
solution of the RNA, or electroporation of cell membranes in the
presence of the RNA. A viral construct packaged into a viral
particle would accomplish both efficient introduction of an
expression construct into the cell and transcription of RNA encoded
by the expression construct. Other methods known in the art for
introducing nucleic acids to cells may be used, such as
lipid-mediated carrier transport, chemical-mediated transport, such
as calcium phosphate, and the like. Thus the RNA may be introduced
along with components that perform one or more of the following
activities: enhance RNA uptake by the cell, promote annealing of
the duplex strands, stabilize the annealed strands, or other-wise
increase inhibition of the target gene.
[0075] Methods for the delivery of nucleic acid molecules also are
described in Akhtar and Juliano (1992) and Akhtar (1995), each of
which is incorporated herein by reference. Sullivan et al. (1994)
further describes the general methods for delivery of enzymatic RNA
molecules. These protocols can be utilized for the delivery of
virtually any nucleic acid molecule. Nucleic acid molecules can be
administered to cells by a variety of methods known to those
familiar to the art, including, but not restricted to,
encapsulation in liposomes, by iontophoresis, or by incorporation
into other vehicles, such as hydrogels, cyclodextrins,
biodegradable nanocapsules, and bioadhesive microspheres.
Alternatively, the nucleic acid/vehicle combination is locally
delivered by direct injection or by use of an infusion pump. Other
routes of delivery include, but are not limited to oral (tablet or
pill form), intrathecal, mucosal, or transdermal delivery. Other
approaches include the use of various transport and carrier
systems, for example, through the use of conjugates and
biodegradable polymers. More detailed descriptions of nucleic acid
delivery and administration are provided in Sullivan et al. (1994),
Draper et al. (1993), Beigelman et al. (1999) and Klimuk et al.
(1999), all of which are incorporated by reference herein.
[0076] In accordance with the present invention, interferon
induction and anti-viral activity can be induced in response to a
variety of RNAI molecules. To test for interferon induction and
antiviral activity of an RNAi molecule, first, RNA interference was
tested in one embodiment as a method to block herpes simplex virus
1 (HSV-1) infection. To perform this test, two siRNAs targeting the
early ICP4 gene transcript were created using T7 RNA polymerase.
The sequences of these are provided in Table 1. To monitor viral
infection, an HSV-1 recombinant that contains the gene encoding
VP20 fused to the gene encoding the enhanced green fluorescent
protein (EGFP) was used (Elliott, G. and O'Hare, P., 1999). When
cells are infected with the virus, they express EGFP, allowing
simple microscopic assays for viral infectivity. First, human
embryonic kidney (HEK) 293 cells were transfected with the siRNAs
(10 nM each) before viral infection. Twenty hours later the
recombinant HSV-EGFP virus was added to the cultured cells at a
multiplicity of infection (MOI) of 1. Twenty-four hours after viral
challenge, infectivity was monitored by microscopic analysis of
EGFP expression. The two siRNAs targeting HSV-1 as well as one of
the irrelevant siRNA controls inhibited viral infectivity
dramatically (FIG. 1A). When analyzing the results of these
experiments a correlation was found between the anti-HSV-1 activity
and the source of the siRNAs. Whereas the two chemically
synthesized siRNAs showed no anti-HSV-1 activity, all three of the
siRNAs prepared by in vitro transcription using T7 RNA polymerase
showed potent HSV-1 inhibition. Next, an siRNA with a sequence
identical to the chemically synthesized control siRNA, the RNA
binding protein La (Table 1), which did not have antiviral
activity, was transcribed using a T7 RNA polymerase. The T7 RNA
polymerase-transcribed version of this siRNA elicited a potent
anti-HSV-1 response, supporting the hypothesis that some component
of the T7 siRNA was eliciting an anti-HSV-1 response in a
non-sequence-dependent manner (FIG. 1A). TABLE-US-00001 TABLE 1
Sequence of siRNAs 5' sequence 3' Id of siRNAs (SEQ ID NO:) Source
Anti-La #2 AACTGGATGAAGGCTGGGTAC Dharmacon (10) Anti-Ro #1
AATCTGTAAACCAAATGCAGC Dharmacon (11) Anti-HSV #1
AACAAGCAGCGCCCCGGCTCC T7 (12) transcription Anti-HSV #2
AACAGCAGCTCCTTCATCACC T7 (13) transcription Anti-SF3A3 #1
AAGGAACGGCTCATGGACGTC T7 (14) transcription
[0077] To further investigate the nature of the T7 siRNA-mediated
inhibition of HSV-1 infection, HEK-293 cells were transfected with
the chemically synthesized or T7-transcribed siRNAs and monitored
for cell growth. The T7 siRNA-transfected cells underwent cell
death after 5 days, indicative of possible activation of the
interferon response pathway in response to the T7 transcripts (FIG.
1B). It was also found that the anti-HSV-1 effect was transferable
with the medium of T7 siRNA-transfected cells, evidence of secreted
protein(s), which further supports the likelihood of an
interferon-mediated response. To verify the presence of an
interferon-mediated response, the medium of T7 siRNA-transfected
cells was assayed for interferon .alpha. and .beta. using an
enzyme-linked immunosorbent assay (ELISA). Substantial amounts of
both interferons were induced by transfection of 10 nM of the T7
siRNAs (Table 2). TABLE-US-00002 TABLE 2 Induction of interferon by
the T7 siRNAs Amount of Amount of Interferon .alpha. Interferon
.beta. SiRNA (10 nM) (pg/ml) (pg/ml) Mock 0.2 .+-. 0.3 3 .+-. 2
Synthetic siRNA 2 .+-. 0.5 5 .+-. 5 T7 siRNA 1 (anti-La #2) 300
.+-. 85 4,000 .+-. 300 T7 siRNA 2 (anti-Ro #1) 250 .+-. 35 3,500
.+-. 300
[0078] To confirm that the anti-HSV-1 effect was mediated by the
interferons, HSV-1 infection was tested using medium from T7
siRNA-transfected cells previously treated with neutralizing
antibodies (FIG. 2a). A combination of antibodies to interferon
.alpha. and .beta. was required to neutralize the inhibition,
suggesting that both interferons are mediating the antiviral
response. In this embodiment, inhibition of HSV-1 infection took
place preferably when cells were pretreated with the T7 siRNAs, or
in another preferred embodiment when medium from the T7
siRNA-treated cells was added to a fresh cell culture before HSV-1
challenge. These results are consistent with the known mechanisms
of interferon inhibition of HSV-1 and the anti-interferon mechanism
of this virus, which shuts down the host response during infection
(Samuel, C. E., 2001). In this embodiment, the interferons were
induced before infection, presumably triggering the expression of
antiviral genes (Samuel, C. E., 2001).
[0079] Because the initial experiments in the above embodiment were
done with HEK-293 cells, and at least one report shows that HEK-293
cells lack an antiviral interferon response (Stojdl, D. F., et al.,
2000), other cell lines were tested for their T7 siRNA-mediated
interferon response. For example, both HeLa cells and African Green
Monkey kidney fibroblasts (CV1) were transfected with either
chemically synthesized or T7 transcribed-siRNAs (FIG. 2b). In each
case the T7 transcripts elicited a non-sequence-dependent
inhibition of HSV-1, whereas the chemically synthesized siRNAs did
not. Next, a different batch of HeLa cells obtained from the ATCC
were tested and a similar level of interferon induction was found.
In other embodiments, T7 siRNA-mediated interferon levels were
measured in media from K562, CEM and Jurkat cells transfected with
T7 siRNAs, and again interferon induction was observed in each of
these media.
[0080] Further, siRNAs targeting EGFP itself were chemically
synthesized or transcribed in vitro by T7 RNA polymerase (FIG. 2C).
Two different sites in EGFP were chosen, one that is highly
susceptible to siRNA knockdown, and one that is not (Kim, D. H. and
Rossi, J. J., 2003). When EGFP expression was monitored, the T7
siRNAs showed more potent RNAi than the synthetic siRNAs (FIG. 2C,
top, col. 2 versus 4, 3 versus 5). Each of the T7 siRNAs also
showed potent interferon induction, indicating that the potency of
the knockdown and the interferon induction are two independent
phenomena. Unlike the T7 siRNAs, chemically synthesized siRNAs did
not induce interferon (FIG. 2C, bottom, col. 2, 3). In addition to
the EGFP analyses, the anti-HSV-1 activities of the chemically
synthesized versus the T7-transcribed siRNAs were assayed. Up to
200 nM synthetic siRNAs did not inhibit HSV-1, whereas
T7-transcribed RNAs completely inhibited HSV-1 at approximately 5
nM (FIG. 2D).
[0081] To test for interferon induction and antiviral activity of
an RNAi molecule, additional tests were preformed in connection
with other embodiments using RNAi molecules and other viruses, for
example, encephalomyocarditis virus (EMCV). An anti-EMCV siRNA
having a 5'-triphosphate, which was produced by a bacteriophage T7
RNA polymerase, was created and introduced into cells.
Polyinosinic-polycylidylic acid (Poly IC) was also introduced into
cells. EMCV was added to the cultured cells at a multiplicity of
infection (MOI) of 10 and the results are shown in FIG. 3A.
Triphosphate containing anti-EMCV T7 siRNAs stimulate interferon,
thus protecting cells from EMCV infection (FIG. 3A, third panel
from top). In contrast, poly IC is toxic, as seen in FIG. 3A,
bottom panel. Cells are expressing EGFP, so toxicity results in
cell death and loss of EGFP signal. Additional experimental results
obtained under various conditions also are shown in FIGS. 3B and
3C.
[0082] In other embodiments, (HEK) 293, HeLa and 3T3 cells were
exposed to T7 siRNAs, made in accordance with the present
invention. (HEK) 293, HeLa and 3T3 cells were also exposed to Poly
IC. Cell type specific Poly IC and T7 triphosphate siRNA interferon
responses in the different cells under various conditions are shown
in Table 3 below. TABLE-US-00003 TABLE 3 Cell type specific Poly IC
and T7 triphosphate siRNA responses Toxicity on Interferon beta
Transfected RNA Amount day 2 (pg/ml) 293 Mock - 0 T7 siRNA 10 nM -
300 .+-. 50 Poly IC 50 ng - 10 .+-. 10 Poly IC 100 ng + 10 .+-. 5
T7 siRNA + Poly IC 10 nM + 50 ng - 20 .+-. 5 HeLa Mock - 0 T7 siRNA
10 nM - 250 .+-. 100 Poly IC 50 ng - 0 Poly IC 100 ng + 20 .+-. 10
T7 siRNA + Poly IC 10 nM + 50 ng - 0 3T3 Mock - 0 T7 siRNA 10 nM -
300 .+-. 75 Poly IC 250 ng - 250 .+-. 50 Poly IC 500 ng + 200 .+-.
50 T7 siRNA + Poly IC 10 nM + 250 ng - 350 .+-. 75
[0083] Table 3 shows the advantages of T7 triphosphate siRNAs over
Poly IC in the three different cell types. For example, T7
triphosphate siRNAs are less toxic than Poly IC. They also exhibit
a more potent induction of interferon .beta. and a strong antiviral
effect.
[0084] In another embodiment, the invention provides a method for
inducing an anti-viral response in a cell comprising introducing
into a cell, preferably a mammalian cell, an RNAi molecule having a
triphosphate, preferably a 5'-triphosphate, wherein the RNAi
molecule induces a synergistic effect resulting from an RNAi
molecule-mediated RNAi effect together with a
5'-triphosphate-mediated interferon response.
[0085] In another embodiment, the invention provides an anti-viral
reagent comprising an RNAi molecule having a triphosphate,
preferably a 5'-triphosphate, wherein the RNAi molecule induces
both an RNAi effect and an interferon response.
[0086] In a preferred embodiment, the RNAi molecule having a
5'-triphosphate, can be produced in vitro by a bacteriophage T7 RNA
polymerase. In other embodiments of the invention, the RNAi
molecule having a 5'-triphosphate can be produced by other phage
polymerases, including but not limited to, a bacteriophage T3 RNA
polymerase and a bacteriophage Sp6 RNA polymerase. In another
embodiment, the RNAi molecule having a 5'-triphosphate is
chemically synthesized.
[0087] In preferred embodiments, the RNAi molecule having a
5'-triphosphate is a siRNA or a shRNA molecule. The RNAi molecule,
or other double-stranded RNA molecule, can be those otherwise known
in the art.
[0088] In the above embodiment, when an RNAI molecule having a
5'-triphosphate, preferably a short dsRNA and more preferably an
siRNA, is designed in a sequence specific manner, potent anti-viral
effects can be detected as the result of synergistic effects of the
5'-triphosphate mediated innate immune response, i.e., interferon
mediated response, of cells and the siRNA mediated RNAi effect
(FIG. 4). Since this anti-viral effect is much more than a simple
additive effect of an interferon response and siRNA mediated RNAi,
the RNAi molecule can be a powerful anti-viral reagent.
[0089] In a preferred embodiment, FIG. 5A shows the synergistic
effect of siRNAs and triphosphates in protecting cells from the
cytopathic effects of EMCV infection at a MOI of 3. In another
embodiment, FIG. 5B shows the synergistic effect of siRNAs and
triphosphates in protecting cells from the cytopathic effects of
EMCV infection at a MOI of 10.
[0090] Another embodiment of the present invention provides a
method for inducing an interferon response in a cell, comprising
introducing into the cell, preferably a mammalian cell, a single
stranded RNA (ssRNA) having a triphosphate, preferably a
5'-triphosphate, wherein the presence of the 5'-triphosphate
induces the interferon response. In a preferred embodiment, the
ssRNA having a 5'-triphosphate induces one or more of interferon
.alpha. and .beta..
[0091] In a preferred embodiment, the ssRNA having a
5'-triphosphate is produced in vitro by a bacteriophage RNA
polymerase. More preferably the ssRNA having a 5'-triphosphate is
produced in vitro by a bacteriophage T7 RNA polymerase. In other
embodiments, the ssRNA having a 5'-triphosphate may be produced by
other phage polymerases, including but not limited to, a
bacteriophage T3 RNA polymerase and a bacteriophage Sp6 RNA
polymerase.
[0092] In another embodiment, the ssRNA having a triphosphate can
be chemically synthesized.
[0093] The preferred lengths of short ssRNAs having a triphosphate,
preferably a 5'-triphosphate, are expected to be roughly the same
as for double-stranded RNA molecules. At least one difference is
that the effect of length of a ssRNA molecule may vary depending on
the cell type. For example, while some cells show an effect similar
for dsRNAs, others may not as a result of being mediated by
different nuclease activity. In particular, similar effects can
occur in both ssRNA and dsRNA in certain cell lines, such as HEK
293 cells, while in other cell lines lesser of an effect may be
observed with ssRNA on account of ssRNA being less stable than
dsRNA.
[0094] In another embodiment, an antiviral response can be induced
by introducing into a cell an ssRNA having a triphosphate,
preferably a 5'-triphosphate, wherein the presence of the
5'-triphosphate induces an interferon response as well as an
anti-viral response. In another embodiment, the ssRNA is introduced
into a cell prior to viral infection, and thereby inhibiting viral
infection. Viruses include, for example, herpes simplex virus 1
(HSV-1), EMCV or Influenza virus A, as well as other viruses.
[0095] To confirm the role of the triphosphate, T7 RNA
polymerase-transcribed ssRNAs were tested as well (FIG. 8A). No
HSV-1 inhibition was observed when cells were transfected with the
RNase A-treated ssRNAs (FIG. 8A, mock 1) or T7 ssRNA in the absence
of a transfection reagent (FIG. 8A, mock 2), but anti-HSV-1
activity was observed when cells were transfected with a
non-RNAse-treated-ssRNA in the presence of cationic lipid.
Additional experiments were carried out in other embodiments using
ssRNAs transcribed by the bacteriophage T3 and Sp6 RNA polymerases
(FIG. 8B). Each of these transcripts also elicited anti-HSV-1
activity.
[0096] Interferon assays from these experiments indicate that the
ssRNAs are also potent inducers of interferons (Table 4).
TABLE-US-00004 TABLE 4 Induction of interferon mediated by various
in vitro transcribed RNAs. Amount of Amount of Interferon-.alpha.
of Interferon-.beta. RNAs (pg/ml) (pg/ml) T7 siRNA.sup.1 10 nM 300
.+-. 85 4,000 .+-. 300 40 nM 650 .+-. 100 9,500 .+-. 500 T7 single
stranded RNA.sup.2 10 nM 580 .+-. 120 8,000 .+-. 250 40 nM 1050
.+-. 280 10,000 .+-. 500 T3 single stranded RNA.sup.3 10 nM 620
.+-. 180 7,000 .+-. 500 40 nM 1000 .+-. 240 10,000 .+-. 1000 Sp6
single stranded RNA.sup.4 10 nM 600 .+-. 50 7,000 .+-. 500 40 nM
800 .+-. 80 8,000 .+-. 300 .sup.1Anti-La #2 siRNA. .sup.2The sense
RNA of HSV #1. .sup.3The T3 transcript from the BamHI digested
pBluescript DNA template. .sup.4The Sp6 transcript from the SalI
digested pGEM9Df(-) DNA template.
[0097] The ssRNAs were transcribed in the presence of
[.gamma.-.sup.32P]GTP and analyzed by gel electrophoresis
confirming their single stranded nature (FIG. 8C, middle and
bottom). These ssRNAs all induce interferon, but this capacity is
lost when these RNAs are treated with calf intestine phosphatase
(CIP) (FIG. 8C).
[0098] In another embodiment, the present invention provides a
method for inhibiting the interferon inducing activity of a RNAi
molecule having a 5'-triphosphate comprising removing, preferably
by cleaving, the 5'-triphosphate and/or the initiating 5'
nucleotides, from the RNAi molecule, wherein removal of the
5'-triphosphate and/or nucleotides reduces the interferon inducing
activity of the RNAi molecule while still maintaining partial or
full efficacy.
[0099] In a preferred embodiment, means are incorporated at the 3'
terminus of the RNAi molecule to prevent base pairing with the
initiating 5' nucleotides, preferably 5' guanines, of the molecule.
In one embodiment, at least two bases, preferably one or more
adenosines, are incorporated at the 3' terminus of the RNAi
molecule to prevent base pairing with one or more initiating 5'
guanines of the RNAi molecule prior to cleaving the 5'-triphosphate
and/or nucleotides from the RNAi molecule. Incorporation of the
bases thereby allows the cleavage means, preferably a ribonuclease
and/or phosphatase, to remove the initiating 5'-triphosphates
and/or nucleotides of the transcripts.
[0100] In another preferred embodiment, the invention provides a
method for inhibiting interferon inducing activity of a ssRNA
having a 5'-triphosphate comprising removing, preferably by
cleaving, the 5'-triphosphate and/or initiating 5' nucleotides from
the ssRNA, wherein removal of the 5'-triphosphate and/or
nucleotides reduces the interferon inducing activity of the
ssRNA.
[0101] The cleavage step is performed preferably by a nuclease,
more preferably a ribonuclease, preferably T1 ribonuclease, or by a
phosphatase, preferably calf intestine phosphatase (CIP). However,
it is understood that other means and enzymes can be used to effect
the cleavage.
[0102] In a preferred embodiment, the cleavage step is performed by
both a ribonuclease and a phosphatase, preferably T1 ribonuclease
and calf intestine phosphatase (CIP).
[0103] To determine the active interferon-inducing agent in the
RNAi molecules, a series of experiments were carried out focusing
on the initiating G residues. Because T7 RNA polymerase initiates
transcription with 5'-pGGG, a determination was made as to whether
the GGG associated with the 5' end of the transcript was the
inducing agent by chemically synthesizing the anti-EGFP #2 siRNA
(FIG. 7A, EGFP #2 synthetic 1) with a 5'-OH-GGG, and testing this
siRNA for interferon induction. No interferon induction in HEK-293
cells was elicited by this siRNA.
[0104] The other major difference between the synthetic and in
vitro T7-transcribed siRNAs is the 5' triphosphate. The anti-EGFP
#2 siRNA was transcribed by T7 RNA polymerase in the presence of
[.gamma.-.sup.32P]GTP to label the .gamma.-phosphate. The
initiating pGGG should be cleaved from the transcript by the single
strand-specific ribonuclease T1 (Wang, L., et al., 1976) if the Gs
are within a single-stranded region of the siRNA. When the
anti-EGFP #2 siRNA was treated with RNase T1, there was a modest
reduction in interferon induction compared with the untreated siRNA
(FIG. 7B, bottom, col. 2). When the RNA was sequentially created
with ribonuclease T1 and calf intestine phosphatase (CIP), the
interferon induction was further reduced (FIG. 7B, col. 3). For
each of these samples, removal of the labeled 5'.gamma.-phosphate
was monitored using native gel electrophoresis (FIG. 7B, top). From
these analyses it was concluded that the residual amount of siRNA
containing 5'.gamma.-triphosphate was proportional to the extent of
interferon induction.
[0105] Given that the ribonuclease T1 treatment of the anti-EGFP #2
siRNA did not completely remove the 5'-pGGG, it was reasoned that
perhaps it or the adjacent Gs were involved in wobble base pairing
with the 3' terminal Us of the transcript, making this a poor
substrate for the single strand-specific ribonuclease and CIP. To
test this possibility, a version of the EGFP #2 siRNA that
contained 19 bases complementary to EGFP followed by AA at the 3'
end (FIG. 7A, EGFP #2 T7 (19-AA) was transcribed. When this siRNA
was treated with T1 and tested in cell culture for interferon
induction, there was a reduction relative to the pGGG-containing
control (FIG. 7B, col. 5). When this RNA was further treated with
CIP, the 5' triphosphate was completely removed along with complete
loss of interferon induction (FIG. 7B, col. 6) even at a
concentration of 100 nM. Combining these results, it was concluded
that the interferon induction observed with the in vitro
transcribed siRNAs is linked to the presence of a 5'
triphosphate.
[0106] The EGFP #2 T7 (19-AA) siRNA was also tested for EGFP
knockdown activity, but it showed little potency (FIG. 7C, col. 4).
It was reasoned that because this siRNA now contained a total of
only 19 bases complementary to EGFP, it was not as potent as an
siRNA with 21 complementary bases. To test this, an siRNA with 21
bases complementary to the same EGFP target and still maintaining
the two adenosines at the 3' terminus was created (FIG. 7A, EGFP
#2T7 (21-AA)). This particular siRNA elicited a potent EGFP
knockdown (FIG. 7C, col. 5) in the complete absence of an
interferon response. Thus, by preventing the formation of base
pairs with the initiating Gs, a combination of T1 ribonuclease and
CIP treatment completely eliminated the interferon response, while
maintaining active RNAi function for these siRNAs.
[0107] Moreover, the fact that transcripts containing triphosphates
are such potent inducers of interferon makes it of great interest
to understand which, if any, of the interferon-linked receptors
respond to the triphosphate-containing siRNAs. The triphosphate at
the 5'-end of the uncapped negative (genomic) strands of RNA
viruses like influenza virus (Honda, et al. 1998) may correspond to
the biological substrate targeted by the interferon response seen
with T7 ssRNA. To this extent, it is important to understand the
biological role that triphosphate induction of interferon plays in
normal cellular viral defense mechanisms.
[0108] Preferred embodiments of the invention provide an siRNA
synthesized from the T7 RNA polymerase system, which can trigger a
potent induction of interferon .alpha. and .beta. in a variety of
cell lines. In addition, very potent induction of interferon
.alpha. and .beta. by short single-stranded RNAs (ssRNAs)
transcribed with T3, T7 and Sp6 RNA polymerases was also found.
Analyses of the potential mediators of this response revealed that
the initiating 5' triphosphate is required for interferon
induction.
[0109] In another embodiment, the present invention provides for
short dsRNAs having triphosphates, preferably 5' triphosphates,
which are potent enhancers of interferons as well as potential
anti-viral reagents. The present invention also provides for the
use of short dsRNAs or RNAi molecules, e.g., siRNA or shRNA,
transcribed in vitro, and not processed to remove the initiating
5'-triphosphate, which exhibit potent interferon stimulation both
in cell culture and in mice. This interferon stimulation may
inhibit viral infection if the treatment is provided prior to viral
infection, or in some instances, when it is provided after viral
infection. Viral infection otherwise is treatable with the present
invention.
[0110] The present invention answers the question of how the
triphosphate-containing siRNAs and ssRNAs induce interferon. For
example, when HEK-293 cells were transfected with up to 20 .mu.g
total cellular RNA, no interferon induction was observed. In
contrast, as little as 1 nM of the in vitro transcribed siRNA
initiates the interferon response (FIG. 2D). The antiviral
activities of interferons are well studied (Samuel, C. E., 2001),
but the present invention is believed to be first to show that the
presence of a triphosphate on in vitro transcribed-RNAs can
potently induce interferon .alpha. and .beta., and furthermore
elicit a strong, non-sequence-specific antiviral response to viral
challenges, such as HSV-1 challenge. In contrast, other reports in
which T7-transcribed siRNAs were used as antiviral agents did not
incorporate interferon assays in the analyses (Capodici, J., et
al., 2002; Kapadia, S. B., et al., 2003), and thus whether any
anti-viral effect was due to interferon induction rather than the
RNAi effect was not recognized.
[0111] The above shows that short interfering RNAs (siRNAs)
prepared by in vitro transcription using T7 RNA polymerase induce
potent anti-Herpes Simplex Virus 1 (HSV1) activity that is mediated
by the induction of type 1 interferons. The anti-viral activity is
dependent on the presence of a 5' triphosphate motif on either
strand of the siRNA duplex and the antiviral effects are reversed
by simple treatment with calf intestinal phosphatase (CIP). We
hypothesized that a host defense system exists which recognizes 5'
triphophate-containing viral RNAs. To further characterize the
anti-viral properties of the 5' triphosphate motif experiments were
performed with genomic RNA derived from the Influenza A virus.
Influenza viral RNAs lack 5' modifications since the virus-derived
transcriptase is unable to modify the 5' terminus of mRNAs in the
cytoplasm (Lamb, R. A. and Choppin, P. A., 1983). Purified
influenza viral RNAs were incubated in the presence or absence of
CIP prior to transfection into HEK293 cells (FIG. 10A). The cells
were sequentially challenged by HSV1 harboring an EGFP reporter
gene (Elliott, G. and O'Hare, P., 1999). When cells were
pre-transfected with influenza viral RNA, they were protected from
HSV1 infection in a manner that was dependent on pre-treatment with
CIP (FIG. 10B). The CIP treatment is limited to the removal of the
5' triphosphate and does not affect the integrity of the RNA (FIG.
10A) (Kim, D. H. et al., 2004).
[0112] We further investigated if the anti-viral effect is mediated
by type 1 interferon induction. The level of interferon a was
determined by ELISA (FIG. 10C). Consistent with the results from
the anti-HSV response, the induction of interferon .alpha. is
dependent on CIP treatment, which was shown to be augmented by
prolonging the exposure to CIP. To generalize this observation
using a different model, the mouse cell line NIH3T3 stably
expressing EGFP (Kim, D. H. et al., 2005) was used. When this cell
line was infected with Encephalomyocarditis virus (EMCV), the
cytotoxic effect of the virus was measured by the loss of EGFP
expression (FIG. 10D, the first vs. second row). The cytotoxic
effect by EMCV was reduced when the cells were transfected with
either T7 RNA or Influenza viral RNA prior to viral challenge (FIG.
10D, third and fourth rows). Clearly the antiviral activity is
dependent on the presence of a 5' triphosphate motif on introduced
RNA (FIG. 10D, fourth vs. fifth rows) and this property is not
limited to human cells.
[0113] Since a 5' triphosphate group present on any RNA induces an
innate immune response, there is the distinct possibility that
endogenous cellular RNAs can be potentially immunogenic. Although
all nascent transcripts in the nucleus may harbor a 5'
triphosphate, it is capped prior to cytoplasmic export (Wei, C. and
Moss, B., 1977; Gu, M. and Lima, C. D., 2005). To test whether
endogenous cellular RNAs from different compartments can elicit an
immune response, cytoplasmic and nuclear extracts of HEK293 cells
were prepared. The integrity of the fractionate samples was
confirmed by by Western blot analyses to detect the nuclear
specific hnRNP H (Chou, M. Y., et al., 1999) or cytoplasmic
specific enolase (Dolken, G. et al., 1975) (FIG. 11A). The majority
of enolase staining was in the cytoplasmic fraction whereas the
hnRNP H detection took place only in the nuclear fraction. RNA was
purified from each fraction and used in cationic lipid mediated
transfections of HEK293 cells (FIG. 11B) which were subsequently
challenged with HSV1 (FIG. 11C). RNA derived from the cytoplasmic
fraction did not elicit an anti-HSV protective response whereas the
nuclear-derived RNAs showed an anti-viral response that could be
abrogated by prior treatment with CIP (FIG. 11C). These data
indicate that two types of RNAs separated by the nuclear membrane
have different immunogenic characteristics mediated by the 5'
triphosphate. These results suggest that cells have adopted their
antiviral defense strategy based on the biological principal that
most if not all cytoplasmic RNAs lack an exposed 5' triphosphate as
a consequence of capping. Thus 5'-triphosphate-containing RNAs may
be recognized as infectious viral RNAs, thereby activating the
innate immune system as a defense mechanism.
[0114] A comprehensive profile of gene expression by
double-stranded RNA has been previously undertaken (Geis, G. et
al., 2001). However, to characterize the signaling pathways
elicited by 5'-triphosphate labeled RNA, NIH3T3 cells were
transfected with either poly IC or bacteriophage T7-generated RNA
(T7 RNA initiates with a tri-phosphate) and their relative gene
expression profiles were compared using a murine oligonucleotide
microarray. RNA was extracted at three different time points: 4, 8,
and 16 hours following transfection with T7 RNA. Unlike the early
response induced by Poly IC (Geis, G. et al., 2001), no expression
changes were detected until 16 hours post transfection, indicating
that the tri-phosphate RNA mediated response takes place more
slowly than the the Poly IC induced response (data not presented).
T7 transcribed RNA resulted in upregulation of the expression of 86
genes among the 16,261 genes on the array when a three-fold
threshold was used (FIG. 12A). In a parallel experiment, 229 genes
were up-regulated, 12 genes down-regulated in poly IC-transfected
cells. Interestingly, all 86 genes upregulated by the T7
transcribed RNA were also upregulated by poly IC (FIGS. 13A-13B),
although poly IC activated a large number of additional genes
(FIGS. 14A-14D).
[0115] To minimize the possibility that poly IC we used in the
microarray is contaminated with impure materials such as LPS,
additional microarray experiments were performed using purified
poly IC or poly IC supplemented with 20 ug/ml polymyxin B, which is
a well-characterized LPS inhibitor (Kariko, K., et al., 2004). The
identical set of genes was found to be activated under all these
conditions (data not presented). Among the genes whose expression
was induced by poly IC, several genes related to the apoptosis
pathway have been identified as previously reported (FIGS. 14A-14D)
(Der, S. D. et al., 1997). When the T7 transcribed RNAs was treated
with CIP prior to transfection, the expression profile was
identical to that of the non-transfected control cells (data not
presented). We confirmed some of the induced gene expression
identified in the microarray analyses using quantitative RT-PCR for
each representative group of genes. Expression of two genes
upregulated in cells transfected with both T7 RNA and Poly IC
(Ifi44 and Tgtp) or upregulated when only transfected with Poly IC
(Tnf3ip3 and Gadd4alpha) were tested with an internal control
(beta-actin) was confirmed in this manner (data not presented).
[0116] The Toll like receptors respond to pathogens that present
certain motifs, termed the pathogen-associated molecular pattern
(PAMP), that are displayed on the surface of the invading organisms
(Beutler, B., et al., 2004a; Boehme, K. W. and Compton, T., 2004;
Beutler, B., 2004b). To define the receptor for the T7 transcribed,
tri-phosphate containing RNA, the expression of Toll Like Receptors
were compared in microarray data generated from RNA-transfected
NIH3T3 cells. The microarray results show that the T7 transcribed
RNA induces TLR3 expression (data not presented) which was further
confirmed by RT-PCR. TLR3 expression was determined by RT-PCR in
poly IC-treated cells, which is known to possess a PAMP for TLR3
(Alexopoulou, L., et al., 2001) (FIG. 12B). Recognition of T7
transcribed RNAs by TLR3 was additionally confirmed by a functional
inhibition assay using appropriate antibodies. IFN-.beta.,
production of poly IC is known to be inhibited by an anti-TLR3 mAb
in a human lung fibroblast cell line, MRC-5, which expresses TLR3
on the cell surface (Matsumoto, M. et al., 2002). When T7
transcribed RNA or influenza viral RNA was transfected into these
cells, expression levels increased similarly to Poly IC-treated
cells (FIG. 12C). Interferon .beta. induction was inhibited when
the cells were pre-incubated in the presence of an anti-TLR3
antibody, but not by an anti-TLR2 antibody.
[0117] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA, genetics,
immunology, cell biology, cell culture and transgenic biology,
which are within the skill of the art. See, e.g., Maniatis et al.,
1982, Molecular Cloning (Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.); Sambrook et al., 1989, Molecular Cloning, 2nd
Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.); Sambrook and Russell, 2001, Molecular Cloning, 3rd Ed. (Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.); Ausubel
et al., 1992), Current Protocols in Molecular Biology (John Wiley
& Sons, including periodic updates); Glover, 1985, DNA Cloning
(IRL Press, Oxford); Anand, 1992; Guthrie and Fink, 1991; Harlow
and Lane, 1988, Antibodies, (Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.); Jakoby and Pastan, 1979; Nucleic Acid
Hybridization (B. D. Hames and S. J. Higgins eds. 1984);
Transcription And Translation (B. D. Hames and S. J. Higgins eds.
1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc.,
1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal,
A Practical Guide To Molecular Cloning (1984); the treatise,
Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer
Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds.,
1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols.
154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And
Molecular Biology (Mayer and Walker, eds., Academic Press, London,
1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M.
Weir and C. C. Blackwell, eds., 1986); Riott, Essential Immunology,
6th Edition, Blackwell Scientific Publications, Oxford, 1988; Hogan
et al., Manipulating the Mouse Embryo, (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1986); Westerfield, M.,
The zebrafish book. A guide for the laboratory use of zebrafish
(Danio rerio), (4th Ed., Univ. of Oregon Press, Eugene, 2000).
[0118] The present invention is described by reference to the
following Examples, which are offered by way of illustration and
are not intended to limit the invention in any manner. Standard
techniques well known in the art or the techniques specifically
described below were utilized. Examples 1-5 relate to studies with
HSV-1 and ECMV. Examples 6-12 relate to studies with Influenza A
virus.
EXAMPLE 1
RNAs
[0119] The chemically synthesized RNAs were purchased from
Dharmacon. The T7 siRNAs were synthesized using the Silencer siRNA
construction kit from Ambion according to the manufacturer's
protocol. To transcribe RNA in vitro, T7 primer I
(5'-TAATACGACTCACTAT A-3' Q ID NO:15)) was hybridized with T7
primer II, which contains antisense sequence of each transcribed
RNA and the tail sequence of 5'-CCCTATAGTGAGTCGTA-3' Q ID NO:16).
To make siRNA without interferon induction, the first AA was
replaced by TT and included in the T7 primer II. For example, to
make GFP #2 T7 (21-AA), two primers were used
(5'-TTAAGCTGACCCTGAAGTTCATCCCCTATAGTGAGTCGTA-3' (SEQ ID NO:17) and
5'-TTGATGAACTTCAGGGTCAGCTTCCCTATAGTGAGTCGTA-3' (SEQ ID NO:18)). For
the CIP, 20 U of RNAs (NEB) was added to the siRNA after DNase and
RNase T1 digestion, and further incubated at 37.degree. C. for 1 h.
Final siRNAs were column-purified using conditions recommended for
the Silencer siRNA construction kit.
[0120] To synthesize the [.gamma.-.sup.32P]GTP-labeled siRNA, the
transcription was done in the presence of 10 mM of cold ATP, CTP
and UTP, 2 mM of GTP and [.gamma.-.sup.32P]GTP (10 mCi/ml; ICN),
and purified using a G50 column (Amersham). For RNAse T1 treatment,
the RNA was incubated in the presence of 5 U of RNase T1 in
1.times. buffer (50 mM Tris-HCl, pH 7.0; 5 mM EDTA; 50 mM NaCl).
CIP treatment of EGFP RNA was carried out at 37.degree. C. for 1 h
at 1.times. buffer (100 mM NaCl, 50 mM Tri-HCl, 10 mM MgCl2, 1 mM
dithiothreitol (DTT)).
[0121] For T3 RNAs, 1 .mu.g of pBluescript DNA template (Stratagen)
was digested with either BamHI or EcoRI and used as a template of
in vitro transcription using the T3 RNA polymerase (Promega). The
Sp6 RNAs were transcribed from the same amount of SalI- or
EcoRI-digested pGEM9Df(-) DNA template using the Sp6 RNA polymerase
(Promega). All transcription reactions were done under standard
reaction conditions and contained 1 .mu.g of linearized DNA
template, 2 .mu.l of 100 mM DTT, 2 .mu.l of 10.times. reaction
buffer supplied by each manufacturer, 8 .mu.l of final 2 mM of NTP
and 1 .mu.l of each enzyme at 37.degree. C. for 1.5 h. All RNAs
were digested with 4 U of RNase-free DNAse (Ambion) for 1 h and
used in the transfection assay.
EXAMPLE 2
Transfection and RNAi Assay
[0122] All transfection assays were done using Lipofectamine 2000
following the manufacturer's protocol (Invitrogen). HEK-293 cells
at ninety percent confluency were transfected in 24-well plates
with the reporter genes and siRNAs. 250 ng of the pLEGFP-C1 vector
(Clontech) and 10 nM of each anti-EGFP siRNA were cotransfected.
EGFP expression levels were determined 24 h later from the mean
number of EGFP-fluorescent cells determined by
fluorescence-activated cell sorting (FACS) analyses. Percentages of
EGFP expression were determined relative to nonspecific
controls.
[0123] For monitoring of cell death, the medium from transfected
cells was changed 24 h after transfection. Additional media changes
were made after 48 h, and the plates were examined microscopically
after another 48 h incubation.
EXAMPLE 3
[0124] Anti-HSV-1 Assays
[0125] 60% confluent HEK-293 cells were transfected in 24-well
dishes with siRNA or ssRNA using Lipofectamine 2000 (Invitrogen)
according to the manufacturer's protocol. The cells were placed in
fresh medium 18 h after transfection. The cells were infected 6 h
later with HSV-1 expressing EGFP at an MOI of 1. Cells were subject
to FACS analyses 24 h after infection to determine levels of EGFP
expression.
EXAMPLE 4
Assays for Interferon .alpha. and .beta.
[0126] The amount of interferon .alpha. and .beta. secreted into
the growth medium was determined using interferon ELISA kits (RDI).
The medium from Lipofectamine-complexed, RNA-transfected HEK-293
cells was collected 24 h after the initial infection. The medium
was serially diluted and assayed for the amount of secreted
interferon according to the manufacturer's protocol. Each assay was
carried out in triplicate. The antibody neutralization assays were
carried out as follows. Neutralizing antibodies for interferon
.alpha. and .beta. were purchased from RDI. The medium was
collected 24 h after transfection with 40 nM of T7 ssRNA. The
medium was next diluted 3.3% with the fresh medium and mixed with
100 U/ml of one or both interferon neutralizing antibodies for 1 h.
The antibody-treated medium was added to the cell cultures and left
for 24 h before HSV-1 challenge.
EXAMPLE 5
Interferon Assay in Mice
[0127] An assay for interferon can be performed to detect
interferon induction by triphosphate siRNAs, produced in accordance
with the present invention, in mice. The effect of T7 siRNA in 4
mice samples was observed by measuring interferon .alpha. induction
at day 1, day 3 and day 7 following injection of T7 siRNA. (FIG.
9). Assays were performed as follows: (1) Inject mouse with saline
(mock) or 70 .mu.M triphosphate siRNAs minus triphosphate or 70
.mu.M triphosphate siRNAs into leg muscle in 25 .mu.l volume; (2)
Bleed the mouse days 1, 3, or 7 following RNA injection; (3) Assay
IFN .alpha. using mouse ELISA kit.
EXAMPLE 6
Materials
[0128] Reagents
[0129] Poly IC and Polymysin B were purchased from Sigma. Poly IC
was further purified through extraction twice with phenol followed
by ethanol precipitation. For determination of interferon alpha and
beta, ELISA kits were purchased from RDI (Concord, Mass.). HEK293,
NIH3T3, and MRC5 cells were cultured in DMEM media supplemented
with 10% Fetus Bovine Serum and glutamine. The enolase antibody was
purchased from Biogenesis (Kingston, HN). HnRNP H antibody was a
generous gift from Dr. Black Lab (UCLA, CA). Cytoplasmic and
nucleus extracts were prepared as described with a modification
(Robb, G. G., et al., 2005). The isolated nuclei and cytoplasmic
extract were mixed with Stat 60 (Tel-Test) followed by the
Manufacturer's instructions to purify RNA.
[0130] siRNAs
[0131] The anti-poliovirus siRNA (siC (Gitlin, L., et al., 2002);
sense sequence 5'-GCGUGUAAUGACUUCAGCGUG-3' (SEQ ID NO:19)) and
anti-HSV siRNA (sigE (Bhuyan, P. K., et al., 2004); sense sequence
5'-AATATACGAATCGTGTCTGTA-3' (SEQ ID NO:20)).were synthesized by the
oligo synthesis facility at the City of Hope (Duarte, Calif.).
[0132] T7 siRNAs
[0133] The T7 siRNAs were synthesized using the Silencer siRNA
Construction kit from Ambion, Inc. according to the manufacturer's
protocol. To transcribe RNA in vitro, T7 primer I
(5'-TAATACGACTCACTATA-3' (SEQ ID NO:15)) was hybridized with T7
primer II which contains the antisense sequence of each transcribed
RNA and the tail sequence: 5'-CCCTATAGTGAGTCGTA-3' (SEQ ID NO:16).
The anti-EMCV siRNA is targeted to the sequence:
5'-GATAGTGCCAGGGCGGGTACT-3' (SEQ ID NO:21). The transcribed ssRNA
was used as T7 RNA without hybridization. For the CIP treatment, 20
U of enzyme (NEB) was added to the siRNA after DNase and RNase T1
digestion, and further incubated at 37.degree. C. for 1 hour.
siRNAs were column purified using conditions recommended for the
Silencer siRNA Construction Kit.
EXAMPLE 7
Transfection
[0134] All transfection assays were done using Lipofectamine 2000
(Invitrogen). HEK293 or NIH3T3 cells at 50 to 60 percent confluency
were transfected with each siRNAs using indicated concentrations.
The siRNA and lipofectamine complex was simply added on top of
existing growth media.
EXAMPLE 8
Viral Challenge Assay
[0135] For anti-HSV-1 or anti-polioviral assays, 60% confluent 293
cells on plates were transfected with siRNA or ssRNA using
Lipofectarnine 2000 (Invitrogen). The following day (24 hours) the
cells were infected with HSV-1 expressing the EGFP or Poliovirus
Mahoney strain at a multiplicity of infection of 1 or 0.1,
respectively. 24 hours post infection, the anti-HSV activity was
measured by determining the EGFP level in the extract using a
Fluorometer (Bio-Rad). To prepare the extract, the cells in the 24
well plates were mixed with 200 .mu.l of passive lysis buffer
(Promega). For the anti-polioviral assay, the cells in each well
were washed with PBS three times to remove dead cells caused by the
cytotoxic effect of the virus and lysed by adding 200 .mu.l of the
lysis buffer. Total amount of protein was measured by the Bradford
assay. For anti-proliferation effect of T7 RNA or poly IC, 40% of
the NIH3T3 cells stably expressing EGFP gene was plated in 24 well
plates on day 1. The cells were transfected with T7 RNA or poly IC
and harvested on day 5. Total cell numbers were determined by
measuring EGFP levels using the fluorometer. For the anti-EMCV
activity assay, cells were transfected with indicated amount of
each RNAs on day 2. On day 3, the cells were infected with a 0.1
MOI of EMCV. Total anti-EMCV activity was measured on day 5 or day
7. Total numbers of survived cells were determined by the level of
EGFP expression in the extracts after normalization to the value of
each parallel sample from the anti-proliferation activity
assay.
EXAMPLE 9
[0136] Viral RNA
[0137] Influenza virus A/PR/8/34 (PR8), subtype H1N1, a kind gift
from Dr. Peter Palese, Mount Sinai School of Medicine, was grown
for 48 hours in 10-day-embryonated chicken eggs (Charles River
laboratories, MA) at 37.degree. C. 48 hours after virus
inoculation, the allantoic fluid was harvested and was centrifuged
at 1300 rpm for 10 min. The supernatant was then mixed with 25%
sucrose in 0.1 M Tris (pH8.0) and ultracentrifuged at 25,000 rpm
for 2 hours using SW28. Following centrifugation, Trizol
(Invitrogen) was added to the pellet and RNA purification was
performed according to the manufacturer's instructions.
EXAMPLE 10
RT-PCR
[0138] Total RNA was purified using Stat60 and treated with 2 U of
DNase (Promega) per ug of RNA for 20 min at 37.degree. C. To detect
Tlr3, Tlr7 and .beta.-actin mRNA using reverse transcriptase (RT)
and PCR, first strand cDNA synthesis was performed at 37.degree. C.
for 1 hour in a 30 .mu.l reaction mixture containing 2 .mu.g of
total cellular RNA, 2 pmol of gene-specific primer (50 ng of random
primers (invitrogen)), 0.5 mM each of dATP, dCTP, dTTP and dGTP, 3
mM MgCl.sub.2, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 20 mM DTT, 5 U
RNasin RNase inhibitor (Promega) and 200 U M-MLV Reverse
Transcriptase (Invitrogen). Reverse primers used for the PCR
reaction (see below) were used as gene-specific primers for first
strand synthesis of Tlr3 and Tlr7. Aliquots (5 .mu.l) of the cDNA
reaction mixture were used to amplify Tlr3, Tlr7 and .beta.-actin
sequences separately. The PCR reaction mixtures included 50 mM KCl,
10 mM Tris-HCl (pH 8.3 at 25.degree. C.), 1.5 mM Mg(OAc).sub.2, 0.2
mM each of dATP, dCTP, dTTP and dGTP, 15 pmol each of forward and
reverse primers, and 2.5 U of Taq DNA polymerase (Eppendorf).
Sequences of forward and reverse Tlr3 primers were
5'-AGATACAACGTAGCTGACTGCAGCCATTTG-3' (SEQ ID NO:22) and
5'-CTTCACTTCGCAACGCAAGGATTTTATTTT-3' (SEQ ID NO:23). Sequences of
forward and reverse Tlr7 primers were 5'-CATTCCCACTAACACCACCAATCT
TACCCT-3' (SEQ ID NO:24) and 5'-ATCCTGTGGTATCTCCAGAAGTTGGTTTCC-3'
(SEQ ID NO:25). Sequences of forward and reverse .beta.-actin
primers were 5'-ACCAACTGGGACGACATGGAGAAGATCTGG-3' (SEQ ID NO:26)
and 5'-GCTGGGGTGTTGAAGGTCTCAAACATGATC-3' (SEQ ID NO:27). Thermal
cycling reactions were conducted at 95.degree. C. for 30 seconds,
58.degree. C. for 30 seconds and 72.degree. C. for 1 minute.
Aliquots were removed from the PCR reaction mixtures during the
exponential phase of amplification after 25 (.beta.-actin) and 35
cycles (Tlr3 and Tlr7). Samples were resolved using 2% agarose gel
electrophoresis. The same procedure was used for RT-PCR of other
genes using each pair of primers (for Stat 1, Ifi44, Tgtp, TNFaip3,
Gadd4alpha).
EXAMPLE 11
Functional Inhibition Assay for TLR3
[0139] The procedure was followed as previously described
(Matsumoto, M., et al., 2002). Anti-TLR2 and TLR3 antibodies were
purchased from eBioscience (San Diego, Calif.). Briefly, MRC-5
cells in 24 well pates (1.times.10.sup.5) were preincubated with 20
.mu.g/ml of anti-TLR2 or anti-TLR3 antibody for 1 hour at
37.degree. C. The cells were transfected with either 5 nM of T7 RNA
or 500 ng of poly IC. The next day, interferon beta levels in the
media was determined by ELISA (RDI).
EXAMPLE 12
Microarray
[0140] Mouse oligonucleotides were purchased from Operon
Technologies Inc. (Alameda, Calif.) and Sigma-Genosys (The
Woodlands, Tex.), and were inkjet-printed by Agilent Technologies
(Palo Alto, Calif.). The 16K oligo array includes 13,536 Operon
designed and synthesized probes (70 mer), and 2,304 Compugen Ltd.
(Jamesburg, N.J.) designed and Sigma-Genosys synthesized probes (65
mer). The aminoallyl method was used for the preparation of
fluorescently labeled target samples. Briefly, both first and
second strand cDNAs were synthesized by incubating 3 .mu.g of total
RNA with the T7 promoter primer
(5'-GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT).sub.24-3' (SEQ ID
NO:28)) (Qiagen Inc., Valencia, Calif.) followed by using
SuperScript II (Invitrogen Life Technologies, Carlsbad, Calif.).
Aminoallyl-UTP (aaUTP) labeled antisense RNA (aRNA) was synthesized
by adding reagents to the 15 .mu.l of cDNA template in the
following order: 4 .mu.l of 75 mM ATP solution; 4 .mu.l of 75 mM
CTP solution; 4 .mu.l of 75 mM GTP solution; 2 .mu.l of 75 mM UTP
solution; 4 .mu.l of 10.times. reaction buffer; 3 .mu.l of 50 mM
aaUTP (Ambion, Austin, Tex.); and 4 .mu.l of MEGAscript T7 enzyme
mix (Ambion). The coupling reaction was performed by mixing 10
.mu.g of aRNA with 2 .mu.l of 0.5 M sodium bicarbonate, pH 9.5,
along with 10 .mu.l of mono-Cy3 or mono-Cy5 solution (PerkinElmer,
Inc.; Boston, Mass.), and adjusting the final volume to 20
.mu.l/reaction. Three .mu.g of each labeled aRNA target was
hybridized after being fragmented by mixing with fragmentation
buffer (Agilent Technologies). After hybridization and washing,
oligo arrays were scanned by the Agilent Scanner G2505A (Agilent
Technologies). Genes that were saturated, non-uniform, or not
significantly above background (below 2.6.times. standard deviation
of background) in either channel were removed. The remaining values
were used for the analysis.
[0141] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0142] Embodiments of this invention are described herein,
including the best mode known to the inventors for carrying out the
invention. Variations of those embodiments may become apparent to
those of ordinary skill in the art upon reading the foregoing
description. The inventors expect skilled artisans to employ such
variations as appropriate, and the inventors intend for the
invention to be practiced otherwise than as specifically described
herein. Accordingly, this invention includes all modifications and
equivalents of the subject matter recited in the claims appended
hereto as permitted by applicable law. Moreover, any combination of
the above-described elements in all possible variations thereof is
encompassed by the invention unless otherwise indicated herein or
otherwise clearly contradicted by context.
BIBLIOGRAPHY
[0143] Ackermann, E. J., et al. Antisense modulation of novel
anti-apoptotic bc1-2-related proteins. U.S. Pat. No. 6,001,992
(1999).
[0144] Agrawal, S., et al. Method of down-regulating gene
expression. U.S. Pat. No. 6,645,943 (2003).
[0145] Akhtar, S. (ed.). Delivery Strategies for Antisense
Oligonucleotide Therapeutics, CRC Press, Boca Raton, Fla.
(1995).
[0146] Akhtar, S. and Juliano, R. L. Cellular uptake and
intracellular fate of antisense oligonucleotides. Trends Cell Biol,
2, 139 (1992).
[0147] Alexopoulou, L., et al. Recognition of double-stranded RNA
and activation of NF-kappaB by Toll-like receptor 3. Nature 413,
732-8 (2001).
[0148] Andino, R. RNAi puts a lid on virus replication. Nat.
Biotechnol. 21, 629-630 (2003).
[0149] Beigelman et al. Novel compositions for the delivery of
negatively charged molecules. PCT international published
application No. WO 99/05094 (1999).
[0150] Beutler, B. Inferences, questions and possibilities in
Toll-like receptor signalling. Nature 430, 257-63 (2004a).
[0151] Beutler, B. Innate immunity: an overview. Mol Immunol 40,
845-59 (2004b).
[0152] Boehme, K. W. and Compton, T. Innate sensing of viruses by
toll-like receptors. J Virol 78, 7867-73 (2004).
[0153] Bridge, A. J., et al., Induction of an interferon response
by RNAi vectors in mammalian cells. Nature, 34(3), 263-264
(2003).
[0154] Capodici, J., et al. Inhibition of HIV-1 infection by small
interfering RNA-mediated RNA interference. J. Immunol. 169,
5196-5201 (2002).
[0155] Chou, M. Y., et al. hnRNP H is a component of a splicing
enhancer complex that activates a c-src alternative exon in
neuronal cells. Mol Cell Biol 19, 69-77 (1999).
[0156] Der, S. D., et al. A double-stranded RNA-activated protein
kinase-dependent pathway mediating stress-induced apoptosis. Proc
Natl Acad Sci USA 94, 3279-83 (1997).
[0157] Diebold, S. S., et al. Innate antiviral responses by means
of TLR7-mediated recognition of single-stranded RNA. Science 303,
1529-31 (2004).
[0158] Dolken, G., et al. Immunofluorescent localization of
glycogenolytic and glycolytic enzyme proteins and of malate
dehydrogenase isozymes in cross-striated skeletal muscle and heart
of the rabbit. Histochemistry 43, 113-21 (1975).
[0159] Donze, 0. and Picard, D. RNA interference in mammalian cells
using siRNAs synthesized with T7 RNA polymerase. Nucleic Acids Res.
30, e46 (2002).
[0160] Draper et al. Method and reagent for inhibiting viral
replication. PCT international published application No. WO
93/23569 (1993).
[0161] Elbashir, S. M., et al. Duplexes of 21-nucleotide RNAs
mediate RNA interference in cultured mammalian cells. Nature 411,
494-498 (2001).
[0162] Elliott, G. and O'Hare, P. Live-cell analysis of a green
fluorescent protein-tagged herpes simplex virus infection. J.
Virol. 73, 4110-4119 (1999).
[0163] Fire, A., et al. Genetic inhibition by double-stranded RNA.
U.S. Pat. No. 6,506,559 (2003).
[0164] Geiss, G. et al. A comprehensive view of regulation of gene
expression by double-stranded RNA-mediated cell signaling. J Biol
Chem 276, 30178-82 (2001).
[0165] Gu, M. and Lima, C. D. Processing the message: structural
insights into capping and decapping mRNA. Curr Opin Struct Biol 15,
99-106 (2005).
[0166] Hannon, G. J. RNA interference. Nature 418,
244-251(2002).
[0167] Heil, F. et al. Species-specific recognition of
single-stranded RNA via toll-like receptor 7 and 8. Science 303,
1526-9 (2004).
[0168] Honda, A., et al. Identification of the 5' terminal
structure of influenza virus genome RNA by a newly developed
enzymatic method. Virus Res. 55, 199-206 (1998).
[0169] Hornung, V. et al. Sequence-specific potent induction of
IFN-alpha by short interfering RNA in plasmacytoid dendritic cells
through TLR7. Nat Med 11, 263-70 (2005).
[0170] Kapadia, S. B., et al. Interference of hepatitis C virus RNA
replication by short interfering RNAs. Proc. Natl. Acad. Sci. USA
100, 2014-2018 (2003).
[0171] Kariko, K., et al. MRNA is an endogenous ligand for
Toll-like receptor 3. J Biol Chem 279, 12542-50 (2004).
[0172] Kim, D. H. and Rossi, J. J. Coupling of RNAi-mediated target
downregulation with gene replacement. Antisense Nucleic Acid Drug
Dev. 13, 151-155 (2003).
[0173] Kim, D. H. et al. Interferon induction by siRNAs and ssRNAs
synthesized by phage polymerase. Nat Biotechnol 22, 321-5
(2004).
[0174] Kim, D. H. et al. Synthetic dsRNA Dicer substrates enhance
RNAi potency and efficacy. Nat Biotechnol 23, 222-6 (2005).
[0175] Klimuk, et al. Liposomal compositions for the delivery of
nucleic acid catalysts. PCT international published application No.
WO 99/04819 (1999).
[0176] Lamb, R. A. & Choppin, P. W. The gene structure and
replication of influenza virus. Annu Rev Biochem 52, 467-506
(1983).
[0177] Lund, J. M. et al. Recognition of single-stranded RNA
viruses by Toll-like receptor 7. Proc Natl Acad Sci USA 101,
5598-603 (2004).
[0178] Malmgaard, L. Induction and regulation of IFNs during viral
infections. J Interferon Cytokine Res 24, 439-54 (2004).
[0179] Matsumoto, M., et al. Establishment of a monoclonal antibody
against human Toll-like receptor 3 that blocks double-stranded
RNA-mediated signaling. Biochem Biophys Res Commun 293, 1364-9
(2002).
[0180] Marcus, P. I., Interferon, 3 (ed. Gresser, I.) 115-180
(Academic Press, London, 1983).
[0181] Montgomery, M. K. RNA Interference, Editing, and
Modification: Methods and Protocols. Methods in Molecular Biology,
265, 3-21, (2004).
[0182] Samuel, C. E. Antiviral actions of interferons. Clin.
Microbiol. Rev. 14, 778-809 (2001).
[0183] Samuel, C. E. Knockdown by RNAi-proceed with caution. Nature
Biotechnology, 22(3), 280-82 (2004).
[0184] Sledz, C. A., et al. Activation of the interferon system by
short-interfering RNAs. Nature Cell Biology, 5(9), 834-39
(2003).
[0185] Sohail, M., et al. A simple and cost-effective method for
producing small interfering RNAs with high efficacy. Nucleic Acids
Res. 31, e38 (2003).
[0186] Stewart, W. E., II., The Interferon System (Springer, N.Y.,
1979).
[0187] Stojdl, D. F. et al. Exploiting tumor-specific defects in
the interferon pathway with a previously unknown oncolytic virus.
Nat. Med. 6, 821-825 (2000).
[0188] Sullivan et al. Method and reagent for treatment of animal
diseases. PCT international published application No. WO 94/02595
(1994).
[0189] Thompson, J. et al. Nucleic acid molecules with novel
chemical compositions capable of modulating gene expression. U.S.
Pat. No. 6,673,611 (2004).
[0190] Wang, L. et al. Mapping oligonucleotides of Rous sarcoma
virus RNA that segregate with polymerase and group-specific antigen
markers in recombinants. Proc. Natl. Acad. Sci. USA 73, 3952-3956
(1976).
[0191] Wei, C. and Moss, B. 5'-Terminal capping of RNA by
guanylyltransferase from HeLa cell nuclei. Proc Natl Acad Sci USA
74, 3758-61 (1977).
Sequence CWU 1
1
28 1 120 DNA Encephalomyocarditis virus 1 ttgaaagccg ggggtgggag
atccggattg ccagtctact cgatatcgca ggctgggtcc 60 gtgactaccc
actcctactt tcaacgtgaa ggctacgata gtgccagggc gggtactgcc 120 2 21 RNA
Artificial siRNA 2 gcugacccug aaguucaucu u 21 3 21 RNA Artificial
siRNA 3 gaugaacuuc agggucagcu u 21 4 24 RNA Artificial siRNA 4
ggggcugacc cugaaguuca ucuu 24 5 24 RNA Artificial siRNA 5
ggggaugaac uucaggguca gcuu 24 6 24 RNA Artificial siRNA 6
ggggcugacc cugaaguuca ucaa 24 7 24 RNA Artificial siRNA 7
ggggaugaac uucaggguca gcaa 24 8 26 RNA Artificial siRNA 8
gggaagcuga cccugaaguu caucaa 26 9 26 RNA Artificial siRNA 9
ggggaugaac uucaggguca gcuuaa 26 10 21 DNA Artificial siRNA 10
aactggatga aggctgggta c 21 11 21 DNA Artificial siRNA 11 aatctgtaaa
ccaaatgcag c 21 12 21 DNA Artificial siRNA 12 aacaagcagc gccccggctc
c 21 13 21 DNA Artificial siRNA 13 aacagcagct ccttcatcac c 21 14 21
DNA Artificial siRNA 14 aaggaacggc tcatggacgt c 21 15 17 DNA
Artificial T7 primer 15 taatacgact cactata 17 16 17 DNA Artificial
T7 primer 16 ccctatagtg agtcgta 17 17 40 DNA Artificial Primer 17
ttaagctgac cctgaagttc atcccctata gtgagtcgta 40 18 40 DNA Artificial
Primer 18 ttgatgaact tcagggtcag cttccctata gtgagtcgta 40 19 21 RNA
Artificial siRNA 19 gcguguaaug acuucagcgu g 21 20 21 DNA Artificial
siRNA 20 aatatacgaa tcgtgtctgt a 21 21 21 DNA Artificial siRNA
target 21 gatagtgcca gggcgggtac t 21 22 30 DNA Artificial Tlr3
primer 22 agatacaacg tagctgactg cagccatttg 30 23 30 DNA Artificial
Tlr3 primer 23 cttcacttcg caacgcaagg attttatttt 30 24 30 DNA
Artificial Tlr7 primer 24 cattcccact aacaccacca atcttaccct 30 25 30
DNA Artificial Tlr7 primer 25 atcctgtggt atctccagaa gttggtttcc 30
26 30 DNA Artificial Beta-actin primer 26 accaactggg acgacatgga
gaagatctgg 30 27 30 DNA Artificial Beta-actin primer 27 gctggggtgt
tgaaggtctc aaacatgatc 30 28 63 DNA Artificial T7 promoter primer 28
ggccagtgaa ttgtaatacg actcactata gggaggcggt tttttttttt tttttttttt
60 ttt 63
* * * * *