U.S. patent application number 11/402542 was filed with the patent office on 2006-08-10 for delta 4,5 glycuronidase and methods of hydrolyzing therewith.
This patent application is currently assigned to Massachusetts Institute of Technology. Invention is credited to Maitland W. McLean, James R. Myette, Ram Sasisekharan, Zachary Shriver, Ganesh Venkataraman.
Application Number | 20060177910 11/402542 |
Document ID | / |
Family ID | 32850488 |
Filed Date | 2006-08-10 |
United States Patent
Application |
20060177910 |
Kind Code |
A1 |
Myette; James R. ; et
al. |
August 10, 2006 |
Delta 4,5 glycuronidase and methods of hydrolyzing therewith
Abstract
The invention relates to .DELTA.4,5 glycuronidase, related
compositions, and methods of use thereof.
Inventors: |
Myette; James R.; (Belmont,
MA) ; Shriver; Zachary; (Boston, MA) ;
Venkataraman; Ganesh; (Bedford, MA) ; Sasisekharan;
Ram; (Bedford, MA) ; McLean; Maitland W.;
(Orkney, GB) |
Correspondence
Address: |
WOLF GREENFIELD & SACKS, PC
FEDERAL RESERVE PLAZA
600 ATLANTIC AVENUE
BOSTON
MA
02210-2206
US
|
Assignee: |
Massachusetts Institute of
Technology
Cambridge
MA
|
Family ID: |
32850488 |
Appl. No.: |
11/402542 |
Filed: |
April 11, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10429921 |
May 5, 2003 |
|
|
|
11402542 |
Apr 11, 2006 |
|
|
|
60377488 |
May 3, 2002 |
|
|
|
Current U.S.
Class: |
435/85 |
Current CPC
Class: |
A61P 7/04 20180101; C07H
21/04 20130101; C12Y 302/01056 20130101; A61P 43/00 20180101; A61P
35/00 20180101; Y02A 50/481 20180101; Y02A 50/30 20180101; C12N
9/2402 20130101; C12Q 1/34 20130101; A61P 9/00 20180101; A61P 7/00
20180101; A61K 38/00 20130101; C12Y 302/01166 20130101 |
Class at
Publication: |
435/085 |
International
Class: |
C12P 19/28 20060101
C12P019/28 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] Aspects of the invention may have been made using funding
from National Institutes of Health Grant number NIHGM57073 and
CA090940. Accordingly, the Government may have rights in the
invention.
Claims
1. A method of hydrolyzing a chondroitin or hyaluronan
disaccharide, comprising: reacting the chondroitin or hyaluronan
disaccharide with a .DELTA.4,5 unsaturated glycuronidase.
2. The method of claim 1, wherein the chondroitin or hyaluronan
disaccharide is .DELTA.UGal.sub.Nac,6S.
3. The method of claim 1, wherein the chondroitin or hyaluronan
disaccharide is .DELTA.UGal.sub.Nac.
4. The method of claim 1, wherein the chondroitin or hyaluronan
disaccharide is .DELTA.UH.
5. The method of claim 1, wherein the reacting is conducted for
greater than 12 hours.
6. The method of claim 1, wherein the reacting is conducted for 18
hours.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. patent application
Ser. No. 10/429921, filed on May 5, 2003 and currently pending,
which claims priority under 35 U.S.C. .sctn.119 from U.S.
provisional application Ser. No. 60/377,488 filed May 3, 2002, the
entire contents of each of which are incorporated herein by
reference.
FIELD OF THE INVENTION
[0003] The invention relates to .DELTA.4,5 glycuronidase and uses
thereof. In particular, the invention relates to substantially pure
.DELTA.4,5 glycuronidase which is useful for a variety of purposes,
including analysis of glycosaminoglycans (GAGs), sequencing,
identifying, quantifying and purifying glycosaminoglycans present
in a sample, removing glycosaminoglycans, such as heparin, from a
solution and inhibiting angiogenesis, controlling coagulation, etc.
The invention also relates to methods of treating cancer and
inhibiting cellular proliferation and/or metastasis using
.DELTA.4,5 glycuronidase and/or GAG fragments produced by enzymatic
cleavage with .DELTA.4,5 glycuronidase.
BACKGROUND OF THE INVENTION
[0004] Glycosaminoglycans (GAGs) are linear, acidic polysaccharides
that exist ubiquitously in nature as residents of the extracellular
matrix and at the cell surface of many different organisms of
divergent phylogeny [Habuchi, O. (2000) Biochim Biophys Acta 1474,
115-27; Sasisekharan, R., Bulmer, M., Moremen, K. W., Cooney, C.
L., and Langer, R. (1993) Proc Natl Acad Sci USA 90, 3660-4]. In
addition to a structural role, GAGs act as critical modulators of a
number of biochemical signaling events [Tumova, S., Woods, A., and
Couchman, J. R. (2000) Int J Biochem Cell Biol 32, 269-88]
requisite for cell growth and differentiation, cell adhesion and
migration, and tissue morphogenesis.
[0005] Heparan sulfate like glycosaminoglycans (GAGS or HSGAGs) are
present both at the cell surface and in the extracellular matrix.
Heparin-like glycosaminoglycans are important components of the
extracellular matrix that are believed to regulate a wide variety
of cellular activities including invasion, migration, proliferation
and adhesion (Khodapkar, et al. 1998; Woods, et al., 1998). HSGAGs
accomplish some of these functions by binding to and regulating the
biological activities of diverse molecules, including growth
factors, morphogens, enzymes, extracellular proteins. HSGAGs are a
group of complex polysaccharides that are variable in length,
consisting of a disaccharide repeat unit composed of glucosamine
and an uronic acid (either iduronic or glucuronic acid). The high
degree of complexity for HSGAGs arises not only from their
polydispersity and the possibility of two different uronic acid
components, but also from differential modification at four
positions of the disaccharide unit. Three positions, viz., C2 of
the uronic acid and the C3, C6 positions of the glucosamine can be
O-sulfated. In addition, C2 of the glucosamine can be N-acetylated
or N-sulfated. Together, these modifications could theoretically
lead to 32 possible disaccharide units, making HSGAGs potentially
more information dense than either DNA (4 bases) or proteins (20
amino acids). It is this enormity of possible structural variants
that allows HSGAGs to be involved in a large number of diverse
biological processes, including angiogenesis (Sasisekharan, R.,
Moses, M. A., Nugent, M. A., Cooney, C. L. & Langer, R. (1994)
Proc Natl Acad Sci USA, 1524-8.), embryogenesis (Binari, R. et al
(1997) Development, 2623-32; Tsuda, M., et al. (1999) Nature,
276-80.; and Lin, X., et al (1999) Development, 3715-23.) and the
formation of .beta.-fibrils in Alzheimer's disease (McLaurin, J.,
et al (1999) Eur J Biochem, 1101-10. and Lindahl, B., et al (1999)
J Biol Chem, 30631-5).
[0006] One specific example of an HSGAG is heparin. Heparin, a
highly sulphated HSGAG produced by mast cells, is a widely used
clinical anticoagulant, and is one of the first biopolymeric drugs
and one of the few carbohydrate drugs. Heparin primarily elicits
its effect through two mechanisms, both of which involve binding of
antithrombin III (AT-III) to a specific pentasaccharide sequence,
H.sub.NAc/S,6SGH.sub.NS,3S,6SI.sub.2SH.sub.NS,6S contained within
the polymer. HSGAGs have also emerged as key players in a range of
biological processes that range from angiogenesis [Folkman, J.,
Taylor, S., and Spillberg, C. (1983) Ciba Found Symp 100, 132-49]
and cancer biology [Blackhall, F. H., Merry, C. L., Davies, E. J.,
and Jayson, G. C. (2001) Br J Cancer 85, 1094-8] to microbial
pathogenesis [Shukla, et al (1999) Cell 99, 13-22]. HSGAGs have
also recently been shown to play a fundamental role in multiple
aspects of development [Perrimon, N. and Bernfield, M. (2000)
Nature 404, 725-8]. The ability of HSGAGs to orchestrate multiple
biological events is again likely a consequence of its structural
complexity and information density [Sasisekharan, R. and
Venkataraman, G. (2000) Curr Opin Chem Biol 4, 626-31].
[0007] Although the structure and chemistry of HSGAGs are fairly
well understood, information on how specific HSGAG sequences
modulate different biological processes has proven harder to
obtain. Determination of these HSGAG sequence has been technically
challenging. HSGAGs are naturally present in very limited
quantities, -which, unlike other biopolymers such as proteins and
nucleic acids, cannot be readily amplified. Second, due to their
highly charged character and structural heterogeneity, HSGAGs are
not easily isolated from biological sources in a highly purified
state. Additionally, the lack of sequence-specific tools to cleave
HSGAGs in a manner analogous to DNA sequencing or restriction
mapping has made sequencing a challenge.
[0008] Recently, in an effort to develop an understanding of HSGAG
structure, focus has been placed on the cloning and
characterization of the enzymes involved in HSGAG biosynthesis.
Another, strategy for elucidating the structure of HSGAGs has been
to employ specific HSGAG degradation procedures, including chemical
or enzymatic cleavage, in conjunction with analytical
methodologies, including gel electrophoresis or HPLC, to sequence
HSGAGs. Recently, we have introduced a sequencing procedure that
couples a bioinformatics framework with mass spectrometric and
capillary electrophoretic procedures to sequence rapidly
biologically important HSGAGs, including saccharide sequences
involved in modulating anticoagulation. The sequencing methodology
uses chemical and enzymatic tools to modify or degrade an unknown
glycosaminoglycan polymer in a sequence-specific manner.
(Venkataraman, G., et al., Science, 286, 537-542 (1999), and U.S.
patent application Ser. Nos. 09/557,997 and 09/558,137, both filed
on Apr. 24, 2000, having common inventorship).
SUMMARY OF THE INVENTION
[0009] .DELTA.4,5 glycuronidase has been cloned from the F.
heparinum genome and its subsequent recombinant expression in E.
coli as a soluble, highly active enzyme has been accomplished.
Thus, in one aspect the present invention provides for a
substantially pure .DELTA.4,5 glycuronidase. In one embodiment of
the invention the substantially pure .DELTA.4,5 glycuronidase is a
recombinantly produced glycuronidase. Recombinant expression may be
accomplished in one embodiment with an expression vector. An
expression vector may be a nucleic acid for SEQ ID NO:2, optionally
operably linked to a promoter. In another embodiment the expression
vector may be a nucleic acid for SEQ ID NO:4 or a variant thereof
also optionally linked to a promoter. In one embodiment the
substantially pure .DELTA.4,5 glycuronidase is produced using a
host cell comprising the expression vector. In another embodiment
the substantially pure .DELTA.4,5 glycuronidase is a synthetic
glycuronidase.
[0010] In another aspect the glycuronidase of the invention is a
polypeptide having an amino acid sequence of SEQ ID NO:1, or a
functional variant thereof. In yet another aspect the polypeptide
has an amino acid sequence of SEQ ID NO:3, or a functional variant
thereof.
[0011] In yet another aspect of the invention the polypeptide of
the .DELTA.4,5 glycuronidase is an isolated polypeptide. The
isolated polypeptide in some embodiments is set forth in SEQ ID
NO:1 or is a functional variant thereof. In other embodiments the
isolated polypeptide is set forth in SEQ ID NO:3 or a functional
variant thereof.
[0012] In one aspect, the invention is a composition comprising, an
isolated .DELTA.4,5 unsaturated glycuronidase having a higher
specific activity than native glycuronidase. In some embodiments,
the specific activity is at least about 60 picomoles of substrate
hydrolyzed per minute per picomole of enzyme. In one embodiment the
.DELTA.4,5 glycuronidase has a specific activity that is about 2
fold higher than the native enzyme. In another embodiment the
.DELTA.4,5 glycuronidase has a specific activity that is about 3
fold higher. The specific activity of the .DELTA.4,5 glycuronidase
in other embodiments may be about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100 or any integer therebetween fold higher
than the activity of the native enzyme.
[0013] In yet another aspect of the invention an isolated nucleic
acid molecule is provided. The nucleic acid is (a) nucleic acid
molecules which hybridize under stringent conditions to a nucleic
acid molecule having a nucleotide sequence set forth as SEQ ID NO:2
or SEQ ID NO:4, and which code for .DELTA.4,5 unsaturated
glycuronidase having an amino acid sequence set forth as SEQ ID
NO:1 or SEQ ID NO:3, respectively, (b) nucleic acid molecules that
differ from the nucleic acid molecules of (a) in codon sequence due
to degeneracy of the genetic code, or (c) complements of (a) or
(b). In one embodiment the isolated nucleic acid molecule codes for
SEQ ID NO:1. In another embodiment the isolated nucleic acid
molecule comprises the nucleotide sequence set forth as SEQ ID
NO:2. In still other embodiments the isolated nucleic acid molecule
codes for SEQ ID NO:3 and in yet other embodiments the isolated
nucleic acid molecule comprises the nucleotide sequence set forth
as SEQ ID NO:4.
[0014] Pharmaceutical compositions of any of the compositions or
vectors described herein are also encompassed in the invention.
[0015] In other aspects the invention relates to a method of
cleaving a glycosaminoglycan with a .DELTA.4,5 unsaturated
glycuronidase. The method may be performed by contacting a
glycosaminoglycan with the glycuronidase in an effective amount to
cleave the glycosaminoglycan. In one embodiment the invention is a
glycosaminoglycan prepared according to this method.
[0016] In other aspects the invention also provides a method of
cleaving a glycosaminoglycan comprised of at least one disaccharide
unit. The method may be performed by contacting the
glycosaminoglycan with a glycuronidase of the invention in an
effective amount to cleave the glycosaminoglycan. In some
embodiments the glycosaminoglycan is a long chain saccharide. In
other embodiments the glycosaminoglycan does not contain a 2-0
sulfated uronidate or it does not contain N-substituted
glycosamine. In yet another embodiment the glycosaminoglycan is 6-0
sulfated. The disaccharide units in some embodiments are
.DELTA.UH.sub.NAc; .DELTA.UH.sub.NAc,6S; .DELTA.UH.sub.NS,6S; or
.DELTA.UH.sub.NS. In another embodiment the invention also provides
for the products of the cleavage of a glycosaminoglycan with the
.DELTA.4,5 glycuronidase. In some embodiments the glycuronidase is
used to generate a LMWH.
[0017] The present invention also provides methods for the analysis
of glycosaminoglycan. In one aspect the invention is a method of
analyzing a glycosaminoglycan by contacting a glycosaminoglycan
with the glycuronidase of the invention in an effective amount to
analyze the glycosaminoglycan. In one embodiment the method is a
method for identifying the presence of a particular
glycosaminoglycan in a sample. In another embodiment the method is
a method for determining the identity of a glycosaminoglycan in a
sample. In yet another embodiment the method is a method for
determining the purity of a glycosaminoglycan in a sample. In still
a further embodiment the method is a method for determining the
composition of a glycosaminoglycan in a sample. In another
embodiment the method is a method for determining the sequence of
saccharide units in a glycosaminoglycan. In other embodiments,
these methods may also comprise an additional analytical technique
such as mass spectrometry, gel electrophoresis, capillary
electrophoresis and HPLC. In some embodiments the glycosaminoglycan
is LMWH.
[0018] In other aspects the invention is a method of removing
heparin from a heparin containing fluid by contacting a heparin
containing fluid with a glycuronidase of the invention in an
effective amount to remove heparin from the heparin containing
fluid. In one embodiment the glycuronidase is immobilized on a
solid support. In another embodiment a heparinase is also provided
and the heparinase is also immobilized on the solid support.
[0019] In another aspect the invention is a method of inhibiting
angiogenesis by administering to a subject in need thereof an
effective amount of any of the pharmaceutical preparations
described herein for inhibiting angiogenesis.
[0020] In another aspect a method of treating cancer by
administering to a subject in need thereof an effective amount of
any of the pharmaceutical preparations described herein for
treating cancer is also provided.
[0021] Yet another aspect of the invention is a method of
inhibiting cellular proliferation by administering to a subject in
need thereof an effective amount of any of the pharmaceutical
preparations described herein for inhibiting cellular
proliferation.
[0022] In another aspect a method of treating a coagulation disease
by administering to a subject in need thereof a LMWH prepared using
the glycuronidase of the invention.
[0023] In some embodiments of the methods of the invention the
glycuronidase is used concurrently with or following treatment with
heparinase.
[0024] In other aspects of the invention, the pharmaceutical
compositions and therapeutic methods are provided using the
.DELTA.4,5 unsaturated glycuronidase and the cleaved GAG fragments
alone or in combination.
[0025] Other aspects of the invention provide compositions that
include other enzymes such as heparinase with the .DELTA.4,5
unsaturated glycuronidase.
[0026] In other aspects a pharmaceutical preparation of a
composition or vector of the invention in a pharmaceutically
acceptable carrier is provided.
[0027] Each of the limitations of the invention can encompass
various embodiments of the invention. It is, therefore, anticipated
that each of the limitations of the invention involving any one
element or combinations of elements can be included in each aspect
of the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0028] FIG. 1 depicts the purification of .DELTA.4,5 glycuronidase
from Flavobacterium and resultant proteolysis. A. Gel filtration
chromatography of the purified enzyme. B. Purification of
.DELTA.4,5 peptides by reverse phase HPLC following trypsinization
of the native protein. C. Amino acid sequence of select peptides
isolated in B. Peaks 8, 12, 13, 19, 24 and 26 are SEQ ID NOs:
18-23, respectively.
[0029] FIG. 2 provides a schematic map of .DELTA.4,5 genomic
clones. A. Partial carboxy-terminal clones G5A and G5H (black
arrows) were isolated by hybridization screening of a .lamda.ZAP
Flavobacterial library using probes 1 and 2, respectively. Also
shown is the Eco R1 restriction site delimiting the 5' end of G5A.
B. Strategy to obtain the .DELTA.4,5 5' terminus by Southern
hybridization. Shown are the autoradiogram and its corresponding
restriction map. Genomic DNA was restricted with Eco R1 alone (lane
1) or as a double digest with Hind III (lane 2), Bam H1 (lane3), or
Bgl II (lane 4), respectively. DNA hybridization probe 3 used was
amplified by PCR using N-terminal primers 68 and 74, both of which
are 5' to the Eco R1 site. The Bgl II-Eco R1.about.1.5 kb DNA
fragment (gray bar) was isolated for subcloning and DNA sequencing.
C. Schematic representation of the full-length .DELTA.4,5 gene (1.2
kb) compiled from overlapping clones shown in A. and B.
[0030] FIG. 3 depicts the .DELTA.4,5 glycuronidase gene sequence.
Full-length gene was isolated using methods outlined in FIG. 2. The
amino acid and nucleic acid sequences are given in SEQ ID NOS: 3
and 4, respectively. Shown here are both the coding and flanking
DNA sequences. The CDS (coding sequence) of 1209 base pairs
contains an ORF encoding a putative protein of 402 amino acids.
Initiation and termination codons are highlighted in bold. A
possible Shine-Dalgarno (SD) sequence is boxed. The presumed signal
sequence is underlined and its cleavage site delimited by a
vertical arrow. The Eco R1 restriction site is double-overscored.
Also shown are the degenerate primer pairs (shown as arrows) used
to PCR amplify DNA hybridization probes 1 and 2 as well as the
relative positions of purified .DELTA.4,5 peptides (shaded in gray)
for which direct sequence information was obtained.
[0031] FIG. 4 illustrates the .DELTA.4,5 glycuronidase primary
sequence analyses. A. Hydropathy plot (Kyte-Doolittle). Positive
values represent increasing hydrophobicity. B. Theoretical signal
sequence determination using amino acids 1-65. Indices were
calculated using SignalP V.1.1 using networks trained on
gram-negative bacteria. Putative cleavage site located between G20
and M21 is represented by a vertical arrow. C. CLUSTAL W multiple
alignment of full-length .DELTA.4,5 glycuronidase with select
glucuronyl hydrolases. Protein sequences were selected from an
initial BLASTP search of the protein database. Identical amino
acids are shaded in dark gray, near invariant positions in
charcoal, and conservative substitutions in light gray. Gen Bank
accession numbers are as follows: Bacillus sp. (AB019619);
Streptococcus pneumoniae (AE008410); Streptococcus pyogenes
(AE006517); Agaricus bisporsus (AJ271692); Bactobacillus halodurans
(AP001514).
[0032] FIG. 5 provides results of recombinant
.DELTA.4,5.sup..DELTA.0 protein expression and purification. The
amino acid and nucleic acid sequences are given as SEQ ID NOS: 1
and 2, respectively. SDS-PAGE of .DELTA.4,5 protein fractions at
various purification stages following expression in BL21 (DE3) as a
6.times. HIS N-terminal fusion protein. Shown here is a 12% gel
that is stained with Coomassie-Brilliant blue. Lane 2, lysate from
uninduced bacterial cells; Lane 3, crude cell lysate from induced
cultures; Lane 4, Ni.sup.+2 chelation chromatography purification;
Lane 5, thrombin cleavage to remove N-terminal 6.times. His
purification tag. Molecular weight markers (Lanes 1 and 6) are also
noted.
[0033] FIG. 6 depicts the effects of .DELTA.4,5 glycuronidase
biochemical reaction conditions. A. [NaCl] titration; B. Effect of
reaction temperature C. pH profile. Relative enzyme activities were
derived from the initial rates normalized to 100 mM NaCl (A) or
30.degree. C. (C). k.sub.cat and K.sub.m values for the pH profile
were extrapolated from Michaelis-Menten kinetics as described in
the Methods (and FIG. 8) The disulfated heparin disaccharide
.DELTA.UH.sub.NS,6S was used in all three experiments.
[0034] FIG. 7 depicts a kinetic comparison of native and
recombinant enzymes. Relative specific activities were measured for
both enzyme fractions under identical reaction conditions that
included 200 nM enzyme and 500 .mu.M of the heparin disaccharide
substrate (.DELTA.UHNAc). Flavobacterial .DELTA.4,5 (closed
circles); recombinant .DELTA.4,5 (open circles).
[0035] FIG. 8 illustrates disaccharide substrate specificity. A.
Kinetic profiles for heparin disaccharides of varying sulfation.
Initial rates were determined using 200 nM enzyme under standard
conditions. Vo vs. [S] curves were fit to Michaelis-Menten steady
state kinetics using a non-linear least squares analysis. B.
Lineweaver-Burke representation of the data shown in A.
.DELTA.UH.sub.Nac,6S(.lamda.); .DELTA.UH.sub.Nac(.largecircle.);
.DELTA.UH.sub.NS,6S(.sigma.); .DELTA.H.sub.NS(.DELTA.);
.DELTA.UH.sub.NH2,16S(+) .DELTA.U.sub.2SH.sub.NS(+, no
activity).
[0036] FIG. 9 depicts the tandem use of heparinases and .DELTA.4,5
glycuronidase in HSGAG compositional analyses. 200 .mu.g heparin
was exhaustively digested with heparinases I, II, and III, after
which .DELTA.4,5 was added for a varying length of time.
disaccharide products were resolved by capillary electrophoresis.
Assignment of saccharide composition shown for each peak was
confirmed by MALDI-MS. A., minus .DELTA.4,5 enzyme control; dashed
line, B., minute (partial) .DELTA.4,5 incubation; C., 30 minute
(exhaustive) .DELTA.4,5 incubation.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The invention in some aspects relates to .DELTA.4,5
glycuronidase, substantially pure forms thereof and uses thereof.
In particular the invention arose, in part, from the cloning of
.DELTA.4,5 glycuronidase that now enables one of skill in the art
to produce the enzyme in large quantities and in substantially pure
form. The invention also provides another tool that may be used to
determine the structure of glycosaminoglycans and to help elucidate
their role in cellular processes. It has now also been discovered
that substantially pure preparations of .DELTA.4,5 glycuronidase
having higher specific activity than the enzyme produced from
culture may be produced. The invention also provides for cleavage
of glycosaminoglycans (GAGs) as well as for the analysis of a
sample of GAGs and for their sequencing. This present invention
also provides treatment and prevention methods for cancer through
the control of cellular proliferation, angiogenesis and/or
coagulation disorders with the enzyme and/or its cleavage products
(GAG fragments).
[0038] One aspect of the invention enables one of ordinary skill in
the art, in light of the present disclosure, to produce
substantially pure preparations of the .DELTA.4,5 glycuronidase by
standard technology, including recombinant technology, direct
synthesis, mutagenesis, etc. For instance, using recombinant
technology one may produce substantially pure preparations of the
.DELTA.4,5 glycuronidase having the amino acid sequences of SEQ ID
NO:1 or encoded by the nucleic acid sequence of SEQ ID NO:2. In
other aspects of the invention substantially pure preparations of
the .DELTA.4,5 glycuronidase having the amino acid sequences of SEQ
ID NO:3 or encoded by the nucleic acid sequence of SEQ ID NO:4 can
be prepared. One of skill in the art may also substitute
appropriate codons to produce the desired amino acid substitutions
in SEQ ID NOs:1 or 3 by standard site-directed mutagenesis
techniques. One may also use any sequence which differs from the
nucleic acid equivalents of SEQ ID NO:1 or 3 only due to the
degeneracy of the genetic code as the starting point for site
directed mutagenesis. The mutated nucleic acid sequence may then be
ligated into an appropriate expression vector and expressed in a
host such as E. coli. The resultant .DELTA.4,5 glycuronidase may
then be purified by techniques, including those disclosed
below.
[0039] As used herein, the term "substantially pure" means that the
proteins are essentially free of other substances to an extent
practical and appropriate for their intended use. In particular,
the proteins are sufficiently pure and are sufficiently free from
other biological constituents of their hosts cells so as to be
useful in, for example, protein sequencing, or producing
pharmaceutical preparations.
[0040] As used herein, a "substantially pure .DELTA.4,5 unsaturated
glycuronidase" is a preparation of .DELTA.4,5 unsaturated
glycuronidase which has been isolated or synthesized and which is
greater than about 90% free of contaminants. A contaminant is a
substance with which the .DELTA.4,5 unsaturated glycuronidase is
ordinarily associated in nature that interfere with the activity of
the enzyme. Preferably, the material is greater than about 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or even greater than about 99%
free of contaminants. The degree of purity may be assessed by means
known in the art. One method for assessing the purity of the
material may be accomplished through the use of specific activity
assays. The native .DELTA.4,5 glycuronidase which has been
described in the prior art as being isolated from F. heparinum has
low specific activity because of impurities inherent in harvesting
the enzyme from bacterial cultures of F. heparinum.
[0041] The invention also provides isolated polypeptides (including
whole proteins and partial proteins), of .DELTA.4,5 glycuronidase
having the amino acid sequence of SEQ ID NO:1 and functional
variants thereof. Isolated polypeptides are also provided by the
invention that have the amino acid sequence of SEQ ID NO:3.
Polypeptides can be isolated from biological samples, and can also
be expressed recombinantly in a variety of prokaryotic and
eukaryotic expression systems by constructing an expression vector
appropriate to the expression system, introducing the expression
vector into the expression system, and isolating the recombinantly
expressed protein. Polypeptides can also be synthesized chemically
using well-established methods of peptide synthesis.
[0042] As used herein with respect to polypeptides, "isolated"
means separated from its native environment and present in
sufficient quantity to permit its identification or use. Isolated,
when referring to a protein or polypeptide, means, for example: (i)
selectively produced by expression cloning or (ii) purified as by
chromatography or electrophoresis. Isolated proteins or
polypeptides may be, but need not be, substantially pure. Because
an isolated polypeptide may be admixed with a pharmaceutically
acceptable carrier in a pharmaceutical preparation, the polypeptide
may comprise only a small percentage by weight of the preparation.
The polypeptide is nonetheless isolated in that it has been
separated from the substances with which it may be associated in
living systems, i.e., isolated from other proteins.
[0043] Thus the term ".DELTA.4,5 glycuronidase polypeptides"
embraces variants as well as the natural .DELTA.4,5 glycuronidase
polypeptides. As used herein, a "variant" of a .DELTA.4,5
glycuronidase polypeptide is a polypeptide which contains one or
more modifications to the primary amino acid sequence of a
naturally occurring .DELTA.4,5 glycuronidase polypeptide. Variants
include modified .DELTA.4,5 glycuronidase polypeptides that do not
have altered function relative to the polypeptide of the unmodified
(naturally occurring) sequence. Variants also include .DELTA.4,5
glycuronidase polypeptides with altered function. Modifications
which create a .DELTA.4,5 glycuronidase polypeptide variant are
typically made to the nucleic acid which encodes the .DELTA.4,5
glycuronidase polypeptide, and can include deletions, point
mutations, truncations, amino acid substitutions and addition of
amino acids or non-amino acid moieties to: 1) enhance a property of
a .DELTA.4,5 glycuronidase polypeptide, such as protein stability
in an expression system or the stability of protein-protein
binding; 2) provide a novel activity or property to a .DELTA.4,5
glycuronidase polypeptide, such as addition of a detectable moiety;
or 3) to provide equivalent or better interaction with other
molecules (e.g., heparin). Alternatively, modifications can be made
directly to the polypeptide, such as by cleavage, addition of a
linker molecule, addition of a detectable moiety, such as biotin,
addition of a fatty acid, and the like. Modifications also embrace
fusion proteins comprising all or part of the .DELTA.4,5
glycuronidase amino acid sequence. One of skill in the art will be
familiar with methods for predicting the effect on protein
conformation of a change in protein sequence, and can thus "design"
a variant .DELTA.4,5 glycuronidase polypeptide according to known
methods. One example of such a method is described by Dahiyat and
Mayo in Science 278:82-87, 1997, whereby proteins can be designed
de novo. The method can be applied to a known protein to vary a
only a portion of the polypeptide sequence. By applying the
computational methods of Dahiyat and Mayo, specific variants of a
polypeptide can be proposed and tested to determine whether the
variant retains a desired conformation.
[0044] Variants can include .DELTA.4,5 glycuronidase polypeptides
which are modified specifically to alter a feature of the
polypeptide unrelated to its physiological activity. For example,
cysteine residues can be substituted or deleted to prevent unwanted
disulfide linkages. Similarly, certain amino acids can be changed
to enhance expression of a .DELTA.4,5 glycuronidase polypeptide by
eliminating proteolysis by proteases in an expression system (e.g.,
dibasic amino acid residues in yeast expression systems in which
KEX2 protease activity is present).
[0045] Mutations of a nucleic acid which encodes a .DELTA.4,5
glycuronidase polypeptide preferably preserve the amino acid
reading frame of the coding sequence, and preferably do not create
regions in the nucleic acid which are likely to hybridize to form
secondary structures, such a hairpins or loops, which can be
deleterious to expression of the variant polypeptide.
[0046] Mutations can be made by selecting an amino acid
substitution, or by random mutagenesis of a selected site in a
nucleic acid which encodes the polypeptide. Variant polypeptides
are then expressed and tested for one or more activities to
determine which mutation provides a variant polypeptide with the
desired properties. Further mutations can be made to variants (or
to non-variant .DELTA.4,5 glycuronidase polypeptides) which are
silent as to the amino acid sequence of the polypeptide, but which
provide preferred codons for translation in a particular host. The
preferred codons for translation of a nucleic acid in, e.g., E.
coli, are well known to those of ordinary skill in the art. Still
other mutations can be made to the noncoding sequences of a
.DELTA.4,5 glycuronidase gene or cDNA clone to enhance expression
of the polypeptide.
[0047] One type of amino acid substitution is referred to as a
"conservative substitution." As used herein, a "conservative amino
acid substitution" or "conservative substitution" refers to an
amino acid substitution in which the substituted amino acid residue
is of similar charge as the replaced residue and is of similar or
smaller size than the replaced residue. Conservative substitutions
of amino acids include substitutions made amongst amino acids
within the following groups: (a) the small non-polar amino acids,
A, M, I, L, and V; (b) the small polar amino acids, G, S, T and C;
(c) the amido amino acids, Q and N; (d) the aromatic amino acids,
F, Y and W; (e) the basic amino acids, K, R and H; and (f) the
acidic amino acids, E and D. Substitutions which are charge neutral
and which replace a residue with a smaller residue may also be
considered "conservative substitutions" even if the residues are in
different groups (e.g., replacement of phenylalanine with the
smaller isoleucine). The term "conservative amino acid
substitution" also refers to the use of amino acid analogs or
variants.
[0048] Methods for making amino acid substitutions, additions or
deletions are well known in the art. The terms "conservative
substitution", "non-conservative substitutions", "non-polar amino
acids", "polar amino acids", and "acidic amino acids" are all used
consistently with the prior art terminology. Each of these terms is
well-known in the art and has been extensively described in
numerous publications, including standard biochemistry text books,
such as "Biochemistry" by Geoffrey Zubay, Addison-Wesley Publishing
Co., 1986 edition, which describes conservative and
non-conservative substitutions, and properties of amino acids which
lead to their definition as polar, non-polar or acidic.
[0049] One skilled in the art will be able to predict the effect of
a substitution by using routine screening assays, preferably the
biological assays described herein. Modifications of peptide
properties including thermal stability, enzymatic activity,
hydrophobicity, susceptibility to proteolytic degradation or the
tendency to aggregate with carriers or into multimers are assayed
by methods well known to the ordinarily skilled artisan. For
additional detailed description of protein chemistry and structure,
see Schulz, G. E. et al., Principles of Protein Structure,
Springer-Verlag, New York, 1979, and Creighton, T. E., Proteins:
Structure and Molecular Principles, W. H. Freeman & Co., San
Francisco, 1984.
[0050] Additionally, some of the amino acid substitutions are
non-conservative substitutions. In certain embodiments where the
substitution is remote from the active or binding sites, the
non-conservative substitutions are easily tolerated provided that
they preserve a tertiary structure characteristic of, or similar
to, native .DELTA.4,5 glycuronidase, thereby preserving the active
and binding sites. Non-conservative substitutions, such as between,
rather than within, the above groups (or two other amino acid
groups not shown above), which will differ more significantly in
their effect on maintaining (a) the structure of the peptide
backbone in the area of the substitution (b) the charge or
hydrophobicity of the molecule at the target site, or (c) the bulk
of the side chain.
[0051] In another set of embodiments an isolated nucleic acid
equivalent of SEQ ID NO:2 encode the substantially pure .DELTA.4,5
glycuronidase of the invention and functional variants thereof. In
still further embodiments isolated nucleic acid equivalents of SEQ
ID NO:4 are also given. According to the invention, isolated
nucleic acid molecules that code for a .DELTA.4,5 glycuronidase
polypeptide are provided and include: (a) nucleic acid molecules
which hybridize under stringent conditions to a molecule selected
from a group consisting of the nucleic acid equivalent of SEQ ID
NO:2 or 4 and which code for a .DELTA.4,5 glycuronidase polypeptide
or parts thereof, (b) deletions, additions and substitutions of (a)
which code for a respective .DELTA.4,5 glycuronidase polypeptide or
parts thereof, (c) nucleic acid molecules that differ from the
nucleic acid molecules of (a) or (b) in codon sequence due to the
degeneracy of the genetic code, and (d) complements of (a), (b) or
(c).
[0052] The invention also includes degenerate nucleic acids which
include alternative codons to those present in the naturally
occurring materials. For example, serine residues are encoded by
the codons TCA, AGT, TCC, TCG, TCT and AGC. Each of the six codons
is equivalent for the purposes of encoding a serine residue. Thus,
it will be apparent to one of ordinary skill in the art that any of
the serine-encoding nucleotide triplets may be employed to direct
the protein synthesis apparatus, in vitro or in vivo, to
incorporate a serine residue into an elongating .DELTA.4,5
glycuronidase polypeptide. Similarly, nucleotide sequence triplets
which encode other amino acid residues include, but are not limited
to: CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA
and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine
codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT
(isoleucine codons). Other amino acid residues may be encoded
similarly by multiple nucleotide sequences. Thus, the invention
embraces degenerate nucleic acids that differ from the biologically
isolated nucleic acids in codon sequence due to the degeneracy of
the genetic code.
[0053] As used herein with respect to nucleic acids, the term
"isolated" means: (i) amplified in vitro by, for example,
polymerase chain reaction (PCR); (ii) recombinantly produced by
cloning; (iii) purified, as by cleavage and gel separation; or (iv)
synthesized by, for example, chemical synthesis. An isolated
nucleic acid is one which is readily manipulable by recombinant DNA
techniques well known in the art. Thus, a nucleotide sequence
contained in a vector in which 5' and 3' restriction sites are
known or for which polymerase chain reaction (PCR) primer sequences
have been disclosed is considered isolated but a nucleic acid
sequence existing in its naturally occurring state in its natural
host is not. An isolated nucleic acid may be substantially
purified, but need not be. For example, a nucleic acid that is
isolated within a cloning or expression vector is not pure in that
it may comprise only a tiny percentage of the material in the cell
in which it resides. Such a nucleic acid is isolated, however, as
the term is used herein because it is readily manipulable by
standard techniques known to those of ordinary skill in the
art.
[0054] One embodiment of the invention provides .DELTA.4,5
glycuronidase that is recombinantly produced. Such molecules may be
recombinantly produced using a vector including a coding sequence
operably joined to one or more regulatory sequences. As used
herein, a coding sequence and regulatory sequences are said to be
"operably joined" when they are covalently linked in such a way as
to place the expression or transcription of the coding sequence
under the influence or control of the regulatory sequences. If it
is desired that the coding sequences be translated into a
functional protein the coding sequences are operably joined to
regulatory sequences. Two DNA sequences are said to be operably
joined if induction of a promoter in the 5' regulatory sequences
results in the transcription of the coding sequence and if the
nature of the linkage between the two DNA sequences does not (1)
result in the introduction of a frame-shift mutation, (2) interfere
with the ability of the promoter region to direct the transcription
of the coding sequences, or (3) interfere with the ability of the
corresponding RNA transcript to be translated into a protein. Thus,
a promoter region would be operably joined to a coding sequence if
the promoter region were capable of effecting transcription of that
DNA sequence such that the resulting transcript might be translated
into the desired protein or polypeptide.
[0055] The precise nature of the regulatory sequences needed for
gene expression may vary between species or cell types, but shall
in general include, as necessary, 5' non-transcribing and 5'
non-translating sequences involved with initiation of transcription
and translation respectively, such as a TATA box, capping sequence,
CAAT sequence, and the like. Especially, such 5' non-transcribing
regulatory sequences will include a promoter region which includes
a promoter sequence for transcriptional control of the operably
joined gene. Promoters may be constitutive or inducible. Regulatory
sequences may also include enhancer sequences or upstream activator
sequences, as desired.
[0056] As used herein, a "vector" may be any of a number of nucleic
acids into which a desired sequence may be inserted by restriction
and ligation for transport between different genetic environments
or for expression in a host cell. Vectors are typically composed of
DNA although RNA vectors are also available. Vectors include, but
are not limited to, plasmids and phagemids. A cloning vector is one
which is able to replicate in a host cell, and which is further
characterized by one or more endonuclease restriction sites at
which the vector may be cut in a determinable fashion and into
which a desired DNA sequence may be ligated such that the new
recombinant vector retains its ability to replicate in the host
cell. In the case of plasmids, replication of the desired sequence
may occur many times as the plasmid increases in copy number within
the host bacterium, or just a single time per host as the host
reproduces by mitosis. In the case of phage, replication may occur
actively during a lytic phase or passively during a lysogenic
phase. An expression vector is one into which a desired DNA
sequence may be inserted by restriction and ligation such that it
is operably joined to regulatory sequences and may be expressed as
an RNA transcript. Vectors may further contain one or more marker
sequences suitable for use in the identification of cells which
have or have not been transformed or transfected with the vector.
Markers include, for example, genes encoding proteins which
increase or decrease either resistance or sensitivity to
antibiotics or other compounds, genes which encode enzymes whose
activities are detectable by standard assays known in the art
(e.g., .beta.-galactosidase or alkaline phosphatase), and genes
which visibly affect the phenotype of transformed or transfected
cells, hosts, colonies or plaques. Preferred vectors are those
capable of autonomous replication and expression of the structural
gene products present in the DNA segments to which they are
operably joined.
[0057] As used herein, the term "stringent conditions" refers to
parameters known to those skilled in the art. One example of
stringent conditions is hybridization at 65.degree. C. in
hybridization buffer (3.5.times.SSC, 0.02% Ficoll, 0.02% polyvinyl
pyrolidone, 0.02% bovine serum albumin (BSA), 25 mM
NaH.sub.2PO.sub.4 (pH7), 0.5% SDS, 2 mM EDTA). SSC is 0.15M sodium
chloride/0.15M sodium citrate, pH7; SDS is sodium dodecylsulphate;
and EDTA is ethylene diamine tetra acetic acid. There are other
conditions, reagents, and so forth which can be used, which result
in the same degree of stringency. A skilled artisan will be
familiar with such conditions, and thus they are not given
here.
[0058] The skilled artisan also is familiar with the methodology
for screening cells for expression of such molecules, which then
are routinely isolated, followed by isolation of the pertinent
nucleic acid. Thus, homologs and alleles of the substantially pure
.DELTA.4,5 glycuronidase of the invention, as well as nucleic acids
encoding the same, may be obtained routinely, and the invention is
not intended to be limited to the specific sequences disclosed. It
will be understood that the skilled artisan will be able to
manipulate the conditions in a manner to permit the clear
identification of homologs and alleles of the .DELTA.4,5
glycuronidase nucleic acids of the invention. The skilled artisan
also is familiar with the methodology for screening cells and
libraries for expression of such molecules which then are routinely
isolated, followed by isolation of the pertinent nucleic acid
molecule and sequencing.
[0059] In general homologs and alleles typically will share at
least about 40% nucleotide identity and/or at least about 50% amino
acid identity with the equivalents of SEQ ID Nos: 2 and 1,
respectively. Homologs and alleles of the invention are also
intended to encompass the nucleic acid and amino acid equivalents
of SEQ ID Nos: 4 and 3, respectively. In some instances sequences
will share at least about 50% nucleotide identity and/or at least
about 65% amino acid identity and in still other instances
sequences will share at least about 60% nucleotide identity and/or
at least about 75% amino acid identity. The homology can be
calculated using various, publicly available software tools
developed by NCBI (Bethesda, Md.) that can be obtained through the
internet (ftp:/ncbi.nlm.nih.gov/pub/). Exemplary tools include the
BLAST system available at http:H/wwww.ncbi.nlm.nih.gov. Pairwise
and ClustalW alignments (BLOSUM30 matrix setting) as well as
Kyte-Doolittle hydropathic analysis can be obtained using the
MacVetor sequence analysis software (Oxford Molecular Group).
Watson-Crick complements of the foregoing nucleic acids also are
embraced by the invention.
[0060] In screening for .DELTA.4,5 glycuronidase related genes,
such as homologs and alleles of .DELTA.4,5 glycuronidase, a
Southern blot may be performed using the foregoing conditions,
together with a radioactive probe. After washing the membrane to
which the DNA is finally transferred, the membrane can be placed
against X-ray film or a phosphoimager plate to detect the
radioactive signal.
[0061] For prokaryotic systems, plasmid vectors that contain
replication sites and control sequences derived from a species
compatible with the host may be used. Examples of suitable plasmid
vectors include pBR322, pUC18, pUC19 and the like; suitable phage
or bacteriophage vectors include .lamda.gt10, .lamda.gt11 and the
like; and suitable virus vectors include pMAM-neo, pKRC and the
like. Preferably, the selected vector of the present invention has
the capacity to autonomously replicate in the selected host cell.
Useful prokaryotic hosts include bacteria such as E. coli,
Flavobacterium heparinum, Bacillus, Streptomyces, Pseudomonas,
Salmonella, Serratia, and the like.
[0062] To express the substantially pure .DELTA.4,5 glycuronidase
of the invention in a prokaryotic cell, it is desirable to operably
join the nucleic acid sequence of a substantially pure .DELTA.4,5
glycuronidase of the invention to a functional prokaryotic
promoter. Such promoter may be either constitutive or, more
preferably, regulatable (i.e., inducible or derepressible).
Examples of constitutive promoters include the int promoter of
bacteriophage .lamda., the bla promoter of the .beta.-lactamase
gene sequence of pBR322, and the CAT promoter of the
chloramphenicol acetyl transferase gene sequence of pPR325, and the
like. Examples of inducible prokaryotic promoters include the major
right and left promoters of bacteriophage .lamda. (P.sub.L and
P.sub.R), the trp, recA, lacZ lacI, and gal promoters of E. coli,
the .alpha.-amylase (Ulmanen et al., J. Bacteriol. 162:176-182
(1985)) and the .zeta.-28-specific promoters of B. subtilis (Gilman
et al., Gene sequence 32:11-20 (1984)), the promoters of the
bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of
the Bacilli, Academic Press, Inc., NY (1982)), and Streptomyces
promoters (Ward et al., Mol. Gen. Genet. 203:468-478 (1986)).
[0063] Prokaryotic promoters are reviewed by Glick (J. Ind.
Microbiol. 1:277-282 (1987)); Cenatiempo (Biochimie 68:505-516
(1986)); and Gottesman (Ann. Rev. Genet. 18:415-442 (1984)).
[0064] Proper expression in a prokaryotic cell also requires the
presence of a ribosome binding site upstream of the encoding
sequence. Such ribosome binding sites are disclosed, for example,
by Gold et al. (Ann. Rev. Microbiol. 35:365-404 (1981)).
[0065] Because prokaryotic cells may not produce the .DELTA.4,5
glycuronidase of the invention with normal eukaryotic
glycosylation, expression of the .DELTA.4,5 glycuronidase of the
invention of the eukaryotic hosts is useful when glycosylation is
desired. Preferred eukaryotic hosts include, for example, yeast,
fungi, insect cells, and mammalian cells, either in vivo or in
tissue culture. Mammalian cells which may be useful as hosts
include HeLa cells, cells of fibroblast origin such as VERO or
CHO-K1, or cells of lymphoid origin, such as the hybridoma
SP2/0-AG14 or the myeloma P3.times.63Sg8, and their derivatives.
Preferred mammalian host cells include SP2/0 and J558L, as well as
neuroblastoma cell lines such as IMR 332 that may provide better
capacities for correct post-translational processing. Embryonic
cells and mature cells of a transplantable organ also are useful
according to some aspects of the invention.
[0066] In addition, plant cells are also available as hosts, and
control sequences compatible with plant cells are available, such
as the nopaline synthase promoter and polyadenylation signal
sequences.
[0067] Another preferred host is an insect cell, for example in
Drosophila larvae. Using insect cells as hosts, the Drosophila
alcohol dehydrogenase promoter can be used (Rubin, Science
240:1453-1459 (1988)). Alternatively, baculovirus vectors can be
engineered to express large amounts of the .DELTA.4,5 glycuronidase
of the invention in insect cells (Jasny, Science 238:1653 (1987);
Miller et al., In: Genetic Engineering (1986), Setlow, J. K., et
al., eds., Plenum, Vol. 8, pp. 277-297).
[0068] Any of a series of yeast gene sequence expression systems
which incorporate promoter and termination elements from the genes
coding for glycolytic enzymes and which are produced in large
quantities when the yeast are grown in media rich in glucose may
also be utilized. Known glycolytic gene sequences can also provide
very efficient transcriptional control signals. Yeast provide
substantial advantages in that they can also carry out
post-translational peptide modifications. A number of recombinant
DNA strategies exist which utilize strong promoter sequences and
high copy number plasmids which can be utilized for production of
the desired proteins in yeast. Yeast recognize leader sequences on
cloned mammalian gene sequence products and secrete peptides
bearing leader sequences (i.e., pre-peptides).
[0069] A wide variety of transcriptional and translational
regulatory sequences may be employed, depending upon the nature of
the host. The transcriptional and translational regulatory signals
may be derived from viral sources, such as adenovirus, bovine
papilloma virus, simian virus, or the like, where the regulatory
signals are associated with a particular gene sequence which has a
high level of expression. Alternatively, promoters from mammalian
expression products, such as actin, collagen, myosin, and the like,
may be employed. Transcriptional initiation regulatory signals may
be selected which allow for repression or activation, so that
expression of the gene sequences can be modulated. Of interest are
regulatory signals that are temperature-sensitive so that by
varying the temperature, expression can be repressed or initiated,
or which are subject to chemical (such as metabolite)
regulation.
[0070] As discussed above, expression of the .DELTA.4,5
glycuronidase of the invention in eukaryotic hosts is accomplished
using eukaryotic regulatory regions. Such regions will, in general,
include a promoter region sufficient to direct the initiation of
RNA synthesis. Preferred eukaryotic promoters include, for example,
the promoter of the mouse metallothionein I gene sequence (Hamer et
al., J Mol. Appl. Gen. 1:273-288 (1982)); the TK promoter of Herpes
virus (McKnight, Cell 31:355-365 (1982)); the SV40 early promoter
(Benoist et al., Nature (London) 290:304-310 (1981)); the yeast
gal4 gene sequence promoter (Johnston et al., Proc. Natl. Acad.
Sci. (USA) 79:6971-6975 (1982); Silver et al., Proc. Natl. Acad.
Sci. (USA) 81:5951-5955 (1984)).
[0071] As is widely known, translation of eukaryotic mRNA is
initiated at the codon which encodes the first methionine. For this
reason, it is preferable to ensure that the linkage between a
eukaryotic promoter and a DNA sequence which encodes the .DELTA.4,5
glycuronidase of the invention does not contain any intervening
codons which are capable of encoding a methionine (i.e., AUG). The
presence of such codons results either in the formation of a fusion
protein (if the AUG codon is in the same reading frame as the
.DELTA.4,5 glycuronidase of the invention coding sequence) or a
frame-shift mutation (if the AUG codon is not in the same reading
frame as the .DELTA.4,5 glycuronidase of the invention coding
sequence).
[0072] In one embodiment, a vector is employed which is capable of
integrating the desired gene sequences into the host cell
chromosome. Cells which have stably integrated the introduced DNA
into their chromosomes can be selected by also introducing one or
more markers which allow for selection of host cells which contain
the expression vector. The marker may, for example, provide for
prototrophy to an auxotrophic host or may confer biocide resistance
to, e.g., antibiotics, heavy metals, or the like. The selectable
marker gene sequence can either be directly linked to the DNA gene
sequences to be expressed, or introduced into the same cell by
co-transfection. Additional elements may also be needed for optimal
synthesis of the .DELTA.4,5 glycuronidase mRNA. These elements may
include splice signals, as well as transcription promoters,
enhancers, and termination signals. cDNA expression vectors
incorporating such elements include those described by Okayama,
Molec. Cell. Biol. 3:280 (1983).
[0073] In a preferred embodiment, the introduced sequence will be
incorporated into a plasmid or viral vector capable of autonomous
replication in the recipient host. Any of a wide variety of vectors
may be employed for this purpose. Factors of importance in
selecting a particular plasmid or viral vector include: the ease
with which recipient cells that contain the vector may be
recognized and selected from those recipient cells which do not
contain the vector; the number of copies of the vector which are
desired in a particular host; and whether it is desirable to be
able to "shuttle" the vector between host cells of different
species. Preferred prokaryotic vectors include plasmids such as
those capable of replication in E. coli (such as, for example,
pBR322, ColE1, pSC101, pACYC 184, and .pi.VX). Such plasmids are,
for example, disclosed by Sambrook, et al. (Molecular Cloning. A
Laboratory Manual, second edition, edited by Sambrook, Fritsch,
& Maniatis, Cold Spring Harbor Laboratory, 1989)). Bacillus
plasmids include pC194, pC221, pT127, and the like. Such plasmids
are disclosed by Gryczan (In: The Molecular Biology of the Bacilli,
Academic Press, NY (1982), pp. 307-329). Suitable Streptomyces
plasmids include pIJ101 (Kendall et al., J. Bacteriol.
169:4177-4183 (1987)), and streptomyces bacteriophages such as
.phi.C31 (Chater et al., In: Sixth International Symposium on
Actinomycetales Biology, Akademiai Kaido, Budapest, Hungary (1986),
pp. 45-54). Pseudomonas plasmids are reviewed by John et al. (Rev.
Infect. Dis. 8:693-704 (1986)), and Izaki (Jpn. J. Bacteriol.
33:729-742 (1978)).
[0074] Preferred eukaryotic plasmids include, for example, BPV,
EBV, SV40, 2-micron circle, and the like, or their derivatives.
Such plasmids are well known in the art (Botstein et al., Miami
Wntr. Symp. 19:265-274 (1982); Broach, In: The Molecular Biology of
the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y., p. 445-470 (1981);
Broach, Cell 28:203-204 (1982); Bollon et al., J. Clin. Hematol.
Oncol. 10:39-48 (1980); Maniatis, In: Cell Biology: A Comprehensive
Treatise, Vol. 3, Gene Sequence Expression, Academic Press, NY, pp.
563-608 (1980)). Other preferred eukaryotic vectors are viral
vectors. For example, and not by way of limitation, the pox virus,
herpes virus, adenovirus and various retroviruses may be employed.
The viral vectors may include either DNA or RNA viruses to cause
expression of the insert DNA or insert RNA.
[0075] Once the vector or DNA sequence containing the construct(s)
has been prepared for expression, the DNA construct(s) may be
introduced into an appropriate host cell by any of a variety of
suitable means, i.e., transformation, transfection, conjugation,
protoplast fusion, electroporation, calcium
phosphate-precipitation, direct microinjection, and the like.
Additionally, DNA or RNA encoding the .DELTA.4,5 glycuronidase of
the invention may be directly injected into cells or may be
impelled through cell membranes after being adhered to
microparticles. After the introduction of the vector, recipient
cells are grown in a selective medium, which selects for the growth
of vector-containing cells. Expression of the cloned gene
sequence(s) results in the production of the .DELTA.4,5
glycuronidase of the invention. This can take place in the
transformed cells as such, or following the induction of these
cells to differentiate (for example, by administration of
bromodeoxyuracil to neuroblastoma cells or the like).
[0076] The present invention also provides for the use of
.DELTA.4,5 glycuronidase as an enzymatic tool due to its substrate
specificity and specific activity. In a direct and more rigorous
comparison between the recombinant and native enzymes, it was found
that at least some of the recombinant enzyme
(.DELTA.4,5.sup..DELTA.20) possessed at least about two-fold higher
and in some cases a roughly about three-fold higher specific
activity relative to the native Flavobacterial enzyme when measured
under identical reaction conditions. Additionally, the activity of
a cloned enzyme is not compromised by its recombinant expression in
E. coli.
[0077] The recombinant .DELTA.4,5 glycuronidase exhibited a sharp
ionic strength dependence. These results are interesting given both
the ionic character of the disulfated heparin disaccharide used in
the experiments described below as well as the many ionic residues
present within the enzyme that may function in substrate binding
and/or catalysis; many of these charged residues are conserved in
structurally and functionally related enzymes. From a substrate
perspective, all of the unsaturated disaccharides examined possess
a negative charge (at pH 6.4) due to the C6 carboxylate of the
uronic acid. It is possible that this acid acts as a critical
structural determinant, especially given its proximity to the
.DELTA.4,5 bond. Charge neutralization of 6-O sulfate (e.g., in
.DELTA.UH.sub.NS,6S) could possibly be another contributing factor.
From the enzyme perspective, the recombinant glycuronidase
(.DELTA.4,5.sup..DELTA.20) does possess 47 basic residues
(theoretical pI of 8.5), including R151 whose position is
invariantly conserved among the different glycuronidases examined.
R151 may possibly interact with the uronic-acid carboxylate. At the
same time, .DELTA.4,5 also possesses 44 acidic residues. At least
ten of these positions are highly conserved. Charge masking of some
of these ionic residues (either acidic or basic) by increasing salt
concentration might interfere with enzymatic activity. A similar
observation of this ionic strength dependency has been made for the
heparinases [Ernst S, et al Expression in Escherichia coli,
purification and characterization of heparinase I from
Flavobacterium heparinum. Biochem J. Apr. 15; 1996 315 (pt 2):
589-97.]
[0078] A bell-shaped pH profile with a 6.4 optimum was also
observed in the present invention. The 6.4 pH optimum generally
agrees with results originally reported for the F. heparinum
.DELTA.4,5 as well as for more recent results published for an
unsaturated glucuronyl hydrolase purified from Bacillus sp. GL1
[Hashimoto, W., et al. (1999) Arch Biochem Biophys 368, 367-74].
While there are 11 histidines present within the primary sequence,
three histidines (H115, H201, and H218) appear to be highly
conserved. Interestingly, catalytically critical histidines also
exist in all three heparin lyases [Pojasek, K., et al. (2000)
Biochemistry 39, 4012-9] as well as chondroitin AC lyase [Huang,
W., et al. (2001) Biochemistry 40, 2359-72] from Flavobacterium
heparinum. While these two classes of enzymes cleave
glycosaminoglycans by somewhat different mechanisms (i.e.,
.beta.-elmination vs. hydrolysis), both would presumably involve
acid-base catalysis, viz the imidazole.
[0079] The question of substrate specificity has now been
considered from three structural perspectives: (1) the nature of
the glycosidic linkage; (2) the relative sulfation pattern of the
unsaturated disaccharide; and (3) the role of saccharide chain
length (e.g., di-vs. tetrasaccharide). Our results indicate that
for the recombinant .DELTA.4,5 glycuronidase, there is an
unambiguous preference for the 1.fwdarw.4 linkage over the
1.fwdarw.3 linkage making heparin rather than chondroitin/dermatan
and/or hyaluronan the best substrate. It should be noted, however,
that while this linkage position is important, it is not absolute.
Both chondroitin and hyaluronan .DELTA.4,5 disaccharides were
hydrolyzed, albeit at much slower rates and using higher enzyme
concentrations than were required to hydrolyze heparin
disaccharides.
[0080] We also present a kinetic pattern of the .DELTA.4,5
glycuronidase with regard to the specific sulfation within a
heparin disaccharide. First and foremost, we find that unsaturated
saccharides containing a 2-O-sulfated uronidate (.DELTA.U.sub.2S)
at the non-reducing end are in general not cleaved by the
.DELTA.4,5 glycuronidase. Furthermore, the inability of a
2-O-sulfated disaccharide to competitively inhibit the hydrolysis
of non 2-O-containing disaccharide substrates (such as
.DELTA.UH.sub.NAc) further suggests that the presence of a 2-O
sulfate precludes binding of this saccharide to the enzyme.
[0081] In considering the effect of specific sulfate groups present
on the glucosamine, the enzyme may be loosely summarized as having
a graded preference for 6-O-sulfation but a clear selection against
unsubstituted or sulfated amines. This hierarchy is not an absolute
distinction given the fact that all the non 2-O-containing heparin
disaccharides examined were cleaved by the enzyme. Instead, it is
based on relative kinetic parameters. This apparent substrate
discrimination at the N and 6 positions of the glucosamine appears
to be somewhat contextual, especially in the case of 6-O-sulfation.
That is, while 6-0 sulfation may bestow a favorable selectivity to
a saccharide substrate, this positive effect may be offset by the
presence of a deacetylated amine (e.g., .DELTA.UH.sub.NAc6S vs.
.DELTA.UH.sub.NH26S or .DELTA.UH.sub.NS,6S).
[0082] The structural preference the .DELTA.4,5 demonstrates
against 2-O-sulfated uronidates along with a so-called "N-position"
discrimination for the glucosamine may be exploited for use of the
glycuronidase as an analytical tool for the compositional analyses
of glycosaminoglycans. We were able to predict the extent and
relative rates by which specific disaccharide "peaks" would
disappear (i.e., due to the glycuronidase-dependent loss of
absorbance at 232 nm.), based entirely on our kinetically defined
substrate specificity determinations described in the Examples
below. All 2-O-sulfate containing disaccharides tested were
refractory to hydrolysis by the .DELTA.4,5 glycuronidase. On the
other hand, the remaining disaccharides were hydrolyzed in a
time-dependent fashion that corresponded to their relative
substrate specificities (i.e.,
.DELTA.UH.sub.NAc6S>.DELTA.UH.sub.NS,6S>.DELTA.UH.sub.NS).
[0083] From this experiment, another important and surprising
observation was made, namely that the .DELTA.4,5 glycuronidase also
hydrolyzes .DELTA.4,5 unsaturated tetrasaccharides. It is also very
interesting to note that this particular tetrasaccharide is as good
of a substrate as the disaccharide .DELTA.UH.sub.NS. This
observation may argue against a substrate discrimination used by
the enzyme that is negatively based on increasing molecular weight
as was first reported [Hovingh, P. and Linker, A. (1977) Biochem J
165, 287-93].
[0084] Therefore, the invention also provides for the cleavage of
glycosaminoglycans using the substantially pure .DELTA.4,5
glycuronidase described herein. The .DELTA.4,5 glycuronidase of the
invention may be used to specifically cleave an HSGAG by contacting
the HSGAG substrate with the .DELTA.4,5 glycuronidase of the
invention. The invention is useful in a variety of in vitro, in
vivo and ex vivo methods in which it is useful to cleave
HSGAGs.
[0085] As used herein the terms "HSGAG", "GAG", and
"glycosaminoglycans" are used interchangeably to refer to a family
of molecules having heparin-like/heparan sulfate-like structures
and properties. These molecules include but are not limited to low
molecular weight heparin (LMWH), heparin, biotechnologically
prepared heparin, chemically modified heparin, synthetic heparin,
and heparan sulfate. The term "biotechnological heparin"
encompasses heparin that is prepared from natural sources of
polysaccharides which have been chemically modified and is
described for example in Razi et al., Bioche. J. Jul. 15;1995 309
(Pt 2): 465-72. Chemically modified heparin is described in Yates
et al., Carbohydrate Res (1996) November 20;294:15-27, and is known
to those of skill in the art. Synthetic heparin is well known to
those of skill in the art and is described in Petitou, M. et al.,
Bioorg Med Chem Lett. (1999) April 19;9(8):1161-6.
[0086] Analysis of a sample of glycosaminoglycans is also possible
with .DELTA.4,5 glycuronidase alone or in conjunction with other
enzymes. Other HSGAG degrading enzymes include but are not limited
to heparinase-I, heparinase-II, heparinase-III, heparinase-IV,
D-glucuronidase and L-iduronidase, modified versions of
heparinases, variants and functionally active fragments
thereof.
[0087] The methods that may be used to test the specific activity
of .DELTA.4,5 glycuronidase of the present invention are known in
the art, e.g., those described in the Examples. These methods may
also be used to assess the function of variants and functionally
active fragments of .DELTA.4,5 glycuronidase. The k.sub.cat value
may be determined using any enzymatic activity assay to assess the
activity of a .DELTA.4,5 glycuronidase enzyme. Several such assays
are well-known in the art. For instance, an assay for measuring
k.sub.cat is described in (Ernst, S. E., Venkataraman, G., Winkler,
S., Godavarti, R., Langer, R., Cooney, C. and Sasisekharan. R.
(1996) Biochem. J. 315, 589-597. The "native .DELTA.4,5
glycuronidase k.sub.cat value" is the measure of enzymatic activity
of the native .DELTA.4,5 glycuronidase obtained from cell lysates
of F. heparinum also described in the Examples below. Therefore,
based on the disclosure provided herein, those of ordinary skill in
the art will be able to identify other .DELTA.4,5 glycuronidase
molecules having altered enzymatic activity with respect to the
naturally occurring .DELTA.4,5 glycuronidase molecule such as
functional variants.
[0088] The term "specific activity" as used herein refers to the
enzymatic activity of a preparation of .DELTA.4,5 glycuronidase. In
general, it is preferred that the substantially pure and/or
isolated .DELTA.4,5 glycuronidase preparations of the invention
have a specific activity of at least about 60 picomoles of
substrate hydrolized per minute per picomole of enzyme. This
generally corresponds to a k.sub.cat of at least about 10 per
second for the enzyme using a substrate such as heparin
disaccharide .DELTA.UH.sub.NAc.
[0089] Due to the activity of .DELTA.4,5 glycuronidase on
glycosaminoglycans, the product profile produced by a .DELTA.4,5
glycuronidase may be determined by any method known in the art for
examining the type or quantity of degradation product produced by
.DELTA.4,5 glycuronidase alone or in combination with other
enzymes. One of skill in the art will also recognize that the
.DELTA.4,5 glycuronidase may also be used to assess the purity of
glycosaminoglycans in a sample. One preferred method for
determining the type and quantity of product is described in
Rhomberg, A. J. et al., PNAS, v. 95, p. 4176-4181, (April 1998),
which is hereby incorporated in its entirety by reference. The
method disclosed in the Rhomberg reference utilizes a combination
of mass spectrometry and capillary electrophoretic techniques to
identify the enzymatic products produced by heparinase. The
Rhomberg study utilizes heparinase to degrade HSGAGs to produce
HSGAG oligosaccharides. MALDI (Matrix-Assisted Laser Desorption
Ionization) mass spectrometry can be used for the identification
and semiquantitative measurement of substrates, enzymes, and end
products in the enzymatic reaction. The capillary electrophoresis
technique separates the products to resolve even small differences
amongst the products and is applied in combination with mass
spectrometry to quantitate the products produced. Capillary
electrophoresis may even resolve the difference between a
disaccharide and its semicarbazone derivative. Detailed methods for
sequencing polysaccharides and other polymers are disclosed in
co-pending U.S. patent application Ser. Nos. 09/557,997 and
09/558,137, both filed on Apr. 24, 2000 and having common
inventorship. The entire contents of both applications are hereby
incorporated by reference.
[0090] For example, the method is performed by enzymatic digestion,
followed by mass spectrometry and capillary electrophoresis. The
enzymatic assays can be performed in a variety of manners, as long
as the assays are performed identically on the .DELTA.4,5
glycuronidase, so that the results may be compared. In the example
described in the Rhomberg reference, enzymatic reactions are
performed by adding 1 mL of enzyme solution to 5 mL of substrate
solution. The digestion is then carried out at room temperature
(22.degree. C.), and the reaction is stopped at various time points
by removing 0.5 mL of the reaction mixture and adding it to 4.5 mL
of a MALDI matrix solution, such as caffeic acid (approximately 12
mg/mL) and 70% acetonitrile/water. The reaction mixture is then
subjected to MALDI mass spectrometry. The MALDI surface is prepared
by the method of Xiang and Beavis (Xiang and Beavis (1994) Rapid.
Commun. Mass. Spectrom. 8, 199-204). A two-fold lower access of
basic peptide (Arg/Gly).sub.15 is premixed with matrix before being
added to the oligosaccharide solution. A 1 mL aliquot of
sample/matrix mixture containing 1-3 picomoles of oligosaccharide
is deposited on the surface. After crystallization occurs
(typically within 60 seconds), excess liquid is rinsed off with
water. MALDI mass spectrometry spectra is then acquired in the
linear mode by using a PerSeptive Biosystems (Framingham, Mass.)
Voyager Elite reflectron time-of-flight instrument fitted with a
337 nanometer nitrogen laser. Delayed extraction is used to
increase resolution (22 kV, grid at 93%, guidewire at 0.15%, pulse
delay 150 ns, low mass gate at 1,000, 128 shots averaged). Mass
spectra are calibrated externally by using the signals for
proteinated (Arg/Gly).sub.15 and its complex with the
oligosaccharide.
[0091] Capillary electrophoresis may then be performed on a
Hewlett-Packard.sup.3D CE unit by using uncoated fused silica
capillaries (internal diameter 75 micrometers, outer diameter 363
micrometers, 1.sub.det 72.1 cm, and 1.sub.tot 85 cm). Analytes are
monitored by using UV detection at 230 nm and an extended light
path cell (Hewlett-Packard). The electrolyte is a solution of 10 mL
dextran sulfate and 50 millimolar Tris/phosphoric acid (pH2.5).
Dextran sulfate is used to suppress nonspecific interactions of the
heparin oligosaccharides with a silica wall. Separations are
carried out at 30 kV with the anode at the detector side (reversed
polarity). A mixture of a 1/5-naphtalenedisulfonic acid and
2-naphtalenesulfonic acid (10 micromolar each) is used as an
internal standard.
[0092] Other methods for assessing the product profile may also be
utilized. For instance, other methods include methods which rely on
parameters such as viscosity (Jandik, K. A., Gu, K. and Linhardt,
R. J., (1994), Glycobiology, 4:284-296) or total UV absorbance
(Ernst, S. et al., (1996), Biochem. J, 315:589-597) or mass
spectrometry or capillary electrophoresis alone.
[0093] The .DELTA.4,5 glycuronidase molecules of the invention are
also useful as tools for sequencing HSGAGs. Detailed methods for
sequencing polysaccharides and other polymers are disclosed in
co-pending U.S. patent application Ser. Nos. 09/557,997 and
09/558,137, both filed on Apr. 24, 2000 and having common
inventorship. These methods utilize tools such as heparinases in
the sequencing process. The .DELTA.4,5 glycuronidase of the
invention is useful as such a tool.
[0094] One of ordinary skill in the art, in light of the present
disclosure, is enabled to produce substantially pure preparations
of HSGAG and/or GAG fragment compositions utilizing the .DELTA.4,5
glycuronidase molecules alone or in conjunction with other enzymes.
These GAG fragments have many therapeutic utilities. The
glycuronidase molecules and/or GAG fragments can be used for the
treatment of any type of condition in which GAG fragment therapy
has been identified as a useful therapy, e.g., preventing
coagulation, inhibiting angiogenesis, inhibiting proliferation. The
GAG fragment preparations are prepared from HSGAG sources. A "HSGAG
source" as used herein refers to heparin-like/heparan sulfate-like
glycosaminoglycan composition which can be manipulated to produce
GAG fragments using standard technology, including enzymatic
degradation etc. As described above, HSGAGs include but are not
limited to isolated heparin, chemically modified heparin,
biotechnology prepared heparin, synthetic heparin, heparan sulfate,
and LMWH. Thus HSGAGs can be isolated from natural sources,
prepared by direct synthesis, mutagenesis, etc.
[0095] Thus, the methods of the invention enable one of skill in
the art to prepare or identify an appropriate composition of GAG
fragments, depending on the subject and the disorder being treated.
These compositions of GAG fragments may be used alone or in
combination with the .DELTA.4,5 glycuronidase and/or other enzymes.
Likewise .DELTA.4,5 glycuronidase and/or other enzymes may also be
used to produce GAG fragments in vivo.
[0096] The compositions of the invention can be used for the
treatment of any type of condition in which GAG fragment therapy
has been identified as a useful therapy. Thus, the invention is
useful in a variety of in vitro, in vivo and ex vivo methods in
which therapies are useful. For instance, it is known that GAG
fragments are useful for preventing coagulation, inhibiting cancer
cell growth and metastasis, preventing angiogenesis, preventing
neovascularization, preventing psoriasis. The GAG fragment
compositions may also be used in in vitro assays, such as a quality
control sample.
[0097] Each of these disorders is well-known in the art and is
described, for instance, in Harrison's Principles of Internal
Medicine (McGraw Hill, Inc., New York), which is incorporated by
reference.
[0098] In one embodiment the preparations of the invention are used
for inhibiting angiogenesis. An effective amount for inhibiting
angiogenesis of the GAG fragment preparation is administered to a
subject in need of treatment thereof. Angiogenesis as used herein
is the inappropriate formation of new blood vessels. "Angiogenesis"
often occurs in tumors when endothelial cells secrete a group of
growth factors that are mitogenic for endothelium causing the
elongation and proliferation of endothelial cells which results in
a generation of new blood vessels. Several of the angiogenic
mitogens are heparin binding peptides which are related to
endothelial cell growth factors. The inhibition of angiogenesis can
cause tumor regression in animal models, suggesting a use as a
therapeutic anticancer agent. An effective amount for inhibiting
angiogenesis is an amount of GAG fragment preparation which is
sufficient to diminish the number of blood vessels growing into a
tumor. This amount can be assessed in an animal model of tumors and
angiogenesis, many of which are known in the art.
[0099] The .DELTA.4,5 glycuronidase is, in some embodiments,
immobilized on a support. The glycuronidase may be immobilized to
any type of support but if the support is to be used in vivo or ex
vivo it is desired that the support is sterile and biocompatible. A
biocompatible support is one which would not cause an immune or
other type of damaging reaction when used in a subject. The
.DELTA.4,5 glycuronidase may be immobilized by any method known in
the art. Many methods are known for immobilizing proteins to
supports. A "solid support" as used herein refers to any solid
material to which a polypeptide can be immobilized.
[0100] Solid supports, for example, include but are not limited to
membranes, e.g., natural and modified celluloses such as
nitrocellulose or nylon, Sepharose, Agarose, glass, polystyrene,
polypropylene, polyethylene, dextran, amylases, polyacrylamides,
polyvinylidene difluoride, other agaroses, and magnetite, including
magnetic beads. The carrier can be totally insoluble or partially
soluble and may have any possible structural configuration. Thus,
the support may be spherical, as in a bead, or cylindrical, as in
the inside surface of a test tube or microplate well, or the
external surface of a rod. Alternatively, the surface may be flat
such as a sheet, test strip, bottom surface of a microplate well,
etc.
[0101] The .DELTA.4,5 glycuronidase of the invention may also be
used to remove active GAGs from a GAG containing fluid. A GAG
containing fluid is contacted with the .DELTA.4,5 glycuronidase of
the invention to degrade the GAG. The method is particularly useful
for the ex vivo removal of GAGs from blood. In one embodiment of
the invention the .DELTA.4,5 glycuronidase is immobilized on a
solid support as is conventional in the art. The solid support
containing the immobilized .DELTA.4,5 glycuronidase may be used in
extracorporeal medical devices (e.g. hemodialyzer, pump-oxygenator)
for systemic heparinization to prevent the blood in the device from
clotting. The support membrane containing immobilized .DELTA.4,5
glycuronidase is positioned at the end of the device to neutralize
the GAG before the blood is returned to the body.
[0102] Thus, the .DELTA.4,5 glycuronidase molecules are useful for
treating or preventing disorders associated with coagulation. A
"disease associated with coagulation" as used herein refers to a
condition characterized by an interruption in the blood supply to a
tissue due to a blockage of the blood vessel responsible for
supplying blood to the tissue such as is seen for myocardial or
cerebral infarction. A cerebral ischemic attack or cerebral
ischemia is a form of ischemic condition in which the blood supply
to the brain is blocked. This interruption in the blood supply to
the brain may result from a variety of causes, including an
intrinsic blockage or occlusion of the blood vessel itself, a
remotely originated source of occlusion, decreased perfusion
pressure or increased blood viscosity resulting in inadequate
cerebral blood flow, or a ruptured blood vessel in the subarachnoid
space or intracerebral tissue.
[0103] The .DELTA.4,5 glycuronidase or the GAG fragments generated
therewith may be used alone or in combination with a therapeutic
agent for treating a disease associated with coagulation. Examples
of therapeutics useful in the treatment of diseases associated with
coagulation include anticoagulation agents, antiplatelet agents,
and thrombolytic agents.
[0104] Anticoagulation agents prevent the coagulation of blood
components and thus prevent clot formation. Anticoagulants include,
but are not limited to, heparin, warfarin, coumadin, dicumarol,
phenprocoumon, acenocoumarol, ethyl biscoumacetate, and indandione
derivatives.
[0105] Antiplatelet agents inhibit platelet aggregation and are
often used to prevent thromboembolic stroke in patients who have
experienced a transient ischemic attack or stroke. Antiplatelet
agents include, but are not limited to, aspirin, thienopyridine
derivatives such as ticlopodine and clopidogrel, dipyridamole and
sulfinpyrazone, as well as RGD mimetics and also antithrombin
agents such as, but not limited to, hirudin.
[0106] Thrombolytic agents lyse clots which cause the
thromboembolic stroke.
[0107] Thrombolytic agents have been used in the treatment of acute
venous thromboembolism and pulmonary emboli and are well known in
the art (e.g. see Hennekens et al, J Am Coll Cardiol; v. 25 (7
supp), p. 18S-22S (1995); Holmes, et al, J Am Coll Cardiol; v.25 (7
suppl), p. 10S-17S(1995)). Thrombolytic agents include, but are not
limited to, plasminogen, a.sub.2-antiplasmin, streptokinase,
antistreplase, tissue plasminogen activator (tPA), and urokinase.
"tPA" as used herein includes native tPA and recombinant tPA, as
well as modified forms of tPA that retain the enzymatic or
fibrinolytic activities of native tPA. The enzymatic activity of
tPA can be measured by assessing the ability of the molecule to
convert plasminogen to plasmin. The fibrinolytic activity of tPA
may be determined by any in vitro clot lysis activity known in the
art, such as the purified clot lysis assay described by Carlson,
et. al., Anal. Biochem. 168, 428-435 (1988) and its modified form
described by Bennett, W. F. et al., 1991, J. Biol. Chem.
266(8):5191-5201, the entire contents of which are hereby
incorporated by reference.
[0108] The invention compositions of the invention are useful for
the same purposes as heparinases and the degradation products of
heparinases (HSGAG fragments). Thus, for instance, the compositions
of the invention are useful for treating and preventing cancer cell
proliferation and metastasis. Thus, according to another aspect of
the invention, there is provided methods for treating subjects
having or at risk of having cancer.
[0109] Critically, HSGAGs (along with collagen) are key components
of the cell surface-extracelluar matrix (ECM) interface. While
collagen-like proteins provide the necessary extracellular scaffold
for cells to attach and form tissues, the complex polysaccharides
fill the space created by the scaffold and act as a molecular
sponge by specifically binding and regulating the biological
activities of numerous signaling molecules like growth factors,
cytokines etc. It has recently been recognized that cells
synthesize distinct HSGAG sequences and decorate themselves with
these sequences, using the extraordinary information content
present in the sequences to bind specifically to many signaling
molecules and thereby regulate various biological processes.
[0110] The invention also contemplates the use of therapeutic GAG
fragments for the treatment and prevention of tumor cell
proliferation and metastasis. A "therapeutic GAG fragment" as used
herein refers to a molecule or molecules which are pieces or
fragments of a GAG that have been identified or generated through
the use of the .DELTA.4,5 glycuronidase possibly along with other
naturally occurring and/or modified heparinases. In some aspects
the therapeutic GAG fragments have the same structure as
commercially available LMWH, but are generated using the .DELTA.4,5
glycuronidase.
[0111] The invention also encompasses screening assays for
identifying therapeutic GAG fragments for the treatment of a tumor
and for preventing metastasis. The assays are accomplished by
treating a tumor or isolated tumor cells with .DELTA.4,5
glycuronidase and/or other naturally occurring or modified
heparinases and isolating the resultant GAG fragments.
Surprisingly, these GAG fragments have therapeutic activity in the
prevention of tumor cell proliferation and metastasis. Thus the
invention encompasses individualized therapies, in which a tumor or
portion of a tumor is isolated from a subject and used to prepare
the therapeutic GAG fragments. These therapeutic fragments can be
re-administered to the subject to protect the subject from further
tumor cell proliferation or metastasis or from the initiation of
metastasis if the tumor is not yet metastatic. Alternatively the
fragments can be used in a different subject having the same type
or tumor or a different type of tumor.
[0112] Therapeutic GAG fragments include GAG fragments which have
therapeutic activity in that they prevent the proliferation and/or
metastasis of a tumor cell. Such compounds may be generated using
.DELTA.4,5 glycuronidase to produce therapeutic fragments or they
may be synthesized de novo. Putative GAG fragments can be tested
for therapeutic activity using any of the assays described herein
or known in the art. Thus the therapeutic GAG fragment may be a
synthetic GAG fragment generated based on the sequence of the GAG
fragment identified when the tumor is contacted with .DELTA.4,5
glycuronidase, or having minor variations which do not interfere
with the activity of the compound. Alternatively the therapeutic
GAG fragment may be an isolated GAG fragment produced when the
tumor is contacted with .DELTA.4,5 glycuronidase.
[0113] The invention is useful for treating and/or preventing tumor
cell proliferation or metastasis in a subject. The terms "treat"
and "treating" tumor cell proliferation as used herein refer to
inhibiting completely or partially the proliferation or metastasis
of a cancer or tumor cell, as well as inhibiting any increase in
the proliferation or metastasis of a cancer or tumor cell.
[0114] A "subject having a cancer" is a subject that has detectable
cancerous cells. The cancer may be a malignant or non-malignant
cancer. Cancers or tumors include but are not limited to biliary
tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal
cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver
cancer; lung cancer (e.g. small cell and non-small cell); melanoma;
neuroblastomas; oral cancer; ovarian cancer; pancreas cancer;
prostate cancer; rectal cancer; sarcomas; skin cancer; testicular
cancer; thyroid cancer; and renal cancer, as well as other
carcinomas and sarcomas.
[0115] A "subject at risk of having a cancer" as used herein is a
subject who has a high probability of developing cancer. These
subjects include, for instance, subjects having a genetic
abnormality, the presence of which has been demonstrated to have a
correlative relation to a higher likelihood of developing a cancer
and subjects exposed to cancer causing agents such as tobacco,
asbestos, or other chemical toxins, or a subject who has previously
been treated for cancer and is in apparent remission. When a
subject at risk of developing a cancer is treated with a .DELTA.4,5
glycuronidase or degradation product thereof the subject may be
able to kill the cancer cells as they develop.
[0116] Effective amounts of the .DELTA.4,5 glycuronidase, variant
.DELTA.4,5 glycuronidase or therapeutic GAGs of the invention are
administered to subjects in need of such treatment. Effective
amounts are those amounts which will result in a desired
improvement in the condition or symptoms of the condition, e.g.,
for cancer this is a reduction in cellular proliferation or
metastasis, without causing other medically unacceptable side
effects. Such amounts can be determined with no more than routine
experimentation. It is believed that doses ranging from 1
nanogram/kilogram to 100 milligrams/kilogram, depending upon the
mode of administration, will be effective. The absolute amount will
depend upon a variety of factors (including whether the
administration is in conjunction with other methods of treatment,
the number of doses and individual patient parameters including
age, physical condition, size and weight) and can be determined
with routine experimentation. It is preferred generally that a
maximum dose be used, that is, the highest safe dose according to
sound medical judgment. The mode of administration may be any
medically acceptable mode including oral, subcutaneous,
intravenous, etc.
[0117] In some aspects of the invention the effective amount of
.DELTA.4,5 glycuronidase or therapeutic GAG is that amount
effective to prevent invasion of a tumor cell across a barrier. The
invasion and metastasis of cancer is a complex process which
involves changes in cell adhesion properties which allow a
transformed cell to invade and migrate through the extracellular
matrix (ECM) and acquire anchorage-independent growth properties
Liotta, L. A., et al., Cell 64:327-336, 1991. Some of these changes
occur at focal adhesions, which are cell/ECM contact points
containing membrane-associated, cytoskeletal, and intracellular
signaling molecules. Metastatic disease occurs when the
disseminated foci of tumor cells seed a tissue which supports their
growth and propagation, and this secondary spread of tumor cells is
responsible for the morbidity and mortality associated with the
majority of cancers. Thus the term "metastasis" as used herein
refers to the invasion and migration of tumor cells away from the
primary tumor site.
[0118] The barrier for the tumor cells may be an artificial barrier
in vitro or a natural barrier in vivo. In vitro barriers include
but are not limited to extracellular matrix coated membranes, such
as Matrigel. Thus the .DELTA.4,5 glycuronidase compositions or
degradation products thereof can be tested for their ability to
inhibit tumor cell invasion in a Matrigel invasion assay system as
described in detail by Parish, C. R., et al., "A Basement-Membrane
Permeability Assay which Correlates with the Metastatic Potential
of Tumour Cells," Int. J. Cancer, 1992, 52:378-383. Matrigel is a
reconstituted basement membrane containing type IV collagen,
laminin, heparan sulfate proteoglycans such as perlecan, which bind
to and localize bFGF, vitronectin as well as transforming growth
factor-.beta. (TGF-.beta.), urokinase-type plasminogen activator
(uPA), tissue plasminogen activator (tPA), and the serpin known as
plasminogen activator inhibitor type 1 (PAI-1). Other in vitro and
in vivo assays for metastasis have been described in the prior art,
see, e.g., U.S. Pat. No. 5,935,850, issued on Aug. 10, 1999, which
is incorporated by reference. An in vivo barrier refers to a
cellular barrier present in the body of a subject.
[0119] In general, when administered for therapeutic purposes, the
formulations of the invention are applied in pharmaceutically
acceptable solutions. Such preparations may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0120] The compositions of the invention may be administered per se
(neat) or in the form of a pharmaceutically acceptable salt. When
used in medicine the salts should be pharmaceutically acceptable,
but non-pharmaceutically acceptable salts may conveniently be used
to prepare pharmaceutically acceptable salts thereof and are not
excluded from the scope of the invention. Such pharmacologically
and pharmaceutically acceptable salts include, but are not limited
to, those prepared from the following acids: hydrochloric,
hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic,
salicylic, p-toluene sulphonic, tartaric, citric, methane
sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and
benzene sulphonic. Also, pharmaceutically acceptable salts can be
prepared as alkaline metal or alkaline earth salts, such as sodium,
potassium or calcium salts of the carboxylic acid group.
[0121] Suitable buffering agents include: acetic acid and a salt
(1-2% W/V); citric acid and a salt (1-3% W/V); boric acid and a
salt (0.5-2.5% W/V); and phosphoric acid, and a salt (0.8-2% W/V).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
W/V); chlorobutanol (0.3-0.9% W/T); parabens (0.01-0.25% W/V) and
thimerosal (0.004-0.02% W/V).
[0122] The present invention provides pharmaceutical compositions,
for medical use, which comprise .DELTA.4,5 glycuronidase, variant
.DELTA.4,5 glycuronidase of the invention, or therapeutic GAG
fragments together with one or more pharmaceutically acceptable
carriers and optionally other therapeutic ingredients. The term
"pharmaceutically-acceptable carrier" as used herein, and described
more fully below, means one or more compatible solid or liquid
filler, dilutants or encapsulating substances which are suitable
for administration to a human or other animal. In the present
invention, the term "carrier" denotes an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application. The components of the
pharmaceutical compositions also are capable of being commingled
with the .DELTA.4,5 glycuronidase of the present invention or other
compositions, and with each other, in a manner such that there is
no interaction which would substantially impair the desired
pharmaceutical efficiency.
[0123] A variety of administration routes are available. The
particular mode selected will depend, of course, upon the
particular active agent selected, the particular condition being
treated and the dosage required for therapeutic efficacy. The
methods of this invention, generally speaking, may be practiced
using any mode of administration that is medically acceptable,
meaning any mode that produces effective levels of the drug without
causing clinically unacceptable adverse effects. A preferred mode
of administration is a parenteral route. The term "parenteral"
includes subcutaneous injections, intravenous, intramuscular,
intraperitoneal, intra sternal injection or infusion techniques.
Other modes of administration include oral, mucosal, rectal,
vaginal, sublingual, intranasal, intratracheal, inhalation, ocular,
transdermal, etc.
[0124] For oral administration, the compounds can be formulated
readily by combining the active compound(s) with pharmaceutically
acceptable carriers well known in the art. Such carriers enable the
compounds of the invention to be formulated as tablets, pills,
dragees, capsules, liquids, gels, syrups, slurries, suspensions and
the like, for oral ingestion by a subject to be treated.
Pharmaceutical preparations for oral use can be obtained as solid
excipient, optionally grinding a resulting mixture, and processing
the mixture of granules, after adding suitable auxiliaries, if
desired, to obtain tablets or dragee cores. Suitable excipients
are, in particular, fillers such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate. Optionally the oral formulations may also be formulated
in saline or buffers for neutralizing internal acid conditions or
may be administered without any carriers.
[0125] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0126] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration.
[0127] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0128] For administration by inhalation, the compounds for use
according to the present invention may be conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or
a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g. gelatin for use in an inhaler or insufflator may
be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0129] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0130] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0131] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0132] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0133] In addition to the formulations described previously, the
compounds may also be formulated as a depot preparation. Such long
acting formulations may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable
oil) or ion exchange resins, or as sparingly soluble derivatives,
for example, as a sparingly soluble salt.
[0134] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0135] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer, Science 249:1527-1533, 1990, which is incorporated herein
by reference.
[0136] The compositions may conveniently be presented in unit
dosage form and may be prepared by any of the methods well known in
the art of pharmacy. All methods include the step of bringing the
active .DELTA.4,5 glycuronidase into association with a carrier
which constitutes one or more accessory ingredients. In general,
the compositions are prepared by uniformly and intimately bringing
the polymer into association with a liquid carrier, a finely
divided solid carrier, or both, and then, if necessary, shaping the
product. The polymer may be stored lyophilized.
[0137] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the heparinases of the invention,
increasing convenience to the subject and the physician. Many types
of release delivery systems are available and known to those of
ordinary skill in the art. They include polymer based systems such
as polylactic and polyglycolic acid, polyanhydrides and
polycaprolactone; nonpolymer systems that are lipids including
sterols such as cholesterol, cholesterol esters and fatty acids or
neutral fats such as mono-, di and triglycerides; hydrogel release
systems; silastic systems; peptide based systems; wax coatings,
compressed tablets using conventional binders and excipients,
partially fused implants and the like. Specific examples include,
but are not limited to: (a) erosional systems in which the
polysaccharide is contained in a form within a matrix, found in
U.S. Pat. No. 4,452,775 (Kent); U.S. Pat. No. 4,667,014 (Nestor et
al.); and U.S. Pat. Nos. 4,748,034 and 5,239,660 (Leonard) and (b)
diffusional systems in which an active component permeates at a
controlled rate through a polymer, found in U.S. Pat. Nos.
3,832,253 (Higuchi et al.) and U.S. Pat. No. 3,854,480 (Zaffaroni).
In addition, a pump-based hardware delivery system can be used,
some of which are adapted for implantation.
[0138] A subject is any human or non-human vertebrate, e.g., dog,
cat, horse, cow, pig.
[0139] When administered to a patient undergoing cancer treatment,
the .DELTA.4,5 glycuronidase or therapeutic GAG compounds may be
administered in cocktails containing other anti-cancer agents. The
compounds may also be administered in cocktails containing agents
that treat the side-effects of radiation therapy, such as
anti-emetics, radiation protectants, etc.
[0140] Anti-cancer drugs that can be co-administered with the
compounds of the invention include, but are not limited to
Acivicin; Aclarubicin; Acodazole Hydrochloride; Acronine;
Adriamycin; Adozelesin; Aldesleukin; Altretamine; Ambomycin;
Ametantrone Acetate; Aminoglutethimide; Amsacrine; Anastrozole;
Anthramycin; Asparaginase; Asperlin; Azacitidine; Azetepa;
Azotomycin; Batimastat; Benzodepa; Bicalutamide; Bisantrene
Hydrochloride; Bisnafide Dimesylate; Bizelesin; Bleomycin Sulfate;
Brequinar Sodium; Bropirimine; Busulfan; Cactinomycin; Calusterone;
Caracemide; Carbetimer; Carboplatin; Carmustine; Carubicin
Hydrochloride; Carzelesin; Cedefingol; Chlorambucil; Cirolemycin;
Cisplatin; Cladribine; Crisnatol Mesylate; Cyclophosphamide;
Cytarabine; Dacarbazine; Dactinomycin; Daunorubicin Hydrochloride;
Decitabine; Dexormaplatin; Dezaguanine; Dezaguanine Mesylate;
Diaziquone; Docetaxel; Doxorubicin; Doxorubicin Hydrochloride;
Droloxifene; Droloxifene Citrate; Dromostanolone Propionate;
Duazomycin; Edatrexate; Eflornithine Hydrochloride; Elsamitrucin;
Enloplatin; Enpromate; Epipropidine; Epirubicin Hydrochloride;
Erbulozole; Esorubicin Hydrochloride; Estramustine; Estramustine
Phosphate Sodium; Etanidazole; Etoposide; Etoposide Phosphate;
Etoprine; Fadrozole Hydrochloride; Fazarabine; Fenretinide;
Floxuridine; Fludarabine Phosphate; Fluorouracil; Flurocitabine;
Fosquidone; Fostriecin Sodium; Gemcitabine; Gemcitabine
Hydrochloride; Hydroxyurea; Idarubicin Hydrochloride; Ifosfamide;
Ilmofosine; Interferon Alfa-2a; Interferon Alfa-2b; Interferon
Alfa-n1; Interferon Alfa-n3; Interferon Beta-I a; Interferon
Gamma-I b; Iproplatin; Irinotecan Hydrochloride; Lanreotide
Acetate; Letrozole; Leuprolide Acetate; Liarozole Hydrochloride;
Lometrexol Sodium; Lomustine; Losoxantrone Hydrochloride;
Masoprocol; Maytansine; Mechlorethamine Hydrochloride; Megestrol
Acetate; Melengestrol Acetate; Melphalan; Menogaril;
Mercaptopurine; Methotrexate; Methotrexate Sodium; Metoprine;
Meturedepa; Mitindomide; Mitocarcin; Mitocromin; Mitogillin;
Mitomalcin; Mitomycin; Mitosper; Mitotane; Mitoxantrone
Hydrochloride; Mycophenolic Acid; Nocodazole; Nogalamycin;
Ormaplatin; Oxisuran; Paclitaxel; Pegaspargase; Peliomycin;
Pentamustine; Peplomycin Sulfate; Perfosfamide; Pipobroman;
Piposulfan; Piroxantrone Hydrochloride; Plicamycin; Plomestane;
Porfimer Sodium; Porfiromycin; Prednimustine; Procarbazine
Hydrochloride; Puromycin; Puromycin Hydrochloride; Pyrazofurin;
Riboprine; Rogletimide; Safingol; Safingol Hydrochloride;
Semustine; Simtrazene; Sparfosate Sodium; Sparsomycin;
Spirogermanium Hydrochloride; Spiromustine; Spiroplatin;
Streptonigrin; Streptozocin; Sulofenur; Talisomycin; Tecogalan
Sodium; Tegafur; Teloxantrone Hydrochloride; Temoporfin;
Teniposide; Teroxirone; Testolactone; Thiamiprine; Thioguanine;
Thiotepa; Tiazofurin; Tirapazamine; Topotecan Hydrochloride;
Toremifene Citrate; Trestolone Acetate; Triciribine Phosphate;
Trimetrexate; Trimetrexate Glucuronate; Triptorelin; Tubulozole
Hydrochloride; Uracil Mustard; Uredepa; Vapreotide; Verteporfin;
Vinblastine Sulfate; Vincristine Sulfate; Vindesine; Vindesine
Sulfate; Vinepidine Sulfate; Vinglycinate Sulfate; Vinleurosine
Sulfate; Vinorelbine Tartrate; Vinrosidine Sulfate; Vinzolidine
Sulfate; Vorozole; Zeniplatin; Zinostatin; Zorubicin
Hydrochloride.
[0141] The .DELTA.4,5 glycuronidase or therapeutic GAG compounds
may also be linked to a targeting molecule. A targeting molecule is
any molecule or compound which is specific for a particular cell or
tissue and which can be used to direct the .DELTA.4,5 glycuronidase
or therapeutic GAG to the cell or tissue. Preferably the targeting
molecule is a molecule which specifically interacts with a cancer
cell or a tumor. For instance, the targeting molecule may be a
protein or other type of molecule that recognizes and specifically
interacts with a tumor antigen.
[0142] Tumor-antigens include Melan-A/M-ART-1, Dipeptidyl peptidase
IV (DPPIV), adenosine deaminase-binding protein (ADAbp),
cyclophilin b, Colorectal associated antigen (CRC)--C017-1A/GA733,
Carcinoembryonic Antigen (CEA) and its immunogenic epitopes CAP-1
and CAP-2, etv6, aml1, Prostate Specific Antigen (PSA) and its
immunogenic epitopes PSA-1, PSA-2, and PSA-3, prostate-specific
membrane antigen (PSMA), T-cell receptor/CD3-zeta chain,
MAGE-family of tumor antigens (e.g., MAGE-A1, MAGE-A2, MAGE-A3,
MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10,
MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3),
MAGE-Xp4 (MAGE-B4), MAGE-C1, MAGE-C2, MAGE-C3, MAGE-C4, MAGE-C5),
GAGE-family of tumor antigens (e.g., GAGE-1, GAGE-2, GAGE-3,
GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, GAGE-9), BAGE, RAGE,
LAGE-1, NAG, GnT-V, MUM-1, CDK4, tyrosinase, p53, MUC family,
HER2/neu, p21ras, RCAS1, .alpha.-fetoprotein, E-cadherin,
.alpha.-catenin, .beta.-catenin and .gamma.-catenin, p120ctn,
gp100.sup.Pmel117, PRAME, NY-ESO-1, brain glycogen phosphorylase,
SSX-1, SSX-2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5, SCP-1, CT-7, cdc27,
adenomatous polyposis coli protein (APC), fodrin, P1A, Connexin 37,
Ig-idiotype, p15, gp75, GM2 and GD2 gangliosides, viral products
such as human papilloma virus proteins, Smad family of tumor
antigens, lmp-1, EBV-encoded nuclear antigen (EBNA)-1, and
c-erbB-2.
[0143] The present invention is further illustrated by the
following Examples, which in no way should be construed as further
limiting. The entire contents of all of the references (including
literature references, issued patents, published patent
applications, and co-pending patent applications) cited throughout
this application are hereby expressly incorporated by
reference.
EXAMPLES
Materials And Methods
[0144] Chemicals and reagents. Unless otherwise stated,
biochemicals were purchased from Sigma Aldrich Chemical (St. Louis,
Mo.). Disaccharides were purchased from Calbiochem (San Diego,
Calif.). Reagents for .lamda.ZAP II genomic library construction
and screening were obtained from Stratagene (La Jolla, Calif.).
Restriction endonucleases were purchased from New England Biolabs
(Beverly, Mass.). DNA oligonucleotide primers were manufactured by
Invitrogen/Life Technologies (Carlsbad, Calif.). Additional
molecular cloning reagents were obtained from the manufacturers
listed.
[0145] Bacterial strains and growth conditions. F. heparinum
(Pedobacter heparinus) was obtained as a lyophilized stock from
American Type Culture Collection (ATCC, Manassas, Va.), stock no.
13125. Rehydrated cultures were grown aerobically at 30.degree. C.
with moderate shaking to an optical density (A.sub.600) between 1.5
and 2 in defined media containing 6.4 mM NaH.sub.2PO.sub.4, 7.6 mM
Na.sub.2HPO.sub.4, 12 mM KH.sub.2PO.sub.4, 14.3 mM
K.sub.2HPO.sub.4, 1.7 mM NaCl, and 1.9 mM NH.sub.4Cl, pH 6.9 and
supplemented with 0.1 mM trace metals CaCl.sub.2, FeSO.sub.4,
CuSO.sub.4, NaMoO.sub.4, CoCl.sub.2, and MnSO.sub.4 (added from a
100X stock in 10 mM H.sub.2SO.sub.4), 0.8% glucose, 0.05%
methionine, 0.05% histidine, 2 mM MgSO.sub.4, and 0.1% heparin all
added under sterile conditions. E. coli strains included TOP10
(Invitrogen) or DH5.alpha. for PCR cloning and subcloning and BL21
(DE3) (Novagen, Madison Wis.) for recombinant protein expression.
Bacteriophage host strains XL1-Blue MRF' and SOLR were obtained
from Stratagene.
[0146] Purification of glycuronidase peptides and protein
sequencing. The 4,5 glycuronidase was purified from 10 liter
fermentation cultures using a method such as those described in
McLean, M. W., Bruce, J. S., Long, W. F., and Williamson, F. B.,
1984, Eur J Biochem 145, 607-15.
[0147] Molecular cloning of the .DELTA.4,5 glycuronidase gene from
F. heparinum genomic DNA.
[0148] Flavobacterial genomic DNA was isolated from 10 mL of
Flavobacterial culture using the QIAGEN DNeasy DNA purification kit
according to the Manufacturer's instructions for gram-negative
bacteria using approximately 2.times.10.sup.9 cells per column.
Following purification, genomic DNA was ethanol precipitated and
resuspended in TE, pH 7.5 at 0.5 mg/mL. The quality of genomic DNA
was confirmed spectrophotometrically at 260/280 nm, by
electrophoresis on a 0.5% agarose gel and by PCR using
Flavobacterial specific primers.
[0149] The following degenerate primers were synthesized from
peptides corresponding initially to peaks 19 and 24 (Example 1): 5'
GARACNCAYCARGGNYTNACNAAYGAR 3' (SEQ ID NO. 5) (peak 19 forward), 5'
YTCRTTNGTNARNCCYTGRTGNGTYTC 3' (SEQ ID NO. 6) (peak 19 reverse); 5'
AAYTAYGCNGAYTAYTAYTAY 3' (SEQ ID NO. 7) (peak 24 forward); 5'
RTARTARTARTCNGCRTARTT 3' (SEQ ID NO. 8) (peak 24 reverse). All four
primers were screened in a PCR assay using all possible pairings
(forward and reverse). The PCR reaction conditions included 200 ng
of genomic DNA, 200 picomoles for each forward and reverse primer,
200 .mu.M dNTPs, 1 unit of Vent DNA Polymerase (New England
Biolabs) in a 100 .mu.l reaction volume. 35 cycles were completed
using a 52.degree. C. annealing temperature and 1.5 minute
extensions at 72.degree. C. The 450 bp product amplified using
primers 19 forward and 24 reverse was gel purified and subject to
direct DNA sequencing which confirmed the inclusion of translated
sequence corresponding to peptide peaks 19 and 24 in addition to
peak 12. The same DNA was also .sup.32P radiolabeled by random
priming using 200 .mu.Ci .alpha..sup.32P[dCTP] at 6000 Ci/mmole
(NEN, Boston, Mass.), 50-100 ng of DNA and the Prime-it II random
priming kit (Stratagene) (probe 1). Unincorporated .sup.32P dNTPs
were removed by gel filtration using G-50 Quick-spin columns (Roche
Biochemicals, New Jersey). Labeling reactions typically yielded
approximately 50 ng of radiolabeled DNA with specific activities
exceeding 10.sup.9 cpm/.mu.g.
[0150] DNA hybridization probe 2 was initially created by PCR as
described above except using degenerate primer 26 5'
CARACNTAYACNCCNGGNATGAAY 3' (SEQ ID NO. 9) (peak 26 forward) and 20
picomoles of reverse, non-degenerate primer 54 (5'
TTCATGGTCGTAACCGCATG 3') (SEQ ID NO. 10); the latter
oligonucleotide corresponds to .DELTA.4,5 DNA sequence 3' of peak
8. Direct sequencing of this PCR fragment confirmed the presence of
peak 26 and peak 13 peptides. DNA probe 3 used in DNA southern
hybridizations (below) was PCR amplified from genomic DNA using
primer 68 (5' TATACACCAGGCATGAACCC 3') (SEQ ID NO. 11) and 74 (5'
CCCAGTATAAATACTCCAGGT 3') (SEQ ID NO. 12).
[0151] Plaque hybridization screening of F. heparinum genomic
library. A .lamda. ZAP II genomic library (Stratagene) was
constructed as described [Sasisekharan, R., Bulmer, M., Moremen, K.
W., Cooney, C. L., and Langer, R. (1993) Proc Natl Acad Sci USA 90,
3660-4]. The amplified library (1.times.1010 pfu/mL) was plated out
at approximately 1.times.10.sup.6 pfu (.about.50,000 pfu/plate) on
100.times.150 mm LB plates. Plaque lifts on to nylon membranes
(Nytran Supercharge, Schleicher and Schuell) and subsequent
hybridization screenings were completed using standard methods and
solutions [Current Protocols in Molecular Biology, 1987, John Wiley
and Sons, New York]. DNA was crosslinked to each filter by
UV-irradiation (Stratagene Stratalinker) for 30 seconds at 1200
joules/cm.sup.3. Hybridizations were carried at 42.degree. C. using
10.sup.7-10.sup.8 cpm of radiolabeled probe (at approximately 0.25
ng/mL). Low stringency washes were carried out at room temperature
in 2.times.SSC, 0.1% SDS; high stringency washes carried out at
58-60.degree. C in 0.2X SSC and 0.1% SDS. Hybridized plaques were
visualized by phosphor imaging (Molecular Dynamics) and/or .sup.32P
autoradiography. Tertiary screens of positive clones were completed
and the recombinant phage was excised as a double-stranded phagemid
(pBluescript) using the ExAssist interference-resistant helper
phage and SOLR strain according to the manufacturer's protocol
(Stratagene). Recombinants were characterized by DNA sequencing
using both T7 and T3 primers.
[0152] Creation of a flavobacterium Bgl II-EcoR1 subgenomic library
for isolation of the .DELTA.4,5 5' terminus. 1 .mu.g of genomic DNA
was cut with 20 units of Eco R1, Bgl II, and Hind III individually
or as double digests. Restriction products were resolved by gel
electrophoresis on 1% agarose gels run in 1.times. TAE buffer.
Southern DNA hybridizations were completed according to standard
protocols [Current Protocols in Molecular Biology, 1987, John Wiley
and Sons, New York] using .sup.32P radiolabeled probe 3. Based on
this Southern analysis, 5 .mu.g of Flavobacterial genomic DNA was
digested with Bgl-II-Eco R1 and the DNA resolved on a preparative
1% agarose gel run under identical conditions as those described
for the analytical gel. DNA ranging from approximately 1-2 kb was
gel purified and ligated into pLITMUS as a Bgl II-EcoR1 cassette.
Positive clones were identified by PCR colony screening using
primers 68 and 74 and confirmed by DNA sequencing.
[0153] PCR cloning of .DELTA.4,5 gene and recombinant expression in
E. coli. The full-length glycuronidase gene was directly PCR
amplified from genomic DNA using forward primer 85 5'
TGTTCTAGACATATGAAATCACTACTCAGTGC (SEQ ID NO. 13) 3' and reverse
primer 86 5' GTCTCGAGGATCCTTAAGACTGATTAATTGTT 3' (SEQ ID NO. 14)
(with Nde 1 and Xho1 restriction sites denoted in bold), 200 ng
genomic DNA, and Vent DNA Polymerase for 35 cycles. dA overhangs
were generated in a final 10 minute extension at 72.degree. C.
using AmpliTaq DNA polymerase (Applied Biosystems). PCR products
were gel purified, ligated into the TOPO/TA PCR cloning vector
(Invitrogen), and transformed into One-shot TOP10 chemically
competent cells. Positive clones were identified by blue/white
colony selection and confirmed by PCR colony screening. The 1.2 kb
.DELTA.4,5 gene was subcloned into expression plasmid pET28a
(Novagen) as an Nde 1-Xho 1 cassette. Final expression clones were
confirmed by plasmid DNA sequencing.
[0154] For the expression of .DELTA.4,5 glycuronidase beginning
with M2 1 (.DELTA.4,5.sup..DELTA.20), the forward primer 95 5' TGT
TCT AGA CAT ATG ACA GTT ACG AAA GGC AA 3' (SEQ ID NO. 15) (also
containing an Nde 1 restriction site near its 5' terminus) was used
in place of primer 85 (above). 50 ng of the original expression
plasmid pET28a/.DELTA.4,5 was used as the DNA template in PCR
reactions involving a total of 20 cycles. Otherwise, cloning was as
described for the full-length gene. Both pET28a/.DELTA.4,5 and
pET28a.DELTA.4,5.sup..DELTA.20 plasmids were transformed into BL21
(DE3) for expression as N-terminal 6X His tagged proteins. 1 liter
cultures were grown at room temperature (.about.20.degree. C.) in
LB media supplemented with 40 .mu.g/mL kanamycin. Protein
expression was induced with 500 .mu.M IPTG added at an A.sub.600 of
1.0. Induced cultures were allowed to grow for 15 hours (also at
room temperature).
[0155] Recombinant .DELTA.4,5 glycuronidase purification. Bacterial
cells were harvested by centrifugation at 6000.times.g for 20
minutes and resuspended in 40 mL of binding buffer (50 mM Tris-HCL,
pH 7.9, 0.5 M NaCl, and 10 mM imidazole). Lysis was initiated by
the addition of 0.1 mg/mL lysozyme (20 minutes at room temperature)
followed by intermittent sonication in an ice-water bath using a
Misonex XL sonicator at 40-50% output. The crude lysate was
fractionated by low-speed centrifugation (18,000.times.g; 4.degree.
C.; 15 minutes) and the supernatant was filtered through a 0.45
micron filter. The 6X-His tag .DELTA.4,5 glycuronidase was purified
by Ni.sup.+2 chelation chromatography on a 5 mL Hi-Trap column
(Pharmacia Biotech, New Jersey) pre-charged with 200 mM NiSO.sub.4
and subsequently equilibrated with binding buffer. The column was
run at a flow rate of approximately 3-4 mL/minute that included an
intermediate wash step with 50 mM imidazole. The .DELTA.4,5 enzyme
was eluted from the column in 5 mL fractions using high imidazole
elution buffer (50 mM Tris-HCL, pH 7.9, 0.5 M NaCl, and 250 mM
imidazole). Peak fractions were dialyzed overnight against 4 liters
of phosphate buffer (0.1M sodium phosphate, pH 7.0, 0.5 M NaCl) to
remove the imidazole.
[0156] The 6.times. His tag was effectively cleaved by adding
biotinylated thrombin at 2 units/milligram of recombinant protein,
overnight at 4.degree. C. with gentle inversion. Thrombin was
captured by binding to streptavidin agarose at 4.degree. C. for two
hours using the Thrombin Capture Kit (Novagen). The cleaved peptide
5' MGSSHHHHHHSSGLVPR 3' (SEQ ID NO. 16) was removed by final
dialysis against a 1000-fold volume of phosphate buffer.
[0157] Protein concentrations were determined by protein assay
(Bio-Rad, Hercules, Calif.) and confirmed by UV spectroscopy using
a theoretical molar extinction coefficient .epsilon.=88,900 for
.DELTA.4,5.sup..DELTA.20. Protein purity was assessed by SDS-PAGE
followed by Coomassie Brilliant Blue staining.
[0158] Computational methods. Signal sequence predictions were made
by SignalP V1.1 using the von Heijne computational method [Nielsen,
H., Engelbrecht, J., Brunak, S., and von Heijne, G., 1997, Protein
Eng 10, 1-6] with maximum Y and S cutoffs set at 0.36 and 0.88,
respectively. Glycuronidase multiple sequence alignments were made
from select BLASTP database sequences (with scores exceeding 120
bits and less than 6% gaps) using the CLUSTAL W program (version
1.81) preset to an open gap penalty of 10.0, a gap extension
penalty of 0.20, and both hydrophilic and residue-specific gap
penalties turned on.
[0159] Assay for enzyme activity and determination of kinetic
parameters. Standard reactions were carried out at 30.degree. C.
and included 100 mM sodium phosphate buffer, pH 6.4, 50 mM NaCl,
500 .mu.M disaccharide substrate and 200 nM enzyme in a 100 .mu.I
reaction volume. Hydrolysis of heparin disaccharides was determined
spectrophotometrically by measuring the loss of the .DELTA.4,5
chromophore measured at 232 nm. Substrate hydrolysis was calculated
using the following molar extinction coefficients empirically
determined for each disaccharide substrate: .DELTA.UH.sub.NAc,
.epsilon..sub.232=4,524; .DELTA.UH.sub.NAc6S,
.epsilon..sub.232=4,300; .DELTA.UH.sub.NS, .epsilon..sub.232=6,600;
.DELTA.UH.sub.NS,6S, .epsilon..sub.232=6,075; .DELTA.UH.sub.NH26S,
.epsilon..sub.232=4,826; .DELTA.U.sub.2SH.sub.NS,
.epsilon..sub.232=4,433. Initial rates (V.sub.o) were extrapolated
from linear activities representing <10% substrate turnover and
fit to pseudo first-order kinetics. For kinetic experiments,
disaccharide concentration for each respective substrate was varied
from 48 to 400 .mu.M concentrations. K.sub.m and k.sub.cat values
were extrapolated from V.sub.o vs. [S] curves fit to the Michaelis
Menten equation by a non-linear, least squares regression.
[0160] For experiments measuring the relative effect of ionic
strength on glycuronidase activity, the NaCl concentration was
varied from 0.05 to 1 M in 0.1 M sodium phosphate buffer (pH 6.4),
200 .mu.M .DELTA.UH.sub.NS,6S and 100 .mu.M enzyme under otherwise
standard reaction conditions. The effect of pH on catalytic
activity was kinetically determined at varying .DELTA.UH.sub.NS,6S
concentrations in 0.1 M sodium phosphate buffer at pH 5.2, 5.6,
6.0, 6.4, 6.8, 7.2 and 7.8. Data were fit to Michaelis-Menten
kinetics as described above and the relative k.sub.cat/K.sub.m
ratios plotted as a function of pH.
[0161] Detection of .DELTA.4,5 glycuronidase activity by capillary
electrophoresis. 200 .mu.g of heparin (Celsus Laboratories) was
subject to exhaustive heparinase digestion as described
[Venkataraman, G., Shriver, Z., Raman, R., and Sasisekharan, R.,
1999, Science 286, 537-42] with certain modifications that included
a 50 mM PIPES buffer, pH 6.5 with 100 mM NaCl in a 100 .mu.l
reaction volume. Following heparinase treatment, 25 picomoles of
.DELTA.4,5 glycuronidase was added to one-half of the original
reaction (pre-equilibrated at 30.degree. C.). 20 .mu.l aliquots
were removed at 1 minute and 30 minutes and activity quenched by
heating at 95.degree. C. for 10 minutes. 20 .mu.l of the minus
.DELTA.4,5 control (also heated for 10 minutes) was used as the 0
time point. Disaccharide products were resolved by capillary
electrophoresis run for 25 minutes under positive polarity mode as
previously described [Rhomberg, A. J., Ernst, S., Sasisekharan, R.,
and Biemann, K., 1998, Proc Natl Acad Sci USA 95, 4176-81].
[0162] Molecular mass determinations. Molecular mass determinations
were carried out by MALDI-MS as described [Rhomberg, A. J., Ernst,
S., Sasisekharan, R., and Biemann, K., 1998, Proc Natl Acad Sci USA
95, 4176-81].
Example 1
Molecular Cloning of .DELTA.4,5 Glycuronidase Gene from F.
heparinum Genome
[0163] To clone the .DELTA.4,5 glycuronidase gene, we isolated a
series of .DELTA.4,5 glycuronidase-derived peptides after protease
treatment of the purified enzyme. The native enzyme was directly
purified from fermentation cultures of F. heparinum using a 5-step
chromatography scheme as previously described [McLean, M. W.,
Bruce, J. S., Long, W. F., and Williamson, F. B., 1984, Eur J
Biochem 145, 607-15]. The extent of purity was ultimately
characterized by reverse phase chromatography, which indicated a
single major peak (FIG. 1A). We were able to generate a number of
peptides by a limited trypsin digestion of the purified enzyme. 26
peptide fragments were resolved by reverse phase chromatography
(FIG. 1B). From these 26, at least eight peptides (corresponding to
major peaks 8, 12, 13, 19, 24, and 26) were of sufficient yield and
purity and were selected for protein sequence determination (FIG.
1C).
[0164] Based on this information, we designed degenerate primers
corresponding to peaks 19, 24, and 26. These primers were used to
PCR amplify .DELTA.4,5 specific sequences to be used as a suitable
DNA hybridization probes for screening the Flavobacterial genomic
library. A combination of two primer pairs in particular (peak 19
forward and peak 24 reverse) gave a discrete PCR product of
approximately 450 base pairs. The translation of the corresponding
DNA sequence indicated that it contained the expected amino acid
sequence corresponding to peaks 19 and 24. The peak 12 peptide also
mapped to this region. We used this discrete PCR amplified DNA
fragment (designated as probe 1, FIG. 2A) in the initial plaque
hybridizations. The most 5' terminal clone obtained in this
screening (represented by clone G5A) included approximately
one-half of the predicted gene size corresponding to the carboxy
terminus of the putative ORF. Invariably, all of the isolated
clones possessed and Eco R1 site at their respective 5' termini. In
an attempt to isolate a clone from the phage library possessing the
other half of the gene, we rescreened additional plaques, this time
using a second N-terminal specific DNA hybridization probe (probe
2) in tandem with the original probe 1. This second strategy also
failed to yield any clones with the fully-intact .DELTA.4,5 gene. A
partial, overlapping clone (G5H), however, did extend the known 5'
sequence of A 4,5 by approximately 540 base pairs.
[0165] Alternate approaches were taken in an attempt to obtain the
5' terminus of the glycuronidase gene. The size of this missing
region was estimated, based on the molecular weight of the native
protein, to be approximately 45 amino acids (or 135 base pairs). We
completed DNA southern analyses to identify potentially useful DNA
restriction sites flanking the 5' end of the .DELTA.4,5 gene (FIG.
2B). This restriction mapping ultimately involved the use of the
Eco R1 site within the gene in conjunction with hybridization probe
3 (whose 3' end lies just 5' to this restriction site) to
positively bias our search for the remaining amino terminus. Based
on this refined map, we successfully isolated and subcloned an
approximately 1.5 kb Bgl II-Eco R1 .DELTA.4,5 fragment into
pLITMUS. The 5' terminus of the .DELTA.4,5 gene was obtained from
direct DNA sequencing of this subgenomic clone.
Results
[0166] A summary of the full-length gene obtained from the two
overlapping cloning methods is depicted in FIG. 2C. The DNA
sequence analysis compiled from the overlapping .DELTA.4,5 clones
(and confirmed by direct sequencing of a single PCR amplified
genomic clone) is shown in FIG. 3. The .DELTA.4,5 coding sequence
is comprised of 1209 base pairs corresponding to an ORF that
encodes a 402 amino acid protein. The amino acid and nucleotide
sequences for the full-length enzyme are given as SEQ ID Nos.:3 and
4, respectively. The predicted molecular weight of 45,621 daltons
for the translated protein corresponds very well with an empirical
molecular mass of 45,566 daltons for the purified Flavobacterial
enzyme determined by MALDI-MS. All of the peptides for which we
obtained sequence information map to this .DELTA.4,5 ORF. Based on
further primary sequence analyses, we have also identified a likely
bacterial signal sequence spanning amino acids 1-20 also possessing
a putative cleavage site between residues G20 and M21 (FIG. 4B).
The presence of a markedly hydrophobic amino terminus (see
hydropathy plot, FIG. 4A) and the identification of an AXXA
peptidase cleavage motif further support this assumption [von
Heijne, G., 1988, Biochim Biophys Acta 947, 307-33].
[0167] A search for related sequences in the NCBI protein database
led to several functionally related enzymes. In a multiple sequence
alignment of our cloned enzyme with select glucuronyl hydrolases,
we found a homology that generally corresponded to upwards of 30%
identity and nearly 50% similarity at the primary sequence level
(FIG. 4C). This relatedness spanned most of the enzyme sequence,
excluding the N-terminus. Based on this alignment, we found several
highly conserved positions within the F. heparinum .DELTA.4,5
glycuronidase that included, in particular, several aromatic and
acidic residues. Other invariant amino acids of possible catalytic
importance include H115 and R511.
Example 2
Recombinant Expression and Purification of the .DELTA.4,5
Glycuronidase
[0168] Using PCR, we cloned from the F. heparinum genome both the
full-length enzyme and the "mature" enzyme lacking the N-terminal
20 amino acid signal sequence (.DELTA.4,5.sup..DELTA.20) into a
T7-based expression plasmid. Cloning into pET28a permitted the
expression of the glycuronidase as an N-terminal 6.times. His-tag
fusion protein. Pilot expression studies focused on the full-length
enzyme. In these initial experiments, we examined several different
induction conditions such as temperature, time and length of
induction, and even IPTG concentrations. In every case, the
full-length enzyme was present nearly exclusively as an insoluble
fraction. Attempts to purify the enzyme directly from inclusion
bodies and then refold the apparently mis-folded protein were
initially not successful; while solubility was partially achieved
by a combined use of detergents (e.g., CHAPS), increasing salt
concentrations, and the presence of glycerol, the partially
purified enzyme was largely inactive.
[0169] A possible explanation for this insolubility points to the
presence of a very hydrophobic region within the wild-type protein
sequence spanning the first 20 amino acids. The N-terminal sequence
is also predicted to comprise a cleavable prokaryotic signal
sequence with the most likely cleavage site occurring between
position G20 and M21 (FIG. 3). Within this sequence, we also find
the alanine repeat 5' AXXAXXAXXXXA 3' (SEQ ID NO. 17) that may
serve as part of the actual cleavage recognition sequence [von
Heijne, G., 1988, Biochim Biophys Acta 947, 307-33]. This signal
peptide would indicate a periplasmic location for the glycuronidase
with the N-terminus of the secreted (mature) protein beginning with
M21. We recombinantly expressed this mature variant
(.DELTA.4,5.sup..DELTA.20) in which the signal sequence was
replaced entirely by an N-terminal 6.times. His purification tag.
Recombinant expression of the enzyme lacking the presumed signal
sequence yielded remarkably different results. In this case,
soluble recombinant expression levels routinely reached several
hundred milligrams of protein per liter of induced cells. The
specific activity of this enzyme on the heparin disaccharide
.DELTA.UH.sub.Nac was likewise robust.
Results
[0170] A summary of the expression and purification of
.DELTA.4,5.sup..DELTA.20 is summarized in FIG. 5 and Table 1. A
two-step purification comprised of Ni.sup.+2 chelation
chromatography followed by thrombin cleavage to remove the 6.times.
His purification tag, typically yielded over 200 mg of greater than
90% pure enzyme as assessed by SDS-PAGE followed by Coomassie
Brilliant Blue staining. An approximately three-fold purification
of activity was achieved in a single chromatographic step. Most
notably, the specific activity of the recombinant enzyme acting
upon .DELTA.UH.sub.NAc far exceeded those values reported in the
literature [Warnick, C. T. and Linker, A., 1972, Biochemistry 11,
568-72]. While removal of the 6.times. His tag from the N-terminus
of the enzyme was unnecessary for optimal hydrolytic activity, the
presence of the histidine tag did appear to instigate protein
precipitation over an extended time especially at higher enzyme
concentrations. This tag was, therefore removed for all subsequent
biochemical experiments. In this manner, the recombinant protein
was stable at 4.degree. C. for at least two weeks during which time
it remained in solution at protein concentrations exceeding 10
mg/mL under the buffer conditions described.
[0171] A molecular mass of 44,209 daltons was determined for the
recombinant enzyme (i.e., A4,5.sup..DELTA.20) by MALDI-MS. The
amino acid and nucleotide sequence for the enzyme which lacks the
N-terminal 20 amino acid signal sequence is given as SEQ ID Nos.: 1
and 2, respectively. This empirically-established molecular weight
is consistent with its theoretical value of 43,956 Daltons based on
its amino acid composition. This value physically differs by 1357
Daltons in comparison to a molecular weight of 45,566 daltons
likewise measured for the native enzyme. This mass differential is
largely accounted for by the engineered removal in the recombinant
protein of the 20 amino acid signal sequence. However, we cannot
exclude the possibility of differential posttranslational
modifications such as glycosylation largely accounting for the
observed differences between the two enzyme populations.
Unfortunately, chemical blocking precluded us from determining the
N-terminal sequence of the native protein. TABLE-US-00001 TABLE 1
Purification summary for the recombinant .DELTA.4, 5 glycuronidase.
Specific activities for each fraction were measured using 800 ng of
protein and 120 .mu.M of the unsulfated heparin disaccharide (DiS)
.DELTA.UH.sub.NAc in a 100 .mu.l reaction volume. The fold
purification was calculated relative to the specific activity
measured for the crude lysate. Sp. Activity Protein (.mu.moles DiS/
Purification Step Yield (mg) min./mg protein) % purification Crude
lysate 400 4.7 -- Ni.sup.+2 chromatography 205 12.9 2.7 Thrombin
cleavage 205 13.6 2.9
Example 3
Biochemical Conditions for Optimal Enzyme Activity
[0172] To determine the optimal reaction conditions for .DELTA.4,5
glycuronidase activity, we analyzed initial reaction rates as a
function of buffer, pH, temperature, and ionic strength (FIG. 6).
For these experiments, we used the disulfated heparin disaccharide
substrate .DELTA.UH.sub.NS,6S. Based on what is known about the
degradation of heparin/heparan sulfate-like glycosaminoglycans by
flavobacteria as well as initial biochemical characterization of
this and related enzymes [Warnick, C. T. and Linker, A., 1972,
Biochemistry 11, 568-72], we hypothesized that a heparin
disaccharide would be an optimal substrate for the .DELTA.4,5
glycuronidase. Enzyme activity was routinely monitored by a loss of
absorbance at 232 nm, corresponding indirectly to the hydrolysis of
the uronic acid from the non-reducing end.
Results
[0173] Under these conditions, we observed a NaCl
concentration-activity dependence that was optimal between 50 and
100 mM. NaCl concentrations exceeding 100 mM demonstrated a
significant and relatively sharply negative effect on specific
activity (FIG. 6A), i.e., with approximately 60% inhibition
occurring at 250 mM NaCl relative to 100% activity measured at 100
mM NaCl. The steep transition observed in the NaCl titration curve
suggests an important role of ionic interactions in some aspect of
enzymatic function.
[0174] The observed pH profile for the glycuronidase is bell-shaped
(FIG. 6C) with a pH optimum of 6.4. Interestingly, initial reaction
rates are significantly reduced at the highest temperatures
measured, especially at 42.degree. C. (FIG. 6B). Precincubation
experiments at 30, 37, and 42.degree. C. to assess relative enzyme
stabilities at these temperatures, however, indicated no
significant change in relative enzyme activities when subsequently
measured under the standard 30.degree. C. reaction conditions. The
results of such an experiment strongly suggest that thermal
lability is not the issue.
[0175] As a final variable for optimizing .DELTA.4,5 glycuronidase
in vitro reaction conditions, we also considered any requirement
for divalent metal ions. We found no evidence that metals are
either required for catalysis or activate the enzyme to any
appreciable extent.
[0176] Having established the reaction conditions for optimal
.DELTA.4,5 glycuronidase activity, we next compared the specific
activity of the recombinant enzyme (.DELTA.4,5.sup..DELTA.20)
relative to the native enzyme purified directly from F. heparinum
(FIG. 7). The activities of both enzyme fractions were measured in
parallel under identical reaction conditions. In this comparison,
the recombinant .DELTA.4,5 possessed an approximately three-fold
higher specific glycuronidase activity relative to the native
enzyme. These observed rates demonstrate quite clearly that the
cloned .DELTA.4,5 enzyme possesses "wild-type" activity that is in
no way adversely affected by its recombinant expression in E.
coli.
Example 4
.DELTA.4,5 Glycuronidase Substrate Specificity
[0177] The specificity of the .DELTA.4,5 glycuronidase acting on
various glycosaminoglycan disaccharide substrates was investigated.
The various substrates examined included both heparin and
chondroitin disaccharides as well as an hyaluronadate. In
particular, we considered the possibility of any structural
discriminations pertaining to glycosidic linkage position
(1.fwdarw.4 vs. 1.fwdarw.3) and relative sulfation state within the
disaccharide. For each substrate, kinetic parameters were
determined based on substrate saturation profiles that fit
Michaelis-Menten assumptions (FIG. 8). These kinetic values are
listed in Table 2. For the heparin disaccharides, k.sub.cat values
varied significantly from approximately 2 to 15 sec.sup.-1, while
the apparent K.sub.m values for each respective disaccharide were
comparable, ranging from approximately 100-300 .mu.M.
Results
[0178] The heparin disaccharide .DELTA.U.sub.2SH.sub.NS was not a
substrate at any of the concentrations studied, even following an
extended incubation time spanning several hours. For those heparin
disaccharides that were hydrolyzed under the conditions tested and
for which kinetic parameters could be determined, an interesting
substrate preference was apparent. In this hierarchy and under
these conditions, the two disaccharides .DELTA.UH.sub.NAc and
.DELTA.UH.sub.Nac6S were the best substrates; in comparison,
.DELTA.UH.sub.NH26S and .DELTA.UH.sub.NS were less good as
substrates. The kinetic values for .DELTA.UH.sub.NS,6S fell roughly
in the middle between these two boundaries.
[0179] The data show that heparin is a better substrate than
chondroitin/dermatan and/or hyaluronan, although these compounds
are also substrates. None of the non-heparin disaccharides were
hydrolyzed under the conditions for measuring substrate kinetics.
This result indicates an unequivocal discrimination of the
.DELTA.4,5 in regard to linkage position, with a strong preference
for 1.fwdarw.4 versus 1.fwdarw.3 linkages. At the same time, these
disaccharides were slowly hydrolyzed to varying degrees when the
enzyme reactions were conducted over a much longer timecourse
(>12 hours) and at considerably higher enzyme concentrations.
After approximately 18 hours, greater than 80% of monosulfated
chondroitin disaccharide (.DELTA.UGal.sub.Nac6S) was hydrolyzed,
whereas the non-sulfated chondroitin (.DELTA.UGal.sub.NAc) and the
hyaluronan disaccharide (.DELTA.UH) were still present at
approximately 40% and 65%, respectively. The importance of the
linkage position is, therefore, not absolute. The apparently
positive effect of chondroitin 6-O-sulfation within the
galactosamine is consistent with our results for the heparin
substrates and provides further evidence for the influence of this
position in dictating substrate specificity.
[0180] Based on the kinetically defined substrate specificity for
the disaccharides, we set out to validate these results while, at
the same time, to investigate the utility of the .DELTA.4,5
glycuronidase as an enzymatic tool for HSGAG compositional
analyses. In this manner, the .DELTA.4,5 should be very useful in
assessing the composition of disaccharides resulting from prior
heparinase treatment of heparin/heparan sulfate. For this
particular experiment, we pre-treated 200 .mu.g of heparin with a
heparinase cocktail. This exhaustive digestion was then directly
followed by a relatively short (1 minute) or long (30 minute)
.DELTA.4,5 glycuronidase treatment carried out under optimal
reaction conditions. The disaccharide products were then resolved
by capillary electrophoresis. The electrophoretic mobility profile
for the .DELTA.4,5 treated saccharides were then directly compared
to the untreated control (i.e., heparinase treatment only) run
under identical conditions (FIG. 9). 7 disaccharide peaks were
present in the capillary electrophoretogram corresponding to the
heparinase only control (A.). A structural assignment for each one
of these peaks was made based on previously established
compositional analyses. For the most part, the resolution of these
.DELTA.4,5 containing saccharides was such that each alternating
peak (1,3,5, . . . ) corresponded to a disaccharide possessing a
2-O sulfated uronic acid at the non-reducing end. Predictably, the
relative amplitude and area of these peaks remained the same, over
the entire timecourse of the .DELTA.4,5 preincubation. This
unchanging result extended to 18 hours. On the other hand, peaks
corresponding to disaccharides lacking the 2-O sulfate were
eliminated. Moreover, the relative rates of their disappearances
elegantly corresponded to their respective preferences as
substrates as determined in the previous kinetic experiment.
.DELTA.UH.sub.NAc6S (peak 8) was essentially hydrolyzed within one
minute; .DELTA.UH.sub.NS,6S (peak 4) and .DELTA.UH.sub.NS (peak 6)
were approximately 75% and 50% hydrolyzed, respectively. These two
latter substrates were completely depleted by 30 minutes.
[0181] In addition to the assigned disaccharides, the .DELTA.4,5
glycuronidase also acted on a heparinase-generated tetrasaccharide
(identified as peak 2 in FIG. 9). The assignment of Peak 2 as a
tetrasaccharide was confirmed by MALDI-MS indicating a mass of
1036.9 that corresponds to a singly acetylated tetrasaccharide with
four sulfates. Disaccharide analysis of this tetrasaccharide
further indicated that it does not contain a 2-O sulfate at the
non-reducing end. The .DELTA.4,5 enzyme hydrolyzed approximately
one-half of the starting material after one minute. The relative
rate of hydrolysis for this tetrasaccharide roughly corresponded to
the rate observed for the disaccharide .DELTA.UH.sub.NS (peak 6).
This exciting result clearly indicates that a longer chain
saccharide such as a tetrasaccharide is in fact a substrate for the
.DELTA.4,5 catalyzed hydrolysis. TABLE-US-00002 TABLE 2 Kinetic
parameters for heparin disaccharides. Disaccharide substrates
k.sub.cat (sec.sup.-1) K.sub.m (.mu.M) k.sub.cat/K.sub.m Relative
k.sub.cat/K.sub.m .DELTA.UH.sub.Nac 15.3 .+-. 0.9 283 .+-. 31 0.054
0.49 .DELTA.UH.sub.NAc,6S 11.7 .+-. 0.6 107 .+-. 15 0.110 1.0
.DELTA.UH.sub.NS 4.9 .+-. 0.4 251 .+-. 40 0.020 0.18
.DELTA.UH.sub.NS,6S 8.8 .+-. 0.9 334 .+-. 57 0.026 0.24
.DELTA.UH.sub.NH2,6S 2.4 .+-. 0.2 235 .+-. 40 0.010 0.09
.DELTA.U.sub.2SH.sub.NS N.A. N.A. N.A. N.A. k.sub.cat and K.sub.m
values were determined from non-linear regression analyses of the
Michaelis-Menten curves presented in FIG. 9. *N.A., no activity was
detected for.DELTA.U.sub.2SH.sub.NS.
[0182] Each of the foregoing patents, patent applications and
references that are recited in this application are herein
incorporated in their entirety by reference. Having described the
presently preferred embodiments, and in accordance with the present
invention, it is believed that other modifications, variations and
changes will be suggested to those skilled in the art in view of
the teachings set forth herein. It is, therefore, to be understood
that all such variations, modifications, and changes are believed
to fall within the scope of the present invention as defined by the
appended claims.
Sequence CWU 1
1
23 1 382 PRT Flavobacterium heparinum 1 Met Thr Val Thr Lys Gly Asn
Gly Asp Asp Trp Leu Lys Lys Ser Thr 1 5 10 15 Lys Thr Ala Val Ile
Gln Leu Thr Arg Ala Ala Gln Thr Tyr Thr Pro 20 25 30 Gly Met Asn
Pro Arg Ser Val Asn Pro Asp Gly Thr Val Arg Leu Ala 35 40 45 Pro
Pro Arg Asp Trp Thr Thr Gly Phe Phe Pro Gly Thr Leu Trp Tyr 50 55
60 Gly Tyr Glu Leu Ser Gly Asp Lys Asn Leu Ala Ala Glu Ala Lys Arg
65 70 75 80 Phe Thr Leu Ala Leu Asp Thr Ile Gln Tyr Val Lys Asp Thr
His Asp 85 90 95 Leu Gly Phe Met Leu Tyr Cys Ser Tyr Gly Asn Ala
Tyr Arg Val Thr 100 105 110 Gly Asp Lys Ile Tyr Leu Lys Pro Leu Glu
Asn Gly Ala Ala Asn Leu 115 120 125 Tyr Ala Arg Phe Asn Lys Lys Val
Gly Ala Ile Arg Ser Trp Asp Phe 130 135 140 Gly His Trp Gln Phe Pro
Val Ile Ile Asp Asn Leu Met Asn Leu Glu 145 150 155 160 Tyr Leu Tyr
Trp Ala Gly Lys Glu Phe Asn Lys Pro Glu Trp Phe Asp 165 170 175 Ala
Ala Lys Thr His Ala Val Thr Thr Met Lys Asn His Phe Arg Lys 180 185
190 Asp Tyr Ser Ser Tyr His Val Ile Ser Tyr Asp Thr Leu Ser Gly Lys
195 200 205 Val Leu Gln Arg Glu Thr His Gln Gly Leu Thr Asn Glu Ser
Ala Trp 210 215 220 Ala Arg Gly Gln Ala Trp Gly Leu Tyr Gly Tyr Thr
Met Ser Tyr Lys 225 230 235 240 Asp Thr Lys Asp Lys Lys Phe Ile Glu
His Ala Glu His Ile Ala Ala 245 250 255 Phe Ile Met Asn His Pro Ala
Met Pro Ala Asp Lys Ile Pro Leu Trp 260 265 270 Asp Phe Asp Val His
Asn Arg Asp Arg Ser Pro Arg Asp Ala Ser Ala 275 280 285 Ala Ala Val
Ile Ala Ser Ala Leu Leu Asp Leu Ser Thr Gln Val Lys 290 295 300 Asp
Gly Gln Lys Tyr Phe Lys Phe Ala Glu Asp Ile Leu Lys Thr Leu 305 310
315 320 Ser Ser Asp Glu Tyr Leu Ala Lys Pro Gly Glu Asn Gln Phe Phe
Ile 325 330 335 Leu Lys His Ser Val Gly Ala Leu Leu Tyr Asn Ser Glu
Ile Asp Thr 340 345 350 Pro Leu Asn Tyr Ala Asp Tyr Tyr Tyr Leu Glu
Ala Leu Lys Arg Tyr 355 360 365 Ala Glu Ile Lys Lys Ile Asp Leu Lys
Thr Ile Asn Gln Ser 370 375 380 2 1149 DNA Flavobacterium heparinum
2 atgacagtta cgaaaggcaa cggcgatgac tggttaaaga aatcaactaa aaccgcagta
60 atacagttaa cacgggctgc acaaacctat acaccaggca tgaacccaag
gtctgtcaat 120 ccggacggga cggtaaggct ggcccctccc cgcgactgga
ccacaggttt tttcccggga 180 acgttgtggt atggttatga actatcgggc
gataaaaacc tggcggccga agccaaaaga 240 tttacccttg ccttagatac
gatacaatat gttaaagata cgcacgacct gggctttatg 300 ttgtattgtt
cttatggcaa tgcctaccgt gtaaccggag acaagattta cctgaagcca 360
ttagaaaacg gtgcggccaa tttatatgcc cgtttcaata aaaaagtagg ggccatccgc
420 tcatgggatt tcggacactg gcaatttccg gtaattatag acaacctgat
gaacctggag 480 tatttatact gggcaggaaa ggaattcaat aagccagaat
ggttcgatgc tgctaaaaca 540 catgcggtta cgaccatgaa aaaccatttc
agaaaagatt atagttctta ccatgtgatc 600 agttacgata ccctgtctgg
aaaagtactg caacgtgaaa cccatcaggg acttaccaac 660 gaatcggcct
gggcacgggg gcaagcctgg ggactttacg gctataccat gagctataag 720
gatacgaaag acaaaaaatt catcgaacat gcagagcata tcgctgcttt catcatgaac
780 caccctgcaa tgccggcaga taaaattcca ctttgggact ttgatgtcca
caaccgcgac 840 aggtcgccaa gggatgcttc tgctgctgca gtaattgctt
cagccctgct agacctgagc 900 acgcaggtaa aagatggtca gaaatatttt
aaatttgccg aggatatcct gaaaacattg 960 tcatcagatg aatacctggc
gaaacccggc gagaaccagt tttttatatt gaaacatagt 1020 gtaggtgcat
tgctgtacaa ttcggaaatc gatacacctt tgaattatgc cgactattac 1080
tatctggagg ctttaaaacg ctatgcagag attaaaaaaa ttgacctgaa aacaattaat
1140 cagtcttaa 1149 3 402 PRT Flavobacterium heparinum 3 Met Lys
Ser Leu Leu Ser Ala Phe Val Ala Thr Ile Ala Leu Ile Gly 1 5 10 15
Ser Ala Asn Gly Met Thr Val Thr Lys Gly Asn Gly Asp Asp Trp Leu 20
25 30 Lys Lys Ser Thr Lys Thr Ala Val Ile Gln Leu Thr Arg Ala Ala
Gln 35 40 45 Thr Tyr Thr Pro Gly Met Asn Pro Arg Ser Val Asn Pro
Asp Gly Thr 50 55 60 Val Arg Leu Ala Pro Pro Arg Asp Trp Thr Thr
Gly Phe Phe Pro Gly 65 70 75 80 Thr Leu Trp Tyr Gly Tyr Glu Leu Ser
Gly Asp Lys Asn Leu Ala Ala 85 90 95 Glu Ala Lys Arg Phe Thr Leu
Ala Leu Asp Thr Ile Gln Tyr Val Lys 100 105 110 Asp Thr His Asp Leu
Gly Phe Met Leu Tyr Cys Ser Tyr Gly Asn Ala 115 120 125 Tyr Arg Val
Thr Gly Asp Lys Ile Tyr Leu Lys Pro Leu Glu Asn Gly 130 135 140 Ala
Ala Asn Leu Tyr Ala Arg Phe Asn Lys Lys Val Gly Ala Ile Arg 145 150
155 160 Ser Trp Asp Phe Gly His Trp Gln Phe Pro Val Ile Ile Asp Asn
Leu 165 170 175 Met Asn Leu Glu Tyr Leu Tyr Trp Ala Gly Lys Glu Phe
Asn Lys Pro 180 185 190 Glu Trp Phe Asp Ala Ala Lys Thr His Ala Val
Thr Thr Met Lys Asn 195 200 205 His Phe Arg Lys Asp Tyr Ser Ser Tyr
His Val Ile Ser Tyr Asp Thr 210 215 220 Leu Ser Gly Lys Val Leu Gln
Arg Glu Thr His Gln Gly Leu Thr Asn 225 230 235 240 Glu Ser Ala Trp
Ala Arg Gly Gln Ala Trp Gly Leu Tyr Gly Tyr Thr 245 250 255 Met Ser
Tyr Lys Asp Thr Lys Asp Lys Lys Phe Ile Glu His Ala Glu 260 265 270
His Ile Ala Ala Phe Ile Met Asn His Pro Ala Met Pro Ala Asp Lys 275
280 285 Ile Pro Leu Trp Asp Phe Asp Val His Asn Arg Asp Arg Ser Pro
Arg 290 295 300 Asp Ala Ser Ala Ala Ala Val Ile Ala Ser Ala Leu Leu
Asp Leu Ser 305 310 315 320 Thr Gln Val Lys Asp Gly Gln Lys Tyr Phe
Lys Phe Ala Glu Asp Ile 325 330 335 Leu Lys Thr Leu Ser Ser Asp Glu
Tyr Leu Ala Lys Pro Gly Glu Asn 340 345 350 Gln Phe Phe Ile Leu Lys
His Ser Val Gly Ala Leu Leu Tyr Asn Ser 355 360 365 Glu Ile Asp Thr
Pro Leu Asn Tyr Ala Asp Tyr Tyr Tyr Leu Glu Ala 370 375 380 Leu Lys
Arg Tyr Ala Glu Ile Lys Lys Ile Asp Leu Lys Thr Ile Asn 385 390 395
400 Gln Ser 4 1209 DNA Flavobacterium heparinum 4 atgaaatcac
tactcagtgc gtttgttgcg actattgcat taataggatc tgcaaacggg 60
atgacagtta cgaaaggcaa cggcgatgac tggttaaaga aatcaactaa aaccgcagta
120 atacagttaa cacgggctgc acaaacctat acaccaggca tgaacccaag
gtctgtcaat 180 ccggacggga cggtaaggct ggcccctccc cgcgactgga
ccacaggttt tttcccggga 240 acgttgtggt atggttatga actatcgggc
gataaaaacc tggcggccga agccaaaaga 300 tttacccttg ccttagatac
gatacaatat gttaaagata cgcacgacct gggctttatg 360 ttgtattgtt
cttatggcaa tgcctaccgt gtaaccggag acaagattta cctgaagcca 420
ttagaaaacg gtgcggccaa tttatatgcc cgtttcaata aaaaagtagg ggccatccgc
480 tcatgggatt tcggacactg gcaatttccg gtaattatag acaacctgat
gaacctggag 540 tatttatact gggcaggaaa ggaattcaat aagccagaat
ggttcgatgc tgctaaaaca 600 catgcggtta cgaccatgaa aaaccatttc
agaaaagatt atagttctta ccatgtgatc 660 agttacgata ccctgtctgg
aaaagtactg caacgtgaaa cccatcaggg acttaccaac 720 gaatcggcct
gggcacgggg gcaagcctgg ggactttacg gctataccat gagctataag 780
gatacgaaag acaaaaaatt catcgaacat gcagagcata tcgctgcttt catcatgaac
840 caccctgcaa tgccggcaga taaaattcca ctttgggact ttgatgtcca
caaccgcgac 900 aggtcgccaa gggatgcttc tgctgctgca gtaattgctt
cagccctgct agacctgagc 960 acgcaggtaa aagatggtca gaaatatttt
aaatttgccg aggatatcct gaaaacattg 1020 tcatcagatg aatacctggc
gaaacccggc gagaaccagt tttttatatt gaaacatagt 1080 gtaggtgcat
tgctgtacaa ttcggaaatc gatacacctt tgaattatgc cgactattac 1140
tatctggagg ctttaaaacg ctatgcagag attaaaaaaa ttgacctgaa aacaattaat
1200 cagtcttaa 1209 5 27 DNA Artificial Sequence Degenerate Primer
5 garacncayc arggnytnac naaygar 27 6 27 DNA Artificial Sequence
Degenerate Primer 6 ytcrttngtn arnccytgrt gngtytc 27 7 21 DNA
Artificial Sequence Degenerate Primer 7 aaytaygcng aytaytayta y 21
8 21 DNA Artificial Sequence Degenerate Primer 8 rtartartar
tcngcrtart t 21 9 24 DNA Artificial Sequence Degenerate Primer 9
caracntaya cnccnggnat gaay 24 10 20 DNA Artificial Sequence Primer
10 ttcatggtcg taaccgcatg 20 11 20 DNA Artificial Sequence Primer 11
tatacaccag gcatgaaccc 20 12 21 DNA Artificial Sequence Primer 12
cccagtataa atactccagg t 21 13 32 DNA Artificial Sequence Primer 13
tgttctagac atatgaaatc actactcagt gc 32 14 32 DNA Artificial
Sequence Primer 14 gtctcgagga tccttaagac tgattaattg tt 32 15 32 DNA
Artificial Sequence Primer 15 tgttctagac atatgacagt tacgaaaggc aa
32 16 17 PRT Artificial Sequence Cleaved N-terminal 6X His Tagged
Peptide 16 Met Gly Ser Ser His His His His His His Ser Ser Gly Leu
Val Pro 1 5 10 15 Arg 17 12 PRT Artificial Sequence Motif Sequence
17 Ala Xaa Xaa Ala Xaa Xaa Ala Xaa Xaa Xaa Xaa Ala 1 5 10 18 12 PRT
Flavobacterium heparinum 18 Glu Phe Asn Lys Pro Glu Trp Phe Asp Ala
Ala Lys 1 5 10 19 10 PRT Flavobacterium heparinum 19 Pro Gly Glu
Asn Gln Phe Phe Ile Leu Lys 1 5 10 20 12 PRT Flavobacterium
heparinum 20 Phe Thr Leu Ala Leu Asp Thr Ile Gln Tyr Val Lys 1 5 10
21 32 PRT Flavobacterium heparinum 21 Val Leu Gln Arg Glu Thr His
Gln Gly Leu Thr Asn Glu Ser Ala Trp 1 5 10 15 Ala Arg Gly Gln Ala
Trp Gly Leu Tyr Gly Tyr Thr Met Ser Tyr Lys 20 25 30 22 28 PRT
Flavobacterium heparinum 22 His Ser Val Gly Ala Leu Leu Tyr Asn Ser
Glu Ile Asp Thr Pro Leu 1 5 10 15 Asn Tyr Ala Asp Tyr Tyr Tyr Leu
Glu Ala Leu Lys 20 25 23 34 PRT Flavobacterium heparinum 23 Thr Ala
Val Ile Gln Leu Thr Arg Ala Ala Gln Thr Tyr Thr Pro Gly 1 5 10 15
Met Asn Pro Arg Ser Val Asn Pro Asp Gly Thr Val Arg Leu Ala Pro 20
25 30 Pro Arg
* * * * *