U.S. patent application number 11/401228 was filed with the patent office on 2006-08-03 for bmp-11 compositions.
This patent application is currently assigned to Genetics Institute. LLC.. Invention is credited to Anthony J. Celeste, John M. Wozney.
Application Number | 20060172391 11/401228 |
Document ID | / |
Family ID | 22035966 |
Filed Date | 2006-08-03 |
United States Patent
Application |
20060172391 |
Kind Code |
A1 |
Wozney; John M. ; et
al. |
August 3, 2006 |
BMP-11 compositions
Abstract
Purified BMP-11 proteins and processes for producing them are
disclosed. Recombinant DNA molecules encoding the BMP-11 proteins
are also disclosed. The proteins may be useful in regulating
follicle stimulating hormone, such as for contraception. In
addition, the proteins may be useful for the induction of bone,
cartilage and/or other connective tissue.
Inventors: |
Wozney; John M.; (Hudson,
MA) ; Celeste; Anthony J.; (Hudson, MA) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER;LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Assignee: |
Genetics Institute. LLC.
|
Family ID: |
22035966 |
Appl. No.: |
11/401228 |
Filed: |
April 11, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10188886 |
Jul 5, 2002 |
|
|
|
11401228 |
Apr 11, 2006 |
|
|
|
08919850 |
Aug 28, 1997 |
6437111 |
|
|
10188886 |
Jul 5, 2002 |
|
|
|
08452772 |
May 30, 1995 |
5700911 |
|
|
08919850 |
Aug 28, 1997 |
|
|
|
08247907 |
May 20, 1994 |
5639638 |
|
|
08452772 |
May 30, 1995 |
|
|
|
08061464 |
May 12, 1993 |
|
|
|
08247907 |
May 20, 1994 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 530/399; 536/23.5 |
Current CPC
Class: |
A61P 35/00 20180101;
C07K 14/51 20130101; A61P 25/28 20180101; C12N 5/0619 20130101;
A61P 25/00 20180101; A61P 15/00 20180101; A61P 7/00 20180101; C12N
2501/155 20130101; A61P 13/02 20180101; C07K 14/575 20130101; A61P
15/18 20180101; C07K 2319/00 20130101; A61P 43/00 20180101; A61K
38/1875 20130101; Y10S 930/12 20130101; A61P 19/00 20180101 |
Class at
Publication: |
435/069.1 ;
536/023.5; 435/320.1; 435/325; 530/399 |
International
Class: |
C12P 21/06 20060101
C12P021/06; C07H 21/04 20060101 C07H021/04; C07K 14/475 20060101
C07K014/475; A61K 38/18 20060101 A61K038/18 |
Claims
1-27. (canceled)
28. A purified BMP-11 polypeptide, wherein the polypeptide
comprises an amino acid sequence encoded by a DNA sequence selected
from the group consisting of: (a) nucleotides 1 to 759 of SEQ ID
NO:10; (b) nucleotides encoding amino acids -253 to -1 of SEQ ID
NO:11; and (c) a nucleotide sequence that hybridizes under
stringent conditions with the complement of the nucleotide sequence
of (a) or (b) wherein the stringent conditions comprise hybridizing
at 65.degree. C. and washing at 65.degree. C. in 0.1.times.SSC,
0.1% SDS.
29. A purified BMP-11 polypeptide encoded by a DNA sequence chosen
from: (a) nucleotides 1 to 759 of SEQ ID NO:10; (b) nucleotides
encoding amino acids -253 to -1 of SEQ ID NO:11; and (c) a
nucleotide sequence that hybridizes under stringent conditions with
the complement of the nucleotide sequence of (a) or (b) wherein the
stringent conditions comprise hybridizing at 65.degree. C. and
washing at 65.degree. C. in 0.1.times.SSC, 0.1% SDS.
30. The BMP-11 polypeptide of claim 28, wherein the polypeptide
comprises amino acids -253 to -1 of SEQ ID NO:11.
31. The BMP-11 polypeptide of claim 29, wherein the DNA sequence is
chosen from nucleotides 1 to 759 of SEQ ID NO:10 and nucleotides
encoding amino acids -253 to -1 of SEQ ID NO:11.
32. A pharmaceutical composition comprising an effective amount of
the BMP-11 polypeptide of claim 28.
33. The pharmaceutical composition of claim 32 in admixture with a
pharmaceutically acceptable vehicle.
34. A pharmaceutical composition comprising an effective amount of
the BMP-11 polypeptide of claim 30.
35. The pharmaceutical composition of claim 34 in admixture with a
pharmaceutically acceptable vehicle.
36. The pharmaceutical composition of claim 31 in admixture with a
pharmaceutically acceptable vehicle.
37. A method of inhibiting BMP-11 activity in a mammal, comprising
administering a pharmaceutical composition of claim 32 to the
mammal, thereby inhibiting a BMP-11 activity.
38. A method of promoting neuronal cell survival comprising
administering to a mammal a pharmaceutical composition of claim
32.
39. A method of promoting neuronal cell survival comprising
administering to a mammal a pharmaceutical composition of claim
33.
40. A method of promoting neuronal cell survival comprising
administering to a mammal a pharmaceutical composition of claim
34.
41. A method of promoting neuronal cell survival comprising
administering to a mammal a pharmaceutical composition of claim
35.
42. A method of promoting neuronal cell survival comprising
administering to a mammal a pharmaceutical composition of claim
36.
43. A method of treating a mammal, comprising administering a
pharmaceutical composition of claim 32 to a mammal to treat one or
more conditions selected from bone defects, connective tissue
defects, periodontal disease, and tissue wounds.
44. A pharmaceutical composition comprising the BMP-11 polypeptide
of claim 28 and a factor chosen from epidermal growth factor (EGF),
fibroblast growth factor (FGF), platelet derived growth factor
(PDGF), transforming growth factors (TGF-.alpha. and TGF-.beta.),
k-fibroblast growth factor (kFGF), parathyroid hormone (PTH),
leukemia inhibitory factor (LIF/HILDA/DIA), and insulin-like growth
factor (IGF), in admixture with a pharmaceutically acceptable
vehicle.
Description
[0001] This application is a Continuation-in-part application of
Ser. No. 08/061,464 filed on May 12, 1993.
BACKGROUND OF THE INVENTION
[0002] The present invention relates to a novel family of purified
proteins designated BMP-11, DNA molecules encoding them, and
processes for obtaining them. The inventors have previously
designated the BMP-11 proteins as Activin WC. The BMP-11 proteins
may be useful to induce bone and/or cartilage formation and in
wound healing and tissue repair, or for augmenting the activity of
other bone morphogenetic proteins. The BMP-11 proteins may also be
useful to regulate the production of follicle stimulating hormone,
for contraception, to promote neuronal cell survival, to stimulate
hematopoiesis, and to suppress the development of gonadal
tumors.
[0003] U.S. Pat. No. 4,798,885 disclosed DNA encoding the prepro
inhibin .alpha. and .beta. chains. U.S. Pat. No. 5,071,834
discloses pharmaceutical compositions of activin with two
beta.sub.B chains formulated in a pharmaceutically acceptable
carrier.
[0004] U.S. Pat. No. 5,102,807 discloses a purified inhibin protein
which suppresses production of FSH without suppressing production
of luteinizing hormone.
SUMMARY OF THE INVENTION
[0005] BMP-11 protein is a member of the TGF-1 superfamily of
proteins. The TGF-.beta. superfamily includes the family of
proteins known as bone morphogenetic proteins (BMPs), as well as a
group of proteins that are termed inhibin-.beta.. As discussed
further herein, when dimerized with another BMP-11 (homodimer),
BMP-11 protein is expected to demonstrate BMP-11 activity, as
further described herein, as may be measured in accordance with the
assays described in the examples herein. When dimerized as a
heterodimer with inhibin-.alpha. proteins or with other inhibin-t
proteins, the inhibin-.beta./BMP-11 heterodimer is expected to
demonstrate effects on the production of follicle stimulating
hormone (FSH), as described further herein. It is further expected
that, in homodimeric form or in heterodimeric form with another
member of the bone morphogenetic protein family, BMP-11 will
exhibit BMP activity, i.e., the ability to induce the formation of
bone, cartilage and/or other connective tissue. Thus, depending
upon the environment of BMP-11, it may form dimers which will
demonstrate either activin or inhibin activity, or bone, cartilage
and/or other connective tissue-inducing activity. Accordingly,
BMP-11 activity is defined as the ability to regulate the
production of FSH in the assay described at Example 8 herein, or
the ability to induce the formation of bone, cartilage and/or other
connective tissue in the assays described at Examples 5 to 7
herein.
[0006] Proteins termed inhibins and activins are produced in the
gonad and exist naturally in follicular fluid. These proteins act
at the level of the anterior pituitary gland to inhibit (inhibins)
or stimulate (activins) the release of follicle-stimulating hormone
(FSH) [for reviews see, e.g., Ying, S.-Y., Endocr. Rev., 9:267-293
(1988) or Ling, N. et al, Vitamins and Hormones, 44:1-46 (Academic
Press 1988)]. Briefly, dimeric proteins comprised of one chain of
inhibin a and one chain of inhibin .beta. (.beta..sub.A or
.beta..sub.B) are termed inhibins and are characterized by their
ability to inhibit the release of follicle stimulating hormone
(FSH), while other dimeric proteins comprised of two chains of
inhibin .beta. (.beta..sub.A or .beta..sub.B) are termed activins
and are characterized by their ability to stimulate the release of
follicle stimulating hormone (FSH) [see, e.g., Ling et al., Nature,
321:779-782 (1986) or Vale, et al., Nature, 321:776-779 (1986) or
Mason et al., Nature, 318:659-663 (1985) or Forage et al., Proc.
Natl. Acad. Sci. USA, 83:3091-3095 (1986)].
[0007] It is recognized that FSH stimulates the development of ova
in mammalian ovaries (Ross et al., in Textbook of Endocrinology,
ed. Williams, p. 355 (-1981) and that excessive stimulation of the
ovaries with FSH will lead to multiple ovulations. FSH is also
important in testicular function. Thus, BMP-11, in heterodimers
with a member of the inhibin a family, may be useful as a
contraceptive based on the ability of inhibins to decrease
fertility in female mammals and decrease spermatogenesis in male
mammals. Administration of sufficient amounts of other inhibins can
induce infertility these mammals. BMP-11, as a homodimer or as a
heterodimer with other protein subunits of the inhibin-.beta.
group, may be useful as a fertility inducing therapeutic, based
upon the ability of activin molecules in stimulating FSH release
from cells of the anterior pituitary. See, for example, U.S. Pat.
No. 4,798,885. BMP-11 may also be useful for advancement of the
onset of fertility in sexually immature mammals, so as to increase
the lifetime reproductive performance of domestic animals such as
cows, sheep and pigs. It is further contemplated that BMP-11 may be
useful in promoting neuronal cell survival [see, e.g., Schubert et
al., Nature, 344:868-870 (1990)], modulating hematopoiesis by
inducing the differentiation of erythroid cells [see, e.g.,
Broxmeyer et al, Proc. Natl. Acad. Sci. USA, 85:9052-9056 (1988) or
Eto et al, Biochem. Biophys. Res. Comm., 142:1095-1103 (1987)], for
suppressing the development of gonadal tumors [see, e.g., Matzuk et
al., Nature, 360:313-319 (1992)] or for augmenting the activity of
bone morphogenetic proteins [see, e.g., Ogawa et al., J. Biol.
Chem., 267:14233-14237 (1992)].
[0008] BMP-11 proteins may be further characterized by their
ability to modulate the release of follicle stimulating hormone
(FSH) in established in vitro bioassays using rat anterior
pituitary cells as described [see, e.g., Vale et al, Endocrinology,
91:562-572 (1972); Ling et al., Nature, 321:779-782 (1986) or Vale
et al., Nature, 321:776-779 (1986)]. It is contemplated that the
BMP-11 protein of the invention, when composed as a homodimer or a
heterodimer with other inhibin .beta. chains will exhibit
stimulatory effects on the release of follicle stimulating hormone
(FSH) from anterior pituitary cells as described [Ling et al.,
Nature, 321:779-782 (1986) or Vale et al., Nature, 321:776-779
(1986)].
[0009] Additionally, it is contemplated that the BMP-11 protein of
the invention, when composed as a heterodimer with the inhibin a
chain, will inhibit the release of follicle stimulating hormone
(FSH) from anterior pituitary cells as described [see, e.g., Vale
et al, Endocrinology, 91:562-572 (1972). Therefore, depending on
the particular composition, it is expected that the BMP-11 protein
of the invention may have contrasting and opposite effects on the
release of follicle stimulating hormone (FSH) from the anterior
pituitary.
[0010] Activin A (the homodimeric composition of inhibin
.beta..sub.A) has been shown to have erythropoietic-stimulating
activity [see e.g. Eto et al., Biochem. Biophys. Res. Commun.,
142:1095-1103 (1987) and Murata et al., Proc. Natl. Acad. Sci.
U.S.A., 85:2434-2438 (1988) and Yu et al., Nature, 330:765-767
(1987)]. It is contemplated that the BMP-11 protein of the
invention has a similar erythropoietic-stimulating activity. This
activity of the BMP-11 protein may be further characterized by the
ability of the BMP-11 protein to demonstrate erythropoietin
activity in the biological assay performed using the human K-562
cell line as described by [Lozzio et al., Blood, 45:321-334 (1975)
and U.S. Pat. No. 5,071,834].
[0011] The structures of several proteins, designated BMP-1 through
BMP-9, have previously been elucidated. The unique inductive
activities of these proteins, along with their presence in bone,
suggests that they are important regulators of bone repair
processes, and may be involved in the normal maintenance of bone
tissue. The BMP-11 protein of the present invention is related to
the above BMP proteins, and is expected to share BMP activities
such as the ability to induce bone, cartilage and/or other
connective tissue, such as tendon or ligament, and wound healing
activities of the BMPs. In addition, it is expected that the
proteins of the invention may act in concert with or perhaps
synergistically with other related proteins and growth factors.
Further therapeutic methods and compositions of the invention
therefore comprise a therapeutic amount of at least one BMP-11
protein of the invention with a therapeutic amount of at least one
of the other BMP proteins disclosed in co-owned patents and
applications described below. Such combinations may comprise
separate molecules of the BMP proteins or heteromolecules comprised
of different BMP moieties. Further, BMP-11 proteins may be combined
with other agents beneficial to the treatment of the bone and/or
cartilage defect, wound, or tissue in question. These agents
include various growth factors such as epidermal growth factor
(EGF), fibroblast growth factor (FGF), platelet derived growth
factor (PDGF), transforming growth factors (TGF-.alpha. and
TGF-.beta.), and k-fibroblast growth factor (kFGF), parathyroid
hormone (PTH), leukemia inhibitory factor (LIF/HILDA/DIA),
insulin-like growth factors (IGF-I and IGF-II). Portions of these
agents may also be used in compositions of the present
invention.
[0012] The bovine BMP-11 DNA sequence (SEQ ID NO: 1) and amino acid
sequence (SEQ ID: 2) and human BMP-11 DNA sequence (SEQ ID NO:10)
and amino acid sequence (SEQ ID NO:11) are set forth in the
Sequence Listings herein. Activin proteins are capable of
regulating the production of follicle-stimulating hormone (FSH),
and thus BMP-11 may be useful as a contraceptive or a fertility
inducing therapeutic. In homodimeric form or in heterodimers with
proteins of the inhibin-.beta. group, purified BMP-11 protein is
expected to demonstrate activin activity, and may be used to
stimulate FSH. In addition, it is expected that the purified BMP-11
protein may be useful for the induction of bone, cartilage and/or
other connective tissue.
[0013] Bovine BMP-11 may be produced by culturing a cell
transformed with a DNA sequence comprising nucleotide #375 to
nucleotide #704 as shown in SEQ ID NO: 1 and recovering and
purifying from the culture medium a protein characterized by the
amino acid sequence comprising amino acid # 1 to # 109 as shown in
SEQ ID NO: 2 substantially free from other proteinaceous materials
with which it is co-produced.
[0014] Human BMP-11 is expected to be homologous to bovine BMP-11.
The invention, therefore, includes methods for obtaining the DNA
sequences encoding human BMP-11, the DNA sequences obtained by
these methods, and the human protein encoded by these DNA
sequences. This method entails utilizing the bovine BMP-11
nucleotide sequence or portions thereof to design probes to screen
libraries for the human gene or fragments thereof using standard
techniques. A DNA sequence encoding part of the human BMP-11
protein (SEQ ID NO: 3) and the corresponding amino acid sequence
(SEQ ID NO: 4) are set forth in the Sequence Listing. These
sequences may also be used in order to design probes to obtain the
complete human BMP-11 gene through standard techniques. Human
BMP-11 may be produced by culturing a cell transformed with the
BMP-11 DNA sequence and recovering and purifying BMP-11 from the
culture medium. The purified expressed protein is substantially
free from other proteinaceous materials with which it is
co-produced, as well as from other contaminants.
[0015] The recovered purified protein is contemplated to
demonstrate the ability to regulate the production of FSH. The
proteins of the invention may be further characterized by the
ability to regulate the production of follicle stimulating hormone
(FSH) in established in vitro bioassays using rat anterior
pituitary cells. BMP-11 proteins may also be characterized by the
ability to induce the formation of bone, cartilage and/or other
connective tissue, for example, in the rat bone formation assay
described below.
[0016] Another aspect of the invention provides pharmaceutical
compositions containing a therapeutically effective amount of a
BMP-11 protein in a pharmaceutically acceptable vehicle or carrier.
BMP-11 compositions of the invention may be useful for the
regulation of follicle stimulating hormone, and may be useful in
contraception. Compositions of the invention may further include at
least one other therapeutically useful agent such as the BMP
proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7,
disclosed for instance in U.S. Pat. Nos. 5,108,922; 5,013,649;
5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in
PCT publication WO91/18098; and BMP-9, disclosed in PCT publication
WO93/00432, and BMP-10, disclosed in co-pending patent application
Ser. No. 08/061,695, filed on May 12, 1993. The BMP-11 compositions
may also be useful for a number of uses involving regulation of the
production of follicle stimulating hormone, including
contraception. These methods, according to the invention, entail
administering to a patient needing such treatment, an effective
amount of BMP-11.
[0017] The compositions of the invention may comprise, in addition
to a BMP-11 protein, other members of the inhibin-t group of
proteins or inhibin-.alpha. proteins, as well as other
therapeutically useful agents including growth factors such as
epidermal growth factor (EGF), fibroblast growth factor (FGF),
transforming growth factor (TGF-.alpha. and TGF-.beta.), and
insulin-like growth factor (IGF).
[0018] The BMP-11 compositions of the present invention may also be
useful for treating a number of bone and/or cartilage defects,
periodontal disease and various types of wounds. These methods,
according to the invention, entail administering to a patient
needing such bone and/or cartilage formation wound healing or
tissue repair, an effective amount of a BMP-11 protein. These
methods may also entail the administration of a protein of the
invention in conjunction with at least one of the novel BMP
proteins disclosed in the co-owned patents and applications
described above. In addition, these methods may also include the
administration of a BMP-11 protein with other growth factors
including EGF, FGF, TGF-.alpha., TGF-.beta., and IGF.
[0019] Still a further aspect of the invention are DNA sequences
coding for expression of a BMP-11 protein. Such sequences include
the sequence of nucleotides in a 5' to 3' direction illustrated in
SEQ ID NO: 1 or DNA sequences which hybridize under stringent
conditions with the DNA sequence of SEQ ID NO: 1 and encode a
protein having BMP-11 activity. Finally, allelic or other
variations of the sequences of SEQ ID NO: 1, whether such
nucleotide changes result in changes in the peptide sequence or
not, are also included in the present invention.
[0020] Still a further aspect of the invention are DNA sequences
coding for expression of a BMP-11 protein. Such sequences include
the sequence of nucleotides in a 5' to 3' direction illustrated in
SEQ ID NO: 1 or SEQ ID NO:10, and DNA sequences which, but for the
degeneracy of the genetic code, are identical to the DNA sequence
of SEQ ID NO: 1 or SEQ ID NO:10, and encode the protein of SEQ ID
NO: 2 or SEQ ID NO:11. Further included in the present invention
are DNA sequences which hybridize under stringent conditions with
the DNA sequence of SEQ ID NO: 1 or SEQ ID NO:10 and encode a
protein having BMP-11 activity. Finally, allelic or other
variations of the sequences of SEQ ID NO: 1 or SEQ ID NO: 10,
whether such nucleotide changes result in changes in the peptide
sequence or not, but where the peptide sequence still has BMP-11
activity, are also included in the present invention.
[0021] A further aspect of the invention includes vectors
comprising a DNA sequence as described above in operative
association with an expression control sequence therefor. These
vectors may be employed in a novel process for producing a BMP-11
protein of the invention in which a cell line transformed with a
DNA sequence encoding a BMP-11 protein in operative association
with an expression control sequence therefor, is cultured in a
suitable culture medium and a BMP-11 protein is recovered and
purified therefrom. This process may employ a number of known cells
both prokaryotic and eukaryotic as host cells for expression of the
polypeptide.
[0022] The present invention also includes the use of the DNA
sequences and vectors of the invention in gene therapy
applications. In such use, the vectors may be transfected into the
cells of a patient in vitro, and the cells may be re-introduced
into a patient. Alternatively, the vectors may be introduced into a
patient in vivo through targeted transfection.
[0023] Other aspects and advantages of the present invention will
be apparent upon consideration of the following detailed
description and preferred embodiments thereof.
DESCRIPTION OF THE SEQUENCES
[0024] SEQ ID NO:1 is a partial nucleotide sequence of the bovine
BMP-11 encoding the mature bovine BMP-11 polypeptide.
[0025] SEQ ID NO:2 is the amino acid sequence of a partial
propeptide and the complete mature bovine BMP-11 polypeptide,
encoded by SEQ ID NO:1.
[0026] SEQ ID NO:3 is a partial nucleotide sequence of human
BMP-11.
[0027] SEQ ID NO:4 is a partial amino acid sequence for human
BMP-11 polypeptide encoded by SEQ ID NO:3.
[0028] SEQ ID NO:5 and 6 are primers to bovine BMP-11 used to
isolate the human BMP-11 or other BMP-11 proteins.
[0029] SEQ ID NO:7 is a DNA sequence that is inserted into pMT2 CXM
to add an XhoI recognition site near the SV40 origin of
replication.
[0030] SEQ ID NO:8 is a DNA sequence inserted into pMT21 to insert
an XhoI recognition site upstream from the DHFR gene.
[0031] SEQ ID NO:9 is a DNA sequence comprising a portion of the
EMC virus leader sequence.
[0032] SEQ ID NO:10 is a DNA sequence encoding a partial propeptide
and the complete mature human BMP-11 protein.
[0033] SEQ ID NO:11 is the amino acid sequence of a partial
propeptide and the complete mature human BMP-11 protein encoded by
SEQ ID NO:10.
DETAILED DESCRIPTION OF THE INVENTION
BMP-11
[0034] The bovine BMP-11 nucleotide sequence (SEQ ID NO: 1) and
encoded amino acid sequence (SEQ ID NO: 2) and human BMP-11
nucleotide sequence (SEQ ID NO:10) and encoded amino acid sequence
(SEQ ID NO:11) are depicted in the Sequence Listings herein.
Purified bovine BMP-11 proteins of the present invention are
produced by culturing a host cell transformed with a DNA sequence
comprising the DNA coding sequence of SEQ ID NO: 1 from nucleotide
#375 to #704 or the DNA coding sequence of SEQ ID NO: 10 from
nucleotide #760 to #1086 and recovering and purifying from the
culture medium a protein which contains the amino acid sequence or
a substantially homologous sequence as represented by amino acids
#1 to # 109 of SEQ ID NO: 2 or amino acids 1 to 109 of SEQ ID NO:
11. For production of BMP-11 proteins in mammalian cells, the DNA
sequence further comprises a suitable propeptide linked in frame
with the above DNA coding sequences f or BMP-11. The propeptide may
be the native propeptide of BMP-11 or a propeptide from another
member of the TGF-.beta. superfamily
[0035] The human BMP-11 sequence of the present invention is
obtained using the whole or fragments of the bovine BMP-11 DNA
sequence, or the partial human BMP-11 sequence of SEQ ID NO: 3 as a
probe. Thus, the human BMP-11 DNA sequence comprise the DNA
sequence of nucleotides #28 to #185 of SEQ ID NO: 3. The human
BMP-11 protein comprise the amino acid sequence of amino acids #1
to #52 of SEQ ID NO: 4.
[0036] It is expected that BMP-11, as expressed by mammalian cells
such as CHO cells, exists as a heterogeneous population of active
species of BMP-11 protein with varying N-termini. It is expected
that active species will comprise an amino acid sequence beginning
at least with the cysteine residue at amino acid #6 of SEQ ID NO:1
or SEQ ID NO:10, or further in the N-terminal direction. Thus, it
is expected that DNA sequences encoding active BMP-11 proteins will
comprise nucleotides #375 or #390 to 701 of SEQ ID NO:1 or
nucleotides #760 or #775 to #1086 of SEQ ID NO:110, and may
comprise additional nucleotide sequence in the 5' direction of SEQ
ID NO:1 or SEQ ID NO:10.
[0037] The N-terminus of human BMP-11 has been experimentally
determined by expression in E. coli to be as follows:
[M]NLGLDXDEHSSE, wherein X designates an amino acid residue with no
clear signal, consistent with a location of cysteine at that
position. Thus, it is expected that this species of BMP-11 will
have an N-terminus at amino acid # 1 of SEQ ID NO:1 or SEQ. ID NO:
10, and DNA sequences encoding this species will comprise
nucleotides # 375 to # 701 of SEQ ID NO:1 (bovine) or nucleotides #
760 to 1086 of SEQ ID NO:10 (human). The apparent molecular weight
of human BMP-11 monomer was determined by SDS-PAGE to be
approximately 12 kd. The human BMP-11 protein exists as a clear,
colorless solution in 0.1% trifluoroacetic acid.
[0038] The BMP-11 proteins recovered from the culture medium are
purified by isolating them from other proteinaceous materials from
which they are co-produced and from other contaminants present.
[0039] BMP-11 proteins may be characterized by the ability to LO
regulate the production of FSH. BMP-11 proteins may further be
characterized by the ability to modulate the release of follicle
stimulating hormone (FSH) in established in vitro bioassays using
rat anterior pituitary cells as described [see, e.g., Vale et al,
Endocrinology, 91:562-572 (1972); Ling et al., Nature, 321:779-782
(1986) or Vale et al., Nature, 321:776-779 (1986)]. BMP-11 proteins
may also be characterized by the ability to induce the formation of
bone, cartilage and/or other connective tissue. Such
tissue-inducing activity of BMP-11 may further be characterized by
the ability to induce the formation of bone, cartilage and/or other
connective tissue in the assays described in the examples
below.
[0040] The BMP-11 proteins provided herein also include factors
encoded by the sequences similar to those of SEQ ID NO: 1 or SEQ ID
NO:10, but into which modifications are naturally provided (e.g.
allelic variations in the nucleotide sequence which may result in
amino acid changes in the polypeptide) or deliberately engineered.
For example, synthetic polypeptides may wholly or partially
duplicate continuous sequences of the amino acid residues of SEQ ID
NO:2 or SEQ ID NO:11. These sequences, by virtue of sharing
primary, secondary, or tertiary structural and conformational
characteristics with inhibin-.beta. polypeptides of SEQ ID NO:2 or
SEQ ID NO:11 may possess BMP-11 activity in common therewith. Thus,
they may be employed as biologically active substitutes for
naturally-occurring BMP-11 polypeptides in therapeutic
processes.
[0041] Other specific mutations of the sequences of BMP-11 proteins
described herein involve modifications of glycosylation sites.
These modifications may involve O-linked or N-linked glycosylation
sites. For instance, the absence of glycosylation or only partial
glycosylation results from amino acid substitution or deletion at
asparagine-linked glycosylation recognition sites. The
asparagine-linked glycosylation recognition sites comprise
tripeptide sequences which are specifically recognized by
appropriate cellular glycosylation enzymes. These tripeptide
sequences are either asparagine-X-threonine or asparagine-X-serine,
where X is usually any amino acid. A variety of amino acid
substitutions or deletions at one or both of the first or third
amino acid positions of a glycosylation recognition site (and/or
amino acid deletion at the second position) results in
non-glycosylation at the modified tripeptide sequence. In addition,
expression of the BMP-11 protein in bacterial cells results in
non-glycosylated protein, without altering the glycosylation
recognition sites.
[0042] The present invention also encompasses the novel DNA
sequences, free of association with DNA sequences encoding other
proteinaceous materials, and coding for expression of BMP-11
proteins. These DNA sequences include those depicted in SEQ ID NO:1
or SEQ ID NO:10 in a 5' to 3' direction and those sequences which
hybridize thereto under stringent hybridization conditions, for
example 0.1.times.SSC, 0.1% SDS at 65.degree. C. [see, Maniatis et
al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor
Laboratory (1982), pages 387 to 389] and encode a protein having
BMP-11 activity. These DNA sequences also include those which
comprise the DNA sequence of SEQ ID NO:3 and those which hybridize
thereto under stringent hybridization conditions and encode a
protein having BMP-11 activity.
[0043] Similarly, DNA sequences which code for BMP-11 proteins
coded for by the sequences of SEQ ID NO:1 or SEQ ID NO:10, but
which differ in codon sequence due to the degeneracies of the
genetic code or allelic variations (naturally-occurring base
changes in the species population which may or may not result in an
amino acid change) also encode the novel factors described herein.
Variations in the DNA sequences of SEQ ID NO:1 or SEQ ID NO:10
which are caused by point mutations or by induced modifications
(including insertion, deletion, and substitution) to enhance the
activity, half-life or production of the polypeptides encoded are
also encompassed in the invention.
[0044] Another aspect of the present invention provides a novel
method for producing BMP-11 proteins. The method of the present
invention involves culturing a suitable cell line, which has been
transformed with a DNA sequence encoding a BMP-11 protein of the
invention, under the control of known regulatory sequences. The
transformed host cells are cultured and the BMP-11 proteins
recovered and purified from the culture medium. The purified
proteins are substantially free from other proteins with which they
are co-produced as well as from other contaminants.
[0045] Suitable cells or cell lines may be mammalian cells, such as
Chinese hamster ovary cells (CHO). The selection of suitable
mammalian host cells and methods for transformation, culture,
amplification, screening, product production and purification are
known in the art. See, e.g., Gething and Sambrook, Nature,
293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell.
Biol., 5(7):1750-1759 (1985) or Howley et al, U.S. Pat. No.
4,419,446. Another suitable mammalian cell line, which is described
in the accompanying examples, is the monkey COS-1 cell line. The
mammalian cell CV-1 may also be suitable.
[0046] Bacterial cells may also be suitable hosts. For example, the
various strains of E. coli (e.g., HB101, MC1061) are well-known as
host cells in the field of biotechnology. Various strains of B.
subtilis, Pseudomonas, other bacilli and the like may also be
employed in this method.
[0047] Many strains of yeast cells known to those skilled in the
art may also be available as host cells for expression of the
polypeptides of the present invention. Additionally, where desired,
insect cells may be utilized as host cells in the method of the
present invention. See, e.g. Miller et al, Genetic Engineering,
8:277-298 (Plenum Press 1986) and references cited therein.
[0048] Another aspect of the present invention provides vectors for
use in the method of expression of these novel BMP-11 polypeptides.
Preferably the vectors contain the full novel DNA sequences
described above which encode the novel factors of the invention.
Additionally, the vectors contain appropriate expression control
sequences permitting expression of the BMP-11 protein sequences.
Alternatively, vectors incorporating modified sequences as
described above are also embodiments of the present invention.
Additionally, the sequence of SEQ ID NO:1 or SEQ ID NO:10 or other
sequences encoding BMP-11 proteins could be manipulated to express
a mature BMP-11 by deleting BMP-11 encoding propeptide sequences
and replacing them with sequences encoding the complete propeptides
of other BMP proteins, activin proteins or other members of the
TGF-.beta. superfamily.
[0049] The vectors may be employed in the method of transforming
cell lines and contain selected regulatory sequences in operative
association with the DNA coding sequences of the invention which
are capable of directing the replication and expression thereof in
selected host cells. Regulatory sequences for such vectors are
known to those skilled in the art and may be selected depending
upon the host cells. Such selection is routine and does not form
part of the present invention.
[0050] For expression in mammalian host cells, the vector may
comprise a coding sequence encoding a propeptide suitable for
secretion of proteins by the host cell linked in proper reading
frame to the coding sequence for mature BMP-11 protein. Suitable
propeptide encoding sequences may be obtained from DNA encoding
proteins of the TGF-.beta. superfamily of proteins, for example,
including BMP-2 through BMP-9. For example, see U.S. Pat. No.
5,168,150, the disclosure of which is hereby incorporated by
reference, in which a DNA encoding a precursor portion of a
mammalian protein other than BMP-2 is fused to the DNA encoding a
mature BMP-2 protein. Thus, the present invention includes chimeric
DNA molecules comprising a DNA sequence encoding a propeptide from
a member of the TGF-.beta. superfamily of proteins linked in
correct reading frame to a DNA sequence encoding a BMP-11
polypeptide. The term "chimeric" is used to signify that the
propeptide originates from a different polypeptide than BMP-11.
[0051] A protein of the present invention, which regulates the
production of FSH, has possible application in increasing
fertility, when expressed in a composition as a homodimer or as a
heterodimer with other proteins of the inhibin-.beta. family. The
proteins of the present invention may also be useful for
contraception, when expressed in a composition as a heterodimer
with proteins of the inhibin-.alpha. family.
[0052] A protein of the present invention, which induces cartilage
and/or bone formation in circumstances where bone is not normally
formed, has application in the healing of bone fractures and
cartilage defects in humans and other animals. Such a preparation
employing a BMP-11 protein may have prophylactic use in closed as
well as open fracture reduction and also in the improved fixation
of artificial joints. De novo bone formation induced by an
osteogenic agent contributes to the repair of congenital, trauma
induced, or oncologic resection induced craniofacial defects, and
also is useful in cosmetic plastic surgery. A BMP-11 protein may be
used in the treatment of periodontal disease, and in other tooth
repair processes. Such agents may provide an environment to attract
bone-forming cells, stimulate growth of bone-forming cells or
induce differentiation of progenitors of bone-forming cells. BMP-11
polypeptides of the invention may also be useful in the treatment
of osteoporosis. A variety of osteogenic, cartilage-inducing and
bone inducing factors have been described. See, e.g., European
patent applications 148,155 and 169,016 for discussions
thereof.
[0053] The proteins of the invention may also be used in wound
healing and related tissue repair. The types of wounds include, but
are not limited to burns, incisions and ulcers. (See, e.g. PCT
Publication WO84/01106 for discussion of wound healing and related
tissue repair).
[0054] A further aspect of the invention is a therapeutic method
and composition for repairing fractures and other conditions
related to cartilage and/or bone defects or periodontal diseases.
The invention further comprises therapeutic methods and
compositions for wound healing and tissue repair. Such compositions
comprise a therapeutically effective amount of at least one of the
BMP-11 proteins of the invention in admixture with a
pharmaceutically acceptable vehicle, carrier or matrix.
[0055] Such a preparation employing a BMP-11 protein may also
increase neuronal survival and therefore be useful in
transplantation and treatment of conditions exhibiting a decrease
in neuronal survival.
[0056] It is expected that the BMP-11 proteins of the invention may
act in concert with or perhaps synergistically with other related
proteins and growth factors. Further therapeutic methods and
compositions of the invention therefore comprise a therapeutic
amount of at least one BMP-11 protein of the invention with a
therapeutic amount of at least one of the BMP proteins or other
growth factors disclosed in co-owned patents and applications
described above. Such combinations may comprise separate molecules
or heteromolecules comprised of different moieties. For example, a
method and composition of the invention may comprise a disulfide
linked dimer comprising a BMP-11 protein subunit and a subunit from
an inhibin-.alpha. protein, an inhibin-.beta. protein or a BMP
protein, such as BMP-1 through BMP-10. The agents useful with
BMP-11 may include various growth factors such as epidermal growth
factor (EGF), platelet derived growth factor (PDGF), transforming
growth factors (TGF-.alpha. and TGF-.beta.), and insulin-like
growth factor (IGF). Further therapeutic methods and compositions
of the invention comprise a therapeutic amount of at least one
BMP-11 protein of the invention with a therapeutic amount of at
least one of the BMP proteins disclosed in co-owned patents and
applications described above. Such combinations may comprise
separate molecules of the BMP proteins or heteromolecules comprised
of different BMP moieties. For example, a method and composition of
the invention may comprise a disulfide linked dimer comprising a
BMP-11 protein subunit and a subunit from one of the "BMP" proteins
described above. Thus, the present invention includes a purified
BMP-11 polypeptide which is a heterodimer wherein one subunit
comprises at least the amino acid sequence from amino acid #1 to
amino acid #109 of SEQ ID NO:2 or SEQ ID NO:11, and one subunit
comprises an amino acid sequence for a bone morphogenetic protein
selected from the group consisting of BMP-1, BMP-2, BMP-3, BMP-4,
BMP-5, BMP-6, BMP-7, BMP-8 and BMP-9. A further embodiment may
comprise a heterodimer of BMP-11 moieties. Further, BMP-11 proteins
may be combined with other agents beneficial to the treatment of
the bone and/or cartilage defect, wound, or tissue in question.
These agents include various growth factors such as epidermal
growth factor (EGF), fibroblast growth factor (FGF), platelet
derived growth factor (PDGF), transforming growth factors
(TGF-.alpha. and TGF-.beta.), and k-fibroblast growth factor
(kFGF), parathyroid hormone (PTH), leukemia inhibitory factor
(LIF/HILDA/DIA), insulin-like growth factors (IGF-I and IGF-II).
Portions of these agents may also be used in compositions of the
present invention.
[0057] The BMP-11 proteins of the present invention may also be
used in compositions combined with bone morphogenetic proteins. See
for example, Ogawa et al., WO 92/14481 (1992); Ogawa et al., J.
Biol. Chem., 267:14233-14237 (1992). The bone morphogenetic
proteins useful in such compositions include BMP-1, BMP-2, BMP-3,
BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in U.S. Pat.
Nos. 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and
5,141,905; BMP-8, disclosed in PCT publication WO91/18098; and
BMP-9, disclosed in PCT publication WO93/00432; and BMP-10
disclosed in co-pending patent application Ser. No. 08/061,695,
filed on May 12, 1993.
[0058] The preparation and formulation of such physiologically
acceptable protein compositions, having due regard to pH,
isotonicity, stability and the like, is within the skill of the
art. The therapeutic compositions are also presently valuable for
veterinary applications due to the lack of species specificity in
BMP and TGF proteins. Particularly domestic animals and
thoroughbred horses in addition to humans are desired patients for
such treatment with BMP-11 of the present invention.
[0059] The therapeutic method includes administering the
composition topically, systemically, or locally as an implant or
device. When administered, the therapeutic composition for use in
this invention is, of course, in a pyrogen-free, physiologically
acceptable form. Further, the composition may desirably be
encapsulated or injected in a viscous form for delivery to the site
of bone, cartilage or tissue damage. Topical administration may be
suitable for wound healing and tissue repair. Therapeutically
useful agents other than the BMP-11 proteins which may also
optionally be included in the composition as described above, may
alternatively or additionally, be administered simultaneously or
sequentially with the BMP-11 composition in the methods of the
invention.
[0060] Preferably for bone, cartilage or other connective tissue
formation, the composition includes a matrix capable of delivering
BMP-11 or other BMP proteins to the site of tissue damage in need
of repair, providing a structure for the developing bone and
cartilage and optimally capable of being resorbed into the body.
The matrix may provide slow release of BMP-11 and/or other bone
inductive protein, as well as proper presentation and appropriate
environment for cellular infiltration. Such matrices may be formed
of materials presently in use for other implanted medical
applications.
[0061] The choice of matrix material is based on biocompatibility,
biodegradability, mechanical properties, cosmetic appearance and
interface properties. The particular application of the BMP-11
compositions will define the appropriate formulation. Potential
matrices for the compositions may be biodegradable and chemically
defined calcium sulfate, tricalciumphosphate, hydroxyapatite,
polylactic acid and polyanhydrides other potential materials are
biodegradable and biologically well defined, such as bone, tendon
or dermal collagen. Further matrices are comprised of pure proteins
or extracellular matrix components. Other potential matrices are
nonbiodegradable and chemically defined, such as sintered
hydroxyapatite, bioglass, aluminates, or other ceramics. Matrices
may be comprised of combinations of any of the above mentioned
types of material, such as polylactic acid and hydroxyapatite or
collagen and tricalciumphosphate. The bioceramics may be altered in
composition, such as in calcium-aluminate-phosphate and processing
to alter pore size, particle size, particle shape, and
biodegradability.
[0062] Progress can be monitored by periodic assessment of bone
growth and/or repair. The progress can be monitored, for example,
x-rays, histomorphometric determinations and tetracycline
labeling.
[0063] The dosage regimen will be determined by the attending
physician considering various factors which modify the action of
the BMP-11 protein, e.g. the patient's age, sex, and diet, the
severity of any infection, time of administration and other
clinical factors. The dosage may vary with the type of BMP protein
or growth factor present in the composition. The dosage may also
vary with the type of matrix used.
[0064] The following examples illustrate practice of the present
invention in recovering and characterizing bovine BMP-11 protein
and employing it to recover the human and other BMP-11 proteins,
obtaining the human proteins and expressing the proteins via
recombinant techniques.
EXAMPLE 1
Bovine BMP-11
[0065] 800,000 recombinants of a bovine genomic library constructed
in the vector .lamda.EMBL3 are plated at a density of 8000
recombinant bacteriophage plaques per plate on 100 plates.
Duplicate nitrocellulose replicas of the recombinant bacteriophage
plaques are made from these plates and amplified. A fragment of
human BMP-7 DNA corresponding to nucleotides #1081 to #1403 (FIG.
4, U.S. Pat. No. 5,141,905) is .sup.32P-labelled by the random
priming procedure of Feinberg et al. [Anal. Biochem. 132: 6-13
(1983)] and hybridized to one set of filters in standard
hybridization buffer (SHB) (5.times.SSC, 0.170 SDS, 5.times.
Denhardt's, 100 .mu.g/ml Salmon sperm DNA) at 60.degree. C. for 2
to 3 days. The filters are washed under reduced stringency
conditions (4.times.SSC, 0.1% SDS at 60.degree. C.). Multiple
positively hybridizing recombinants are noted. 52 positively
hybridizing recombinant bacteriophage plaques are selected and
replated for secondaries. Duplicate nitrocellulose replicas of the
recombinant plaques are made from these 52 secondary plates and
amplified. One set of nitrocellulose filters is hybridized to the
human BMP-7 DNA probe as described above and washed under the same
reduced stringency conditions. The other set of filters is
hybridized to a mixed BMP-5, BMP-6, and BMP-7 probe in SHB at
65.degree. C. overnight and washed with a 0.1.times.SSC, 0.1% SDS
at 65.degree. C. (stringent hybridization and wash conditions). The
mixed probe consists of relatively equal amounts of
.sup.32P-labelled DNA fragments comprising nucleotides #1452 to
#2060 (FIG. 4, U.S. Pat. No. 5,106,748) of the human BMP-5
sequence, nucleotides #1395 to #1698 (FIG. 4, U.S. Pat. No.
5,187,076) of the human BMP-6 sequence, and nucleotides #1081 to
#1403 (FIG. 4, U.S. Pat. No. 5,141,905) of the human BMP-7
sequence. The BMP-5, BMP-6 and BMP-7 DNA fragments are
.sup.32P-labelled by the random priming procedure and equal numbers
of counts per minute (cpms) of each probe are combined and added to
the SHB containing the other set of nitrocellulose filter replicas
of the 52 secondary plates. 14 recombinants, which hybridized
positively to the human BMP-7 probe under the reduced stringency
conditions and exhibited weak or no hybridization to the mixed
BMP-5/6/7 probe under high stringency conditions, are selected for
further analysis. All 14 recombinants which exhibit these
hybridization characteristics are plaque purified and bacteriophage
DNA is prepared from each. The positively hybridizing region of one
of the 14 recombinants exhibiting the hybridization characteristics
described above, designated .lamda.7r-30, is localized to a 0.5 kb
SacI restriction fragment. This fragment is subcloned into a
plasmid vector (pGEM-3) and DNA sequence analysis is performed. The
partial DNA sequence (SEQUENCE ID NO. 1) and derived amino acid
sequence (SEQUENCE ID NO. 2) of clone .lamda.7r-30 are shown in the
Sequence Listings.
[0066] The bacteriophage .lamda.7r-30 has been deposited with the
ATCC on Apr. 7, 1993, and accorded the accession number ATCC 75439.
This deposit meets the requirements of the Budapest Treaty of the
International Recognition of the Deposit of Microorganisms for the
Purpose of Patent Procedures and regulations thereunder.
[0067] This .lamda.7r-30 clone encodes at least a portion of the
bovine BMP-11 protein of the present invention. The nucleotide
sequence of clone .lamda.7r-30 contains an open reading frame of
456 nucleotides #246-701 of SEQ ID NO:1. The nucleotide sequence of
#324 to #701 of SEQ ID NO:1 defines an open reading frame of 378
nucleotides, encoding at least 126 amino acids of the C-terminal
portion of a bovine BMP-11 protein, as determined by alignment to
other BMP proteins and other proteins within the TGF-.beta. family.
The nucleotide sequence #246 to #323 defines an open reading frame
contiguous with the sequence encoding the predicted 126 amino acid
BMP-11 peptide, however a reduced degree of amino acid identity of
the peptide deduced from this region of DNA sequence (#246 to #323)
to other BMP proteins and other proteins of the TGF-.beta. family
and the presence of multiple potential splice acceptor consensus
sequences make it difficult to define the 5' limit of this exon of
the bovine BMP-11 gene. The presence of an in-frame stop codon at
nucleotide positions #243 to #245 indicates that nucleotide
sequence of clone .lamda.7r-30 contains at least one exon/intron
boundary of the bovine BMP-11 gene.
[0068] Based upon the knowledge of other proteins within the
TGF-.beta. family, it is predicted that the BMP-11 precursor
polypeptide would be cleaved at the multibasic sequence
ARG-SER-ARG-ARG in agreement with a proposed consensus proteolytic
processing sequence of ARG-X-X-ARG. Cleavage of the BMP-11
precursor polypeptide is expected to generate a 109 amino acid
mature peptide beginning with the amino acid ASN at position #1.
The processing of BMP-11 into the mature form is expected to
involve dimerization and removal of the N-terminal region in a
manner analogous to the processing of the related protein
TGF-.beta. [Gentry et al., Molec. & Cell. Biol., 8:4162 (1988);
Derynck et al., Nature, 316:701(1985)].
[0069] It is contemplated therefore that the mature active species
of BMP-11 comprises a homodimer of two polypeptide subunits, each
subunit comprising amino acids # 1 to # 109 with a predicted
molecular weight of approximately 12,000 daltons. Further active
species are contemplated comprising amino acids #6 to #109, thereby
including the first conserved cysteine residue. As with other
members of the TGF-.beta. family of proteins, the carboxy-terminal
region of the BMP-11 protein exhibits greater sequence conservation
than the more amino-terminal portion. The percent amino acid
identity of the BMP-11 protein in the cysteine-rich C-terminal
domain (amino acids #6 to #109) to the corresponding region of
other proteins within the TGF-.beta. family is as follows: BMP-2,
39%; BMP-3, 37%; BMP-4, 37%; BMP-5, 42%, BMP-6, 45%; BMP-7, 42%;
BMP-8, 39%; BMP-9, 40%; Vg1, 39%; GDF-1, 34%; TGF-.beta.1, 36%;
TGF-.beta.2, 38%; TGF-.beta.3, 38%; inhibin .beta.(B), 41%; inhibin
.beta.(A), 39%.
EXAMPLE 2
Human BMP-11
[0070] Bovine and human BMP-11 genes are presumed to be
significantly homologous, therefore the bovine coding sequence or a
portion thereof is used as a probe to screen a human genomic
library or as a probe to identify a human cell line or tissue which
synthesizes the analogous human protein. A human genomic library,
such as Stratagene catalog #944201, may be screened with such a
probe, and presumptive positives isolated and DNA sequence
obtained. Evidence that this recombinant encodes a portion of the
human BMP-11 relies on the bovine/human protein and gene structure
homologies.
[0071] Once a recombinant bacteriophage containing DNA encoding a
portion of the human BMP-11 molecule is obtained, the human coding
sequence can be used as a probe to identify a human cell line or
tissue which synthesizes BMP-11 mRNA. Alternatively, the bovine
BMP-11 coding sequence can be used as a probe to identify such
human cell line or tissue. Briefly described, RNA is extracted from
a selected cell or tissue source and either electrophoresed on a
formaldehyde agarose gel and transferred to nitrocellulose, or
reacted with formaldehyde and spotted on nitrocellulose directly.
The nitrocellulose is then hybridized to a probe derived from a
coding sequence of the bovine or human BMP-11. Alternatively, the
bovine BMP-11 coding sequence is used to design oligonucleotide
primers which will specifically amplify a portion of the BMP-11
encoding sequence located in the region located between the primers
utilized to perform the specific amplification reaction. It is
contemplated that bovine and human BMP-11 sequences would allow one
to specifically amplify corresponding human BMP-11 encoding
sequences from mRNA, cDNA or genomic DNA templates. Once a positive
source has been identified by one of the above described methods,
mRNA is selected by oligo (dT) cellulose chromatography and cDNA is
synthesized and cloned in .lamda.gt10 or other .lamda.
bacteriophage vectors known to those skilled in the art. (i.e.
.lamda.ZAP) by established techniques (Toole et al., supra). It is
also possible to perform the oligonucleotide primer directed
amplification reaction, described above, directly on a
pre-established human cDNA or genomic library which has been cloned
into a .lamda. bacteriophage vector. In such cases, a library which
yields a specifically amplified DNA product encoding a portion of
human BMP-11 protein could be screened directly, utilizing the
fragment of amplified BMP-11 encoding DNA as a probe.
[0072] Oligonucleotide primers designed on the basis of the DNA
sequence of the bovine BMP-11 genomic clone .lamda.7r-30 are
predicted to allow the specific amplification of human BMP-11
encoding sequences. The following oligonucleotide primer is
designed on the basis of nucleotides #501 to #521 of the DNA
sequence set forth in SEQ ID NO. 1 and synthesized on an automated
DNA synthesizer. TABLE-US-00001 Primer C:
TAGTCTAGATGCTCCGGCCAGTGCGAGTAC
[0073] The first nine nucleotides of primer C (underlined) comprise
the recognition sequence for the restriction endonuclease XbaI
which can be utilized to facilitate the manipulation of a
specifically amplified DNA sequence encoding the BMP-11 protein of
the invention and are thus not derived from the DNA sequence
presented in SEQ ID NO: 1.
[0074] The following oligonucleotide primer is designed on the
basis of nucleotides # 701 to # 678 of the DNA sequence set forth
in SEQ ID NO. 1 and synthesized on an automated DNA synthesizer:
TABLE-US-00002 Primer D: TGCGGATCCGGAGCAGCCACAGCGATCCAC
[0075] The first nine nucleotides of primer D (underlined) comprise
the recognition sequence for the restriction endonuclease BamHI
which can be utilized to facilitate the manipulation of a
specifically amplified DNA sequence encoding the BMP-11 protein of
the invention and are thus not derived from the DNA sequence
present in SEQ ID NO:1.
[0076] The standard nucleotide symbols in the above identified
primers are as follows: A, adenosine; C, cytosine, G, guanine; and
T, thymine.
[0077] Primers C and D identified above are utilized as primers to
allow the amplification of a specific nucleotide from human genomic
DNA. The amplification reaction is performed as follows:
[0078] Human genomic DNA (source: peripheral blood lymphocytes) is
denatured at 100.degree. C. for five minutes and then chilled on
ice prior to addition to a reaction mixture containing 200 .mu.M
each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10
mM Tris-HCl pH8.3, 50 mM KCl, 1.5 mM MgCl.sub.2, 0.001% gelatin,
1.25 units Taq DNA polymerase, 100 pM oligonucleotide primer C and
100 pM oligonucleotide primer D. This reaction mixture is then
subjected to thermal cycling in the following manner: 3 minutes at
94.degree. C., 1 minute at 50.degree. C., 1 minute at 72.degree. C.
for one cycle, then 1 minute at 94.degree. C., 1 minute at
50.degree. C., 1 minute at 72.degree. C. for thirty-nine
cycles.
[0079] The DNA which is specifically amplified by this reaction is
separated from the excess oligonucleotide primers C and D utilized
to initiate the amplification by the use of a DNA purification
resin based protocol under the conditions suggested by the
manufacturer. The resulting DNA product is digested with the
restriction endonucleases XbaI and BamHI, phenol extracted,
chloroform extracted. Buffer exchange and removal of small
fragments of DNA resulting from the XbaI/BaHI restriction digest is
accomplished by dilution of the digested DNA product in 10 Mm
Tris-Hcl pH8.0, 1 Mm EDTA followed by centrifugation through a
centriconm 30 microconcentrator (W.R. Grace & Co., Beverly,
Ma.; Product #4209). The resulting XbaI/BamHI digested amplified
DNA product is subcloned into a plasmid vector (pBluescript)
between the XbaI and BamHI restriction sites of the polylinker
region. DNA sequence analysis of the resulting subclones indicates
that the specifically amplified DNA sequence product encodes a
portion of the human BMP-11 protein of this invention. The DNA
sequence (SEQ ID NO:3) and derived amino acid sequence (SEQ ID
NO:4) of this specifically amplified DNA fragment are set forth in
the Sequence Listings.
[0080] Nucleotides #1 to #27 of this sequence comprise a portion of
oligonucleotide primer C and nucleotides #186 to #213 comprise a
portion of oligonucleotide primer D utilized to perform the
specific amplification reaction. Due to the function of
oligonucleotide primers C and D (designed on the basis of bovine
BMP-11 DNA sequence) in initiating the amplification reaction, they
may not correspond exactly to the actual sequence encoding a human
BMP-11 and are therefore not translated in the above amino acid
sequence derivation. The DNA sequence, from nucleotide #28 to #185
of SEQ ID NO: 3, or portions thereof, specifically amplified from
the human genomic DNA template can be utilized as a probe to
identify additional human BMP-11 encoding sequences from human
genomic or human cDNA libraries by standard hybridization/screening
techniques known to those skilled in the art.
[0081] One million, two hundred thousand recombinants of a human
fetal brain cDNA library (Stratagene catalog # 936206) constructed
in the vector .lamda.ZAPII are plated at a density of 24,000
recombinant bacteriophge plaques per plate on 50 plates. Duplicate
nitrocellulose replicas of the recombinant bacteriophage plaques
are made from these plates. An oligonucleotide probe designed on
the basis of nucleotides #53-#82 of SEQ ID NO:3 is synthesized on
an automated DNA synthesizer. This oligonucleotide probe is
radioactively labelled with .gamma..sup.32P-ATP and is hybridized
to both sets of the duplicate nitrocellulose replicas in SHB at
65.degree. C. Nine positively hybridizing recombinants are noted.
One of the positively hybridizing recombinants, named
.lamda.FB30.5, is plaque purified. Bacteriophage plate stocks of
the purified .lamda.FB30.5 cDNA clone are prepared and
bacteriophage DNA is isolated. A bacterial plasmid named FB30.5,
generated by the in vivo excision protocol described by the
supplier (Stratagene) and containing the entire insert of the
.lamda.FB30.5 bacteriophage cDNA clone, has been deposited with the
ATCC, 12301 Parklawn Drive, Rockville, Md. USA under the
requirements of the Budapest Treaty and designated as ATCC #
______. A portion of the DNA sequence of clone FB30.5 is set forth
in SEQ ID NO: 10.
[0082] One million recombinants of a human genomic library
(Stratagene Catalog # 944201) constructed in the vector .lamda.FIX
are plated at a density of 20,000 recombinant bacteriophge plaques
per plate on 50 plates. Duplicate nitrocellulose replicas of the
recombinant bacteriophage plaques are made from these plates. An
oligonucleotide probe designed on the basis of nucloetides #57-#86
of SEQ ID NO:10, with the exception of an inadvertent substitution
of CAC for GCG at nucleotides #59-#61 of SEQ ID NO:10, is
synthesized on an automated DNA synthesizer. This oligonucleotide
probe is radioactively labelled with .gamma..sup.32P-ATP and is
hybridized to both sets of the duplicate nitrocellulose replicas in
SHB at 65.degree. C. Five positively hybridizing recombinants are
noted. One of the positively hybridizing recombinants, named
30GEN.4, is plaque purified. Bacteriophage plate stocks of the
purified 30GEN.4 genomic clone are prepared and bacteriophage DNA
is isolated. A bacteriophage stock of this genomic clone has been
deposited with the ATCC, 12301 Parklawn Drive, Rockville, Md. USA
under the requirements of the Budapest Treaty and designated as
ATCC # ______. A portion of the DNA sequence of clone 30GEN.4 is
set forth in SEQ ID NO: 10. A portion of the DNA sequence of the
genomic clone 30GEN.4 was determined to be identical to a portion
of the DNA sequence of the cDNA clone FB30.5. The extent of this
overlap (nucleotides #1-#198) of SEQ ID NO:10 were used as a basis
to compile the partial coding sequence of the BMP-10 protein. The
genomic clone 30GEN.4 is expected to contain additional 5' coding
sequences of the human BMP-11 protein which are expected to encode
the remainder of the BMP-11 precursor polypeptide, including the
initiator methionine. The partial sequence of human BMP-11 is
presented in SEQ ID NO:10 and it should be noted that nucleotides
#1-198 have been determined to be present in both the 30GEN.4
genomic clone and the FB30.5 cDNA clone while nucleotides
#199-#1270 are derived entirely from the cDNA clone FB30.5. SEQ ID
NO:10 predicts a human BMP11 precursor protein of at least 362
amino acids. Based on the knowledge of other BMPs and other
proteins within the TGF-.beta. family, it is predicted that the
precursor polypeptide would be cleaved at the multibasic sequence
ARG-SER-ARG-ARG (amino acids #-4 through #-1 of SEQ ID NO:11) in
agreement with the proposed consensus proteolytic processing
sequence ARG-X-X-ARG. Cleavage of the human BMP-11 precursor
polypeptide at this location would generate a 109 amino acid mature
peptide beginning with the amino acid ASN at position #1 of SEQ ID
NO:11. The processing of human BMP-11 into the mature form is
expected to involve dimerization and removal of the N-terminal
region in a manner analogous to the procesing of the related
protein TGF-.beta. [L. E. Gentry, et al. Molec. & Cell. Biol.
8:4162 (1988); R. Derynck, et al., Nature 316:701 (1985). It is
contemplated that the mature active species of human BMP-11
comprises a homodimer of two polypeptide subunits, each subunit
comprising amino acids #1-#108 of SEQ ID NO:11, with a predicted
molecular weight of 12,000 daltons. Further active species are
contemplated comprising amino acids #7-#108 of SEQ ID NO:11,
thereby including the first conserved cysteine residue.
Heterodimeric molecules comprising one subunit of BMP-11 and
another subunit of another member of the BMP/TGF-.beta. superfamily
are also contemplated.
EXAMPLE 3
Expression of BMP-11
[0083] In order to produce bovine, human or other mammalian BMP-11
proteins, the DNA encoding it is transferred into an appropriate
expression vector and introduced into mammalian cells or other
preferred eukaryotic or prokaryotic hosts by conventional genetic
engineering techniques. The preferred expression system for
biologically active recombinant human BMP-11 is contemplated to be
stably transformed mammalian cells.
[0084] One skilled in the art can construct mammalian expression
vectors by employing the sequence of SEQ ID NO:1 or SEQ ID NO:10,
or other DNA sequences encoding BMP-11 proteins or other modified
sequences and known vectors, such as pCD [Okayama et al., Mol. Cell
Biol., 2:161-170 (1982)], pJL3, pJL4 (Gough et al., EMBO J.,
4:645-653 (1985)] and pMT2 CXM.
[0085] The mammalian expression vector pMT2 CXM is a derivative of
p91023(b) (Wong et al., Science 228:810-815, 1985) differing from
the latter in that it contains the ampicillin resistance gene in
place of the tetracycline resistance gene and further contains a
XhoI site for insertion of cDNA clones. The functional elements of
pMT2 CXM have been described (Kaufman, R. J., 1985, Proc. Natl.
Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the
SV40 origin of replication including the 72 bp enhancer, the
adenovirus major late promoter including a 5' splice site and the
majority of the adenovirus tripartite leader sequence present on
adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert,
the SV40 early polyadenylation site (SV40), and pBR322 sequences
needed for propagation in E. coli.
[0086] Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF,
which has been deposited with the American Type Culture Collection
(ATCC), Rockville, Md. (USA) under accession number ATCC 67122.
EcoRI digestion excises the cDNA insert present in pMT2-VWF,
yielding pMT2 in linear form which can be ligated and used to
transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid
pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then
constructed using loopout/in mutagenesis (Morinaga, et al.,
Biotechnology 84: 636 (1984). This removes bases 1075 to 1145
relative to the Hind III site near the SV40 origin of replication
and enhancer sequences of pMT2. In addition it inserts the
following sequence: TABLE-US-00003 5' PO-CATGGGCAGCTCGAG-3'
at nucleotide 1145. This sequence contains the recognition site for
the restriction endonuclease Xho I. A derivative of pMT2CXM, termed
pMT23, contains recognition sites for the restriction endonucleases
PstI, Eco RI, SalI and XhoI. Plasmid pMT2 CXM and pMT23 DNA may be
prepared by conventional methods.
[0087] pEMC2.beta.1 derived from pMT21 may also be suitable in
practice of the invention. pMT21 is derived from pMT2 which is
derived from pMT2-VWF. As described above EcoRI digestion excises
the cDNA insert present in pMT-VWF, yielding pMT2 in linear form
which can be ligated and used to transform E. Coli HB 101 or DH-5
to ampicillin resistance. Plasmid pMT2 DNA can be prepared by
conventional methods.
[0088] pMT21 is derived from pMT2 through the following two
modifications. First, 76 bp of the 5' untranslated region of the
DHFR cDNA including a stretch of 19 G residues from G/C tailing for
cDNA cloning is deleted. In this process, a XhoI site is inserted
to obtain the following sequence immediately upstream from DHFR:
TABLE-US-00004 5'-CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' PstI Eco RI
XhoI
[0089] Second, a unique ClaI site is introduced by digestion with
EcoRV and XbaI, treatment with Klenow fragment of DNA polymerase I,
and ligation to a ClaI linker (CATCGATG). This deletes a 250 bp
segment from the adenovirus associated RNA (VAI) region but does
not interfere with VAI RNA gene expression or function. pMT21 is
digested with EcoRI and XhoI, and used to derive the vector
pEMC2B1.
[0090] A portion of the EMCV leader is obtained from pMT2-ECAT1 [S.
K. Jung, et al, J. Virol 63:1651-1660 (1989)] by digestion with Eco
RI and PstI, resulting in a 2752 bp fragment. This fragment is
digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which
is purified by electrophoresis on low melting agarose gel. A 68 bp
adapter and its complementary strand are synthesized with a 5' TaqI
protruding end and a 3' XhoI protruding end which has the following
sequence: TABLE-US-00005
5'-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTT TaqI
TCCTTTGAAAAACACGATTGC-3' XhoI
This sequence matches the EMC virus leader sequence from nucleotide
763 to 827. It also changes the ATG at position 10 within the EMC
virus leader to an ATT and is followed by a XhoI site. A three way
ligation of the pMT21 Eco RI-XhoI fragment, the EMC virus
EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter
TaqI-XhoI adapter resulting in the vector pEMC2.beta.1.
[0091] This vector contains the SV40 origin of replication and
enhancer, the adenovirus major late promoter, a cDNA copy of the
majority of the adenovirus tripartite leader sequence, a small
hybrid intervening sequence, an SV40 polyadenylation signal and the
adenovirus VA I gene, DHFR and .beta.-lactamase markers and an EMC
sequence, in appropriate relationships to direct the high level
expression of the desired cDNA in mammalian cells.
[0092] The construction of vectors may involve modification of the
BMP-11 DNA sequences. For instance, BMP-11 cDNA can be modified by
removing the non-coding nucleotides on the 5' and 3' ends of the
coding region. The deleted non-coding nucleotides may or may not be
replaced by other sequences known to be beneficial for expression.
These vectors are transformed into appropriate host cells for
expression of BMP-11 proteins. Additionally, the sequence of SEQ ID
NO:1 or SEQ ID NO:10 or other sequences encoding BMP-11 proteins
could be manipulated to express a mature BMP-11 by deleting BMP-11
encoding propeptide sequences and replacing them with sequences
encoding the complete propeptides of other BMP proteins, activin
proteins or other members of the TGF-.beta. superfamily.
[0093] One skilled in the art can manipulate the sequences of SEQ
ID NO:1 or SEQ ID.NO:10 by eliminating or replacing the mammalian
regulatory sequences flanking the coding sequence with bacterial
sequences to create bacterial vectors for intracellular or
extracellular expression by bacterial cells. For example, the
coding sequences could be further manipulated (e.g. ligated to
other known linkers or modified by deleting non-coding sequences
therefrom or altering nucleotides therein by other known
techniques). The modified BMP-11 coding sequence could then be
inserted into a known bacterial vector using procedures such as
described in T. Taniguchi et al., Proc. Natl. Acad. Sci. USA,
77:5230-5233 (1980). This exemplary bacterial vector could then be
transformed into bacterial host cells and a BMP-11 protein
expressed thereby. For a strategy for producing extracellular
expression of BMP-11 proteins in bacterial cells, see, e.g.
European patent application EPA 177,343.
[0094] Similar manipulations can be performed for the construction
of an insect vector [See, e.g. procedures described in published
European patent application 155,476] for expression in insect
cells. A yeast vector could also be constructed employing yeast
regulatory sequences for intracellular or extracellular expression
of the factors of the present invention by yeast cells. [See, e.g.,
procedures described in published PCT application WO86/00639 and
European patent application EPA 123,289].
[0095] A method for producing high levels of a BMP-11 protein of
the invention in mammalian cells may involve the construction of
cells containing multiple copies of the heterologous BMP-11 gene.
The heterologous gene is linked to an amplifiable marker, e.g. the
dihydrofolate reductase (DHFR) gene for which cells containing
increased gene copies can be selected for propagation in increasing
concentrations of methotrexate (MTX) according to the procedures of
Kaufman and Sharp, J. Mol. Biol., 159:601-629 (1982). This approach
can be employed with a number of different cell types.
[0096] For example, a plasmid containing a DNA sequence for a
BMP-11 of the invention in operative association with other plasmid
sequences enabling expression thereof and the DHFR expression
plasmid pAdA26SV(A).sub.3 [Kaufman and Sharp, Mol. Cell. Biol.,
2:1304 (1982)] can be co-introduced into DHFR-deficient CHO cells,
DUKX-BII, by various methods including calcium phosphate
coprecipitation and transfection, electroporation or protoplast
fusion. DHFR expressing transformants are selected for growth in
alpha media with dialyzed fetal calf serum, and subsequently
selected for amplification by growth in increasing concentrations
of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5 uM MTX) as
described in Kaufman et al., Mol Cell Biol., 5:1750 (1983).
Transformants are cloned, and biologically active BMP-11 expression
is monitored by one or more of the BMP-11 activity assays described
in Examples 5 to 8 below. BMP-11 expression should increase with
increasing levels of MTX resistance. BMP-11 polypeptides are
characterized using standard techniques known in the art such as
pulse labeling with [.sup.35S] methionine or cysteine and
polyacrylamide gel electrophoresis. Similar procedures can be
followed to produce other related BMP-11 proteins.
EXAMPLE 4
Biological Activity of Expressed BMP-11
[0097] To measure the biological activity of the expressed BMP-11
proteins obtained in Example 3 above, the proteins are recovered
from the cell culture and purified by isolating the BMP-11 proteins
from other proteinaceous materials with which they are co-produced
as well as from other contaminants. The purified protein may be
assayed in accordance with the assays for BMP-11 activity described
in Examples 5 to 8 below.
EXAMPLE 5
W-20 BIOASSAYS
[0098] A. Description of W-20 Cells
[0099] Use of the W-20 bone marrow stromal cells as an indicator
cell line is based upon the conversion of these cells to
osteoblast-like cells after treatment with a BMP protein [Thies et
al, Journal of Bone and Mineral Research, 5:305 (1990); and Thies
et al, Endocrinology, 130:1318 (1992)]. Specifically, W-20 cells
are a clonal bone marrow stromal cell line derived from adult mice
by researchers in the laboratory of Dr. D. Nathan, Children's
Hospital, Boston, Mass. Treatment of W-20 cells with certain BMP
proteins results in (1) increased alkaline phosphatase production,
(2) induction of PTH stimulated cAMP, and (3) induction of
osteocalcin synthesis by the cells. While (1) and (2) represent
characteristics associated with the osteoblast phenotype, the
ability to synthesize osteocalcin is a phenotypic property only
displayed by mature osteoblasts. Furthermore, to date we have
observed conversion of W-20 stromal cells to osteoblast-like cells
only upon treatment with BMPs. In this manner, the in vitro
activities displayed by BMP treated W-20 cells correlate with the
in vivo bone forming activity known for BMPs.
[0100] Below two in vitro assays useful in comparison of BMP
activities of novel osteoinductive molecules are described.
[0101] B. W-20 Alkaline Phosphatase Assay Protocol
[0102] W-20 cells are plated into 96 well tissue culture plates at
a density of 10,000 cells per well in 200 .mu.l of media (DME with
10% heat inactivated fetal calf serum, 2 mM glutamine and 100
Units/ml penicillin +100 .mu.g/ml streptomycin. The cells are
allowed to attach overnight in a 95% air, 5% CO.sub.2 incubator at
37.degree. C.
[0103] The 200 .mu.l of media is removed from each well with a
multichannel pipettor and replaced with an equal volume of test
sample delivered in DME with 10% heat inactivated fetal calf serum,
2 mM glutamine and 1% penicillin-streptomycin. Test substances are
assayed in triplicate.
[0104] The test samples and standards are allowed a 24 hour
incubation period with the W-20 indicator cells. After the 24
hours, plates are removed from the 37.degree. C. incubator and the
test media are removed from the cells.
[0105] The W-20 cell layers are washed 3 times with 200 .mu.l per
well of calcium/magnesium free phosphate buffered saline and these
washes are discarded.
[0106] 50 .mu.l of glass distilled water is added to each well and
the assay plates are then placed on a dry ice/ethanol bath for
quick freezing. Once frozen, the assay plates are removed from the
dry ice/ethanol bath and thawed at 37.degree. C. This step is
repeated 2 more times for a total of 3 freeze-thaw procedures. Once
complete, the membrane bound alkaline phosphatase is available for
measurement.
[0107] 50 .mu.l of assay mix (50 mM glycine, 0.05% Triton X-100, 4
mM MgCl.sub.2, 5 mM p-nitrophenol phosphate, pH=10.3) is added to
each assay well and the assay plates are then incubated for 30
minutes at 37.degree. C. in a shaking waterbath at 60 oscillations
per minute.
[0108] At the end of the 30 minute incubation, the reaction is
stopped by adding 100 .mu.l of 0.2 N NaOH to each well and placing
the assay plates on ice.
[0109] The spectrophotometric absorbance for each well is read at a
wavelength of 405 nanometers. These values are then compared to
known standards to give an estimate of the alkaline phosphatase
activity in each sample. For example, using known amounts of
p-nitrophenol phosphate, absorbance values are generated. This is
shown in Table I. TABLE-US-00006 TABLE I Absorbance Values for
Known Standards of P-Nitrophenol Phosphate P-nitrophenol phosphate
umoles Mean absorbance (405 nm) 0.000 0 0.006 0.261 +/- .024 0.012
0.521 +/- .031 0.018 0.797 +/- .063 0.024 1.074 +/- .061 0.030
1.305 +/- .083
[0110] Absorbance values for known amounts of BMPs can be
determined and converted to .mu.moles of p-nitrophenol phosphate
cleaved per unit time as shown in Table II. TABLE-US-00007 TABLE II
Alkaline Phosphatase Values for W-20 Cells Treating with BMP-2
BMP-2 concentration Absorbance Reading umoles substrate ng/ml 405
nmeters per hour 0 0.645 0.024 1.56 0.696 0.026 3.12 0.765 0.029
6.25 0.923 0.036 12.50 1.121 0.044 25.0 1.457 0.058 50.0 1.662
0.067 100.0 1.977 0.080
[0111] These values are then used to compare the activities of
known amounts of BMP-11 to BMP-2.
[0112] C. Osteocalcin RIA Protocol
[0113] W-20 cells are plated at 10.sup.6 cells per well in 24 well
multiwell tissue culture dishes in 2 mls of DME containing 10% heat
inactivated fetal calf serum, 2 mM glutamine. The cells are allowed
to attach overnight in an atmosphere of 95% air 5% CO.sub.2 at
37.degree. C.
[0114] The next day the medium is changed to DME containing 10%
fetal calf serum, 2 mM glutamine and the test substance in a total
volume of 2 ml. Each test substance is administered to triplicate
wells. The test substances are incubated with the W-20 cells for a
total of 96 hours with replacement at 48 hours by the same test
medias.
[0115] At the end of 96 hours, 50 .mu.l of the test media is
removed from each well and assayed for osteocalcin production using
a radioimmunoassay for mouse osteocalcin. The details of the assay
are described in the kit manufactured by Biomedical Technologies
Inc., 378 Page Street, Stoughton, Mass. 02072. Reagents for the
assay are found as product numbers BT-431 (mouse osteocalcin
standard), BT-432 (Goat anti-mouse Osteocalcin), BT-431R (iodinated
mouse osteocalcin), BT-415 (normal goat serum) and BT-414 (donkey
anti goat IgG). The RIA for osteocalcin synthesized by W-20 cells
in response to BMP treatment is carried out as described in the
protocol provided by the manufacturer.
[0116] The values obtained for the test samples are compared to
values for known standards of mouse osteocalcin and to the amount
of osteocalcin produced by W-20 cells in response to challenge with
known amounts of BMP-2. The values for BMP-2 induced osteocalcin
synthesis by W-20 cells is shown in Table III. TABLE-US-00008 TABLE
III Osteocalcin Synthesis by W-20 Cells BMP-2 Concentration
Osteocalcin Synthesis ng/ml ng/well 0 0.8 2 0.9 4 0.8 8 2.2 16 2.7
31 3.2 62 5.1 125 6.5 250 8.2 500 9.4 1000 10.0
EXAMPLE 6
Rosen-Modified Sampath-Reddi Assay.
[0117] A modified version of the rat bone formation assay described
in Sampath and Reddi, Proc. Natl. Acad. Sci. USA, 80:6591-6595
(1983) is used to evaluate bone, cartilage and/or other connective
tissue inductive activity of BMP-11 proteins. This modified assay
is herein called the Rosen-modified Sampath-Reddi assay. The
ethanol precipitation step of the Sampath-Reddi procedure is
replaced by dialyzing (if the composition is a solution) or
diafiltering (if the composition is a suspension) the fraction to
be assayed against water. The solution or suspension is then
equilibrated to 0.1% TFA. The resulting solution is added to 20 mg
of rat matrix. A mock rat matrix sample not treated with the
protein serves as a control. This material is frozen and
lyophilized and the resulting powder enclosed in #5 gelatin
capsules. The capsules are implanted subcutaneously in the
abdominal thoracic area of 21-49 day old male Long Evans rats. The
implants are removed after 7-14 days. Half of each implant is used
for alkaline phosphatase analysis [see, Reddi et al, Proc. Natl.
Acad. Sci., 69:1601 (1972)].
[0118] The other half of each implant is fixed and processed for
histological analysis. 1 .mu.m glycolmethacrylate sections are
stained with Von Kossa and acid fuschin to score the amount of
induced bone and cartilage formation present in each implant. The
terms +1 through +5 represent the area of each histological section
of an implant occupied by new bone and/or cartilage cells and
matrix. A score of +5 indicates that greater than 50% of the
implant is new bone and/or cartilage produced as a direct result of
protein in the implant. A score of +4, +3, +2, and +1 would
indicate that greater than 40%, 30%, 20% and 10% respectively of
the implant contains new cartilage and/or bone.
[0119] The BMP-11 proteins of this invention may be assessed for
activity on this assay.
EXAMPLE 7
Biological Activity of Expressed BMP-11
[0120] To measure the biological activity of the expressed BMP-11
proteins obtained in Example 3 above, the proteins are recovered
from the cell culture and purified by isolating the BMP-11 proteins
from other proteinaceous materials with which they are co-produced
as well as from other contaminants. The purified-protein may be
assayed in accordance with the rat bone formation assay described
in Example 6.
[0121] Purification is carried out using standard techniques known
to those skilled in the art.
[0122] Protein analysis is conducted using standard techniques such
as SDS-PAGE acrylamide [Laemmli, Nature. 227:680 (1970)] stained
with silver [Oakley, et al. Anal. Biochem. 105:361 (1980)] and by
immunoblot [Towbin, et al. Proc. Natl. Acad. Sci. USA 76:4350
(1979)].
[0123] The foregoing descriptions detail presently preferred
embodiments of the present invention. Numerous modifications and
variations in practice thereof are expected to occur to those
skilled in the art upon consideration of these descriptions. Those
modifications and variations are believed to be encompassed within
the claims appended hereto.
EXAMPLE 8
Tests to Determine Activin Activity of BMP-11
[0124] Purification is carried out using standard techniques known
to those skilled in the art. It is contemplated, as with other
proteins of the TGF-.beta. superfamily, that purification may
include the use of Heparin sepharose.
[0125] Protein analysis is conducted using standard techniques such
as SDS-PAGE acrylamide [Laemmli, Nature 227:680 (1970)] stained
with silver [Oakley, et al. Anal. Biochem. 105:361 (1980)] and by
immunoblot [Towbin, et al. Proc. Natl. Acad. Sci. USA 76:4350
(1979)].
[0126] BMP-11 proteins may be further characterized by their
ability to modulate the release of follicle stimulating hormone
(FSH) in established in vitro bioassays using rat anterior
pituitary cells as described in, for example, Vale et al,
Endocrinology, 91:562-572 (1972); Ling et al., Nature, 321:779-782
(1986) or Vale et al., Nature, 321:776-779 (1986), the disclosures
of which are hereby incorporated by reference. Alternatively,
BMP-11 may be characterized by their ability to stimulate
erythropoietin activity in the human K-562 cell line, as described
by Lozzio et al., Blood, 45:321-334 (1975) and U.S. Pat. No.
5,071,834, at column 15, the disclosures of which are hereby
incorporated by reference.
[0127] In addition, BMP-11 may be characterized by their activity
in cell survival assays, as described in Schubert, Nature,
344:868-870 (1990), the disclosure of which is incorporated by
reference.
[0128] The foregoing descriptions, detail presently preferred
embodiments of the present invention. Numerous modifications and
variations in practice thereof are expected to occur to those
skilled in the art upon consideration of these descriptions. Those
modifications and variations are believed to be encompassed within
the claims appended hereto.
Sequence CWU 1
1
* * * * *