U.S. patent application number 11/040596 was filed with the patent office on 2006-07-27 for methods, compositions, and cells for encapsidating recombinant vectors in aav particles.
This patent application is currently assigned to Targeted Genetics Corporation. Invention is credited to Haim Burstein, Dara H. Lockert, Carmel M. Lynch, Anthony M. Stepan.
Application Number | 20060166318 11/040596 |
Document ID | / |
Family ID | 26833013 |
Filed Date | 2006-07-27 |
United States Patent
Application |
20060166318 |
Kind Code |
A1 |
Lockert; Dara H. ; et
al. |
July 27, 2006 |
Methods, compositions, and cells for encapsidating recombinant
vectors in AAV particles
Abstract
Isolated recombinant polynucleotides comprising elements which
promote encapsidation into AAV particles, packaging cells
comprising the recombinant polynucleotides, and methods for their
use are provided in the present invention. These isolated
recombinant polynucleotides comprise a non-AAV ITR encapsidation
element (such as the P1 sequence located within the AAV S1
integration site of human chromosome 19) operably linked to one or
more heterologous genes to be encapsidated. The constructs may be
either integrated into a mammalian cell genome, maintained
episomally, or provided transiently.
Inventors: |
Lockert; Dara H.; (Seattle,
WA) ; Lynch; Carmel M.; (Kenmore, WA) ;
Burstein; Haim; (Sammamish, WA) ; Stepan; Anthony
M.; (Seattle, WA) |
Correspondence
Address: |
MORRISON & FOERSTER LLP
755 PAGE MILL RD
PALO ALTO
CA
94304-1018
US
|
Assignee: |
Targeted Genetics
Corporation
Seattle
WA
|
Family ID: |
26833013 |
Appl. No.: |
11/040596 |
Filed: |
January 21, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09561190 |
Apr 27, 2000 |
6893865 |
|
|
11040596 |
Jan 21, 2005 |
|
|
|
60135119 |
Apr 28, 1999 |
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/325; 435/456; 530/350; 536/23.5 |
Current CPC
Class: |
C12N 7/00 20130101; C12N
15/86 20130101; C07K 14/005 20130101; C12N 2750/14152 20130101;
A61K 48/00 20130101; C12N 2750/14122 20130101; C12N 2750/14143
20130101 |
Class at
Publication: |
435/069.1 ;
435/456; 435/325; 530/350; 536/023.5 |
International
Class: |
C12P 21/06 20060101
C12P021/06; C12N 15/861 20060101 C12N015/861; C07H 21/04 20060101
C07H021/04; C07K 14/075 20060101 C07K014/075 |
Claims
1. A method for producing a recombinant polynucleotide encapsidated
in an adeno-associated virus (AAV) particle, comprising providing a
mammalian cell which produces AAV rep and cap gene products,
wherein said mammalian cell contains the recombinant polynucleotide
which comprises a heterologous gene operably linked to an
encapsidation element which promotes encapsidation of said
heterologous gene into an AAV particle, and wherein said
encapsidation element is other than an AAV inverted terminal repeat
(ITR) or its D sequence.
2. The method of claim 1, wherein said encapsidation element has a
nucleotide sequence which has at least about 30% nucleotide
sequence identity with SEQ ID NO:1.
3. The method of claim 1, wherein said encapsidation element has a
nucleotide sequence which has at least about 47% nucleotide
sequence identity with SEQ ID NO:1.
4. The method of claim 1, wherein said encapsidation element
comprises at least about 35 contiguous nucleotides of the
nucleotide sequence depicted in SEQ ID NO:1.
5. The method of claim 1, wherein said encapsidation element
comprises a terminal resolution site.
6. The method of claim 1, wherein said encapsidation element
comprises a binding site for AAV Rep68 and Rep78 proteins.
7. The method of claim 1, wherein said encapsidation element
comprises a terminal resolution site and a binding site for AAV
Rep68 and Rep78 proteins.
8. The method of claim 1, wherein said encapsidation element
comprises the nucleotide sequence GGTTGG(X)nGCXCGCTCGCTCGCTX,
wherein X is any nucleotide and n is an integer from 1 to about
20.
9. The method of claim 1, wherein said encapsidation element
comprises a nucleotide sequence having the sequence of nucleotides
19 to 48 of SEQ ID NO:1.
10. The method of claim 1, wherein said encapsidation element has
the nucleotide sequence depicted in SEQ ID NO:1.
11. The method of claim 1, wherein the encapsidation activity of
said encapsidation element is activated by helper function.
12. The method of claim 11, wherein said helper function is
provided by an adenovirus.
13. The method of claim 1, wherein said AAV rep and cap gene
products produced by said mammalian cell are encoded by AAV rep and
cap genes which are stably integrated into the genome of said
cell.
14. The method of claim 1, wherein said AAV rep and cap gene
products are encoded by an extrachromosomal polynucleotide.
15. An isolated recombinant polynucleotide sequence comprising a
heterologous gene flanked by encapsidation elements other than
adeno-associated virus (AAV) inverted terminal repeats (ITR) or AAV
ITR D sequences, wherein said encapsidation elements promote
encapsidation of said heterologous gene in the presence of AAV rep
and cap gene products and helper virus function.
16. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element has a nucleotide sequence which has at
least about 30% nucleotide sequence identity with SEQ ID NO:1.
17. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element has a nucleotide sequence which has at
least about 47% nucleotide sequence identity with SEQ ID NO:1.
18. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element comprises at least about 35 contiguous
nucleotides of the nucleotide sequence depicted in SEQ ID NO:1.
19. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element comprises a terminal resolution
site.
20. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element comprises a binding site for AAV Rep68
and Rep78 proteins.
21. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element comprises a terminal resolution site and
a binding site for AAV Rep68 and Rep78 proteins.
22. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element comprises the nucleotide sequence
GGTTGG(X)nGCXCGCTCGCTCGCTX, wherein X is any nucleotide and n is an
integer from 1 to about 20.
23. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element comprises a nucleotide sequence having
the sequence of nucleotides 19 to 48 of SEQ ID NO:1.
24. The isolated recombinant polynucleotide of claim 15, wherein
said encapsidation element has the nucleotide sequence depicted in
SEQ ID NO:1.
25. The isolated recombinant polynucleotide of claim 15, wherein
the encapsidation activity of said encapsidation element is
activated by helper function.
26. The isolated recombinant polynucleotide of claim 15, wherein
said helper function is provided by an adenovirus.
27. The isolated recombinant polynucleotide of claim 15, wherein
said AAV rep and cap gene products produced by said mammalian cell
are encoded by AAV rep and cap genes which are stably integrated
into the genome of said cell.
28. The isolated recombinant polynucleotide of claim 15, wherein
said AAV rep and cap gene products are encoded by an
extrachromosomal polynucleotide.
29. The isolated recombinant polynucleotide of claim 15, wherein
said heterologous gene encodes a functional CFTR polypeptide.
30. A method for generating a packaging cell capable of producing
stocks of a recombinant polynucleotide comprising a heterologous
gene encapsidated in an adeno-associated virus (AAV) particle,
comprising transfecting mammalian cells which produce AAV rep and
cap gene products with the recombinant polynucleotide, wherein said
recombinant polynucleotide comprises a heterologous gene operably
linked to an encapsidation element other than an AAV inverted
terminal repeat (ITR) or an AAV ITR D sequence, wherein said
encapsidation element promotes encapsidation of said heterologous
gene into an AAV particle.
31. The method of claim 30, wherein said AAV rep and cap gene
products produced by said mammalian cell are encoded by AAV rep and
cap genes stably integrated into the genome of the cell.
32. The method of claim 30, wherein said AAV rep and cap gene
products are encoded by an extrachromosomal polynucleotide.
33. The method of claim 30, wherein said recombinant polynucleotide
further comprises a selectable marker.
34. The method of claim 30, wherein said recombinant polynucleotide
integrates into the genome of the cell.
35. A packaging cell produced by the method of claim 18.
36. A mammalian packaging cell for producing stocks of a
recombinant polynucleotide encapsidated in an adeno-associated
virus (AAV) particle, wherein said packaging cell comprises the
recombinant polynucleotide, wherein said cell produces
adeno-associated virus (AAV) rep and cap gene products, and wherein
said recombinant polynucleotide comprises a heterologous gene
operably linked to an encapsidation element other than an AAV
inverted terminal repeat (ITR) or an AAV ITR D sequence, wherein
said encapsidation element promotes encapsidation of said
heterologous gene.
37. The mammalian packaging cell of claim 36, wherein said rep and
said cap gene products are encoded by genes stably integrated into
the genome of the cell.
38. The mammalian packaging cell of claim 36, wherein said rep and
said cap gene products are encoded by extrachromosomal genes.
39. The mammalian packaging cell of claim 36, wherein said
recombinant vector is maintained episomally.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
09/561,190, filed Apr. 27, 2000, which claims priority to U.S.
provisional application 60/135,119 (converted from U.S. Ser. No.
09/301,514), filed Apr. 28, 1999, all of which are incorporated by
reference in its entirety.
STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH
[0002] (Not applicable)
TECHNICAL FIELD
[0003] This invention is in the field of recombinant DNA constructs
for gene delivery. More specifically, the invention is in the field
of recombinant DNA constructs for use in the production of
recombinant DNA vectors for gene delivery.
BACKGROUND ART
[0004] Vectors based on adeno-associated virus (AAV) are believed
to have utility for gene therapy but a significant obstacle has
been the difficulty in generating such vectors in amounts that
would be clinically useful for human gene therapy applications.
This is a particular problem for in vivo applications such as
direct delivery to the lung. Another important goal in the gene
therapy context, discussed in more detail herein, is the production
of vector preparations that are essentially free of
replication-competent virions. The following description briefly
summarizes studies involving adeno-associated virus and AAV
vectors, and then describes a number of novel improvements
according to the present invention that are useful for efficiently
generating high titer recombinant AAV vector (rAAV) preparations
suitable for use in gene therapy.
[0005] Adeno-associated virus is a defective parvovirus that grows
only in cells in which certain functions are provided by a
co-infecting helper virus. General reviews of AAV may be found in,
for example, Carter, 1989, Handbook of Parvoviruses, Vol. I, pp.
169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press,
(New York). Examples of co-infecting viruses that provide helper
functions for AAV growth and replication are adenoviruses,
herpesviruses and, in some cases, poxviruses such as vaccinia. The
nature of the helper function is not entirely known but it appears
that the helper virus indirectly renders the cell permissive for
AAV replication. This belief is supported by the observation that
AAV replication may occur at low efficiency in the absence of
helper virus co-infection if the cells are treated with agents that
are either genotoxic or that disrupt the cell cycle.
[0006] Although AAV may replicate to a limited extent in the
absence of helper virus, under such conditions as noted above, more
generally infection of cells with AAV in the absence of helper
functions results in the proviral AAV genome integrating into the
host cell genome. Unlike other viruses, such as many retroviruses,
it appears that AAV generally integrates into a unique position in
the human genome. Thus, it has been reported that, in human cells,
AAV integrates into a unique position (referred to as an "AAV
integration site") which is located on chromosome 19. See, e.g.,
Weitzman et al. (1994) Proc. Natl. Acad. Sci. USA 91: 5808-5812. If
host cells having an integrated AAV are subsequently superinfected
with a helper virus such as adenovirus, the integrated AAV genome
can be rescued and replicated to yield a burst of infectious
progeny AAV particles. A sequence at the AAV integration site,
referred to as "P1", shares limited homology with the AAV inverted
terminal repeat (ITR) sequence, exhibits Rep binding activity in a
cell-free replication system, and is believed to be involved in
both the integration and rescue of AAV. See, e.g., Weitzman et al.,
id., Kotin et al. (1992) EMBO J. 11:5071-5078, and Urcelay et al.,
J. Virol. 69: 2038-2046. The fact that integration of AAV appears
to be efficient and site-specific makes AAV a useful vector for
introducing genes into cells for uses such as human gene
therapy.
[0007] AAV has a very broad host range without any obvious species
or tissue specificity and can replicate in virtually any cell line
of human, simian or rodent origin provided that an appropriate
helper is present. AAV is also relatively ubiquitous and has been
isolated from a wide variety of animal species including most
mammalian and several avian species.
[0008] AAV is not associated with the cause of any disease. Nor is
AAV a transforming or oncogenic virus, and integration of AAV into
the genetic material of human cells generally does not cause
significant alteration of the growth properties or morphological
characteristics of the host cells. These properties of AAV also
recommend it as a potentially useful human gene therapy vector
because most of the other viral systems proposed for this
application, such as retroviruses, adenoviruses, herpesviruses, or
poxviruses, are disease-causing.
[0009] Although various serotypes of AAV are known to exist, they
are all closely related functionally, structurally, and at the
genetic level (see, e.g., Blacklow, 1988, pp. 165-174 of
Parvoviruses and Human Disease, J. R. Pattison (ed.); and Rose,
1974, Comprehensive Virology 3: 1-61). For example, all AAV
serotypes apparently exhibit very similar replication properties
mediated by homologous rep genes; and all bear three related capsid
proteins such as those expressed in AAV2. The degree of relatedness
is further suggested by heteroduplex analysis which reveals
extensive cross-hybridization between serotypes along the length of
the genome; and the presence of analogous self-annealing segments
at the termini that correspond to inverted terminal repeats (ITRs).
The similar infectivity patterns also suggest that the replication
functions in each serotype are under similar regulatory control.
Thus, although the AAV2 serotype was used in various illustrations
of the present invention that are set forth in the Examples,
general reference to AAV herein encompasses all AAV serotypes, and
it is fully expected that the methods and compositions disclosed
herein will be applicable to all AAV serotypes.
[0010] AAV particles comprise a proteinaceous capsid having three
capsid proteins, VP1, VP2 and VP3, which enclose a DNA genome. The
AAV2 DNA genome, for example, is a linear single-stranded DNA
molecule having a molecular weight of about 1.5.times.10.sup.6
daltons and a length of about 5 kb. Individual particles package
only one DNA molecule strand, but this may be either the "plus" or
"minus" strand. Particles containing either strand are infectious
and replication occurs by conversion of the parental infecting
single strand to a duplex form and subsequent amplification of a
large pool of duplex molecules from which progeny single strands
are displaced and packaged into capsids. Duplex or single-strand
copies of AAV genomes can be inserted into bacterial plasmids or
phagemids and transfected into adenovirus-infected cells; these
techniques have facilitated the study of AAV genetics and the
development of AAV vectors.
[0011] The AAV genome, which encodes proteins mediating replication
and encapsidation of the viral DNA, is generally flanked by two
copies of inverted terminal repeats (ITRs). In the case of AAV2,
for example, the ITRs are each 145 nucleotides in length, flanking
a unique sequence region of about 4470 nucleotides that contains
two main open reading frames for the rep and cap genes (Srivastiva
et al., 1983, J. Virol., 45:555-564; Hermonat et al., 1984, J.
Virol. 51:329-339; Tratschin et al., 1984, J. Virol., 51:611-619).
The AAV2 unique region contains three transcription promoters p5,
p19, and p40 (Laughlin et al., 1979, Proc. Natl. Acad. Sci. USA,
76:5567-5571) that are used to express the rep and cap genes. The
ITR sequences are required in cis and are sufficient to provide a
functional origin of replication (ori), signals required for
integration into the cell genome, and efficient excision and rescue
from host cell chromosomes or recombinant plasmids. It has also
been shown that the ITR can function directly as a transcription
promoter in an AAV vector. See Carter et al., U.S. Pat. No.
5,587,308.
[0012] The rep and cap gene products are required in trans to
provide functions for replication and encapsidation of viral
genome, respectively. Again, using AAV2 for purposes of
illustration, the rep gene is expressed from two promoters, p5 and
p19, and produces four proteins. Transcription from p5 yields an
unspliced 4.2 kb mRNA encoding a first Rep protein (Rep78), and a
spliced 3.9 kb mRNA encoding a second Rep protein (Rep68).
Transcription from p19 yields an unspliced mRNA encoding a third
Rep protein (Rep52), and a spliced 3.3 kb mRNA encoding a fourth
Rep protein (Rep40). Thus, the four Rep proteins all comprise a
common internal region sequence but differ in their amino and
carboxyl terminal regions. Only the large Rep proteins (i.e. Rep78
and Rep68) are required for AAV duplex DNA replication, but the
small Rep proteins (i.e. Rep52 and Rep40) appear to be needed for
progeny, single-strand DNA accumulation (Chejanovsky & Carter,
1989, Virology 173:120-128). Rep68 and Rep78 bind specifically to
the hairpin conformation of the AAV ITR and possess several enzyme
activities required for resolving replication at the AAV termini.
Rep52 and Rep40 have none of these properties. Reports by C.
Holscher et al. (1994, J. Virol. 68:7169-7177; and 1995, J. Virol.
69:6880-6885) have suggested that expression of Rep78 or Rep 68 may
in some circumstances be sufficient for infectious particle
formation.
[0013] The Rep proteins, primarily Rep78 and Rep68, also exhibit
pleiotropic regulatory activities including positive and negative
regulation of AAV genes and expression from some heterologous
promoters, as well as inhibitory effects on cell growth (Tratschin
et al., 1986, Mol. Cell. Biol. 6:2884-2894; Labow et al., 1987,
Mol. Cell. Biol., 7:1320-1325; Khleif et al., 1991, Virology,
181:738-741). The AAV p5 promoter is negatively auto-regulated by
Rep78 or Rep68 (Tratschin et al., 1986). Due to the inhibitory
effects of expression of rep on cell growth, constitutive
expression of rep in cell lines has not been readily achieved. For
example, Mendelson et al. (1988, Virology, 166:154-165) reported
very low expression of some Rep proteins in certain cell lines
after stable integration of AAV genomes.
[0014] The capsid proteins VP1, VP2, and VP3 share a common
overlapping sequence, but VP1 and VP2 contain additional amino
terminal sequences. All three proteins are encoded by the same cap
gene reading frame typically expressed from a spliced 2.3 kb mRNA
transcribed from the p40 promoter. VP2 and VP3 can be generated
from this mRNA by use of alternate initiation codons. Generally,
transcription from p40 yields a 2.6 kb precursor mRNA which can be
spliced at alternative sites to yield two different transcripts of
about 2.3 kb. VP2 and VP3 can be encoded by either transcript
(using either of the two initiation sites), whereas VP1 is encoded
by only one of the transcripts. VP3 is the major capsid protein,
typically accounting for about 90% of total virion protein. VP1 is
coded from a minor mRNA using a 3' donor site that is 30
nucleotides upstream from the 3' donor used for the major mRNA that
encodes VP2 and VP3. All three proteins are required for effective
capsid production. Mutations which eliminate all three proteins
(Cap-negative) prevent accumulation of single-strand progeny AAV
DNA, whereas mutations in the VP1 amino-terminus ("Lip-negative" or
"Inf-negative") can permit assembly of single-stranded DNA into
particles but the infectious titer is greatly reduced.
[0015] The genetic analysis of AAV described above was largely
based upon mutational analysis of AAV genomes cloned into bacterial
plasmids. In early work, molecular clones of infectious genomes of
AAV were constructed by insertion of double-strand molecules of AAV
into plasmids by procedures such as GC-tailing (Samulski et al.,
1982, Proc. Natl. Acad. Sci. USA, 79:2077-2081), addition of
synthetic linkers containing restriction endonuclease cleavage
sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct,
blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem.,
259:4661-4666). Transfection of such AAV recombinant plasmids into
mammalian cells that were also infected with an appropriate helper
virus, such as adenovirus, resulted in rescue and excision of the
AAV genome free of any plasmid sequence, replication of the rescued
genome and generation of progeny infectious AAV particles. This
provided the basis for performing genetic analysis of AAV as
summarized above and permitted construction of AAV transducing
vectors.
[0016] There are at least two desirable features of any AAV vector
designed for use in human gene therapy. The first is that the
transducing vector be generated at titers sufficiently high to be
practicable as a delivery system. This is especially important for
gene therapy strategies aimed at in vivo delivery of the vector.
For example, it is likely that for many desirable applications of
AAV vectors, such as treatment of cystic fibrosis by direct in vivo
delivery to the airway, the desired dose of transducing vector may
be from 10.sup.8 to 10.sup.10, or, in some cases, in excess of
10.sup.10 particles. Secondly, the vector preparations are
preferably essentially free of wild-type AAV virus (or any
replication-competent AAV). The attainment of high titers of AAV
vectors has been difficult for several reasons including
preferential encapsidation of wild-type AAV genomes (if they are
present or generated by recombination), and the difficulty in
generating sufficient complementing functions such as those
provided by the wild-type rep and cap genes. Useful cell lines
expressing such complementing functions have been especially
difficult to generate, in part because of pleiotropic inhibitory
functions associated with the rep gene products. Thus, cell lines
in which the rep gene is integrated and expressed may grow slowly
or express rep at very low levels.
[0017] Based on genetic analyses described above, the general
principles of AAV vector construction have been described. See, for
example, Carter, 1992, Current Opinions in Biotechnology,
3:533-539; Muzyczka, 1992, Curr. Topics in Microbiol. and Immunol.,
158:97-129. AAV vectors are generally constructed in AAV
recombinant plasmids by substituting portions of the AAV coding
sequence with foreign DNA to generate a recombinant AAV (rAAV)
vector or "pro-vector". It is well established in the AAV
literature that, in the vector, the terminal (ITR) portions of the
AAV sequence must be retained intact because these regions are
required in cis for several functions, including excision from the
plasmid after transfection, replication of the vector genome and
integration and rescue from a host cell genome. In some situations,
providing a single ITR may be sufficient to carry out the functions
normally associated with two wild-type ITRs (see, e.g., Samulski et
al., WO 94/13788, published 23 Jun. 1994).
[0018] As described in the art, AAV ITRs generally consist of a
palindromic hairpin (HP) structure and a 20-nucleotide region,
designated the D-sequence, that is not involved in the HP
formation. Wang et al. identified AAV ITR sequences required for
rescue, replication and encapsidation of the AAV genome (Wang et
al., 1996, J. Virol. 70:1668-1677). Wang et al. (1996) reported the
following: (i) two HP structures and one D-sequence are sufficient
for efficient rescue and preferential replication of the AAV DNA,
(ii) two HP structures alone allow a low level rescue and
replication of the AAV DNA, but rescue and replication of the AAV
vector DNA sequences also occur in the absence of the of the
D-sequences, (iii) one HP structure and two D-sequences, but not
one HP structure and one D-sequence, also allow rescue and
replication of the AAV as well as the vector DNA sequences, (iv)
one HP structure alone or two D-sequences but not one D-sequence
alone allows replication of full length plasmid DNA but no rescue
of the AAV genome occurs, (v) no rescue-replication occurs in the
absence of the HP structures and D-sequence, (vi) in the absence of
the D-sequences, the HP structures are insufficient for successsful
encapsidation of the AAV genomes, and (vii) the AAV genomes
containing only one ITR structure can be packaged into biologically
active virions. Thus, Wang et al. conclude that the D-sequence
plays a crucial role in the efficient rescue and selective
replication and encapsidation of the AAV genome. Subsequent studies
published by this group suggested that the first 10 nucleotides of
the D-sequence proximal to the hairpin structure of the ITR are
necessary and sufficient for optimal rescue and replication of the
AAV genome (Wang et al., 1997, J. Virol. 71:3077-3082). Thus, this
work identifies the D-sequence as required for packaging of the AAV
genome.
[0019] The vector can then be packaged into an AAV particle to
generate an AAV transducing virus by transfection of the vector
into cells that are infected by an appropriate helper virus such as
adenovirus or herpesvirus; provided that, in order to achieve
replication and encapsidation of the vector genome into AAV
particles, the vector must generally be complemented for any AAV
functions required in trans, particularly rep and cap, that were
deleted in construction of the vector.
[0020] Such AAV vectors are among a small number of recombinant
virus vector systems which have been shown to have utility as in
vivo gene transfer agents (reviewed in Carter, 1992; Muzyczka,
1992) and thus are potentially of great importance for human gene
therapy. AAV vectors are capable of high-frequency transduction and
expression in a variety of cells including cystic fibrosis (CF)
bronchial and nasal epithelial cells (see, e.g., Flotte et al.,
1992, Am. J. Respir. Cell Mol. Biol. 7:349-356; Egan et al., 1992,
Nature, 358:581-584; Flotte et al., 1993a, J. Biol. Chem.
268:3781-3790; and Flotte et al., 1993b, Proc. Natl. Acad. Sci.
USA, 93:10163-10167); human bone marrow-derived erythroleukemia
cells (see, e.g., Walsh et al., 1992, Proc. Natl. Acad. Sci. USA,
89:7257-7261); as well as brain, eye and muscle cells. AAV may not
require active cell division for transduction and expression which
would be another clear advantage over retroviruses, especially in
tissues such as the human airway epithelium where most cells are
terminally differentiated and non-dividing.
[0021] There is a significant need for methods that can be used to
efficiently generate recombinant vectors encapsidated in AAV
particles that are essentially free of wild-type or other
replication-competent AAV; and a corresponding need for cell lines
that can be used to effectively generate such recombinant vectors.
The present invention provides methods, compositions, and cells for
the production of high-titer, AAV particle-encapsidated,
recombinant vector preparations.
[0022] All publications and patent applications cited herein are
hereby incorporated by reference in their entirety.
SUMMARY OF THE INVENTION
[0023] The present invention provides compositions and methods
that, when operably linked in cis to a heterologous gene, promote
encapsidation of the heterologous gene into an AAV particle,
wherein the in cis encapsidation function is provided by a
polynucleotide (i.e., an encapsidation element) other than an AAV
ITR or preferably, other than a D-sequence of an AAV ITR. In
particular, the inventors have found that by using one or more
non-AAV ITR encapsidation elements in operable linkage with a
heterologous gene, and additionally providing AAV rep and cap gene
products, it is possible to obtain encapsidation of the
heterologous gene in an AAV particle. As described and exemplified
herein, heterologous gene sequences in operable linkage with a
non-AAV ITR encapsidation element can be integrated into the
chromosome of a host cell or can be maintained extrachromosomally
as an episome. The methods and compositions of the present
invention can be used to generate stable producer cells that are
capable of supporting production of a very large burst of AAV
particles containing a recombinant vector (recombinant
polynucleotide), upon infection with a suitable helper virus (such
as adenovirus) or provision of helper functions.
[0024] Accordingly, in one embodiment, the invention provides an
isolated recombinant polynucleotide sequence comprising a
heterologous gene operably linked to an encapsidation element other
than an AAV ITR or a D-sequence of an AAV ITR. In some of these
embodiments, the encapsidation element is a P1 element, as
described herein.
[0025] In additional embodiments, the invention provides methods
for producing high-titer stocks of recombinant vectors containing a
foreign gene encapsidated in an AAV particle, by providing a
mammalian cell which produces AAV rep and cap gene products and
which contains the recombinant vector comprising a heterologous
gene operably linked to an encapsidation element other than an AAV
ITR or preferably, other than a D-sequence of an AAV ITR.
[0026] The invention also provides compositions and methods for
producing cell lines which comprise a recombinant vector comprising
a heterologous gene operably linked to an encapsidation element
other than an AAV ITR or a D-sequence of an AAV ITR, which
synthesize AAV rep and cap gene products, and which encapsidate the
recombinant vector in an AAV particle; cells and cell lines
produced thereby; compositions and methods for high-efficiency
packaging of a recombinant vector containing a heterologous gene;
and recombinant vectors packaged according to the method of the
invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 depicts a nucleotide sequence of a SmaI fragment
comprising a P1 element. SmaI sites are underlined.
[0028] FIG. 2 depicts a nucleotide sequence alignment between the
nucleotide sequence of a 62-nucleotide P1 encapsidation element
(upper line) and nucleotides 145-79 of AAV2 ITR (lower line). The
terminal resolution site is underlined, a Rep68/Rep78 binding site
is indicated in bold, and the 20-nucleotide D sequence of the AAV2
ITR is italicized and in bold. Vertical lines indicate nucleotide
identity. A gap, indicated by dashes, of five nucleotides was
introduced into the P1 sequence for optimal alignment.
[0029] FIG. 3 depicts nucleotide sequence alignments between the
nucleotide sequence of a 62-nucleotide P1 encapsidation element
(upper lines) and nucleotides of ITRs of various AAV serotypes
(lower lines). The terminal resolution site is underlined, a
Rep68/Rep78 binding site is indicated in bold and vertical lines
indicate nucleotide identity. As with the alignment with the AAV2
ITR shown in FIG. 2, a gap, indicated by dashes, was introduced
into the P1 sequences for optimal alignment.
[0030] FIG. 4 shows a map of the p5repcapDHFR plasmid.
[0031] FIG. 5 shows a map of the P1RCD plasmid.
[0032] FIG. 6 depicts an autoradiograph showing results of
experiments performed to determine the sizes of recombinant vectors
encapsidated in AAV particles, as described in Example 3. Numbers
on the left-hand side are sizes, in kilobases, of DNA. Lane 1, 4.8
kb Bgl II to Nae I fragment from plasmid P1RCD; lane 2, 10.sup.8
DRP of lysate from C29 cells; lane 3, 10.sup.8 DRP of lysate from
C29 cells treated with DNase; lane 4, 10.sup.9 DRP of lot 1
purified virions from P1/ACAPSN; lane 5, 10.sup.8 DRP of lot 1
purified virions from P1/ACAPSN; lane 6, 10.sup.9 DRP of lot 2
purified virions from P1/ACAPSN; lane 7, 10.sup.8 DRP of lot 2
purified virions from P1/ACAPSN; lane 8, 10.sup.8 DRP of lot 1
purified virions from P1/ALinBg; lane 9, 10.sup.8 DRP of lot 2
purified virions from P1/ALinBg.
MODES FOR CARRYING OUT THE INVENTION
[0033] A basic challenge in the area of gene therapy is the
development of strategies for efficient gene delivery to cells and
tissues in vivo. One strategy involves the use of recombinant
vectors encapsidated in AAV particles. Recombinant AAV
particle-packaged vectors are recombinant constructs comprising
sequences required in cis for vector packaging, along with
heterologous polynucleotide(s) encoding a protein or function of
interest. Recombinant vectors packaged in AAV particles are
potentially powerful tools for human gene therapy, and in general
are useful for introducing a polynucleotide into a cell.
[0034] Although recombinant vectors packaged in AAV particles are
capable of in vivo gene delivery, for example in the respiratory
tract, high titers of such vectors are necessary to allow the
delivery of a sufficiently high multiplicity of vector in a minimal
volume. Consequently, optimal packaging methodology is of central
importance for AAV-mediated gene therapy approaches. Packaging of
recombinant vectors into AAV particles is mediated in part by the
products of two AAV genes: rep (replication proteins) and cap
(capsid proteins), which can be provided separately in trans.
Previously, it was believed that, in addition to the rep and cap
gene products provided in trans, an ITR was necessary to provide
encapsidation functions in cis. In addition, it was previously
shown that a 20-nucleotide portion of the AAV ITR, known as the "D
sequence", plays a crucial role in the efficient rescue and
selective replication and encapsidation of the AAV genome (Wang et
al., 1996, J. Virol. 70:1668-1677). The inventors of this invention
have made the surprising discovery that sequences other than an AAV
ITR or a D-sequence of an AAV ITR can provide encapsidation
function in cis.
[0035] The inventors of the instant invention have previously shown
(in co-owned International Patent Application No. PCT/US98/21938,
the contents of which are incorporated by reference herein) that P1
or a P1-like element provides for controlled amplification of DNA
comprising the P1 or P1-like element amplifiably linked to AAV rep
and cap genes, thereby providing increased template levels for
synthesis of AAV packaging proteins. It has now been discovered
that P1 or a P1-like element can promote encapsidation of an
operably linked polynucleotide.
[0036] The present invention provides methods, polynucleotides, and
packaging cells for producing stocks of recombinant vector
encapsidated in an AAV particle. A heterologous polynucleotide is
operably linked to an encapsidation element other than an AAV ITR
or a D-sequence of an AAV ITR. In some embodiments, the activating
element is directly or indirectly triggered by the user when it is
desired to initiate vector production, preferably by infection with
helper virus or provision of helper function. The use of the P1
sequence of human chromosome 19 is exemplary in these respects.
[0037] Without wishing to be bound by theory, it appears that upon
infection or provision of helper function, the p5 promoter is
turned on to some degree, resulting in the synthesis of some Rep
protein, which may then, by acting via the encapsidation element,
trigger an encapsidation event by which the linked gene(s) are
encapsidated in an AAV particle. The encapsidation element,
exemplified by P1, can thus promote encapsidation of a gene or
genes to which it is linked.
[0038] The invention also provides recombinant vectors comprising a
heterologous gene operably linked to an encapsidation element other
than an AAV ITR or a D-sequence of an AAV ITR. Preferably, the
recombinant vector comprising the heterologous gene have a size no
greater than the upper size limit for packaging into an AAV
particle, including, but not limited to, a size of approximately 5
kb. These vectors, when encapsidated into an AAV particle, are
useful for introducing heterologous genes into a cell.
General Methods
[0039] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology, recombinant DNA, and immunology, which are within the
skill of the art. Such techniques are explained fully in the
literature. See e.g., Sambrook, Fritsch, and Maniatis, Molecular
Cloning: A Laboratory Manual, Second Edition (1989);
Oligonucleotide Synthesis (M. J. Gait Ed., 1984); Animal Cell
Culture (R. I. Freshney, Ed., 1987); the series Methods in
Enzymology (Academic Press, Inc.); Gene Transfer Vectors for
Mammalian Cells (J. M. Miller and M. P. Calos eds. 1987); Handbook
of Experimental Immunology, (D. M. Weir and C. C. Blackwell, Eds.);
Current Protocols in Molecular Biology (F. M. Ausubel, R. Brent, R.
E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K.
Struhl, eds., 1987, and updates); and Current Protocols in
Immunology (J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M.
Shevach and W. Strober, eds., 1991).
[0040] All patents, patent applications, and publications mentioned
herein, both supra and infra, are hereby incorporated herein by
reference.
Definitions
[0041] As used in the specification and claims, the singular form
"a", "an" and "the" include plural references unless the context
clearly dictates otherwise. For example, the term "a cell" includes
a plurality of cells, including mixtures thereof.
[0042] The terms "polypeptide", "peptide" and "protein" are used
interchangeably to refer to polymers of amino acids of any length.
These terms also include proteins that are post-translationally
modified through reactions that include, but are not limited to,
glycosylation, acetylation and phosphorylation.
[0043] "Polynucleotide" refers to a polymeric form of nucleotides
of any length, either ribonucleotides or deoxyribonucleotides, or
analogs thereof. This term refers only to the primary structure of
the molecule. Thus, double- and single-stranded DNA, as well as
double- and single-stranded RNA are included. It also includes
modified polynucleotides such as methylated or capped
polynucleotides.
[0044] A polynucleotide or polynucleotide region (or a polypeptide
or polypeptide region) has a certain percentage (for example, 80%,
85%, 90%, or 95%) of "sequence identity" to another sequence means
that, when aligned, that percentage of bases (or amino acids) are
the same in comparing the two sequences. This alignment and the
percent homology or sequence identity can be determined using
software programs known in the art, for example those described in
Current Protocols in Molecular Biology (F. M. Ausubel et al., eds.,
1987) Supplement 30, section 7.7.18, Table 7.7.1. Preferably,
default parameters are used for alignment. A preferred alignment
program is BLAST, using default parameters. In particular,
preferred programs are BLASTN and BLASTP, using the following
default parameters: Genetic code=standard; filter=none;
strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50
sequences; sort by=HIGH SCORE; Databases=non-redundant,
GenBank+EMBL+DDBJ+PDB+GenBank CDS
translations+SwissProtein+SPupdate+PIR. Details of these programs
can be found at the following Internet address:
http://www.ncbi.nlm.nih.gov/BLAST.
[0045] A "gene" refers to a polynucleotide containing at least one
open reading frame that is capable of encoding a particular protein
after being transcribed and translated.
[0046] As used herein, "an encapsidation element other than an AAV
ITR or a D sequence of an AAV ITR", used interchangeably herein
with "a packaging signal other than an AAV ITR or a D sequence of
an AAV ITR" and "a non-AAV ITR encapsidation element", intends a
polynucleotide sequence which, when operably linked in cis to a
heterologous gene, promotes (or enhances or increases)
encapsidation of the heterologous gene into an AAV particle, when
AAV rep and cap gene products are provided in trans. For the
purposes of the present invention, an encapsidation element is not
an AAV ITR or a D sequence of an AAV ITR. AAV ITRs and their D
sequences are known in the art, and those skilled in the art, given
the guidance provided herein, can readily determine whether a given
encapsidation element is an AAV ITR or an AAV ITR D sequence or a
non-AAV ITR encapsidation element.
[0047] As used herein, the terms "heterologous gene operably linked
to an encapsidation element", "heterologous polynucleotide operably
linked to an encapsidation element", used interchangeably herein,
refer to a polynucleotide sequence which is not normally associated
in nature with a given encapsidation element.
[0048] In the context of the physical linkage between a
heterologous gene and an encapsidation element, the term "operably
linked", as used herein, intends a physical and/or functional
arrangement of a heterologous gene and an encapsidation element
that permits the encapsidation element to function in cis, in the
presence of AAV rep and cap gene products, to encapsidate the
heterologous gene in an AAV particle. Methods of determining
whether a given encapsidation element is "operably linked" to a
given heterologous gene are known in the art, and are described
herein, and include, but are not limited to, measuring the number
of DNAse-resistant particles (DRPs) which contain the heterologous
gene, as determined, for example, by hybridization analysis.
[0049] The term "ITR" refers to an inverted terminal repeat at
either end of the AAV genome. Generally, AAV ITRs are approximately
145 nucleotides long. The first 125 bases of the ITR can form a T
shaped hairpin structure which is composed of two small internal
palindromes flanked by a larger palindrome (Muzycska et al., 1992).
ITRs have been identified as being involved in AAV DNA replication
and rescue, or excision, from prokaryotic plasmids (Samulski et
al., 1983, Cell 33:135-143, Samulski et al., 1987, J. Virol.
61:3096-3101; Senapathy et al., 1984, J. Mol. Biol. 179:1-20;
Gottlieb and Muzyczka, 1988, Mol. Cell. Biol. 6:2513-2522).
[0050] As used herein, the term "D sequence of an AAV ITR" refers
to a specific sequence element within an AAV ITR which has been
identified as playing a role in rescue, selective replication and
encapsidation of the AAV genome as described, for example, in Wang
et al., 1996 and Wang et al., 1997. The D sequence of an AAV2 ITR
is illustrated in FIG. 2 and, as used herein, a "D sequence of an
AAV ITR" refers to the D sequence of AAV2 ITR as well as D
sequences of the ITRs of other AAV serotypes.
[0051] A "transcriptional regulatory sequence" as used herein,
refers to a nucleotide sequence that controls the transcription of
a gene or coding sequence to which it is operably linked.
Transcriptional regulatory sequences of use in the present
invention generally include at least one transcriptional promoter
and may also include one or more enhancers and/or terminators of
transcription.
[0052] A "promoter," as used herein, refers to a nucleotide
sequence that directs the transcription of a gene or coding
sequence to which it is operably linked.
[0053] "Operably linked" refers to an arrangement of two or more
components, wherein the components so described are in a
relationship permitting them to function in a coordinated manner.
By way of illustration, a transcriptional regulatory sequence or a
promoter is operably linked to a coding sequence if the
transcriptional regulatory sequence or promoter promotes
transcription of the coding sequence. An operably linked
transcriptional regulatory sequence is generally joined in cis with
the coding sequence, but it is not necessarily directly adjacent to
it.
[0054] "Recombinant," refers to a genetic entity distinct from that
generally found in nature. As applied to a polynucleotide or gene,
this means that the polynucleotide is the product of various
combinations of cloning, restriction and/or ligation steps, and
other procedures that result in a construct that is distinct from a
polynucleotide found in nature.
[0055] "Heterologous" means derived from a genotypically distinct
entity from that of the rest of the entity to which it is compared.
For example, a polynucleotide introduced by genetic engineering
techniques into a different cell type is a heterologous
polynucleotide (and, when expressed, can encode a heterologous
polypeptide). Similarly, a transcriptional regulatory sequence or
promoter that is removed from its native coding sequence and
operably linked to a different coding sequence is a heterologous
transcriptional regulatory sequence or promoter.
[0056] A "vector", as used herein, refers to a recombinant plasmid
or virus that comprises a polynucleotide to be delivered into a
host cell, either in vitro or in vivo. The polynucleotide to be
delivered, sometimes referred to as a "target polynucleotide,"
"transgene", or "gene of interest" may comprise a coding sequence
of interest in gene therapy (such as a gene encoding a protein of
therapeutic interest) and/or a selectable or detectable marker.
[0057] A "replicon" refers to a polynucleotide comprising an origin
of replication which allows for replication of the polynucleotide
in an appropriate host cell. Examples of replicons include episomes
(including plasmids), as well as chromosomes (such as the nuclear
or mitochondrial chromosomes).
[0058] An "origin," "replication origin," "ori-like sequence" or
"ori element" is a nucleotide sequence involved in one or more
aspects of initiation of DNA replication, such as, for example,
binding of replication initiation factors, unwinding of the DNA
duplex, primer formation, and/or template-directed synthesis of a
complementary strand. As discussed in detail herein and in the art,
ori-like sequences can generally be found in any polynucleotide
that is naturally replicated, including plasmids and viruses, as
well as prokaryotic, mitochondrial and chloroplast genomes and
eukaryotic chromosomes. Such ori-like sequences can be identified
genetically (i.e., replication-defective mutants, ars sequences) or
functionally (i.e., through biochemical assay, electron microscopy,
etc.), as is known in the art.
[0059] "Stable integration" of a polynucleotide into a cell means
that the polynucleotide has been integrated into a replicon that
tends to be stably maintained in the cell. Although episomes such
as plasmids can sometimes be maintained for many generations,
genetic material carried episomally is generally more susceptible
to loss than chromosomally-integrated material. However,
maintenance of a polynucleotide can often be effected by
incorporating a selectable marker into or adjacent to a
polynucleotide, and then maintaining cells carrying the
polynucleotide under selective pressure. In some cases, sequences
cannot be effectively maintained stably unless they have become
integrated into a chromosome; and, therefore, selection for
retention of a sequence comprising a selectable marker can result
in the selection of cells in which the marker has become
stably-integrated into a chromosome. Antibiotic resistance genes
can be conveniently employed as such selectable markers, as is well
known in the art. Typically, stably-integrated polynucleotides
would be expected to be maintained on average for at least about
twenty generations, preferably at least about one hundred
generations, still more preferably they would be maintained
permanently. The chromatin structure of eukaryotic chromosomes can
also influence the level of expression of an integrated
polynucleotide. Having the genes carried on stably-maintained
episomes can be particularly useful where it is desired to have
multiple stably-maintained copies of a particular gene. The
selection of stable cell lines having properties that are
particularly desirable in the context of the present invention are
described and illustrated below.
[0060] "AAV" is adeno-associated virus. Adeno-associated virus is a
defective parvovirus that grows only in cells in which certain
functions are provided by a co-infecting helper virus. General
reviews of AAV may be found in, for example, Carter, 1989, Handbook
of Parvoviruses, Vol. I, pp. 169-228, and Berns, 1990, Virology,
pp. 1743-1764, Raven Press, (New York). The AAV2 serotype was used
in some of the illustrations of the present invention that are set
forth in the Examples. However, it is fully expected that these
same principles will be applicable to other AAV serotypes since it
is now known that the various serotypes are quite closely
related--both functionally and structurally, even at the genetic
level (see, e.g., Blacklow, 1988, pp. 165-174 of Parvoviruses and
Human Disease, J. R. Pattison (ed.); and Rose, 1974, Comprehensive
Virology 3: 1-61). For example, all AAV serotypes apparently
exhibit very similar replication properties mediated by homologous
rep genes; and all bear three related capsid proteins such as those
expressed in AAV2. The degree of relatedness is further suggested
by heteroduplex analysis which reveals extensive
cross-hybridization between serotypes along the length of the
genome; and the presence of analogous self-annealing segments at
the termini that correspond to inverted terminal repeats (ITRs).
The similar infectivity patterns also suggest that the replication
functions in each serotype are under similar regulatory
control.
[0061] A "recombinant AAV vector" (or "rAAV vector") refers to a
vector comprising one or more polynucleotide sequences of interest,
genes of interest or "transgenes" that are flanked by AAV inverted
terminal repeat sequences (ITRs). Such rAAV vectors can be
replicated and packaged into infectious viral particles when
present in a host cell that has been infected with a suitable
helper virus and that is expressing AAV rep and cap gene products
(i.e. AAV Rep and Cap proteins). When an rAAV vector is
incorporated into a larger polynucleotide (e.g. in a chromosome or
in another vector such as a plasmid used for cloning or
transfection), then the rAAV vector is typically referred to as a
"pro-vector" which can be "rescued" by replication and
encapsidation in the presence of AAV packaging functions and
necessary helper functions.
[0062] As used herein, a recombinant vector to be packaged
(encapsidated) in an AAV particle intends a vector comprising one
or more heterologous polynucleotide sequences, heterologous genes
or "transgenes" that are operably linked to an encapsidation
element other than an AAV ITR or a D-sequence of an AAV ITR. Such
recombinant vectors can be replicated and packaged into infectious
AAV particles when present in a host cell that has been infected
with a suitable helper virus (or provided with helper function(s))
and that synthesizes AAV rep and cap gene products (i.e. AAV Rep
and Cap proteins).
[0063] A "helper virus" for AAV refers to a virus that allows AAV
(which is a "defective" parvovirus) to be replicated and packaged
by a host cell. A number of such helper viruses have been
identified, including adenoviruses, herpesviruses and poxviruses
such as vaccinia. The adenoviruses encompass a number of different
subgroups, although Adenovirus type 5 of subgroup C (Ad5) is most
commonly used. Numerous adenoviruses of human, non-human mammalian
and avian origin are known and available from depositories such as
the ATCC. Viruses of the herpes family include, for example, herpes
simplex viruses (HSV) and Epstein-Barr viruses (EBV), as well as
cytomegaloviruses (CMV) and pseudorabies viruses (PRV); which are
also available from depositories such as ATCC. "Helper function"
refers to the activity provided by the helper virus that allows
replication and packaging of an AAV genome, or any equivalent
activity. Helper functions are also believed to stimulate
transcription of some AAV promoters, including p5, and may enhance
processivity of replication in cells in which helper functions are
expressed.
[0064] "Packaging" as used herein refers to a series of subcellular
events that results in the assembly and encapsidation of all or
part of a recombinant vector comprising one or more encapsidation
elements other than an AAV ITR or and AAV ITR D-sequence. Thus,
when a recombinant vector comprising an encapsidation element other
than an AAV ITR or its D sequence, is introduced into a packaging
cell, or packaging cell line, under appropriate conditions, it can
be assembled into a viral particle. Functions associated with
packaging of viral vectors, particularly AAV vectors, are described
herein and in the art.
[0065] AAV "rep" and "cap" genes are genes encoding replication and
encapsidation proteins, respectively. AAV rep and cap genes have
been found in all AAV serotypes examined, and are described herein
and in the references cited. In wild-type AAV, the rep and cap
genes are generally found adjacent to each other in the viral
genome (i.e. they are "coupled" together as adjoining or
overlapping transcriptional units), and they are generally
conserved among AAV serotypes. AAV rep and cap genes are also
individually and collectively referred to herein as "AAV packaging
genes." AAV packaging genes that have been modified by deletion or
point mutation, or which have been subdivided into components which
can be rejoined by recombination (e.g., as described in co-owned
International Patent Application No. PCT/US97/23247, the disclosure
of which is hereby incorporated by reference), may also be used in
the present invention. AAV packaging genes can also be operably
linked to other transcriptional regulatory sequences, including
promoters, enhancers and polyadenylation ("polyA") sequences (which
additional transcriptional regulatory sequences can also be
heterologous). An "AAV packaging cassette" is a recombinant
construct which includes one or more AAV packaging genes.
[0066] "Efficiency" when used in describing a cell line refers to
certain useful attributes of the line; in particular, the growth
rate, and (for packaging cell lines) the number of virus particles
produced per cell. "Efficient growth" of a packaging cell line
refers to the effective growth rate of the packaging cell, related
to a comparable parental-type cell (i.e., a cell that does not
carry an introduced AAV packaging gene). Preferably, the relative
growth rate is at least 20% of the parental type, more preferably,
40%, more preferably, 80%, still more preferably, 90% and, most
preferably, 100%. "High efficiency packaging" indicates production
of at least about 100 viral particles per cell, more preferably at
least about 1,000 viral particles per cell, still more preferably
at least about 10,000 viral particles per cell. "High safety
packaging" indicates that, of the recombinant AAV viral particles
produced, fewer than about 1 in 10.sup.6 are replication-competent
AAV viral particles, preferably fewer than about 1 in 10.sup.8 are
replication-competent, more preferably fewer than about 1 in
10.sup.10 are replication-competent, still more preferably fewer
than about 1 in 10.sup.12 are replication-competent, most
preferably none are replication-competent. Preferred packaging
cells of the present invention exhibit combinations of such high
efficiency and high safety.
[0067] "Host cells", "cell lines", "cell cultures", "packaging cell
line" and other such terms denote higher eukaryotic cells,
preferably mammalian cells, most preferably human cells, useful in
the present invention. These cells can be used as recipients for
recombinant vectors, viruses or other transfer polynucleotides, and
include the progeny of the original cell that was transduced. It is
understood that the progeny of a single cell may not necessarily be
completely identical (in morphology or in genomic complement) to
the original parent cell.
[0068] A "therapeutic gene", "target polynucleotide", "transgene",
"gene of interest", "heterologous gene", "heterologous
polynucleotide" and the like generally refer to a gene or genes to
be transferred using a vector. Typically, in the context of the
present invention, such genes are located within a recombinant
vector (which vector comprises the heterologous gene and one or
more encapsidation elements other than an AAV ITR or its D
sequence) for packaging in an AAV particle. Target polynucleotides
can be used in this invention to generate recombinant vectors for a
number of different applications. Such polynucleotides include, but
are not limited to: (i) polynucleotides encoding proteins useful in
other forms of gene therapy to relieve deficiencies caused by
missing, defective or sub-optimal levels of a structural protein or
enzyme; (ii) polynucleotides that are transcribed into anti-sense
molecules; (iii) polynucleotides that are transcribed into decoys
that bind transcription or translation factors; (iv)
polynucleotides that encode cellular modulators such as cytokines;
(v) polynucleotides that can make recipient cells susceptible to
specific drugs, such as the herpes virus thymidine kinase gene;
(vi) polynucleotides for cancer therapy, such as E1A tumor
suppressor genes or p53 tumor suppressor genes for the treatment of
various cancers, (vii) polynucleotides that encode antigens or
antibodies and (viii) polynucleotides that encode viral proteins,
including, but not limited to, AAV Rep and Cap proteins. To effect
expression of the transgene in a recipient host cell, it is
preferably operably linked to a promoter or other such
transcriptional regulatory sequence, either its own or a
heterologous promoter. A large number of suitable promoters are
known in the art, the choice of which depends on the desired level
of expression of the target polynucleotide; whether one wants
constitutive expression, inducible expression, cell-specific or
tissue-specific expression, etc. The recombinant vector may also
contain a selectable marker.
[0069] An "activating element" is a sequence that responds to the
presence of an activation signal by amplifying (i.e., replicating
the sequences) to which it is amplifiably linked. A preferred
activating element is the P1 element and preferred activation
signals include AAV helper functions (as exemplified by adenovirus
E1A function) or their equivalents. As used herein, two sequences,
one of which is an activating element, are "amplifiably linked"
when they are in sufficient proximity to each other that
replication initiating from the activating element results in
amplification (i.e., increased copy number) of the other sequence.
Preferably, the copy number of the amplified sequence is amplified
2-fold or greater, more preferably, 10-fold or greater, still more
preferably, 20-fold or greater. It is to be noted that the ability
of an activating element to amplify an amplifiably-linked sequence
will be influenced by the degree of processivity of replication
initiating from the activating element. Thus, factors that enhance
processivity of replication will tend to increase the effective
level of amplification of a sequence that is amplifiably linked to
an activating element. In the context of the present invention,
infection with adenovirus, or provision of equivalent helper
function, may enhance processivity of replication as well as
initiating amplification.
Encapsidation Elements for Use in Recombinant Vectors, Packaging
Cells, and Methods of the Invention
[0070] The present inventors have discovered that non-AAV ITR
encapsidation elements such as the P1 sequence (normally found on
human chromosome 19), when operably linked to one or more
heterologous genes, in a mammalian cell which synthesizes AAV rep
and cap gene products, can promote encapsidation of the linked
heterologous gene into an AAV particle. In particular, when a
recombinant vector of the present invention comprising an
encapsidation element operably linked to a heterologous gene is
provided in a mammalian cell which synthesizes AAV rep and cap gene
products, under suitable conditions, including the provision of
helper virus or helper function, high titers of AAV particles
containing the recombinant vector are produced by the host cells.
P1 exemplifies a class of encapsidation elements possessing, among
other properties, activatable encapsidation function, that is
useful in the generating recombinant vectors encapsidated in an AAV
particle.
[0071] The methods and compositions of the invention will therefore
utilize recombinant DNA constructs wherein a heterologous gene is
operably linked to one or more encapsidation elements. The
presently preferred encapsidation elements are exemplified by P1
and P1-like elements that exhibit functional properties related to
encapsidation functions normally associated with AAV ITRs. Most
preferred are elements that act as helper function-inducible
encapsidation elements.
[0072] The P1 element contains at least two distinct sequence
motifs, a site at which Rep proteins can bind, known as the
"Rep-binding motif" (or "Rep-binding site" or "RB site") and a
terminal resolution site ("trs"), at which bound Rep protein can
nick the DNA (see FIG. 2). During AAV replication, it is believed
that Rep protein binds within the AAV inverted terminal repeat and
catalyzes the formation of a nick (at the terminal resolution
site), resulting in covalent attachment of Rep protein to the newly
generated 5' end. The 3' end of the nick serves as a primer for AAV
DNA synthesis. Subsequently, operably linked polynucleotides are
encapsidated unidirectionally. Further, as shown in Example 3,
either of both strands of a double-stranded polynucleotide can be
encapsidated. In the Examples, encapsidation of a given
polynucleotide into AAV particles is determined by measuring
DNAse-resistant particles, and further by determining the
polynucleotide contents of the DRPs by hybridization with a
labelled probe complementary to the polynucleotide. These methods
can be used as an assay to identify additional encapsidation
elements.
[0073] Weitzman et al. ((1994) Proc. Natl. Acad. Sci. USA
91:5808-5812) reported that a 109-base pair SmaI fragment (FIG. 1),
designated P1, at the site of AAV integration into the human genome
specifically binds Rep 68 and Rep78 proteins. A P1 element for use
in the present invention can comprise this 109-bp fragment.
However, as discussed below, portions of this 109-bp fragment can
function to encapsidate an operably linked polynucleotide. In
addition, longer fragments from the AAV integration site which
comprise this P1 element can also be used. Further, variants of
this sequence can be used to promote encapsidation of an operably
linked polynucleotide sequence.
[0074] As shown in FIG. 2, a 62-nucleotide encapsidation element,
which is a sub-fragment of the 109-bp P1 element described above,
shares about 47% nucleotide sequence identity when aligned with an
AAV2 ITR from nucleotide 145 to 79 (Muzyczka, 1992), where a
5-nucleotide gap is introduced between nucleotides 32 and 33 of the
P1 element shown in FIG. 2.
[0075] As was done with the AAV2 ITR sequence, ITR sequences from
other AAV serotypes have also been aligned with the 62-nucleotide
P1 encapsidation element (FIG. 3). AAV ITR sequences were taken
from Xiao et al., 1999, J. Virol. 73:3994-4003; Muramatsu et al.,
1996, Virology 221:208-217; Chiorini et al., 1997, J. Virol.
71:6823-6833 and Chiorini et al., 1999, J. Virol. 73:4293-4298. As
depicted in FIG. 3, the P1 element shares about 42% nucleotide
sequence identity when aligned with an AAV1 ITR, the P1 element
shares about 44% nucleotide sequence identity when aligned with an
AAV3 ITR, the P1 element shares about 45% nucleotide sequence
identity when aligned with an AAV4 ITR, the P1 element shares about
53% nucleotide sequence identity when aligned with an AAV5 ITR and
the P1 element shares about 39% nucleotide sequence identity when
aligned with an AAV6 ITR.
[0076] In some embodiments, a non-AAV ITR encapsidation element
shares at least about 25 to about 30%, more preferably at least
about 30 to about 40%, more preferably at least about 40 to about
45%, more preferably at least about 45 to about 47%, more
preferably at least about 47 to about 53%, more preferably from at
least about 53 to about 60%, more preferably at least about 60% to
about 70%, more preferably at least about 70% to about 80%, more
preferably at least about 80% to about 90%, even more preferably at
least about 90% or more sequence identity with the 62-nucleotide P1
element shown in FIG. 2. In some embodiments, recombinant vectors
of the invention comprise one or more P1 elements, one or both of
which have the sequence of the P1 element shown in FIG. 2.
[0077] In some embodiments, a non-AAV ITR encapsidation element
comprises a binding site for AAV Rep68/Rep78 proteins. In some of
these embodiments, the Rep68/Rep78 binding site has the nucleotide
sequence 5' GCXCGCTCGCTCGCTX, where X is any nucleotide. In other
embodiments, a non-AAV ITR encapsidation element comprises a
terminal resolution site. In some of these embodiments, a terminal
resolution site has the nucleotide sequence GGTTGG. In other
embodiments, a non-AAV ITR encapsidation element comprises both a
Rep68/Rep78 binding site and a terminal resolution site. In some of
these embodiments, a non-AAV ITR comprises the nucleotide sequence
GGTTGG(X)nGCXCGCTCGCTCGCTX, wherein X is any nucleotide and n is a
number from 1 to about 100, preferably about 50, more preferably
about 20, more preferably about 10.
[0078] A non-AAV ITR encapsidation element for use in the present
invention promotes (or increases, or enhances) encapsidation of an
operably linked heterologous gene into an AAV particle. Those
skilled in the art can readily determine whether a given nucleotide
sequence functions as an encapsidation element. Any of a variety of
methods known to those skilled in the art can be employed for this
determination, including, but not limited to, measuring the number
of DRPs (i.e., encapsidated recombinant vectors), and subjecting
the DRPs to hybridization analysis, as described in Example 2. A
non-AAV ITR encapsidation element for use in the present invention
promotes encapsidation of an operably linked heterologous gene such
that at least about 10.sup.2, more preferably at least about
10.sup.4, more preferably at least about 10.sup.6, more preferably
at least about 10.sup.7, more preferably at least about 10.sup.8,
more preferably at least about 10.sup.9, even more preferably at
least about 10.sup.10 or more, DRP containing the heterologous gene
per milliliter are generated when the vector is provided in a
mammalian cell which synthesizes AAV rep and cap gene products, and
to which mammalian cell is provided helper virus function(s).
Isolated Recombinant Polynucleotides Comprising a Heterologous Gene
Operably Linked to a Non-AAV ITR Encapsidation Element
[0079] Urcelay et al. ((1995) J. Virol. 69:2038-2046) describe a
plasmid, pMAT50, which comprises a P1 element and a lacZ gene and
an AAV ITR. No encapsidation function was attributed to this P1
element. The present invention provides an isolated recombinant
polynucleotide (also referred to herein as an isolated recombinant
vector) comprising a non-AAV ITR encapsidation element operably
linked to a heterologous gene(s), wherein the encapsidation element
promotes encapsidation of the operably linked heterologous gene
into an AAV particle under conditions permissive for encapsidation,
and wherein the isolated recombinant vector is not pMAT50.
Conditions permissive for encapsidation are provided when the
isolated recombinant polynucleotide is in a mammalian cell which
synthesizes AAV rep and cap gene products, and which is provided
with helper virus function. In these embodiments, the isolated
recombinant polynucleotide is introduced into a mammalian cell
which synthesizes AAV rep and cap gene products. When helper virus
function is further provided, the isolated recombinant
polynucleotide is encapsidated in AAV particles.
[0080] We have observed that placing an encapsidation element, as
exemplified by a P1 sequence, near a heterologous gene, e.g., a cap
gene, resulted in a efficient packaging of the heterologous gene in
AAV particles. Indeed, as shown below, a P1 element placed at a
distance of 5.2 kb from the DHFR sequence, for example, resulted in
efficient packaging of the heterologous gene with production of
approximately 10.sup.10 DRPs per milliliter. This compares
favorably with encapsidation efficiencies reported for ITR-mediated
packaging of AAV vector genomes. Although placing an encapsidation
element further away from an AAV packaging gene (e.g. 5-10 kb or
further) may result in somewhat lower levels of encapsidation,
longer distances between an encapsidation element and an operably
linked heterologous gene would still be expected to provide a
degree of encapsidation sufficient for production of isolated
recombinant polynucleotides encapsidated in AAV particles.
Accordingly, in some embodiments, the non-AAV ITR encapsidation
element is less than about 10 kb, more preferably less than about 5
kb, more preferably less than about 4 kb, more preferably less than
about 3 kb, more preferably less than about 2 kb, more preferably
less than about 1 kb, more preferably less than about 0.5 kb away
from (i.e., in the direction of encapsidation from) the isolated
recombinant polynucleotide comprising a heterologous gene to be
packaged into an AAV particle.
[0081] In some embodiments, the isolated recombinant polynucleotide
further comprises a selectable marker. Once this recombinant
polynucleotide is introduced into a mammalian cell, the cell can be
subjected to selection appropriate to the selectable marker. A
variety of selectable markers suitable for use in mammalian cells,
and the manner of selection, are known in the art, and need not be
described in detail herein. Any such selectable marker is suitable
for use in the isolated recombinant polynucleotides of the
invention. Mammalian cells comprising an isolated recombinant
polynucleotide containing a selectable marker, subjected to
selection appropriate to the selectable marker can yield cells
which comprise the recombinant polynucleotide stably integrated
into the genome of the cell, as described in the Examples. When
such a cell synthesizes AAV rep and cap gene products, and exhibits
helper virus function, or is provided with helper virus function,
the recombinant polynucleotide can be rescued and encapsidated into
AAV particles.
[0082] In encapsidating copies of integrated operably linked
heterologous gene(s) in response to helper virus infection, the P1
element appears to direct encapsidation unidirectionally. Without
wishing to be bound by theory, it is believed that interaction of
Rep with a Rep-binding motif may be followed by nicking between the
two T residues in a Terminal Resolution Site (TRS), as illustrated
below. Subsequently, replication may initiate from the 3' hydroxyl
end of the nick and proceed toward the Rep-binding motif.
Accordingly, in some embodiments, a unidirectional encapsidation
element (for example, P1) is oriented such that unidirectional
replication proceeds from the encapsidation element toward the
associated (i.e., operably linked) heterologous gene(s).
[0083] Alternatively, a heterologous gene(s) can be flanked by
encapsidation elements that are oriented so that replication
initiated at each element proceeds "inward" toward the heterologous
gene(s).
[0084] It is understood that while the polynucleotides containing
the encapsidation element(s) and the heterologous gene(s) may be
integrated, they may also exist in an episomal state.
[0085] In some embodiments, the isolated recombinant
polynucleotides of the invention have a size no greater than the
upper size limit for packaging into an AAV particle. In some of
these embodiments, isolated recombinant polynucleotides of the
invention have a size greater than about 5 kb. In some of these
embodiments, isolated recombinant polynucleotides of the invention
have a size less than about 5 kb. In some of these embodiments, the
size of the isolated recombinant polynucleotide is about 4.7 kb or
less. Examples of recombinant polynucleotides sizes packageable
into an AAV particle include, but are not limited to, those sizes
exemplified in Dong et al., 1996, Human Gene Ther. 7:2101-2112.
Production of AAV Particles Comprising a Heterologous Gene
[0086] To generate recombinant AAV particles useful for such
purposes as gene therapy, or introducing a transgene into a cell, a
packaging cell, or a packaging cell line, which synthesizes AAV rep
and cap gene products, is generally supplied with a recombinant
vector comprising a heterologous gene operably linked to an
encapsidation element other than an AAV ITR or a D-sequence of an
AAV ITR, such that the recombinant vector enters the cell and is
packaged into an AAV particle in the presence of helper virus
function(s). The vector can be introduced into the packaging cell
by any known means, including, but not limited to, electroporation
and lipofection. The packaging cell provides AAV rep and cap
functions, which can be encoded by polynucleotide sequences which
are stably integrated into the genome, or which are maintained in
the packaging cell episomally, or are produced by transiently
transfecting the cell with a vector, such as a plasmid vector,
which comprises sequences encoding AAV rep and cap gene products.
Helper functions can be provided by infecting the packaging cell
with helper virus before, during, or after providing the cell with
the recombinant vector. Alternatively, a vector which comprises
nucleotide sequences which encode helper virus function(s) can be
provided to the cell before, during, or after providing the cell
with the recombinant vector. In some embodiments, the recombinant
vector is provided to the cell transiently. In other embodiments,
the recombinant vector comprises a selectable marker and the
packaging cell is selected on the basis of the selectable marker
such that the recombinant vector is stably integrated into the
genome of the packaging cell. In other embodiments, the recombinant
vector can stably integrate into the genome of the packaging cell
without the need for a selectable marker.
Heterologous Polynucleotides
[0087] The heterologous polynucleotide, if it is intended to be
expressed, is generally operably linked to a promoter, either its
own or a heterologous promoter. A large number of suitable
promoters are known in the art, the choice of which depends on the
desired level of expression of the target polynucleotide; whether
one wants constitutive expression, inducible expression,
cell-specific or tissue-specific expression, etc. The recombinant
vector can also contain a positive selectable marker in order to
allow for selection of cells that have been infected by the
recombinant vector; and/or a negative selectable marker (as a means
of selecting against those same cells should that become necessary
or desirable); see, e.g., S. D. Lupton, PCT/US91/08442 and
PCT/US94/05601.
[0088] As an example, a recombinant vector can be constructed which
comprises an encapsidation element operably linked to a
polynucleotide that encodes a functional cystic fibrosis
transmembrane conductance regulator polypeptide (CFTR) operably
linked to a promoter. As is now known in the art, there are a
variety of CFTR polypeptides that are capable of reconstituting
CFTR activity in cells derived from cystic fibrosis patients. For
example, Carter et al. have described truncated variants of CFTR
genes that encode functional CFTR proteins (see, e.g., U.S. Pat.
No. 5,866,696). See also, Rich et al. (1991, Science 253: 205-207)
who have described a CFTR derivative missing amino acid residues
708-835, that was capable of transporting chloride and capable of
correcting a naturally occurring CFTR defect, and Egan et al.
(1993) who described another CFTR derivative (comprising about 25
amino acids from an unrelated protein followed by the sequence of
native CFTR beginning at residue 119) that was also capable of
restoring electrophysiological characteristics of normal CFTR. To
take two additional examples, Arispe et al. (1992, Proc. Natl.
Acad. Sci. USA 89: 1539-1543) showed that a CFTR fragment
comprising residues 433-586 was sufficient to reconstitute a
correct chloride channel in lipid bilayers; and Sheppard et al.
(1994, Cell 76:1091-1098) showed that a CFTR polypeptide truncated
at residue 836 to about half its length was still capable of
building a regulated chloride channel. Thus, the native CFTR
protein, and mutants and fragments thereof, all constitute CFTR
polypeptides that are useful in the practice of this invention.
[0089] Other useful target polynucleotides can be used in this
invention to generate recombinant vectors for a number of different
applications. Such polynucleotides include, but are not limited to:
(i) polynucleotides encoding proteins useful in other forms of gene
therapy to relieve deficiencies caused by missing, defective or
sub-optimal levels of a structural protein or enzyme; (ii)
polynucleotides that are transcribed into anti-sense molecules;
(iii) polynucleotides that are transcribed into decoys that bind
transcription or translation factors; (iv) polynucleotides that
encode cellular modulators such as cytokines; (v) polynucleotides
that can make recipient cells susceptible to specific drugs, such
as the herpes virus thymidine kinase gene; and (vi) polynucleotides
for cancer therapy, such as the wild-type p53 tumor suppressor cDNA
for replacement of the missing or damaged p53 gene associated with
over 50% of human cancers, including those of the lung, breast,
prostate and colon.
Mammalian Packaging Cells
[0090] The present invention provides mammalian packaging cells for
producing stocks of a recombinant polynucleotide encapsidated in an
AAV particle, wherein the recombinant polynucleotide comprises a
heterologous gene operably linked to a non-AAV ITR encapsidation
element which promotes encapsidation of the operably linked
heterologous gene into the AAV particle.
[0091] For production of a recombinant polynucleotide encapsidated
in an AAV particle, wherein the recombinant polynucleotide
comprises a heterologous gene operably linked to a non-AAV ITR
encapsidation element, and preferably to a non-AAV ITR D-sequence
encapsidation element, a mammalian cell which synthesizes AAV rep
and cap gene products, i.e., a packaging cell, is used. AAV rep and
cap gene products can be encoded by stably integrated AAV rep and
cap genes, or can be encoded by polynucleotides comprised in a
vector which is introduced into the cell before, during, or after
introduction of the recombinant vector. Further, stable cell lines
can be generated which comprise the recombinant vector stably
integrated into the genome of the cell.
[0092] Since the therapeutic specificity of the resulting
recombinant vector is determined by the plasmid introduced, the
same packaging cell line can be used for any of these applications.
The plasmid comprising the specific target polynucleotide is
introduced into the packaging cell for production of the AAV vector
by any known method; including, but not limited to,
electroporation.
[0093] A number of packaging cells comprising stably integrated AAV
cap and/or rep genes are known in the art and can be used for
packaging the recombinant vectors described herein. see, e.g., T.
Flotte et al., WO 95/13365 (Targeted Genetics Corporation and Johns
Hopkins University), and corresponding U.S. Pat. No. 5,658,776; J.
Trempe et al., WO 95/13392 (Medical College of Ohio), and
corresponding U.S. Pat. No. 5,837,484; and J. Allen, WO 96/17947
(Targeted Genetics Corporation).
[0094] Such packaging cells include, but are not limited to,
packaging cells which comprise a stably integrated AAV cap gene
operably linked to a promoter and a stably integrated AAV rep gene
operably linked to a heterologous promoter, for example as
described by Allen (International Patent Application No.
PCT/US95/15892); packaging cells comprising an AAV rep gene, which
may be operably linked to a heterologous promoter; packaging cells
comprising an AAV cap gene operably linked to a promoter. When
packaging cells comprising stably integrated rep and cap genes are
used, the recombinant vector comprising a heterologous gene
operably linked to an encapsidation element is introduced into the
cell, and, in the presence of helper virus function, the
recombinant vector is packaged into AAV particles. When packaging
cells comprising stably integrated AAV rep or AAV cap genes are
used, the missing in trans product is supplied, typically on a
plasmid vector which is introduced before, simultaneously with, or
after, introduction of the recombinant vector.
[0095] In other embodiments, the packaging cells are provided with
both AAV rep and AAV cap gene products by introducing into the cell
a vector comprising coding sequences for AAV rep and cap gene
products before, simultaneously with, or after, introduction of the
recombinant vector comprising a heterologous gene operably linked
to an encapsidation element. Plasmid-encoded AAV rep and/or cap
genes can optionally be maintained episomally.
[0096] In other embodiments, also illustrated in the Examples
below, the recombinant vector is itself stably integrated into a
packaging cell line. Such stable, vector-containing packaging lines
can also optionally contain stable chromosomal or episomal copies
of AAV cap and/or rep genes. Cell lines such as those described
above can be grown and stored until ready for use. To induce
production of recombinant vector packaged into AAV particles in
cells that contain Rep and Cap proteins, the user simply infects
the cells with helper virus, or provides helper functions on a
plasmid introduced by any known method, and cultures the cells
under conditions suitable for replication and packaging of AAV (as
described below).
Helper Virus Function
[0097] Helper virus can be introduced before, during or after
introduction of the recombinant vector. For instance, the plasmid
can be co-infected into the culture along with the helper virus.
The cells are then cultured for a suitable period, typically 2-5
days, in conditions suitable for replication and packaging as known
in the art (see references above and examples below). Lysates are
prepared, and the recombinant AAV vector particles are purified by
techniques known in the art. Alternatively, helper virus functions
are provided to the cell on recombinant vectors, such as
plasmids.
Purification of Recombinant Vectors
[0098] Recombinant vectors encapsidated in AAV particles prepared
using the methods and compositions of the present invention can be
purified according to techniques known in the art, see, e.g., the
various AAV references cited above. Alternatively, improved
purification techniques can be employed, such as those described by
Atkinson et al. in International Patent Application No.
PCT/US98/18600.
Introduction of Heterologous Genes into a Cell Using Encapsidated
Recombinant Vectors of the Invention
[0099] The recombinant vectors encapsidated into AAV particles can
be used to deliver polynucleotides to target cells either in vitro,
in vivo, or ex vivo, as described in the references cited herein
and in the art. For delivery in vivo, the recombinant vectors
encapsidated in AAV particles will typically be contained in a
physiological suitable buffered solution that can optionally
comprise one or more components that promote sterility, stability
and/or activity. Any means convenient for introducing the vector
preparation to a desired location within the body can be employed,
including, for example, by intravenous or localized injection, by
infusion from a catheter or by aerosol delivery.
[0100] The examples presented below are provided as a further guide
to a practitioner of ordinary skill in the art, and are not meant
to be limiting in any way.
EXAMPLES
Example 1
Construction of Recombinant Vectors Comprising a Non-AAV ITR
Encapsidation Element Operably Linked to a Heterologous Gene, and
Cells Comprising the Vectors
1. Construction of a Recombinant Vector Employing P1 as an
Exemplary Encapsidation Element
[0101] An exemplary P1 sequence we used as the source of
encapsidation element comprises nucleotides 354-468 of the AAV S1
locus (Kelman et al (1994) Curr. Opin. Genet. Dev. 4:185-195;
Weitzman et al (1994) Proc. Natl. Acad. Sci. 91:5808-5817). Shown
below is the nucleotide sequence of a P1 encapsidation element (SEQ
ID NOs. 1 and 2), including a presumed terminal resolution site
(TRS) at nucleotides 19-24 of SEQ ID NO:1 (i.e., nucleotides
372-377 of the AAV S1 locus), and a presumed Rep binding motif (RB
Motif, also known as a Rep-binding site or RBS), at nucleotides
33-48 of SEQ ID NO:1 (i.e., nucleotides 386-401 of the AAV S1
locus). Also indicated (by the downward-pointing arrow) is the
presumed Rep cleavage site located between the thymidines of the
TRS. TABLE-US-00001 TRS SEQ ID NO:1 .dwnarw. 5'
CGGGCGGGTGGTGGCGGCGGTTGGGGCTCGGCGCTCGCTCGCTCGCTGGGCGGGCGGGCGGT 3'
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 3'
GCCCGCCCACCACCGCCGCCAACCCCGAGCCGCGAGCGAGCGAGCGACCCGCCCGCCCGCCA 5'
SEQ ID NO:2 RB Motif
2. Construction of p5repcap
[0102] We linked a P1 element (as described above) to AAV rep and
cap genes that remained operably linked to their native AAV
promoters. As a first step in that process, an AAV packaging
cassette, p5repcap, comprising the AAV rep and cap encoding
sequences transcriptionally linked to the native p5, p19 and p40
promoters and followed by the AAV2 polyadenylation signal, was
constructed as follows. Briefly, a fragment from pAV2 comprising
nucleotides 193 to 379 (Srivastiva et al. (1983) J. Virol.
45:555-564) was obtained by PCR amplification. The design of the
PCR primers resulted in addition of a BglII site at the 5' end of
the amplified fragment and encompassed the PpuMI site (at AAV-2
nucleotide 350) close to the 3' end. The PCR-amplified DNA was
digested with BglII and PpuMI to generate a restriction fragment
comprising AAV-2 nucleotides 193-350. A restriction fragment
comprising nucleotides 351-4498 of pAV2 was isolated from pAV2 by
digestion with PpuMI and SnaBI. These two fragments (representing
nucleotides 193-4498 of pAV2) were ligated into a tgLS(+)HyTK
retroviral vector (S. D. Lupton et al., Molecular and Cellular
Biology, 11: 3374-3378, 1991) in a four-way ligation that also
included a StuI-BstEII fragment of tgLS(+)HyTK and a BstEI-StuI
fragment of tgLS(+)HyTK to which a BglII linker had been attached
at the StuI end. This ligation generated tgLS(+)HyTK-repcap.
Subsequently, a BglII-ClaI fragment from tgLS(+)HyTK-repcap,
including AAV rep and cap genes transcriptionally linked to the
native p5, p19 and p40 promoters and followed by the AAV2
polyadenylation signal, was isolated and cloned into the BamHI and
ClaI sites of pSP72 (Promega).
3. Construction of p5repcapDHFR
[0103] Expression plasmid p5repcapDHFR was constructed for the
purpose of producing an integrated packaging line including the
construct p5repcap (Example 1, section 2) and a modified
dihydrofolate reductase gene (DHFR) as a selectable marker.
Specifically, p5repcap (Example 1, section 2) was linearized at a
PvuII site located just upstream of the rep gene, and blunt-end
ligated to a 1.8 kb fragment of pFR400 (Simonsen et al. (1983)
Proc. Natl. Acad. Sci. USA 80:2495-2499). This pFR400 fragment
comprises a modified DHFR gene, with a reduced affinity for
methotrexate (Mtx), transcriptionally linked to the SV40 early
promoter and followed by the polyadenylation site from the
Hepatitis B virus (HBV) surface antigen gene. The pFR400 fragment
was prepared by first digesting with SalI, followed by a four base
pair fill-in (to generate a blunt end) and subsequent PvuII
digestion and gel purification. The resulting construct,
p5repcapDHFR (FIG. 4), contains a DHFR gene whose transcription is
regulated by an upstream SV40 early promoter and a downstream
Hepatitis B Virus polyadenylation site. Immediately downstream of
this DHFR transcriptional cassette lie the AAV rep and cap genes,
followed by an AAV polyadenylation site.
4. Addition of P1 to a Repcap-Containing Plasmid: Construction of
P1RCD
[0104] A P1 element (Example 1, section 1) was then incorporated
into expression plasmid p5repcapDHFR (Example 1, section 3). In the
construction of the plasmid, "P1RCD", containing this packaging
cassette, the P1 element was inserted downstream of the AAV
polyadenylation signal in p5repcapDHFR in an orientation such that
replication initiating from the P1 element proceeds first into the
cap gene and then into the rep gene (i.e., replication initiates at
the 3' --OH of the TRS on the anti-sense strand and proceeds in a
5'-to-3' direction towards the cap gene). To facilitate insertion
of the P1 element into p5repcapDHFR, a pair of oligonucleotides was
synthesized which include the P1 sequence flanked by ends
compatible with a BglII restriction site (see sequences below, SEQ
ID NOs. 3 and 4). The pair was annealed, then ligated to
p5repcapDHFR previously linearized at a BglII site located just
downstream of the AAV polyadenylation site (Example 1, section 3,
nucleotide 6217). A clone named P1RCD was selected, containing a P1
insert in an orientation such that replication initiated at P1
proceeds in the direction of the cap and rep genes (FIG. 5). This
vector contains no AAV ITR sequences. TABLE-US-00002 P1
Oligonucleotide pair: SEQ ID NO:3 RB Motif 5'
GATCACTAGTACCGCCCGCCCGCCCAGCGAGCGAGCGAGCGCCGAGCCCCAACCGCCGCCACCACCCGCCC-
GA 3'
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||-
|| 3'
TGATCATGGCGGGCGGGCGGGTCGCTCGCTCGCTCGCGGCTCGGGGTTGGCGGCGGTGGTGGGCGGG-
CTCTAGA 5' SEQ ID NO:4 TRS
5. Construction of rAAV Vector ACAPSN
[0105] The plasmid ACAPSN was constructed according to Lynch et al.
(1997) Circ. Res. 80: 497-505 and PCT Publication WO 97/32990, as
follows. The ITR sequences and plasmid backbone were derived from
AAV-CFTR. Afione et al. (1996) J. Virol. 70:3235-3241. Briefly, the
AAV-CFTR vector was digested with XhoI and SnaBI and the ITRs and
plasmid backbone were gel isolated. An XhoI to SnaBI fragment
containing a portion of the CMV promoter (nucleotides -671 to -464)
[See, e.g., Boshart, et al., Cell, 41: 521-530 (1985)] was gel
isolated and ligated to the ITR plasmid backbone fragment derived
from AAV-CFTR to generate "pAAV-CMV (SnaBI)." Next, an SpeI to
SnaBI fragment containing the synthetic polyadenylation signal was
inserted into SpeI/SnaBI digested pAAV-CMV (SnaB1) to generate
"pAAV-CMV (SpeI)-spA." The pAAV-CMV (SpeI)-spA vector contains
nucleotides -671 to -584 of the CMV promoter. Next, the human
placental alkaline phosphatase cDNA sequence linked to the Simian
virus 40 promoter driving the E. coli neomycin gene was isolated
from LAPSN [See, e.g., Clowes et al., 1994, J. Clin. Invest.
93:644-651] as an SpeI to NheI fragment and inserted into pAAV-CMV
(SpeI)-spA (which had been linearized with SpeI) to create
"pAAV-APSN." An SpeI to NheI fragment containing CMV promoter
nucleotides -585 to +71 was inserted into SpeI-linearized PAAV-APSN
to generate vector "ACAPSN."
6. Production of Packaging Cell Lines Containing P1RCD
[0106] Polyclonal cell lines with an integrated AAV packaging
cassette containing the P1 element (P1RCD) were produced by
electroporation of HeLa cells. Specifically, 4.times.10.sup.6 HeLa
cells were electroporated with 12 .mu.g DNA (P1RCD) that had been
linearized with PvuII restriction endonuclease, which cleaves just
upstream of the SV40 promoter-DHFR gene cassette. The cells were
electroporated in serum free DMEM using a BioRad Gene Pulser at
0.25 Volts and 960 .mu.F. After electroporation, cells were
resuspended in Dulbecco's Modified Eagles medium, 10% fetal bovine
serum, with 1% penicillin and streptomycin (DMEM complete) and
allowed to recover at 37.degree. C. in a humidified atmosphere of
10% CO.sub.2. After 24 hours, cells were subjected to selection in
complete medium containing 500 nM methotrexate.
7. Production of P1RCD Clonal Cell Lines
[0107] P1RCD polyclonal cells were plated in 96-well plates at a
density of 1, 0.3, and 0.1 cell per well in DMEM containing 10%
dialyzed fetal bovine serum, 1% penicillin, streptomycin, and
L-glutamine plus 500 nM methotrexate. Wells were visually inspected
for cell growth and the presence of single colonies. Clones were
expanded from 96-well plates with 15 or fewer positive wells per
plate and from wells containing single colonies. Cells were
maintained under selection of 500 nM methotrexate in DMEM
containing 10% dialyzed serum until individual clones were frozen.
Clones were screened for the presence of the P1RCD construct.
Positive clonal cell lines were frozen and stored in liquid
nitrogen. The C29 clonal cell line containing the P1RCD construct
was chosen for subsequent experiments.
8. Production of Producer Cell Lines P1/ACAPSN and P1/ALinBg
[0108] Producer cell line P1/ACAPSN was generated by
electroporating P1RCD C29 packaging cells in an analogous manner as
the P1RCD packaging line above. Specifically, 4.times.10.sup.6
P1RCD C29 cells were electroporated with 10 .mu.g of tgACAPSN DNA
that had been linearized with Xmn I endonuclease. Electroporation
conditions are described in Example 1, section 6. After
electroporation, the cells were resuspended in DMEM complete and
allowed to recover at 37.degree. C. for 24 hours. Cells were then
subjected to selection in complete media containing 1 mg/ml G418.
Clones of P1/ACAPSN were selected and expanded in the manner
described above (Example 1, section 7) using 1 mg/ml G418 as
selection media. The P1/ACAPSN C19 cell line was chosen for
subsequent experiments. Clones were screened for the ability to
produce ACAPSN virions according to Example 2.
[0109] P1/ALinBg clones were produced in an analogous manner by
electroporating P1RCD C29 cells with ALinBg DNA.
Example 2
P1 Element Promotes Encapsidation of Operably Linked Gene into AAV
Particles
1. Production of Virions
[0110] C29 cells (Example 1, section 7) were seeded at a density of
5.times.10.sup.6 cells in a T225 cm.sup.2 flask one day prior to
infection with adenovirus (Ad). Four replicate flasks were seeded.
Twenty-four hours later, one flask of cells was treated with
trypsin and the number of cells counted. The remaining three flasks
of cells were infected with Ad at a multiplicity of infection of
10. Seventy-two hours later cells were collected by centrifugation
and resuspended to a concentration of 5.times.10.sup.6 cells/mL in
50 mM TRIS, pH 8.0, 5 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol (TMEG).
Cells were subjected to repeated freeze/thaw (-70.degree.
C./37.degree. C.) cycles and sonication (4.times.15 sec bursts).
After confirmation that greater than 95% of the cells were lysed,
cell debris was removed by low speed centrifugation. The resulting
cleared lysates were examined for the presence of encapsidated
P1RCD DNA sequences.
2. DRP Slot-Blot Analysis
[0111] Encapsidated DNA sequences were examined by DNA
hybridization following DNase treatment of cleared lysates. A
number of radiolabeled probes were generated which spanned the
P1RCD construct: cap; rep-cap; DHFR#1 (DHFR gene and hepatitis B
polyadenylation signal); and DHFR #2 (DHFR coding sequences only).
The number of DNase Resistant Particles (DRP) was quantitated by
comparison to a standard curve included on each slot-blot. P1RCD
plasmid DNA was used to generate standards.
[0112] DNase resistant, i.e. encapsidated, DNA sequences were
detected in cleared lysates generated from C29 cells with each of
the P1RCD probes, as shown in Table 1, below. In general, the
number of DNase Resistant Particles was on the order of
1.times.10.sup.10/mL. This level of encapsidation is comparable to
that typically seen with ITR-mediated packaging of AAV vector
genomes. TABLE-US-00003 TABLE 1 Probe DRP/mL rep-cap 1 .times.
10.sup.10 cap 1 .times. 10.sup.10 DHFR #1 1.3 .times. 10.sup.10
DHFR #2 1.3 .times. 10.sup.10
Example 3
Characterization of the P1 Encapsidation Element
1. The P1 Encapsidation Element Is Included in the Encapsidated
DNA
[0113] DNase resistant, i.e. encapsidated, DNA sequences were
detected in cleared lysates generated from C29 cells using a P1
probe. Oligonucleotides comprising the P1 element were synthesized,
annealed and end-labeled. Similar numbers of virions were detected
with the P1 probe (2.times.10.sup.10 DRP/mL) as previously detected
with the rep-cap, cap and DHFR probes. This indicates that the P1
encapsidation element is included in the encapsidated DNA
sequences.
2. P1 Encapsidation Element Promotes Encapsidation of Sense and
Anti-Sense DNA Strands at an Equal Ratio.
[0114] Duplicate slot-blots of DNase-treated C29 cleared lysate
were individually hybridized with oligonucleotide probes
representing the 5' to 3' and 3' to 5' sequences of the P1 element.
Titers of DRPs observed with the sense and anti-sense P1 probes
were 2.6.times.10.sup.10 and 1.3.times.10.sup.10 DRP/mL,
respectively. It appears that the P1 encapsidation element directs
encapsidation of DNA strands of either polarity at equal
frequency.
3. P1 Encapsidation Element Promotes Packaging in a Vector Producer
Cell Line in the Presence of ITR Sequences
[0115] Slot-blots of DNase treated P1/ACAPSN C19 cleared lysate
were hybridized with the cap, DHFR#1 and DHFR#2 probes described in
Example 2, section 2, above. The number of ACAPSN vector particles
present was also determined using a CMV probe. The results are
shown in Table 2. "NA" indicates "not applicable" TABLE-US-00004
TABLE 2 DRP/mL DRP/mL Probe (P1 packaging) (ITR Packaging) cap 3
.times. 10.sup.9 NA DHFR #1 2.7 .times. 10.sup.9 NA DHFR #2 2.3
.times. 10.sup.9 NA CMV NA 1.3 .times. 10.sup.11
[0116] Both ITR- and P1-promoted encapsidation of DNA sequences
were observed in P1/ACAPSN C19 cleared lysate. The titer of
particles containing recombinant polynucleotides operably linked to
P1 (i.e., P1-directed encapsidation) was one-half log lower than
previously observed in the C29 clonal cell line, which lacks an
ITR-flanked ACAPSN vector cassette. These data demonstrate that the
P1 element can function as a packaging signal even in the presence
of a bona fida AAV ITR packaging signal.
4. Encapsidated DNA Sequences in Purified Recombinant Vector
Preparations from HeLa Cells Containing a P1 Element
[0117] Large-scale vector preparations were manufactured from the
P1 /ACAPSN C19 cell line and purified by CsCl ultra-centrifugation
and ion-exchange chromatography. Two independent lots of vector
were manufactured. In addition to the ACAPSN vector particles, the
purified preparations contained encapsidated DNase resistant
particles which contained recombinant polynucleotides operably
linked to P1.
[0118] Another P1 producer cell line was independently generated
from an AAV vector carrying the .beta.-galactosidase reporter gene
(ALinBg). Vector preparations manufactured from the P1/AlinBg
producer cell line also contained DNAse resistant particles
containing recombinant polynucleotides operably linked to P1, in
addition to ALinBg vector particles.
[0119] Southern Analysis
[0120] The P1-encapsidated DNA was examined by Southern blot
analysis. Purified virions from the P1/ACAPSN and P1/ALiNBg cell
lines were lysed and the encapsidated DNA fractionated by
electrophoresis in alkaline gels. A predominant band of
approximately 4.7 kb in size was observed in all vector lots when
hybridized with a rep-cap probe, as shown in FIG. 6. This suggests
that the predominant DNA species packaged using the P1 packaging
signal are similar in size to the wild-type AAV genome length, i.e
the normal AAV packaging capacity.
[0121] Thus, using two different AAV vectors and two producer cell
lines independently derived from the C29 packaging cell line, we
have observed P1 promoted encapsidation of cis linked sequences.
Furthermore, P1-promoted packaging occurred in the presence of
ITR-mediated encapsidation of recombinant AAV vectors. The P1
packaged sequences were co-purified with rAAV virions by CsCl
isopycnic ultra-centrifugation and survived treatment with DNase
and heating to 54.degree. C. for 10 minutes. This indicates that P1
promotes encapsidation into AAV particles that are robust and can
be purified by methods used for recombinant AAV vectors.
Example 4
Construction and Encapsidation of a Recombinant Polynucleotide
Comprising a P1 Element Operably Linked to Coding Sequences for
CFTR
[0122] The region comprising AAV rep and cap genes is excised by
BglII restriction endonuclease digestion from P1RCD and the
fragment including P1 element and DHFR gene is isolated. A DNA
fragment encoding CFTR and having compatible restriction
endonuclease overhangs with the P1-containing fragment is isolated.
The P1-containing fragment is ligated to the DNA fragment encoding
CFTR, to produce a recombinant polynucleotide in which a P1 element
is operably linked to sequences encoding CFTR.
[0123] This recombinant polynucleotide is introduced into a
mammalian cell line producing AAV rep and cap gene products, and
subsequently the cell line is infected with Ad helper virus.
[0124] Cells are lysed and DRPs are measured in the cleared
lysates, as described above, then analyzed by slot blot
hybridization with probes which hybridize to the P1 element and to
CFTR-coding regions.
[0125] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be apparent to those skilled in the art
that certain changes and modifications will be practiced.
Therefore, the description and examples should not be construed as
limiting the scope of the invention, which is delineated by the
appended claims.
Sequence CWU 1
1
16 1 62 DNA Artificial Sequence P1 Encapsidation Element 1
cgggcgggtg gtggcggcgg ttggggctcg gcgctcgctc gctcgctggg cgggcgggcg
60 gt 62 2 62 DNA Artificial Sequence P1 Encapsidation Element 2
accgcccgcc cgcccagcga gcgagcgagc gccgagcccc aaccgccgcc accacccgcc
60 cg 62 3 73 DNA Artificial Sequence P1 Oligonucleotide 3
gatcactagt accgcccgcc cgcccagcga gcgagcgagc gccgagcccc aaccgccgcc
60 accacccgcc cga 73 4 74 DNA Artificial Sequence P1
Oligonucleotide 4 agatctcggg cgggtggtgg cggcggttgg ggctcggcgc
tcgctcgctc gctgggcggg 60 cgggcggtac tagt 74 5 16 DNA Artificial
Sequence A non-AAV ITR encapsidation element 5 gcncgctcgc tcgctn 16
6 122 DNA Artificial Sequence A non-AAV ITR encapsidation element 6
ggttggnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn
60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnngcnc
gctcgctcgc 120 tn 122 7 42 DNA Artificial Sequence A non-AAV ITR
encapsidation element 7 ggttggnnnn nnnnnnnnnn nnnnnngcnc gctcgctcgc
tn 42 8 114 DNA Artificial Sequence P1 base pair smaI fragment 8
cccggggcgg gcgggcgggc gggtggtggc ggcggttggg gctcggcgct cgctcgctcg
60 ctgggcgggc gggcggtgcg atgtccggag aggatggccg gcggctggcc cggg 114
9 32 DNA Artificial Sequence Subfragment of the P1 base pair
fragment 9 cgggcgggtg gtggcggcgg ttggggctcg gc 32 10 30 DNA
Artificial Sequence Subfragment of the P1 base pair fragment 10
gctcgctcgc tcgctgggcg ggcgggcggt 30 11 67 DNA Artificial Sequence
AAV2 ITR 11 aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg
ctcactgagg 60 ccgcccc 67 12 59 DNA Artificial Sequence AAV1 ITR 12
ttacccctag tgatggagtt gcccactccc tctctgcgcg ctcgctcgct cggtggggc 59
13 62 DNA Artificial Sequence AAV3 ITR 13 gccatacctc tagtgatgga
gttggccact ccctctatgc gcactcgctc gctcggtggg 60 gc 62 14 62 DNA
Artificial Sequence AAV4 ITR 14 gggcaaacct agatgatgga gttggccact
ccctctatgc gcgctcgctc actcactcgg 60 cc 62 15 76 DNA Artificial
Sequence AAV5 ITR 15 acaaaacctc cttgcttgag agtgtggcac tctcccccct
gtcgcgttcg ctcgctcgct 60 ggctcgtttg gggggg 76 16 60 DNA Artificial
Sequence AAV6 ITR 16 ttacccctag tgatggagtt gcccactccc tctctgcgcg
ctcgctcgct cactgaggcc 60
* * * * *
References