U.S. patent application number 11/334885 was filed with the patent office on 2006-07-27 for detection of fungal pathogens using the polymerase chain reaction.
This patent application is currently assigned to Syngenta Participations AG. Invention is credited to Charles Jason Barnett, James Joseph Beck, Christy Violet Perry.
Application Number | 20060166246 11/334885 |
Document ID | / |
Family ID | 26956887 |
Filed Date | 2006-07-27 |
United States Patent
Application |
20060166246 |
Kind Code |
A1 |
Barnett; Charles Jason ; et
al. |
July 27, 2006 |
Detection of fungal pathogens using the polymerase chain
reaction
Abstract
The present invention relates to the use of primers in
polymerase chain reaction assays for the detection of fungal
pathogens Colletotrichum acutatum, Ateniaria spp., and Cladosporium
carpophilum. Specific primers are identified as being useful for
the identification of fungal isolates using PCR based techniques.
Also described are novel extraction buffer solutions for use in
isolating DNA from an organism, methods of extracting DNA from
tissue, and methods of performing PCR analysis on DNA extracted
from tissue.
Inventors: |
Barnett; Charles Jason;
(Derwood, MD) ; Beck; James Joseph; (Research
Triangle Park, NC) ; Perry; Christy Violet; (Apex,
NC) |
Correspondence
Address: |
SYNGENTA BIOTECHNOLOGY, INC.;PATENT DEPARTMENT
3054 CORNWALLIS ROAD
P.O. BOX 12257
RESEARCH TRIANGLE PARK
NC
27709-2257
US
|
Assignee: |
Syngenta Participations AG
|
Family ID: |
26956887 |
Appl. No.: |
11/334885 |
Filed: |
February 15, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10623880 |
Jul 21, 2003 |
7060816 |
|
|
11334885 |
Feb 15, 2006 |
|
|
|
09939379 |
Aug 24, 2001 |
6645720 |
|
|
10623880 |
Jul 21, 2003 |
|
|
|
60274540 |
Mar 9, 2001 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
536/24.1 |
Current CPC
Class: |
C12Q 1/6895
20130101 |
Class at
Publication: |
435/006 ;
536/024.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04 |
Claims
1. An oligonucleotide primer consisting of SEQ ID NO: 16 or 12.
2. A pair of oligonucleotide primers, wherein said pair consists of
said primer of claim 1.
3. A pair of oligonucleotide primers, consisting of: a) SEQ ID
NO:16 and SEQ ID NO:12;.
4-7. (canceled)
8. A method for the detection of Alternaria spp., comprising the
steps of: (a) isolating DNA from a plant tissue infected with a
pathogen; (b) subjecting said DNA to polymerase chain reaction
amplification using at least one primer according to claim 1; and
(c) detecting Alternaria spp. by visualizing the product or
products of said polymerase chain reaction amplification.
9. (canceled)
10. A method for the detection of Alternaria spp., comprising the
steps of: (a) isolating DNA from a plant tissue infected with
Alternaria spp.; (b) amplifying a part of the Internal Transcribed
Spacer sequence of Alternaria spp. using said DNA as a template in
a polymerase chain reaction with a pair of primers according to
claim 2; and (c) detecting Alternaria spp. by visualizing the
amplified part of the Internal Transcribed Spacer sequence.
11. (canceled)
12. The method of claim 10, wherein said pair of primers is
according to claim 3.
13-16. (canceled)
17. A diagnostic kit used in detecting a fungal pathogen,
comprising the primer of claim 1.
18. A diagnostic kit used in detecting a fungal pathogen,
comprising the pair of primers of claim 2.
19. A diagnostic kit used in detecting a fungal pathogen,
comprising the pair of primers of claim 3.
46. (canceled)
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the use of primers in
polymerase chain reaction assays for the detection of stone fruit
and nut, in particular almond pathogens Colletotrichum acutatum,
Alternaria spp., and Cladosporium carpophilum. The use of these
primers enables the detection of specific isolates of fungal
pathogens and the monitoring of disease development in plant
populations. The present invention also relates to novel extraction
buffer solutions, methods of extracting DNA from tissue, and
methods of performing PCR analysis on DNA extracted from
tissue.
BACKGROUND OF THE INVENTION
[0002] Diseases in plants cause considerable crop loss from year to
year resulting both in economic deprivation to farmers and, in many
parts of the world, to shortfalls in the nutritional provision for
local populations. The widespread use of fungicides has provided
considerable security against plant pathogen attack. However,
despite $1 billion worth of expenditure on fungicides, worldwide
crop losses amounted to approximately 10% of crop value in 1981
(James, 1981; Seed Sci. & Technol. 9: 679-685).
[0003] The severity of the destructive process of disease depends
on the aggressiveness of the pathogen and the response of the host.
One aim of most plant breeding programs is to increase the
resistance of host plants to disease. Typically, different races of
pathogens interact with different varieties of the same crop
species differentially, and many sources of host resistance only
protect against specific pathogen races. Furthermore, some pathogen
races show early signs of disease symptoms, but cause little damage
to the crop. Jones and Clifford (1983; Cereal Diseases, John Wiley)
report that virulent forms of the pathogen are expected to emerge
in the pathogen population in response to the introduction of
resistance into host cultivars and that it is therefore necessary
to monitor pathogen populations. In addition, there are several
documented cases of the evolution of fungal strains that are
resistant to particular fungicides. As early as 1981, Fletcher and
Wolfe (1981; Proc. 1981 Brit. Crop Prot. Conf.) contended that 24%
of the powdery mildew populations from spring barley and 53% from
winter barley showed considerable variation in response to the
fungicide triadimenol and that the distribution of these
populations varied between varieties, with the most susceptible
variety also giving the highest incidence of less susceptible
types. Similar variation in the sensitivity of fungi to fungicides
As been documented for wheat mildew (also to triadimenol), Botrytis
(to benomyl), Pyrerpophora (to organomercury), Pseudocercosporella
(to MBC-type fungicides) and Myccasphaerella fijiensis to triazoles
to mention just a few (Jones and Clifford; Cereal Diseases, John
Wiley, 1983).
[0004] Commercial almond growers are faced with a number of fungi
that infect their crops in diverse ways. The impact of these
pathogens on tree growth depends on a number of factors, and the
cause is not immediately apparent from the symptoms a diseased tree
may present. Vascular pathogens invade and plug the xylem vessels,
thereby halting movement of water and nutrients up from roots
(Integrated Pest Management for Almonds, U. California Division of
Agriculture and Natural resources publication 3308 (1985)).
Symptoms often reflect a partial or complete cut-off from food or
water as vascular tissues are closed. Thus, symptoms of crown and
root rots of almond, as well as wilts caused by pathogens infecting
leaf and branch tissues, may appear very similar to one another;
and similar to the consequences of environmental conditions such as
the availability of nutrients and water and factors affecting their
uptake.
[0005] Some pathogens cause infections that are limited to
branches, foliage, and fruit. Several of the fungi and bacteria
that cause disease in almonds have been found to infect orchards
during the fall months and over-winter in host tissues. During the
spring, they produce localized lesions or larger infections that
become evident after environmental conditions such as a recent rain
or irrigation promote the growth of the pathogens.
[0006] The same pathogens that cause economic problems in almond
orchard management also affect other crops. For instance,
Cladosporium carpophilum has a host range that extends over stone
fruits. For example, in addition to the scabs it causes in almond
crops, C. carpophilum also causes scabs in peaches, nectarines,
apricots, plums, and cherries (Compendium of Stone Fruit Diseases,
Ogawa, J. M.; Zehr, E. I.; Bird, G. W.; Ritchie, D. F.; Uriu, K.;
Uyemoto, J. K. eds., p. 11 (1995 APS Press, St. Paul, Minn.)).
[0007] Alternaria spp. has been documented as causing infection on
many economically important crops. To date, it has been reported to
cause alternaria blight of peas, and alternaria leaf spots have
been reported on peanuts, almonds, corn, cotton, and in all soybean
growing areas of the world (Compendium of Soybean Diseases,
4.sup.th Ed. Hartman, G. L.; Sinclair, J. B.; Rupe, J. C. eds., pp.
12-13 (1999, APS Press, St. Paul, Minn.)); (Compendium of Cotton
Diseases, Watkins, G. M. ed., p. 28 (1981, APS Press, St. Paul,
Minn.); Compendium of Pea Diseases, Hagedorn, D. J., ed., p. 15
(1984, APS Press, St. Paul, Minn.)); (Compendium of Peanut
Diseases, Porter, D. M.; Smith, D. H.; Rodriguez-Kabana, R. eds.
Pp. 13 (1984, APS Press, St. Paul, Minn.); (Compendium of Stone
Fruit Diseases, Ogawa, J. M.; Zehr, E. I.; Bird, G. W.; Ritchie, D.
F.; Uriu, K.; Uyemoto, J. K. eds., p. 11 (1995 APS Press, St. Paul,
Minn.)); and Compendium of Corn Diseases, 3.sup.rd Ed. White, D.
G., ed., p. 25 (1999, APS Press, St. Paul, Minn.)). Altenzaria spp.
is responsible for widespread leaf and pod spots on beans grown in
Brazil, Cananda, Costa Rica, Colombia, Chile, East Africa, England,
Mexico, the United States, and Venezuela (Compendium of Bean
Diseases, Hall, R. ed., p. 14 (1991, APS Press, St. Paul, MN)).
Alternaria spp. also form lesions on potatoes and the leaves of
other solanaceous crops; (Compendium of Potato Diseases, Hooker, W.
J. ed., p. 44 (1981, APS Press, St. Paul, Minn.)) and appear as
secondary infections on sugar beet leaves (Compendium of Beet
Diseases and Insects, Whitney, E. D., Duffus, J. E. eds., p. 11
(1991 APS Press, St. Paul, Minn.)). It causes grain molds in
sorghum (Compendium of Sorghum Diseases, Frederiksen, R. A. ed., p.
36 (1986 APS Press, St. Paul, N)) and is one cause of black mold
rot of tomato (Compendium of Tomato Diseases, Jones, J. B.; Jones,
J. P.; Stall, R. E.; Zitter, T. A., eds., p. 46 (1991 APS Press,
St. Paul, Minn.)). Alternaria spp. also causes fruit spot of
papaya, a major disease in orchards located in dry areas and in
mangos (Compendium of Tropical Fruit Diseases, Ploetz, R. C.;
Zentmyer, G. A.; Nishijima, W. T.; Rohrbach, K. G.; Ohr, H. D.,
eds., pp. 34 and 58 (1994 APS Press, St. Paul, Minn.)).
[0008] Colletotrichum acutatum has been reported to infect a large
number of fruit crops including avocado, strawberry, almond, apple,
and peach. C. acutatum causes post-harvest fruit diseases in
avocado and mango. C. acutatum is also known to cause both
post-bloom fruit drop and key lime anthracnose in citrus crops (see
Freeman, S. et al., 1998, Plant Disease Vol. 82, No. 6, pp.
596-605).
[0009] In view of the above, there is a real need for the
development of technology that will allow the identification of
specific races of pathogenic fungi early in the infection process.
By identifying the specific race of a pathogen before disease
symptoms become evident in the crop stand, the agriculturist can
assess the likely effects of further development of the pathogen in
the crop variety in which it has been identified and can choose an
appropriate fungicide if such application is deemed necessary.
SUMMARY OF THE INVENTION
[0010] The present invention is drawn to methods of identification
of different pathotypes of plant pathogenic fungi. The invention
provides Internal Transcribed Spacer (ITS) DNA sequences that show
variability between different fungal pathotypes. Such DNA sequences
are useful in the method of the invention as they can be used to
derive primers for use in polymerase chain reaction (PCR)-based
diagnostic assays. These primers generate unique fragments in PCR
reactions in which the DNA template is provided by specific fungal
pathotypes and can thus be used to identify the presence or absence
of specific pathotypes in host plant material before the onset of
disease symptoms.
[0011] In a preferred embodiment, the invention provides
ITS-derived diagnostic primers for the detection of Colletotrichum
acutatum, Alternaria spp., and Cladosporium carpophilum.
[0012] This invention provides the possibility of assessing
potential damage in a specific crop variety/pathogen strain
relationship and of utilizing judiciously the diverse armory of
fungicides that is available. Furthermore, the invention can be
used to provide detailed information on the development and spread
of specific pathogen races over extended geographical areas. The
invention provides a method of detection that is especially
suitable for diseases with a long latent phase.
[0013] Kits useful in the practice of the invention are also
provided. The kits find particular use in the identification of
Colletotrichum acutatum, Alternaria spp., and Cladosporium
carpophilum.
[0014] The invention also provides methods for preparing an extract
of DNA from tissue using novel DNA extraction buffer. The invention
further provides for methods for performing PCR analysis on DNA
extracted from tissue using the novel DNA extraction buffer and
methods of preparing an extract of DNA.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
SEQ-ID-NO: 1 Oligonucleotide Primer ITS1
SEQ-ID-NO: 2 Oligonucleotide Primer ITS2
SEQ-ID-NO: 3 Oligonucleotide Primer ITS3
SEQ-ID-NO: 4 oligonucleotide Primer ITS4
SEQ-ID-NO: 5 Oligonucleotide Primer FORWARD
SEQ-ID-NO: 6 Oligonucleotide Primer REVERSE
SEQ-ID-NO: 7 Oligonucleotide Primer CaINT-1
SEQ-ID-NO: 8 Oligonucleotide Primer CaINT-2
SEQ-ID-NO: 9 Oligonucleotide Primer CaInt2
SEQ-ID-NO: 10 Oligonucleotide Primer JB677
SEQ-ID-NO: 11 Oligonucleotide Primer JB678
SEQ-ID-NO: 12 Oligonucleotide Primer JB679
SEQ-ID-NO: 13 Oligonucleotide Primer Ala1-1
SEQ-ID-NO: 14 Oligonucleotide Primer Ala1-2
SEQ-ID-NO: 15 Oligonucleotide Primer Ala1-3
SEQ-ID-NO: 16 Oligonucleotide Primer Ala1-4
SEQ-ID-NO: 17 Oligonucleotide Primer Ala1-5
SEQ-ID-NO: 18 Oligonucleotide Primer Alat-6
SEQ-ID-NO: 19 Oligonucleotide Primer Alt1
SEQ-ID-NO: 20 Oligonucleotide Primer Alt2
SEQ-ID-NO: 21 Oligonucleotide Primer Vcarp1
SEQ-ID-NO: 22 Oligonucleotide Primer Vcarp2
SEQ-ID-NO: 23 Oligonucleotide Primer Vcarp3
SEQ-ID-NO: 24 Oligonucleotide Primer Vcarp4
SEQ-ID-NO: 25 Oligonucleotide Primer Vcarp5
SEQ-ID-NO: 26 Oligonucleotide Primer Vcarp6
SEQ-ID-NO: 27 Oligonucleotide Primer Vcarp7
SEQ-ID-NO: 28 Oligonucleotide Primer JB677.1
SEQ-ID-NO: 29 Oligonucleotide Primer JB677.2
SEQ-ID-NO: 30 Oligonucleotide Primer JB677.3
DETAILED DESCRIPTION OF THE INVENTION
[0015] The present invention provides unique DNA sequences that are
useful in identifying different pathotypes of plant pathogenic
fungi. Particularly, the DNA sequences can be used as primers in
PCR-based analysis for the identification of fungal pathotypes. The
DNA sequences of the invention include the Internal Transcribed
Spacer (ITS) sequences of the ribosomal RNA gene regions of
particular fungal pathogens as well as primers derived from these
regions that are capable of identifying the particular pathogen.
ITS DNA sequences from different pathotypes within a pathogen
species or genus, which vary between the different members of the
species or genus, can be used to identify those specific
members.
[0016] Biomedical researchers have used PCR-based techniques for
some time and with moderate success to detect pathogens in infected
animal tissues. Only recently, however, has this technique been
applied to detect plant pathogens. The presence of Gaumannomyces
graminis in infected wheat has been detected using PCR of sequences
specific to the pathogen mitochondrial genome (Schlesser et al.,
1991; Applied and Environ. Microbiol. 57: 553-556), and random
amplified polymorphic DNA (i.e. RAPD) markers were able to
distinguish numerous races of Gremmeniella abietina, the causal
agent of sclerodrerris canker in conifers. U.S. Pat. No. 5,585,238
(herein incorporated by reference in its entirety) describes
primers derived from the ITS sequences of the ribosomal RNA gene
region of strains of Septoria, Pseudocercosporella, and
Mycosphaerella and their use in the identification of these fungal
isolates using PCR-based techniques. In addition, U.S. Pat. No.
5,955,274 (herein incorporated by reference in its entirety)
describes primers derived from the ITS sequences of the ribosomal
RNA gene region of strains of Fusarium and their use in the
identification of these fungal isolates using PCR-based techniques.
Furthermore, U.S. Pat. No. 5,800,997 (herein incorporated by
reference in its entirety) describes primers derived from the ITS
sequences of the ribosomal RNA gene region of strains of
Cercospora, Helminthosporium, Kabatiella, and Puccinia and their
use in the identification of these fungal isolates using PCR-based
techniques.
[0017] Ribosomal genes are suitable for use as molecular probe
targets because of their high copy number. Despite the high
conservation between mature rRNA sequences, the non-transcribed and
transcribed spacer sequences are usually poorly conserved and are
thus suitable as target sequences for the detection of recent
evolutionary divergence. Fungal rRNA genes are organized in units,
each of which encodes three mature subunits of 18S (small subunit),
5.8S, and 28S (large subunit). These subunits are separated by two
Internal Transcribed Spacers, ITS1 and ITS2, of around 300 bp
(White et al., 1990; In: PCR Protocols; Eds.: Innes et al.; pages
315-322). In addition, the transcriptional units are
[0018] The present invention provides, a method for the detection
of a fungal pathogen, comprising the steps of: [0019] (a) isolating
DNA from a plant tissue infected with a pathogen; [0020] (b)
subjecting said DNA to polymerase chain reaction amplification
using at least one primer according to SEQ ID NO: 1-4 and 7-30; and
[0021] (c) detecting said fungal pathogen by visualizing the
product or products of said polymerase chain reaction
amplification.
[0022] In a preferred embodiment, the primer is at least one
according to SEQ ID NO: 10-30.
[0023] In another embodiment, the method for detection is used when
the fungal pathogen is Colletotrichum acutatum, Altenaria spp., and
Cladosporium carpophilum.
[0024] In another embodiment, the invention provides a method for
the detection of a fungal pathogen, comprising the steps of: [0025]
(a) isolating DNA from a plant tissue infected with said fungal
pathogen; [0026] (b) amplifying a part of the Internal Transcribed
Spacer sequence of said fungal pathogen using said DNA as a
template in a polymerase chain reaction with a pair of primers
wherein the pair comprises or consists of at least one primer of
SEQ ID NO:1-4 or 7-10. In a preferred embodiment, the pair consists
of at least one primer of SEQ ID NO:10-30; and [0027] (c) detecting
said fungal pathogen by visualizing the amplified part of the
Internal Transcribed Spacer sequence.
[0028] In a preferred embodiment, the method detects a fungal
pathogen, wherein said fungal pathogen is Colletotrichum acutatum,
Altenaria spp., and Cladosporium carpophilum. In yet other
embodiments, the method of detection uses a pair of primers,
wherein said pair of primers is selected from the group consisting
of: SEQ ID NO: 30 and SEQ ID NO:4; SEQ ID NO:27 and SEQ ID NO:4;
SEQ ID NO:16 and SEQ ID NO:12; SEQ ID NO:16 and SEQ ID NO:18; SEQ
ID NO:17 and SEQ ID NO:12; SEQ ID NO:1 and SEQ ID NO:27; SEQ ID
NO:24 and SEQ ID NO:25; and SEQ ID NO:21 and SEQ ID NO:4.
[0029] In preferred embodiments, the pair of oligonucleotide
primers consists of SEQ ID NO:16 and SEQ ID NO:12; or SEQ ID NO:16
and 18; or SEQ ID NO:17 and SEQ ID NO:12; or SEQ ID NO:24 and SEQ
ID NO:25.
[0030] The present invention also provides a method for performing
PCR analysis on DNA extracted from tissue, comprising the steps
of:
(a) taking a plurality of random tissue samples from an organism
population;
(b) adding the extraction buffer described in Example 2, to the
tissue samples;
(c) macerating the tissue samples and extraction buffer to form an
extract;
(d) removing the extract from the macerated tissue and buffer;
and
(e) performing PCR analysis on the extract.
[0031] In another embodiment, the method further comprises the step
of boiling the extract after removing it from the macerated tissue
and buffer.
[0032] In yet another embodiment, the method further comprises the
step of diluting the extract.
[0033] In a preferred embodiment, the method uses an organism
population that is a plant population. In more preferred
embodiments, the method uses tissue samples selected from leaves,
stems, roots, blossoms, immature flowers, peduncles, hulls, fruits,
immature fruits, or woody tissue.
[0034] In another preferred embodiment, the method uses the
extraction buffer comprising: 100 mM Tris, pH 8.0; 1.4 M NaCl; 20
mM EDTA; 2% w/v CTAB; 2% w/v PVP and 0.1% w/v ascorbic acid.
[0035] The present invention lends itself readily to the
preparation of "kits" containing the elements necessary to carry
out the process. Such a kit may comprise a carrier being
compartmentalized to receive in close confinement therein one or
more container, such as tubes or vials. One of the containers may
contain unlabeled or detectably labeled DNA primers. The labeled
DNA primers may be present in lyophilized form or in an appropriate
buffer as necessary. One or more containers may contain one or more
enzymes or reagents to be utilized in PCR reactions. These enzymes
may be present by themselves or in admixtures, in lyophilized form
or in appropriate buffers.
[0036] Finally, the kit may contain all of the additional elements
necessary to carry out the technique of the invention, such as
buffers, extraction reagents, enzymes, pipettes, plates, nucleic
acids, nucleoside triphosphates, filter paper, gel materials,
transfer materials, autoradiography supplies, and the like.
[0037] In an embodiment of the invention, the diagnostic kit used
in detecting a fungal pathogen, comprises a primer of the present
invention as described above.
[0038] In yet another embodiment, the diagnostic kit used in
detecting a fungal pathogen, comprises a pair of primers of the
present invention as described above. The primers, methods and kits
of the present invention are useful for detecting the presence of
fungal pathogens in any plants or plant parts that are infected by
fungal pathogens. In particular, the present invention is useful
for detection of Colletotrichum acutatum, Alternaria spp., and
Cladosporium carpophilum. Examples of plants or plant tissues or
plant parts infected by these pathogens include, but are not
limited to, stone fruits, nuts, solanaceous plants such as tomato
and potato, peanuts, corn, sorghum, peas, papaya, avacado, apples,
and sugarbeets. Examples of stone fruits include, but are not
limited to peaches, nectarines, cherries, apricots and plums.
Examples of nut crops include, but are not limited to peanuts,
almonds, walnuts, cashews, hazelnuts, brazil nuts, etc.
[0039] The examples below show typical experimental protocols that
can be used in the selection of suitable primer sequences, the
testing of primers for selective and diagnostic efficacy, and the
use of such primers for disease and fungal isolate detection. Such
examples are provided by way of illustration and not by way of
limitation.
EXAMPLES
[0040] Standard recombinant DNA and molecular cloning techniques
used here are well known in the art and are described by J.
Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning: A
Laboratory manual, Cold Spring Harbor laboratory, Cold Spring
Harbor, N.Y. (1989) and by T. J. Silhavy, M. L. Berman, and L. W.
Enquist, Experiments with Gene Fusions, Cold Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M.
et al., Current Protocols in Molecular Biology, pub. by Greene
Publishing Assoc. and Wiley-Interscience (1987).
Example 1
Fungal Isolates and Genomic Fungal DNA Extraction
[0041] See Table 1 for a listing of the fungal isolates used and
their source. Fungi are grown on PDA (Potato Dextrose Agar) plates.
Cultures are incubated for up to 10 days at 28.degree. C. Mycelia
are ground in liquid nitrogen, and total genomic DNA is extracted
using the protocol of Lee and Taylor (1990; In: PCR Protocols: A
Guide to Methods and Applications; Eds.: Innes et al.; pages
282-287). TABLE-US-00001 TABLE 1 Source of Test Isolates Isolate
Source Isolation Geographic Origin Colletotrichum acutatum 26255
ATCC.sup.1 Tomato New Zealand Colletotrichum acutatum 42373
ATCC.sup.1 Mango Australia Colletotrichum acutatum 60468 ATCC.sup.1
Vaccinium New Zealand corymbosum Colletotrichum acutatum 66367
ATCC.sup.1 Strawberry Indiana, USA Colletotrichum acutatum 38689
ATCC.sup.1 Pinus -- f.sp. pinea radiata Colletotrichum 44228
ATCC.sup.1 Stylosanthes Australia gloeosporioides hamata cv. Verano
Colletotrichum 38237 ATCC.sup.1 Mango -- gloeosporioides
Cladosporium carpophilum 52935 ATCC.sup.1 Peach Georgia, USA
Cladosporium carpophilum BS-1 Jones.sup.2 Peach Michigan, USA
Cladosporium carpophilum BS-2 Jones.sup.2 Peach Michigan, USA
Cladosporium carpophilum BS-3 Jones.sup.2 Peach Michigan, USA
Cladosporium carpophilum BS-4 Jones.sup.2 Peach Michigan, USA
Cladosporium carpophilum BS-5 Jones.sup.2 Peach Michigan, USA
Cladosporium carpophilum BS-6 Jones.sup.2 Peach Michigan, USA
Alternaria alternata 56835 ATCC.sup.1 Wheat grain England
Alternaria alternata 34509 ATCC.sup.1 Apple Japan Alternaria
alternata 26294 ATCC.sup.1 Tobacco Maryland, USA Alternaria
alternata 60647 ATCC.sup.1 Tomato Greece f.sp. lycopersici
Alternaria alternata sensu lato Aa001 Pryor.sup.3 Almond --
Alternaria alternata sensu lato Aa002 Pryor.sup.3 Almond --
Alternaria alternata sensu lato Aa003 Pryor.sup.3 Almond --
Alternaria alternata sensu lato Aa004 Pryor.sup.3 Almond --
Alternaria alternata sensu lato Aa005 Pryor.sup.3 Almond --
Alternaria alternata sensu lato Aa006 Pryor.sup.3 Almond --
Alternaria sp. 2000#47 Novartis.sup.4 Almond California, USA
Alternaria brassicae 21-61-02 Pryor.sup.3 -- -- Alternaria
brassicola 2232 Pryor.sup.3 -- -- Alternaria radicina 96831
Pryor.sup.3 -- -- Alternaria petroselini 06-196 Pryor.sup.3 -- --
Alternaria dauci 36613 Pryor.sup.3 -- -- Alternaria porri 58175
Pryor.sup.3 -- -- Alternaria alternata P154 Pryor.sup.3 Pistachio
-- Alternaria tenuissima P59 Pryor.sup.3 Pistachio -- Alternaria
arborescens P67 Pryor.sup.3 Pistachio -- Alternaria infectoria P60
Pryor.sup.3 Pistachio -- Alternaria tenuissima 34-015 Pryor.sup.3
-- -- Alternaria arborescens 39-128 Pryor.sup.3 -- -- Alternaria
infectoria 27-193 Pryor.sup.3 -- -- Colletotrichum fragariae 26010
ATCC.sup.1 Bean Florida, USA Colletotrichum fragariae 58718
ATCC.sup.1 Strawberry Florida, USA Monilinia laxa 32671 ATCC.sup.1
Nectarine California, USA Monilinia fructicola 32670 ATCC.sup.1
Peach California, USA Whetzelinia sclerotiorum 46762 ATCC.sup.1
Cauliflower Australia Unknown 2000#69A1 Novartis.sup.4 Almond
California, USA Unknown 2000#105C Novartis.sup.4 Almond California,
USA Unknown 2000#106A(2P) Novartis.sup.4 Almond California, USA
.sup.1American Type Culture Collection; Rockville, MD, USA
.sup.2Jones, A. L.; Michigan State University, East Lansing, MI,
USA (Strains documented in Phytopathology (1999) 89: 100-108)
.sup.3Pryor, B.; University of California, Davis, CA, USA
.sup.4Novartis Agribusiness Biotechnology Research, Inc.; Research
Triangle Park, NC, USA
Example 2
DNA Extraction from Almond Tissues
[0042] DNA was extracted from almond leaves by using a bulk
maceration method with a modified version of the CTAB extraction
buffer (Wang et al., 1993, "PCR amplification from single seeds,
facilitating DNA marker-assisted breeding," Nucleic Acids Res.
21:2527). The bulk maceration method was used to isolate DNA from
several naturally infected tissues from the field. The potential
concentration ranges of the buffer ingredients of the modified CTAB
extraction buffer are as follows:
[0043] approximately 100 mM Tris, pH 8.0;
[0044] 0.2-2.0 M NaCl;
[0045] 1-200 mM ethylenediaminetetraacetic acid (EDTA);
[0046] 0.1-5% w/v hexadecyltrimethylammonium (CTAB);
[0047] 0.1-5% w/v polyvinylpyrolidine (PVP); and
[0048] 0.01-2% w/v ascorbic acid.
[0049] In other embodiments of the invention, the DNA extraction
buffer comprises 100 mM Tris, pH 8.0; or comprises 1.4 M NaCl; or
comprises 20 mM EDTA; or comprises 2% w/v CTAB; or comprises 2% w/v
PVP; or comprises 0.1% w/v ascorbic acid.
[0050] However, in the preferred embodiment of the bulk maceration
method, the following concentrations are used: 100 mM Tris, pH 8.0;
1.4 M NaCl; 20 mM EDTA; 2% w/v CTAB; 2% w/v PVP and 0.1% w/v
ascorbic acid.
[0051] The present invention provides a method for preparing an
extract of DNA from tissue, comprising the steps of:
(a) taking a plurality of random tissue samples from an organism
population;
(b) adding the DNA extraction buffer described above, to the tissue
samples;
(c) macerating the tissue samples and extraction buffer to form an
extract; and
(d) removing the extract from the macerated tissue and buffer.
[0052] In another embodiment, the method of extraction takes tissue
samples from a plant population. In yet another embodiment, the
tissue samples are selected from leaves, stems, roots, blossoms,
immature flowers, peduncles, hulls, fruits, immature fruits, or
woody tissue.
[0053] In a preferred embodiment the method of extraction uses the
extraction buffer comprising: 100 mM Tris, pH 8.0; 1.4 M NaCl; 20
mM EDTA; 2% w/v CTAB; 2% w/v PVP and 0.1% w/v ascorbic acid.
[0054] DNA is extracted from almond tissues as follows:
[0055] Bulk Maceration Method: [0056] (1) A sample consists of
almond tissue taken from trees suspected of disease within a given
orchard. [0057] (2) Samples are handled individually using a
different pair of gloves for each. Any implements used in preparing
the samples are washed with water and then with 70% EtOH between
each sample. [0058] (3) Samples are separated into subsamples for
testing according to tissue: [0059] A. Blossoms, immature flowers,
and peduncles. [0060] B. Hulls from last season's almonds (mummies)
and old crescents (immature fruit). Only the outer part of the
almond fruit that was once fleshy and can now be separated from the
shell of the nut is to be tested. [0061] C. Hulls from fresh
almonds and crescents from this season. Again, only the outer,
fleshy part of the fruit is tested. [0062] D. Woody tissue. [0063]
(4) The sample is placed in a Bioreba (Reinach, Switzerland) heavy
duty plastic bag (cat#490100). The plant tissue is weighed, plastic
bag with leaves minus the tare (weight of the plastic bag).
[0064] (5) A volume (mL) of well-mixed CTAB extraction buffer is
added per gram fresh weight of sample according to the following:
TABLE-US-00002 Tissue Volume/Weight A. Blossoms, peduncles 3 X B.
Hulls, old almond fruit 4 X C. Hulls, fresh almond fruit 2 X D.
Woody tissue 2 X
[0065] CTAB extraction buffer: (100 mM Tris, pH 8.0; 1.4 M NaCl; 20
mM ethylenediaminetetraacetic acid (EDTA); 2% w/v
hexadecyltrimethylammonium bromide (CTAB); 2% w/v
polyvinylpyrolidine (PVP); and 0.1% w/v ascorbic acid. The tissue
is macerated using a Bioreba Homex 6 homogenizer (Reinach,
Switzerland, cat #400005) set at 90. The sample is ground until
tissues appear as broken as possible to liberate fungal DNA. [0066]
(6) Once maceration is complete, the extraction is pressed into the
bottom of the extraction bag. Using clean scissors cut the bag at a
length to allow a 10 or 25 mL transfer pipet to reach the
extraction without contaminating the pipettor. [0067] (7) By
pipetting up and down several times, the extraction juice is
homogenized. [0068] (8) One milliliter of extraction juice is
transferred into each of two eppendorf tubes. One of these tubes is
immediately frozen in storage for reference. The other is further
processed. [0069] (9) The test aliquot is boiled for five minutes.
A centrifuge cap sleeve is used to ensure that the tube will not
pop open. [0070] (10) The boiled extracted is allowed to cool on
ice for 2 minutes. [0071] (11) The extraction is centrifuged at
15,000.times. G for 5 minutes. [0072] (12) Extracts are either
diluted and tested directly (13A) or nucleic acids are purified
from them prior to testing (13B).
[0073] (13A) Extracts are diluted for testing. Extraction
supernatant is added to ice-cold water according to the following
scheme: TABLE-US-00003 Tissue mL CTAB/g tissue Dilution Tested E.
Blossoms, peduncles 3 X 1:67 F. Hulls, old almond fruit 4 X 1:50 G.
Hulls, fresh almond fruit 2 X 1:100 H. Woody tissue 2 X 1:100
[0074] (13B) Nucleic acids are purified from almond extracts by
performing an equal volume 25:24:1 phenol:chloroform:isoamyl
alcohol extraction on 1 mL of homogenized extraction juice. The
aqueous phase of this extraction is transferred to a fresh
microcentrifuge tube and 0.5 volumes of ice-cold isopropanol are
added. After incubation for 20 minutes at -20.degree. C., the
precipitate is spun down at 15,000 rpm for 10 minutes. The
supernatant is discarded and the pellet is washed with 0.7 mL of
70% ethanol. The wash is discarded and the pellet allowed to dry.
The pellet is resuspended in Tris EDTA buffer (10 mM Tris base, 1
mM EDTA, pH 8.0) with RNase added at a concentration of 10 mg/mL.
The DNA concentration can be read on a spectrophotometer and
adjusted to 100 ng/.mu.L by addition of TE buffer. TABLE-US-00004
TABLE 2 Source of almond tissues used Origin (City, Sample
Identification Tissue type California, USA) 1999#3 Almond hulls
Escalon 1999#5 Almond hulls -- 1999#11 Almond hulls Modesto 1999#41
Almond hulls Chico 1999#42 Almond hulls Chico 1999#104 Almond hulls
Salida 1999#109B Almond hulls Modesto 1999#118D Almond hulls
Turlock 2000#8 Almond hulls Ripon 2000#11 Almond hulls Turlock
2000#19 Almond hulls Hughson 2000#31A Mummified fruit Ripon
2000#JA-1A Flower blossoms -- 2000#59B Flower blossoms Gridley and
crescents
Example 3
Polymerase Chain Reaction Amplification
[0075] Polymerase chain reactions are performed with the GeneAmp
Kit from Perkin-Elmer (Foster City, Calif.; part no.
N.sub.8O.sub.8-0009) using 50 mM KCl, 2.5 mM MgCl.sub.2, 10 mM
Tris-HCl, pH8.3, containing 200 .mu.M of each dTTP, dATP, dCTP, and
dGTP in either 25 or 50 .mu.L reactions containing 50 .mu.M each
primer, 0.25 U/.mu.L of Taq polymerase and 0.2 ng/.mu.L of genomic
DNA. Reactions are run for 30-40 cycles of 15 s at 94.degree. C.,
15 s at 50.degree. C.-70.degree. C., and 45 s at 72.degree. C. in a
Perkin-Elmer Model 9600 or 9700 thermal cycler. The products are
analyzed by loading 10 .mu.l of each PCR sample on a 1.0% agarose
gel and electrophoresing
Example 4
Synthesis and Purification of Oligonucleotides
[0076] Oligonucleotides (primers) are synthesized by, for example,
either Integrated DNA Technologies (Coralville, Iowa) or Midland
Certified Reagent Company (Midland, Tex.).
Example 5
Cloning and Sequencing of ITS Region rDNA
[0077] ITS region sequences are PCR-amplified using conserved
primers ITS1 and ITS4 (SEQ-ID-NO: 1 and 4) as described in Example
3. Products cloned into the pCR.RTM.2.1-TOPO TA-cloning vector
using the TOPO-TA Cloning Kit (Invitrogen, Carlsbad, Calif.; part
no. K455040) according to manufacturer's directions. Clones
containing the ITS fragment inserts are sequenced using the TA
cloning vector's FORWARD (5'-gtaaaacgacggccagt-3'; SEQ ID NO:5) and
REVERSE (5'-caggaaacagctatgac-3'; SEQ ID NO:6) primers. Sequencing
is performed on an ABI PRISM 377.TM. DNA sequencer (Perkin Elmer
Applied Biosystems, Foster City, Calif.).
Example 6
Design of Species-Specific PCR Primers
[0078] Example 6 is broken down into three subsections describing
details of the design of specific primers for Colletotrichum
acutatum, Alternaria spp., and Cladosporium carpophilum. A few
common steps are involved in the design of primers for the three
target species. In the design of each assay, Internal Transcribed
Spacer region DNA sequences are obtained either from the GenBank
database of the National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov) or from PCR-amplified and sequenced DNA from
isolates in Example 1 according to the protocol in Example 5. A
multiple sequence alignment is made of these sequences. The
alignment is analyzed for divergences among the target sequences
and among sequences for other fungal DNAs. The divergences permit
the development of primers that will specifically amplify target
sequences in PCR reactions. Oligonucleotide primers are designed to
target regions that contain the greatest differences in sequence
among the species analyzed (See individual tables 4-7). These
primers are synthesized according to Example 4. In addition, the
published ribosomal gene-specific primers ITS 1, ITS2, ITS3 and
ITS4 (White et al., 1990; In: PCR Protocols; Eds.: Innes et al.
pages 315-322) are synthesized for testing in combination with the
primers specific for the ITS regions. The conserved fungal ITS
region primers are shown in Table 3. TABLE-US-00005 TABLE 3
Conserved primers designed for amplification of fungal ITS region
DNA Oligo Sequence Name (5' .fwdarw. 3') Target Identifier ITS1
TCCGTAGGTGAACCTGCGG Fungal Nuclear SEQ-ID-NO:1 rDNA ITS region ITS2
GCTGCGTTCTTCATCGATG Fungal Nuclear SEQ-ID-NO:2 C rDNA ITS region
ITS3 GCATCGATGAAGAACGCAG Fungal Nuclear SEQ-ID-NO:3 C rDNA ITS
region ITS4 TCCTCCGCTTATTGATATG Fungal Nuclear SEQ-ID-NO:4 C rDNA
ITS region
Example 6A
Design of Colletotrichum acutatum-Specific PCR Primers
[0079] Primers are designed for the specific detection of
Colletotrichum acutatum. Internal Transcribed Spacer region I DNA
sequences for C. acutatum are obtained from the GenBank database.
Those sequences include accession numbers Z32907, Z32913, Z32915,
Z32916, Z32917, Z32918, Z32921, Z32922, Z32924, Z32925, Z32926, and
Z32928. A multiple sequence alignment is made of these sequences
along with ITS I region sequences for other almond pathogens
(Z32930 for Colletotrichum coccodes; Z32938, C. dematium; Z32943,
C. fragariae; Z32961, C. gloeosporioides; Z32981, C. graminicola;
Z32984, C. linicola; Z33000, C. trichellum). The alignment is
analyzed for divergences between the target sequences and sequences
for other fungal DNAs. The divergences permit the development of
primers that will specifically amplify C. acutatum ITS region DNA
when used in PCR reactions. Oligonucleotide primers JB677, JB677.1,
JB677.2, JB677.3 and JB678 (SEQ-ID-NO: 10, 28, 29, 30 and 11,
respectively) are designed to target the ITS region I DNA of C.
acutatum. Primers JB677, JB677.1, JB677.2, and JB677.3 are targeted
to the same region of ITS 1 and demonstrate how adding or removing
bases to a primer that contains a target-specific sequence can
produce a diverse number of oligonucleotides for use in the
detection of the same target.
SEQ-ID-NO: 7 Oligonucleotide Primer CaINT-1
SEQ-ID-NO: 8 Oligonucleotide Primer CaINT-2
SEQ-ID-NO: 9 Oligonucleotide Primer CaInt2
[0080] In a similar alignment obtained from the literature (Bailey
et al., Phytopathology 86: 1076-1083), ITS region 2 DNA sequences
of several Colletotrichum species are compared. The alignment in
this report is used to find divergences among the species compared
for the design of a C. acutatum ITS region 2 primer.
Oligonucleotide primer JB679 (SEQ-ID-NO: 12) is designed to target
ITS region 2 DNA of C. acutatum. The C. acutatum specific primers
are shown in Table 4. These primers may be used in combination with
one another, with one of the conserved primers in Table 3, or with
one of the C. acutatum specific primers from the literature
(Primers CaINT-1,5'-GGCGCCGGCCCCCACCACGGGGA-3' and
CaINT-2,5'-GGCGCCGGCCCCGTCACGGGGG-3' referenced in Adaskaveg and
Hartin, Phytopathology 87:979-987, or primer
CaInt2,5'-GGGGAAGCCTCTCGCGG-3' referenced in Sreenivasaprasad et
al. Plant Pathology (1996) 45, 650-655) to target C. acutatum DNA.
TABLE-US-00006 TABLE 4 Primers designed for detection of
Colletotrichum acutatum Oligonucleotide sequence Name (5' .fwdarw.
3') Identifier JB677 CGGGCAGGGGAAGCCTC SEQ-ID-NO: 10 JB678
GGAAGCCTCTCGCGGGC SEQ-ID-NO: 11 JB679 ATCCCAGTGCGAGACGTTAG
SEQ-ID-NO: 12 JB677.1 GCGGGCAGGGGAAGCCTCT SEQ-ID-NO: 28 JB677.2
CGGCGGGCAGGGGAAGCCTCT SEQ-ID-NO: 29 JB677.3 GTTGCTTCGGCGGGCAGGGGAA
SEQ-ID-NO: 30
Example 6B
Design of Alternaria spp.-specific PCR Primers
[0081] Primers are designed for the specific detection of
Alternaria spp. ITS region DNA sequences for A. alternata were
obtained as described in Example 5 for four ATCC isolates (56835,
34509, 26294, and 60647) as well as plate isolates obtained from
almond sample 2000#47 (See Table 1 for more information on
isolates). Additionally, GenBank sequences for the A. alternata ITS
region were obtained (Accession # AF229461, AF229460, AF229459,
AF218791, AJ276059, AJ276055, and AF071346). These sequences were
aligned in SeqMan II ver 3.6.0 (DNAStar, Madison, Wis., USA). A
consensus sequence of these sequences was generated and labeled
"Alternaria ITS sequence".
[0082] A multiple sequence alignment is made of this sequence along
with ITS region sequences for other almond pathogens. These include
sequences obtained from GenBank for Colletotrichum gloeosporioides
(Accession #AF090855), C. acutatum (AF090853), C. fragariae
(AF090854), Venturia carpophila (syn. Fusicladium carpophilum,
Cladosporium carpophilum) (AF065849), Monilinia fructigena
(Z73781), M. laxa (Z73786), Sclerotinia sclerotiorum (Z73799), and
Botrytis cinerea (Z73765). An ITS region sequence generated as in
Example 5 for ATCC Fusicladium carpophilum isolate 52935 is also
included in the multiple sequence alignment.
[0083] The alignment is analyzed for divergences between the A.
alternata consensus sequence target and other fungal sequences. The
divergences found allow for the development of primers that will
specifically amplify Alternaria spp. ITS region DNA when used in
PCR reactions. Oligonucleotide primers Ala1-1, Ala1-2, Ala1-3,
Ala1-4, ala1-5, and Ala1-6 (SEQ-ID-NOs: 13-18) are designed to
target the ITS region DNA of Alternaria spp. (Table 5).
[0084] Additionally, these primers can be used with conserved ITS
region primers in Table 3 as well as other ITS derived Alternaria
spp. primers found in the literature (primers alt1,
5'-ATTGCAATCAGCGTCAGTAAC-3' and alt2,5-CAAGCAAAGCTTGAGGGTACA-3'Zur
et al. 1999. J. Food Protection 62(10) p 1191-1197) (SEQ-ID-NOs: 19
and 20, respectively). TABLE-US-00007 TABLE 5 Primers designed for
detection of Alternaria spp. Oligonucleotide sequence Name (5'
.fwdarw. 3') Identifier Alal-1 AAATATGAAGGCGGGCTGGA SEQ-ID-NO: 13
Alal-2 AGACCTTTGCTGATAGAGAGTGCGA SEQ-ID-NO: 14 Alal-3
CCTTTGCTGATAGAGAGTGCGACTT SEQ-ID-NO: 15 Alal-4 CTCGGGGTTACAGCCTTGCT
SEQ-ID-NO: 16 Alal-5 AACCTCTCGGGGTTACAGCCTTGCT SEQ-ID-NO: 17 Alal-6
TGATAGAGAGTGCGACTTGT SEQ-ID-NO: 18
Example 6C
Design of Cladosporium carpophilum-Specific PCR Primers
[0085] Primers are designed for the specific detection of
Cladosporium carpophilum. ITS region DNA sequences for C.
carpophilum were obtained as described in Example 5 for six
isolates (BS-1, BS-2, BS-3, BS-4, BS-6, and ATCC isolate 52935).
One additional sequence for C. carpophilum ITS region DNA was
obtained from GenBank (Accession # AF065489). These sequences were
aligned in SeqMan II ver 3.6.0 (DNAStar, Madison, Wis., USA). A
consensus sequence of these sequences was generated and labeled
"Vcarpophila consensus".
[0086] A multiple sequence alignment is made of this sequence along
with ITS region sequences for other almond pathogens. These include
sequences obtained from GenBank for Colletotrichum gloeosporioides
(Accession #AF090855), C. acutatum (AF090853), C. fragariae
(AF090854), Monilinia fructigena (Z73781), M. laxa (Z73786),
Sclerotinia sclerotiorum (Z73799), and Botrytis cinerea (Z73765).
The consensus sequence generated in Example 6B for multiple
Altenzaria alternata sequences is also included in the multiple
sequence alignment.
[0087] The alignment is analyzed for divergences between the C.
carpophilum consensus sequence target and other fungal sequences.
The divergences found allow for the development of primers that
will specifically amplify C. carpophilum ITS region DNA when used
in PCR reactions. Oligonucleotide primers Vcarp1, Vcarp2, Vcarp3,
Vcarp4, Vcarp5, Vcarp6, and Vcarp7 (SEQ-ID-NOs: 21-27) are designed
to target the ITS region of C. carpophilum (Table 6). These primers
can be used with conserved ITS region primers in Table 3.
TABLE-US-00008 TABLE 6 Primers designed for detection of
Cladosporium carpophilum Oligonucleotide sequence Name (5' .fwdarw.
3') Identifier Vcarp1 TGCCGGAATCAGCAAGCCCT SEQ-ID-NO: 21 Vcarp2
CAACCGCGGCCCGGAT SEQ-ID-NO: 22 Vcarp3 TCAGCAAGCCCTGCCTAGAA
SEQ-ID-NO: 23 Vcarp4 GTCTGAGGAGAAAGCCAAACGA SEQ-ID-NO: 24 Vcarp5
GCTCCGGGCGAGGGAT SEQ-ID-NO: 25 Vcarp6 GCGACGGCGCCTACGGGTTT
SEQ-ID-NO: 26 Vcarp7 CCGGGCGAGGGATTTCTCTT SEQ-ID-NO: 27
Example 7
Determination of Primer Specificity to Purified Fungal Genomic
DNA
[0088] PCRs are performed according to Example 3 using different
primer combinations (Table 7) in an attempt to amplify single
specific fragments. Specific PCR amplification products are
produced from primers designed from the nuclear rDNA ITS regions of
each fungal species of interest.
[0089] In an initial screen for specificity, PCR reaction mixtures
are made according to Example 3 for each of the primer combinations
in Table 7. These are run against a negative control (no DNA
added), a healthy almond tissue control (prepared as in Example 2)
to test for background amplification, and 10 ng of fungal DNA for
each of the known species listed in Table 1 prepared as described
in example 1. TABLE-US-00009 TABLE 7 Possible combinations of PCR
primers for the specific amplification of Colletotrichum acutatum,
Alternaria spp., and Cladosporium carpophilum. Target Pathogen 5'
primer 3' primer C. acutatum CaINT-1 (SEQ-ID-NO: 7) JB679
(SEQ-ID-NO: 12) C. acutatum CaINT-2 (SEQ-ID-NO: 8) JB679
(SEQ-ID-NO: 12) C. acutatum CaInt2 (SEQ-ID-NO: 9) JB679 (SEQ-ID-NO:
12) C. acutatum JB677.1 (SEQ-ID-NO: 28) JB679 (SEQ-ID-NO: 12) C.
acutatum JB677.1 (SEQ-ID-NO: 28) ITS4 (SEQ-ID-NO: 4) C. acutatum
JB677.1 (SEQ-ID-NO: 28) ITS2 (SEQ-ID-NO: 2) C. acutatum JB677.2
(SEQ-ID-NO: 29) JB679 (SEQ-ID-NO: 12) C. acutatum JB677.2
(SEQ-ID-NO: 29) ITS4 (SEQ-ID-NO: 4) C. acutatum JB677.2 (SEQ-ID-NO:
29) ITS2 (SEQ-ID-NO: 2) C. acutatum JB677.3 (SEQ-ID-NO: 30) JB679
(SEQ-ID-NO: 12) C. acutatum JB677.3 (SEQ-ID-NO: 30) ITS4
(SEQ-ID-NO: 4) C. acutatum JB677.3 (SEQ-ID-NO: 30) ITS2 (SEQ-ID-NO:
2) C. acutatum JB677 (SEQ-ID-NO: 10) JB679 (SEQ-ID-NO: 12) C.
acutatum JB677 (SEQ-ID-NO: 10) ITS4 (SEQ-ID-NO: 4) C. acutatum
JB677 (SEQ-ID-NO: 10) ITS2 (SEQ-ID-NO: 2) C. acutatum JB678
(SEQ-ID-NO: 11) JB679 (SEQ-ID-NO: 12) C. acutatum JB678 (SEQ-ID-NO:
11) ITS4 (SEQ-ID-NO: 4) C. acutatum JB678 (SEQ-ID-NO: 11) ITS2
(SEQ-ID-NO: 2) C. acutatum ITS1 (SEQ-ID-NO: 1) JB679 (SEQ-ID-NO:
12) C. acutatum ITS3 (SEQ-ID-NO: 3) JB679 (SEQ-ID-NO: 12)
Alternaria spp. Ala1-4 (SEQ-ID-NO: 16) ITS2 (SEQ-ID-NO: 2)
Alternaria spp. Ala1-4 (SEQ-ID-NO: 16) Alt2 (SEQ-ID-NO: 20)
Alternaria spp. Ala1-4 (SEQ-ID-NO: 16) Ala1-2 (SEQ-ID-NO: 14)
Alternaria spp. Ala1-4 (SEQ-ID-NO: 16) Ala1-3 (SEQ-ID-NO: 15)
Alternaria spp. Ala1-4 (SEQ-ID-NO: 16) Ala1-6 (SEQ-ID-NO: 18)
Alternaria spp. Ala1-5 (SEQ-ID-NO: 17) ITS4 (SEQ-ID-NO: 4)
Alternaria spp. Ala1-5 (SEQ-ID-NO: 17) ITS2 (SEQ-ID-NO: 2)
Alternaria spp. Ala1-5 (SEQ-ID-NO: 17) Alt2 (SEQ-ID-NO: 20)
Alternaria spp. Ala1-5 (SEQ-ID-NO: 17) Ala1-2 (SEQ-ID-NO: 14)
Alternaria spp. Ala1-5 (SEQ-ID-NO: 17) Ala1-3 (SEQ-ID-NO: 15)
Alternaria spp. Ala1-5 (SEQ-ID-NO: 17) Ala1-6 (SEQ-ID-NO: 18)
Alternaria spp. Alt1 (SEQ-ID-NO: 19) Ala1-2 (SEQ-ID-NO: 14)
Alternaria spp. Alt1 (SEQ-ID-NO: 19) Ala1-3 (SEQ-ID-NO: 15)
Alternaria spp. Alt1 (SEQ-ID-NO: 19) Ala1-6 (SEQ-ID-NO: 18)
Alternaria spp. ITS1 (SEQ-ID-NO: 1) Ala1-2 (SEQ-ID-NO: 14)
Alternaria spp. ITS1 (SEQ-ID-NO: 1) Ala1-3 (SEQ-ID-NO: 15)
Alternaria spp. ITS1 (SEQ-ID-NO: 1) Ala1-6 (SEQ-ID-NO: 18)
Alternaria spp. ITS3 (SEQ-ID-NO: 3) Ala1-2 (SEQ-ID-NO: 14)
Alternaria spp. ITS3 (SEQ-ID-NO: 3) Ala1-3 (SEQ-ID-NO: 15)
Alternaria spp. ITS3 (SEQ-ID-NO: 3) Ala1-6 (SEQ-ID-NO: 18) C.
carpophilum Vcarp1 (SEQ-ID-NO: 21) Vcarp5 (SEQ-ID-NO: 25) C.
carpophilum Vcarp1 (SEQ-ID-NO: 21) Vcarp6 (SEQ-ID-NO: 26) C.
carpophilum Vcarp1 (SEQ-ID-NO: 21) Vcarp7 (SEQ-ID-NO: 27) C.
carpophilum Vcarp1 (SEQ-ID-NO: 21) ITS4 (SEQ-ID-NO: 4) C.
carpophilum Vcarp1 (SEQ-ID-NO: 21) ITS2 (SEQ-ID-NO: 2) C.
carpophilum Vcarp2 (SEQ-ID-NO: 22) Vcarp5 (SEQ-ID-NO: 25) C.
carpophilum Vcarp2 (SEQ-ID-NO: 22) Vcarp6 (SEQ-ID-NO: 26) C.
carpophilum Vcarp2 (SEQ-ID-NO: 22) Vcarp7 (SEQ-ID-NO: 27) C.
carpophilum Vcarp2 (SEQ-ID-NO: 22) ITS4 (SEQ-ID-NO: 4) C.
carpophilum Vcarp2 (SEQ-ID-NO: 22) ITS2 (SEQ-ID-NO: 2) C.
carpophilum Vcarp3 (SEQ-ID-NO: 23) Vcarp5 (SEQ-ID-NO: 25) C.
carpophilum Vcarp3 (SEQ-ID-NO: 23) Vcarp6 (SEQ-ID-NO: 26) C.
carpophilum Vcarp3 (SEQ-ID-NO: 23) Vcarp7 (SEQ-ID-NO: 27) C.
carpophilum Vcarp3 (SEQ-ID-NO: 23) ITS4 (SEQ-ID-NO: 4) C.
carpophilum Vcarp3 (SEQ-ID-NO: 23) ITS2 (SEQ-ID-NO: 2) C.
carpophilum Vcarp4 (SEQ-ID-NO: 24) Vcarp5 (SEQ-ID-NO: 25) C.
carpophilum Vcarp4 (SEQ-ID-NO: 24) Vcarp6 (SEQ-ID-NO: 26) C.
carpophilum Vcarp4 (SEQ-ID-NO: 24) Vcarp7 (SEQ-ID-NO: 27) C.
carpophilum Vcarp4 (SEQ-ID-NO: 24) ITS4 (SEQ-ID-NO: 4) C.
carpophilum Vcarp4 (SEQ-ID-NO: 24) ITS2 (SEQ-ID-NO: 2) C.
carpophilum ITS1 (SEQ-ID-NO: 1) Vcarp5 (SEQ-ID-NO: 25) C.
carpophilum ITS1 (SEQ-ID-NO: 1) Vcarp6 (SEQ-ID-NO: 26) C.
carpophilum ITS1 (SEQ-ID-NO: 1) Vcarp7 (SEQ-ID-NO: 27) C.
carpophilum ITS3 (SEQ-ID-NO: 3) Vcarp5 (SEQ-ID-NO: 25) C.
carpophilum ITS3 (SEQ-ID-NO: 3) Vcarp6 (SEQ-ID-NO: 26) C.
carpophilum ITS3 (SEQ-ID-NO: 3) Vcarp7 (SEQ-ID-NO: 27)
[0090] When visualized on an ethidium bromide stained gel several
primer pairs give satisfactory results: good amplification of
target DNA from multiple isolates of the target species with all
other reactions (negative control, almond background, and other
fungal DNAs) free of both specific and nonspecific reaction
products. Some give unsatisfactory results including nonspecific
amplification, no amplification of target DNA, and amplification of
DNAs from fungal species other that the target. The primer pairs
that give the good amplification for their specific targets with no
cross-amplification are summarized in Table 8. TABLE-US-00010 TABLE
8 PCR primer pairs providing specific and sensitive amplification
of target DNA for Colletotrichum accutatum, Alternia spp., and
Cladosporium carpophilum PCR assays. Target Pathogen 5' primer 3'
primer C. acutatum JB677.3 (SEQ-ID-NO: 30) ITS4 (SEQ-ID-NO: 4) C.
acutatum JB677 (SEQ-ID-NO: 27) ITS4 (SEQ-ID-NO: 4) Alternaria spp.
Ala1-4 (SEQ-ID-NO: 16) Ala1-2 (SEQ-ID-NO: 12) Alternaria spp.
Ala1-4 (SEQ-ID-NO: 16) Ala1-6 (SEQ-ID-NO: 18) Alternaria spp.
Ala1-5 (SEQ-ID-NO: 17) Ala1-2 (SEQ-ID-NO: 12) C. carpophilum ITS1
(SEQ-ID-NO: 1) Vcarp7 (SEQ-ID-NO: 27) C. carpophilum Vcarp4
(SEQ-ID-NO: 24) Vcarp5 (SEQ-ID-NO: 25) C. carpophilum Vcarp1
(SEQ-ID-NO: 21) ITS4 (SEQ-ID-NO: 4)
Example 7
Validation of Almond Pathogen PCR Assays Against a Panel of Almond
Tissue DNA Extractions
[0091] For the primer pairs that give the best amplification of
their given targets (JB677.3 with ITS4 for C. acutatum, Ala1-4 with
Ala1-2 for Alternaria spp., and ITS1 with Vcarp7 for C.
carpophilum), each is run in PCR reactions against a panel of
almond tissue extractions prepared as in Example 2 on tissues
listed in Table 2. In this experiment, extractions from sample
designated as "1999" are diluted and tested directly. Nucleic acids
are purified from extractions on samples designated as "2000" and
then tested at a 100 ng per reaction concentration. Results are
scored as either positive (+) or negative (-) with any product
visible being considered a positive and with nonspecifics recorded
if present. Results of these tests are shown in Table 9.
TABLE-US-00011 TABLE 9 Results of almond pathogen PCR assays
against a panel of Almond tissue DNA extractions. Alter- Sample
Colletotrichum naria Cladosporium Identification Tissue type
acutatum spp. carpophilum 1999#3 Almond hulls + + - 1999#5 Almond
hulls + + - 1999#11 Almond hulls - + - 1999#41 Almond hulls - - -
1999#42 Almond hulls - + - 1999#104 Almond hulls + + - 1999#109B
Almond hulls + + - 1999#118D Almond hulls - + - 2000#8 Almond hulls
+ + - 2000#19 Almond hulls - - - 2000#31A Mummified - + - fruit
2000#JA-1A Flower + - - blossoms 2000#59B Flower - - - blossoms and
crescents
[0092] For the thirteen isolates tested, the assays detect and
differentiate Colletotichum acutatum, Altenaria spp., and
Cladosporium carpophilum in almond extractions. This experiment
demonstrates the utility of these primers in directly
characterizing almond tissue extractions for the presence of
disease.
Example 8
Validation of Almond Pathogen PCR Assays Against a Panel of Unknown
Fungal Isolates Collected from Almond Tissues
[0093] DNAs are extracted from unknown fungal isolates (Table 1,
bottom) collected from almond samples by the method in Example 1.
These purified DNA extracts are tested using PCR reaction mixtures
made according to Example 3 for each of the primer combinations in
Table 8. Table 10 shows the utility of these assays in the
characterization of purified fungal isolates grown from almond
tissues. TABLE-US-00012 TABLE 10 Results of almond pathogen PCR
assays against a panel of Unknown fungal isolates from field-grown
almonds. Sample Colletotrichum Alternaria Cladosporium
Identification Acutatum spp. carpophilum 2000#69A1 - + - 2000#105C
+ - - 2000#106A(2P) - + -
[0094] All references cited herein are incorporated by reference in
their entireties.
Appendix I:
GenBank sequences used in the development of C. acutatum
primers
Z32907
C. acutatum (4885) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483613|emb|Z32907.1|CAITS1A[483613]
Z32913
C. acutatum (179) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483614|emb|Z32913.1|CAITS1B[483614]
Z32915
C. acutatum (397) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483615|emb|Z32915.1|CAITS1D[483615]
Z32916
C. acutatum (493/BOX88) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483616|emb|Z32916.1|CAITS1E[483616]
Z32917
C. acutatum (495/17729) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483617|emb|Z32917.1|CAITS1F[483617]
Z32918
C. acutatum (534/90.368) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483618|emb|Z32918.1|CAITS1G[483618]
Z32921
C. acutatum (547/90.410) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483621|emb|Z32921.1|CAITS1J[483621]
Z32922
C. acutatum (549) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483622|emb|Z32922.1|CAITS1 K[483622]
Z32924
C. acutatum (602/91.326) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483624|emb|Z32924.1|CAITS1 M[483624]
Z32925
C. acutatum (615/91.414) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483625|emb|Z32925.1|CAITS1N[483625]
Z32926
C. acutatum (616/91.414) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483626|emb|Z32926.1|CAITS1O[483626]
Z32928
C. acutatum (NI90) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483627|emb|Z32928.1|CAITS1Q[483627]
Z32930
C. coccodes (527.77) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483630|emb|Z32930.1|CAITS1B[483630]
Z32938
C. dematium (288810) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483639|emb|Z32938.1|CDITS1A[483639]
Z32943
C. fragariae (63-1) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483643|emb|Z32943.1|CFITS1B[483643]
Z32961
C. gloeosporioides (561) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483673 |emb|Z32961.1|CGITS1Q[483673]
Z32981
C. graminicola (84032) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483657|emb|Z32981.1|CGITS1 AM[483657]
Z32984
C. linicola (103844) DNA for ITS1 (between small sub-unit and 5.8S
rRNA genes) gi|483685|emb|Z32984.1|CLITS1A[483685]
Z33000
C. trichellum (180.52) DNA for ITS1 (between small sub-unit and
5.8S rRNA genes) gi|483713|emb|Z33000.1|CTITS1A[483713]
Appendix II:
GenBank sequences used in the development of Alternaria spp.
primers
AF229461
Alternaria alternata strain BMP 2141-10 internal transcribed spacer
1, partial sequence; 5.8S ribosomal RNA gene, complete sequence;
and internal transcribed spacer 2, partial sequence
gi|7546946|gb|AF229461.1|AF229461[7546946]
AF229460
Alternaria alternata strain BMP 2141-07 internal transcribed spacer
1, partial sequence; 5.8S ribosomal RNA gene, complete sequence;
and internal transcribed spacer 2, partial sequence
gi|7546945|gb|AF229460.1|AF229460[7546945]
AF229459
Alternaria alternata strain ATCC 28329 internal transcribed spacer
1, partial sequence; 5.8S ribosomal RNA gene, complete sequence;
and internal transcribed spacer 2, partial sequence
gi|7546944|gb|AF229459.1|AF229459[7546944]
AF218791
[0095] Alternaria alternata internal transcribed spacer 1, 5.8S
ribosomal RNA gene and internal transcribed spacer 2, complete
sequence; 28S ribosomal RNA gene, partial sequence; and 18S
ribosomal RNA gene, complete sequence
gi|6715474|gb|AF218791.1|AF218791[6715474]
AJ276059
Altemaria alternata 5.8S rRNA gene and ITS 1 and 2, strain MZ20
gi|7208649|emb|AJ276059.1|AAL276059[7208649]
AJ276055
Altemaria alternata 5.8S rRNA gene and ITS 1 and 2, strain MZ7
gi|7208647|emb|AJ276055.1|AAL276055[7208.647]
AF071346
[0096] Altemaria alternata 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence
gi|50311211|gb|AF071346.1|AF071346[503112]
AF090855
Colletotrichum gloeosporioides internal transcribed spacer 1, 5.8S
ribosomal RNA gene and internal transcribed spacer 2, complete
sequence; and 28S ribosomal RNA gene, partial sequence
gi|6650331|gb|AF090855.1|AF090855[6650331]
AF065849
Venturia carpophila internal transcribed spacer 1, 5.8S ribosomal
RNA gene, and internal transcribed spacer 2, complete sequence
gi|4185734|gb|AF065849.1|AF065849[4185734]
AF090854
Colletotrichum fragariae internal transcribed spacer 1, 5.8S
ribosomal RNA gene and internal transcribed spacer 2, complete
sequence; and 28S ribosomal RNA gene, partial sequence
gi|6650330|gb|AF090854.1|AF090854[6650330]
AF090853
[0097] Colletotrichum acutatum 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence
gi|6650329|gb|AF090853.1|AF090853[6650329]
Z73781
M. fructigena gene for 5.8S ribosomal RNA, internal transcribed
spacer 1 and internal transcribed spacer 2
gi|2125846|emb|Z73781.1|MFRUCITSE[2125846]
Z73799
S. sclerotiorum gene for 5.8S ribosomal RNA, internal transcribed
spacer 1 and internal transcribed spacer 2
gi|2125909|emb|Z73799.1|SSCLEITSA[2125909]
Z73786
M. laxa gene for 5.8S ribosomal RNA, internal transcribed spacer 1
and internal transcribed spacer 2
gi|2125857|emb|Z73786.1|MLAXAITSC[2125857]
Z73765
B. cinerea gene for 5.8S ribosomal RNA, internal transcribed spacer
1 and internal transcribed spacer 2
gi|2125789|emb|Z73765.1|BCINEITSB[2125789]
Sequence CWU 1
1
30 1 19 DNA artificial sequence misc_feature (1) . .(19) Primer
ITS1 1 tccgtaggtg aacctgcgg 19 2 20 DNA artificial sequence
misc_feature (1) . . (20) Primer ITS2 2 gctgcgttct tcatcgatgc 20 3
20 DNA artificial sequence misc_feature (1). . (20) Primer ITS3 3
gcatcgatga agaacgcagc 20 4 20 DNA artificial sequence misc_feature
(1) . . (20) Pimer ITS4 4 tcctccgctt attgatatgc 20 5 17 DNA
artificial sequence misc_feature (1)..(17) Primer FORWARD 5
gtaaaacgac ggccagt 17 6 17 DNA artificial sequence misc_feature
(1). . (17) Primer REVERSE 6 caggaaacag ctatgac 17 7 23 DNA
artificial sequence misc_feature (1). . (23) Primer CaINT-1 7
ggcgccggcc cccaccacgg gga 23 8 22 DNA artificial sequence
misc_feature (1) . .(22) Primer CaINT-2 8 ggcgccggcc ccgtcacggg gg
22 9 17 DNA artificial sequence misc_feature (1) . . (17) Primer
CaInt2 9 ggggaagcct ctcgcgg 17 10 17 DNA artificial sequence
misc_feature (1) . . (17) Primer CaInt2 10 cgggcagggg aagcctc 17 11
17 DNA artificial sequence misc_feature (1) . .(17) Primer JB677 11
ggaagcctct cgcgggc 17 12 20 DNA artificial sequence misc_feature
(1) . . (20) Primer JB678 12 atcccagtgc gagacgttag 20 13 20 DNA
artificial sequence misc_feature (1) . .(20) Primer Alal-1 13
aaatatgaag gcgggctgga 20 14 25 DNA artificial sequence misc_feature
(1). . (25) Primer Alal-2 14 agacctttgc tgatagagag tgcga 25 15 25
DNA artificial sequence misc_feature (1) . . (25) Primer Alal-3 15
cctttgctga tagagagtgc gactt 25 16 20 DNA artificial sequence
misc_feature (1) . .(20) Primer Alal-4 16 ctcggggtta cagccttgct 20
17 25 DNA artificial sequence misc_feature (1) . . (25) Primer
Ala-5 17 aacctctcgg ggttacagcc ttgct 25 18 20 DNA artificial
sequence misc_feature (1) . .(20) Primer Alal-6 18 tgatagagag
tgcgacttgt 20 19 21 DNA artificial sequence misc_feature (1) .
.(21) Primer Alt1 19 attgcaatca gcgtcagtaa c 21 20 21 DNA
artificial sequence misc_feature (1) . . (21) Primer Alt2 20
caagcaaagc ttgagggtac a 21 21 20 DNA artificial sequence
misc_feature (1) . . (20) Primer Vcarp1 21 tgccggaatc agcaagccct 20
22 16 DNA artificial sequence misc_feature (1) . .(16) Primer
Vcarp2 22 caaccgcggc ccggat 16 23 20 DNA artificial sequence
misc_feature (1) . .(20) Primer Vcarp3 23 tcagcaagcc ctgcctagaa 20
24 22 DNA artificial sequence misc_feature (1) . . (22) Primer
Vcarp4 24 gtctgaggag aaagccaaac ga 22 25 16 DNA artificial sequence
misc_feature (1) . .(16) Primer Vcarp5 25 gctccgggcg agggat 16 26
20 DNA artificial sequence misc_feature (1) . . (20) Primer Vcarp6
26 gcgacggcgc ctacgggttt 20 27 20 DNA artificial sequence
misc_feature (1) .. (20) Vcarp7 27 ccgggcgagg gatttctctt 20 28 19
DNA artificial sequence misc_feature (1) . .(19) Primer JB677.1 28
gcgggcaggg gaagcctct 19 29 21 DNA artificial sequence misc_feature
(1) . .(21) Primer JB677.2 29 cggcgggcag gggaagcctc t 21 30 22 DNA
artificial sequence misc_feature (1) . .(22) Primer JB677.3 30
gttgcttcgg cgggcagggg aa 22
* * * * *