U.S. patent application number 11/290896 was filed with the patent office on 2006-07-27 for methods and compositions useful for inhibition of alpha v beta 5 mediated angiogenesis.
This patent application is currently assigned to The Scripps Research Institute. Invention is credited to Peter Brooks, David A. Cheresh, Martin Friedlander.
Application Number | 20060165703 11/290896 |
Document ID | / |
Family ID | 36462574 |
Filed Date | 2006-07-27 |
United States Patent
Application |
20060165703 |
Kind Code |
A1 |
Brooks; Peter ; et
al. |
July 27, 2006 |
Methods and compositions useful for inhibition of alpha v beta 5
mediated angiogenesis
Abstract
The present invention describes methods for inhibiting
angiogenesis in tissues using vitronectin .alpha..sub.v.beta..sub.5
antagonists. The .alpha..sub.v.beta..sub.5-mediated angiogenesis is
correlated with exposure to cytokines including vascular
endothelial growth factor, transforming growth factor-.alpha. and
epidermal growth factor. Inhibition of
.alpha..sub.v.beta..sub.5-mediated angiogenesis is particularly
preferred in vascular endothelial ocular neovascular diseases, in
tumor growth and in inflammatory conditions, using therapeutic
compositions containing .alpha..sub.v.beta..sub.5 antagonists.
Inventors: |
Brooks; Peter; (Carmel,
NY) ; Cheresh; David A.; (Encinitas, CA) ;
Friedlander; Martin; (Del Mar, CA) |
Correspondence
Address: |
THE SCRIPPS RESEARCH INSTITUTE
OFFICE OF PATENT COUNSEL, TPC-8
10550 NORTH TORREY PINES ROAD
LA JOLLA
CA
92037
US
|
Assignee: |
The Scripps Research
Institute
La Jolla
CA
|
Family ID: |
36462574 |
Appl. No.: |
11/290896 |
Filed: |
November 29, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09194552 |
Mar 23, 1999 |
7053041 |
|
|
PCT/US97/09099 |
May 30, 1997 |
|
|
|
11290896 |
Nov 29, 2005 |
|
|
|
PCT/US96/13194 |
Aug 13, 1996 |
|
|
|
09194552 |
Mar 23, 1999 |
|
|
|
08514799 |
Aug 14, 1995 |
|
|
|
PCT/US96/13194 |
Aug 13, 1996 |
|
|
|
60018773 |
May 31, 1996 |
|
|
|
60015869 |
May 31, 1996 |
|
|
|
Current U.S.
Class: |
424/155.1 ;
424/185.1; 530/350; 530/388.8 |
Current CPC
Class: |
C07K 16/2848 20130101;
A61K 2039/505 20130101; A61K 38/57 20130101; C07K 2317/76 20130101;
C07K 16/2839 20130101 |
Class at
Publication: |
424/155.1 ;
530/350; 530/388.8; 424/185.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 39/00 20060101 A61K039/00; C07K 14/82 20060101
C07K014/82; C07K 16/30 20060101 C07K016/30 |
Claims
1-48. (canceled)
49. A method for inhibiting .alpha..sub.v.beta..sub.5 mediated
angiogenesis in a tissue comprising administering to said tissue a
composition comprising an angiogenesis inhibiting amount of an
.alpha..sub.v.beta..sub.5 antagonist, wherein said antagonist
comprises a matrix metalloproteinase polypeptide or an active
fragment thereof.
50. The method of claim 50, wherein said antagonist consists
essentially of the matrix metalloproteinase polypeptide or an
active fragment thereof.
51. The method of claim 50, wherein the matrix metalloproteinase
polypeptide comprises an amino acid sequence shown in SEQ ID NOs:
11-22.
Description
TECHNICAL FIELD
[0001] The present invention relates generally to the field of
medicine, and relates specifically to methods and compositions for
inhibiting .alpha..sub.v.beta..sub.5-mediated angiogenesis of
tissues using antagonists of the vitronectin receptor
.alpha..sub.v.beta..sub.5.
BACKGROUND
[0002] Integrins are a class of cellular receptors known to bind
extracellular matrix proteins, and therefore mediate cell-cell and
cell-extracellular matrix interactions, referred generally to as
cell adhesion events. However, although many integrins and their
respective ligands are described in the literature, the biological
function of many of the integrins remains elusive. The integrin
receptors constitute a family of proteins with shared structural
characteristics of noncovalent heterodimeric glycoprotein complexes
formed of .alpha. and .beta. subunits.
[0003] The vitronectin receptor, named for its original
characteristic of preferential binding to vitronectin, is now known
to refer to three different integrins, designated
.alpha..sub.v.beta..sub.1, .alpha..sub.v.beta..sub.3 and
.alpha..sub.v.beta..sub.5. Horton, Int. J. Exp. Pathol., 71:741-759
(1990). .alpha..sub.v.beta..sub.1 binds fibronectin and
vitronectin. .alpha..sub.v.beta..sub.3 binds a large variety of
ligands, including fibrin, fibrinogen, laminin, thrombospondin,
vitronectin, von Willebrand's factor, osteospontin and bone
sialoprotein I. .alpha..sub.v.beta..sub.5 binds vitronectin. The
specific cell adhesion roles these three integrins play in the many
cellular interactions in tissues are still under investigation.
However, it is clear that there are different integrins with
different biological functions as well as different integrins and
subunits having shared biological specificities.
[0004] One important recognition site in a ligand for many
integrins is the arginine-glycine-aspartic acid (RGD) tripeptide
sequence. RGD is found in all of the ligands identified above for
the vitronectin receptor integrins. This RGD recognition site can
be mimicked by polypeptides ("peptides") that contain the RGD
sequence, and such RGD peptides are known inhibitors of integrin
function. It is important to note, however, that depending upon the
sequence and structure of the RGD peptide, the specificity of the
inhibition can be altered to target specific integrins.
[0005] For discussions of the RGD recognition site, see
Pierschbacher et al., Nature, 309:30-33 (1984), and Pierschbacher
et al., Proc. Natl. Acad. Sci. USA. 81:5985-5988 (1984). Various
RGD polypeptides of varying integrin specificity have also been
described by Grant et al., Cell, 58:933-943 (1989), Cheresh, et
al., Cell, 58:945-953 (1989), Aumailley et al., FEBS Letts.,
291:50-54 (1991), and Pfaff et al., J. Biol. Chem., 269:20233-20238
(1994), and in U.S. Pat. Nos. 4,517,686, 4,578,079, 4,589,881,
4,614,517, 4,661,111, 4,792,525, 4,683,291, 4,879,237, 4,988,621,
5,041,380 and 5,061,693.
[0006] Angiogenesis, also referred to as neovascularization, is a
process of tissue vascularization that involves the growth of new
developing blood vessels into a tissue. The process is mediated by
the infiltration of endothelial cells and smooth muscle cells. The
process is believed to proceed in any one of three ways: 1) The
vessels can sprout from pre-existing vessels; 2) De novo
development of vessels can arise from precursor cells
(vasculogenesis); or 3) Existing small vessels can enlarge in
diameter. Blood et al., Bioch. Biophys. Acta, 1032:89-118 (1990).
Vascular endothelial cells are known to contain at least five
RGD-dependent integrins, including the vitronectin receptor
(.alpha..sub.v.beta..sub.3 or .alpha..sub.v.beta..sub.5) the
collagen Types I and IV receptor (.alpha..sub.1.beta..sub.1), the
laminin receptor (.alpha..sub.2.beta..sub.1), the
fibronectin/laminin/collagen receptor (.alpha..sub.3.beta..sub.1)
and the fibronectin receptor (.alpha..sub.5.beta..sub.1) Davis et
al., J. Cell. Biochem., 51:206-218 (1993). The smooth muscle cell
is known to contain at least six RGD-dependent integrins, including
.alpha..sub.5.beta..sub.1, .alpha..sub.v.beta..sub.3 and
.alpha..sub.v.beta..sub.5.
[0007] Angiogenesis is an important process in neonatal growth, but
is also important in wound healing and in the pathogenesis of a
large variety of clinically important diseases including tissue
inflammation, arthritis, psoriasis, cancer, diabetic retinopathy,
macular degeneration and other neovascular eye diseases. These
clinical entities associated with angiogenesis are referred to as
angiogenic diseases. Folkman et al., Science, 235:442-447 (1987).
Angiogenesis is generally absent in adult or mature tissues,
although it does occur in wound healing and in the corpus luteum
growth cycle. See, for example, Moses et al., Science,
248:1408-1410 (1990).
[0008] Inhibition of cell adhesion in vitro using monoclonal
antibodies immunospecific for various integrin .alpha. or .beta.
subunits have implicated the vitronectin receptor
.alpha..sub.v.beta..sub.3 in cell adhesion of a variety of cell
types including microvascular endothelial cells. Davis et al., J.
Cell. Biol., 51:206-218 (1993). In addition, Nicosia et al., Am. J.
Pathol., 138:829-833 (1991), described the use of the RGD peptide,
GRGDS, to inhibit the in vitro formation of "microvessels" from rat
aorta cultured in collagen gel.
[0009] However, the inhibition of formation of "microvessels" in
vitro in collagen gel cultures is not a model for inhibition of
angiogenesis in a tissue because it is not shown that the
microvessel structures are the same as capillary sprouts or that
the formation of the microvessel in collagen gel culture is the
same as neo-vascular growth into an intact tissue, such as
arthritic tissue, tumor tissue or disease tissue where inhibition
of angiogenesis is desirable.
[0010] The role of .alpha..sub.v.beta..sub.3 in angiogenesis was
recently confirmed. See, Brooks, et al. Science, 264:569-571
(1994). The integrin was shown to be expressed on blood vessels in
human wound granulation tissue but not in normal skin. Monoclonal
antibodies against the .alpha..sub.v.beta..sub.3 receptor inhibited
angiogenesis induced by the growth factors (cytokines) basic
fibroblast growth factor (bFGF) and tumor necrosis factor-.alpha.
(TNF-.alpha.), as well as by melanoma fragments. However, the
antagonists only inhibited new and not preexisting vessels. In
addition, specific linear and cyclic RGD-containing peptides were
also shown to inhibit neovascularization.
[0011] It has been proposed that inhibition of angiogenesis would
be a useful therapy for restricting tumor growth. Inhibition of
angiogenesis has been proposed by (1) inhibition of release of
"angiogenic molecules" such as bFGF (basic fibroblast growth
factor), (2) neutralization of angiogenic molecules, such as by use
of anti-bFGF antibodies, and (3) inhibition of endothelial cell
response to angiogenic stimuli. This latter strategy has received
attention, and Folkman et al., Cancer Biology, 3:89-96 (1992), have
described several endothelial cell response inhibitors, including
collagenase inhibitor, basement membrane turnover inhibitors,
angiostatic steroids, fungal-derived angiogenesis inhibitors,
platelet factor 4, thrombospondin, arthritis drugs such as
D-penicillamine and gold thiomalate, vitamin D.sub.3 analogs,
alpha-interferon, and the like that might be used to inhibit
angiogenesis. For additional proposed inhibitors of angiogenesis,
see Blood et al., Bioch. Biophys. Acta., 1032:89-118 (1990), Moses
et al., Science, 248:1408-1410 (1990), Ingber et al., Lab. Invest.,
59:44-51 (1988), and U.S. Pat. Nos. 5,092,885, 5,112,946,
5,192,744, and 5,202,352.
[0012] However, the role of the integrin .alpha..sub.v.beta..sub.5
in angiogenesis has neither been suggested or identified until the
present invention nor have any of the inhibitors of angiogenesis
described in the foregoing references been targeted at inhibition
of .alpha..sub.v.beta..sub.5. Moreover, no references, other than
the present invention, have implicated the
.alpha..sub.v.beta..sub.5 integrin in neovascularization,
particularly that induced by the growth factors, vascular
endothelial growth factor (VEGF), transforming growth
factor-.alpha. (TGF-.alpha.) and epidermal growth factor (EGF).
[0013] Although the numbers of growth factors involved in the
control of angiogenesis are limited, different levels of control of
the process exist for conversion of a quiescent state to a
neovascular state. See, D'Amore, Investigative Ophthal, Visual
Sci., 35:3974-3979 (1994). While some growth factors involved in
angiogenesis are regulated at the synthesis level, others are
regulated by the state of activation. These cellular events occur
as a quiescent vessel undergoes neovascularization following injury
or ischemia.
[0014] VEGF, in particular, is thought to be a major mediator of
angiogenesis in a primary tumor and in ischemic ocular diseases.
For review, see Folkman, Nature Medicine, 1:27-31 (1995). VEGF is a
46 kilodalton (kDa) homodimer that is an endothelial cell-specific
angiogenic (Ferrara et al., Endocrin. Rev., 13:18-32 (1992)) and
vasopermeable factor (Senger et al., Cancer Res., 46:5629-5632
(1986)) that binds to high-affinity membrane-bound receptors with
tyrosine kinase activity (Jakeman et al., J. Clin. Invest.,
89:244-253 (1992)).
[0015] Activation of receptor tyrosine kinases has recently been
shown to promote integrin-dependent cell migration on extracellular
matrix proteins. In particular, Klemke et al., J. Cell Biol.,
127:859-866 (1994) have implicated the EGF receptor (EGFR) tyrosine
kinase in promoting cell motility but not adhesion of FG human
pancreatic carcinoma cells on vitronectin using the
.alpha..sub.v.beta..sub.5 integrin. The authors provide direct
evidence that occupation of EGFR with the EGF ligand activates the
tyrosine kinase activation of the EGFR that ultimately stimulates a
protein kinase C (PKC)-dependent pathway leading to the induction
of .alpha..sub.v.beta..sub.5-dependent cell migration of a
vitronectin substrate on which the cells are normally unable to
migrate. Thus, the Klemke et al. findings provide evidence for
correlating the presence of cytokines, specifically EGF, with
integrin activity in cell migration. Activation of PKC has been
shown to be involved in the regulation of angiogenesis in the chick
chorioallantoic membrane model system. See, Tsopanoglou et al., J.
Vasc. Res., 30:202-208 (1993). The authors identified specific
activators and inhibitors of PKC that respectively stimulated and
inhibited angiogenesis in the model system.
[0016] However, neither Klemke et al. nor Tsopanoglou et al.
discussed above describe the role of cytokines and expression
and/or activation of the .alpha..sub.v.beta..sub.5 integrin in
promoting angiogenesis in various conditions and disease states and
inhibition thereof with .alpha..sub.v.beta..sub.5-specific
antagonists.
[0017] Recent experimental evidence has shown in a monkey model
system of eye disease that retinal ischemia induced by retinal vein
occlusion resulted in a rapid rise of VEGF in the aqueous chambers
of the eye. This rise coincided with the iris neovascularization
that was observed as described by Miller et al., Am. J. Path.,
145:574-584 (1994). Additional data in an mouse model system of
proliferative retinopathy in which hypoxia is induced, VEGF
messenger RNA was shown to increase within 6-12 hours of relative
hypoxia that remained elevated until neovascularization developed.
As the new blood vessels declined, so did the VEGF expression as
described by Pierce et al., Proc. Natl. Acad. Sci. USA, 92:905-909
(1995).
[0018] Thus, the recent data as demonstrated in animal models of
ischemia have correlated the induction of VEGF with that of
ischemia followed by neovascularization. VEGF, as well as other
growth factors, have also been implicated in other conditions and
disease states involving neovascularization as reviewed by Folkman,
Nature Medicine, 1:27-31 (1995).
[0019] The Folkman et al. reference also summarizes the current
clinical approaches used to control undesirable angiogenesis.
Patients in clinical trials have received therapeutic treatments
with angiogenic inhibitors including platelet factor 4, a
fumagillin-derivative, carboxy-amino-triazole, and the like.
However, no references or current therapeutic references correlate
the expression of .alpha..sub.v.beta..sub.5 with angiogenesis,
particularly that induced by VEGF. Thus, prior to the present
invention, no one has described nor utilized a therapeutic regimen
with .alpha..sub.v.beta..sub.5 antagonists to control angiogenesis
in a tissue undergoing angiogenesis correlated with the presence
and activation of .alpha..sub.v.beta..sub.5.
[0020] Therefore, other than the studies reported here on
.alpha..sub.v.beta..sub.3 and the relationship with growth factors
to angiogenesis, Applicants are unaware of any other demonstration
that angiogenesis could be inhibited in a tissue using inhibitors
of .alpha..sub.v.beta..sub.5-mediated cell adhesion. In particular,
it has never been previously demonstrated that
.alpha..sub.v.beta..sub.5 function is required for angiogenesis in
a tissue or that .alpha..sub.v.beta..sub.5 antagonists can inhibit
angiogenesis in a tissue, particularly in ocular neovascular
diseases.
BRIEF DESCRIPTION OF THE INVENTION
[0021] The present invention demonstrates that in addition to an
.alpha..sub.v.beta..sub.3-requiring angiogenesis pathway in
tissues, a separate novel .alpha..sub.v.beta..sub.5-dependent
pathway also exists. Thus, the invention describes inhibitors of
.alpha..sub.v.beta..sub.5 that can inhibit angiogenesis. The
invention further describes that .alpha..sub.v.beta..sub.5-mediated
activity in promoting angiogenesis is correlated with growth factor
(cytokine) activation of growth factor receptor tyrosine kinases
and protein kinase C (PKC). The growth factors (cytokines) that
function in this manner include vascular endothelial growth factor
(VEGF), transforming growth factor-.alpha. (TGF-.alpha.), epidermal
growth factor (EGF), and the like.
[0022] The invention therefore describes methods for inhibiting
angiogenesis in a tissue comprising administering to the tissue a
composition comprising an angiogenesis-inhibiting amount of an
.alpha..sub.v.beta..sub.5 antagonist.
[0023] The tissue to be treated can be any tissue in which
inhibition of angiogenesis is desirable, such as diseased tissue
where neovascularization is occurring. Exemplary tissues include
ocular tissue undergoing neovascularization, inflamed tissue, solid
tumors, metastases, tissues undergoing restenosis, and the like
tissues. In preferred embodiments, the neovascularization
associated with expression of .alpha..sub.v.beta..sub.5 is the
result of exposure to the growth factors, VEGF, TGF-.alpha. and
EGF.
[0024] Particularly preferred are therapeutic methods directed to
inhibiting VEGF-induced vascularization in tissues such as the eye
where angiogenesis is pronounced in diseases, including diabetic
retinopathy (also called proliferative diabetic retinopathy),
age-related macular degeneration, presumed ocular histoplasmosis,
retinopathy of prematurity, sickle cell retinopathy and neovascular
glaucoma In further preferred embodiments, the therapeutic methods
are directed to inhibiting angiogenesis that occurs in corneal
neovascular disorders that include corneal transplantation,
herpetic keratitis, luetic keratitis, pterygium, neovascular pannus
associated with contact lens use, and the like.
[0025] An .alpha..sub.v.beta..sub.5 antagonist for use in the
present methods is capable of binding to .alpha..sub.v.beta..sub.5
and competitively inhibiting the ability of
.alpha..sub.v.beta..sub.5 to bind to the natural vitronectin
ligand. Preferably, the antagonist exhibits specificity for
.alpha..sub.v.beta..sub.5 over other integrins. In a particularly
preferred embodiment, the .alpha..sub.v.beta..sub.5 antagonist
inhibits binding of vitronectin or other RGD-containing ligands to
.alpha..sub.v.beta..sub.5 but does not substantially inhibit
binding of vitronectin to .alpha..sub.v.beta..sub.3 or
.alpha..sub.IIb.beta..sub.3. A preferred .alpha..sub.v.beta..sub.5
antagonist can be a fusion polypeptide, a linear or cyclic
polypeptide, a derivatized polypeptide, a monoclonal antibody or a
functional fragment thereof, or an organic molecule that is a
mimetic of an .alpha..sub.v.beta..sub.5 ligand that is also
referred to as an organic mimetic, all of which specifically
interacts with .alpha..sub.v.beta..sub.5.
[0026] Administration of the .alpha..sub.v.beta..sub.5 antagonists
of this invention includes intraocular, intravenous, transdermal,
intrasynovial, intramuscular and oral administration. In other
preferred embodiments, administration is coordinated with a
chemotherapeutic regimen to control tumorigenesis and cancer
metastasis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In the drawings forming a portion of this disclosure:
[0028] FIGS. 1A-1D illustrate inhibition of cytokine-induced rabbit
corneal angiogenesis by .alpha..sub.v integrin antibody
antagonists. Induction of angiogenesis by treatment with either
bFGF or VEGF and effects of treatment thereof with the
.alpha..sub.v integrin antibody antagonists, P1F6
(.alpha..sub.v.beta..sub.5) and LM609 (.alpha..sub.v.beta..sub.3),
are described in Example 4. OD and OS are respectively the right
and left eyes of an experimental rabbit. Large arrows indicate
corneal angiogenesis with edema while small arrows point to normal
conjunctival limbal vessels. FIGS. 1A and 1B show induction of
angiogenesis with bFGF while FIGS. 1C and 1D show that with VEGF.
Rabbit corneas in FIGS. 1A and 1C show treatment with P1F6 while
FIGS. 1B and 1D show treatment with LM609.
[0029] FIGS. 2A and 2B are histograms showing the mean neovascular
area in mm.sup.2 .+-. the standard error (n=8 for each of two
series) after induction respectively with either bFGF or VEGF
followed by mAb treatment with either P1F6 or LM609. The results
are discussed in Example 4.
[0030] FIGS. 3A-3F photographically illustrate the effects of
anti-integrin antibody treatment on the chick CAM preparation. The
results are described in Example 6A. Angiogenesis is either induced
with bFGF or VEGF followed by intravenous administration of
phosphate buffered saline (PBS) as a control or with P1F6 or LM609
monoclonal antibodies described in the legend for FIG. 1. CAMs
treated with bFGF are shown in FIGS. 3A, 3C and 3E while CAMs
treated with VEGF are shown in FIGS. 3B, 3D and 3F. Control CAMs
receiving intravenous injections of PBS are shown in FIGS. 3A and
3B. The P1F6 antibody was used to treat CAMs shown in FIGS. 3C and
3D while the LM609 antibody was used to treat CAMs in FIGS. 3E and
3F.
[0031] FIGS. 4A and 4B provide in histogram format the quantitation
of results shown in FIGS. 3A-3F. The angiogenesis index is plotted
on the Y-axis against control or antibody treatment. FIGS. 4A and
4B respectively show bFGF- and VEGF-induced angiogenesis. The
results are discussed in Example 4.
[0032] FIGS. 5A-5F photographically illustrate the effects of
synthetic peptide treatment on the chick CAM preparation as
described in Example 6. Angiogenesis is either induced with bFGF or
VEGF followed by intravenous administration of phosphate buffered
saline (PBS) as a control or with the synthetic cyclic peptides
RGDfV (SEQ ID NO 4) or RADfV (SEQ ID NO 5). CAMs treated with bFGF
are shown in FIGS. 5A, 5C and 5E while CAMs treated with VEGF are
shown in FIGS. 5B, 5D and 5F. Control CAMs receiving intravenous
injections of PBS are shown in FIGS. 5A and 5B. The RDGfV peptide
was used to treat CAMs shown in FIGS. 5C and 5D while the RADfV
peptide was used to treat CAMs in FIGS. 5E and 5F.
[0033] FIGS. 6A and 6B provide, in histogram format, the
quantitation of results shown in FIGS. 5A-5F. The angiogenesis
index is plotted on the Y-axis against control or antibody
treatment. FIGS. 6A and 6B respectively show bFGF- and VEGF-induced
angiogenesis. The results are discussed in Example 6.
[0034] FIGS. 7A-7E show the effects of anti-integrin monoclonal
antibodies and calphostin C on CAM angiogenesis induced by the
separate cytokines, bFGF, TNF-.alpha., VEGF and TGF-.alpha.. PMA
was also evaluated. The assays and results are described in Example
6. The results are plotted in histogram format where angiogenesis
index is graphed on the Y-axis and the various control or
inhibitors are shown on the X-axis. FIGS. 7A-7E respectively show
angiogenesis induced with bFGF, TNF-.alpha., VEGF, TGF-.alpha. and
PMA.
[0035] FIG. 8 is a histogram showing the effects of antibody
treatment on CS1 melanoma tumor growth in the chick embryo CAM
assayed performed as described in Examples 5C and 6D. The weight of
the tumors in milligrams (mg) is plotted on the Y-axis against the
various treatments indicated on X-axis. CSAT is a control antibody
specific for the integrin .beta.1 subunit. LM609 and P1F6 are
previously described.
[0036] FIG. 9 is a histogram of the effects of control versus an
.alpha..sub.v.beta..sub.5 peptide antagonist, labeled peptide 189
(SEQ ID NO 9) on melanoma tumor growth as measured by tumor volume
in mm.sup.3 plotted on the Y-axis. The assay and results are
described in Example 8.
[0037] FIG. 10 illustrates the synthesis of Compound 7 as described
in Example 10A-G.
[0038] FIG. 11 illustrates the synthesis of Compound 9 as described
in Example 10A-C; H-I.
[0039] FIG. 12 illustrates the synthesis of Compound 10 as
described in Example 10J.
[0040] FIG. 13 illustrates the synthesis of Compound 12 and
Compound 14 as respectively described in Example 10K-L and
10M-N.
[0041] FIG. 14 shows the chemical structures of Compound 15,
Compound 16, Compound 17 and Compound 18. The detailed synthesis of
said compounds are described in Example 10O-R.
[0042] FIGS. 15A and 15B show the consecutive cDNA sequence of
chicken MMP-2 along with the deduced amino acid sequence shown on
the second line. The third and fourth lines respectively show the
deduced amino acid sequence of human and mouse MMP-2 as described
in Example 7. The chicken cDNA sequence is listed in SEQ ID NO 23
along with the encoded amino acid sequence that is also presented
separately as SEQ ID NO 24. The numbering of the first nucleotide
of the 5' untranslated region and region encoding the proenzyme
shown in FIG. 15A as a negative number is actually presented as
number 1 in Sequence Listing making the latter appear longer than
the figure; however, the nucleotide sequence is the figure is
identical in length and sequence to that as presented in the
listing with the exception of the numbering. Accordingly,
references to nucleotide position for chicken or human MMP-2 in the
specification, such as in primers for use in amplifying MMP-2
fragments, are based on the nucleotide position as indicated in the
figure and not as listed in the Sequence Listing.
[0043] FIG. 16 shows the amino acid residue sequence of mature
human MMP-2 protein having 631 residues. Amino acid residue
positions of human MMP-2-derived fragments correspond to those in
the figure. The amino acid residue sequence is listed in SEQ ID NO
25.
[0044] FIG. 17 shows the effects of peptides 85189 and inert salt
counterpart 121974 on VEGF-induced angiogenesis in the CAM model as
further described in Example 6A. The effect is compared to
untreated (labeled as NT) and control (labeled as 69601) peptide
treated preparations. The effect on angiogenesis is measured by
calculation of the number of branch points as further described in
Example 6A.
[0045] FIGS. 18, 19 and 20 respectively show the reduction in tumor
weight for UCLAP-3, M21-L and FgM tumors following intravenous
exposure to control peptide 69601 and antagonist 85189 as further
described in Example 6D. The data is plotted with tumor weight on
the Y-axis against the peptide treatments on the X-axis.
[0046] FIG. 21 illustrates the effect of peptides and antibodies on
melanoma tumor growth in the chimeric mouse:human model as further
described in Example 8. The peptides assessed included control
69601 (labeled 601) and antagonist 85189 (labeled 189). The
antibody tested was LM609. Tumor volume in mm.sup.3 is plotted on
the Y-axis against the various treatments on the X-axis.
[0047] FIGS. 22A and 22B respectively show the effect of antagonist
85189 (labeled 189) compared to control peptide 69601 (labeled 601)
in reducing the volume and wet weight of M21L tumors over a dosage
range of 10, 50 and 250 .mu.g/injection as further described in
Example 8.
[0048] FIGS. 23A and 23B show the effectiveness of antagonist
peptide 85189 (labeled 189 with a solid line and filled circles)
against control peptide 69601 (labeled 601 on a dotted line and
open squares) at inhibiting M21L tumor volume in the mouse:human
model with two different treatment regimens as further described in
Example 8. Tumor volumes in mm.sup.3 is plotted on the Y-axis
against days on the X-axis.
DETAILED DESCRIPTION OF THE INVENTION
A. Definitions
[0049] Amino Acid Residue: An amino acid formed upon chemical
digestion (hydrolysis) of a polypeptide at its peptide linkages.
The amino acid residues described herein are preferably in the "L"
isomeric form. However, residues in the "D" isomeric form can be
substituted for any L-amino acid residue, as long as the desired
functional property is retained by the polypeptide. NH.sub.2 refers
to the free amino group present at the amino terminus of a
polypeptide. COOH refers to the free carboxy group present at the
carboxy terminus of a polypeptide. In keeping with standard
polypeptide nomenclature (described in J. Biol. Chem., 243:3552-59
(1969) and adopted at 37 CFR .sctn.1.822(b)(2)), abbreviations for
amino acid residues are shown in the following Table of
Correspondence: TABLE-US-00001 TABLE OF CORRESPONDENCE SYMBOL
1-Letter 3-Letter AMINO ACID Y Tyr tyrosine G Gly glycine F Phe
phenylalanine M Met methionine A Ala alanine S Ser serine I Ile
isoleucine L Leu leucine T Thr threonine V Val valine P Pro proline
K Lys lysine H His histidine Q Gln glutamine E Glu glutamic acid Z
Glx Glu and/or Gln W Trp tryptophan R Arg arginine D Asp aspartic
acid N Asn asparagine B Asx Asn and/or Asp C Cys cysteine X Xaa
Unknown or other
[0050] In addition the following have the meanings below:
TABLE-US-00002 BOC tert-butyloxycarbonyl DCCI
dicylcohexylcarbodiimide DMF dimethylformamide OMe methoxy HOBt
1-hydroxybezotriazole
[0051] It should be noted that all amino acid residue sequences are
represented herein by formulae whose left and right orientation is
in the conventional direction of amino-terminus to
carboxy-terminus. Furthermore, it should be noted that a dash at
the beginning or end of an amino acid residue sequence indicates a
peptide bond to a further sequence of one or more amino acid
residues.
[0052] Polypeptide: A linear series of amino acid residues
connected to one another by peptide bonds between the alpha-amino
group and carboxy group of contiguous amino acid residues.
[0053] Peptide: A linear series of no more than about 50 amino acid
residues connected one to the other as in a polypeptide.
[0054] Cyclic peptide: refers to a compound having a heteroatom
ring structure that includes several amide bonds as in a typical
peptide. The cyclic peptide can be a "head to tail" cyclized linear
polypeptide in which a linear peptide's n-terminus has formed an
amide bond with the terminal carboxylate of the linear peptide, or
it can contain a ring structure in which the polymer is homodetic
ore heterodetic and comprises amide bonds and/or other bonds to
close the ring, such as disulfide bridges, thioesters, thioamides,
guanidino, and the like linkages.
[0055] Protein: A linear series,of greater than 50 amino acid
residues connected one to the other as in a polypeptide.
[0056] Fusion protein: refers to a polypeptide containing at least
two different polypeptide domains operatively linked by a typical
peptide bond ("fused"), where the two domains correspond to
peptides no found fused in nature.
[0057] Synthetic peptide: A chemically produced chain of amino acid
residues linked together by peptide bonds that is free of naturally
occurring proteins and fragments thereof.
B. General Considerations
[0058] The present invention relates generally to the discovery
that angiogenesis is mediated by the specific vitronectin receptor
.alpha..sub.v.beta..sub.5, and that inhibition of
.alpha..sub.v.beta..sub.5 function inhibits angiogenesis. This
discovery is important because of the role that angiogenesis plays
in a variety of disease processes. By inhibiting angiogenesis, one
can intervene in the disease, ameliorate the symptoms, and in some
cases cure the disease.
[0059] Where the growth of new blood vessels is the cause of, or
contributes to, the pathology associated with a disease, inhibition
of angiogenesis will reduce the deleterious effects of the disease.
Examples include rheumatoid arthritis, diabetic retinopathy,
inflammatory diseases, restenosis, and the like. Where the growth
of new blood vessels is required to support growth of a deleterious
tissue, inhibition of angiogenesis will reduce the blood supply to
the tissue and thereby contribute to reduction in tissue mass based
on blood supply requirements. Examples include growth of new blood
vessels in response to ischemia, resulting in growth factor-induced
angiogenesis, growth of tumors where neovascularization is a
continual requirement in order that the tumor grow beyond a few
millimeters in thickness, and for the establishment of solid tumor
metastases.
[0060] The methods of the present invention are effective in part
because the therapy is highly selective for angiogenesis and not
other biological processes. As shown in the Examples, only new
vessel growth contains substantial .alpha..sub.v.beta..sub.5, and
therefore the therapeutic methods do not adversely effect mature
vessels.
[0061] The discovery that inhibition of .alpha..sub.v.beta..sub.5
alone will effectively inhibit angiogenesis allows for the
development of therapeutic compositions with potentially high
specificity, and therefore relatively low toxicity. Although the
invention discloses the use of peptide-based reagents which have
the ability to inhibit one or more integrins, one can design other
reagents which more selectively inhibit .alpha..sub.v.beta..sub.5.
Therefore, certain peptide-based reagents do not have the side
effect of inhibiting other biological processes other that those
mediated by .alpha..sub.v.beta..sub.5.
[0062] For example, as shown by the present teachings, it is
possible to prepare monoclonal antibodies highly selective for
immunoreaction with .alpha..sub.v.beta..sub.5, and not
.alpha..sub.v.beta..sub.1, .alpha..sub.v.beta..sub.3, or
.alpha..sub.IIb.beta..sub.3, that are similarly selective for
inhibition of .alpha..sub.v.beta..sub.5 function. In addition,
RGD-containing peptides can be designed to be selective for
inhibition of .alpha..sub.v.beta..sub.5, as described further
herein.
[0063] Prior to the discoveries of the present invention, it was
not known that angiogenesis, and any of the processes dependent on
angiogenesis, could be inhibited in vivo by the use of reagents
that antagonize the biological function of
.alpha..sub.v.beta..sub.5.
C. Methods For Inhibition of Angiogenesis
[0064] The invention provides for a method of inhibiting
angiogenesis in a tissue, and thereby inhibiting events in the
tissue which depend upon angiogenesis. Generally, the method
comprises administering to the tissue a composition comprising an
angiogenesis-inhibiting amount of an .alpha..sub.v.beta..sub.5
antagonist.
[0065] The target tissue used in practicing the methods of this
invention is defined as .alpha..sub.v.beta..sub.5-containing tissue
that is characterized by the detectable presence of
.alpha..sub.v.beta..sub.5 integrin receptor. In other words, an
.alpha..sub.v.beta..sub.5-containing tissue is defined by the
presence of the .alpha..sub.v.beta..sub.5 receptor complex in the
cell membranes. Such tissues include epithelially and mesenchymally
derived cells. The presence of the receptor can be determined by a
number of means including immunoreactivity of the receptor with an
anti-.alpha..sub.v.beta..sub.5 integrin receptor antibody, wherein
the immunoreaction is detected in tissues by microscopy, by
immunoprecipitation, by competition in ligand binding assays and
the like techniques. Preferred antibodies for use in detecting the
presence of .alpha..sub.v.beta..sub.5 in a tissue are described
below and in Example 1. For example, the distribution of
.alpha..sub.v.beta..sub.5 in kidney, skin and ocular tissues by
immunofluorescence microscopy is described in Example 2.
[0066] In the context of the methods of this invention, an
.alpha..sub.v.beta..sub.5-containing tissue is also characterized
as one that has an indicia of angiogenesis. As described earlier,
angiogenesis includes a variety of processes involving
neovascularization of a tissue including "sprouting",
vasculogenesis, or vessel enlargement, all of which angiogenesis
processes are mediated by and dependent upon the expression of
.alpha..sub.v.beta..sub.5. With the exception of traumatic wound
healing, corpus luteum formation and embryogenesis, it is believed
that the majority of angiogenesis processes are associated with
disease processes and therefore the use of the present therapeutic
methods are selective for the disease and do not have deleterious
side effects.
[0067] There are a variety of diseases in which angiogenesis is
believed to be important, referred to as angiogenic diseases,
including but not limited to, inflammatory disorders such as immune
and non-immune inflammation, chronic articular rheumatism and
psoriasis, disorders associated with inappropriate or inopportune
invasion of vessels such as restenosis, capillary proliferation in
atherosclerotic plaques and osteoporosis, and cancer associated
disorders, such as solid tumors, solid tumor metastases,
angiofibromas, retrolental fibroplasia, hemangiomas, Kaposi sarcoma
and the like cancers which require neovascularization to support
tumor growth.
[0068] Eye diseases characterized by neovascularization present a
particularly preferred target for therapy. Ocular
neovascularization is the most common pathological change observed
in the vast majority of eye diseases that result in catastrophic
loss of vision. The growth of new blood vessels from the
preexisting choroidal, retinal or paralimbal vessels can lead to
edema, hemorrhage or fibrovascular membrane formation resulting in
disruption of the normal anatomic relationships of the eye and
concomitant loss of normal visual function.
[0069] Eye diseases characterized by angiogenesis include corneal
neovascular disorders that include corneal transplantation,
herpetic keratitis, luetic keratitis, pterygium, neovascular pannus
associated with contact lens use, and the like. Additional eye
diseases also include diabetic retinopathy (DR), age-related
macular degeneration (ARMD), presumed ocular histoplasmosis (POHS),
retinopathy of prematurity (ROP) and neovascular glaucoma and the
like. While inhibition of angiogenesis in these diseases would not
necessarily cure the underlying disease, it would significantly
reduce the visual morbidity associated with them.
[0070] For example, 90% of the 300,000 persons having diabetes for
over 25 years will have some form of DR that is a retinal disease
characterized by leaking and/or proliferating blood vessels. Thirty
percent of these patients will in fact have the latter condition
that can be ameliorated with the therapeutic methods of this
invention. For ARDM, 25% of the population over 65, approximately
630,000, will have some form of the disease with the expectation
that by the year 2030, over 6.3 million individuals will have ARDM.
As a result, having the ability to inhibit
.alpha..sub.v.beta..sub.5-associated angiogenesis with the
therapeutic compositions and methods of this invention has great
medicinal value.
[0071] Thus, methods which inhibit angiogenesis in a diseased
tissue ameliorate symptoms of the disease and, depending upon the
disease, can contribute to cure of the disease. In one embodiment,
the invention contemplates inhibition of angiogenesis, per se, in a
tissue. The extent of angiogenesis in a tissue, and therefore the
extent of inhibition achieved by the present methods, can be
evaluated by a variety of methods, such as are described in the
Examples for detecting .alpha..sub.v.beta..sub.5-immunopositive
nascent and immature vessel structures by
imnnunohistochemistry.
[0072] As described herein, any of a variety of tissues, or organs
comprised of organized tissues, can support angiogenesis in disease
conditions including skin, muscle, gut, connective tissue, joints,
bones and the like tissue in which blood vessels can invade upon
angiogenic stimuli.
[0073] In particular, the methods and .alpha..sub.v.beta..sub.5
antagonist compositions of this invention are therapeutically
useful for inhibiting angiogenesis that has been induced by growth
factors, also referred to as cytokines. Under physiological
conditions, angiogenesis is highly regulated and as previously
published by Brooks et al., Science, 264:569-5761 (1994), has been
shown to be activated by specific angiogenic molecules such as
basic fibroblast growth factor (bFGF). Negative regulators of
angiogenesis have also been described. Angiogenesis is thus
regulated by an intricate balance between local stimulators and
inhibitors. See, D'Amore, Investigative Ophthal. Visual Sci.,
35:3974-3979 (1994).
[0074] When the physiologic balance of angiogenic stimulators and
inhibitors that tightly control the normally quiescent capillary
vascular is disturbed, as occurs is certain disease states,
capillary endothelial cells are induced to proliferate, migrate and
ultimately differentiate to form new blood vessels.
[0075] Angiogenesis is characterized as an event cascade having a
set of early events followed by a set of late events as reviewed by
Leibovich, "Role of Cytokines in the Process of Tumor
Angiogenesis", in "Human Cytokines: Their Role in Disease and
Therapy", eds. Aggarwal and Puri, Chapter 35, Blackwell Science,
Inc. (1995). The early events are preceded by the delivery of
angiogenic growth factors and cytokines delivered from an
extravascular source. The early events then proceed in the target
microvasculature with the disruption of intercellular junctions,
induction of expression of endothelial cell activation antigens and
a proteolytic phenotype, and initiation of endothelial cell
migration in a directional manner. The late events are
characterized with autocrine and paracrine expression of growth
factor and cytokine genes within the cells, endothelial cells,
pericytes and smooth muscle cells, of the developing capillary bud.
These cells in turn modulate the interactions of the cells with the
extracellular matrix resulting in the formation of new functional
capillary loops from existing mature vessels.
[0076] As discussed herein and in the Background, reports in the
literature describe an association between the appearance of growth
factors, including those associated with an increase of
.alpha..sub.v.beta..sub.5 expression, namely VEGF, TGF-.alpha. and
EGF, with the expansion of a tumor mass and in the onset of
angiogenesis in proliferative neovascular eye diseases, both in
humans and experimental animals.
[0077] Thus, VEGF, EGF, TGF-.alpha., among many others, are
considered growth factors which are characterized by their
properties of stimulating cellular growth. Growth factors are
proteins that are secreted by one cell that act on the secreting
cell or another cell. Their ability to act is dependent on the
presence of growth factor receptors that are usually transmembrane
proteins. Growth factors such as VEGF are also referred to
generally as cytokines that are defined as polypeptide hormones,
secreted by a cell, that affect growth and metabolism either of the
same (autocrine) or of another (paracrine) cell. The term cytokine
is not limited to molecules produced by cells of the immune system
and the biological response modifiers of the same system. Thus, the
term cytokine is a broad category of which one subcategory based on
the type of biological response is stimulatory growth factors or
enhancers such as VEGF, bFGF, EGF, TGF-.alpha., and the like. For
review see, Aggarwal et al., "Common and Uncommon Features of
Cytokines and Cytokine Receptors: An Overview", in "Human
Cytokines: Their Role in Disease and Therapy", eds. Aggarwal and
Puri, Chapter 1, Blackwell Science, Inc. (1995).
[0078] In the present invention, .alpha..sub.v.beta..sub.5-specific
antagonists, and not growth factor antagonists such as antibodies
against VEGF, are contemplated for use in inhibiting angiogenesis
in a tissue. In preferred embodiments, the
.alpha..sub.v.beta..sub.5 antagonists described herein are useful
for inhibiting growth factor-induced angiogenesis in which the
expression of the .alpha..sub.v.beta..sub.5 integrin receptor is
induced. Preferred growth factors in this context include VEGF,
EGF, TGF-.alpha. and the like.
[0079] As discussed in the Background, the growth factors EGF and
VEGF are both known to bind to their cellular receptors that act as
tyrosine kinases. Activation of the EGF receptor has further been
shown to be correlated with activation of protein kinase C that
results in activation of .alpha..sub.v.beta..sub.5 to allow for
migration of specific cells on a vitronectin substrate. Thus, the
mechanism of action between exposure to cytokines or growth factors
and the coordinate response in integrin expression or activation is
a complex biological process. As shown in the present invention
(see Example 6A), treatment of tissues in either the rabbit eye
model or the chick chorioallantoic model with the cytokine VEGF
results in the .alpha..sub.v.beta..sub.5-potentiated angiogenesis
that is dependent on activation of protein kinase C.
[0080] In a particularly preferred embodiment, the present
invention contemplates the use of .alpha..sub.v.beta..sub.5
antagonists for inhibiting angiogenesis in any tissue in which
angiogenesis has been induced by VEGF. For example, ischemia of the
retina in various animal model systems has been shown to result in
the upregulation of VEGF that is secreted from Muller cells, the
production of which consequently induces neovascularization of
tissues within the eye. See, Miller et al., Am. J. Path.,
145:574-584 (1994) and Pierce et al., Proc. Natl. Acad. Sci., USA,
92:905-909 (1995).
[0081] Thus, in the present invention, a tissue to be treated is a
retinal tissue of a patient with diabetic retinopathy, macular
degeneration, neovascular glaucoma or the like diseases as
discussed above and the angiogenesis to be inhibited is retinal
tissue angiogenesis where there is neovascularization of retinal
tissue. Exemplary tissues, including corneal tissues, from patients
with ocular neovascularization conditions or diseases are described
above and in the Examples. An exemplary model system for assessing
the effects of an .alpha..sub.v.beta..sub.5 antagonist of this
invention for treating retinal angiogenesis is the murine model of
retinal neovascularization as described in Example 9.
[0082] In another related embodiment, a tissue to be treated is an
inflamed tissue and the angiogenesis to be inhibited is inflamed
tissue angiogenesis where there is neovascularization of inflamed
tissue. In this class, the method contemplates inhibition of
angiogenesis in arthritic tissues, such as in a patient with
chronic articular rheumatism, in immune or non-immune inflamed
tissues, in psoriatic tissue and the like.
[0083] The cytokines, interleukin 1 and tumor necrosis
factor-.alpha., are thought to be associated with rheumatoid
arthritis with their direct role in joint destructions based on the
induction of adhesion molecule expression on endothelial cells and
on enzyme release. See, Arend et al., Arthritis & Rheumatism,
38:151-160 (1995). Therapeutic regimens have been proposed for
blocking both the cytokines with cytokine-specific inhibitors as
well as targeting cell adhesion molecules that are expressed in the
condition. See, Haskard et al., Cell Adhesion Comm., 2:235-238
(1994).
[0084] Thus, inhibition of angiogenesis in arthritic conditions by
addressing and directing the therapy to the involvement of the
.alpha..sub.v.beta..sub.5 adhesion molecule is another preferred
embodiment of the invention as prior to this invention.
[0085] In an additional related embodiment, a tissue to be treated
is a tumor tissue of a patient with a solid tumor, a metastases, a
skin cancer, a breast cancer, a hemangioma or angiofibroma and the
like cancer, and the angiogenesis to be inhibited is tumor tissue
angiogenesis where there is neovascularization of a tumor tissue.
Typical solid tumor tissues treatable by the present methods
include lung, pancreas, breast, colon, laryngeal, ovarian, and the
like tissues.
[0086] The role of the complex cytokine network that exists in
solid human tumors is the subject of a review by Leek et al., J.
Leukocyte Biol., 56:423-435 (1994), the disclosure of which is
hereby incorporated by reference. A number of cytokines including
VEGF, acidic as well as basic FGF (bFGF), TGF-.alpha. and -.beta.,
EGF, TNF-.alpha., platelet derived endothelial cell growth factor,
angiogenin, interferons .alpha. and .gamma., interleukins 1, 6 and
8 and the like are thought to influence various cellular mechanisms
of angiogenesis in malignant tissues and cell lines. For example,
in addition to its localization of various kinds of tumors, VEGF
has recently been shown to be linked to angiogenesis in breast
carcinoma as described by Brown et al. Human Path., 26:86-91
(1995).
[0087] Tumors that secrete various cytokines and therein induce
localized angiogenesis in response, specifically in the present
invention with the cytokines VEGF, TGF-.alpha. and EGF and the
resultant .alpha..sub.v.beta..sub.5-mediated angiogenesis, are
identifiable by screening tumor tissue samples with anti-cytokine
antibodies. Such methods are familiar to one of ordinary skill in
the art for either cultured or biopsied tumor tissue samples.
Antibodies against the above-described cytokines are commercially
available through Oncogene Sciences (Uniondale, N.Y.) or Upstate
Biotech Incorporated (Lake Placid, N.Y.). The screening of selected
tumor tissues by these means thereby allows one to assess the
potential of angiogenesis inhibitory activity by the
.alpha..sub.v.beta..sub.5 antagonists of this invention.
[0088] Exemplary tumor tissue angiogenesis, and inhibition thereof,
is described in the Examples.
[0089] Inhibition of tumor tissue angiogenesis is still another
preferred embodiment of the invention because of the important role
neovascularization plays in tumor growth. In the absence of
neovascularization of tumor tissue, the tumor tissue does not
obtain the required nutrients, slows in growth, ceases additional
growth, regresses and ultimately becomes necrotic resulting in
killing of the tumor.
[0090] Stated in other words, the present invention provides for a
method of inhibiting tumor neovascularization by inhibiting tumor
angiogenesis according to the present methods. Similarly, the
invention provides a method of inhibiting tumor growth by
practicing the angiogenesis-inhibiting methods.
[0091] The methods are also particularly effective against the
formation of metastases because (1) their formation requires
vascularization of a primary tumor so that the metastatic cancer
cells can exit the primary tumor and (2) their establishment in a
secondary site requires neovascularization to support growth of the
metastases. In a related embodiment, the invention contemplates the
practice of the method in conjunction with other therapies such as
conventional chemotherapy directed against solid tumors and for
control of establishment of metastases. The administration of
angiogenesis inhibitor is typically conducted during or after
chemotherapy, although it is preferable to inhibit angiogenesis
after a regimen of chemotherapy at times where the tumor tissue
will be responding to the toxic assault by inducing angiogenesis to
recover by the provision of a blood supply and nutrients to the
tumor tissue. In addition, it is preferred to administer the
angiogenesis inhibition methods after surgery where solid tumors
have been removed as a prophylaxis against metastases.
[0092] Insofar as the present methods apply to inhibition of tumor
neovascularization, the methods can also apply to inhibition of
tumor tissue growth, to inhibition of tumor metastases formation,
and to regression of established tumors. For the latter, the
diminishment of a tumor mass is evaluated in the rabbit eye assay
model as described for use in this invention or with a model system
of a chimeric mouse:human model in which skin of a mouse having
severe combined immunodeficiency (SCID) is replaced with human
neonatal foreskin as described by Yan et al., J. Clin. Invest.,
91:986-996 (1993), the disclosure of which is hereby incorporated
by reference. The latter model presents an additional in vivo model
to investigate angiogenesis and inhibition thereof with the methods
of this invention. Exemplary results with the rabbit tumor model
and an .alpha..sub.v.beta..sub.5 antagonists of this invention are
presented in Examples 5C and 6D while results for inbition of
angiogenesis in the SCID mouse model is described in Example 8.
[0093] Restenosis is a process of smooth muscle cell (SMC)
migration and proliferation at the site of percutaneous
transluminal coronary angioplasty which hampers the success of
angioplasty. The migration and proliferation of SMC's during
restenosis can be considered a process of angiogenesis which is
inhibited by the present methods. Therefore, the invention also
contemplates inhibition of restenosis by inhibiting angiogenesis
according to the present methods in a patient following angioplasty
procedures. For inhibition of restenosis, the
.alpha..sub.v.beta..sub.5 antagonist is typically administered
after the angioplasty procedure for from about 2 to about 28 days,
and more typically for about the first 14 days following the
procedure.
[0094] The patient treated in the present invention in its many
embodiments is desirably a human patient, although it is to be
understood that the principles of the invention indicate that the
invention is effective with respect to all mammals, which are
intended to be included in the term "patient". In this context, a
mammal is understood to include any mammalian species in which
treatment of diseases, particularly agricultural and domestic
mammalian species, is sought with respect to the methods of this
invention.
[0095] The present method for inhibiting angiogenesis in a tissue,
and therefore for also practicing the methods for treatment of
angiogenesis-related diseases, comprises contacting a tissue in
which angiogenesis is occurring, or is at risk for occurring, with
a composition comprising a therapeutically effective amount of an
.alpha..sub.v.beta..sub.5 antagonist capable of inhibiting
.alpha..sub.v.beta..sub.5 binding to its natural ligand. Thus, the
method comprises administering to a patient a therapeutically
effective amount of a physiologically tolerable composition
containing an .alpha..sub.v.beta..sub.5 antagonist of the
invention.
[0096] The dosage ranges for the administration of the
.alpha..sub.v.beta..sub.5 antagonist depend upon the form of the
antagonist, and its potency, as described further herein, and are
amounts large enough to produce the desired effect in which
angiogenesis and the disease symptoms mediated by angiogenesis are
ameliorated. The dosage should not be so large as to cause adverse
side effects, such as hyperviscosity syndromes, pulmonary edema,
congestive heart failure, and the like. Generally the dosage will
vary with the age, condition, sex and extent of the disease in the
patient and can be determined by one of skill in the art. The
dosage can also be adjusted by the individual physician in the
event of any complication.
[0097] An .alpha..sub.v.beta..sub.5 antagonist is a molecule that
blocks or inhibits the physiologic or pharmacologic activity of
.alpha..sub.v.beta..sub.5 by inhibiting the binding activity of the
receptor to its ligand namely vitronectin. Preferred
.alpha..sub.v.beta..sub.5 antagonists can either be a monoclonal
antibody, a peptide or an organic-based molecule that is a mimetic
of an .alpha..sub.v.beta..sub.5 ligand.
[0098] A therapeutically effective amount is an amount of
.alpha..sub.v.beta..sub.5 antagonist sufficient to produce a
measurable inhibition of angiogenesis in the tissue being treated.
i.e., an angiogenesis-inhibiting amount. Inhibition of angiogenesis
can be measured in situ by immunohistochemistry, as described
herein, or by other methods known to one skilled in the art.
[0099] Insofar as an .alpha..sub.v.beta..sub.5 antagonist can take
the form of an .alpha..sub.v.beta..sub.5 ligand organic mimetic, an
RGD-containing peptide, an anti-.alpha..sub.v.beta..sub.5
monoclonal antibody, or fragment thereof, or an
.alpha..sub.v.beta..sub.5 receptor mimetic it is to be appreciated
that the potency, and therefore an expression of a "therapeutically
effective" amount can vary. However, as shown by the present assay
methods, one skilled in the art can readily assess the potency of a
candidate .alpha..sub.v.beta..sub.5 antagonist of this
invention.
[0100] Potency of an .alpha..sub.v.beta..sub.5 antagonist can be
measured by a variety of means including inhibition of angiogenesis
in the CAM assay, in the in vivo rabbit eye assay, and by measuring
inhibition of binding of natural ligand to
.alpha..sub.v.beta..sub.5, all as described herein, and the like
assays.
[0101] A preferred .alpha..sub.v.beta..sub.5 antagonist has the
ability to substantially inhibit binding of a natural ligand such
as vitronectin to .alpha..sub.v.beta..sub.5 in solution at
antagonist concentrations of less than 0.5 micromolar (.mu.M),
preferably less than 0.1 .mu.M, and more preferably less than 0.05
.mu.M. By "substantially" is meant that at least a 50 percent
reduction in binding of vitronectin is observed by inhibition in
the presence of the .alpha..sub.v.beta..sub.5 antagonist, and-at
50% inhibition is referred to herein as an IC.sub.50 value.
[0102] A more preferred .alpha..sub.v.beta..sub.5 antagonist
exhibits selectivity for .alpha..sub.v.beta..sub.5 over other
integrins. Thus, a preferred .alpha..sub.v.beta..sub.5 antagonist
substantially inhibits vitronectin binding to
.alpha..sub.v.beta..sub.5 but does not substantially inhibit
binding of vitronectin to another integrin, such as
.alpha..sub.v.beta..sub.1, .alpha..sub.v.beta..sub.3 or
.alpha..sub.IIb.beta..sub.3. Particularly preferred is an
.alpha..sub.v.beta..sub.5 antagonist that exhibits a 10-fold to
100-fold lower IC.sub.50 activity at inhibiting vitronectin binding
to .alpha..sub.v.beta..sub.5 compared to the IC.sub.50 activity at
inhibiting vitronectin binding to another integrin. Exemplary
assays for measuring IC.sub.50 activity at inhibiting vitronectin
binding to an integrin are described in the Examples.
[0103] A therapeutically effective amount of an
.alpha..sub.v.beta..sub.5 antagonist of this invention in the form
of a monoclonal antibody is typically an amount such that when
administered in a physiologically tolerable composition is
sufficient to achieve a plasma concentration of from about 0.01
microgram (.mu.g) per milliliter (ml) to about 100 .mu.g/ml,
preferably from about 1 .mu.g/ml to about 5 .mu.g/ml, and usually
about 5 .mu.g/ml. Stated differently, the dosage can vary from
about 0.1 mg/kg to about 300 mg/kg, preferably from about 0.2 mg/kg
to about 200 mg/kg, most preferably from about 0.5 mg/kg to about
20 mg/kg, in one or more dose administrations daily, for one or
several days.
[0104] Where the antagonist is in the form of a fragment of a
monoclonal antibody, the amount can readily be adjusted based on
the mass of the fragment relative to the mass of the whole
antibody. A preferred plasma concentration in molarity is from
about 2 micromolar (.mu.M) to about 5 millimolar (mM) and
preferably about 100 .mu.M to 1 mM antibody antagonist.
[0105] A therapeutically effective amount of an
.alpha..sub.v.beta..sub.5 antagonist of this invention in the form
of a polypeptide, or other similarly-sized small molecule
.alpha..sub.v.beta..sub.5 ligand mimetic, is typically an amount of
polypeptide such that when administered in a physiologically
tolerable composition is sufficient to achieve a plasma
concentration of from about 0.1 microgram (.mu.g) per milliliter
(ml) to about 200 .mu.g/ml, preferably from about 1 .mu.g/ml to
about 150 .mu.g/ml. Based on a polypeptide having a mass of about
500 grams per mole, the preferred plasma concentration in molarity
is from about 2 micromolar (.mu.M) to about 5 millimolar (mM) and
preferably about 100 .mu.M to 1 mM polypeptide antagonist. Stated
differently, the dosage per body weight can vary from about 0.1
mg/kg to about 300 mg/kg, and preferably from about 0.2 mg/kg to
about 200 mg/kg, in one or more dose administrations daily, for one
or several days.
[0106] The monoclonal antibodies, polypeptides or organic mimetics
of this invention can be administered parenterally by injection or
by gradual infusion over time. Although the tissue to be treated
can typically be accessed in the body by systemic administration
and therefore most often treated by intravenous administration of
therapeutic compositions, other tissues and delivery means are
contemplated where there is a likelihood that the tissue targeted
contains the target molecule. Thus, monoclonal antibodies,
polypeptides or organic mimetics of this invention can be
administered intraocularly, intravenously, intraperitoneally,
intramuscularly, subcutaneously, intracavity, transdermally, and
can also be delivered by peristaltic means.
[0107] The therapeutic compositions containing an
.alpha..sub.v.beta..sub.5 antagonist of this invention are
conventionally administered intravenously, as by injection of a
unit dose, for example. The term "unit dose" when used in reference
to a therapeutic composition of the present invention refers to
physically discrete units suitable as unitary dosage for the
subject, each unit containing a predetermined quantity of active
material calculated to produce the desired therapeutic effect in
association with the required diluent, i.e., carrier, or
vehicle.
[0108] In one preferred embodiment as shown in the Examples, the
.alpha..sub.v.beta..sub.5 antagonist is administered in a single
dosage intravenously.
[0109] The compositions are administered in a manner compatible
with the dosage formulation and in a therapeutically effective
amount. The quantity to be administered and timing of
administration depends on the subject to be treated, capacity of
the subject's system to utilize the active ingredient, and degree
of therapeutic effect desired. Precise amounts of active ingredient
required to be administered depend on the judgement of the
practitioner and are peculiar to each individual. However, suitable
dosage ranges for systemic application are disclosed herein and
depend on the route of administration. Suitable regimens for
administration are also variable but are typified by an initial
administration followed by repeated doses at one or more hour
intervals by a subsequent injection or other administration.
Alternatively, continuous intravenous infusion sufficient to
maintain concentrations in the blood in the ranges specified for in
vivo therapies are contemplated.
D. Therapeutic Compositions
[0110] The present invention contemplates therapeutic compositions
useful for practicing the therapeutic methods described herein.
Therapeutic compositions of the present invention contain a
physiologically tolerable carrier together with an
.alpha..sub.v.beta..sub.5 antagonist as described herein, dissolved
or dispersed therein as an active ingredient. In a preferred
embodiment, the therapeutic .alpha..sub.v.beta..sub.5 antagonist
composition is not immunogenic when administered to a mammal or
human patient for therapeutic purposes.
[0111] As used herein, the terms "pharmaceutically acceptable",
"physiologically tolerable" and grammatical variations thereof, as
they refer to compositions, carriers, diluents and reagents, are
used interchangeably and represent that the materials are capable
of administration to or upon a mammal without the production of
undesirable physiological effects such as nausea, dizziness,
gastric upset and the like.
[0112] The preparation of a pharmacological composition that
contains active ingredients dissolved or dispersed therein is well
understood in the art and need not be limited based on formulation.
Typically such compositions are prepared as injectables either as
liquid solutions or suspensions, however, solid forms suitable for
solution, or suspensions, in liquid prior to use can also be
prepared. The preparation can also be emulsified.
[0113] The active ingredient can be mixed with excipients which are
pharmaceutically acceptable and compatible with the active
ingredient and in amounts suitable for use in the therapeutic
methods described herein. Suitable excipients are, for example,
water, saline, dextrose, glycerol, ethanol or the like and
combinations thereof. In addition, if desired, the composition can
contain minor amounts of auxiliary substances such as wetting or
emulsifying agents, pH buffering agents and the like which enhance
the effectiveness of the active ingredient.
[0114] The therapeutic composition of the present invention can
include pharmaceutically acceptable salts of the components
therein. Pharmaceutically acceptable salts include the acid
addition salts (formed with the free amino groups of the
polypeptide) that are formed with inorganic acids such as, for
example, hydrochloric or phosphoric acids, or such organic acids as
acetic, tartaric, mandelic and the like. Salts formed with the free
carboxyl groups can also be derived from inorganic bases such as,
for example, sodium, potassium, ammonium, calcium or ferric
hydroxides, and such organic bases as isopropylamine,
trimethylamine, 2-ethylamino ethanol, histidine, procaine and the
like.
[0115] Particularly preferred is the HCl salt when used in the
preparation of cyclic polypeptide .alpha..sub.v.beta..sub.5
antagonists.
[0116] Physiologically tolerable carriers are well known in the
art. Exemplary of liquid carriers are sterile aqueous solutions
that contain no materials in addition to the active ingredients and
water, or contain a buffer such as sodium phosphate at
physiological pH value, physiological saline or both, such as
phosphate-buffered saline. Still further, aqueous carriers can
contain more than one buffer salt, as well as salts such as sodium
and potassium chlorides, dextrose, polyethylene glycol and other
solutes.
[0117] Liquid compositions can also contain liquid phases in
addition to and to the exclusion of water. Exemplary of such
additional liquid phases are glycerin, vegetable oils such as
cottonseed oil, and water-oil emulsions.
[0118] A therapeutic composition contains an
angiogenesis-inhibiting amount of an .alpha..sub.v.beta..sub.5
antagonist of the present invention, typically formulated to
contain an amount of at least 0.1 weight percent of antagonist per
weight of total therapeutic composition. A weight percent is a
ratio by weight of inhibitor to total composition. Thus, for
example, 0.1 weight percent is 0.1 grams of inhibitor per 100 grams
of total composition.
E. Antagonists of Integrin .alpha..sub.v.beta..sub.5
[0119] .alpha..sub.v.beta..sub.5 antagonists are used in the
present methods for inhibiting angiogenesis in tissues, and can
take a variety of forms that include compounds which interact with
.alpha..sub.v.beta..sub.5 in a manner such that functional
interactions with the natural .alpha..sub.v.beta..sub.5 ligands are
interfered. Exemplary antagonists include analogs or mimetics of
.alpha..sub.v.beta..sub.5 derived from the ligand binding site on
.alpha..sub.v.beta..sub.5, mimetics of a natural ligand of
.alpha..sub.v.beta..sub.5 that mimic the structural region involved
in .alpha..sub.v.beta..sub.5-ligand binding interactions,
polypeptides having a sequence corresponding to a functional
binding domain of the natural ligand specific for
.alpha..sub.v.beta..sub.5, particularly corresponding to the
RGD-containing domain of a natural ligand of
.alpha..sub.v.beta..sub.5, and antibodies which immunoreact with
either .alpha..sub.v.beta..sub.5 or the natural ligand, all of
which exhibit antagonist activity as defined herein.
1. Polypeptides
[0120] In one embodiment, the invention contemplates
.alpha..sub.v.beta..sub.5 antagonists in the form of polypeptides.
A polypeptide (peptide) .alpha..sub.v.beta..sub.5 antagonist can
have the sequence characteristics of either the natural ligand of
.alpha..sub.v.beta..sub.5 or .alpha..sub.v.beta..sub.5 itself at
the region involved in .alpha..sub.v.beta..sub.5-ligand interaction
and exhibits .alpha..sub.v.beta..sub.5 antagonist activity as
described herein. A preferred .alpha..sub.v.beta..sub.5 antagonist
peptide contains the RGD tripeptide and corresponds in sequence to
the natural ligand in the RGD-containing region.
[0121] Preferred RGD-containing polypeptides have a sequence
corresponding to the amino acid residue sequence of the
RGD-containing region of a natural ligand of
.alpha..sub.v.beta..sub.5 such as vitronectin, for which the
sequence is well known.
[0122] A particularly preferred .alpha..sub.v.beta..sub.5
antagonist peptide preferentially inhibits
.alpha..sub.v.beta..sub.5 binding to its natural ligand(s) when
compared to other integrins, as described earlier. These
.alpha..sub.v.beta..sub.5-specific peptides are particularly
preferred at least because the specificity for
.alpha..sub.v.beta..sub.5 reduces the incidence of undesirable side
effects such as inhibition of other integrins. The identification
of preferred .alpha..sub.v.beta..sub.5 antagonist peptides having
selectivity for .alpha..sub.v.beta..sub.5 can readily be identified
in a typical inhibition of binding assay, such as the ELISA assay
described in the Examples.
[0123] A polypeptide of the present invention typically comprises
no more than about 100 amino acid residues, preferably no more than
about 60 residues, more preferably no more than about 30 residues.
Peptides can be linear or cyclic, although particularly preferred
peptides are cyclic. Preferred peptides are described in the
Examples.
[0124] Where the polypeptide is greater than about 100 residues, it
is typically provided in the form of a fusion protein or protein
fragment, as described herein.
[0125] It should be understood that a subject polypeptide need not
be identical to the amino acid residue sequence of a
.alpha..sub.v.beta..sub.5 natural ligand, so long as it includes a
sequence necessary for antagonizing the binding of an
.alpha..sub.v.beta..sub.5 ligand to .alpha..sub.v.beta..sub.5 and
is able to function as an .alpha..sub.v.beta..sub.5 antagonist in
an assay such as those described herein.
[0126] A subject polypeptide includes any analog, fragment or
chemical derivative of a polypeptide whose amino acid residue
sequence is shown herein so long as the polypeptide is an
.alpha..sub.v.beta..sub.5 antagonist. Therefore, a present
polypeptide can be subject to various changes, substitutions,
insertions, and deletions where such changes provide for certain
advantages in its use. In this regard, an .alpha..sub.v.beta..sub.5
antagonist polypeptide of this invention corresponds to, rather
than is identical to, the sequence of a recited peptide where one
or more changes are made and it retains the ability to function as
an .alpha..sub.v.beta..sub.5 antagonist in one or more of the
assays as defined herein.
[0127] Thus, a polypeptide can be in any of a variety of forms of
peptide derivatives, that includes amides, conjugates with
proteins, cyclic peptides, polymerized peptides, analogs,
fragments, chemically modified peptides, and the like
derivatives.
[0128] The term "analog" includes any polypeptide having an amino
acid residue sequence substantially identical to a sequence
specifically shown herein in which one or more residues have been
conservatively substituted with a functionally similar residue and
which displays the .alpha..sub.v.beta..sub.5 antagonist activity as
described herein. Examples of conservative substitutions include
the substitution of one non-polar (hydrophobic) residue such as
isoleucine, valine, leucine or methionine for another, the
substitution of one polar (hydrophilic) residue for another such as
between arginine and lysine, between glutamine and asparagine,
between glycine and serine, the substitution of one basic residue
such as lysine, arginine or histidine for another, or the
substitution of one acidic residue, such as aspartic acid or
glutamic acid for another.
[0129] The phrase "conservative substitution" also includes the use
of a chemically derivatized residue in place of a non-derivatized
residue provided that such polypeptide displays the requisite
inhibition activity.
[0130] A "chemical derivative" refers to a subject polypeptide
having one or more residues chemically derivatized by reaction of a
functional side group. In additioin to side group derivitations, a
chemical derivative can have one or more backbone modifications
including .alpha.-amino substitutions such as N-methyl, N-ethyl,
N-propyl and the like, and .alpha.-carbonyl substitutions such as
thioester, thioamide, guanidino and the like. Such derivatized
molecules include for example, those molecules in which free amino
groups have been derivatized to form amine hydrochlorides,
p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl
groups, chloroacetyl groups or formyl groups. Free carboxyl groups
may be derivatized to form salts, methyl and ethyl esters or other
types of esters or hydrazides. Free hydroxyl groups may be
derivatized to form O-acyl or O-alkyl derivatives. The imidazole
nitrogen of histidine may be derivatized to form
N-im-benzylhistidine. Also included as chemical derivatives are
those peptides which contain one or more naturally occurring amino
acid derivatives of the twenty standard amino acids. For example:
4-hydroxyproline may be substituted for proline; 5-hydroxylysine
may be substituted for lysine; 3-methylhistidine may be substituted
for histidine; homoserine may be substituted for serine; and
ornithine may be substituted for lysine. Polypeptides of the
present invention also include any polypeptide having one or more
additions and/or deletions or residues relative to the sequence of
a polypeptide whose sequence is shown herein, so long as the
requisite activity is maintained.
[0131] A particularly preferred derivative is a cyclic peptide
according to the formula cyclo(Arg-Gly-Asp-D-Phe-NMeVal),
abbreviated c(RGDf-NMeV), in which there is an N-methyl substituted
.alpha.-amino group on the valine residue of the peptide and
cyclization has joined the primary amino and carboxy termini of the
peptide.
[0132] The term "fragment" refers to any subject polypeptide having
an amino acid residue sequence shorter than that of a polypeptide
whose amino acid residue sequence is shown herein.
[0133] When a polypeptide of the present invention has a sequence
that is not identical to the sequence of an
.alpha..sub.v.beta..sub.5 natural ligand, it is typically because
one or more conservative or non-conservative substitutions have
been made, usually no more than about 30 number percent, and
preferably no more than 10 number percent of the amino acid
residues are substituted. Additional residues may also be added at
either terminus of a polypeptide for the purpose of providing a
"linker" by which the polypeptides of this invention can be
conveniently affixed to a label or solid matrix, or carrier.
[0134] Labels, solid matrices and carriers that can be used with
the polypeptides of this invention are described hereinbelow.
[0135] Amino acid residue linkers are usually at least one residue
and can be 40 or more residues, more often 1 to 10 residues, but do
not form .alpha..sub.v.beta..sub.5 ligand epitopes. Typical amino
acid residues used for linking are tyrosine, cysteine, lysine,
glutamic and aspartic acid, or the like. In addition, a subject
polypeptide can differ, unless otherwise specified, from the
natural sequence of an .alpha..sub.v.beta..sub.5 ligand by the
sequence being modified by terminal-NH.sub.2 acylation, e.g.,
acetylation, or thioglycolic acid amidation, by
terminal-carboxylamidation, e.g., with ammonia, methylamine, and
the like terminal modifications. Terminal modifications are useful,
as is well known, to reduce susceptibility by proteinase digestion,
and therefore serve to prolong half life of the polypeptides in
solutions, particularly biological fluids where proteases may be
present. In this regard, polypeptide cyclization is also a useful
terminal modification, and is particularly preferred also because
of the stable structures formed by cyclization and in view of the
biological activities observed for such cyclic peptides as
described herein.
[0136] Any peptide of the present invention may be used in the form
of a pharmaceutically acceptable salt. Suitable acids which are
capable of forming salts with the peptides of the present invention
include inorganic acids such as trifluoroacetic acid (TFA)
hydrochloric acid (HCl), hydrobromic acid, perchloric acid, nitric
acid, thiocyanic acid, sulfuric acid, methane sulfonic acid, acetic
acid, phosphoric acetic acid, propionic acid, glycolic acid, lactic
acid, pyruvic acid, oxalic acid, malonic acid, succinic acid,
maleic acid, fumaric acid, anthranilic acid, cinnamic acid,
naphthalene sulfonic acid, sulfanilic acid or the like. HCl salt is
particularly preferred.
[0137] Suitable bases capable of forming salts with the peptides of
the present invention include inorganic bases such as sodium
hydroxide, ammonium hydroxide, potassium hydroxide and the like;
and organic bases such as mono-, di- and tri-alkyl and aryl amines
(e.g. triethylamine, diisopropyl amine, methyl amine, dimethyl
amine and the like) and optionally substituted ethanolamines (e.g.
ethanolamine, diethanolamine and the like).
[0138] In addition, a peptide of this invention can be prepared as
described in the Examples without including a free ionic salt in
which the charged acid or base groups present in the amino acid
residue side groups (e.g., Arg, Asp, and the like) associate and
neutralize each other to form an "inner salt" compound.
[0139] A peptide of the present invention also referred to herein
as a subject polypeptide, can be synthesized by any of the
techniques that are known to those skilled in the polypeptide art,
including recombinant DNA techniques. Synthetic chemistry
techniques, such as a solid-phase Merrifield-type synthesis, are
preferred for reasons of purity, antigenic specificity, freedom
from undesired side products, ease of production and the like. An
excellent summary of the many techniques available can be found in
Steward et al., "Solid Phase Peptide Synthesis", W. H. Freeman Co.,
San Francisco, 1969; Bodanszky, et al., "Peptide Synthesis", John
Wiley & Sons, Second Edition, 1976; J. Meienhofer, "Hormonal
Proteins and Peptides", Vol. 2, p. 46, Academic Press (New York),
1983; Merrifield, Adv. Enzymol., 32:221-96,1969; Fields et al.,
Int. J. Peptide Protein Res., 35:161-214, 1990; and U.S. Pat. No.
4,244,946 for solid phase peptide synthesis, and Schroder et al.,
"The Peptides". Vol. 1, Academic Press (New York), 1965 for
classical solution synthesis, each of which is incorporated herein
by reference. Appropriate protective groups usable in such
synthesis are described in the above texts and in J. F. W. McOmie,
"Protective Groups in Organic Chemistry", Plenum Press, New York,
1973, which is incorporated herein by reference.
[0140] In general, the solid-phase synthesis methods contemplated
comprise the sequential addition of one or more amino acid residues
or suitably protected amino acid residues to a growing peptide
chain. Normally, either the amino or carboxyl group of the first
amino acid residue is protected by a suitable, selectively
removable protecting group. A different, selectively removable
protecting group is utilized for amino acids containing a reactive
side group such as lysine.
[0141] Using a solid phase synthesis as exemplary, the protected or
derivatized amino acid is attached to an inert solid support
through its unprotected carboxyl or amino group. The protecting
group of the amino or carboxyl group is then selectively removed
and the next amino acid in the sequence having the complimentary
(amino or carboxyl) group suitably protected is admixed and reacted
under conditions suitable for forming the amide linkage with the
residue already attached to the solid support. The protecting group
of the amino or carboxyl group is then removed from this newly
added amino acid residue, and the next amino acid (suitably
protected) is then added, and so forth. After all the desired amino
acids have been linked in the proper sequence, any remaining
terminal and side group protecting groups (and solid support) are
removed sequentially or concurrently to generate the final linear
polypeptide.
[0142] The resultant linear polypeptides prepared, for example, as
described above may be reacted to form their corresponding cyclic
peptides. An exemplary method for preparing a cyclic peptide is
described by Zimmer et al., Peptides 1992, pp. 393-394, ESCOM
Science Publishers. B. V., 1993. Typically, tertbutoxycarbonyl
protected peptide methyl ester is dissolved in methanol and sodium
hydroxide solution are added and the admixture is reacted at
20.degree. C. (20 C) to hydrolytically remove the methyl ester
protecting group. After evaporating the solvent, the
tertbutoxycarbonyl protected peptide is extracted with ethyl
acetate from acidified aqueous solvent. The tertbutoxycarbonyl
protecting group is then removed under mildly acidic conditions in
dioxane cosolvent. The unprotected linear peptide with free amino
and carboxy termini so obtained is converted to its corresponding
cyclic peptide by reacting a dilute solution of the linear peptide,
in a mixture of dichloromethane and dimethylformamide, with
dicyclohexylcarbodiimide in the presence of 1-hydroxybenzotriazole
and N-methylmorpholine. The resultant cyclic peptide is then
purified by chromatography.
[0143] Alternate methods for cyclic peptide synthesis are described
by Gurrath et al., Eur. J. Biochem., 210:911-921 (1992), and
described in the Examples.
[0144] In addition, the .alpha..sub.v.beta..sub.5 antagonist can be
provided in the form of a fusion protein. Fusion proteins are
proteins produced by recombinant DNA methods as described herein in
which the subject polypeptide is expressed as a fusion with a
second carrier protein such as a glutathione sulfhydryl transferase
(GST) or other wll known carrier. Preferred fusion proteins
comprise an MMP-2 polypeptide described herein. The preparation of
a MMP-2 fusion protein is described in the Examples.
[0145] Particularly preferred peptides or derivative peptides for
use in the present methods in tissues primarily exhibiting
.alpha..sub.v.beta..sub.5-associated angiogenesis are described in
the Examples, and include the polypeptides shown in SEQ ID NOs 4,
6, 7, 8 and 9.
[0146] Also preferred are polypeptides derived from MMP-2 described
herein, having sequences shown in SEQ ID Nos 11-22.
2. Monoclonal Antibodies
[0147] The present invention describes, in one embodiment,
.alpha..sub.v.beta..sub.5 antagonists in the form of monoclonal
antibodies which immunoreact with .alpha..sub.v.beta..sub.5 and
inhibit .alpha..sub.v.beta..sub.5 binding to its natural ligand as
described herein. The invention also describes cell lines which
produce the antibodies, methods for producing the cell lines, and
methods for producing the monoclonal antibodies.
[0148] A monoclonal antibody of this invention comprises antibody
molecules that 1) immunoreact with isolated
.alpha..sub.v.beta..sub.5, and 2) inhibit vitronectin binding to
.alpha..sub.v.beta..sub.5. Preferred monoclonal antibodies which
preferentially bind to .alpha..sub.v.beta..sub.5 include a
monoclonal antibody having the immunoreaction characteristics of
mAb P1F6 and mAb P5H9, which are described in the Examples.
[0149] The term "antibody or antibody molecule" in the various
grammatical forms is used herein as a collective noun that refers
to a population of immunoglobulin molecules and/or immunologically
active portions of immunoglobulin molecules, i.e., molecules that
contain an antibody combining site or paratope.
[0150] An "antibody combining site" is that structural portion of
an antibody molecule comprised of heavy and light chain variable
and hypervariable regions that specifically binds antigen.
[0151] Exemplary antibodies for use in the present invention are
intact immunoglobulin molecules, substantially intact
immunoglobulin molecules and those portions of an immunoglobulin
molecule that contain the paratope, including those portions known
in the art as Fab, Fab', F(ab').sub.2 and F(v), and also referred
to as antibody fragments.
[0152] In another preferred embodiment, the invention contemplates
a truncated immunoglobulin molecule comprising a Fab fragment
derived from a monoclonal antibody of this invention. The Fab
fragment, lacking Fc receptor, is soluble, and affords therapeutic
advantages in serum half life, and diagnostic advantages in modes
of using the soluble Fab fragment. The preparation of a soluble Fab
fragment is generally known in the immunological arts and can be
accomplished by a variety of methods.
[0153] For example, Fab and F(ab').sub.2 portions (fragments) of
antibodies are prepared by the proteolytic reaction of papain and
pepsin, respectively, on substantially intact antibodies by methods
that are well known. See for example, U.S. Pat. No. 4,342,566 to
Theofilopolous and Dixon. Fab' antibody portions are also well
known and are produced from F(ab').sub.2 portions followed by
reduction of the disulfide bonds linking the two heavy chain
portions as with mercaptoethanol, and followed by alkylation of the
resulting protein mercaptan with a reagent such as iodoacetamide.
An antibody containing intact immunoglobulin molecules are
preferred and are utilized as illustrative herein.
[0154] The phrase "monoclonal antibody" in its various grammatical
forms refers to a population of antibody molecules that contain
only one species of antibody combining site capable of
immunoreacting with a particular epitope. A monoclonal antibody
thus typically displays a single binding affinity for any epitope
with which it immunoreacts. A monoclonal antibody may therefore
contain an antibody molecule having a plurality of antibody
combining sites, each immunospecific for a different epitope, e.g.,
a bispecific monoclonal antibody.
[0155] A monoclonal antibody is typically composed of antibodies
produced by clones of a single cell called a hybridoma that
secretes (produces) only one kind of antibody molecule. The
hybridoma cell is formed by fusing an antibody-producing cell and a
myeloma or other self-perpetuating cell line. The preparation of
such antibodies was first described by Kohler and Milstein, Nature,
256:495-497 (1975), the description of which is incorporated by
reference. Additional methods are described by Zola, Monoclonal
Antibodies: A Manual of Techniques, CRC Press, Inc. (1987). The
hybridoma supernates so prepared can then be screened for the
presence of antibody molecules that immunoreact with
.alpha..sub.v.beta..sub.5 and for inhibition of
.alpha..sub.v.beta..sub.5 binding to natural ligands.
[0156] Briefly, to form the hybridoma from which the monoclonal
antibody composition is produced, a myeloma or other
self-perpetuating cell line is fused with lymphocytes obtained from
the spleen of a mammal hyperimmunized with a source of
.alpha..sub.v.beta..sub.5.
[0157] It is preferred that the myeloma cell line used to prepare a
hybridoma be from the same species as the lymphocytes. Typically, a
mouse of the strain 129 GIX.sup.+ is the preferred mammal. Suitable
mouse myelomas for use in the present invention include the
hypoxanthine-aminopterin-thymidine-sensitive (HAT) cell lines
P3X63-Ag8.653, and Sp2/0-Ag14 that are available from the American
Type Culture Collection, Rockville, Md., under the designations CRL
1580 and CRL 1581, respectively.
[0158] Splenocytes are typically fused with myeloma cells using
polyethylene glycol (PEG) 1500. Fused hybrids are selected by their
sensitivity to HAT. Hybridomas producing a monoclonal antibody of
this invention are identified using the enzyme linked immunosorbent
assay (ELISA), a variation of which is described in the
Examples.
[0159] A monoclonal antibody of the present invention can also be
produced by initiating a monoclonal hybridoma culture comprising a
nutrient medium containing a hybridoma that secretes antibody
molecules of the appropriate specificity. The culture is maintained
under conditions and for a time period sufficient for the hybridoma
to secrete the antibody molecules into the medium. The
antibody-containing medium is then collected. The antibody
molecules can then be further isolated by well known
techniques.
[0160] Media useful for the preparation of these compositions are
both well known in the art and commercially available and include
synthetic culture media, inbred mice and the like. An exemplary
synthetic medium is Dulbecco's minimal essential medium (DMEM;
Dulbecco et al., Virol., 8:396, 1959) supplemented with 4.5 gm/l
glucose, 20 mM glutamine, and 20% fetal calf serum. An exemplary
inbred mouse strain is the Balb/c.
[0161] Other methods of producing a monoclonal antibody, a
hybridoma cell or a hybridoma cell culture are also well known.
See, for example, the method of isolating monoclonal antibodies
from an immunological repertoire as described by Sastry et al.,
Proc. Natl. Acad. Sci., USA, 86:5728-5732 (1989) and Huse et al.,
Science, 246:1275-1281 (1989).
[0162] Also contemplated by this invention is the hybridoma cell,
and cultures containing a hybridoma cell that produce a monoclonal
antibody of this invention. Particularly preferred is the hybridoma
cell line that secretes monoclonal antibody mAb P1F6 and mAb P5H9,
the preparation of which is described in the Examples.
[0163] The invention contemplates, in one embodiment, a monoclonal
antibody that has the immunoreaction characteristics of mAb P1F6 or
mAb P5H9.
[0164] It is also possible to determine, without undue
experimentation, if a monoclonal antibody has the same (i.e.,
equivalent) specificity (immunoreaction characteristics) as a
monoclonal anti-body of this invention by ascertaining whether the
former prevents the latter from binding to a preselected target
molecule. If the monoclonal antibody being tested competes with the
monoclonal antibody of the invention, as shown by a decrease in
binding by the monoclonal antibody of the invention in standard
competition assays for binding to the target molecule when present
in the solid phase, then it is likely that the two monoclonal
antibodies bind to the same, or a closely related, epitope.
[0165] Still another way to determine whether a monoclonal antibody
has the specificity of a monoclonal antibody of the invention is to
pre-incubate the monoclonal antibody of the invention with the
target molecule with which it is normally reactive, and then add
the monoclonal antibody being tested to determine if the monoclonal
antibody being tested is inhibited in its ability to bind the
target molecule. If the monoclonal antibody being tested is
inhibited then, in all likelihood, it has the same, or functionally
equivalent, epitopic specificity as the monoclonal antibody of the
invention.
[0166] An additional way to determine whether a monoclonal antibody
has the specificity of a monoclonal antibody of the invention is to
determine the amino acid residue sequence of the CDR regions of the
antibodies in question. Antibody molecules having identical, or
functionally equivalent, amino acid residue sequences in their CDR
regions have the same binding specificity. Methods for sequencing
polypeptides are well known in the art.
[0167] The immunospecificity of an antibody, its target molecule
binding capacity and the attendant affinity the antibody exhibits
for the epitope are defined by the epitope with which the antibody
immunoreacts. The epitope specificity is defined at least in part
by the amino acid residue sequence of the variable region of the
heavy chain of the immunoglobulin the antibody and in part by the
light chain variable region amino acid residue sequence.
[0168] Use of the term "having the binding specificity of"
indicates that equivalent monoclonal antibodies exhibit the same or
similar immunoreaction (binding) characteristics and compete for
binding to a preselected target molecule.
[0169] Humanized monoclonal antibodies offer particular advantages
over murine monoclonal antibodies, particularly insofar as they can
be used therapeutically in humans. Specifically, human antibodies
are not cleared from the circulation as rapidly as "foreign"
antigens. In addition, human antibodies do not activate the immune
system in the same manner as foreign antigens and foreign
antibodies. Methods of preparing "humanized" antibodies are
generally well known in the art and can readily be applied to the
antibodies of the present invention.
[0170] Thus, the invention contemplates, in one embodiment, a
monoclonal antibody of this invention that is humanized by grafting
to introduce components of the human immune system without
substantially interfering with the ability of the antibody to bind
antigen.
3. .alpha..sub.v.beta..sub.5-Specific Mimetics
[0171] The present invention demonstrates that
.alpha..sub.v.beta..sub.5 antagonists generally can be used in the
present invention, the antagonists of which can include
polypeptides, antibodies and other molecules, designated
"mimetics", that have the capacity to interfere with
.alpha..sub.v.beta..sub.5 function. Particularly preferred are
antagonists which specifically interfere with
.alpha..sub.v.beta..sub.5 function, and do not interfere with
function of other integrins.
[0172] In this context it is appreciated that a variety of reagents
may be suitable for use in the present methods, so long as these
reagents possess the requisite biological activity. These reagents
are generically referred to a mimetics because they possess the
ability to "mimic" an .alpha..sub.v.beta..sub.5 ligand involved in
the functional interaction of the receptor and ligand by blocking
the ligand binding domain in the receptor, and thereby interfere
with (i.e., inhibit) normal function. In an alternative embodiment,
an .alpha..sub.v.beta..sub.5 antagonist may be a mimetic of the
receptor rather than its ligand.
[0173] A mimetic is any molecule, other than an antibody or
ligand-derived peptide, which exhibits the above-described
properties. It can be a synthetic peptide, an analog or derivative
of a peptide, a compound which is shaped like the binding pocket of
the above-described binding domain such as an organic mimetic
molecule, or other molecule.
[0174] A preferred mimetic of this invention is an organic-based
molecule and thus is referred to as organic mimetic. Particularly
preferred organic mimetic molecules that function as
.alpha..sub.v.beta..sub.5 antagonists by being a mimetic to a
ligand of .alpha..sub.v.beta..sub.5 are Compounds 7, 9, 10, 12, 14,
15, 16, 17 and 18 as described in Example 10.
[0175] The design of an .alpha..sub.v.beta..sub.5 mimetic can be
conducted by any of a variety of structural analysis methods for
drug-design known in the art, including molecular modeling,
two-dimensional nuclear magnetic resonance (2-D NMR) analysis,
x-ray crystallography, random screening of peptide, peptide analog
or other chemical polymer or compound libraries, and the like drug
design methodologies.
[0176] In view of the broad structural evidence presented in the
present specification which shows that an .alpha..sub.v.beta..sub.5
antagonist can be a fusion polypeptide (e.g., an MMP-2 fusion
protein), a small polypeptide, a cyclic peptide, a derivative
peptide, an organic mimetic molecule, or a monoclonal antibody,
that are diversely different chemical structures which share the
functional property of selective inhibition of
.alpha..sub.v.beta..sub.5 the structure of a subject
.alpha..sub.v.beta..sub.5 antagonist useful in the present methods
need not be so limited, but includes any .alpha..sub.v.beta..sub.5
mimetic, as defined herein.
F. Methods For Identifying Antagonists of
.alpha..sub.v.beta..sub.5
[0177] The invention also describes assay methods for identifying
candidate .alpha..sub.v.beta..sub.5 antagonists for use according
to the present methods. In these assay methods candidate molecules
are evaluated for their potency in inhibiting
.alpha..sub.v.beta..sub.5 binding to natural ligands, and
furthermore are evaluated for their potency in inhibiting
angiogenesis in a tissue.
[0178] The first assay measures angiogenesis in the chick
chorioallantoic membrane (CAM) and is referred to as the CAM assay.
The CAM assay has been described in detail by others, and further
has been used to measure both angiogenesis and neovascularization
of tumor tissues. See Ausprunk et al., Am. J. Pathol. 79:597-618
(1975) and Ossonski et al., Cancer Res., 40:2300-2309 (1980).
[0179] The CAM assay is a well recognized assay model for in vivo
angiogenesis because neovascularization of whole tissue is
occurring. Actual chick embryo blood vessels are growing into the
CAM or into the tissue grown on the CAM.
[0180] As demonstrated herein, the CAM assay illustrates inhibition
of neovascularization based on both the amount and extent of new
vessel growth. Furthermore, it is easy to monitor the growth of any
tissue transplanted upon the CAM, such as a tumor tissue. Finally,
the assay is particularly useful because there is an internal
control for toxicity in the assay system. The chick embryo is
exposed to any test reagent. As such, the health of the embryo is
an indication of toxicity.
[0181] The second assay that measures angiogenesis is the in vivo
rabbit eye model and is referred to as the rabbit eye assay. The
rabbit eye assay has been described in detail by others and further
has been used to measure both angiogenesis and neovascularization
in the presence of angiogenic inhibitors such as thalidomide. See
D'Amato, et al., Proc. Natl. Acad. Sci., USA, 91:4082-4085
(1994).
[0182] The rabbit eye assay is a well recognized assay model for in
vivo angiogenesis because the neovascularization process,
exemplified by rabbit blood vessels growing from the rim of the
cornea into the cornea, is easily visualized through the naturally
transparent cornea of the eye. Additionally, both the extent and
the amount of stimulation or inhibition of neovascularization or
regression of neovascularization can easily be monitored over
time.
[0183] Finally, the rabbit is exposed to any test reagent and as
such the health of the rabbit is an indication of toxicity of the
test reagent.
[0184] The third assay measures inhibition of direct binding of the
natural ligand, vitronectin, to .alpha..sub.v.beta..sub.5, and a
preferred embodiment is described in detail in the Examples. The
assay typically measures the degree of inhibition of binding of a
natural ligand, such as vitronectin, to isolated
.alpha..sub.v.beta..sub.5 in the solid phase by ELISA, the
inhibition of which is mediated by an
.alpha..sub.v.beta..sub.5-specific inhibition.
[0185] Thus, the assay can also be used to identify compounds which
exhibit specificity for .alpha..sub.v.beta..sub.5 and do not
inhibit natural ligands from binding other integrins. The
specificity assay is conducted by running parallel ELISA assays
where both .alpha..sub.v.beta..sub.5 and other integrins are
screened concurrently in separate assay chambers for their
respective abilities to bind a natural ligand and for the candidate
compound to inhibit the respective abilities of the integrins to
bind a preselected ligand. Preferred screening assay formats are
described in the Examples.
G. Article of Manufacture
[0186] The invention also contemplates an article of manufacture
which is a labelled container for providing an
.alpha..sub.v.beta..sub.5 antagonist of the invention. An article
of manufacture comprises packaging material and a pharmaceutical
agent contained within the packaging material.
[0187] The pharmaceutical agent in an article of manufacture is any
of the .alpha..sub.v.beta..sub.5 antagonists of the present
invention, formulated into a pharmaceutically acceptable form as
described herein according the the disclosed indications. The
article of manufacture contains an amount of pharmaceutical agent
sufficient for use in treating a condition indicated herein, either
in unit or multiple dosages.
[0188] The packaging material comprises a label which indicates the
use of the pharmaceutical agent contained therein, e.g., for
treating conditions assisted by the inhibition of angiogenesis, and
the like conditions disclosed herein. The label can further include
instructions for use and related information as may be required for
marketing. The packaging material can include container(s) for
storage of the pharmaceutical agent.
[0189] As used herein, the term packaging material refers to a
material such as glass, plastic, paper, foil, and the like capable
of holding within fixed means a pharmaceutical agent. Thus, for
example, the packaging material can be plastic or glass vials,
laminated envelopes and the like containers used to contain a
pharamaceutical composition including the pharmaceutical agent.
[0190] In preferred embodiments, the packaging material includes a
label that is a tangible expression describing the contents of the
article of manufacture and the use of the pharmaceutical agent
contained therein.
EXAMPLES
[0191] The following examples relating to this invention are
illustrative and should not, of course, be construed as
specifically limiting the invention. Moreover, such variations of
the invention, now known or later developed, which would be within
the purview of one skilled in the art are to be considered to fall
within the scope of the present invention hereinafter claimed.
1. Preparation of .alpha..sub.v.beta..sub.5-Specific Monoclonal
Antibodies
[0192] The monoclonal antibodies, P1F6 and P5H9, were produced
using standard hybridoma methods by immunization into RBF/DnJ mice
with A549 lung carcinoma cells as described by Wayner et al., J.
Cell Biol., 113:919-929 (1991), the disclosure of which is hereby
incorporated by reference. Spleens were removed from the immunized
mice and fused with Ns-1/FOX-NY myeloma cells. Hybridomas producing
antibody directed to carcinoma cell vitronectin receptors were
screened by the specific inhibition of UCLA-P3 adhesion to
vitronectin-coated surfaces as described by Wayner et al. and
cloned by limiting dilution on thymocyte feeder layers.
[0193] Both the P1F6 and P5H9 monoclonal antibodies have been shown
to specifically immunoreact with the .alpha..sub.v.beta..sub.5
complex, and not immunoreact with .alpha..sub.v subunit, with
.beta..sub.5 subunit, or with other integrins. The P1F6 monoclonal
antibody is commercially available from Gibco BRL (Life
Technologies, Inc., Gaithersburg, Md.) and the P5H9 monoclonal is
available from Dr. E. Wayner at the Fred Hutchinson Cancer Research
Institute, Seattle, Wash.
[0194] Other .alpha..sub.v.beta..sub.5 monoclonal antibodies for
use in this invention are similarly derived and characterized as
described herein. In addition, .alpha..sub.v.beta..sub.5 monoclonal
antibodies are produced by fusing spleens isolated from mice that
receive immunizations with the .alpha..sub.v.beta..sub.5 receptor
in either an impure or purified form. Purification of the
.alpha..sub.v.beta..sub.5 is a procedure well known to one of
ordinary skill in the art of integrin biology and has also been
described by Smith et al., J. Biol. Chem., 265:11008-11013 (1990),
the disclosure of which is hereby incorporated by reference. Once
purified, the isolated receptor is prepared as an immunogen for
immunizing mice as described in Section E2 and as prepared
essentially as described by Kohler and Milstein, Nature,
256:495-497 (1975), the disclosure of which is hereby incorporated
by reference. The resultant hybridoma clones are screened for
reactivity with the immunogen and are then characterized as
described in the following Examples.
2. Characterization of the Specificity of the
Anti-.alpha..sub.v.beta..sub.5 Monoclonal Antibodies and Use in
Mapping the Tissue Distribution of .alpha..sub.v.beta..sub.5
Expression
A. Specificity for Vitronectin
[0195] The P5H9 monoclonal antibody prepared in Example 1 was shown
by Wayner et al., J. Cell. Biol., 113:919-929 (1991) to block
attachment of UCLA-P3 carcinoma cells to vitronectin while not
affecting cell attachment to collagen or fibronectin. The same
cells were also shown to contain only the .alpha..sub.v.beta..sub.5
vitronectin receptor and not one with .alpha..sub.v.beta..sub.3
specificity, immunoprecipitating a heterodimer consisting of an
.alpha. chain (160 kD) and a .beta. chain (95 kD) with nonreducing
conditions. The .alpha..sub.v.beta..sub.5 receptor detected by P5H9
was also shown to mediate adhesion of M21 melanoma cells and H2981
carcinoma cells to vitronectin. The P1F6 monoclonal antibody has
the same immunoreactivity profile.
B. Immunofluorescence with Anti-Integrin Receptor Antibodies
[0196] During wound healing, the basement membranes of blood
vessels express several adhesive proteins, including von Willebrand
factor, fibronectin, and fibrin. In addition, several members of
the integrin family of adhesion receptors are expressed on the
surface of cultured smooth muscle and endothelial cells. See,
Cheresh, Proc. Natl. Acad. Sci., USA, 84:6471 (1987); Janat et al.,
J. Cell Physiol., 151:588 (1992); and Cheng et al., J. Cell
Physiol., 139:275 (1989).
[0197] In addition to the structure and function of the integrin
.beta..sub.5 subunit, the tissue distribution of the subunit by
mapping with other anti-.beta..sub.5 monoclonal antibodies has been
described by Pasqualini et al., J. Cell Sci., 105:101-111 (1993),
the disclosure of which is hereby incorporated by reference.
[0198] The .beta..sub.5 subunit-specific monoclonal antibodies
described above, similar to those described in Example 1, were
secreted from hybridomas that were prepared using splenocytes from
a mouse that received immunizations with the A549 human lung
carcinoma cell line. The hybridomas were selected by positive
surface staining of A549 cells with the hybridomas culture
supernatant and by immunoprecipitation of .alpha..sub.v.beta..sub.5
complexes from surface-labeled A549 extracts. The monoclonal
antibodies were then used to map the tissue distribution of the
.beta..sub.5 subunit in normal human thymus, skin and kidney. Four
micron thick sections were cut from the frozen tissue blocks on a
cryostat microtome for subsequent streptavidin-biotin
immunoperoxidase staining with antibodies specific for the
.beta..sub.5 integrins performed as described in the Pasqualini et
al. reference.
[0199] Staining of thymic sections showed the distribution of
.beta..sub.5 on blood vessels, Hassal's corpuscles, cortical and
medullary stromal cells, and basement membranes. Skin sections
showed .beta..sub.5 on the basal layer of the epidermis and on some
dermal blood vessel walls, and kidney sections showed staining of
glomerular regions, juxtaglomerular apparatus, proximal convoluted
tubules and collecting tubules. Thus, the distribution of
.beta..sub.5 is heterogeneous to different cell types including
and, more importantly, on capillary endothelial cells, the staining
of which was consistent with staining of cultured umbilical vein
endothelial cells.
C. Immunofluorescence of Human Retinal Tissue from Patients with
Ocular Disease with Anti-Integrin Receptor Antibodies
[0200] Ocular neovascularization is the most common pathological
change observed in the vast majority of eye diseases that result in
catastrophic loss of vision. The growth of new blood vessels from
the pre-existing choroidal, retinal or paralimbal vessels can lead
to edema, hemorrhage or fibrovascular membrane formation resulting
in disruption of the normal anatomic relationships of the eye and
concomitant loss of normal visual function.
[0201] Under physiological conditions, angiogenesis is highly
regulated and has been shown to be activated by specific angiogenic
cytokines such as basic fibroblast growth factor (bFGF) and tumor
necrosis factor-.alpha. (TNF-.alpha.). As described by Brooks et
al., Science, 264:569-571 (1994), monoclonal antibodies against
.alpha..sub.v.beta..sub.3 have been shown to be block both bFGF-
and TNF-.alpha.-induced angiogenesis in model systems including the
CAM model described below. As described in Examples 4-6, monoclonal
antibodies against .alpha..sub.v.beta..sub.5 block a separate
pathway of angiogenesis, specifically that induced by vascular
endothelial growth factor (VEGF), transforming growth
factor-.alpha. (TGF-.alpha.) and epidermal growth factor (EGF).
[0202] Thus, as described herein in the context of the present
invention, two pathways of angiogenesis are defined by distinct
integrins, .alpha..sub.v.beta..sub.3 and .alpha..sub.v.beta..sub.5.
To investigate the expression and role of these integrins in human
ocular disease, epiretinal neovascular membranes and subretinal
neovascular membranes were obtained en bloc at vitrectomy from
patients with proliferative diabetic retinopathy (PDR). These
patients had been followed clinically and were selected for
histological evaluation on the basis of having active,
proliferative neovascular disease documented by clinical
examination and fundus fluorescein angiography. The obtained tissue
was frozen immediately in Tissue Tek cryopreservative and
sectioned.
[0203] When the tissues from these patients were examined by
immunofluorescence, the blood vessels were positive for the
integrin .alpha..sub.v.beta..sub.3 as indicated by immunoreactivity
with the mouse monoclonal antibody LM609. The distribution of the
integrin appeared to be restricted to blood vessels and coincided
with staining for a marker of blood vessels, von Willebrand Factor,
as mapped with a rabbit antibody to the factor. The sites of
immunoreactivity were visualized with either rhodamine-conjugated
anti-mouse immunoglobulin or fluorescein-conjugated anti-rabbit
immunoglobulin, the use of both of which allowed co-localization of
the integrin location and blood vessel-specific antibodies.
[0204] Specimens obtained from normal eyes or patients with
atrophic membranes free from actively proliferating blood vessels
were negative for the integrin .alpha..sub.v.beta..sub.3 by
immunofluorescence.
[0205] In parallel, the same tissues were analyzed
immunohistochemically for the presence and distribution of
.alpha..sub.v.beta..sub.5 with the anti-.alpha..sub.v.beta..sub.5
monoclonal antibody, P1F6, prepared in Example 1. The staining
revealed that .alpha..sub.v.beta..sub.5 was present on blood
vessels that co-localized with the distribution of von Willebrand
factor. However, the non-vascular tissue also displayed limited
fluorescence with the P1F6 antibody indicating a wider distribution
of .alpha..sub.v.beta..sub.5. This was in contrast to the presence
of .alpha..sub.v.beta..sub.3 that was limited to blood vessels.
[0206] When immunofluorescent staining of membranes was compared
between .alpha..sub.v.beta..sub.3 and .alpha..sub.v.beta..sub.5
with the respective antibodies LM609 and P1 F6, the pattern of
staining on the blood vessel wall was virtually identical
indicating that both .alpha..sub.v.beta..sub.3 and
.alpha..sub.v.beta..sub.5 are displayed on the surface of newly
proliferating human blood vessels present in neovascular eye
diseases such as diabetic retinopathy.
[0207] The results described herein thus show that the
.alpha..sub.v.beta..sub.5 integrin receptor is selectively
expressed in specific tissue types in which angiogenesis is
occurring, such as that seen with neovascular membranes from
patients having active, proliferative neovascular disease. These
tissues, along with those tissues exposed to particular growth
factors as described below in Examples 4-6, therefore provide ideal
targets for therapeutic aspects of this invention.
3. Preparation of Synthetic Peptides
a. Synthesis Procedure
[0208] The cyclic polypeptides used in practicing the methods of
this invention were synthesized using standard solid-phase
synthesis techniques as, for example, described by Merrifield, Adv.
Enzymol., 32:221-296 (1969), and Fields, G. B. and Noble, R. L.,
Int. J. Peptide Protein Res., 35:161-214 (1990).
[0209] Two grams (g) of BOC-Arg-Gly-Asp-D-Phe-Val-OMe (SEQ ID NO 1)
were first dissolved in 60 milliliters (ml) of methanol to which
was added 1.5 ml of 2 N sodium hydroxide solution to form an
admixture. The admixture was then stirred for 3 hours at 20 degrees
C. (20 C). After evaporation, the residue was taken up in water and
acidified to pH 3 with diluted HCl and extracted with ethyl
acetate. The extract was dried over Na.sub.2SO.sub.4, evaporated
again and the resultant BOC-Arg-Gly-Asp-D-Phe-Val-OH (SEQ ID NO 2)
was stirred at 20 C for 2 hours with 20 ml of 2 N HCl in dioxane.
The resultant admixture was evaporated to obtain
H-Arg-Gly-Asp-D-Phe-Val-OH (SEQ ID NO 3) that was subsequently
dissolved in a mixture of 1800 ml of dichloromethane and 200 ml of
dimethylformamide (DMF) followed by cooling to 0 C. Thereafter, 0.5
g of dicyclohexylcarbodiimide (DCCI), 0.3 g of I
-hydroxybenzotriazole (HOBt) and 0.23 ml of N-methylmorpholine were
added sequentially with stirring.
[0210] The resultant admixture was stirred for another 24 hours at
0 C and then at 20 C for yet another 48 hours. The solution was
concentrated and treated with a mixed bed ion exchanger to remove
salts. After the resulting resin was removed by filtration, the
clarified solution was evaporated and the residue was purified by
chromatography resulting in the recovery of
cyclo(Arg-Gly-Asp-D-Phe-Val) (also listed in single letter code as
c-RGDfV) (SEQ ID NO 4). The lower case letters in the peptide
indicate the D form of the amino acid and not the L form as
indicated by capital letters.
[0211] The cyclic control peptide, cyclo(Arg-Ala-Asp-D-Phe-Val)
(also listed in single letter code as RADfV) (SEQ ID NO 5) was
prepared as described above. The cyclic peptide c-RADfV (SEQ ID NO
5) has previously been shown to inhibit binding of fibrinogen to
the integrin .alpha..sub.v.beta..sub.3, and not inhibit binding of
fibrinogen to the integrins .alpha..sub.IIb.beta..sub.3 or
.alpha..sub.5.beta..sub.1 (Pfaff, et al. J. Biol. Chem.,
269:20233-20238, 1994).
[0212] Other peptides that are specifically inhibitory to the
binding of natural ligands to .alpha..sub.v.beta..sub.5 are
similarly prepared as tested for specificity and range of activity
as described in the following examples. These include the following
peptides that were analogously obtained:
cyclo(Gly-D-Arg-Gly-Asp-Phe-Val) (SEQ ID NO 6) and
cyclo(Arg-Gly-Asp-Phe-D-Val) (SEQ ID NO 7).
[0213] The peptides having the amino acid residue sequence
Tyr-Thr-Ala-Glu-Cys-Lys-Pro-Gln-Val-Thr-Arg-Gly-Asp-Val-Phe (SEQ ID
NO 8) and cyclo (Arg-Gly-Asp-D-Phe-NMeVal) (SEQ ID NO 9) were also
synthetically prepared. In SEQ ID NO 9. the prefix "Me" in MeVal
signifies that the valine in position 6 is modified by methylation
at the alpha amino nitrogen in the amide bond of the valine
residue.
b. Alternate Synthesis Procedure
i. Synthesis of cyclo-(Arg-Gly-Asp-DPhe-NmeVal), TFA salt
[0214] Fmoc-Arg(Mtr)-Gly-Asp(OBut)-DPhe-NMeVal-ONa is synthesized
using solid-phase Merrifield-type procedures by sequentially adding
NMeVal, DPhe, Asp(OBut), Gly and Fmoc-Arg(Mtr) in a step-wise
manner to a 4-hydroxymethyl-phenoxymethyl-polystyrene resin (Wang
type resin) (customary Merrifield-type methods of peptide synthesis
are applied as described in Houben-Weyl. l.c., Volume 15/II, Pages
1 to 806 (1974). The polystyrene resin and amino acid residues
precursors are commercially available from Aldrich, Sigma or Fluka
chemical companies). After completion of sequential addition of the
amino acid residues, the resin is then eliminated from the peptide
chain using a 1:1 mixture of TFA/dichloromethane which provides the
Fmoc-Arg(Mtr)-Gly-Asp(OBut)-DPhe-NMeVal-OH product. The Fmoc group
is then removed with a 1:1 mixture of piperidine/DMF which provides
the crude Arg(Mtr)-Gly-Asp(OBut)-DPhe-NMeVal-OH precursor which is
then purified by HPLC in the customary manner.
[0215] For cyclization, a solution of 0.6 g of
Arg(Mtr)-Gly-Asp(OBut)-DPhe-NMeVal-OH (synthesized above) in 15 ml
of DMF (dimethylformamide; Aldrich) is diluted with 85 ml of
dichloromethane (Aldrich), and 50 mg of NaHCO.sub.3 are added.
After cooling in a dry ice/acetone mixture, 40 .mu.l of
diphenylphosphoryl azide (Aldrich) are added. After standing at
room temperature for 16 hours, the solution is concentrated. The
concentrate is gel-filtered (Sephadex G10 column in
isopropanol/water 8:2) and then purified by HPLC in the customary
manner. Treatment with TFA (trifluoroacetic acid)/H.sub.2O (98:2)
gives cyclo-(Arg-Gly-Asp-DPhe-NmeVal).times.TFA which is then
purified by HPLC in the customary manner; RT=19.5; FAB-MS (M+H):
589.
ii. Synthesis of"Inner Salt"
[0216] TFA salt is removed from the above-produced cyclic peptide
by suspending the cyclo-(Arg-Gly-Asp-DPhe-NmeVal).times.TFA in
water followed by evaporation under vacuum to remove the TFA. The
cyclic peptide formed is referred to as an "inner salt" and is
designated cyclo-(Arg-Gly-Asp-DPhe-NMeVal). The term "inner salt"
is used because the cyclic peptide contains two oppositely charged
residues which intra-electronically counterbalance each other to
form an overall noncharged molecule. One of the charged residues
contains an acid moiety and the other charged residue contains an
amino moiety. When the acid moiety and the amino moiety are in
close proximity to one another, the acid moiety can be deprotonated
by the amino moiety which forms a carboxylate/ammonium salt species
with an overall neutral charge.
iii. HCl treatment to give
cyclo-(Arg-Gly-Asp-DPhe-NMeVal).times.HCl
[0217] 80 mg of cyclo-(Arg-Gly-Asp-DPhe-NMeVal) are dissolved in
0.01 M HCl five to six times and freeze dried after each dissolving
operation. Subsequent purification by HPLC give
cyclo-(Arg-Gly-Asp-DPhe-NMeVal).times.HCl; FAB-MS (M+H): 589.
iv. Methane sulfonic acid treatment to give
cyclo-(Arg-Gly-Asp-DPhe-NMeVal).times.MeSO.sub.3H
[0218] 80 mg of cyclo-(Arg-Gly-Asp-DPhe-NMeVal) are dissolved in
0.01 M MeSO.sub.3H (methane sulfonic acid) five to six times and
freeze dried after each dissolving operation. Subsequent
purification by HPLC give
cyclo-(Arg-Gly-Asp-DPhe-NMeVal).times.MeSO.sub.3H; RT=17.8: FAB-MS
(M+H): 589.
[0219] Alternative methods of cyclization include derivatizing the
side group chains of an acyclic peptide precursor with sulfhydryl
moieties, and when exposed to slightly higher than normal
physiological pH conditions (pH 7.5), intramolecularly forms
disulfide bonds with other sulfhydryl groups present in the
molecule to form a cyclic peptide. Additionally, the C-terminus
carboxylate moiety of an acyclic peptide precurosor can be reacted
with a free sulfhydryl moiety present within the molecule for
producing thioester cyclized peptides. TABLE-US-00003 TABLE 1
Peptide Designation Amino Acid Sequence SEQ ID NO 62184 (66203*)
cyclo (RGDfV) 4 62185 (69601*) cyclo (RADfV) 5 62181 cyclo (GrGDFV)
6 62187 cyclo (RGDFv) 7 62880 YTAECKPQVTRGDVF 8 121974 (85189*)
cyclo (RDGf-NMeV) 9 112784 cyclo (RGEf-NMeV) 10 huMMP-2 (410-631)**
11 huMMP-2 (439-631)** 12 huMMP-2 (439-512)** 13 huMMP-2
(439-546)** 14 huMMP-2 (510-631)** 15 huMMP-2 (543-631)** 16
chMMP-2 (410-637)*** 17 chMMP-2 (445-637)*** 18 chMMP-2
(445-518)*** 19 chMMP-2 (445-552)*** 20 chMMP-2 (516-637)*** 21
chMMP-2 (549-637)*** 22 *The peptides designated with an asterisk
are prepared in HCl and are identical in sequence to the peptide
designated on the same line; the peptides without an asterisk are
prepared in TFA. Lower case letters indicate a D-amino acid;
capital letters indicate a L-amino acid. **The human MMP-2 amino
acid residue sequences for synthetic peptides are indicated by the
corresponding residue positions shown in Figures 15A and 15B and
also in Figure 16. (MMP-2 refers to a member of the family of
matrix metalloproteinase enzymes). The human MMP-2 sequences are
listed with the natural cysteine residues but are not listed with
engineered cysteine residues as described for the fusion peptides.
The non-natural cysteine residues were substituted for the natural
amino acid # residue at the indicated residue positions in order to
facilitate solubility of the synthetic as well as expressed fusion
proteins and to ensure proper folding for presentation of the
binding site. ***The chicken MMP-2 amino acid residue sequences for
synthetic peptides are indicated by the corresponding residue
positions shown in Figures 15A and 15B. The chicken MMP-2 sequences
are listed with the natural cysteine residues but not with the
engineered cysteine residues as described for the fusion peptides
as described above.
4. Inhibition of Growth Factor-Induced Angiogenesis with
.alpha..sub.v.beta..sub.5 Antagonists as Measured by In Vivo Rabbit
Eye Model Assay
[0220] The effect of anti-.alpha..sub.v.beta..sub.5 antagonists on
growth factor-induced angiogenesis can be observed in naturally
transparent structures as exemplified by the cornea of the eye. New
blood vessels grow from the rim of the cornea, which has a rich
blood supply, toward the center of the cornea, which normally does
not have a blood vessels. Stimulators of angiogenesis, such as VEGF
and TGF-.alpha., when applied to the cornea induce the growth of
new blood vessels from the rim of the cornea. Antagonists of
angiogenesis, applied to the cornea, inhibit the growth of new
blood vessels from the rim of the cornea. Thus, the cornea
undergoes angiogenesis through an invasion of endothelial cells
from the rim of the cornea into the tough collagen-packed corneal
tissue which is easily visible. The rabbit eye model assay
therefore provides an in vivo model for the direct observation of
stimulation and inhibition of angiogenesis following the
implantation of compounds directly into the cornea of the eye.
A. In Vivo Rabbit Eye Model Assay
1) Angiogenesis Induced by Growth Factors
[0221] Angiogenesis was induced in the in vivo rabbit eye model
assay with growth factors and is described in the following.
a. Preparation of Hydron Pellets Containing Growth Factor and
Monoclonal Antibodies
[0222] Hydron polymer pellets containing growth factor and
monoclonal antibodies (mAbs) were prepared as described by D'Amato,
et al., Proc. Natl. Acad. Sci., 91:4082-4085 (1994). The individual
pellets contained 750 ng of the growth factor (also referred to as
cytokine), specifically either bFGF or VEGF, bound to sucralfate
(carafate) (Carafet, Marion Merrell Dow Corporation, Cincinnati,
Ohio) to stabilize the cytokines and ensure their slow release into
the surrounding tissue. In addition, hydron pellets were prepared
which contained either 40 .mu.g of the mAb P1F6
(anti-.alpha..sub.v.beta..sub.5) or the control antibody, LM609
(anti-.alpha..sub.v.beta..sub.3) in PBS.
[0223] All of the mAbs tested were purified from ascites fluid
using Protein-A Sepharose CL-4B affinity column chromatography
according to well-known methods. The eluted immunoglobulin was then
dialyzed against PBS and treated with Detoxi-gel (Pierce Chemicals.
Rockford, Ill.) to remove endotoxin. Endotoxin has been shown to be
a potent angiogenic and inflammatory stimulant. Monoclonal
antibodies were therefore tested for the presence of endotoxin with
the Chromogenic Limulus Amebocyte Lysate Assay (Bio Whittaker,
Walkersville, Md.) and only those mAbs without detectable endotoxin
were used in the rabbit eye model assay.
[0224] The pellets were cast in specially prepared Teflon pegs that
had a 2.5 mm core drilled into their surfaces. Approximately 12
.mu.l of casting material was placed into each peg and polymerized
overnight in a sterile hood. Pellets were then sterilized by
ultraviolet irradiation.
[0225] A series of eight animals were used for paired eye
experiments where each animal received a Hydron implant containing
a preselected cytokine with a preselected antibody or control
immunoglobulin. Specifically, for each rabbit, one cornea was
surgically implanted with a Hydron pellet containing either bFGF or
VEGF in conjunction with mAb P1F6 and the other cornea was treated
with either bFGF or VEGF in conjunction with MAb LM609. Individual
pellets were implanted into surgically created "pockets" formed in
the mid-stroma of the cornea of rabbits. The surgical procedure was
done under sterile technique using a Wild model M691 operating
microscope equipped with a beamsplitter to which was mounted a
camera for photographically recording individual corneas. A 3 mm by
5 mm "pocket" was created in the corneal stroma by making a 3 mm
incision to half the corneal thickness with a 69 Beaver blade. The
stroma was dissected peripherally using an iris spatula and the
pellet was implanted with its peripheral margin 2 mm from the
limbus.
[0226] During the following 12 days, the cytokines and mAbs
diffused from the implanted pellets into the surrounding tissue
thereby effecting angiogenesis from the rim of the cornea.
[0227] The left and right corneas are respectively referred to as
OS and OD. The corneas were then observed for 12 days. Photographs
were taken on postoperative day 10, the time at which
neovascularization is maximal.
[0228] Representative photographic results of the above-treatments
with cytokine/mAb admixtures are shown in FIGS. 1A-1D. The parallel
quantitation of mAb inhibition of cytokine-induced angiogenesis is
shown in FIGS. 2A and 2B. In FIGS. 1A and 1D, in which corneas were
respectively exposed to bFGF/P1F6 and VEGF/LM609 combinations,
cytokine-induced angiogenesis with edema is prominent as indicated
by the large arrows. Therefore, the .alpha..sub.v.beta..sub.5
antibody, P1F6, was not effective at inhibiting bFGF-induced
angiogenesis. Similarly, the .alpha..sub.v.beta..sub.3 antibody,
LM609, was not effective at inhibiting VEGF-induced
angiogenesis.
[0229] In contrast, when the cytokine/mAb combinations of
bFGF/LM609 and VEGF/P1F6 were used in the rabbit model, the
cytokine-induced angiogenesis was inhibited by the antibodies as
shown in FIGS. 1B and 1C, respectively. In these figures, normal
conjunctival limbal vessels indicated by the small arrows are shown
indicating effectiveness of the integrin antibodies in inhibiting
one type of cytokine-induced angiogenesis.
[0230] The effects of specific mAb integrin immunoreactivity on the
above cytokine-induced angiogenesis is also quantified as shown in
FIGS. 2A and 2B. Angiogenesis was stimulated with either bFGF or
VEGF as shown respectively in FIGS. 2A and 2B. The treated eyes
were photographed daily through a Wild operating microscope
outfitted with a Nikon camera. Photographs were recorded on Kodak
Ektachrome 64T slide film and images were converted for
computer-assisted quantitation using Biorad's Molecular Analyst 1.1
software after acquisition through a Model GS670 imaging
densitometer. Histograms illustrating the mean neovascular area
.+-. the standard error (n=8 for each of two series) after exposure
to the mAbs P1F6 or LM609.
[0231] As shown in FIG. 2A, LM609 reduced bFGF-induced angiogenesis
by 86% (p<0.005, paired t-test) when compared to treatment of
the paired eye on the same animal with P1F6. When VEGF was used to
stimulate angiogenesis as shown in FIG. 2B, the opposite effect was
observed where P1F6 reduced the mean area of neovascularization by
60% (p<0.03, paired t-test) compared to the LM609-treated eye
that had a minimal effect on VEGF-induced angiogenesis.
[0232] Significantly, only the newly cytokine-induced blood vessels
were effected by exposure to a particular mAb while the
pre-existing perilimbal vessels were unaffected by either mAb
suggesting that the effects observed are restricted to newly
forming blood vessels of the cornea.
[0233] Similar assays are performed with synthetic peptides
prepared in Example 3 and as described below for use in inhibiting
cytokine-induced angiogenesis that is specifically correlated with
.alpha..sub.v.beta..sub.5 expression.
[0234] To confirm these results indicating that angiogenesis
induced by a particular cytokine was only effected by one type of
anti-integrin antibody, specifically that .alpha..sub.v.beta..sub.5
integrin receptor plays a role in VEGF-induced angiogenesis,
another neovascular model of the chick chorioallantoic membrane
(CAM) was evaluated with the combinations of cytokines and integrin
antibodies as shown in the next Example.
b. Treatment with Polypeptides
[0235] Each experiment consisted of eight rabbits in which one eye
received a pellet comprising 100 nanograms (ng) bFGF and the other
eye received a pellet comprising 1 microgram (ug) VEGF. The pellets
were inserted into the corneal pocket as described above, and the
cytokines subsequently stimulated the growth of new blood vessels
into the cornea. Peptides were administered subcutaneously (s.q.)
in 1 ml PBS at an initial dosage of 50 ug per kg rabbit the day of
pellet insertion, and daily s.q. dosages were given at 20 ug/kg
thereafter. After 7 days, the cornea were evaluated as described
above.
[0236] Rabbits receiving control peptide 69601 showed substantial
corneal blood vessel growth at 7 days, in both vFGF and VEGF
stimulated eyes. Rabbits receiving peptide 85189 showed less than
50% of the amount of corneal blood vessel growth compared to
controls in vFGF-stimulated eyes and nearly 100% inhibition in
VEGF-stimulated eyes.
5. Angiogenesis in the Chick Chorioallantoic Membrane (CAM)
Preparation
A. Characterization of the Untreated CAM
1) Preparation of the CAM
[0237] Angiogenesis can be induced on the chick chorioallantoic
membrane (CAM) after normal embryonic angiogenesis has resulted in
the formation of mature blood vessels. Angiogenesis has been shown
to be induced in response to specific cytokines or tumor fragments
as described by Leibovich et al., Nature, 329:630 (1987) and
Ausprunk et al., Am. J. Pathol., 79:597 (1975). CAMs were prepared
from chick embryos for subsequent induction of angiogenesis and
inhibition thereof as described below and in Example 6 with the
.alpha..sub.v.beta..sub.5 antagonists of this invention.
[0238] Ten day old chick embryos were obtained from McIntyre
Poultry (Lakeside, Calif.) and incubated at 37 C with 60% humidity.
A small hole was made through the shell at the end of the egg
directly over the air sac with the use of a small crafts drill
(Dremel, Division of Emerson Electric Co., Racine, Wis.). A second
hole was drilled on the broad side of the egg in a region devoid of
embryonic blood vessels determined previously by candling the egg.
Negative pressure was applied to the original hole, which resulted
in the CAM (chorioallantoic membrane) pulling away from the shell
membrane and creating a false air sac over the CAM. A 1.0
centimeter (cm).times.1.0 cm square window was cut through the
shell over the dropped CAM with the use of a small model grinding
wheel (Dremel). The small window allowed direct access to the
underlying CAM.
[0239] The resultant CAM preparation was then used at 10 days of
embryogenesis where angiogenesis has subsided. The preparation was
thus used in this invention for inducing renewed angiogenesis in
response to cytokine treatment.
2) Histology of the CAM
[0240] To analyze the microscopic structure of the chick embryo
CAMs, six micron (.mu.m) thick sections were cut from the frozen
blocks on a cryostat microtome for immunofluorescence analysis.
[0241] Typical of an untreated 10 day old CAM is an area devoid of
blood vessels. As angiogenesis in the CAM system is subsiding by
this stage of embryogenesis, the system is useful in this invention
for stimulating with various cytokines the production of new
vasculature from existing vessels from adjacent areas into areas of
the CAM currently lacking any vessels.
[0242] As shown in the CAM model and in the following Examples,
while the blood vessels are undergoing new growth in normal
embryogenesis or induced by cytokines, the blood vessels are
expressing .alpha..sub.v.beta..sub.3 and
.alpha..sub.v.beta..sub.5.
B. Angiogenesis Induced by Growth Factors
[0243] Angiogenesis has been shown to be induced by cytokines or
growth factors as described in Example 4A in the rabbit eye model.
In the experiments described herein, angiogenesis in the rabbit
corneal preparation described in Example 4 was similarly induced by
growth factors that were topically applied onto the CAM blood
vessels as described herein.
[0244] Angiogenesis was induced by placing a 5 millimeter
(mm).times.5 mm Whatman filter disk (Whatman Filter paper No. 1)
saturated with Hanks Balanced Salt Solution (HBSS, GIBCO, Grand
Island, N.Y.) or HBSS containing preselected cytokines at a
preselected concentration, i.e., one to test the effect on
angiogenesis, on the CAM of a 10 day chick embryo in a region
devoid of blood vessels and the windows were later sealed with
tape. Angiogenesis was monitored by photomicroscopy after 72 hours.
CAMs were snap frozen then 6 .mu.m cryostat sections were fixed
with acetone and stained by immunofluorescence as described in
Example 2B and 2C with 10 .mu.g/ml of selected anti-integrin
antibodies, including those directed against
.alpha..sub.v.beta..sub.5 as described in Example 1.
[0245] Previous studies by Brooks et al., Science, 264:569-571
(1994), have shown that blood vessels are readily apparent in both
the bFGF and TNF-.alpha. treated preparations but are not present
in the untreated CAM. The authors have also shown that
.alpha..sub.v.beta..sub.3 expression was enhanced following
bFGF-induced angiogenesis. While the expression of integrin
.beta..sub.1 did not change from that seen in an untreated CAM,
.beta..sub.1 was also readily detectable on stimulated blood
vessels.
[0246] These published findings indicated that in both human and
chick, blood vessels involved in angiogenesis show enhanced
expression of .alpha..sub.v.beta..sub.3. Consistent with this,
expression of .alpha..sub.v.beta..sub.3 on cultured endothelial
cells were induced by various cytokines in vitro as described by
Janat et al., J. Cell Physiol., 151:588 (1992); Enenstein et al.,
Exp. Cell Res., 203:499 (1992) and Swerlick et al., J. Invest.
Derm., 99:715 (1993).
[0247] In this invention, a separate cytokine-mediated pathway for
simulating angiogenesis that is dependent upon expression and
activation of a different adhesive integrin receptor,
.alpha..sub.v.beta..sub.5, has now been determined. The effect of
exposure of a CAM as described herein to the cytokines VEGF,
TGF-.alpha. and EGF in relationship to the expression of
.alpha..sub.v.beta..sub.5, to angiogenesis and inhibition thereof
with .alpha..sub.v.beta..sub.5 antagonists is described in Example
6.
C. Angiogenesis Induced by Tumors
[0248] To investigate the role of .alpha..sub.v.beta..sub.5 in
tumor-induced angiogenesis, various
.alpha..sub.v.beta..sub.5-negative human melanoma and carcinoma
fragments are used in the CAM assay that are previously grown and
isolated from the CAM of 17 day chick embryo as described by Brooks
et al., J. Cell Biol., 122:1351 (1993) and as described herein.
[0249] Angiogenesis is induced in the CAM assay system by direct
apposition of a tumor fragment on the CAM. Preparation of the chick
embryo CAM is identical to the procedure described above. Instead
of a filter paper disk, a 50 milligram (mg) to 55 mg in weight
fragment of one .alpha..sub.v.beta..sub.5-negative tumor resulting
from growth of cell line suspensions described below, is placed on
the CAM in an area originally devoid of blood vessels.
[0250] The cell lines, rabdomyosarcoma, myeloid (HL-60 or KG-1),
and lymphoid (T cells-Jurkat, HPB/ALL, PEER; and various B cell
lines) as described by Pasqualini et al. J. Cell Sci., 105:101-111
(1993), are used to grow the solid human tumors on the CAMs of
chick embryos. A single cell suspension of tie various cell lines
are first applied to the CAMs in a total volume of 30 .mu.l of
sterile HBSS. The windows are sealed with tape and the embryos are
incubated for 7 days to allow growth of human tumor lesions. At the
end of 7 days, now a 17 day embryo, the tumors are resected from
the CAMs and trimmed free of surrounding CAM tissue. The tumors are
sliced into 50 mg to 55 mg tumor fragments for use in angiogenesis.
The tumor fragments are placed on a new set of 10 day chick embryo
CAMs as described in Example 5A in an area devoid of blood
vessels.
[0251] Tumors grown in vivo on the chick embryo CAMs with and
without topical or intravenous application of
.alpha..sub.v.beta..sub.5-inducing cytokines (VEGF, TGF-.alpha., or
EGF) are then stained for .alpha..sub.v.beta..sub.5 expression with
mAbs, P1F6 or P5H9, as previously described.
[0252] These CAM tumor preparations are then subsequently treated
as described in Examples 6C and 6D for measuring the effects of
antibodies and peptides including MMP-2 C-terminal fragments on
tumor-induced angiogenesis.
[0253] In one embodiment, hamster melanoma cells, CS-1, obtained
from Dr. Caroline Damsky from University of California at San
Francisco, were used in the CAM assay as described above for
formation of melanoma tumors. Following the transfer of
approximately a 50 mg CS-1 tumor fragment on a new 10 day chick
embryo CAM, separate preparations received an intravenous
injections of either 100 .mu.g or 300 .mu.g of P1F6 antibody, LM609
antibody or control CSAT (anti-.beta.1) antibody. An additional
control included a preparation that received no treatment. The
results are discussed below in Example 6D.
6. Inhibition of Angiogenesis as Measured in the CAM Assay
A. Inhibition of Growth Factor-Induced Angiogenesis by Intravenous
Application of Inhibitors
[0254] The effect on growth factor-induced angiogenesis with
monoclonal antibodies intravenously injected into the CAM
preparation was evaluated for use as an in vivo model system of
this invention.
[0255] Following active neovascularization, once the vessels have
stopped developing, the expression of .alpha..sub.v.beta..sub.5
diminishes to levels not detectable by immunofluorescence analysis.
This regulation of .alpha..sub.v.beta..sub.5 expression in blood
vessels undergoing angiogenesis as contrasted to the lack of
expression in mature vessels provides for the unique ability of
this invention to control and inhibit angiogenesis as shown below
as modeled in the CAM angiogenesis assay system.
[0256] The preparation of the chick embryo CAMs for intravenous
injections was essentially as described above.
[0257] Angiogenesis was first induced on 10 day old chick embryos
by application of growth factor-saturated filter disks.
Specifically, in the first assays, angiogenesis was induced by
exposure to either bFGF or VEGF, each at a concentration of 150
ng/ml.
[0258] For application of growth factors, during the candling
procedures, prominent blood vessels were selected and marks were
made on the egg shell to indicate their positions. The holes were
drilled in the shell, the CAMs were dropped and growth
factor-saturated filter papers were then separately placed on the
CAMs as described above. The windows were sealed with sterile tape
and the embryos were replaced in the incubator.
[0259] Twenty four hours later, a second small window was carefully
cut on the lateral side of the egg shell directly over prominent
blood vessels selected previously. The outer egg shell was
carefully removed leaving the embryonic membranes intact. The shell
membrane was made transparent with a small drop of mineral oil
(Perkin-Elmer Corp, Norwalk, Conn.) which allowed the blood vessels
to be visualized easily. Then, phosphate buffered saline (PBS), 75
.mu.g of purified sterile anti-integrin antibodies or 75 .mu.g of
synthetic peptides (cyclic peptide RGDfV, SEQ ID NO 4 and control
cyclic peptide RADfV, SEQ ID NO 5) in PBS were injected into blood
vessels apparent on the growth factor-induced CAMs. The windows
were sealed with tape and the embryos were allowed to incubate
until 72 hours.
[0260] The filter discs and representative surrounding CAM tissues
were photographed in a stereomicroscope (FIGS. 3A-3F and FIGS.
5A-5F) and the mean angiogenic index .+-. the standard error was
determined for 12 CAMs per condition (FIGS. 4A-4B and FIGS. 6A-6B).
Angiogenesis was scored for each embryo in a double blind manner by
analyzing the number and extent of branching of blood vessels
within the area of each disc. The scores ranged from 1 (low) to 4
(high) and the angiogenesis index was determined by subtracting a
background of 1 from all data.
[0261] Specificity of integrin antibody-mediated inhibition of
growth factor-induced angiogenesis in the CAM model mirrored that
seen in the rabbit cornea model described above. As respectively
shown in FIGS. 3A and 3B, both bFGF and VEGF caused angiogenesis in
the control PBS-treated CAM. Treatment with the
.alpha..sub.v.beta..sub.5-specific antibody, P1F6, however,
resulted in inhibition of VEGF-induced angiogenesis as shown in
FIG. 3D while no inhibition was detected on bFGF-induced
angiogenesis as seen in FIG. 3C. In contrast, the LM609
.alpha..sub.v.beta..sub.3-specific antibody inhibited bFGF-induced
angiogenesis (FIG. 3E) but had little effect on angiogenesis in the
VEGF-induced CAM (FIG. 3F).
[0262] These results are also shown in the bar graphs of FIGS. 4A
and 4B, respectively for both bFGF- and VEGF-treated CAMs, in which
the angiogenesis index is plotted against exposure to either LM609
or P1F6 along with no antibody exposure as a control. Thus,
inhibition of growth factor-induced angiogenesis by
integrin-specific antibodies is dependent upon the type of growth
factor.
[0263] Exposure to RGD-containing peptides supports the above
results. In the presence of PBS, as shown in FIGS. 5A and 5B,
exposure to both bFGF and VEGF resulted in angiogenesis in the
control CAM. In contrast, the cyclic peptide antagonist RGDfV (SEQ
ID NO 4), directed to both .alpha..sub.v.beta..sub.3 and
.alpha..sub.v.beta..sub.5, abolished angiogenesis induced by either
bFGF or VEGF. The cyclic peptide RADfV (SEQ ID NO 5) did not effect
angiogenesis in either the bFGF- or VEGF-treated CAM preparations.
The results are also shown in FIGS. 6A and 6B where the
angiogenesis index of bFGF- and VEGF-stimulated CAMS are graphed
showing exposure to test and control peptides. Thus, these findings
together with those in the rabbit corneas indicate that bFGF- and
VEGF-induced angiogenesis depend on distinct but homologous
.alpha..sub.v-specific integrins that however are both inhibitable
with the cyclic peptide RGDfV.
[0264] In a further assay performed in the CAM model having
VEGF-induced angiogenesis, 2 .mu.g of peptides 85189 (SEQ ID NO 9)
and the inert salt counterpart 121974 were separately intravenously
injected as previously described. The effect of the peptides was
assessed in comparison to that of control peptide 69601 (SEQ ID NO
5) and to untreated (labeled as NT) preparations.
[0265] The effect of the peptides on VEGF-induced angiogenesis is
measured through a determination of the number of blood vessel
branch points. Thus, angiogenesis or the lack therof was quantified
by counting the number of blood vessels branch points that occur
within the confines of the filter discs. The branched blood vessels
are considered to correspond primarily to new angiogenic sprouting
blood vessels. Quantification was performed in a double blind
manner by at least two independent observers. The results are
expressed as the Angiogenic Index where the angiogenic index is the
number of branch points (VEGF stimulated) minus the number of
branch points (control unstimulated) per filter disc. Experiments
routinely had 6-10 embryos per condition. As shown in FIG. 17, both
peptides 85189 and 121974 completely inhibited angiogenesis as
indicated by a reduction of the measurable branch points in
comparison to untreated or control peptide-treated
preparations.
[0266] Additional similar assays are performed with synthetic
peptides prepared as described in Example 3 to define peptides that
exhibit specificity to .alpha..sub.v.beta..sub.5 and not
.alpha..sub.v.beta..sub.3 correlated angiogenesis. Assays are also
performed with the MMP-2 C-terminal fragments prepared as described
in Example 3 and 7 and with the organic molecules prepared as
described in Example 10.
[0267] The specificity of integrin antibody-inhibition of growth
factor-induced angiogenesis was further confirmed and strengthened
by extending the growth factor angiogenesis induction analyses to
include tumor necrosis factor-.alpha. (TNF-.alpha.), transforming
growth factor-.alpha. (TGF-.alpha.) or the phorbol ester,
4-.beta.-phorbol-12-myristate-13-acetate (PMA).
[0268] The above growth factors (cytokines), including bFGF and
VEGF, were separately applied at a concentration of 1.0 .mu.g/ml to
the 10 day old CAM model as previously described. PMA was used at a
concentration of 20 ng/ml.
[0269] After 24 hours after growth factor treatment, the
antibodies, LM609 and P1F6, or the protein kinase C (PKC)
inhibitor, calphostin C, were separately provided to the CAM model,
either by a single intravascular dose as described above or by
topical administration as described below in the next example. For
intravascular injections over the next 3 day consecutive period,
the antibodies were used at a concentration of 75 .mu.g per embryo
and the calphostin C was at a dosage of 100 nM.
[0270] On day 13, filter discs and associated CAM tissue were
dissected and analyzed for angiogenesis with a stereo microscope.
Angiogenesis was scored in a double blind manner by analyzing the
number and extent of branching of the blood vessels within the area
of the discs. The scores ranged from low (1) to high (4). The
angiogenesis index was determined by subtracting a background score
of 1 from all data. Experiments were repeated 2-4 times with 5-6
embryos per condition.
[0271] As shown respectively in FIGS. 7A and 7B, the
anti-.alpha..sub.v.beta..sub.3 antibody, LM609, blocked
angiogenesis in response to bFGF and TNF-.alpha. whereas the
anti-.alpha..sub.v.beta..sub.5 antibody, P1F6, had little
inhibitory effect. In contrast, as shown respectively in FIGS.
7C-7E, P1F6 was effective at inhibiting angiogenesis induced by
VEGF, TGF-.alpha., or PMA whereas LM609 failed to do so.
[0272] PMA, a potent inducer of angiogenesis, is capable of
activating protein kinase C (PKC), an intracellular family of
serine threonine kinases. Therefore, we also examined the effects
of calphostin C, a PKC inhibitor, on angiogenesis on the chick CAM.
Calphostin C blocked angiogenesis induced by PMA (FIG. 7E) as well
as VEGF and TGF-.alpha. (respectively shown in FIGS. 7C and 7D)
while having minimal effects on bFGF- or TNF-.alpha. mediated
angiogenesis (respectively shown in FIGS. 7A and 7B).
[0273] Together, these results indicate the existence of two
separate distinct angiogenesis pathways where one is dependent upon
an .alpha..sub.v.beta..sub.3-mediated signal that is largely
independent of PKC, as previously described by Brooks et al.,
Science, 264:569-571 (1994), and a second pathway is potentiated by
an .alpha..sub.v.beta..sub.5-mediated transduction signal that
critically depends of PKC activation.
[0274] In addition to the above experiments, to determine the
localization of the P1F6 and LM609 mAbs in CAM tissues that were
inoculated intravenously with LM609, the fixed sections are blocked
with 2.5% BSA in HBSS for 1 hour at room temperature followed by
staining with a 1:250 dilution of goat anti-mouse rhodamine labeled
secondary antibody (Tago). The sections are then analyzed with a
Zeiss immunofluorescence compound microscope.
B. Inhibition of Growth Factor-Induced Angiogenesis by Topical
Application of Inhibitors
[0275] To determine whether .alpha..sub.v.beta..sub.5 plays an
active role in angiogenesis, filter disks saturated with growth
factors described above are placed on CAMs to induce angiogenesis
followed by application of either P1F6 or LM609.
[0276] Disks are then treated with 50 ml HBSS containing 25 mg of
mAb in a total volume of 25 .mu.l of sterile HBSS at 0, 24, and 48
hours. At 72 hours. CAMs are harvested and placed in a 35 mm petri
dish and washed once with 1 ml of PBS. The bottom side of the
filter paper and CAM tissue is then analyzed under an Olympus
stereo microscope, with two observers in a double-blind fashion.
Angiogenesis inhibition is considered significant when CAMs
exhibits >50% reduction in blood vessel infiltration of the CAM
directly under the disk. Experiments are repeated four times per
antibody, with 6 to 7 embryos per condition.
[0277] To examine the effects of the integrin antibodies on
preexisting mature blood vessels present from normal vessel
development adjacent to the areas devoid of vessels, filter disks
saturated with mAbs are placed on vascularized regions of CAMs from
10 day embryos that do not receive topical application of
cytokine.
[0278] CAM assays are also performed with the synthetic peptides of
this invention to determine the effect of cyclic and linearized
peptides on growth factor induced angiogenesis. Eight .mu.g of
peptides, prepared as previously described, are separately
presented in a total volume of 25 .mu.l of sterile HBSS. The
peptide solution is applied to the CAM preparation immediately and
then again at 24 and 48 hrs. At 72 hours the filter paper and
surrounding CAM tissue are dissected and viewed as described
above.
[0279] Similar assays are performed with the MMP-2 fragments and
organic molecules prepared as respectively described in Examples 7
and 10.
C. Inhibition of Tumor-Induced Angiogenesis by Topical
Application
1) Treatment with Monoclonal Antibodies
[0280] In addition to the angiogenesis assays described above where
the effects of anti-.alpha..sub.v.beta..sub.5 antibody and peptide
antagonists were evaluated, the role of .alpha..sub.v.beta..sub.5
in tumor-induced angiogenesis is also investigated. As an inducer,
.alpha..sub.v.beta..sub.5-negative human tissues previously grown
and isolated from the CAM of a 17-day chick embryo are used. The
fragments are prepared as described in Example 5C.
[0281] As described above, mAbs are separately topically applied to
the tumor fragments at a concentration of 25 .mu.g in 25 .mu.l of
HBSS and the windows are then sealed with tape. The mAbs are added
again in the same fashion at 24 hours and 48 hours. At 72 hours,
the tumors and surrounding CAM tissues are analyzed as described
above.
[0282] As described in Example 5C, tumors are initially derived by
transplanting human cell lines, which do not express integrin
.alpha..sub.v.beta..sub.5, onto the CAMs of 10 day old chick
embryos.
[0283] In order to quantitate the effect of the mAbs on the
tumor-induced angiogenesis, blood vessels entering the tumor within
the focal plane of the CAM are counted under a stereo microscope by
two observers in a double-blind fashion.
[0284] The synthetic peptides prepared in Example 3, the MMP-2
preparations described in Example 7 and the organic molecules
prepared in Example 10 are similarly topically applied to the
tumor-induced angiogenic CAM assay system as described above. The
effect of the peptides including the MMP-2 preparations and organic
molecules described in this invention on the viability of the
vessels is similarly assessed.
D. Inhibition of Tumor-Induced Angiogenesis by Intravenous
Application
1) Treatment with Monoclonal Antibodies
[0285] Tumor-induced blood vessels prepared above were also treated
with mAbs applied by intravenous injection. CS-1 melanoma tumors
were placed on the CAMs as described in Example 5C and the windows
were sealed with tape and 24 hours later, 100 to 300 .mu.g of
purified mAbs were inoculated once intravenously in chick embryo
blood vessels as described previously. The chick embryos were then
allowed to incubate for 7 days. The extent of angiogenesis was then
observed as described in above. After this time period, the tumors
were resected and analyzed by their weight to determine the effect
of antibody exposure on tumor growth or suppression.
[0286] The results of treatment of CS-1 tumors with 300 .mu.g of
.alpha..sub.v.beta..sub.5 specific antibody P1F6 are shown in FIG.
8. The tumor weight was dramatically reduced to less than 50 mg as
compared to untreated to CSAT-treated tumors. The
.alpha..sub.v.beta..sub.3 specific antibody, LM609, also inhibited
tumor growth, however, less effective than that with P1F6.
Comparable results were obtained with tumors receiving treatment
with 100 .mu.g of P1F6. Thus, P1F6 was effective at inhibiting
.alpha..sub.v.beta..sub.5-mediated angiogenesis in a tumor model on
a CAM preparation resulting in a diminution of tumor cell mass.
2) Treatment with Other .alpha..sub.v.beta..sub.5 Antagonists
[0287] The effects of peptides, MMP-2 preparations or organic
molecules on tumor-induced vasculature in the CAM assay system are
also assessed. The tumor-CAM preparation is used as described above
with the exception that instead of intravenous injection of a mAb,
synthetic peptides including MMP-2 preparations prepared as
described in Example 7 and organic molecules prepared in Example 10
are separately intravenously injected into visible blood
vessels.
[0288] In one particular set of assays, additional tumor regression
assays were performed with the .alpha..sub.v.beta..sub.5-reactive
peptide 85189 (SEQ ID NO 9) against 69601 (SEQ ID NO 5) as a
control. The assays were performed as described above with the
exception that 100 .mu.g of peptide was intravenously injected into
the CAM at 18 hourst postimplantation of the various tumors which
in this case included UCLAP-3, M21-L and FgM tumor types. After 48
hours more, the tumors were then resected and wet weights were
obtained.
[0289] FIGS. 18, 19 and 20 respectively show the reduction in tumor
weight for UCLAP-3, M21-L and FgM tumors following intravenous
exposure to peptide 85189 in contrast to the lack of effect with
either PBS or peptide 69601.
7. Identification of .alpha..sub.v.beta..sub.5-Specific Antagonists
Detected by Inhibition of Cell Attachment and by a Ligand-Receptor
Binding Assay
A. Inhibition of Cell Attachment
[0290] As one means to determine integrin receptor specificity of
the antagonists of this invention, inhibition of cell attachment
assays are performed as described below.
[0291] Briefly, CS-1 hamster melanoma cells lacking expression of
.alpha..sub.v.beta..sub.3 and .alpha..sub.v.beta..sub.5 are first
transfected with an plasmid for expressing the .beta..sub.5 subunit
as previously described by Filardo et al., J. Cell Biol.,
130:441-450 (1995). Specificity of potential
.alpha..sub.v.beta..sub.5 antagonists was determined by the ability
to block the binding of .alpha..sub.v.beta..sub.5-expressing CS-1
cells to VN or laminin coated plates. As an example of a typical
assay, the wells were first coated with 10 ug/ml substrate
overnight. After rinsing and blocking with 1% heat-denatured BSA in
PBS at room temperature for 30 minutes, peptide 85189 (SEQ ID NO 9)
over a concentration range of 0.0001 uM to 100 uM, are separately
mixed with CS-1 cells for applying to wells with a cell number of
50,000 cells/well. After a 10-15 minute incubation at 37 C, the
solution containing the cells and peptides is discarded. The number
of attached cells is then determined following staining with 1%
crystal violet. Cell associated crystal violet is eluted by the
addition of 100 microliters (.mu.l) of 10% acetic acid. Cell
adhesion was quantified by measuring the optical density of the
eluted crystal violet at a wave length of 600 nm.
[0292] Similar assays are performed with fusion proteins or the
synthetic peptide counterparts containing various regions of the
MMP-2 protein. The MMP-2-derived polypeptides include regions of
the C-terminus of MMP-2 active in the binding interaction with
.alpha..sub.v.beta..sub.5 and thereby capable of inhibiting MMP-2
activation and associated activities. These polypeptides are
prepared either as synthetic polypeptides having a sequence derived
from the C-terminal domain of MMP-2 as described in Example 1 or as
fusion proteins including all or a portion of the C-terminal domain
of MMP-2, prepared as described below. MMP-2 C-terminal molecules
are presented for both chicken and human specific sequences.
[0293] The chicken-derived MMP-2 C-terminal domain, also referred
to as the hemopexin domain immediately contiguous with the hinge
region, comprises the amino acid residues 445-637 of MMP-2. The
complete nucleotide and encoded amino acid sequence of chicken
MMP-2 is described below and is shown in FIGS. 15A and 15B, with
the nucleotide and amino acid sequences respectively listed as SEQ
ID NOs 23 and 24. The human MMP-2 nucleotide and encoded amino acid
sequence is also described below, with the latter shown in FIG. 16
and SEQ ID NO 25. The C-terminal domain in the human MMP-2 that
corresponds to the chicken region of 445-637 begin at amino acid
residue 439 and ends with 631 due to six missing residues from the
human sequence as shown in FIGS. 15A and 15B. Both human- and
chicken-derived C-terminal MMP-2 synthetic peptides for use in
practicing the methods of this invention are listed in Table 1. The
amino acid residue sequences of the synthetic peptides are the same
as those generated by the recombinant fusion protein counterparts
but without the GST fusion component. The C-terminal MMP-2 fusion
proteins derived from both chicken and human are prepared as
described below.
[0294] A MMP-2 fusion protein is a chimeric polypeptide having a
sequence of MMP-2 C-terminal domain or a portion thereof fused
(operatively linked by covalent peptide bond) to a carrier (fusion)
protein, such as glutathione sulfhydryl transferase (GST).
[0295] To amplify various regions of chicken and human MMP-2.
primer sequences were designed based on the known respective cDNA
sequences of chicken and human MMP-2. The complete top strand of
the cDNA nucleotide sequence of unprocessed chicken MMP-2, also
referred to as progelatinase, is shown in FIGS. 15A and 15B along
with the deduced amino acid sequence shown on the second line
(Aimes et al., Biochem. J., 300:729-736, 1994). The third and
fourth lines of the figure respectively show the deduced amino acid
sequence of human (Collier et al., J. Biol. Chem., 263:6579-6587
(1988)) and mouse MMP-2 (Reponen et al., J. Biol. Chem.,
267:7856-7862 (1992)). Identical residues are indicated by dots
while the differing residues are given by their one letter IUPAC
lettering. Missing residues are indicated by a dash. The numbering
of the amino acid residues starts from the first residue of the
proenzyme, with the residues of the signal peptide being given
negative numbers. The nucleotide sequence is numbered accordingly
in the figure although in the Sequence Listing. the first
nucleotide is listed as number 1. The putative initation of
translation (ATG) is marked with three forward arrowheads and the
translation termination signal (TGA) is indicated by an asterisk.
The amino terminal sequences for the chicken proenzyme and active
enzyme are contained with diamonds and single arrowheads. As
previously stated, the chicken progelatinase nucleotide and amino
acid residue sequences are listed together as SEQ ID NO 23 while
the encoded amino acid residue sequence is listed separately as SEQ
ID NO 24.
[0296] Templates for generating amplified regions of chicken MMP-2
were either a cDNA encoding the full-length mature chicken MMP-2
polypeptide provided by Dr. J. P. Quigley of the State University
of New York at Stoney Brook, N.Y. or a cDNA generated from a total
cellular RNA template derived by standard techniques from an
excised sample of chicken chorioallantoic membrane tissue. For the
latter, the cDNA was obtained with MuLV reverse transcriptase and a
downstream primer specific for the 3' -terminal nucleotides,
5'ATTGAATTCTTCTACAGTTCA3' (SEQ ID NO 26), the 5' and 3' ends of
which was respectively complementary to nucleotides 1932-1912 of
the published chick MMP-2 sequence. As described in the FIG. 15
figure legend, the nucleotide positions of the primers described
herein correspond to those shown in the figure and not as shown in
the Sequence Listing as the latter begins with number 1 and not as
a negative number as indicated in the figure. Reverse transcriptase
polymerase chain reaction (RT-PCR) was performed according to the
specifications of the manufacturer for the GeneAmp RNA PCR Kit
(Perkin Elmer). The primer was also engineered to contain an
internal EcoRI restriction site.
[0297] From either of the above-described cDNA templates, a number
of C-terminal regions of chicken MMP-2. each having the natural
cysteine residue at position 637 at the carboxy terminus, were
obtained by PCR with the 3' primer listed above (SEQ ID NO 26)
paired with one of a number of 5' primers listed below. The
amplified regions encoded the following MMP-2 fusion proteins,
having sequences corresponding to the amino acid residue positions
as shown in FIGS. 15A and 15B and also listed in SEQ ID NO 24: 1)
203-637; 2) 274-637; 3) 292-637; 4) 410-637; 5) 445-637. Upstream
or 5' primers for amplifying each of the nucleotide regions for
encoding the above-listed MMP-2 fusion proteins were designed to
encode the polypeptide start sites 3' to an engineered, i.e.,
PCR-introduced, internal BamHI restriction site to allow for
directional ligation into either pGEX-1.lamda.T or pGEX-3X
expression vectors. The 5' primers included the following
sequences, the 5' and 3' ends of which correspond to the indicated
5' and 3' nucleotide positions of the chicken MMP-2 sequence shown
in the figure (the amino acid residue position start sites are also
indicated for each primer): 1) Nucleotides 599-619, encoding a 203
start site 5'ATGGGATCCACTGCAAATTTC3' (SEQ ID NO 27); 2) Nucleotides
809-830, encoding a 274 start site 5'GCCGGATCCATGACCAGTGTA3' (SEQ
ID NO 28); 3) Nucleotides 863-883, encoding a 292 start site
5'GTGGGATCCCTGAAGACTATG3' (SEQ ID NO 29); 4) Nucleotides 1217-1237,
encoding a 410 start 5'AGGGGATCCTTAAGGGGATTC3' (SEQ ID NO 30); and
5) Nucleotides 1325-1345, encoding a 445 start site
5'CTCGGATCCTCTGCAAGCACG3' (SEQ ID NO 31).
[0298] The indicated nucleotide regions of the template cDNA were
subsequently amplified for 35 cycles (annealing temperature 55 C)
according to the manufacturer's instructions for the Expand High
Fidelity PCR System (Boehringer Mannheim). The resulting PCR
products were gel-purified, digested with BamHI and EcoRI
restriction enzymes, and repurified before ligation into either
pGEX-1.lamda.T or pGEX-3X vector (Pharmacia Biotech, Uppsala,
Sweden) which had been similarly digested as well as
dephosphorylated prior to the ligation reaction. The choice of
plasmid was based upon the required reading frame of the
amplification product. Competent E. coli strain BSJ72 or BL21 cells
were transformed with the separate constructs by heat shock. The
resulting colonies were screened for incorporation of the
respective MMP-2 fusion protein-encoding plasmid by PCR prior to
dideoxy sequencing of positive clones to verify the integrity of
the introduced coding sequence. In addition, verification of
incorporation of plasmid was confirmed by expression of the
appropriately-sized GST-MMP-2 fusion protein.
[0299] Purification of each of the recombinant GST-MMP-2 fusion
proteins was performed using IPTG-induced log-phase cultures
essentially as described by the manufacturer for the GST Gene
Fusion System (Pharmacia Biotech). Briefly, recovered bacteria were
lysed by sonication and incubated with detergent prior to
clarification and immobilization of the recombinant protein on
sepharose 4B-coupled glutathione (Pharmacia Biotech). After
extensive washing, the immobilized fusion proteins were separately
eluted from the affinity matrix with 10 mM reduced glutathione in
50 mM Tris-HCl, pH 8.0. and dialyzed extensively against PBS to
remove residual glutathione prior to use.
[0300] Prior attempts to produce fusion proteins between chicken
MMP-2 residues 445 and 637 that only had one encoded cysteine
residue resulted in insoluble products. Therefore, in order to
generate additional soluble MMP-2 fusion proteins derived from the
C-terminal region that did not include an endogenous terminal
cysteine residue as present in the previously-described fusion
protein, nucleotide sequences were introduced into amplified MMP-2
regions to encode a cysteine residue if necessary depending on the
particular fusion protein. A cysteine residue is naturally present
in the chicken MMP-2 sequence at position 446 and at position 637.
In the human sequence, these positions correspond respectively to
440 and 631. Therefore, fusion proteins were designed to contain
engineered terminal cysteine residues at the amino- or
carboxy-terminus of the chicken MMP-2 sequences of interest so as
to provide for disulfide-bonding with the naturally occurring
cysteine at the other terminus, as required by the construct.
Synthetic MMP-2 fragments for both chicken and human are similarly
prepared as previously described in Example 3.
[0301] Oligonucleotide primers were accordingly designed to allow
for amplification of chicken MMP-2 C-terminal regions for
expression of soluble MMP-2/GST fusion proteins. Amplified chicken
MMP-2 C-terminal regions included those for encoding amino acid
residue positions 445-518, 445-552, 516-637 and 549-637. For fusion
proteins containing residue 517, the naturally encoded tyrosine
residue was substituted for a cysteine to allow for disulfide
bonding with either cysteine at residue position 446 or 637. For
fusion proteins containing residue 551, the naturally encoded
tryptophan residue was substituted for a cysteine to allow for
disulfide bonding with either naturally encoded cysteine at residue
position 446 or 637.
[0302] Briefly, the pGEX-3X plasmid construct encoding the
recombinant GST/MMP-2(410-637) fusion protein prepared above was
used as a template for amplification according to the
manufacturer's protocol for the Expand High Fidelity PCR Kit
(Boehringer Mannheim) utilizing a set of oligonucleotide primers
whose design was based on the published chicken MMP-2 sequence
(also shown in FIGS. 15A and 15B and in SEQ ID NO 23). One upstream
primer, designed to encode a chicken MMP-2 protein start site at
position 445 after an engineered internal BamHI endonuclease
restriction site for insertion into the pGEX-3X GST vector, had the
nucleotide sequence (5'CTCGGATCCTCTGCAAGCACG3' (SEQ ID NO 32)). The
5' and 3' ends of the primer respectively corresponded to positions
1325-1345 of the chicken MMP-2 sequence in FIGS. 15A and 15B.
Another upstream primer, designed to encode a chicken MMP-2 protein
start site at position 516 after an engineered internal BamHI
restriction site for insertion into the pGEX-1.lamda.T GST vector
and to encode a cysteine residue at position 517, had the
nucleotide sequence (5'GCAGGATCCGAGTGCTGGGTTTATAC3' (SEQ ID NO
33)). The 5' and 3' ends of the primer respectively corresponded to
positions 1537-1562 of the chicken MMP-2 sequence in the figure. A
third upstream primer, designed to encode a chicken MMP-2 protein
start site at position 549 following an engineered internal EcoRI
endonuclease restriction site for insertion into the pGEX-1.lamda.T
GST vector and to encode a cysteine residue at position 551, had
the nucleotide sequence (5'GCAGAATTCAACTGTGGCAGAAACAAG3' (SEQ ID NO
34)). The 5' and 3' ends of the primer respectively corresponded to
positions 1639-1665 of the chicken MMP-2 sequence in the
figure.
[0303] These upstream primers were separately used with one of the
following downstream primers listed below to produce the
above-described regions from the C-terminal domain of chicken
MMP-2. A first downstream primer (antisense), designed to encode a
chicken MMP-2 protein termination site at position 518, to encode a
cysteine residue at position 517, and to contain an internal EcoRI
endonuclease restriction site for insertion into a GST vector, had
the nucleotide sequence (5'GTAGAATTCCAGCACTCATTTCCTGC3' (SEQ ID NO
35)). The 5' and 3' ends of the primer, written in the 5'-3'
direction, were respectively complementary in part to positions
1562-1537 of the chicken MMP-2 sequence in the figure. A second
downstream primer, designed to encode a chicken MMP-2 protein
termination site at position 552, to encode a cysteine residue at
position 551, and to contain an internal EcoRI endonuclease
restriction site for insertion into a GST vector, had the
nucleotide sequence (5'TCTGAATTCTGCCACAGTTGAAGG3' (SEQ ID NO 36)).
The 5' and 3' ends of the primer, written in the 5'-3' direction,
were respectively complementary in part to positions 1666-1643 of
the chicken MMP-2 sequence in the figure. A third downstream
primer, designed to encode a chicken MMP-2 protein termination site
at position 637 and to contain an internal EcoRI endonuclease
restriction site for insertion into a GST vector, had the
nucleotide sequence (5'ATTGAATTCTTCTACAGTTCA3' (SEQ ID NO 37)). The
5' and 3' ends of the primer, written in the 5'-3' direction, were
respectively complementary in part to positions 1932-1912 of the
chicken MMP-2 sequence in the figure.
[0304] The regions of the chicken MMP-2 carboxy terminus bounded by
the above upstream and downstream primers, used in particular
combinations to produce the fusion proteins containing at least one
engineered cysteine residue as described above, were separately
amplified for 30 cycles with an annealing temperature of 55 C
according to the manufacturer's instructions for the Expand High
Fidelity PCR System (Boehringer Mannheim). The resulting
amplification products were separately purified, digested with
BamHI and or EcoRI restriction enzymes as necessary, and repurified
before ligation into the appropriate GST fusion protein vector,
either pGEX-3X or pGEX-1.lamda.T, as indicated above by the reading
frame of the upstream oligonucleotide primer. For ligating the
amplified MMP-2 products, the vectors were similarly digested as
well as dephosphorylated prior to the ligation reaction. Competent
E. coli strain BL21 cells were then separately transformed with the
resultant MMP-2-containing vector constructs by heat shock.
Resulting colonies were then screened for incorporation of the
appropriate fusion protein-encoding plasmid by PCR and production
of the appropriate sized GST-fusion protein prior to dideoxy
sequencing of positive clones to verify the integrity of the
introduced coding sequence. Purification of recombinant GST fusion
proteins were then performed using IPTG-induced log-phase cultures
essentially as described above for producing the other GST-MMP-2
fusion proteins.
[0305] In addition to the chicken MMP-2 GST-fusion proteins
described above, two human MMP-2 GST fusion proteins were produced
for expressing amino acid regions 203-631 and 439-631 of the mature
human MMP-2 proenzyme polypeptide. The indicated regions correspond
respectively to chicken MMP-2 regions 203-637 and 445-637. Human
MMP-2-GST fusion proteins were produced by PCR as described above
for the chicken MMP-2-GST fusion proteins utilizing a cDNA template
that encoded the entire human MMP-2 open reading frame provided by
Dr. W. G. Stetler-Stevenson at the National Cancer Institute,
Bethesda, Md. Upstream 5' primer sequences were designed based upon
the previously published sequence of human MMP-2 (Collier et al.,
J. Biol. Chem., 263:6579-6587 (1988) and to encode an introduced
internal EcoRI restriction site to allow for insertion of the
amplified products into the appropriate expression vector.
[0306] One upstream primer, designed to encode a human MMP-2
protein start site at position 203 after an engineered internal
EcoRI endonuclease restriction site for insertion into the
pGEX-1.lamda.T GST vector, had the nucleotide sequence
(5'GATGAATTCTACTGCAAGTT3' (SEQ ID NO 38)). The 5' and 3' ends of
the primer respectively corresponded to positions 685-704 of the
human MMP-2 open reading frame sequence. Another upstream primer,
designed to encode a human MMP-2 protein start site at position 439
after an engineered internal EcoRI restriction site for insertion
into the pGEX-1.lamda.T GST vector, had the nucleotide sequence
(5'CACTGAATTCATCTGCAAACA3' (SEQ ID NO 39)). The 5' and 3' ends of
the primer respectively corresponded to positions 1392 and 1412 of
the human MMP-2 open reading frame sequence.
[0307] Each of the above primers were used separately with a
downstream primer, having 5' and 3' ends respectively complementary
to bases 1998 and 1978 of the human MMP-2 sequence that ends distal
to the MMP-2 open reading frame and directs protein termination
after amino acid residue 631. The amplified products produced
expressed fusion proteins containing human MMP-2 amino acid
residues 203-631 (SEQ ID NO 40) and 439-631 (SEQ ID NO 12).
[0308] The resulting PCR products were purified, digested with
EcoRI and repurified for ligation into a pGEX-1.lamda.T plasmid
that was similarly digested and dephosphorylated prior to the
ligation reaction. Cells were transformed as described above.
[0309] Other human MMP-2 fusion proteins containing amino acid
residues 410-631 (SEQ ID NO 11), 439-512 (SEQ ID NO 13), 439-546
(SEQ ID NO 14), 510-631 (SEQ ID NO 15) and 543-631 (SEQ ID NO 16)
are also prepared as described above for use in the methods of this
invention.
B. Ligand-Receptor Binding Assay
[0310] The .alpha..sub.v.beta..sub.5-immunoreactive antibodies and
synthetic peptides prepared respectively in Examples 1 and 3 are
screened by measuring their ability to antagonize
.alpha..sub.v.beta..sub.5, .alpha..sub.v.beta..sub.3, and
.alpha..sub.IIb.beta..sub.3 receptor binding activity in purified
ligand-receptor binding assays. The method for these binding
studies has been described by Barbas et al., Proc. Natl. Acad.
Sci., USA. 90:10003-10007 (1993), Smith et al., J. Biol. Chem.,
265:11008-11013 (1990) and Pfaff et al., J. Biol. Chem.,
269:20233-20238 (1994), the disclosures of which are hereby
incorporated by reference.
[0311] A method of identifying antagonists in a ligand-receptor
binding assay is described in which the receptor is immobilized to
a solid support and the ligand and antagonist are soluble. A
ligand-receptor binding assay is also described in which the ligand
is immobilized to a solid support and the receptor and antagonists
are soluble.
[0312] Briefly, selected purified integrins are separately
immobilized in Titertek microtiter wells at a coating concentration
of 50 nanograms (ng) per well. The purification of the receptors
used in the ligand-receptor binding assays are well known in the
art and are readily obtainable with methods familiar to one of
ordinary skill in the art. After incubation for 18 hours at 4 C,
nonspecific binding sites on the plate are blocked with 10
milligrams/milliliter (mg/ml) of bovine serum albumin (BSA) in
Tris-buffered saline. For inhibition studies, various
concentrations of selected antibodies or peptides are tested for
the ability to block the binding of .sup.125I-vitronectin or other
labeled ligands to the integrin receptors,
.alpha..sub.v.beta..sub.5, .alpha..sub.v.beta..sub.3,
.alpha..sub.v.beta..sub.1 and .alpha..sub.IIb.beta..sub.3.
[0313] Although these ligands exhibit optimal binding for a
particular integrin, vitronectin for .alpha..sub.v.beta..sub.5 and
.alpha..sub.v.beta..sub.3 and fibrinogen for
.alpha..sub.IIb.beta..sub.3, inhibition of binding studies using
either antibodies or peptides to block the binding of vitronectin
to either receptor allows for the accurate determination of the
amount in micromoles (.mu.M) of peptide necessary to half-maximally
inhibit the binding of receptor to ligand. Radiolabeled ligands are
used at concentrations of 1 nM and binding is challenged separately
with unlabeled synthetic peptides. Following a three hour
incubation, free ligand is removed by washing and bound ligand is
detected by gamma counting.
[0314] Thus, the ligand-receptor assay described herein is used to
screen for both circular or linearized synthetic peptides along
with monoclonal antibodies and organic molecules that exhibit
selective specificity for a particular integrin receptor,
specifically .alpha..sub.v.beta..sub.5, as used as vitronectin
receptor (.alpha..sub.v.beta..sub.5) antagonists in practicing this
invention.
8. In Vivo Regression of Tumor Tissue Growth with
.alpha..sub.v.beta..sub.5 Antagonists as Measured by Chimeric
Mouse:Human Assay
[0315] An in vivo chimeric mouse:human model was generated by
replacing a portion of skin from a SCID mouse with human neonatal
foreskin. The in vivo chimeric mouse:human model was prepared
essentially as described in Yan, et al., J. Clin. Invest.,
91:986-996 (1993). Briefly, a 2 cm.sup.2 square area of skin was
surgically removed from a SCID mouse (6-8 weeks of age) and
replaced with a human foreskin. The mouse was anesthetized and the
hair removed from a 5 cm.sup.2 area on each side of the lateral
abdominal region by shaving. Two circular graft beds of 2 cm.sup.2
were prepared by removing the full thickness of skin down to the
fascia. Full thickness human skin grafts of the same size derived
from human neonatal foreskin were placed onto the wound beds and
sutured into place. The graft was covered with a Band-Aid which was
sutured to the skin. Micropore cloth tape was also applied to cover
the wound.
[0316] After the skin graft was established, the human foreskin was
inoculated with melanoma cells. The M21L human melanoma cell line
was used to form the solid human tumors on the human skin grafts on
the SCID mice. A single cell suspension of 2.times.10.sup.6 M21L
was injected intradermally into the human skin graft. The mice were
then observed for 2 to 4 weeks to allow growth of measurable human
tumors.
[0317] After a measurable tumor was established, either 250 .mu.g
of the peptide (in a volume of 100 .mu.l) having SEQ ID NO 9
(cyclic RGD-containing peptide Arg-Gly-Asp-D-Phe-Asn-NMeVal) or a
control peptide, cyclo Arg-.beta.Ala-Asp-D-Phe-Val, were injected
intraperitoneally into the mouse 3 times per week over 3 weeks. At
the end of this time, the tumor was excised and analyzed by weight
and histology.
[0318] The results are shown in FIG. 9 where the tumor volume in
mm.sup.3 is plotted on the Y-axis against the peptide treatments on
the X-axis. The test peptide having SEQ ID NO 9, labeled in the
figure as peptide 189, significantly reduced the tumor volume to
approximately 25 mm.sup.3 compared to control peptide (labeled as
peptide 601) where the tumor volume was greater than 300
mm.sup.3.
[0319] Thus, the blocking of the .alpha..sub.v.beta..sub.5 receptor
by the intravenous application of .alpha..sub.v.beta..sub.5
antagonist peptide 189 resulted in a regression of a melanoma tumor
in this model system in the same manner as the CAM and rabbit eye
model systems as described previously.
[0320] In other experiments with M21-L melanoma tumor cells in the
mouse:human chimeric assay system, the response with mAB LM609 was
compared with the response obtained with the synthetic peptide
85189 (SEQ ID NO 9) as compared to control synthetic peptide 69601
(SEQ ID NO 5). The assays were performed as described above. The
results, shown in FIG. 21, demonstrate that the synthetic peptide
85189 reduced tumor volume to below 25 mm.sup.3 as compared to
control peptide where the tumor volume was approximately 360
mm.sup.3. The mAB LM609 also significantly reduced tumor volume to
approximately 60 mm.sup.3.
[0321] Thus, blocking of the .alpha..sub.v.beta..sub.3 receptor by
the intravenous application of .alpha..sub.v.beta..sub.3-specific
LM609 antibody and peptides resulted in a regression of a carcinoma
in this model system as compared to the other model systems
described in this invention.
[0322] In additional assays with the SCID mice model having
measurable M21-L tumors, in a preliminary analysis, a dose response
curve was performed for peptides 69601 (control) and 85189 (test)
injected over a concentration range of 10 to 250 .mu.g/ml. The mean
volume and weight of resected tumors following treatment were
determined with the results respectively shown in FIGS. 22A and
22B. Peptide 85189 was effective at inhibiting M21-L tumor growth
over the concentration range tested compared to treatment with
control peptide with the most effective dosage being 250
.mu.g/ml.
[0323] For analyzing peptide 85189 treatment effectiveness over a
time course, two treatment regimens were evaluated in the same SCID
tumor model. In one assay, treatment with either peptide 85189 or
69601 was initiated on day 6, with day 0 being the day of M21-L
tumor injection of 3.times.10.sup.6 cells subcutaneously into mouse
skin, with intraperitoneal injections of 250 .mu.g/ml peptide 85189
or control 69601 every other day until day 29. The other assay was
identically performed with the exception that treatment was
initiated on day 20. At the end of the assays, the tumors were
resected and the mean tumor volume in mm.sup.3 was determined. The
data was plotted as this value .+-. the standard error of the
mean.
[0324] The results of these assays, respectively shown in FIGS. 23A
and 23B, indicate that peptide 85189 but not 69601 inhibited tumor
growth at various days after treatment was initiated, depending on
the particular treatment regimen. Thus, peptide 85189 is an
effective .alpha..sub.v.beta..sub.5 antagonist of both angiogenesis
and thus tumor growth.
[0325] The SCID/human chimeric model above is also used for
assessing the effectiveness of other .alpha..sub.v.beta..sub.5
antagonists of this invention, namely antibodies. MMP-2
preparations, previously prepared, and organic molecules, the
latter of which are prepared as described in Example 10.
90. Preparation of a Murine Mouse Model for
.alpha..sub.v.beta..sub.5-Mediated Retinal Angiogenesis and
Inhibition Thereof with .alpha..sub.v.beta..sub.5 Antagonists
[0326] Based on the observation in Example 2C of
.alpha..sub.v.beta..sub.3 and .alpha..sub.v.beta..sub.5 expression
in retinal neovascular tissue, a novel mouse model was used to
study the effects of systemically administered cyclic peptide
antagonists of both integrins on retinal angiogenesis. Newborn mice
develop retinal vessels during the first two weeks postnatally
during which time the superficial retinal vasculature forms a rich,
highly branched network of vessels that originate at the optic
nerve head and radiate peripherally to cover the retinal surface in
a manner similar to that observed in other mammals and humans
(Jiang et al., Glia, 15:1-10 (1995).
[0327] For the model, newborn mice were injected subcutaneously
twice daily for four days starting from day 0 with the cyclic
peptide RGDfV (SEQ ID NO 4) (also referred to as peptide 203) or
the control peptide RADfV (SEQ ID NO 5). On postnatal day five,
globes were removed and fixed in 4.0% paraformaldehyde (PFA) at
room temperature.
[0328] To quantitate mouse retinal angiogenesis, the distance from
the optic nerve head to the most distal point of a single vessel
selected in each of six equal sectors around a twelve hour clock
was measured. The mean distance was calculated and averaged with
similar data obtained from an entire litter. To measure the total
volume of retinal blood vessels, the entire specimen was scanned in
2.0 .mu.m optical sections and stored digitally. The "seed"
function in Bio-Rad's Lasersharp software was then used to
threshold and count cubic pixels in each section. A macro was
written to sum the volume of all sections and determine the value
for all vascular structures.
[0329] With the direct measurement of vessel growth in two
dimensions from photographs, systemically administered peptide
antagonist 203 inhibited retinal vasculogenesis, relative to
control peptide, by 44% (N=9, p<0.0000001, paired t-test). No
statistical difference was seen between untreated newborn mice and
five-day old mice receiving peptide 203, thus the peptide
effectively inhibits vasculogenesis. In addition, no statistical
difference was seen between untreated five-day old mice and the
same aged mice receiving control peptide. Thus, inhibition of
retinal vasculogenesis in RGDfV-treated newborn mice when compared
to untreated counterparts is effectively 100%.
[0330] Using a more quantitative analysis taking the three
dimensional nature of vessel growth, a 78% reduction in the retinal
vascular volume in the peptide 203-treated animals compared to the
controls was seen. The mean volume of vessels on postnatal day five
in 203-treated animals was 3.6.times.10.sup.6 .mu.m.sup.3 and in
control-treated animal was 15.7.times.10.sup.6 .mu.m.sup.3. The
volume occupied by retinal blood vessels in untreated newborn mice
was indistinguishable from the five-day old 203-treated
animals.
[0331] The results obtained above showed that the antagonists
specifically blocked new blood vessel formation with no effect on
established vessels. The results indicate that the pathology of
retinal neovascular disease is distinct from that seen with
subretinal neovascular disease and that antagonists of
.alpha..sub.v.beta..sub.5 are effective for treating patients with
blinding eye disease associated with angiogenesis.
[0332] Similar assays are performed with the MMP-2 and organic
mimetic .alpha..sub.v.beta..sub.5 antagonists prepared as
respectively described in Example 7 and Example 10.
10. Preparation of Organic Molecule .alpha..sub.v.beta..sub.5
Antagonists
[0333] The synthesis of organic .alpha..sub.v.beta..sub.5
antagonist Compounds 7, 9, 10, 12, 14, 15, 16, 17 and 18 is
described below and is also shown in the noted figures. The
resultant organic molecules, referred to as organic mimetics of
this invention, are then used in the methods for inhibiting
.alpha..sub.v.beta..sub.5-mediated angiogenesis.
[0334] For each of the syntheses described below, optical rotations
were measured on Perkin-Elmer 241 spectrophotometer UV and visible
spectra were recorded on a Beckmann DU-70 spectrometer. .sup.1H and
.sup.13C NMR spectra were-recorded at 400 and 500 MHz on Bruker
AMX-400 and AMX-500 spectrometer. High-resolution mass spectra
(HRMS) were recorded on a VG ZAB-ZSE mass spectrometer under fast
atom bombardment (FAB) conditions. Column chromatography was
carried out with silica gel of 70-230 mesh. Preparative TLC was
carried out on Merck Art. 5744 (0.5 mm). Melting points were taken
on a Thomas Hoover apparatus.
A. Compound 1: t-Boc-L-tyrosine benzyl ester as Illustrated in FIG.
10
[0335] ##STR1##
[0336] To a solution of
N-(tert-butoxycarbonyl)-L-tyrosine(t-Boc-L-tyrosine) (1.0
equivalents;
[0337] Aldrich) in 0.10 M (M) methylene chloride was added
dicyclohexylcarbodiimide (DCC) (1.5 equivalents) at 25.degree. C.
and allowed to stir for 1 hour. Next, 1.5 equivalents benzyl
alcohol was added and the mixture was stirred for an additional 12
hours at 25.degree. C. The reaction mixture was then diluted with
ethyl acetate (0.10 M) and washed twice (2.times.) with water, once
(1.times.) with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography. Compound 1, t-Boc-L-tyrosine
benzyl ester can also be commercially purchased from Sigma.
B. Compound 2:
(S)-3-(4-(4-Bromobutyloxy)phenyl-2-N-tert-butyloxycarbonyl-propionic
acid benzyl ester as illustrated in FIG. 10 step i
[0338] ##STR2##
[0339] A mixture of t-Boc-L-tyrosine benzyl ester (2 grams, 5.38
mmol; synthesized as described above), 1,4dibromobutane (1.9 ml,
16.2 mmol; Aldrich), potassium carbonate (5 g) and 18-crown-6 (0.1
g; Aldrich), was heated at 80.degree. C. for 12 hours. After
cooling, the precipate was filtered off and the reaction mixture
was evaporated to dryness in vacuo. The crude product was then
purified by crystallization using 100% hexane to yield 2.5 g (92%)
of Compound 2.
C. Compound 3:
(S)-3-(4(4-Azidobutyloxy)phenyl-2-N-tert-butyloxycarbonyl-propionic
acid benzyl ester as illustrated in FIG. 10 step ii
[0340] ##STR3##
[0341] Compound 2 (2.5 g, 4.9 mmol) was stirred with sodium azide
(1.6 g, 25 mmol) in dimethylformamide (DMF) (20 ml) at 25.degree.
C. for 12 hours. The solvent was then evaporated and the residue
was treated with water (approx 10 ml) and extracted twice with
ethyl acetate. The organic layers were combined, dried via
magnesium sulfate and evaporated to yield 2.0 grams (90%) of
Compound 3 as a colorless syrup (FAB-MS: 469 (M+H.sup.+).
D. Compound 4: (S)-3-(4-(4-Azidobutyloxy)phenyl-2-amino-propionic
acid benzyl ester as illustrated in FIG. 10 step iii
[0342] ##STR4##
[0343] Compound 3 (2.0 g (4.4 mmol)) was dissolved in
trifluoroacetic acid (TFA; 2 ml) and stirred for 3 hours at room
temperature. Evaporation in vacuo yielded 1.6 grams (quantitative)
of Compound 4 as a colorless syrup that was used without further
purification for the next step. FAB-MS: 369 (M.sup.+H.sup.+).
E. Compound 5:
(S)-3-(4-(4-Azidobutyloxy)phenyl-2-butylsulfonamido-propionic acid
benzyl ester as illustrated in FIG. 10 step iv
[0344] ##STR5##
[0345] A mixture of Compound 4 (1.6 g; 4.3 mmol), butane sulfonic
acid chloride (0.84 ml; 6.6 mmol) and triethyl amine (1.5
equivalents) were stirred in methylene chloride (20 ml) for 12
hours at room temperature. The reaction mixture was then evaporated
and the residue was dissolved in ethylacetate, washed with dilute
HCl, aqueous sodium bicarbonate and water. After evaporation to
dryness the crude product was purified by flash chromatography
(silica gel, toluene/ethylacetate 15:1) to yield 1.4 grams (67%) of
Compound 5 as an amorphous solid.
F. Compound 6:
(S)-3-(4(4-Aminobutyloxy)phenyl-2-butylsulfonamido-propionic acid
as illustrated in FIG. 10 step v
[0346] ##STR6##
[0347] Compound 5 (1.3 g (2.6 mmol) was dissolved in 20 ml of ethyl
acetate/methanol/water 5/3/1 and 0.2 ml trifluoroacetic acid (TFA)
and hydrogenated under hydrogen (1 atmosphere; Parr Shaker
apparatus) at 25.degree. C. in the presence of 100 mg palladium
(10% on charcoal). After 3 hours, the catalyst was filtered off and
the solvent was evaporated to yield Compound 6 as an oily residue.
After lyophilization from water 1.0 gram (quantitative) of Compound
6 was obtained as a white powder. FAB-MS: 373 (M.sup.+H.sup.+).
G. Compound 7:
(S)-3-(4-(4-Guanidinobutyloxy)phenyl-2-butylsulfonamido-propionic
acid as illustrated in FIG. 10 step vi
[0348] ##STR7##
[0349] Compound 6 (200 mg; 0.5 mmol),
3,5-dimethylpyrazol-1-carboxamidine nitrate (DPFN) (170 mg; 0.8
mmol; Aldrich Chemical Company) and triethylamine (0.15 ml, 1.0
mmol) in dimethylformamide (DMF; 5 ml) were heated at 60.degree. C.
for 12 hours. After cooling, the solvent was evaporated in vacuo,
and the residue was purified by HPLC (Lichrocart RP-18, gradient
acetonitrile/water+0.3% TFA 99:1 to 1:99) to yield 50 mg (25%) of
Compound 7 as a white, amorphous powder, after lyophilization.
FAB-MS: 415 (M.sup.+H.sup.+), m.p.: 70.degree. C.
H. Compound 8:
(S)-3-(4-(4-Aminobutyloxy)phenyl-2-N-tert.butyloxycarbonyl-propionic
acid as illustrated in FIG. 11 step iii
[0350] ##STR8##
[0351] Compound 3 (0.5 g (1.07 mmol) was dissolved in 10 ml of
ethyl acetate/methanol/water 5/3/1 and 0.1 ml trifluoroacetic acid
(TFA) and hydrogenated under hydrogen (1 atmosphere; Parr Shaker
apparatus) at 25.degree. C. in the presence of 30 mg palladium (10%
on charcoal). After 3 hours, the catalyst was filtered off and the
solvent was evaporated to yield Compound 8 as an oily residue.
After lyophilization from water 370 milligram (quantitative) of
Compound 8 was obtained as a white powder. FAB-MS: 353
(M.sup.+H.sup.+).
I. Compound 9:
(S)-3-(4-(4Guanidinobutyloxy)phenyl-2-N-tert.butyloxycarbonyl-propionic
acid as illustrated in FIG. 11 step iv
[0352] ##STR9##
[0353] Compound 8 (200 mg; 0.5 mmol),
3,5-dimethylpyrazol-1-carboxamidine nitrate (DPFN) (170 mg; 0.8
mmol; Aldrich Chemical Company) and triethylamine (0.15 ml, 1.0
mmol) in dimethylformamide (DMF; 5 ml) were heated at 60.degree. C.
for 12 hours. After cooling, the solvent was evaporated in vacuo,
and the residue was purified by HPLC (Lichrocart RP-18, gradient
acetonitrile/water+0.3% TFA 99:1 to 1:99) to yield 160 mg (90%) of
Compound 9 as a white, amorphous powder, after lyophilization.
FAB-MS: 395 (M.sup.+H.sup.+).
J. Compound 10:
(R)-3-(4-(4-Guanidinobutyloxy)phenyl-2-butylsulfonamido-propionic
acid as illustrated in FIG. 12 steps i-vi
[0354] ##STR10##
[0355] The identical reaction sequence to synthesize Compound 7 was
used to prepare the D-tyrosine analog 10 of which 205 mg were
obtained as a white amorphous material FAB-MS: 415 (M.sup.+H.sup.+)
as follows using intermediate Compounds 100-600 to form Compound
10:
1) Compound 100: t-Boc-D-tyrosine benzyl ester as illustrated in
FIG. 12
[0356] ##STR11##
[0357] To a solution of
N-(tert-butoxycarbonyl)D-tyrosine(t-Boc-L-tyrosine) (1.0
equivalents; Aldrich) in 0.10 M methylene chloride was added
dicyclohexylcarbodiimide (DCC) (1.5 equivalents) at 25.degree. C.
and allowed to stir for 1 hour. Next, 1.5 equivalents benzyl
alcohol was added and the mixture was stirred for an additional 12
hours at 25.degree. C. The reaction mixture was then diluted with
ethyl acetate (0.10 M) and washed 2.times. with water, 1.times.
with brine and dried over magnesium sulfate. The solvent was then
removed in vacuo and the crude product was then purified by silica
gel column chromatography.
2) Compound 200:
(R)-3-(4-(4-Bromobutyloxy)phenyl-2-N-tert-butyloxycarbonyl-propionic
acid benzyl ester as illustrated in FIG. 12 step i
[0358] ##STR12##
[0359] A mixture of t-Boc-D-tyrosine benzyl ester (2 grams, 5.38
mmol; synthesized as described above), 1,4-dibromobutane (1.9 ml,
16.2 mmol; Aldrich), potassium carbonate (5 g) and 18-crown-6 (0.1
g; Aldrich), was heated at 80.degree. C. for 12 hours. After
cooling, the precipate was filtered off and the reaction mixture
was evaporated to dryness in vacuo. The crude product was then
purified by crystallization using 100% hexane to yield 2.5 g (92%)
of Compound 200.
3) Compound 300:
(R)-3-(4-(4-Azidobutyloxy)phenyl-2-N-tert-butyloxycarbonyl-propionic
acid benzyl ester as illustrated in FIG. 12 step ii
[0360] ##STR13##
[0361] Compound 200 (2.5 g, 4.9 mmol) was stirred with sodium azide
(1.6 g, 25 mmol) in dimethylformamide (DMF) (20 ml) at 25.degree.
C. for 12 hours. The solvent was then evaporated and the residue
was treated with water (approx 10 ml) and extracted twice with
ethyl acetate. The organic layers were combined, dried via
magnesium sulfate and evaporated to yield 2.0 grams (90%) of
Compound 300 as a colorless syrup (FAB-MS: 469 (M+H.sup.+).
4) Compound 400: (R)-3-(4-(4-Azidobutyloxy)phenyl-2-amino-propionic
acid benzyl ester as illustrated in FIG. 12 step iii
[0362] ##STR14##
[0363] Compound 300 (2.0 g (4.4 mmol)) was dissolved in
trifluoroacetic acid (TFA; 2 ml) and stirred for 3 hours at room
temperature. Evaporation in vacuo yielded 1.6 grams (quantitative)
of Compound 400 as a colorless syrup that was used without further
purification for the next step. FAB-MS: 369 (M.sup.+H.sup.+).
5) Compound 500:
(R)-3-(4(4-Azidobutyloxy)phenyl-2-butylsulfonamido-propionic acid
benzyl ester as illustrated in FIG. 12 step iv
[0364] ##STR15##
[0365] A mixture of Compound 400 (1.6 g; 4.3 mmol), butane sulfonic
acid chloride (0.84 ml; 6.6 mmol) and triethyl amine (1.5
equivalents) were stirred in methylene chloride (20 ml) for 12
hours at room temperature. The reaction mixture was then evaporated
and the residue was dissolved in ethylacetate, washed with dilute
HCl, aqueous sodium bicarbonate and water. After evaporation to
dryness the crude product was purified by flash chromatography
(silica gel, toluene/ethylacetate 15:1) to yield 1.4 grams (67%) of
Compound 500 as an amorphous solid.
6) Compound 600:
(R)-3-(4-(4-Aminobutyloxy)phenyl-2-butylsulfonamido-propionic acid
as illustrated in FIG. 12 step v
[0366] ##STR16##
[0367] Compound 500 (1.3 g (2.6 mmol) was dissolved in 20 ml of
ethyl acetate/methanol/water 5/3/1 and 0.2 ml trifluoroacetic acid
(TFA) and hydrogenated under hydrogen (1 atmosphere; Parr Shaker
apparatus) at 25.degree. C. in the presence of 100 mg palladium
(10% on charcoal). After 3 hours, the catalyst was filtered off and
the solvent was evaporated to yield Compound 600 as an oily
residue. After lyophilization from water 1.0 gram (quantitative) of
Compound 600 was obtained as a white powder. FAB-MS: 373
(M.sup.+H.sup.+).
7) Compound 10:
(R)-3-(4-(4-Guanidinobutyloxy)phenyl-2-butylsulfonamido-propionic
acid as illustrated in FIG. 12 step vi
[0368] Compound 600 (200 mg; 0.5 mmol),
3,5-dimethylpyrazol-1-carboxamidine nitrate (DPFN) (170 mg; 0.8
mmol; Aldrich Chemical Company) and triethylamine (0.15 ml, 1.0
mmol) in dimethylformamide (DMF; 5 ml) were heated at 60.degree. C.
for 12 hours. After cooling, the solvent was evaporated in vacuo,
and the residue was purified by HPLC (Lichrocart RP-18, gradient
acetonitrile/water+0.3% TFA 99:1 to 1:99) to yield 50 mg (25%) of
Compound 10 as a white, amorphous powder, after lyophilization.
FAB-MS: 415 (M.sup.+H.sup.+), m.p.: 70.degree. C.
K. Compound 11:
(S)-3-(4-(4-Azidobutyloxy)phenyl-2-(10-camphorsulfonamido)-propionic
acid benzyl ester as illustrated in FIG. 4
[0369] ##STR17##
[0370] A mixture of compound 4 (1.0 g; 2.7 mmol),
10-camphorsulfonic acid chloride (6.6 mmol; Aldrich Chemical
Company) and triethyl amine (1.5 equivalents) were stirred in
methylene chloride (20 mL) for 12 hours at room temperature. The
reaction mixture was then evaporated and the residue was dissolved
in ethylacetate, washed with dilute HCl, aqueous sodium bicarbonate
and water. After evaporation to dryness the crude product was
purified by flash chromatography (silica gel, toluene/ethylacetate
15:1) to yield 1.4 grams (67%) of compound 11 as an amorphous
solid.
L. Compound 12:
(S)-3-(4-(4Guanidinobutyloxy)phenyl-2-(10-camphorsulfonamido)-propionic
acid as illustrated in FIG. 4 steps i-ii
[0371] ##STR18##
[0372] Compound 12 is obtained after hydrogenation and guanylation
of compound 11 according to the following conditions:
[0373] Step i: Compound 11 (1.3 g (2.6 mmol) was dissolved in 20 mL
of ethyl acetate/methanol/water 5/3/1 and 0.2 mL trifluoroacetic
acid (TFA) and hydrogenated under hydrogen (1 atmosphere; Parr
Shaker apparatus) at 25.degree. C. in the presence of 100 mg
palladium (10% on charcoal). After 3 hours, the catalyst was
filtered off and the solvent was evaporated to yield the
intermediate amine as an oily residue. After lyophylisation from
water 1.0 gram (quantitative) of the intermediate amine was
obtained as a white powder, which was carried on as follows:
[0374] Step ii: The above formed intermediate amine compound (200
mg; 0.5 mmol), 3,5-dimethylpyrazol-1-carboxamidine nitrate (DPFN)
(170 mg; 0.8 mmol; Aldrich Chemical Company) and triethylamine
(0.15 mL, 1.0 mmol) in dimethylformamide (DMF; 5 mL) were heated at
60.degree. C. for 12 hours. After cooling, the solvent was
evaporated in vacuo, and the residue was purified by HPLC
(Lichrocart RP-18, gradient acetonitrile/water+0.3% TFA 99:1 to
1:99) to yield 50 mg (25%) of compound 12 as a white, amorphous
powder, after lyophylisation. FAB-MS: 509.6 (M+H.sup.+).
M. Compound 13:
(S)-3-(4-(5-Bromopentyloxy)phenyl-2-N-tert.butyloxycarbonyl-propionic
acid benzyl ester as illustrated in FIG. 13
[0375] ##STR19##
[0376] A mixture of t-Boc-L-tyrosine benzyl ester (4.5 grams, 12.1
mmol; Compound 1 synthesized as described above),
1,5-dibromopentane (5 ml, 36.7 mmol; Aldrich), potassium carbonate
(10 g) and 18-crown-6 (0.25 g; Aldrich), was heated at 80.degree.
C. for 12 hours. After cooling, the precipate was filtered off and
the reaction mixture was evaporated to dryness in vacuo. The crude
product was then purified by crystallization using 100% hexane to
yield 5.35 g (85%) of Compound 13.
N. Compound 14:
(S)-3-(4-(5-Guanidinopentyloxy)phenyl-2-butylsulfonamido-propionic
acid as illustrated in FIG. 13 steps i-v
[0377] ##STR20##
[0378] The 5 step reaction sequence of bromine-azide-exchange,
Boc-cleavage, sulfonylation with butane sulfonic acid chloride,
hydrogenation and guanylation with DPFN was carried out identically
to the above procedures using intermediate Compounds 1-6 to form
Compound 7 or the procedures using Compounds 100-600 to form
Compound 10, as disclosed above. Compound 14 was obtained as a
white powder FAB-MS: 429 (M.sup.+H.sup.+).
O. Compound 15:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-amino-ethyl)phenoxy)methyl-2-oxazol-
idinone, dihydrochloride as shown in FIG. 14
1) Synthesis of starting material
2-N-BOC-amino-3-(4-hydroxy-phenyl)propionate for Compound 15
[0379] ##STR21##
[0380] The starting material
2-N-BOC-amino-3-(4-hydroxy-phenyl)propionate was obtained via
esterification of (D or L), N-(tert-butoxycarbonyl)-L(D)-tyrosine
(t-Boc-L(D)-tyrosine) (1.0 equivalents; Sigma) in 0.10 M methanol
and dilute 1% HCl. The reaction mixture was stirred at 25.degree.
C. for 12 hours and then neutralized via potassium carbonate and
then diluted with ethyl acetate (0.10 M) and washed 2.times. with
water, 1.times. with brine and dried over magnesium sulfate. The
solvent was then removed in vacuo and the crude product was then
purified by silica gel column chromatography to obtain
2-N-BOC-amino-3-(4-hydroxy-phenyl)propionate.
2) Synthesis of starting material
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
for Compound 15: 3-step procedure as follows
[0381] p-amino-benzonitrile (1.0 equivalents; Aldrich) in methylene
chloride (0.10 M) was stirred with 2,3-epoxypropanol (1.0
equivalents; Aldrich) for 12 hours at 25.degree. C. The solvent was
next removed in vacuo and the crude
4-(2,3-dihydroxypropylamino)benzonitrile was carried onto the next
step as follows:
[0382] 4-(2,3-dihydroxypropylamino)benzonitrile (1.0 equivalents;
as described above), in dimethylformamide (0.10 M), at 25.degree.
C., was stirred with diethyl carbonate (1.1 equivalents; Aldrich)
and potassium tert-butylate (1.1 equivalents; Aldrich) at
110.degree. C. for 6 hours. Next, the reaction mixture was diluted
with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain
3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine and carried onto
the next step as follows:
[0383] 3-(4cyanophenyl)-5-hydroxymethyl-2-oxazolidine (1.0
equivalents; as described above), in methylene chloride (0.10 M) at
25.degree. C. was stirred with 1.1 equivalents hydrogen sulfide,
1.1 equivalents methyl iodide, and 1.1 equivalents ammonium
acetate. The reaction mixture was stirred for 6 hours and then
diluted with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain the amidine which was
carried onto the next step as follows:
[0384] 1.0 equivalents of the amidine, synthesized as described
above, was protected with 1.1 equivalents of BOC-ON
(2-(BOC-oxyimino)-2-phenylacetonitrile; Aldrich) in methylene
chloride (0.10 M) at 25.degree. C. and stirred for 6 hours. Next,
the reaction mixture was diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then esterified in 0.10 M methylene chloride and
1.1 equivalents methanesulfonyl chloride. The reaction mixture was
stirred at 0.degree. C. for 6 hours and then quenched with water (5
equivalents) and then diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then purified by silica gel column chromatography
to obtain
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidino-
ne.
3) Coupling of intermediates
2-N-BOC-amino-3-(4-hydroxy-phenyl)propionate with
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
to form protected form of Compound 15,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2N-BOC-aminoethyl)phenyo-
xylmethyl-2-oxazolidinone
[0385] A mixture of 1.9 grams
2-N-BOC-amino-3-(4-hydroxy-phenyl)propionate (as described above),
20 ml dimethylformamide (DMF) and NaH (1.0 equivalent), was stirred
for 30 minutes at room temperature. After stirring, 1.8 grams
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
(as described above) in 10 ml dimethylformamide (DMF) was added and
stirred again for 15 minutes at room temperature. The reaction
mixture was then diluted with ethyl acetate (0.10 M) and washed
2.times. with water, 1.times. with brine and dried over magnesium
sulfate. The solvent was then removed in vacuo and the crude
product was then purified by silica gel column chromatography to
obtain protected form of Compound 15,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2N-BOC-aninoethyl)phenyo-
xylmethyl-2-oxazolidinone which was carried onto the next step.
4) Deprotection of protected form of Compound 15 to form Compound
15:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-amino-ethyl)phenoxy)methyl-2-oxazol-
idinone, dihydrochloride, FIG. 14
[0386] Treatment of the protected form of Compound 15,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2N-BOC-aminoethyl)phenyo-
xylmethyl-2-oxazolidinone (1.0 equivalents; synthesized as
described above), with 4 ml 2N NaOH for 4 hours at room
temperature. The mixture was then followed with 40 ml 2N
HCl-solution in dioxane added dropwise at 0.degree. C. to
25.degree. C. for 3 hours. The reaction mixture was then quenched
with sodium bicarbonate (5 equivalents) and then diluted with ethyl
acetate (0.10 M) and washed 2.times. with water, 1.times. with
brine and dried over magnesium sulfate. The solvent was then
removed in vacuo and the crude product was then purified by silica
gel column chromatography to obtain Compound 15:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-amino-ethyl)phenoxy)methyl-2-oxazol-
idinone, dihydrochloride; m.p. 165.degree. C. (d).
P. Compound 16:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-butylsulfonylaminoethyl)phenoxy)m-
ethyl-2-oxazolidinone as shown in FIG. 14
1) Synthesis of starting material
2-N-butylsulfonylamino-3-(4-hydroxy-phenyl)propionate for Compound
16
[0387] ##STR22##
[0388] The starting material
2-N-butylsulfonylamino-3-(4-hydroxy-phenyl)propionate was obtained
via esterification of ((D or L) tyrosine) (1.0 equivalents; Sigma)
in 0.10 M methanol and dilute 1% HCl. The reaction mixture was
stirred at 25.degree. C. for 12 hours and then neutralized via
potassium carbonate and then diluted with ethyl acetate (0.10 M)
and washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then carried on as follows:
[0389] A mixture of the above compound (4.3 mmol), butane sulfonic
acid chloride (6.6 mmol) and triethyl amine (1.5 equivalents) were
stirred in methylene chloride (20 ml) for 12 hours at room
temperature. The reaction mixture was then evaporated and the
residue was dissolved in ethylacetate, washed with dilute HCl,
aqueous sodium bicarbonate and water. After evaporation to dryness
the crude product was purified by flash chromatography (silica gel,
toluene/ethylacetate 15:1) to yield the title compound.
2) Synthesis of starting material
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
for Compound 16: 3-step procedure as follows
[0390] p-amino-benzonitrile (1.0 equivalents; Aldrich) in methylene
chloride (0.10 M) was stirred with 2,3-epoxypropanol (1.0
equivalents; Aldrich) for 12 hours at 25.degree. C. The solvent was
next removed in vacuo and the crude
4-(2,3-dihydroxypropylamino)benzonitrile was carried onto the next
step as follows:
[0391] 4-(2,3-dihydroxypropylamino)benzonitrile (1.0 equivalents;
as described above), in dimethylformamide (0.10 M), at 25.degree.
C., was stirred with diethyl carbonate (1.1 equivalents; Aldrich)
and potassium tert-butylate(1.1 equivalents; Aldrich) at
110.degree. C. for 6 hours. Next, the reaction mixture was diluted
with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain
3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine and carried onto
the next step as follows:
[0392] 3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine (1.0
equivalents; as described above), in methylene chloride (0.10 M) at
25.degree. C. was stirred with 1.1 equivalents hydrogen sulfide,
1.1 equivalents methyl iodide, and 1.1 equivalents ammonium
acetate. The reaction mixture was stirred for 6 hours and then
diluted with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain the amidine which was
carried onto the next step as follows:
[0393] 1.0 equivalents of the amidine, synthesized as described
above, was protected with 1.1 equivalents of BOC-ON
(2-(BOC-oxyimino)-2-phenylacetonitrile; Aldrich) in methylene
chloride (0.10 M) at 25.degree. C. and stirred for 6 hours. Next,
the reaction mixture was diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then esterified in 0.10 M methylene chloride and
1.1 equivalents methanesulfonyl chloride. The reaction mixture was
stirred at 0.degree. C. for 6 hours and then quenched with water (5
equivalents) and then diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then purified by silica gel column chromatography
to obtain
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidino-
ne.
3) Coupling of intermediates
2-N-butylsulfonylamino-3-(4-hydroxy-phenyl)propionate with
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
to form protected form of Compound 16,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-butylsulfonylaminoet-
hyl)phenyoxylmethyl-2-oxazolidinone
[0394] A mixture of 1.9 grams
2-N-butylsulfonylamino-3-(4-hydroxy-phenyl)propionate (as described
above), 20 ml dimethylformamide (DMF) and NaH (1.0 equivalent), was
stirred for 30 minutes at room temperature. After stirring, 1.8
grams
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
(as described above) in 10 ml dimethylformamide (DMF) was added and
stirred again for 15 minutes at room temperature. The reaction
mixture was then diluted with ethyl acetate (0.1 0 M) and washed
2.times. with water, 1.times. with brine and dried over magnesium
sulfate. The solvent was then removed in vacuo and the crude
product was then purified by silica gel column chromatography to
obtain protected form of Compound 16,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-butylsulfonylaminoet-
hyl)-phenyoxylmethyl-2-oxazolidinone which was carried onto the
next step.
4) Deprotection of protected form of Compound 16 to form Compound
16:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-butylsulfonylaminoethyl)phenoxy)m-
ethyl-2-oxazolidinone, FIG. 14
[0395] Treatment of the protected form of Compound 16,
3-(4-BOC-amidinophenyl)-5-(4-2-methoxy-carbonyl-2-N-butylsulfonylaminoeth-
yl)phenyoxylmethyl-2-oxazolidinone (1.0 equivalents; synthesized as
described above), with 4 ml 2N NaOH for 4 hours at room
temperature. The mixture was then followed with 40 ml 2N
HCl-solution in dioxane added dropwise at 0.degree. C. to
25.degree. C. for 3 hours. The reaction mixture was then quenched
with sodium bicarbonate (5 equivalents) and then diluted with ethyl
acetate (0.10 M) and washed 2.times. with water, 1.times. with
brine and dried over magnesium sulfate. The solvent was then
removed in vacuo and the crude product was then purified by silica
gel column chromatography to obtain Compound 16:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-butylsulfonylaminoethyl)phenoxy)m-
ethyl-2-oxazolidinone; m.p. 236-237.degree. C.
Q. Compound 17:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-propyl-sulfonylaminoethyl)phenoxy-
)methyl-2-oxazolidinone as shown in FIG. 14
1) Synthesis of starting material
2-N-propyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate for
Compound 17
[0396] ##STR23##
[0397] The starting material
2-N-propyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate was
obtained via esterification of ((D or L) tyrosine) (1.0
equivalents; Sigma) in 0.10 M methanol and dilute 1% HCl. The
reaction mixture was stirred at 25.degree. C. for 12 hours and then
neutralized via potassium carbonate and then diluted with ethyl
acetate (0.10 M) and washed 2.times. with water, 1.times. brine and
dried over magnesium sulfate. The solvent was then removed in vacuo
and the crude product was then carried on as follows:
[0398] A mixture of the above compound (4.3 mmol), propyl sulfonic
acid chloride (6.6 mmol; Aldrich) and triethyl amine (1.5
equivalents) were stirred in methylene chloride (20 ml) for 12
hours at room temperature. The reaction mixture was then evaporated
and the residue was dissolved in ethylacetate, washed with dilute
HCl, aqueous sodium bicarbonate and water. After evaporation to
dryness the crude product was purified by flash chromatography
(silica gel, toluene/ethylacetate 15:1) to yield the title
compound.
2) Synthesis of starting material
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
for Compound 17: 3-step procedure as follows
[0399] p-amino-benzonitrile (1.0 equivalents; Aldrich) in methylene
chloride (0.10 M) was stirred with 2,3-epoxypropanol (1.0
equivalents; Aldrich) for 12 hours at 25.degree. C. The solvent was
next removed in vacuo and the crude
4-(2,3-dihydroxypropylamino)benzonitrile was carried onto the next
step as follows:
[0400] 4(2,3-dihydroxypropylamino)benzonitrile (1.0 equivalents; as
described above), in dimethylformamide (0.10 M), at 25.degree. C.,
was stirred with diethyl carbonate (1.1 equivalents; Aldrich) and
potassium tert-butylate (1.1 equivalents; Aldrich) at 110.degree.
C. for 6 hours. Next, the reaction mixture was diluted with ethyl
acetate (0.10 M) and washed 2.times. with water, 1.times. with
brine and dried over magnesium sulfate. The solvent was then
removed in vacuo and the crude product was then purified by silica
gel column chromatography to obtain
3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine and carried onto
the next step as follows:
[0401] 3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine (1.0
equivalents; as described above), in methylene chloride (0.10 M) at
25.degree. C. was stirred with 1.1 equivalents hydrogen sulfide,
1.1 equivalents methyl iodide, and 1.1 equivalents ammonium
acetate. The reaction mixture was stirred for 6 hours and then
diluted with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain the amidine which was
carried onto the next step as follows:
[0402] 1.0 equivalents of the amidine, synthesized as described
above, was protected with 1.1 equivalents of BOC-ON
(2-(BOC-oxyimino)-2-phenylacetonitrile; Aldrich) in methylene
chloride (0.10 M) at 25.degree. C. and stirred for 6 hours. Next,
the reaction mixture was diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then esterified in 0.10 M methylene chloride and
1.1 equivalents methanesulfonyl chloride. The reaction mixture was
stirred at 0.degree. C. for 6 hours and then quenched with water (5
equivalents) and then diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then purified by silica gel column chromatography
to obtain
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidino-
ne.
3) Coupling of intermediates
2-N-propyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate with
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
to form protected form of Compound 17,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-propyl-sulfonylamino-
ethyl)-phenyoxylmethyl-2-oxazolidinone
[0403] A mixture of 1.9 grams
2-N-propyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate (as
described above), 20 ml dimethylformamide (DMF) and NaH (1.0
equivalent), was stirred for 30 minutes at room temperature. After
stirring, 1.8 grams
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
(as described above) in 10 ml dimethylformamide (DMF) was added and
stirred again for 15 minutes at room temperature. The reaction
mixture was then diluted with ethyl acetate (0.10 M) and washed
2.times. with water, 1.times. with brine and dried over magnesium
sulfate. The solvent was then removed in vacuo and the crude
product was then purified by silica gel column chromatography to
obtain protected form of Compound 17,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-propyl-sulfonylamino-
ethyl)-phenyoxylmethyl-2-oxazolidinone which was carried onto the
next step.
4) Deprotection of protected form of Compound 17 to form Compound
17:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-propylsulfonylaminoethyl)phenoxy)-
methyl-2-oxazolidinone, FIG. 14
[0404] Treatment of the protected form of Compound 17,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-propylsulfonylaminoe-
thyl)phenyoxylmethyl-2-oxazolidinone (1.0 equivalents; synthesized
as described above), with 4 ml 2N NaOH for 4 hours at room
temperature. The mixture was then followed with 40 ml 2N
HCl-solution in dioxane added dropwise at 0.degree. C. to
25.degree. C. for 3 hours. The reaction mixture was then quenched
with sodium bicarbonate (5 equivalents) and then diluted with ethyl
acetate (0.10 M) and washed 2.times. with water, 1.times. with
brine and dried over magnesium sulfate. The solvent was then
removed in vacuo and the crude product was then purified by silica
gel column chromatography to obtain Compound 17:
3-(4amidinophenyl)-5-(4-(2-carboxy-2-N-propylsulfonylaminoethyl)phenoxy)m-
ethyl-2-oxazolidinone; m.p. 200.degree. C. (d).
R. Compound 18:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-ethyl-sulfonylaminoethyl)phenoxy)-
methyl-2-oxazolidinone as shown in FIG. 14
1) Synthesis of starting material
2-N-ethyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate for Compound
18
[0405] ##STR24##
[0406] The starting material
2-N-ethyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate was obtained
via esterification of ((D or L) tyrosine) (1.0 equivalents; Sigma)
in 0.10 M methanol and dilute 1% HCl. The reaction mixture was
stirred at 25.degree. C. for 12 hours and then neutralized via
potassium carbonate and then diluted with ethyl acetate (0.10 M)
and washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then carried on as follows:
[0407] A mixture of the above compound (4.3 mmol), ethyl sulfonic
acid chloride (6.6 mmol; Aldrich) and triethyl amine (1.5
equivalents) were stirred in methylene chloride (20 ml) for 12
hours at room temperature. The reaction mixture was then evaporated
and the residue was dissolved in ethylacetate, washed with dilute
HCl, aqueous sodium bicarbonate and water. After evaporation to
dryness the crude product was purified by flash chromatography
(silica gel, toluene/ethylacetate 15:1) to yield the title
compound.
2) Synthesis of starting material
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
for Compound 18: 3-step procedure as follows
[0408] p-amino-benzonitrile (1.0 equivalents; Aldrich) in methylene
chloride (0.10 M) was stirred with 2,3-epoxypropanol (1.0
equivalents; Aldrich) for 12 hours at 25.degree. C. The solvent was
next removed in vacuo and the crude
4-(2,3-dihydroxypropylamino)benzonitrile was carried onto the next
step as follows:
[0409] 4-(2,3-dihydroxypropylamino)benzonitrile (1.0 equivalents;
as described above), in dimethylformamide (0.10 M), at 25.degree.
C., was stirred with diethyl carbonate (1.1 equivalents; Aldrich)
and potassium tert-butylate (1.1 equivalents; Aldrich) at
110.degree. C. for 6 hours. Next, the reaction mixture was diluted
with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain
3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine and carried onto
the next step as follows:
[0410] 3-(4-cyanophenyl)-5-hydroxymethyl-2-oxazolidine (1.0
equivalents; as described above), in methylene chloride (0.10 M) at
25.degree. C. was stirred with 1.1 equivalents hydrogen sulfide,
1.1 equivalents methyl iodide, and 1.1 equivalents ammonium
acetate. The reaction mixture was stirred for 6 hours and then
diluted with ethyl acetate (0.10 M) and washed 2.times. with water,
1.times. with brine and dried over magnesium sulfate. The solvent
was then removed in vacuo and the crude product was then purified
by silica gel column chromatography to obtain the amidine which was
carried onto the next step as follows:
[0411] 1.0 equivalents of the amidine, synthesized as described
above, was protected with 1.1 equivalents of BOC-ON
(2-(BOC-oxyimino)-2-phenylacetonitrile; Aldrich) in methylene
chloride (0.10 M) at 25.degree. C. and stirred for 6 hours. Next,
the reaction mixture was diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then esterified in 0.10 M methylene chloride and
1.1 equivalents methanesulfonyl chloride. The reaction mixture was
stirred at 0.degree. C. for 6 hours and then quenched with water (5
equivalents) and then diluted with ethyl acetate (0.10 M) and
washed 2.times. with water, 1.times. with brine and dried over
magnesium sulfate. The solvent was then removed in vacuo and the
crude product was then purified by silica gel column chromatography
to obtain
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidino-
ne.
3) Coupling of intermediates
2-N-ethyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate with
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
to form protected form of Compound 18,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-ethyl-sulfonylaminoe-
thyl)-phenyoxylmethyl-2-oxazolidinone
[0412] A mixture of 1.9 grams
2-N-ethyl-sulfonylamino-3-(4-hydroxy-phenyl)propionate (as
described above), 20 ml dimethylformamide (DMF) and NaH (1.0
equivalent), was stirred for 30 minutes at room temperature. After
stirring, 1.8 grams
3-p-N-BOC-amidino-phenyl-5-methanesulfonyloxy-methyl-2-oxazolidinone
(as described above) in 10 ml dimethylformamide (DMF) was added and
stirred again for 15 minutes at room temperature. The reaction
mixture was then diluted with ethyl acetate (0.10 M) and washed
2.times. with water, 1.times. with brine and dried over magnesium
sulfate. The solvent was then removed in vacuo and the crude
product was then purified by silica gel column chromatography to
obtain protected form of Compound 18,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-ethyl-sulfonylaminoe-
thyl)-phenyoxylmethyl-2-oxazolidinone which was carried onto the
next step.
4) Deprotection of protected form of Compound 18 to form Compound
18:
3-(4-amidinophenyl)-5-(4-(2-carboxy-2-N-ethylsulfonylaminoethyl)phenoxy)m-
ethyl-2-oxazolidinone, FIG. 14
[0413] Treatment of the protected form of Compound 18,
3-(4-BOC-amidinophenyl)-5-(4-(2-methoxy-carbonyl-2-N-ethylsulfonylaminoet-
hyl)phenyoxylmethyl-2-oxazolidinone (1.0 equivalents; synthesized
as described above), with 4 ml 2N NaOH for 4 hours at room
temperature. The mixture was then followed with 40 ml 2N
HCl-solution in dioxane added dropwise at 0.degree. C. to
25.degree. C. for 3 hours. The reaction mixture was then quenched
with sodium bicarbonate (5 equivalents) and then diluted with ethyl
acetate (0.10 M) and washed 2.times. with water, 1.times. with
brine and dried over magnesium sulfate. The solvent was then
removed in vacuo and the crude product was then purified by silica
gel column chromatography to obtain Compound 18:
3-(4-amidinophenyl)-5-(4-2-carboxy-2-N-ethylsulfonylaminoethyl)phenoxy)me-
thyl-2-oxazolidinone; m.p. 212.degree. C. (d).
[0414] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. Indeed, various modifications of the invention in
addition to those shown and described herein will become apparent
to those skilled in the art from the foregoing description and fall
within the scope of the appended claims.
Sequence CWU 1
1
43 1 5 PRT Artificial Sequence Description of Artificial Sequence
Peptide 1 Arg Gly Asp Phe Val 1 5 2 5 PRT Artificial Sequence
Description of Artificial Sequence Peptide 2 Arg Gly Asp Phe Val 1
5 3 5 PRT Artificial Sequence Description of Artificial Sequence
Peptide 3 Arg Gly Asp Phe Val 1 5 4 5 PRT Artificial Sequence
Description of Artificial Sequence Peptide 4 Arg Gly Asp Phe Val 1
5 5 5 PRT Artificial Sequence Description of Artificial Sequence
Peptide 5 Arg Ala Asp Phe Val 1 5 6 6 PRT Artificial Sequence
Description of Artificial Sequence Peptide 6 Gly Arg Gly Asp Phe
Val 1 5 7 5 PRT Artificial Sequence Description of Artificial
Sequence Peptide 7 Arg Gly Asp Phe Val 1 5 8 15 PRT Artificial
Sequence Description of Artificial Sequence Peptide 8 Tyr Thr Ala
Glu Cys Lys Pro Gln Val Thr Arg Gly Asp Val Phe 1 5 10 15 9 6 PRT
Artificial Sequence Description of Artificial Sequence Peptide 9
Arg Gly Asp Phe Asn Val 1 5 10 5 PRT Artificial Sequence
Description of Artificial Sequence Peptide 10 Arg Gly Glu Phe Val 1
5 11 222 PRT Homo sapiens 11 Lys Gly Ile Gln Glu Leu Tyr Gly Ala
Ser Pro Asp Ile Asp Leu Gly 1 5 10 15 Thr Gly Pro Thr Pro Thr Leu
Gly Pro Val Thr Pro Glu Ile Cys Lys 20 25 30 Gln Asp Ile Val Phe
Asp Gly Ile Ala Gln Ile Arg Gly Glu Ile Phe 35 40 45 Phe Phe Lys
Asp Arg Phe Ile Trp Arg Thr Val Thr Pro Arg Asp Lys 50 55 60 Pro
Met Gly Pro Leu Leu Val Ala Thr Phe Trp Pro Glu Leu Pro Glu 65 70
75 80 Lys Ile Asp Ala Val Tyr Glu Ala Pro Gln Glu Glu Lys Ala Val
Phe 85 90 95 Phe Ala Gly Asn Glu Tyr Trp Ile Tyr Ser Ala Ser Thr
Leu Glu Arg 100 105 110 Gly Tyr Pro Lys Pro Leu Thr Ser Leu Gly Leu
Pro Pro Asp Val Gln 115 120 125 Arg Val Asp Ala Ala Phe Asn Trp Ser
Lys Asn Lys Lys Thr Tyr Ile 130 135 140 Phe Ala Gly Asp Lys Phe Trp
Arg Tyr Asn Glu Val Lys Lys Lys Met 145 150 155 160 Asp Pro Gly Phe
Pro Lys Leu Ile Ala Asp Ala Trp Asn Ala Ile Pro 165 170 175 Asp Asn
Leu Asp Ala Val Val Asp Leu Gln Gly Gly Gly His Ser Tyr 180 185 190
Phe Phe Lys Gly Ala Tyr Tyr Leu Lys Leu Glu Asn Gln Ser Leu Lys 195
200 205 Ser Val Lys Phe Gly Ser Ile Lys Ser Asp Trp Leu Gly Cys 210
215 220 12 193 PRT Homo sapiens 12 Ile Cys Lys Gln Asp Ile Val Phe
Asp Gly Ile Ala Gln Ile Arg Gly 1 5 10 15 Glu Ile Phe Phe Phe Lys
Asp Arg Phe Ile Trp Arg Thr Val Thr Pro 20 25 30 Arg Asp Lys Pro
Met Gly Pro Leu Leu Val Ala Thr Phe Trp Pro Glu 35 40 45 Leu Pro
Glu Lys Ile Asp Ala Val Tyr Glu Ala Pro Gln Glu Glu Lys 50 55 60
Ala Val Phe Phe Ala Gly Asn Glu Tyr Trp Ile Tyr Ser Ala Ser Thr 65
70 75 80 Leu Glu Arg Gly Tyr Pro Lys Pro Leu Thr Ser Leu Gly Leu
Pro Pro 85 90 95 Asp Val Gln Arg Val Asp Ala Ala Phe Asn Trp Ser
Lys Asn Lys Lys 100 105 110 Thr Tyr Ile Phe Ala Gly Asp Lys Phe Trp
Arg Tyr Asn Glu Val Lys 115 120 125 Lys Lys Met Asp Pro Gly Phe Pro
Lys Leu Ile Ala Asp Ala Trp Asn 130 135 140 Ala Ile Pro Asp Asn Leu
Asp Ala Val Val Asp Leu Gln Gly Gly Gly 145 150 155 160 His Ser Tyr
Phe Phe Lys Gly Ala Tyr Tyr Leu Lys Leu Glu Asn Gln 165 170 175 Ser
Leu Lys Ser Val Lys Phe Gly Ser Ile Lys Ser Asp Trp Leu Gly 180 185
190 Cys 13 74 PRT Homo sapiens 13 Ile Cys Lys Gln Asp Ile Val Phe
Asp Gly Ile Ala Gln Ile Arg Gly 1 5 10 15 Glu Ile Phe Phe Phe Lys
Asp Arg Phe Ile Trp Arg Thr Val Thr Pro 20 25 30 Arg Asp Lys Pro
Met Gly Pro Leu Leu Val Ala Thr Phe Trp Pro Glu 35 40 45 Leu Pro
Glu Lys Ile Asp Ala Val Tyr Glu Ala Pro Gln Glu Glu Lys 50 55 60
Ala Val Phe Phe Ala Gly Asn Glu Tyr Trp 65 70 14 108 PRT Homo
sapiens 14 Ile Cys Lys Gln Asp Ile Val Phe Asp Gly Ile Ala Gln Ile
Arg Gly 1 5 10 15 Glu Ile Phe Phe Phe Lys Asp Arg Phe Ile Trp Arg
Thr Val Thr Pro 20 25 30 Arg Asp Lys Pro Met Gly Pro Leu Leu Val
Ala Thr Phe Trp Pro Glu 35 40 45 Leu Pro Glu Lys Ile Asp Ala Val
Tyr Glu Ala Pro Gln Glu Glu Lys 50 55 60 Ala Val Phe Phe Ala Gly
Asn Glu Tyr Trp Ile Tyr Ser Ala Ser Thr 65 70 75 80 Leu Glu Arg Gly
Tyr Pro Lys Pro Leu Thr Ser Leu Gly Leu Pro Pro 85 90 95 Asp Val
Gln Arg Val Asp Ala Ala Phe Asn Trp Ser 100 105 15 122 PRT Homo
sapiens 15 Glu Tyr Trp Ile Tyr Ser Ala Ser Thr Leu Glu Arg Gly Tyr
Pro Lys 1 5 10 15 Pro Leu Thr Ser Leu Gly Leu Pro Pro Asp Val Gln
Arg Val Asp Ala 20 25 30 Ala Phe Asn Trp Ser Lys Asn Lys Lys Thr
Tyr Ile Phe Ala Gly Asp 35 40 45 Lys Phe Trp Arg Tyr Asn Glu Val
Lys Lys Lys Met Asp Pro Gly Phe 50 55 60 Pro Lys Leu Ile Ala Asp
Ala Trp Asn Ala Ile Pro Asp Asn Leu Asp 65 70 75 80 Ala Val Val Asp
Leu Gln Gly Gly Gly His Ser Tyr Phe Phe Lys Gly 85 90 95 Ala Tyr
Tyr Leu Lys Leu Glu Asn Gln Ser Leu Lys Ser Val Lys Phe 100 105 110
Gly Ser Ile Lys Ser Asp Trp Leu Gly Cys 115 120 16 89 PRT Homo
sapiens 16 Phe Asn Trp Ser Lys Asn Lys Lys Thr Tyr Ile Phe Ala Gly
Asp Lys 1 5 10 15 Phe Trp Arg Tyr Asn Glu Val Lys Lys Lys Met Asp
Pro Gly Phe Pro 20 25 30 Lys Leu Ile Ala Asp Ala Trp Asn Ala Ile
Pro Asp Asn Leu Asp Ala 35 40 45 Val Val Asp Leu Gln Gly Gly Gly
His Ser Tyr Phe Phe Lys Gly Ala 50 55 60 Tyr Tyr Leu Lys Leu Glu
Asn Gln Ser Leu Lys Ser Val Lys Phe Gly 65 70 75 80 Ser Ile Lys Ser
Asp Trp Leu Gly Cys 85 17 228 PRT Gallus gallus 17 Lys Gly Ile Gln
Glu Leu Tyr Glu Val Ser Pro Asp Val Glu Pro Gly 1 5 10 15 Pro Gly
Pro Gly Pro Gly Pro Gly Pro Arg Pro Thr Leu Gly Pro Val 20 25 30
Thr Pro Glu Leu Cys Lys His Asp Ile Val Phe Asp Gly Val Ala Gln 35
40 45 Ile Arg Gly Glu Ile Phe Phe Phe Lys Asp Arg Phe Met Trp Arg
Thr 50 55 60 Val Asn Pro Arg Gly Lys Pro Thr Gly Pro Leu Leu Val
Ala Thr Phe 65 70 75 80 Trp Pro Asp Leu Pro Glu Lys Ile Asp Ala Val
Tyr Glu Ser Pro Gln 85 90 95 Asp Glu Lys Ala Val Phe Phe Ala Gly
Asn Glu Tyr Trp Val Tyr Thr 100 105 110 Ala Ser Asn Leu Asp Arg Gly
Tyr Pro Lys Lys Leu Thr Ser Leu Gly 115 120 125 Leu Pro Pro Asp Val
Gln Arg Ile Asp Ala Ala Phe Asn Trp Gly Arg 130 135 140 Asn Lys Lys
Thr Tyr Ile Phe Ser Gly Asp Arg Tyr Trp Lys Tyr Asn 145 150 155 160
Glu Glu Lys Lys Lys Met Glu Leu Ala Thr Pro Lys Phe Ile Ala Asp 165
170 175 Ser Trp Asn Gly Val Pro Asp Asn Leu Asp Ala Val Leu Gly Leu
Thr 180 185 190 Asp Ser Gly Tyr Thr Tyr Phe Phe Lys Asp Gln Tyr Tyr
Leu Gln Met 195 200 205 Glu Asp Lys Ser Leu Lys Ile Val Lys Ile Gly
Lys Ile Ser Ser Asp 210 215 220 Trp Leu Gly Cys 225 18 193 PRT
Gallus gallus 18 Leu Cys Lys His Asp Ile Val Phe Asp Gly Val Ala
Gln Ile Arg Gly 1 5 10 15 Glu Ile Phe Phe Phe Lys Asp Arg Phe Met
Trp Arg Thr Val Asn Pro 20 25 30 Arg Gly Lys Pro Thr Gly Pro Leu
Leu Val Ala Thr Phe Trp Pro Asp 35 40 45 Leu Pro Glu Lys Ile Asp
Ala Val Tyr Glu Ser Pro Gln Asp Glu Lys 50 55 60 Ala Val Phe Phe
Ala Gly Asn Glu Tyr Trp Val Tyr Thr Ala Ser Asn 65 70 75 80 Leu Asp
Arg Gly Tyr Pro Lys Lys Leu Thr Ser Leu Gly Leu Pro Pro 85 90 95
Asp Val Gln Arg Ile Asp Ala Ala Phe Asn Trp Gly Arg Asn Lys Lys 100
105 110 Thr Tyr Ile Phe Ser Gly Asp Arg Tyr Trp Lys Tyr Asn Glu Glu
Lys 115 120 125 Lys Lys Met Glu Leu Ala Thr Pro Lys Phe Ile Ala Asp
Ser Trp Asn 130 135 140 Gly Val Pro Asp Asn Leu Asp Ala Val Leu Gly
Leu Thr Asp Ser Gly 145 150 155 160 Tyr Thr Tyr Phe Phe Lys Asp Gln
Tyr Tyr Leu Gln Met Glu Asp Lys 165 170 175 Ser Leu Lys Ile Val Lys
Ile Gly Lys Ile Ser Ser Asp Trp Leu Gly 180 185 190 Cys 19 74 PRT
Gallus gallus 19 Leu Cys Lys His Asp Ile Val Phe Asp Gly Val Ala
Gln Ile Arg Gly 1 5 10 15 Glu Ile Phe Phe Phe Lys Asp Arg Phe Met
Trp Arg Thr Val Asn Pro 20 25 30 Arg Gly Lys Pro Thr Gly Pro Leu
Leu Val Ala Thr Phe Trp Pro Asp 35 40 45 Leu Pro Glu Lys Ile Asp
Ala Val Tyr Glu Ser Pro Gln Asp Glu Lys 50 55 60 Ala Val Phe Phe
Ala Gly Asn Glu Tyr Trp 65 70 20 108 PRT Gallus gallus 20 Leu Cys
Lys His Asp Ile Val Phe Asp Gly Val Ala Gln Ile Arg Gly 1 5 10 15
Glu Ile Phe Phe Phe Lys Asp Arg Phe Met Trp Arg Thr Val Asn Pro 20
25 30 Arg Gly Lys Pro Thr Gly Pro Leu Leu Val Ala Thr Phe Trp Pro
Asp 35 40 45 Leu Pro Glu Lys Ile Asp Ala Val Tyr Glu Ser Pro Gln
Asp Glu Lys 50 55 60 Ala Val Phe Phe Ala Gly Asn Glu Tyr Trp Val
Tyr Thr Ala Ser Asn 65 70 75 80 Leu Asp Arg Gly Tyr Pro Lys Lys Leu
Thr Ser Leu Gly Leu Pro Pro 85 90 95 Asp Val Gln Arg Ile Asp Ala
Ala Phe Asn Trp Gly 100 105 21 122 PRT Gallus gallus 21 Glu Tyr Trp
Val Tyr Thr Ala Ser Asn Leu Asp Arg Gly Tyr Pro Lys 1 5 10 15 Lys
Leu Thr Ser Leu Gly Leu Pro Pro Asp Val Gln Arg Ile Asp Ala 20 25
30 Ala Phe Asn Trp Gly Arg Asn Lys Lys Thr Tyr Ile Phe Ser Gly Asp
35 40 45 Arg Tyr Trp Lys Tyr Asn Glu Glu Lys Lys Lys Met Glu Leu
Ala Thr 50 55 60 Pro Lys Phe Ile Ala Asp Ser Trp Asn Gly Val Pro
Asp Asn Leu Asp 65 70 75 80 Ala Val Leu Gly Leu Thr Asp Ser Gly Tyr
Thr Tyr Phe Phe Lys Asp 85 90 95 Gln Tyr Tyr Leu Gln Met Glu Asp
Lys Ser Leu Lys Ile Val Lys Ile 100 105 110 Gly Lys Ile Ser Ser Asp
Trp Leu Gly Cys 115 120 22 89 PRT Gallus gallus 22 Phe Asn Trp Gly
Arg Asn Lys Lys Thr Tyr Ile Phe Ser Gly Asp Arg 1 5 10 15 Tyr Trp
Lys Tyr Asn Glu Glu Lys Lys Lys Met Glu Leu Ala Thr Pro 20 25 30
Lys Phe Ile Ala Asp Ser Trp Asn Gly Val Pro Asp Asn Leu Asp Ala 35
40 45 Val Leu Gly Leu Thr Asp Ser Gly Tyr Thr Tyr Phe Phe Lys Asp
Gln 50 55 60 Tyr Tyr Leu Gln Met Glu Asp Lys Ser Leu Lys Ile Val
Lys Ile Gly 65 70 75 80 Lys Ile Ser Ser Asp Trp Leu Gly Cys 85 23
2123 DNA Gallus gallus CDS (132)..(2123) 23 aattccggca aaagagaaaa
cggtgcagag agttaagatg tgcagataag caactagtgc 60 actgtgcagc
caaagtaact gacagtcagt cagagaaatc ttttaaagag gattgcaaaa 120
atataggcag a atg aag act cac agt gtt ttt ggc ttc ttt ttt aaa gta
170 Met Lys Thr His Ser Val Phe Gly Phe Phe Phe Lys Val 1 5 10 cta
tta atc caa gtg tat ctt ttt aac aaa act tta gct gca ccg tca 218 Leu
Leu Ile Gln Val Tyr Leu Phe Asn Lys Thr Leu Ala Ala Pro Ser 15 20
25 cca atc att aag ttc cct gga gac agc act cca aaa aca gac aaa gag
266 Pro Ile Ile Lys Phe Pro Gly Asp Ser Thr Pro Lys Thr Asp Lys Glu
30 35 40 45 cta gca gtg caa tac ctg aat aaa tat tat gga tgc cca aaa
gac aat 314 Leu Ala Val Gln Tyr Leu Asn Lys Tyr Tyr Gly Cys Pro Lys
Asp Asn 50 55 60 tgc aac tta ttt gta ttg aaa gat act ttg aag aaa
atg cag aaa ttt 362 Cys Asn Leu Phe Val Leu Lys Asp Thr Leu Lys Lys
Met Gln Lys Phe 65 70 75 ttt ggg ctg cct gaa aca gga gat ttg gat
caa aac aca att gag aca 410 Phe Gly Leu Pro Glu Thr Gly Asp Leu Asp
Gln Asn Thr Ile Glu Thr 80 85 90 atg aag aaa ccc cgc tgt ggt aac
ccc gat gtg gcc aat tac aac ttc 458 Met Lys Lys Pro Arg Cys Gly Asn
Pro Asp Val Ala Asn Tyr Asn Phe 95 100 105 ttt cca aga aag cca aaa
tgg gaa aag aat cat ata aca tac agg att 506 Phe Pro Arg Lys Pro Lys
Trp Glu Lys Asn His Ile Thr Tyr Arg Ile 110 115 120 125 ata ggc tat
acc ccg gat ttg gat cct gag aca gta gat gat gcc ttt 554 Ile Gly Tyr
Thr Pro Asp Leu Asp Pro Glu Thr Val Asp Asp Ala Phe 130 135 140 gcc
cga gcc ttt aaa gtc tgg agt gat gtc acg cca ctg aga ttt aac 602 Ala
Arg Ala Phe Lys Val Trp Ser Asp Val Thr Pro Leu Arg Phe Asn 145 150
155 cga ata aat gat gga gag gca gac att atg att aat ttt ggc cga tgg
650 Arg Ile Asn Asp Gly Glu Ala Asp Ile Met Ile Asn Phe Gly Arg Trp
160 165 170 gaa cat ggt gat ggc tat cca ttt gat ggc aaa gat ggt ctc
ctg gct 698 Glu His Gly Asp Gly Tyr Pro Phe Asp Gly Lys Asp Gly Leu
Leu Ala 175 180 185 cac gcc ttt gca ccg ggg cca gga att gga gga gac
tcc cat ttt gat 746 His Ala Phe Ala Pro Gly Pro Gly Ile Gly Gly Asp
Ser His Phe Asp 190 195 200 205 gat gat gaa ctg tgg act ctt gga gaa
ggg caa gtg gtt aga gta aag 794 Asp Asp Glu Leu Trp Thr Leu Gly Glu
Gly Gln Val Val Arg Val Lys 210 215 220 tat gga aat gca gat ggt gaa
tac tgc aaa ttt ccc ttc tgg ttc aat 842 Tyr Gly Asn Ala Asp Gly Glu
Tyr Cys Lys Phe Pro Phe Trp Phe Asn 225 230 235 ggt aag gaa tac aac
agc tgc aca gat gca gga cgt aat gat gga ttc 890 Gly Lys Glu Tyr Asn
Ser Cys Thr Asp Ala Gly Arg Asn Asp Gly Phe 240 245 250 ctc tgg tgt
tcc aca acc aaa gac ttt gat gca gat ggc aaa tat ggc 938 Leu Trp Cys
Ser Thr Thr Lys Asp Phe Asp Ala Asp Gly Lys Tyr Gly 255 260 265 ttt
tgt ccc cat gag tca ctt ttt aca atg ggt ggc aat ggt gat gga 986 Phe
Cys Pro His Glu Ser Leu Phe Thr Met Gly Gly Asn Gly Asp Gly 270 275
280 285 cag ccc tgc aag ttt ccc ttt aaa ttt caa ggc cag tcc tat gac
cag 1034 Gln Pro Cys Lys Phe Pro Phe Lys Phe Gln Gly Gln Ser Tyr
Asp Gln 290 295 300 tgt aca aca gaa ggc agg aca gat gga tac aga tgg
tgt gga acc act 1082 Cys Thr Thr Glu Gly Arg Thr Asp Gly Tyr Arg
Trp Cys Gly Thr Thr 305 310 315 gaa gac tat gat aga gat aag aaa tac
gga ttc tgc cca gaa act gcc 1130 Glu Asp Tyr Asp Arg Asp Lys Lys
Tyr Gly Phe Cys Pro Glu Thr Ala 320 325 330 atg tca aca gtt ggt gga
aat tca gaa gga gct cct tgt gta ttc ccc 1178 Met Ser Thr Val Gly
Gly Asn Ser Glu Gly Ala Pro Cys Val Phe Pro 335 340 345 ttc atc ttc
ctt ggg aat aaa tac gac tcc tgt aca agt gca ggt cgc 1226 Phe Ile
Phe Leu Gly Asn Lys Tyr Asp Ser Cys Thr Ser Ala Gly Arg 350 355 360
365 aat gat ggc aag ctg tgg tgt
gct tct acc agc agc tat gat gat gac 1274 Asn Asp Gly Lys Leu Trp
Cys Ala Ser Thr Ser Ser Tyr Asp Asp Asp 370 375 380 cgc aag tgg ggc
ttt tgt cca gat caa gga tac agt ctc ttc ttg gtt 1322 Arg Lys Trp
Gly Phe Cys Pro Asp Gln Gly Tyr Ser Leu Phe Leu Val 385 390 395 gct
gcc cac gaa ttt ggc cat gcg atg gga tta gag cac tcc gag gac 1370
Ala Ala His Glu Phe Gly His Ala Met Gly Leu Glu His Ser Glu Asp 400
405 410 cca gga gct ctc atg gcc ccg atc tac acc tac acc aag aac ttc
cgc 1418 Pro Gly Ala Leu Met Ala Pro Ile Tyr Thr Tyr Thr Lys Asn
Phe Arg 415 420 425 ctt tct cag gat gac att aag ggg att cag gag cta
tat gaa gta tca 1466 Leu Ser Gln Asp Asp Ile Lys Gly Ile Gln Glu
Leu Tyr Glu Val Ser 430 435 440 445 cct gat gtg gaa cct gga cca ggg
cca gga cca ggg cca gga cca cgt 1514 Pro Asp Val Glu Pro Gly Pro
Gly Pro Gly Pro Gly Pro Gly Pro Arg 450 455 460 cct acc ctt gga cct
gtc act cca gag ctc tgc aag cac gac att gta 1562 Pro Thr Leu Gly
Pro Val Thr Pro Glu Leu Cys Lys His Asp Ile Val 465 470 475 ttt gat
gga gtt gca caa att aga gga gaa ata ttt ttc ttc aaa gac 1610 Phe
Asp Gly Val Ala Gln Ile Arg Gly Glu Ile Phe Phe Phe Lys Asp 480 485
490 aga ttc atg tgg agg act gta aac cct cga gga aaa ccc aca ggt cct
1658 Arg Phe Met Trp Arg Thr Val Asn Pro Arg Gly Lys Pro Thr Gly
Pro 495 500 505 ctt ctc gtt gct aca ttc tgg cct gat ctg cca gag aaa
atc gat gct 1706 Leu Leu Val Ala Thr Phe Trp Pro Asp Leu Pro Glu
Lys Ile Asp Ala 510 515 520 525 gtc tac gag tcc cct cag gat gag aag
gct gta ttt ttt gca gga aat 1754 Val Tyr Glu Ser Pro Gln Asp Glu
Lys Ala Val Phe Phe Ala Gly Asn 530 535 540 gag tac tgg gtt tat aca
gcc agc aac ctg gat agg ggc tat cca aag 1802 Glu Tyr Trp Val Tyr
Thr Ala Ser Asn Leu Asp Arg Gly Tyr Pro Lys 545 550 555 aaa ctc acc
agc ctg gga cta ccc cct gat gtg caa cgc att gat gca 1850 Lys Leu
Thr Ser Leu Gly Leu Pro Pro Asp Val Gln Arg Ile Asp Ala 560 565 570
gcc ttc aac tgg ggc aga aac aag aag aca tat att ttc tct gga gac
1898 Ala Phe Asn Trp Gly Arg Asn Lys Lys Thr Tyr Ile Phe Ser Gly
Asp 575 580 585 aga tac tgg aag tac aat gaa gaa aag aaa aaa atg gag
ctt gca acc 1946 Arg Tyr Trp Lys Tyr Asn Glu Glu Lys Lys Lys Met
Glu Leu Ala Thr 590 595 600 605 cca aaa ttc att gcg gat tct tgg aat
gga gtt cca gat aac ctc gat 1994 Pro Lys Phe Ile Ala Asp Ser Trp
Asn Gly Val Pro Asp Asn Leu Asp 610 615 620 gct gtc ctg ggt ctt act
gac agc ggg tac acc tat ttt ttc aaa gac 2042 Ala Val Leu Gly Leu
Thr Asp Ser Gly Tyr Thr Tyr Phe Phe Lys Asp 625 630 635 cag tac tat
cta caa atg gaa gac aag agt ttg aag att gtt aaa att 2090 Gln Tyr
Tyr Leu Gln Met Glu Asp Lys Ser Leu Lys Ile Val Lys Ile 640 645 650
ggc aag ata agt tct gac tgg ttg ggt tgc tga 2123 Gly Lys Ile Ser
Ser Asp Trp Leu Gly Cys 655 660 24 663 PRT Gallus gallus 24 Met Lys
Thr His Ser Val Phe Gly Phe Phe Phe Lys Val Leu Leu Ile 1 5 10 15
Gln Val Tyr Leu Phe Asn Lys Thr Leu Ala Ala Pro Ser Pro Ile Ile 20
25 30 Lys Phe Pro Gly Asp Ser Thr Pro Lys Thr Asp Lys Glu Leu Ala
Val 35 40 45 Gln Tyr Leu Asn Lys Tyr Tyr Gly Cys Pro Lys Asp Asn
Cys Asn Leu 50 55 60 Phe Val Leu Lys Asp Thr Leu Lys Lys Met Gln
Lys Phe Phe Gly Leu 65 70 75 80 Pro Glu Thr Gly Asp Leu Asp Gln Asn
Thr Ile Glu Thr Met Lys Lys 85 90 95 Pro Arg Cys Gly Asn Pro Asp
Val Ala Asn Tyr Asn Phe Phe Pro Arg 100 105 110 Lys Pro Lys Trp Glu
Lys Asn His Ile Thr Tyr Arg Ile Ile Gly Tyr 115 120 125 Thr Pro Asp
Leu Asp Pro Glu Thr Val Asp Asp Ala Phe Ala Arg Ala 130 135 140 Phe
Lys Val Trp Ser Asp Val Thr Pro Leu Arg Phe Asn Arg Ile Asn 145 150
155 160 Asp Gly Glu Ala Asp Ile Met Ile Asn Phe Gly Arg Trp Glu His
Gly 165 170 175 Asp Gly Tyr Pro Phe Asp Gly Lys Asp Gly Leu Leu Ala
His Ala Phe 180 185 190 Ala Pro Gly Pro Gly Ile Gly Gly Asp Ser His
Phe Asp Asp Asp Glu 195 200 205 Leu Trp Thr Leu Gly Glu Gly Gln Val
Val Arg Val Lys Tyr Gly Asn 210 215 220 Ala Asp Gly Glu Tyr Cys Lys
Phe Pro Phe Trp Phe Asn Gly Lys Glu 225 230 235 240 Tyr Asn Ser Cys
Thr Asp Ala Gly Arg Asn Asp Gly Phe Leu Trp Cys 245 250 255 Ser Thr
Thr Lys Asp Phe Asp Ala Asp Gly Lys Tyr Gly Phe Cys Pro 260 265 270
His Glu Ser Leu Phe Thr Met Gly Gly Asn Gly Asp Gly Gln Pro Cys 275
280 285 Lys Phe Pro Phe Lys Phe Gln Gly Gln Ser Tyr Asp Gln Cys Thr
Thr 290 295 300 Glu Gly Arg Thr Asp Gly Tyr Arg Trp Cys Gly Thr Thr
Glu Asp Tyr 305 310 315 320 Asp Arg Asp Lys Lys Tyr Gly Phe Cys Pro
Glu Thr Ala Met Ser Thr 325 330 335 Val Gly Gly Asn Ser Glu Gly Ala
Pro Cys Val Phe Pro Phe Ile Phe 340 345 350 Leu Gly Asn Lys Tyr Asp
Ser Cys Thr Ser Ala Gly Arg Asn Asp Gly 355 360 365 Lys Leu Trp Cys
Ala Ser Thr Ser Ser Tyr Asp Asp Asp Arg Lys Trp 370 375 380 Gly Phe
Cys Pro Asp Gln Gly Tyr Ser Leu Phe Leu Val Ala Ala His 385 390 395
400 Glu Phe Gly His Ala Met Gly Leu Glu His Ser Glu Asp Pro Gly Ala
405 410 415 Leu Met Ala Pro Ile Tyr Thr Tyr Thr Lys Asn Phe Arg Leu
Ser Gln 420 425 430 Asp Asp Ile Lys Gly Ile Gln Glu Leu Tyr Glu Val
Ser Pro Asp Val 435 440 445 Glu Pro Gly Pro Gly Pro Gly Pro Gly Pro
Gly Pro Arg Pro Thr Leu 450 455 460 Gly Pro Val Thr Pro Glu Leu Cys
Lys His Asp Ile Val Phe Asp Gly 465 470 475 480 Val Ala Gln Ile Arg
Gly Glu Ile Phe Phe Phe Lys Asp Arg Phe Met 485 490 495 Trp Arg Thr
Val Asn Pro Arg Gly Lys Pro Thr Gly Pro Leu Leu Val 500 505 510 Ala
Thr Phe Trp Pro Asp Leu Pro Glu Lys Ile Asp Ala Val Tyr Glu 515 520
525 Ser Pro Gln Asp Glu Lys Ala Val Phe Phe Ala Gly Asn Glu Tyr Trp
530 535 540 Val Tyr Thr Ala Ser Asn Leu Asp Arg Gly Tyr Pro Lys Lys
Leu Thr 545 550 555 560 Ser Leu Gly Leu Pro Pro Asp Val Gln Arg Ile
Asp Ala Ala Phe Asn 565 570 575 Trp Gly Arg Asn Lys Lys Thr Tyr Ile
Phe Ser Gly Asp Arg Tyr Trp 580 585 590 Lys Tyr Asn Glu Glu Lys Lys
Lys Met Glu Leu Ala Thr Pro Lys Phe 595 600 605 Ile Ala Asp Ser Trp
Asn Gly Val Pro Asp Asn Leu Asp Ala Val Leu 610 615 620 Gly Leu Thr
Asp Ser Gly Tyr Thr Tyr Phe Phe Lys Asp Gln Tyr Tyr 625 630 635 640
Leu Gln Met Glu Asp Lys Ser Leu Lys Ile Val Lys Ile Gly Lys Ile 645
650 655 Ser Ser Asp Trp Leu Gly Cys 660 25 631 PRT Homo sapiens 25
Ala Pro Ser Pro Ile Ile Lys Phe Pro Gly Asp Val Ala Pro Lys Thr 1 5
10 15 Asp Lys Glu Leu Ala Val Gln Tyr Leu Asn Thr Phe Tyr Gly Cys
Pro 20 25 30 Lys Glu Ser Cys Asn Leu Phe Val Leu Lys Asp Thr Leu
Lys Lys Met 35 40 45 Gln Lys Phe Phe Gly Leu Pro Gln Thr Gly Asp
Leu Asp Gln Asn Thr 50 55 60 Ile Glu Thr Met Arg Lys Pro Arg Cys
Gly Asn Pro Asp Val Ala Asn 65 70 75 80 Tyr Asn Phe Phe Pro Arg Lys
Pro Lys Trp Asp Lys Asn Gln Ile Thr 85 90 95 Tyr Arg Ile Ile Gly
Tyr Thr Pro Asp Leu Asp Pro Glu Thr Val Asp 100 105 110 Asp Ala Phe
Ala Arg Ala Phe Gln Val Trp Ser Asp Val Thr Pro Leu 115 120 125 Arg
Phe Ser Arg Ile His Asp Gly Glu Ala Asp Ile Met Ile Asn Phe 130 135
140 Gly Arg Trp Glu His Gly Asp Gly Tyr Pro Phe Asp Gly Lys Asp Gly
145 150 155 160 Leu Leu Ala His Ala Phe Ala Pro Gly Thr Gly Val Gly
Gly Asp Ser 165 170 175 His Phe Asp Asp Asp Glu Leu Trp Thr Leu Gly
Glu Gly Gln Val Val 180 185 190 Arg Val Lys Tyr Gly Asn Ala Asp Gly
Glu Tyr Cys Lys Phe Pro Phe 195 200 205 Leu Phe Asn Gly Lys Glu Tyr
Asn Ser Cys Thr Asp Thr Gly Arg Ser 210 215 220 Asp Gly Phe Leu Trp
Cys Ser Thr Thr Tyr Asn Phe Glu Lys Asp Gly 225 230 235 240 Lys Tyr
Gly Phe Cys Pro His Glu Ala Leu Phe Thr Met Gly Gly Asn 245 250 255
Ala Glu Gly Gln Pro Cys Lys Phe Pro Phe Arg Phe Gln Gly Thr Ser 260
265 270 Tyr Asp Ser Cys Thr Thr Glu Gly Arg Thr Asp Gly Tyr Arg Trp
Cys 275 280 285 Gly Thr Thr Glu Asp Tyr Asp Arg Asp Lys Lys Tyr Gly
Phe Cys Pro 290 295 300 Glu Thr Ala Met Ser Thr Val Gly Gly Asn Ser
Glu Gly Ala Pro Cys 305 310 315 320 Val Phe Pro Phe Thr Phe Leu Gly
Asn Lys Tyr Glu Ser Cys Thr Ser 325 330 335 Ala Gly Arg Ser Asp Gly
Lys Met Trp Cys Ala Thr Thr Ala Asn Tyr 340 345 350 Asp Asp Asp Arg
Lys Trp Gly Phe Cys Pro Asp Gln Gly Tyr Ser Leu 355 360 365 Phe Leu
Val Ala Ala His Glu Phe Gly His Ala Met Gly Leu Glu His 370 375 380
Ser Gln Asp Pro Gly Ala Leu Met Ala Pro Ile Tyr Thr Tyr Thr Lys 385
390 395 400 Asn Phe Arg Leu Ser Gln Asp Asp Ile Lys Gly Ile Gln Glu
Leu Tyr 405 410 415 Gly Ala Ser Pro Asp Ile Asp Leu Gly Thr Gly Pro
Thr Pro Thr Leu 420 425 430 Gly Pro Val Thr Pro Glu Ile Cys Lys Gln
Asp Ile Val Phe Asp Gly 435 440 445 Ile Ala Gln Ile Arg Gly Glu Ile
Phe Phe Phe Lys Asp Arg Phe Ile 450 455 460 Trp Arg Thr Val Thr Pro
Arg Asp Lys Pro Met Gly Pro Leu Leu Val 465 470 475 480 Ala Thr Phe
Trp Pro Glu Leu Pro Glu Lys Ile Asp Ala Val Tyr Glu 485 490 495 Ala
Pro Gln Glu Glu Lys Ala Val Phe Phe Ala Gly Asn Glu Tyr Trp 500 505
510 Ile Tyr Ser Ala Ser Thr Leu Glu Arg Gly Tyr Pro Lys Pro Leu Thr
515 520 525 Ser Leu Gly Leu Pro Pro Asp Val Gln Arg Val Asp Ala Ala
Phe Asn 530 535 540 Trp Ser Lys Asn Lys Lys Thr Tyr Ile Phe Ala Gly
Asp Lys Phe Trp 545 550 555 560 Arg Tyr Asn Glu Val Lys Lys Lys Met
Asp Pro Gly Phe Pro Lys Leu 565 570 575 Ile Ala Asp Ala Trp Asn Ala
Ile Pro Asp Asn Leu Asp Ala Val Val 580 585 590 Asp Leu Gln Gly Gly
Gly His Ser Tyr Phe Phe Lys Gly Ala Tyr Tyr 595 600 605 Leu Lys Leu
Glu Asn Gln Ser Leu Lys Ser Val Lys Phe Gly Ser Ile 610 615 620 Lys
Ser Asp Trp Leu Gly Cys 625 630 26 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 26
attgaattct tctacagttc a 21 27 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 27
atgggatcca ctgcaaattt c 21 28 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 28
gccggatcca tgaccagtgt a 21 29 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 29
gtgggatccc tgaagactat g 21 30 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 30
aggggatcct taaggggatt c 21 31 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 31
ctcggatcct ctgcaagcac g 21 32 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 32
ctcggatcct ctgcaagcac g 21 33 26 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 33
gcaggatccg agtgctgggt ttatac 26 34 27 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 34
gcagaattca actgtggcag aaacaag 27 35 26 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 35
gtagaattcc agcactcatt tcctgc 26 36 24 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 36
tctgaattct gccacagttg aagg 24 37 21 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 37
attgaattct tctacagttc a 21 38 20 DNA Artificial Sequence
Description of Artificial Sequence Oligonucleotide primer 38
gatgaattct actgcaagtt 20 39 21 DNA Artificial Sequence Description
of Artificial Sequence Oligonucleotide primer 39 cactgaattc
atctgcaaac a 21 40 429 PRT Artificial Sequence Description of
Artificial Sequence Human MMP-2 fusion protein 40 Tyr Cys Lys Phe
Pro Phe Leu Phe Asn Gly Lys Glu Tyr Asn Ser Cys 1 5 10 15 Thr Asp
Thr Gly Arg Ser Asp Gly Phe Leu Trp Cys Ser Thr Thr Tyr 20 25 30
Asn Phe Glu Lys Asp Gly Lys Tyr Gly Phe Cys Pro His Glu Ala Leu 35
40 45 Phe Thr Met Gly Gly Asn Ala Glu Gly Gln Pro Cys Lys Phe Pro
Phe 50 55 60 Arg Phe Gln Gly Thr Ser Tyr Asp Ser Cys Thr Thr Glu
Gly Arg Thr 65 70 75 80 Asp Gly Tyr Arg Trp Cys Gly Thr Thr Glu Asp
Tyr Asp Arg Asp Lys 85 90 95 Lys Tyr Gly Phe Cys Pro Glu Thr Ala
Met Ser Thr Val Gly Gly Asn 100 105 110 Ser Glu Gly Ala Pro Cys Val
Phe Pro Phe Thr Phe Leu Gly Asn Lys 115 120 125 Tyr Glu Ser Cys Thr
Ser Ala Gly Arg Ser Asp Gly Lys Met Trp Cys 130 135 140 Ala Thr Thr
Ala Asn Tyr Asp Asp Asp Arg Lys Trp Gly Phe Cys Pro 145 150 155 160
Asp Gln Gly Tyr Ser Leu Phe Leu Val Ala Ala His Glu Phe Gly His 165
170 175 Ala Met Gly Leu Glu His Ser Gln Asp Pro Gly Ala Leu Met Ala
Pro 180 185 190 Ile Tyr Thr Tyr Thr Lys Asn Phe Arg Leu Ser Gln Asp
Asp Ile Lys 195 200 205 Gly Ile Gln Glu Leu Tyr Gly Ala Ser Pro Asp
Ile Asp Leu Gly Thr 210 215 220 Gly Pro Thr Pro Thr Leu Gly Pro Val
Thr Pro Glu Ile Cys Lys Gln 225 230 235 240 Asp Ile Val Phe Asp Gly
Ile Ala Gln Ile Arg Gly Glu Ile Phe Phe 245 250 255 Phe Lys Asp Arg
Phe Ile Trp Arg Thr Val Thr Pro Arg Asp Lys Pro 260 265 270 Met Gly
Pro Leu Leu Val Ala Thr Phe Trp Pro Glu Leu Pro Glu Lys 275 280 285
Ile Asp Ala Val Tyr Glu Ala Pro Gln Glu Glu Lys Ala Val Phe Phe 290
295 300 Ala Gly Asn Glu Tyr Trp Ile Tyr Ser Ala Ser Thr Leu Glu Arg
Gly 305 310 315
320 Tyr Pro Lys Pro Leu Thr Ser Leu Gly Leu Pro Pro Asp Val Gln Arg
325 330 335 Val Asp Ala Ala Phe Asn Trp Ser Lys Asn Lys Lys Thr Tyr
Ile Phe 340 345 350 Ala Gly Asp Lys Phe Trp Arg Tyr Asn Glu Val Lys
Lys Lys Met Asp 355 360 365 Pro Gly Phe Pro Lys Leu Ile Ala Asp Ala
Trp Asn Ala Ile Pro Asp 370 375 380 Asn Leu Asp Ala Val Val Asp Leu
Gln Gly Gly Gly His Ser Tyr Phe 385 390 395 400 Phe Lys Gly Ala Tyr
Tyr Leu Lys Leu Glu Asn Gln Ser Leu Lys Ser 405 410 415 Val Lys Phe
Gly Ser Ile Lys Ser Asp Trp Leu Gly Cys 420 425 41 5 PRT Artificial
Sequence Description of Artificial Sequence peptide 41 Arg Gly Asp
Phe Val 1 5 42 5 PRT Artificial Sequence Description of Artificial
Sequence peptide 42 Arg Gly Asp Phe Val 1 5 43 5 PRT Artificial
Sequence Description of Artificial Sequence peptide 43 Arg Gly Asp
Phe Val 1 5
* * * * *