U.S. patent application number 11/373534 was filed with the patent office on 2006-07-20 for compositions and methods for nonenzymatic ligation of oligonucleotides and detection of genetic polymorphisms.
This patent application is currently assigned to University of Rochester. Invention is credited to Eric T. Kool.
Application Number | 20060160125 11/373534 |
Document ID | / |
Family ID | 36190971 |
Filed Date | 2006-07-20 |
United States Patent
Application |
20060160125 |
Kind Code |
A1 |
Kool; Eric T. |
July 20, 2006 |
Compositions and methods for nonenzymatic ligation of
oligonucleotides and detection of genetic polymorphisms
Abstract
The invention is directed to novel compositions and methods for
nonenzymatic ligation of oligonucleotides. In one aspect of the
invention, the nonenzymatic ligation is selenium-mediated or
tellurium mediated ligation. In another aspect, the invention
provides for the use of fluorescence resonance energy transfer
(FRET) to detect the nonenzymatic ligation.
Inventors: |
Kool; Eric T.; (Stanford,
CA) |
Correspondence
Address: |
MUETING, RAASCH & GEBHARDT, P.A.
P.O. BOX 581415
MINNEAPOLIS
MN
55458
US
|
Assignee: |
University of Rochester
Rochester
NY
|
Family ID: |
36190971 |
Appl. No.: |
11/373534 |
Filed: |
March 10, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09483337 |
Jan 14, 2000 |
7033753 |
|
|
11373534 |
Mar 10, 2006 |
|
|
|
60116059 |
Jan 15, 1999 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
544/243; 544/244 |
Current CPC
Class: |
C12Q 2523/109 20130101;
C12Q 2525/101 20130101; C12Q 2561/125 20130101; C12Q 1/6827
20130101; C12Q 1/6827 20130101 |
Class at
Publication: |
435/006 ;
544/243; 544/244 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07F 9/6512 20060101 C07F009/6512 |
Goverment Interests
STATEMENT OF GOVERNMENT RIGHTS
[0002] This invention was made with government support under a
grant from the National Institutes of Health, Grant No.
R01-GM46625. The U.S. Government has certain rights in this
invention.
Claims
1. A nucleotide comprising a phosphoroselenoate group or a
phosphorotelluroate group.
2. An oligonucleotide comprising as its 3' end the nucleotide of
claim 1.
3. The oligonucleotide of claim 2 comprising as its 5' end a
nucleoside comprising a 5' leaving group.
4. An oligonucleotide comprising a plurality of
2'-deoxyribonucleotides and one ribonucleotide, the ribonucleotide
comprising a functional group selected from the group consisting of
a phosphorothioate group, a phosphoroselenoate group and a
phosphorotelluroate group; wherein the oligonucleotide comprises,
as its 3' end, the ribonucleotide.
5. A solid support comprising the oligonucleotide of claim 4.
6. An oligonucleotide comprising at least one 5' bridging
phosphoroselenoester or phosphorotelluroester.
7. The oligonucleotide of claim 6 comprising at least one
deoxyribonucleotide.
8. The oligonucleotide of claim 6 comprising at least one
ribonucleotide.
9. The oligonucleotide of claim 6 wherein at least one 5' bridging
phosphoroselenoester or phosphorotelluroester forms a bridge
between a deoxyribonucleotide and a ribonucleotide.
10. The oligonucleotide of claim 6 that is circular or linear.
11. A nucleic acid duplex comprising the oligonucleotide of claim 2
hybridized to a complementary oligonucleotide.
12. A nucleoside selected from the group consisting of a
5'-deoxy-5'-iodothymidine (5'-I-T),
5'-deoxy-5'-iodo-2'-deoxycytidine (5'-I-dC),
5'-deoxy-5'-iodo-2'-deoxyadenosine (5'-I-dA),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyadenosine (5'-I-3-deaza-dA),
5'-deoxy-5'-iodo-2'-deoxyguanosine (5'-I-dG),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyguanosine (5'-I-3-deaza-dG),
5'-deoxy-5'-iodouracil (5'-I-U), 5'-deoxy-5'-iodocytidine (5'-I-C),
5'-deoxy-5'-iodoadenosine (5'-I-A),
5'-deoxy-5'-iodo-3-deazaadenosine (5'-I-3-deaza-A),
5'-deoxy-5'-iodoguanosine (5'-I-G) and
5'-deoxy-5'-iodo-3-deazaguanosine (5'-I-3-deaza-G), and the
phosphoroamidite derivatives thereof.
13. An oligonucleotide comprising as its 5'end a nucleotide derived
form the nucleoside of claim 12.
14. An oligonucleotide comprising a plurality of
2'-deoxyribonucleotides and one ribonucleotide, the ribonucleotide
comprising a 5' leaving group; wherein the oligonucleotide
comprises, as its 5' end, the ribonucleotide.
15. A solid support comprising the oligonucleotide of claim 14.
16. The solid support of claim 15 further comprising an
oligonucleotide comprising a plurality of 2'-deoxyribonucleotides
and one ribonucleotide, the ribonucleotide comprising a functional
group selected from the group consisting of a phosphorothioate
group, a phosphoroselenoate group and a phosphorotelluroate group;
wherein the oligonucleotide comprises, as its 3' end, the
ribonucleotide.
17. A solid support comprising at least one oligonucleotide
selected from the group consisting of an oligonucleotide comprising
a phosphoroselenoate group, an oligonucleotide comprising
phosphoroselenoate group, an oligonucleotide comprising a
phosphorotelluroate group, and an oligonucleotide comprising a 5'
leaving group.
18. The solid support of claim 17 comprising an oligonucleotide
comprising a 5' leaving group and at least one oligonucleotide
selected from the group consisting of an oligonucleotide comprising
a phosphoroselenoate group, an oligonucleotide comprising
phosphoroselenoate group, an oligonucleotide comprising a
phosphorotelluroate group.
19. A method for making an oligonucleotide comprising: binding at
least one upstream oligonucleotide and at least one downstream
oligonucleotide to a polynucleotide template; the upstream
oligonucleotide comprising, as its 5' end, a nucleoside comprising
a 5' leaving group; and the downstream oligonucleotide comprising,
as its 3' end, a nucleoside comprising a 3' phosphoroselenoate or a
3' phosphorotelluroate, wherein the downstream oligonucleotide
binds such that it 3' end is substantially adjacent to the 5' end
of the upstream oligonucleotide; to yield an autoligated
oligonucleotide product comprising the upstream oligonucleotide
ligated to the downstream oligonucleotide.
20. The method of claim 19 where one oligonucleotide comprises a
fluorescence energy donor group and the other oligonucleotide
comprises a fluorescence energy acceptor group, and wherein the
presence or absence of the autoligated oligonucleotide product is
accompanied by a detectable change in fluorescence emission of the
ligated product compared to the fluorescence energy emissions of
the unligated oligonucleotides.
21. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising, as its 5'
end, a nucleoside comprising a 5' leaving group and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3'
phosphoroselenoate or a 3' phosphorotelluroate, such that, when
both probes are bound to the target polynucleotide, an end of the
universal oligonucleotide probe is substantially adjacent to an end
of the mutant polymorphism oligonucleotide probe so as to position
the 5' leaving group and the 3' phosphoroselenoate or a 3'
phosphorotelluroate in close proximity to one another; contacting
the target polynucleotide with the universal oligonucleotide probe
and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and the mutant polymorphism probe; and
detecting the presence of the autoligated oligonucleotide
product.
22. The method of claim 21 wherein at least one of the mutant
polymorphism oligonucleotide probe and the universal
oligonucleotide probe comprises a detectable label.
23. The method of claim 22 wherein the detectable label is a
radiolabel.
24. The method of claim 21 wherein the genetic polymorphism is
selected from the group consisting of a single base mutation, a
plurality of single base mutations, a deletion, an insertion, and a
genetic rearrangement.
25. The method of claim 21 wherein the nucleotide position of the
genetic polymorphism is not the nucleotide position corresponding
to the ligation junction end of the mutant polymorphism probe.
26. The method of claim 21 wherein the mutant polymorphism probe is
about 3 to about 12 nucleotides in length.
27. The method of claim 26 wherein the mutant polymorphism probe is
about 3 to about 6 nucleotides in length.
28. The method of claim 21 wherein the target polynucleotide is DNA
or RNA.
29. The method of claim 21 wherein the target polynucleotide is
double-stranded or single-stranded.
30. The method of claim 21 wherein one oligonucleotide probe
comprises a fluorescence energy donor group and the other
oligonucleotide comprises a fluorescence energy acceptor group, and
wherein the presence or absence of the autoligated oligonucleotide
product is accompanied by a detectable change in fluorescence
emission of the ligated product compared to the fluorescence
emissions of the unligated oligonucleotides.
31. A method for determining whether a target polynucleotide
contains a genetic polymorphism comprising: providing a mutant
polymorphism oligonucleotide probe comprising a first fluorescence
energy acceptor group, wherein the mutant polymorphism
oligonucleotide probe is complementary to a region on the target
polynucleotide that comprises the genetic polymorphism; providing a
wild-type polymorphism oligonucleotide probe comprising a second
fluorescence energy acceptor group, wherein the wild-type
polymorphism oligonucleotide probe is complementary to a region on
the analogous wild-type polynucleotide that is analogous to the
region comprising the genetic polymorphism; providing a universal
oligonucleotide probe comprising a fluorescence energy donor group,
wherein the universal probe is capable of binding to the target
polynucleotide at a region that is conserved in the analogous
wild-type polynucleotide; wherein either (i) the universal
oligonucleotide probe constitutes an upstream oligonucleotide
comprising, as its 5' end, a nucleoside comprising a 5' leaving
group and both polymorphism oligonucleotide probes constitute
downstream oligonucleotides comprising, as their 3' ends, a
nucleoside comprising a 3' functional group selected from the group
consisting of a 3' phosphorothioate, a 3' phosphoroselenoate and a
3' phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides comprising, as their 5'
ends, a nucleoside comprising a 5' leaving group and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate; such that,
when a universal probe and a polymorphism probe are bound to the
target polynucleotide, an end of the universal oligonucleotide
probe is substantially adjacent to an end of the polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target polynucleotide with the universal
oligonucleotide probe, the mutant polymorphism oligonucleotide
probe and the wild-type polymorphism oligonucleotide probe to yield
an autoligated oligonucleotide product comprising the universal
oligonucleotide probe either the mutant polymorphism probe or the
wild-type polymorphism oligonucleotide probe; causing the
autoligated oligonucleotide product to fluoresce; and analyzing the
fluorescence emission from the autoligated oligonucleotide product
to determine whether the autoligated oligonucleotide product
comprises the mutant polymorphism probe or the wild-type
polymorphism oligonucleotide probe, wherein the presence of the
mutant polymorphism probe in the autoligated oligonucleotide
product indicates the presence of a genetic polymorphism in the
target polynucleotide.
32. The method of claim 31 wherein the genetic polymorphism is
selected from the group consisting of a single base mutation, a
plurality of single base mutations, a deletion, an insertion, and a
genetic rearrangement.
33. The method of claim 31 wherein the nucleotide position of the
genetic polymorphism is not the nucleotide position corresponding
to the ligation junction end of the mutant polymorphism probe.
34. The method of claim 31 wherein the mutant polymorphism probe is
about 3 to about 12 nucleotides in length.
35. The method of claim 34 wherein the mutant polymorphism probe is
about 3 to about 6 nucleotides in length.
36. The method of claim 31 wherein the target polynucleotide is DNA
or RNA.
37. The method of claim 31 wherein the target polynucleotide is
single-stranded or double-stranded.
38. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising, as its 5'
end, a nucleoside comprising a 5' leaving group and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate, such that,
when both probes are bound to the target polynucleotide, an end of
the universal oligonucleotide probe is substantially adjacent to an
end of the mutant polymorphism oligonucleotide probe so as to
position the 5' leaving group and the 3' functional group in close
proximity to one another; and wherein one oligonucleotide probe
comprises a fluorescence energy donor group and the other
oligonucleotide comprises a fluorescence energy acceptor group;
contacting the target polynucleotide with the universal
oligonucleotide probe and the mutant polymorphism oligonucleotide
probe to yield an autoligated oligonucleotide product comprising
the universal oligonucleotide probe and the mutant polymorphism
probe; and detecting the presence or absence of the autoligated
oligonucleotide product, wherein the presence or absence of the
autoligated oligonucleotide product is accompanied by a detectable
change in fluorescence emission of the ligated product compared to
the fluorescence emissions of the unligated oligonucleotides.
39. The method of claim 38 wherein the nucleotide position of the
genetic polymorphism is not the nucleotide position corresponding
to the ligation junction end of the mutant polymorphism probe.
40. The method of claim 38 wherein the mutant polymorphism probe is
about 3 to about 12 nucleotides in length.
41. The method of claim 40 wherein the mutant polymorphism probe is
about 3 to about 6 nucleotides in length.
42. The method of claim 38 wherein the target polynucleotide is DNA
or RNA.
43. The method of claim 38 wherein the target polynucleotide is
single-stranded or double-stranded.
44. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising, as its 5'
end, a nucleoside comprising a 5' leaving group and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate, such that,
when both probes are bound to the target polynucleotide, an end of
the universal oligonucleotide probe is substantially but not
directly adjacent to an end of the mutant polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target polynucleotide with the universal
oligonucleotide probe and the mutant polymorphism oligonucleotide
probe to yield an autoligated oligonucleotide product comprising
the universal oligonucleotide probe and the mutant polymorphism
probe; and detecting the presence of the autoligated
oligonucleotide product.
45. The method of claim 44 wherein at least one of the mutant
polymorphism oligonucleotide probe and the universal
oligonucleotide probe comprises a detectable label.
46. The method of claim 45 wherein the detectable label is a
radiolabel.
47. The method of claim 44 wherein the genetic polymorphism is
selected from the group consisting of a single base mutation, a
plurality of single base mutations, a deletion, an insertion, and a
genetic rearrangement.
48. The method of claim 44 wherein the nucleotide position of the
genetic polymorphism is not the nucleotide position corresponding
to the ligation junction end of the mutant polymorphism probe.
49. The method of claim 44 where one oligonucleotide comprises a
fluorescence energy donor group and the other oligonucleotide
comprises a fluorescence energy acceptor group, and wherein the
presence or absence of the autoligated oligonucleotide product is
accompanied by a detectable change in fluorescence emission of the
ligated product compared to the fluorescence energy emissions of
the unligated oligonucleotides.
50. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe of less than 7 nucleotides in length that is
complementary to a region on the target polynucleotide that
comprises the genetic polymorphism; providing a universal
oligonucleotide probe capable of binding to the target
polynucleotide at a region that is conserved in the analogous
wild-type polynucleotide; wherein one oligonucleotide probe
constitutes an upstream oligonucleotide comprising, as its 5' end,
a nucleoside comprising a 5' leaving group and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate, such that,
when both probes are bound to the target polynucleotide, an end of
the universal oligonucleotide probe is substantially adjacent to an
end of the mutant polymorphism oligonucleotide probe so as to
position the 5' leaving group and the 3' functional in close
proximity to one another; contacting the target polynucleotide with
the universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe and the
mutant polymorphism probe; and detecting the presence of the
autoligated oligonucleotide product.
51. The method of claim 50 wherein at least one of the mutant
polymorphism oligonucleotide probe and the universal
oligonucleotide probe comprises a detectable label.
52. The method of claim 51 wherein the detectable label is a
radiolabel.
53. The method of claim 50 wherein the genetic polymorphism is
selected from the group consisting of a single base mutation, a
plurality of single base mutations, a deletion, an insertion, and a
genetic rearrangement.
54. The method of claim 50 wherein the nucleotide position of the
genetic polymorphism is not the nucleotide position corresponding
to the ligation junction end of the mutant polymorphism probe.
55. The method of claim 50 where one oligonucleotide comprises a
fluorescence energy donor group and the other oligonucleotide
comprises a fluorescence energy acceptor group, and wherein the
presence or absence of the autoligated oligonucleotide product is
accompanied by a detectable change in fluorescence emission of the
ligated product compared to the fluorescence energy emissions of
the unligated oligonucleotides.
56. A method for detecting a genetic polymorphism in a target RNA
comprising: providing a mutant polymorphism oligonucleotide probe
that is complementary to a region on the target RNA that comprises
the genetic polymorphism; providing a universal oligonucleotide
probe capable of binding to the target RNA at a region that is
conserved in the analogous wild-type RNA; wherein one
oligonucleotide probe constitutes an upstream oligonucleotide
comprising, as its 5' end, a nucleoside comprising a 5' leaving
group and the other oligonucleotide probe constitutes a downstream
oligonucleotide comprising, as its 3' end, a nucleoside comprising
a 3' functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate, such that, when both probes are bound to the
target RNA, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the mutant polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target RNA with the universal oligonucleotide probe
and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and the mutant polymorphism probe; and
detecting the presence of the autoligated oligonucleotide
product.
57. The method of claim 56 wherein at least one of the mutant
polymorphism oligonucleotide probe and the universal
oligonucleotide probe comprises a detectable label.
58. The method of claim 57 wherein the detectable label is a
radiolabel.
59. The method of claim 56 wherein the genetic polymorphism is
selected from the group consisting of a single base mutation, a
plurality of single base mutations, a deletion, an insertion, and a
genetic rearrangement.
60. The method of claim 56 wherein the nucleotide position is not
the nucleotide position corresponding to the ligation junction end
of the mutant polymorphism probe.
61. The method of claim 56 where one oligonucleotide comprises a
fluorescence energy donor group and the other oligonucleotide
comprises a fluorescence energy acceptor group, and wherein the
presence or absence of the autoligated oligonucleotide product is
accompanied by a detectable change in fluorescence emission of the
ligated product compared to the fluorescence energy emissions of
the unligated oligonucleotides.
62. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising, as its 5'
end, a nucleoside comprising a 5' leaving group and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3'
phosphoroselenoate or a 3' phosphorotelluroate, such that, when
both probes are bound to the target polynucleotide, an end of the
universal oligonucleotide probe is substantially adjacent to an end
of the mutant polymorphism oligonucleotide probe so as to position
the 5' leaving group and the 3' phosphoroselenoate or a 3'
phosphorotelluroate in close proximity to one another; contacting
the target polynucleotide with the universal oligonucleotide probe
and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and the mutant polymorphism probe; and
detecting the presence of the autoligated oligonucleotide product;
wherein the autoligation is reversible by contacting the
autoligated oligonucleotide product with silver or mercuric
ions.
63. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising, as its 5'
end, a 5'-iodopyrene and the other oligonucleotide probe
constitutes a downstream oligonucleotide comprising, as its 3' end,
a pyrene nucleoside selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate, such that, when both probes are bound to the
target polynucleotide, an end of the universal oligonucleotide
probe is substantially adjacent to an end of the mutant
polymorphism oligonucleotide probe so as to position the
5'-iodopyrene and the 3' pyrene nucleoside in close proximity to
one another; contacting the target polynucleotide with the
universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe, the mutant
polymorphism probe, and a pyrene excimer; and detecting the
presence of the autoligated oligonucleotide product using excimers
as labels.
64. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising, as its 5'
end, a nucleoside comprising a 5' leaving group and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate, such that,
when both probes are bound to the target polynucleotide, either (a)
there is a gap of 1 or 2 bases between an end of the universal
oligonucleotide probe and an end of the mutant polymorphism
oligonucleotide probe, or (b) there is a 1 or 2 nucleotide overlap
between an end of the universal oligonucleotide probe and an end of
the mutant polymorphism oligonucleotide probe, so as to position
the 5' leaving group and the 3' functional group in close proximity
to one another; contacting the target polynucleotide with the
universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe and the
mutant polymorphism probe; and detecting the presence of the
autoligated oligonucleotide product.
65. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising a sequence
of nucleotides, wherein the nucleotide at its 5' end comprises a
nucleoside comprising a 5' leaving group, and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
3' end comprises a nucleoside comprising a 3' functional group
selected from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when
both probes are bound to the target polynucleotide, an end of the
universal oligonucleotide probe is not directly adjacent to an end
of the mutant polymorphism oligonucleotide probe so as to position
the 5' leaving group and the 3' functional group in close proximity
to one another; contacting the target polynucleotide with the
universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe and the
mutant polymorphism probe; and detecting the presence of the
autoligated oligonucleotide product.
66. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a universal oligonucleotide probe capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide; wherein one oligonucleotide
probe constitutes an upstream oligonucleotide comprising a sequence
of nucleotides, wherein the nucleotide at its 5' end comprises a
nucleoside comprising a 5' leaving group, and the other
oligonucleotide probe constitutes a downstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
3' end comprises a nucleoside comprising a 3' functional group
selected from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when
both probes are bound to the target polynucleotide, either (a)
there is a gap of 1 or 2 bases between an end of the universal
oligonucleotide probe and an end of the mutant polymorphism
oligonucleotide probe, or (b) there is a 1 or 2 nucleotide overlap
between an end of the universal oligonucleotide probe and an end of
the mutant polymorphism oligonucleotide probe, so as to position
the 5' leaving group and the 3' functional group in close proximity
to one another; contacting the target polynucleotide with the
universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe and the
mutant polymorphism probe; and detecting the presence of the
autoligated oligonucleotide product.
67. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe of less than 7 nucleotides in length that is
complementary to a region on the target polynucleotide that
comprises the genetic polymorphism; providing a wild-type
polymorphism oligonucleotide probe that is complementary to a
region on an analogous wild-type polynucleotide that is analogous
to the region comprising the genetic polymorphism; providing a
universal oligonucleotide probe capable of binding to the target
polynucleotide at a region that is conserved in the analogous
wild-type polynucleotide; wherein either (i) the universal
oligonucleotide probe constitutes an upstream oligonucleotide
comprising, as its 5' end, a nucleoside comprising a 5' leaving
group, and both polymorphism oligonucleotide probes constitute
downstream oligonucleotides comprising, as their 3' ends, a
nucleoside comprising a 3' functional group selected from the group
consisting of a 3' phosphorothioate, a 3' phosphoroselenoate and a
3' phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides comprising, as their 5'
ends, a nucleoside comprising a 5' leaving group, and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside comprising a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate, such that,
when a universal probe and a polymorphism probe are bound to the
target polynucleotide, either (a) an end of the universal
oligonucleotide probe is directly adjacent to an end of the
polymorphism oligonucleotide probe, (b) there is a gap of 1 or 2
bases between an end of the universal oligonucleotide probe and an
end of the polymorphism oligonucleotide probe, or (c) there is a 1
or 2 nucleotide overlap between an end of the universal
oligonucleotide probe and an end of the polymorphism
oligonucleotide probe, so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target polynucleotide with the universal
oligonucleotide probe, the wild-type polymorphism oligonucleotide
probe and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and either the mutant polymorphism
oligonucleotide probe or the wild-type polymorphism oligonucleotide
probe; and detecting the presence of the autoligated
oligonucleotide product.
68. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe of less than 7 nucleotides in length that is
complementary to a region on the target polynucleotide that
comprises the genetic polymorphism; providing a wild-type
polymorphism oligonucleotide probe that is complementary to a
region on an analogous wild-type polynucleotide that is analogous
to the region comprising the genetic polymorphism; providing a
universal oligonucleotide probe capable of binding to the target
polynucleotide at a region that is conserved in the analogous
wild-type polynucleotide; wherein either (i) the universal
oligonucleotide probe constitutes an upstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
5' end comprises a nucleoside comprising a 5' leaving group, and
both polymorphism oligonucleotide probes constitute downstream
oligonucleotides comprising sequences of nucleotides, wherein the
nucleotide at their 3' ends comprises a nucleoside comprising a 3'
functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides comprising sequences of
nucleotides, wherein the nucleotide at their 5' ends comprises a
nucleoside comprising a 5' leaving group, and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
3' end comprises a nucleoside comprising a 3' functional group
selected from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when a
universal probe and a polymorphism probe are bound to the target
polynucleotide, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target polynucleotide with the universal
oligonucleotide probe, the wild-type polymorphism oligonucleotide
probe and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and either the mutant polymorphism
oligonucleotide probe or the wild-type polymorphism oligonucleotide
probe; and detecting the presence of the autoligated
oligonucleotide product.
69. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe of less than 7 nucleotides in length that is
complementary to a region on the target polynucleotide that
comprises the genetic polymorphism; providing a wild-type
polymorphism oligonucleotide probe that is complementary to a
region on an analogous wild-type polynucleotide that is analogous
to the region comprising the genetic polymorphism; providing a
universal oligonucleotide probe capable of binding to the target
polynucleotide at a region that is conserved in the analogous
wild-type polynucleotide; wherein either (i) the universal
oligonucleotide probe constitutes an upstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
5' end comprises a nucleoside comprising a 5' leaving group, and
both polymorphism oligonucleotide probes constitute downstream
oligonucleotides comprising sequences of nucleotides, wherein the
nucleotide at their 3' ends comprises a nucleoside comprising a 3'
functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides comprising sequences of
nucleotides, wherein the nucleotide at their 5' ends comprises a
nucleoside comprising a 5' leaving group, and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
3' end comprises a nucleoside comprising a 3' functional group
selected from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when a
universal probe and a polymorphism probe are bound to the target
polynucleotide, either (a) an end of the universal oligonucleotide
probe is directly adjacent to an end of the polymorphism
oligonucleotide probe, (b) there is a gap of 1 or 2 bases between
an end of the universal oligonucleotide probe and an end of the
polymorphism oligonucleotide probe, or (c) there is a 1 or 2
nucleotide overlap between an end of the universal oligonucleotide
probe and an end of the polymorphism oligonucleotide probe, so as
to position the 5' leaving group and the 3' functional group in
close proximity to one another; contacting the target
polynucleotide with the universal oligonucleotide probe, the
wild-type polymorphism oligonucleotide probe and the mutant
polymorphism oligonucleotide probe to yield an autoligated
oligonucleotide product comprising the universal oligonucleotide
probe and either the mutant polymorphism oligonucleotide probe or
the wild-type polymorphism oligonucleotide probe; and detecting the
presence of the autoligated oligonucleotide product.
70. A method for detecting a genetic polymorphism in a target RNA
comprising: providing a mutant polymorphism oligonucleotide probe
that is complementary to a region on the target RNA that comprises
the genetic polymorphism; providing a universal oligonucleotide
probe capable of binding to the target RNA at a region that is
conserved in the analogous wild-type RNA; wherein one
oligonucleotide probe constitutes an upstream oligonucleotide
comprising, as its 5' end, a nucleoside comprising a 5' leaving
group and the other oligonucleotide probe constitutes a downstream
oligonucleotide comprising, as its 3' end, a nucleoside comprising
a 3' functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate, such that, when both probes are bound to the
target RNA, either (a) an end of the universal oligonucleotide
probe is adjacent to an end of the mutant polymorphism
oligonucleotide probe, (b) there is a gap of 1 or 2 bases between
an end of the universal oligonucleotide probe and an end of the
mutant polymorphism oligonucleotide probe, or (c) there is a 1 or 2
nucleotide overlap between an end of the universal oligonucleotide
probe and an end of the mutant polymorphism oligonucleotide probe,
so as to position the 5' leaving group and the 3' functional group
in close proximity to one another; contacting the target RNA with
the universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe and the
mutant polymorphism probe; and detecting the presence of the
autoligated oligonucleotide product.
71. A method for detecting a genetic polymorphism in a target RNA
comprising: providing a mutant polymorphism oligonucleotide probe
that is complementary to a region on the target RNA that comprises
the genetic polymorphism; providing a universal oligonucleotide
probe capable of binding to the target RNA at a region that is
conserved in the analogous wild-type RNA; wherein one
oligonucleotide probe constitutes an upstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
5' end comprises a nucleoside comprising a 5' leaving group, and
the other oligonucleotide probe constitutes a downstream
oligonucleotide comprising a sequence of nucleotides, wherein the
nucleotide as its 3' end comprises a nucleoside comprising a 3'
functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate, such that, when both probes are bound to the
target RNA, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the mutant polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target RNA with the universal oligonucleotide probe
and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and the mutant polymorphism probe; and
detecting the presence of the autoligated oligonucleotide
product.
72. A method for detecting a genetic polymorphism in a target RNA
comprising: providing a mutant polymorphism oligonucleotide probe
that is complementary to a region on the target RNA that comprises
the genetic polymorphism; providing a universal oligonucleotide
probe capable of binding to the target RNA at a region that is
conserved in the analogous wild-type RNA; wherein one
oligonucleotide probe constitutes an upstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
5' end comprises a nucleoside comprising a 5' leaving group, and
the other oligonucleotide probe constitutes a downstream
oligonucleotide comprising a sequence of nucleotides, wherein the
nucleotide at its 3' end comprises a nucleoside comprising a 3'
functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate, such that, when both probes are bound to the
target RNA, either (a) an end of the universal oligonucleotide
probe is adjacent to an end of the mutant polymorphism
oligonucleotide probe, (b) there is a gap of 1 or 2 bases between
an end of the universal oligonucleotide probe and an end of the
mutant polymorphism oligonucleotide probe, or (c) there is a 1 or 2
nucleotide overlap between an end of the universal oligonucleotide
probe and an end of the mutant polymorphism oligonucleotide probe,
so as to position the 5' leaving group and the 3' functional group
in close proximity to one another; contacting the target RNA with
the universal oligonucleotide probe and the mutant polymorphism
oligonucleotide probe to yield an autoligated oligonucleotide
product comprising the universal oligonucleotide probe and the
mutant polymorphism probe; and detecting the presence of the
autoligated oligonucleotide product.
73. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a wild-type polymorphism oligonucleotide probe that is
complementary to a region on an analogous wild-type polynucleotide
that is analogous to the region comprising the genetic
polymorphism; providing a universal oligonucleotide probe capable
of binding to the target polynucleotide at a region that is
conserved in the analogous wild-type polynucleotide; wherein either
(i) the universal oligonucleotide probe constitutes an upstream
oligonucleotide comprising, as its 5' end, a nucleoside comprising
a 5' leaving group and both polymorphism oligonucleotide probes
constitute downstream oligonucleotides comprising, as their 3'
ends, a nucleoside comprising a 3' functional group selected from
the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate; or (ii) both
polymorphism oligonucleotide probes constitute upstream
oligonucleotides comprising, as their 5' ends, a nucleoside
comprising a 5' leaving group and the universal oligonucleotide
probe constitutes a downstream oligonucleotide comprising, as its
3' end, a nucleoside comprising a 3' functional group selected from
the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when a
universal probe and a polymorphism probe are bound to the target
polynucleotide, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target polynucleotide with the universal
oligonucleotide probe, the wild-type polymorphism oligonucleotide
probe and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and either the mutant polymorphism
oligonucleotide probe or the wild-type polymorphism oligonucleotide
probe; and detecting the presence of the autoligated
oligonucleotide product.
74. The method of claim 73 wherein at least one of the mutant
polymorphism oligonucleotide probe and the universal
oligonucleotide probe further comprises a detectable label.
75. The method of claim 74 wherein the detectable label is a
radiolabel.
76. The method of claim 73 wherein the genetic polymorphism is
selected from the group consisting of a single base mutation, a
plurality of single base mutations, a deletion, an insertion, and a
genetic rearrangement.
77. The method of claim 73 wherein the nucleotide position of the
genetic polymorphism is not the nucleotide position corresponding
to the ligation junction end of the mutant polymorphism probe.
78. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a wild-type polymorphism oligonucleotide probe that is
complementary to a region on an analogous wild-type polynucleotide
that is analogous to the region comprising the genetic
polymorphism; providing a universal oligonucleotide probe capable
of binding to the target polynucleotide at a region that is
conserved in the analogous wild-type polynucleotide; wherein either
(i) the universal oligonucleotide probe constitutes an upstream
oligonucleotide comprising, as its 5' end, a nucleoside comprising
a 5' leaving group, and both polymorphism oligonucleotide probes
constitute downstream oligonucleotides comprising, as their 3'
ends, a nucleoside comprising a 3' functional group selected from
the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate; or (ii) both
polymorphism oligonucleotide probes constitute upstream
oligonucleotides comprising, as their 5' ends, a nucleoside
comprising a 5' leaving group, and the universal oligonucleotide
probe constitutes a downstream oligonucleotide comprising, as its
3' end, a nucleoside comprising a 3' functional group selected from
the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when a
universal probe and a polymorphism probe are bound to the target
polynucleotide, either (a) an end of the universal oligonucleotide
probe is directly adjacent to an end of the polymorphism
oligonucleotide probe, (b) there is a gap of 1 or 2 bases between
an end of the universal oligonucleotide probe and an end of the
polymorphism oligonucleotide probe, or (c) there is a 1 or 2
nucleotide overlap between an end of the universal oligonucleotide
probe and an end of the polymorphism oligonucleotide probe, so as
to position the 5' leaving group and the 3' functional group in
close proximity to one another; contacting the target
polynucleotide with the universal oligonucleotide probe, the
wild-type polymorphism oligonucleotide probe and the mutant
polymorphism oligonucleotide probe to yield an autoligated
oligonucleotide product comprising the universal oligonucleotide
probe and either the mutant polymorphism oligonucleotide probe or
the wild-type polymorphism oligonucleotide probe; and detecting the
presence of the autoligated oligonucleotide product.
79. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a wild-type polymorphism oligonucleotide probe that is
complementary to a region on an analogous wild-type polynucleotide
that is analogous to the region comprising the genetic
polymorphism; providing a universal oligonucleotide probe capable
of binding to the target polynucleotide at a region that is
conserved in the analogous wild-type polynucleotide; wherein either
(i) the universal oligonucleotide probe constitutes an upstream
oligonucleotide comprising a sequence of nucleotides, wherein the
nucleotide at its 5' end comprises a nucleoside comprising a 5'
leaving group, and both polymorphism oligonucleotide probes
constitute downstream oligonucleotides comprising sequences of
nucleotides, wherein the nucleotide at their 3' ends comprises a
nucleoside comprising a 3' functional group selected from the group
consisting of a 3' phosphorothioate, a 3' phosphoroselenoate and a
3' phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides comprising sequences of
nucleotides, wherein the nucleotide at their 5' ends comprises a
nucleoside comprising a 5' leaving group, and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
3' end comprises a nucleoside comprising a 3' functional group
selected from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when a
universal probe and a polymorphism probe are bound to the target
polynucleotide, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another;
contacting the target polynucleotide with the universal
oligonucleotide probe, the wild-type polymorphism oligonucleotide
probe and the mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and either the mutant polymorphism
oligonucleotide probe or the wild-type polymorphism oligonucleotide
probe; and detecting the presence of the autoligated
oligonucleotide product.
80. A method for detecting a genetic polymorphism in a target
polynucleotide comprising: providing a mutant polymorphism
oligonucleotide probe that is complementary to a region on the
target polynucleotide that comprises the genetic polymorphism;
providing a wild-type polymorphism oligonucleotide probe that is
complementary to a region on an analogous wild-type polynucleotide
that is analogous to the region comprising the genetic
polymorphism; providing a universal oligonucleotide probe capable
of binding to the target polynucleotide at a region that is
conserved in the analogous wild-type polynucleotide; wherein either
(i) the universal oligonucleotide probe constitutes an upstream
oligonucleotide comprising a sequence of nucleotides, wherein the
nucleotide at its 5' end comprises a nucleoside comprising a 5'
leaving group, and both polymorphism oligonucleotide probes
constitute downstream oligonucleotides comprising sequences of
nucleotides, wherein the nucleotide at their 3' ends comprises a
nucleoside comprising a 3' functional group selected from the group
consisting of a 3' phosphorothioate, a 3' phosphoroselenoate and a
3' phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides comprising sequences of
nucleotides, wherein the nucleotide at their 5' ends comprises a
nucleoside comprising a 5' leaving group, and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising a sequence of nucleotides, wherein the nucleotide at its
3' end comprises a nucleoside comprising a 3' functional group
selected from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate, such that, when a
universal probe and a polymorphism probe are bound to the target
polynucleotide, either (a) an end of the universal oligonucleotide
probe is directly adjacent to an end of the polymorphism
oligonucleotide probe, (b) there is a gap of 1 or 2 bases between
an end of the universal oligonucleotide probe and an end of the
polymorphism oligonucleotide probe, or (c) there is a 1 or 2
nucleotide overlap between an end of the universal oligonucleotide
probe and an end of the polymorphism oligonucleotide probe, so as
to position the 5' leaving group and the 3' functional group in
close proximity to one another; contacting the target
polynucleotide with the universal oligonucleotide probe, the
wild-type polymorphism oligonucleotide probe and the mutant
polymorphism oligonucleotide probe to yield an autoligated
oligonucleotide product comprising the universal oligonucleotide
probe and either the mutant polymorphism oligonucleotide probe or
the wild-type polymorphism oligonucleotide probe; and detecting the
presence of the autoligated oligonucleotide product.
Description
[0001] This application is a continuation of application Ser. No.
09/483,337, filed Jan. 14, 2000, (pending) which claims the benefit
of U.S. Provisional Application Ser. No. 60/116,059, filed 15 Jan.
1999.
BACKGROUND OF THE INVENTION
[0003] Once the genome is sequenced, the second phase of the Humane
Genome Project is aimed at surveying single nucleotide
polymorphisms (SNPs) that exist in different human DNAs. It is now
clear that changes in sequence as small as a single base in a gene
can be diagnostic for many disease states and susceptibilities. As
a result, in the future the medical community will commonly make
use of genetic screens of individual patients as a routine part of
diagnosis. This means that the development of rapid, sensitive, and
accurate methods for detecting and identifying SNPs is very
important to the future of medicine.
[0004] One type of SNP that has been recognized as very important
to diagnosis of cancer is the set of single-base mutations that
have been associated with the development of cancer. An increasing
number of point mutations in oncogenes and tumor suppressor genes
have been linked to cancer, and some of these are not merely
diagnostic (i.e., associated with cancer) but also causative
(responsible for the cancerous phenotype). Among the most important
examples already starting to be screened in medical laboratories
today are point mutations in the H-ras and K-ras oncogene family as
well as in the p53 tumor suppressor gene. In some kinds of cancer,
such point mutations are strongly specific; for example, a single
K-ras codon 12 point mutation is found in .about.90% of all
pancreatic cancers.
[0005] SNPs can be detected using various DNA ligation strategies.
Methods for joining strands of DNA are widely used in chemistry,
molecular biology, and biomedicine. Both enzymatic and chemical
methods for DNA ligation are known. Enzymatic ligation of DNA has
been important for the development of DNA diagnostic methods.
Moreover, current methods for enzymatic DNA ligation cannot be used
for direct detection of RNAs, since these ligases require duplex
DNAs as substrates. In addition, although very short probes exhibit
the highest sequence specificity, ligase enzymes cannot utilize
oligodeoxynucleotides shorter than about 9 nucleotides (C.
Pritchard et al., Nucleic Acids Res. 25: 3403-3407 (1997)). Also,
because of the sensitivity to native DNA structure, ligase-mediated
approaches are unlikely to be useful with modified probes that
contain nonnatural DNA structure such as PNA, phosphoramidate DNA,
or 2'-O-methyl RNA. Even relatively simple modifications such as
conjugation with biotin or fluorescent labels may be expected to
cause difficulties near the ligation junction. Finally, ligase
methods are not likely to be useful in intact cellular or tissue
preparations, since it would be difficult to deliver the ligase
into cells.
[0006] By comparison, nonenzymatic ligation strategies have the
advantage of not requiring natural structure at the ligation site
and, potentially, of proceeding in higher yields at lower cost.
Some nonenzymatic ligation approaches require reducing reagents
such as borohydride, oxidizing reagents such as ferricyanide,
condensing reagents such as carbodiimides or cyanoimidazole, or UV
irradiation to carry out the reaction. Other nonenzymatic
ligations, termed autoligations or self-ligations, proceed in the
absence of additional reagents. While the need for added reagents
is not limiting in many situations, autoligation is simpler, and
might be carried out in media where reagents are inactive or where
they will affect biochemical processes.
[0007] Letsinger et al. (U.S. Pat. No. 5,476,930) have described an
irreversible, nonenzymatic, covalent autoligation of adjacent,
template-bound oligodeoxynucleotides wherein one oligonucleotide
has a 5' or 3' .alpha.-haloacyl reactive group, such as a
3'-bromoacetylamino, and the second oligonucleotide has a 3' or 5'
phosphorothioate group. The resulting linkage takes the form of a
thiophosphorylacetylamino bond.
[0008] Letsinger et al. (U.S. Pat. No. 5,780,613; Herrlein et al.,
J. Am. Chem. Soc., 117, 10151 (1995)) have also described an
approach to the templated ligation of oligodeoxynucleotides that
involves reacting an oligonucleotide having a 3'-phosphorothioate
group with a second oligonucleotide having as 5' tosylate leaving
group giving S.sub.N2 displacement and resulting in more natural
DNA structure, having a sulfur atom replacing one of the bridging
phosphodiester oxygen atoms. This method was used to ligate
self-templated ends to yield dumbbell-type structures in good
yields. However, due to the reactivity of the 5'-tosylate to
ammonia, it was necessary to use labile protecting groups and rapid
deprotection, and significant degradation was still observed for
oligonucleotides carrying the reactive leaving group. Xu et al.
(Tetrahedron Lett., 38, 5595-5598 (1997)) describe an improvement
in this method utilizing, as the leaving group, a 5'-iodide which
is stable to ammonia deprotection.
[0009] There is a clear need for simple, rapid and reliable methods
for detecting SNPs, and there will be many formats in which they
will be applied, such as in sequence detection in PCR-amplified
DNAs, detection in DNAs or in RNAs isolated directly from clinical
samples (blood, tissue, urine, etc), detection in isolated cells
(such as from blood), detection in tissue cross sections (such as
from biopsies), and detection in the living body. Because of the
advantages of nonenzymatic ligation methods in both diagnostic and
preparative nucleic acid technologies, further improvements in the
speed, selectivity and specificity of nonenzymatic ligation of
oligonucleotides are very important. An improved ligation chemistry
(1) would require no added reagents to carry out the reaction, (2)
would require no post-synthesis modification of the DNA prior to
reaction, (3) could be carried out on an RNA template (unlike
enzymatic ligations), and (4) would create a junction that causes
little perturbation to the DNA structure.
SUMMARY OF THE INVENTION
[0010] The invention is directed to novel compositions and methods
for nonenzymatic ligation of oligonucleotides.
[0011] In one aspect, the invention is directed to a nucleotide
containing a phosphoroselenoate group or a phosphorotelluroate
group, as well as an oligonucleotide having such nucleotide at its
3' end. The invention is further directed to a 5' iodonucleoside
including 5'-deoxy-5'-iodothymidine (5'-I-T),
5'-deoxy-5'-iodo-2'-deoxycytidine (5'-I-dC),
5'-deoxy-5'-iodo-2'-deoxyadenosine (5'-I-dA),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyadenosine (5'-I-3-deaza-dA),
5'-deoxy-5'-iodo-2'-deoxyguanosine (5'-I-dG),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyguanosine (5'-I-3-deaza-dG),
5'-deoxy-5'-iodouracil (5'-I-U), 5'-deoxy-5'-iodocytidine (5'-I-C),
5'-deoxy-5'-iodoadenosine (5'-I-A),
5'-deoxy-5'-iodo-3-deazaadenosine (5'-I-3-deaza-A),
5'-deoxy-5'-iodoguanosine (5'-I-G) and
5'-deoxy-5'-iodo-3-deazaguanosine (5'-I-3-deaza-G), and the
phosphoroamidite derivatives thereof, as well as the related
nucleotides and an oligonucleotide having at its 5' end such a
5'-deoxy-5'-iodonucleotide. Methods of making the
5'-deoxy-5'-iodonucleosides of the invention are also included.
[0012] Also included in the invention is an oligonucleotide that
has, at its 3' end, a phosphoroselenoate group or a
phosphorotelluroate group and, at its 5' end, a nucleoside
comprising a 5' leaving group.
[0013] The invention further includes an oligonucleotide formed
from two or more 2'-deoxyribonucleotides and one ribonucleotide. In
one embodiment, the ribonucleotide is positioned at the 3' end of
the oligonucleotide and contains a phosphorothioate group, a
phosphoroselenoate group or a phosphorotelluroate group. In another
embodiment, the ribonucleotide is positioned at the 5' end of the
oligonucleotide and contains a 5' leaving group.
[0014] In another aspect, the invention provides a solid support
having attached to it one or more oligonucleotides as described
herein, including but not limited to an oligonucleotide containing
a phosphorothioate group, a phosphoroselenoate group, or a
phosphorotelluroate group; an oligonucleotide comprising a 5'
leaving group, including an oligonucleotide containing an
.alpha.-haloacyl group; an oligonucleotide containing one or more
deoxyribonucleotides; and an oligonucleotide containing one or more
ribonucleotides.
[0015] In yet another aspect, the invention provides an
oligonucleotide containing at least one 5' bridging
phosphoroselenoester or phosphorotelluroester. The oligonucleotide
can be a DNA or an RNA oligonucleotide, or can contain a
combination of one or more deoxyribonucleotides and one or more
ribonucleotides. It can be circular or linear. In a preferred
embodiment, the bridging phosphoroselenoester or
phosphorotelluroester forms a bridge between a deoxyribonucleotide
and a ribonucleotide. Also included is a nucleic acid duplex formed
from the hybridization of the selenium-containing or
tellurium-containing oligonucleotide hybridized to a complementary
oligonucleotide.
[0016] In another aspect, the invention is directed to a method for
making an oligonucleotide that includes binding at least one
upstream oligonucleotide and at least one downstream
oligonucleotide to a polynucleotide template to yield an
autoligated oligonucleotide product formed from the upstream
oligonucleotide ligated to the downstream oligonucleotide. The
polynucleotide template can be DNA or RNA, and can be
double-stranded or single-stranded. Multiple oligonucleotides can
be used, in which event the middle oligonucleotides serve as both
upstream and downstream oligonucleotides. The upstream
oligonucleotide includes, as its 5' end, a nucleoside having a 5'
leaving group, and the downstream oligonucleotide includes, as its
3' end, a nucleoside containing a 3' phosphoroselenoate or a 3'
phosphorotelluroate. The downstream oligonucleotide binds such that
its 3' end is substantially adjacent to the 5' end of the upstream
oligonucleotide. In embodiments of the method in which the end of
the upstream oligonucleotide is substantially but not directly
adjacent to an end of the downstream oligonucleotide; in which the
polynucleotide template is RNA; or in which one or more
oligonucleotide of less than 7 nucleotides in length are used; the
downstream oligonucleotide can contain, instead of the 3'
phosphoroselenoate and a 3' phosphorotelluroate, a 3'
phosphorothioate group. In a preferred embodiment, one of the
oligonucleotides contains a fluorescence energy donor group and the
other contains a fluorescence energy acceptor group. The presence
or absence of the autoligated oligonucleotide product is
accompanied by a detectable change in fluorescence emission of the
ligated product compared to the fluorescence energy emissions of
the unligated oligonucleotides.
[0017] In yet another aspect, the invention provides a method for
detecting a genetic polymorphism in a target polynucleotide. The
target polynucleotide can be DNA or RNA, and can be double-stranded
or single-stranded. A target polynucleotide containing a genetic
polymorphism is contacted with a universal oligonucleotide probe
and a mutant polymorphism oligonucleotide probe to yield an
autoligated oligonucleotide product comprising the universal
oligonucleotide probe and the mutant polymorphism probe. The mutant
polymorphism oligonucleotide probe is complementary to a region on
the target polynucleotide that comprises the genetic polymorphism,
and the universal oligonucleotide probe is capable of binding to
the target polynucleotide at a region that is conserved in the
analogous wild-type polynucleotide. Preferably, the nucleotide
position of the suspected genetic polymorphism on the
polynucleotide target does not correspond to the nucleotide
position of the ligation junction end of the mutant polymorphism
probe. Rather, it is preferred that the site or sites on the mutant
polymorphism probe that correspond to the genetic polymorphism on
the target polynucleotide be positioned toward the middle of the
probe. The mutant polymorphism probe is preferably about 3 to about
12 nucleotides in length; in some applications, it is preferably
about 3 to about 6 nucleotides in length. One of the
oligonucleotide probes constitutes an upstream oligonucleotide that
contains, as its 5' end, a nucleoside comprising a 5' leaving
group, while the other oligonucleotide probe constitutes a
downstream oligonucleotide that contains, as its 3' end, a
nucleoside containing a 3' phosphoroselenoate or a 3'
phosphorotelluroate. When both probes are bound to the target
polynucleotide, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the mutant polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' phosphoroselenoate or 3' phosphorotelluroate in close
proximity to one another. Detection of an autoligated
oligonucleotide product indicates that the polynucleotide target
contained the genetic polymorphism. To facilitate detection, either
the mutant polymorphism oligonucleotide probe or the universal
oligonucleotide probe, or both, can include a detectable label.
Alternatively or in addition, one oligonucleotide probe can include
a fluorescence energy donor group while the other includes a
fluorescence energy acceptor group. In that event, the presence or
absence of the autoligated oligonucleotide product is accompanied
by a detectable change in fluorescence emission of the ligated
product compared to the fluorescence emissions of the unligated
oligonucleotides. In embodiments of the method in which the end of
the bound universal oligonucleotide probe is substantially but not
directly adjacent to an end of the bound mutant polymorphism
oligonucleotide probe; in which the polynucleotide target is RNA;
or in which mutant probes of less than 7 nucleotides in length are
used; the downstream oligonucleotide can contain, instead of the 3'
phosphoroselenoate and a 3' phosphorotelluroate, a 3'
phosphorothioate group.
[0018] In yet another aspect, the invention is directed to a
general method for detecting a genetic polymorphism in a target
polynucleotide using fluorescence energy resonance transfer (FRET).
A target polynucleotide, as described above, is contacted with a
universal oligonucleotide probe and at least one mutant
polymorphism oligonucleotide probe to yield an autoligated
oligonucleotide product comprising the universal oligonucleotide
probe and a mutant polymorphism probe. When two oligonucleotide
probes are used, one constitutes an upstream oligonucleotide
having, as its 5' end, a nucleoside comprising a 5' leaving group
and the other constitutes a downstream oligonucleotide containing,
as its 3' end, a nucleoside comprising a functional group selected
from the group consisting of a 3' phosphorothioate, a 3'
phosphoroselenoate and a 3' phosphorotelluroate. When both probes
are bound to the target polynucleotide, an end of the universal
oligonucleotide probe is substantially adjacent to an end of the
mutant polymorphism oligonucleotide probe so as to position the 5'
leaving group and the 3' phosphoroselenoate or the 3'
phosphorotelluroate in close proximity to one another.
Additionally, one of the oligonucleotide probes contains a
fluorescence energy donor group and the other oligonucleotide
contains a fluorescence energy acceptor group. The presence or
absence of an autoligated oligonucleotide product is accompanied by
a detectable change in fluorescence emission of the ligated product
compared to the fluorescence emissions of the unligated
oligonucleotides, which is detected using FRET.
[0019] The invention is further directed to a method for using
3-color FRET to determine whether a target polynucleotide contains
a genetic polymorphism. A target polynucleotide, as described
above, is contacted with the universal oligonucleotide probe, a
mutant polymorphism oligonucleotide probe and a wild-type
polymorphism oligonucleotide probe to yield an autoligated
oligonucleotide product that includes the universal oligonucleotide
probe either the mutant polymorphism probe or the wild-type
polymorphism oligonucleotide probe. The wild-type polymorphism
oligonucleotide probe is complementary to a region on the analogous
wild-type polynucleotide that is analogous to the region comprising
the genetic polymorphism. The universal probe contains a
fluorescence energy donor group; the mutant polymorphism probe
contains a first fluorescence energy acceptor group; and wild-type
polymorphism oligonucleotide probe includes a second energy
acceptor group. Either (i) the universal oligonucleotide probe
constitutes an upstream oligonucleotide comprising, as its 5' end,
a nucleoside having a 5' leaving group and both polymorphism
oligonucleotide probes constitute downstream oligonucleotides
comprising, as their 3' ends, a nucleoside containing a 3'
functional group selected from the group consisting of a 3'
phosphorothioate, a 3' phosphoroselenoate and a 3'
phosphorotelluroate; or (ii) both polymorphism oligonucleotide
probes constitute upstream oligonucleotides having, as their 5'
ends, a nucleoside comprising a 5' leaving group and the universal
oligonucleotide probe constitutes a downstream oligonucleotide
comprising, as its 3' end, a nucleoside containing a 3' functional
group selected from the group consisting of a 3' phosphorothioate,
a 3' phosphoroselenoate and a 3' phosphorotelluroate. When a
universal probe and a polymorphism probe are bound to the target
polynucleotide, an end of the universal oligonucleotide probe is
substantially adjacent to an end of the polymorphism
oligonucleotide probe so as to position the 5' leaving group and
the 3' functional group in close proximity to one another. The
autoligated oligonucleotide product is excited so as to cause
fluorescence, and the fluorescence emission is analyzed to
determine whether the autoligated oligonucleotide product comprises
the mutant polymorphism probe or the wild-type polymorphism
oligonucleotide probe. The presence of the mutant polymorphism
probe in the autoligated oligonucleotide product indicates the
presence of a genetic polymorphism in the target
polynucleotide.
[0020] Methods of making oligonucleotides or detecting genetic
polymorphisms that make use of FRET to detect the presence or
absence of an autoligation product can, without limitation, instead
utilize pyrenes at the 5' and 3' reactive ends of the upstream and
downstream oligonucleotides, respectively, such the presence or
absence of the autoligated oligonucleotide product is detectable
using pyrene excimers as labels.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 depicts the chemistry of (a) sulfur-mediated and (b)
selenium-mediated autoligation; in (c), "upstream" and "downstream"
oligonucleotide probes, defined in relation to a polynucleotide
template, are schematized.
[0022] FIG. 2 depicts the structure of 5'-iodo-thymidine (5'-I-T)
and variants.
[0023] FIG. 3 shows the synthesis of the iodophosphoroamidite of
thymidine.
[0024] FIG. 4 shows (a) the starting sequences and product
sequences in the three types of ligations described in Example I
and (b) preparative yields for the three typed of ligations.
[0025] FIG. 5 shows sequences of autoligation precursor DNAs and
products obtained after ligation, where "p.sub.S" denotes
5'-bridging phosphorothioester linkage.
[0026] FIG. 6 shows the time course of autoligation of a hairpin
DNA to closed circular dumbbell form at 25.degree. C. (lanes 5-10),
with comparison to ligation mediated by T4 DNA ligase in the same
sequence (lanes 1-4); complete reaction requires two ligations, the
first of which joins two hairpins (creating a nicked dumbbell), and
then a second, which closes the dumbbell into circular form; the
sequence of the autoligating hairpin is
5'-I-d(TCCAGCGTACTTTTGTACGCTGGATGCA)-p.sub.S-3' (SEQ ID NO:1), and
that of the comparison hairpin is d(pTCCAGCGTACTTTTGTACGCTGGATGCA)
(SEQ ID NO:2).
[0027] FIG. 7 shows attempted cleavage of a short duplex DNA
containing 5' bridging phosphorothioate linkages by the restriction
endonuclease Nsi 1; the sulfur linkage (denoted by "s") occurs in
both strands between the two nucleotides where cleavage is
performed by the enzyme; for comparison the cleavage of the same
duplex lacking the sulfur linkages is shown.
[0028] FIG. 8 shows sequences of autoligation probes and DNA
targets; mismatches between probes and targets are denoted by "x";
target sequences are derived from H-ras; the 3'MM target
corresponds to the protooncogene sequence and MUT, the codon 12
oncogenic mutation; the 3' end phosphorothioate groups are denoted
by "p.sub.S", and iodothymidine by "I-T".
[0029] FIG. 9 shows the effects of varied conditions on
autoligation yields for 7mer+10mer probes; (a) time course of
ligation at 25.degree. C. with 20 mM probe concentration; (b) time
course of ligation at 25.degree. C. with 1.3 mM probe
concentration; (c) time course at 37.degree. C. with 1.3 mM probe
concentration.
[0030] FIG. 10 shows the effects of varied conditions on
autoligation yields for 48mer cyclization probe having 10 nt of
possible complementarity on either side of the junction; (a) time
course of ligation at 25.degree. C. with 1.3 mM probe
concentration; (b) time course at 70.degree. C. with 1.3 mM probe
concentration.
[0031] FIG. 11 shows the effects of ligation junction placement on
autoligation yields for 48mer cyclization probe having 6 and 14 nt
of possible complementarity on the two sides of the junctions; (a)
sequences of probe and target DNAs (b) time course of ligation at
70.degree. C. with 1.3 mM probe concentration.
[0032] FIG. 12 shows optimized ligation of 7 and 13 nt probes on
wild-type and codon 12 mutant H-ras DNA 50mer target strands,
showing selectivity of probes for codon 12 mutant target; ligation
is monitored by use of a radiolabeled 7mer probe; (a) sequences of
H-ras optimized probes; (b) time course of ligation at 37.degree.
C. with 1.3 mM probe concentration; (c) early time course showing
initial-rate linear fits; correlation coefficients are 0.999 or
better.
[0033] FIG. 13 depicts the probe and target sequences utilized in
Example IV; iodine end groups are marked with "5'-I", and 3' end
phosphorothioate groups by "S".
[0034] FIG. 14 depicts time courses of autoligation (a) differing
rates of autoligation on matched and singly-mismatched target DNA
strands; (b) relative autoligation rates on DNA and RNA target
strands of identical sequence.
[0035] FIG. 15 depicts (a) turnover data for autoligation and (b) a
graph showing excess ligated products generated per equivalent of
target DNA.
[0036] FIG. 16 depicts sequence specificity of autoligation on
duplex targets in the slot-blot assay; (a) comparison of
autoligation probe yields on complementary and singly mismatched
targets with a single low stringency wash; (b) effect of successive
SSC washes on increasing specificity of already-ligated probes;
total mismatch specificity is the product of autoligation
specificity and ligated probe (i.e., product) binding
specificity.
[0037] FIG. 17 shows the structures and sequences of
fluorescent-labeled autoligating energy transfer (ALET) probes
targeted to H-ras.
[0038] FIG. 18 depicts solution detection of H-ras sequences by
ALET probes; (a) three-probe reaction with MUT DNA target; (b)
three-probe reaction with WT target; (c) difference spectra (1
hour-18 hours) showing spectral changes characteristic of
fluorescence resonance energy transfer; sequences are given in FIG.
17.
[0039] FIG. 19 depicts nucleotide sequences used for ligation
studies in Example V; the target DNAs correspond to the H-ras gene
sequence including codon 12 (E. Reddy et al., Nature, 300, 149-152
(1982)).
[0040] FIG. 20 depicts the time course of phosphoroselenoate
autoligation on DNA and RNA template strands, with comparison to
sulfur mediated ligations with the same sequences; lines represent
fits to the early data points for initial rates analysis;
conditions: 1.3 mM in each DNA strand, 10 mM MgCl.sub.2, 70 mM
Tris-borate (pH 7.0) at 37.degree. C.; sequences are given in FIG.
19 (MUT targets).
[0041] FIG. 21 depicts the time course of ligation of 7mer and
13mer probes on a DNA template (FIG. 19) using phosphoroselenoate
or phosphorothioate as nucleophile.
DETAILED DESCRIPTION OF THE INVENTION
[0042] Template-directed oligonucleotide ligation is accomplished
using "upstream" and "downstream" autoligating oligonucleotides
that are chemically modified to ligate themselves to one another
without enzymes or added reagents (see FIG. 1). In a preferred
embodiment, the autoligation proceeds between an upstream
oligonucleotide containing a 5' leaving group and a downstream
oligonucleotide containing a phosphorothioate, phosphoroselonate or
a phosphorotelluroate group, to yield a product containing a 5'
bridging phosphorothioester (--O--P(O)(O.sup.-)--S--),
phosphoroselenoester (--O--P(O)(O.sup.-)--Se--) or
phosphorotelluroester (--O--P(O)(O.sup.-)--Te--), as dictated by
the group comprising the 3' end of the downstream oligonucleotide.
The nonenzymatic oligonucleotide ligation method of the invention
is useful, for example, for preparative oligonucleotide production
or to detect genetic polymorphisms in DNA or RNA.
Chemically Modified Autoligating Oligonucleotides
[0043] Chemically modified autoligating oligonucleotides can
contain DNA or RNA, including naturally occurring or non-naturally
occurring nucleotides such as chemically or enzymatically modified
nucleotides, derivatives, or analogs thereof, including peptide
nucleic acid (PNA), phosphorothioate DNA, phosphorodithioate DNA,
phosphoramidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl
RNA, alpha-DNA, methylphosphonate DNA, 2'-O-methyl RNA, 2'-fluoro
RNA, 2'-amino RNA, 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl
DNA, hexose DNA, pyranosyl RNA, anhydrohexitol DNA, or DNA
containing C-5 substituted pyrimidine nucleosides, C-7 substituted
7-deazapurine nucleosides, inosine nucleosides and diaminopurine
nucleosides, and the like. It should be understood that, for
purposes of the present invention and unless otherwise specified,
the term "nucleoside" includes both 2'-deoxynucleosides (building
blocks of DNA) and nucleosides (building blocks of RNA), and their
derivatives and analogs, as described above. Likewise, the term
"nucleotide", unless otherwise specified, includes both
2'-deoxynucleotides (building blocks of DNA) and nucleotides
(building blocks of RNA), and their derivatives and analogs, as
described above. An "oligonucleotide," unless otherwise specified,
can includes either 2'-deoxyribonucleotides or ribonucleotides or a
combination thereof. In some preferred embodiments, an
oligonucleotide is a DNA oligonucleotide containing only
2'-deoxyribonucleotides, including derivatives and analogs as
described above. In other preferred embodiments, an oligonucleotide
is an RNA oligonucleotide containing ribonucleotides, including
derivatives and analogs as described above.
[0044] The "upstream" oligonucleotide, defined in relation to the
5' to 3' direction of the polynucleotide template as the
oligonucleotide that binds on the "upstream" side (i.e., the left,
or 5' side) of the template (FIG. 1(c)), includes, as its 5' end, a
5'-leaving group. Any leaving group capable of participating in an
S.sub.N2 reaction involving sulfur, selenium, or tellurium as the
nucleophile can be utilized. The leaving group is an atom or group
attached to carbon such that on nucleophilic attack of the carbon
atom by the nucleophile (sulfur, selenium or tellurium) of the
modified phosphoryl group, the leaving group leaves as an anion.
Suitable leaving groups include, but are not limited to a halide,
such as iodide, bromide or chloride, a tosylate, benzenesulfonate
or p-nitrophenylester, as well as RSO.sub.3 where R is phenyl or
phenyl substituted with one to five atoms or groups comprising F,
Cl, Br, I, alkyl (C1 to C6), nitro, cyano, sulfonyl and carbonyl,
or R is alkyl with one to six carbons. The leaving group is
preferably an iodide, and the nucleoside at the 5' end of the
upstream oligonucleotide is, in the case of DNA, a
5'-deoxy-5'-iodo-2'-deoxynucleoside. Examples of suitable
5'-deoxy-5'-iodo-2'-deoxynucleosides include, but are not limited
to, 5'-deoxy-5'-iodothymidine (5'-I-T),
5'-deoxy-5'-iodo-2'-deoxycytidine (5'-I-dC),
5'-deoxy-5'-iodo-2'-deoxyadenosine (5'-I-dA),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyadenosine (5'-I-3-deaza-dA),
5'-deoxy-5'-iodo-2'-deoxyguanosine (5'-I-dG) and
5'-deoxy-5'-iodo-3-deaza-2'-deoxyguanosine (5'-I-3-deaza-dG), and
the phosphoroamidite derivatives thereof (see FIG. 2). In the case
of RNA oligonucleotides, analogous examples of suitable
5'-deoxy-5'-iodonucleosides include, but are not limited to,
5'-deoxy-5'-iodouracil (5'-I-U), 5'-deoxy-5'-iodocytidine (5'-I-C),
5'-deoxy-5'-iodoadenosine (5'-I-A),
5'-deoxy-5'-iodo-3-deazaadenosine (5'-I-3-deaza-A),
5'-deoxy-5'-iodoguanosine (5'-I-G) and
5'-deoxy-5'-iodo-3-deazaguanosine (5'-I-3-deaza-G), and the
phosphoroamidite derivatives thereof.
[0045] In a preferred embodiment, an upstream oligonucleotide
contains 2'-deoxyribonucleotides except that the modified
nucleotide on the 5' end, which comprises the 5' leaving group, is
a ribonucleotide. This embodiment of the upstream nucleotide is
advantageous because the bond between the penultimate
2'-deoxyribonucleotide and the terminal 5' ribonucleotide is
susceptible to cleavage using base. This allows for potential reuse
of an oligonucleotide probe that is, for example, bound to a solid
support, as described in more detail below.
[0046] The "downstream" oligonucleotide, which binds to the
polynucleotide template "downstream" of, i.e., 3' to, the upstream
oligonucleotide, includes, as its 3' end, a nucleoside having
linked to its 3' hydroxyl a phosphorothioate group (i.e., a
"3'-phosphorothioate group"), a phosphoroselenoate group (i.e., a
"3'-phosphoroselenoate group"), or a phosphorotelluroate group
(i.e., a "3'-phosphorotelluroate group"). The chemistries used for
autoligation are thus sulfur-mediated, selenium-mediated, or
tellurium mediated. Self-ligation yields a ligation product
containing a 5' bridging phosphorothioester
(--O--P(O)(O.sup.-)--S--), phosphoroselenoester
(--O--P(O)(O.sup.-)--Se--) or phosphorotelluroester
(--O--P(O)(O.sup.-)--Te--), as dictated by the group comprising the
3' end of the downstream oligonucleotide. This non-natural, achiral
bridging diester is positioned between two adjacent nucleotides and
takes the place of a naturally occurring 5' bridging
phosphodiester. Surprisingly, the selenium-mediated ligation is 3-4
times faster than the sulfur-mediated ligation, and the
selenium-containing ligation product was very stable, despite the
lower bond strength of the Se--P bond. Further, the bridging
phosphoroselenoester, as well as the bridging
phosphorotelluroester, are expected to be cleavable selectively by
silver or mercuric ions under very mild conditions (see M. Mag et
al., Nucleic Acids Res., 19, 1437-1441 (1991)).
[0047] In a preferred embodiment, an downstream oligonucleotide
contains 2'-deoxyribonucleotides except that the modified
nucleotide on the 3' end, which comprises the 3' phosphorothioate,
phosphoroselenoate, or phosphorotelluroate, is a ribonucleotide.
This embodiment of the upstream nucleotide is advantageous because
the bond between the penultimate 2'-deoxyribonucleotide and the
terminal ribonucleotide is susceptible to cleavage using base,
allowing for potential reuse of an oligonucleotide probe that is,
for example, bound to a solid support.
[0048] It should be noted that the "upstream" and "downstream"
oligonucleotides can, optionally, constitute the two ends of a
single oligonucleotide, in which event ligation yields a circular
ligation product. The binding regions on the 5' and 3' ends of the
linear precursor oligonucleotide must be linked by a number of
intervening nucleotides that is sufficient to allow binding of the
5' and 3' binding regions to the polynucleotide target.
[0049] Compositions provided by the invention include a
5'-deoxy-5-'iodo-2'-deoxynucleoside, for example a
5'-deoxy-5'-iodothymidine (5'-I-T),
5'-deoxy-5'-iodo-2'-deoxycytidine (5'-I-dC),
5'-deoxy-5'-iodo-2'-deoxyadenosine (5'-I-dA),
5'-deoxy-5'-iodo-3-deaza-2'-deoxyadenosine (5'-I-3-deaza-dA),
5'-deoxy-5'-iodo-2'-deoxyguanosine (5'-I-dG) and
5'-deoxy-5'-iodo-3-deaza-2'-deoxyguanosine (5'-I-3-deaza-dG), and
the phosphoroamidite derivatives thereof, as well as an
oligonucleotide comprising, as its 5' end, a
5'-deoxy-5'-iodo-2'-deoxynucleoside of the invention. Compositions
provided by the invention further include a
5'-deoxy-5'-iodonucleoside such as 5'-deoxy-5'-iodouracil (5'-I-U),
5'-deoxy-5'-iodocytidine (5'-I-C), 5'-deoxy-5'-iodoadenosine
(5'-I-A), 5'-deoxy-5'-iodo-3-deazaadenosine (5'-I-3-deaza-A),
5'-deoxy-5'-iodoguanosine (5'-I-G) and
5'-deoxy-5'-iodo-3-deazaguanosine (5'-I-3-deaza-G), and the
phosphoroamidite derivatives thereof, as well as an oligonucleotide
comprising, as its 5' end, a 5'-deoxy-5'-iodonucleoside of the
invention. Also included in the invention is a nucleoside
comprising a 3'-phosphoroselenoate group or a
3'-phosphorotelluroate group, and an oligonucleotide comprising as
its 3' end a nucleoside comprising a 3'-phosphoroselenoate group or
a 3'-phosphorotelluroate group. Oligonucleotides containing either
or both of these classes of modified nucleosides are also included
in the invention, as are methods of making the various nucleosides
and oligonucleotides. Oligonucleotides that are modified at either
or both of the 5' or 3' ends in accordance with the invention
optionally, but need not, include a detectable label, preferably a
radiolabel, a fluorescence energy donor or acceptor group, an
excimer label, or any combination thereof.
Template or Target Polynucleotide
[0050] In methods directed to oligonucleotide synthesis, the
oligonucleotide or polynucleotide to which the two chemically
modified autoligating oligonucleotides bind is sometimes referred
to herein as the "template" oligonucleotide or polynucleotide. In
methods directed to detection of mutations in a nucleic acid, the
oligonucleotide or polynucleotide to which the two chemically
modified auto-ligating oligonucleotides bind is sometimes referred
to herein as the "target" oligonucleotide or polynucleotide. It
should be understood that the terms "oligonucleotide" and
"polynucleotide," as used herein interchangeably. It should be
further understood that the general term "template-directed"
autoligation is meant to include the self-ligation of two
chemically modified auto-ligating oligonucleotides that are bound
to a third oligonucleotide substantially adjacent to each other,
regardless of whether the third oligonucleotide is referred to as a
"template" oligonucleotide or polynucleotide, a "target"
oligonucleotide or polynucleotide, or by any other descriptive
term.
[0051] The template or target polynucleotide can be single-stranded
or double stranded, and can be RNA or DNA. It can be a synthetic
polynucleotide or a naturally occurring oligonucleotide, without
limitation. If naturally occurring, the target polynucleotide is
typically isolated from a biological sample such as a cell, bodily
fluid or tissue.
Autoligation
[0052] The chemically modified autoligating oligonucleotides bind
to a polynucleotide template or target substantially adjacent to
each other. Oligonucleotides bind to a template or target
polynucleotide "substantially adjacent" to each other when the 5'
end of the "upstream" nucleotide binds to a base on the template or
target polynucleotide that is directly adjacent to (see FIG. 1), or
within 2 bases either side of, preferably within about 1 base
either side of, a base on the template or target polynucleotide
bound by the 3' end of the "downstream" nucleotide. The term
"substantially adjacent" thus includes, for example,
oligonucleotides that are bound to the template or target
polynucleotide directly adjacent to each other; oligonucleotides
bound to the template or target polynucleotide such that there is a
gap of 1 or 2 bases between the "upstream" and "downstream"
oligonucleotide; and oligonucleotides bound to the template or
target polynucleotide such that there is a 1 or 2 nucleotide
overlap between the two oligonucleotides. When bound to a
polynucleotide template or target substantially adjacent to each
other, the upstream and downstream oligonucleotides self-ligate due
to their close proximity and the presence of reactive groups on
their adjacent ends. Chemically modified oligonucleotides that bind
to a template or target polynucleotide directly adjacent to each
other are, of course, preferred, but the method of invention is by
no means limited to directly adjacent binding.
Preparative Oligonucleotide Synthesis
[0053] The method of the invention can be used to construct
oligonucleotides that are too large to be synthesized in a single
chain. To construct a large oligonucleotide, a polynucleotide
template is designed to serve as a "splint" having adjacent regions
that are complementary to the 5' end of one constituent
oligonucleotide and the 3' end of the other constituent nucleotide
so as to bring the 3' and 5' ends of the constituent
oligonucleotides in close proximity to allow auto-ligation
according to the method. Two or more oligonucleotides can be
contacted to the splint simultaneously; in methods where three or
more constituent oligonucleotides are used, oligonucleotides
occupying middle positions will include both a 5' leaving group and
a 3' phosphoroselenoate, phosphorotelluroate, or phosphorothioate
group, depending on the ligation chemistry employed. Using this
method, large DNAs can be generated for use in, for example, in
vitro transcription. Synthetic genes can also be constructed.
Likewise, an polynucleotide "splint" having adjacent regions that
are complementary to the 5' end and the 3' ends of a single linear
oligonucleotide can be used to circularize the linear
oligonucleotide via autoligation of its 5' and 3' ends.
[0054] It should be noted that oligonucleotides containing a 5'
bridging phosphoroselenoester or phosphorotelluroester were unknown
until the present invention and are thus encompassed within the
invention.
Detection of Genetic Polymorphisms
[0055] Genetic polymorphisms include, but are not limited to, one
or more single nucleotide polymorphisms (SNPs, also known as point
mutations), insertions, deletions, translocations, or larger
rearrangements of genetic material, such as DNA or RNA. In one
embodiment of the invention, upstream and downstream
oligonucleotides are designed to bind to a target polynucleotide
suspected of containing the polymorphism, such that they are
substantially adjacent to each other and thereby amenable to
autoligation. As described above, the upstream oligonucleotide
contains, at its 5' end, the 5' leaving group, while the downstream
oligonucleotide contains, at its 3' end, the nucleophile (i.e., the
phosphorothioate, phosphoroselenoate, or phosphorotelluroate);
binding of the oligonucleotides to the target polynucleotide allows
self-ligation to occur between the 5' end of the upstream
oligonucleotide and the 3' end of the downstream oligonucleotide,
producing a single linear ligation product (or, if the upstream and
downstream oligonucleotides are a single oligonucleotide, a
circular ligation product). Typically the method for detecting
genetic polymorphisms utilizes one "universal" oligonucleotide and
two or more "polymorphism" oligonucleotides, one of which is a
wild-type oligonucleotide used as a control. If the universal
oligonucleotide is the upstream oligonucleotide, the polymorphism
oligonucleotides(s) are the downstream oligonucleotides;
alternatively, if the universal oligonucleotide is the downstream
oligonucleotide, the polymorphism oligonucleotide(s) are the
upstream oligonucleotides. It is also within the scope of the
invention that the polymorphism oligonucleotide(s) are flanked by
two universal oligonucleotides on a single polynucleotide target,
or, alternatively, that two polymorphism oligonucleotides
(detecting different mutations) flank a single universal
oligonucleotide. The use of multiple universal oligonucleotides and
polymorphism oligonucleotides in a single detection method, either
simultaneously or serially, is likewise contemplated.
[0056] The "universal oligonucleotide" binds to both the wild-type
and mutant polynucleotide target, either 5' (in the case of an
upstream oligonucleotide) or 3' (in the case of a downstream
oligonucleotide) to the site of the genetic polymorphism. The
universal oligonucleotide is preferably about 6 to about 100
nucleotides in length, more preferably about 10 to about 30
nucleotides in length. It is preferably about 80% to about 100%
complementary to the polynucleotide target; more preferably it is
100% complementary to the target. The "wild-type" polymorphism
oligonucleotide has a nucleotide sequence that is preferably 100%
complementary to a sequence in the wild-type polynucleotide target,
such that it binds to the wild-type target substantially adjacent
to the universal oligonucleotide. A "mutant" polymorphism
oligonucleotide binds the analogous location in the mutated
polynucleotide target, and has a nucleotide sequence that is
preferably 100% complementary to a sequence in the mutant
polynucleotide target, such that it binds to the mutant target
substantially adjacent to the universal oligonucleotide. Where a
single nucleotide polymorphism (SNP) is being detected, the
wild-type and mutant polymorphism oligonucleotides, if they are the
same length, will differ by only a single base, at the site of the
point mutation. An oligonucleotide probe of the invention is
preferably between about 3 and about 12 nucleotides in length, more
preferably between about 4 and about 8 nucleotides in length.
Significantly, this process allows very short SNP oligonucleotide
probes to be used, e.g. those of 3, 4, 5, and 6 nucleotides in
length. The mutant and wild-type polymorphism oligonucleotide
probes may be the same length or they can differ in length. The
site of the genetic polymorphism, in this case the point mutation,
is preferably near the middle of the mutant polymorphism
oligonucleotide, although it may alternatively be at or near the
ligation junction end. Where two closely positioned SNPs are being
detected, mutant oligonucleotide probes can be designed that
contain either one or both of the point mutations, and will differ
from the wild-type polymorphism oligonucleotide probe accordingly.
Where genetic rearrangements are being detected, the wild-type and
mutant polymorphism probes may have no sequence identity at
all.
[0057] The mutant oligonucleotide probe having a nucleotide
sequence complementary to the mutant target will selectively
self-ligate with the universal oligonucleotide probe in a
template-directed, nonenzymatic ligation in the presence of a
mutant polynucleotide target, whereas the wild-type polymorphism
oligonucleotide probe having a nucleotide sequence complementary to
the wild-type target will selectively self-ligate in the presence
of a wild-type polynucleotide target. Preferably, at least one of
the oligonucleotide probes is detectably labeled so that at least
one of the ligation products is thereby labeled, although ligation
events also can be detected using PCR, rolling circle
amplification, gel electrophoresis or the like without detectably
labeling the ligation products.
[0058] The presence or absence of a labeled ligation product can be
used to detect a genetic polymorphism in various ways. For example,
the target polynucleotide can be contacted with the universal
oligonucleotide probe and a mutant polymorphism oligonucleotide
probe, one of which is labeled, to determine whether a ligation
product is produced (indicating the presence of a point mutation)
and/or the target polynucleotide can be contacted with the
universal oligonucleotide probe and the wild-type polymorphism
oligonucleotide probe, at least one of which is labeled, to
determine whether a ligation product is produced (indicating the
absence of a point mutation). Preferably, the target polynucleotide
is contacted with three or more oligonucleotide probes
simultaneously (i.e., the universal probe, the wild-type
polymorphism probe, and at least one mutant polymorphism probe)
such that the mutant and wild-type polymorphism probes compete for
binding to the polynucleotide template. One of the mutant or
wild-type polymorphism probes is preferably radiolabeled, such that
the presence of a ligation product can be associated with either
the wild-type or mutant genotype. Alternatively or in addition, the
oligonucleotide probes are fluorescently labeled such that a
ligation event is accompanied by a change in color upon excitation,
due to a transfer of energy from a fluorescence energy donor on one
probe to a fluorescence energy acceptor on the probe to which it is
ligated. In a particularly preferred embodiment of the invention,
the fluorescent labels are selected such that ligation of the
mutant probe to the universal probe is associated with one color
change, and ligation of the wild-type polymorphism probe to the
universal probe is associated with a color change that is different
from the color change that characterizes the mutant-universal probe
ligation, as discussed in more detail below. It should be
understood that the ligation reactions are conducted under
conditions that allow selective binding of the mutant polymorphism
probe or the wild-type polymorphism probe, which in many cases will
differ by only one nucleotide, to the target polynucleotide.
[0059] The nonenzymatic oligonucleotide ligation method of the
invention is thus very useful for detection and identification of
suspected point mutations (single nucleotide polymorphisms) in a
polynucleotide target, for example in patient samples as a method
of diagnosis or genetic screening. It is also useful in medical
diagnostic methods such as ligation-mediated polymerase chain
reaction (PCR) and padlock probe ligation. With respect to existing
padlock probe technology, the method of the present invention
utilizes chemistry that obviates the need for an enzyme. Reagents
for use in practicing the method of the present invention, for
example to detect known genetic mutations in human genetic material
associated with cancer or other disease, can be conveniently
packaged as a kit for use in medical or laboratory diagnostics or
screening. The non-natural sulfur linkages (and, by extension, the
non-natural selenium or tellurium linkages) introduced in the
ligation does not hinder the activity of polymerases, implying that
technologies such as rolling-circle amplification (U.S. Pat. No.
5,714,320, Kool) can be used for the formation of padlock probes
and other ligase-mediated diagnostic methods. Like ligase-based
methods, the present method is highly selective against point
mutations in the polynucleotide target at or near the ligation
junction.
[0060] In addition to detection of point mutations, the method of
the invention can be used to detect deletions, insertions, and
translocations of genetic material. Detection of specific RNAs and
viruses, including identification of mutants, can also be
accomplished. The method of the invention is also readily adaptable
to use in high-density arrays for genetic screening and
pharmocogenomics. For example, it is useful to detect point
mutations in genes that are associated with, or causative of,
pancreatic and colon cancer. Also, the method can be used to stain
RNAs in tissues and cells.
[0061] As noted above, at least one of the oligonucleotide probes
is, optionally, detectably labeled to facilitate detection of the
ligation product. The detectable label can be a radiolabel, a
fluorescent label, a chemical label, an enzymatic label, an
affinity label, or the like. Additionally, the method of the
invention was found under certain conditions to be capable of
self-amplification of the signal provided by the detectable label;
in some instances, the ligated product may dissociate from the
target polynucleotide template, leaving the target open for more
unligated oligonucleotide probes to bind and be ligated.
[0062] The present method of genetic polymorphism detection has a
number of advantages over enzymatic (ligase-based) detection
methods and over other existing methods based on chemical ligation.
Ligase-based detection methods work only on DNA targets, since
formation of a DNA-DNA duplex is critical to the functioning of the
ligase; however the present method can be used to probe (e.g.,
detect mutations in) RNA sequences as well as DNA sequences.
Moreover, the method of the present invention appears to be more
sequence-specific than all known methods for SNPS detection other
than enzymatic method using Tth ligase. Because it involves
auto-ligation of the oligonucleotides, it requires no enzymes or
reagents, reducing cost and simplifying the process. This feature
also allows use of the method in situ, such as inside intact cells
or tissues. Since it is nonenzymatic, the present method can also
be used in other biological and nonbiological environments, such as
cell extracts or media, denaturing solvents, or the like, in which
ligases can not function effectively. Finally, unlike many other
chemical ligations, the method of the invention produces ligation
junctions which can be replicated by polymerases, allowing
post-ligation amplification of the ligated oligonucleotide using
standard techniques, such as PCR, if desired.
[0063] Ligation of fluorescently labeled oligonucleotides can be
advantageously detected in solution or cell extracts using
fluorescence spectroscopy, or in whole cells using fluorescence
microscopy, or fluorescence-based cell sorting techniques, such as
flow-assisted cell sorting (FACS). Fluorescence can also be
detected in gels and blots under ultraviolet light. In this
embodiment of the invention, one oligonucleotide is modified so as
to contain a fluorescence energy donor group, and a second
oligonucleotide is modified to contain a fluorescence energy
acceptor group. Successful ligation is detectable by a change in
color. Upon ligation of the two oligonucleotides, the donor and
acceptor groups are placed in sufficiently close proximity for
energy transfer to occur.
Enzymatic Ligation on a Solid Support
[0064] The preparative and diagnostic methods of the present
invention can advantageously be adapted for use on a solid support,
such as a column or a chip. One or more oligonucleotide probes is
conjugated to a support, preferably at the end opposite of the end
containing the functional group that participates in the ligation
reaction. In a particularly preferred embodiment, the ligation
product is cleavable such that the conjugated oligonucleotide
probes can be reused. To facilitate this aspect of the invention,
an oligonucleotide probe can contain 2'-deoxyribonucleotides except
that the modified nucleotide on the ligating end, which comprises
the functional group that participates in ligation, is a
ribonucleotide. Either the oligonucleotide comprising the 5'
leaving group or the oligonucleotide comprising the 3' functional
group (i.e., the 3' phosphorothioate, phosphoroselenoate or
phosphorotelluroate), or both, can include the terminal, modified
ribonucleotide. As noted above, the bond between a
2'-deoxyribonucleotide and a ribonucleotide) susceptible to
cleavage using base. This allows for potential reuse of the
conjugated oligonucleotide probe.
Autoligating Energy Transfer (ALET) Oligonucleotides
[0065] In a particularly advantageous embodiment of the
nonenzymatic ligation method of the invention, autoligating
fluorescence resonance energy transfer oligonucleotides can be
employed to detect genetic polymorphisms in a target
polynucleotide. In a preferred embodiment of this aspect of the
invention, the universal oligonucleotide probe contains a
fluorescence energy donor group, such as fluorescein, and one or
more of the polymorphism oligonucleotide probes contain a
fluorescence energy acceptor group, such as tetramethylrhodamine
(ROX) or hexachlorofluorescein (HCF); alternatively, the universal
oligonucleotide probe can contain a fluorescence energy acceptor
group while at least of the polymorphism oligonucleotide probes
contains a fluorescence energy donor group. For example, an
universal oligonucleotide probe can contain fluorescein, a
wild-type polymorphism oligonucleotide probe can contain ROX, and a
mutant polymorphism oligonucleotide probe can contain HCF. An
unligated mixture of all three probes yields green fluorescence
when subjected to short wavelengths (about 400 nm to about 500 nm)
chosen to selectively excite fluorescein. Ligation of the mutant
oligonucleotide to the universal oligonucleotide is accompanied by
a color change from green to red (energy transfer from fluorescein
to ROX) indicating the presence of the point mutation in the
polynucleotide template. Ligation of the wild-type oligonucleotide
to the universal oligonucleotide, on the other hand, is accompanied
by a color change from green to yellow (energy transfer from
fluorescein to HCF), indicating the absence of the point mutation
in the polynucleotide template.
[0066] Alternatively, genetic polymorphisms in a polynucleotide
template can be detected using fluorescently labeled universal and
mutant polymorphism oligonucleotide probes without labeling the
wild-type polymorphism oligonucleotide probe. Also, it should be
noted that multiple mutant polymorphism probes can be used to
detect multiple mutations in a polynucleotide template, each probe
containing a different fluorescence energy transfer group such that
each possible ligation event is individually detectable using the
appropriate excitation wavelengths coupled with monitoring of the
fluorescence emission spectrum. It should further be noted that
changes in fluorescence emission can be detected while the
autoligated oligonucleotide product is still hybridized to the
polynucleotide template or target; it is not necessary that it
dissociate therefrom.
[0067] The autoligating energy transfer (ALET) ligation method of
the invention has an advantage over other energy transfer
strategies of "locking in" the result by covalent joining of the
oligonucleotides harboring the two dyes. This means that the signal
will remain under any conditions, even denaturing conditions. It
should, of course, be understood that the ALET method of the
invention is not intended to be limited to the use of any
particular dye color combination or fluorophore.
[0068] The ligation method of the invention can also be used to
ligate pyrene-containing upstream and downstream oligonucleotides
as described herein, wherein the upstream oligonucleotide contains,
as its 5' end, a pyrene nucleoside such as a 5'-iodopyrene (Paris
et al., Nucleic Acids Research 26:3789-3793 (1998)), and the
downstream oligonucleotide contains, as its 3' end, a pyrene
nucleoside having a 3'-phosphorothioate, a 3'-phosphoroselenoate,
or a 3' phosphorotelluroate. Joining of the pyrene moieties yields
efficient excimer which is not eliminated by denaturation.
Moreover, pyrene excimers are expected to serve as good donors for
energy transfer. Therefore, as an alternative to fluorescence
resonance energy transfer (FRET) to effect the color changes,
excimer resonance energy transfer (ERET) can be used in combination
with the fluorescence energy transfer in accordance with the
autoligation method of the invention by using oligonucleotide
probes comprising pyrene excimers.
Ligation Products Containing Phosphorylacetylamino Bonds
[0069] The invention is not intended to be limited to ligation
products containing achiral phosphoroester linkages. For example,
in an alternative embodiment of the invention, the autoligation
proceeds between an upstream oligonucleotide containing an
.alpha.-haloacyl group, such as an .alpha.-haloacetylamino group,
and a downstream oligonucleotide containing a phosphoroselenoate or
a phosphorotelluroate group product to yield a product containing a
5' bridging selenophosphorylacetylamino or
tellurophosphorylacetylamino group. See U.S. Pat. No. 5,476,930
(Letsinger et al.) for a list of suitable .alpha.-haloacyl groups.
In another embodiment, autoligation of an upstream oligonucleotide
containing an .alpha.-haloacyl group, such as an
.alpha.-haloacetylamino group, and a downstream oligonucleotide
containing a phosphorothioate, phosphoroselenoate or a
phosphorotelluroate group proceeds on an RNA template to yield a
product containing a 5' bridging selenophosphorylacetylamino,
selenophosphorylacetylamino or tellurophosphorylacetylamino
group.
[0070] The present invention is illustrated by the following
examples. It is to be understood that the particular examples,
materials, amounts, and procedures are to be interpreted broadly in
accordance with the scope and spirit of the invention as set forth
herein.
EXAMPLES
Example I
Novel 5'-Iodonucleoside Allows Efficient Nonenzymatic Ligation of
Single-Stranded and Duplex DNAs
Synthesis and Stability of 5'-iodo-thymidine
[0071] The iodophosphoramidite of thymidine (1) was synthesized in
only two steps and in straightforward fashion (FIG. 3). Iodination
of thymidine was performed according to the method of Verheyden et
al. (J. Org. Chem., 35, 2319 (1970)) and subsequent phosphitylation
proceeded normally to yield the iodide (1), suitable for automated
DNA synthesis. Incorporation into oligonucleotides was carried out
using the standard coupling cycle. Intact incorporation into DNA
proceeded in .about.85-95% yield, and was confirmed by HPLC
analysis of oligonucleotide products, which have slower mobility on
a reverse-phase column when iodinated. Analysis showed one major
product (monitoring at 260 nm) and only minor amounts of
non-coupled (n-1)mer product, as confirmed by coinjection with
authentic samples.
[0072] The stability of the 5'-iodothymidine in comparison to the
5'-tosylthymidine was analyzed by thin layer chromatography under
varied conditions. Results showed that the tosylnucleoside in
concentrated ammonia (55.degree. C.) has a half-life of less than 1
hour, whereas the iodonucleoside has a half-life of about 7 hours.
When treated at room temperature for 24 hours (conc. NH.sub.3) the
tosylnucleoside is >90% degraded, while the iodonucleoside is
<2% degraded. The stability of the iodide in oligonucleotides
was also analyzed by reverse-phase HPLC. Chromatograms revealed
that the iodide (in the sequence 5'-I-TTCACGAGCCTG) (SEQ ID NO:3)
has a half-life of >4 days in conc. NH.sub.3 at 23.degree. C.,
similar to that of the nucleoside alone. Based on the HPLC analysis
we chose the following conditions for deprotection: concentrated
ammonia, 55.degree. C. for 1 hour, followed by incubation at room
temperature for 23 hours, or treatment at room temperature alone
for 24 hours. It is anticipated that the iodide would also be
stable to rapid deprotection conditions, although this was not
explicitly tested.
Template-Directed Oligonucleotide Ligation
[0073] The ability of 5'-iodo-oligonucleotides to undergo
template-directed ligations (as in FIG. 1(a)) was also examined.
Previous studies used the tosylnucleoside strategy to close
self-templated dumbbell structures and to ligate a synthetic "cap"
to close a hairpin structure. Our own goals involved the ligation
of single-stranded oligonucleotides (using a complementary
"splint") to yield longer sequences, ligation of duplexes, and
cyclization of oligonucleotides, also using a short splint
sequence. We therefore examined three different ligation reactions
on preparative scales: ligation of two short (8mer+12mer)
oligonucleotides using an 18mer splint, one-pot ligation of
30+33mers (20mer splint) followed by cyclization to yield a 63mer
circular DNA, and dimerization-ligation of self-complementary 28mer
hairpin duplexes having 4-base overhanging "sticky" ends. The
sequences tested, expected products are shown in FIG. 4 (a).
[0074] Also required for ligations are 3'-phosphorothioate groups,
which were incorporated as described in Herrlein et al. (J. Am.
Chem. Soc., 117, 10151 (1995)). The standard conditions used for
ligations were: 10 mM MgCl.sub.2, 10 mM Tris.cndot.acetate (pH
7.0), 23.degree. C., and a DNA concentration of 50 mM for
intermolecular reactions or 1.3 mM for intramolecular reactions.
Splint concentrations were 1.1 times that of the DNAs being
ligated. The results were analyzed by denaturing gel
electrophoresis. A time course of the simple ligation showed that
it proceeds over a period of 12-18 hours and reaches a plateau of
about 90% ligation after about 18 hours. The preparative reactions
were carried out on 20-50 nmole scales over 18 hours using crude,
unpurified starting materials and the products were isolated by
preparative electrophoresis. Reaction conversions and isolated
yields are shown in FIG. 4(b). In general, the ligation is found to
proceed quite well, with apparent conversions (as judged by UV
shadowing of the preparative gels) of ca. 45-95%, and isolated
yields ranging from 20% for the combined two-step ligation and
cyclization to 44% for the simple ligation. The one-pot two-step
reaction was carried out using only the top splint in the first
step; after 18 hour (room temperature) the reaction was diluted
with buffer to lower the strand concentration to 1.3 mM, and the
second splint was added. After another 18 hours the reaction was
worked up and the products isolated. The cyclic product was
distinguished from undesired dimer by treatment with S1 nuclease
(S. Wang et al., Nucleic Acids Res., 23, 1157 (1995)). Although the
same reactions were not compared, it appears that ligation rates
may be somewhat slower for the less reactive iodide than for a
tosylate; however, both methods appear to give quite high ligation
yields.
[0075] The results thus showed that a 5'-iodide can be conveniently
incorporated into DNA oligonucleotides in a thymidine derivative,
and that the reactive group undergoes little or no degradation
under standard conditions of synthesis and deprotection. Reacting
an oligonucleotide having as a leaving group a 5'-iodo group with
an oligonucleotide having a 3' phosphorothioate group gave good
ligation yields and, because of the stability of the iodide,
allowed the use of standard deprotection methods. This makes
possible several practically useful template-directed ligations,
including the ligation of ssDNAs, cyclization of ssDNAs, and
ligation of sticky-ended duplexes. These reactions proceed in good
yield and without specialized protecting groups or deprotection
conditions. The method further obviates the need for ligase enzyme,
which is costly on a preparative scale.
Example II
Chemical and Enzymatic Properties of Bridging
5'-S-Phosphorothioester Linkages in DNA
Introduction
[0076] Strategically placed sulfur atoms have found widespread
utility in the probing of specific interactions of proteins,
enzymes, and metals with nucleic acids. Replacements of sulfur for
oxygen in the sugar-phosphate backbone of DNA and RNA have been
central to many mechanistic studies of bond cleavage reactions. For
example, much work has been carried out with sulfur replacing
specific non-bridging phosphate oxygens in DNA and RNA, which has
led to important insights into enzymatic and RNA-catalyzed cleavage
of phosphodiesters in several classes of molecules. Sulfur
replacements for oxygen have also been carried out at the 2'
position of RNA and in the 3' and 5' positions of RNA and of DNA.
These last two positions are termed "bridging" positions in the
phosphate linkage, and these positions are important because they
can make specific interactions with proteins or metals and because
they act as leaving groups in various catalyzed RNA or DNA cleavage
reactions.
[0077] Recent work has focused on the properties of the 5' bridging
sulfur in the context of RNA, in part because of its relevance to
enzymatic and RNA-catalyzed cleavage reactions. This sulfur
replacement is useful as a mechanistic probe, and it is especially
labile to hydrolysis because it presents the already-labile RNA
linkage with a better leaving group. This property results in about
a 10.sup.6-fold increase in its ease of hydrolysis at neutral
pH.
[0078] The analogous 5' bridging sulfur in DNA is considerably less
well studied as a mechanistic probe. While a number of synthetic
methods have been investigated for creating such a linkage, very
few studies of chemoenzymatic properties of this structure exist.
Although it has been shown that silver nitrate and other chemical
reagents can cleave this linkage specifically (M. Mag et al.,
Nucleic Acids Res. 19, 1437-1441 (1991)), we are aware of only two
studies which investigate enzyme-DNA interactions. One report
studied a dinucleotide containing a 5'-bridging sulfur, and it was
reported that phosphodiesterases from calf spleen and snake venom
were able to cleave this linkage, but without reference to rate or
comparison with the natural DNA linkage (A. Cook, J. Am. Chem. Soc.
92, 190-195 (1970)). A second study investigated dT oligomers
completely substituted with 5' bridging sulfur (V. Rybakov et al.,
Nucleic Acids Res. 9, 189-201 (1981)), and it was found that the
exonuclease of T4 DNA polymerase and Snake Venom Phosphodiesterase
(SVPDE) showed significantly reduced ability to cleave such
oligomers. Thus, little detailed work has been focused on this
linkage and importantly, no studies have examined the hydrolytic
stability of this linkage, the effect of isolated 5'-S linkages on
duplex stability, or whether this linkage can act as a substrate
for either restriction endonucleases or polymerase enzymes.
[0079] In this Example, the 5'-S linkages were found to be stable
for extended periods in aqueous buffers and to be resistant to
some, but not all, exonuclease enzymes. A restriction endonuclease
was strongly inhibited in cleaving bonds adjacent to the P--S
bonds, although singly-placed 5' bridging sulfurs are found to
cause only small thermal destabilization of duplexes. Surprisingly,
DNAs with 5'-S linkages were found to act as normal templates for
DNA and RNA polymerases. The chemical stability and surprisingly
small perturbation by the 5'-bridging sulfur suggest that an
oligonucleotide containing a phosphorothioester linkage will be
very useful as a physical and mechanistic probe for specific
protein or metal interactions involving this position in DNA.
Preparation of 5'-Iodinated Oligodeoxyribonucleotides and
3'-Phosphorothioate Oligodeoxyribonucleotides
[0080] Phosphorylation at the 3' end of DNA strands was carried out
with a phosphoramidite reagent (T. Horn et al., Tetrahedron Lett.
27, 4705-4708 (1986)) purchased from Glen Research.
Oligodeoxyribonucleotides were synthesized on an Applied Biosystems
(ABI) 392 synthesizer using standard b-cyanoethylphosphoramidite
chemistry, except that for 3' phosphorothioate sequences, the first
nucleotide added after the phosphorylation reagent was sulfurized
by the sulfurizing reagent from ABI (H. Vu et al., Tetrahedron
Lett. 32, 3005-3008 (1991)). 5' Iodo-oligonucleotides were
synthesized as described in Example 1.
Ligations to Produce 5'-S-Thioester Linkages
[0081] Oligonucleotides containing 5 '-iodo- and
3'-phosphorothioate groups (20 mM) were incubated with 22 mM
complementary splint oligomer in a pH 7.0 buffer (50 mM
Tris.cndot.borate) containing 10 mM MgCl.sub.2 at room temperature
for 24 hours as described in Example I. The splint sequence used
for the 20mer and 45mer DNAs was 5'-d(CTA GTC CAA AGT GCT CGG) (SEQ
ID NO:4); for the hairpin sequence no splint was needed. Ligation
products were isolated by preparative denaturing polyacrylamide
gels.
Exonuclease Cleavage
[0082] Snake Venom Phosphodiesterase Digestion:
[0083] 5'-.sup.32P-labeled oligonucleotides (500,000 CPM), 0.12 mU
SVPD (Boehringer Mannheim) were incubated at room temperature in a
pH 7.5 buffer (70 mM Tris.cndot.borate) containing 10 mM
MgCl.sub.2, in a total volume of 50 mL. Aliquots (8 mL) were
removed at desired time points and stopped by the addition of 8 mL
stop solution (30 mM EDTA, 8 M urea).
[0084] T4 Polymerase Digestion:
[0085] 5'-.sup.32P-labeled oligonucleotides, 0.2 units T4 DNA
Polymerase (United States Biochemical) were incubated at room
temperature in a pH 8.8 buffer (33 mM Tris.cndot.HCl) containing 10
mM MgCl.sub.2, 66 mM KOAc, 5 mM dithiothreitol, 0.01% bovine serum
albumin (BSA), in a total volume of 50 mL. Aliquots (8 mL) were
removed at desired time points and stopped by the addition of 8 mL
stop solution.
[0086] Calf Spleen Phosphodiesterase Digestion:
[0087] 20mer oligodeoxynucleotides (FIG. 5) were 3' end-labeled
with [a-.sup.32P]ddATP and Terminal Deoxynucleotidyl Transferase
(United States Biochemical). They were incubated with 0.2 U CSPD
(United States Biochemical) at room temperature in a pH 6.0 buffer
(30 mM NaOAc), in a total volume of 30 mL. Aliquots (4 mL) were
removed at desired time points and stopped by the addition of 8 mL
stop solution.
Endonuclease Cleavage
[0088] Endonuclease Cleavage:
[0089] 0.05 nmol dumbbell DNA (FIG. 5) and 50 units NsiI (GIBCO
BRL) were incubated at 37.degree. C. for 1.5 h in a pH 8.0 buffer
(50 mM Tris.cndot.HCl) containing 10 mM MgCl.sub.2, 100 mM NaCl, in
a total volume of 50 mL. Reactions were stopped by heating at
68.degree. C. for 20 min. After phenol-chloroform extraction and
ethanol precipitation, pellets were brought up in 5 ml H.sub.2O
prior to loading on an analytical PAGE gel.
Polymerase Studies
[0090] Conditions for the primer extension experiment were as
follows: 10 nM template DNA strand, 10 nM primer strand (FIG. 5), 1
mM each of dATP, dTTP, dCTP, and dGTP (Boehringer Mannheim), and 3
units Klenow fragment of DNA Polymerase I (exo.sup.-, United States
Biochemical) were incubated in a pH 7.5 buffer (50 mM
Tris.cndot.HCl) containing 10 mM MgCl.sub.2, 1 mM dithiothreitol,
50 mg/mL BSA) at 37.degree. C., in a total reaction volume of 20
mL. Reactions were stopped by addition of 10 mL stop solution and
heated to 90.degree. C. for 2 minutes, followed by chilling on ice
prior to loading on the gel.
[0091] Conditions for the run-off transcription reactions were as
follows: 1 mM template, 50 units T7 RNA Polymerase (New England
Biolabs), 0.5 mM each of ATP, GTP and CTP, 60 mM UTP, 0.27 mCi of
a-.sup.32P-UTP were incubated in a pH 7.9 buffer (40 mM
Tris.cndot.HCl) containing 6 mM MgCl.sub.2, 2 mM spermidine, 10 mM
dithiothreitol at 37.degree. C., in a total volume of 15 mL.
Reactions were stopped by addition of 15 mL stop solution and
heated to 90.degree. C. for 2 min, followed by chilling on ice
prior to loading on the gel.
Thermal Melting Studies
[0092] Solutions for thermal denaturation studies contained a 1:1
ratio of the complementary strands (1.0 mM each). The solution for
the 20mer duplexes contained 100 mM NaCl and 10 mM MgCl.sub.2
buffered with 10 mM Na.cndot.PIPES at pH 7.0. The solutions for the
dumbbell duplexes contained 10 mM Na.cndot.PIPES at pH 7.0 and 1 mM
EDTA. Solutions were heated to 90.degree. C. and allowed to cool
slowly to room temperature prior to the melting experiments.
Melting studies were carried out in Teflon-stopped 1 cm path length
quartz cells under a nitrogen atmosphere on a Varian Cary 1 UV-VIS
spectrophotometer equipped with a thermoprogrammer. Absorbance was
monitored at 260 nm while the temperature was raised from
10.degree. C. to 95.degree. C. at a rate of 0.5.degree. C./min.
Melting temperatures were determined by computer fitting using a
two-state approximation with linear sloping baselines. Error in
T.sub.m is estimated at.+-.0.5.degree. C. or less.
Results and Discussion
[0093] To test the ability of enzymes and varied buffer conditions
to cleave P--S bonds in 5' bridging phosphorothioates, a 20mer
5'-S-containing oligonucleotide (FIG. 5) was constructed by
ligation of an octamer carrying a 3'-phosphorothioate with a 12mer
carrying a 5' iodide in the presence of an 18mer complementary
strand. This produces a single sulfur at the 5' carbon of thymidine
in the ninth position of this sequence.
[0094] Hydrolysis of the P--S bond in the absence of enzymes is
expected to be much more rapid than occurs with DNA
phosphodiesters, which have a half-life of many thousands of years
at neutral pH. To examine this we incubated the 20mer containing a
sulfur linkage (FIG. 5) at varied pH (pH 5.0, 7.0, and 9.0) over a
four day period. Under these conditions no specific cleavage is
visible (<1%) at any pH. This allows us to set an upper limit
for the hydrolysis rate constant for this P--S bond at
k.sub.obs=3.times.10.sup.-8 sec.sup.-1 or less, and the half-life
of the bond is therefore greater than one year at pH values near
neutral. The corresponding half-life for 5'-bridging thioesters in
RNA is three days (H. van Tol, et al., Nucleic Acids Res. 18,
1971-1975 (1990)). It is worth noting that such linkages in DNA can
be cleaved rapidly, if desired, in the presence of silver nitrate
(M. Mag et al., Nucleic Acids Res. 19, 1437-1441 (1991)).
[0095] We then investigated the susceptibility of this linkage
([5'-.sup.32P]dGATCAGGTp.sub.STTCACGAGCCTG (SEQ ID NO:5), where "s"
denotes position of sulfur in phosphorothioate linkage) to
different exonuclease enzymes, specifically, the 3'-exonuclease
activity of T4 DNA polymerase, snake venom phosphodiesterase
(SVPDE) (a different 3' exonuclease), and calf spleen
phosphodiesterase (CSPDE), which is a 5'-exonuclease. We found that
sulfur causes a significant inhibition of T4 exonuclease activity.
The pauses occur at sites one and two nucleotides 3' (prior) to the
thioester rather than during the removal of the sulfur-containing
nucleotide itself. We estimate the cleavage of the most resistant
linkage to be inhibited by a factor of five to tenfold. Since the
S--P bond is not expected to be cleaved by this enzyme (products
with this enzyme are normally 5'-monophosphates ), we surmise that
this pause is due to unfavorable interaction of the enzyme with
this sulfur, possibly because of the increased bond lengths or
relatively poor hydrogen bond accepting ability of the sulfur
relative to oxygen.
[0096] Interestingly, the snake venom 3' exonuclease showed no
visible inhibition by the presence of a bridging sulfur. This
enzyme also produces 5' phosphates and would not be expected to
break the P--S bond in the thioester. It is clear that the
interactions of this enzyme with DNA are significantly different
than those in the exonuclease domain of T4 polymerase, or that the
bond length sensitivity is much lower for the snake venom enzyme.
It is worth noting that the only previous report of SVPDE cleavage
by 5'-bridging sulfur linkages in DNA reported significant slowing
of the enzyme (V. Rybakov et al., Nucleic Acids Res. 9, 189-201
(1981)). However, in that case all linkages were modified rather
than a single one as in the present case, a fact which might
explain the differences.
[0097] The final enzyme, calf spleen phosphodiesterase, which is a
5' exonuclease that produces 3' phosphate products, was studied for
its ability to digest a 21mer with sulfur between the 8th and 9th
nucleotides. This case is particularly noteworthy since this enzyme
would be expected to cleave the P--S bond in the 5' bridging sulfur
linkage. In this experiment a significant pause was observed,
although cleavage beyond this point clearly does occur, eventually
yielding only very short products. The pause occurs at the position
assigned to the nucleotide immediately before the linkage, which
indicates that cleavage of the P--S bond by the enzyme is slower
than processing of a normal P--O bond. Since sulfur is expected to
be a much better leaving group than oxygen in the absence of an
enzyme, we surmise that this inhibition arises from less favorable
protein (or protein-bound metal) electrophilic interactions with
the leaving group. Alternatively, it is possible that the increased
bond lengths cause a geometric problem at the active site. The P--S
bond and the S--C bond in the diester linkage are each expected to
be approximately 0.4 .ANG. longer than the analogous P--O and O--C
bonds in unmodified DNA (W. Knight et al., Biochemistry 30,
4970-4977 (1991)).
[0098] We then tested the ability of a site-specific endonuclease
to cleave a double-stranded sequence containing the 5'-bridging
sulfur. For this study a hairpin-forming sequence with a
self-complementary overhang was ligated with another copy to
produce a dumbbell DNA consisting of a 24 bp duplex capped by 4 nt
loops (FIGS. 5 and 6). The two sulfur linkages are present at the
cleavage site of restriction endonuclease NsiI in its 6 bp
palindromic recognition sequence. An unmodified version of this
sequence was constructed as a control. Although the unmodified
sequence is completely cleaved by the enzyme in 1.5 hour, the
sulfur-containing sequence shows no cleavage over this period. The
enzyme would not be expected to cleave the P--S bond since it
normally leaves 5' phosphate ends. This inhibition must therefore
be due to unfavorable interactions between the enzyme and the
5'-bridging position, or to altered geometry of the DNA arising
from the longer P--S bonds.
[0099] We also investigated the question of whether the increased
bond lengths (S--C and S--P) in the modified DNA would be
recognized as a template for common polymerase enzymes. This
question has not previously been examined with this class of
linkage. For this we constructed a 45mer template with sulfur after
the 37th position from the 3' end. Thus, binding of a 17mer primer
at the 3' end allows DNA polymerase extension for 20 nucleotides up
to the sulfur position. This primer also acts as a promoter top
strand for T7 RNA polymerase, thus allowing both DNA and RNA
polymerase to be tested on the same template. Once again, an
unmodified template was tested for comparison. The polymerases
studied were the Klenow fragment (Kf) of E. coli DNA polymerase I
(exo- mutant) and T7 RNA polymerase.
[0100] Interestingly, both the DNA and RNA polymerases proceeded
beyond the sulfur-containing thymidines with no apparent pause seen
before, at, or after this residue. No difference is observed in the
length of the products or in the amount of time necessary to reach
this full length with these concentrations of enzyme and DNA. Thus
these polymerases apparently recognize no difference between the
oxygen and sulfur-containing templates under these conditions,
despite the longer bonds in the latter case.
[0101] Finally, we examined the effects of one or two 5' bridging
sulfur linkages on the thermal stability of DNA-DNA duplexes. This
was tested first in the context of a 20mer duplex carrying one
sulfur linkage in one strand (d(GAT CAG GTp.sub.ST TCA CGA GCC TG))
(SEQ ID NO:6) and its unmodified 20mer complement), and a
completely unmodified duplex of the same sequence was examined for
comparison. Thermal denaturation studies (100 mM Na.sup.+, 10 mM
Mg.sup.2+) showed that both cases were well-behaved, showing sharp
transitions. T.sub.m values were 68.8.degree. C. for the
sulfur-containing duplex and 71.5.degree. C. for the unmodified
duplex. A second case was then examined with 5'-S linkages in both
strands of a duplex, this time using the dumbbell sequences shown
in FIG. 7). Because of their high stability the denaturation
studies were performed under low salt conditions (10 mM
Na.cndot.PIPES, 1 mM EDTA). The results showed that the thermal
stabilities of the modified duplex (T.sub.m=82.8.degree. C.) and
the unmodified one (T.sub.m=83.3.degree. C.) are essentially the
same. Thus, the 5'-bridging sulfur linkage causes very little
destabilization of duplexes, at least for the cases studied
here.
[0102] The results show overall that the 5' bridging sulfur causes
significant inhibition of some nuclease enzymes but no apparent
inhibition of DNA or RNA polymerase enzymes. In terms of stability
in the absence of enzymes, the 5'-thioester linkage is likely to be
considerably more labile to hydrolysis than natural DNA
phosphodiesters, but is stable at least for months at pH values of
5 to 9. This linkage is much more stable, therefore, than
previously reported 5' bridging thioesters in RNA. However, when
specific cleavage is desired in thioester-linked DNA, treatment
with silver produces cleavage under mild conditions (M. Mag et al.,
Nucleic Acids Res. 19, 1437-1441 (1991).
Example III
High Sequence Fidelity in a Nonenzymatic DNA Autoligation
Reaction
Introduction
[0103] The ability to detect single base differences in DNA is of
great importance in molecular genetics. Specific identification of
point mutations is playing an increasingly important role in
diagnosis of hereditary disease and in identification of mutations
within oncogenes, tumor suppressors genes and of mutations
associated with drug resistance. Oligonucleotides can distinguish
single nucleotide differences by small changes in hybridization
efficiency, however the selectivity seen for oligonucleotide probes
of 20 nt or longer is relatively small.
[0104] One of the most common strategies in current use for
engendering high specificity in sequence detection is the use of
DNA ligase enzymes. Ligases such as the T4 and Tth enzymes are
quite sensitive to base mismatches at the ligation junction, and
thus these enzymes are used as the basis for methods such as ligase
chain reaction (LCR) and ligase detection reaction (LDR). Enzymatic
ligation selectivities against single base mismatches are high, on
the order of 10 to 100-fold for T4 DNA ligase, and 100-10,000-fold
for the Tth enzyme.
[0105] Non-enzymatic (chemical) methods for ligation may have some
possible advantages over ligase enzymes in application to detection
of mutations. Among these are lower sensitivity to nonnatural DNA
analog structures, the ability to be ligated on RNA targets, lower
cost, and greater robustness under varied conditions. In addition,
non-enzymatic ligations might possibly be carried out inside intact
cells or tissues which might not be accessible to ligase enzymes
added to the medium.
[0106] Oligonucleotides formed by the reaction of phosphorothioates
at the 3' end of one strand with a leaving group (such as tosylate
or iodide) on thymidine in the adjacent strand (Example I) differ
from natural DNAs only by replacement of a single oxygen atom with
sulfur. Because of the close resemblance to natural DNA, the
junction apparently does not affect the ability of polymerases to
replicate or transcribe the sequence (Example II), which makes this
ligation approach particularly promising for sequence detection
methods that require further manipulation such as DNA
amplification. This Example reports studies delineating the
sensitivity of the phosphorothioate-iodide DNA autoligation
reaction to single nucleotide mismatches at or near the ligation
junction. This is investigated in the context of H-ras target
sequences both with dual probes ligating on the single-stranded
target DNA as well as for single probes designed to self-ligate
intramolecularly to circular form ("padlock" probes (M. Nilsson et
al., Science, 265, 2085-2088 (1994)). The data show that optimized
placement of a single-base mismatch can lead to selectivities
comparable to those seen with ligase enzymes.
Preparation of Autoligation Probes
[0107] All oligodeoxynucleotides were synthesized on 1 mmole scale
on an ABI model 392 synthesizer using standard
b-cyanoethylphosphoramidite coupling chemistry. The 3' end
phosphorothioate groups required for the ligation reaction were
incorporated into DNA strands substantially as described in
Examples I and II. Briefly, the oligonucleotide synthesis was
carried out with a 3' phosphate controlled pore glass support
(Cruachem). The first nucleotide unit was added with normal
oxidation being replaced by a sulfurizing reagent (Applied
Biosystems). The remaining synthesis and deprotection were as for
the standard DNA cycle. The second requirement for ligation is a 5'
end carrying an iodide. This is added with a commercially available
5-iodothymidine phosphoramidite reagent (Glen Research).
Deprotection and removal of iodine-containing strands from the CPG
support was done by incubation in concentrated ammonia for 24 hours
at 23.degree. C. to avoid small amounts of degradation which occur
at 50.degree. C. Probe DNAs were then lyophilized and used without
further purification, to avoid disulfide formation of the
phosphorothioate ends. Analytical gels showed the purity of
phosphorothioate and iodide probes to be better than 90%.
[0108] Purification of target oligodeoxynucleotides was carried out
by preparative denaturing polyacrylamide gel electrophoresis. All
DNAs were quantitated by UV absorbance using the nearest neighbor
approximation to calculate molar absorptivities.
Ligation Reactions
[0109] Reactions were performed in 600 ml pH 7.0 Tris.cndot.borate
buffer containing 10 mM MgCl.sub.2, with target and probe DNA
concentrations of 1.3 or 20 mM. Ligations with radiolabeled probes
also contained 50 mM dithiothreitol. Reactions were incubated at
the indicated temperatures. Aliquots (100 mL) were removed at
various times and then were frozen and lyophilized for one hour.
Pellets were taken up in 5 ml water-formamide-urea loading buffer.
Samples were heated to 95.degree. C. for 2 minutes and then chilled
on ice prior to loading on a 20% polyacrylamide gel containing 8 M
urea. Gels were visualized with Stains-All dye (Sigma) and
quantified by densitometry using NIH Image version 1.62b7 software.
For radiolabeled probes, radioactivity was quantitated on a
Molecular Dynamics Phosphorimager. The circular identity of the
intramolecular probe after ligation was confirmed by isolation and
treatment with S1 Nuclease. This produced a second major band which
co-migrated with the linear precursor.
Intermolecular Autoligation
[0110] To evaluate the effects of complementary and mismatched
template DNAs on the phosphorothioate-iodide autoligation reaction,
we synthesized two probes ten and seven nucleotides in length
carrying a 3'-phosphorothioate and a 5'-iodothymidine,
respectively. The sequences are given in FIG. 8. We also
synthesized four 28mer target DNAs which correspond to the fully
complementary sequence (MUT) and singly mismatched targets where
the position of the mismatch is at the 3' and 5' side of the
junction (templates 3'MM and 5'MM, with G-A and T-C mismatches
respectively), and one in which a G-G mismatch is centered on the
7mer iodo-probe (template MMM ("mid-mismatch")). The sequence of
the fully complementary target corresponds to that of the codon 12
mutation commonly found in the H-ras oncogene, while the 3'MM
target corresponds to the unmutated protooncogene sequence.
[0111] Ligations were carried out at pH 7.0 in a buffer containing
10 mM Mg.sup.2+. We tested the effects of probe+target
concentration and temperature on the extent and rate of ligation.
The products of ligation were analyzed by following time courses
over 24 hours, and were examined by denaturing gel electrophoresis.
Yields as a function of reaction time were quantitated by
densitometry.
[0112] Simple qualitative inspection of gels for a given set of
reactions with these linear probes showed that both the reaction
conditions and the relative placement of the mismatch are
significant factors affecting the ligation yield. At 37.degree. C.
and 1.3 mM probe and target concentration, the ligation proceeded
to high conversion over 9-18 hours with the complementary target,
while only very little product was observed in the 3'MM and 5'MM
cases, and none at all in the MMM case. We also examined the same
sets of ligations at 20.degree. C. with 1.3 mM DNA and at
37.degree. C. with 20 mM DNA, and the results were qualitatively
similar.
[0113] Quantitative comparisons of these three sets of conditions
indicate that selectivity was highest at 37.degree. C. with 1.3 mM
target and probe concentrations (FIG. 9). In all three cases, the
mid-mismatch (MMM) gave the highest level of discrimination; there
was little difference between the junction mismatches (3'MM and
5'MM), which overall gave lower levels of discrimination. At the
two sets of conditions having lower DNA concentration there was no
observable ligation on the MMM template at 24 hours; we estimate
that the densitometry could have detected 4% or higher yield at the
last time point. This suggests selectivity of greater than one
order of magnitude (see below). In some of the slow ligation cases,
a leveling off of the reaction appeared to occur. In these cases it
is possible that there was a small amount of disulfide formation
between phosphorothioate probes that makes the kinetics appear
biphasic. We have observed DTT-sensitive slower-moving dimer bands
when the probes are at high concentrations (such as during
precipitation). The quantitative kinetics experiments with
radiolabeled probes were carried out with DTT present (below) to
avoid possible disulfide formation.
Intramolecular Autoligation/Cyclization
[0114] We then investigated whether such ligations could be carried
out intramolecularly to yield circular products. This type of
ligation would be the nonenzymatic equivalent of those carried out
with "padlock"-type probes. Initially, the probe DNA was designed
to form 10 base pairs on either side of the junction; the sequences
are shown in FIG. 8. The reactions were again observed
qualitatively, with analysis after 24 hours, and quantitatively, by
following a time course under varied conditions (FIG. 10). Since
the reaction is intramolecular we varied temperature (37.degree. C.
and 70.degree. C.) but not concentration.
[0115] The results showed that the intramolecular
phosphorothioate-iodide ligation proceeded in high yields with a
fully complementary (MUT) target, and that there was significant
selectivity against single mismatches. In contrast to the
intermolecular ligation, however, the levels of discrimination
appeared to be somewhat lower. For the mismatches, the most
ligation was seen with the central mismatch (MMM), which showed
.about.2-fold discrimination in yield at 24 hour. Somewhat greater
selectivity occurred with the 3' and 5' junction mismatches (3.5-
and 2.5-fold). This is the reverse of what was observed for
ligation of the intermolecular 7mer+10mer probes, which showed
highest discrimination in the MMM case. At 25.degree. C. with the
cyclization probe, the MMM case showed only a very small amount of
discrimination relative to the fully complementary sequence, while
at 70.degree. C. the MMM discrimination increased somewhat (FIG.
10(a)). The magnitude of selectivity at 70.degree. C. in the
"padlock"-type case was similar to that seen for the 3'MM and 5'MM
cases for the intermolecular reaction.
[0116] To test whether this ligation would be more sensitive to
mismatches when located in a shorter binding domain, three new
target DNAs were constructed (FIG. 11(a)). Binding of the
cyclization probe to these new targets would give hybridization
that still totals 20 base pairs, but arranged with 6 bp on one side
of the junction and 14 bp on the other side. The MMM case had a
mismatch that fell within the shorter 6 bp binding domain. Ligation
experiments were again carried out with the three targets at
70.degree. C. The data (FIG. 11(b)) showed that with this new
sequence, selectivity against a mismatch at the junction was
similar to that seen with 10 bp+10 bp of hybridization. However,
when the mismatch fell within the shorter binding domain, the
selectivity was increased. At 20 hour the comparative yields for
the 6 bp+14 bp case were 65% for the complementary (MUT) template
and 13% for the mismatched (MMM) one. This compares favorably to
the 10 bp+10 bp case, which displayed yields of 63% (MUT) and 32%
(MMM) at 24 hour. It should be noted that the sequences were
different in the 10+10 and 6+14 cases, however.
Optimized Ligation of Two Probes for H-ras
[0117] The results indicated that in the intermolecular ligation,
highest levels of discrimination would be observed with a mismatch
located centrally in a short 7mer probe. To attempt to apply this
optimized strategy to detection of the ras codon 12 mutation, we
constructed two new probes (FIG. 12(a)) in which the
well-characterized G.fwdarw.T transversion (C.fwdarw.A in the
complementary strand) could be targeted with the best mismatch
location. We then evaluated the relative rates of ligation as
described above, using the MUT 50mer complementary target
(corresponding to the mutated oncogene) and the WT 50mer target
(corresponding to the wild-type sequence). In this case the
expected mismatch is a T-C located at the center of the 7mer
phosphorothioate probe binding site.
[0118] The ligation was carried out at 37.degree. C. with 1.3 mM
DNA and probes, conditions under which the earlier set of probes
gave highest discrimination. The shorter phosphorothioate probe was
5' radiolabeled to obtain greater sensitivity for quantitative rate
measurements. The results are plotted as a time course in FIG.
12(b), which shows a quite large difference for the two targets.
The data for the complementary ligation (MUT template) could be fit
well using a second-order kinetic fit giving a rate constant of
29.1 M.sup.-sec.sup.-1. The initial rates were measured for the two
templates (FIG. 12(c)), and this allowed us to determine a rate
constant of 0.16 M.sup.-1 sec.sup.-1 for the same probes with the
mismatched (WT) template. Thus, the rates are different by a factor
of 1.8.times.10.sup.2-fold, a level of discrimination comparable to
that seen for ligase enzymes (see below).
Ligation Selectivity
[0119] Because the ligation experiments in this Example were aimed
primarily at quantitating and optimizing fidelity of the reaction,
only single-stranded targets were used. However, it is fully
expected that more complex double-stranded DNA sequences can also
be used as a target. A number of viable strategies for overcoming
problems presented by hybridization to double-stranded targets have
been noted in studies of other sequence detection methods, and a
have been described (U. Landegren et al., Science, 241, 1077-1080
(1988); H. Gamper et al., J. Mol. Biol., 197, 349-362 (1987); V.
Somers et al., Biochim. Biophys. Acta, 1379, 42-52 (1998)), and our
preliminary studies have shown success with relatively long
double-stranded sequences in slot-blot assays (see Example II).
[0120] The present results show that the phosphorothioate-iodide
autoligation reaction can proceed with good yields and high
selectivities against single base mismatches, particularly when the
mismatch falls near the center of a heptamer probe. In the
optimized cases, G-G or C-T mismatches are selected against by a
factor of at least two orders of magnitude. This level of
specificity is higher than that seen for the same mismatches using
phage T4 DNA ligase or Chlorella virus DNA ligase, although it is
not as high as that seen for the more discriminating bacterial Tth
ligase under optimized conditions. Application of this autoligation
to current assay methods such as LDA (ligase detection assay) and
ligation-mediated PCR is also envisioned.
[0121] It is of interest to consider the physicochemical origins of
the selectivity for this autoligation reaction. The data show that
selectivity is lower at the ligation junctions but higher near the
center of a short probe. We surmise, therefore, that the chief
factor in successful ligation is the binding affinity of the probe
rather than the precise geometry at the ligation junction. This is
consistent with our finding that the reaction proceeds with
second-order kinetics. In contrast, enzymatic ligations are
commonly most selective at the junction, a fact which is attributed
to the precise geometric control that the enzyme takes in orienting
the reactive groups for in-line attack at phosphorus (N. Higgins et
al., Meth. Enzymol., 68, 50-71 (1979)). For the present reaction it
seems that the transition state S.sub.N2 geometry can be reached
even with mismatched geometries; this is likely due to the
relatively high flexibility of the DNA at the nicked junction.
Presumably, ligase enzymes curtail this mobility to a high
degree.
[0122] It should be noted that in the present Example, since the
iodide exists only on a thymidine residue, there is a sequence
limitation in which an adenine must be present at the desired
ligation site. If either sense or antisense strands of the DNA
target can be probed, then the restriction is relaxed to either T
or A at the junction, which means that at least half of all
possible sites can be probed optimally. In most applications the
ligation junction can be shifted by one or two nucleotides as
needed, therefore this is not expected to be a major problem.
Indeed, since there is likely to be at least.+-.1 nt of latitude in
junction placement for a given point mutation, and since the
ligation junction can be placed either 5' or 3' to the mutation,
the restriction is calculated to be a significant hindrance in only
about 5% of possible sequences. Nevertheless, there is a simple
answer to this problem: an iododeoxycytidine nucleoside variant of
the 5'-iodoT used here could be utilized. While not commercially
available at present, we anticipate that it could be readily
produced.
Advantages of Autoligation Over Enzymatic Approaches
[0123] There are a number of aspects of the autoligation reaction
which may give it advantages over standard enzymatic approaches.
Since no enzymes or added reagents are needed, the ligation might
be carried out in media that would prevent enzymatic reactions. For
example, it is conceivable that the ligation could be carried out
inside whole cells or tissue samples, or in gels, solvents, or
physical conditions not amenable to enzyme permeability or
stability. The ligation proceeds well in the presence of millimolar
amounts of dithiothreitol, thus it is feasible that the reducing
environment of the cell might not interfere with reactivity.
Another benefit of the autoligation is that it can be used with
short probes such as heptamers, which cannot be ligated by the
commonly used Tth ligase. In addition, the absence of enzyme
requirements makes it feasible to carry out ligations of structures
which are not substrates for DNA ligases. Examples of this might be
the ligation of DNA probes on RNA targets, and the use of
chemically modified DNA probes. A further benefit of this
autoligation reaction relative to enzymatic methods is that the 3'
probe cannot serve as a primer for polymerases, since it has a
phosphorothioate group blocking the 3' hydroxyl. In standard
enzymatically ligated probes, both unligated probes as well as the
product can potentially act as primers. It is worth pointing out
that since the phosphorothioate and iodide probes are constructed
on an automated synthesizer using commercially available reagents,
requiring no post-synthesis modification, these potential benefits
can be realized without any additional preparative effort over
standard methods.
Example IV
Nonenzymatic Autoligation in Direct Three Color Detection of RNA
and DNA Point Mutations
Summary
[0124] The use of nonenzymatic phosphorothioate/iodide DNA
autoligation chemistry for the detection and identification of both
RNA and DNA sequences is described in this Example. Combining
ligation specificity with the hybridization specificity of the
ligated product allowed discrimination of a point mutation of as
high as>10.sup.4-fold. Unlike enzymatic ligations, this
self-ligation reaction was found to be equally efficient on RNA or
DNA templates. The reaction was also found to exhibit a significant
level of self-amplification, with the template acting in catalytic
fashion to ligate multiple pairs of probes. The autoligating energy
transfer (ALET) probe design offers direct RNA detection combining
high sequence specificity with an easily detectable color change by
fluorescence resonance energy transfer.
Preparation of Probes and Targets
[0125] The goals of the work reported in this Example were to
investigate the scope of this autoligation chemistry on varied
sequences with RNA or DNA substrates, and to test methods for
detecting the products of ligation. To carry this out we chose a
probe design involving ligation of 7mer and 13mer probes (FIG. 13),
which can afford very high sequence specificity due to the high
mismatch selectivity of the shorter of these probes. We utilized
probes complementary to the H-ras protooncogene and to the
well-characterized codon 12 G.fwdarw.T mutation. Two 7mer probes
(mutant and wild-type) were designed such that the position of the
point mutation fell at the center position, to maximize
selectivity, and were constructed with 3'-end phosphorothioate
groups to act as nucleophiles in the ligation. Coupled with these
mutation probes was a 13mer probe designed to bind directly
adjacent to the mutation probes. This longer "universal" probe was
expected to bind equally strongly to wild-type as well as mutant
targets. Studies were initially carried out with a single pair of
probes at a time (one radiolabeled 7mer and the 13mer), and later
studies were carried out with the three probes simultaneously, each
carrying a different fluorescent label.
[0126] Specifically, DNA and RNA oligonucleotides were synthesized
on 1 mmol scale on a Perkin Elmer/Applied Biosystems 392
synthesizer using standard b-cyanoethylphosphoramidite coupling
chemistry. Phosphorylation was carried out using Phosphate-on
reagent from Glen Research. For 3'-phosphorothioate sequences, the
first nucleotide added after the phosphorylation reagent was
sulfurized by the sulfurizing reagent from ABI.
5'-Iodo-oligonucleotides were synthesized by published procedures
using iodo-T phosphoramidite from Glen Research, as described in
Examples I and II. Automated RNA synthesis was carried out using
t-butyldimethylsilyl-protected phosphoramidites from Glen Research.
Oligonucleotides were deprotected in 3:1 concentrated
ammonia:ethanol at 55.degree. C. for 18 hours and dried. Silyl
protecting groups were removed by adding 400 mL 1M
tetrabutylammonium fluoride in tetrahydrofuran (Sigma) to the
residue and shaking at room temperature for 24 hours. RNA was
desalted on a Sep-pak column (Water) and purified by denaturing
polyacrylamide gel electrophoresis.
[0127] FAM and HEX labels were introduced with FAM-thymidine and 5'
HEX phosphoramidites (Glen Research), during automated DNA
synthesis. Labeling of ROX was done by conjugation of the NHS ester
with 5' amino modified DNA. The 5'-amino-modifier C6 (Glen
Research) was introduced into the 5' end of the probe during
automated DNA synthesis. The MMT protecting group was removed by
detritylation for 5 minutes right before the dye labeling
reactions. To prevent the potential reaction of the 3'
phosphorothioate with the NHS ester of the dye, the labeling
reaction was carried out before DNA was cleaved from the beads. 2
mg of 6-carboxy-X-rhodamine succinimidyl ester (Molecular Probes)
was dissolved in 200 .mu.L of dimethylformamide immediately before
reaction. The reaction solution was prepared by adding 400 .mu.L
0.5 M sodium bicarbonate (pH 7.6) and 400 .mu.L water to the above
dye DMF solution. DNA on the silica was added to the mix and
allowed to react at room temperature for 1 hour with slow shaking
(vigorous shaking is to be avoided). DNA beads were recovered by
filtering the reaction mixture through glass wool and rinsed with
water and acetonitrile several times.
[0128] All dye-labeled oligonucleotides were cleaved and
deprotected in ammonium hydroxide at room temperature for 24 hours,
and lyophilized. They were quantitated without further purification
using nearest neighbor methods, subtracting the dye's contribution
at 260 nm. The degrees of substitution of all three probes were
determined to be above 90%.
[0129] Plasmid pT24-C3 containing the c-Ha-ras 1 activated oncogene
mutation at codon 12 (GGC-GTC) and pbc-N1, containing wild type
c-Ha-ras were obtained from American Type Culture Collection. 300
bp regions including nucleotides -53 (relative to the transcription
initiation site) and +244 , of normal and activated Ha-ras genomic
clones were PCR amplified using the primers
5'-GTG-GGG-CAG-GAG-ACC-CTG-TA (SEQ ID NO:7) (sense) and
5'-CCC-TCC-TCT-AGA-GGA-AGC-AG (SEQ ID NO:8) (antisense).
Steady State Fluorescence
[0130] Measurements were performed on a Spex Fluorolog-2
fluorimeter using a bandwidth of 1.8 nm and 1.times.1 cm quartz
cuvettes. The source of radiation was a xenon arc lamp. All slits
were set to 2 mm, resulting in approximately 3.4 nm resolution.
Fluorescence measurements were taken in the right angle mode.
Emission spectra were corrected for instrument response. FRET
spectra were measured at FAM's excitation wavelength which is 495
nm.
Ligation Reactions on DNA and RNA Templates
[0131] To investigate the rate of the 7mer plus 13mer ligation
reaction, and to test whether RNA as well as DNA targets would
support the reaction, we prepared synthetic 40mer targets of DNA
and RNA having the same H-ras mutant target sequence. Ligations
were carried out at 25.degree. C. at 1 mM probe and target
concentrations, in a pH 7.0 Tris buffer containing 10 mM Mg.sup.2+
(MgCl.sub.2). A time course of the reaction was followed using 20%
denaturing polyacrylamide gel electrophoresis of reactants and
products. Fluorescent bands were visualized over a UV
transilluminator and images were recorded using a Kodak DC120
digital camera.
[0132] Results showed that the reaction takes place over a period
of hours on the DNA template (FIG. 14), reaching the 50% stage in
approximately 6 hours. Significantly, the reaction on the RNA
template is observed to occur at virtually the same rate as on the
DNA.
Turnover Experiments
[0133] DNA templates have in some cases been observed to foster the
ligation of multiple equivalents of ligating strands, by
dissociation of the ligated product followed by binding and
ligation of a new pair of ligating strands. This turnover is
commonly inhibited by the stronger binding of the product than the
unligated strands to the template, but if it occurred even to a
relatively small degree, it would be valuable to possible
diagnostic applications, since one target would engender more than
one ligated signal. The present phosphorothioate-iodide ligation
results in a duplex weakly destabilized relative to natural DNA
(see Example II) and so might be expected to give some degree of
turnover, but with significant product inhibition. Nonetheless, we
investigated whether a degree of amplification might be possible in
this reaction.
[0134] We therefore investigated the yields of ligated product as a
function of target concentration, from 1-100 nM, and temperature.
Experiments were carried out on a synthetic MUT DNA target using
FAM labeled probes. Specifically, 100-10,000 equivalents of probes
per equivalent of DNA target strand were present with target
concentration from 1-100 nM. Reactions were carried out at
25.degree. C., 37.degree. C., 50.degree. C. or with thermal cycling
for 24 hours, and were then analyzed by denaturing gel
electrophoresis. Images were obtained by FluorImager and
quantitated by ImageQuant (Molecular Dynamics).
[0135] Results are given in FIG. 15(a) and compared graphically in
FIG. 15(b). The results showed that there is significant turnover
of autoligation observed at the lower target concentrations. The
most efficient conversion is seen with the 32.degree. C.
incubation, under which the binding equilibrium and S.sub.N2
displacement reaction rate may be best balanced. At the lowest
target concentration we observe 40 turnovers (producing 280 fmol of
ligated signal for 7 fmol of target). In general, cycling is found
to increase turnover only by a small amount (by up to
1.5-fold).
Slot-Blot Analysis
[0136] To examine whether the autoligation chemistry would proceed
on DNAs affixed to nylon membranes, we obtained plasmids encoding
wild-type H-ras and the codon 12 G.fwdarw.T point mutation. Their
sequences were independently confirmed by automated Sanger
sequencing. We prepared two 300 bp duplexes corresponding to these
two sequences by polymerase chain reaction, and affixed them to
nylon membranes in the slot blot format. Specifically, crude PCR
products were denatured and adsorbed onto positively charged
Zeta-Probe nylon membrane using a slot-blot manifold (Bio-Rad)
according to manufacturer's instructions. Membranes were incubated
for 1 hour at 37.degree. C. in 6.times.SSC prehybridization
solution containing 5.times. Denhardt's solution (0.1% w/v
polyvinylpyrrolidone, 0.1% w/v Ficoll type 400, 0.1% w/v BSA), 100
ug/ml salmon sperm DNA, 0.05% (w/v) sodium pyrophosphate, and 0.5%
(w/v) SDA. After prehybridization, membranes were incubated at
37.degree. C. for 18 hour in 6.times.SSC hybridization solution
containing 0.05% sodium pyrophosphate, 0.13 .mu.M of probe UNIV,
0.01 .mu.M of 5'-.sup.32P-labeled MUT and 1 mM dithiothreitol. The
specific activity of the probe was ca. 0.5 .mu.Ci pmol.sup.-1. The
membrane was rinsed once in 6.times.SSC for 15 minutes at room
temperature. Exposure to x-ray film was carried out at -70.degree.
C. with two intensifying screens. Subsequent washes, when used with
preligated 20mer probes, was carried out with 2.times.SSC at
60.degree. C. for 30 minutes each time.
[0137] These experiments showed that the extent of ligation reached
a maximum after about 10 hours, and that a strong signal was
observed with the complementary mutant DNA (FIG. 16). No signal was
observed with radiolabeled 7mer alone or with probes lacking
sulfur, confirming that ligation was necessary for producing this
signal. Importantly, very little signal was observable under the
same conditions with wild-type H-ras DNA differing by a single
base; quantitation showed a difference of 788-fold in signal for
the two closely related targets.
[0138] In such a ligation reaction, there are two possible sources
of specificity: the ligation reaction itself, and the hybridization
selectivity of the ligated product. In the above experiment it was
possible that the ligation occurred indiscriminately, and that the
complementary ligated 20mer was remaining bound only to its
complementary target. To investigate this possibility we
constructed a pre-ligated 20mer probe and labeled it in identical
fashion. It was then hybridized to the two DNAs in the slot-blot
apparatus under the same conditions as the ligating probes. Results
showed that this 20mer hybridized almost equally well (1.8:1) to
complementary and mismatched targets under these hybridization and
low stringency single wash conditions, giving equal signals for
matched versus mismatched DNA. Thus, almost all the selectivity
observed above was a result of the ligation reaction alone.
However, under increasing stringency of washing, the ligated 20mer
does shows significant hybridization selectivity (FIG. 16(b));
after the 8th wash at 60.degree. C. with 2.times.SSC we measured a
180:1 ratio of correct to mismatched signals. The total selectivity
achievable by the autoligating probes is the product of the
ligation and hybridization selectivities, which here is measured to
be between 10.sup.4 and 10.sup.5. Thus, a false positive signal is
much lower than the correct signal with equal amounts of DNA,
suggesting that such probes could potentially discriminate this
mutation in the presence of a 10.sup.4-fold or greater excess of
wild-type DNA. Subsequent experiments, described below, showed that
specificity could be further increased by direct competition of the
short probes.
Energy Transfer Probe Design
[0139] Fluorescence is a convenient signal for solution-based
diagnostic methods, and energy transfer can be used to report on
the proximity of two molecules or groups. We therefore investigated
whether FRET could be coupled to the autoligation reaction to give
a detectable signal that responds only when the bond is formed.
Simple side-by-side binding of two appropriately labeled
oligonucleotides on a DNA target is known to result in energy
transfer. In the present case we did not wish for such a signal to
be observable until actual ligation occurred, since the ligation
adds a high degree of sequence specificity. We felt it possible
that the use of one very short probe might prevent simple
binding-induced FRET because it might not saturate the binding site
adjacent to the longer probe. If binding-induced FRET could be
prevented, it would not be necessary to dissociate the ligation
product from the polynucleotide template before assessing whether
FRET has occurred. Thus, our design (FIG. 17) included the use of a
13mer universal probe labeled with the FRET donor
5-carboxyfluorescein (FAM) and a 7mer mutant probe 5'-end-labeled
with the acceptor dye rhodamine (ROX). Excitation of the FAM dye in
unligated probes should lead almost exclusively to green FAM
emission (520 nm); however, after ligation the resulting energy
transfer might be expected to result in ROX emission (602 nm)
coupled with quenching of FAM emission. With these probe sequences
there is a thymidine in the universal probe ten nucleotides from
the position of the ROX label. We chose this as the site for FAM
labeling, since suitably labeled deoxyuridine is readily available,
and since this distance is near the optimum for energy
transfer.
[0140] In this dual probe strategy, one expects to see a color
change on detection of H-ras codon 12 mutations, but no change in
the presence of H-ras wild type DNA. Since such a negative signal
might be confused with false negatives (such as when no DNA is
present or no ligation occurs), we sought to include a different
color change for detection of wild type DNA. To do this we prepared
a third (WT) probe carrying a different FRET acceptor dye,
hexachlorofluorescein (HEX) (FIG. 17). If this were ligated to the
FAM-labeled universal probe, energy transfer would result in a
color change from green to yellow, corresponding to HEX dye
emission (556 nm). Simultaneous use of all three probes might be
possible, wherein the two short probes carrying acceptor dyes
compete for ligation to the universal probe. In principle, a yellow
signal would represent detection of wild type target, a red signal
would represent mutant target, a combination of the two would
represent a mixture, and a green signal would indicate absence of
relevant target or inactive ligation.
[0141] The three probes were prepared on solid support without the
need for post-synthesis modification. In the universal probe, the
iodide and FAM-dU conjugate were introduced during standard DNA
synthesis. The phosphorothioate group was introduced into the MUT
and WT probes using standard sulfurization chemistry. The HEX dye
was incorporated as a commercial phosphoramidite. The ROX dye was
added to the terminus of the MUT probe by reaction of an activated
ROX NHS ester derivative with a terminal amino group while the DNA
remained on the solid support. Measurements were performed on a
Spex Fluorolog-2 fluorimeter using a bandwidth of 1.8 nm and
1.times.1 cm quartz cuvettes. The source of radiation was a xenon
arc lamp. All slits were set to 2 mm, resulting in approximately
3.4 nm resolution. Fluorescence measurements were taken in the
right angle mode. Emission spectra were corrected for instrument
response. FRET spectra were measured at FAM's excitation wavelength
which is 495 nm.
Color-Based Detection of Ligation in Solution
[0142] The three labeled ALET probes were then incubated with 50
nucleotide single-stranded DNAs corresponding to wild-type or codon
12 mutant H-ras antisense strand. The reactions were followed by
fluorescence spectrometer (FIG. 18). Results showed that after one
hour of incubation with mutant DNA there was very little spectral
change, but after 18 hours a significant FRET signal was observed,
with quenching of the FAM signal coupled with gain in the ROX
signal. An analogous result was observed with the same probe
mixture in the presence of wild-type DNA, but with an increase in a
yellow HEX signal. No increase in the 602 nm emission was observed
in this second experiment, confirming that the WT probe effectively
outcompetes the MUT probe for ligation to the universal probe.
Although energy transfer and/or ligation appeared to be incomplete
in both cases, difference spectra (comparing 1 hour to 18 hours,
FIG. 18) allowed this background to be eliminated, and clearly
showed the expected energy transfer signals. Significantly, the
energy transfer did not occur until ligation brought the two dyes
into permanent proximity, since simple hybridization of the probes
was expected to be complete within seconds at these
concentrations.
[0143] The products of these ligation reactions were also examined
by denaturing gel electrophoresis, where the longer ligated probes
were readily separated from any unreacted starting materials. These
products were visualized over a UV transilluminator and digitally
imaged. In the presence of mutant DNA the ligated probe appeared
red to the eye, which indicates (1) that energy transfer within the
ligated probe was efficient, and (2) that ligation of the
mismatched WT (HEX) probe occurred to a very small extent if at
all. In a second experiment, the same probes were incubated instead
with wild type DNA. Results in this case were quite distinct,
giving a clearly yellow ligation product having slightly slower
mobility, presumably because of the difference in dye structure.
None of this retarded yellow band was observable in the mutant DNA
ligation. In subsequent ligations the MUT/universal probe pair was
used in increasing dilutions with wild type DNA. The red MUT signal
appeared to dilute as expected, with no yellow-tagged product
visible, suggesting that unintended ligation occurs to very little
extent.
Discussion
[0144] The phosphorothioate-iodide autoligation chemistry is thus
shown to proceed efficiently on RNAs as well as DNAs, and we have
developed a three probe strategy coupled to a color change as a
reporting system. When products can be separated from reactants,
such as in blot or gel based assays, then simple radiolabeling can
be used for detection with autoligating probes. In that case, one
must probe for a single sequences at a time. The ALET probe
strategy, however, allows the ligation reaction to be followed
visually or spectroscopically. Since more than one acceptor dye can
be used, this makes it possible to use more than one mutation probe
simultaneously. Two were used in the present case, although it is
possible that more than two could be used with careful choice of
FRET donor with multiple acceptors.
[0145] The observation of turnover on the DNA target is interesting
and potentially useful, as it results in significant amplification
of the ligation signal. The observation of higher turnover at the
lowest target concentration is expected in a case of product
inhibition, as no doubt occurs here. It is expected that even lower
target concentrations would lead to higher degrees of turnover, as
the concentration of the duplex product necessarily drops. It is
also possible that alteration of the ligation chemistry might
result higher degrees of turnover by lowering duplex stability more
than pre-ligation complex stability. For example, incorporation of
a phosphorylacetylamino bond as in Letsinger et al. (U.S. Pat. No.
5,476,930), which approximates the natural phosphodiester linkage
less closely than a phosphorothioester or a phosphoroselenoester
linkage, might increase turnover on the DNA target. Alternatively,
use of a 5'-deoxy-5'-iodomethylene-2'-deoxynucleoside on the 5' end
of the upstream oligonucleotide probe might likewise destabilize
the hybridization with the target and increase turnover.
[0146] One of the most useful features of the autoligation
chemistry is its ability to be utilized in the direct detection of
RNAs. We are unaware of any other ligation-based genetic detection
method in which this capability has been demonstrated. At present,
RNAs are commonly detected by simple hybridization, such as in
Northern blots and in situ hybridization, or are detected
indirectly as their cDNAs after RT-PCR amplification. The present
method offers considerably higher sequence specificity than simple
hybridization alone, and the ALET probes allow for ease of
detection by changes in fluorescence emission. These probes can be
used with no more difficulty than simple hybridization probes,
since no extra reagents or enzymes are needed. Indeed, unreacted
probes are more easily washed from targets (such as in blots)
because of their very short length. In addition, the ALET probe
strategy allows unreacted probes to be easily distinguished from
ligated (specifically hybridized) probes because of the change in
emission wavelength on ligation. Although multiple dyes are used in
this approach, only one excitation source is required (as in ET
primers; S. Hung et al., Anal. Biochem. 252:78-88 (1997)) because
only one donor label is used. A possible limitation in this
autoligation strategy is that the current reagents allow only for
ligations in which the downstream probe has a "T" at its 5' end
(and thus the target has an "A" at this position). Nevertheless,
there is a simple answer to this problem: one could utilize a
5'-iodoC variant of the 5'-iodoT used here. While not commercially
available at present, we anticipate that it could be readily
produced (see Example VI).
[0147] Ligase enzymes have been used recently in a related
fluorescent reporter probe strategy, giving color-based FRET
signals (M. Samiotaki et al., Genomics 20:238-42 (1994)). However,
ligases, while highly sequence specific, require significantly
longer probes than the 7mers used here. Longer probes would likely
remain bound even prior to ligation, thus rendering the FRET
responsive to binding rather than ligation and necessitating
dissociation of the oligonucleotide probes or ligation product from
the template polynucleotide before ligation can actually be
detected. In addition, the use of longer sequences requires higher
stringency to wash away unligated probes. A second potential
difficulty with the use of ligase enzymes in this approach is that
efficient energy transfer as we observe here requires close dye
proximity, and it is questionable whether ligases (which are highly
sensitive to native DNA structure), would accept probes with dye
labels positioned within the ligase binding site. Third, as already
mentioned, ligase enzymes would not allow detection of RNA as do
ALET probes. Finally, the autoligating probes are simpler to use
because they do not need added reagents or enzymes for ligation to
occur; it remains to be seen whether this fact will allow
autoligations to be useful in intact cells or tissues.
Example V
Rapid and Selective Selenium-Mediated Autoligation of DNA
Strands
Introduction
[0148] This Example describes a convenient and efficient new
chemistry for the joining of DNA ends, and its use in detection of
RNA and DNA sequences. This autoligation approach involves the
reaction of a phosphoroselenoate anion on one strand with a
5'-carbon carrying an iodide leaving group on another. Selenium has
previously been incorporated into DNA at non-bridging positions in
the phosphodiester linkage (K. Mori et al., Nucleic Acids Res. 17,
8207-8219 (1989)); however, the monosubstituted selenium was
unstable and was rapidly lost. Prior to the present work, bridging
selenium esters were unknown in nucleic acids.
[0149] Thus the objectives of this study were to test (i) whether
the phosphoroselenoate anion would be stable enough in solution for
utility in ligations; (ii) whether the intended ligation reaction
would occur and at what rate; (iii) whether the product (a bridging
phosphoroselenoate ester embedded in a longer DNA strand) would be
hydrolytically stable; and (iv) how well this selenium-bridged DNA
hybridizes with complementary nucleic acids.
Oligonucleotide Synthesis
[0150] All oligodeoxynucleotides were synthesized on 1 mmole scale
on an ABI model 392 synthesizer using standard
b-cyanoethylphosphoramidite coupling chemistry. Deprotection and
removal of iodine-containing strands from the CPG support was done
by incubation in concentrated ammonia for 24 hours at 23.degree. C.
to avoid small amounts of degradation which occur at 55.degree. C.
Automated RNA synthesis was carried out using
t-butyldimethylsilyl-protected phosphoramidites from Glen Research.
Oligonucleotides were deprotected in 3:1 concentrated
ammonia:ethanol at 55.degree. C. for 18 hours and dried. Silyl
protecting groups were removed by adding 400 mL 1M
tetrabutylammonium fluoride in tetrahydrofuran (Sigma) to the
residue and shaking at room temperature for 24 hours. RNA was
desalted on a Sep-pak column (Water) and purified by denaturing
polyacrylamide gel electrophoresis. Purification of target
oligodeoxynucleotides was carried out by preparative denaturing
polyacrylamide gel electrophoresis. All DNAs and RNAs were
quantitated by UV absorbance using the nearest neighbor
approximation to calculate molar absorptivities.
Incorporation of Selenium
[0151] Oligonucleotides containing 3' phosphoroselenoate groups
were prepared as for 3' phosphate groups, but with selenizing
reagents replacing the standard oxidation step. Typically, the
synthesis was initiated using Phosphate-ON controlled pore glass
(Glen Research). Detritylation was followed by coupling with the 3'
end nucleotide (in this case, using G phosphoramidite (Applied
Biosystems)). Prior to the next step (oxidation), the synthesis was
stopped. The selenization reaction was carried out manually, by
removing the synthesis column from the synthesizer. Two selenizing
reagents were tried: a solution of 0.1M KSeCN (Aldrich) in
CH.sub.3CN (N. Seeman, Annu. Rev. Biophys. Biomol. Struct, 27,
225-248 (1998)). and a suspension of 0.1M Se powder (Aldrich) in
dioxane (W. Stec et al., J. Am. Chem. Soc., 106, 6077-6079 (1984)).
Both were purged with nitrogen for one hour to remove oxygen. 0.1M
KSeCN/CH.sub.3CN was found to give a higher degree of selenium
incorporation. The controlled pore glass beads were transferred
from the DNA synthesis column to a screw-cap vial. The vial was
filled with the selenizing reagent, and shaken at room temperature
for 20 hours. Beads were recovered by filtering through glass wool.
After washing with CH.sub.3CN, beads were put back into the DNA
synthesis column and the rest of the chain elongation was carried
out in the normal fashion. Deprotection and cleavage from the
support was carried out in concentrated ammonia for 24 hr at
23.degree. C. The deprotection solutions were lyophilized to a
pellet, and the oligonucleotides were used without further
manipulation.
Synthesis of 5'-Iodinated Oligonucleotides
[0152] Oligodeoxyribonucleotides were synthesized on an Applied
Biosystems (ABI) 392 synthesizer using standard
b-cyanoethylphosphoramidite chemistry. 5' Iodo-oligonucleotides
were synthesized by the standard coupling protocol using a
5'-iodo-T phosphoramidite from Glen Research (Examples I and II).
Deprotection and removal of iodine-containing strands from the CPG
support was done by incubation in concentrated ammonia for 24 hours
at 23.degree. C. to avoid small amounts of degradation that occur
at 55.degree. C. Oligonucleotides were used without further
manipulation after lyophilization. They were quantitated by the
nearest neighbor method. Iodo-T was treated as unmodified T in
these calculations.
Ligation Reactions
[0153] Ligations were performed in 600 ml pH 7.0 Tris-borate (70
mM) buffer containing 10 mM MgCl.sub.2, with target and probe DNA
concentrations of 1.3 mM. Ligations also contained 50 mM
dithiothreitol. Reactions were incubated at 37.degree. C. Aliquots
(100 mL) were removed at various times and then were frozen and
lyophilized for one hour. Pellets were taken up in 5 mL
water-formamide-urea loading buffer. Samples were heated to
95.degree. C. for 2 minutes and then chilled on ice prior to
loading on 20% polyacrylamide gels containing 8 M urea. Gels were
visualized with Stains-All dye (Sigma) and quantified by
densitometry using NIH Image version 1.62b7 software.
[0154] In cases that were followed quantitatively, a
fluorescent-labeled iodinated oligonucleotide (as in FIG. 19, but
with fluorescein-dT (Glen Research) replacing T at the 3rd
position) was used. Fluorescence images of gels were obtained using
a Molecular Dynamics Storm 860 Fluorimager, and ligated starting
material and product bands were quantitated with ImageQuant
(Version 1.2). FIG. 21 shows the time course of ligation of 7mer
and 13mer probes on a DNA template using phosphoroselenoate or
phosphorothioate as nucleophile. The 13mer probe is labeled with
fluorescein, and fluorescence is imaged on a Molecular Dynamics 860
Phosphorimager/Fluorimager. The lane at far right shows extent of
ligation of mutant probes on the singly mismatched wild-type DNA
target after 1440 minutes. In some cases, ligation products were
isolated by preparative denaturing polyacrylamide gel
electrophoresis. Bands were visualized by UV shadowing, and were
excised from the gel. The crushed gel was incubated with 0.1 N NaCl
and the DNA solution was separated from the gel by centrifugal
filtration. The DNAs were desalted by dialysis against water.
[0155] Ligated oligonucleotides were characterized by their gel
mobility and by electrospray mass spectrometry: [0156] 5'dGTG GGC
GCC G-pO-TC GGT GT (SEQ ID NO:9) calculated mass 5274.6; found,
5274 [0157] 5'dGTG GCG GCC G-pS-TC GGT GT (SEQ ID NO:10) calculated
mass 5290.6; found, 5290 [0158] 5'dGTG GGC GCC G-pSe-TC GGT GT (SEQ
ID NO:11) calculated mass 5337.6; found, 5337 Thermal Denaturation
Studies
[0159] Solutions for thermal denaturation studies contained a 1:1
ratio of the complementary strands shown below (1.0 mM each). Also
present was 10 mM MgCl.sub.2 buffered with 10 mM Na.cndot.PIPES at
pH 7.0. Solutions were heated to 90.degree. C. and allowed to cool
slowly to room temperature prior to the melting experiments.
[0160] Melting studies were carried out in Teflon-stoppered 1 cm
path length quartz cells under a nitrogen atmosphere on a Varian
Cary 1 UV-VIS spectrophotometer equipped with a thermoprogrammer.
Absorbance was monitored at 260 nm while the temperature was raised
from 10.degree. C. to 90.degree. C. at a rate of 0.5.degree.
C./min. Melting temperatures were determined by computer fitting
using program Meltwin 3.0 assuming a two state model.
Hydrolysis Studies
[0161] Oligonucleotides were incubated in Tris.cndot.HCl buffers
(10 mM) at the indicated pH at 23.degree. C. The DNA concentration
was 25 mM. After 7 days, 5 mL aliquots were removed and added to 5
mL water-formamide-urea loading buffer. Samples were heated t
95.degree. C. for 2 minutes and then chilled on ice prior to
loading on a 20% polyacrylamide gel containing 8 M urea. Gels were
visualized with Stains-All dye (Sigma).
Results and Discussion
[0162] We incorporated selenium into short synthetic DNA strands by
methods analogous to those commonly used for sulfur (e.g., S.
Beaucage et al., Tetrahedron, 48, 2223-2311 (1992). We found KSeCN
to be more convenient as a selenizing reagent than Se powder, and
experimentation showed that the reaction could be carried out on
the glass beads after temporary removal from the synthesizer. The
presence of the selenium did not noticeably affect the subsequent
phosphoramidite coupling yields. The end-selenated oligonucleotides
were removed from the solid support and deprotected using standard
ammonia conditions. Because of uncertainties as to the long-term
stability of the terminal phosphoroselenoate anion, we used this
modified DNA without further purification in subsequent ligation
reactions. For reaction with this nucleophile we prepared
5'-iodinated oligonucleotides by incorporation of 5'-iodothymidine
phosphoramidite, as described in Examples I and II.
[0163] As with other DNA ligations, this chemistry requires that
the reacting ends be bound at adjacent sites on a longer
complementary template strand, which serves to raise effective
concentrations of the reactive groups markedly. Ligations were
therefore carried out in the presence of fully complementary DNA or
RNA template strands. The sequences chosen for the studies were
taken from the H-ras protooncogene (the target sequence "WT") and
the activated H-ras oncogene (labeled "MUT"), which has a
C.fwdarw.A point mutation in codon 12 (FIG. 19). We used a 13mer
iodinated probe that was fully complementary both to normal and
oncogene sequences. Combined with this were used either of two
shorter (7mer) selenium-containing probes, one complementary to the
normal codon 12 and the other to the mutant sequence. The reactions
were carried out at 1.3 mM DNA concentration in a pH 7.0
Tris-borate buffer containing 10 mM MgCl.sub.2, and were
quantitated by fluorescence imaging of gels separating ligated
products.
[0164] Experiments showed that on the DNA target, the selenium
chemistry proceeds more rapidly than the older sulfur chemistry
(FIG. 20). Analysis of the initial slopes of product yields as a
function of time shows a difference of 3.7-fold in rate when MUT
probes were used on the MUT target DNA. Similarly, we carried out
the same reaction on the MUT target RNA, and we again found that
the selenium chemistry proceeded more rapidly (a 3.5-fold
difference).
[0165] Importantly, we found that the selenium/iodide autoligation
was highly sensitive to the sequence of the target nucleic acid. We
carried out a ligation reaction using the 13mer iodo-probe with the
7mer MUT selenium-containing probe and followed the course of the
reaction with fully complementary (MUT) or singly mismatched (WT)
DNAs. The mismatch in the latter case is T-C. While the fully
complementary ligation proceeded to 27% yield in 60 minutes, the
mismatched case showed no ligated product at this short time. After
24 hours, we were able to detect a trace of ligation product;
quantitation of this product suggests a 190-fold slower rate for
ligation based on the initial slopes. Thus the selenium ligation is
highly sensitive to a single base mismatch. This is greater
selectivity than reported for T4 DNA ligase, the enzyme most widely
used for ligations.
[0166] Because bridging selenium esters were previously unknown in
DNA, we characterized the product, a 5' bridging
phosphoroselenoester, produced in an autoligation reaction.
Electrospray mass spectrometry confirmed the presence of the
selenium in a 17mer DNA strand, clearly distinguishing it from
sulfur- and oxygen-containing strands of the same sequence. The
hydrolytic stability of this joined DNA was also tested, by a
seven-day incubation at 23.degree. C. in buffers over the pH range
5-9. We found no measurable degradation at any of these pH values,
indicating that the bridging ester has good stability. Based on
these data, we place a lower limit of at least one year on the
half-life for hydrolysis of this junction under these
conditions.
[0167] In a related experiment, the ALET probe strategy of Example
IV was successfully adapted to the selenium-mediated ligation, and
ligation was detectable by way of fluorescence resonance energy
transfer.
[0168] Finally, we tested the ability of the selenium-bridged DNA
to hybridize to a complementary strand of DNA. For comparison we
evaluated sulfur-bridged DNA and natural DNA having the same
sequence. Binding stability of the resulting duplexes were measured
by thermal denaturation experiments in pH 7 buffer containing 10 mM
Mg.sup.2+. The results showed that the selenium-bridged DNA
hybridizes somewhat less strongly than the natural
oxygen-containing case, with T.sub.m values (free energies
(70.degree. C.)) of 73.degree. C. (-11.3 kcal/mol) for selenium and
76.degree. C. (-13.1 kcal/mol) for oxygen. Perhaps not
surprisingly, the sulfur case falls between the two at 74.degree.
C. (-12.0 kcal/mol). Overall, the selenium does not appear to be
strongly destabilizing to the double helix.
[0169] In Examples III and IV we showed that a sulfur-mediated
autoligation reaction can be employed in sequence-sensitive
detection of nucleic acids in solution. The results in this Example
show that the use of selenium as a nucleophile allows for a
substantial increase in ligation rate, and that the chemistry is
carried out with equal ease. Importantly, the selenium reaction can
be carried out on RNA strands as readily as DNA strands and shows
very high selectivity against point mutations. It is notable that
enzyme-mediated ligations are widely used in diagnostic sensing of
DNA sequences, but cannot be used for RNA analysis. Thus, the
selenium autoligation may prove useful in diagnostic strategies for
direct analysis of RNAs. Because the newer selenium-mediated
reaction is faster, we anticipate that it may prove more convenient
than previous sulfur chemistry.
[0170] The selenium/iodide autoligation reaction may also find
utility in a number of other applications for which previous
ligation chemistries may not be well suited. For example, the
selenium may be employed for probing mechanisms of catalyzed
nucleic acid hydrolysis, which seems plausible given that sulfur
substitution is widely used for this kind of study. In addition,
selenium incorporation in DNAs may find use in structural biology,
since heavy atom replacement is widely used as an aid in solving
complex x-ray crystal structures of large biomolecules and
complexes. It has not previously been possible to stably
incorporate selenium into DNA, in analogy to the use of
selenomethionine in proteins (see, e.g., I. Uson et al., Curr.
Opin. Struct. Biol., 9, 643-648 (1999)).
Example VI
Synthesis of Various 5'-Iodo-2'-deoxynucleosides
Base-Protected Derivatives of 5'-iodo-5'deoxy-2'-deoxycytidine
[0171] Using the standard transient protection strategy,
2'-deoxycytidine was treated in pyridine first with trimethylsilyl
chloride and then benzoyl chloride to protect the N4-amino group as
the benzoyl derivative, which was purified by silica gel
chromatography. The base-protected nucleoside was then treated with
Moffat's reagent (methyltriphenoxyphosphonium iodide) in
tetrahydrofuran solvent to yield the protected
5'-iodo-5'-deoxy-2'-deoxycytidine in moderate yield. It was
purified by silica gel chromatography.
[0172] To prepare this nucleoside for DNA synthesis, the
3'-O-phosphoramidite derivative is prepared by reacting the
iodonucleoside with 2-cyanoethyldiisopropylaminophosphonamidic
chloride in the presence of diisopropylethylamine. The product is
isolated by silica gel chromatography.
Base-Protected Derivatives of 5'-iodo-5'deoxy-2'-deoxyadenosine
[0173] Using the standard transient protection strategy,
2'-deoxycytidine was treated in pyridine first with trimethylsilyl
chloride and then benzoyl chloride to protect the N6-amino group as
the benzoyl derivative, which was purified by silica gel
chromatography. The base-protected nucleoside was then treated with
Moffat's reagent in tetrahydrofuran solvent to yield the
5'-iodo-5'-deoxy-2'-deoxyadenosine derivative in moderate yield. It
was purified by silica gel chromatography.
[0174] To prepare this nucleoside for DNA synthesis, the
3'-O-phosphoramidite derivative is prepared by reacting the
iodonucleoside with 2-cyanoethyldiisopropylaminophosphonamidic
chloride in the presence of diisopropylethylamine. The product is
isolated by silica gel chromatography.
Base-Protected Derivatives of 5'-iodo-5'deoxy-2'-deoxyguanosine
[0175] Using the standard transient protection strategy,
2'-deoxycytidine was treated in pyridine first with trimethylsilyl
chloride and then isobutyric anhydride to protect the N2-amino
group as the isobutyryl derivative, which was purified by silica
gel chromatography. The base-protected nucleoside was then treated
with Moffat's reagent in tetrahydrofuran solvent to yield the
5'-iodo-5'-deoxy-2'-deoxyguanosine derivative in moderate yield. It
was purified by silica gel chromatography.
[0176] To prepare this nucleoside for DNA synthesis, the
3'-O-phosphoramidite derivative is prepared by reacting the
iodonucleoside with 2-cyanoethyldiisopropylaminophosphonamidic
chloride in the presence of diisopropylethylamine. The product is
isolated by silica gel chromatography.
[0177] The complete disclosure of all patents, patent applications,
and publications, and electronically available material (e.g.,
GenBank amino acid and nucleotide sequence submissions) cited
herein are incorporated by reference. The foregoing detailed
description and examples have been given for clarity of
understanding only. No unnecessary limitations are to be understood
therefrom. The invention is not limited to the exact details shown
and described, for variations obvious to one skilled in the art
will be included within the invention defined by the claims.
Sequence CWU 1
1
40 1 28 DNA Artificial Sequence autoligating hairpin 1 nccagcgtac
ttttgtacgc tggatgcn 28 2 28 DNA Artificial Sequence hairpin 2
tccagcgtac ttttgtacgc tggatgca 28 3 12 DNA Artificial Sequence
oligonucleotide 3 ntcacgagcc tg 12 4 18 DNA Artificial Sequence
splint oligomer 4 ctagtccaaa gtgctcgg 18 5 20 DNA Artificial
Sequence oligonucleotide 5 natcaggntt cacgagcctg 20 6 20 DNA
Artificial Sequence 20mer duplex carrying a sulfur linkage 6
gatcaggntt cacgagcctg 20 7 20 DNA Artificial Sequence sense primer
7 gtggggcagg agaccctgta 8 20 DNA Artificial Sequence antisense
primer 8 ccctcctcta gaggaagcag 20 9 17 DNA Artificial Sequence
ligated oligonucleotide 9 gtgggcgccg tcggtgt 17 10 17 DNA
Artificial Sequence ligated oligonucleotide 10 tgggcgccn tcggtgt 17
11 17 DNA Artificial Sequence ligated oligonucleotide 11 gtgggcgccn
tcggtgt 17 12 12 DNA Artificial Sequence ssDNA starting sequence 12
ntcacgagcc tg 12 13 18 DNA Artificial Sequence ssDNA template 13
ggctcgtgaa acctgatc 18 14 20 DNA Artificial Sequence product of
ssDNA ligation 14 gatcaggntt cacgagcctg 20 15 28 DNA Artificial
Sequence duplex DNA starting sequence 15 nccagcgtac ttttgtacgc
tggatgcn 28 16 56 DNA Artificial Sequence circular product of
duplex DNA ligation 16 nccagcgtac ttttgtacgc tggatgcanc cagcgtactt
ttgtacgctg gatgca 56 17 20 DNA Artificial Sequence splint oligomer
17 acggtccaaa acatattttg 20 18 30 DNA Artificial Sequence one-pot
ligation oligonucleotide 18 ngatcacttc gtctcttcag caaaatatgn 30 19
33 DNA Artificial Sequence one-pot ligation oligonucleotide 19
nttggaccgt tggtttcgac ttgtcagagg acn 33 20 18 DNA Artificial
Sequence splint oligonucleotide 20 agtgatcaag tcctctga 18 21 63 DNA
Artificial Sequence circular product of one-pot ligation 21
nttggaccgt tggtttcgac ttgtcagagg actngatcac ttcgtctctt cagcaaaata
60 tgt 63 22 17 DNA Artificial Sequence 18mer complementary strand
22 taatacgact cactata 17 23 45 DNA Artificial Sequence template for
replication/transcription 23 gatcaggtnt cacgagcctt atccgtccta
tagtgagtcg tatta 45 24 58 DNA Artificial Sequence 5'-bridging
phosphorothioate duplex DNA 24 nccagcgtat cttttgatac gctggatgca
nccagcgtac ttttgtacgc tggatgca 58 25 58 DNA Artificial Sequence all
phosphodiester DNA 25 tccagcgtat cttttgatac gctggatgca tccagcgtac
ttttgtacgc tggatgca 58 26 10 DNA Artificial Sequence linear
autoligation probe 26 gtgggcgccn 10 27 28 DNA Artificial Sequence
MUT target 27 cttacccaca ccgacggagc ccaccacc 28 28 28 DNA
Artificial Sequence 5'MM target 28 cttacccaca ccgccggagc ccaccacc
28 29 28 DNA Artificial Sequence 3'MM target 29 cttacccaca
ccgaaggagc ccaccacc 28 30 28 DNA Artificial Sequence MMM target 30
cttacccaca cggacggagc ccaccacc 28 31 48 DNA Artificial Sequence
cyclization probe 31 ncggtgtggg ttttcactga atatcacgat tacattttgt
gggcgccn 48 32 28 DNA Artificial Sequence MMM target 32 cttacccaaa
ccgacggagc ccaccacc 28 33 28 DNA Artificial Sequence MUT target 33
cttgaaaacc cacaccgacg gcgcatca 28 34 28 DNA Artificial Sequence
3'MM target 34 cttgaaaacc cacaccgaag gcgcatca 28 35 28 DNA
Artificial Sequence MMM target 35 cttgaaaacc cacaccgacg tcgcatca 28
36 13 DNA Artificial Sequence linear probe 36 ngtgggcaag agt 13 37
50 DNA Artificial Sequence wild-type target 37 gtcagcgcac
tcttgcccac accgccggcg cccaccacca ccagcttata 50 38 50 DNA Artificial
Sequence mutant H-ras target 38 gtcagcgcac tcttgcccac accgacggcg
cccaccacca ccagcttata 50 39 13 DNA Artificial Sequence universal
probe 39 ngngggcaag agt 13 40 28 RNA Artificial Sequence H-ras
oncogene target 40 gcgcacucuu gcccacaccg acggcgcc 28
* * * * *