U.S. patent application number 10/323179 was filed with the patent office on 2006-07-06 for biocidal proteins.
Invention is credited to Willem Frans Broekaert, Bruno Philippe Angelo Cammue, Rupert William Osborn, Sarah Bronwen Rees, Josef Vanderleyden.
Application Number | 20060148717 10/323179 |
Document ID | / |
Family ID | 27450690 |
Filed Date | 2006-07-06 |
United States Patent
Application |
20060148717 |
Kind Code |
A1 |
Broekaert; Willem Frans ; et
al. |
July 6, 2006 |
Biocidal proteins
Abstract
Biocidal proteins capable of isolation from seeds have been
characterized. The proteins have an amino acid sequence containing
the common cysteine/glycine domain of Chitin-binding Plant Proteins
but show substantially better activity against pathogenic fungi, a
higher ratio of basic amino acids to acidic amino acids, and/or
antifungal activity which results in increased hyphal branching.
Antimicrobial proteins isolated from Amaranthus, Capsicum, Briza
and related species are provided. The proteins show a wide range of
antifungal activity and are active against Gram-positive bacteria.
DNA encoding the proteins may be isolated and incorporated into
vectors. Plants may be transformed with this DNA. The proteins find
agricultural or pharmaceutical application as antifungal or
antibacterial agents. Transgenic plants expressing the protein will
show increased disease resistance.
Inventors: |
Broekaert; Willem Frans;
(Dilbeek, BE) ; Cammue; Bruno Philippe Angelo;
(Alsemberg, BE) ; Osborn; Rupert William;
(Middlesex, GB) ; Rees; Sarah Bronwen; (Berkshire,
GB) ; Vanderleyden; Josef; (Heverlee, BE) |
Correspondence
Address: |
Syngenta
P.O. Box 12257
3054 Cornwallis Rd.
Research Triangle Park
NC
27709
US
|
Family ID: |
27450690 |
Appl. No.: |
10/323179 |
Filed: |
December 18, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09298574 |
Apr 29, 1999 |
6521590 |
|
|
10323179 |
Dec 18, 2002 |
|
|
|
08777113 |
Dec 30, 1996 |
5986176 |
|
|
09298574 |
Apr 29, 1999 |
|
|
|
08451566 |
May 26, 1995 |
5691199 |
|
|
08777113 |
Dec 30, 1996 |
|
|
|
08149839 |
Nov 10, 1993 |
5514779 |
|
|
08451566 |
May 26, 1995 |
|
|
|
08002842 |
Jan 14, 1993 |
|
|
|
08149839 |
Nov 10, 1993 |
|
|
|
PCT/GB92/00999 |
Jun 3, 1992 |
|
|
|
08002842 |
Jan 14, 1993 |
|
|
|
Current U.S.
Class: |
435/325 ;
435/252.3; 435/320.1; 435/348; 435/69.1; 514/21.4; 514/3.3;
530/329 |
Current CPC
Class: |
C07K 14/415 20130101;
A01N 65/20 20130101; A01N 65/38 20130101; C12N 15/8281 20130101;
A61K 38/00 20130101; A01N 65/32 20130101; A01N 65/44 20130101; C12N
15/8282 20130101 |
Class at
Publication: |
514/017 ;
530/329; 435/069.1; 435/320.1; 435/325; 435/252.3; 435/348 |
International
Class: |
A61K 38/08 20060101
A61K038/08; C07K 7/06 20060101 C07K007/06; C12P 21/06 20060101
C12P021/06 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 7, 1991 |
GB |
9112300.0 |
Nov 12, 1992 |
GB |
9223708.0 |
Feb 23, 1993 |
GB |
9303564.0 |
Claims
1. An isolated DNA sequence encoding a protein comprising
-cysteine-cysteine-(serine or threonine)-(one amino
acid)-(tryptophan, tyrosine or phenylalanine)-glycine-(tryptophan,
tyrosine or phenylalaine)-cysteine-glycine-(SEQ ID NO:21), wherein
said protein has a ratio of basic amino acids to acidic amino acids
of 5:1, 4:1 or 3:1, and wherein said protein also has antimicrobial
and/or antifungal activity, said antifungal activity being at least
one order of magnitude greater than the antifungal activity of
hevein or nettle lectin.
2. The isolated DNA sequence as claimed in claim 1, wherein said
antimicrobial and/or antifungal activity is activity against plant
pathogenic fungi resulting in hyphal branching.
3. A vector containing a DNA sequence as claimed in claim 1.
4. A vector containing a DNA sequence as claimed in claim 2.
5. A biological system including an isolated DNA sequence as
claimed in claim 1.
6. A biological system including an isolated DNA sequence as
claimed in claim 2.
7. The biological system of claim 5 which is selected from the
group consisting of a micro-organism, a cultured insect cell, a
cultured mammalian cell and a plant cell.
8. The biological system of claim 6 which is selected from the
group consisting of a micro-organism, a cultured insect cell, a
cultured mammalian cell and a plant cell.
9. An isolated DNA sequence as claimed in claim 1 wherein said
protein comprises a central motif of -cysteine-(four amino
acids)-cysteine-cysteine (serine or threonine)-(one amino
acid)-(tryptophan, tyrosine or phenylalanine)-glycine-(tryptophan,
tyrosine or phenylalanine)-cysteine-glycine (five amino
acids)-cysteine-(six amino acids)-cysteine-(SEQ ID No. 22).
Description
[0001] This is a divisional of application Ser. No. 09/298,574
filed on Apr. 29, 1999, which is a continuation of application Ser.
No. 08/777,113 filed on Dec. 30, 1996, now U.S. Pat. No. 5,986,176,
which is a divisional of application Ser. No. 08/451,566 filed May
26, 1995, now U.S. Pat. No. 5,597,801, which is a divisional of
application Ser. No. 08/149,839 filed Nov. 10, 1993, now U.S. Pat.
No. 5,514,779, which is a continuation-in-part of application Ser.
No. 08/002,842, filed Jan. 14, 1993, now abandoned, which is a
continuation-in-part of PCT/GB92/00999 filed Jun. 3, 1992.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] This invention relates to biocidal proteins, processes for
their manufacture and use, and DNA sequences encoding them. In
particular it relates to a class of antimicrobial proteins
including protein capable of being isolated from seeds of
Amaranthus, Capsicum or Briza.
[0004] In this context, antimicrobial proteins are defined as
proteins possessing at least one of the following activities:
antifungal activity (which may include anti-yeast activity);
antibacterial activity. Activity includes a range of antagonistic
effects such as partial inhibition or death. Such proteins may be
oligomeric or may be single peptide subunits.
[0005] 2. Description of the Related Art
[0006] Amaranthus caudatus (amaranth) belongs to a large family,
the Amaranthaceae, of herbs and shrubs which grow widely in
tropical, sub-tropical and temperate regions. Amaranth is an
ancient food crop of the Americas, and is still cultivated for
grain production in parts of Central and South America, Asia and
Africa. Amaranth seeds can be popped, toasted, cooked for gruel,
milled into flour or made into flat breads, and have a particularly
high nutritive value (Betschart et al, 1981, J Food Sci,
46:1181-1187; Pedersen et al, 1987, Plant Food Hum Nutr,
36:309-324). Amaranth is also cultivated world-wide as a garden
ornamental.
[0007] The genus Capsicum comprises fifty species and includes many
important vegetable species which are grown throughout the world
(for example, green and red peppers, chillies, paprika and cayenne
pepper). As well as these widely cultivated examples, Capsicum also
includes a number of species which are grown for their colourful
but inedible fruits.
[0008] The genus Briza comprises many ornamental grasses and
belongs to the Gramineae family. The genus is closely related to
grass species found in high-grade temperate pasture, such as rye
grass.
[0009] Plants produce a wide array of antifungal compounds to
combat potential invaders and over the last ten years it has become
clear that proteins with antifungal activity form an important part
of these defences. Several classes of proteins have been described
including thionins, beta-1,3-glucanases, ribosome-inactivating
proteins and chitinases. This last group of enzymes falls into a
wider class hereafter referred to as the "Chitin binding Plant
Proteins".
[0010] Chitin (poly-.beta.-1,4-N-acetyl-D-glucosamine) is a
polysaccharide occurring in the cell wall of fungi and in the
exoskeleton of invertebrates. Although plants do not contain chitin
or chitin-like structures, proteins exhibiting strong affinity to
this polysaccharide have been isolated from different plant sources
(Raikhel and Broekaert, 1991, in: Verma, ed, Control of plant gene
expression, in press).
[0011] Basic chitinases have been isolated from bean (Boller et al,
1983, Planta, 157:22-31), wheat (Molano et al, 1979, J Biol Chem,
254:4901-4907), tobacco (Shinshi et al, 1987, Proc Nat Acad Sci
USA, 84:89-93) and other plants. The other known Chitin-binding
Plant Proteins have no defined catalytic activity and have thus
been described solely on their lectin activity. These include
chitin-binding lectins from wheat (Rice and Etzler, 1974, Biochem
Biophys Res Comm, 59:414-419), barley (Peumans et al, 1982, Biochem
J, 203:239-143), rice (Tsuda, 1979, J Biochem, 86:1451-1461) and
stinging nettle (Peumans et al, 1983, FEBS Lett, 177:99-103) plus a
small protein from the latex of the rubber tree, called hevein (van
Parijs et al, 1991, Planta, 183:258-264).
[0012] Thus the Chitin-binding Plant Proteins (as herein defined)
are a protein group consisting of chitinases, chitin-binding
lectins and hevein. All these proteins contain a conserved
cysteine-glycine rich domain (for a review see Raikel and
Broekaert, 1991, in Control of plant gene expression, Verma D P
(ed), Telford Press). This common region may confer the
chitin-binding activity. The domain is 40-43 amino acids in length
and is either repeated twice (nettle lectin), four-fold (in wheat,
barley and rice lectins) or fused to an unrelated domain (in basic
chitinases and prohevein). Hevein itself is 43 amino acids in
length and comprises essentially just this conserved domain
(Broekaert et al, 1990, Proc Nat Acad Sci USA, 87:7633-7637). A
cDNA clone (HEV1) encoding hevein has been isolated (Raikhel and
Broekaert, U.S. Pat. No. 5,187,262, published 16 Feb. 1993). FIG.
15 shows the common cysteine/glycine-rich domain found in the
following Chitin-binding Plant Proteins: tobacco chitinase, bean
chitinase, hevein, wheat lectin, nettle lectin. Sequence identities
and conserved changes are boxed (conserved changes are considered
as substitutions within the amino acid homology groups Phe/Trp/Tyr,
Met/Ile/Leu/Val (SEQ ID NO: 20), Arg/Lys/His, Glu/Asp, Asn/Gln,
Ser/Thr, and Pro/Ala/Gly; gaps introduced for maximum alignment are
represented by dashes). The central region of nine amino acid
residues is a particularly well conserved feature of the domain and
has the sequence (SEQ ID NO: 21): TABLE-US-00001
cysteine--cysteine- (serine or threonine) - 1 2 3 (any residue) -
(tryptophan, tyrosine of phenyl- alanine) 4 5 -glycine-
(tryptophan, tyrosine or phenyl- alanine) - 5 7 -cysteine-glycine.
8 9
[0013] Around this core region, the central cysteine motif of the
cysteine/glycine rich domain is also absolutely conserved and has
the sequence (SEQ ID NO: 22): cysteine-(four amino
acids)-cysteine-cysteine-(five amino acids)-cysteine-(six amino
acids)-cysteine.
[0014] The exact physiological role of these proteins remains
uncertain, but a defence-related function has been suggested. The
Chitin-binding Plant Proteins have been found to affect the growth
of certain organisms that contain chitin (fungi or insects).
However there are differences in the specificity of the proteins.
For example, the wheat/barley/rice-type lectins are toxic to
weevils, but are inactive to fungi in vitro (Murdock et al, 1990,
Phytochem, 29:85-89). On the other hand, hevein and the chitinases
have been found to be inhibitory to the growth of certain
pathogenic fungi in vitro (Van Parijs et al, 1991 Planta,
183:258-264; Broekaert et al, 1988, Physiol Mol Plant Path,
33:319-331). The HEV1 protein can be used to inhibit the growth of
fungi (Raikhel and Broekaert, U.S. Pat. No. 5,187,262, published
Feb. 16, 1993). Nettle lectin has also been shown to exert
antifungal activity in vitro and at a level 2- to 5-fold greater
than hevein (Broekaert et al, 1989, Science, 245:1100-1102). It is
not established whether or not the observed effects on fungi or
insects are related to the chitin-binding activity of these
proteins.
[0015] Application of Chitin-binding Plant Proteins, especially
chitinases, in the protection of plants against fungal disease has
been reported, and the potential usefulness of these proteins to
engineer resistance in plants has been described (for example,
Pioneer Hi Bred's European Patent Application 502718). In U.S. Pat.
No. 4,940,840 (DNA Plant Technology Corporation), tobacco plants
expressing a chitinase gene from the bacterium Serratia marcescens
appear to be less sensitive to the fungus Alternaria longipes.
European Patent Application Number 418695 (Ciba Geigy) describes
the use of regulatory DNA sequences from tobacco chitinase gene to
drive expression of introduced genes producing transgenic plants
with improved resistance to pathogens. Patent Application Number
W09007001 (Du Pont de Nemours Company) describes production of
transgenic plants which over-express a chitinase gene giving
improved resistance to fungal pathogens.
SUMMARY OF THE INVENTION
[0016] We have now identified a new class of potent antimicrobial
proteins.
[0017] According to the present invention, there is provided an
isolated antimicrobial protein having an amino acid sequence
containing the common cysteine/glycine domain of Chitin-binding
Plant Proteins and having one or more of the following
properties:
substantially better activity against plant pathogenic fungi than
that of the Chitin-binding Plant Proteins;
a higher ratio of basic amino acids to acidic amino acids than the
Chitin-binding Plant Proteins; activity against plant pathogenic
fungi resulting in hyphal branching.
[0018] In particular there is provided an antimicrobial protein
capable of being isolated from seeds of Amaranthus, an
antimicrobial protein capable of being isolated from seeds of
Capsicum, and an antimicrobial protein capable of being isolated
from seeds of Briza. Such antimicrobial proteins may also be
isolated from the seeds of both related and unrelated species
(including Catapodium, Baptisia, Microsensis, Delphinium), or may
be produced or synthesized by any suitable method.
[0019] We have isolated two antimicrobial proteins from seeds of
Amaranthus caudatus (amaranth). The two protein factors are
hereafter called Ac-AMP1 (Amaranthus caudatus-Antimicrobial Protein
1) and Ac-AMP2 (Amaranthus caudatus-Antimicrobial Protein 2)
respectively. Both are dimeric proteins, composed of two identical
3 kDa subunits. Both proteins are highly basic and have pI values
above 10. Proteins with similar antifungal activity have been
extracted from the seed of several closely related species,
including Amaranthus paniculatus, Amaranthus retroflexus,
Amaranthus lividus and Gomphrena globossa.
[0020] The amino acid sequence of Ac-AMP1 (29 residues) is
identical to that of Ac-AMP2 (30 residues), except that the latter
has one additional residue at the carboxyl-terminus. A similar
antimicrobial protein, hereafter called Ar-AMP1, has been isolated
from Amaranthus retroflexus seed. The amino acid sequence of
Ar-AMP1 (31 residues) is almost identical to that of Ac-AMP2,
having one additional residue at the carboxyl-terminus plus one
conservative change and two real amino acid changes.
[0021] The amino acid sequences of Ac-AMP1 and Ac-AMP2 are highly
homologous to those of the Chitin-binding Plant Proteins and
essentially comprise the cysteine/glycine-rich domain identified in
chitin-binding lectins. Moreover, Ac-AMP1 and Ac-AMP2 bind to
chitin and can be desorbed at low pH (a property shared by
chitinases and lectins). However, when compared to the regular
40-43 amino acid cysteine/glycine-rich domains found in the
Chitin-binding Plant Proteins, the Ac-AMPs distinguish themselves
by several features. These include a higher abundance of basic
amino acids, the presence of an additional amino-terminal residue,
the occurrence of a gap of four amino acids at position 6 to 9, and
the lack of a carboxyl-terminal portion of 10-12 residues.
[0022] Both Ac-AMP1 and Ac-AMP2 show surprisingly high activity:
they inhibit the growth of a variety of plant pathogenic fungi at
much lower doses than the antifungal Chitin-binding Plant Proteins.
The antifungal effect of the novel proteins is antagonized by
Ca.sup.2+. On five tested fungi, the antifungal activity of Ar-AMP1
is indistinguishable from that of the Ac-AMPs.
[0023] Some Chitin-binding Plant Proteins are known to have an
effect against insects which possess an exoskeleton comprising
chitin. The sequence similarity between the Ac-AMPs and the
Chitin-binding Plant Proteins implies that the Ac-AMPs may also
possess insecticidal properties.
[0024] We have also purified a new antimicrobial protein from seeds
of Capsicum annuum, hereafter called Ca-AMP1 (Capsicum annuum
antimicrobial protein 1). The protein shares the common
cysteine/glycine domain of the Chitin-binding Plant Proteins, but
is unique as it possesses very potent and broad spectrum antifungal
activity which is at least an order of magnitude greater than
hevein or nettle lectin. So despite the conserved nature of these
protein sequences (for example, the amino acid sequence for Ca-AMP1
is 65% identical to hevein), the Capsicum protein is markedly
improved in the potency and spectrum of its antifungal activity.
Indeed, it is remarkable that Ca-AMP1 and hevein are so similar in
size and amino acid sequence, but differ so dramatically in their
levels and spectrum of activity.
[0025] We have also purified a new antimicrobial protein from seeds
of Briza maxima, hereafter called Bm-AMP1 (Briza maxima
antimicrobial protein 1). The protein shares the common
cysteine/glycine domain of the Chitin-binding Plant Proteins, but
is unique as it possesses very potent and broad spectrum antifungal
activity. So despite the conserved nature of these protein
sequences, the Briza protein is markedly improved in the potency
and spectrum of its antifungal activity. The amino acid sequence
for Bm-AMP1 is 45% identical to Ca-AMP1 but only 35% to hevein.
[0026] The antifungal activity of Ca-AMP1 and of Bm-AMP1 is similar
to that of the Amaranthus (Ac-AMP) proteins discussed above: all
these proteins are substantially more basic than hevein or the
nettle lectin which may account for the difference in activity.
[0027] We have found that possession of an overall basic profile
contributes to the effectiveness of an antifungal protein. For
example, in different classes of antifungal proteins isolated from
Mirabilis and Raphanus it is always the more basic homologue that
is the most active (Terras et al, 1992, J Biol Chem,
267:15301-15309; Cammue et al, 1992, J Biol Chem, 267:2228-2233).
The basic amino acids are lysine (K), arginine (R) and histidine
(H); the acidic amino acids are aspartate (D) and glutamate (E).
Although the sequence of the Capsicum (Ca-AMP1) protein is very
similar to that of hevein, the ratio of basic to acidic amino acids
is 4:1 for Ca-AMP1 but 4:5 (ie much lower) for hevein. In Ac-AMP1,
the ratio of basic to acidic amino acids is 4:1 and in Ac-AMP2 and
Ar-AMP1 the ratio is 5:1. The ratio of basic to acidic amino acids
is 3:1 for Bm-AMP1. It may be that the basic nature of Ca-AMP1, the
Ac-AMPs, Ar-AMP1 and Bm-AMP1 accounts for their improved potency.
It is likely therefore that increasing the basic nature of certain
Chitin-binding Plant Proteins (such as hevein) using site-directed
mutagenesis would potentiate any antifungal activity, particularly
if substitutions were made at positions where there are basic amino
acids in the Capsicum (Ca-AMP1) protein (such as replacement of the
aspartic acid at position 28 in hevein) or at positions where there
are basic amino acids in the Briza (Bm-AMP1) protein. By adapting
the structure of certain Chitin-binding Plant Proteins, it is
therefore possible to create new, more potent antimicrobial
proteins of the invention.
[0028] During the course of screening many different plant species
it has become evident that the protein class of the invention is
fairly common in plant seeds. It is possible to distinguish the
proteins' antifungal activity on the basis of the unexpected
morphological effect they produce: severe branching of hyphae
occurs in partially inhibited germinating fungal spores. This is
particularly evident when using Fusarium culmorum. The nature of
the inhibition may also be characterized by the fact that it is
very sensitive to the concentration of cations used in the
assay.
[0029] Despite the similarities in sequence, activity (level and
effect) and basicity between the Capsicum protein (Ca-AMP1) and the
Amaranthus proteins (Ac-AMPs), there are certain differences in
their primary and tertiary structures. FIG. 15 shows that the
sequence of Ca-AMP1 contains at least forty-two amino acid
residues. However, Ac-AMP2 is a shorter peptide: the full Ac-AMP2
sequence contains only thirty amino acid residues. Furthermore, the
extra sequence of Ca-AMP1 contains two additional cysteine residues
which are not found in the Ac-AMP2 protein. As cysteines are
involved in internal linkages within proteins, it is probable that
the tertiary structures of Ca-AMP1 and Ac-AMP2 are different.
[0030] Bm-AMP1 resembles Ca-AMP1 with respect to its total number
of amino acids and its number of cysteine residues. It is probable
that Bm-AMP1 and Ca-AMP1 share considerable homology at both the
secondary and tertiary level. It is also probable that, like
Ca-AMP1, Bm-AMP1 differs from Ac-AMP2 in its tertiary structure due
in part to the two additional cysteine residues found in
Bm-AMP1.
[0031] The invention further provides an isolated DNA sequence
coding for a protein of the invention, and a vector containing said
sequence. The DNA may be cloned or transformed into a biological
system allowing expression of the encoded protein.
[0032] There is further provided a plant transformed with
recombinant DNA encoding an antimicrobial protein according to the
invention.
[0033] There is also provided a process of combating fungi or
bacteria, whereby they are exposed to the protein according to the
invention.
[0034] The Ac-AMP, Ar-AMP1, Ca-AMP1 and Bm-AMP1 proteins show a
wide range of antifungal activity, and are also active against
Gram-positive bacteria. Each protein is useful as a fungicide or an
antibiotic, for agricultural or pharmaceutical applications.
Exposure of a plant pathogen to an antimicrobial protein may be
achieved by expression of the protein within a micro-organism which
is applied to a plant or the soil in which a plant grows. The
proteins may also be used to combat fungal or bacterial disease by
application of the protein to plant parts using standard
agricultural techniques (eg spraying). The proteins may also be
used to combat fungal or bacterial disease by expression within
plant bodies, either during the life of the plant or for
post-harvest crop protection. The protein may also be used as a
fungicide to treat mammalian infections.
[0035] The antimicrobial protein may be isolated and purified from
appropriate seeds, synthesized artificially from its known amino
acid sequence, or produced within a suitable micro-organism by
expression of recombinant DNA. The proteins may also be expressed
within a transgenic plant.
[0036] Knowledge of the primary structure enables manufacture of
the antimicrobial protein, or parts thereof, by chemical synthesis
using a standard peptide synthesizer. It also enables production of
DNA constructs encoding the antimicrobial protein. The DNA sequence
may be predicted from the known amino acid sequence or the sequence
may be isolated from plant-derived DNA libraries.
[0037] Oligonucleotide probes may be derived from the known amino
acid sequence and used to screen a cDNA library for cDNA clones
encoding some or all of the protein. These same oligonucleotide
probes or cDNA clones may be used to isolate the actual
antimicrobial protein gene(s) by screening genomic DNA libraries.
Such genomic clones may include control sequences operating in the
plant genome. Thus it is also possible to isolate promoter
sequences which may be used to drive expression of the
antimicrobial (or other) proteins. These promoters may be
particularly responsive to environmental conditions (such as the
presence of a fungal pathogen), and may be used to drive expression
of any target gene.
[0038] cDNA encoding the Ac-AMPs has been isolated and sequenced.
The cDNA encoding Ac-AMP2 has been identified. It encodes an
86-amino acid pre-protein and a 25-amino acid carboxy-terminal
extension. The structure of this preprotein differs from all
precursors of Chitin-binding Plant Proteins. The cDNA encoding
Ac-AMP1 has been identified as a post-translational cleavage
product of Ac-AMP2.
[0039] DNA encoding the antimicrobial protein (which may be a cDNA
clone, a genomic DNA clone or DNA manufactured using a standard
nucleic acid synthesizer) can then be cloned into a biological
system which allows expression of the protein or a part of the
protein. The DNA may be placed under the control of a constitutive
or inducible promoter. Examples of inducible systems include
pathogen induced expression and chemical induction. Hence the
protein can be produced in a suitable micro-organism or cultured
cell, extracted and isolated for use. Suitable micro-organisms
include Escherichia coli, Pseudomonas and yeast. Suitable cells
include cultured insect cells and cultured mammalian cells. The
genetic material can also be cloned into a virus or bacteriophage.
The DNA can also be transformed by known methods into any plant
species, so that the antimicrobial protein is expressed within the
plant.
[0040] Plant cells according to the invention may be transformed
with constructs of the invention according to a variety of known
methods (Agrobacterium Ti plasmids, electroporation,
microinjection, microprojectile gun, etc). The transformed cells
may then in suitable cases be regenerated into whole plants in
which the new nuclear material is stably incorporated into the
genome. Both transformed monocotyledonous and dicotyledonous plants
may be obtained in this way, although the latter are usually more
easy to regenerate.
[0041] Examples of genetically modified plants which may be
produced include field crops, cereals, fruit and vegetables such
as: canola, sunflower, tobacco, sugarbeet, cotton, soya, maize,
wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples,
pears, strawberries, bananas, melons, potatoes, carrot, lettuce,
cabbage, onion.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] The invention may be further understood by reference to the
drawings, in which:
[0043] FIGS. 1A and 1B show the cation exchange chromatogram for
the antifungal proteins and the associated graph of fungal growth
inhibition.
[0044] FIGS. 2A1 and 2A2 show the HPLC profile of purified
Ac-AMP1.
[0045] FIGS. 2B1 and 2B2 show the HPLC profile of purified
Ac-AMP2.
[0046] FIG. 3A shows the amino acid sequences of Ac-AMP1, Ac-AMP2
and Ar-AMP 1 (SEQ ID NO: 5 to SEQ ID NO: 7, respectively).
[0047] FIG. 3B shows the alignment of amino acid sequences from
tobacco chitinase, bean chitinase, hevein, wheat lectin, nettle
lectin (SEQ ID NO: 8 to SEQ ID NO: 12, respectively), and Ac-AMP2
(SEQ ID NO: 6).
[0048] FIG. 4A shows the dose-response curves of fungal growth
inhibition measured at varying concentrations of Ac-AMP1.
[0049] FIG. 4B shows the dose-response curves of fungal growth
inhibition measured at varying concentrations of Ac-AMP2.
[0050] FIG. 5A shows the growth inhibition curves of B. cinerea
measured at varying concentrations of Ac-AMP-1 with and without
different additions of KCl or CaCl.sub.2.
[0051] FIG. 5B shows the growth inhibition curves of B. cinerea
measured at varying concentrations of Ac-AMP2 with and without
different additions of KCl or CaCl.sub.2.
[0052] FIG. 6 shows the nucleotide sequence and deduced amino a id
sequence of a cDNA clone encloding Ac-AMP2 (SEQ ID NO: 13 and SEQ
ID NO: 14, respectively).
[0053] FIGS. 7A and 7B show the structure of the expression vectors
pAC11 and pAC12.
[0054] FIG. 8 shows the structure of the plant transformation
vectors pAC111 and pAC112.
[0055] FIG. 9A shows a graph of antifungal activity of Ca-AMP1.
[0056] FIG. 9B shows the cation exchange chromatogram for the
purificiation of Ca-AMP1.
[0057] FIG. 10A shows a graph of antifungal activity Ca-AMP1.
[0058] FIG. 10B shows the HPLC profile of purified Ca-AMP1.
[0059] FIG. 11 shows the amino acid sequence of Ca-AMP1 (SEQ ID NO:
15).
[0060] FIG. 12 shows the alignment of the amino acid sequence of
Bm-AMP1 (SEQ ID NO: 16), Ca-AMP1 (SEQ ID NO: 15), Ac-AMP2 (SEQ ID
NO: 6) and a number of chitin-binding lectins (SEQ ID NOS: 8-12,
respectively).
[0061] FIG. 13 shows one possible predicted DNA sequence for the
Ca-AMP1 gene (SEQ ID NO: 17).
[0062] FIG. 14A shows a graph of antifungal activity of
Bm-AMP1.
[0063] FIG. 14B shows the cation exchange chromatogram for the
purification of Bm-AMP1.
[0064] FIG. 15A shows a graph of antifungal activity of
Bm-AMP1.
[0065] FIG. 15B shows the HPLC profile of purified Bm-AMP1.
[0066] FIG. 16 shows the amino acid sequence of Bm-AMP1 (SEQ ID NO:
16 and SEQ ID NO: 18, respectively).
[0067] FIG. 17 shows one possible predicted DNA sequence for
Bm-AMP1 (SEQ ID NO: 19).
DESCRIPTION OF PREFERRED EMBODIMENTS
[0068] The following examples illustrate the invention.
Example 1
Antifungal and Antibacterial Activity Assays
[0069] Antifungal activity was measured by microspectrophotometry
as previously described (Broekaert, 1990, FEMS Microbiol Lett,
69:55-60). Routinely, tests were performed with 20 .mu.l of a
(filter-sterilized) test solution and 80 .mu.l of a fungal spore
suspension (2.times.10.sup.4 spores/ml) or mycelium fragments in
either half strength potato dextrose broth (medium A) or half
strength potato dextrose broth with CaCl.sub.2 and KCl added to
final concentrations of 1 mM and 50 mM respectively (medium B). For
experiments on the antagonistic effect of cations, a synthetic
growth medium was used instead of Potato Dextrose Broth. The
synthetic growth medium consisted of K.sub.2 HPO.sub.4 (2.5 mM),
MgSO.sub.4 (50 mu.M), CaCl.sub.2 (50 .mu.M), FeSO.sub.4 (5 .mu.M),
CoCl.sub.2 (0.1 .mu.M), CuSO.sub.4 (0.1 mu.M), Na.sub.2 MoO.sub.4
(2 mu.M), H.sub.3 BO.sub.3 (0.5 .mu.M), KI (0.1 mu.M), ZnSO.sub.4
(0.5 mu.M), MnSO.sub.4 (0.1 .mu.M), glucose (10 g/l), asparagine (1
g/l), methionine (20 mg/l), myo-inositol (2 mg/l), biotin (0.2
mg/l), thiamine-HCl (1 mg/l), and pyridoxine-HCl (0.2 mg/l).
Control microcultures contained 20 mu.l of sterile distilled water
and 80 mu.l of the fungal spore suspension.
[0070] Unless otherwise stated the test organism was Fusarium
culmorum (strain IMI 180420) and incubation was carried out at
25.degree. C. for 48 hours. Percent growth inhibition is defined as
100 times the ratio of the corrected absorbance of the control
microculture minus the corrected absorbance of the test
microculture over the corrected absorbance at 595 nm of the control
microculture. The corrected absorbance values equal the absorbance
at 595 nm of the culture measured after 48 hours minus the
absorbance at 595 nm measured after 30 min. Values of growth
inhibition lower than 15% are not indicated on the chromatograms.
The antifungal activity (units per ml) is calculated as 50 times
the dilution factor of a test solution at which 50% growth
inhibition is obtained under the given assay conditions.
[0071] Antibacterial activity was measured
microspectrophotometrically as follows. A bacterial suspension was
prepared by inoculating soft nutrient agarose (tryptone, 10 g/l;
Seaplaque agarose (FMC), 5 g/l) and kept at 37.degree. C. to
prevent solidification. Aliquots (80 .mu.l) of the bacterial
suspension (10.sup.5 colony forming units per ml) were added to
filter-sterilized samples (20 .mu.l) in flat-bottom 96-well
microplates. The absorbance at 595 nm of the culture was measured
with the aid of a microplate reader after 30 minutes and 24 hours
of incubation at 28.degree. C. Percent growth inhibition was
calculated as described above for the antifungal activity
assay.
Example 2
Extraction of Basic Heat-Stable Proteins From Seeds
2.1 Amaranthus caudatus seeds
[0072] Ammonium sulphate fractionation of proteins precipitating in
the interval of 30 to 75% relative saturation was followed by
isolation of the basic protein fraction (pI>9) by passage over a
Q-Sepharose (Pharmacia) anion exchange column equilibrated at pH 9.
The detailed methods are described below.
[0073] One kg of A caudatus seeds (obtained from Gonthier, Wanze,
Belgium) was ground in a coffee mill and the resulting meal was
extracted for 2 hours at 4.degree. C. with 3 litres of an ice-cold
extraction buffer containing 10 mM NaH.sub.2 PO.sub.4, 15 mM
Na.sub.2 HPO.sub.4, 100 mM KCl, 2 mM EDTA, 2 mM thiourea, 1 mM PMSF
and 1 mg/l leupeptin. The homogenate was squeezed through
cheesecloth and clarified by centrifugation (5 min at
7,000.times.g). Solid ammonium sulphate was added to the
supernatant to obtain 30% relative saturation and the precipitate
formed after standing for 1 hour at room temperature was removed by
centrifugation (10 min at 7,000.times.g). The supernatant was
adjusted to 75% relative ammonium sulphate saturation and the
precipitate formed overnight at room temperature collected by
centrifugation (30 min at 7,000.times.g). After redissolving the
pellet in 300 ml distilled water, the insoluble material was
removed by further centrifugation (20 min at 7,000.times.g). The
clear supernatant was dialyzed extensively against distilled water
using benzoylated cellulose tubing (Sigma, St Louis, Mo.) with a
molecular weight cut off of 2,000 Da. After dialysis the solution
was adjusted to 50 mM Tris-HCl (pH 9) by addition of the ten-fold
concentrated buffer, and subsequently passed over a Q-Sepharose
Fast Flow (Pharmacia, Uppsala, Sweden) column (12.times.5 cm) in
equilibrium with 50 mM Tris-HCl (pH 9). The proteins passed through
the column were dialyzed extensively against 20 mM sodium phosphate
buffer (pH 7).
[0074] This material represents the basic protein fraction of A
caudatus seeds. Its chromatographic purification is described in
Example 3.
[0075] 2.2 Capsicum annuum or Briza maxima Seeds
[0076] One kilogramme of Capsicum annuum or Briza maxima seeds
(from Chiltern seeds, Cumbria, UK) were ground in a coffee mill and
the resulting meal was extracted for 2 hours at 4.degree. C. with 2
litres of an ice-cold extraction buffer containing 10 mM NaH.sub.2
PO.sub.4, 15 mM Na.sub.2 HPO.sub.4, 100 mM kCl, 2 mM EDTA and 1 mM
benzamidine. The resulting homogenate was squeezed through
cheesecloth and clarified by centrifugation (30 min at
7,000.times.g). Solid ammonium sulphate was added to the
supernatant to obtain 75% relative saturation and the precipitate
allowed to form by standing overnight at 4.degree. C. Following
centrifugation at 7,000.times.g for 30 minutes, the precipitate was
redissolved in a minimal volume of distilled water and dialyzed
extensively against distilled water using benzoylated cellulose
tubing (Sigma, St Louis, Mo.). After dialysis the solution was
adjusted to 50 mM NH.sub.4 Ac (pH 9) by addition of the ten-fold
concentrated buffer and passed over a Q-Sepharose Fast Flow
(Pharmacia, Uppsala, Sweden) column (12.times.5 cm) equilibrated in
50 mM NH.sub.4 Ac (pH 9). The protein fraction which passed through
the column was adjusted to pH6 with acetic acid. This material
represents the basic (pI>9) protein fraction of the seeds. The
fractions were further purified as described in Example 3.
Example 3
Purification of Antimicrobial Proteins
3.1 A caudatus Seeds
[0077] The starting material for the isolation of the A caudatus
antifungal proteins was the basic protein fraction extracted from
the mature seeds as in Example 2.1. These proteins were further
separated by cation exchange chromatography, as shown in FIG.
1B.
[0078] About 100 mg of the basic protein fraction dissolved in 20
mM sodium phosphate buffer (pH 7) was applied on a S-Sepharose High
Performance (Pharmacia) column (10.times.1.6 cm) previously
equilibrated with the sodium phosphate buffer. The column was
eluted at 3 ml/min with a linear gradient of 210 ml form 0 to 150
mM NaCl in 20 mM sodium phosphate buffer (pH 7). The eluate was
monitored for protein by online measurement of the absorbance at
280 nm (results shown in FIG. 1B) and collected in 7.5 ml fractions
of which 20 .mu.l was tested in the microspectrophotometric
antifungal activity assay described in Example 1 (results shown in
FIG. 1A).
[0079] Upon fractionation, the mixture resolved into four distinct
peaks (FIG. 1B). The antifungal activity co-eluted with the
material from peaks 2 and 4, respectively.
[0080] The active fractions were finally purified by reversed-phase
chromatography. About 1 mg amounts of peak 2 material (FIG. 2A) and
peak 4 material (FIG. 2B) were loaded on a Pep-S (porous silica
C.sub.2/C.sub.18, Pharmacia) column (25.times.0.93 cm) in
equilibrium with 0.1% TFA. The column was eluted at 5 ml/min with
the following gradients (solvent B is methanol containing 0.1%
TFA): 0-3 min, 0-15% B; 3-23 min, 15-35% B; 23-25 min, 35-100% B.
The eluate was monitored for protein by online measurement of the
absorption at 280 nm. Five ml fractions of the eluate were
collected, vacuum-dried, and finally dissolved in 0.5 ml distilled
water of which 10 .mu.was used in a microspectrophotometric
antifungal activity assay.
[0081] FIG. 2A and FIG. 2B show the HPLC profiles of purified peak
2 and peak 4 material respectively. The lower panels show
monitoring of the eluate for protein by measurement of the
absorption at 280 nm. Results of the microspectrophotometric
antifungal activity assay are shown in the upper panels.
[0082] Both material from peak 2 and from peak 4 yielded well
resolved major peaks that co-eluted with the antifungal activity.
The active factor purified from peak 2 is called Ac-AMP1
(Amaranthus caudatus antifungal protein 1), and that from peak 4 is
designated analogously as Ac-AMP2.
3.2 Capsicum annuum or Briza maxima Seeds
[0083] The starting material for the isolation of the C annuum or B
maxima antimicrobial protein was the basic protein fraction
extracted from the mature seeds as in Example 2.2. Proteins were
further purified by cation exchange chromatography of this
extract.
[0084] Approximately 500 ml of the basic protein fraction was
applied to a S-Sepharose High Performance (Pharmacia) column
(10.times.1.6 cm) equilibrated in 50 mM NH.sub.4Ac, pH 6.0. The
column was eluted at 3.0 ml/min with a linear gradient of 50-750 mM
NH.sub.4Ac, pH 6.0 over 325 minutes. The eluate was monitored for
protein by online measurement of the absorbance at 280 run (results
for Capsicum and for Briza shown in FIGS. 9B and 14B respectively)
and collected in 10 ml fractions. Samples from each fraction were
assayed for antifungal activity as described in Example 1 (results
for Capsicum and for Briza shown in FIGS. 9A and 14A
respectively).
[0085] Following chromatography, the Capsicum extract yielded a
broad peak of activity eluting at around 220 mM NH.sub.4Ac. The
Briza extract yielded a broad peak of activity eluting at around
250 mM HN.sub.4Ac. The fractions showing antifungal activity were
pooled and further purified by reverse-phase HPLC. About 3 mg
amounts of the peak were loaded on a PEP-S (porous silica
C.sub.2/C.sub.18, Pharmacia) column (25.times.0.4 cm) equilibrated
with 0.1% TFA (trifluoracetic acid). The column was developed at 1
ml/min with a linear gradient of 0.1% TFA to 100% acetonitrile/0.1%
TFA over 100 minutes. The eluate was monitored for protein by
online measurement of the absorption at 280 nm (results for
Capsicum and for Briza shown in FIGS. 10B and 15B respectively).
One ml fractions were collected, vacuum dried, and redissolved in 1
ml distilled water of which 10 .mu.l was used in an anti-fungal
assay (results for Capsicum and for Briza shown in FIGS. 10A and
15A respectively). The single well-resolved peaks of activity were
called Ca-AMP1 and Bm-AMP1 respectively.
Example 4
Molecular Structure of the Purified Antimicrobial Proteins
[0086] The molecular structure of the purified antimicrobial
protein was further analysed. Sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) was performed on
precast commercial gels (PhastGel High Density from Pharmacia)
using a PhastSystem (Pharmacia) electrophoresis apparatus. The
sample buffer contained 200 mM Tris-HCl (pH 8.3), 1% (w/v) SDS, 1
mM EDTA, 0.005% bromophenol blue and, unless otherwise stated, 1%
(w/v) dithioerythritol (DTE). Proteins were fixed after
electrophoresis in 12.5% glutaraldehyde and silver-stained
according to Heukeshoven and Dernick (1985, Electrophoresis,
6:103-112). Molecular weight markers (Pharmacia) were run for
comparison: 17 kDa, 14.5 kDa, 8 kDa, 6 kDa, 2.5 kDa. 4.1
Ac-AMPs
[0087] The amaranth antifungal proteins were analysed by SDS-PAGE
before and after reduction with dithioerythritol. Reduced Ac-AMP1
and Ac-AMP2 both migrated as single bands with an apparent
molecular weight of about 3 kDa. However, in their unreduced state,
Ac-AMP1 and Ac-AMP2 yielded a 4 kDa and a 6 kDa band respectively.
It appears therefore that the antifungal factors are dimeric
proteins stabilized by disulphide bridges, each comprised of two
identical 3 kDa subunits. Attempts to determine the molecular
weight of the native Ac-AMPs by gel filtration on either
Superose-12 or Superdex-75 (Pharmacia) were unsuccessful as the
proteins were retarded.
[0088] Free cysteine thiol groups were assessed qualitatively as
follows. Hundred .mu.g amounts of reduced or unreduced proteins
were dissolved in 6 M guanidinium-Cl containing 100 mM sodium
phosphate buffer (pH 7) and 1 mM EDTA. The mixtures were allowed to
react with 5,5'-dithionitrobenzoic acid and monitored for release
of nitrothiobenzoate as described by Creighton (1989, Protein
structure, a practical approach, 155-167). Reduction of the
proteins was done by addition of Tris-HCl (pH 8.6) to 100 mM and
dithiothreitol to 30 mM, followed by incubation at 45.degree. C.
for 1 hour. The proteins were separated from the excess reagents by
reversed-phase chromatography on a C.sub.2 /C.sub.18 silica
column.
[0089] The unreduced Ac-AMPs did not contain free cysteine thiol
groups, whereas the reduced proteins did, indicating that all
cysteine residues participate in disulphide bonds. The presence of
a relatively high number of disulphide linkages in such small
polypeptides suggests that the Ac-AMPs have compact structures.
[0090] The pI values of Ac-AMP1 and Ac-AMP2 were determined by
isoelectric focusing and found to be 10.3 and over 10.6
respectively. Isoelectric focusing was performed on precast
Immobiline Dry Strips (Pharmacia) rehydrated in 8 M urea, using
marker proteins in the pI range from 4.7 to 10.6 (Pharmacia).
4.2 Ca-AMP1
[0091] Ca-AMP1 was analysed by SDS-PAGE. After reduction with
(.beta.-mercaptoethanol, Ca-AMP1 runs as a single band with an
apparent molecular mass of 4 to 5 kDa. Unreduced Ca-AMP1 migrates
as a single band of 14 kDa. These results show that the native
Ca-AMP1 is in oligomeric protein, probably a dimer.
Example 5
Amino Acid Sequencing of the Ac-AMPs
[0092] Cysteine residues of the antifungal proteins were modified
by S-carboxyamidomethylation as follows: 100 .mu.g amounts of
purified proteins were dissolved in 150 .mu.l 0.3 M Tris-HCl (pH
8.6) containing 30 mM DTT and reacted for 1 hour at 45.degree. C.
Iodoacetamide was added to a final concentration of 100 mM and the
mixture was kept in the dark at 37.degree. C. for 1 hour. The
reaction was finally quenched by addition of DTT to a final
concentration of 100 mM and allowed to react for an additional hour
at 37.degree. C. Removal of excess reagents was done by
reversed-phase chromatography. The resulting protein fractions were
subjected to amino acid sequence analysis in a 477A Protein
Sequencer (Applied Biosystems) with on-line detection of
phenylthiohydantoin amino acid derivatives in a 120A Analyser (Appl
Biosystems).
[0093] The amino acid sequence of the reduced and
carboxyamidomethylated antifungal proteins was determined by direct
N-terminal sequencing. FIG. 4A shows the N-terminal amino acid
sequences of Ac-AMP1 and Ac-AMP2, shown with the sequence of
Ar-AMP1. Ac-AMP1 is 29 amino acids in length, whereas Ac-AMP2 has
30 residues and Ar-AMP1 has 31 residues. The sequence of AC-AMP2 is
identical to that of Ac-AMP1 except that it has one additional
amino acid at its carboxyl terminus (arginine). The Ac-AMPs are
particularly rich in cysteine (6 residues), glycine (7 residues)
and basic amino acids (4 and 5 residues for Ac-AMP1 and Ac-AMP2
respectively). The amino acid sequence of Ar-AMP1 is almost
identical to that of Ac-AMP2: Ar-AMP1 has one additional arginine
residue at the carboxyl-terminus, a conservative change at position
23 (from lysine to arginine), and two real changes at position 1
(from valine to alanine) and at position 6 (from arginine to
glutamine). Like Ac-AMP2, Ar-AMP1 has 6 cysteine residues, 7
glycine residues and 5 basic residues.
[0094] Ac-AMP1 appears to be a truncated form of Ac-AMP2. It is
possible that the two proteins result from the same precursor
molecule by differential post-translational processing.
[0095] The theoretical isoelectric points calculated from the
sequence data are 10.1 and 11.0 for Ac-AMP1 and Ac-AMP2
respectively, assuming that all cysteine residues participate in
disulphide linkages. These compare well to the measured pI values
given in Example 4.
[0096] FIG. 3B shows the alignment of N-terminal amino acid
sequences from tobacco chitinase (Shinshi et al, 1987, Proc Natl
Acad Sci USA, 84:89-93), bean chitinase (Broglie et al, 1986, Proc
Natl Acad Sci USA, 83:6820-6824), hevein (Broekaert et al, 1990
Proc Natl Acad Sci USA, 87:7633-7637), wheat lectin (Raikhel and
Wilkins, 1987, Proc Natl Acad Sci USA, 84:6745-6749), nettle lectin
(Chapot et al, 1986, FEBS Lett, 195:231-234) and the sequence of
Ac-AMP2. Sequence identities with the tobacco chitinase are
indicated in capitals, conserved changes are marked in italics and
non-conserved changes in lower case. Conserved changes are
considered as substitutions within the amino acid homology groups
FWY, MILV, RKH, ED, NQ, ST and PAG. Gaps introduced for optimal
alignment are represented by asterisks.
[0097] The amino acid sequence of the Ac-AMPs shows striking
similarity to the cysteine/glycine-rich domains of Chitin-binding
Plant Proteins, such as chitinases, chitin-binding lectins, and
hevein. However, the Ac-AMPs also contain unique features. Sequence
alignment of Ac-AMP2 and the N-terminus of a basic chitinase from
tobacco (FIG. 3B) showed 14 identical amino acids and 5 conserved
changes in the first 30 residues. A single gap of four amino acids
had to be introduced in the N-terminal portion of Ac-AMP2 to allow
optimal alignment with the Chitin-binding Plant Proteins. After
introduction of the gap, all of the cysteine residues appeared at
invariant positions.
Example 6
Amino Acid Sequencing of Ca-AMP1 and Bm-AMP1
[0098] Cysteine residues were modified by S-pyridylethylation using
the method of Fullmer (1984, Anal Biochem, 142, 336-341). Reagents
were removed by HPLC on a Pep-S (porous silica C.sub.2 /C.sub.18)
(Pharmacia) column (25.times.0.4 cm). The S-pyridylethylated
proteins were recovered by eluting the column with a linear
gradient from 0.1% trifluoroacetic acid (TFA) to acetonitrile
containing 0.1% TFA. The resulting protein fractions were subjected
to amino acid sequence analysis in a 477A Protein Sequencer
(Applied Biosystems) with on-line detection of phenylthiohydantoin
amino acid derivatives in a 120A Analyser (Applied Biosystems).
[0099] Initial attempts to sequence Ca-AMP1 showed that the protein
was N-terminally blocked. Subsequently, the S-pyridylethylated
protein was unblocked with pyroglutamate amino peptidase according
to the supplier's instructions (Boehringer Mannheim, FRG). The
reaction was only partially successful and yielded sequence for the
first 16 amino acids.
[0100] In order to obtain sequence for the C-terminus, Ca-AMP1 was
digested with trypsin and three of the resulting fragments were
sequenced. One was found to be blocked and represents the
N-terminus. Sequenceing of the other two peptides showed that they
could be aligned with the sequence for the N-terminus (FIG. 11) and
that the complete sequence was homologous to the
cysteine/glycine-rich domain found in chitin-binding plant lectins
(FIG. 12). It is possible that the sequence for Ca-AMP1 is
incomplete and that there are more amino acids at the C-terminus.
The finding that the peptide was N-terminally blocked and that this
could be removed with aminopeptidase suggests that the N-terminal
amino acid may be a glutamine.
[0101] The amino acid sequence of Bm-AMP1 is shown in FIG. 16. At
two positions in the sequence there is a choice of two amino acids.
At position 9 the amino acid is either arginine (R) or histidine
(H), and at position 23 the amino acid is either serine (S) or
asparagine (N). The purified protein fraction Bm-AMP1 may be a
mixture of peptides having sequences varying at these two positions
with any combination of the stated amino acids.
[0102] FIG. 12 shows the alignment of N-terminal amino acid
sequences from tobacco chitinase (Shinshi et al, 1987, Proc Nat
Acad Sci USA, 84:89-93), bean chitinase (Broglie et al, 1986, Proc
Nat Acad Sci USA, 83:6820-6824), hevein (Broekaert et al, 1990, Pro
Nat Acad Sci USA, 87:7633-7637), wheat lectin (Raikhel and Nilkins,
1987, Proc Nat Acad Sci USA, 84:6745-6749), nettle lectin (Chapot
et al, 1986, FEBS Lett, 195:231-234), Ac-AMP2 (Broekaert et al,
1992, Biochemistry, 31:4308-4314; International Patent Publication
Number WO92/21699) and the sequences for Ca-AMP1 and Bm-AMP1.
Sequence identities and conserved changes are boxed. Conserved
changes are considered as substitutions within the amino acid
homology groups Phe/Trp/Tyr, Met/ILe/Teu/Val, Arg/Lys/His, Glu/Asp,
Asn/Gln, Ser/Thr, and Pro/Ala/Gly. Gaps introduced for maximum
alignment are represented by dashes.
[0103] The amino acid sequence for Ca-AMP1 and for Bm-AMP1 shows
striking similarity to the cysteine/glycine rich domain in
Chitin-binding Plant Proteins. In particular, Ca-AMP1 is 65%
identical to hevein. Bm-AMP1 is 35% to hevein and 45% identical to
Ca-AMP1. Like the Amaranthus proteins, Ca-AMP1 and Bm-AMP1 are
substantially more basic than hevein.
[0104] Both Ca-AMP1 and hevein have four basic amino acids, but
Ca-AMP1 has only one acidic amino acid compared to five in hevein.
If the overall basic nature of these proteins is important for
their activity then substitutions of the aspartic acid at position
28 in hevein for the arginine found at this position in Ca-AMP1
would be expected to increase the specific activity of hevein.
Indeed, it seems quite remarkable that Ca-AMP1 and hevein are so
similar in size and amino acid sequence, but differ so dramatically
in their levels and spectrum of activity.
[0105] Bm-AMP1 contains six basic amino acids and only two acidic
amino acids, whereas hevein has four basic amino acids but five
acidic amino acids. The overall basic profile of Bm-AMP1 may
therefore be related to the increased antifungal activity of this
protein compared to hevein and other Chitin-binding Plant
Proteins.
[0106] FIG. 13 and FIG. 17 show one of the possible DNA sequences
of the gene coding for Ca-AMP1 and Bm-AMP1 respectively. This gene
sequence has been predicted from the known amino acid sequence
using codons which commonly occur in dicotyledonous plants. The
actual gene sequence within Capsicum or Briza many differ due to
the degeneracy of the genetic code.
Example 7
Chitin-Binding Activity of the Proteins
7.1 Ac-AMPs
[0107] Because of the similarity at the amino acid sequence level
between the Ac-AMPs and Chitin-binding Plant Proteins, the ability
of the amaranth antifungal proteins to bind on a chitin substrate
was investigated.
[0108] Micro-columns packed with chitin were loaded with either
Ac-AMP1 or Ac-AMP2 and subsequently eluted at neutral pH and low pH
(pH 2.8). Chitin was prepared by N-acetylation of chitosan (Sigma,
St Louis, Mo.) by the method of Molano et al (1977, Anal Biochem,
83:648-656). Protein samples (50 .mu.g) dissolved in 1 ml phosphate
buffered saline (pH 7) were applied on the chitin micro-column
(2.5.times.6 mm) and recycled three times over the column. The
column was eluted five times with 1 ml phosphate buffered saline
(PBS) and once with 1 ml 100 mM acetic acid (pH 2.8). Fractions (1
ml) of the eluate were desalted and concentrated by reversed-phase
chromatography and finally redissolved in 50 .mu.l sample buffer
for SDS-PAGE analysis.
[0109] SDS-PAGE analysis after this affinity chromatography of
Ac-AMP1 (lanes 1-4) and Ac-AMP2 (lanes 5-8) was carried out. Lanes
1 and 5 included the antifungal proteins at equivalent amounts as
those loaded on the columns; lanes 2 and 6 were the fractions
passed through the column; lanes 3 and 7 were the fractions eluted
with PBS (pH 7); lanes 4 and 8 were the fractions eluted with 100
mM acetic acid (pH 2.8). It can be seen that the Ac-AMPs were
absent from the fraction passed through the column and from the
neutral pH washings, but instead were recovered in the low pH
desorption buffer. These results indicate that both Ac-AMP1 and
Ac-AMP2 exhibit affinity toward chitin.
7.2 Ca-AMP1
[0110] The similarity in sequence between Ca-AMP1 and
chitin-binding plant lectins suggested that Ca-AMP1 might also bind
to chitin.
[0111] Micro-chitin-columns were loaded with Ca-AMP1 and the
columns washed with 50 mM NH.sub.4 Ac (pH 7.0). 50.mu.g Ca-AMP1 was
loaded onto the column (0.5.times.l cm) and the eluate recycled
over the column three times. The final eluate was collected. The
column was washed five times with 1 ml 50 mM NH.sub.4 Ac (pH 7.0)
and this fraction collected. Finally, the column was washed with 1
ml 100 mM acetic acid (pH 2.8) and this acid-wash fraction
collected. The collected fractions were desalted and concentrated
by reverse-phase chromatography and finally dissolved in 50.mu.l
sample buffer for SDS-PAGE analysis.
[0112] It was seen on an SDS analyses that the majority of the
protein binds to the column and is eluted in the low pH desorption
buffer, suggesting that Ca-AMP1 exhibits affinity to chitin.
Example 8
Stability of the Antifungal Activity
[0113] Tests for antifungal activity were performed with 20
.mu.samples diluted five-fold with growth medium containing
Fusarium culmorum spores, according to the assay method given in
Example 1. Untreated control samples consisted of the test proteins
at 500 .mu.g/ml in 10 mM sodium phosphat buffer (pH 7). For
digestions, different proteases were added at 100 .mu.g/ml and
incubated at 37.degree. C. for 16 hours. Heat stability tests were
performed by heating aliquots of the test proteins for 10 minutes
at different temperatures up to 100.degree. C. pH stability was
tested by incubation of test proteins for 1 hour in either 20 mM
glycine-HCl (pH 2) or glycine-NaOH (pH 11) and subsequent dialysis
for 16 hours against 10 mM sodium phosphate buffer (pH 7) using
benzoylated cellulose tubing. Reduction of dishulphide bridges was
done by addition of DTE at 30 mM and Tris-HCl (pH 8.6) at 300 mM.
The reagents were removed by reversed-phase chromatography. For
digestions, different proteases were added at 200 .mu.g/ml and
incubated at 37.degree. C. for 3 hours. The control treatments
containing only the reagents proved negative for antifungal
activity after the dialysis or reversed-phase chromatography
steps.
8.1 Ac-AMPs
[0114] The antifungal activity of the Ac-AMPs was resistant to
digestion by proteinase K, pronase E, chymotrypsin or trypsin.
Moreover, the Ac-AMPs were not affected by heat treatments at up to
100.degree. C. for 10 minutes nor by exposure to pH conditions as
extreme as pH 2 or pH 11. Reduction of their cysteine residues by
dithiothreitol, however, completely abolished the antifungal
activity.
[0115] The proteins are remarkably stable, since their biological
activity is unaffected by protease treatments or by exposure to
extreme temperatures and pH conditions. This stability may be due
to a compact globular structure maintained by the relatively high
number of disulphide linkages. These disulphide linkages are
essential for biological activity.
8.2 Ca-AMP1 and Bm-AMP1
[0116] The antifungal activity of the purified Ca-AMP1 protein and
the Bm-AMP1 protein was resistant to heat treatment at up to
80.degree. C. for 10 minutes. Reduction of the disulphide bonds by
DTE, however, completely abolished the antifungal activity. These
disulphide linkages are essential for biological activity.
[0117] Treatment of Ca-AMP1 with proteinase K or pronase E reduced
the antifungal activity by at least 10-fold, whereas trypsin only
reduced the activity by 2-fold and chymotrypsin had no affect on
activity.
Example 9
Antifungal Potency of the Proteins
9.1 Ac-AMPs
[0118] The antifungal potency of the Ac-AMPs was assessed on
fourteen different plant pathogenic fungi, using the assay
described in Example 1. Growth of fungi, collection and harvest of
fungal spores, and preparation of mycelial fragments were done as
previously described (Broekaert et al, 1990, FEMS Microbiol Lett,
69:55-60). The following fungal strains were used: Alternaria
brassicola MUCL 20297, Ascochyta pisi MUCL 30164, Botrytis cinerea
MUCL 30158, Cercospora beticola strain K897, Colletotrichum
lindemuthianum MUCL 9577, Fusarium culmorum IMI 180420,
Mycosphaerella fijiensis var fijiensis IMI 105378, Phytophthora
infestans, Rhizoctonia solani CBS 207-84, Sclerotinia sclerotianum
MUCL 30163, Septoria nodorum MUCL 30111, Trichoderma hamatum MUCL
29736, Verticillium dahliae MUCL 19210, and Venturia inaegualis
MUCL 15927.
[0119] For C beticola, R solani, S sclerotianum, S nodorum, M
fijiensis and P infestans, mycelial fragments were used as
inoculum. All other fungi were inoculated as spores.
[0120] FIG. 4 shows the dose-response curves of fungal growth
inhibition measured at varying concentrations of Ac-AMP1 (FIG. 4A)
and Ac-AMP2 (FIG. 4B) using the following test fungi: A brassicola
(*); A pisi (x); B cinerea (+); C lindemuthianum (open square); F
culmorum (solid square); V dahliae (solid triangle). The antifungal
activity of the Ac-AMPs on the fourteen plant pathogenic fungi
listed above was compared to that of two Chitin-binding Plant
Proteins, nettle lectin and pea chitinase. Table 1 summarises the
results: IC.sub.50 is the concentration (.mu.g/ml) required for 50%
growth inhibition after 48 hours of incubation. The IC.sub.50
values for the slow growing fungi S nodorum and V inaequalis were
measured after 5 and 15 days of incubation respectively. The nettle
lectin (or Urtica dioica agglutinin, UDA) was isolated from
stinging nettle (Urtica dioica) rhizomes as previously described
(Peumans et al, 1983, FEBS Lett, 177:99-103). Chitinase was
isolated from pea pods by the method of Mauch et al (1988, Plant
Physiol, 87:325-333). TABLE-US-00002 TABLE 1 Antifungal activity of
Ac-AMPs, nettle lectin and pea chitinase IC50 ( mu g/ml) Fungus
Ac-AMP1 Ac-AMP2 UDA chitinase A brassicola 7 4 200 400 A pisi 8 8
1000 >500 B cinerea 10 8 >1000 >500 C beticola 0.8 0.8 ND
ND C lindemuthianum 8 8 20 >500 F culmorum 2 2 >1000 >500
M fijiensis 3 ND 4 ND P infestans 12 ND 4 ND R solani 30 20 30 ND s
sclerotianum 20 10 ND ND S nodorum 20 20 ND ND T hamatum 7 3 90 1.5
V dahliae 6 5 80 500 V inaequalis ND 3 1000 ND ND = not
determined
[0121] The concentration of AC-AMP protein required for 50% growth
inhibition after 48 hours of incubation (IC.sub.50) varied from 0.8
to 30 .mu.g/ml, depending on the test organism. The antifungal
potency of Ac-AMP1 was almost identical to that of Ac-AMP2.
[0122] The Ac-AMPs are potent inhibitors of all fourteen fungi
tested in this study. Their specificity is comparable to that of
wheat thionin which also typically inhibits fungal growth with
IC.sub.50 values between 1 and 10 .mu.g/ml (Cammue et al, 1992, J
Biol Chem, 267, 2228-2233). Relative to Chitin-binding Plant
Proteins, such as the nettle lectin or chitinase, the AC-AMPS have
much higher specific activities. The nettle lectin only inhibits 6
out of 11 fungi at concentrations below 100 .mu.g/ml, whereas at
this concentration the pea chitinase is only inhibitory to 1 out of
7 tested fungi.
[0123] The unique properties of the Ac-AMPs as potent inhibitors of
fungal growth in vitro suggest that they may play a role in the
defence of seeds or seedlings against invasion by fungal
organisms.
9.2 Ca-AMP1
[0124] The antifungal potency of the purified protein was assessed
on different plant pathogenic fungi, using the assay described in
Example 1. Growth of fungi, collection and harvest of fungal
spores, and preparation of mycelial fragments were done as
previously described (Broekaert et al, 1990, FEMS Microbiol Lett,
69:55-60). The following fungal strains were used: Alternaria
brassicola MUCL 20297, Ascochyta pisi MUCL 30164, Botrytis cinerea
MUCL 30158, Cercospora beticola strain K897, Colletotrichum
lindemuthianum MUCL 9577, Fusarium culmorum IMI 180420, Fusarium
oxysporum f.sp. pisi IMI 236441, Fusarium oxysporum f.sp.
lycopersici MUCL 909, Nectria haematococca Collection Van Etten
160-2-2, Penicillium digitatum (K0879), Phoma betae MUCL 9916,
Pyrenophora tritici-repentis MUCL 30217, Pyricularia oryzae MUCL
30166, Rhizoctonia solani CBS 207-84, Septoria tritici (K1097D),
Trichoderma viride (K1127), Verticillium albo-atrum (K0937),
Verticillium dahliae MUCL 19210.
[0125] For R solani, mycelial fragments were used as inoculum,
whereas all other fungi were inoculated as spores.
[0126] Serial dilutions of the antifungal proteins were applied to
the fungi, either using growth medium A or medium B. The percent
growth inhibition was measured by microspectrophotometry. The
concentration required for 50% growth inhibition after 48 h of
incubation (IC.sub.50 value) was calculated from the dose-reponse
curves. Results are summarised in Table 2. TABLE-US-00003 TABLE 2
IC50 ( mu g/ml) Fungus Medium A Medium B A brassicola 20 >500 A
pisi 3 >500 B cinerea 2 >500 C beticola 3 200 C
lindemuthianum 50 >500 F culmorum 4 >500 F oxysporum pisi
>500 >500 F oxysporum lycopersici 300 >500 N haematococca
4 >500 P digitatum 10 >500 P betae 300 >500 P
tritici-repentis 70 >500 P oryzae 5 >500 R solani 8 >500 S
tritici 1.5 400 T viride 200 >500 V albo-atrum 2 >500 V
dahliae 6 >500
[0127] Assayed on a range of fungi in medium A the IC.sub.50 values
varied from 1 .mu.g/ml to over 500 .mu.g/ml. However, for 12 of the
18 pathogenic fungi the IC.sub.50 value was below 50 .mu.g/ml and
for 10 of the fungi the IC.sub.50 value was below 10 .mu.g/ml. The
results show that Ca-AMP1 is a potent and broad spectrum inhibitor
of fungal growth.
[0128] The activity of Ca-AMP1 is, however, very sensitive to the
ionic conditions used in the assay and it's activity is essentially
abolished in high salt (medium B).
[0129] The level of antifungal activity obtained with Ca-AMP1 is
comparable to that of two peptides (Ac-AMPs) previously isolated
from Amaranthus seeds (Broekaert et al, 1992, Biochemistry,
31:4308-4314). Relative to Chitin-binding Plant Proteins, such as
hevein or nettle lectin, Ca-AMP1 has much higher specific activity.
Previously we have shown that nettle lectin inhibits only 3 of 7
fungi tested at concentrations below 100 .mu.g/ml and none below 20
.mu.g/ml (Broekaert et al, 1992, Biochemistry 31:4308-4314).
Similarly, hevein has been reported to be much less active than
even nettle lectin (Van Parijs et al, 1991, Planta 183:258-264).
Despite the similarity in amino acid sequence, therefore, Ca-AMP1
can, like the Amaranthus proteins, be classed separately from the
Chitin-binding Plant Proteins.
[0130] Ca-AMP1 and the Amaranthus proteins give rise to the same
morphological changes in partially inhibited fungal spores. This is
readily visualised when Fusarium culmorum spores are used in the
assay and at concentrations of the proteins which are 2-4 fold
below the IC.sub.50 value. Viewed under a light microscope, the
proteins cause severe branching of the emerging hyphal tips. Hevein
has been reported to cause the development of thick hyphae and buds
(Van Parijs et al, 1991, Planta, 183:258-264).
9.3 Bm-AMP1
[0131] The antifungal potency of the purified protein was assessed
on different plant pathogenic fungi, using the assay described in
Example 1. Growth of fungi, collection and harvest of fungal
spores, and preparation of mycelial fragments were done as
previously described (Broekaert et al, 1990, FEMS Microbiol Lett,
69:55-60). The following fungal strains were used: Alternaria
longipes strain CBS 620.83, Botrytis cinerea MUCL 30158,
Cladosporium sphaerospermum strain K0791, Fusarium culmorum IMI
180420, Penicillium digitatum strain K0879, Septoria tritici
(K1097D), Trichoderma viride (K1127), Verticillium dahliae MUCL
19210.
[0132] All fungi were inoculated as spores. Serial dilutions of the
antifungal proteins were applied to the fungi, either using growth
medium A or medium B. The percent growth inhibition was measured by
microspectrophotometry. The concentration required for 50% growth
inhibition after 48 h of incubation (IC.sub.50 value) was
calculated from the dose-reponse curves.
[0133] The results for Bm-AMP1 are summarised in Table 3.
TABLE-US-00004 TABLE 3 IC50 ( mu g/ml) Fungus Medium A Medium B A
longipes 2 >500 B cinerea 9 >500 C sphaerospermum 3 >500 F
culmorum 9 >500 P digitatum 6 >500 S tritici 1 400 T viride
150 >500 V dahliae 10 >500
[0134] Assayed on a range of fungi in medium A the IC.sub.50 values
varied from 1 .mu.g/ml to 150 .mu.g/ml. However, for six of the
eight pathogenic fungi the IC.sub.50 value was below 10 .mu.g/ml.
The results show that Bm-AMP1 is a potent and broad spectrum
inhibitor of fungal growth.
[0135] The activity of Bm-AMP1 is, however, very sensitive to the
ionic conditions used in the assay and it's activity is essentially
abolished in high salt (medium B).
[0136] The level and spectrum of antifungal activity obtained with
Bm-AMP1 is comparable to that of Ca-AMP1 and to that of the two
peptides (Ac-AMPs) previously isolated from Amaranthus seeds.
Relative to Chitin-binding Plant Proteins, such as hevein or nettle
lectin, Bm-AMP1 has much higher specific activity. Previously we
have shown that nettle lectin inhibits only 3 of 7 fungi tested at
concentrations below 100 .mu.g/ml and none below 20 .mu.g/ml
(Broekaert et al, 1992, Biochemistry 31:4308-4314). Similarly,
hevein has been reported to be much less active than even nettle
lectin (Van Parijs et al, 1991, Planta 183:258-264). Despite the
similarity in amino acid sequence, therefore, Bm-AMP1 can, like
Ca-AMP1 and the Amaranthus proteins, be classed separately from
Chitin-binding Plant Proteins.
Example 10
Effect of Ions on Antifungal Activity
[0137] The specific activity of the Ac-AMPs was found to be
strongly dependent on the ionic constitution of the growth medium.
FIG. 5 shows the dose-response curves of Ac-AMP1 (FIG. 5A) and
Ac-AMP2 (FIG. 5B) on B cinerea in a low ionic strength synthetic
growth medium, with and without different additions of KCl or
CaCl.sub.2. The antagonistic effect of K.sup.+ and Ca.sup.2+ on
growth inhibition of B cinerea caused by the Ac-AMPs is obvious. In
the reference medium (solid square), containing 2.5 mM monovalent
cations and 0.1 mM divalent cations, Ac-AMP1 and Ac-AMP2 had
IC.sub.50 values of 2.2 and 1.6 .mu.g/ml respectively.
Administering KCl at 10 mM (.times.) to this medium did not
significantly affect the dose-response curves, whereas KCl at
concentrations of 50 mM (open square) increased the IC.sub.50
values by about three-fold. CaCl.sub.2 had a much more dramatic
antagonistic effect. When supplemented at 1 mM (*) to the reference
medium, CaCl.sub.2 caused a five to six-fold increase of the
IC.sub.50 values. At 5 mM CaCl.sub.2 (+) the drops in specific
activity were more than 50-fold. The antagonistic effect of other
salts with monovalent cations, such as NaCl and NH.sub.4 Cl, was
similar to that of KCl, whereas the effect of the salts with
divalent cations, MgCl.sub.2 and BaCl.sub.2, was similar to that of
CaCl.sub.2.
[0138] These results show that the antifungal activity of the
Ac-AMPs is strongly reduced by the presence of inorganic salts. The
antagonistic effect of salts is primarily due to the cations;
divalent cations are more potent antagonists than monovalent
cations.
Example 11
Effect of AC-AMPs on Bacteria
[0139] Antibacterial activity was measured as described in Example
1. The following bacterial strains were used: Bacillus megaterium
ATCC 13632, Erwinia carotovora strain 3912, Escherichia coli strain
HB101 and Sarcina lutea ATCC 9342. The antibacterial effect of the
Ac-AMPs was assessed by adding serial dilutions of the proteins to
bacterial suspensions. The highest test concentration was 500
.mu.g/ml (final concentration). Results are shown in Table 4.
TABLE-US-00005 TABLE 4 Antibacterial activity of the Ac-AMPs IC50 (
mu g/ml) Bacteria Ac-AMP1 Ac-AMP2 B megaterium 40 10 S lutea 250 40
E carotovora no inhibition E coli no inhibition
[0140] The Ac-AMPs inhibited growth of the Gram-positive bacteria,
B megaterium and S lutea. However, the Ac-AMPs (at 500 .mu.g/ml)
did not inhibit growth of the gram-negative bacteria E carotovora
and E coli.
Example 12
Anti-Bacterial and Anti-Yeast Activity of Ca-AMP1 and of
Bm-AMP1
[0141] The purified proteins were assessed for effect on the growth
of the following bacteria: Bacillus megaterium ATCC 13632,
Escherichia coli strain HB101 and Pseudomonas aeurogenasa NCIB
8295; and for its effect on the growth of Saccharomyces cerevisiae
JRY188. Bioassays were carried out as described in Example 1. The
results are summarised in Table 5. Ca-AMP1 and Bm-AMP1 each
strongly inhibited the growth of B megaterium and S cerevisiae but
had little or no effect on the two Gram negative bacteria tested.
TABLE-US-00006 TABLE 5 Activity of Ca-AMP1 and Bm-AMP1 on bacteria
and yeast IC50 ( mu g/ml) Ca-AMP1 Bm-AMP1 B megaterium 20 10 P
aeurogenasa 500 500 E coli >800 >800 S cerevisiae 30 15
Example 13
Effect of the Ac-AMPs on Cultured Human Cells
[0142] The Ac-AMPs were evaluated for their potential toxic effects
on mammalian cells.
[0143] Human cell toxicity assays were performed either on
umbilical vein endothelial cells (Alessi et al, 1988, Eur J
Biochem, 175, 531-540) or skin-muscle fibroblasts (Van Damme et al,
1987, Eur J Immunol, 17, 1-7) cultured in 96-well microplates. The
growth medium was replaced by 80 .mu.l of serum-free medium
(optimem 1 for endothelial cells or Eagle's minimal essential
medium (EMEM) for fibroblasts, both from GIBCO), to which 20 .mu.l
of a filter-sterilized test solution was added. The cells were
further incubated for 24 hours at 37 .degree. C. under a 5%
CO.sub.2 atmosphere with 100% relative humidity. The viability of
the cells was assessed microscopically after staining with trypane
blue (400 mg/l in phosphate buffered saline, PBS) for 10 minutes.
Alternatively, cells were stained with neutral red (56 mg/l in PBS)
for 2 h at 37.degree. C. Cells were lysed in acidic ethanol (100 mM
sodium citrate, pH 4, containing 50% ethanol) and scored for
release of the dye by microspectrophotometry at 540 nm.
[0144] When added at up to 500 .mu.g/ml to either cultured human
umbilical vein endothelial cells or human skin-muscle fibroblasts,
neither Ac-AMP1 nor Ac-AMP2 affected cell viability after 24 h of
incubation. In contrast, .beta.-purothionin administered at 50
.mu.g/ml decreased the viability of both cell types by more than
90%.
Example 14
Molecular Cloning of Ac-AMP2 cDNA
[0145] Fully matured seeds of Amaranthus caudatus were collected
from outdoor grown plants, immediately frozen in liquid nitrogen
and stored at -80.degree. C. Total RNA was extracted from 5 g of
pulverized seeds by the method of De Vries et al (1988, Plant
Molecular Biology Manual, B6, 1-13) using 6 ml of a 1:2 phenol:RNA
extraction buffer mixture and 2 ml of chloroform per g tissue. Poly
(A).sup.+ RNA was purified by oligo (dT)-cellulose affinity
chromatography as described by Silflow et al (1979, Biochemistry,
18, 2725-2731) yielding about 7 .mu.g of poly (A).sup.+ RNA.
Double-stranded cDNAs were prepared from 1.5 .mu.g of poly
(A).sup.+ RNA according to Gubler and Hoffman (1983, Gene, 25,
263-269) and ligated to EcoRI/NotI adaptors using the cDNA
Synthesis Kit of Pharmacia. The cDNAs were cloned into the lambda.
ZAP II phage vector (Stratagene) and packaged in vitro with the
Gigapack II Gold packaging system (Stratagene) according to the
manufacturer's instructions.
[0146] A DNA probe for screening of the cDNA library was produced
by polymerase chain reaction (PCR) as follows. Two degenerate
oligonucleotides were synthesized: OWB13 (5'GTNGGNGARTGKGTNMGNGG)
(SEQ ID NO: 1) and OWB14 (5'CCRCARTAYTTNGGNCCYTTNCC) (SEQ ID NO:
2). OWB13 corresponds to amino acids 1 to 7 of Ac-AMP1 and has a
sense orientation. OWB14 corresponds to amino acids 22 to 29 of
Ac-AMP1 and has an antisense orientation. PCR was performed with
the Taq polymerase under standard conditions (Sambrook et al, 1989,
Molecular Cloning, Cold Spring Harbour Lab Press) using OWB13 and
OWB14 as amplimers and 25 ng of cDNA as target DNA. The temperature
programme included an initial step at 94.degree. for 5 min, 30
cycles (94.degree. C. for 1 min; 45.degree. C. for 2 min;
72.degree. C. for 3 min) and a final step at 72.degree. C. for 10
min. The 100 bp PCR amplification product was purified on a 3%
agarose (NuSieve, FMC) gel and reamplified by PCR under the same
conditions except that the reaction mixtures contained 130 .mu.M
dTTP and 70 .mu.M digoxigenin-11-dUTP instead of 200 .mu.M dTTP.
The digoxigenin-labelled PCR product was purified on a 3% NuSieve
agarose gel. About 100,000 plaque forming units of the lambda. ZAP
II cDNA library were screened with the digoxigenin-labelled PCR
product by in situ plaque hybridization using nylon membranes
(Hybond-N, Amersham). Membranes were air-dried and DNA was
crosslinked on the membranes under UV light (0.15 J/cm.sup.2).
Hybridization was performed for 16 hours at 65.degree. C. in
5.times.SSC, 1% blocking reagent (Boehringer Mannheim), 0.1%
N-lauroylsarcosine, 0.02% sodium dodecylsulphate containing 10
ng/ml of heat denatured digoxigenin-labelled probe.
Non-specifically bound probe was removed by rinsing twice for 5 min
in 2.times.SSC/0.1% SDS at 25.degree. C. and twice for 15 min in
0.1.times.SSC/0.1% SDS at 60.degree. C. Detection of the probe was
done using anti-digoxigenin antibodies linked to alkaline
phosphatase (Boehringer Mannheim) and its substrate
5-bromo-4-chloro-3-indolyl phosphate (Boehringer Mannheim)
according to the manufacturer's instructions. Positive plaques were
purified by two additional screening rounds with the same probe
under the same conditions. Inserts from purified plaques were
excised in vivo into the pBluescript phagemid form with the aid of
the helper phage R408, according to the instructions of Stratagene.
Nucleotide sequencing was done with an ALF automated sequencer
(Pharmacia) using fluoresceine-labelled M13 forward and reverse
primers (Pharmacia). Sequence analysis was performed by the
Intelligenetics PC-gene software.
[0147] Inserts from ten different positive clones were released by
EcoRI digestion and their sizes compared by agarose
electrophoresis. The clone with the longest insert (ACE) was
subjected to nucleotide sequence analysis. AC1 is 590 nucleotides
long and contains an open reading frame of 86 amino acids. The 25
amino-terminal amino acids have a predictable signal peptide
structure obeying the (-1, -3)-rule (Von Heijne, 1985, Mol Biol,
184, 99-105). The deduced amino acid sequence of the region
following the putative signal peptide is identical to the 30-amino
acid sequence of mature Ac-AMP2 as determined by protein
sequencing. In addition, the mature protein domain is extended by a
31-amino acids carboxy-terminal domain. This carboxy-terminal
extension may play a role in the subcellular targeting of Ac-AMP2.
AC1 has 45-nucleotide and 284-nucleotide untranslated regions at
the 5' and 3' end, respectively. The 3' end untranslated region is
not terminated by a poly(A) tail, indicating that AC1 is not a full
length cDNA clone.
[0148] All of the other nine sequenced positive clones had deduced
amino acid sequences identical to that of AC1. They differed from
each other by various degrees of truncation at the 5' or 3' end.
The fact that the 10 sequenced clones all contained an arginine at
position 30 of the mature protein domain suggests that Ac-AMP1 and
Ac-AMP2 are both derived from the same precursor preprotein.
[0149] The carboxy-terminal extension peptide did not show relevant
homology either at the amino acid or nucleotide level with any of
the entries from the Swiss-Prot (release 20) or EMBL gene bank
(release 29), respectively. The structure of the Ac-AMP2 cDNA thus
appears to be unique and obviously different from that of known
genes encoding Chitin-binding Plant Proteins.
[0150] FIG. 6 shows the nucleotide sequence and deduced amino acid
sequence of clone ACd. The putative signal sequence is underlined
and the sequence of mature Ac-AMP2 is boxed. The stop codon is
marked with an asterisk.
Example 15
Molecular Cloning of Ca-AMP1 and Bm-AMP1 cDNAs
[0151] From outdoor grown plants, seeds at 6 different
developmental stages are collected, frozen in liquid nitrogen and
stored at -80 degree. C. After pulverization, total RNA is
extracted from 15 g of a mixture of the 6 different developmental
stages, using the method of De Vries et al (1988, Plant Molecular
Biology Manual, B6, 1-13) with the exception that 6 ml of a 1:2
phenol:RNA extraction buffer mixture and 2 ml of chloroform are
used per g of tissue. Poly (A).sup.+ mRNA is purified by affinity
chromatography on oligo(dT)-cellulose as described by Siflow et al
(1979, Biochemistry 18, 2725-2731). Double stranded cDNAs are
prepared from 1.5 .mu.g of poly(A).sup.+ RNA according to Gubler
and Hoffman (1983, Gene 25, 263-269) and ligated to EcoRI/NotI
adaptors using the cDNA Synthesis Kit of Pharmacia.
[0152] The cDNAs are cloned into the lambda ZAPII phage vector
(Stratagene) according to the manufacturers instructions. A DNA
probe for screening the cDNA library is produced by polymerase
chain reaction (PCR) as follows. Two degenerate oligonucleotides
are synthesized, corresponding to a run of amino acids of Ca-AMP1
or Bm-AMP1: one has a sense orientation and the other has an
antisense orientation. Both primers have the AAAGAATTC (i.e. AAA
followed by the EcoRI recognition sequence) sequence at their 5'
ends. PCR is performed with the Tag polymerase under standard
conditions (Sambrook et al, 1989, Molecular Cloning, Cold Spring
Harbor Laboratory Press) using the oligonucleotides as amplimers
and 25 ng of cDNA as target DNA. The temperature programme includes
an initial step at 94.degree. C. for 5 min, 30 cycles (94.degree.
C. for 1 min; 45.degree. C. for 2 min, 72.degree. C. for 3 min) and
a final step at 72.degree. C. for 10 min. The PCR amplification
product is purified on a 3% agarose (NuSieve, FMC) gel. This PCR
product is partially reamplified using degenerate oligonucleotides.
This PCR amplification product is again purified on a 3% agarose
(NuSieve, FMC) gel and reamplified by PCR under the same conditions
except that the reaction mixture contained 130.mu.M dTTP and 70
.mu.M digoxigenin-11-dUTP instead of 200.mu.M dTTP. The
digoxigenin-labeled PCR product is purified on a 3% NuSieve agarose
gel. About 10,000 plaque forming units of the lambda ZAPII cDNA
library are screened with the digoxigenin-labeled PCR product by in
situ plaque hybridization using nylon membranes (Hybond-N,
Amersham). Membranes are air-dried and DNA is crosslinked to the
membranes under UV light (0.15 J/cm.sup.2). Hybridization is
performed for 16 h at 64.degree. C. in 5.times.SSC, 1% blocking
reagent (Boehringer Mannheim), 0.1% N-lauroylsarcosine, 0.02%
sodium dodecylsulphate containing 10 ng/ml of heat denatured
digoxigenin-labeled probe. Non-specifically bound probe is removed
by rinsing two times 5 min in 2.times.SSC/0.1% SDS at 25.degree. C.
and two times 15 min in 0.1.times.SSC/0.1% SDS at 60.degree. C.
Detection of the probe is done using anti-digoxigenin antibodies
linked to alkaline phosphatase (Boehringer Mannheim) and its
substrate 5-bromo-4-chloro-3-indolyl phosphate (Boehringer
Mannheim) according to the manufacturers instructions. Positive
plaques are purified by two additional screening rounds with the
same probe under the same conditions. Inserts from purified plaques
are excised in vivo into the pBluescript phagemid form with the aid
of the helper phage R408. The inserts from different positive
clones are excised by EcoRI digestion and their sizes compared by
agarose gel electrophoresis. Some of the clones are subjected to
nucleotide sequence analysis. The clones with the largest insert
may have an open reading frame corresponding to Ca-AMP1 or Bm-AMP1,
as could be determined by comparison to the experimental N-terminal
amino acid sequences. The full-length cDNA clones may differ from
each other in the length of their 5' and 3' end untranslated
regions and polyadenylation signals.
[0153] In order to obtain a full-length cDNA, another approach may
be followed. PCR is performed under standard conditions using an
antisense oligonucleotide in combination with the M13 universal
primer at one hand and the M13 reverse primer at the other hand.
The last nucleotides of the oligonucleotide form the inverted
complementary sequence of part of the 3' untranslated region
immediately flanking the poly-A tail of the less-than-full-length
cDNA clone. This sequence is extended to the 5' end with the GAATTC
EcoRI recognition site preceded by the nucleotides `ATA`. As a
template, either 2 .mu.g of total cDNA or 10.sup.5 recombinant
phages are used. In both cases, 3 separate reactions are set up.
Prior to amplification, phages are lysed by an initial step in the
PCR temperature programme of 5 min at 99.degree. C. to liberate the
phage DNA. The size of the amplification products is determined by
electrophoresis on a 3% agarose (NuSieve, FMC) gel. Products are
obtained with sizes corresponding to inserts of different length,
including a full-length cDNA clones if one is present in the cDNA
library.
Example 16
Construction of the Expression Vectors pAC11 and pAC12 (encoding
Ac-AMP2)
[0154] Two different expression cassettes were constructed based on
two portions of the insert of clone AC1.
[0155] The first expression vector (pAC11, as shown in FIG. 7A
contains the full coding region of Ac-AMP2 cDNA flanked at its 5'
end by the strong constitutive promoter of the 35S RNA of
cauliflower mosaic virus, CaMV35S (Odell et al, 1985, Nature, 313,
810-812) with a duplicated enhancer element to allow for high
transcriptional activity (Kay et al, 1987, Science, 236,
1299-1302). The Ac-AMP2 cDNA coding region includes the signal
peptide (SP), the mature protein (MP), and the carboxy-terminal
extension peptide (CP) as shown in FIG. 7A. The coding region of
Ac-AMP2 cDNA is flanked at its 3' side by the CaMV35S
polyadenylation sequence. The plasmid backbone of this vector is
the phagemid pUC120 (Vieira and Messing, 1987, Methods Enzymol,
153, 3-11).
[0156] pAC11 was constructed from clone AC1 as follows. Clone AC1
consists of the Ac-AMP2 cDNA (shown in FIG. 6) cloned into the
EcoRI site of pBluescript SK(+) (from Stratagene) such that the 5'
end faces the M13 universal primer binding site. AC1 was digested
with EcoRV (cuts within the SK polylinker of pBluescript) and NheI
(cuts internally in the Ac-AMP2 cDNA sequence at base position 315
which is 9 bases downstream of the stop codon). The EcoRV/HheI 332
by fragment was subcloned into the expression vector pFAJ3002 which
was pre-digested with SmaI and XbaI. PFAJ3002 is a derivative of
the expression vector pFF19 (Timmermans et al, 1990, J
Biotechnology, 14, 333-344) in which the unique EcoRI site is
replaced by a HindIII site. The second expression vector (pAC12,
shown in FIG. 7B) contains an open reading frame coding for the
signal peptide (SP) and mature domain (MP) of the Ac-AMP
preprotein. This open reading frame is flanked at its 5' side by
the duplicated
[0157] CaMV35S promoter and at its 3' side by the CaMV35S
polyadenlyation sequence.
[0158] pAC12 was constructed as follows. A 216 bp fragment was
amplified by polymerase chain reaction using AC1 as DNA template
and OWB32, OWB33 as sense and antisense primers respectively. The
primer OWB32 (5'AATTGGATCCAGTCAAGAGTATTAATTAGG) (SEQ ID NO: 3)
corresponds to nucleotides 17 to 36 of Ac-AMP2 cDNA and introduces
a BamHI site at the 5' end of the PCR amplification product. The
primer OWB33 (5'AATTGTCGACTCAACGGCCACAGTACTTTGGGCC) (SEQ ID NO: 4)
corresponds to nucleotides 190 to 210 of Ac-AMP2 cDNA and links an
inframe stop codon and a SalI site to the 3' end of the PCR
products. Both OWB32 and OWB33 have a 4 by random sequence at the
5' end prior to the restriction site. The PCR product was digested
with BamHI and SalI and subsequently subcloned into the expression
vector pFAJ3002, previously digested with the same restriction
enzymes.
Example 17
Construction of the Plant Transformation Vectors pAC111 and pAC112
(Encoding Ac-AMP2)
[0159] The expression vector pAC11 and pAC12 were digested with
HindIII and the fragments containing the Ac-AMP2 cDNA expression
cassettes were subcloned into the unique HindIII site of pBin19Ri.
pBin19Ri is a modified version of the plant transformation vector
pBin19 (Bevan, 1984, Nucleic Acids Research, 12:22, 8711-8721)
wherein the unique EcoRI and HindIII sites are switched and the
defective npt II expression cassette (Yenofsky et al, 1990, Proc
Natl Acad Sci USA, 87:3435-3439) is replaced by the npt II
expression cassette described by An et al (1985, EMBO J,
4:277-284).
[0160] The plant transformation vector containing the pAC11
expression cassette was designated pAC111, while the transformation
vector containing the pAC12 expression cassette was designated
pAC112. The structure of the two transformation vectors is shown in
FIG. 8. pAC111 includes DNA encoding the Ac-AMP2 signal peptide
(SP), mature protein (MP), and carboxy-terminal extension peptide
(CP); pAC112 includes DNA encoding the Ac-AMP2 signal peptide (SP)
and mature protein (MP).
Example 18
Plant Transformation
[0161] The disarmed Agrobacterium tumefaciens strain LBA4404
[pAL4404] (Hoekema et al, 1983, Nature, 303:179-180) may be
transformed by either of the vectors pAC111 or pAC112, using the
method of de Framond A et al (Biotechnology, 1:262-9).
[0162] Tobacco transformation may be carried out using leaf discs
of Nicotiana tabacum Samsun based on the method of Hozsch R B et al
(1985, Science, 227, 1229-31) and co-culturing with Agrobacterium
strains containing pAC111 or pAC112. Co-cultivation may be carried
out under selection pressure of 100 .mu.g/ml kanamycin. Transgenic
plants (transformed with pAC111 or pAC112) may be regenerated on
media containing 100 .mu.g/ml kanamycin. These transgenic plants
may be analysed for expression of the newly introduced genes using
standard Western blotting techniques. Transgenic plants may also be
analysed for increased resistance to fungal or bacterial
diseases.
[0163] Plants capable of constitutive expression of the introduced
genes may be selected and self-pollinated to give seed. The progeny
of the seed exhibiting stable integration of the Ac-AMP genes would
be expected to show typical Mendelian inheritance patterns for the
Ac-AMP genes.
Example 19
Construction of an Expression Vector Encoding Ca-AMP1 or
Bm-AMP1
[0164] An expression vector is constructed, containing the full
coding region of the Ca-AMP1 or Bm-AMP1 DNA flanked at its 5' end
by the strong constitutive promoter of the 35S RNA of the
cauliflower mosaic virus (Odell et al, 1985, Nature 313, 810-812)
with a duplicated enhancer element to allow for high
transcriptional activity (Kay et al, 1987, Science 236, 1299-1302).
The coding region of the Ca-AMP1/Bm-AMP1 DNA is flanked at its 3'
end side by the polyadenylation sequence of 35S RNA of the
cauliflower mosaic virus (CaMV35S). The plasmid backbone of this
vector is the phagemid pUC120 (Vieira and Messing 1987, Methods
Enzymol. 153, 3-11). The expression vector is constructed as
follows. A cDNA clone consisting of the Ca-AMP1/Bm-AMP1 DNA is
cloned into the BamHI/SalI sites of pEMBL18+, Boehringer). The
BamHI/SalI fragment is subcloned into the expression vector
pFAJ3002 which was pre-digested with BamHI and SalI. pFAJ3002 is a
derivative of the expression vector pFF19 (Timmermans et al, 1990,
J. Biotechnol. 14, 333-344) of which the unique EcoRI site is
replaced by a HindIII site.
Example 20
Construction of a Plant Transformation Vector Encoding Ca-AMP1 or
Bm-AMP1
[0165] The expression vector from Example 19 is digested with
HindIII and the fragment containing the Ca-AMP1/Bm-AMP1 DNA
expression cassette is subcloned into the unique HindIII site of
pBin19Ri. pBin19Ri is a modified version of the plant
transformation vector pBin19 (Bevan 1984, Nucleic Acids Research
12, 8711-8721) wherein the unique EcoRI and HindIII sites are
switched and the defective nptII expression cassette (Yenofsky et
al. 1990, Proc. Natl. Acad. Sci. USA 87: 3435-3439) is
introduced.
Example 21
Plant Transformation
[0166] The disarmed Agrobacterium tumefaciens strain LBA4404
(pAL4404)(Hoekema et al, 1983, Nature 303, 179-180) is transformed
with the vector made in Example 20 using the method of de Framond
et al (BioTechnology 1, 262-269).
[0167] Tobacco transformation is carried out using leaf discs of
Nicotiana tabacum Samsun based on the method of Horsch et al (1985,
Science 227, 1229-1231) and co-culturing with Agrobacterium strains
containing pFRG8. Co-cultivation is carried out under selection
pressure of 100 .mu.g/ml kanamycin. Transgenic plants (transformed
with pFRG8) are regenerated on media containing 100 .mu.g/ml
kanamycin. These transgenic plants may be analysed for expression
of the newly introduced genes using standard western blotting
techniques. Plants capable of constitutive expression of the
introduced genes may be selected and self-pollinated to give seed.
F1 seedlings of the transgenic plants may be further analysed.
Sequence CWU 1
1
22 1 20 DNA Artificial sequence Primer 1 gtnggngart gkgtnmgngg 20 2
23 DNA Artificial sequence Primer 2 ccrcartayt tnggnccytt ncc 23 3
30 DNA Artificial sequence Primer 3 aattggatcc agtcaagagt
attaattagg 30 4 34 DNA Artificial sequence Primer 4 aattgtcgac
tcaacggcca cagtactttg ggcc 34 5 29 PRT Amaranthus caudatus 5 Val
Gly Glu Cys Val Arg Gly Arg Cys Pro Ser Gly Met Cys Cys Ser 1 5 10
15 Gln Phe Gly Tyr Cys Gly Lys Gly Pro Lys Tyr Cys Gly 20 25 6 30
PRT Amaranthus caudatus 6 Val Gly Glu Cys Val Arg Gly Arg Cys Pro
Ser Gly Met Cys Cys Ser 1 5 10 15 Gln Phe Gly Tyr Cys Gly Lys Gly
Pro Lys Tyr Cys Gly Arg 20 25 30 7 31 PRT Amaranthus retroflexus 7
Ala Gly Glu Cys Val Gln Gly Arg Cys Pro Ser Gly Met Cys Cys Ser 1 5
10 15 Gln Phe Gly Tyr Cys Gly Arg Gly Pro Lys Tyr Cys Gly Arg Arg
20 25 30 8 43 PRT Tobacco 8 Glu Gln Cys Gly Ser Gln Ala Gly Gly Ala
Arg Cys Ala Ser Gly Leu 1 5 10 15 Cys Cys Ser Lys Phe Gly Trp Cys
Gly Asn Thr Asn Asp Tyr Cys Gly 20 25 30 Pro Gly Asn Cys Gln Ser
Gln Cys Pro Gly Gly 35 40 9 41 PRT Bean 9 Glu Gln Cys Gly Arg Gln
Ala Gly Gly Ala Leu Cys Pro Gly Gly Asn 1 5 10 15 Cys Cys Ser Gln
Phe Gly Trp Cys Gly Ser Thr Thr Asp Tyr Cys Gly 20 25 30 Pro Gly
Cys Gln Ser Gln Cys Gly Gly 35 40 10 44 PRT Hevein 10 Glu Gln Cys
Gly Arg Gln Ala Gly Gly Lys Leu Cys Pro Asn Asn Leu 1 5 10 15 Cys
Cys Ser Gln Trp Gly Trp Cys Gly Ser Thr Asp Glu Tyr Cys Ser 20 25
30 Pro Asp His Asn Cys Gln Ser Asn Cys Lys Asp Ser 35 40 11 43 PRT
Wheat 11 Gln Arg Cys Gly Glu Gln Gly Ser Asn Asn Glu Cys Pro Asn
Asn Leu 1 5 10 15 Cys Cys Ser Gln Tyr Gly Tyr Cys Gly Met Gly Gly
Asp Tyr Cys Gly 20 25 30 Lys Gly Cys Gln Asp Gly Ala Cys Trp Thr
Ser 35 40 12 31 PRT Nettle 12 Gln Arg Cys Gly Ser Gln Gly Gly Gly
Gly Thr Cys Pro Ala Leu Arg 1 5 10 15 Cys Cys Ser Ile Trp Gly Trp
Cys Gly Ala Ser Ser Pro Tyr Cys 20 25 30 13 590 DNA Amaranthus
caudatus 13 caaaaaaaaa aaataaagtc aagagtatta attaggtgag aaaaaatggt
gaacatgaag 60 tgtgttgcat tgatagttat agttatgatg gcgtttatga
tggtggatcc atcaatggga 120 gtgggagaat gtgtgagagg acgttgccca
agtgggatgt gttgcagtca gtttgggtac 180 tgtggtaaag gcccaaagta
ctgtggccgt gccagtacta ctgtggatca ccaagctgat 240 gttgctgcca
ccaaaactgc caagaatcct accgatgcta aacttgctgg tgctggtagt 300
ccatgaaagt agtagctagc taggttcacg ttggattacc aagccgtgcc agtactactg
360 tggccgtgcc agtactaatg ttctcttata tgtctgaaat aagctcctat
ataaatacta 420 gtatcttgat gtaatggagt attttcattt tgtttttatt
tgagttatga tcgtgacttc 480 cttgtgttgg tttaacttgt atattgtaat
gcatcttaaa tgctgtctca aataatttga 540 tgtattaaac acttgttttg
tttttaatac atactaagtg ctgtaaattc 590 14 86 PRT Amaranthus caudatus
14 Met Val Asn Met Lys Cys Val Ala Leu Ile Val Ile Val Met Met Ala
1 5 10 15 Phe Met Met Val Asp Pro Ser Met Gly Val Gly Glu Cys Val
Arg Gly 20 25 30 Arg Cys Pro Ser Gly Met Cys Cys Ser Gln Phe Gly
Tyr Cys Gly Lys 35 40 45 Gly Pro Lys Tyr Cys Gly Arg Ala Ser Thr
Thr Val Asp His Gln Ala 50 55 60 Asp Val Ala Ala Thr Lys Thr Ala
Lys Asn Pro Thr Asp Ala Lys Leu 65 70 75 80 Ala Gly Ala Gly Ser Pro
85 15 42 PRT Capsicum annuum 15 Gln Glu Gln Cys Gly Asn Gln Ala Gly
Gly Arg Ala Cys Ala Asn Arg 1 5 10 15 Leu Cys Cys Ser Gln Tyr Gly
Tyr Cys Gly Ser Thr Arg Ala Tyr Cys 20 25 30 Gly Val Gly Cys Gln
Ser Asn Cys Gly Arg 35 40 16 37 PRT Briza maxima Modified-site
(9)..(9) Xaa = R or H 16 Cys Ser Ser His Asn Pro Cys Pro Xaa His
Gln Cys Cys Ser Lys Tyr 1 5 10 15 Gly Tyr Cys Gly Leu Gly Xaa Asp
Tyr Cys Gly Leu Gly Cys Arg Gly 20 25 30 Gly Pro Cys Asp Arg 35 17
126 DNA Artificial sequence Predicted Ca-AMP1 sequence 17
caagagcaat gcggaaacca agctggagga agagcttgcg ctaacagact ttgctgctct
60 caatacggat actgcggatc tactagagct tactgcggag ttggatgcca
atctaactgc 120 ggaaga 126 18 37 PRT Briza maxima 18 Cys Ser Ser His
Asn Pro Cys Pro His His Gln Cys Cys Ser Lys Tyr 1 5 10 15 Gly Tyr
Cys Gly Leu Gly Asn Asp Tyr Cys Gly Leu Gly Cys Arg Gly 20 25 30
Gly Pro Cys Asp Arg 35 19 111 DNA Artificial sequence Predicted
Bm-AMP1 sequence 19 tgctcttctc acaacccgtg cccgagacac caatgctgct
ctaagtacgg atactgcgga 60 cttggatctg actactgcgg acttggatgc
agaggaggac cgtgcgacag a 111 20 4 PRT Artificial sequence Amino acid
homology group 20 Met Ile Leu Val 1 21 9 PRT Artificial sequence
domain 21 Cys Cys Xaa Xaa Xaa Gly Xaa Cys Gly 1 5 22 20 PRT
Artificial sequence Conserved cysteine motif 22 Cys Xaa Xaa Xaa Xaa
Cys Cys Xaa Xaa Xaa Xaa Xaa Cys Xaa Xaa Xaa 1 5 10 15 Xaa Xaa Xaa
Cys 20
* * * * *