U.S. patent application number 11/357337 was filed with the patent office on 2006-07-06 for human serine protease and serpin polypeptides.
This patent application is currently assigned to Human Genome Sciences, Inc.. Invention is credited to Jian Ni, Steven M. Ruben.
Application Number | 20060147454 11/357337 |
Document ID | / |
Family ID | 22116864 |
Filed Date | 2006-07-06 |
United States Patent
Application |
20060147454 |
Kind Code |
A1 |
Ni; Jian ; et al. |
July 6, 2006 |
Human serine protease and serpin polypeptides
Abstract
The present invention relates to novel human secreted proteins
and isolated nucleic acids containing the coding regions of the
genes encoding such proteins. Also provided are vectors, host
cells, antibodies, and recombinant methods for producing human
secreted proteins. The invention further relates to diagnostic and
therapeutic methods useful for diagnosing and treating disorders
related to these novel human secreted proteins.
Inventors: |
Ni; Jian; (Germantown,
MD) ; Ruben; Steven M.; (Brookeville, MD) |
Correspondence
Address: |
HUMAN GENOME SCIENCES INC;INTELLECTUAL PROPERTY DEPT.
14200 SHADY GROVE ROAD
ROCKVILLE
MD
20850
US
|
Assignee: |
Human Genome Sciences, Inc.
Rockville
MD
|
Family ID: |
22116864 |
Appl. No.: |
11/357337 |
Filed: |
February 21, 2006 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10325745 |
Dec 23, 2002 |
|
|
|
11357337 |
Feb 21, 2006 |
|
|
|
09244111 |
Feb 4, 1999 |
6566498 |
|
|
10325745 |
Dec 23, 2002 |
|
|
|
60073961 |
Feb 6, 1998 |
|
|
|
Current U.S.
Class: |
424/146.1 ;
435/226; 435/320.1; 435/325; 435/6.14; 435/6.18; 435/69.1;
530/388.26; 536/23.2 |
Current CPC
Class: |
A61P 29/00 20180101;
C12N 9/6424 20130101; A61P 7/04 20180101; C12N 2799/026 20130101;
A61P 7/06 20180101; C07K 2319/00 20130101; A61P 7/02 20180101; A61P
35/00 20180101; A61P 31/00 20180101; A61P 37/06 20180101; A61K
38/00 20130101; C07K 14/8121 20130101 |
Class at
Publication: |
424/146.1 ;
435/006; 435/069.1; 435/226; 435/320.1; 435/325; 530/388.26;
536/023.2 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12Q 1/68 20060101 C12Q001/68; C07H 21/04 20060101
C07H021/04; C12P 21/06 20060101 C12P021/06; C12N 9/64 20060101
C12N009/64 |
Claims
1. An isolated nucleic acid molecule comprising a nucleotide
sequence encoding an amino acid sequence at least 95% identical to
a sequence selected from the group consisting of: (a) residues 1 to
283 of SEQ ID NO:2; (b) residues 32 to 283 of SEQ ID NO:2; (c)
residues 1 to 207 of SEQ ID NO:4; (d) residues 24 to 207 of SEQ ID
NO:4; (e) residues 1 to 162 of SEQ ID NO:6; (f) residues 18 to 162
of SEQ ID NO:6; (g) residues 1 to 422 of SEQ ID NO:8; (h) residues
20 to 422 of SEQ ID NO:8; (i) residues 1 to 316 of SEQ ID NO:10; 0)
residues 50 to 316 of SEQ ID NO:10; (k) residues 1 to 76 of SEQ ID
NO:12; and (l) residues 20 to 76 of SEQ ID NO:12.
2. The isolated nucleic acid molecule of claim 1 comprising the
nucleotide sequence selected from the group consisting of: SEQ ID
NO:1 and SEQ ID NO:3.
3. The isolated nucleic acid molecule of claim 1 comprising the
nucleotide sequence selected from the group consisting of: SEQ ID
NO:5 and SEQ ID NO:7.
4. The isolated nucleic acid molecule of claim 1 comprising the
nucleotide sequence selected from the group consisting of: SEQ ID
NO:9 and SEQ ID NO:11.
5. The isolated nucleic acid molecule of claim 1 comprising the
nucleotide sequence shown as SEQ ID NO:1.
6. The isolated nucleic acid molecule of claim 1 comprising a
nucleotide sequence encoding an amino acid sequence selected from
the group consisting of: (a) at least 30 contiguous amino acid
residues of SEQ ID NO:2; (b) at least 30 contiguous amino acid
residues of SEQ ID NO:4; (c) at least 30 contiguous amino acid
residues of SEQ ID NO:6; (d) at least 30 contiguous amino acid
residues of SEQ ID NO:8; (e) at least 30 contiguous amino acid
residues of SEQ ID NO:10; and (f) at least 30 contiguous amino acid
residues of SEQ ID NO:12.
7. A vector comprising the isolated nucleic acid molecule of claim
1.
8. A nucleic acid molecule comprising the nucleic acid molecule of
claim 1 operably associated with a heterologous regulatory element
which controls gene expression.
9. A host cell comprising the vector of claim 7.
10. A host cell comprising the nucleic acid molecule of claim
8.
11. An isolated polypeptide comprising an amino acid sequence at
least 95% identical to a sequence selected from the group
consisting of: (a) residues 32 to 283 of SEQ ID NO:2; (b) residues
24 to 207 of SEQ ID NO:4; (c) residues 18 to 162 of SEQ ID NO:6;
(d) residues 20 to 422 of SEQ ID NO:8; (e) residues 50 to 316 of
SEQ ID NO: 10; and (f) residues 20 to 76 of SEQ ID NO:12.
12. An isolated polypeptide comprising an amino acid sequence
selected from the group consisting of: (a) at least 30 contiguous
amino acid residues of SEQ ID NO:2; (b) at least 30 contiguous
amino acid residues of SEQ ID NO:4; (c) at least 30 contiguous
amino acid residues of SEQ ID NO:6; (d) at least 30 contiguous
amino acid residues of SEQ ID NO:8; (e) at least 30 contiguous
amino acid residues of SEQ ID NO:10; and (f) at least 30 contiguous
amino acid residues of SEQ ID NO:12.
13. An isolated antibody that binds specifically to the isolated
polypeptide of claim 11.
14. A composition comprising the polypeptide of claim 11.
15. A method of making an isolated polypeptide comprising: (a)
culturing the host cell of claim 10 under conditions such that said
polypeptide is expressed; and (b) recovering said polypeptide.
16. The polypeptide produced by the method of claim 15.
17. A method for treating a medical condition, comprising
administering to a patient a therapeutically effective amount of
the polypeptide of claim 11.
18. A method of diagnosing a pathological condition or a
susceptibility to a pathological condition in a subject comprising:
(a) determining the presence or absence of a mutation in the
polynucleotide of claim 1; and (b) diagnosing a pathological
condition or a susceptibility to a pathological condition based on
the presence or absence of said mutation.
19. A method of diagnosing a pathological condition or a
susceptibility to a pathological condition in a subject comprising:
(a) determining the presence or amount of expression of the
polypeptide of claim 11 in a biological sample; and (b) diagnosing
a pathological condition or a susceptibility to a pathological
condition based on the presence or amount of expression of the
polypeptide.
20. A method for identifying a binding partner to the polypeptide
of claim 11 comprising: (a) contacting the polypeptide of claim 11
with a binding partner; and (b) determining whether the binding
partner effects an activity of the polypeptide.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/325,745, filed Dec. 23, 2002, which is a divisional of and
claims priority under 35 U.S.C. .sctn. 120 to U.S. application Ser.
No. 09/244,111, filed Feb. 4, 1999 (now U.S. Pat. No. 6,566,498,
issued May 20, 2003), which claims benefit under 35 U.S.C.
.sctn.119(e) to U.S. Provisional Application No. 60/073,961 filed
Feb. 6, 1998, all of which are hereby incorporated by reference in
their entireties.
FIELD OF THE INVENTION
[0002] This invention relates to newly identified human
polynucleotides and the polypeptides encoded by these
polynucleotides, uses of such polynucleotides and polypeptides, and
their production. More particularly the invention provides novel
Serine Protease polypeptides, Serpin polypeptides and
polynucleotides encoding such polypeptides.
BACKGROUND OF THE INVENTION
[0003] Localized proteolytic activity through the action of
proteases plays a critical regulatory role in a variety of
important biological processes. For instance, the enzyme plasmin
plays such a role in hemostasis, angiogenesis, tumor metastasis,
cellular migration and ovulation. Plasmin is generated from its
precursor zymogen plasminogen by the action of plasminogen
activators (PAs) such as tissue-type PA (t-PA) and urokinase-type
(u-PA), both of which are serine proteases. The activity of the PA
system is precisely regulated by several mechanisms, one of which
involves the interaction of t-PA and u-PA with specific plasminogen
activator inhibitors. Among these serine protease inhibitors (i.e.,
serpins), plasminogen activator inhibitor type 1 (PAI-1) is unique
in its ability to efficiently inhibit u-PA as well as the single
and two-chain forms of t-PA. High PAI-1 levels are associated with
an increased risk of thromboembolic disease, while PAI-1 deficiency
may represent an inherited autosomal recessive bleeding disorder.
See, for instance, Reilly, T. M., et al., Recombinant plasminogen
activator inhibitor type 1: a review of structural, functional, and
biological aspects, Blood Coag. And Fibrinolysis 5:73-81
(1994).
Serpin Mechanism
[0004] The serpins are a gene family that encompasses a wide
variety of protein products, including many of the proteinase
inhibitors in plasma (Huber & Carrell, 1989; full citations of
references cited in this section on Serpin Mechanism are listed at
the end of this section). However, in spite of their name, not all
serpins are proteinase inhibitors. They include steroid binding
globulins, the prohormone angiotensinogen, the egg white protein
ovalbumin, and barley protein Z, a major constituent of beer. The
serpins are thought to share a common tertiary structure
(Doolittle. 1983) and to have evolved from a common ancestor (Hunt
& Dayhoff. 1980). Proteins with recognizable sequence homology
have been identified in vertebrates, plants, insects and viruses
but not, thus far, in prokaryotes (Huber & Carrell. 1989;
Sasaki. 1991; Komiyama, Ray, Pickup, et al. 1994). Current models
of serpin structure are based largely on seminal X-ray
crystallographic studies of one member of the family,
a-1-antitrypsin (a1AT), also called a-1-proteinase inhibitor (Huber
& Carrell. 1989). The structure of a modified form of a1AT,
cleaved in its reactive center, was solved by Loebermann and
coworkers in 1984 (Loebermann, Tokuoka, Deisenhofer, & Huber.
1984). An interesting feature of this structure was that the two
residues normally comprising the reactive center (Met-Ser), were
found on opposite ends of the molecule, separated by almost 70
.ANG.. Loebermann and coworkers proposed that a relaxation of a
strained configuration takes place upon cleavage of the reactive
center peptide bond, rather than a major rearrangement of the
inhibitor structure. In this model, the native reactive center is
part of an exposed loop, also called the strained loop (Loebermann,
Tokuoka, Deisenhofer, & Huber. 1984; Carrell & Boswell.
1986; Sprang. 1992). Upon cleavage, this loop moves or "snaps
back", becoming one of the central strands in a major b-sheet
structure (b-sheet A). This transformation is accompanied by a
large increase in thermal stability (Carrell & Owen. 1985;
Gettins & Harten. 1988; Bruch, Weiss, & Engel. 1988;
Lawrence, Olson, Palaniappan, & Ginsburg. 1994b).
[0005] Recent crystallographic structures of several native
serpins, with intact reactive center loops, have confirmed
Loebermann's hypothesis that the overall native serpin structure is
very similar to cleaved a1AT, but that the reactive center loop is
exposed above the plane of the molecule (Schreuder, de Boer,
Dijkema, et al. 1994; Carrell, Stein, Fermi, & Wardell. 1994;
Stein, Leslie, Finch, Turnell, McLaughlin, & Carrell. 1990;
Wei, Rubin, Cooperman, & Christianson. 1994). Additional
evidence for this model has come from studies where synthetic
peptides, homologous to the reactive center loops of a1AT,
antithrombin III (ATIII), or PAI-1 when added in trans, incorporate
into their respective molecules, presumably as a central strand of
b-sheet A (Bjork, Ylinenjarvi, Olson, & Bock. 1992; Bjork,
Nordling, Larsson, & Olson. 1992; Schulze, Baumann, Knof,
Jaeger, Huber, & Laurell. 1990; Carrell, Evans, & Stein.
1991; Kvassman, Lawrence, & Shore. 1995). This leads to an
increase in thermal stability similar to that observed following
cleavage of a serpin at its reactive center, and converts the
serpin from an inhibitor to a substrate for its target proteinase.
A third serpin structural form has also been identified, the
so-called latent conformation. In this structure the reactive
center loop is intact, but instead of being exposed, the entire
amino-terminal side of the reactive center loop is inserted as the
central strand into b-sheet A (Mottonen, Strand, Symersky, et al.
1992). This accounts for the increased stability of latent PAI-1
(Lawrence, Olson, Palaniappan, & Ginsburg. 1994a) as well as
its lack of inhibitory activity (Hekman & Loskutoff. 1985). The
ability to adopt this conformation is not unique to PAI-1, but has
also now been shown for ATIII and a1AT (Carrell, Stein, Fermi,
& Wardell. 1994; Lomas, Elliot, Chang, Wardell, & Carrell.
1995). Together, these data have led to the hypothesis that active
serpins have mobile reactive center loops, and that this mobility
is essential for inhibitor function (Lawrence, Strandberg, Ericson,
& Ny. 1990; Carrell, Evans, & Stein. 1991; Carrell &
Evans. 1992; Lawrence, Olson, Palaniappan, & Ginsburg. 1994b;
Shore, Day, Francis-Chmura, et al. 1994; Lawrence, Ginsburg, Day,
et al. 1995; Fa, Karolin, Aleshkov, Strandberg, Johansson, &
Ny. 1995; Olson, Bock, Kvassman, et al. 1995). The large increase
in thermal stability observed with loop insertion, is presumably
due to reorganization of the five stranded b-sheet A from a mixed
parallel-antiparallel arrangement to a six stranded, predominantly
antiparallel b-sheet (Carrell & Owen. 1985; Gettins &
Harten. 1988; Bruch, Weiss, & Engel. 1988; Lawrence, Olson,
Palaniappan, & Ginsburg. 1994a). This dramatic stabilization
has led to the suggestion that native inhibitory serpins may be
metastable structures, kinetically trapped in a state of higher
free energy than their most stable thermodynamic state (Lawrence,
Ginsburg, Day, et al. 1995; Lee, Park, & Yu. 1996). Such an
energetically unfavorable structure would almost certainly be
subject to negative selection, and thus its retention in all
inhibitory serpins implies that it has been conserved for
functional reasons.
[0006] The serpins act as "suicide inhibitors" that react only once
with a target proteinase forming an SDS-stable complex. They
interact by presenting a "bait" amino acid residue, in their
reactive center, to the enzyme. This bait residue is thought to
mimic the normal substrate of the enzyme and to associate with the
specificity crevice, or S1 site, of the enzyme (Carrell &
Boswell. 1986; Huber & Carrell. 1989; Bode & Huber. 1994).
The bait amino acid is called the P1 residue, with the amino acids
toward the N-terminal side of the scissile reactive center bond
labeled in order P1 P2 P3 etc. and the amino acids on the carboxyl
side labeled P1' P2' etc. (Carrell & Boswell. 1986). The
reactive center P1-P1' residues, appear to play a major role in
determining target specificity. This point was dramatically
illustrated by the identification of a unique human mutation, a1AT
"Pittsburgh", in which a single amino acid substitution of Arg for
Met at the P1 residue converted a1AT from an inhibitor of elastase
to an efficient inhibitor of thrombin, resulting in a unique and
ultimately fatal bleeding disorder (Owen, Brennan, Lewis, &
Carrell. 1983). Numerous mutant serpins have been constructed,
demonstrating a wide range of changes in target specificity,
particularly with substitutions at P1 (York, Li, & Gardell.
1991; Strandberg, Lawrence, Johansson, & Ny. 1991; Shubeita,
Cottey, Franke, & Gerard. 1990; Lawrence, Strandberg, Ericson,
& Ny. 1990; Sherman, Lawrence, Yang, et al. 1992).
[0007] The exact structure of the complex between serpins and their
target proteinases has been controversial. Originally it was
thought that the complex was covalently linked via an ester bond
between the active site serine residue of the proteinase and the
new carboxyl-terminal end of the P1 residue, forming an acyl-enzyme
complex (Moroi & Yamasaki, 1974; Owen, 1975; Cohen, Gruenke,
Craig, & Geczy. 1977; Nilsson & Wiman. 1982). However, in
the late 1980s and early 1990s it was suggested that this
interpretation was incorrect, and that the serpin-proteinase
complex is instead trapped in a tight non-covalent association
similar to the so called standard mechanism inhibitors of the Kazal
and Kunitz family (Longstaff & Gaffney, J. 1991; Shieh,
Potempa, & Travis. 1989; Potempa, Korzus, & Travis. 1994).
Alternatively, one study suggested a hybrid of these two models
where the complex was frozen in a covalent but un-cleaved
tetrahedral transition state configuration (Matheson, van Halbeek,
& Travis. 1991). Recently however, new data by several groups
have suggested that the debate has come full circle, with various
studies using independent methods indicating that the inhibitor is
indeed cleaved in its reactive-center and that the complex is most
likely trapped as a covalent acyl-enzyme complex (Lawrence,
Ginsburg, Day, et al. 1995; Olson, Bock, Kvassman, et al. 1995; Fa,
Karolin, Aleshkov, Strandberg, Johansson, & Ny. 1995;
Wilczynska, Fa, Ohlsson, & Ny. 1995; Lawrence, Olson,
Palaniappan, & Ginsburg. 1994b; Shore, Day, Francis-Chmura, et
al. 1994; Plotnick, Mayne, Schechter, & Rubin. 1996).
[0008] Recently, three groups have almost simultaneously proposed
similar mechanisms for serpin inhibition (Lawrence, Ginsburg, Day,
et al. 1995; Wilczynska, Fa, Ohlsson, & Ny. 1995; Wright &
Scarsdale. 1995). This model suggests that upon encountering a
target proteinase, a serpin binds to the enzyme forming a
reversible complex that is similar to a Michaelis complex between
an enzyme and substrate. Next, the proteinase cleaves the P1-P1'
peptide bond resulting in formation of a covalent acyl-enzyme
intermediate. This cleavage is coupled to a rapid insertion of the
reactive center loop (RCL) into b-sheet A at least up to the P9
position. Since the RCL is covalently linked to the enzyme via the
active-site Ser, this transition should also affect the proteinase,
significantly changing its position relative to the inhibitor. If,
during this transition, the RCL is prevented from attaining full
insertion because of its association with the enzyme, and the
complex becomes locked, with the RCL only partially inserted, then
the resulting stress might be sufficient to distort the active site
of the enzyme. This distortion would then prevent efficient
deacylation of the acyl-enzyme intermediate, thus trapping the
complex. However, if RCL insertion is prevented, or if deacylation
occurs before RCL insertion then the cleaved serpin is turned over
as a substrate and the active enzyme released. This means that what
determines whether a serpin is an inhibitor or a substrate is the
ratio of k.sub.diss to k.sub.stab. If deacylation (k.sub.diss) is
faster than RCL insertion (k.sub.stab) then the substrate reaction
predominates. However, if RCL insertion and distortion of the
active site can occur before deacylation then the complex is frozen
as a covalent acyl-enzyme. A similar model was first proposed in
1990 (Lawrence, Strandberg, Ericson, & Ny. 1990) and is
consistent with studies demonstrating that RCL insertion is not
required for proteinase binding but is necessary for stable
inhibition (Lawrence, Olson, Palaniappan, & Ginsburg. 1994b) as
well as the observation that only an active enzyme can induce RCL
insertion (Olson, Bock, Kvassman, et al. 1995). Very recently,
direct evidence for this model was provided by Plotnick et al., who
by NMR observed an apparent distortion of an enzyme's catalytic
site in a serpin-enzyme complex (Plotnick, Mayne, Schechter, &
Rubin. 1996). In conclusion, these data suggest that serpins act as
molecular springs where the native structure is kinetically trapped
in a high energy state. Upon association with an enzyme some of the
energy liberated by RCL insertion is used to distort the active
site of the enzyme, preventing deacylation and trapping the
complex.
[0009] During the development of the nervous system, neurons form
axons which extend along a prespecified path into the target area,
where they engage in the formation and refinement of synaptic
connections. These stages depend critically on the capability of
the axonal growth cones to interact with a variety of structures
which they encounter along their way and at their destination.
These structures include cell surfaces of neuronal and non-neuronal
origin and the extracellular matrix. Along their trajectory and at
their target sites, growth cones not only receive and respond to
signals from their local environment, but also actively secrete
macromolecules. In particular, secreted proteases have been
implicated in supporting the growth cone advancement through the
tissue. More than a decade ago, it was demonstrated that
plasminogen activators are axonally secreted by neurons in culture.
Recently, their occurrence in the developing rat nervous system
during the period of axon outgrowth has been revealed. Moreover,
several pieces of evidence were presented which indicated that
serine proteases, such as plasminogen activators or thrombin, are
involved in restructuring of the synaptic connectivity during
development and regeneration. Such processes include elimination
during development and synaptic plasticity associated with learning
and memory in the adult. See, for instance, Osterwalder, T., et
al., "Neuroserpin, an axonally secreted serine protease inhibitor,"
EMBO J. 15:2944-2953 (1996).
[0010] During normal development of the nervous system, about 50%
of postmitotic lumbosacral motoneurons undergo naturally occurring
(programmed) cell death during a period when these cells are
forming synaptic connections with their target muscles. Naturally
occurring motoneuron death has been described in many vertebrate
species, including chicken, mouse, rat, and human embryos or
fetuses. For example, programmed motoneuron death occurs between
embryonic day (E)6 and E10 in the chicken. This system has been
used as a biological model for testing different neurotrophic
agents on motoneuron survival in vivo. See, for instance, Houenou,
L. J., et al., "A serine protease inhibitor, protease nexin I,
rescues motoneurons from naturally occurring and axotomy-induced
cell death," Proc. Natl. Acad. Sci. USA 92:895-899 (1995).
[0011] Although programmed cell death is completed before birth in
mammals, the maintenance of motoneurons continues to be dependent
on support from the target for some time after birth. Thus, if
transection of motor axons is performed in neonatal mammals and
reinnervation is prevented, a large number of motoneurons
degenerate and die. Axotomy-induced death of motoneurons has also
been extensively used as a model for testing the survival effects
of various agents, including neurotrophic and growth factors on
motoneurons.
[0012] Protease nexin I (PNI), also known as glia-derived nexin, is
a 43-47-kDa protein that was first found secreted by cultured
fibroblasts but is also produced by glial (glioma and primary) and
skeletal muscle cells. PNI has been shown to promote neurite
outgrowth from different neuronal cell types. These include
neuroblastoma cells, as well as primary hippocampal and sympathetic
neurons. The neurite-promoting activity of PNI in vitro is mediated
by inhibition of thrombin, a potent serine protease. PNI (mRNA and
protein) is transiently up-regulated in rat sciatic nerve after
axotomy, and PNI-producing cells are localized distal to the lesion
site. This up-regulation of PNI occurs 2-3 days after a similar
up-regulation of prothrombin and thrombin in the distal stump. Free
PNI protein is significantly decreased, while endogenous
PNI-thrombin complexes are increased, in various anatomical brain
regions, including hippocampus of patients with Alzheimer disease.
When considered together with the recent demonstration that PNI can
promote the in vitro survival of mixed mouse spinal chord neurons
and that PNI is released from glia cells by neuropeptides such as
vasoactive intestinal polypeptide, these observations suggest that
PNI may play a physiological role in neuronal survival,
differentiation, and/or axonal regeneration in vivo.
[0013] Recently, it has been reported that PNI rescues spinal
motoneuron death in the neonatal mouse. Houenou, L. J. et al.,
1995, supra. The survival effect of PNI on motoneurons during the
period of programmed cell death was not associated with increased
intramuscular nerve branching. PNI also significantly increased the
nuclear size of motoneurons during the period of programmed cell
death and prevented axotomy-induced atrophy of surviving
motoneurons. These results indicate a possible role of PNI as a
neurotrophic agent. They also support the idea that serine
proteases or, more precisely, the balance of proteases and serpins
may be involved in regulating the fate of neuronal cells during
development.
[0014] More recently, a cDNA encoding an axonally secreted
glycoprotein of central nervous system (CNS) and peripheral nervous
system (PNS) neurons of the chicken has been cloned and sequenced.
Osterwalder, T., et al., 1996) supra. Analysis of the primary
structural features characterized this protein as a novel member of
the serpin superfamily which was therefore called "neuroserpin." No
demonstration of inhibition of any protease was included in this
report, however. In situ hybridization revealed a predominately
neuronal expression during the late stages of neurogenesis and in
the adult brain in regions which exhibit synaptic plasticity. Thus,
it has been suggested that neuroserpin may function as an axonally
secreted regulator of the local extracellular proteolysis involved
in the reorganization of the synaptic connectivity during
development and synapse plasticity in the adult. A role for serine
proteases and serpins in neuronal remodeling is further supported
by the finding that elevated tPA mRNA and protein levels are found
in cerebellar Purkinje neurons of rats undergoing motor learning
(Seeds N W; Williams B L; Bickford P. C., "Tissue plasminogen
activator induction in Purkinje neurons after cerebellar motor
learning." Science 270:1992-4 (1995)).
[0015] The amplification of a human cDNA fragment of about 450 bp
corresponding to the region of the chicken cDNA encoding the
putative reactive site loop of the so-called neuroserpin, using a
polymerase chain reaction with two pairs of nested primers flanking
that region, has also been reported. Osterwalder, T., et al., 1996,
supra, page 2946. The authors also reported that the deduced amino
acid sequences of the human and corresponding mouse cDNA exhibited
a sequence identity of 88% and 87% respectively, with chicken
neuroserpin. No nucleotide or amino acid sequence was reported for
this human cDNA. However, the present inventors are not aware of
any other public disclosure of full length cDNA sequence data for a
human counterpart of the chicken neuroserpin cDNA or
polypeptide.
[0016] Thus, there is a need for human polypeptides that function
as serpins in the regulation of various serine proteases,
particularly in the nervous system, since disturbances of such
regulation may be involved in disorders relating to hemostasis,
angiogenesis, tumor metastasis, cellular migration and ovulation,
as well as neurogenesis; and, therefore, there is a need for
identification and characterization of such human polypeptides
which can play a role in preventing, ameliorating or correcting
such disorders.
SUMMARY OF THE INVENTION
[0017] The present invention relates to novel polynucleotides and
the encoded polypeptides. Moreover, the present invention relates
to vectors, host cells, antibodies, and recombinant methods for
producing the polypeptides and polynucleotides. Also provided are
diagnostic methods for detecting disorders related to the
polypeptides, and therapeutic methods for treating such disorders.
The invention further relates to screening methods for identifying
binding partners of the polypeptides.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows the nucleotide sequence (SEQ ID NO:1) of the
human cDNA in clone HMWJH67 and the deduced amino acid sequence
(SEQ ID NO:2) encoded thereby.
[0019] FIG. 2 shows the nucleotide sequence (SEQ ID NO:3) of the
human cDNA in clone HKAET41 and the deduced amino acid sequence
(SEQ ID NO:4) encoded thereby.
[0020] FIG. 3 shows the nucleotide sequence (SEQ ID NO:5) of the
human cDNA in clone HKAFV61 and the deduced amino acid sequence
(SEQ ID NO:6) encoded thereby.
[0021] FIG. 4A shows the nucleotide sequence (SEQ ID NO:7) of the
human cDNA in clone HETDK50, while FIG. 4B shows the deduced amino
acid sequence (SEQ ID NO:8) encoded thereby.
[0022] FIG. 5 shows the nucleotide sequence (SEQ ID NO:9) of the
human cDNA in clone HKAEF09 and the deduced amino acid sequence
(SEQ ID NO:10) encoded thereby.
[0023] FIG. 6 shows the nucleotide sequence (SEQ ID NO:11) of the
human cDNA in clone HKABR62 and the deduced amino acid sequence
(SEQ ID NO:12) encoded thereby.
DETAILED DESCRIPTION
Definitions
[0024] The following definitions are provided to facilitate
understanding of certain terms used throughout this
specification.
[0025] In the present invention, "isolated" refers to material
removed from its original environment (e.g., the natural
environment if it is naturally occurring), and thus is altered "by
the hand of man" from its natural state. For example, an isolated
polynucleotide could be part of a vector or a composition of
matter, or could be contained within a cell, and still be
"isolated" because that vector, composition of matter, or
particular cell is not the original environment of the
polynucleotide.
[0026] In the present invention, a "secreted" protein refers to
those proteins capable of being directed to the ER, secretory
vesicles, or the extracellular space as a result of a signal
sequence, as well as those proteins released into the extracellular
space without necessarily containing a signal sequence. If the
secreted protein is released into the extracellular space, the
secreted protein can undergo extracellular processing to produce a
"mature" protein. Release into the extracellular space can occur by
many mechanisms, including exocytosis and proteolytic cleavage.
[0027] As used herein, a "polynucleotide" refers to a molecule
having a nucleic acid sequence contained in SEQ ID NO:X or the cDNA
contained within the clone deposited with the ATCC. For example,
the polynucleotide can contain the nucleotide sequence of the full
length cDNA sequence, including the 5' and 3' untranslated
sequences, the coding region, with or without the signal sequence,
the secreted protein coding region, as well as fragments, epitopes,
domains, and variants of the nucleic acid sequence. Moreover, as
used herein, a "polypeptide" refers to a molecule having the
translated amino acid sequence generated from the polynucleotide as
broadly defined.
[0028] In the present invention, the full length sequence
identified as SEQ ID NO:X was often generated by overlapping
sequences contained in multiple clones (contig analysis). A
representative clone containing all or most of the sequence for SEQ
ID NO:X was deposited with the American Type Culture Collection
("ATCC"). As shown in Table 1, each clone is identified by a cDNA
Clone ID (Identifier) and the ATCC Deposit Number. The ATCC is
located at 10801 University Boulevard, Manassas, Va. 20110-2209,
USA. The ATCC deposit was made pursuant to the terms of the
Budapest Treaty on the international recognition of the deposit of
microorganisms for purposes of patent procedure.
[0029] A "polynucleotide" of the present invention also includes
those polynucleotides capable of hybridizing, under stringent
hybridization conditions, to sequences contained in SEQ ID NO:X,
the complement thereof, or the cDNA within the clone deposited with
the ATCC. "Stringent hybridization conditions" refers to an
overnight incubation at 42.degree. C. in a solution comprising 50%
formamide, 5.times.SSC (750 mM NaCl, 75 mM sodium citrate), 50 mM
sodium phosphate (pH 7.6), 5.times. Denhardt's solution, 10%
dextran sulfate, and 20 .mu.g/ml denatured, sheared salmon sperm
DNA, followed by washing the filters in 0.1.times.SSC at about
65.degree. C.
[0030] Also contemplated are nucleic acid molecules that hybridize
to the polynucleotides of the present invention at lower stringency
hybridization conditions. Changes in the stringency of
hybridization and signal detection are primarily accomplished
through the manipulation of formamide concentration (lower
percentages of formamide result in lowered stringency); salt
conditions, or temperature. For example, lower stringency
conditions include an overnight incubation at 37.degree. C. in a
solution comprising 6.times.SSPE (20.times.SSPE=3M NaCl; 0.2M
NaH.sub.2PO.sub.4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide,
100 ug/ml salmon sperm blocking DNA; followed by washes at
50.degree. C. with 1.times.SSPE, 0.1% SDS. In addition, to achieve
even lower stringency, washes performed following stringent
hybridization can be done at higher salt concentrations (e.g.
5.times.SSC).
[0031] Note that variations in the above conditions may be
accomplished through the inclusion and/or substitution of alternate
blocking reagents used to suppress background in hybridization
experiments. Typical blocking reagents include Denhardt's reagent,
BLOTTO, heparin, denatured salmon sperm DNA, and commercially
available proprietary formulations. The inclusion of specific
blocking reagents may require modification of the hybridization
conditions described above, due to problems with compatibility.
[0032] Of course, a polynucleotide which hybridizes only to polyA+
sequences (such as any 3' terminal polyA+ tract of a cDNA shown in
the sequence listing), or to a
[0033] complementary stretch of T (or U) residues, would not be
included in the definition of "polynucleotide," since such a
polynucleotide would hybridize to any nucleic acid molecule
containing a poly (A) stretch or the complement thereof (e.g.,
practically any double-stranded cDNA clone).
[0034] The polynucleotide of the present invention can be composed
of any polyribonucleotide or polydeoxribonucleotide, which may be
unmodified RNA or DNA or modified RNA or DNA. For example,
polynucleotides can be composed of single- and double-stranded DNA,
DNA that is a mixture of single- and double-stranded regions,
single- and double-stranded RNA, and RNA that is mixture of single-
and double-stranded regions, hybrid molecules comprising DNA and
RNA that may be single-stranded or, more typically, double-stranded
or a mixture of single- and double-stranded regions. In addition,
the polynucleotide can be composed of triple-stranded regions
comprising RNA or DNA or both RNA and DNA. A polynucleotide may
also contain one or more modified bases or DNA or RNA backbones
modified for stability or for other reasons. "Modified" bases
include, for example, tritylated bases and unusual bases such as
inosine. A variety of modifications can be made to DNA and RNA;
thus, "polynucleotide" embraces chemically, enzymatically, or
metabolically modified forms.
[0035] The polypeptide of the present invention can be composed of
amino acids joined to each other by peptide bonds or modified
peptide bonds, i.e., peptide isosteres, and may contain amino acids
other than the 20 gene-encoded amino acids. The polypeptides may be
modified by either natural processes, such as posttranslational
processing, or by chemical modification techniques which are well
known in the art. Such modifications are well described in basic
texts and in more detailed monographs, as well as in a voluminous
research literature. Modifications can occur anywhere in a
polypeptide, including the peptide backbone, the amino acid
side-chains and the amino or carboxyl termini. It will be
appreciated that the same type of modification may be present in
the same or varying degrees at several sites in a given
polypeptide. Also, a given polypeptide may contain many types of
modifications. Polypeptides may be branched, for example, as a
result of ubiquitination, and they may be cyclic, with or without
branching. Cyclic, branched, and branched cyclic polypeptides may
result from posttranslation natural processes or may be made by
synthetic methods. Modifications include acetylation, acylation,
ADP-ribosylation, amidation, covalent attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid
or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking, cyclization, disulfide bond formation,
demethylation, formation of covalent cross-links, formation of
cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation, iodination, methylation, myristoylation, oxidation,
pegylation, proteolytic processing, phosphorylation, prenylation,
racemization, selenoylation, sulfation, transfer-RNA mediated
addition of amino acids to proteins such as arginylation, and
ubiquitination. (See, for instance, PROTEINS--STRUCTURE AND
MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and
Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION
OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs.
1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990);
Rattan et al., Ann NY Acad Sci 663:48-62 (1992).)
[0036] "SEQ ID NO:X" refers to a polynucleotide sequence while "SEQ
ID NO:Y" refers to a polypeptide sequence, both sequences
identified by an integer specified in Table 1.
[0037] "A polypeptide having biological activity" refers to
polypeptides exhibiting activity similar, but not necessarily
identical to, an activity of a polypeptide of the present
invention, including mature forms, as measured in a particular
biological assay, with or without dose dependency. In the case
where dose dependency does exist, it need not be identical to that
of the polypeptide, but rather substantially similar to the
dose-dependence in a given activity as compared to the polypeptide
of the present invention (i.e., the candidate polypeptide will
exhibit greater activity or not more than about 25-fold less and,
preferably, not more than about tenfold less activity, and most
preferably, not more than about three-fold less activity relative
to the polypeptide of the present invention.)
Polynucleotides and Polypeptides of the Invention
Features of Proteins Encoded by SEQ ID NOS: 1, 3 and 5
[0038] Each of the polypeptides shown as SEQ ID NOS:2, 4 and 6
herein are members of the Serine Protease polypeptide family. This
determination has been made based on the strong degree of sequence
similarity each of the polypeptides share with other members of the
Serine Protease family. The predicted translation product of the
human cDNA in clone HMWJH67 (SEQ ID NO:2) shows a high degree of
sequence similarity to putative Preproadipsin [Sus scrofa
domestica] (Genbank accession no. gi|915533); the predicted
translation product of the human cDNA in clone HKAET41 (SEQ ID
NO:4) shows a high degree of sequence similarity to Protease M
[Homo sapiens] (gnl|1518788), Neuropsin [Homo sapiens]
(gnl|PID|d1011968), and Serine Protease [Homo sapiens]
(gi|2318115); and the predicted translation product of the human
cDNA in clone HKAFV61 (SEQ ID NO:6) shows a high degree of sequence
similarity to Neuropsin [Mus musculus] (gnl|PID|d1007022). Thus,
the polypeptides showns as SEQ ID NOS:7-9 and those encoded by cDNA
clones HMWJH67, HKAFV61, and HKAET41, are expected to share serine
protease activities common to other members of the serine protease
family. Such activity may be measured by assays known to those of
skill in the art, and assays referenced and described elsewhere
herein.
[0039] Human cDNA clone HMWJH67 was isolated from a cDNA library
derived from the human bone marrow cell line RS4;11. Human cDNA
clones HKAET41 and HKAFV61 were isolated from a cDNA library
derived from human keratinocyte tissue.
[0040] Serine protease inhibitors, such as an antagonist of the
serine proteases of the invention (e.g. an antibody), may be used
to inhibit the action of serine proteases, for example, in the
treatment of disorders characterized by degradation of the
extracellular matrix, such as, e.g., cancer, arthritis,
cardiovascular disorders, cachexia, immune system disorders,
digestive disorders and multiple sclerosis.
[0041] Serine proteases themselves are useful in the development of
antagonists, e.g., antibodies. Assays for identifying antagonists
of protease activity are described elsewhere herein and are well
known in the art.
Features of Proteins Encoded by SEQ ID NOS:7, 9 and 11
[0042] Each of the polypeptides shown as SEQ ID NOS:8, 10 and 12
herein are members of the Serpin polypeptide family. This
determination has been made based on the strong degree of sequence
similarity each of the polypeptides described herein share with
other members of the Serpin polypeptide family. The predicted
translation product of HETDK50 (SEQ ID NO:8) shows a high degree of
sequence similarity to Pre-alpha-1-antitrypsin precursor [Homo
sapiens] (gi|77822); the predicted translation product of HKAEF09
(SEQ ID NO: 10) shows a high degree of sequence similarity to
Squamous Cell Carcinoma Antigen [Homo sapiens] (gill 172087); and
the predicted translation product of HKABR62 (SEQ ID NO:12) shows a
high degree of sequence similarity to Secretory Leukocyte Protease
Inhibitor [Mus musculus] (gi|763263).
[0043] Human cDNA clone HETDK50 was isolated from a cDNA library
derived from human endometrial tumor tissue. Human cDNA clones
HKAEF09 and HKABR62 were isolated from a cDNA library derived from
human keratinocyte tissue.
[0044] Based on the identification of these polypeptides as
Serpins, they are expected to be useful to treat wasting associated
with excessive protease production during inflammation or diseases
associated with nervous tissue degeneration. For example, neuronal
loss is associated with such diseases as Kallmann's and Down's
syndromes, and Alzheimer's and Huntington's diseases may also be
treated by administration of these novel serpin polypeptides. The
serpins may also be used to decrease the amount of free circulating
somatostatin to prevent somatostatin's inhibitory effect on the
release of growth hormone. Further, serpins may be used to remove
excess levels of prolactin in the treatment of galactorrhea and/or
hypogandism.
[0045] As noted above, the Serpin polynucleotides, polypeptides of
this invention are useful for diagnosis of various nervous
system-related disorders in mammals, including impaired processes
of learning and memory, including impaired spatial, olfactory and
taste-aversion learning, learning and memory impairments associated
with Alzheimer's disease, and the like. Given the activities
modulated by such Serpin polypeptides, it is readily apparent that
a substantially altered (increased or decreased) level of
expression of a Serpin polypeptide of the invention in an
individual compared to the standard or "normal" level produces
pathological conditions such as those described above in relation
to diagnosis of nervous system-related disorders. It will also be
appreciated by one of ordinary skill that, since the Serpin
proteins of the invention are translated with a leader peptide
suitable for secretion of the mature protein from the cells which
express such proteins, when a Serpin protein (particularly the
mature form) is added from an exogenous source to cells, tissues or
the body of an individual, the protein will exert its modulating
activities on any of its target cells of that individual.
Therefore, it will be appreciated that conditions caused by a
decrease in the standard or normal level of a Serpin activity in an
individual, or an increase in a protease susceptible to inhibition
by the Serpin, particularly disorders of the nervous system, can be
treated by administration of such Serpin protein.
[0046] As noted above, one member in the serpin family is protease
nexin I (PNI) or glia-derived nexin (GDN) which has been shown to
inhibit thrombin specifically and to promote, in vitro, neurite
extension in neuroblastoma cell lines as well as primary
hippocampal, and sympathetic neurons. The PNI gene is induced
transcriptionally and protein levels are increased following rat
sciatic nerve axotomy. Other neurotrophic factors like nerve growth
factor, brain-derived neurotrophic factor, and insulin-like growth
factor I respond likewise to peripheral nerve damage. Treatment of
chick developing motoneurons, i.e. E6-E9 lumbrosacral motoneurons
which normally undergo apoptosis, with PNI results in increased
survival of motoneurons. Motoneuron death experimentally induced by
sciatic nerve lesioning in mouse is also decreased by PNI addition.
Alzheimer-diseased brain regions contain higher PNI/thrombin
complexes compared with free PNI than do normal brains suggesting
that PNI may have a role in CNS pathology.
[0047] Thus, due to the similarities in amino acid sequence and
tissue localization between the Serpin polypeptides of this
invention and PNI, the Serpins can be used for treating peripheral
neuropathies such as ALS or multiple sclerosis. Motoneuron or
sensory neuron damage resulting from spinal cord injury also my be
prevented by treatment with the Serpin proteins of this invention.
In addition, central nervous system diseases like Alzheimer's
disease may be treated with a Serpin or, preferably, a small
molecule analog capable of crossing the blood-brain barrier, which
analog can be identified according to the methods of the present
invention.
[0048] Aside from the nervous system-related disorders described
above, under diagnostic uses of the invention based on detecting
Serpin expression, the protease inhibitory activity of a Serpin
protein of the present invention also indicates that this protein
may be used for therapeutic treatment of other conditions where
excessive proteolytic activity of a Serpin susceptible protease may
be involved, particularly t-PA. Thus, BAIT may be used to modulate
the process of clot breakdown, for instance, in combination with
Activase (recombinant t-PA) which Genentech is marketing for clot
dissolution after stoke. A major problem with the present Activase
therapy is that frequently excessive hemorrhaging occurs. The
Serpins of this invention provide a specific inhibitor of t-PA
which would fine tune the treatment process and not interact with
other serine proteases in the nervous system. Similarly, a product
called Trasylol (aprotinin), a protease inhibitor, is being
marketed by Bayer for bleeding disorders. The beneficial action of
this serine protease inhibitor in limiting blood loss after
cardiopulmonary bypass has been widely reported. The Serpin
polypeptides of this invention are likewise useful during surgical
procedures.
[0049] PNI has been shown to inhibit breakdown of extracellular
matrix in a fibroblast tumor cell line. Such breakdown is thought
to enable tumor cells to metastasize by weakening of extracellular
matrix which normally prevents penetration of unrelated cells
through a tissue. The presently claimed Serpin polypeptides also
may be used to inhibit extracellular matrix destruction associated
with tumors secreting a Serpin-susceptible protease, for instance,
neural tissue tumors secreting t-PA. TABLE-US-00001 5' NT NT 5' of
First Last Protein ATCC SEQ NT 3' NT 5' NT First AA AA AA First
Last ID Deposit ID Total of of of AA of SEQ of of AA of AA (Group-
cDNA Nr and NO: NT Clone Clone Start Signal ID Sig Sig Secreted of
Nr) Clone ID Date Vector X Seq. Seq. Seq. NOTE Codon Pep NO: Y Pep
Pep Portion ORF PF391-1 HMWJH67 209644 Uni-ZAP XR 1 1062 1 1062 25
25 2 1 31 32 283 Feb. 25, 1998 PF391-2 HKAET41 209644 pCMVSport 3
792 1 792 85 85 4 1 23 24 207 Feb. 25, 2.0 1998 PF391-3 HKAFV61
209644 pCMVSport 5 840 1 840 115 115 6 1 17 18 162 Feb. 25, 2.0
1998 PF391-4 HETDK50 209644 Uni-ZAP XR 7 1527 1 1527 67 67 8 1 19
20 422 Feb. 25, 1998 PF391-5 HKAEF09 209644 pCMVSport 9 1405 1 1405
70 70 10 1 49 50 316 Feb. 25, 2.0 1998 PF391-6 HKABR62 209644
pCMVSport 11 478 1 478 19 19 12 1 19 20 76 Feb. 25, 2.0 1998
[0050] Table 1, above, summarizes the information corresponding to
each "Gene No." described above.
[0051] The cDNA Clone ID was deposited on the date and given the
corresponding deposit number listed in "ATCC Deposit No:Z and
Date." "Vector" refers to the type of vector into which the human
cDNA has been inserted.
[0052] "Total NT Seq." refers to the total number of nucleotides in
the contig identified by "Gene No." The deposited clone may contain
all or most of these sequences, reflected by the nucleotide
position indicated as "5' NT of Clone Seq." and the "3' NT of Clone
Seq." of SEQ ID NO:X. The nucleotide position of SEQ ID NO:X of the
putative start codon (methionine) is identified as "5' NT of Start
Codon." Similarly, the nucleotide position of SEQ ID NO:X of the
predicted signal sequence is identified as "5' NT of First AA of
Signal Pep."
[0053] The translated amino acid sequence, beginning with the
methionine, is identified as "AA SEQ ID NO:Y," although other
reading frames can also be easily translated using known molecular
biology techniques. The polypeptides produced by these alternative
open reading frames are specifically contemplated by the present
invention.
[0054] The first and last amino acid position of SEQ ID NO:Y of the
predicted signal peptide is identified as "First AA of Sig Pep" and
"Last AA of Sig Pep." The predicted first amino acid position of
SEQ ID NO:Y of the secreted portion is identified as "Predicted
First AA of Secreted Portion." Finally, the amino acid position of
SEQ ID NO:Y of the last amino acid in the open reading frame is
identified as "Last AA of ORF."
[0055] SEQ ID NO:X and the translated SEQ ID NO:Y are sufficiently
accurate and otherwise suitable for a variety of uses well known in
the art and described further below. For instance, SEQ ID NO:X is
useful for designing nucleic acid hybridization probes that will
detect nucleic acid sequences contained in SEQ ID NO:X or the cDNA
contained in the deposited clone. These probes will also hybridize
to nucleic acid molecules in biological samples, thereby enabling a
variety of forensic and diagnostic methods of the invention.
Similarly, polypeptides identified from SEQ ID NO:Y may be used to
generate antibodies which bind specifically to the proteins encoded
by the cDNA clones identified in Table 1.
[0056] Nevertheless, DNA sequences generated by sequencing
reactions can contain sequencing errors. The errors exist as
misidentified nucleotides, or as insertions or deletions of
nucleotides in the generated DNA sequence. The erroneously inserted
or deleted nucleotides cause frame shifts in the reading frames of
the predicted amino acid sequence. In these cases, the predicted
amino acid sequence diverges from the actual amino acid sequence,
even though the generated DNA sequence may be greater than 99.9%
identical to the actual DNA sequence (for example, one base
insertion or deletion in an open reading frame of over 1000
bases).
[0057] Accordingly, for those applications requiring precision in
the nucleotide sequence or the amino acid sequence, the present
invention provides not only the generated nucleotide sequence
identified as SEQ ID NO:X and the predicted translated amino acid
sequence identified as SEQ ID NO:Y, but also a sample of plasmid
DNA containing a human cDNA of the invention deposited with the
ATCC, as set forth in Table 1. The nucleotide sequence of each
deposited clone can readily be determined by sequencing the
deposited clone in accordance with known methods. The predicted
amino acid sequence can then be verified from such deposits.
Moreover, the amino acid sequence of the protein encoded by a
particular clone can also be directly determined by peptide
sequencing or by expressing the protein in a suitable host cell
containing the deposited human cDNA, collecting the protein, and
determining its sequence.
[0058] The present invention also relates to the genes
corresponding to SEQ ID NO:X, SEQ ID NO:Y, or the deposited clone.
The corresponding gene can be isolated in accordance with known
methods using the sequence information disclosed herein. Such
methods include preparing probes or primers from the disclosed
sequence and identifying or amplifying the corresponding gene from
appropriate sources of genomic material.
[0059] Also provided in the present invention are species homologs.
Species homologs may be isolated and identified by making suitable
probes or primers from the sequences provided herein and screening
a suitable nucleic acid source for the desired homologue.
[0060] The polypeptides of the invention can be prepared in any
suitable manner. Such polypeptides include isolated naturally
occurring polypeptides, recombinantly produced polypeptides,
synthetically produced polypeptides, or polypeptides produced by a
combination of these methods. Means for preparing such polypeptides
are well understood in the art.
[0061] The polypeptides may be in the form of the secreted protein,
including the mature form, or may be a part of a larger protein,
such as a fusion protein (see below). It is often advantageous to
include an additional amino acid sequence which contains secretory
or leader sequences, pro-sequences, sequences which aid in
purification, such as multiple histidine residues, or an additional
sequence for stability during recombinant production.
[0062] The polypeptides of the present invention are preferably
provided in an isolated form, and preferably are substantially
purified. A recombinantly produced version of a polypeptide,
including the secreted polypeptide, can be substantially purified
by the one-step method described in Smith and Johnson, Gene
67:31-40 (1988). Polypeptides of the invention also can be purified
from natural or recombinant sources using antibodies of the
invention raised against the protein in methods which are well
known in the art.
Signal Sequences
[0063] Methods for predicting whether a protein has a signal
sequence, as well as the cleavage point for that sequence, are
available. For instance, the method of McGeoch, Virus Res.
3:271-286 (1985), uses the information from a short N-terminal
charged region and a subsequent uncharged region of the complete
(uncleaved) protein. The method of von Heinje, Nucleic Acids Res.
14:4683-4690 (1986) uses the information from the residues
surrounding the cleavage site, typically residues -13 to +2, where
+1 indicates the amino terminus of the secreted protein. The
accuracy of predicting the cleavage points of known mammalian
secretory proteins for each of these methods is in the range of
75-80%. (von Heinje, supra.) However, the two methods do not always
produce the same predicted cleavage point(s) for a given
protein.
[0064] In the present case, the deduced amino acid sequence of the
secreted polypeptide was analyzed by a computer program called
SignalP (Henrik Nielsen et al., Protein Engineering 10:1-6 (1997)),
which predicts the cellular location of a protein based on the
amino acid sequence. As part of this computational prediction of
localization, the methods of McGeoch and von Heinje are
incorporated. The analysis of the amino acid sequences of the
secreted proteins described herein by this program provided the
results shown in Table 1.
[0065] As one of ordinary skill would appreciate, however, cleavage
sites sometimes vary from organism to organism and cannot be
predicted with absolute certainty. Accordingly, the present
invention provides secreted polypeptides having a sequence shown in
SEQ ID NO:Y which have an N-terminus beginning within 5 residues
(i.e., + or -5 residues) of the predicted cleavage point.
Similarly, it is also recognized that in some cases, cleavage of
the signal sequence from a secreted protein is not entirely
uniform, resulting in more than one secreted species. These
polypeptides, and the polynucleotides encoding such polypeptides,
are contemplated by the present invention.
[0066] Moreover, the signal sequence identified by the above
analysis may not necessarily predict the naturally occurring signal
sequence. For example, the naturally occurring signal sequence may
be further upstream from the predicted signal sequence. However, it
is likely that the predicted signal sequence will be capable of
directing the secreted protein to the ER. These polypeptides, and
the polynucleotides encoding such polypeptides, are contemplated by
the present invention.
Polynucleotide and Polypeptide Variants
[0067] "Variant" refers to a polynucleotide or polypeptide
differing from the polynucleotide or polypeptide of the present
invention, but retaining essential properties thereof. Generally,
variants are overall closely similar, and, in many regions,
identical to the polynucleotide or polypeptide of the present
invention.
[0068] By a polynucleotide having a nucleotide sequence at least,
for example, 95% "identical" to a reference nucleotide sequence of
the present invention, it is intended that the nucleotide sequence
of the polynucleotide is identical to the reference sequence except
that the polynucleotide sequence may include up to five point
mutations per each 100 nucleotides of the reference nucleotide
sequence encoding the polypeptide. In other words, to obtain a
polynucleotide having a nucleotide sequence at least 95% identical
to a reference nucleotide sequence, up to 5% of the nucleotides in
the reference sequence may be deleted or substituted with another
nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the reference sequence may be inserted into the
reference sequence. The query sequence may be an entire sequence
shown in Table 1, the ORF (open reading frame), or any fragment
specified as described herein.
[0069] As a practical matter, whether any particular nucleic acid
molecule or polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99%
identical to a nucleotide sequence of the presence invention can be
determined conventionally using known computer programs. A
preferred method for determining the best overall match between a
query sequence (a sequence of the present invention) and a subject
sequence, also referred to as a global sequence alignment, can be
determined using the FASTDB computer program based on the algorithm
of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245). In a
sequence alignment the query and subject sequences are both DNA
sequences. An RNA sequence can be compared by converting U's to
T's. The result of said global sequence alignment is in percent
identity. Preferred parameters used in a FASTDB alignment of DNA
sequences to calculate percent identity are: Matrix=Unitary,
k-tuple=4, Mismatch Penalty=1, Joining Penalty=30, Randomization
Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap Size Penalty
0.05, Window Size=500 or the length of the subject nucleotide
sequence, whichever is shorter.
[0070] If the subject sequence is shorter than the query sequence
because of 5' or 3' deletions, not because of internal deletions, a
manual correction must be made to the results. This is because the
FASTDB program does not account for 5' and 3' truncations of the
subject sequence when calculating percent identity. For subject
sequences truncated at the 5' or 3' ends, relative to the query
sequence, the percent identity is corrected by calculating the
number of bases of the query sequence that are 5' and 3' of the
subject sequence, which are not matched/aligned, as a percent of
the total bases of the query sequence. Whether a nucleotide is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This corrected score is what is used for the purposes of the
present invention. Only bases outside the 5' and 3' bases of the
subject sequence, as displayed by the FASTDB alignment, which are
not matched/aligned with the query sequence, are calculated for the
purposes of manually adjusting the percent identity score.
[0071] For example, a 90 base subject sequence is aligned to a 100
base query sequence to determine percent identity. The deletions
occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10
bases at 5' end. The 10 unpaired bases represent 10% of the
sequence (number of bases at the 5' and 3' ends not matched/total
number of bases in the query sequence) so 10% is subtracted from
the percent identity score calculated by the FASTDB program. If the
remaining 90 bases were perfectly matched the final percent
identity would be 90%. In another example, a 90 base subject
sequence is compared with a 100 base query sequence. This time the
deletions are internal deletions so that there are no bases on the
5' or 3' of the subject sequence which are not matched/aligned with
the query. In this case the percent identity calculated by FASTDB
is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections
are to made for the purposes of the present invention.
[0072] By a polypeptide having an amino acid sequence at least, for
example, 95% "identical" to a query amino acid sequence of the
present invention, it is intended that the amino acid sequence of
the subject polypeptide is identical to the query sequence except
that the subject polypeptide sequence may include up to five amino
acid alterations per each 100 amino acids of the query amino acid
sequence. In other words, to obtain a polypeptide having an amino
acid sequence at least 95% identical to a query amino acid
sequence, up to 5% of the amino acid residues in the subject
sequence may be inserted, deleted, (indels) or substituted with
another amino acid. These alterations of the reference sequence may
occur at the amino or carboxy terminal positions of the reference
amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference
sequence or in one or more contiguous groups within the reference
sequence.
[0073] As a practical matter, whether any particular polypeptide is
at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the amino acid sequences shown in Table 1 or to the amino acid
sequence encoded by deposited DNA clone can be determined
conventionally using known computer programs. A preferred method
for determining the best overall match between a query sequence (a
sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, can be determined using
the FASTDB computer program based on the algorithm of Brutlag et
al. (Comp. App. Biosci. (1990) 6:237-245). In a sequence alignment
the query and subject sequences are either both nucleotide
sequences or both amino acid sequences. The result of said global
sequence alignment is in percent identity. Preferred parameters
used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2,
Mismatch Penalty=1, Joining Penalty=20, Randomization Group
Length=0, Cutoff Score=1, Window Size=sequence length, Gap
Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of
the subject amino acid sequence, whichever is shorter.
[0074] If the subject sequence is shorter than the query sequence
due to N- or C-terminal deletions, not because of internal
deletions, a manual correction must be made to the results. This is
because the FASTDB program does not account for N- and C-terminal
truncations of the subject sequence when calculating global percent
identity. For subject sequences truncated at the N- and C-termini,
relative to the query sequence, the percent identity is corrected
by calculating the number of residues of the query sequence that
are N- and C-terminal of the subject sequence, which are not
matched/aligned with a corresponding subject residue, as a percent
of the total bases of the query sequence. Whether a residue is
matched/aligned is determined by results of the FASTDB sequence
alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the
specified parameters, to arrive at a final percent identity score.
This final percent identity score is what is used for the purposes
of the present invention. Only residues to the N- and C-termini of
the subject sequence, which are not matched/aligned with the query
sequence, are considered for the purposes of manually adjusting the
percent identity score. That is, only query residue positions
outside the farthest N- and C-terminal residues of the subject
sequence.
[0075] For example, a 90 amino acid residue subject sequence is
aligned with a 100 residue query sequence to determine percent
identity. The deletion occurs at the N-terminus of the subject
sequence and therefore, the FASTDB alignment does not show a
matching/alignment of the first 10 residues at the N-terminus. The
10 unpaired residues represent 10% of the sequence (number of
residues at the N- and C-termini not matched/total number of
residues in the query sequence) so 10% is subtracted from the
percent identity score calculated by the FASTDB program. If the
remaining 90 residues were perfectly matched the final percent
identity would be 90%. In another example, a 90 residue subject
sequence is compared with a 100 residue query sequence. This time
the deletions are internal deletions so there are no residues at
the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity
calculated by FASTDB is not manually corrected. Once again, only
residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in the FASTDB alignment, which are not
matched/aligned with the query sequence are manually corrected for.
No other manual corrections are to made for the purposes of the
present invention.
[0076] The variants may contain alterations in the coding regions,
non-coding regions, or both. Especially preferred are
polynucleotide variants containing alterations which produce silent
substitutions, additions, or deletions, but do not alter the
properties or activities of the encoded polypeptide. Nucleotide
variants produced by silent substitutions due to the degeneracy of
the genetic code are preferred. Moreover, variants in which 5-10,
1-5, or 1-2 amino acids are substituted, deleted, or added in any
combination are also preferred. Polynucleotide variants can be
produced for a variety of reasons, e.g., to optimize codon
expression for a particular host (change codons in the human mRNA
to those preferred by a bacterial host such as E. coli).
[0077] Naturally occurring variants are called "allelic variants,"
and refer to one of several alternate forms of a gene occupying a
given locus on a chromosome of an organism. (Genes II, Lewin, B.,
ed., John Wiley & Sons, New York (1985).) These allelic
variants can vary at either the polynucleotide and/or polypeptide
level. Alternatively, non-naturally occurring variants may be
produced by mutagenesis techniques or by direct synthesis.
[0078] Using known methods of protein engineering and recombinant
DNA technology, variants may be generated to improve or alter the
characteristics of the polypeptides of the present invention. For
instance, one or more amino acids can be deleted from the
N-terminus or C-terminus of the protein without substantial loss of
biological function. The authors of Ron et al., J. Biol. Chem. 268:
2984-2988 (1993), reported variant KGF proteins having heparin
binding activity even after deleting 3, 8, or 27 amino-terminal
amino acid residues. Similarly, Interferon gamma exhibited up to
ten times higher activity after deleting 8-10 amino acid residues
from the carboxy terminus of this protein. (Dobeli et al., J.
Biotechnology 7:199-216 (1988).)
[0079] Moreover, ample evidence demonstrates that variants often
retain a biological activity similar to that of the naturally
occurring protein. For example, Gayle and coworkers (J. Biol. Chem
268:22105-22111 (1993)) conducted extensive mutational analysis of
human cytokine IL-1a. They used random mutagenesis to generate over
3,500 individual IL-1a mutants that averaged 2.5 amino acid changes
per variant over the entire length of the molecule. Multiple
mutations were examined at every possible amino acid position. The
investigators found that "[m]ost of the molecule could be altered
with little effect on either [binding or biological activity]."
(See, Abstract.) In fact, only 23 unique amino acid sequences, out
of more than 3,500 nucleotide sequences examined, produced a
protein that significantly differed in activity from wild-type.
[0080] Furthermore, even if deleting one or more amino acids from
the N-terminus or C-terminus of a polypeptide results in
modification or loss of one or more biological functions, other
biological activities may still be retained. For example, the
ability of a deletion variant to induce and/or to bind antibodies
which recognize the secreted form will likely be retained when less
than the majority of the residues of the secreted form are removed
from the N-terminus or C-terminus. Whether a particular polypeptide
lacking N- or C-terminal residues of a protein retains such
immunogenic activities can readily be determined by routine methods
described herein and otherwise known in the art.
[0081] Thus, the invention further includes polypeptide variants
which show substantial biological activity. Such variants include
deletions, insertions, inversions, repeats, and substitutions
selected according to general rules known in the art so as have
little effect on activity. For example, guidance concerning how to
make phenotypically silent amino acid substitutions is provided in
Bowie, J. U. et al., Science 247:1306-1310 (1990), wherein the
authors indicate that there are two main strategies for studying
the tolerance of an amino acid sequence to change.
[0082] The first strategy exploits the tolerance of amino acid
substitutions by natural selection during the process of evolution.
By comparing amino acid sequences in different species, conserved
amino acids can be identified. These conserved amino acids are
likely important for protein function. In contrast, the amino acid
positions where substitutions have been tolerated by natural
selection indicates that these positions are not critical for
protein function. Thus, positions tolerating amino acid
substitution could be modified while still maintaining biological
activity of the protein.
[0083] The second strategy uses genetic engineering to introduce
amino acid changes at specific positions of a cloned gene to
identify regions critical for protein function. For example, site
directed mutagenesis or alanine-scanning mutagenesis (introduction
of single alanine mutations at every residue in the molecule) can
be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The
resulting mutant molecules can then be tested for biological
activity.
[0084] As the authors state, these two strategies have revealed
that proteins are surprisingly tolerant of amino acid
substitutions. The authors further indicate which amino acid
changes are likely to be permissive at certain amino acid positions
in the protein. For example, most buried (within the tertiary
structure of the protein) amino acid residues require nonpolar side
chains, whereas few features of surface side chains are generally
conserved. Moreover, tolerated conservative amino acid
substitutions involve replacement of the aliphatic or hydrophobic
amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and Thr; replacement of the acidic residues Asp and
Glu; replacement of the amide residues Asn and Gln, replacement of
the basic residues Lys, Arg, and His; replacement of the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized
amino acids Ala, Ser, Thr, Met, and Gly.
[0085] Besides conservative amino acid substitution, variants of
the present invention include (i) substitutions with one or more of
the non-conserved amino acid residues, where the substituted amino
acid residues may or may not be one encoded by the genetic code, or
(ii) substitution with one or more of amino acid residues having a
substituent group, or (iii) fusion of the mature polypeptide with
another compound, such as a compound to increase the stability
and/or solubility of the polypeptide (for example, polyethylene
glycol), or (iv) fusion of the polypeptide with additional amino
acids, such as an IgG Fc fusion region peptide, or leader or
secretory sequence, or a sequence facilitating purification. Such
variant polypeptides are deemed to be within the scope of those
skilled in the art from the teachings herein.
[0086] For example, polypeptide variants containing amino acid
substitutions of charged amino acids with other charged or neutral
amino acids may produce proteins with improved characteristics,
such as less aggregation. Aggregation of pharmaceutical
formulations both reduces activity and increases clearance due to
the aggregate's immunogenic activity. (Pinckard et al., Clin. Exp.
Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-845
(1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993).)
Polynucleotide and Polypeptide Fragments
[0087] In the present invention, a "polynucleotide fragment" refers
to a short polynucleotide having a nucleic acid sequence contained
in the deposited clone or shown in SEQ ID NO:X. The short
nucleotide fragments are preferably at least about 15 nt, and more
preferably at least about 20 nt, still more preferably at least
about 30 nt, and even more preferably, at least about 40 nt in
length. A fragment "at least 20 nt in length," for example, is
intended to include 20 or more contiguous bases from the cDNA
sequence contained in the deposited clone or the nucleotide
sequence shown in SEQ ID NO:X. These nucleotide fragments are
useful as diagnostic probes and primers as discussed herein. Of
course, larger fragments (e.g., 50, 150, 500, 600, 2000
nucleotides) are preferred.
[0088] Moreover, representative examples of polynucleotide
fragments of the invention, include, for example, fragments having
a sequence from about nucleotide number 1-50, 51-100, 101-150,
151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 451-500,
501-550, 551-600, 651-700, 701-750, 751-800, 800-850, 851-900,
901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200,
1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450, 1451-1500,
1501-1550, 1551-1600, 1601-1650, 1651-1700, 1701-1750, 1751-1800,
1801-1850, 1851-1900, 1901-1950, 1951-2000, or 2001 to the end of
SEQ ID NO:X or the cDNA contained in the deposited clone. In this
context "about" includes the particularly recited ranges, larger or
smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini. Preferably, these fragments encode a
polypeptide which has biological activity. More preferably, these
polynucleotides can be used as probes or primers as discussed
herein.
[0089] In the present invention, a "polypeptide fragment" refers to
a short amino acid sequence contained in SEQ ID NO:Y or encoded by
the cDNA contained in the deposited clone. Protein fragments may be
"free-standing," or comprised within a larger polypeptide of which
the fragment forms a part or region, most preferably as a single
continuous region. Representative examples of polypeptide fragments
of the invention, include, for example, fragments from about amino
acid number 1-20, 21-40, 41-60, 61-80, 81-100, 102-120, 121-140,
141-160, or 161 to the end of the coding region. Moreover,
polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90,
100, 110, 120, 130, 140, or 150 amino acids in length. In this
context "about" includes the particularly recited ranges, larger or
smaller by several (5, 4, 3, 2, or 1) amino acids, at either
extreme or at both extremes.
[0090] Preferred polypeptide fragments include the complete protein
as well as the mature form. Further preferred polypeptide fragments
include the complete protein or the mature form having a continuous
series of deleted residues from the amino or the carboxy terminus,
or both. For example, any number of amino acids, ranging from 1-60,
can be deleted from the amino terminus of either the secreted
polypeptide or the mature form. Similarly, any number of amino
acids, ranging from 1-30, can be deleted from the carboxy terminus
of the protein or mature form. Furthermore, any combination of the
above amino and carboxy terminus deletions are preferred.
Similarly, polynucleotide fragments encoding these polypeptide
fragments are also preferred.
[0091] Also preferred are polypeptide and polynucleotide fragments
characterized by structural or functional domains, such as
fragments that comprise alpha-helix and alpha-helix forming
regions, beta-sheet and beta-sheet-forming regions, turn and
turn-forming regions, coil and coil-forming regions, hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta
amphipathic regions, flexible regions, surface-forming regions,
substrate binding region, and high antigenic index regions.
Polypeptide fragments of SEQ ID NO:Y falling within conserved
domains are specifically contemplated by the present invention.
Moreover, polynucleotide fragments encoding these domains are also
contemplated.
[0092] Other preferred fragments are biologically active fragments.
Biologically active fragments are those exhibiting activity
similar, but not necessarily identical, to an activity of the
polypeptide of the present invention. The biological activity of
the fragments may include an improved desired activity, or a
decreased undesirable activity.
Epitopes & Antibodies
[0093] In the present invention, "epitopes" refer to polypeptide
fragments having antigenic or immunogenic activity in an animal,
especially in a human. A preferred embodiment of the present
invention relates to a polypeptide fragment comprising an epitope,
as well as the polynucleotide encoding this fragment. A region of a
protein molecule to which an antibody can bind is defined as an
"antigenic epitope." In contrast, an "immunogenic epitope" is
defined as a part of a protein that elicits an antibody response.
(See, for instance, Geysen et al., Proc. Natl. Acad. Sci. USA
81:3998-4002 (1983).)
[0094] Fragments which function as epitopes may be produced by any
conventional means. (See, e.g., Houghten, R. A., Proc. Natl. Acad.
Sci. USA 82:5131-5135 (1985) further described in U.S. Pat. No.
4,631,211.)
[0095] In the present invention, antigenic epitopes preferably
contain a sequence of at least seven, more preferably at least
nine, and most preferably between about 15 to about 30 amino acids.
Antigenic epitopes are useful to raise antibodies, including
monoclonal antibodies, that specifically bind the epitope. (See,
for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe, J.
G. et al., Science 219:660-666 (1983).)
[0096] Similarly, immunogenic epitopes can be used to induce
antibodies according to methods well known in the art. (See, for
instance, Sutcliffe et al., supra; Wilson et al., supra; Chow, M.
et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle, F. J. et
al., J. Gen. Virol. 66:2347-2354 (1985).) A preferred immunogenic
epitope includes the complete protein. The immunogenic epitopes may
be presented together with a carrier protein, such as an albumin,
to an animal system (such as rabbit or mouse) or, if it is long
enough (at least about 25 amino acids), without a carrier. However,
immunogenic epitopes comprising as few as 8 to 10 amino acids have
been shown to be sufficient to raise antibodies capable of binding
to, at the very least, linear epitopes in a denatured polypeptide
(e.g., in Western blotting.)
[0097] As used herein, the term "antibody" (Ab) or "monoclonal
antibody" (Mab) is meant to include intact molecules as well as
antibody fragments (such as, for example, Fab and F(ab')2
fragments) which are capable of specifically binding to protein.
Fab and F(ab')2 fragments lack the Fc fragment of intact antibody,
clear more rapidly from the circulation, and may have less
non-specific tissue binding than an intact antibody. (Wahl et al.,
J. Nucl. Med. 24:316-325 (1983).) Thus, these fragments are
preferred, as well as the products of a FAB or other immunoglobulin
expression library. Moreover, antibodies of the present invention
include chimeric, single chain, and humanized antibodies.
Fusion Proteins
[0098] Any polypeptide of the present invention can be used to
generate fusion proteins. For example, the polypeptide of the
present invention, when fused to a second protein, can be used as
an antigenic tag. Antibodies raised against the polypeptide of the
present invention can be used to indirectly detect the second
protein by binding to the polypeptide. Moreover, because secreted
proteins target cellular locations based on trafficking signals,
the polypeptides of the present invention can be used as targeting
molecules once fused to other proteins.
[0099] Examples of domains that can be fused to polypeptides of the
present invention include not only heterologous signal sequences,
but also other heterologous functional regions. The fusion does not
necessarily need to be direct, but may occur through linker
sequences.
[0100] Moreover, fusion proteins may also be engineered to improve
characteristics of the polypeptide of the present invention. For
instance, a region of additional amino acids, particularly charged
amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence during purification from the host
cell or subsequent handling and storage. Also, peptide moieties may
be added to the polypeptide to facilitate purification. Such
regions may be removed prior to final preparation of the
polypeptide. The addition of peptide moieties to facilitate
handling of polypeptides are familiar and routine techniques in the
art.
[0101] Moreover, polypeptides of the present invention, including
fragments, and specifically epitopes, can be combined with parts of
the constant domain of immunoglobulins (IgG), resulting in chimeric
polypeptides. These fusion proteins facilitate purification and
show an increased half-life in vivo. One reported example describes
chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the
heavy or light chains of mammalian immunoglobulins. (EP A 394,827;
Traunecker et al., Nature 331:84-86 (1988).) Fusion proteins having
disulfide-linked dimeric structures (due to the IgG) can also be
more efficient in binding and neutralizing other molecules, than
the monomeric protein or protein fragment alone. (Fountoulakis et
al., J. Biochem. 270:3958-3964 (1995).)
[0102] Similarly, EP-A-O 464 533 (Canadian counterpart 2045869)
discloses fusion proteins comprising various portions of constant
region of immunoglobulin molecules together with another human
protein or part thereof. In many cases, the Fc part in a fusion
protein is beneficial in therapy and diagnosis, and thus can result
in, for example, improved pharmacokinetic properties. (EP-A 0232
262.) Alternatively, deleting the Fc part after the fusion protein
has been expressed, detected, and purified, would be desired. For
example, the Fc portion may hinder therapy and diagnosis if the
fusion protein is used as an antigen for immunizations. In drug
discovery, for example, human proteins, such as hIL-5, have been
fused with Fc portions for the purpose of high-throughput screening
assays to identify antagonists of hIL-5. (See, D. Bennett et al.,
J. Molecular Recognition 8:52-58 (1995); K. Johanson et al., J.
Biol. Chem. 270:9459-9471 (1995).)
[0103] Moreover, the polypeptides of the present invention can be
fused to marker sequences, such as a peptide which facilitates
purification of the fused polypeptide. In preferred embodiments,
the marker amino acid sequence is a hexa-histidine peptide, such as
the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, Calif., 91311), among others, many of which are
commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine
provides for convenient purification of the fusion protein. Another
peptide tag useful for purification, the "HA" tag, corresponds to
an epitope derived from the influenza hemagglutinin protein.
(Wilson et al., Cell 37:767 (1984).)
[0104] Thus, any of these above fusions can be engineered using the
polynucleotides or the polypeptides of the present invention.
Vectors, Host Cells, and Protein Production
[0105] The present invention also relates to vectors containing the
polynucleotide of the present invention, host cells, and the
production of polypeptides by recombinant techniques. The vector
may be, for example, a phage, plasmid, viral, or retroviral vector.
Retroviral vectors may be replication competent or replication
defective. In the latter case, viral propagation generally will
occur only in complementing host cells.
[0106] The polynucleotides may be joined to a vector containing a
selectable marker for propagation in a host. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate, or in a complex with a charged lipid. If the vector is
a virus, it may be packaged in vitro using an appropriate packaging
cell line and then transduced into host cells.
[0107] The polynucleotide insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E.
coli lac, trp, phoA and tac promoters, the SV40 early and late
promoters and promoters of retroviral LTRs, to name a few. Other
suitable promoters will be known to the skilled artisan. The
expression constructs will further contain sites for transcription
initiation, termination, and, in the transcribed region, a ribosome
binding site for translation. The coding portion of the transcripts
expressed by the constructs will preferably include a translation
initiating codon at the beginning and a termination codon (UAA, UGA
or UAG) appropriately positioned at the end of the polypeptide to
be translated.
[0108] As indicated, the expression vectors will preferably include
at least one selectable marker. Such markers include dihydrofolate
reductase, G418 or neomycin resistance for eukaryotic cell culture
and tetracycline, kanamycin or ampicillin resistance genes for
culturing in E. coli and other bacteria. Representative examples of
appropriate hosts include, but are not limited to, bacterial cells,
such as E. coli, Streptomyces and Salmonella typhimurium cells;
fungal cells, such as yeast cells; insect cells such as Drosophila
S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293,
and Bowes melanoma cells; and plant cells. Appropriate culture
mediums and conditions for the above-described host cells are known
in the art.
[0109] Among vectors preferred for use in bacteria include pQE70,
pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors,
Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from
Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3,
pDR540, pRIT5 available from Pharmacia Biotech, Inc. Among
preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and
pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL
available from Pharmacia. Other suitable vectors will be readily
apparent to the skilled artisan.
[0110] Introduction of the construct into the host cell can be
effected by calcium phosphate transfection, DEAE-dextran mediated
transfection, cationic lipid-mediated transfection,
electroporation, transduction, infection, or other methods. Such
methods are described in many standard laboratory manuals, such as
Davis et al., Basic Methods In Molecular Biology (1986). It is
specifically contemplated that the polypeptides of the present
invention may in fact be expressed by a host cell lacking a
recombinant vector.
[0111] A polypeptide of this invention can be recovered and
purified from recombinant cell cultures by well-known methods
including ammonium sulfate or ethanol precipitation, acid
extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite
chromatography and lectin chromatography. Most preferably, high
performance liquid chromatography ("HPLC") is employed for
purification.
[0112] Polypeptides of the present invention, and preferably the
secreted form, can also be recovered from: products purified from
natural sources, including bodily fluids, tissues and cells,
whether directly isolated or cultured; products of chemical
synthetic procedures; and products produced by recombinant
techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, higher plant, insect, and mammalian
cells. Depending upon the host employed in a recombinant production
procedure, the polypeptides of the present invention may be
glycosylated or may be non-glycosylated. In addition, polypeptides
of the invention may also include an initial modified methionine
residue, in some cases as a result of host-mediated processes.
Thus, it is well known in the art that the N-terminal methionine
encoded by the translation initiation codon generally is removed
with high efficiency from any protein after translation in all
eukaryotic cells. While the N-terminal methionine on most proteins
also is efficiently removed in most prokaryotes, for some proteins,
this prokaryotic removal process is inefficient, depending on the
nature of the amino acid to which the N-terminal methionine is
covalently linked.
Uses of the Polynucleotides
[0113] Each of the polynucleotides identified herein can be used in
numerous ways as reagents. The following description should be
considered exemplary and utilizes known techniques.
[0114] The polynucleotides of the present invention are useful for
chromosome identification. There exists an ongoing need to identify
new chromosome markers, since few chromosome marking reagents,
based on actual sequence data (repeat polymorphisms), are presently
available. Each polynucleotide of the present invention can be used
as a chromosome marker.
[0115] Briefly, sequences can be mapped to chromosomes by preparing
PCR primers (preferably 15-25 bp) from the sequences shown in SEQ
ID NO:X. Primers can be selected using computer analysis so that
primers do not span more than one predicted exon in the genomic
DNA. These primers are then used for PCR screening of somatic cell
hybrids containing individual human chromosomes. Only those hybrids
containing the human gene corresponding to the SEQ ID NO:X will
yield an amplified fragment.
[0116] Similarly, somatic hybrids provide a rapid method of PCR
mapping the polynucleotides to particular chromosomes. Three or
more clones can be assigned per day using a single thermal cycler.
Moreover, sublocalization of the polynucleotides can be achieved
with panels of specific chromosome fragments. Other gene mapping
strategies that can be used include in situ hybridization,
prescreening with labeled flow-sorted chromosomes, and preselection
by hybridization to construct chromosome specific-cDNA
libraries.
[0117] Precise chromosomal location of the polynucleotides can also
be achieved using fluorescence in situ hybridization (FISH) of a
metaphase chromosomal spread. This technique uses polynucleotides
as short as 500 or 600 bases; however, polynucleotides 2,000-4,000
bp are preferred. For a review of this technique, see Verma et al.,
"Human Chromosomes: a Manual of Basic Techniques," Pergamon Press,
New York (1988).
[0118] For chromosome mapping, the polynucleotides can be used
individually (to mark a single chromosome or a single site on that
chromosome) or in panels (for marking multiple sites and/or
multiple chromosomes). Preferred polynucleotides correspond to the
noncoding regions of the cDNAs because the coding sequences are
more likely conserved within gene families, thus increasing the
chance of cross hybridization during chromosomal mapping.
[0119] Once a polynucleotide has been mapped to a precise
chromosomal location, the physical position of the polynucleotide
can be used in linkage analysis. Linkage analysis establishes
coinheritance between a chromosomal location and presentation of a
particular disease. (Disease mapping data are found, for example,
in V. McKusick, Mendelian Inheritance in Man (available on line
through Johns Hopkins University Welch Medical Library).) Assuming
1 megabase mapping resolution and one gene per 20 kb, a cDNA
precisely localized to a chromosomal region associated with the
disease could be one of 50-500 potential causative genes.
[0120] Thus, once coinheritance is established, differences in the
polynucleotide and the corresponding gene between affected and
unaffected individuals can be examined. First, visible structural
alterations in the chromosomes, such as deletions or
translocations, are examined in chromosome spreads or by PCR. If no
structural alterations exist, the presence of point mutations are
ascertained. Mutations observed in some or all affected
individuals, but not in normal individuals, indicates that the
mutation may cause the disease. However, complete sequencing of the
polypeptide and the corresponding gene from several normal
individuals is required to distinguish the mutation from a
polymorphism. If a new polymorphism is identified, this polymorphic
polypeptide can be used for further linkage analysis.
[0121] Furthermore, increased or decreased expression of the gene
in affected individuals as compared to unaffected individuals can
be assessed using polynucleotides of the present invention. Any of
these alterations (altered expression, chromosomal rearrangement,
or mutation) can be used as a diagnostic or prognostic marker.
[0122] In addition to the foregoing, a polynucleotide can be used
to control gene expression through triple helix formation or
antisense DNA or RNA. Both methods rely on binding of the
polynucleotide to DNA or RNA. For these techniques, preferred
polynucleotides are usually 20 to 40 bases in length and
complementary to either the region of the gene involved in
transcription (triple helix--see Lee et al., Nucl. Acids Res.
6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science 251:1360 (1991)) or to the mRNA itself
(antisense--Okano, J. Neurochem. 56:560 (1991);
Oligodeoxy-nucleotides as Antisense Inhibitors of Gene Expression,
CRC Press, Boca Raton, Fla. (1988).) Triple helix formation
optimally results in a shut-off of RNA transcription from DNA,
while antisense RNA hybridization blocks translation of an mRNA
molecule into polypeptide. Both techniques are effective in model
systems, and the information disclosed herein can be used to design
antisense or triple helix polynucleotides in an effort to treat
disease.
[0123] Polynucleotides of the present invention are also useful in
gene therapy. One goal of gene therapy is to insert a normal gene
into an organism having a defective gene, in an effort to correct
the genetic defect. The polynucleotides disclosed in the present
invention offer a means of targeting such genetic defects in a
highly accurate manner. Another goal is to insert a new gene that
was not present in the host genome, thereby producing a new trait
in the host cell.
[0124] The polynucleotides are also useful for identifying
individuals from minute biological samples. The United States
military, for example, is considering the use of restriction
fragment length polymorphism (RFLP) for identification of its
personnel. In this technique, an individual's genomic DNA is
digested with one or more restriction enzymes, and probed on a
Southern blot to yield unique bands for identifying personnel. This
method does not suffer from the current limitations of "Dog Tags"
which can be lost, switched, or stolen, making positive
identification difficult. The polynucleotides of the present
invention can be used as additional DNA markers for RFLP.
[0125] The polynucleotides of the present invention can also be
used as an alternative to RFLP, by determining the actual
base-by-base DNA sequence of selected portions of an individual's
genome. These sequences can be used to prepare PCR primers for
amplifying and isolating such selected DNA, which can then be
sequenced. Using this technique, individuals can be identified
because each individual will have a unique set of DNA sequences.
Once an unique ID database is established for an individual,
positive identification of that individual, living or dead, can be
made from extremely small tissue samples.
[0126] Forensic biology also benefits from using DNA-based
identification techniques as disclosed herein. DNA sequences taken
from very small biological samples such as tissues, e.g., hair or
skin, or body fluids, e.g., blood, saliva, semen, etc., can be
amplified using PCR. In one prior art technique, gene sequences
amplified from polymorphic loci, such as DQa class II HLA gene, are
used in forensic biology to identify individuals. (Erlich, H., PCR
Technology, Freeman and Co. (1992).) Once these specific
polymorphic loci are amplified, they are digested with one or more
restriction enzymes, yielding an identifying set of bands on a
Southern blot probed with DNA corresponding to the DQa class II HLA
gene. Similarly, polynucleotides of the present invention can be
used as polymorphic markers for forensic purposes.
[0127] There is also a need for reagents capable of identifying the
source of a particular tissue. Such need arises, for example, in
forensics when presented with tissue of unknown origin. Appropriate
reagents can comprise, for example, DNA probes or primers specific
to particular tissue prepared from the sequences of the present
invention. Panels of such reagents can identify tissue by species
and/or by organ type. In a similar fashion, these reagents can be
used to screen tissue cultures for contamination.
[0128] In the very least, the polynucleotides of the present
invention can be used as molecular weight markers on Southern gels,
as diagnostic probes for the presence of a specific mRNA in a
particular cell type, as a probe to "subtract-out" known sequences
in the process of discovering novel polynucleotides, for selecting
and making oligomers for attachment to a "gene chip" or other
support, to raise anti-DNA antibodies using DNA immunization
techniques, and as an antigen to elicit an immune response.
Uses of the Polypeptides
[0129] Each of the polypeptides identified herein can be used in
numerous ways. The following description should be considered
exemplary and utilizes known techniques.
[0130] A polypeptide of the present invention can be used to assay
protein levels in a biological sample using antibody-based
techniques. For example, protein expression in tissues can be
studied with classical immunohistological methods. (Jalkanen, M.,
et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J.
Cell. Biol. 105:3087-3096 (1987).) Other antibody-based methods
useful for detecting protein gene expression include immunoassays,
such as the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in
the art and include enzyme labels, such as, glucose oxidase, and
radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium (3H), indium (112In), and technetium (99mTc), and
fluorescent labels, such as fluorescein and rhodamine, and
biotin.
[0131] In addition to assaying protein levels in a biological
sample, proteins can also be detected in vivo by imaging. Antibody
labels or markers for in vivo imaging of protein include those
detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium,
which emit detectable radiation but are not overtly harmful to the
subject. Suitable markers for NMR and ESR include those with a
detectable characteristic spin, such as deuterium, which may be
incorporated into the antibody by labeling of nutrients for the
relevant hybridoma.
[0132] A protein-specific antibody or antibody fragment which has
been labeled with an appropriate detectable imaging moiety, such as
a radioisotope (for example, 131I, 112In, 99mTc), a radio-opaque
substance, or a material detectable by nuclear magnetic resonance,
is introduced (for example, parenterally, subcutaneously, or
intraperitoneally) into the mammal. It will be understood in the
art that the size of the subject and the imaging system used will
determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a
human subject, the quantity of radioactivity injected will normally
range from about 5 to 20 millicuries of 99mTc. The labeled antibody
or antibody fragment will then preferentially accumulate at the
location of cells which contain the specific protein. In vivo tumor
imaging is described in S. W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their
Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical
Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson
Publishing Inc. (1982).)
[0133] Thus, the invention provides a diagnostic method of a
disorder, which involves (a) assaying the expression of a
polypeptide of the present invention in cells or body fluid of an
individual; (b) comparing the level of gene expression with a
standard gene expression level, whereby an increase or decrease in
the assayed polypeptide gene expression level compared to the
standard expression level is indicative of a disorder.
[0134] Moreover, polypeptides of the present invention can be used
to treat disease. For example, patients can be administered a
polypeptide of the present invention in an effort to replace absent
or decreased levels of the polypeptide (e.g., insulin), to
supplement absent or decreased levels of a different polypeptide
(e.g., hemoglobin S for hemoglobin B), to inhibit the activity of a
polypeptide (e.g., an oncogene), to activate the activity of a
polypeptide (e.g., by binding to a receptor), to reduce the
activity of a membrane bound receptor by competing with it for free
ligand (e.g., soluble TNF receptors used in reducing inflammation),
or to bring about a desired response (e.g., blood vessel
growth).
[0135] Similarly, antibodies directed to a polypeptide of the
present invention can also be used to treat disease. For example,
administration of an antibody directed to a polypeptide of the
present invention can bind and reduce overproduction of the
polypeptide. Similarly, administration of an antibody can activate
the polypeptide, such as by binding to a polypeptide bound to a
membrane (receptor).
[0136] At the very least, the polypeptides of the present invention
can be used as molecular weight markers on SDS-PAGE gels or on
molecular sieve gel filtration columns using methods well known to
those of skill in the art. Polypeptides can also be used to raise
antibodies, which in turn are used to measure protein expression
from a recombinant cell, as a way of assessing transformation of
the host cell. Moreover, the polypeptides of the present invention
can be used to test the following biological activities.
Biological Activities
[0137] The polynucleotides and polypeptides of the present
invention can be used in assays to test for one or more biological
activities. If these polynucleotides and polypeptides do exhibit
activity in a particular assay, it is likely that these molecules
may be involved in the diseases associated with the biological
activity. Thus, the polynucleotides and polypeptides could be used
to treat the associated disease.
Immune Activity
[0138] A polypeptide or polynucleotide of the present invention may
be useful in treating deficiencies or disorders of the immune
system, by activating or inhibiting the proliferation,
differentiation, or mobilization (chemotaxis) of immune cells.
Immune cells develop through a process called hematopoiesis,
producing myeloid (platelets, red blood cells, neutrophils, and
macrophages) and lymphoid (B and T lymphocytes) cells from
pluripotent stem cells. The etiology of these immune deficiencies
or disorders may be genetic, somatic, such as cancer or some
autoimmune disorders, acquired (e.g., by chemotherapy or toxins),
or infectious. Moreover, a polynucleotide or polypeptide of the
present invention can be used as a marker or detector of a
particular immune system disease or disorder.
[0139] A polynucleotide or polypeptide of the present invention may
be useful in treating or detecting deficiencies or disorders of
hematopoietic cells. A polypeptide or polynucleotide of the present
invention could be used to increase differentiation and
proliferation of hematopoietic cells, including the pluripotent
stem cells, in an effort to treat those disorders associated with a
decrease in certain (or many) types hematopoietic cells. Examples
of immunologic deficiency syndromes include, but are not limited
to: blood protein disorders (e.g. agammaglobulinemia,
dysgammaglobulinemia), ataxia telangiectasia, common variable
immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV
infection, leukocyte adhesion deficiency syndrome, lymphopenia,
phagocyte bactericidal dysfunction, severe combined
immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia,
thrombocytopenia, or hemoglobinuria.
[0140] Moreover, a polypeptide or polynucleotide of the present
invention could also be used to modulate hemostatic (the stopping
of bleeding) or thrombolytic activity (clot formation). For
example, by increasing hemostatic or thrombolytic activity, a
polynucleotide or polypeptide of the present invention could be
used to treat blood coagulation disorders (e.g., afibrinogenemia,
factor deficiencies), blood platelet disorders (e.g.
thrombocytopenia), or wounds resulting from trauma, surgery, or
other causes. Alternatively, a polynucleotide or polypeptide of the
present invention that can decrease hemostatic or thrombolytic
activity could be used to inhibit or dissolve clotting. These
molecules could be important in the treatment of heart attacks
(infarction), strokes, or scarring.
[0141] A polynucleotide or polypeptide of the present invention may
also be useful in treating or detecting autoimmune disorders. Many
autoimmune disorders result from inappropriate recognition of self
as foreign material by immune cells. This inappropriate recognition
results in an immune response leading to the destruction of the
host tissue. Therefore, the administration of a polypeptide or
polynucleotide of the present invention that inhibits an immune
response, particularly the proliferation, differentiation, or
chemotaxis of T-cells, may be an effective therapy in preventing
autoimmune disorders.
[0142] Examples of autoimmune disorders that can be treated or
detected by the present invention include, but are not limited to:
Addison's Disease, hemolytic anemia, antiphospholipid syndrome,
rheumatoid arthritis, dermatitis, allergic encephalomyelitis,
glomerulonephritis, Goodpasture's Syndrome, Graves' Disease,
Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia,
Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura,
Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis,
Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation,
Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and
autoimmune inflammatory eye disease.
[0143] Similarly, allergic reactions and conditions, such as asthma
(particularly allergic asthma) or other respiratory problems, may
also be treated by a polypeptide or polynucleotide of the present
invention. Moreover, these molecules can be used to treat
anaphylaxis, hypersensitivity to an antigenic molecule, or blood
group incompatibility.
[0144] A polynucleotide or polypeptide of the present invention may
also be used to treat and/or prevent organ rejection or
graft-versus-host disease (GVHD). Organ rejection occurs by host
immune cell destruction of the transplanted tissue through an
immune response. Similarly, an immune response is also involved in
GVHD, but, in this case, the foreign transplanted immune cells
destroy the host tissues. The administration of a polypeptide or
polynucleotide of the present invention that inhibits an immune
response, particularly the proliferation, differentiation, or
chemotaxis of T-cells, may be an effective therapy in preventing
organ rejection or GVHD.
[0145] Similarly, a polypeptide or polynucleotide of the present
invention may also be used to modulate inflammation. For example,
the polypeptide or polynucleotide may inhibit the proliferation and
differentiation of cells involved in an inflammatory response.
These molecules can be used to treat inflammatory conditions, both
chronic and acute conditions, including inflammation associated
with infection (e.g., septic shock, sepsis, or systemic
inflammatory response syndrome (SIRS)), ischemia-reperfusion
injury, endotoxin lethality, arthritis, complement-mediated
hyperacute rejection, nephritis, cytokine or chemokine induced lung
injury, inflammatory bowel disease, Crohn's disease, or resulting
from over production of cytokines (e.g., TNF or IL-1.)
Hyperproliferative Disorders
[0146] A polypeptide or polynucleotide can be used to treat or
detect hyperproliferative disorders, including neoplasms. A
polypeptide or polynucleotide of the present invention may inhibit
the proliferation of the disorder through direct or indirect
interactions. Alternatively, a polypeptide or polynucleotide of the
present invention may proliferate other cells which can inhibit the
hyperproliferative disorder.
[0147] For example, by increasing an immune response, particularly
increasing antigenic qualities of the hyperproliferative disorder
or by proliferating, differentiating, or mobilizing T-cells,
hyperproliferative disorders can be treated. This immune response
may be increased by either enhancing an existing immune response,
or by initiating a new immune response. Alternatively, decreasing
an immune response may also be a method of treating
hyperproliferative disorders, such as a chemotherapeutic agent.
[0148] Examples of hyperproliferative disorders that can be treated
or detected by a polynucleotide or polypeptide of the present
invention include, but are not limited to neoplasms located in the:
abdomen, bone, breast, digestive system, liver, pancreas,
peritoneum, endocrine glands (adrenal, parathyroid, pituitary,
testicles, ovary, thymus, thyroid), eye, head and neck, nervous
(central and peripheral), lymphatic system, pelvic, skin, soft
tissue, spleen, thoracic, and urogenital.
[0149] Similarly, other hyperproliferative disorders can also be
treated or detected by a polynucleotide or polypeptide of the
present invention. Examples of such hyperproliferative disorders
include, but are not limited to: hypergammaglobulinemia,
lymphoproliferative disorders, paraproteinemias, purpura,
sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia,
Gaucher's Disease, histiocytosis, and any other hyperproliferative
disease, besides neoplasia, located in an organ system listed
above.
Infectious Disease
[0150] A polypeptide or polynucleotide of the present invention can
be used to treat or detect infectious agents. For example, by
increasing the immune response, particularly increasing the
proliferation and differentiation of B and/or T cells, infectious
diseases may be treated. The immune response may be increased by
either enhancing an existing immune response, or by initiating a
new immune response. Alternatively, the polypeptide or
polynucleotide of the present invention may also directly inhibit
the infectious agent, without necessarily eliciting an immune
response.
[0151] Viruses are one example of an infectious agent that can
cause disease or symptoms that can be treated or detected by a
polynucleotide or polypeptide of the present invention. Examples of
viruses, include, but are not limited to the following DNA and RNA
viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus,
Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae,
Coronaviridae, Flaviviridae, Hepadnaviridae (Hepatitis),
Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes
Zoster), Mononegavirus (e.g., Paramyxoviridae, Morbillivirus,
Rhabdoviridae), Orthomyxoviridae (e.g., Influenza), Papovaviridae,
Parvoviridae, Picornaviridae, Poxyiridae (such as Smallpox or
Vaccinia), Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I,
HTLV-II, Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses
falling within these families can cause a variety of diseases or
symptoms, including, but not limited to: arthritis, bronchiollitis,
encephalitis, eye infections (e.g., conjunctivitis, keratitis),
chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active,
Delta), meningitis, opportunistic infections (e.g., AIDS),
pneumonia, Burkitt's Lymphoma, chickenpox, hemorrhagic fever,
Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio,
leukemia, Rubella, sexually transmitted diseases, skin diseases
(e.g., Kaposi's, warts), and viremia. A polypeptide or
polynucleotide of the present invention can be used to treat or
detect any of these symptoms or diseases.
[0152] Similarly, bacterial or fungal agents that can cause disease
or symptoms and that can be treated or detected by a polynucleotide
or polypeptide of the present invention include, but not limited
to, the following Gram-Negative and Gram-positive bacterial
families and fungi: Actinomycetales (e.g., Corynebacterium,
Mycobacterium, Norcardia), Aspergillosis, Bacillaceae (e.g.,
Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella,
Borrelia, Brucellosis, Candidiasis, Campylobacter,
Coccidioidomycosis, Cryptococcosis, Dermatocycoses,
Enterobacteriaceae (Klebsiella, Salmonella, Serratia, Yersinia),
Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis,
Listeria, Mycoplasmatales, Neisseriaceae (e.g., Acinetobacter,
Gonorrhea, Menigococcal), Pasteurellacea Infections (e.g.,
Actinobacillus, Heamophilus, Pasteurella), Pseudomonas,
Rickettsiaceae, Chlamydiaceae, Syphilis, and Staphylococcal. These
bacterial or fungal families can cause the following diseases or
symptoms, including, but not limited to: bacteremia, endocarditis,
eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis,
opportunistic infections (e.g., AIDS related infections),
paronychia, prosthesis-related infections, Reiter's Disease,
respiratory tract infections, such as Whooping Cough or Empyema,
sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid
Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis,
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis,
Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract
infections, wound infections. A polypeptide or polynucleotide of
the present invention can be used to treat or detect any of these
symptoms or diseases.
[0153] Moreover, parasitic agents causing disease or symptoms that
can be treated or detected by a polynucleotide or polypeptide of
the present invention include, but not limited to, the following
families: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis,
Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and
Trichomonas. These parasites can cause a variety of diseases or
symptoms, including, but not limited to: Scabies, Trombiculiasis,
eye infections, intestinal disease (e.g., dysentery, giardiasis),
liver disease, lung disease, opportunistic infections (e.g., AIDS
related), Malaria, pregnancy complications, and toxoplasmosis. A
polypeptide or polynucleotide of the present invention can be used
to treat or detect any of these symptoms or diseases.
[0154] Preferably, treatment using a polypeptide or polynucleotide
of the present invention could either be by administering an
effective amount of a polypeptide to the patient, or by removing
cells from the patient, supplying the cells with a polynucleotide
of the present invention, and returning the engineered cells to the
patient (ex vivo therapy). Moreover, the polypeptide or
polynucleotide of the present invention can be used as an antigen
in a vaccine to raise an immune response against infectious
disease.
Regeneration
[0155] A polynucleotide or polypeptide of the present invention can
be used to differentiate, proliferate, and attract cells, leading
to the regeneration of tissues. (See, Science 276:59-87 (1997).)
The regeneration of tissues could be used to repair, replace, or
protect tissue damaged by congenital defects, trauma (wounds,
burns, incisions, or ulcers), age, disease (e.g. osteoporosis,
osteocarthritis, periodontal disease, liver failure), surgery,
including cosmetic plastic surgery, fibrosis, reperfusion injury,
or systemic cytokine damage.
[0156] Tissues that could be regenerated using the present
invention include organs (e.g., pancreas, liver, intestine, kidney,
skin, endothelium), muscle (smooth, skeletal or cardiac), vascular
(including vascular endothelium), nervous, hematopoietic, and
skeletal (bone, cartilage, tendon, and ligament) tissue.
Preferably, regeneration occurs without or decreased scarring.
Regeneration also may include angiogenesis.
[0157] Moreover, a polynucleotide or polypeptide of the present
invention may increase regeneration of tissues difficult to heal.
For example, increased tendon/ligament regeneration would quicken
recovery time after damage. A polynucleotide or polypeptide of the
present invention could also be used prophylactically in an effort
to avoid damage. Specific diseases that could be treated include of
tendonitis, carpal tunnel syndrome, and other tendon or ligament
defects. A further example of tissue regeneration of non-healing
wounds includes pressure ulcers, ulcers associated with vascular
insufficiency, surgical, and traumatic wounds.
[0158] Similarly, nerve and brain tissue could also be regenerated
by using a polynucleotide or polypeptide of the present invention
to proliferate and differentiate nerve cells. Diseases that could
be treated using this method include central and peripheral nervous
system diseases, neuropathies, or mechanical and traumatic
disorders (e.g., spinal cord disorders, head trauma,
cerebrovascular disease, and stoke). Specifically, diseases
associated with peripheral nerve injuries, peripheral neuropathy
(e.g., resulting from chemotherapy or other medical therapies),
localized neuropathies, and central nervous system diseases (e.g.,
Alzheimer's disease, Parkinson's disease, Huntington's disease,
amyotrophic lateral sclerosis, and Shy-Drager syndrome), could all
be treated using the polynucleotide or polypeptide of the present
invention.
Chemotaxis
[0159] A polynucleotide or polypeptide of the present invention may
have chemotaxis activity. A chemotaxic molecule attracts or
mobilizes cells (e.g., monocytes, fibroblasts, neutrophils,
T-cells, mast cells, eosinophils, epithelial and/or endothelial
cells) to a particular site in the body, such as inflammation,
infection, or site of hyperproliferation. The mobilized cells can
then fight off and/or heal the particular trauma or
abnormality.
[0160] A polynucleotide or polypeptide of the present invention may
increase chemotaxic activity of particular cells. These chemotactic
molecules can then be used to treat inflammation, infection,
hyperproliferative disorders, or any immune system disorder by
increasing the number of cells targeted to a particular location in
the body. For example, chemotaxic molecules can be used to treat
wounds and other trauma to tissues by attracting immune cells to
the injured location. Chemotactic molecules of the present
invention can also attract fibroblasts, which can be used to treat
wounds.
[0161] It is also contemplated that a polynucleotide or polypeptide
of the present invention may inhibit chemotactic activity. These
molecules could also be used to treat disorders. Thus, a
polynucleotide or polypeptide of the present invention could be
used as an inhibitor of chemotaxis.
Binding Activity
[0162] A polypeptide of the present invention may be used to screen
for molecules that bind to the polypeptide or for molecules to
which the polypeptide binds. The binding of the polypeptide and the
molecule may activate (agonist), increase, inhibit (antagonist), or
decrease activity of the polypeptide or the molecule bound.
Examples of such molecules include antibodies, oligonucleotides,
proteins (e.g., receptors), or small molecules.
[0163] Preferably, the molecule is closely related to the natural
ligand of the polypeptide, e.g., a fragment of the ligand, or a
natural substrate, a ligand, a structural or functional mimetic.
(See, Coligan et al., Current Protocols in Immunology 1(2):Chapter
5 (1991).) Similarly, the molecule can be closely related to the
natural receptor to which the polypeptide binds, or at least, a
fragment of the receptor capable of being bound by the polypeptide
(e.g., active site). In either case, the molecule can be rationally
designed using known techniques.
[0164] Preferably, the screening for these molecules involves
producing appropriate cells which express the polypeptide, either
as a secreted protein or on the cell membrane. Preferred cells
include cells from mammals, yeast, Drosophila, or E. coli. Cells
expressing the polypeptide (or cell membrane containing the
expressed polypeptide) are then preferably contacted with a test
compound potentially containing the molecule to observe binding,
stimulation, or inhibition of activity of either the polypeptide or
the molecule.
[0165] The assay may simply test binding of a candidate compound to
the polypeptide, wherein binding is detected by a label, or in an
assay involving competition with a labeled competitor. Further, the
assay may test whether the candidate compound results in a signal
generated by binding to the polypeptide.
[0166] Alternatively, the assay can be carried out using cell-free
preparations, polypeptide/molecule affixed to a solid support,
chemical libraries, or natural product mixtures. The assay may also
simply comprise the steps of mixing a candidate compound with a
solution containing a polypeptide, measuring polypeptide/molecule
activity or binding, and comparing the polypeptide/molecule
activity or binding to a standard.
[0167] Preferably, an ELISA assay can measure polypeptide level or
activity in a sample (e.g., biological sample) using a monoclonal
or polyclonal antibody. The antibody can measure polypeptide level
or activity by either binding, directly or indirectly, to the
polypeptide or by competing with the polypeptide for a
substrate.
[0168] All of these above assays can be used as diagnostic or
prognostic markers. The molecules discovered using these assays can
be used to treat disease or to bring about a particular result in a
patient (e.g., blood vessel growth) by activating or inhibiting the
polypeptide/molecule. Moreover, the assays can discover agents
which may inhibit or enhance the production of the polypeptide from
suitably manipulated cells or tissues.
[0169] Therefore, the invention includes a method of identifying
compounds which bind to a polypeptide of the invention comprising
the steps of: (a) incubating a
[0170] candidate binding compound with a polypeptide of the
invention; and (b) determining if binding has occurred. Moreover,
the invention includes a method of identifying agonists/antagonists
comprising the steps of: (a) incubating a candidate compound with a
polypeptide of the invention, (b) assaying a biological activity,
and (b) determining if a biological activity of the polypeptide has
been altered.
Other Activities
[0171] A polypeptide or polynucleotide of the present invention may
also increase or decrease the differentiation or proliferation of
embryonic stem cells, besides, as discussed above, hematopoietic
lineage.
[0172] A polypeptide or polynucleotide of the present invention may
also be used to modulate mammalian characteristics, such as body
height, weight, hair color, eye color, skin, percentage of adipose
tissue, pigmentation, size, and shape (e.g., cosmetic surgery).
Similarly, a polypeptide or polynucleotide of the present invention
may be used to modulate mammalian metabolism affecting catabolism,
anabolism, processing, utilization, and storage of energy.
[0173] A polypeptide or polynucleotide of the present invention may
be used to change a mammal's mental state or physical state by
influencing biorhythms, caricadic rhythms, depression (including
depressive disorders), tendency for violence, tolerance for pain,
reproductive capabilities (preferably by Activin or Inhibin-like
activity), hormonal or endocrine levels, appetite, libido, memory,
stress, or other cognitive qualities.
[0174] A polypeptide or polynucleotide of the present invention may
also be used as a food additive or preservative, such as to
increase or decrease storage capabilities, fat content, lipid,
protein, carbohydrate, vitamins, minerals, cofactors or other
nutritional components.
Other Preferred Embodiments
[0175] Other preferred embodiments of the claimed invention include
an isolated nucleic acid molecule comprising a nucleotide sequence
which is at least 95% identical to a sequence of at least about 50
contiguous nucleotides in the nucleotide sequence of SEQ ID NO:X
wherein X is any integer as defined in Table 1.
[0176] Also preferred is a nucleic acid molecule wherein said
sequence of contiguous nucleotides is included in the nucleotide
sequence of SEQ ID NO:X in the range of positions beginning with
the nucleotide at about the position of the 5' Nucleotide of the
Clone Sequence and ending with the nucleotide at about the position
of the 3' Nucleotide of the Clone Sequence as defined for SEQ ID
NO:X in Table 1.
[0177] Also preferred is a nucleic acid molecule wherein said
sequence of contiguous nucleotides is included in the nucleotide
sequence of SEQ ID NO:X in the range of positions beginning with
the nucleotide at about the position of the 5' Nucleotide of the
Start Codon and ending with the nucleotide at about the position of
the 3' Nucleotide of the Clone Sequence as defined for SEQ ID NO:X
in Table 1.
[0178] Similarly preferred is a nucleic acid molecule wherein said
sequence of contiguous nucleotides is included in the nucleotide
sequence of SEQ ID NO:X in the range of positions beginning with
the nucleotide at about the position of the 5' Nucleotide of the
First Amino Acid of the Signal Peptide and ending with the
nucleotide at about the position of the 3' Nucleotide of the Clone
Sequence as defined for SEQ ID NO:X in Table 1.
[0179] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a sequence of at least about 150 contiguous nucleotides in the
nucleotide sequence of SEQ ID NO:X.
[0180] Further preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a sequence of at least about 500 contiguous nucleotides in the
nucleotide sequence of SEQ ID NO:X.
[0181] A further preferred embodiment is a nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
the nucleotide sequence of SEQ ID NO:X beginning with the
nucleotide at about the position of the 5' Nucleotide of the First
Amino Acid of the Signal Peptide and ending with the nucleotide at
about the position of the 3' Nucleotide of the Clone Sequence as
defined for SEQ ID NO:X in Table 1.
[0182] A further preferred embodiment is an isolated nucleic acid
molecule comprising a nucleotide sequence which is at least 95%
identical to the complete nucleotide sequence of SEQ ID NO:X.
[0183] Also preferred is an isolated nucleic acid molecule which
hybridizes under stringent hybridization conditions to a nucleic
acid molecule, wherein said nucleic acid molecule which hybridizes
does not hybridize under stringent hybridization conditions to a
nucleic acid molecule having a nucleotide sequence consisting of
only A residues or of only T residues.
[0184] Also preferred is a composition of matter comprising a DNA
molecule which comprises a human cDNA clone identified by a cDNA
Clone Identifier in Table 1, which DNA molecule is contained in the
material deposited with the American Type Culture Collection and
given the ATCC Deposit Number shown in Table 1 for said cDNA Clone
Identifier.
[0185] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a sequence of at least 50 contiguous nucleotides in the nucleotide
sequence of a human cDNA clone identified by a cDNA Clone
Identifier in Table 1, which DNA molecule is contained in the
deposit given the ATCC Deposit Number shown in Table 1.
[0186] Also preferred is an isolated nucleic acid molecule, wherein
said sequence of at least 50 contiguous nucleotides is included in
the nucleotide sequence of the complete open reading frame sequence
encoded by said human cDNA clone.
[0187] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
sequence of at least 150 contiguous nucleotides in the nucleotide
sequence encoded by said human cDNA clone.
[0188] A further preferred embodiment is an isolated nucleic acid
molecule comprising a nucleotide sequence which is at least 95%
identical to sequence of at least 500 contiguous nucleotides in the
nucleotide sequence encoded by said human cDNA clone.
[0189] A further preferred embodiment is an isolated nucleic acid
molecule comprising a nucleotide sequence which is at least 95%
identical to the complete nucleotide sequence encoded by said human
cDNA clone.
[0190] A further preferred embodiment is a method for detecting in
a biological sample a nucleic acid molecule comprising a nucleotide
sequence which is at least 95% identical to a sequence of at least
50 contiguous nucleotides in a sequence selected from the group
consisting of: a nucleotide sequence of SEQ ID NO:X wherein X is
any integer as defined in Table 1; and a nucleotide sequence
encoded by a human cDNA clone identified by a cDNA Clone Identifier
in Table 1 and contained in the deposit with the ATCC Deposit
Number shown for said cDNA clone in Table 1; which method comprises
a step of comparing a nucleotide sequence of at least one nucleic
acid molecule in said sample with a sequence selected from said
group and determining whether the sequence of said nucleic acid
molecule in said sample is at least 95% identical to said selected
sequence.
[0191] Also preferred is the above method wherein said step of
comparing sequences comprises determining the extent of nucleic
acid hybridization between nucleic acid molecules in said sample
and a nucleic acid molecule comprising said sequence selected from
said group. Similarly, also preferred is the above method wherein
said step of comparing sequences is performed by comparing the
nucleotide sequence determined from a nucleic acid molecule in said
sample with said sequence selected from said group. The nucleic
acid molecules can comprise DNA molecules or RNA molecules.
[0192] A further preferred embodiment is a method for identifying
the species, tissue or cell type of a biological sample which
method comprises a step of detecting nucleic acid molecules in said
sample, if any, comprising a nucleotide sequence that is at least
95% identical to a sequence of at least 50 contiguous nucleotides
in a sequence selected from the group consisting of: a nucleotide
sequence of SEQ ID NO:X wherein X is any integer as defined in
Table 1; and a nucleotide sequence encoded by a human cDNA clone
identified by a cDNA Clone Identifier in Table 1 and contained in
the deposit with the ATCC Deposit Number shown for said cDNA clone
in Table 1.
[0193] The method for identifying the species, tissue or cell type
of a biological sample can comprise a step of detecting nucleic
acid molecules comprising a nucleotide sequence in a panel of at
least two nucleotide sequences, wherein at least one sequence in
said panel is at least 95% identical to a sequence of at least 50
contiguous nucleotides in a sequence selected from said group.
[0194] Also preferred is a method for diagnosing in a subject a
pathological condition associated with abnormal structure or
expression of a gene encoding a protein identified in Table 1,
which method comprises a step of detecting in a biological sample
obtained from said subject nucleic acid molecules, if any,
comprising a nucleotide sequence that is at least 95% identical to
a sequence of at least 50 contiguous nucleotides in a sequence
selected from the group consisting of: a nucleotide sequence of SEQ
ID NO:X wherein X is any integer as defined in Table 1; and a
nucleotide, sequence encoded by a human cDNA clone identified by a
cDNA Clone Identifier in Table 1 and contained in the deposit with
the ATCC Deposit Number shown for said cDNA clone in Table 1.
[0195] The method for diagnosing a pathological condition can
comprise a step of detecting nucleic acid molecules comprising a
nucleotide sequence in a panel of at least two nucleotide
sequences, wherein at least one sequence in said panel is at least
95% identical to a sequence of at least 50 contiguous nucleotides
in a sequence selected from said group.
[0196] Also preferred is a composition of matter comprising
isolated nucleic acid molecules wherein the nucleotide sequences of
said nucleic acid molecules comprise a panel of at least two
nucleotide sequences, wherein at least one sequence in said panel
is at least 95% identical to a sequence of at least 50 contiguous
nucleotides in a sequence selected from the group consisting of: a
nucleotide sequence of SEQ ID NO:X wherein X is any integer as
defined in Table 1; and a nucleotide sequence encoded by a human
cDNA clone identified by a cDNA Clone Identifier in Table 1 and
contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1. The nucleic acid molecules can comprise
DNA molecules or RNA molecules.
[0197] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 90% identical to a sequence of at
least about 10 contiguous amino acids in the amino acid sequence of
SEQ ID NO:Y wherein Y is any integer as defined in Table 1.
[0198] Also preferred is a polypeptide, wherein said sequence of
contiguous amino acids is included in the amino acid sequence of
SEQ ID NO:Y in the range of positions beginning with the residue at
about the position of the First Amino Acid of the Secreted Portion
and ending with the residue at about the Last Amino Acid of the
Open Reading Frame as set forth for SEQ ID NO:Y in Table 1.
[0199] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 30 contiguous amino acids in the amino acid sequence of
SEQ ID NO:Y.
[0200] Further preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 100 contiguous amino acids in the amino acid sequence
of SEQ ID NO:Y.
[0201] Further preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to the complete amino
acid sequence of SEQ ID NO:Y.
[0202] Further preferred is an isolated polypeptide comprising an
amino acid sequence at least 90% identical to a sequence of at
least about 10 contiguous amino acids in the complete amino acid
sequence of a secreted protein encoded by a human cDNA clone
identified by a cDNA Clone Identifier in Table 1 and contained in
the deposit with the ATCC Deposit Number shown for said cDNA clone
in Table 1.
[0203] Also preferred is a polypeptide wherein said sequence of
contiguous amino acids is included in the amino acid sequence of a
secreted portion of the complete protein encoded by a human cDNA
clone identified by a cDNA Clone Identifier in Table 1 and
contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0204] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 30 contiguous amino acids in the amino acid sequence of
the secreted portion of the protein encoded by a human cDNA clone
identified by a cDNA Clone Identifier in Table 1 and contained in
the deposit with the ATCC Deposit Number shown for said cDNA clone
in Table 1.
[0205] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to a sequence of at
least about 100 contiguous amino acids in the amino acid sequence
of the secreted portion of the protein encoded by a human cDNA
clone identified by a cDNA Clone Identifier in Table 1 and
contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0206] Also preferred is an isolated polypeptide comprising an
amino acid sequence at least 95% identical to the amino acid
sequence of the secreted portion of the protein encoded by a human
cDNA clone identified by a cDNA Clone Identifier in Table 1 and
contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0207] Further preferred is an isolated antibody which binds
specifically to a polypeptide comprising an amino acid sequence
that is at least 90% identical to a sequence of at least 10
contiguous amino acids in a sequence selected from the group
consisting of: an amino acid sequence of SEQ ID NO:Y wherein Y is
any integer as defined in Table 1; and a complete amino acid
sequence of a protein encoded by a human cDNA clone identified by a
cDNA Clone Identifier in Table 1 and contained in the deposit with
the ATCC Deposit Number shown for said cDNA clone in Table 1.
[0208] Further preferred is a method for detecting in a biological
sample a polypeptide comprising an amino acid sequence which is at
least 90% identical to a sequence of at least 10 contiguous amino
acids in a sequence selected from the group consisting of: an amino
acid sequence of SEQ ID NO:Y wherein Y is any integer as defined in
Table 1; and a complete amino acid sequence of a protein encoded by
a human cDNA clone identified by a cDNA Clone Identifier in Table 1
and contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1; which method comprises a step of
comparing an amino acid sequence of at least one polypeptide
molecule in said sample with a sequence selected from said group
and determining whether the sequence of said polypeptide molecule
in said sample is at least 90% identical to said sequence of at
least 10 contiguous amino acids.
[0209] Also preferred is the above method wherein said step of
comparing an amino acid sequence of at least one polypeptide
molecule in said sample with a sequence selected from said group
comprises determining the extent of specific binding of
polypeptides in said sample to an antibody which binds specifically
to a polypeptide comprising an amino acid sequence that is at least
90% identical to a sequence of at least 10 contiguous amino acids
in a sequence selected from the group consisting of: an amino acid
sequence of SEQ ID NO:Y wherein Y is any integer as defined in
Table 1; and a complete amino acid sequence of a protein encoded by
a human cDNA clone identified by a cDNA Clone Identifier in Table 1
and contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0210] Also preferred is the above method wherein said step of
comparing sequences is performed by comparing the amino acid
sequence determined from a polypeptide molecule in said sample with
said sequence selected from said group.
[0211] Also preferred is a method for identifying the species,
tissue or cell type of a biological sample which method comprises a
step of detecting polypeptide molecules in said sample, if any,
comprising an amino acid sequence that is at least 90% identical to
a sequence of at least 10 contiguous amino acids in a sequence
selected from the group consisting of: an amino acid sequence of
SEQ ID NO:Y wherein Y is any integer as defined in Table 1; and a
complete amino acid sequence of a protein encoded by a human cDNA
clone identified by a cDNA Clone Identifier in Table 1 and
contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0212] Also preferred is the above method for identifying the
species, tissue or cell type of a biological sample, which method
comprises a step of detecting polypeptide molecules comprising an
amino acid sequence in a panel of at least two amino acid
sequences, wherein at least one sequence in said panel is at least
90% identical to a sequence of at least 10 contiguous amino acids
in a sequence selected from the above group.
[0213] Also preferred is a method for diagnosing in a subject a
pathological condition associated with abnormal structure or
expression of a gene encoding a protein identified in Table 1,
which method comprises a step of detecting in a biological sample
obtained from said subject polypeptide molecules comprising an
amino acid sequence in a panel of at least two amino acid
sequences, wherein at least one sequence in said panel is at least
90% identical to a sequence of at least 10 contiguous amino acids
in a sequence selected from the group consisting of: an amino acid
sequence of SEQ ID NO:Y wherein Y is any integer as defined in
Table 1; and a complete amino acid sequence of a protein encoded by
a human cDNA clone identified by a cDNA Clone Identifier in Table 1
and contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0214] In any of these methods, the step of detecting said
polypeptide molecules includes using an antibody.
[0215] Also preferred is an isolated nucleic acid molecule
comprising a nucleotide sequence which is at least 95% identical to
a nucleotide sequence encoding a polypeptide wherein said
polypeptide comprises an amino acid sequence that is at least 90%
identical to a sequence of at least 10 contiguous amino acids in a
sequence selected from the group consisting of: an amino acid
sequence of SEQ ID NO:Y wherein Y is any integer as defined in
Table 1; and a complete amino acid sequence of a protein encoded by
a human cDNA clone identified by a cDNA Clone Identifier in Table 1
and contained in the deposit with the ATCC Deposit Number shown for
said cDNA clone in Table 1.
[0216] Also preferred is an isolated nucleic acid molecule, wherein
said nucleotide sequence encoding a polypeptide has been optimized
for expression of said polypeptide in a prokaryotic host.
[0217] Also preferred is an isolated nucleic acid molecule, wherein
said polypeptide comprises an amino acid sequence selected from the
group consisting of: an amino acid sequence of SEQ ID NO:Y wherein
Y is any integer as defined in Table 1; and a complete amino acid
sequence of a protein encoded by a human cDNA clone identified by a
cDNA Clone Identifier in Table 1 and contained in the deposit with
the ATCC Deposit Number shown for said cDNA clone in Table 1.
[0218] Further preferred is a method of making a recombinant vector
comprising inserting any of the above isolated nucleic acid
molecule into a vector. Also preferred is the recombinant vector
produced by this method. Also preferred is a method of making a
recombinant host cell comprising introducing the vector into a host
cell, as well as the recombinant host cell produced by this
method.
[0219] Also preferred is a method of making an isolated polypeptide
comprising culturing this recombinant host cell under conditions
such that said polypeptide is expressed and recovering said
polypeptide. Also preferred is this method of making an isolated
polypeptide, wherein said recombinant host cell is a eukaryotic
cell and said polypeptide is a secreted portion of a human protein
comprising an amino acid sequence selected from the group
consisting of: an amino acid sequence of SEQ ID NO:Y beginning with
the residue at the position of the First Amino Acid of the Secreted
Portion of SEQ ID NO:Y wherein Y is an integer set forth in Table 1
and said position of the First Amino Acid of the Secreted Portion
of SEQ ID NO:Y is defined in Table 1; and an amino acid sequence of
a secreted portion of a protein encoded by a human cDNA clone
identified by a cDNA Clone Identifier in Table 1 and contained in
the deposit with the ATCC Deposit Number shown for said cDNA clone
in Table 1. The isolated polypeptide produced by this method is
also preferred.
[0220] Also preferred is a method of treatment of an individual in
need of an increased level of a protein activity, which method
comprises administering to such an individual a pharmaceutical
composition comprising an amount of an isolated polypeptide,
polynucleotide, or antibody of the claimed invention effective to
increase the level of said protein activity in said individual.
[0221] Having generally described the invention, the same will be
more readily understood by reference to the following examples,
which are provided by way of illustration and are not intended as
limiting.
EXAMPLES
Example 1
Isolation of a Selected cDNA Clone from the Deposited Sample
[0222] Each cDNA clone in a cited ATCC deposit is contained in a
plasmid vector. Table 1 identifies the vectors used to construct
the cDNA library from which each clone was isolated. In many cases,
the vector used to construct the library is a phage vector from
which a plasmid has been excised. The table immediately below
correlates the related plasmid for each phage vector used in
constructing the cDNA library. For example, where a particular
clone is identified in Table 1 as being isolated in the vector
"Lambda Zap," the corresponding deposited clone is in
"pBluescript." TABLE-US-00002 Vector Used to Construct Library
Corresponding Deposited Plasmid Lambda Zap pBluescript (pBS)
Uni-Zap XR pBluescript (pBS) Zap Express pBK lafmid BA plafmid BA
pSport1 pSport1 pCMVSport 2.0 pCMVSport 2.0 pCMVSport 3.0 pCMVSport
3.0 pCR .RTM. 2.1 pCR .RTM. 2.1
[0223] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636),
Uni-Zap XR (U.S. Pat. Nos. 5,128,256 and 5,286,636), Zap Express
(U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short,
J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees,
M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK
(Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are
commercially available from Stratagene Cloning Systems, Inc., 11011
N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an
ampicillin resistance gene and pBK contains a neomycin resistance
gene. Both can be transformed into E. coli strain XL-1 Blue, also
available from Stratagene. pBS comes in 4 forms SK+, SK-, KS+ and
KS. The S and K refers to the orientation of the polylinker to the
T7 and T3 primer sequences which flank the polylinker region ("S"
is for SacI and "K" is for KpnI which are the first sites on each
respective end of the linker). "+" or "-" refer to the orientation
of the f1 origin of replication ("ori"), such that in one
orientation, single stranded rescue initiated from the f1 ori
generates sense strand DNA and in the other, antisense.
[0224] Vectors pSport1, pCMVSport 2.0 and pCMVSport 3.0, were
obtained from Life Technologies, Inc., P.O. Box 6009, Gaithersburg,
Md. 20897. All Sport vectors contain an ampicillin resistance gene
and may be transformed into E. coli strain DH10B, also available
from Life Technologies. (See, for instance, Gruber, C. E., et al.,
Focus 15:59 (1993).) Vector lafmid BA (Bento Soares, Columbia
University, NY) contains an ampicillin resistance gene and can be
transformed into E. coli strain XL-1 Blue. Vector pCR.RTM.2.1,
which is available from Invitrogen, 1600 Faraday Avenue, Carlsbad,
Calif. 92008, contains an ampicillin resistance gene and may be
transformed into E. coli strain DH10B, available from Life
Technologies. (See, for instance, Clark, J. M., Nuc. Acids Res.
16:9677-9686 (1988) and Mead, D. et al., Bio/Technology 9: (1991).)
Preferably, a polynucleotide of the present invention does not
comprise the phage vector sequences identified for the particular
clone in Table 1, as well as the corresponding plasmid vector
sequences designated above.
[0225] The deposited material in the sample assigned the ATCC
Deposit Number cited in Table 1 for any given cDNA clone also may
contain one or more additional plasmids, each comprising a cDNA
clone different from that given clone. Thus, deposits sharing the
same ATCC Deposit Number contain at least a plasmid for each cDNA
clone identified in Table 1. Typically, each ATCC deposit sample
cited in Table 1 comprises a mixture of approximately equal amounts
(by weight) of about 50 plasmid DNAs, each containing a different
cDNA clone; but such a deposit sample may include plasmids for more
or less than 50 cDNA clones, up to about 500 cDNA clones.
[0226] Two approaches can be used to isolate a particular clone
from the deposited sample of plasmid DNAs cited for that clone in
Table 1. First, a plasmid is directly isolated by screening the
clones using a polynucleotide probe corresponding to SEQ ID
NO:X.
[0227] Particularly, a specific polynucleotide with 30-40
nucleotides is synthesized using an Applied Biosystems DNA
synthesizer according to the sequence reported. The oligonucleotide
is labeled, for instance, with .sup.32P-.gamma.-ATP using T4
polynucleotide kinase and purified according to routine methods.
(E.g., Maniatis et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Press, Cold Spring, N.Y. (1982).) The plasmid
mixture is transformed into a suitable host, as indicated above
(such as XL-1 Blue (Stratagene)) using techniques known to those of
skill in the art, such as those provided by the vector supplier or
in related publications or patents cited above. The transformants
are plated on 1.5% agar plates (containing the appropriate
selection agent, e.g., ampicillin) to a density of about 150
transformants (colonies) per plate. These plates are screened using
Nylon membranes according to routine methods for bacterial colony
screening (e.g., Sambrook et al., Molecular Cloning: A Laboratory
Manual, 2nd Edit., (1989), Cold Spring Harbor Laboratory Press,
pages 1.93 to 1.104), or other techniques known to those of skill
in the art.
[0228] Alternatively, two primers of 17-20 nucleotides derived from
both ends of the SEQ ID NO:X (i.e., within the region of SEQ ID
NO:X bounded by the 5' NT and the 3' NT of the clone defined in
Table 1) are synthesized and used to amplify the desired cDNA using
the deposited cDNA plasmid as a template. The polymerase chain
reaction is carried out under routine conditions, for instance, in
25 .mu.l of reaction mixture with 0.5 ug of the above cDNA
template. A convenient reaction mixture is 1.5-5 mM MgCl.sub.2,
0.01% (w/v) gelatin, 20 .mu.M each of dATP, dCTP, dGTP, dTTP, 25
pmol of each primer and 0.25 Unit of Taq polymerase. Thirty five
cycles of PCR (denaturation at 94.degree. C. for 1 min; annealing
at 55.degree. C. for 1 min; elongation at 72.degree. C. for 1 min)
are performed with a Perkin-Elmer Cetus automated thermal cycler.
The amplified product is analyzed by agarose gel electrophoresis
and the DNA band with expected molecular weight is excised and
purified. The PCR product is verified to be the selected sequence
by subcloning and sequencing the DNA product.
[0229] Several methods are available for the identification of the
5' or 3' non-coding portions of a gene which may not be present in
the deposited clone. These methods include but are not limited to,
filter probing, clone enrichment using specific probes, and
protocols similar or identical to 5' and 3' "RACE" protocols which
are well known in the art. For instance, a method similar to 5'
RACE is available for generating the missing 5' end of a desired
full-length transcript. (Fromont-Racine et al., Nucleic Acids Res.
21(7):1683-1684 (1993).)
[0230] Briefly, a specific RNA oligonucleotide is ligated to the 5'
ends of a population of RNA presumably containing full-length gene
RNA transcripts. A primer set containing a primer specific to the
ligated RNA oligonucleotide and a primer specific to a known
sequence of the gene of interest is used to PCR amplify the 5'
portion of the desired full-length gene. This amplified product may
then be sequenced and used to generate the full length gene.
[0231] This above method starts with total RNA isolated from the
desired source, although poly-A+ RNA can be used. The RNA
preparation can then be treated with phosphatase if necessary to
eliminate 5' phosphate groups on degraded or damaged RNA which may
interfere with the later RNA ligase step. The phosphatase should
then be inactivated and the RNA treated with tobacco acid
pyrophosphatase in order to remove the cap structure present at the
5' ends of messenger RNAs. This reaction leaves a 5' phosphate
group at the 5' end of the cap cleaved RNA which can then be
ligated to an RNA oligonucleotide using T4 RNA ligase.
[0232] This modified RNA preparation is used as a template for
first strand cDNA synthesis using a gene specific oligonucleotide.
The first strand synthesis reaction is used as a template for PCR
amplification of the desired 5' end using a primer specific to the
ligated RNA oligonucleotide and a primer specific to the known
sequence of the gene of interest. The resultant product is then
sequenced and analyzed to confirm that the 5' end sequence belongs
to the desired gene.
Example 2
Isolation of Genomic Clones Corresponding to a Polynucleotide
[0233] A human genomic P1 library (Genomic Systems, Inc.) is
screened by PCR using primers selected for the cDNA sequence
corresponding to SEQ ID NO:X, according to the method described in
Example 1. (See also, Sambrook.)
Example 3
Tissue Distribution of Polypeptide
[0234] Tissue distribution of mRNA expression of polynucleotides of
the present invention is determined using protocols for Northern
blot analysis, described by, among others, Sambrook et al. For
example, a cDNA probe produced by the method described in Example 1
is labeled with P.sup.32 using the rediprime.TM. DNA labeling
system (Amersham Life Science), according to manufacturer's
instructions. After labeling, the probe is purified using CHROMA
SPIN-100.TM. column (Clontech Laboratories, Inc.), according to
manufacturer's protocol number PT1200-1. The purified labeled probe
is then used to examine various human tissues for mRNA
expression.
[0235] Multiple Tissue Northern (MTN) blots containing various
human tissues (H) or human immune system tissues (IM) (Clontech)
are examined with the labeled probe using ExpressHyb.TM.
hybridization solution (Clontech) according to manufacturer's
protocol number PT1190-1. Following hybridization and washing, the
blots are mounted and exposed to film at -70.degree. C. overnight,
and the films developed according to standard procedures.
Example 4
Chromosomal Mapping of the Polynucleotides
[0236] An oligonucleotide primer set is designed according to the
sequence at the 5' end of SEQ ID NO:X. This primer preferably spans
about 100 nucleotides. This primer set is then used in a polymerase
chain reaction under the following set of conditions: 30 seconds,
95.degree. C.; 1 minute, 56.degree. C.; 1 minute, 70.degree. C.
This cycle is repeated 32 times followed by one 5 minute cycle at
70.degree. C. Human, mouse, and hamster DNA is used as template in
addition to a somatic cell hybrid panel containing individual
chromosomes or chromosome fragments (Bios, Inc). The reactions is
analyzed on either 8% polyacrylamide gels or 3.5% agarose gels.
Chromosome mapping is determined by the presence of an
approximately 100 bp PCR fragment in the particular somatic cell
hybrid.
Example 5
Bacterial Expression of a Polypeptide
[0237] A polynucleotide encoding a polypeptide of the present
invention is amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' ends of the DNA sequence, as
outlined in Example 1, to synthesize insertion fragments. The
primers used to amplify the cDNA insert should preferably contain
restriction sites, such as BamHI and XbaI, at the 5' end of the
primers in order to clone the amplified product into the expression
vector. For example, BamHI and XbaI correspond to the restriction
enzyme sites on the bacterial expression vector pQE-9. (Qiagen,
Inc., Chatsworth, Calif.). This plasmid vector encodes antibiotic
resistance (Amp.sup.r), a bacterial origin of replication (ori), an
IPTG-regulatable promoter/operator (P/O), a ribosome binding site
(RBS), a 6-histidine tag (6-His), and restriction enzyme cloning
sites.
[0238] The pQE-9 vector is digested with BamHI and XbaI and the
amplified fragment is ligated into the pQE-9 vector maintaining the
reading frame initiated at the bacterial RBS. The ligation mixture
is then used to transform the E. coli strain M15/rep4 (Qiagen,
Inc.) which contains multiple copies of the plasmid pREP4, which
expresses the lacI repressor and also confers kanamycin resistance
(Kan.sup.r). Transformants are identified by their ability to grow
on LB plates and ampicillin/kanamycin resistant colonies are
selected. Plasmid DNA is isolated and confirmed by restriction
analysis.
[0239] Clones containing the desired constructs are grown overnight
(O/N) in liquid culture in LB media supplemented with both Amp (100
ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a
large culture at a ratio of 1:100 to 1:250. The cells are grown to
an optical density 600 (O.D..sup.600) of between 0.4 and 0.6. IPTG
(Isopropyl-B-D-thiogalacto pyranoside) is then added to a final
concentration of 1 mM. IPTG induces by inactivating the lacI
repressor, clearing the P/O leading to increased gene
expression.
[0240] Cells are grown for an extra 3 to 4 hours. Cells are then
harvested by centrifugation (20 mins at 6000.times.g). The cell
pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl
by stirring for 3-4 hours at 4.degree. C. The cell debris is
removed by centrifugation, and the supernatant containing the
polypeptide is loaded onto a nickel-nitrilo-tri-acetic acid
("Ni-NTA") affinity resin column (available from QIAGEN, Inc.,
supra). Proteins with a 6.times.His tag bind to the Ni-NTA resin
with high affinity and can be purified in a simple one-step
procedure (for details see: The QIAexpressionist (1995) QIAGEN,
Inc., supra).
[0241] Briefly, the supernatant is loaded onto the column in 6 M
guanidine-HCl, pH 8, the column is first washed with 10 volumes of
6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M
guanidine-HCl pH 6, and finally the polypeptide is eluted with 6 M
guanidine-HCl, pH 5.
[0242] The purified protein is then renatured by dialyzing it
against phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6
buffer plus 200 mM NaCl. Alternatively, the protein can be
successfully refolded while immobilized on the Ni-NTA column. The
recommended conditions are as follows: renature using a linear
6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH
7.4, containing protease inhibitors. The renaturation should be
performed over a period of 1.5 hours or more. After renaturation
the proteins are eluted by the addition of 250 mM immidazole.
Immidazole is removed by a final dialyzing step against PBS or 50
mM sodium acetate pH 6 buffer plus 200 mM NaCl. The purified
protein is stored at 4.degree. C. or frozen at -80.degree. C.
[0243] In addition to the above expression vector, the present
invention further includes an expression vector comprising phage
operator and promoter elements operatively linked to a
polynucleotide of the present invention, called pHE4a. (ATCC
Accession Number 209645, deposited on Feb. 25, 1998.) This vector
contains: 1) a neomycinphosphotransferase gene as a selection
marker, 2) an E. coli origin of replication, 3) a T5 phage promoter
sequence, 4) two lac operator sequences, 5) a Shine-Delgarno
sequence, and 6) the lactose operon repressor gene (lacIq). The
origin of replication (oriC) is derived from pUC19 (LTI,
Gaithersburg, Md.). The promoter sequence and operator sequences
are made synthetically.
[0244] DNA can be inserted into the pHEa by restricting the vector
with NdeI and XbaI, BamHI, XhoI, or Asp718, running the restricted
product on a gel, and isolating the larger fragment (the stuffer
fragment should be about 310 base pairs). The DNA insert is
generated according to the PCR protocol described in Example 1,
using PCR primers having restriction sites for NdeI (5' primer) and
XbaI, BamHI, XhoI, or Asp718 (3' primer). The PCR insert is gel
purified and restricted with compatible enzymes. The insert and
vector are ligated according to standard protocols.
[0245] The engineered vector could easily be substituted in the
above protocol to express protein in a bacterial system.
Example 6
Purification of a Polypeptide from an Inclusion Body
[0246] The following alternative method can be used to purify a
polypeptide expressed in E coli when it is present in the form of
inclusion bodies. Unless otherwise specified, all of the following
steps are conducted at 4-10.degree. C.
[0247] Upon completion of the production phase of the E. coli
fermentation, the cell culture is cooled to 4-10.degree. C. and the
cells harvested by continuous centrifugation at 15,000 rpm (Heraeus
Sepatech). On the basis of the expected yield of protein per unit
weight of cell paste and the amount of purified protein required,
an appropriate amount of cell paste, by weight, is suspended in a
buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The
cells are dispersed to a homogeneous suspension using a high shear
mixer.
[0248] The cells are then lysed by passing the solution through a
microfluidizer (Microfluidics Corp. or APV Gaulin, Inc.) twice at
4000-6000 psi. The homogenate is then mixed with NaCl solution to a
final concentration of 0.5 M NaCl, followed by centrifugation at
7000.times.g for 15 min. The resultant pellet is washed again using
0.5M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.
[0249] The resulting washed inclusion bodies are solubilized with
1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After
7000.times.g centrifugation for 15 min., the pellet is discarded
and the polypeptide containing supernatant is incubated at
4.degree. C. overnight to allow further GuHCl extraction.
[0250] Following high speed centrifugation (30,000.times.g) to
remove insoluble particles, the GuHCl solubilized protein is
refolded by quickly mixing the GuHCl extract with 20 volumes of
buffer containing 50 mM sodium, pH 4.5, 150 mM NaCl, 2 mM EDTA by
vigorous stirring. The refolded diluted protein solution is kept at
4.degree. C. without mixing for 12 hours prior to further
purification steps.
[0251] To clarify the refolded polypeptide solution, a previously
prepared tangential filtration unit equipped with 0.16 .mu.m
membrane filter with appropriate surface area (e.g., Filtron),
equilibrated with 40 mM sodium acetate, pH 6.0 is employed. The
filtered sample is loaded onto a cation exchange resin (e.g., Poros
HS-50, Perseptive Biosystems). The column is washed with 40 mM
sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and
1500 mM NaCl in the same buffer, in a stepwise manner. The
absorbance at 280 nm of the effluent is continuously monitored.
Fractions are collected and further analyzed by SDS-PAGE.
[0252] Fractions containing the polypeptide are then pooled and
mixed with 4 volumes of water. The diluted sample is then loaded
onto a previously prepared set of tandem columns of strong anion
(Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20,
Perseptive Biosystems) exchange resins. The columns are
equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are
washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20
column is then eluted using a 10 column volume linear gradient
ranging from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M
NaCl, 50 mM sodium acetate, pH 6.5. Fractions are collected under
constant A.sub.280 monitoring of the effluent. Fractions containing
the polypeptide (determined, for instance, by 16% SDS-PAGE) are
then pooled.
[0253] The resultant polypeptide should exhibit greater than 95%
purity after the above refolding and purification steps. No major
contaminant bands should be observed from Commassie blue stained
16% SDS-PAGE gel when 5 .mu.g of purified protein is loaded. The
purified protein can also be tested for endotoxin/LPS
contamination, and typically the LPS content is less than 0.1 ng/ml
according to LAL assays.
Example 7
Cloning and Expression of a Polypeptide in a Baculovirus Expression
System
[0254] In this example, the plasmid shuttle vector pA2 is used to
insert a polynucleotide into a baculovirus to express a
polypeptide. This expression vector contains the strong polyhedrin
promoter of the Autographa californica nuclear polyhedrosis virus
(AcMNPV) followed by convenient restriction sites such as BamHI,
Xba I and Asp718. The polyadenylation site of the simian virus 40
("SV40") is used for efficient polyadenylation. For easy selection
of recombinant virus, the plasmid contains the beta-galactosidase
gene from E. coli under control of a weak Drosophila promoter in
the same orientation, followed by the polyadenylation signal of the
polyhedrin gene. The inserted genes are flanked on both sides by
viral sequences for cell-mediated homologous recombination with
wild-type viral DNA to generate a viable virus that express the
cloned polynucleotide.
[0255] Many other baculovirus vectors can be used in place of the
vector above, such as pAc373, pVL941, and pAcIM1, as one skilled in
the art would readily appreciate, as long as the construct provides
appropriately located signals for transcription, translation,
secretion and the like, including a signal peptide and an in-frame
AUG as required. Such vectors are described, for instance, in
Luckow et al., Virology 170:31-39 (1989).
[0256] Specifically, the cDNA sequence contained in the deposited
clone, including the AUG initiation codon and the naturally
associated leader sequence identified in Table 1, is amplified
using the PCR protocol described in Example 1. If the naturally
occurring signal sequence is used to produce the secreted protein,
the pA2 vector does not need a second signal peptide.
Alternatively, the vector can be modified (pA2 GP) to include a
baculovirus leader sequence, using the standard methods described
in Summers et al., "A Manual of Methods for Baculovirus Vectors and
Insect Cell Culture Procedures," Texas Agricultural Experimental
Station Bulletin No. 1555 (1987).
[0257] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with appropriate
restriction enzymes and again purified on a 1% agarose gel.
[0258] The plasmid is digested with the corresponding restriction
enzymes and optionally, can be dephosphorylated using calf
intestinal phosphatase, using routine procedures known in the art.
The DNA is then isolated from a 1% agarose gel using a commercially
available kit ("Geneclean" BIO 101 Inc., La Jolla, Calif.).
[0259] The fragment and the dephosphorylated plasmid are ligated
together with T4 DNA ligase. E. coli HB101 or other suitable E.
coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla,
Calif.) cells are transformed with the ligation mixture and spread
on culture plates. Bacteria containing the plasmid are identified
by digesting DNA from individual colonies and analyzing the
digestion product by gel electrophoresis. The sequence of the
cloned fragment is confirmed by DNA sequencing.
[0260] Five .mu.g of a plasmid containing the polynucleotide is
co-transfected with 1.0 .mu.g of a commercially available
linearized baculovirus DNA ("BaculoGold.TM. baculovirus DNA",
Pharmingen, San Diego, Calif.), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. USA
84:7413-7417 (1987). One .mu.g of BaculoGold.TM. virus DNA and 5
.mu.g of the plasmid are mixed in a sterile well of a microtiter
plate containing 50 .mu.l of serum-free Grace's medium (Life
Technologies Inc., Gaithersburg, Md.). Afterwards, 10 .mu.l
Lipofectin plus 90 .mu.l Grace's medium are added, mixed and
incubated for 15 minutes at room temperature. Then the transfection
mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711)
seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum. The plate is then incubated for 5 hours at
27.degree. C. The transfection solution is then removed from the
plate and 1 ml of Grace's insect medium supplemented with 10% fetal
calf serum is added. Cultivation is then continued at 27.degree. C.
for four days.
[0261] After four days the supernatant is collected and a plaque
assay is performed, as described by Summers and Smith, supra. An
agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg)
is used to allow easy identification and isolation of
gal-expressing clones, which produce blue-stained plaques. (A
detailed description of a "plaque assay" of this type can also be
found in the user's guide for insect cell culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg,
page 9-10.) After appropriate incubation, blue stained plaques are
picked with the tip of a micropipettor (e.g., Eppendorf). The agar
containing the recombinant viruses is then resuspended in a
microcentrifuge tube containing 200 .mu.l of Grace's medium and the
suspension containing the recombinant baculovirus is used to infect
Sf9 cells seeded in 35 mm dishes. Four days later the supernatants
of these culture dishes are harvested and then they are stored at
4.degree. C.
[0262] To verify the expression of the polypeptide, Sf9 cells are
grown in Grace's medium supplemented with 10% heat-inactivated FBS.
The cells are infected with the recombinant baculovirus containing
the polynucleotide at a multiplicity of infection ("MOI") of about
2. If radiolabeled proteins are desired, 6 hours later the medium
is removed and is replaced with SF900 II medium minus methionine
and cysteine (available from Life Technologies Inc., Rockville,
Md.). After 42 hours, 5 .mu.Ci of .sup.35S-methionine and 5 .mu.Ci
.sup.35S-cysteine (available from Amersham) are added. The cells
are further incubated for 16 hours and then are harvested by
centrifugation. The proteins in the supernatant as well as the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled).
[0263] Microsequencing of the amino acid sequence of the amino
terminus of purified protein may be used to determine the amino
terminal sequence of the produced protein.
Example 8
Expression of a Polypeptide in Mammalian Cells
[0264] The polypeptide of the present invention can be expressed in
a mammalian cell. A typical mammalian expression vector contains a
promoter element, which mediates the initiation of transcription of
mRNA, a protein coding sequence, and signals required for the
termination of transcription and polyadenylation of the transcript.
Additional elements include enhancers, Kozak sequences and
intervening sequences flanked by donor and acceptor sites for RNA
splicing. Highly efficient transcription is achieved with the early
and late promoters from SV40, the long terminal repeats (LTRs) from
Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the
cytomegalovirus (CMV). However, cellular elements can also be used
(e.g., the human actin promoter).
[0265] Suitable expression vectors for use in practicing the
present invention include, for example, vectors such as pSVL and
pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr
(ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport
3.0. Mammalian host cells that could be used include, human Hela,
293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7
and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary
(CHO) cells.
[0266] Alternatively, the polypeptide can be expressed in stable
cell lines containing the polynucleotide integrated into a
chromosome. The co-transfection with a selectable marker such as
dhfr, gpt, neomycin, hygromycin allows the identification and
isolation of the transfected cells.
[0267] The transfected gene can also be amplified to express large
amounts of the encoded protein. The DHFR (dihydrofolate reductase)
marker is useful in developing cell lines that carry several
hundred or even several thousand copies of the gene of interest.
(See, e.g., Alt, F. W., et al., J. Biol. Chem. 253:1357-1370
(1978); Hamlin, J. L. and Ma, C., Biochem. et Biophys. Acta,
1097:107-143 (1990); Page, M. J. and Sydenham, M. A., Biotechnology
9:64-68 (1991).) Another useful selection marker is the enzyme
glutamine synthase (GS) (Murphy et al., Biochem J. 227:277-279
(1991); Bebbington et al., Bio/Technology 10:169-175 (1992). Using
these markers, the mammalian cells are grown in selective medium
and the cells with the highest resistance are selected. These cell
lines contain the amplified gene(s) integrated into a chromosome.
Chinese hamster ovary (CHO) and NSO cells are often used for the
production of proteins.
[0268] Derivatives of the plasmid pSV2-dhfr (ATCC Accession No.
37146), the expression vectors pC4 (ATCC Accession No. 209646) and
pC6 (ATCC Accession No. 209647) contain the strong promoter (LTR)
of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular
Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer
(Boshart et al., Cell 41:521-530 (1985).) Multiple cloning sites,
e.g., with the restriction enzyme cleavage sites BamHI, XbaI and
Asp718, facilitate the cloning of the gene of interest. The vectors
also contain the 3' intron, the polyadenylation and termination
signal of the rat preproinsulin gene, and the mouse DHFR gene under
control of the SV40 early promoter.
[0269] Specifically, the plasmid pC6, for example, is digested with
appropriate restriction enzymes and then dephosphorylated using
calf intestinal phosphates by procedures known in the art. The
vector is then isolated from a 1% agarose gel.
[0270] A polynucleotide of the present invention is amplified
according to the protocol outlined in Example 1. If the naturally
occurring signal sequence is used to produce the secreted protein,
the vector does not need a second signal peptide. Alternatively, if
the naturally occurring signal sequence is not used, the vector can
be modified to include a heterologous signal sequence. (See, e.g.,
WO 96/34891.)
[0271] The amplified fragment is isolated from a 1% agarose gel
using a commercially available kit ("Geneclean," BIO 101 Inc., La
Jolla, Calif.). The fragment then is digested with appropriate
restriction enzymes and again purified on a 1% agarose gel.
[0272] The amplified fragment is then digested with the same
restriction enzyme and purified on a 1% agarose gel. The isolated
fragment and the dephosphorylated vector are then ligated with T4
DNA ligase. E. coli HB 101 or XL-1 Blue cells are then transformed
and bacteria are identified that contain the fragment inserted into
plasmid pC6 using, for instance, restriction enzyme analysis.
[0273] Chinese hamster ovary cells lacking an active DHFR gene is
used for transfection. Five .mu.g of the expression plasmid pC6 is
cotransfected with 0.5 .mu.g of the plasmid pSVneo using lipofectin
(Felgner et al., supra). The plasmid pSV2-neo contains a dominant
selectable marker, the neo gene from Tn5 encoding an enzyme that
confers resistance to a group of antibiotics including G418. The
cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
After 2 days, the cells are trypsinized and seeded in hybridoma
cloning plates (Greiner, Germany) in alpha minus MEM supplemented
with 10, 25, or 50 ng/ml of methotrexate plus 1 mg/ml G418. After
about 10-14 days single clones are trypsinized and then seeded in
6-well petri dishes or 10 ml flasks using different concentrations
of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones
growing at the highest concentrations of methotrexate are then
transferred to new 6-well plates containing even higher
concentrations of methotrexate (1 .mu.M, 2 .mu.M, 5 .mu.M, 10 mM,
20 mM). The same procedure is repeated until clones are obtained
which grow at a concentration of 100-200 .mu.M. Expression of the
desired gene product is analyzed, for instance, by SDS-PAGE and
Western blot or by reversed phase HPLC analysis.
Example 9
Protein Fusions
[0274] The polypeptides of the present invention are preferably
fused to other proteins. These fusion proteins can be used for a
variety of applications. For example, fusion of the present
polypeptides to His-tag, HA-tag, protein A, IgG domains, and
maltose binding protein facilitates purification. (See Example 5;
see also EP A 394,827; Traunecker, et al., Nature 331:84-86
(1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases
the halflife time in vivo. Nuclear localization signals fused to
the polypeptides of the present invention can target the protein to
a specific subcellular localization, while covalent heterodimer or
homodimers can increase or decrease the activity of a fusion
protein. Fusion proteins can also create chimeric molecules having
more than one function. Finally, fusion proteins can increase
solubility and/or stability of the fused protein compared to the
non-fused protein. All of the types of fusion proteins described
above can be made by modifying the following protocol, which
outlines the fusion of a polypeptide to an IgG molecule, or the
protocol described in Example 5.
[0275] Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the
sequence described below. These primers also should have convenient
restriction enzyme sites that will facilitate cloning into an
expression vector, preferably a mammalian expression vector.
[0276] For example, if pC4 (Accession No. 209646) is used, the
human Fc portion can be ligated into the BamHI cloning site. Note
that the 3' BamHI site should be destroyed. Next, the vector
containing the human Fc portion is re-restricted with BamHI,
linearizing the vector, and a polynucleotide of the present
invention, isolated by the PCR protocol described in Example 1, is
ligated into this BamHI site. Note that the polynucleotide is
cloned without a stop codon, otherwise a fusion protein will not be
produced.
[0277] If the naturally occurring signal sequence is used to
produce the secreted protein, pC4 does not need a second signal
peptide. Alternatively, if the naturally occurring signal sequence
is not used, the vector can be modified to include a heterologous
signal sequence. (See, e.g., WO 96/34891.)
[0278] Human IgG Fc Region: TABLE-US-00003 (SEQ ID NO:13)
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGC
CCAGCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAA
ACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGG
TGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTG
GACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTA
CAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACT
GGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCA
ACCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACC
ACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGG
TCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTG
GAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCC
CGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGG
ACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCAT
GAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGG
TAAATGAGTGCGACGGCCGCGACTCTAGAGGAT
Example 10
Production of an Antibody from a Polypeptide
[0279] The antibodies of the present invention can be prepared by a
variety of methods. (See, Current Protocols, Chapter 2.) For
example, cells expressing a polypeptide of the present invention is
administered to an animal to induce the production of sera
containing polyclonal antibodies. In a preferred method, a
preparation of the secreted protein is prepared and purified to
render it substantially free of natural contaminants. Such a
preparation is then introduced into an animal in order to produce
polyclonal antisera of greater specific activity.
[0280] In the most preferred method, the antibodies of the present
invention are monoclonal antibodies (or protein binding fragments
thereof). Such monoclonal
[0281] antibodies can be prepared using hybridoma technology.
(Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292
(1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N.Y., pp. 563-681 (1981).) In general, such
procedures involve immunizing an animal (preferably a mouse) with
polypeptide or, more preferably, with a secreted
polypeptide-expressing cell. Such cells may be cultured in any
suitable tissue culture medium; however, it is preferable to
culture cells in Earle's modified Eagle's medium supplemented with
10% fetal bovine serum (inactivated at about 56.degree. C.), and
supplemented with about 10 g/l of nonessential amino acids, about
1,000 U/ml of penicillin, and about 100 .mu.g/ml of
streptomycin.
[0282] The splenocytes of such mice are extracted and fused with a
suitable myeloma cell line. Any suitable myeloma cell line may be
employed in accordance with the present invention; however, it is
preferable to employ the parent myeloma cell line (SP20), available
from the ATCC. After fusion, the resulting hybridoma cells are
selectively maintained in HAT medium, and then cloned by limiting
dilution as described by Wands et al. (Gastroenterology 80:225-232
(1981).) The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of
binding the polypeptide.
[0283] Alternatively, additional antibodies capable of binding to
the polypeptide can be produced in a two-step procedure using
anti-idiotypic antibodies. Such a method makes use of the fact that
antibodies are themselves antigens, and therefore, it is possible
to obtain an antibody which binds to a second antibody. In
accordance with this method, protein specific antibodies are used
to immunize an animal, preferably a mouse. The splenocytes of such
an animal are then used to produce hybridoma cells, and the
hybridoma cells are screened to identify clones which produce an
antibody whose ability to bind to the protein-specific antibody can
be blocked by the polypeptide. Such antibodies comprise
anti-idiotypic antibodies to the protein-specific antibody and can
be used to immunize an animal to induce formation of further
protein-specific antibodies.
[0284] It will be appreciated that Fab and F(ab')2 and other
fragments of the antibodies of the present invention may be used
according to the methods disclosed herein. Such fragments are
typically produced by proteolytic cleavage, using enzymes such as
papain (to produce Fab fragments) or pepsin (to produce F(ab')2
fragments). Alternatively, secreted protein-binding fragments can
be produced through the application of recombinant DNA technology
or through synthetic chemistry.
[0285] For in vivo use of antibodies in humans, it may be
preferable to use "humanized" chimeric monoclonal antibodies. Such
antibodies can be produced using genetic constructs derived from
hybridoma cells producing the monoclonal antibodies described
above. Methods for producing chimeric antibodies are known in the
art. (See, for review, Morrison, Science 229:1202 (1985); Oi et
al., BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494;
Neuberger et al., WO 8601533; Robinson et al., WO 8702671;
Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature
314:268 (1985).)
Example 11
Method of Determining Alterations in a Gene Corresponding to a
Polynucleotide
[0286] RNA isolated from entire families or individual patients
presenting with a phenotype of interest (such as a disease) is be
isolated. cDNA is then generated from these RNA samples using
protocols known in the art. (See, Sambrook.) The cDNA is then used
as a template for PCR, employing primers surrounding regions of
interest in SEQ ID NO:X. Suggested PCR conditions consist of 35
cycles at 95.degree. C. for 30 seconds; 60-120 seconds at
52-58.degree. C.; and 60-120 seconds at 70.degree. C., using buffer
solutions described in Sidransky, D., et al., Science 252:706
(1991).
[0287] PCR products are then sequenced using primers labeled at
their 5' end with T4 polynucleotide kinase, employing SequiTherm
Polymerase. (Epicentre Technologies). The intron-exon borders of
selected exons is also determined and genomic PCR products analyzed
to confirm the results. PCR products harboring suspected mutations
is then cloned and sequenced to validate the results of the direct
sequencing.
[0288] PCR products is cloned into T-tailed vectors as described in
Holton, T. A. and Graham, M. W., Nucleic Acids Research, 19:1156
(1991) and sequenced with T7 polymerase (United States
Biochemical). Affected individuals are identified by mutations not
present in unaffected individuals.
[0289] Genomic rearrangements are also observed as a method of
determining alterations in a gene corresponding to a
polynucleotide. Genomic clones isolated according to Example 2 are
nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson,
Cg. et al., Methods Cell Biol. 35:73-99 (1991). Hybridization with
the labeled probe is carried out using a vast excess of human cot-1
DNA for specific hybridization to the corresponding genomic
locus.
[0290] Chromosomes are counterstained with
4,6-diamino-2-phenylidole and propidium iodide, producing a
combination of C- and R-bands. Aligned images for precise mapping
are obtained using a triple-band filter set (Chroma Technology,
Brattleboro, Vt.) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson, Ariz.) and variable excitation
wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl.,
8:75 (1991).) Image collection, analysis and chromosomal fractional
length measurements are performed using the ISee Graphical Program
System. (Inovision Corporation, Durham, N.C.) Chromosome
alterations of the genomic region hybridized by the probe are
identified as insertions, deletions, and translocations. These
alterations are used as a diagnostic marker for an associated
disease.
Example 12
Method of Detecting Abnormal Levels of a Polypeptide in a
Biological Sample
[0291] A polypeptide of the present invention can be detected in a
biological sample, and if an increased or decreased level of the
polypeptide is detected, this polypeptide is a marker for a
particular phenotype. Methods of detection are numerous, and thus,
it is understood that one skilled in the art can modify the
following assay to fit their particular needs.
[0292] For example, antibody-sandwich ELISAs are used to detect
polypeptides in a sample, preferably a biological sample. Wells of
a microtiter plate are coated with specific antibodies, at a final
concentration of 0.2 to 10 ug/ml. The antibodies are either
monoclonal or polyclonal and are produced by the method described
in Example 10. The wells are blocked so that non-specific binding
of the polypeptide to the well is reduced.
[0293] The coated wells are then incubated for >2 hours at RT
with a sample containing the polypeptide. Preferably, serial
dilutions of the sample should be used to validate results. The
plates are then washed three times with deionized or distilled
water to remove unbounded polypeptide.
[0294] Next, 50 ul of specific antibody-alkaline phosphatase
conjugate, at a concentration of 25-400 ng, is added and incubated
for 2 hours at room temperature. The plates are again washed three
times with deionized or distilled water to remove unbounded
conjugate.
[0295] Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or
p-nitrophenyl phosphate (NPP) substrate solution to each well and
incubate 1 hour at room temperature. Measure the reaction by a
microtiter plate reader. Prepare a standard curve, using serial
dilutions of a control sample, and plot polypeptide concentration
on the X-axis (log scale) and fluorescence or absorbance of the
Y-axis (linear scale). Interpolate the concentration of the
polypeptide in the sample using the standard curve.
Example 13
Formulating a Polypeptide
[0296] The secreted polypeptide composition will be formulated and
dosed in a fashion consistent with good medical practice, taking
into account the clinical condition of the individual patient
(especially the side effects of treatment with the secreted
polypeptide alone), the site of delivery, the method of
administration, the scheduling of administration, and other factors
known to practitioners. The "effective amount" for purposes herein
is thus determined by such considerations.
[0297] As a general proposition, the total pharmaceutically
effective amount of secreted polypeptide administered parenterally
per dose will be in the range of about 1 .mu.g/kg/day to 10
mg/kg/day of patient body weight, although, as noted above, this
will be subject to therapeutic discretion. More preferably, this
dose is at least 0.01 mg/kg/day, and most preferably for humans
between about 0.01 and 1 mg/kg/day for the hormone. If given
continuously, the secreted polypeptide is typically administered at
a dose rate of about 1 .mu.g/kg/hour to about 50 .mu.g/kg/hour,
either by 1-4 injections per day or by continuous subcutaneous
infusions, for example, using a mini-pump. An intravenous bag
solution may also be employed. The length of treatment needed to
observe changes and the interval following treatment for responses
to occur appears to vary depending on the desired effect.
[0298] Pharmaceutical compositions containing the secreted protein
of the invention are administered orally, rectally, parenterally,
intracistemally, intravaginally, intraperitoneally, topically (as
by powders, ointments, gels, drops or transdermal patch), bucally,
or as an oral or nasal spray. "Pharmaceutically acceptable carrier"
refers to a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or formulation auxiliary of any type. The
term "parenteral" as used herein refers to modes of administration
which include intravenous, intramuscular, intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and
infusion.
[0299] The secreted polypeptide is also suitably administered by
sustained-release systems. Suitable examples of sustained-release
compositions include semi-permeable polymer matrices in the form of
shaped articles, e.g., films, or microcapsules. Sustained-release
matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481),
copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman,
U. et al., Biopolymers 22:547-556 (1983)), poly (2-hydroxyethyl
methacrylate) (R. Langer et al., J. Biomed. Mater. Res. 15:167-277
(1981), and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene
vinyl acetate (R. Langer et al.) or poly-D-(-)-3-hydroxybutyric
acid (EP 133,988). Sustained-release compositions also include
liposomally entrapped polypeptides. Liposomes containing the
secreted polypeptide are prepared by methods known per se: DE
3,218,121; Epstein et al., Proc. Natl. Acad. Sci. USA 82:3688-3692
(1985); Hwang et al., Proc. Natl. Acad. Sci. USA 77:4030-4034
(1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641;
Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and
4,544,545; and EP 102,324. Ordinarily, the liposomes are of the
small (about 200-800 Angstroms) unilamellar type in which the lipid
content is greater than about 30 mol. percent cholesterol, the
selected proportion being adjusted for the optimal secreted
polypeptide therapy.
[0300] For parenteral administration, in one embodiment, the
secreted polypeptide is formulated generally by mixing it at the
desired degree of purity, in a unit dosage injectable form
(solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at
the dosages and concentrations employed and is compatible with
other ingredients of the formulation. For example, the formulation
preferably does not include oxidizing agents and other compounds
that are known to be deleterious to polypeptides.
[0301] Generally, the formulations are prepared by contacting the
polypeptide uniformly and intimately with liquid carriers or finely
divided solid carriers or both. Then, if necessary, the product is
shaped into the desired formulation. Preferably the carrier is a
parenteral carrier, more preferably a solution that is isotonic
with the blood of the recipient. Examples of such carrier vehicles
include water, saline, Ringer's solution, and dextrose solution.
Non-aqueous vehicles such as fixed oils and ethyl oleate are also
useful herein, as well as liposomes.
[0302] The carrier suitably contains minor amounts of additives
such as substances that enhance isotonicity and chemical stability.
Such materials are non-toxic to recipients at the dosages and
concentrations employed, and include buffers such as phosphate,
citrate, succinate, acetic acid, and other organic acids or their
salts; antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids, such as glycine, glutamic acid, aspartic acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose or its derivatives, glucose, mannose, or
dextrins; chelating agents such as EDTA; sugar alcohols such as
mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
[0303] The secreted polypeptide is typically formulated in such
vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml,
preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be
understood that the use of certain of the foregoing excipients,
carriers, or stabilizers will result in the formation of
polypeptide salts.
[0304] Any polypeptide to be used for therapeutic administration
can be sterile. Sterility is readily accomplished by filtration
through sterile filtration membranes (e.g., 0.2 micron membranes).
Therapeutic polypeptide compositions generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle.
[0305] Polypeptides ordinarily will be stored in unit or multi-dose
containers, for example, sealed ampoules or vials, as an aqueous
solution or as a lyophilized formulation for reconstitution. As an
example of a lyophilized formulation, 10-ml vials are filled with 5
ml of sterile-filtered 1% (w/v) aqueous polypeptide solution, and
the resulting mixture is lyophilized. The infusion solution is
prepared by reconstituting the lyophilized polypeptide using
bacteriostatic Water-for-Injection.
[0306] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions of the invention.
Associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. In addition, the polypeptides of the present
invention may be employed in conjunction with other therapeutic
compounds.
Example 14
Method of Treating Decreased Levels of the Polypeptide
[0307] It will be appreciated that conditions caused by a decrease
in the standard or normal expression level of a secreted protein in
an individual can be treated by administering the polypeptide of
the present invention, preferably in the secreted form. Thus, the
invention also provides a method of treatment of an individual in
need of an increased level of the polypeptide comprising
administering to such an individual a pharmaceutical composition
comprising an amount of the polypeptide to increase the activity
level of the polypeptide in such an individual.
[0308] For example, a patient with decreased levels of a
polypeptide receives a daily dose 0.1-100 ug/kg of the polypeptide
for six consecutive days. Preferably, the polypeptide is in the
secreted form. The exact details of the dosing scheme, based on
administration and formulation, are provided in Example 23.
Example 15
Method of Treating Increased Levels of the Polypeptide
[0309] Antisense technology is used to inhibit production of a
polypeptide of the present invention. This technology is one
example of a method of decreasing levels of a polypeptide,
preferably a secreted form, due to a variety of etiologies, such as
cancer.
[0310] For example, a patient diagnosed with abnormally increased
levels of a polypeptide is administered intravenously antisense
polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21
days. This treatment is repeated after a 7-day rest period if the
treatment was well tolerated. The formulation of the antisense
polynucleotide is provided in Example 23.
Example 16
Method of Treatment Using Gene Therapy
[0311] One method of gene therapy transplants fibroblasts, which
are capable of expressing a polypeptide, onto a patient. Generally,
fibroblasts are obtained from a subject by skin biopsy. The
resulting tissue is placed in tissue-culture medium and separated
into small pieces. Small chunks of the tissue are placed on a wet
surface of a tissue culture flask, approximately ten pieces are
placed in each flask. The flask is turned upside down, closed tight
and left at room temperature over night. After 24 hours at room
temperature, the flask is inverted and the chunks of tissue remain
fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with 10% FBS, penicillin and streptomycin) is added. The
flasks are then incubated at 37.degree. C. for approximately one
week.
[0312] At this time, fresh media is added and subsequently changed
every several days. After an additional two weeks in culture, a
monolayer of fibroblasts emerge. The monolayer is trypsinized and
scaled into larger flasks.
[0313] pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219-25 (1988)),
flanked by the long terminal repeats of the Moloney murine sarcoma
virus, is digested with EcoRI and HindIII and subsequently treated
with calf intestinal phosphatase. The linear vector is fractionated
on agarose gel and purified, using glass beads.
[0314] The cDNA encoding a polypeptide of the present invention can
be amplified using PCR primers which correspond to the 5' and 3'
end sequences respectively as set forth in Example 1. Preferably,
the 5' primer contains an EcoRI site and the 3' primer includes a
HindIII site. Equal quantities of the Moloney murine sarcoma virus
linear backbone and the amplified EcoRI and HindIII fragment are
added together, in the presence of T4 DNA ligase. The resulting
mixture is maintained under conditions appropriate for ligation of
the two fragments. The ligation mixture is then used to transform
bacteria HB101, which are then plated onto agar containing
kanamycin for the purpose of confirming that the vector has the
gene of interest properly inserted.
[0315] The amphotropic pA317 or GP+am12 packaging cells are grown
in tissue culture to confluent density in Dulbecco's Modified
Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and
streptomycin. The MSV vector containing the gene is then added to
the media and the packaging cells transduced with the vector. The
packaging cells now produce infectious viral particles containing
the gene (the packaging cells are now referred to as producer
cells).
[0316] Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of
confluent producer cells. The spent media, containing the
infectious viral particles, is filtered through a millipore filter
to remove detached producer cells and this media is then used to
infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the
producer cells. This media is removed and replaced with fresh
media. If the titer of virus is high, then virtually all
fibroblasts will be infected and no selection is required. If the
titer is very low, then it is necessary to use a retroviral vector
that has a selectable marker, such as neo or his. Once the
fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine whether protein is produced.
[0317] The engineered fibroblasts are then transplanted onto the
host, either alone or after having been grown to confluence on
cytodex 3 microcarrier beads.
[0318] It will be clear that the invention may be practiced
otherwise than as particularly described in the foregoing
description and examples. Numerous modifications and variations of
the present invention are possible in light of the above teachings
and, therefore, are within the scope of the appended claims.
[0319] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background
of the Invention, Detailed Description, and Examples is hereby
incorporated herein by reference. Further, the hard copy of the
sequence listing submitted herewith and the corresponding computer
readable form are both incorporated herein by reference in their
entireties.
Sequence CWU 1
1
13 1 1062 DNA Homo sapiens CDS (25)..(876) 1 cacgagcgcc agcctgcgtc
tgcc atg ggg ctc ggg ttg agg ggc tgg gga 51 Met Gly Leu Gly Leu Arg
Gly Trp Gly 1 5 cgt cct ctg ctg act gtg gcc acc gcc ctg atg ctg ccc
gtg aag ccc 99 Arg Pro Leu Leu Thr Val Ala Thr Ala Leu Met Leu Pro
Val Lys Pro 10 15 20 25 ccc gca ggc tcc tgg ggg gcc cag atc atc ggg
ggc cac gag gtg acc 147 Pro Ala Gly Ser Trp Gly Ala Gln Ile Ile Gly
Gly His Glu Val Thr 30 35 40 ccc cac tcc agg ccc tac atg gca tcc
gtg cgc ttc ggg ggc caa cat 195 Pro His Ser Arg Pro Tyr Met Ala Ser
Val Arg Phe Gly Gly Gln His 45 50 55 cac tgc gga ggc ttc ctg ctg
cga gcc cgc tgg gtg gtc tcg gcc gcc 243 His Cys Gly Gly Phe Leu Leu
Arg Ala Arg Trp Val Val Ser Ala Ala 60 65 70 cac tgc ttc agc cac
aga gac ctc cgc act ggc ctg gtg gtg ctg ggc 291 His Cys Phe Ser His
Arg Asp Leu Arg Thr Gly Leu Val Val Leu Gly 75 80 85 gcc cac gtc
ctg agt act gcg gag ccc acc cag cag gtg ttt ggc atc 339 Ala His Val
Leu Ser Thr Ala Glu Pro Thr Gln Gln Val Phe Gly Ile 90 95 100 105
gat gct ctc acc acg cac ccc gac tac cac ccc atg acc cac gcc aac 387
Asp Ala Leu Thr Thr His Pro Asp Tyr His Pro Met Thr His Ala Asn 110
115 120 gac atc tgc ctg ctg cgg ctg aac ggc tct gct gtc ctg ggc cct
gca 435 Asp Ile Cys Leu Leu Arg Leu Asn Gly Ser Ala Val Leu Gly Pro
Ala 125 130 135 gtg ggg ctg ctg agg ctg cca ggg aga agg gcc agg ccc
ccc aca gcg 483 Val Gly Leu Leu Arg Leu Pro Gly Arg Arg Ala Arg Pro
Pro Thr Ala 140 145 150 ggg aca cgg tgc cgg gtg gct ggc tgg ggc ttc
gtg tct gac ttt gag 531 Gly Thr Arg Cys Arg Val Ala Gly Trp Gly Phe
Val Ser Asp Phe Glu 155 160 165 gag ctg ccg cct gga ctg atg gag gcc
aag gtc cga gtg ctg gac ccg 579 Glu Leu Pro Pro Gly Leu Met Glu Ala
Lys Val Arg Val Leu Asp Pro 170 175 180 185 gac gtc tgc aac agc tcc
tgg aag ggc cac ctg aca ctt acc atg ctc 627 Asp Val Cys Asn Ser Ser
Trp Lys Gly His Leu Thr Leu Thr Met Leu 190 195 200 tgc acc cgc agt
ggg gac agc cac aga cgg ggc ttc tgc tcg gcc gac 675 Cys Thr Arg Ser
Gly Asp Ser His Arg Arg Gly Phe Cys Ser Ala Asp 205 210 215 tcc gga
ggg ccc ctg gtg tgc agg aac cgg gct cac ggc ctc gtt tcc 723 Ser Gly
Gly Pro Leu Val Cys Arg Asn Arg Ala His Gly Leu Val Ser 220 225 230
ttc tcg ggc ctc tgg tgc ggc gac ccc aag acc ccc gac gtg tac acg 771
Phe Ser Gly Leu Trp Cys Gly Asp Pro Lys Thr Pro Asp Val Tyr Thr 235
240 245 cag gtg tcc gcc ttt gtg gcc tgg atc tgg gac gtg gtt cgg cgg
agc 819 Gln Val Ser Ala Phe Val Ala Trp Ile Trp Asp Val Val Arg Arg
Ser 250 255 260 265 agt ccc cag ccc ggc ccc ctg cct ggg acc acc agg
ccc cca gga gaa 867 Ser Pro Gln Pro Gly Pro Leu Pro Gly Thr Thr Arg
Pro Pro Gly Glu 270 275 280 gcc gcc tga gccacaacct tgcggcatgc
aaatgagatg gccgctccag 916 Ala Ala gcctggaatg ttccgtggct gggccccacg
ggaagcctga tgttcagggt tggggtggga 976 cgggcagcgg tggggcacac
ccattccaca tgcaaagggc agaagcaaac ccagtaaaat 1036 gttaactgac
aaaaaaaaaa aaaaaa 1062 2 283 PRT Homo sapiens 2 Met Gly Leu Gly Leu
Arg Gly Trp Gly Arg Pro Leu Leu Thr Val Ala 1 5 10 15 Thr Ala Leu
Met Leu Pro Val Lys Pro Pro Ala Gly Ser Trp Gly Ala 20 25 30 Gln
Ile Ile Gly Gly His Glu Val Thr Pro His Ser Arg Pro Tyr Met 35 40
45 Ala Ser Val Arg Phe Gly Gly Gln His His Cys Gly Gly Phe Leu Leu
50 55 60 Arg Ala Arg Trp Val Val Ser Ala Ala His Cys Phe Ser His
Arg Asp 65 70 75 80 Leu Arg Thr Gly Leu Val Val Leu Gly Ala His Val
Leu Ser Thr Ala 85 90 95 Glu Pro Thr Gln Gln Val Phe Gly Ile Asp
Ala Leu Thr Thr His Pro 100 105 110 Asp Tyr His Pro Met Thr His Ala
Asn Asp Ile Cys Leu Leu Arg Leu 115 120 125 Asn Gly Ser Ala Val Leu
Gly Pro Ala Val Gly Leu Leu Arg Leu Pro 130 135 140 Gly Arg Arg Ala
Arg Pro Pro Thr Ala Gly Thr Arg Cys Arg Val Ala 145 150 155 160 Gly
Trp Gly Phe Val Ser Asp Phe Glu Glu Leu Pro Pro Gly Leu Met 165 170
175 Glu Ala Lys Val Arg Val Leu Asp Pro Asp Val Cys Asn Ser Ser Trp
180 185 190 Lys Gly His Leu Thr Leu Thr Met Leu Cys Thr Arg Ser Gly
Asp Ser 195 200 205 His Arg Arg Gly Phe Cys Ser Ala Asp Ser Gly Gly
Pro Leu Val Cys 210 215 220 Arg Asn Arg Ala His Gly Leu Val Ser Phe
Ser Gly Leu Trp Cys Gly 225 230 235 240 Asp Pro Lys Thr Pro Asp Val
Tyr Thr Gln Val Ser Ala Phe Val Ala 245 250 255 Trp Ile Trp Asp Val
Val Arg Arg Ser Ser Pro Gln Pro Gly Pro Leu 260 265 270 Pro Gly Thr
Thr Arg Pro Pro Gly Glu Ala Ala 275 280 3 792 DNA Homo sapiens CDS
(85)..(708) 3 gacccacgcg tccggtactg gggcctcctc cactgggtcc
gaatcagtag gtgaccccgc 60 ccctggattc tggaagacct cacc atg gga cgc ccc
cga cct cgt gcg gcc 111 Met Gly Arg Pro Arg Pro Arg Ala Ala 1 5 aag
acg tgg atg ttc ctg ctc ttg ctg ggg gga gcc tgg gca ggg aaa 159 Lys
Thr Trp Met Phe Leu Leu Leu Leu Gly Gly Ala Trp Ala Gly Lys 10 15
20 25 tac aca gta cgc ctg gga gac cac agc cta cag aat aaa gat ggc
cca 207 Tyr Thr Val Arg Leu Gly Asp His Ser Leu Gln Asn Lys Asp Gly
Pro 30 35 40 gag caa gaa ata cct gtg gtt cag tcc atc cca cac ccc
tgc tac aac 255 Glu Gln Glu Ile Pro Val Val Gln Ser Ile Pro His Pro
Cys Tyr Asn 45 50 55 agc agc gat gtg gag gac cac aac cat gat ctg
atg ctt ctt caa ctg 303 Ser Ser Asp Val Glu Asp His Asn His Asp Leu
Met Leu Leu Gln Leu 60 65 70 cgt gac cag gca tcc ctg ggg tcc aaa
gtg aag ccc atc agc ctg gca 351 Arg Asp Gln Ala Ser Leu Gly Ser Lys
Val Lys Pro Ile Ser Leu Ala 75 80 85 gat cat tgc acc cag ctg gcc
aga agt gca ccg tct cag gct ggg ggc 399 Asp His Cys Thr Gln Leu Ala
Arg Ser Ala Pro Ser Gln Ala Gly Gly 90 95 100 105 act gtc acc agt
ccc cga gag aat ttt cct gac act ctc aac tgt gca 447 Thr Val Thr Ser
Pro Arg Glu Asn Phe Pro Asp Thr Leu Asn Cys Ala 110 115 120 gaa gta
aaa tct ttc ccc cag aag aag tgt gag gat gct tac ccg ggg 495 Glu Val
Lys Ser Phe Pro Gln Lys Lys Cys Glu Asp Ala Tyr Pro Gly 125 130 135
cag atc aca gat ggc atg gtc tgt gca ggc agc agc aaa ggg gct gac 543
Gln Ile Thr Asp Gly Met Val Cys Ala Gly Ser Ser Lys Gly Ala Asp 140
145 150 acg tgc cag ggc gat tct gga ggc ccc ctg gtg tgt gat ggt gca
ctc 591 Thr Cys Gln Gly Asp Ser Gly Gly Pro Leu Val Cys Asp Gly Ala
Leu 155 160 165 cag ggc atc aca tcc tgg ggc tca gac ccc tgt ggg agg
tcc gac aaa 639 Gln Gly Ile Thr Ser Trp Gly Ser Asp Pro Cys Gly Arg
Ser Asp Lys 170 175 180 185 cct ggc gtc tat acc aac atc tgc cgc tac
ctg gac tgg atc aag aag 687 Pro Gly Val Tyr Thr Asn Ile Cys Arg Tyr
Leu Asp Trp Ile Lys Lys 190 195 200 atc ata ggc agc aag ggc tga
ttttaggata agcaccgatc tcccttaata 738 Ile Ile Gly Ser Lys Gly 205
aactcacaac tctctggttc aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaa 792 4
207 PRT Homo sapiens 4 Met Gly Arg Pro Arg Pro Arg Ala Ala Lys Thr
Trp Met Phe Leu Leu 1 5 10 15 Leu Leu Gly Gly Ala Trp Ala Gly Lys
Tyr Thr Val Arg Leu Gly Asp 20 25 30 His Ser Leu Gln Asn Lys Asp
Gly Pro Glu Gln Glu Ile Pro Val Val 35 40 45 Gln Ser Ile Pro His
Pro Cys Tyr Asn Ser Ser Asp Val Glu Asp His 50 55 60 Asn His Asp
Leu Met Leu Leu Gln Leu Arg Asp Gln Ala Ser Leu Gly 65 70 75 80 Ser
Lys Val Lys Pro Ile Ser Leu Ala Asp His Cys Thr Gln Leu Ala 85 90
95 Arg Ser Ala Pro Ser Gln Ala Gly Gly Thr Val Thr Ser Pro Arg Glu
100 105 110 Asn Phe Pro Asp Thr Leu Asn Cys Ala Glu Val Lys Ser Phe
Pro Gln 115 120 125 Lys Lys Cys Glu Asp Ala Tyr Pro Gly Gln Ile Thr
Asp Gly Met Val 130 135 140 Cys Ala Gly Ser Ser Lys Gly Ala Asp Thr
Cys Gln Gly Asp Ser Gly 145 150 155 160 Gly Pro Leu Val Cys Asp Gly
Ala Leu Gln Gly Ile Thr Ser Trp Gly 165 170 175 Ser Asp Pro Cys Gly
Arg Ser Asp Lys Pro Gly Val Tyr Thr Asn Ile 180 185 190 Cys Arg Tyr
Leu Asp Trp Ile Lys Lys Ile Ile Gly Ser Lys Gly 195 200 205 5 840
DNA Homo sapiens CDS (115)..(603) 5 cgggtcgacc cacgcgtccg
ggacgagaga tagcagcgac gcgacaggcc aaacagtgac 60 agccacgtag
aggatctggc agacaaagag acaagacttt ggaagtgacc cacc atg 117 Met 1 ggg
ctc agc atc ttt ttg ctc ctg tgt gtt ctt ggg ctc agc cag gca 165 Gly
Leu Ser Ile Phe Leu Leu Leu Cys Val Leu Gly Leu Ser Gln Ala 5 10 15
gcc aca ccg aag att ttc aat ggc act gag tgt ggg cgt aac tca cag 213
Ala Thr Pro Lys Ile Phe Asn Gly Thr Glu Cys Gly Arg Asn Ser Gln 20
25 30 ccg tgg cag gtg ggg ctg ttt gag ggc acc agc ctg cgc tgc ggg
ggt 261 Pro Trp Gln Val Gly Leu Phe Glu Gly Thr Ser Leu Arg Cys Gly
Gly 35 40 45 gtc ctt att gac cac agg tgg gtc ctc aca gcg gct cac
tgg cag cgg 309 Val Leu Ile Asp His Arg Trp Val Leu Thr Ala Ala His
Trp Gln Arg 50 55 60 65 cag acc cat tcc ccg gat ctg ctc cag tgc ctc
aac ctc tcc atc gtc 357 Gln Thr His Ser Pro Asp Leu Leu Gln Cys Leu
Asn Leu Ser Ile Val 70 75 80 tcc cat gcc acc tgc cat ggt gtg tat
ccc ggg aga atc acg agc aac 405 Ser His Ala Thr Cys His Gly Val Tyr
Pro Gly Arg Ile Thr Ser Asn 85 90 95 atg gtg tgt gca ggc ggc gtc
ccg ggg caa gat gcc tgc cag ggt gat 453 Met Val Cys Ala Gly Gly Val
Pro Gly Gln Asp Ala Cys Gln Gly Asp 100 105 110 tct ggg ggc ccc ctg
gtg tgt ggg gga gtc ctt caa ggt ctg gtg tcc 501 Ser Gly Gly Pro Leu
Val Cys Gly Gly Val Leu Gln Gly Leu Val Ser 115 120 125 tgg ggg tct
gtg ggg ccc tgt gga caa gat ggc atc cct gga gtc tac 549 Trp Gly Ser
Val Gly Pro Cys Gly Gln Asp Gly Ile Pro Gly Val Tyr 130 135 140 145
acc tat att tgc aag tat gtg gac tgg atc cgg atg atc atg agg aac 597
Thr Tyr Ile Cys Lys Tyr Val Asp Trp Ile Arg Met Ile Met Arg Asn 150
155 160 aac tga cctgtttcct ccacctccac ccccacccct taacttgggt
acccctctgg 653 Asn ccctcagagc accaatatct cctccatcac ttcccctagc
tccactcttg ttggcctggg 713 aacttcttgg aactttaact cctgccagcc
cttctaagac ccacgagcgg ggtgagagaa 773 gtgtgcaata gtctggaata
aatataaatg aaggagggaa aaaaaaaaaa aaaaaaaaaa 833 aaaaaaa 840 6 162
PRT Homo sapiens 6 Met Gly Leu Ser Ile Phe Leu Leu Leu Cys Val Leu
Gly Leu Ser Gln 1 5 10 15 Ala Ala Thr Pro Lys Ile Phe Asn Gly Thr
Glu Cys Gly Arg Asn Ser 20 25 30 Gln Pro Trp Gln Val Gly Leu Phe
Glu Gly Thr Ser Leu Arg Cys Gly 35 40 45 Gly Val Leu Ile Asp His
Arg Trp Val Leu Thr Ala Ala His Trp Gln 50 55 60 Arg Gln Thr His
Ser Pro Asp Leu Leu Gln Cys Leu Asn Leu Ser Ile 65 70 75 80 Val Ser
His Ala Thr Cys His Gly Val Tyr Pro Gly Arg Ile Thr Ser 85 90 95
Asn Met Val Cys Ala Gly Gly Val Pro Gly Gln Asp Ala Cys Gln Gly 100
105 110 Asp Ser Gly Gly Pro Leu Val Cys Gly Gly Val Leu Gln Gly Leu
Val 115 120 125 Ser Trp Gly Ser Val Gly Pro Cys Gly Gln Asp Gly Ile
Pro Gly Val 130 135 140 Tyr Thr Tyr Ile Cys Lys Tyr Val Asp Trp Ile
Arg Met Ile Met Arg 145 150 155 160 Asn Asn 7 1527 DNA Homo sapiens
CDS (67)..(1335) 7 tacgaggtgg gtagaggtga tgcagtgctg aagacctggg
cccctgctca gtgcctttgc 60 tctaga atg ggt cca gct tgg ctt tgg cta ctg
gga aca ggg atc ctg 108 Met Gly Pro Ala Trp Leu Trp Leu Leu Gly Thr
Gly Ile Leu 1 5 10 gcc tct gtc cac tgt cag ccc ctt ctt gcc cat gga
gat aaa agt ctg 156 Ala Ser Val His Cys Gln Pro Leu Leu Ala His Gly
Asp Lys Ser Leu 15 20 25 30 cag ggg cct caa ccc ccc agg cat cag ctc
tca gag cca gcc ccc gcc 204 Gln Gly Pro Gln Pro Pro Arg His Gln Leu
Ser Glu Pro Ala Pro Ala 35 40 45 tac cac aga atc aca ccc acc att
acc aat ttt gct ttg cgt ttg tat 252 Tyr His Arg Ile Thr Pro Thr Ile
Thr Asn Phe Ala Leu Arg Leu Tyr 50 55 60 aaa gag ctg gca gca gac
gcc ccc gga aac atc ttc ttc tcg cca gtg 300 Lys Glu Leu Ala Ala Asp
Ala Pro Gly Asn Ile Phe Phe Ser Pro Val 65 70 75 agc atc tcc acc
acc ctg gcc ctg ctc tct ctt ggg gcc caa gct aac 348 Ser Ile Ser Thr
Thr Leu Ala Leu Leu Ser Leu Gly Ala Gln Ala Asn 80 85 90 acc tca
gct ctg atc ctg gag ggc ctg gga ttc aac ctc aca gaa acc 396 Thr Ser
Ala Leu Ile Leu Glu Gly Leu Gly Phe Asn Leu Thr Glu Thr 95 100 105
110 cct gaa gcc gac atc cac cag ggc ttc cgg agc ctc ctc cac acc ctt
444 Pro Glu Ala Asp Ile His Gln Gly Phe Arg Ser Leu Leu His Thr Leu
115 120 125 gcc ctg ccc agc ccc aaa ctc gaa cta aaa gta gga aac tcc
ctg ttc 492 Ala Leu Pro Ser Pro Lys Leu Glu Leu Lys Val Gly Asn Ser
Leu Phe 130 135 140 cta gac aag cga cta aag cct cgg cag cac tat ttg
gac agc atc aag 540 Leu Asp Lys Arg Leu Lys Pro Arg Gln His Tyr Leu
Asp Ser Ile Lys 145 150 155 gag ctt tat gga gct ttt gct ttt tct gcc
aac ttc aca gat tct gtt 588 Glu Leu Tyr Gly Ala Phe Ala Phe Ser Ala
Asn Phe Thr Asp Ser Val 160 165 170 aca act ggg agg cag att aat gac
tat ttg aga agg caa aca tac ggg 636 Thr Thr Gly Arg Gln Ile Asn Asp
Tyr Leu Arg Arg Gln Thr Tyr Gly 175 180 185 190 caa gtc gtg gac tgc
ctc ccg gag ttc agc cag gac acg ttc atg gtt 684 Gln Val Val Asp Cys
Leu Pro Glu Phe Ser Gln Asp Thr Phe Met Val 195 200 205 ctt gcc aat
tac atc ttc ttc aaa gcc aag tgg aag cac cct ttc agt 732 Leu Ala Asn
Tyr Ile Phe Phe Lys Ala Lys Trp Lys His Pro Phe Ser 210 215 220 cgc
tac cag acc cag aag cag gaa agt ttc ttt gtg gat gag agg act 780 Arg
Tyr Gln Thr Gln Lys Gln Glu Ser Phe Phe Val Asp Glu Arg Thr 225 230
235 tct ctc cag gtc ccc atg atg cac caa aag gaa atg cac aga ttc ctc
828 Ser Leu Gln Val Pro Met Met His Gln Lys Glu Met His Arg Phe Leu
240 245 250 tat gac cag gat ttg gct tgc acc gtc ctc cag ata gaa tac
aga gga 876 Tyr Asp Gln Asp Leu Ala Cys Thr Val Leu Gln Ile Glu Tyr
Arg Gly 255 260 265 270 aat gcc ttg gcg ctg ctg gtc ctc cct gac ccg
ggg aaa atg aag cag 924 Asn Ala Leu Ala Leu Leu Val Leu Pro Asp Pro
Gly Lys Met Lys Gln 275 280 285 gtg gag gct gct ctg cag cca cag acc
ctg aga aaa tgg ggc caa ttg 972 Val Glu Ala Ala Leu Gln Pro Gln Thr
Leu Arg Lys Trp Gly Gln Leu 290 295 300 ctc ctg ccc agt ctg ttg gat
ttg cac ttg cca agg ttt tca att tct 1020 Leu Leu Pro Ser Leu Leu
Asp Leu His Leu Pro Arg Phe Ser Ile Ser 305 310 315 gga aca tat aac
ctg gaa gac ata ctt ccc caa att ggt ctc acc aac 1068 Gly Thr Tyr
Asn Leu Glu Asp Ile Leu Pro Gln Ile Gly Leu Thr Asn 320 325 330
ata
ctc aac tta gaa gct gac ttc tca gga gtc act ggg cag ctc aac 1116
Ile Leu Asn Leu Glu Ala Asp Phe Ser Gly Val Thr Gly Gln Leu Asn 335
340 345 350 aaa acc atc tcc aag gtg tca cac aag gcg atg gtg gac atg
agt gag 1164 Lys Thr Ile Ser Lys Val Ser His Lys Ala Met Val Asp
Met Ser Glu 355 360 365 aag ggg acc gag gcc ggg gct gct tca ggc ctc
ctc tcc cag ccc cca 1212 Lys Gly Thr Glu Ala Gly Ala Ala Ser Gly
Leu Leu Ser Gln Pro Pro 370 375 380 tct ctg aac acc atg tca gac cca
cat gcc cac ttc aac agg cct ttc 1260 Ser Leu Asn Thr Met Ser Asp
Pro His Ala His Phe Asn Arg Pro Phe 385 390 395 ctc ttg ctc ctt tgg
gag gtc acc acc cag agc tta ctc ttc ctg gga 1308 Leu Leu Leu Leu
Trp Glu Val Thr Thr Gln Ser Leu Leu Phe Leu Gly 400 405 410 aaa gtt
gtc aac cca gtt gca ggg taa ccatggtggg aggccaggag 1355 Lys Val Val
Asn Pro Val Ala Gly 415 420 ttatcttatc tcatcctgga ccaaacagat
aggccagaac cagcctgcat cctggggctg 1415 ctatgtggtt cagttaatca
gtgtgccaag attctaataa agttgacctt gggttctgtg 1475 aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 1527 8 422 PRT Homo
sapiens 8 Met Gly Pro Ala Trp Leu Trp Leu Leu Gly Thr Gly Ile Leu
Ala Ser 1 5 10 15 Val His Cys Gln Pro Leu Leu Ala His Gly Asp Lys
Ser Leu Gln Gly 20 25 30 Pro Gln Pro Pro Arg His Gln Leu Ser Glu
Pro Ala Pro Ala Tyr His 35 40 45 Arg Ile Thr Pro Thr Ile Thr Asn
Phe Ala Leu Arg Leu Tyr Lys Glu 50 55 60 Leu Ala Ala Asp Ala Pro
Gly Asn Ile Phe Phe Ser Pro Val Ser Ile 65 70 75 80 Ser Thr Thr Leu
Ala Leu Leu Ser Leu Gly Ala Gln Ala Asn Thr Ser 85 90 95 Ala Leu
Ile Leu Glu Gly Leu Gly Phe Asn Leu Thr Glu Thr Pro Glu 100 105 110
Ala Asp Ile His Gln Gly Phe Arg Ser Leu Leu His Thr Leu Ala Leu 115
120 125 Pro Ser Pro Lys Leu Glu Leu Lys Val Gly Asn Ser Leu Phe Leu
Asp 130 135 140 Lys Arg Leu Lys Pro Arg Gln His Tyr Leu Asp Ser Ile
Lys Glu Leu 145 150 155 160 Tyr Gly Ala Phe Ala Phe Ser Ala Asn Phe
Thr Asp Ser Val Thr Thr 165 170 175 Gly Arg Gln Ile Asn Asp Tyr Leu
Arg Arg Gln Thr Tyr Gly Gln Val 180 185 190 Val Asp Cys Leu Pro Glu
Phe Ser Gln Asp Thr Phe Met Val Leu Ala 195 200 205 Asn Tyr Ile Phe
Phe Lys Ala Lys Trp Lys His Pro Phe Ser Arg Tyr 210 215 220 Gln Thr
Gln Lys Gln Glu Ser Phe Phe Val Asp Glu Arg Thr Ser Leu 225 230 235
240 Gln Val Pro Met Met His Gln Lys Glu Met His Arg Phe Leu Tyr Asp
245 250 255 Gln Asp Leu Ala Cys Thr Val Leu Gln Ile Glu Tyr Arg Gly
Asn Ala 260 265 270 Leu Ala Leu Leu Val Leu Pro Asp Pro Gly Lys Met
Lys Gln Val Glu 275 280 285 Ala Ala Leu Gln Pro Gln Thr Leu Arg Lys
Trp Gly Gln Leu Leu Leu 290 295 300 Pro Ser Leu Leu Asp Leu His Leu
Pro Arg Phe Ser Ile Ser Gly Thr 305 310 315 320 Tyr Asn Leu Glu Asp
Ile Leu Pro Gln Ile Gly Leu Thr Asn Ile Leu 325 330 335 Asn Leu Glu
Ala Asp Phe Ser Gly Val Thr Gly Gln Leu Asn Lys Thr 340 345 350 Ile
Ser Lys Val Ser His Lys Ala Met Val Asp Met Ser Glu Lys Gly 355 360
365 Thr Glu Ala Gly Ala Ala Ser Gly Leu Leu Ser Gln Pro Pro Ser Leu
370 375 380 Asn Thr Met Ser Asp Pro His Ala His Phe Asn Arg Pro Phe
Leu Leu 385 390 395 400 Leu Leu Trp Glu Val Thr Thr Gln Ser Leu Leu
Phe Leu Gly Lys Val 405 410 415 Val Asn Pro Val Ala Gly 420 9 1405
DNA Homo sapiens CDS (70)..(1017) 9 ggtcgaccca cgcgtccgtg
cccagccacc accgtctctc caaaaacccg aggtctcgct 60 aaaatcatc atg gat
tca ctt ggc gcc gtc agc act cga ctt ggg ttt gat 111 Met Asp Ser Leu
Gly Ala Val Ser Thr Arg Leu Gly Phe Asp 1 5 10 ctt ttc aaa gag ctg
aag aaa aca aat gat ggc aac atc ttc ttt tcc 159 Leu Phe Lys Glu Leu
Lys Lys Thr Asn Asp Gly Asn Ile Phe Phe Ser 15 20 25 30 cct gtg ggc
atc ttg act gca att ggc atg gtc ctc ctg ggg acc cga 207 Pro Val Gly
Ile Leu Thr Ala Ile Gly Met Val Leu Leu Gly Thr Arg 35 40 45 gga
gcc acc gct tcc cag ttg gag gag gtg ttt cac tct gaa aaa gag 255 Gly
Ala Thr Ala Ser Gln Leu Glu Glu Val Phe His Ser Glu Lys Glu 50 55
60 acg aag agc tca aga ata aag gct gaa gaa aaa gag gtg att gag aac
303 Thr Lys Ser Ser Arg Ile Lys Ala Glu Glu Lys Glu Val Ile Glu Asn
65 70 75 aca gaa gca gta cat caa caa ttc caa aag ttt ttg act gaa
ata agc 351 Thr Glu Ala Val His Gln Gln Phe Gln Lys Phe Leu Thr Glu
Ile Ser 80 85 90 aaa ctc act aat gat tat gaa ctg aac ata acc aac
agg ctg ttt gga 399 Lys Leu Thr Asn Asp Tyr Glu Leu Asn Ile Thr Asn
Arg Leu Phe Gly 95 100 105 110 gaa aaa aca tac ctc ttc ctt caa aaa
tac tta gat tat gtt gaa aaa 447 Glu Lys Thr Tyr Leu Phe Leu Gln Lys
Tyr Leu Asp Tyr Val Glu Lys 115 120 125 tat tat cat gca tct ctg gaa
cct gtt gat ttt gta aat gca gcc gat 495 Tyr Tyr His Ala Ser Leu Glu
Pro Val Asp Phe Val Asn Ala Ala Asp 130 135 140 gaa agt cga aag aag
att aat tcc tgg gtt gaa agc aaa aca aat gaa 543 Glu Ser Arg Lys Lys
Ile Asn Ser Trp Val Glu Ser Lys Thr Asn Glu 145 150 155 aaa atc aag
gac ttg ttc cca gat ggc tct att agt agc tct acc aag 591 Lys Ile Lys
Asp Leu Phe Pro Asp Gly Ser Ile Ser Ser Ser Thr Lys 160 165 170 ctg
gtg ctg gtg aac atg gtt tat ttt aaa ggg caa tgg gac agt tac 639 Leu
Val Leu Val Asn Met Val Tyr Phe Lys Gly Gln Trp Asp Ser Tyr 175 180
185 190 gat cta gag gcg gtc ctg gct gcc atg ggg atg ggc gat gcc ttc
agt 687 Asp Leu Glu Ala Val Leu Ala Ala Met Gly Met Gly Asp Ala Phe
Ser 195 200 205 gag cac aaa gcc gac tac tcg gga atg tcg tca ggc tcc
ggg ttg tac 735 Glu His Lys Ala Asp Tyr Ser Gly Met Ser Ser Gly Ser
Gly Leu Tyr 210 215 220 gcc cag aag ttc ctg cac agt tcc ttt gtg gca
gta act gag gaa ggc 783 Ala Gln Lys Phe Leu His Ser Ser Phe Val Ala
Val Thr Glu Glu Gly 225 230 235 acc gag gct gca gct gcc act ggc ata
ggc ttt act gtc aca tcc gcc 831 Thr Glu Ala Ala Ala Ala Thr Gly Ile
Gly Phe Thr Val Thr Ser Ala 240 245 250 cca ggt cat gaa aat gtt cac
tgc aat cat ccc ttc ctg ttc ttc atc 879 Pro Gly His Glu Asn Val His
Cys Asn His Pro Phe Leu Phe Phe Ile 255 260 265 270 agg aac cat gca
tcc cca aaa cca agg agc cct gcc acc cca agg tgc 927 Arg Asn His Ala
Ser Pro Lys Pro Arg Ser Pro Ala Thr Pro Arg Cys 275 280 285 ctg agc
cct gcc acc cca aag tgc ctg agc cct gcc agc cca agg ttc 975 Leu Ser
Pro Ala Thr Pro Lys Cys Leu Ser Pro Ala Ser Pro Arg Phe 290 295 300
cag agc cat gcc acc cca agg tgc ctg agc cct gcc ctt caa 1017 Gln
Ser His Ala Thr Pro Arg Cys Leu Ser Pro Ala Leu Gln 305 310 315
tagtcactcc agcaccagcc cagcagaaga ccaagcagaa gtaatgtggt ccacagccat
1077 gcccttgagg agccggccac cagatgctga atcccctatc ccattctgtg
tatgaggtcc 1137 catttgccct tgcaattggc attctgtctc ccccaaaaaa
gaatgtgcta tgaagctttc 1197 tttcctacac actctgagtc tctgaatgaa
gctgaaggtc ttagtaccca gagctagttt 1257 tcagctgctc agaattcatc
tgaagagaga cttaagatga aagcaaatga ttcagctccc 1317 ttataccccc
attaaattca ctttcaattc caaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1377
aaaaaaaaaa aaaaaaaaaa aaaaaaaa 1405 10 316 PRT Homo sapiens 10 Met
Asp Ser Leu Gly Ala Val Ser Thr Arg Leu Gly Phe Asp Leu Phe 1 5 10
15 Lys Glu Leu Lys Lys Thr Asn Asp Gly Asn Ile Phe Phe Ser Pro Val
20 25 30 Gly Ile Leu Thr Ala Ile Gly Met Val Leu Leu Gly Thr Arg
Gly Ala 35 40 45 Thr Ala Ser Gln Leu Glu Glu Val Phe His Ser Glu
Lys Glu Thr Lys 50 55 60 Ser Ser Arg Ile Lys Ala Glu Glu Lys Glu
Val Ile Glu Asn Thr Glu 65 70 75 80 Ala Val His Gln Gln Phe Gln Lys
Phe Leu Thr Glu Ile Ser Lys Leu 85 90 95 Thr Asn Asp Tyr Glu Leu
Asn Ile Thr Asn Arg Leu Phe Gly Glu Lys 100 105 110 Thr Tyr Leu Phe
Leu Gln Lys Tyr Leu Asp Tyr Val Glu Lys Tyr Tyr 115 120 125 His Ala
Ser Leu Glu Pro Val Asp Phe Val Asn Ala Ala Asp Glu Ser 130 135 140
Arg Lys Lys Ile Asn Ser Trp Val Glu Ser Lys Thr Asn Glu Lys Ile 145
150 155 160 Lys Asp Leu Phe Pro Asp Gly Ser Ile Ser Ser Ser Thr Lys
Leu Val 165 170 175 Leu Val Asn Met Val Tyr Phe Lys Gly Gln Trp Asp
Ser Tyr Asp Leu 180 185 190 Glu Ala Val Leu Ala Ala Met Gly Met Gly
Asp Ala Phe Ser Glu His 195 200 205 Lys Ala Asp Tyr Ser Gly Met Ser
Ser Gly Ser Gly Leu Tyr Ala Gln 210 215 220 Lys Phe Leu His Ser Ser
Phe Val Ala Val Thr Glu Glu Gly Thr Glu 225 230 235 240 Ala Ala Ala
Ala Thr Gly Ile Gly Phe Thr Val Thr Ser Ala Pro Gly 245 250 255 His
Glu Asn Val His Cys Asn His Pro Phe Leu Phe Phe Ile Arg Asn 260 265
270 His Ala Ser Pro Lys Pro Arg Ser Pro Ala Thr Pro Arg Cys Leu Ser
275 280 285 Pro Ala Thr Pro Lys Cys Leu Ser Pro Ala Ser Pro Arg Phe
Gln Ser 290 295 300 His Ala Thr Pro Arg Cys Leu Ser Pro Ala Leu Gln
305 310 315 11 478 DNA Homo sapiens CDS (19)..(249) 11 cccacgcgtc
cgggcaac atg ggg tcc agc agc ttc ttg gtc ctc atg gtg 51 Met Gly Ser
Ser Ser Phe Leu Val Leu Met Val 1 5 10 tct ctc gtt ctt gtg acc ctg
gtg gct gtg gaa gga gtt aaa gag ggt 99 Ser Leu Val Leu Val Thr Leu
Val Ala Val Glu Gly Val Lys Glu Gly 15 20 25 ata gag aaa gca ggg
gtt tgc cca gct gac aac gta cgc tgc ttc aag 147 Ile Glu Lys Ala Gly
Val Cys Pro Ala Asp Asn Val Arg Cys Phe Lys 30 35 40 tcc gat cct
ccc cag tgt cac aca gac cag gac tgt ctg ggg gaa agg 195 Ser Asp Pro
Pro Gln Cys His Thr Asp Gln Asp Cys Leu Gly Glu Arg 45 50 55 aag
tgt tgt tac ctg cac tgt ggc ttc aag tgt gtg att cct gtg aag 243 Lys
Cys Cys Tyr Leu His Cys Gly Phe Lys Cys Val Ile Pro Val Lys 60 65
70 75 aac tga agaaggagga aacaaggatg aagatgtgtc aaggccatac
cctgagccag 299 Asn gatgggaagg ccaagtgtcc aggctcctcc tctacaccag
gtgtcctcag aaatgatgct 359 gggtcctttc tacctctggg ggtcatctca
cttggcacct gcccctgagg tcctgagact 419 tggaatatgg aagaagcaat
acccaacccc accaaagaaa acctgagctg aagtccttt 478 12 76 PRT Homo
sapiens 12 Met Gly Ser Ser Ser Phe Leu Val Leu Met Val Ser Leu Val
Leu Val 1 5 10 15 Thr Leu Val Ala Val Glu Gly Val Lys Glu Gly Ile
Glu Lys Ala Gly 20 25 30 Val Cys Pro Ala Asp Asn Val Arg Cys Phe
Lys Ser Asp Pro Pro Gln 35 40 45 Cys His Thr Asp Gln Asp Cys Leu
Gly Glu Arg Lys Cys Cys Tyr Leu 50 55 60 His Cys Gly Phe Lys Cys
Val Ile Pro Val Lys Asn 65 70 75 13 733 DNA Homo sapiens 13
gggatccgga gcccaaatct tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg
60 aattcgaggg tgcaccgtca gtcttcctct tccccccaaa acccaaggac
accctcatga 120 tctcccggac tcctgaggtc acatgcgtgg tggtggacgt
aagccacgaa gaccctgagg 180 tcaagttcaa ctggtacgtg gacggcgtgg
aggtgcataa tgccaagaca aagccgcggg 240 aggagcagta caacagcacg
taccgtgtgg tcagcgtcct caccgtcctg caccaggact 300 ggctgaatgg
caaggagtac aagtgcaagg tctccaacaa agccctccca acccccatcg 360
agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac accctgcccc
420 catcccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc
aaaggcttct 480 atccaagcga catcgccgtg gagtgggaga gcaatgggca
gccggagaac aactacaaga 540 ccacgcctcc cgtgctggac tccgacggct
ccttcttcct ctacagcaag ctcaccgtgg 600 acaagagcag gtggcagcag
gggaacgtct tctcatgctc cgtgatgcat gaggctctgc 660 acaaccacta
cacgcagaag agcctctccc tgtctccggg taaatgagtg cgacggccgc 720
gactctagag gat 733
* * * * *