U.S. patent application number 11/020560 was filed with the patent office on 2006-06-29 for methods and compositions concerning sirna's as mediators of rna interference.
This patent application is currently assigned to Ambion, Inc.. Invention is credited to Lance P. Ford, Joseph Krebs.
Application Number | 20060142228 11/020560 |
Document ID | / |
Family ID | 36612533 |
Filed Date | 2006-06-29 |
United States Patent
Application |
20060142228 |
Kind Code |
A1 |
Ford; Lance P. ; et
al. |
June 29, 2006 |
Methods and compositions concerning siRNA's as mediators of RNA
interference
Abstract
The present invention concerns an isolated siRNA of from about 5
to about 20 nucleotides that mediates RNA interference. Also
disclosed are methods of reducing expression of a target gene in a
cell comprising obtaining at least one siRNA of 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 basepairs in length; and
delivering the siRNA into the cell. The siRNAs can be chemically
synthesized RNA or an analog of a naturally occurring RNA.
Inventors: |
Ford; Lance P.; (Austin,
TX) ; Krebs; Joseph; (Austin, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI L.L.P.
600 CONGRESS AVE.
SUITE 2400
AUSTIN
TX
78701
US
|
Assignee: |
Ambion, Inc.
|
Family ID: |
36612533 |
Appl. No.: |
11/020560 |
Filed: |
December 23, 2004 |
Current U.S.
Class: |
514/44A ;
435/6.11; 536/23.1 |
Current CPC
Class: |
C12N 15/111 20130101;
C12Y 502/01008 20130101; C12N 2310/14 20130101; C12N 2330/30
20130101; C12N 15/1137 20130101; C12Y 102/01012 20130101 |
Class at
Publication: |
514/044 ;
435/006; 536/023.1 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12Q 1/68 20060101 C12Q001/68; C07H 21/02 20060101
C07H021/02 |
Claims
1. An isolated RNA of from about 5 to about 20 nucleotides that
mediates RNA interference of a target mRNA.
2. The isolated RNA of claim 1 further comprising a terminal 3'
hydroxyl group.
3. The isolated RNA of claim 1 which is chemically synthesized RNA
or an analog of a naturally occurring RNA.
4. The isolated RNA of claim 1, wherein the RNA is from about 12 to
about 18 nucleotides in length.
5. The isolated RNA of claim 1, wherein the RNA is from about 14 to
about 16 nucleotides in length.
6. The isolated RNA of claim 1, wherein the RNA is 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 nucleotides in
length.
7. The isolated RNA of claim 1, wherein the RNA is an siRNA.
8. The isolated RNA of claim 1, wherein the RNA is a
single-stranded.
9. The isolated RNA of claim 1, wherein the RNA is a
double-stranded.
10. The isolated RNA of claim 9, wherein the 3' ends of the double
stranded RNA comprises a 2, 3, 4, or 5 nucleotide overhang.
11. The isolated RNA of claim 10, wherein the nucleotide overhang
is a 2 nucleotide overhang.
12. The isolated RNA of claim 11, wherein the 2 nucleotides are
thymine.
13. The isolated RNA of claim 9, wherein the 5' ends of the double
stranded RNA comprises a 2, 3, 4, or 5 nucleotide overhang.
14. The isolated RNA of claim 13, wherein the nucleotide overhang
is a 2 nucleotide overhang.
15. The isolated RNA of claim 14, wherein the 2 nucleotides are
thymine.
16. The isolated RNA of claim 1, wherein the RNA is formulated into
a pharmaceutically acceptable composition.
17. The isolated RNA of claim 1, wherein the RNA associates with a
protein complex.
18. The isolated RNA of claim 17, wherein the protein complex is
RNA-induced silencing complex (RISC).
19. The isolated RNA of claim 1, wherein the isolated RNA comprises
a nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ
ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13; SEQ ID NO: 14, SEQ ID
NO: 15, SEQ ID NO: 16, SEQ ID NO: 17; SEQ ID NO: 18, SEQ ID NO: 19,
SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID
NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28,
SEQ ID NO: 29, SEQ ID NO: 30; SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID
NO: 33, SEQ ID NO: 34, SEQ ID NO 35, SEQ ID NO: 36; SEQ ID NO: 37,
SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID
NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46,
SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID
NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54.
20. A method of reducing expression of a target gene in a cell
comprising: a) obtaining at least one siRNA of 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length;
and b) delivering the siRNA into the cell.
21. The method of claim 20, wherein the siRNA is 10, 11, 12, 13,
14, 15, 16, or 17 nucleotides in length.
22. The method of claim 21, wherein the siRNA is 12, 13, 14, or 15
nucleotides in length.
23. The method of claim 20, wherein the siRNA is chemically
synthesized siRNA or an analog of a naturally occurring siRNA.
24. The method of claim 20, further comprising isolating the siRNA
prior to delivery.
25. The method of claim 20, further comprising obtaining at least
two siRNAs and delivering them into the cell.
26. The method of claim 20, further comprising obtaining a pool of
siRNAs and delivering the pool into the cell.
27. The method of claim 20, wherein the cell is comprised in an
organism.
28. The method of claim 20, wherein the cell is a human cell.
29. The method of claim 20, wherein multiple siRNA molecules are
delivered into the cell.
30. The method of claim 20, wherein the siRNA comprises a terminal
3' hydroxyl group.
31. The method of claim 20, wherein the siRNA is
double-stranded.
32. The method of claim 31, wherein the 3' ends of the double
stranded siRNA comprise a 2, 3, 4, or 5 nucleotide overhang.
33. The method claim 32, wherein the nucleotide overhang is a 2
nucleotide overhang.
34. The method of claim 33, wherein the 2 nucleotides are
thymine.
35. The method of claim 31, wherein the 5' ends of the double
stranded siRNA comprise a 2, 3, 4, or 5 nucleotide overhang.
36. The method of claim 35, wherein the nucleotide overhang is a 2
nucleotide overhang.
37. The method of claim 36, wherein the two nucleotides are
thymine.
38. The method of claim 20, wherein the siRNA is formulated into a
pharmaceutically acceptable composition.
39. The method of claim 20, wherein the siRNA associates with a
protein complex.
40. The method of claim 39, wherein the protein complex is
RNA-induced silencing complex (RISC).
41. The method of claim 20, wherein the siRNA comprises a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ
ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13; SEQ ID NO: 14, SEQ ID
NO: 15, SEQ ID NO: 16, SEQ ID NO: 17; SEQ ID NO: 18, SEQ ID NO: 19,
SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID
NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28,
SEQ ID NO: 29, SEQ ID NO: 30; SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID
NO: 33, SEQ ID NO: 34, SEQ ID NO 35, SEQ ID NO: 36; SEQ ID NO: 37,
SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID
NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46,
SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID
NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention relates generally to the field of
molecular and cellular biology and has possible application for
therapeutics. More particularly, it concerns the use of small
interfering RNA's ("siRNA") as mediators of RNA interference
("RNAi").
[0003] 2. Description of the Related Art
[0004] RNA interference, originally discovered in Caenorhabditis
elegans by Fire and Mello (Fire et al., 1998), is a phenomenon in
which double stranded RNA (dsRNA) reduces the expression of the
gene to which the dsRNA corresponds. The phenomenon of RNAi was
subsequently proven to exist in many organisms and to be a
naturally occurring cellular process. The RNAi pathway can be used
by the organism to inhibit viral infections, transposon jumping and
to regulate the expression of endogenous genes (Huntvagner et al.,
2001; Tuschl, 2001; Waterhouse et al., 2001; Zamore 2001). In
original studies, researchers were inducing RNAi in non-mammalian
systems and were using long double stranded RNAs. However, most
mammalian cells have a potent antiviral response causing global
changes in gene expression patterns in response to long dsRNA thus
arousing questions as to the existence of RNAi in humans. As more
information about the mechanistic aspects of RNAi was gathered,
RNAi in mammalian cells was shown to also exist.
[0005] In an in vitro system derived from Drosophila embryos, long
dsRNAs are processed into shorter siRNA's by a cellular
ribonuclease containing RNaseIII motifs (Bernstein et al., 2001;
Grishok et al., 2001; Hamilton and Baulcombe, 1999; Knight and
Bass, 2001; Zamore et al., 2000). Genetics studies done in C.
elegans, N. crassa and A. thaliana have lead to the identification
of additional components of the RNAi pathway. These genes include
putative nucleases (Ketting et al., 1999), RNA-dependent RNA
polymerases (Cogoni and Macino, 1999a; Dalmay et al., 2000;
Mourrain et al., 2000; Smardon et al., 2000) and helicases (Cogoni
and Macino, 1999b; Dalmay et al., 2001; Wu-Scharf et al., 2000).
Several of these genes found in these functional screens are
involved not only in RNAi but also in nonsense mediated mRNA decay,
protection against transposon-transposition (Zamore, 2001), viral
infection (Waterhouse et al., 2001), and embryonic development
(Hutvagner et al., 2001; Knight and Bass, 2001). In general, it is
thought that once the siRNAs are generated from longer dsRNAs in
the cell by the RNaseIII like enzyme, the siRNA associate with a
protein complex. The protein complex also called RNA-induced
silencing complex (RISC), then guides the smaller 21 base double
stranded siRNA to the mRNA where the two strands of the double
stranded RNA separate, the antisense strand associates with the
mRNA and a nuclease cleaves the mRNA at the site where the
antisense strand of the siRNA binds (Hammond et al., 2001). The
mRNA is then subsequently degraded by cellular nucleases.
[0006] Based upon some of the information mentioned above, Elbashir
et al. (2001) discovered a method to bypass the anti viral response
and induce gene specific silencing in mammalian cells. Several 21
nucleotide dsRNAs with 2 nucleotide 3' overhangs were transfected
into mammalian cells without inducing a potent antiviral response.
Their have been a few papers demonstrating that the siRNA can
induce expression of some of the antiviral response genes at higher
siRNA concentrations (Ford and Latham (2003)) The small dsRNA
molecules (also referred to as "siRNA") were capable of inducing
the specific suppression of target genes. In one set of
experiments, siRNAs complementary to the luciferase gene were
co-transfected with a luciferase reporter plasmid into NIH3T3,
COS-7, HeLaS3, and 293 cells. In all cases, the siRNAs were able to
specifically reduce luciferase gene expression. In addition, the
authors demonstrated that siRNAs could reduce the expression of
several endogenous genes in human cells. The endogenous targets
were lamin A/C, lamin B1, nuclear mitotic apparatus protein, and
vimentin. The use of siRNAs to modulate gene expression has now
been reproduced by at least two other labs (Caplen et al., 2001;
Hutvagner et al., 2001) and has been shown to exist in more that 10
different organisms spanning a large spectrum of the evolutionary
tree.
[0007] The making of siRNAs has been through direct chemical
synthesis, through processing of longer double stranded RNAs
exposure to Drosophila embryo lysates, through an in vitro system
derived from S2 cells, using page polymerase promoters,
RNA-dependant RNA polymeras, and DNA based vectors. Use of cell
lysates or in vitro processing may further involve the subsequent
isolation of the short, 21-23 nucleotide siRNAs from the lysate,
etc., making the process somewhat cumbersome and expensive.
Chemical synthesis proceeds by making two single stranded
RNA-oligomers followed by the annealing of the two single stranded
oligomers into a double stranded RNA.
[0008] WO 99/32619 and WO 01/68836 suggest that RNA for use in
siRNA may be chemically or enzymatically synthesized. The enzymatic
synthesis contemplated is by a cellular RNA polymerase or a
bacteriophage RNA polymerase (e.g., T3, T7, SP6) via the use and
production of an expression construct as is known in the art. For
example, see U.S. Pat. No. 5,795,715. The contemplated constructs
provide templates that produce RNAs that contain nucleotide
sequences identical to a portion of the target gene. The length of
identical sequences provided by these references is at least 25
bases, and may be as many as 400 or more bases in length. An
important aspect of this reference is that the authors contemplate
digesting longer dsRNAs to 21-25mer lengths with the endogenous
nuclease complex that converts long dsRNAs to siRNAs in vivo. They
do not describe or present data for synthesizing and using in vitro
transcribed 21-25mer dsRNAs. No distinction is made between the
expected properties of chemical or enzymatically synthesized dsRNA
in its use in RNA interference.
[0009] Similarly, WO 00/44914 suggests that single strands of RNA
can be produced enzymatically or by partial/total organic
synthesis. Preferably, single stranded RNA is enzymatically
synthesized from the PCR products of a DNA template, preferably a
cloned cDNA template and the RNA product is a complete transcript
of the cDNA, which may comprise hundreds of nucleotides. WO
01/36646 places no limitation upon the manner in which the siRNA is
synthesized, providing that the RNA may be synthesized in vitro or
in vivo, using manual and/or automated procedures. This reference
also provides that in vitro synthesis may be chemical or enzymatic,
for example using cloned RNA polymerase (e.g., T3, T7, SP6) for
transcription of the endogenous DNA (or cDNA) template, or a
mixture of both. Again, no distinction in the desirable properties
for use in RNA interference is made between chemically or
enzymatically synthesized siRNA.
[0010] U.S. Pat. No. 5,795,715 reports the simultaneous
transcription of two complementary DNA sequence strands in a single
reaction mixture, wherein the two transcripts are immediately
hybridized. The templates used are preferably of between 40 and 100
base pairs, and which is equipped at each end with a promoter
sequence. The templates are preferably attached to a solid surface.
After transcription with RNA polymerase, the resulting dsRNA
fragments may be used for detecting and/or assaying nucleic acid
target sequences. U.S. Pat. No. 5,795,715 was filed Jun. 17, 1994,
well before the phenomenon of RNA interference was described by
Fire, et al. (1998). The production of siRNA was therefore, not
contemplated by these authors.
[0011] In the provisional patent 60/353,332, which is specifically
incorporated by reference, the production of siRNA using the RNA
dependent RNA polymerase, P2 and that this dsRNA can be used to
induce gene silencing. Although this method is not commercially
available or published in a scientific journal it was determined to
be feasible. Several laboratories have demonstrated that DNA
expression vectors containing mammalian RNA polymerase III
promoters can drive the expression of siRNA that can induce
gene-silencing (Brummelkamp et al., 2002; Sui et al., 2002; Lee et
al., 2002; Yu et al., 2002; Miyagishi et al., 2002; Paul et al.,
2002). The RNA produced from the polymerase III promoter can be
designed such that it forms a predicted hairpin with a 19-base stem
and a 3-8 base loop. The approximately 45 base long siRNA expressed
as a single transcription unit folds back on it self to form the
hairpin structure as described above. Hairpin RNA can enter the
RNAi pathway and induce gene silencing. The siRNA mammalian
expression vectors have also been used to express the sense and
antisense strands of the siRNA under separate polymerase III
promoters. In this case, the sense and antisense strands must
hybridize in the cell following their transcription (Lee et al.,
2002; Miyagishi et al., 2002). The siRNA produced from the
mammalian expression vectors weather a hairpin or as separate sense
and antisense strands were able to induce RNAi without inducing the
antiviral response. More recent work described the use of the
mammalian expression vectors to express siRNA that inhibit viral
infection (Jacque et al., 2002; Lee et al., 2002; Novina et al.,
2002). A single point mutation in the siRNA with respect to the
target prevents the inhibition of viral infection that is observed
with the wild type siRNA. This suggests that siRNA mammalian
expression vectors and siRNA could be used to treat viral
diseases.
[0012] An alternative enzymatic approach to siRNA production that
elevates the need to perform screens for siRNA that are functional.
Currently, a 4 or more siRNA to one target need to be designed to a
single target. A siRNA synthesis method that would get around
transfecting 4 or more separate siRNA per target would be
beneficial in cost and time. Therefore, a method in which a mixture
of siRNA can be made from a single reaction would increase the
likely hood of knocking down the gene the first time it is
performed. In order to generate this mixture of siRNA one approach
would be using RNaseIII type nucleases. Recombinant bacterial
RNaseIII (25.6 KDa) is one such nuclease that can cleave long dsRNA
into short dsRNAs containing a 5'-PO.sub.4 and a 2 nucleotide 3'
overhang. Although the RNA cleaved by bacterial RNaseIII are
generally smaller (12-15 bases in length) it leaves a 5'PO4 and a
2-nucleotide 3' overhang which is the same structure found on the
RNA produced by DICER. A second approach would be to produce a
mixture of siRNA and transfecting in the mixture of siRNA into the
same reaction. The siRNA can be generated using a number of
approaches currently methods for siRNA production-include chemical
synthesis, in vitro synthesis using phase polymerase promters, RNA
dependant RNA polymerase or DNA vector based approaches.
[0013] Dicer is a eukaryotic protein that cleaves double-stranded
RNA into 21-25 siRNA (Bernstein et al., 2001; Elbashir et al.,
2001). The use of Dicer for in vitro generation of siRNA is
problematic, however, because the reaction can be inefficient
(Bernstein et al., 2001) and it is difficult to purify for in vitro
application.
SUMMARY OF THE INVENTION
[0014] The present invention is based on the inventors' discovery
that small interfering RNA's ("siRNA") can act as mediators of RNA
interference ("RNAi").
[0015] In some embodiments, the invention concerns an siRNA that is
capable of triggering RNA interference, a process by which a
particular RNA sequence is destroyed. siRNA are dsRNA molecules
that are 100 bases or fewer in length (or have 100 basepairs or
fewer in its complementarity region). In some cases, it has a 2
nucleotide 3' overhang and a 5' phosphate. The particular RNA
sequence is targeted as a result of the complementarity between the
dsRNA and the particular RNA sequence. It will be understood that
dsRNA or siRNA of the invention can effect at least a 20, 30, 40,
50, 60, 70, 80, 90 percent or more reduction of expression of a
targeted RNA in a cell. dsRNA of the invention (the term "dsRNA"
will be understood to include "siRNA") is distinct and
distinguishable from antisense and ribozyme molecules by virtue of
the ability to trigger RNAi. Structurally, dsRNA molecules for RNAi
differ from antisense and ribozyme molecules in that dsRNA has at
least one region of complementarity within the RNA molecule.
[0016] It is contemplated that a dsRNA may be a molecule comprising
two separate RNA strands in which one strand has at least one
region complementary to a region on the other strand.
Alternatively, a dsRNA includes a molecule that is single stranded
yet has at least one complementarity region as described above (see
Sui et al., 2002 and Brummelkamp et al., 2002 in which a single
strand with a hairpin loop is used as a dsRNA for RNAi). For
convenience, lengths of dsRNA may be referred to in terms of bases,
which simply refers to the length of a single strand or in terms of
basepairs, which refers to the length of the complementarity
region. It is specifically contemplated that embodiments discussed
herein with respect to a dsRNA comprised of two strands are
contemplated for use with respect to a dsRNA comprising a single
strand, and vice versa. In a two-stranded dsRNA molecule, the
strand that has a sequence that is complementary to the targeted
mRNA is referred to as the "antisense strand" and the strand with a
sequence identical to the targeted mRNA is referred to as the
"sense strand." Similarly, with a dsRNA comprising only a single
strand, it is contemplated that the "antisense region" has the
sequence complementary to the targeted mRNA, while the "sense
region" has the sequence identical to the targeted mRNA.
Furthermore, it will be understood that sense and antisense region,
like sense and antisense strands, are complementary (i.e., can
specifically hybridize) to each other.
[0017] Strands or regions that are complementary may or may not be
100% complementary ("completely or fully complementary"). It is
contemplated that sequences that are "complementary" include
sequences that are at least 50% complementary, and may be at least
50%, 60%, 70%, 80%, or 90% complementary. In the range of 50% to
70% complementarity, such sequences may be referred to as "very
complementary," while the range of greater than 70% to less than
complete complementarity can be referred to as "highly
complementary." Unless otherwise specified, sequences that are
"complementary" include sequences that are "very complementary,"
"highly complementary," and "fully complementary." It is also
contemplated that any embodiment discussed herein with respect to
"complementary" strands or region can be employed with specifically
"fully complementary," "highly complementary," and/or "very
complementary" strands or regions, and vice versa. Thus, it is
contemplated that in some instances that siRNA generated from
sequence based on one organism may be used in a different organism
to achieve RNAi of the cognate target gene. In other words, siRNA
generated from a dsRNA that corresponds to a human gene may be used
in a mouse cell if there is the requisite complementarity, as
described above. Ultimately, the requisite threshold level of
complementarity to achieve RNAi is dictated by functional
capability.
[0018] It is specifically contemplated that there may be mismatches
in the complementary strands or regions. Mismatches may number at
most or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25 residues or more, depending
on the length of the complentarity region.
[0019] In some embodiments, the strand or strands of dsRNA are 100
bases (or basepairs) or less, in which case they may also be
referred to as "siRNA." In specific embodiments the strand or
strands of the dsRNA are less than 70 bases in length. With respect
to those embodiments, the dsRNA strand or strands may be from 5-70,
10-65, 20-60, 30-55, 40-50 bases or basepairs in length. In certain
aspects, the strands are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20 base pairs in length. A dsRNA that has a
complementarity region equal to or less than 30 basepairs (such as
a single stranded hairpin RNA in which the stem or complementary
portion is less than or equal to 30 basepairs) or one in which the
strands are 30 bases or fewer in length is specifically
contemplated, as such molecules begin to evade a mammalian's cell
antiviral response. Thus, a hairpin dsRNA (one strand) may be 70 or
fewer bases in length with a complementary region of 30 basepairs
or fewer. In some cases, a dsRNA may be processed in the cell into
siRNA.
[0020] Furthermore, it is contemplated that siRNA or the longer
dsRNA template may be labeled. The label may be fluorescent,
radioactive, enzymatic, or calorimetric. When two or more
differentially colored labels are employed, fluorescent resonance
energy transfer (FRET) techniques may be employed to characterize
the dsRNA. Labels contemplated for use in several embodiments are
non-radioactive. In many embodiments of the invention, the labels
are fluorescent, though they may be enzymatic, radioactive, or
positron emitters.
[0021] In some embodiments of the invention, a dsRNA has one or
more non-natural nucleotides, such as a modified residue or a
derivative or analog of a natural nucleotide. Any modified residue,
derivative or analog may be used to the extent that it does not
eliminate or substantially reduce (by at least 50%) RNAi activity
of the dsRNA.
[0022] A person of ordinary skill in the art is well aware of
achieving hybridization of complementary regions or molecules. Such
methods typically involve heat and slow cooling of temperature
during incubation.
[0023] Any cell that undergoes RNAi can be employed in methods of
the invention. The cell may be a eukaryotic cell, mammalian cell
such as a primate, rodent, rabbit, or human cell, a prokaryotic
cell, or a plant cell. In some embodiments, the cell is alive,
while in others the cell or cells is in an organism or tissue.
Alternatively, the cell may be dead. The dead cell may also be
fixed. In some cases, the cell is attached to a solid, non-reactive
support such as a plate or petri dish. Such cells may be used for
array analysis. It is contemplated that cells may be grown on an
array and dsRNA administered to the cells.
[0024] In some methods of the invention, siRNA molecules or
template nucleic acids may be isolated or purified prior to their
being used in a subsequent step. SiRNA molecules may be isolated or
purified prior to transfection into a cell. A template nucleic acid
or amplification primer may be isolated or purified prior to it
being transcribed or amplified. Isolation or purification can be
performed by a number of methods known to those of skill in the art
with respect to nucleic acids. In some embodiments, a gel, such as
an agarose or acrylamide gel, is employed to isolate the siRNA.
[0025] Methods for generating siRNA to more than one target gene
are considered part of the invention. Thus, siRNA or candidate
siRNA directed to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more target
genes may be generated and implemented in methods of the invention.
An array can be created with pools of siRNA to multiple targets may
be used as part of the invention.
[0026] In particular aspects of the present invention, there is
disclosed an isolated RNA of from about 5 to about 20 nucleotides
that mediates RNA interference of a target mRNA. In other
non-limiting aspects, the isolated RNA can inactivate a
corresponding gene by transcriptional silencing. In certain
embodiments, the isolated RNA can be 5, 6, 7, 8, 9, 20, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleotides
in length. The isolated RNA can further comprise a terminal 3'
hydroxyl group or a 5' phosphate group, or both. The isolated RNA
can be an siRNA. The siRNA can be a single or double stranded RNA.
In particular aspects, the 3' or 5' or both ends of the double
stranded RNA comprises a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17 or more nucleotide overhang. In certain embodiments,
the nucleotide overhang is a 2 nucleotide overhang. The nucleotide
overhang can include any combination of a thymine, uracil, adenine,
guanine, or cytosine, or derivatives or analogues thereof. The
nucleotide overhang in certain aspects is a 2 nucleotide overhang,
where both nucleotides are thymine.
[0027] The isolated RNA can be made by any of the methods discussed
throughout the specification. In particular embodiments the
isolated RNA is chemically synthesized or is an analog of a
naturally occurring RNA. In other embodiments, the isolated RNA is
formulated into a pharmaceutically acceptable composition.
[0028] The isolated RNA can also associate with a protein complex.
In certain aspects, the isolated RNA is associated with or bound to
a protein complex. In non-limiting embodiments, the protein complex
is RNA-induced silencing complex (RISC).
[0029] In more particular aspects, the isolated RNA comprises a
nucleotide sequence selected from the group consisting of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ
ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13; SEQ ID NO: 14, SEQ ID
NO: 15, SEQ ID NO: 16, SEQ ID NO: 17; SEQ ID NO: 18, SEQ ID NO: 19,
SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID
NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28,
SEQ ID NO: 29, SEQ ID NO: 30; SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID
NO: 33, SEQ ID NO: 34, SEQ ID NO 35, SEQ ID NO: 36; SEQ ID NO: 37,
SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID
NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46,
SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID
NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54.
[0030] The inventors also contemplate analogs of the isolated RNAs
described throughout the specification. The analog can differ from
the isolated RNA by the addition, deletion, substitution or
alteration of one or more nucleotides. Non-limiting examples of the
different types of nucleotides that can be use with the present
invention are described throughout the specification.
[0031] In yet another embodiment of the present invention there is
provided a method of reducing expression of a target gene in a cell
comprising obtaining at least one siRNA of 5-100 or more
nucleotides in length and delivering the siRNA into the cell. The
siRNA can be from about 10 to about 90, 20, to about 80, 30 to
about 70, 40 to about 60, to about 50 nucleotides in length. In
specific aspects, the siRNA is from about 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19 to about 20 nucleotides in
length. Delivery of the siRNA into a cell can be performed by any
numerous ways that are known to a person of ordinary skill in the
art and that are described throughout this specification. There are
certain embodiments where at least two siRNAs are obtained and are
subsequently delivered into the cell. Other aspects include
obtaining a pool of siRNAs and delivering the pool into the cell.
As noted above and throughout the specification, the siRNAs of the
present invention can be made by many methods. In particular
aspects, the siRNAs are chemically synthesized or are an analog of
a naturally occurring siRNA. There are certain instances of the
invention where the siRNA is isolated prior to its delivery into
the cell. Isolating and purifying siRNAs are known in the art and
are described throughout the specification. Isolating the siRNA can
be done prior to or after delivery into the cell. In non-limiting
embodiments, the cell can be comprised in an organism. The
organism, in non-limiting examples, can be a human, dog, rat,
mouse, pig, rabbit, or cow. The cell can be a human or non-human
cell. In certain aspects, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more siRNA
molecules are delivered into the cell. The siRNAs can be the same
or different siRNAs with different target mRNAs.
[0032] In still another aspect of the present invention, there is
provided a method of mediating RNA interference of mRNA of a gene
in a cell or organism comprising (a) introducing RNA of from about
5 to about 20 nucleotides which targets the mRNA of the gene for
degradation into the cell or organism and maintaining the cell or
organism produced in (a) under conditions under which degradation
of the mRNA occurs, thereby mediating RNA interference of the mRNA
of the gene in the cell or organism. The RNA can be a chemically
synthesized RNA or an analog of naturally occurring RNA. The RNA
can be an siRNA that is from about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20, or more nucleotides in length.
The gene can be any number of genes that are described throughout
the specification and that are known to a person of ordinary skill
in the art. In certain embodiments, the gene encodes a cellular
mRNA or a viral mRNA.
[0033] Another embodiment includes a method of mediating RNA
interference of mRNA of a gene in a cell or organism in which RNA
interference occurs, comprising introducing into the cell or
organism RNA of from about 5 to about 20 nucleotides that mediates
RNA interference of mRNA of the gene, thereby producing a cell or
organism that contains the RNA; and maintaining the cell or
organism that contains the RNA under conditions under which RNA
interference occurs, thereby mediating RNA interference of mRNA of
the gene in the cell or organism. As discussed throughout, in
non-limiting examples, the RNA can be an siRNA that is from about
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20,
or more nucleotides in length. The siRNA can be chemically
synthesized or an analog of RNA that mediates RNA interference.
[0034] In certain aspects, the inventors contemplate a knockdown
cell or organism generated by any one of the methods disclosed
throughout this specification. The knockdown cell or organism can
mimic a disease state.
[0035] There is also disclosed a method of examining the function
of a gene in a cell or organism comprising (a) introducing RNA of
from about 5 to about 20 nucleotides that targets mRNA of the gene
for degradation into the cell or organism, thereby producing a test
cell or test organism; (b) maintaining the test cell or test
organism under conditions under which degradation of mRNA of the
gene occurs, thereby producing a test cell or test organism in
which mRNA of the gene is degraded; and (c) observing the phenotype
of the test cell or test organism produced in (b). In non-limiting
examples, the RNA can be an siRNA that is from about 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or more
nucleotides in length. The siRNA can be chemically synthesized or
an analog of RNA that mediates RNA interference. The method can
further comprise comparing the phenotype observed to that of an
appropriate control cell or control organism, thereby providing
information about the function of the gene.
[0036] Other aspects of the present invention include a composition
comprising biochemical components of a cell that target mRNA of a
gene to be degraded by RNA of about 5 to about 20 nucleotides in
length. In non-limiting examples, the RNA can be an siRNA that is
from about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, or 20, or more nucleotides in length. The siRNA can be
chemically synthesized or an analog of RNA that mediates RNA
interference.
[0037] In still another embodiment of the present invention, there
is provided a method of treating a disease or condition associated
with the presence of a protein in an individual comprising
administering to the individual RNA of from about 5 to about 20
nucleotides that targets the mRNA of the protein for degradation.
In non-limiting examples, the RNA can be an siRNA that is from
about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
or 20, or more nucleotides in length. The siRNA can be chemically
synthesized or an analog of RNA that mediates RNA interference.
[0038] Another method contemplated by the present invention
includes a method of assessing whether an agent acts on a gene
product comprising: (a) introducing RNA of from about 5 to about 20
nucleotides which targets the mRNA of the gene for degradation into
a cell or organism; (b) maintaining the cell or organism of (a)
under conditions in which degradation of the mRNA occurs; (c)
introducing the agent into the cell or organism of (b); and (d)
determining whether the agent has an effect on the cell or
organism, wherein if the agent has no effect on the cell or
organism then the agent acts on the gene product or on a biological
pathway that involves the gene product. In non-limiting examples,
the RNA can be an siRNA that is from about 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or more nucleotides in
length. The siRNA can be chemically synthesized or an analog of RNA
that mediates RNA interference.
[0039] There is also provided a method of assessing whether a gene
product is a suitable target for drug discovery comprising: (a)
introducing RNA of from about 5 to about 20 nucleotides which
targets the mRNA of the gene for degradation into a cell or
organism; (b)maintaining the cell or organism of (a) under
conditions in which degradation of the mRNA occurs resulting in
decreased expression of the gene; and (c) determining the effect of
the decreased expression of the gene on the cell or organism,
wherein if decreased expression has an effect, then the gene
product is a target for drug discovery. In non-limiting examples,
the RNA can be an siRNA that is from about 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or more nucleotides in
length. The siRNA can be chemically synthesized or an analog of RNA
that mediates RNA interference.
[0040] Also contemplated is a gene identified by the sequencing of
endogenous 5 to 20 nucleotide RNA molecules that mediate RNA
interference. In non-limiting examples, the RNA can be an siRNA
that is from about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, or 20, or more nucleotides in length. The siRNA can be
chemically synthesized or an analog of RNA that mediates RNA
interference.
[0041] As discussed above and throughout the specification, there
is also provided a pharmaceutical composition comprising RNA of
from about 5 to about 20 nucleotides that mediates RNA interference
and an appropriate carrier. In non-limiting examples, the RNA can
be an siRNA that is from about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, or 20, or more nucleotides in length. The
siRNA can be chemically synthesized or an analog of RNA that
mediates RNA interference.
[0042] In still another aspect, there is disclosed a method of
producing knockdown cells, comprising introducing into cells in
which a gene is to be knocked down RNA of about 5 to about 20
nucleotides that targets the mRNA corresponding to the gene and
maintaining the resulting cells under conditions under which RNA
interference occurs, resulting in degradation of the mRNA of the
gene, thereby producing knockdown cells. In non-limiting examples,
the RNA can be an siRNA that is from about 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or more nucleotides in
length. The siRNA can be chemically synthesized or an analog of RNA
that mediates RNA interference.
[0043] An additional embodiment of the present invention includes
an isolated DNA comprising DNA encoding RNA that is processed in
eukaryotic cells to RNA segments of about 5 to about 20 nucleotides
in length that inactivate a corresponding gene by transcriptional
silencing or that mediate RNA interference of mRNA of a gene, or
that target mRNA of a protein for degradation. In non-limiting
examples, the RNA can be an siRNA that is from about 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or more
nucleotides in length.
[0044] In certain embodiments, there is provided a kit that
includes an RNA of from about 5 to about 20 nucleotides that
mediates RNA interference of a target mRNA, that inactivate a
corresponding gene by transcriptional silencing, or that targets
mRNA of a protein for degradation. In non-limiting examples, the
RNA can be an siRNA that is from about 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, or 20, or more nucleotides in
length. The siRNA can be chemically synthesized or an analog of RNA
that mediates RNA interference. Other aspects of the kits of the
present invention are described throughout the specification.
[0045] It is specifically contemplated that any method of the
invention may be employed with any kit component or composition
described herein. Furthermore, any kit may contain any component
described herein and any component involved in any method of the
invention. Thus, any element discussed with respect to one
embodiment may be applied to any other embodiment of the
invention.
[0046] It is contemplated that the use of the term "about" in the
context of the present invention is to connote inherent problems
with precise measurement of a specific element, characteristic, or
other trait. Thus, the term "about," as used herein in the context
of the claimed invention, simply refers to an amount or measurement
that takes into account single or collective calibration and other
standardized errors generally associated with determining that
amount or measurement. For example, a concentration of "about" 100
mM of Tris can encompass an amount of 100 mM .+-.5 mM, if 5 mM
represents the collective error bars in arriving at that
concentration. Thus, any measurement or amount referred to in this
application can be used with the term "about" if that measurement
or amount is susceptible to errors associated with calibration or
measuring equipment, such as a scale, pipetteman, pipette,
graduated cylinder, etc.
[0047] The use of the word "a" or "an" when used in conjunction
with the term "comprising" in the claims and/or the specification
may mean "one," but it is also consistent with the meaning of "one
or more," "at least one," and "one or more than one."
[0048] It is contemplated that any embodiment discussed in this
specification can be implemented with respect to any method, kit,
reagent, or composition of the invention, and vice versa.
Furthermore, compositions of the invention can be used to achieve
methods of the invention.
[0049] The use of the term "or" in the claims is used to mean
"and/or" unless explicitly indicated to refer to alternatives only
or the alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or."
[0050] As used in this specification and claim(s), the words
"comprising" (and any form of comprising, such as "comprise" and
"comprises"), "having" (and any form of having, such as "have" and
"has"), "including" (and any form of including, such as "includes"
and "include") or "containing" (and any form of containing, such as
"contains" and "contain") are inclusive or open-ended and do not
exclude additional, unrecited elements or method steps.
[0051] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating specific
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0052] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0053] FIG. 1A-B. Analysis of chemically synthesized siRNA of
varying lengths targeting GFP. Smaller siRNAs were able to knock
down the expression of GFP.
[0054] FIG. 2A-B. Smaller siRNA can knock down endogenous gene
expression as determined by western and real time PCR analysis.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0055] The present invention concerns nucleic acid molecules that
can be used in the process of RNA interference (RNAi). RNAi results
in a reduction of expression of a particular target. Double
stranded RNA has been shown to reduce gene expression of a target.
A portion of one strand of the double stranded RNA is complementary
to a region of the target's mRNA while another portion of the
double stranded RNA molecule is identical to the same region of the
target's mRNA. Discussed below are uses for the present
invention-compositions, methods, and kits-and ways of implementing
the invention.
I. RNA Interference (RNAi)
[0056] RNA interference (also referred to as "RNA-mediated
interference")(RNAi) is a mechanism by which gene expression can be
reduced or eliminated. Double stranded RNA (dsRNA) has been
observed to mediate the reduction, which is a multi-step process.
dsRNA activates post-transcriptional gene expression surveillance
mechanisms that appear to function to defend cells from virus
infection and transposon activity. (Fire et al., 1998; Grishok et
al., 2000; Ketting et al., 1999; Lin et al., 1999; Montgomery et
al., 1998; Sharp et al., 2000; Tabara et al., 1999). Activation of
these mechanisms targets mature, dsRNA-complementary mRNA for
destruction. RNAi offers major experimental advantages for study of
gene function. These advantages include a very high specificity,
ease of movement across cell membranes, and prolonged
down-regulation of the targeted gene. (Fire et al., 1998; Grishok
et al., 2000; Ketting et al., 1999; Lin et al., 1999; Montgomery et
al., 1998; Sharp, 1999; Sharp et al., 2000; Tabara et al., 1999).
Moreover, dsRNA has been shown to silence genes in a wide range of
systems, including plants, protozoans, fungi, C. elegans,
Trypanasoma, Drosophila, and mammals (Grishok et al., 2000; Sharp,
1999; Sharp et al., 2000; Elbashir et al., 2001).
[0057] RNAi can be passed to progeny, both through injection into
the gonad or by introduction into other parts of the body
(including ingestion) followed by migration to the gonad. Several
principles are worth noting (see Plasterk and Ketting, 2000).
First, the dsRNA is typically directed to an exon, although some
exceptions to this have been shown. Second, a homology threshold
(probably about 80-85% over 200 bases) is required. Most tested
sequences are 500 base pairs or greater, though sequences of 30
nucleotides or fewer evade the antiviral response in mammalian
cells. (Baglioni et al., 1983; Williams, 1997). Third, the targeted
mRNA is lost after RNAi. Fourth, the effect is non-stoichiometric,
and thus incredibly potent. In fact, it has been estimated that
only a few copies of dsRNA are required to knock down >95% of
targeted gene expression in a cell (Fire et al., 1998).
[0058] Although the precise mechanism of RNAi is still unknown, the
involvement of permanent gene modification or the disruption of
transcription have been experimentally eliminated. It is now
generally accepted that RNAi acts post-transcriptionally, targeting
RNA transcripts for degradation. It appears that both nuclear and
cytoplasmic RNA can be targeted. (Bosher et al., 2000).
[0059] Some of the uses for RNAi include identifying genes that are
essential for a particular biological pathway, identifying
disease-causing genes, studying structure function relationships,
and implementing therapeutics and diagnostics. As with other types
of gene inhibitory compounds, such as antisense and triplex forming
oligonucleotides, tracking these potential drugs in vivo and in
vitro is important for drug development, pharmacokinetics,
biodistribution, macro and microimaging metabolism and for gaining
a basic understanding of how these compounds behave and function.
siRNAs have high specificity and may perhaps be used to knock out
the expression of a single allele of a dominantly mutated diseased
gene.
[0060] A. Nucleic Acids for RNAi
[0061] The present invention concerns double-stranded RNA capable
of triggering RNAi. The RNA may be synthesized chemically or it may
be produced recombinantly. They may be subsequently isolated and/or
purified.
[0062] As used herein, the term "dsRNA" refers to a double-stranded
RNA molecule. The molecule may be a single strand with intra-strand
complementarity such that two portions of the strand hybridize with
each other or the molecule may be two separate RNA strands that are
partially or fully complementary to each other along one or more
regions or along their entire lengths. Partially complementary
means the regions are less than 100% complementary to each other,
but that they are at least 50%, 60%, 70%, 80%, or 90% complementary
to each other.
[0063] The siRNA provided by the present invention allows for the
modulation and especially the attenuation of target gene expression
when such a gene is present and liable to expression within a cell.
Modulation of expression can be partial or complete inhibition of
gene function, or even the up-regulation of other, secondary target
genes or the enhancement of expression of such genes in response to
the inhibition of the primary target gene. Attenuation of gene
expression may include the partial or complete suppression or
inhibition of gene function, transcript processing or translation
of the transcript. In the context of RNA interference, modulation
of gene expression is thought to proceed through a complex of
proteins and RNA, specifically including small, dsRNA that may act
as a "guide" RNA. The siRNA therefore is thought to be effective
when its nucleotide sequence sufficiently corresponds to at least
part of the nucleotide sequence of the target gene. Although the
present invention is not limited by this mechanistic hypothesis, it
is preferred that the sequence of nucleotides in the siRNA be
substantially identical to at least a portion of the target gene
sequence.
[0064] A target gene generally means a polynucleotide comprising a
region that encodes a polypeptide, or a polynucleotide region that
regulates replication, transcription or translation or other
processes important to expression of the polypeptide, or a
polynucleotide comprising both a region that encodes a polypeptide
and a region operably linked thereto that regulates expression. The
targeted gene can be chromosomal (genomic) or extrachromosomal. It
may be endogenous to the cell, or it may be a foreign gene (a
transgene). The foreign gene can be integrated into the host
genome, or it may be present on an extrachromosomal genetic
construct such as a plasmid or a cosmid. The targeted gene can also
be derived from a pathogen, such as a virus, bacterium, fungus or
protozoan, which is capable of infecting an organism or cell.
Target genes may be viral and pro-viral genes that do not elicit
the interferon response, such as retroviral genes. The target gene
may be a protein-coding gene or a non-protein coding gene, such as
a gene which codes for ribosomal RNAs, splicosomal RNA, tRNAs,
etc.
[0065] Any gene being expressed in a cell can be targeted.
Preferably, a target gene is one involved in or associated with the
progression of cellular activities important to disease or of
particular interest as a research object. Thus, by way of example,
the following are classes of possible target genes that may be used
in the methods of the present invention to modulate or attenuate
target gene expression: developmental genes (e.g. adhesion
molecules, cyclin kinase inhibitors, Wnt family members, Pax family
members, Winged helix family members, Hox family members,
cytokines/lymphokines and their receptors, growth or
differentiation factors and their receptors, neurotransmitters and
their receptors), oncogenes (e.g. ABLI, BLC1, BCL6, CBFA1, CBL,
CSFIR, ERBA, ERBB, EBRB2, ETS1, ETS1, ETV6, FGR, FOX, FYN, HCR,
HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, MYB, MYC, MYCL1, MYCN, NRAS,
PIM1, PML, RET, SRC, TAL1, TCL3 and YES), tumor suppresser genes
(e.g. APC, BRCA1, BRCA2, MADH4, MCC, NF1, NF2, RB1, TP53 and WT1),
and enzymes (e.g. ACP desaturases and hycroxylases, ADP-glucose
pyrophorylases, ATPases, alcohol dehycrogenases, amylases,
amyloglucosidases, catalases, cellulases, cyclooxygenases,
decarboxylases, dextrinases, esterases, DNA and RNA polymerases,
galactosidases, glucanases, glucose oxidases, GTPases, helicases,
hemicellulases, integrases, invertases, isomersases, kinases,
lactases, lipases, lipoxygenases, lysozymes, pectinesterases,
peroxidases, phosphatases, phospholipases, phophorylases,
polygalacturonases, proteinases and peptideases, pullanases,
recombinases, reverse transcriptases, topoisomerases,
xylanases).
[0066] The nucleotide sequence of the siRNA is defined by the
nucleotide sequence of its target gene. The siRNA contains a
nucleotide sequence that is essentially identical to at least a
portion of the target gene. Preferably, the siRNA contains a
nucleotide sequence that is completely identical to at least a
portion of the target gene. Of course, when comparing an RNA
sequence to a DNA sequence, an "identical" RNA sequence will
contain ribonucleotides where the DNA sequence contains
deoxyribonucleotides, and further that the RNA sequence will
typically contain a uracil at positions where the DNA sequence
contains thymidine.
[0067] A siRNA comprises a double stranded structure, the sequence
of which is "substantially identical" to at least a portion of the
target gene. "Identity," as known in the art, is the relationship
between two or more polynucleotide (or polypeptide) sequences, as
determined by comparing the sequences. In the art, identity also
means the degree of sequence relatedness between polynucleotide
sequences, as determined by the match of the order of nucleotides
between such sequences. Identity can be readily calculated. See,
for example: Computational Molecular Biology, Lesk, A. M., ed.
Oxford University Press, New York, 1988; Biocomputing: Informatics
and Genome Projects, Smith, D. W., ed., Academic Press, New York,
1993; and the methods disclosed in WO 99/32619, WO 01/68836, WO
00/44914, and WO 01/36646, specifically incorporated herein by
reference. While a number of methods exist for measuring identity
between two nucleotide sequences, the term is well known in the
art. Methods for determining identity are typically designed to
produce the greatest degree of matching of nucleotide sequence and
are also typically embodied in computer programs. Such programs are
readily available to those in the relevant art. For example, the
GCG program package (Devereux et al.), BLASTP, BLASTN, and FASTA
(Atschul et al.) and CLUSTAL (Higgins et al., 1992; Thompson, et
al., 1994).
[0068] One of skill in the art will appreciate that two
polynucleotides of different lengths may be compared over the
entire length of the longer fragment. Alternatively, small regions
may be compared. Normally sequences of the same length are compared
for a final estimation of their utility in the practice of the
present invention. It is preferred that there be 100% sequence
identity between the dsRNA for use as siRNA and at least 15
contiguous nucleotides of the target gene, although a dsRNA having
70%, 75%, 80%, 85%, 90%, or 95% or greater may also be used in the
present invention. A siRNA that is essentially identical to a least
a portion of the target gene may also be a dsRNA wherein one of the
two complementary strands (or, in the case of a self-complementary
RNA, one of the two self-complementary portions) is either
identical to the sequence of that portion or the target gene or
contains one or more insertions, deletions or single point
mutations relative to the nucleotide sequence of that portion of
the target gene. siRNA technology thus has the property of being
able to tolerate sequence variations that might be expected to
result from genetic mutation, strain polymorphism, or evolutionary
divergence.
[0069] RNA (ribonucleic acid) is known to be the transcription
product of a molecule of DNA (deoxyribonucleic acid) synthesized
under the action of an enzyme, DNA-dependent RNA polymerase. There
are diverse applications of the obtaining of specific RNA
sequences, such as, for example, the synthesis of RNA probes or of
oligoribonucleotides (Milligan et al.), or the expression of genes
(see, in particular, Steen et al., Fuerst, et al. and Patent
Applications WO 91/05,866 and EP 0,178,863), or alternatively gene
amplification as described by Kievits, et al. and Kwoh et al. or in
Patent Applications WO 88/10,315 and WO 91/02,818, and U.S. Pat.
No. 5,795,715, all of which are expressly incorporated herein by
reference.
[0070] One of the distinctive features of most DNA-dependent RNA
polymerases is that of initiating RNA synthesis according to a DNA
template from a particular start site as a result of the
recognition of a nucleic acid sequence, termed a promoter, which
makes it possible to define the precise localization and the strand
on which initiation is to be effected. Contrary to DNA-dependent
DNA polymerases, polymerization by DNA-dependent RNA polymerases is
not initiated from a 3'-OH end, and their natural substrate is an
intact DNA double strand.
[0071] Compared to bacterial, eukaryotic or mitochondrial RNA
polymerases, phage RNA polymerases are very simple enzymes. Among
these, the best known are the RNA polymerases of bacteriophages T7,
T3 and SP6. These enzymes are very similar to one another, and are
composed of a single subunit of 98 to 100 kDa. Two other phage
polymerases share these similarities: that of Klebsiella phage K11
and that of phage BA14 (Diaz et al.). Any DNA dependent RNA
polymerase is expected to perform in conjunction with a
functionally active promoter as desired in the present invention.
These include, but are not limited to the above listed polymerases,
active mutants thereof, E. coli RNA polymerase, and RNA polymerases
I., II, and III from a variety of eukaryotic organisms.
[0072] Initiation of transcription with T7, SP6 RNA and T3 RNA
Polymerases is highly specific for the T7, SP6 and T3 phage
promoters, respectively. The properties and utility of these
polymerases are well known to the art. Their properties and sources
are described in U.S. Pat. Nos. (T7) 5,869,320; 4,952,496;
5,591,601; 6,114,152; (SP6) 5,026,645; (T3) 5,102,802; 5,891,681;
5,824,528; 5,037,745, all of which are expressly incorporated
herein by reference.
[0073] Reaction conditions for use of these RNA polymerases are
well known in the art, and are exemplified by those conditions
provided in the examples and references. The result of contacting
the appropriate template with an appropriate polymerase is the
synthesis of an RNA product, which is typically single-stranded.
Although under appropriate conditions, double stranded RNA may be
made from a double stranded DNA template. See U.S. Pat. No.
5,795,715, incorporated herein by reference. The process of
sequence specific synthesis may also be known as transcription, and
the product the transcript, whether the product represents an
entire, functional gene product or not.
[0074] dsRNA for use as siRNA may also be enzymatically synthesized
through the use of RNA dependent RNA polymerases such as Q beta
replicase, Tobacco mosaic virus replicase, brome mosaic virus
replicase, potato virus replicase, etc. Reaction conditions for use
of these RNA polymerases are well known in the art, and are
exemplified by those conditions provided in the examples and
references. Also see U.S. Pat. No. RE35,443, and U.S. Pat. No.
4,786,600, both of which are incorporated herein by reference. The
result of contacting the appropriate template with an appropriate
polymerase is the synthesis of an RNA product, which is typically
double-stranded. Employing these RNA dependent RNA polymerases
therefore may utilize a single stranded RNA or single stranded DNA
template. If utilizing a single stranded DNA template, the
enzymatic synthesis results in a hybrid RNA/DNA duplex that is also
contemplated as useful as siRNA.
[0075] The templates for enzymatic synthesis of siRNA are nucleic
acids, typically, though not exclusively DNA. A nucleic acid may be
made by any technique known to one of ordinary skill in the art.
Non-limiting examples of synthetic nucleic acid, particularly a
synthetic oligonucleotide, include a nucleic acid made by in vitro
chemical synthesis using phosphotriester, phosphite or
phosphoramidite chemistry and solid phase techniques such as
described in EP 266,032, incorporated herein by reference, or via
deoxynucleoside H-phosphonate intermediates as described by
Froehler et al., 1986, and U.S. Pat. No. 5,705,629, each
incorporated herein by reference, or as described in WO 2003/106630
which is incorporated herein by reference.
[0076] A non-limiting example of enzymatically produced nucleic
acid include one produced by enzymes in amplification reactions
such as PCR.TM. (see for example, U.S. Pat. No. 4,683,202 and U.S.
Pat. No. 4,682,195, each incorporated herein by reference), or the
synthesis of oligonucleotides described in U.S. Pat. No. 5,645,897,
incorporated herein by reference. A non-limiting example of a
biologically produced nucleic acid includes recombinant nucleic
acid production in living cells (see for example, Sambrook, 2001,
incorporated herein by reference).
[0077] The term "nucleic acid" will generally refer to at least one
molecule or strand of DNA, RNA or a derivative or mimic thereof,
comprising at least one nucleotide base, such as, for example, a
naturally occurring purine or pyrimidine base found in DNA (e.g.,
adenine "A," guanine "G," thymine "T," and cytosine "C") or RNA
(e.g. A, G, uracil "U," and C). The term "nucleic acid" encompasses
the terms "oligonucleotide" and "polynucleotide." These definitions
generally refer to at least one single-stranded molecule, but in
specific embodiments will also encompass at least one additional
strand that is partially, substantially or fully complementary to
the at least one single-stranded molecule. Thus, a nucleic acid may
encompass at least one double-stranded molecule or at least one
triple-stranded molecule that comprises one or more complementary
strand(s) or "complement(s)" of a particular sequence comprising a
strand of the molecule.
[0078] As will be appreciated by one of skill in the art, the
useful form of nucleotide or modified nucleotide to be incorporated
will be dictated largely by the nature of the synthesis to be
performed. Thus, for example, enzymatic synthesis typically
utilizes the free form of nucleotides and nucleotide analogs,
typically represented as nucleotide triphospates, or NTPs. These
forms thus include, but are not limited to aminoallyl UTP,
pseudo-UTP, 5-I-UTP, 5-I-CTP, 5-Br-UTP, alpha-S ATP, alpha-S CTP,
alpha-S GTP, alpha-S UTP, 4-thio UTP, 2-thio-CTP, 2'NH.sub.2 UTP,
2'NH.sub.2 CTP, and 2' F UTP. As will also be appreciated by one of
skill in the art, the useful form of nucleotide for chemical
syntheses may be typically represented as aminoallyl uridine,
pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine, alpha-S
adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S uridine,
4-thio uridine, 2-thio-cytidine, 2'NH2 uridine, 2'NH2 cytidine, and
2' F uridine. In the present invention, the listing of either form
is non-limiting in that the choice of nucleotide form will be
dictated by the nature of the synthesis to be performed. In the
present invention, then, the inventors use the terms aminoallyl
uridine, pseudo-uridine, 5-I-uridine, 5-I-cytidine, 5-Br-uridine,
alpha-S adenosine, alpha-S cytidine, alpha-S guanosine, alpha-S
uridine, 4-thio uridine, 2-thio-cytidine, 2'NH.sub.2 uridine,
2'NH.sub.2 cytidine, and 2' F uridine generically to refer to the
appropriate nucleotide or modified nucleotide, including the free
phosphate (NTP) forms as well as all other useful forms of the
nucleotides.
[0079] In certain embodiments, a "gene" refers to a nucleic acid
that is transcribed. As used herein, a "gene segment" is a nucleic
acid segment of a gene. In certain aspects, the gene includes
regulatory sequences involved in transcription, or message
production or composition. In particular embodiments, the gene
comprises transcribed sequences that encode for a protein,
polypeptide or peptide. In other particular aspects, the gene
comprises a nucleic acid, and/or encodes a polypeptide or
peptide-coding sequences of a gene that is defective or mutated in
a hematopoietic and lympho-hematopoietic disorder. In keeping with
the terminology described herein, an "isolated gene" may comprise
transcribed nucleic acid(s), regulatory sequences, coding
sequences, or the like, isolated substantially away from other such
sequences, such as other naturally occurring genes, regulatory
sequences, polypeptide or peptide encoding sequences, etc. In this
respect, the term "gene" is used for simplicity to refer to a
nucleic acid comprising a nucleotide sequence that is transcribed,
and the complement thereof. In particular aspects, the transcribed
nucleotide sequence comprises at least one functional protein,
polypeptide and/or peptide encoding unit. As will be understood by
those in the art, this functional term "gene" includes both genomic
sequences, RNA or cDNA sequences, or smaller engineered nucleic
acid segments, including nucleic acid segments of a non-transcribed
part of a gene, including but not limited to the non-transcribed
promoter or enhancer regions of a gene. Smaller engineered gene
nucleic acid segments may express, or may be adapted to express
using nucleic acid manipulation technology, proteins, polypeptides,
domains, peptides, fusion proteins, mutants and/or such like. Thus,
a "truncated gene" refers to a nucleic acid sequence that is
missing a stretch of contiguous nucleic acid residues.
[0080] Various nucleic acid segments may be designed based on a
particular nucleic acid sequence, and may be of any length. By
assigning numeric values to a sequence, for example, the first
residue is 1, the second residue is 2, etc., an algorithm defining
all nucleic acid segments can be created:
[0081] n to n+y
[0082] where n is an integer from 1 to the last number of the
sequence and y is the length of the nucleic acid segment minus one,
where n+y does not exceed the last number of the sequence. Thus,
for a 10-mer, the nucleic acid segments correspond to bases 1 to
10, 2 to 11, 3 to 12 . . . and/or so on. For a 15-mer, the nucleic
acid segments correspond to bases 1 to 15, 2 to 16, 3 to 17 . . .
and/or so on. For a 20-mer, the nucleic segments correspond to
bases 1 to 20, 2 to 21, 3 to 22 . . . and/or so on.
[0083] The nucleic acid(s) of the present invention, regardless of
the length of the sequence itself, may be combined with other
nucleic acid sequences, including but not limited to, promoters,
enhancers, polyadenylation signals, restriction enzyme sites,
multiple cloning sites, coding segments, and the like, to create
one or more nucleic acid construct(s). The overall length may vary
considerably between nucleic acid constructs. Thus, a nucleic acid
segment of almost any length may be employed, with the total length
preferably being limited by the ease of preparation or use in the
intended protocol.
[0084] To obtain the RNA corresponding to a given template sequence
through the action of an RNA polymerase, it may require placing the
target sequence under the control of the promoter recognized by the
RNA polymerase.
[0085] The spacing between promoter elements frequently is
flexible, so that promoter function is preserved when elements are
inverted or moved relative to one another. The spacing between
promoter elements can be increased to 50 bp apart before activity
begins to decline. Depending on the promoter, it appears that
individual elements can function either cooperatively or
independently to activate transcription. A promoter may or may not
be used in conjunction with an "enhancer," which refers to a
cis-acting regulatory sequence involved in the transcriptional
activation of a nucleic acid sequence.
[0086] T7, T3, or SP6 RNA polymerases display a high fidelity to
their respective promoters. The natural promoters specific for the
RNA polymerases of phages T7, T3 and SP6 are well known.
Furthermore, consensus sequences of promoters are known to be
functional as promoters for these polymerases. The bacteriophage
promoters for T7, T3, and SP6 consist of 23 bp numbered -17 to +6,
where +1 indicates the first base of the coded transcript. An
important observation is that, of the +1 through +6 bases, only the
base composition of +1 and +2 are critical and must be a G and
purine, respectively, to yield an efficient transcription template.
In addition, synthetic oligonucleotide templates only need to be
double-stranded in the -17 to -1 region of the promoter, and the
coding region can be all single-stranded. (See Milligan et al.)
This can reduce the cost of synthetic templates, since the coding
region (i.e., from +1 on) can be left single-stranded and the short
oligonucleotides required to render the promoter region
double-stranded can be used with multiple templates. A further
discussion of consensus promoters and a source of naturally
occurring bacteriophage promoters is U.S. Pat. No. 5,891,681,
specifically incorporated herein by reference.
[0087] Use of a T7, T3 or SP6 cytoplasmic expression system is
another possible embodiment. Eukaryotic cells can support
cytoplasmic transcription from certain bacterial promoters if the
appropriate bacterial polymerase is provided, either as part of the
delivery complex or as an additional genetic expression
construct.
[0088] When made in vitro, siRNA is formed from one or more strands
of polymerized ribonucleotide. When formed of only one strand, it
takes the form of a self-complementary hairpin-type or stem and
loop structure that doubles back on itself to form a partial
duplex. The self-duplexed portion of the RNA molecule may be
referred to as the "stem" and the remaining, connecting single
stranded portion referred to as the "loop" of the stem and loop
structure. When made of two strands, they are substantially
complementary.
[0089] It is contemplated that the region of complementarity in
either case is at least 5 contiguous residues, though it is
specifically contemplated that the region is at least or at most 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57,
58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160,
170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290,
300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420,
430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540,
550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670,
680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800,
810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930,
940, 950, 960, 970, 980, 990, or 1000 nucleotides. It is further
understood that the length of complementarity between the dsRNA and
the targeted mRNA may be any of the lengths identified above.
Included within the term "dsRNA" is small interfering RNA (siRNA),
which are generally 12-15 or 21-23 nucleotides in length and which
possess the ability to mediate RNA interference. It is contemplated
that siRNAs of the present invention may be 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30 or more basepairs in length.
[0090] dsRNA capable of triggering RNAi has one region that is
complementary to the targeted mRNA sequence and another region that
is identical to the targeted mRNA sequence. Of course, it is
understood that an mRNA is derived from genomic sequences or a
gene. In this respect, the term "gene" is used for simplicity to
refer to a functional protein, polypeptide, or peptide-encoding
unit. As will be understood by those in the art, this functional
term includes genomic sequences, cDNA sequences, and smaller
engineered gene segments that express, or may be adapted to
express, proteins, polypeptides, domains, peptides, fusion
proteins, and mutants.
[0091] A dsRNA may be of the following lengths, or be at least or
at most of the following lengths: 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,
65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,
82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210,
220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340,
350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460,
470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590,
600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720,
730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850,
860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980,
990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090,
1095, 1100, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500,
6000, 6500, 7000, 7500, 8000, 9000, 10000, or more nucleotides,
nucleosides, or base pairs. It will be understood that these
lengths refer either to a single strand of a two-stranded dsRNA
molecule or to a single stranded dsRNA molecule having portions
that form a double-stranded molecule.
[0092] Furthermore, outside regions of complementarity, there may
be a non-complementarity region that is not complementary to
another region in the other strand or elsewhere on a single strand.
Non-complementarity regions may be at the 3', 5' or both ends of a
complementarity region and they may number 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 5, 55, 56, 57, 58, 59,
60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93,
94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170,
180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300,
310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430,
440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550,
560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680,
690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810,
820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940,
950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060,
1070, 1080, 1090, 1095, 1100, 1500, 2000, 2500, 3000, 3500, 4000,
4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000, or
more bases.
[0093] The term "recombinant" may be used and this generally refers
to a molecule that has been manipulated in vitro or that is the
replicated or expressed product of such a molecule.
[0094] The term "nucleic acid" is well known in the art. A "nucleic
acid" as used herein will generally refer to a molecule (one or
more strands) of DNA, RNA or a derivative or analog thereof,
comprising a nucleobase. A nucleobase includes, for example, a
naturally occurring purine or pyrimidine base found in DNA (e.g.,
an adenine "A," a guanine "G," a thymine "T" or a cytosine "C") or
RNA (e.g., an A, a G, an uracil "U" or a C). The term "nucleic
acid" encompass the terms "oligonucleotide" and "polynucleotide,"
each as a subgenus of the term "nucleic acid." The term
"oligonucleotide" refers to a molecule of between about 3 and about
100 nucleobases in length. The term "polynucleotide" refers to at
least one molecule of greater than about 100 nucleobases in length.
The use of "dsRNA" encompasses both "oligonucleotides" and
"polynucleotides," unless otherwise specified.
[0095] As used herein, "hybridization", "hybridizes" or "capable of
hybridizing" is understood to mean the forming of a double or
triple stranded molecule or a molecule with partial double or
triple stranded nature. The term "anneal" as used herein is
synonymous with "hybridize." The term "hybridization",
"hybridize(s)" or "capable of hybridizing" encompasses the terms
"stringent condition(s)" or "high stringency" and the terms "low
stringency" or "low stringency condition(s)."
[0096] As used herein "stringent condition(s)" or "high stringency"
are those conditions that allow hybridization between or within one
or more nucleic acid strand(s) containing complementary
sequence(s), but precludes hybridization of random sequences.
Stringent conditions tolerate little, if any, mismatch between a
nucleic acid and a target strand. Such conditions are well known to
those of ordinary skill in the art, and are preferred for
applications requiring high selectivity. Non-limiting applications
include isolating a nucleic acid, such as a gene or a nucleic acid
segment thereof, or detecting at least one specific mRNA transcript
or a nucleic acid segment thereof, and the like.
[0097] Stringent conditions may comprise low salt and/or high
temperature conditions, such as provided by about 0.02 M to about
0.15 M NaCl at temperatures of about 50.degree. C. to about
70.degree. C. It is understood that the temperature and ionic
strength of a desired stringency are determined in part by the
length of the particular nucleic acid(s), the length and nucleobase
content of the target sequence(s), the charge composition of the
nucleic acid(s), and to the presence or concentration of formamide,
tetramethylammonium chloride or other solvent(s) in a hybridization
mixture.
[0098] It is also understood that these ranges, compositions and
conditions for hybridization are mentioned by way of non-limiting
examples only, and that the desired stringency for a particular
hybridization reaction is often determined empirically by
comparison to one or more positive or negative controls. Depending
on the application envisioned it is preferred to employ varying
conditions of hybridization to achieve varying degrees of
selectivity of a nucleic acid towards a target sequence. In a
non-limiting example, identification or isolation of a related
target nucleic acid that does not hybridize to a nucleic acid under
stringent conditions may be achieved by hybridization at low
temperature and/or high ionic strength. Such conditions are termed
"low stringency" or "low stringency conditions", and non-limiting
examples of low stringency include hybridization performed at about
0.15 M to about 0.9 M NaCl at a temperature range of about
20.degree. C. to about 50.degree. C. Of course, it is within the
skill of one in the art to further modify the low or high
stringency conditions to suite a particular application.
[0099] 1. Nucleic Acid Molecules
[0100] a. Nucleobases
[0101] As used herein a "nucleobase" refers to a heterocyclic base,
such as for example a naturally occurring nucleobase (i.e., an A,
T, G, C or U) found in at least one naturally occurring nucleic
acid (i.e., DNA and RNA), and naturally or non-naturally occurring
derivative(s) and analogs of such a nucleobase. A nucleobase
generally can form one or more hydrogen bonds ("anneal" or
"hybridize") with at least one naturally occurring nucleobase in
manner that may substitute for naturally occurring nucleobase
pairing (e.g., the hydrogen bonding between A and T, G and C, and A
and U).
[0102] "Purine" and/or "pyrimidine" nucleobase(s) encompass
naturally occurring purine and/or pyrimidine nucleobases and also
derivative(s) and analog(s) thereof, including but not limited to,
those a purine or pyrimidine substituted by one or more of an
alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e., fluoro, chloro,
bromo, or iodo), thiol or alkylthiol moeity. Preferred alkyl (e.g.,
alkyl, caboxyalkyl, etc.) moeities comprise of from about 1, about
2, about 3, about 4, about 5, to about 6 carbon atoms. Other
non-limiting examples of a purine or pyrimidine include a
deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a
hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine,
a 8-aminoguanine, a 8-hydroxyguanine, a 8-methylguanine, a
8-thioguanine, an azaguanine, a 2-aminopurine, a 5-ethylcytosine, a
5-methylcyosine, a 5-bromouracil, a 5-ethyluracil, a 5-iodouracil,
a 5-chlorouracil, a 5-propyluracil, a thiouracil, a
2-methyladenine, a methylthioadenine, a N,N-diemethyladenine, an
azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a
6-hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine),
and the like. In the table below, non-limiting, purine and
pyrimidine derivatives and analogs are also provided.
TABLE-US-00001 TABLE 3 Purine and Pyrmidine Derivatives or Analogs
Abbr. Modified base description ac4c 4-acetylcytidine Chm5u
5-(carboxyhydroxylmethyl) uridine Cm 2'-O-methylcytidine Cmnm5s2u
5-carboxymethylamino-methyl-2-thioridine Cmnm5u
5-carboxymethylaminomethyluridine D Dihydrouridine Fm
2'-O-methylpseudouridine Gal q Beta,D-galactosylqueosine Gm
2'-O-methylguanosine I Inosine I6a N6-isopentenyladenosine m1a
1-methyladenosine m1f 1-methylpseudouridine m1g 1-methylguanosine
m1I 1-methylinosine m22g 2,2-dimethylguanosine m2a
2-methyladenosine m2g 2-methylguanosine m3c 3-methylcytidine m5c
5-methylcytidine m6a N6-methyladenosine m7g 7-methylguanosine Mam5u
5-methylaminomethyluridine Mam5s2u
5-methoxyaminomethyl-2-thiouridine Man q Beta,D-mannosylqueosine
Mcm5s2u 5-methoxycarbonylmethyl-2-thiouridine Mcm5u
5-methoxycarbonylmethyluridine Mo5u 5-methoxyuridine Ms2i6a
2-methylthio-N6-isopentenyladenosine Ms2t6a
N-((9-beta-D-ribofuranosyl-2-methylthiopurine-6-
yl)carbamoyl)threonine Mt6a
N-((9-beta-D-ribofuranosylpurine-6-yl)N-methyl- carbamoyl)threonine
Mv Uridine-5-oxyacetic acid methylester o5u Uridine-5-oxyacetic
acid (v) Osyw Wybutoxosine P Pseudouridine Q Queosine s2c
2-thiocytidine s2t 5-methyl-2-thiouridine s2u 2-thiouridine s4u
4-thiouridine T 5-methyluridine t6a
N-((9-beta-D-ribofuranosylpurine-6- yl)carbamoyl)threonine Tm
2'-O-methyl-5-methyluridine Um 2'-O-methyluridine Yw Wybutosine X
3-(3-amino-3-carboxypropyl)uridine, (acp3)u
[0103] A nucleobase may be comprised in a nucleoside or nucleotide,
using any chemical or natural synthesis method described herein or
known to one of ordinary skill in the art. Such nucleobase may be
labeled or it may be part of a molecule that is labeled and
contains the nucleobase.
[0104] b. Nucleosides
[0105] As used herein, a "nucleoside" refers to an individual
chemical unit comprising a nucleobase covalently attached to a
nucleobase linker moiety. A non-limiting example of a "nucleobase
linker moiety" is a sugar comprising 5-carbon atoms (i.e., a
"5-carbon sugar"), including but not limited to a deoxyribose, a
ribose, an arabinose, or a derivative or an analog of a 5-carbon
sugar. Non-limiting examples of a derivative or an analog of a
5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic
sugar where a carbon is substituted for an oxygen atom in the sugar
ring.
[0106] Different types of covalent attachment(s) of a nucleobase to
a nucleobase linker moiety are known in the art. By way of
non-limiting example, a nucleoside comprising a purine (i.e., A or
G) or a 7-deazapurine nucleobase typically covalently attaches the
9 position of a purine or a 7-deazapurine to the 1'-position of a
5-carbon sugar. In another non-limiting example, a nucleoside
comprising a pyrimidine nucleobase (i.e., C, T or U) typically
covalently attaches a 1 position of a pyrimidine to a 1'-position
of a 5-carbon sugar (Kornberg and Baker, 1992).
[0107] c. Nucleotides
[0108] As used herein, a "nucleotide" refers to a nucleoside
further comprising a "backbone moiety." A backbone moiety generally
covalently attaches a nucleotide to another molecule comprising a
nucleotide, or to another nucleotide to form a nucleic acid. The
"backbone moiety" in naturally occurring nucleotides typically
comprises a phosphorus moiety, which is covalently attached to a
5-carbon sugar. The attachment of the backbone moiety typically
occurs at either the 3'- or 5'-position of the 5-carbon sugar.
Other types of attachments are known in the art, particularly when
a nucleotide comprises derivatives or analogs of a naturally
occurring 5-carbon sugar or phosphorus moiety.
[0109] d. Nucleic Acid Analogs
[0110] A nucleic acid may comprise, or be composed entirely of, a
derivative or analog of a nucleobase, a nucleobase linker moiety
and/or backbone moiety that may be present in a naturally occurring
nucleic acid. dsRNA with nucleic acid analogs may also be labeled
according to methods of the invention. As used herein a
"derivative" refers to a chemically modified or altered form of a
naturally occurring molecule, while the terms "mimic" or "analog"
refer to a molecule that may or may not structurally resemble a
naturally occurring molecule or moiety, but possesses similar
functions. As used herein, a "moiety" generally refers to a smaller
chemical or molecular component of a larger chemical or molecular
structure. Nucleobase, nucleoside and nucleotide analogs or
derivatives are well known in the art, and have been described (see
for example, Scheit, 1980, incorporated herein by reference).
[0111] Additional non-limiting examples of nucleosides, nucleotides
or nucleic acids comprising 5-carbon sugar and/or backbone moiety
derivatives or analogs, include those in: U.S. Pat. No. 5,681,947,
which describes oligonucleotides comprising purine derivatives that
form triple helixes with and/or prevent expression of dsDNA; U.S.
Pat. Nos. 5,652,099 and 5,763,167, which describe nucleic acids
incorporating fluorescent analogs of nucleosides found in DNA or
RNA, particularly for use as fluorescent nucleic acids probes; U.S.
Pat. No. 5,614,617, which describes oligonucleotide analogs with
substitutions on pyrimidine rings that possess enhanced nuclease
stability; U.S. Pat. Nos. 5,670,663, 5,872,232 and 5,859,221, which
describe oligonucleotide analogs with modified 5-carbon sugars
(i.e., modified 2'-deoxyfuranosyl moieties) used in nucleic acid
detection; U.S. Pat. No. 5,446,137, which describes
oligonucleotides comprising at least one 5-carbon sugar moiety
substituted at the 4' position with a substituent other than
hydrogen that can be used in hybridization assays; U.S. Pat. No.
5,886,165, which describes oligonucleotides with both
deoxyribonucleotides with 3'-5' internucleotide linkages and
ribonucleotides with 2'-5' internucleotide linkages; U.S. Pat. No.
5,714,606, which describes a modified internucleotide linkage
wherein a 3'-position oxygen of the internucleotide linkage is
replaced by a carbon to enhance the nuclease resistance of nucleic
acids; U.S. Pat. No. 5,672,697, which describes oligonucleotides
containing one or more 5' methylene phosphonate internucleotide
linkages that enhance nuclease resistance; U.S. Pat. Nos. 5,466,786
and 5,792,847, which describe the linkage of a substituent moeity
which may comprise a drug or label to the 2' carbon of an
oligonucleotide to provide enhanced nuclease stability and ability
to deliver drugs or detection moieties; U.S. Pat. No. 5,223,618,
which describes oligonucleotide analogs with a 2 or 3 carbon
backbone linkage attaching the 4' position and 3' position of
adjacent 5-carbon sugar moiety to enhanced cellular uptake,
resistance to nucleases and hybridization to target RNA; U.S. Pat.
No. 5,470,967, which describes oligonucleotides comprising at least
one sulfamate or sulfamide internucleotide linkage that are useful
as nucleic acid hybridization probe; U.S. Pat. Nos. 5,378,825,
5,777,092, 5,623,070, 5,610,289 and 5,602,240, which describe
oligonucleotides with three or four atom linker moiety replacing
phosphodiester backbone moiety used for improved nuclease
resistance, cellular uptake and regulating RNA expression; U.S.
Pat. No. 5,858,988, which describes hydrophobic carrier agent
attached to the 2'-O position of oligonucleotides to enhanced their
membrane permeability and stability; U.S. Pat. No. 5,214,136, which
describes oligonucleotides conjugaged to anthraquinone at the 5'
terminus that possess enhanced hybridization to DNA or RNA;
enhanced stability to nucleases; U.S. Pat. No. 5,700,922, which
describes PNA-DNA-PNA chimeras wherein the DNA comprises
2'-deoxy-erythro-pentofuranosyl nucleotides for enhanced nuclease
resistance, binding affinity, and ability to activate RNase H; and
U.S. Pat. No. 5,708,154, which describes RNA linked to a DNA to
form a DNA-RNA hybrid; U.S. Pat. No. 5,728,525, which describes the
labeling of nucleoside analogs with a universal fluorescent
label.
[0112] Additional teachings for nucleoside analogs and nucleic acid
analogs are U.S. Pat. No. 5,728,525, which describes nucleoside
analogs that are end-labeled; U.S. Pat. Nos. 5,637,683, 6,251,666
(L-nucleotide substitutions), and 5,480,980
(7-deaza-2'deoxyguanosine nucleotides and nucleic acid analogs
thereof).
[0113] 2. Preparation of Nucleic Acids
[0114] The present invention concerns various nucleic acids in
different embodiments of the invention. In some embodiments, dsRNA
is created by transcribing a DNA template. The DNA template may be
comprised in a vector or it may be a non-vector template.
Alternatively, a dsRNA may be created by hybridizing two synthetic,
complementary RNA molecules or hybridizing a single synthetic RNA
molecule with at least one complementarity region. Such nucleic
acids may be made by any technique known to one of ordinary skill
in the art, such as for example, chemical synthesis, enzymatic
production or biological production.
[0115] a. Vectors
[0116] Nucleic acids of the invention, particularly DNA templates,
may be produced recombinantly. Protein and polypeptides may be
encoded by a nucleic acid molecule comprised in a vector. The term
"vector" is used to refer to a carrier nucleic acid molecule into
which a nucleic acid sequence can be inserted for introduction into
a cell where it can be replicated. A nucleic acid sequence can be
"exogenous," which means that it is foreign to the cell into which
the vector is being introduced or that the sequence is homologous
to a sequence in the cell but in a position within the host cell
nucleic acid in which the sequence is ordinarily not found. Vectors
include plasmids, cosmids, viruses (bacteriophage, animal viruses,
and plant viruses), and artificial chromosomes (e.g., YACs). One of
skill in the art would be well equipped to construct a vector
through standard recombinant techniques, which are described in
Sambrook et al., (2001) and Ausubel et al., 1994, both incorporated
by reference. A vector may encode non-template sequences such as a
tag or label. Useful vectors encoding such fusion proteins include
pIN vectors (Inouye et al., 1985), vectors encoding a stretch of
histidines, and pGEX vectors, for use in generating glutathione
S-transferase (GST) soluble fusion proteins for later purification
and separation or cleavage.
[0117] The term "expression vector" refers to a vector containing a
nucleic acid sequence coding for at least part of a gene product
capable of being transcribed. In some cases, RNA molecules are then
translated into a protein, polypeptide, or peptide. In other cases,
these sequences are not translated, for example, in the production
of antisense molecules or ribozymes. Expression vectors can contain
a variety of "control sequences," which refer to nucleic acid
sequences necessary for the transcription and possibly translation
of an operably linked coding sequence in a particular host
organism. In addition to control sequences that govern
transcription and translation, vectors and expression vectors may
contain nucleic acid sequences that serve other functions as well
and are described infra.
[0118] A "promoter" is a control sequence that is a region of a
nucleic acid sequence at which initiation and rate of transcription
are controlled. It may contain genetic elements at which regulatory
proteins and molecules may bind such as RNA polymerase and other
transcription factors. The phrases "operatively positioned,"
"operatively linked," "under control," and "under transcriptional
control" mean that a promoter is in a correct functional location
and/or orientation in relation to a nucleic acid sequence to
control transcriptional initiation and/or expression of that
sequence. A promoter may or may not be used in conjunction with an
"enhancer," which refers to a cis-acting regulatory sequence
involved in the transcriptional activation of a nucleic acid
sequence.
[0119] A promoter may be one naturally associated with a gene or
sequence, as may be obtained by isolating the 5' non-coding
sequences located upstream of the coding segment and/or exon. Such
a promoter can be referred to as "endogenous." Similarly, an
enhancer may be one naturally associated with a nucleic acid
sequence, located either downstream or upstream of that sequence.
Alternatively, certain advantages will be gained by positioning the
coding nucleic acid segment under the control of a recombinant or
heterologous promoter (examples include the bacterial promoters
SP6, T3, and T7), which refers to a promoter that is not normally
associated with a nucleic acid sequence in its natural environment.
A recombinant or heterologous enhancer refers also to an enhancer
not normally associated with a nucleic acid sequence in its natural
environment. Such promoters or enhancers may include promoters or
enhancers of other genes, and promoters or enhancers isolated from
any other prokaryotic, viral, or eukaryotic cell, and promoters or
enhancers not "naturally occurring," i.e., containing different
elements of different transcriptional regulatory regions, and/or
mutations that alter expression. In addition to producing nucleic
acid sequences of promoters and enhancers synthetically, sequences
may be produced using recombinant cloning and/or nucleic acid
amplification technology, including PCR.TM., in connection with the
compositions disclosed herein (see U.S. Pat. No. 4,683,202, U.S.
Pat. No. 5,928,906, each incorporated herein by reference).
Furthermore, it is contemplated the control sequences that direct
transcription and/or expression of sequences within non-nuclear
organelles such as mitochondria, chloroplasts, and the like, can be
employed as well.
[0120] Naturally, it may be important to employ a promoter and/or
enhancer that effectively directs the expression of the DNA segment
in the cell type, organelle, and organism chosen for expression.
Those of skill in the art of molecular biology generally know the
use of promoters, enhancers, and cell type combinations for protein
expression, for example, see Sambrook et al. (2001), incorporated
herein by reference. The promoters employed may be constitutive,
tissue-specific, inducible, and/or useful under the appropriate
conditions to direct high level expression of the introduced DNA
segment, such as is advantageous in the large-scale production of
recombinant proteins and/or peptides. The promoter may be
heterologous or endogenous.
[0121] Other elements of a vector are well known to those of skill
in the art. A vector may include a polyadenylation signal, an
initiation signal, an internal ribosomal binding site, a multiple
cloning site, a selective or screening marker, a termination
signal, a splice site, an origin of replication, or a combination
thereof.
[0122] b. In Vitro Synthesis of dsRNA
[0123] A DNA template may be used to generate complementing RNA
molecule(s) to generate a double-stranded RNA molecule. One or two
DNA templates may be employed to generate a dsRNA. In some
embodiments, the DNA template can be part of a vector or plasmid,
as described herein. Alternatively, the DNA template for RNA may be
created by an amplification method.
[0124] The term "primer," as used herein, is meant to encompass any
nucleic acid that is capable of priming the synthesis of a nascent
nucleic acid in a template-dependent process. Typically, primers
are oligonucleotides from ten to twenty and/or thirty base pairs in
length, but longer sequences can be employed. Primers may be
provided in double-stranded and/or single-stranded form, although
the single-stranded form is preferred. Pairs of primers designed to
selectively hybridize to nucleic acids corresponding to the target
gene are contacted with the template nucleic acid under conditions
that permit selective hybridization. Depending upon the desired
application, high stringency hybridization conditions may be
selected that will only allow hybridization to sequences that are
completely complementary to the primers. In other embodiments,
hybridization may occur under reduced stringency to allow for
amplification of nucleic acids contain one or more mismatches with
the primer sequences. Once hybridized, the template-primer complex
is contacted with one or more enzymes that facilitate
template-dependent nucleic acid synthesis. Multiple rounds of
amplification are conducted until a sufficient amount of product is
produced.
[0125] A number of template dependent processes are available to
amplify the oligonucleotide sequences present in a given template
sample. One of the best known amplification methods is the
polymerase chain reaction (referred to as PCR.TM.) which is
described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and
4,800,159, and in Innis et al., 1988, each of which is incorporated
herein by reference in their entirety. A reverse transcriptase
PCR.TM. amplification procedure may be performed to quantify the
amount of mRNA amplified. Methods of reverse transcribing RNA into
cDNA are well known (see Sambrook et al., 2001). Alternative
methods for reverse transcription utilize thermostable DNA
polymerases. These methods are described in WO 90/07641. Polymerase
chain reaction methodologies are well known in the art.
Representative methods of RT-PCR are described in U.S. Pat. No.
5,882,864.
[0126] Another method for amplification is ligase chain reaction
("LCR"), disclosed in European Application No. 320 308,
incorporated herein by reference in its entirety. U.S. Pat. No.
4,883,750 describes a method similar to LCR for binding probe pairs
to a target sequence. A method based on PCR.TM. and oligonucleotide
ligase assy (OLA), disclosed in U.S. Pat. No. 5,912,148, may also
be used.
[0127] Alternative methods for amplification of target nucleic acid
sequences that may be used in the practice of the present invention
are disclosed in U.S. Pat. Nos. 5,843,650, 5,846,709, 5,846,783,
5,849,546, 5,849,497, 5,849,547, 5,858,652, 5,866,366, 5,916,776,
5,922,574, 5,928,905, 5,928,906, 5,932,451, 5,935,825, 5,939,291
and 5,942,391, GB Application No. 2 202 328, and in PCT Application
No. PCT/US89/01025, each of which is incorporated herein by
reference in its entirety. Qbeta Replicase, described in PCT
Application No. PCT/US87/00880, may also be used as an
amplification method in the present invention. In this method, a
replicative sequence of RNA that has a region complementary to that
of a target is added to a sample in the presence of an RNA
polymerase. The polymerase copies the replicative sequence which
may then be detected. An isothermal amplification method, in which
restriction endonucleases and ligases are used to achieve the
amplification of target molecules that contain nucleotide
5'-[alpha-thio]-triphosphates in one strand of a restriction site
may also be useful in the amplification of nucleic acids in the
present invention (Walker et al., 1992). Strand Displacement
Amplification (SDA), disclosed in U.S. Pat. No. 5,916,779, is
another method of carrying out isothermal amplification of nucleic
acids which involves multiple rounds of strand displacement and
synthesis, i.e., nick translation.
[0128] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR (Kwoh et al.,
1989; PCT Application WO 88/10315, incorporated herein by reference
in their entirety). EP Application 329 822 disclose a nucleic acid
amplification process involving cyclically synthesizing ssRNA,
ssDNA, and dsDNA, which may be used in accordance with the present
invention. PCT Application WO 89/06700 (incorporated herein by
reference in its entirety) disclose a nucleic acid sequence
amplification scheme based on the hybridization of a promoter
region/primer sequence to a target single-stranded DNA ("ssDNA")
followed by transcription of many RNA copies of the sequence. This
scheme is not cyclic, i.e., new templates are not produced from the
resultant RNA transcripts. Other amplification methods include
"RACE" and "one-sided PCR" (Frohman, 1990; Ohara et al., 1989).
[0129] c. Chemical Synthesis
[0130] Nucleic acid synthesis is performed according to standard
methods. See, for example, Itakura and Riggs (1980). Additionally,
U.S. Pat. No. 4,704,362, U.S. Pat. No. 5,221,619, and U.S. Pat. No.
5,583,013 each describe various methods of preparing synthetic
nucleic acids. Non-limiting examples of a synthetic nucleic acid
(e.g., a synthetic oligonucleotide), include a nucleic acid made by
in vitro chemically synthesis using phosphotriester, phosphite or
phosphoramidite chemistry and solid phase techniques such as
described in EP 266,032, incorporated herein by reference, or via
deoxynucleoside H-phosphonate intermediates as described by
Froehler et al., 1986 and U.S. Pat. No. 5,705,629, each
incorporated herein by reference. In the methods of the present
invention, one or more oligonucleotide may be used. Various
different mechanisms of oligonucleotide synthesis have been
disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571,
5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146,
5,602,244, each of which is incorporated herein by reference.
[0131] A non-limiting example of an enzymatically produced nucleic
acid include one produced by enzymes in amplification reactions
such as PCR.TM. (see for example, U.S. Pat. No. 4,683,202 and U.S.
Pat. No. 4,682,195, each incorporated herein by reference), or the
synthesis of an oligonucleotide described in U.S. Pat. No.
5,645,897, incorporated herein by reference. A non-limiting example
of a biologically produced nucleic acid includes a recombinant
nucleic acid produced (i.e., replicated) in a living cell, such as
a recombinant DNA vector replicated in bacteria (see for example,
Sambrook et al. 2001, incorporated herein by reference).
[0132] Oligonucleotide synthesis is well known to those of skill in
the art. Various different mechanisms of oligonucleotide synthesis
have been disclosed in for example, U.S. Pat. Nos. 4,659,774,
4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744,
5,574,146, 5,602,244, each of which is incorporated herein by
reference.
[0133] Basically, chemical synthesis can be achieved by the diester
method, the triester method polynucleotides phosphorylase method
and by solid-phase chemistry. These methods are discussed in
further detail below.
[0134] Diester method. The diester method was the first to be
developed to a usable state, primarily by Khorana and co-workers.
(Khorana, 1979). The basic step is the joining of two suitably
protected deoxynucleotides to form a dideoxynucleotide containing a
phosphodiester bond. The diester method is well established and has
been used to synthesize DNA molecules (Khorana, 1979).
[0135] Triester method. The main difference between the diester and
triester methods is the presence in the latter of an extra
protecting group on the phosphate atoms of the reactants and
products (Itakura et al., 1975). The phosphate protecting group is
usually a chlorophenyl group, which renders the nucleotides and
polynucleotide intermediates soluble in organic solvents. Therefore
purification's are done in chloroform solutions. Other improvements
in the method include (i) the block coupling of trimers and larger
oligomers, (ii) the extensive use of high-performance liquid
chromatography for the purification of both intermediate and final
products, and (iii) solid-phase synthesis.
[0136] Polynucleotide phosphorylase method. This is an enzymatic
method of DNA synthesis that can be used to synthesize many useful
oligonucleotides (Gillam et al., 1978; Gillam et al., 1979). Under
controlled conditions, polynucleotide phosphorylase adds
predominantly a single nucleotide to a short oligonucleotide.
Chromatographic purification allows the desired single adduct to be
obtained. At least a trimer is required to start the procedure, and
this primer must be obtained by some other method. The
polynucleotide phosphorylase method works and has the advantage
that the procedures involved are familiar to most biochemists.
[0137] Solid-phase methods. Drawing on the technology developed for
the solid-phase synthesis of polypeptides, it has been possible to
attach the initial nucleotide to solid support material and proceed
with the stepwise addition of nucleotides. All mixing and washing
steps are simplified, and the procedure becomes amenable to
automation. These syntheses are now routinely carried out using
automatic nucleic acid synthesizers.
[0138] Phosphoramidite chemistry (Beaucage and Lyer, 1992) has
become by far the most widely used coupling chemistry for the
synthesis of oligonucleotides. As is well known to those skilled in
the art, phosphoramidite synthesis of oligonucleotides involves
activation of nucleoside phosphoramidite monomer precursors by
reaction with an activating agent to form activated intermediates,
followed by sequential addition of the activated intermediates to
the growing oligonucleotide chain (generally anchored at one end to
a suitable solid support) to form the oligonucleotide product.
[0139] 3. Nucleic Acid Purification
[0140] A nucleic acid may be purified on polyacrylamide gels,
cesium chloride centrifugation gradients, or by any other means
known to one of ordinary skill in the art (see for example,
Sambrook (2001), incorporated herein by reference). Alternatively,
a column, filter, or cartridge containing an agent that binds to
the nucleic acid, such as a glass fiber, may be employed.
[0141] Following any amplification or transcription reaction, it
may be desirable to separate the amplification or transcription
product from the template and/or the excess primer. In one
embodiment, products are separated by agarose, agarose-acrylamide
or polyacrylamide gel electrophoresis using standard methods
(Sambrook et al., 2001). Separated amplification products may be
cut out and eluted from the gel for further manipulation. Using low
melting point agarose gels, the separated band may be removed by
heating the gel, followed by extraction of the nucleic acid.
[0142] Separation of nucleic acids may also be effected by
chromatographic techniques known in art. There are many kinds of
chromatography which may be used in the practice of the present
invention, including adsorption, partition, ion-exchange,
hydroxylapatite, molecular sieve, reverse-phase, column, paper,
thin-layer, and gas chromatography as well as HPLC.
[0143] In certain embodiments, the amplification products are
visualized. A typical visualization method involves staining of a
gel with ethidium bromide and visualization of bands under UV
light. Alternatively, if the amplification products are integrally
labeled with radio- or fluorometrically-labeled nucleotides, the
separated amplification products can be exposed to x-ray film or
visualized under the appropriate excitatory spectra.
[0144] In one embodiment, following separation of amplification
products, a labeled nucleic acid probe is brought into contact with
the amplified marker sequence. The probe preferably is conjugated
to a chromophore but may be radiolabeled. In another embodiment,
the probe is conjugated to a binding partner, such as an antibody
or biotin, or another binding partner carrying a detectable
moiety.
[0145] In particular embodiments, detection is by Southern blotting
and hybridization with a labeled probe. The techniques involved in
Southern blotting are well known to those of skill in the art (see
Sambrook et al., 2001). One example of the foregoing is described
in U.S. Pat. No. 5,279,721, incorporated by reference herein, which
discloses an apparatus and method for the automated electrophoresis
and transfer of nucleic acids. The apparatus permits
electrophoresis and blotting without external manipulation of the
gel and is ideally suited to carrying out methods according to the
present invention.
[0146] Other methods of nucleic acid detection that may be used in
the practice of the instant invention are disclosed in U.S. Pat.
Nos. 5,840,873, 5,843,640, 5,843,651, 5,846,708, 5,846,717,
5,846,726, 5,846,729, 5,849,487, 5,853,990, 5,853,992, 5,853,993,
5,856,092, 5,861,244, 5,863,732, 5,863,753, 5,866,331, 5,905,024,
5,910,407, 5,912,124, 5,912,145, 5,919,630, 5,925,517, 5,928,862,
5,928,869, 5,929,227, 5,932,413 and 5,935,791, each of which is
incorporated herein by reference.
[0147] 4. Nucleic Acid Transfer
[0148] Suitable methods for nucleic acid delivery to effect RNAi
according to the present invention are believed to include
virtually any method by which a nucleic acid (e.g., DNA, RNA,
including viral and nonviral vectors) can be introduced into an
organelle, a cell, a tissue or an organism, as described herein or
as would be known to one of ordinary skill in the art. Such methods
include, but are not limited to, direct delivery of DNA such as by
injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100,
5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and
5,580,859, each incorporated herein by reference), including
microinjection (Harlan and Weintraub, 1985; U.S. Pat. No.
5,789,215, incorporated herein by reference); by electroporation
(U.S. Pat. No. 5,384,253, incorporated herein by reference); by
calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen
and Okayama, 1987; Rippe et al., 1990); by using DEAE-dextran
followed by polyethylene glycol (Gopal, 1985); by direct sonic
loading (Fechheimer et al., 1987); by liposome mediated
transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau
et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al.,
1991); by microprojectile bombardment (PCT Application Nos. WO
94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783
5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each
incorporated herein by reference); by agitation with silicon
carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523 and
5,464,765, each incorporated herein by reference); by
Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and
5,563,055, each incorporated herein by reference); or by
PEG-mediated transformation of protoplasts (Omirulleh et al., 1993;
U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by
reference); by desiccation/inhibition-mediated DNA uptake (Potrykus
et al., 1985). Through the application of techniques such as these,
organelle(s), cell(s), tissue(s) or organism(s) may be stably or
transiently transformed.
[0149] There are a number of ways in which expression vectors may
be introduced into cells to generate dsRNA. In certain embodiments
of the invention, the expression vector comprises a virus or
engineered vector derived from a viral genome, while in other
embodiments, it is a nonviral vector. Other expression systems are
also readily available.
[0150] 5. Host Cells and Target Cells
[0151] The cell containing the target gene may be derived from or
contained in any organism (e.g., plant, animal, protozoan, virus,
bacterium, or fungus). The plant may be a monocot, dicot or
gynmosperm; the animal may be a vertebrate or invertebrate.
Preferred microbes are those used in agriculture or by industry,
and those that a pathogenic for plants or animals. Fungi include
organisms in both the mold and yeast morphologies. Examples of
vertebrates include fish and mammals, including cattle, goat, pig,
sheep, hamster, mouse, rate and human; invertebrate animals include
nematodes, insects, arachnids, and other arthropods. Preferably,
the cell is a vertebrate cell. More preferably, the cell is a
mammalian cell.
[0152] The cell having the target gene may be from the germ line or
somatic, totipotent or pluripotent, dividing or non-dividing,
parenchyma or epithelium, immortalized or transformed, or the like.
The cell can be a gamete or an embryo; if an embryo, it can be a
single cell embryo or a constituent cell or cells from a
multicellular embryo. The term "embryo" thus encompasses fetal
tissue. The cell having the target gene may be an undifferentiated
cell, such as a stem cell, or a differentiated cell, such as from a
cell of an organ or tissue, including fetal tissue, or any other
cell present in an organism. Cell types that are differentiated
include adipocytes, fibroblasts, myocytes, cardiomyocytes,
endothelium, neurons, glia, blood cells, megakaryocytes,
lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast
cells, leukocytes, granulocytes, keratinocytes, chondrocytes,
osteoblasts, osteoclasts, hepatocytes, and cells, of the endocrine
or exocrine glands.
[0153] As used herein, the terms "cell," "cell line," and "cell
culture" may be used interchangeably. All of these terms also
include their progeny, which is any and all subsequent generations
formed by cell division. It is understood that all progeny may not
be identical due to deliberate or inadvertent mutations. A host
cell may be "transfected" or "transformed," which refers to a
process by which exogenous nucleic acid is transferred or
introduced into the host cell. A transformed cell includes the
primary subject cell and its progeny. As used herein, the terms
"engineered" and "recombinant" cells or host cells are intended to
refer to a cell into which an exogenous nucleic acid sequence, such
as, for example, a small, interfering RNA or a template construct
encoding such an RNA has been introduced. Therefore, recombinant
cells are distinguishable from naturally occurring cells which do
not contain a recombinantly introduced nucleic acid.
[0154] In certain embodiments, it is contemplated that RNAs or
proteinaceous sequences may be co-expressed with other selected
RNAs or proteinaceous sequences in the same host cell.
Co-expression may be achieved by co-transfecting the host cell with
two or more distinct recombinant vectors. Alternatively, a single
recombinant vector may be constructed to include multiple distinct
coding regions for RNAs, which could then be expressed in host
cells transfected with the single vector.
[0155] A tissue may comprise a host cell or cells to be transformed
or contacted with a nucleic acid delivery composition and/or an
additional agent. The tissue may be part or separated from an
organism. In certain embodiments, a tissue and its constituent
cells may comprise, but is not limited to, blood (e.g.,
hematopoietic cells (such as human hematopoietic progenitor cells,
human hematopoietic stem cells, CD34.sup.+ cells CD4.sup.+ cells),
lymphocytes and other blood lineage cells), bone marrow, brain,
stem cells, blood vessel, liver, lung, bone, breast, cartilage,
cervix, colon, cornea, embryonic, endometrium, endothelial,
epithelial, esophagus, facia, fibroblast, follicular, ganglion
cells, glial cells, goblet cells, kidney, lymph node, muscle,
neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin,
small intestine, spleen, stomach, testes.
[0156] In certain embodiments, the host cell or tissue may be
comprised in at least one organism. In certain embodiments, the
organism may be, human, primate or murine. In other embodiments the
organism may be any eukaryote or even a prokayrote (e.g., a
eubacteria, an archaea), as would be understood by one of ordinary
skill in the art (see, for example, webpage
http://phylogeny.arizona.edu/tree/phylogeny.html). One of skill in
the art would further understand the conditions under which to
incubate all of the above described host cells to maintain them and
to permit their division to form progeny.
[0157] 6. Labels and Tags
[0158] dsRNA or resulting siRNA may be labeled with a radioactive,
enzymatic, calorimetric, or other label or tag for detection or
isolation purposes. Nucleic acids may be labeled with fluorescence
in some embodiments of the invention. The fluorescent labels
contemplated for use as conjugates include, but are not limited to,
Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665,
BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3,
Cy5,6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green
488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG,
Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA,
TET, Tetramethylrhodamine, and/or Texas Red.
[0159] It is contemplated that dsRNA may be labeled with two
different labels. Furthermore, fluorescence resonance energy
transfer (FRET) may be employed in methods of the invention (e.g.,
Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001, each
incorporated by reference).
[0160] A number of techniques for visualizing or detecting labeled
dsRNA are readily available. The reference by Stanley T. Crooke,
2000 has a discussion of such techniques (Chapter 6) which is
incorporated by reference. Such techniques include, microscopy,
arrays, Fluorometry, Light cyclers or other real time PCR machines,
FACS analysis, scintillation counters, Phosphoimagers, Geiger
counters, MRI, CAT, antibody-based detection methods (Westerns,
immunofluorescence, immunohistochemistry), histochemical
techniques, HPLC (Griffey et al., 1997, spectroscopy, capillary gel
electrophoresis (Cummins et al., 1996), spectroscopy; mass
spectroscopy; radiological techniques; and mass balance techniques.
Alternatively, nucleic acids may be labeled or tagged to allow for
their efficient isolation. In other embodiments of the invention,
nucleic acids are biotinylated.
[0161] 7. Libraries and Arrays
[0162] The present methods and kits may be employed for high volume
screening. A library of either dsRNA or candidate siRNA can be
created using methods of the invention. This library may then be
used in high throughput assays, including microarrays. Specifically
contemplated by the present inventors are chip-based nucleic acid
technologies such as those described by Hacia et al. (1996) and
Shoemaker et al. (1996). Briefly, these techniques involve
quantitative methods for analyzing large numbers of genes rapidly
and accurately. By using fixed probe arrays, one can employ chip
technology to segregate target molecules as high density arrays and
screen these molecules on the basis of hybridization (see also,
Pease et al., 1994; and Fodor et al, 1991). The term "array" as
used herein refers to a systematic arrangement of nucleic acid. For
example, a nucleic acid population that is representative of a
desired source (e.g., human adult brain) is divided up into the
minimum number of pools in which a desired screening procedure can
be utilized to detect or deplete a target gene and which can be
distributed into a single multi-well plate. Arrays may be of an
aqueous suspension of a nucleic acid population obtainable from a
desired mRNA source, comprising: a multi-well plate containing a
plurality of individual wells, each individual well containing an
aqueous suspension of a different content of a nucleic acid
population. Examples of arrays, their uses, and implementation of
them can be found in U.S. Pat. Nos. 6,329,209, 6,329,140,
6,324,479, 6,322,971, 6,316,193, 6,309,823, 5,412,087, 5,445,934,
and 5,744,305, which are herein incorporated by reference.
[0163] Microarrays are known in the art and consist of a surface to
which probes that correspond in sequence to gene products (e.g.,
cDNAs, mRNAs, cRNAs, polypeptides, and fragments thereof), can be
specifically hybridized or bound at a known position. In one
embodiment, the microarray is an array (i.e., a matrix) in which
each position represents a discrete binding site for a product
encoded by a gene (e.g., a protein or RNA), and in which binding
sites are present for products of most or almost all of the genes
in the organism's genome. In a preferred embodiment, the "binding
site" (hereinafter, "site") is a nucleic acid or nucleic acid
analogue to which a particular cognate cDNA can specifically
hybridize. The nucleic acid or analogue of the binding site can be,
e.g., a synthetic oligomer, a full-length cDNA, a less-than full
length cDNA, or a gene fragment.
[0164] The nucleic acid or analogue are attached to a solid
support, which may be made from glass, plastic (e.g.,
polypropylene, nylon), polyacrylamide, nitrocellulose, or other
materials. A preferred method for attaching the nucleic acids to a
surface is by printing on glass plates, as is described generally
by Schena et al., 1995a. See also DeRisi et al., 1996; Shalon et
al., 1996; Schena et al., 1995b. Other methods for making
microarrays, e.g., by masking (Maskos et al., 1992), may also be
used. In principal, any type of array, for example, dot blots on a
nylon hybridization membrane (see Sambrook et al., 1989, which is
incorporated in its entirety for all purposes), could be used,
although, as will be recognized by those of skill in the art, very
small arrays will be preferred because hybridization volumes will
be smaller.
II. Pharmaceutical Compositions and Routes of Administration
[0165] Certain aspects of the present invention include
compositions and methods of treating reducing or preventing the
expression of a target gene in a cell by RNA interference. In
non-limiting embodiments, the method can include obtaining at least
one siRNA of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
or 20 nucleotides in length and delivering the siRNA into a cell.
The siRNA can be formulated into a pharmaceutical composition. An
effective amount of the pharmaceutical composition can include, for
example, an amount sufficient to detectably and repeatedly to
ameliorate, reduce, minimize or limit the extent of the disease or
its symptoms. More rigorous definitions may apply, including
elimination, eradication or cure of disease.
[0166] 1. Pharmaceutical Compositions
[0167] Pharmaceutical compositions of the present invention include
siRNAs. The phrases "pharmaceutical or pharmacologically
acceptable" refers to molecular entities and compositions that do
not produce an adverse, allergic or other untoward reaction when
administered to an animal, such as, for example, a human. The
preparation of a pharmaceutical composition that includes an siRNA
is known to those of skill in the art in light of the present
disclosure, and as exemplified by Remington's Pharmaceutical
Sciences, 18th Ed. Mack Printing Company, 1990. Moreover, for
animal (e.g., human) administration, it will be understood that
preparations should meet sterility, pyrogenicity, general safety
and purity standards as required by FDA Office of Biological
Standards.
[0168] "Therapeutically effective amounts" are those amounts
effective to produce beneficial results in the recipient animal or
patient. Such amounts may be initially determined by reviewing the
published literature, by conducting in vitro tests or by conducting
metabolic studies in healthy experimental animals. Before use in a
clinical setting, it may be beneficial to conduct confirmatory
studies in an animal model, preferably a widely accepted animal
model of the particular disease to be treated. Preferred animal
models for use in certain embodiments are rodent models, which are
preferred because they are economical to use and, particularly,
because the results gained are widely accepted as predictive of
clinical value.
[0169] A "pharmaceutically acceptable carrier" includes any and all
solvents, dispersion media, coatings, surfactants, antioxidants,
preservatives (e.g., antibacterial agents, antifungal agents),
isotonic agents, absorption delaying agents, salts, preservatives,
drugs, drug stabilizers, gels, binders, excipients, disintegration
agents, lubricants, sweetening agents, flavoring agents, dyes, such
like materials and combinations thereof, as would be known to one
of ordinary skill in the art (Remington's, 1990). Except insofar as
any conventional carrier is incompatible with the active
ingredient, its use in the therapeutic or pharmaceutical
compositions is contemplated.
[0170] The actual dosage amount of a composition of the present
invention administered to an animal patient can be determined by
physical and physiological factors such as body weight, severity of
condition, the type of disease being treated, previous or
concurrent therapeutic interventions, idiopathy of the patient and
on the route of administration. The practitioner responsible for
administration will, in any event, determine the concentration of
active ingredient(s) in a composition and appropriate dose(s) for
the individual subject.
[0171] In certain embodiments, pharmaceutical compositions may
comprise, for example, at least about 0.1% of an active compound.
In other embodiments, the an active compound may comprise between
about 2% to about 75% of the weight of the unit, or between about
25% to about 60%, for example, and any range derivable therein. In
other non-limiting examples, a dose may also comprise from about 1
microgram/kg/body weight, about 5 microgram/kg/body weight, about
10 microgram/kg/body weight, about 50 microgram/kg/body weight,
about 100 microgram/kg/body weight, about 200 microgram/kg/body
weight, about 350 microgram/kg/body weight, about 500
microgram/kg/body weight, about 1 milligram/kg/body weight, about 5
milligram/kg/body weight, about 10 milligram/kg/body weight, about
50 milligram/kg/body weight, about 100 milligram/kg/body weight,
about 200 milligram/kg/body weight, about 350 milligram/kg/body
weight, about 500 milligram/kg/body weight, to about 1000
mg/kg/body weight or more per administration, and any range
derivable therein. In non-limiting examples of a derivable range
from the numbers listed herein, a range of about 5 mg/kg/body
weight to about 100 mg/kg/body weight, about 5 microgram/kg/body
weight to about 500 milligram/kg/body weight, etc., can be
administered, based on the numbers described above.
[0172] Alternatively, a patient may be given 1.times.10.sup.-5,
10.sup.-6, 10.sup.-6, 10.sup.-7, 10.sup.-8, 10.sup.-9, 10.sup.-10,
10.sup.-11, 10.sup.-12 M of a substance (or any range derivable
therein), such as an siRNA, in a volume of 0.1 .mu.l, 1.0 .mu.l, 10
.mu.l, 100 .mu.l, 1 ml, 5 ml, 10 ml, 20 ml, 25 ml, 50 ml, 100 ml,
200 ml, 300 ml, 400 ml, 500 ml, or more (or any range derivable
therein). siRNAs may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
or more times over a course of 1, 2, 3, 4, 5, 6, 7, 8, 9 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, 1, 2, 3,
4, 5, 6, 7 days, 1, 2, 3, 4, 5 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more years
on a regular or as needed basis.
[0173] The compositions of the present invention may comprise
different types of carriers depending on whether it is to be
administered in solid, liquid or aerosol form, and whether it need
to be sterile for such routes of administration as injection. The
compositions may be formulated into a composition in a free base,
neutral or salt form. In embodiments where the composition is in a
liquid form, a carrier can be a solvent or dispersion medium
comprising but not limited to, water, ethanol, polyol (e.g.,
glycerol, propylene glycol, liquid polyethylene glycol, etc),
lipids (e.g., triglycerides, vegetable oils, liposomes) and
combinations thereof. Sterile injectable solutions are prepared by
incorporating the active compounds in the required amount in the
appropriate solvent with various of the other ingredients
enumerated above, as required, followed by filtered
sterilization.
[0174] 2. Routes of Administration
[0175] The present invention can be administered intravenously,
intradermally, intraarterially, intraperitoneally, intralesionally,
intracranially, intraarticularly, intraprostaticaly,
intrapleurally, intratracheally, intranasally, intravitreally,
intravaginally, intrauterinely, intrarectally, topically,
intratumorally, intramuscularly, intraperitoneally, subcutaneously,
subconjunctival, intravesicularlly, mucosally, intrapericardially,
intraumbilically, intraocularally, orally, topically, locally,
inhalation (e.g. aerosol inhalation), injection, infusion,
continuous infusion, localized perfusion bathing target cells
directly, via a catheter, via a lavage, in cremes, in lipid
compositions (e.g., liposomes), or by other method or any
combination of the forgoing as would be known to one of ordinary
skill in the art (Remington's, 1990).
III. Kits
[0176] Any of the compositions described herein may be comprised in
a kit. In a non-limiting example, reagents for generating siRNA
molecules are included in a kit. The kit may further include
reagents for creating or synthesizing the dsRNA. It may also
include one or more buffers, such as a nuclease buffer,
transcription buffer, or a hybridization buffer, compounds for
preparing the DNA template or the dsRNA, and components for
isolating the resultant template, dsRNA, or siRNA. Other kits of
the invention may include components for making a nucleic acid
array comprising siRNA, and thus, may include, for example, a solid
support.
[0177] The components of the kits may be packaged either in aqueous
media or in lyophilized form. The container means of the kits will
generally include at least one vial, test tube, flask, bottle,
syringe or other container means, into which a component may be
placed, and preferably, suitably aliquoted. Where there are more
than one component in the kit (labeling reagent and label may be
packaged together), the kit also will generally contain a second,
third or other additional container into which the additional
components may be separately placed. However, various combinations
of components may be comprised in a vial. The kits of the present
invention also will typically include a means for containing the
nucleic acids, and any other reagent containers in close
confinement for commercial sale. Such containers may include
injection or blow-molded plastic containers into which the desired
vials are retained.
[0178] When the components of the kit are provided in one and/or
more liquid solutions, the liquid solution is an aqueous solution,
with a sterile aqueous solution being particularly preferred.
However, the components of the kit may be provided as dried
powder(s). When reagents and/or components are provided as a dry
powder, the powder can be reconstituted by the addition of a
suitable solvent. It is envisioned that the solvent may also be
provided in another container means. In some embodiments, labeling
dyes are provided as a dried power. It is contemplated that 10, 20,
30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170,
180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 .mu.g or at
least or at most those amounts of dried dye are provided in kits of
the invention. The dye may then be resuspended in any suitable
solvent, such as DMSO.
[0179] The container means will generally include at least one
vial, test tube, flask, bottle, syringe and/or other container
means, into which the nucleic acid formulations are placed,
preferably, suitably allocated. The kits may also comprise a second
container means for containing a sterile, pharmaceutically
acceptable buffer and/or other diluent.
[0180] The kits of the present invention will also typically
include a means for containing the vials in close confinement for
commercial sale, such as, e.g., injection and/or blow-molded
plastic containers into which the desired vials are retained.
[0181] Such kits may also include components that facilitate
isolation of the DNA template, long dsRNA, or siRNA. It may also
include components that preserve or maintain the nucleic acids or
that protect against their degradation. Such components may be
RNAse-free or protect against RNAses, such as RNase inhibitors.
Such kits generally will comprise, in suitable means, distinct
containers for each individual reagent or solution.
[0182] A kit can include instructions for employing the kit
components as well the use of any other reagent not included in the
kit. Instructions may include variations that can be
implemented.
[0183] It is contemplated that such reagents are embodiments of
kits of the invention. Such kits, however, are not limited to the
particular items identified above and may include any labeling
reagent or reagent that promotes or facilitates the labeling of a
nucleic acid to trigger RNAi.
IV. Examples
[0184] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
EXAMPLE 1
Materials and Methods
[0185] Transfection of GFP siRNAs or a negative control siRNA:
Transfection was performed in adherent HeLa cells expressing GFP on
glass cover slips in a 24 well dish using siPORT Lipid Reagent. At
approximately 24 hours prior to transfection, Hela cells were
plated into a 24-well dish at an appropriate density
.about.5.times.10.sup.4 cells/well in their normal growth media,
DMEM/10% FBS. The cells were incubated at 37.degree. C. overnight
in humidified 5% CO.sub.2 incubator.
[0186] Formation of a reagent/siRNA complex was performed in a
sterile polystyrene 12.times.75 mm tubes. Dilute 2 ul of siPORT
Lipid Reagent was added dropwise into 5.5 ul Opti-MEM.RTM. I
complexing medium for a 7.5 ul final volume. The final volume was
subsequently vortexed thoroughly and then left alone at room
temperature for 10 min.
[0187] In each well, dilute 1.25 ul of (20 uM) of chemically
synthesized siRNAs was added into 40 ul Opti-MEM.RTM. I media.
Subsequently, diluted siRNAs was added to diluted siPORT Lipid
Reagent, mix by gentle pipetting. Incubation occurred at room
temperature for 20 min.
[0188] Cell preparation occurred by washing the cells with
Opti-MEM.RTM. I, then adjusting the volume of media in each well
containing cells to the pre-transfection volume of 200 .mu.l
(Opti-MEM.RTM. I). The reagent/siRNA complex was then added
dropwise onto the cells. Without swirling, the dish was rocked back
and forth to evenly distribute the complexes. Incubation occurred
for 4 hours at 37.degree. C. in humidified 5% CO.sub.2 incubator.
Subsequently, 500 ul fresh growth medium containing 1.5 times the
normal concentration of serum was added to each well.
[0189] Assays were performed 48h post transfection by analyzing GFP
fluorescent signal using a fluorescent microscope.
[0190] Transfection of GAPDH siRNAs or a negative control siRNA:
Transfection was performed into adherent HeLa cells in a 24 well
dish using siPORT Lipid Reagent. At approximately 24 hours prior to
transfection, Hela cells were plated into a 24-well dish at an
appropriate density .about.5.times.10.sup.4 cells/well in their
normal growth media, DMEM/10% FBS. Incubation of the cells occurred
at 37.degree. C. overnight in humidified 5% CO.sub.2 incubator.
[0191] Formation of the reagent/siRNA complex occurred in sterile
polystyrene 12.times.75 mm tubes. Dilute 2 ul of siPORT Lipid
Reagent was added dropwise into 5.5 ul Opti-MEM.RTM. I complexing
medium for a 7.5 ul final volume. The final volume was vortexed
thoroughly, and left to sit at room temperature for 10 min. For
each well, dilute 1.25 ul of (20 uM) chemically synthesized siRNAs
was placed into 40 ul Opti-MEM.RTM. I media. Diluted siRNAs were
added to diluted siPORT Lipid Reagent, mix by gentle pipetting.
Incubation occurred at room temperature for 20 min.
[0192] Cell preparation occurred by washing the cells with
Opti-MEM.RTM. I, and then adjusting the volume of media in each
well containing cells to the pre-transfection volume of 200 .mu.l
(Opti-MEM.RTM. I). Reagent/siRNA complex was added dropwise onto
the cells by gently rocking the dish back and forth to evenly
distribute the complexes. Incubation occurred for 4 hours at
37.degree. C. in a humidified 5% CO.sub.2 incubator. Subsequently,
500 ul fresh growth medium containing 1.5 times the normal
concentration of serum was added to each well.
[0193] Assays were performed 48h post transfection by analyzing
GAPDH gene knockdown using western blot analysis and real time
PCR.
[0194] Real time and western analysis: Samples were harvested 72
hours after transfection and were subjected to RNA and protein
isolation using the PARIS.TM. Kit. To analyze RNA expression, RNA
was reverse transcribed using the RETROscript.RTM. Kit, and target
cDNA levels were analyzed by real-time PCR using SYBR.RTM. Green
detection with primers specific to GAPDH. Target gene expression in
the transfected cells was compared to cells transfected with an
equal concentration of the Silencer Negative Control #1 siRNA.
Input cDNA in the different samples was normalized using real-time
PCR data for 18S rRNA. The bar graphs (FIG. 2A) represent an
average of three data points.
[0195] Protocol for Western blot with Anti-GAPDH: Total protein
concentration was determined using Bio-Rad Protein Assay Reagent
(Cat #500-0006). Protein was loaded onto an acrylamide stacking
gel-containing SDS. Mini Protein III system from Bio-Rad can be
used. The gel was run at 200V until protein migrated approximately
2/3 of the gel distance. The protein was transferred at 300 mA to
nitrocellulose membrane using the mini Protein III transfer
apparatus. To block non-specific binding, the membrane was immersed
in blocking reagent (1% Dry Milk in 1.times.PBS) for 1 hr at room
temperature with rocking. The membrane was subsequently washed with
50 ml of PBST for 3.times.5 min. The Anti-GAPDH antibody was
diluted in fresh blocking reagent and add 25 ml final volume to the
membrane. GAPDH was used at 1 .mu.g/ml final. The diluted GAPDH
antibody can be reused for up to 3 times. The membrane was then
incubated with the diluted primary antibody for 1 hr at room
temperature with rocking. Subsequently, the membrane was washed
with 50 ml of PBST (0.1% Tween-20 in 1.times.PBS) for 3.times.5
min. The secondary antibody (Peroxidase conjugated rabbit
anti-mouse IgG, Sigma, Cat #A-9917) was diluted in fresh blocking
reagent. The membrane was subsequently incubated with the diluted
secondary antibody for 60 min at room temperature with rocking. The
membrane was then washed with 50 ml of PBST for 3.times.5 min.
Detection was performed by using ECL Detection Kits.
EXAMPLE 2
Chemically Synthesized siRNAs Smaller Than 21 bp Mediate RNAi
[0196] The inventors designed 12, 15, 17, 18, and 21 base siRNA and
tested their potency in silencing GFP (FIGS. 1A-B). The inventors
synthesized these siRNA's by techniques that are known in the art
and discussed throughout the specification. Table 1 includes the
nucleic acid sequences of these molecules. TABLE-US-00002 TABLE 1
Nucleic Acid Sequence* SEQ ID NO. GFP 12 1 and 2 s 5' CAGGAACGCATT
3' as 5' TGCGUUCCUGUA 3' GFP 15 3 and 4 s 5' GUACAGGAACGCATT 3' as
5' UGCGUUCCTGUACAU 3' GFP 17 5 and 6 s 5' AUGUACAGGAACGCATT 3' as
5' UGCGUUCCUGUACAUAA 3' GFP 18 7 and 8 s 5' UAUGUACAGGAACGCATT 3'
as 5' UGCGUUCCUGUACAUAAG 3' GFP 21 9 and 10 s 5'
GGUUAUGUACAGGAACGCATT 3' as 3' UGCGUUCCUGUACAUAAGCTT 5' *"s" is
sense and "as" is antisense.
[0197] These siRNAs were able to knock down the expression of their
target gene (FIGS. 1A-B). HeLa cells expressing GFP were
transfected with the indicated siRNA and analyzed for the reduction
in GFP levels using fluorescent microscope and image analysis
software. The inventors also analyzed the effects that these siRNAs
had on PKR activity. In vitro, the 21 base siRNA induced PKR more
than the smaller siRNA sequences suggesting that shorter dsRNA may
cause fewer off-target effects.
EXAMPLE 3
Chemically Synthesized siRNAs can Silence an Endogenous Gene
[0198] Smaller siRNA molecules targeting GAPDH were also tested to
determine if an endogenous gene could be silenced. FIGS. 2A-B
include data that demonstrates that siRNA smaller than 21 base
pairs can knock down endogenous gene expression. These data were
obtained by western and real time PCR analysis. The nucleic acid
sequences of these smaller siRNAs are listed in Table 2. The
inventors synthesized these siRNA's by techniques that are known in
the art and discussed throughout the specification. TABLE-US-00003
TABLE 2 Last 4 bp Last 4 bp SEQ % GC 5' % GC 5' Nucleic Acid
Sequence* ID NO. % GC (as) (s) GAP80 21 11 and 8/21 = 1/4 = 25% 3/4
= 75% s 5' GUGGAUAUUGUUGCCAUCATT 12 38% 3' as 3'
TTGACCUAUAACAACGGUAGU 5' OFF FROM 5' END OF s STRAND GAP80-20 13
and 7/20 = 1/4 = 25% 2/4 = s 5' UGGAUAUUGUUGCCAUCATT 3' 14 35% 50%
as 3' UCACCUAUAACAACGGUAGU 5' GAP80-19 15 and 7/19 = 1/4 = 25% 2/4
= s 5' GGAUAUUGUUGCCAUCATT 3' 16 37% 50% as 3' CACCUAUAACAACGGUAGU
5' GAP80-18 17 and 6/18 = 1/4 = 25% 1/4 = 25% s 5'
GAUAUUGUUGCCAUCATT 3' 18 33% as 3' ACCUAUAACAACGGUAGU 5' GAP80-17
19 and 5/17 = 1/4 = 25% 0/40 = 0% s 5' AUAUUGUUGCCAUCATT 3' 20 29%
as 3' CCUAUAACAACGGUAGU 5' GAP80-16 21 and 5/16 = 1/4 = 25% 0/4 =
0% s 5' UAUUGUUGCCAUCATT 3' 22 31% as 3' CUAUAACAACGGUAGU 5' OFF
FROM 5' END OF as STRAND GAP80-20 23 and 8/20 = 2/4 = 3/4 = 75% s
5' GUGGAUAUUGUUGCCAUCTT 3' 24 40% 50% as 3' TTCACCUAUAACAACGGUAG 5'
Gap80-19 25 and 7/19 = 2/4 = 3/4 = 75% s 5' GUGGAUAUUGUUGCCAUTT 3'
26 37% 50% as 3' TTCACCUAUAACAACGGUA 5' Gap80-18 27 and 7/18 = 3/4
= 75% 3/4 = 75% s 5' GUGGAUAUUGUUGCCATT 3' 28 39% as 3'
TTCACCUAUAACAACGGU 5' GAP80-17 29 and 7/17 = 3/4 = 75% 3/4 = 75% s
5' GUGGAUAUUGUUGCCTT 3' 30 41% as 3' TTCACCUAUAACAACGG 5' GAP80-16
31 and 6/16 = 2/4 = 3/4 = 75% s 5' GUGGAUAUUGUUGCTT 3' 32 38% 50%
as 3' TTCACCUAUAACAACG 5' *"s" is sense and "as" is antisense.
EXAMPLE 4
Chemically Synthesized siRNAs that are Smaller in Length to
Cyclophilin
[0199] The inventors have also designed siRNAs that are smaller in
length to cyclophilin. The inventors synthesized these siRNA's by
techniques that are known in the art and discussed throughout the
specification. These siRNAs are listed in Table 3 and are active
against endogenous genes. The design of smaller siRNA against other
genes using the procedure discussed throughout the specification is
contemplated. TABLE-US-00004 TABLE 3 Last 4 bp Last 4 bp SEQ % GC5'
% GC 5' Nucleic Acid Sequence* ID NO. % GC (as) (s) Cyclo 175 21 33
and 7/21 = 3/4 = 75% 2/4 = s 5' AGGAUUUGGUUAUAAGGGUTT 34 33% 50% 3'
as 3' TTUCCUAAACCAAUAUUCCCA 5' OFF FROM 5' END OF sSTRAND Cyclo 175
20 35 and 7/20 = 3/4 = 75% 2/4 = s 5' GGAUUUGGUUAUAAGGGUTT 3' 36
35% 50% as 3' TTCCUAAACCAAUAUUCCCA 5' Cyclo 175 19 37 and 6/19 =
3/4 = 75% 1/4 = 25% s 5' GAUUUGGUUAUAAGGGUTT 3' 38 32% as 3'
TTCUAAACCAAUAUUCCCA 5' Cyclo 175 18 39 and 5/18 = 3/4 = 75% 0/4 =
0% s 5' AUUUGGUUAUAAGGGUTT 3' 40 28% as 3' TTUAAACCAAUAUUCCCA 5'
Cyclo 175 17 41 and 5/17 = 3/4 = 75% 1/4 = 25% s 5'
UUUGGUUAUAAGGGUTT 3' 42 29% as 3' TTAAACCAAUAUUCCCA 5' Cyclo 175 16
43 and 5/16 = 3/4 = 75% 2/4 = s 5' UUGGUUAUAAGGGUTT 3' 44 31% 50%
as 3' TTAACCAAUAUUCCCA 5' OFF FROM 5' END OF as STRAND Cyclo 175 20
45 and 7/20 = 3/4 = 75% 2/4 = s 5' AGGAUUUGGUUAUAAGGGTT 3' 46 35%
50% as 3' TTUCCUAAACCAAUAUUCCC 5' Cyclo 175 19 47 and 6/19 = 2/4 =
2/4 = s 5' AGGAUUUGGUUAUAAGGTT 3' 48 32% 50% 50% as 3'
TTUCCUAAACCAAUAUUCC 5' Cyclo 175 18 49 and 5/18 = 1/4 = 25% 2/4 = s
5' AGGAUUUGGUUAUAAGTT 3' 50 28% 50% as 3' TTUCCUAAACCAAUAUUC 5'
Cyclo 175 17 51 and 4/17 = 0/4 = 0% 2/4 = s 5' AGGAUUUGGUUAUAATT 3'
52 24% 50% as 3' TTUCCUAAACCAAUAUU 5' Cyclo 175 16 53 and 4/16 =
0/4 = 0% 2/4 = s 5' AGGAUUUGGUUAUATT 3' 54 25% 50% as 3'
TTUCCUAAACCAAUAU 5' *"s" is sense and "as" is antisense.
[0200] All of the compositions and/or methods disclosed and claimed
herein can be made and executed without undue experimentation in
light of the present disclosure. While the compositions and methods
of this invention have been described in terms of preferred
embodiments, it will be apparent to those of skill in the art that
variations may be applied to the compositions and/or methods and in
the steps or in the sequence of steps of the method described
herein without departing from the concept, spirit and scope of the
invention. More specifically, it will be apparent that certain
agents that are both chemically and physiologically related may be
substituted for the agents described herein while the same or
similar results would be achieved. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
REFERENCES
[0201] The following references are specifically incorporated
herein by reference. [0202] U.S. Prov. Appl. 60/353,332 [0203] U.S.
Pat. RE 35,443 [0204] U.S. Pat. No. 4,554,101 [0205] U.S. Pat. No.
4,659,774 [0206] U.S. Pat. No. 4,682,195 [0207] U.S. Pat. No.
4,683,202 [0208] U.S. Pat. No. 4,684,611 [0209] U.S. Pat. No.
4,704,362 [0210] U.S. Pat. No. 4,704,362 [0211] U.S. Pat. No.
4,786,600 [0212] U.S. Pat. No. 4,800,159 [0213] U.S. Pat. No.
4,816,571 [0214] U.S. Pat. No. 4,883,750 [0215] U.S. Pat. No.
4,952,496 [0216] U.S. Pat. No. 4,952,500 [0217] U.S. Pat. No.
4,959,463 [0218] U.S. Pat. No. 5,026,645 [0219] U.S. Pat. No.
5,037,745 [0220] U.S. Pat. No. 5,102,802 [0221] U.S. Pat. No.
5,141,813 [0222] U.S. Pat. No. 5,214,136 [0223] U.S. Pat. No.
5,221,619 [0224] U.S. Pat. No. 5,223,618 [0225] U.S. Pat. No.
5,264,566 [0226] U.S. Pat. No. 5,302,523 [0227] U.S. Pat. No.
5,322,783 [0228] U.S. Pat. No. 5,378,825 [0229] U.S. Pat. No.
5,384,253 [0230] U.S. Pat. No. 5,428,148 [0231] U.S. Pat. No.
5,445,934 [0232] U.S. Pat. No. 5,446,137 [0233] U.S. Pat. No.
5,464,765 [0234] U.S. Pat. No. 5,466,786 [0235] U.S. Pat. No.
5,470,967 [0236] U.S. Pat. No. 5,480,980 [0237] U.S. Pat. No.
5,538,877 [0238] U.S. Pat. No. 5,538,880 [0239] U.S. Pat. No.
5,550,318 [0240] U.S. Pat. No. 5,554,744 [0241] U.S. Pat. No.
5,563,055 [0242] U.S. Pat. No. 5,574,146 [0243] U.S. Pat. No.
5,580,859 [0244] U.S. Pat. No. 5,583,013 [0245] U.S. Pat. No.
5,589,466 [0246] U.S. Pat. No. 5,591,601 [0247] U.S. Pat. No.
5,591,616 [0248] U.S. Pat. No. 5,602,240 [0249] U.S. Pat. No.
5,602,244 [0250] U.S. Pat. No. 5,610,042 [0251] U.S. Pat. No.
5,610,289 [0252] U.S. Pat. No. 5,614,617 [0253] U.S. Pat. No.
5,623,070 [0254] U.S. Pat. No. 5,637,683 [0255] U.S. Pat. No.
5,645,897 [0256] U.S. Pat. No. 5,652,099 [0257] U.S. Pat. No.
5,656,610 [0258] U.S. Pat. No. 5,670,663 [0259] U.S. Pat. No.
5,672,697 [0260] U.S. Pat. No. 5,681,947 [0261] U.S. Pat. No.
5,700,922 [0262] U.S. Pat. No. 5,702,932 [0263] U.S. Pat. No.
5,705,629 [0264] U.S. Pat. No. 5,708,154 [0265] U.S. Pat. No.
5,714,606 [0266] U.S. Pat. No. 5,728,525 [0267] U.S. Pat. No.
5,736,524 [0268] U.S. Pat. No. 5,744,305 [0269] U.S. Pat. No.
5,763,167 [0270] U.S. Pat. No. 5,777,092 [0271] U.S. Pat. No.
5,780,448 [0272] U.S. Pat. No. 5,789,215 [0273] U.S. Pat. No.
5,792,847 [0274] U.S. Pat. No. 5,795,715 [0275] U.S. Pat. No.
5,824,528 [0276] U.S. Pat. No. 5,843,650 [0277] U.S. Pat. No.
5,846,709 [0278] U.S. Pat. No. 5,846,783 [0279] U.S. Pat. No.
5,849,497 [0280] U.S. Pat. No. 5,849,546 [0281] U.S. Pat. No.
5,849,547 [0282] U.S. Pat. No. 5,858,652 [0283] U.S. Pat. No.
5,858,988 [0284] U.S. Pat. No. 5,859,221 [0285] U.S. Pat. No.
5,866,366 [0286] U.S. Pat. No. 5,869,320 [0287] U.S. Pat. No.
5,872,232 [0288] U.S. Pat. No. 5,882,864 [0289] U.S. Pat. No.
5,886,165 [0290] U.S. Pat. No. 5,891,681 [0291] U.S. Pat. No.
5,891,681 [0292] U.S. Pat. No. 5,912,148 [0293] U.S. Pat. No.
5,916,776 [0294] U.S. Pat. No. 5,916,779 [0295] U.S. Pat. No.
5,922,574 [0296] U.S. Pat. No. 5,928,905 [0297] U.S. Pat. No.
5,928,906 [0298] U.S. Pat. No. 5,932,451 [0299] U.S. Pat. No.
5,935,825 [0300] U.S. Pat. No. 5,939,291 [0301] U.S. Pat. No.
5,942,391 [0302] U.S. Pat. No. 5,945,100 [0303] U.S. Pat. No.
5,981,274 [0304] U.S. Pat. No. 5,994,624 [0305] U.S. Pat. No.
6,114,152 [0306] U.S. Pat. No. 6,251,666 [0307] U.S. Pat. No.
6,309,823 [0308] U.S. Pat. No. 6,316,193 [0309] U.S. Pat. No.
6,322,971 [0310] U.S. Pat. No. 6,324,479 [0311] U.S. Pat. No.
6,329,140 [0312] U.S. Pat. No. 6,329,209 [0313] PCT Applic. No.
PCT/US87/00880 [0314] PCT Applic. No. PCT/US89/01025 [0315] PCT
Applic. No. WO 00/44914 [0316] PCT Applic. No. WO 01/68836 [0317]
PCT Applic. No. WO 01/36646 [0318] PCT Applic. No. WO 89/100700
[0319] PCT Applic. No. WO 99/32619 [0320] PCT Applic. No. WO
88/10315 [0321] PCT Applic. No. WO 94/09699 [0322] PCT Applic. No.
WO 90/07641 [0323] PCT Applic. No. WO 95/06128 [0324] PCT Applic.
No. WO 91/05,866 [0325] PCT Applic. No. WO 91/02,818 [0326] GB
Application No. 2 202 328 [0327] European Appl. 0,178,863 [0328]
European Appl. 266,032 [0329] European Appl. 266,032 [0330]
European Appl. 320,308 [0331] European Appl. 329,822 [0332]
Antisense Drug Technology, Stanley T. Crooke (ed), Marcel Dekker
and Co, Basel, Switzerland, Chapter 6, 2001. [0333] Ausubel et al.,
In: Current Protocols in Molecular Biology, John, Wiley and Sons,
Inc, New York, 1994. [0334] Baglioni and Nilson, Interferon,
5:23-42, 1983. [0335] Beaucage and Lyer, Tetrahedron, 48:2223-2311,
1992. [0336] Bernstein et al., Nature, 409: 363-366, 2001. [0337]
Blaszczyk et al., Structure, 9(12):1225-1236, 2001. [0338] Bosher
and Labouesse, Nat. Cell Biol., 2:E31-E36, 2000. [0339] Brown et
al., Ambion TechNotes 9(1): 3-6, 2002. [0340] Brummelkamp et al.,
Science, 296(5567):550-553, 2002. [0341] Calegari et al., Proc Natl
Acad Sci USA, 99(22):14236, 2002. [0342] Caplen et al., Proc Natl
Acad Sci USA, 98: 9742-9747, 2001. [0343] Chen and Okayama, Mol.
Cell Biol., 7(8):2745-2752, 1987. [0344] Cogoni and Macino,
Science, 286:342-2344, 1999. [0345] Cogoni and Macino, Nature,
399:166-169, 1999. [0346] Court, in "Control of Messenger RNA
Stability" (J. G. Belarco and G. Brauerman, eds., Academic Press,
New York) 1993. [0347] Cummins et al., In IRT: Nucleosides and
nucleosides, La Jolla Calif., 72, 1996. [0348] Dalmay et al., EMBO
J, 20:2069-2078, 2001. [0349] Dalmay et al., Cell, 101:543-553,
2000. [0350] DeRisi et al., Nature Genetics 14:457-460, 1996.
[0351] Didenko, Biotechniques, 31(5):1106-16, 1118, 1120-1, 2001.
[0352] Dunn, in "The Enzymes" (P. D. Boyer, ed., Academic Press,
New York) 1982. [0353] Elbashir et al., Genes Dev. 15: 188-200,
2001. [0354] Elbashir et al., Nature, 411:494-498, 2001. [0355]
Emptage et al., Neuron, 2001 January;29(1):197-208, 2001. [0356]
Fechheimer et al., Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987.
[0357] Fire et al., Nature, 391:806-811, 1998. [0358] Fodor et al.,
Science, 251:767-773, 1991. [0359] Ford and Latham, R&D
Magazine, pp. 48-50, July 2003. [0360] Forster et al., Nucleic
Acids Res., 13(3):745-761, 1985. [0361] Fraley et al., Proc. Natl.
Acad. Sci. USA, 76:3348-3352, 1979. [0362] Froehler et al., Nucleic
Acids Res., 14(13):5399-5407, 1986. [0363] Frohman, In: PCR
Protocols: A Guide To Methods and Applications, Academic Press, NY,
1990. [0364] Gillam et al., J. Biol. Chem., 253:2532, 1978. [0365]
Gillam et al., Nucleic Acids Res., 6:2973, 1979. [0366] Gopal, Mol.
Cell. Biol., 5:1188-1190,1985. [0367] Graham and Van Der Eb,
Virology, 52:456-467, 1973. [0368] Griffey et al., J. Mass.
Spectrom., 32(3):305-13, 1997. [0369] Grishok et al., Cell, 106:
23-34, 2001. [0370] Hacia et al., Nature Genetics, 14:441-447,
1996. [0371] Hamilton and Baulcombe, Science, 286:950-952, 1999.
[0372] Hammond et al., Nat. Rev. Genet., 2(2):110-9, 2001. [0373]
Harland and Weintraub, J. Cell. Biol., 101:1094-1099, 1985. [0374]
Higgins et al., Comput. Appl. Biosci., 8(2):189-191, 1992. [0375]
Hutvagner et al., Science, 293:834-838, 2001. [0376] Innis et al.,
Proc. Natl. Acad. Sci. USA, 85(24):9436-9440, 1988. [0377] Inouye
and Inouye, Nucleic Acids Res., 13:3101-3109, 1985. [0378] Itakura
and Riggs, Science, 209:1401-1405, 1980. [0379] Itakura et al., J.
Biol. Chem., 250:4592 1975. [0380] Jacque et al., Nature, 2002.
[0381] Johnson et al., In: Biotechnology and Pharmacy, Pezzuto et
al., (eds), Chapman and Hall, New York, 1993. [0382] Kaeppler et
al., Plant Cell Reports, 9:415-418, 1990. [0383] Kaneda et al.,
Science, 243:375-378, 1989. [0384] Kato et al., J. Biol. Chem.,
266:3361-3364, 1991. [0385] Ketting et al., Cell, 99:133-141, 1999.
[0386] Kharrat et al., EMBO. J., 14(14):3572-3584, 1995. [0387]
Khorana, Science, 203, 614 1979. [0388] Klostermeier and Millar,
Biopolymers, 61(3):159-79, 2001-2002 [0389] Knight et al., Science,
2:2, 2001. [0390] Komberg and Baker, In: DNA Replication, 2nd Ed.,
Freeman, San Francisco, 1992. [0391] Kwoh et al., Proc. Natl. Acad.
Sci. USA, 86: 1173, 1989. [0392] Kyte and Doolittle, J. Mol. Biol.,
157(1):105-132, 1982. [0393] Lee et al., DNA Cell Biol.,
16(11):1267-1275, 1997. [0394] Lin and Avery, Nature, 402:128-129,
1999. [0395] Maskos et al., Nuc. Acids. Res. 20:1679-1684, 1992.
[0396] Miyagishi and Taira, Biotechnol., 5:497-500, 2002. [0397]
Montgomery et al., Proc. Natl. Acad. Sci. USA, 95:155-2-15507,
1998. [0398] Mourrain et al., Cell, 101:533, 2000. [0399]
Nicholson, FEMS Microbiol. Rev. 23: 371, 1999. [0400] Nicolau and
Sene, Biochim. Biophys. Acta, 721:185-190, 1982. [0401] Nicolau et
al., Methods Enzymol., 149:157-176, 1987. [0402] Nishikura, Cell
16:415-418, 2001. [0403] Novina et al., Nat. Med., 8:681-686, 2002.
[0404] Ohara et al., Proc. Natl. Acad. Sci. USA, 86:5673-5677,
1989. [0405] Omirulleh et al., Plant Mol. Biol., 21(3):415-428,
1993. [0406] Paul et al., Nat. Biotechnol., 20:505-508, 2002.
[0407] Pease et al., Proc. Natl. Acad. Sci. USA, 91:5022-5026,
1994. [0408] Plasterk and Ketting, Curr. Opin. Genet. Dev.,
10:562-567, 2000. [0409] Potrykus et al., Mol. Gen. Genet.,
199(2):169-77, 1985. [0410] Rippe et al., Mol. Cell. Biol.,
10:689-695, 1990. [0411] Robertson et al., J. Biol. Chem. 243: 82,
1968. [0412] Saiki et al. Science, 230:1350-1354, 1985 [0413]
Sambrook et al., In: Molecular cloning, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 2001. [0414] Scheit,
In: Synthesis and Biological Function, Wiley-Interscience, NY,
171-172, 1980. [0415] Schena et al., Science 270:467-470, 1995a.
[0416] Schena et al., Proc. Natl. Acad. Sci. USA 93:10539-11286,
1995b. [0417] Shalon et al., Genome Res. 6:639-645, 1996. [0418]
Sharp and Zamore, Science, 287:2431-2433, 2000. [0419] Sharp, Genes
Dev., 13:139-141, 1999. [0420] Shoemaker et al., Nature Genetics,
14:450-456, 1996. [0421] Smardon et al., Curr. Biol., 10: 169-178,
2000. [0422] Sui et al., Proc. Natl. Acad. Sci. USA,
99(8):5515-5520, 2002. [0423] Tabara et al., Cell, 99:123-132,
1999. [0424] Thompson et al., Nucleic Acids Res., 22(22):4673-4680,
1994. [0425] Trotta et al., Cancer Cell 3:(2):145-60, 2003. [0426]
Tuschl, Chembiochem., 2:239-245, 2001. [0427] Walker et al., Proc.
Natl. Acad. Sci. USA, 89:392-396 1992. [0428] Waterhouse et al.,
Nature, 411:834-842, 2001. [0429] Williams et al., Int. J. Dev.
Biol., 41(2):359-364, 1997. [0430] Wong et al., Gene, 10:87-94,
1980. [0431] Wu-Scharf et al., Science, 290:1159-1162, 2000. [0432]
Yang et al., Proc. Natl. Acad. Sci. USA, 99(15): 9942-7, 2002.
[0433] Yu et al., Proc. Natl. Acad. Sci. USA, 99:6047-6052, 2002.
[0434] Zamore et al., Cell,. 101:25-33, 2000. [0435] Zamore, Nat.
Struct. Biol., 8:746-750, 2001.
Sequence CWU 1
1
54 1 12 DNA Artificial Sequence Description of Artificial Sequence
Synthetic Primer 1 caggaacgca tt 12 2 12 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising a
nucleotide sequence 2 tgcguuccug ua 12 3 15 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising a
nucleotide sequence 3 guacaggaac gcatt 15 4 15 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising a nucleotide sequence 4 ugcguucctg uacau 15 5 17 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising a nucleotide sequence 5 auguacagga acgcatt
17 6 17 DNA Artificial Sequence Description of Combined DNA/RNA
Molecule Isolated RNA comprising anucleotide sequence 6 ugcguuccug
uacauaa 17 7 18 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 7
uauguacagg aacgcatt 18 8 18 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 8 ugcguuccug uacauaac 18 9 21 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 9 gguuauguac aggaacgcat t 21 10 21 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 10 ugcguuccug
uacauaacct t 21 11 21 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 11 guggauauug uugccaucat t 21 12 21 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising anucleotide sequence 12 ttcaccuaua acaacgguag u 21 13 20
DNA Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 13 uggauauugu
ugccaucatt 20 14 20 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 14
ucaccuauaa caacgguagu 20 15 19 DNA Artificial Sequence Description
of Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 15 ggauauuguu gccaucatt 19 16 19 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 16 caccuauaac aacgguagu 19 17 18 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 17 gauauuguug ccaucatt
18 18 18 DNA Artificial Sequence Description of Combined DNA/RNA
Molecule Isolated RNA comprising anucleotide sequence 18 accuauaaca
acgguagu 18 19 17 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 19
auauuguugc caucatt 17 20 17 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 20 ccuauaacaa cgguagu 17 21 16 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 21 uauuguugcc aucatt 16 22 16 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising anucleotide sequence 22 cuauaacaac gguagu 16 23 20 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 23 guggauauug
uugccauctt 20 24 20 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 24
ttcaccuaua acaacgguag 20 25 19 DNA Artificial Sequence Description
of Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 25 guggauauug uugccautt 19 26 19 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 26 ttcaccuaua acaacggua 19 27 18 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 27 guggauauug uugccatt
18 28 18 DNA Artificial Sequence Description of Combined DNA/RNA
Molecule Isolated RNA comprising anucleotide sequence 28 ttcaccuaua
acaacggu 18 29 17 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 29
guggauauug uugcctt 17 30 17 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 30 ttcaccuaua acaacgg 17 31 16 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 31 guggauauug uugctt 16 32 16 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising anucleotide sequence 32 ttcaccuaua acaacg 16 33 21 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 33 aggauuuggu
uauaagggut t 21 34 21 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 34 ttuccuaaac caauauuccc a 21 35 20 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising anucleotide sequence 35 ggauuugguu auaagggutt 20 36 20
DNA Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 36 ttccuaaacc
aauauuccca 20 37 19 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 37
gauuugguua uaagggutt 19 38 19 DNA Artificial Sequence Description
of Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 38 ttcuaaacca auauuccca 19 39 18 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 39 auuugguuau aagggutt 18 40 18 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising anucleotide sequence 40 ttuaaaccaa uauuccca 18 41 17 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 41 uuugguuaua agggutt
17 42 17 DNA Artificial Sequence Description of Combined DNA/RNA
Molecule Isolated RNA comprising anucleotide sequence 42 ttaaaccaau
auuccca 17 43 16 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 43
uugguuauaa gggutt 16 44 16 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 44 ttaaccaaua uuccca 16 45 20 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 45 aggauuuggu uauaagggtt 20 46 20 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 46 ttuccuaaac
caauauuccc 20 47 19 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 47
aggauuuggu uauaaggtt 19 48 19 DNA Artificial Sequence Description
of Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 48 ttuccuaaac caauauucc 19 49 18 DNA Artificial Sequence
Description of Combined DNA/RNA Molecule Isolated RNA comprising
anucleotide sequence 49 aggauuuggu uauaagtt 18 50 18 DNA Artificial
Sequence Description of Combined DNA/RNA Molecule Isolated RNA
comprising anucleotide sequence 50 ttuccuaaac caauauuc 18 51 17 DNA
Artificial Sequence Description of Combined DNA/RNA Molecule
Isolated RNA comprising anucleotide sequence 51 aggauuuggu uauaatt
17 52 17 DNA Artificial Sequence Description of Combined DNA/RNA
Molecule Isolated RNA comprising anucleotide sequence 52 ttuccuaaac
caauauu 17 53 16 DNA Artificial Sequence Description of Combined
DNA/RNA Molecule Isolated RNA comprising anucleotide sequence 53
aggauuuggu uauatt 16 54 16 DNA Artificial Sequence Description of
Combined DNA/RNA Molecule Isolated RNA comprising anucleotide
sequence 54 ttuccuaaac caauau 16
* * * * *
References