U.S. patent application number 10/947786 was filed with the patent office on 2006-06-22 for production of functional proteins: balance of shear stress and gravity.
This patent application is currently assigned to NASA, Johnson Space Center. Invention is credited to Thomas John Goodwin, Timothy Grant Hammond, James Howard Kaysen.
Application Number | 20060134733 10/947786 |
Document ID | / |
Family ID | 34317308 |
Filed Date | 2006-06-22 |
United States Patent
Application |
20060134733 |
Kind Code |
A1 |
Goodwin; Thomas John ; et
al. |
June 22, 2006 |
Production of functional proteins: balance of shear stress and
gravity
Abstract
The present invention provides for a method of culturing cells
and inducing the expression of at least one gene in the cell
culture. The method provides for contacting the cell with a
transcription factor decoy oligonucleotide sequence comprising a
nucleotide sequence encoding a shear stress response element.
Inventors: |
Goodwin; Thomas John;
(Friendswood, TX) ; Hammond; Timothy Grant; (New
Orleans, LA) ; Kaysen; James Howard; (New Orleans,
LA) |
Correspondence
Address: |
James M. Cate;HA/Office of Patent Counsel
2101 NASA Road One
Houston
TX
77058
US
|
Assignee: |
NASA, Johnson Space Center
Houston
TX
|
Family ID: |
34317308 |
Appl. No.: |
10/947786 |
Filed: |
September 20, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09532001 |
Mar 21, 2000 |
6946246 |
|
|
10947786 |
Sep 20, 2004 |
|
|
|
09056363 |
Apr 7, 1998 |
6730498 |
|
|
09532001 |
Mar 21, 2000 |
|
|
|
60043205 |
Apr 8, 1997 |
|
|
|
Current U.S.
Class: |
435/52 ; 435/455;
435/69.1 |
Current CPC
Class: |
C12N 2310/315 20130101;
A61K 38/00 20130101; C12N 2501/60 20130101; C12N 5/0018 20130101;
C12N 15/113 20130101; C12N 2510/02 20130101; C12N 2310/13 20130101;
C12N 15/67 20130101 |
Class at
Publication: |
435/052 ;
435/069.1; 435/455 |
International
Class: |
C12P 33/00 20060101
C12P033/00; C12P 21/06 20060101 C12P021/06; C12N 15/87 20060101
C12N015/87 |
Goverment Interests
ORIGIN OF THE INVENTION
[0002] The jointly made invention described herein was made by an
employee of the United States Government and may be manufactured
and used by or for the Government of the United States of America
for governmental purposes without the payment of any royalties
hereon or therefor.
[0003] The invention described herein was also made by inventors in
the performance of work under an agreement with Tulane Educational
Fund and is subject to the provisions of Section 305 of the
National Aeronautics and Space Act of 1958, Public Law 85-568 (72
Stat. 435; 42 U.S.C. 2457).
[0004] Federal Funding Notice
[0005] The present invention was funded by NIH Grant DK46117, NIH
R21, and NASA NRA Grant 9-811. Consequently, the United States
government has certain rights in this invention.
Claims
1-26. (canceled)
27. A shear stress response element (SSRE) transcription factor
decoy oligonucleotide comprising the nucleotide sequence selected
from the group consisting of GAGACC and GGTCTC.
28. The nucleotide of claim 27, wherein said oligonucleotide
comprises a terminal phosphothioate moiety and a phosphodiester
backbone.
29. The nucleotide of claim 27, wherein said oligonucleotide is a
contiguous single-stranded oligonucleotide comprising: i) a
sequence selected from GAGACC and GGTCTC; and ii) a sequence
compimentary to (i).
30. The nucleotide of claim 27, wherein said oligonucleotide
consists of SEQ ID NO: 1.
31. The nucleotide of claim 27, wherein said oligonucleotide passes
cell membranes and accumulates in the nuclear compartment of a
cultured cell.
32. The nucleotide of claim 31 wherein said cultured cell is grown
in two dimensional culture.
33. The nucleotide of claim 31 wherein said cultured cell is
selected from the group consisting of an epithelial cell and an
endothelial cell.
34. The nucleotide of claim 31 wherein said cultured cell is
selected from the group consisting of renal cortical cell, renal
fibroblast cell, hepatocyte, pancreatic islet, renal interstitial
cell, parathyroid cell, thyroid cell, pituitary cell, ovarian cell
and testicular cell.
35. A method of producing biomolecules comprising the steps of:
culturing at least one cell; contacting said cell with an SSRE
transcription factor decoy oligonucleotide comprising a shear
stress response element sequence selected from the group consisting
of GAGACC and GGTCTC; and isolating biomolecules from the cell
culture.
36. The method of claim 35, wherein said oligonucleotide comprises
a terminal phosphothiorate phosphothioate moiety and a
phosphodiester backbone.
37. The method of claim 36, wherein said oligonucleotide passes
cell membranes and accumulates in the nuclear compartment of said
cell.
38. The method of claim 35, wherein said cultured cell is selected
from the group consisting of an epithelial cell and an endothelial
cell.
39. The method of claim 35, wherein said cultured cell is selected
from the group consisting of renal cortical cell, renal fibroblast
cell, hepatocyte, pancreatic islet, renal interstitial cell,
parathyroid cell, thyroid cell, pituitary cell, ovarian cell and
testicular cell.
40. The method of claim 35, wherein said cultured cell is grown in
two dimensional culture.
41. The method of claim 35, wherein said cultured cell is grown in
a rotating wall vessel.
42. The method of claim 35, wherein the biomolecule is selected
from the group consisting of megalin, cubulin, erythropoietin,
1-.alpha.-hydroxylase, and 1,25-dihydroxy-vitamin D3.
43. A method of producing renal tubular epithelial cells from a
cultured cell, comprising the steps of: culturing at least one
cell; contacting said cell with an SSRE transcription factor decoy
oligonucleotide comprising a shear stress response element sequence
selected from the group consisting of GAGACC and GGTCTC; and
isolating differentiated renal tubular epithelial cells.
44. The method of claim 43, wherein said cultured cell is selected
from the group consisting of an epithelial cell and an endothelial
cell.
45. The method of claim 43, wherein said cultured cell is grown in
a rotating wall vessel.
46. The method of claim 43, wherein the renal tubular epithelial
cell produces biomolecules selected from the group consisting of
megalin, cubulin, erythropoietin, 1-.alpha.-hydroxylase, and
1,25-dihydroxy-vitamin D3.
Description
RELATED APPLICATIONS
[0001] The present application claims the benefit of 35 U.S.C.
.sctn.111(b) provisional patent application 60/043205 filed Apr. 8,
1997.
BACKGROUND OF THE INVENTION
[0006] 1. Field of the Invention
[0007] The present invention relates generally to the fields of
protein chemistry, endocrinology and gene therapy. More
specifically, the present invention relates to a method for
production of functional proteins in culture in response to shear
stress using a rotating wall vessel.
[0008] 2. Description of the Related Art
[0009] A successful and documented modality to induce polarization
and differentiation of cells in culture is the rotating wall vessel
(1-4). In rotating wall vessels gravity is balanced by equal and
opposite physical forces including shear stresses. In engineering
terms this has been claimed to simulated microgravity at boundary
conditions [Wolf D. A. and R. P. Schwarz. (1991) NASA Technical
Paper 3143].
[0010] Rotating wall vessels, including models with perfusion, are
a quantum advance. The rotating wall vessel, is a horizontally
rotated cylindrical cell culture device with a coaxial tubular
oxygenator (1, 5-7). The rotating wall vessel induces expression of
select tissue-specific proteins in diverse cell cultures (1-2,
8-9). Examples of expression of tissue-specific proteins include
carcinoembryonic antigen expression in MIP-101 colon carcinoma
cells (2), prostate specific antigen induction in human prostate
fibroblasts (7), through matrix material induction during
chondrocyte culture (8). The quiescent cell culture environment of
the rotating wall vessel balances gravity with shear and other
forces without obvious mass transfer tradeoff (1-2, 4). The
rotating wall vessel provides a culture environment suitable for
co-cultures of diverse cell types, and three dimensional tissue
construct formation.
[0011] Rotating wall vessel technology is being used in clinical
medical practice recently by facilitating pancreatic islet
implantation (4, 10). Pancreatic islets are prepared in rotating
wall vessels to maintain production and regulation of insulin
secretion. The islets are alginate encapsulated to create a
non-inflammatory immune haven, and are implanted into the
peritoneal cavity of Type I diabetic patients. This implantation of
pancreatic !islets has maintained normoglycemia for 18 months in
diabetic patients, and progressed to Phase III clinical trials (4,
10). These vessels have also been applied to, for example,
mammalian skeletal muscle tissue, cartilage, salivary glands,
ovarian tumor cells, and colon crypt cells (11-13). Previous
studies on shear stress response in endothelial cells, and rotating
wall vessel culture have been limited to structural genes (14-16).
These studies did not address the issue of a process for the
production of functional molecules, such as hormones. Shear stress
response elements have not previously been demonstrated in
epithelial cells, either for structural genes of production of
functional molecules.
[0012] Vitamin D dependent rickets has been a disease familiar to
family farms and larger animal husbandry industries for centuries
(17-18). The development of renal replacement therapy by dialysis
in humans expanded vitamin D deficient bone disease from an
occasional human clinical caveat to a common clinical problem. This
led to identification of the active form of vitamin D as 1,25-diOH
D.sub.3 and the development of a multi-billion dollar per year
worldwide market, predominantly in end-stage renal disease
patients, to provide replacement hormone clinically (18). The
active 1,25-diOH form of vitamin D.sub.3 is mainly used to treat
bone disease in dialysis patients but has*also been implicated as a
therapy for osteoporosis, and some forms of cancer. Recently, the
effects of vitamin D have been recognized to play a central role
not only in other common bone lesions such as osteoporosis due to
aging and steroid induced osteoporosis, but in immune function and
surveillance, growth and development, and cardiac and skeletal
muscle function (19-22).
[0013] Several active forms of vitamin D have been identified,
vitamin D receptors cloned, and nuclear binding proteins for the
hormone identified and cloned (17-22). Studies on the regulation of
1 .alpha.-hydroxylase activity are limited by the lack of a renal
cell line with regulated expression of the enzyme. The only reports
of 1-.alpha.-hydroxylase activity in culture utilize freshly
isolated chicken renal cortical cells in which the activity
declines precipitously within 48 hours of plating in culture
(28).
[0014] The importance of the renal 1-.alpha.-hydroxylase is best
understood by comparing the kinetics of the renal enzyme to other
forms in the body (29-30). Demonstration that nephrectomy in
pregnant rats did not completely abolish 1,25-diOH-D.sub.3
formation sparked an intensive search for extrarenal sites of 1
.alpha.-hydroxylase activity (29). Although 1.alpha.-hydroxylase
activity has been reported in monocytes, liver, aortic endothelium
and a variety of placental and fetal tissues, the enzyme kinetics
contrast sharply with the renal 1 .alpha.-hydroxylase. Extrarenal
1-.alpha.-hydroxylase has a much higher Km indicating that much
higher substrate levels are needed for activity (29). In the uremic
patient, extrarenal 1,25-diOH D.sub.3 production is very limited
due to a relative lack of substrate. Administrating large
quantities of 25-OH D.sub.3 substrate to anephric patients modestly
boosts plasma 1,25-diOH D.sub.3 levels (29).
[0015] The lack of a differentiated polarized line of renal tubular
epithelial cells for investigative purposes persists despite
extensive searches by several laboratories (31-38). Renally derived
cell lines transformed with viruses or tumor cells to produce
immortality continue as some of the most popular cell biological
tools to study polarized delivery (31, 33, 35). But these renally
derived immortal cell lines such as MDCK or LLP-CK1 retain few if
any of the differentiated features characteristic of renal
epithelial cells. Similarly, primary cultures rapidly differentiate
and modalities as diverse as basement membrane matrices, growth
supplements or Millipore inserts achieve only modest degrees of
polarity (37-38).
[0016] The pathognomonic structural features of renal proximal
tubular epithelial cells are the abundance of apically derived
microvilli, the glycoprotein content of associated intermicrovillar
clefts, and the highly distinctive arrangement of subapical
endosomal elements (39-40). Renal epithelial cells of the proximal
tubule are characterized by thousands of long apical microvilli.
The apical endosomal machinery begins in intermicrovillar clefts.
The endosomal pathway is characterized by clathrin coated vesicles,
small spherical endosomal vesicles, with deeper larger endosomal
vacuoles (33, 39). From the endosomal vacuoles proteins and lipids
either recycle to apical surface in dense apical tubules or shuttle
to lysosomes to be degraded.
[0017] A cluster of apical proteins with homologous sequence
repeats are especially desirable to express in cultured cells as
they are thought to be molecular mediators of renal injury (41-43).
Two of these proteins megalin (gp330) and cubulin (gp280)
(Moestrup, et al., J. Biol. Chem..beta.273 (9):5325-5242 (1998) are
molecular mediators of tubular vacuolation and ensuing secondary
damage. Megalin (gp330) is a receptor found on the luminal surface
of the proximal tubular cells of the kidney. Megalin binds several
proteins and drugs including aminoglycoside antibiotics and other
polybasic drugs. Megalin is expressed in the kidney, lung, testes,
ear, and placenta. The only cells which express megalin in culture
are immortalized placental cells. There is no known renal cell
culture which expresses megalin. Gp280 is a receptor found on the
luminal surface of the proximal tubular cells of the kidney. Gp280
binds several proteins and drugs including intrinsic
factor-cobalamin (vitamin B12 bound to its carrier protein) and
myeloma light chains. Cubulin (gp280) is expressed in the kidney,
ear, and placenta. The only cells which express cubulin (gp280) in
culture are immortalized placental cells. There is no known renal
cell culture which expresses cubulin (gp280).
[0018] Erythropoietin (EPO) is a hormone produced in the kidney,
and secreted into the blood. Erythropoietin controls the rate of
production of red blood cells by the bone marrow. Erythropoietin
may be produced by the interstitial cells between the tubules or
the proximal tubular cells or both. Erythropoietin production is
lost in all known renal cell culture systems. Erythropoietin is
mainly used to treat anemia in dialysis patients but is also
popular to treat the anemia of AIDS patients and many forms of
cancer.
[0019] The prior art is deficient in the lack of effective means of
producing functional proteins including hormones in response to
shear stress. Further, the prior art is deficient in the
identification of shear stress response elements in epithelial cell
genes. The present invention fulfills this longstanding need and
desire in the art.
SUMMARY OF THE INVENTION
[0020] In one embodiment of the present invention, there is
provided a method of producing a functional protein, comprising the
steps of: isolating mammalian cells; placing said cells into a
rotating wall vessel containing a cell culture comprising culture
media and culture matrix; producing three-dimensional cell
aggregates under simulated microgravity conditions; and detecting
expression of the functional protein in the cell culture.
[0021] In another embodiment of the present invention, there is
provided a method of inducing expression of at least one gene in a
cell, comprising the steps of: contacting said cell with an
transcription factor decoy oligonucleotide sequence directed
against a nucleotide sequence encoding a shear stress response
element; and determining the expression of said gene in said
cell.
[0022] In yet another embodiment of the present invention, there is
provided a transcription factor decoy, comprising an
oligonucleotide sequence directed against a nucleotide sequence
encoding a shear stress response element.
[0023] Other and further aspects, features, and advantages of the
present invention will be apparent from the following description
of the presently preferred embodiments of the invention given for
the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] So that the matter in which the above-recited features,
advantages and objects of the invention, as well as others which
will become clear, are attained and can be understood in detail,
more particular descriptions of the invention briefly summarized
above may be had by reference to certain embodiments thereof which
are illustrated in the appended drawings. These drawings form a
part of the specification. It is to be noted, however, that the
appended drawings illustrate preferred embodiments of the invention
and therefore are not to be considered limiting in their scope.
[0025] FIG. 1 shows homogeneity and structure of human renal
epithelial cells in culture. Flow cytometry frequency histograms
demonstrate number of cells positive for the proximal tubular
marker .gamma.-glutamyl transferase. FIG. 1A shows the number of
cells with .gamma.-glutamyl transferase activity as the frequency
of activity in 2000 cells compared to an unstained control with
trapping agent alone. This is the raw digest of human renal cells.
FIG. 1B shows that following differential trypsinization, the
percentage of proximal tubular cells present can be increased to
99.+-.1%. FIGS. 1C and 1D show transmission electron micrographs of
human epithelial cells in culture. The intact renal cortex in vivo
(far left panel), is compared to culture of the natural mixture of
human renal cortical cells in conventional 2-dimensional culture
(middle left panel) which is completely devoid of microvilli.
Rotating wall vessel culture of pure proximal tubular cells shows
some microvilli (middle right panel) but there are far more
microvilli during rotating wall vessel culture of the natural mix
of renal cortical cells (far right panel). Compared to these
representative images, some areas of the natural mixture of cells
in the rotating wall vessel show much greater abundance of
microvilli, and well defined desmosomes (lower panel) which are
lacking in the other cultures.
[0026] FIG. 2 shows protein expression in the rotating wall vessel.
FIG. 2A shows analysis of the expression and endosomal
compartmentation of megalin, and cubulin in renal cells following
rotating wall vessel culture. The ability of flow cytometry to make
simultaneous measurements of entrapped fluorescein dextran as an
endosomal marker and antibody binding allows construction of three
dimensional frequency histograms displaying entrapped fluorescein
dextran fluorescence against antibody binding on horizontal axes. A
control sample shows vesicles negative for fluorescein on the left
and fluorescein containing endosomes on the right (2000-vesicles
depicted left panel). A control without fluorescein entrapped shows
only the left population (not shown). Co localization of
anti-cubulin binding demonstrates that all the fluorescein positive
endosomes are positive for cubulin, while non-endosomal membranes
can be subdivided into cubulin positive and negative populations
(middle panel). This pattern is repeated for anti-megalin binding
in renal cortical cells (right panel).
[0027] FIG. 2B shows quantitation of cubulin, and megalin antibody
binding to renal cell membranes under various culture conditions.
Analysis of protein expression in cultured cells by antibody
binding used classic serial log dilution antibody curves. An
increase in binding with a decrease in dilution is pathognomonic
for specific antibody binding during flow cytometry analysis.
Binding of anti-cubulin antisera to membrane vesicles prepared from
renal cortical cells after 16 days in culture, detected by the
fluorescence of a phycoerthyrein tagged secondary antibody, shows
an almost two log increase in binding with antibody dilution (upper
left panel below). This increased cubulin antibody binding in the
cells grown in the rotating wall vessel (STLV) is more than five
times the expression seen in stirred fermentors. Similarly, there
was no detectable expression in the conventional cultures resulting
in a flat line,(not shown). Binding of normal serum and minimal
dilution of primary antisera were not detectably different. Binding
curves for anti-megalin antiserum showed a similar pattern (not
shown).
[0028] FIG. 2C depicts non-specific (minimum) and peak binding of
each antiserum following rotating wall vessel culture and
two-dimensional SDS-PAGE analysis of protein content of cells
following rotating wall vessel culture. Analysis of the protein
content of cultures of the natural mixture of rat renal cortical
cells after 16 days culture in gas permeable bags as a control
(left panel) or rotating wall vessel (right panel) depicts changes
in a select set of proteins. Molecular weight (14-220 kDa) on the
abscissa is displayed against isoelectric point (pH 3-10) on the
ordinate.
[0029] FIG. 3 shows gene expression in the rotating wall vessel.
FIG. 3A and FIG. 3B show differential display of genetic expression
of rat renal cortical cells grown in conventional culture or
rotating wall vessels. Differential display of expressed genes was
compared in aliquots of the same cells grown,in a 55 ml rotating
wall vessel (STLV) or conventional gas permeable 2-dimensional bag
controls. For differential display, copies of expressed genes were
generated by polymerase chain reaction using random 25 mer primers
and separated on a 6% DNA sequencing gel (FIG. 3A). Bands of
different intensity between control and STLV, representing
differentially expressed genes, were identified by visual
inspection, excised and reamplified using the same primers.
Differential expression and transcript size were confirmed by
Northern hybridization (FIG. 3B). PCR products were then subcloned
into the pGEM-T vector and sequenced. Sequences were compared to
the Genebank sequences using the BLAST search engine. One expressed
gene which decreased in the STLV (band D on gelabove) was
identified as rat manganese-containing superoxide dysmutase (98%
match 142 of 144 nucleotides). Two genes which increased in the
STLV, band A was identified as the interleukin-1 beta gene (100%
match for 32 of 32 nucleotides) and Band B which corresponded to a
20 kB transcript on a Northern blot appears to be a unidentified
gene that has a 76% homology to the mouse GABA transporter gene.
FIG. 3C and FIG. 3D show RT-PCR of time dependent change in genes
during rotating wall vessel culture. Semi quantitative RT-PCR shows
increases in the epithelial genes megalin, villin and
extra-cellular calcium sensing receptor (ECaR), the shear stress
response element genes ICAM, VCAM and MnSOD (FIG. 3C). There was no
change in b-actin or GADPH. Unlike in endothelial cells many of
these changes are prolonged as at 16 days megalin, ECaR, ICAM, VCAM
and villin changes persist (FIG. 3D).
[0030] FIG. 4 shows structure and effects of antisense probe for
shear stress response element on rat renal cortical epithelial
cells. FIG. 4A shows the structure. The probe with sequence
CTGAGACCGATATCGGTCTCAG (SEQ ID No:1) has two possible
conformations. As a single strand it would fold back on itself to
form a binding element for the transcription factor. As a double
strand it would then have two binding sites for the transcription
factor, one in the sense orientation and one in the antisense
orientation.
[0031] FIG. 4B shows effects of antisense shear stress response
element probe on time dependent gene expression. The antisense
probe added to conventional 2-dimensional cultures of rat renal
cortical cells at 80 nm increases MnSOD in a time dependent manner.
Comparison is made to controls with the active binding site
scrambled. In contrast the probe has no effect on villin gene
expression.
[0032] FIG. 5 shows gene expression in the rotating wall vessel:
automated gene analysis. Abundance of the expression of over 18,300
genes was assayed by annealing poly A RNA from human renal cortical
epithelial cells grown in a rotating, wall vessel for 8 days to a
filter robotically loaded with oligonucleotide primers. Poly A RNA
from a non adherent bag culture serves as a control. The filters
are shown at the top of the diagram then the analysis of shear
stress responsive genes, renal epithelium specific genes, and other
genes germane to the current analysis.
DETAILED DESCRIPTION OF THE INVENTION
[0033] The present invention is directed to a method of producing a
functional protein, comprising the steps of isolating mammalian
cells; placing said cells into a rotating wall vessel containing a
cell culture comprising culture media and culture matrix; producing
three-dimensional cell aggregates under simulated microgravity
conditions; and detecting expression of the functional protein in
the cell culture. Generally, simulated microgravity conditions
comprise a balance between gravity and oppositely directed physical
forces. Representative examples such physical forces include
sedimentational shear stress, centrifugal forces, viscosity and
coriolus forces.
[0034] Preferably, the functional protein is selected from the
group consisting of a hormone, a toxin receptor and a shear stress
dependent functional biomolecule. Representative examples of
hormones which can be produced according to the method of the
present invention include 1,25-dihydroxy-vitamin D3 and
erythropoietin. Representative examples of toxin receptors which
can be produced according to the method of the present invention
include megalin and cubulin. Representative examples of shear
stress dependent functional biomolecule which can be produced
according to the method of the present invention include is
selected from the group consisting of villin, magnesium dependent
superoxide dismutase, nitric oxide synthase, c-fos, c-jun, platelet
derived growth factor-b, transforming growth factor-b, tissue-type
plasminogen activator and monocyte chemotactic protein-1, megalin,
cubulin, erythropoietin and 1-a-hydroxylase.
[0035] Generally, any mammalian cell could be used in the methods
of the present invention. Representative examples of mammalian
cells include renal cortical cells, renal fibroblast cells,
hepatocytes, pancreatic islets, renal interstitial cells,
parathyroid cells, thyroid cells, pituitary cells, ovarian cells
and testicular cells. Generally, the cell is selected from the
group consisting of epithelial cell and endothelial cell.
Preferably, cell contains shear stress response elements.
Representative examples of shear stress response element include
GAGACC and GGTCTC.
[0036] In the methods of the present invention, the rotating wall
vessel is initiated and maintained from about 6 rotations per
minute to about 16 rotations per minute. Preferably, the
sedimentational shear stress is from about 0.2 dynes/cm2 to about
1.0 dynes/cm2. The culture matrix may contain a core structure
selected from the group consisting of cell aggregates and
microcarrier beads, although other components to such a culture
matrix are well known to those having ordinary skill in this
art.
[0037] The present invention is also directed to a method of
inducing expression of at least one gene in a cell, comprising the
steps of: contacting said cell with an transcription factor decoy
oligonucleotide sequence directed against a nucleotide sequence
encoding a shear stress response element; and determining the
expression of said gene in said cell. Generally, oligonucleotide
comprises a terminal phosphothiorate moiety and a phosphodiester
backbone and a structure which allows the oligonucleotide to pass
cell membranes and accumulate in the nuclear compartment of the
cell. Generally, the cell is a cultured cell. Preferably, the cell
is selected from the group consisting of an epithelial cell and an
endothelial cell. Representative examples of which can be used in
this method include renal cortical cell, renal fibroblast cell,
hepatocyte, pancreatic islet, renal interstitial cell, parathyroid
cell, thyroid cell, pituitary cell, ovarian cell and testicular
cell. In one embodiment, the cell is grown in two dimensional
culture. Representative examples of shear stress response elements
include GAGACC and GGTCTC. Preferably, the gene encodes a protein
selected from the group consisting of megalin, cubulin,
erythropoietin and 1-a-hydroxylase. The concentration of the
oligonucleotide useful in this method generally ranges from about
10 nm to about 10 mm.
[0038] The present invention is also directed to a transcription
factor decoy, comprising an oligonucleotide sequence directed
against a nucleotide sequence encoding a shear stress response
element. Preferably, the nucleotide sequence encoding a shear
stress response element has a sequence selected from the group
consisting of GAGACC and GGTCTC.
[0039] In one preferred technique, the rotating wall vessel is
generally initiated and maintained at 10 rotations per minute.
Preferably, the rotating wall vessel provides a balance of forces
comprising gravity and equal and opposite sedimentational shear
stress. Useful sedimentational shear stress rates within the
context of the claimed methods are from about 0.2 dynes/cm2 to 1.0
dynes/cm2.
[0040] As used herein, rotating wall vessels/refers to a cylidrical
horizontal rotating culture vessel with a coaxial oxygenator.
[0041] As used herein, shear stress response element/refers to a
sequence of a family of genes in the cell nucleus which binds one
or more transcription factors in response to shear stress on the
cell. A representative example of a shear stress response element
is GAGACC or its complementary sequence GGTCTC.
[0042] As used herein, shear stress conditions/refers to flow of
liquid, or current of liquid over cells which causes genes to turn
on or off.
[0043] As used herein, slow turning lateral vessel/refers to one
specific size and shape of a rotating wall vessel.
[0044] As used herein, differential display/refers to displaying on
a filter, gel or chip a discrete set of genes turned on or off in a
cell under two different conditions.
[0045] As used herein, simulated microgravity/refers to balance of
gravity by oppositely directed forces including shear stresses
during rotational wall vessel culture.
[0046] As used herein, graded gravitational sedimentation
shear/refers to the shear imparted to a particle or cell falling
through fluid.
[0047] As used herein, functional protein/refers to a protein with
biological effects.
[0048] As used herein, three-dimensional co-culture process/refers
to cells grown in a matrix or on beads (or other three-dimensional
structural suport) in a three-dimensional array, rather than on a
flat plate.
[0049] As used herein, coriolus force/refers to an incidental flow
field caused by the rotating gravity vector in the rotating wall
vessel.
[0050] As used herein, shear stress/refers to the force felt at the
surface of the particle as it moves through the fluid.
[0051] As used herein, gravity induced sedimentation/refers to the
force on a particle in the rotating wall vessel making it fall
through the fluid due to gravity.
[0052] As used herein, centrifugal force/refers to the force on a
particle in the rotating wall vessel which pulls it towards the
wall due to rotational speed.
[0053] As used, herein, transcription factor decoy/refers to an
oligonucleotide folded to form a double stranded DNA which binds a
nuclear trancription factor. The transcription factor decoy
prevents the transcription factor from binding promoter regions
regulating expression of specific genes.
[0054] The following examples are given for the purpose of
illustrating various embodiments of the invention and are not meant
to limit the present invention in any fashion.
EXAMPLE 1
Human Renal Cortical Cells
[0055] Human renal cortical cells were isolated by Clonetics Inc.
(San Diego, Calif.) from kidneys unsuitable for transplantation.
Differential trypsinization resulted in cell fractions highly
purified for proximal tubular cells compared to the natural mixture
of cells in the renal cortex. The co-culture of the natural cell
mix, and highly purified proximal tubular cells were cultured
separately in a special growth medium with 2% fetal calf serum.
EXAMPLE 2
Rat Renal Cortical Cells
[0056] Rat renal cells were isolated from renal cortex harvested
from euthenized Sprague Dawley rats (Harlan Sprague-Dawley,
Cleveland Ohio) as described (44). In brief, renal cortex was
dissected out with scissors, minced finely in a renal cell buffer
137 mmol NaCl, 5.4 mmol KCl, 2.8 mmol CaCl2, 1.2 mmol MgCl2, 10
mmol HEPES-Tris, pH 7.4. The minced tissue was placed in 10 ml of a
solution of 0.1% Type IV collagenase and 0.1% trypsin in normal
saline. The solution was incubated in a 37.degree. C. shaking water
bath for 45 minutes with intermittent titration. The cells were
spun gently (800 rpm for 5 minutes), the supernatant aspirated, the
cells resuspended in 5 ml renal cell buffer with 0.1% bovine serum,
and passed through a fine (70 mm) mesh. The fraction passing
through the mesh was layered over a discontinuous gradient of 5%
bovine serum albumin and spun gently. The supernatant was again
discarded. The cells were resuspended in DMEM/F-12 medium
(ciprofloxacin and fungizone treated) and placed into culture in
various culture vessels in a 5% CO2 95% O2 incubator.
EXAMPLE 3
Culture Techniques: Rotating Wall Vessels
[0057] When grown under conventional conditions in DMEM/F12
supplemented with fetal calf serum and an antibiotic cocktail such
as ciprofloxacin and fungizone, both the highly purified cells as
well as the cell mix form a monolayer. Fetal calf serum was used at
optimal concentration: 2% for human cells and 10% for rat cells. In
order to increase epithelial cell differentiation (1, 45), renal
cells were cultured in a rotating wall vessels known as a 55 ml
slow tuning lateral vessel (STLV) (1, 45). To initiate cell
culture, the slow turning lateral vessel was filled with medium,
and seeded by addition of cell suspension (2.times.106 cells/ml).
Residual air was removed through a syringe port and vessel rotation
was initiated at 10 rotations per minute, and maintained for 10-16
days. Medium was changed every 2 to 3 days depending on glucose
utilization. Concomitant with cells, microcarrier beads were added
an 5 mg/ml to promote aggregate formation in the slow turning
lateral vessel. Without beads the cells became shattered in the
vessel in a few hours. Beads were cytodex-3 in all protocol except
when electron microscopy was planned when the much more expensive,
but easily sectioned Cultisphere GL cells were added to the
vessels.
EXAMPLE 4
Stirred Controls and Static Controls
[0058] To provide a stirred control stirred fermentors which mixed
in the horizontal plane were loaded with identical concentrations
of cells and beads from the same pool added to the slow turning
lateral vessel (1, 31, 46). Gas permeable Fluoroseal bags
(Fluoroseal Inc, Urbana Ill.) in 7 or 55 ml size were selected as
conventional static controls. Culture beads were added to the
conventional controls at the same density as the slow turning
lateral vessel cultures (1, 45).
EXAMPLE 5
Electron Microscopy Quantitation of Number of Microvilli
[0059] Transmission electron micrographs were performed on cell
aggregates from the rotating wall vessels and conventional
monolayers. Cells were washed with ice cold phosphate buffered
saline, then fixed for electron microscopy with 2.5% glutaraldehyde
in phosphate buffered saline (9, 47). The samples were then
transferred to 1% osmium tetroxide in 0.05 M sodium phosphate (pH
7.2) for several hours, dehydrated in an acetone series followed by
embedding in Epon. Lead-stained thin sections were examined and
photographed using a Phillips EM/200 electron microscope. For
electron microscopy the easily sectioned Cultispere GL beads,
replaced Cytodex-3 which is almost impossible to section.
EXAMPLE6
Analysis of the Proximal Tubule Epithelial Marker, g-glutamyl
Transpeptidase
[0060] The renal cortical cells were 75+4% (n=4) proximal tubules
as determined by flow cytometry analysis of aliquots for the
proximal marker g-glutamyl transferase using Schiff base trapping
of cleavage products of L-g-glu-4-methoxy-4-b-naphthylamine (44)
(FIG. 1).
EXAMPLE 7
Analysis of the Endosomal Distribution of Megalin and Cubulin by
Flow Cytometry
[0061] To quantitate the total and endosomal expression of cubulin,
megalin and aquaporin-2 cells in conventional culture, stirred
fermentors and slow turning lateral vessel rotating wall vessels,
0.3 mg/ml 10S fluorescein-dextran was to each cell culture for 10
minutes at 37.degree. C. in the CO2 incubator. This loads an
entrapped fluorescent dye into the early endosomal pathway (9, 47).
Cells were then immediately diluted into ice cold phosphate
buffered saline and washed once. Next, the cells were homogenized
with 6 passes of a tight fitting glass-Teflon motor driven
homogenizer. A post-nuclear supernatant was formed as the 11,000 g
supernatant, 180,000 g pellet of membrane vessels (FIG. 2A).
[0062] Aliquots of membrane vesicles were labeled with megalin or
cubulin antisera. The megalin and cubulin antisera were rabbit
polyclonals raised to affinity purified and chromatographically
pure receptor (43, 48). Membrane vesicles were first pre-incubated
in 50% normal goat serum for 2 hours to reduce non-specific binding
of secondary antisera raised in goat. After washing aliquots of
membrane vesicles were stained with serial log dilution of antisera
and incubated at 4.degree. C. overnight. After further washing 1:40
of goat anti-rabbit affinity purified rat pre-absorbed
phycoerthyrein conjugated secondary antiserum was added, and
incubated for 4 hours at room temperature. Prior to flow cytometry
the membrane vesicles were washed and resuspended in 200 mM
mannitol, 100 mM KCl, 10 mM HEPES, pH 8.0 with Tris to which had
been added 10 mM nigericin. In the presence of potassium, nigericin
collapses pH gradients, ensuring optimal fluorescence of the highly
pH dependent fluorescein-dextran emission. Fluorescein-dextran and
antibody staining tagged by phycoerythrein were now analyzed and
co-localized on a vesicle-by-vesicle basis by flow cytometry (FIG.
2B).
EXAMPLE 8
Differential Display
[0063] Differential display of expressed genes was compared in
aliquots of the same cells grown in a 55 ml rotating wall vessel
(slow turning lateral vessel) or conventional gas permeable
2-dimensional bag controls (FIGS. 3A and 3B). Differential display
was performed using Delta RNA Fingerprinting system (Clontech labs,
Palo Alto Calif.). Copies of expressed genes were generated by
polymerase chain reaction using random 25 mer primers and separated
on a 6% DNA sequencing gal. Bands of different intensity between
control and slow turning lateral vessel, representing
differentially expressed genes, were identified by visual
inspection, excised and reamplified using the same primers.
Differential expression and transcript size were confirmed by
Northern hybridization. PCR products were then subcloned into the
pGEM-T vector (Promega, Madison Wis.) and sequenced using fMOL
cycle sequencing system (Promega, Madison, Wis.). Sequences were
compared to the Genebank sequences using the BLAST search engine
(National Center for Biotechnology Information). For genes of
interest the bands were labeled with 32P for confirmation of the
changes by Northern blot analysis.
EXAMPLE 9
Detection of Gene Expression in Cell Cultures by RT-PCR
[0064] Cell aggregates from the rotating wall vessel culture were
washed once in ice cold phosphate buffered saline and snap frozen
at -70.degree. C. until RNA was isolated. Total RNA was first
isolated, followed by isolation of poly A+RNA. Following reverse
transcription, 10%-20% of each cDNA was amplified (Robocycler 40,
Stratagene, La Jolla, Calif.) using 95.degree. C. denaturation,
63.degree. C. annealing and 72.degree. C extension temperatures.
Amplification was for a total of 30 cycles with the first three
cycles having extended denaturation and annealing times. Positive
and negative strand PCR primers, respectively, were derived from
published sequences using Generunner software. 20% of the PCR
reaction was electrophoresed on agarose/ethidium bromide gels and
visualized under UV light so that a comparison of amplified gene
fragments could be made to DNA standards (HaeIII digested X174 DNA,
Promega) electrophoresed on the same gel (FIGS. 3C and 3D).
Representative fragments amplified for each gene in question were
isolated from gels and direct sequenced to assure identity of the
PCR product. In addition, 5% of the same cDNA were subjected to PCR
for expression of the housekeeping mRNA, glyceraldehyde 3-phosphate
dehydrogenase, and b-actin to assure that similar amounts of input
RNA and that similar efficiencies of reverse transcription were
being compared. Each cDNA was run in at least three dilutions to
ensure that measurements were made on the initial linear portion of
the response curve.
EXAMPLE 10
Genetic Decoys
[0065] Double stranded genetic decoys matching the sequence of a
known shear stress response element were synthesized (Chemicon
International Inc., La Jolla, Calif.) (structure and sequence shown
ate top of FIG. 4). These decoys had a terminal phosphothiorate
moiety to prevent intracellular lysis, and a phosphodiester to
facilitate passage across cell membranes (49). Passage to and
accumulation in the nuclear compartment of cultured cells was
confirmed by confocal imaging of a fluorescein tagged decoy. Three
decoys were synthesized: the active decoy, a random sequence
control in which the six bases of the shear stress response element
were scrambled, and a fluorescein conjugated form of the decoy.
Decoys were placed in the cell culture medium of rat renal cortical
cells grown as above in conventional two-dimensional culture.
Aliquots of cells exposed to control or active sequence decoy at 80
nm concentration were harvested at 2, 6 and 24 hours after
exposure.
EXAMPLE 11
Genetic Discovery Array
[0066] A sample of human renal cortical cells grown in conventional
flask culture was trypsinized and split into a gas permeable bag
control and a rotating wall vessel (55 ml slow turning lateral
vessel). After 8 days of culture on 5 mg/ml cytodex-3 beads, cells
were washed once with ice cold phosphate buffered saline, the cells
were then lysed and mRNA was selected with biotinylated oligo(dT)
then separated with streptavidin paramagnetic particles
(PolyATtract System 1000, Promega Madison, Wis.). 32P labeled cDNA
probes were then generated by reverse transcription with 32P dCTP.
The cDNA probes were hybridized to identical Gene Discovery Array
Filters (Genome Systems Inc. St. Louis, Mo.). The Gene Discovery
Array filters contain 18,394 unique human genes from the I.M.A.G.E.
Consortium [LLNL](15) cDNA Libraries which are robotically arrayed
on each of a pair of filter membranes. Gene expression was then
detected by phosphor imaging and analyzed using the Gene Discovery
Software [Genome Systems] (50).
EXAMPLE 12
Assay of 1-a-hydroxylase Activity
[0067] As the 1-a-hydroxylase enzyme has never been isolated or
cloned it is assayed functionally by the production of
1,25-dihydroxy-vitamin D3 from ultrapure exogenous 25-hydroxy
vitamin D3. For each measurement, the classic Michaelis Menton
kinetics of the enzyme are determined by assaying equal aliquots of
renal cell aggregates in a curve of 25-OH D3 substrate
concentrations from 0.1. to 10 mg/ml in 6 steps. All incubations
are performed in the presence of the anti-oxidant DPED at 10 mM to
ensure no contribution of non-enzymatic oxygenation (23-26).
1,25-diOH D3 generated in vitro.beta.was quantitated as described
(23-27). In vitro.beta.incubations were terminated by adding a
volume of acetonitrile equal to the incubation volume. Each
incubation tube received 1,000 cpm of 3H-1,25 dihydroxy D3 to
estimate recovery losses during the extensive extraction and
purification scheme. The 1,25-dihydroxy D3 is extracted from the
incubation medium by C18 solid-phase extraction (24-25). Following
extraction, the samples are evaporated to dryness under N2 and
dissolved in 2 ml of methylene chloride. The samples are then
applied to silica Bond-Elut cartridges and the 1,25-dihydroxy
D3-containing fraction is isolated and collected (26). The
individual fractions containing 1,25-diOH D3 and then subjected to
normal phase HPLC on a Beckman model 344 liquid chromatography
system. Normal-phase HPLC was performed with a Zorbax-Sil column
(26) (4.times.25 cm) developed in and eluted with methylene
chloride/isopropanol (96:4 v/v) with a flow rate of 2 ml/min. The
1,25-dihydroxy D3 eluted from this system was dried under N2
resuspended in ethanol and quantitated by radio receptor assay or
radio immunoassay (25-26). Plasma 1-25-dihydroxy vitamin D3 was
assayed in a similar fashion, but as the product is already formed,
assay begins with extraction into acetonitrile (23-26). Hence, all
measurement of 1-a-hydroxylase activity in cells included
determination of the Michaelis Menton Km and Vmax of the enzyme.
The Michaelis Menton parameters were determined by automated curve
fitting.
EXAMPLE 13
Culturing Renal Fibroblasts and Assay for Production of
Erythropoietin
[0068] As renal fibroblasts are the source of erythropoietin
secreted into the circulation, renal fibroblasts were cultured.
Freshly dissected rat renal cortex was minced and
collagenase\trypsin digested prior to removal of debris on a single
discontinuous 5% albumin gradient. The mixture of rat renal
cortical cells was placed into culture in DMEM\F12 with 20% fetal
bovine serum. After two weeks to encourage fibroblast overgrowth in
the rich medium, fibroblast growth factor was added. The resultant
culture had fibroblastic features in the culture flask and was
inoculated into a high aspect rotating vessell (HARV) for culture
under increased shear stress conditions. The cells aggregate on the
beads and slowly increasing their numbers. After 3 weeks growing
the fibroblasts in a HARV, erythropoietin was assayed in the cell
supernatant. The media were concentrated 15.times. and assayed via
RIA. The media alone was also concentrated 15.times. as the
control.
EXAMPLE 14
Culturing Hapatocytes and Assay for Production of
Erythropoietin
[0069] As hepatocytes are a source of erythropoietin secreted into
the circulation, immortalized human hepatocyes were cultured under
control and applied shear stress conditions. The Hep3B cells were
placed into culture in DMEM with 10% fetal bovine serum in static
flask culture. The resultant culture was split, one half remaining
in static flask culture and the other half was inoculated into a
HARV for culture under increased shear stress conditions. The cells
aggregated on the beads. After 24 hours growing the Hep3B cells in
a HARV, erythropoietin was assayed in the cell supernatant. The
media were assayed by RIA. The static flask media was also assayed
as the control.
EXAMPLE 15
Shear Stress Response Elements Mediate Changes in Erythropoietin
Gene Expression
[0070] The immortal hepatic cell line, Hep3B, constitutively
produces erythropoietin. The 5' promoter and 3' enhancer regions of
the gene contain putative shear stress response elements. The role
of these elements in the enhancement of erythropoietin production
in response to shear was tested by using integrated perfused
rotating wall vessel culture to reintroduce graded shear. This
protocol utilizes a library of promoters driving luciferase
reporters genes, with various constructs lacking the putative shear
stress response elements. It also allows DNA footprinting analysis
of the histones which bind the promoter and enhancer elements.
EXAMPLE 16
Results
[0071] The proportion of proximal tubular cells in human renal cell
fractions isolated by differential trypsinization was assayed using
an entrapped fluogenic substrate for the proximal enzyme marker
g-glutamyl-transferase (44). Flow cytometry analysis on a
cell-by-cell basis showed the natural cell mixture in the human
renal cortex to be 85+4%, n=4 proximal tubular cells (FIG. 1A, left
panel). Following differential trypsinization, and selection of the
pure fractions, proximal tubular enrichments as high as 99+1% could
be achieved (right panel). As reported in other systems, rotating
wall vessels were conducive to vigorous cell growth, as evidenced
by the high rates of glucose consumption assayed as 30 mg/dl
glucose/100,000 cells/day. A cell doubling time of 4+3 days was
assayed using Alamar blue in the rotating wall vessel compared to
4+2 days in conventional culture (n=4).
[0072] The ultrastructure of cultures of pure proximal tubular
cells or renal cortical cell mixtures of human kidneys were grown
in rotating wall vessels for 16 days, and were examined by
transmission electron microscopy (FIGS. 1B and 1C). Quantitation of
the number of microvilli present by counting random plates at the
same magnification demonstrates not only that the rotating wall
vessel induces microvillus formation, but co-culture with the
normal mix of renal cortical cells increases the effect (Table 1).
Normal cortical cell mix in conventional two-dimensional culture
has 2 1 microvilli per field; "pure" proximal tubular culture in
rotating wall vessel has 10 4 microvilli per field; and the normal
cortical cell mix in rotating wall vessel has 35 11 microvilli per
field. TABLE-US-00001 TABLE 1 Human proximal tubular cells
microvilli counted on transmission electron-micrographs of cells
grown for 16 days under various culture conditions % Proximal
Microvilli Per Culture Conditions Tubular Markers Field
conventional 2-D culture 85 2 1 pure / culture in rotating wall 99
10 4 vessel normal cortical cell mix in rotating 85 35 11 wall
vessel
[0073] To examine the expression of megalin and cubulin in renal
cells in culture, there are advantages to using human cells instead
of rat cells. Specifically, the rat sequences of megalin and
cubulin have been cloned, while the human sequences have not, and
the antisera recognizes the rat but not the human isoforms of these
proteins. Hence, the natural mixture of cells in the rat renal
cortex was placed into culture in rotating wall vessels, stirred
fermentors, and traditional culture for analysis of protein
expression.
[0074] As the endosomal pathway has been implicated to play a
central role in the function and pathophysiology of cubulin and
megalin, entrapped endosomal markers were co-localized with
receptor antibody binding. The ability of flow cytometry to make
simultaneous measurements of entrapped fluorescein dextran as an
endosomal marker and antibody binding allows construction of three
dimensional frequency histograms displaying entrapped fluorescein
dextran fluorescence against antibody binding on horizontal axes
and number of vesicles in each channel up out of the page (FIG.
2A). A control sample shows vesicles negative for fluorescein on
the left and fluorescein containing endosomes on the right (200
vesicles depicted, left panel). A control without fluorescein
entrapped shows only the left population (not shown). Co
localization of anti-cubulin binding demonstrates that all the
fluorescein positive endosomes were positive for cubulin, while
non-endosomal membranes could be subdivided into cubulin positive
and negative populations (middle panel). This pattern was repeated
for anti-megalin binding in renal cortical cells (right panel) in
culture.
[0075] Next, analysis of protein expression in cultured cells by
antibody binding used classic serial log dilution antibody curves.
An increase in binding with a decrease in dilution is pathognomonic
for specific antibody binding during flow cytometry analysis.
Binding of anti-cubulin antisera to membrane vesicles prepared from
renal cortical cells after 16 days in culture, detected by the
fluorescence of a phycoerthyrein tagged secondary antibody, shows
an almost two log increase in binding with antibody dilution (FIG.
2B). This increase in the cells grown in the rotating wall vessel
(slow turning lateral vessel) is more than five times the
expression seen in stirred fermentors. Similarly there was no
detectable expression in the conventional cultures resulting in a
flat line (not shown). Comparison of maximal binding of the
anti-cubulin antibody to minimum taken to be the antibody dilution
at which there is no further decline in signal with primary
antibody dilution is shown in FIG. 2C. Binding of normal serum and
minimal dilution of primary antisera were not detectably different.
Binding curves for anti-megalin antiserum showed a similar pattern
(not shown) but the peak binding was a little lower (FIG. 2C).
Again stirred fermentor has much less expression than the rotating
wall vessel (slow turning lateral vessel) and the conventional cell
membranes have no detectable binding (not shown).
[0076] To examine the proportion of proteins changing in the
rotating wall vessel, two-dimensional gel SDS-PAGE analysis on
cultures grown in the rotating wall vessel and bag controls were
performed (FIG. 2d). The results shown in FIG. 2D demonstrates
changes were in a selected group of proteins.
[0077] To identify the genes changing during rotating wall vessel
culture, differential display were performed. Differential display
of expressed genes was compared in aliquots of the same cells grown
in a 55 ml rotating wall vessel (slow turning lateral vessel) or
conventional gas permeable 2-dimensional bag controls. Differential
display of copies of expressed genes were generated by polymerase
chain reaction using random 25 mer primers and separated on a 6%
DNA sequencing gel. Bands of different intensity between control
and slow turning lateral vessel, representing differentially
expressed genes, were identified by visual inspection, excised and
reamplified using the same primers. Differential expression and
transcript size were confirmed by Northern hybridization. PCR
products were then subcloned into the pGEM-T vector and sequenced.
Sequences were compared to the Genebank sequences using the BLAST
search engine. One expressed gene which decreased in the slow
turning lateral vessel (band D on gel, FIG. 3A) was identified as
rat manganese-containing superoxide dismutase (98% match 142 of 144
nucleotides). Two genes which increased in the slow turning lateral
vessel, band A was identified as the interleukin-1 beta gene (100%
match for 32 of 32 nucleotides) and Band B which corresponded to a
20 kB transcript on a Northern blot appears to be a unidentified
gene that has a 76% homology to the mouse GABA transporter
gene.
[0078] To examine the genetic changes in specific genes, the
expression of tissue specific epithelial cell markers and classic
shear stress response dependent genes were examined by RT-PCR (FIG.
3c). Several genes specific for renal proximal tubular epithelial
cells, including megalin, cubulin, the extracellular calcium
sensing receptor, and the microvillar structural protein villin,
increase early in rotating wall vessel culture. Similarly there
were dynamic time dependent changes in classic shear stress
dependent genes including intercellular adhesion molecule 1 (ICAM)
and vascular cell adhesion molecule (VCAM) (increased) and
manganese dependent superoxide dismutase (suppressed). Many but not
all of these changes were prolonged, as after 16 days in culture
gene expression of megalin, ICAM, VCAM and the extracellular
calcium sensing receptor were still elevated, while villin and
manganese dependent superoxide dismutase were at control levels.
Expression of control GADPH, b-actin and 18S genes did not change
throughout the time course.
[0079] To test for a role of a putative endothelial shear stress
response element in these renal cortical cell changes, an antisense
probe for the sequence was synthesized (FIG. 4A). A control probe
had the active motif scrambled. Confocal imaging of a fluorescein
conjugated form of the probe confirmed nuclear delivery of the
probe (images not shown). Culture of rat renal cortical cells in 80
nm of the probe, resulted in a time dependent increase in magnesium
dependent superoxide dismutase, but no change in villin gene
expression (FIGS. 4B and 4C). The control probe had no effect.
[0080] In order to confirm the genetic responses to rotating wall
vessel culture and the analysis with human cells, automated gene
display analysis of expressed RNA was performed on human renal
cortical cells grown in a control gas-permeable bag and the slow
turning lateral vessel for 8 days (50). Of the more than 18,000
genes assayed a select group was again observed to change (FIG. 5).
In particular, vectored changes in all the classic shear stress
response genes assayed by RT-PCR and differential display in rat
cell culture were confirmed. A battery of tissue specific genes was
increased including villin, angiotensin converting enzyme,
parathyroid hormone receptor and sodium channels. Other physical
force dependent genes such as heat shock proteins 27/28 kDa and
70-2 changed, as did focal adhesion kinase, and a putative
transcription factor for shear stress responses NF-kb changed.
Fusion proteins such as synabtobrevin 2 mildly decreased gene
expression, and clathrin light chains hugely increased gene
expression.
[0081] To determine whether renal cells grown in simulated
microgravity have 1-a-hydroxylase activity, the 1-a-hydroxylase
activity of cell cultures were compared grown in traditional 2-D
culture in gas permeable bags, and NASA rotating wall vessels. Both
rat renal cells (Table 2) and human embryonic renal cells were
assayed (Table 3). TABLE-US-00002 TABLE 2 The 1 a-hydroxylase
activity of the various rat renal cell cultures detected as
production of 1,25-diOH D3 Volume of 1,25-diOH D3 Supernatant
1,25-diOH D3 Cell Sample concentration (pg/ml) (ml) Production (pg)
Boiled static <2, not detectable 7 ml Not detectable control I
Boiled static <2, not detectable 7 ml Not detectable control II
Static control I <2, not detectable 7 ml Not detectable Static
control II <2, not detectable 7 ml Not detectable Boiled
rotating <2, not detectable 55 ml Not detectable wall vessel
Rotating wall 14.2 55 ml 781 vessel
[0082] The results shown in TABLE 2 indicate that rat renal cells
show increased structural differentiation during culture in
simulated microgravity conditions, and express much greater
1-a-hydroxylase activity than under conventional culture
conditions. TABLE-US-00003 TABLE 3 The 1 a-hydroxylase activity of
the various human embryonic renal cell cultures detected as
production of 1,25-diOH D3 1,25-diOH D3 Concentration Volume of
1,25-diOH D3 Cell Sample (pg/ml) Supernatant (ml) Production (pg)
Boiled static control 8.2 10 82 Static control 14.6 10 146 Rotating
wall vessel 24.8 55 1364
[0083] TABLE 3 indicates that human embryonic kidney cells show
increased structural differentiation during culture in simulated
microgravity conditions, and express 10 fold greater
1-a-hydroxylase activity than under conventional culture
conditions. TABLE-US-00004 TABLE 4 Renal fibroblasts cell
supernatant erythropoietin assay Condition Erythropoietin (mu/ml)
Shear stress culture 1.8 Control media conc 15X 0.23
[0084] TABLE-US-00005 TABLE 5 Hepatocytes cell supernatant
erythropoietin assay Condition Erythropoietin (mu/ml) Shear stress
culture 141.7 mu/l .times. 106 cells Control static flask
undetectable
[0085] Results of cell supernatant erythropoietin assay from renal
fibroblasts and hepatocytes culture were shown in Table 4 and Table
5, respectively. The results shown in TABLES 4 and 5 indicate
erythropoietin production was increased in both renal and hepatic
cells during graded gravitational sedimentation shear.
[0086] Erythropoietin has the classic shear stress response
elements in the promoter and enhancer regions which control
expression of its gene. The results shown in Tables 4 and 5 also
indicate that the expression of the erythropoietin gene was
upregulated by those shear stress response elements during graded
gravitational sedimentation shear in the vessel.
EXAMPLE 17
Discussion
[0087] Rotating wall vessels have been used by other investigators
as "simulated microgravity". The present invention contends that
gravity is still active, and that in a rotating wall vessel gravity
is balanced by equal and opposite sedimentational shear stress. A
centrifugal force due to spinning the cells, quantitatively much
smaller than gravity, is also present and offset by equal and
opposite sedimentational shear stress. Thus, the present invention
presents a new concept that rotating wall vessels provide this new
balance of forces, including application of sedimentational shear,
rather than microgravity.
[0088] The rotating wall vessel bioreactor provides quiescent
co-localization of dissimilar cell types (1, 46), mass transfer
rates that accommodate molecular scaffolding and a
micro-environment that includes growth factors (1, 46). Engineering
analysis of the forces active in the vessel is complex (1, 5-7).
This study provides the first evidence for the cell biological
mechanisms by which the vessel induces changes in tissue specific
gene and protein expression.
[0089] There are two possible explanations why the rotating wall
vessel induces an order of magnitude more expression of the renal
toxin receptors cubulin and megalin than stirred fermentor culture.
First, there are significant differences in the degree of shear
stress induced. The rotating wall vessel induces 0.5-1.0 dynes/cm2
shear stress (1), while stirred fermentors induce 2-40 dynes/cm2
depending on design and rotation speed (1, 5, 46). This degree of
stress damages or kills most epithelial cells (1, 5, 46). Second,
impeller trauma in the stirred fermentor, is absent in the rotating
wall vessel. This explains why there was far more cubulin and
megalin induced in renal cultures in rotating wall vessel culture
than a stirred fermentor, and both receptors were not detectable in
conventional 2-dimensional culture.
[0090] Rotating wall vessel culture induced changes in a select set
of genes, as evidenced by the genetic differential display gels and
2-dimensional protein gel analysis. For example, erythropoietin
production is controlled by a shear stress element which mediates
changes observed during graded gravitation sedimentation shear.
1-a-hydroxylase activity is maintained and increased in both renal
cortical epithelial cells and human embryonic kidney cells, wherein
the induction of the enzyme (1-a-hydroxylase) converts
25-hydroxy-vitamin D3 to the active 1,25-dihydroxy-vitamin D3 form.
The present invention is the first demonstration of a process for
production of molecules including hormones and other biomolecules
induced by shear stress and other forces. The mechanistic
information can be interpreted from knowledge of the pattern of
response and distribution of certain gene products.
[0091] Megalin and cubulin represent the first pattern of change,
as these proteins are restricted in distribution to renal cortical
tubular epithelial cells. The increase in megalin mRNA and protein,
and cubulin protein expression is therefore unequivocal evidence
for changes in the epithelial cells. This provides an important new
tool for studies of nephrotoxicity. Long suspected to play a role
in renal toxicity, the tissue restricted giant glycoprotein
receptors megalin and cubulin, have recently been shown to be
receptors for common nephrotoxins. Megalin is a receptor for
polybasic drugs such as the aminoglycoside antibiotic gentamicin
(48) and vitamin D binding protein (51), and cubulin is the
receptor for vitamin-B12 intrinsic factor (52). Although these
receptors are expressed by transformed placental cells in culture
(9, 43), there is currently no renal model expressing these markers
for toxicology investigations (53). Rotating wall culture provides
a fresh approach to expression of renal specific markers in culture
for study on the pharmacology, biochemistry and toxicology which
define the unique properties and sensitivities of renal epithelial
cells.
[0092] The second pattern of change is represented by villin.
Message for the microvilli protein villin increases in the rotating
wall vessel in the first day of culture, and soon reformation of
microvilli was observed. A decoy matching the nuclear binding motif
of a putative shear stress response element failed to induce
similar changes. Although the promoter for villin has not been
cloned, this suggests the changes in villin were induced by other
transcription factors which may be due to shear stress or other
stimuli in the bioreactor. Villin is also restricted to brush
border membranes such as renal proximal tubular cells, or colonic
villi (54-55). The observed increases in villin message resolved
after 16 days of rotating wall vessel culture.
[0093] Magnesium dependent superoxide dismutase represents a third
pattern of response: a mitochondrial enzyme, ubiquitous is
distribution, modulated by the classic shear stress response
element in endothelial cells (56-57). Magnesium dependent
superoxide dismutase message decreased early in the first day of
rotating wall vessel culture, and this was persistent after 16 days
in culture. These changes were confirmed when magnesium dependent
superoxide dismutase was identified as suppressed in the
differential display analysis of gene changes, and Northern blot
confirmation was performed. A decoy for the classic shear stress
response element induced an increase in magnesium dependent
superoxide dismutase (MnSOD), which indicates that similar changes
to the rotating wall vessel can be induced by the use of genetic
decoys. Thus, the biological process of genetic induction by
defined shear stress elements can be produced by multiple means
including genetic decoys or use of the rotating wall vessel. Other
shear stress response element dependent genes, specifically,
intercellular adhesion molecule 1 (ICAM) and vascular cell adhesion
molecule (VCAM) had changes in the rotating wall vessel opposite to
magnesium dependent superoxide dismutase, mirroring observations
made during flow induced stress in endothelial cells (56-57). This
provides three lines of evidence consistent with a role for shear
stress as one mediator of genetic changes induced in the rotating
wall vessel.
[0094] Differential display of the genes activated and deactivated
under rotating wall vessel culture conditions showed rotating wall
vessel culture was associated with decreased expression of
manganese dependent superoxide dismutase mRNA and increased
expression of interleukin-1 b gene mRNA. This greatly extends and
brings together previous observations on the interactions of
stress, manganese dependent superoxide dismutase expression and
interleukin-1. Topper et al. reported an oppositely directed
effect, i.e., differential display of vascular endothelial cells
exposed to high stress demonstrates increased manganese dependent
superoxide dismutase gene expression (57). Other direct evidence
links superoxide dismutase and interleukin-1 as increases in
manganese superoxide dismutase levels and decreases in
interleukin-1 levels in HT-1080 fibrosarcoma cells (58). In more
indirect evidence overexpression of mitochondrial manganese,
superoxide dismutase promotes the survival of tumor cells exposed
to interleukin-1 (59). The present study provides direct evidence
that modest shear stress decreases magnesium dependent superoxide
dismutase in association with an inverse effect on
interleukin-1.
[0095] The data here demonstrates, internal consistency. The
changes in magnesium dependent superoxide dismutase were observed
on differential display, confirmed by Northern blot analysis, and
matched responses were detected by RT-PCR. Megalin demonstrated
matched changes in RT-PCR gene and protein expression. Changes in
villin observed by RT-PCR were associated with dramatic reformation
of microvilli, in which villin is a major structural protein.
Although semi-quantitative RT-PCR is prone to inherent variation
due to the massive amplification of signals, the use of multiple
controls which remain unchanged (b-actin, GAPDH and 18S), and
experimental confirmation that reactions were linearly related to
cDNA concentration, minimizes these problems. The internally
consistent findings by other methods strongly suggests this RT-PCR
data is valid.
[0096] Study of the mechanisms of action of the rotating wall
vessel to induce gene and protein expression during cell culture
has been hampered by nomenclature. First, the attachment of the
moniker "simulated microgravity", based on engineering analysis of
boundary conditions, clouds intuitive analysis of the cell biology
as there is no cellular equivalent for this term (1, 6-7).
Similarly the reduced shear stress in the rotating wall vessel
compared to stirred fermentors leads to the term "reduced shear
stress culture" (1), whereas there is increased shear stress
compared to conventional 2-dimensional culture (1, 5). As cell
aggregates remain suspended in the rotating wall culture vessels,
gravity is balanced by an equal and opposite force. Engineering
arguments on the relative contributions of fluid shear, drag,
centrifugal force, coriolus motion, and tangential gravity-induced
sedimentation are themselves tangential to the cell biology.
Several lines of evidence are documented that shear stress
responses are one of the component of the biological response. This
opens the door for analysis of other biological response mediators
in the vessels, and investigation as to whether unloading of
gravity plays as big a role as the oppositely directed balancing
forces.
[0097] Using the rotating wall vessel as a tool, data here provide
the first evidence that shear stress response elements, which
modulate gene expression in endothelial cells, are also active in
epithelial cells, although other investigators failed to see an
effect of shear stress on epithelial cells. The present invention
demonstrates that epithelial cells have shear stress response
elements and change gene expression in response to physical forces
including but not limited to sedimentational shear stress. As the
rotating wall vessel gains popularity as a clinical tool to produce
hormonal implants it is desirable to understand mechanisms by which
it induces genetic changes (10, 60), if necessary to prolong the
useful life of implants. Several lines of evidence are provided
that shear stress response elements are the first mechanism
identified by which the rotating wall vessel induces genetic
changes. Using a putative endothelial cell shear stress response
element binding site as a decoy, the role of this sequence in the
regulation of selected genes in epithelial cells was validated.
However, many of the changes observed in the rotating wall vessel
are independent of this response element. It remains to define
other genetic response elements modulated during rotating wall
vessel culture, and whether the induced changes are secondary to
the balancing forces, or primarily related to unloading
gravity.
[0098] The following references were cited herein. [0099] 1.
GOODWIN T J, et al., J cell Biochem 51:301-311, 1993. [0100] 2.
JESSUP J M, et al., J Cell Biochem 51:290-300, 1993. [0101] 3. CHEN
T C, et al., In Vitro Cell & Dev Biol 25:714-722, 1989 [0102]
4. SPAULDING G F, et al., J Cell Biochem 51:249-251, 1993. [0103]
5. Kleis S J, et al., Biotech. & Bioeng. 36:771-777, 1990.
[0104] 6. Wolf D A et al., NASA Technical Paper 3200, 1992. [0105]
7. Zhau H E, et al., In Vitro Cell Dev Biol 33:375-380, 19978.
[0106] 8. Baker T L, et al., In Vitro Cell Dev Biol 33:358-365,
1997 [0107] 9. Hammond T G, et al., J. Mem. Biol. In press [0108]
10. Soon-Shiong P., et al., PNAS USA 90:5843-5847, 1993 [0109] 11.
FREED L E, et al., J cell Biochem 51:257-264, 1993. [0110] 12.
GOODMAN S, et al., In Hayat MA ed. Colloidal gold principles,
methods and applications. Vol 3, New York, Academic Press 1990.
[0111] 13. GRANT, D. S., et al., In Vitro Cell Dev Biol 27A,
327-336, 1991. [0112] 14. Goodwin et al., U.S. Pat. No. 5,496,722,
1996. [0113] 15. Wolf et al., U.S. Pat. No. 5,155,034, 1992. [0114]
16. Goodwin et al., U.S. Pat. No. 5,153,132, 1992. [0115] 17.
DeLuca H F., et al., Endocrinology 130(4):1763, 1992 [0116] 18.
Sanjeevkumar C H H, et al., Kidney International. 46:605-612, 1994.
[0117] 19. DeLuca H F., et al., Ann NY Acad Sci 669:59-68, 1992.
[0118] 20. Baran D T., et al., J Cell Biochem 56(3):303-6, 1994.
[0119] 21. Holick M F., et al., Bone 17(2S):107S-111S, 1995. [0120]
22. Dechant K L, et al., Drugs & Aging. 5(4):300-317, 1994.
[0121] 23. Hollis B W., et al., PNAS USA 87:6009-6013, 1990 [0122]
24. Reinhardt T A, et al., J Clin Endocrinol Metab 58:91-98, 1984.
[0123] 25. Hollis B W., et al., Clin Chem 32:2060-2063, 1986.
[0124] 26. Hollis B W, et al., Clin Chem 42:586-592, 1996. [0125]
27. Hollis B W, et al., Endocrinology 125(3):1254-1230, 1989.
[0126] 28. Henry H L. et al., J Biol Chem 254:2722-2729, 1979.
[0127] 29. Dusso A., et al., Seminars in nephrology. 14(2):144-155,
1994. [0128] 30. Gallieni M, et al., Am J Physiol 268(4):F746-F753,
1995. [0129] 31. LANGER R., et al., Science 260:920-926, 1993.
[0130] 32. HEIDRICH H G, et al., J Cell Biol 74:780-789, 1977
[0131] 33. KEMPSON S A, et al., J Lab Clin Med 113:285-296, 1989
[0132] 34. TAUB M L, et al., In Vitro Cell & Dev Biol
25:776-775, 1989 [0133] 35. VANDEWALLE A., et al., J Cell Physiol
141:203-221, 1989 [0134] 36. VINAY P, et al., Am J Physiol
241:F403-F411, 1981 [0135] 37. WILSON P D, et al., Am J Physiol
248:F436-F443, 1985 [0136] 38. YANG A H, et al. In Vitro Cell &
Dev Biol 23:34-46, 1987 [0137] 39. CHRISTENSEN E I, et al., Sem. in
Nephrol. 11(4):414-439, 1991. [0138] 40. MAUNSBACH A B., J.
Ultrastruct. Res. 16:1-12, 1966. [0139] 41. RONCO P, et al., J.
Immunol. 136:125-130,1986. [0140] 42. SAHALI D, et al., J Exp Med
167:213-218, 1988. [0141] 43. SAHALI D, et al., Am J Pathol
142:1654-1667, 1993. [0142] 44. Hammond, T. G. et al., Kidney Int
42:997-1005, 1992. [0143] 45. Schwarz, R. P., et al., J. Tiss.
Cult. Meth. 14:51-58, 1992. [0144] 46. Topper J N, et al., J. Vasc
Res 33:S100A. [0145] 47. Hammond, T. G., et al., Cytometry 14:
411-420, 1993. [0146] 48. Moestrup, et al., Journal of Clinical
Invest, 96:1404-1413, 1995. [0147] 49. Schlingensiepen, R., (1997)
in Antisense--From Technology to Therapy eds. Schlingensiepen, et
al., (Blackwell Science) pp. 1-87. [0148] 50. Lennon, G. G., et
al., Genomics 33:151-152, 1996. [0149] 51. Christensen E I, et al.,
JASN 8:59A, 1997. [0150] 52. Seetharam B. et al., J Clin Invest.
99, 2317-22,1997 [0151] 53. Orlando R A, et al., PNAS USA
90:4082-4086, 1993. [0152] 54. Arpin M, et al., J Cell Biol
107:1759-1766, 1988. [0153] 55. Chantret I, et al., Cancer Res.
48:1936-1942, 1988. [0154] 56. Resnick N et al., FASEB J.
9:874-882, 1995. [0155] 57. Tuttle R et al., Curr. Opin. Cell Biol.
3: 70-72, 1993. [0156] 58. Melendez J A, et al., J Biol Chem
271(31):18898-18903, 1996. [0157] 59. Hibose K, et al., FASEB J
7:361-368, 1993. [0158] 60. Soon-Shiong P, et al., The Lancet
343:950-951, 1994.
[0159] Any patents or publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains. These patents and publications are herein
incorporated by reference to the same extent as if each individual
publication was specifically and individually indicated to be
incorporated by reference.
[0160] One skilled in the art will readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The present examples along with the methods, procedures,
treatments, molecules, and specific compounds described herein are
presently representative of preferred embodiments, are exemplary,
and are not intended as limitations on the scope of the invention.
Changes therein and other uses will occur to those skilled in the
art which are encompassed within the spirit of the invention as
defined by the scope of the claims.
Sequence CWU 0
0
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF
SEQUENCES: 1 (2) INFORMATION FOR SEQ ID NO: 1 (i) SEQUENCE
CHARACTERISTICS: (A) LENGTH: 22 bp (B) TYPE: nucleic acid (C)
STRANDEDNESS: single-stranded (D) TOPOLOGY: linear (ii) MOLECULE
TYPE: <Unknown> (A) DESCRIPTION: cDNA to mRNA (iii)
HYPOTHETICAL: no (iv) ANTI-SENSE: yes (v) FRAGMENT TYPE:
<Unknown> (vi) ORIGINAL SOURCE: (vii) IMMEDIATE SOURCE:
(viii) POSITION IN GENOME: (ix) FEATURE: (x) PUBLICATION
INFORMATION: (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: CTGAGACCGA
TATCGGTCTC AG 22
* * * * *