U.S. patent application number 10/534800 was filed with the patent office on 2006-06-22 for microwell array chip for detecting antigen-specific lymphocytes, method of detecting and method of manufacturing antigen-specific lymphocytes, and method of cloning antigen-specific lymphocyte antigen receptor genes.
Invention is credited to Hiroyuki Kishi, Atsushi Muraguchi, Masayasu Suzuki, Eiichi Tamiya.
Application Number | 20060134704 10/534800 |
Document ID | / |
Family ID | 32473638 |
Filed Date | 2006-06-22 |
United States Patent
Application |
20060134704 |
Kind Code |
A1 |
Muraguchi; Atsushi ; et
al. |
June 22, 2006 |
Microwell array chip for detecting antigen-specific lymphocytes,
method of detecting and method of manufacturing antigen-specific
lymphocytes, and method of cloning antigen-specific lymphocyte
antigen receptor genes
Abstract
A microwell array chip that has multiple microwells and is
employed to contain a single lymphocyte specimen in each microwell
and detect antigen-specific lymphocytes in single units; wherein
the microwell array chip is of a shape and of dimensions where only
one lymphocyte is contained in each microwell. A method of
detecting antigen-specific lymphocytes comprising the steps of
adding antigen to each microwell in the above microwell array chip,
stimulating the lymphocyte specimen, and detecting lymphocyte
specimens reacting with the antigen.
Inventors: |
Muraguchi; Atsushi;
(Toyama-Shi, Toyama, JP) ; Kishi; Hiroyuki;
(Toyama-Shi, Toyama, JP) ; Tamiya; Eiichi;
(Kanazawa-Shi, Ishikawa, JP) ; Suzuki; Masayasu;
(Toyama-Shi, Toyama, JP) |
Correspondence
Address: |
BIRCH STEWART KOLASCH & BIRCH
PO BOX 747
FALLS CHURCH
VA
22040-0747
US
|
Family ID: |
32473638 |
Appl. No.: |
10/534800 |
Filed: |
September 30, 2003 |
PCT Filed: |
September 30, 2003 |
PCT NO: |
PCT/JP03/12500 |
371 Date: |
December 2, 2005 |
Current U.S.
Class: |
435/7.2 ;
435/287.2 |
Current CPC
Class: |
B01J 2219/00743
20130101; C07K 16/082 20130101; B01J 2219/00317 20130101; G01N
33/56972 20130101; C40B 60/14 20130101; C07K 2317/21 20130101; G01N
33/54366 20130101; G01N 33/5302 20130101 |
Class at
Publication: |
435/007.2 ;
435/287.2 |
International
Class: |
G01N 33/567 20060101
G01N033/567; C12M 1/34 20060101 C12M001/34; G01N 33/53 20060101
G01N033/53 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 14, 2002 |
JP |
2002-331031 |
Nov 29, 2002 |
JP |
2002-346728 |
Claims
1. A microwell array chip that has multiple microwells and is
employed to contain a single lymphocyte specimen in each microwell
and detect antigen-specific lymphocytes in single units; wherein
the microwell array chip is of a shape and of dimensions where only
one lymphocyte is contained in each microwell.
2. The microwell array chip of claim 1, wherein the microwell is of
cylindrical, rectangular parallelepiped, inverse conical, or
inverse pyramid shape, or some combination of two or more
thereof.
3. The microwell array chip of claim 1, wherein the diameter of the
maximum circle inscribable in a planar configuration of the
microwells falls within a range of from one to two times the
diameter of the lymphocytes that are to be contained in the
microwells, and the depth of the microwells falls within a range of
from one to two times the diameter of the lymphocytes to be
contained in the microwells.
4. A microwell array chip that is employed to detect
antigen-specific lymphocytes and has multiple microwells each
containing a single lymphocyte specimen.
5. The microwell array chip of claim 4, wherein the microwell has a
diameter of from 5 to 100 micrometers and a depth of from 5 to 100
micrometers.
6. The microwell array chip of claim 4, wherein the lymphocyte
specimen is contained in the microwell together with a culture
medium.
7. The microwell array chip of claim 4, wherein the lymphocyte
specimen is derived from blood.
8. The microwell array chip of claim 4, wherein the lymphocyte
specimen is a B lymphocyte or T lymphocyte.
9. A method of detecting antigen-specific lymphocytes comprising
the steps of adding antigen to each microwell in the microwell
array chip according to claim 4, stimulating the lymphocyte
specimen, and detecting lymphocyte specimens reacting with the
antigen.
10. The method of claim 9, wherein the detection of cells reacting
with antigen is conducted by using Ca ion dependent fluorescent
dye.
11. The method of claim 9, wherein the detection of cells reacting
with antigen is conducted by employing, as a marker, an activated
marker protein expressed on the surface of the activated lymphocyte
specimen that has been stimulated with antigen.
12. The method of claim 9, wherein the detection of cells reacting
with antigen is conducted by employing, as an indicator, the degree
of polarization of fluorescence emitted by a fluorescent substance
in the lymphocyte specimen.
13. The method of claim 9, wherein the detection of cells reacting
with antigen is conducted by employing, as an indicator, the
proliferation of the lymphocyte specimen or the production of
antibody.
14. The method of claim 9, wherein the antigen is a protein,
peptide, DNA, RNA, lipid, sugar chain, or organic macromolecular
compound.
15. The method of claim 9, wherein the antigen is a bacterium,
virus, autoantigen, tumor antigen, or allergen.
16. A method of manufacturing antigen-specific lymphocytes
comprising the step of recovering from microwells lymphocyte
specimens reacting with antigen that have been detected by the
method of claim 9.
17. A method in which a single lymphocyte reacting specifically
with a certain antigen (referred to hereinafter as an
antigen-specific lymphocyte) is selected and an antigen-specific
antigen receptor gene is cloned from the single antigen-specific
lymphocyte.
18. The method of claim 17, wherein the selection of the
antigen-specific single lymphocyte is conducted by adding antigen
to each microwell in an antigen-specific lymphocyte detection-use
microwell array chip having multiple microwells each containing a
single lymphocyte specimen, detecting which lymphocytes have
reacted with the antigen, and removing the antigen-specific
lymphocytes that have been detected from the microwells.
19. The method of claim 17, wherein the antigen-specific lymphocyte
is present in a frequency of 0.1 percent or less.
20. The method of claim 17, wherein the antigen-specific lymphocyte
is broken down using a cytolytic agent and the antigen-specific
antigen receptor gene is amplified by RT-PCR.
21. The method of claim 20, wherein the RT-PCR is conducted by
preparing cDNA with reverse transcriptase and carrying out PCR
twice with primer mixes for antigen receptor gene.
22. The method of claim 17, wherein the antigen-specific lymphocyte
is a B lymphocyte or T lymphocyte.
23. The method of claim 22, wherein the antigen-specific antigen
receptor gene is an immunoglobulin gene when the antigen-specific
lymphocyte is a B lymphocyte, and a T-cell receptor gene when the
antigen-specific lymphocyte is a T lymphocyte.
24. The method of claim 17, wherein the antigen-specific lymphocyte
is a B lymphocyte and an antigen-specific immunoglobulin gene is
cloned.
25. The method of claim 17, wherein the antigen-specific lymphocyte
is a T lymphocyte and an antigen-specific T-cell receptor gene is
cloned.
26. The method of claim 18, wherein gene amplification is conducted
in the microwell without removing from the microwell the
antigen-specific lymphocyte that has been detected.
27. A method of manufacturing monoclonal antibody using the
antigen-specific immunoglobulin gene that has been cloned by a
method of claim 24.
28. A method of manufacturing material for gene therapy employing
the antigen-specific T-cell receptor gene that has been cloned by a
method of claim 25.
Description
TECHNICAL FIELD
[0001] The present invention relates to a microwell array chip
employed in detecting antigen-specific lymphocytes, a method of
detecting antigen-specific lymphocytes, and a method of
manufacturing antigen-specific lymphocytes. The present invention
further relates to a method of cloning antigen-specific lymphocyte
antigen receptor genes.
TECHNICAL BACKGROUND
[0002] In the past, antigen-specific lymphocytes have been detected
by placing about 200,000 individual lymphocytes per well in a
96-well plate such as that shown in FIG. 3 and culturing them for
from three days to a week ("Lymphocyte Function Detection Methods",
ed. by Junichi Yano, Michio Fujiwara, Chugai Igaku Corp. (1994)
(Nonpatent Reference 1) and "Methods of Conducting Immunological
Experiments I, II", ed. by Shunsuke Ishida, Susumu Konda, Morosuke
Moto, and Toshiyuki Hamaoka, Nankodo (1995) (Nonpatent Reference
2)).
[0003] These detection methods detect antigen-specific lymphocytes
by:
[0004] 1. Cell proliferation (uptake of .sup.3H-thymidine,
detection of live cells), and
[0005] 2. Production of antibody and cytokine.
[0006] These methods are capable of determining the presence of
antigen-specific lymphocytes in a lymphocyte population of about
200,000 cells. However, they are incapable of identifying
individual antigen-specific lymphocytes present in the
lymphocytepopulation.
[0007] By contrast, in recent years, a method of mixing antigen
molecules labeled with fluorescent dye with lymphocytes to cause
fluorescence-labeled antigen to bind to the antigen receptors of
antigen-specific lymphocytes, and then using a flow cytometer to
detect lymphocytes that have bound fluorescence-labeled antigen has
been developed and put to practice (Altman, J. D., Moss, P. A.,
Goulder, P. J., Barouch, D. H., McHeyzer-Williams, M. G., Bell, J.
I., McMichael, A. J., Davis, M. M., Phenotypic analysis of
antigen-specific T lymphocytes, Science, 274: 94-96, 1996
(Nonpatent Reference 3)). This method is capable of identifying a
single lymphocyte bound to antigen. It is also capable of
separating out individual lymphocytes that bind antigen.
[0008] However, the above-cited method requires an expensive and
complex device known as a cell sorter for separating out individual
lymphocytes, and presents the following problems as well:
[0009] (1) It is difficult to set the separating conditions of the
device, requiring skills for operating device to separate out
cells;
[0010] (2) The background is high, precluding the detection of
antigen-specific lymphocytes at frequencies of less than or equal
to 0.1 percent;
[0011] (3) cell separation is inefficient;
[0012] (4) time is required to separate out cells of low frequency;
and
[0013] (5) although antigen binding can be determined, it is
difficult to analyze the reaction of the lymphocyte that has bound
the antigen.
[0014] Another antigen-specific lymphocyte detection method has
been developed in which antigen molecules bound to magnetic beads
are mixed with lymphocytes to cause the magnetic bead-bound antigen
to bind to the antigen receptors of the antigen-specific
lymphocytes, and a magnet is then employed to separate the
antigen-specific lymphocytes (Abts H., Emmerich M., Miltenyi S.,
Radbruch A., Tesch H. CD20 positive human B lymphocytes separated
with the magnetic sorter (MACS) can be induced to proliferation and
antibody secretion in vitro. Journal of Immunological Methods
125:19-28, 1989 (Nonpatent Reference 4)).
[0015] This method requires no complex device, cells are rapidly
separated, and antigen binding can be determined. However, it is
not possible to analyze the reaction of the lymphocyte in binding
the antigen (the metabolic or physiological reaction of the cell,
such as intracellular signal transduction, RNA synthesis, or
protein synthesis). Further, the antigen-specific lymphocyte cannot
be detected when the frequency of the antigen-specific lymphocyte
is less than or equal to 0.1 percent.
[0016] Accordingly, the present invention has as its first object
to provide a method of detecting antigen-specific lymphocytes that
does not require a complex device, rapidly separates cells, permits
the determination of antigen binding, permits the detection of
antigen-specific lymphocytes (even at 0.001 percent and above),
permits analysis of whether the lymphocyte that has bound the
antigen reacts with antigen, and permits the separation of
antigen-specific lymphocytes.
[0017] Further objects of the present invention are to provide a
microwell array chip for detecting antigen-specific lymphocytes to
be employed in the above-described detection method and a method of
manufacturing antigen-specific lymphocytes using the
above-described detection method.
[0018] The following are conventionally known methods of cloning
antigen-specific antibody genes:
[0019] (1) In humans, there exists the method in which peripheral B
lymphocytes are transformed with EB virus, antigen-specific
antibody-producing cells are screened from the colonized cells, and
antibody genes are cloned from the antigen-specific lymphocytes
(Roome, A. J., Reading, C. L. The use of Epstein-Barr virus
transformation for the production of human monoclonal antibodies.
Exp. Biol. 43:35-55, 1984 (Nonpatent Reference 5), Carson, D. A.,
Freimark, B. D. Human lymphocyte hybridomas and monoclonal
antibodies. Adv. Immunol. 38:275-311, 1986 (Nonpatent Reference
6)). This method is bothersome in that the screening of
antigen-specific lymphocyte cell colonies is inefficient and a
whole month is required to culture the cells. Although hybridomas
can be produced for mice, no efficient human hybridoma system has
yet been produced.
[0020] (2) A further method exists in which bacteriophage is
employed to clone antigen-specific antibody genes (Huston, J. S.,
Levinson D., Mudgett-Hunter, M., Tai, M. S., Novotny, J.,
Margolies, M. N., Ridge, R. J., Bruccoleri, R. E., Haber, E., Crea,
R., et al. Protein engineering of antibody binding sites: recovery
of specific activity in an anti-digoxin single-chain Fv analogue
produced in Escherichia Coli. Proc. Natl. Acad. Sci., U.S.A.
85:5879-5883, 1988 (Nonpatent Reference 7)). In this case, mRNA is
extracted from human lymphocytes, cDNA libraries consisting of the
H and L chains of immunoglobulin, respectively, are prepared, the
two are combined into single phage DNA, and the H and L chains are
expressed by the phage. Antigen specificity is determined by the
combination of H and L chains. However, in this system, the
combinations are random and the phages producing antibody binding
to the antigen are screened with antigen. As a result, when a phage
producing antibody binding to antigen is produced, an
antigen-specific antibody gene can be cloned. However, the random
combination of H and L chains renders the screening of
antigen-specific antibody genes highly inefficient. For example,
assuming that the H chain cDNA and L chain cDNA of antibody for a
given antigen are each present in the library at a frequency of one
part in 10.sup.4, the combination of an H chain and L chain capable
of binding the antibody will be present at a frequency of one part
in 10.sup.8. Further, in this system, it is not known whether the
combinations of H and L chains obtained are actually produced in
the human body.
[0021] As set forth above, conventional methods of cloning
antigen-specific antibody genes are highly inefficient. Even so,
with considerable effort, it is possible to clone antigen-specific
antibody genes by these methods. However, it is not possible to
identify and select low-frequency antigen-specific lymphocytes
using conventional methods.
[0022] Accordingly, the present invention has as its object to
provide a method of conveniently selecting lymphocytes reacting
with specificity to a certain antigen and efficiently cloning
antigen-specific antigen receptor gene from the selected
antigen-specific lymphocytes, both for antigen-specific lymphocytes
of relatively high frequency and those of low frequency. Further
objects of the present invention are to provide a method of
manufacturing monoclonal antibody from the cloned antigen-specific
immunoglobulin gene, and to provide a method of manufacturing
materials for gene therapy using the cloned antigen-specific T-cell
receptor gene.
DISCLOSURE OF THE INVENTION
[0023] The present invention, which solves the above-stated
problems, is described below.
[0024] The first aspect of the present invention relates to a
microwell array chip that has multiple microwells and is employed
to contain a single lymphocyte specimen in each microwell and
detect antigen-specific lymphocytes in single units; wherein the
microwell array chip is of a shape and of dimensions where only one
lymphocyte is contained in each microwell.
[0025] In the microwell array chip of the first form of the present
invention, the following are desirable:
[0026] (1) The microwell is of cylindrical, rectangular
parallelepiped, inverse conical, or inverse pyramid shape, or some
combination of two or more thereof.
[0027] (2) The diameter of the maximum circle inscribable in a
planar configuration of the microwells falls within a range of from
one to two times the diameter of the lymphocytes that are to be
contained in the microwells, and the depth of the microwells falls
within a range of from one to two times the diameter of the
lymphocytes to be contained in the microwells.
[0028] The second form of the present invention relates to a
microwell array chip that is employed to detect antigen-specific
lymphocytes and has multiple microwells each containing a single
lymphocyte specimen.
[0029] In the microwell array chip of the second aspect of the
present invention, the following are desirable:
[0030] (1) The microwell has a diameter of from 5 to 100
micrometers and a depth of from 5 to 100 micrometers.
[0031] (2) The lymphocyte specimen is contained in the microwell
together with a culture medium.
[0032] (3) The lymphocyte specimen is derived from blood.
[0033] (4) The lymphocyte specimen is a B lymphocyte or T
lymphocyte.
[0034] The third aspect of the present invention relates to a
method of detecting antigen-specific lymphocytes comprising the
steps of adding antigen to each microwell in the microwell array
chip the above-described second aspect of the present invention,
stimulating the lymphocyte specimen, and detecting lymphocyte
specimens reacting with the antigen.
[0035] In the method of detecting antigen-specific lymphocytes of
the third form of the present invention, the following are
desirable:
[0036] (1) The detection of cells reacting with antigen is
conducted by using Ca ion dependent fluorescent dye.
[0037] (2) The detection of cells reacting with antigen is
conducted by employing, as a marker, an activated marker protein
expressed on the surface of the activated lymphocyte specimen that
has been stimulated with antigen.
[0038] (3) The detection of cells reacting with antigen is
conducted by employing, as an indicator, the degree of polarization
of fluorescence emitted by a fluorescent substance in the
lymphocyte specimen.
[0039] (4) The detection of cells reacting with antigen is
conducted by employing, as an indicator, the proliferation of the
lymphocyte specimen or the production of antibody.
[0040] (5) The antigen is a protein, peptide, DNA, RNA, lipid,
sugar chain, or organic macromolecular compound.
[0041] (6) The antigen is a bacterium, virus, autoantigen, tumor
antigen, or allergen.
[0042] The fourth aspect of the present invention relates to a
method of manufacturing antigen-specific lymphocytes comprising the
step of recovering from microwells lymphocyte specimens reacting
with antigen that have been detected by the method of the
above-described third aspect of the present invention.
[0043] The fifth aspect of the present invention relates to a
method in which a single lymphocyte reacting specifically with a
certain antigen (referred to hereinafter as an antigen-specific
lymphocyte) is selected and an antigen-specific antigen receptor
gene is cloned from the single antigen-specific lymphocyte.
[0044] In the method of cloning antigen-specific antigen receptor
gene of the fifth aspect of the present invention, the following
are desirable:
[0045] (1) The selection of the antigen-specific single lymphocyte
is conducted by adding antigen to each microwell in an
antigen-specific lymphocyte detection-use microwell array chip
having multiple microwells each containing a single lymphocyte
specimen, detecting which lymphocytes have reacted with the
antigen, and removing the antigen-specific lymphocytes that have
been detected from the microwells.
[0046] (2) The antigen-specific lymphocyte is present in a
frequency of 0.1 percent or less.
[0047] (3) The antigen-specific lymphocyte is broken down using a
cytolytic agent and the antigen-specific antigen receptor gene is
amplified by RT-PCR.
[0048] (4) The RT-PCR is conducted by preparing cDNA with reverse
transcriptase and carrying out PCR twice with primer mixes for
antigen receptor gene.
[0049] (5) The antigen-specific lymphocyte is a B lymphocyte or T
lymphocyte.
[0050] (6) The antigen-specific antigen receptor gene is an
immunoglobulin gene when the antigen-specific lymphocyte is a B
lymphocyte and a T-cell receptor gene when the antigen-specific
lymphocyte is a T lymphocyte.
[0051] (7) The antigen-specific lymphocyte is a B lymphocyte and an
antigen-specific immunoglobulin gene is cloned.
[0052] (8) The antigen-specific lymphocyte is a T lymphocyte and an
antigen-specific T-cell receptor gene is cloned.
[0053] (9) Gene amplification is conducted in the microwell without
removing from the microwell the antigen-specific lymphocyte that
has been detected.
[0054] The sixth aspect of the present invention relates to a
method of manufacturing monoclonal antibody using the
antigen-specific immunoglobulin gene that has been cloned by the
method of cloning antigen-specific antigen receptor gene of the
fifth aspect of the present invention, specifically, by the method
of cloning in which the antigen-specific lymphocyte is a B
lymphocyte and the antigen-specific immunoglobulin gene is
cloned.
[0055] The seventh aspect of the present invention relates to a
method of manufacturing material for gene therapy employing the
antigen-specific T-cell receptor gene that has been cloned by the
method of cloning antigen-specific antigen receptor gene of the
fifth aspect of the present invention, specifically, by a method of
cloning in which the antigen-specific lymphocyte is a T lymphocyte
and the antigen-specific T-cell receptor gene is cloned.
BRIEF DESCRIPTION OF THE FIGURES
[0056] FIG. 1 is a drawing descriptive of the method of measuring
change in the concentration of Ca ions within the cell using a
fluorescent dye dependant on Ca ions. In particular, the
introduction of Fluo3 dye into the cell and a method of detecting
antigen-specific lymphocytes are described.
[0057] FIG. 2 is a drawing descriptive of the introduction of cells
into a microwell array chip, antigen stimulation, and removal in a
method employing fluorescent dye. In particular, the introduction
of cells containing Fluo3 dye into the microwells is described.
[0058] FIG. 3 is a conventional 96-well plate employed to measure
antigen-specific lymphocytes.
[0059] FIG. 4 shows the results of a test of the efficiency of
introduction of cells into microwells conducted by fluorescence
microscopy or microarray scanning.
[0060] FIG. 5 shows the test results of antigen-specific
B-lymphocytes by microarray scanning.
[0061] FIG. 6 is a plot of fluorescent intensity for 25 (5.times.5)
cells enclosed in the frame shown in FIG. 5.
[0062] FIG. 7 shows the frequency of cells (antigen-specific B
lymphocytes) in which the fluorescent signal has intensified
following antigen stimulation.
[0063] FIG. 8 is a drawing descriptive of PCR amplification of
antibody gene from antigen-specific B lymphocytes.
[0064] FIG. 9 shows a comparison of the sequence of the antibody (L
chain) gene obtained in an embodiment and the sequence of antibody
genes contained in an existing database.
[0065] FIG. 10 shows a comparison of the sequence of antibody (H
chain) gene obtained in an embodiment and the sequence of antibody
gene contained in an existing database.
BEST MODE OF IMPLEMENTING THE INVENTION
[The Microwell Array Chip]
[0066] The microwell array chip of the present invention is a
microwell array chip that has multiple microwells and is employed
to contain a single lymphocyte specimen in each microwell and
detect antigen-specific lymphocytes in single units. The microwell
array chip is of a shape and of dimensions where only one
lymphocyte is contained in each microwell.
[0067] The shape and size of the microwell are not specifically
limited. However, the shape of the microwell may be, for example,
cylindrical or noncylindrical. It may be that of a rectangular
parallelepiped, inverse conical, or inverse pyramid shape (inverse
triangular pyramid, rectangular pyramid, pentagonal pyramid,
hexagonal pyramid, heptagonal pyramid, or pyramid with a greater
number of angles). It may also be of a shape combining two or more
of these shapes. For example, one portion may be cylindrical, while
the remainder is an inverse cone. Or, in the case of an inverse
cone or inverse pyramid, the bottom surface may be the opening of
the microwell and its shape may be one obtained by cutting off a
portion of the top of an inverse cone or inverse pyramid (in which
case the bottom of the microwell is flat). For cylinders and
rectangular parallelepipes, the bottom of the microwell is normally
flat, but may also be in the form of a curved (convex or concave)
surface. The bottom of the microwell may be in the form of a curved
surface as well in the case of shapes obtained by cutting off a
portion of the top of an inverse cone or inverse pyramid.
[0068] The shape and dimensions of the microwell are suitably
determined in consideration of the type (shape, size, and the like)
of the lymphocyte to be contained in the microwell so that a single
lymphocyte can be contained in each microwell.
[0069] To permit a single lymphocyte to be contained in each
microwell, for example, the diameter of the maximum circle that can
be inscribed in the planar configuration of the microwell is
suitably determined to fall within a range of from one to two
times, preferably 1.1 to 1.9 times, and more preferably 1.2 to 1.8
times, the diameter of the lymphocyte to be contained in the
microwell.
[0070] Further, the depth of the microwell is suitably determined
to fall within a range of from one to two times, preferably 1.1 to
1.9 times, and more preferably 1.2 to 1.8 times the diameter of the
lymphocyte to be contained in the microwell.
[0071] When the microwell is cylindrical in shape, for example, the
diameter thereof can be from 5 to 100 micrometers, and when the
lymphocyte is a B lymphocyte, the diameter is desirably from 5 to
15 micrometers. The depth can be from 5 to 100 micrometers, for
example, and when the lymphocyte is a B lymphocyte, the depth is
desirably from 5 to 40 micrometers. However, the dimensions of the
microwell are suitably determined as stated above to obtain a
suitable ratio of the diameter of the lymphocyte to be contained in
the microwell to the size of the microwell.
[0072] The number of microwells present on each microwell array
chip is not specifically limited. However, given that the frequency
of antigen-specific lymphocytes is often only from 1 to at most 500
per 10.sup.5 lymphocytes, the number of microwells present per
square centimeter can range from about 2,000 to 1,000,000, for
example.
[0073] The microwell array chip for detecting antigen-specific
lymphocytes of the present invention is characterized by comprising
multiple microwells each of which holds a single lymphocyte
specimen. The above-described microwell array chip of the present
invention may be employed as is.
[0074] Since each microwell in the microwell array chip for
detecting antigen-specific lymphocytes of the present invention
holds just one lymphocyte specimen, it is possible to specify
antigen-specific lymphocytes at the individual cell level. That is,
in the method of detecting antigen-specific lymphocytes employing
the microwell array chip of the present invention, since only one
lymphocyte specimen is contained in each microwell, it is possible
to specify the lymphocyte specimen reacting with antigen as a
single cell.
[0075] As a result, it is possible to remove an antigen-specific
lymphocyte that has been detected and clone the antigen-specific
antibody gene or T cell receptor gene. For example, given the
ability to clone antigen-specific antibody genes, it is possible to
produce large amounts of human monoclonal antibody. This antibody
can then be administered to an infected patient or the like to
treat or prevent infection.
[0076] However, cells other than lymphocytes may also be contained
along with the lymphocyte specimen in a single microwell. This is
because cells other than lymphocytes do not react with antigen and
are not detected.
[0077] The lymphocyte specimen is contained in the microwell with
culture medium, for example. The following are examples of culture
media suitable for use.
[0078] 1. 137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl.sub.2, 1 mM
MgCl.sub.2, 1 mg/mL glucose, 1 mg/mL BSA, 20 mM HEPES (pH 7.4).
[0079] 2. RPMI 1640 culture medium containing 10 percent FCS (fetal
calf serum).
[0080] 3. RPMI 1640 culture medium 1 mg/mL BSA.
[0081] 4. Dulbecco's MEM culture medium containing 10 percent
FCS.
[0082] 5. Dulbecco's MEM culture medium containing 1 mg/mL BSA.
[0083] The lymphocyte specimen may be derived from blood; for
example, it may be a B lymphocyte or T lymphocyte. Further examples
are lymphocytes derived from lymphoid tissues such as the tonsils
(lymph nodes) and spleen, and lymphocytes infiltrating
pathologically altered parts, such as cancer-infiltrating
lymphocytes.
[The Method of Detecting Antigen-Specific Lymphocytes]
[0084] The method of detecting antigen-specific lymphocytes of the
present invention comprises the steps of adding antigen to each of
the microwells in the above described microwell array chip of the
present invention, stimulating the lymphocytes, and detecting those
lymphocytes reacting with the antigen.
[0085] The antigen may be added to the individual microwells in the
following manner.
[0086] 1. An antigen solution is supplied with a pipette in a
manner covering the entire surface of the microwell array.
[0087] 2. An antigen solution is supplied with an automatic spotter
to each well.
[0088] The antigen that is detected by the method of detecting
antigen-specific lymphocytes of the present invention is not
specifically limited; examples are proteins, peptides, DNA, RNA,
lipids, sugar chains, and organic macromolecular compounds (for
example, environmental hormones). Further examples are bacteria,
viruses, autoantigens, tumor antigens, allergens and the like.
[0089] The cells may be cultured by, for example, suspending the
lymphocytes in culture medium, inserting them into microwells, and
culturing them at room temperature or at 37.degree. C. in the air
or in a CO.sub.2 incubator.
[0090] The cells reacting with antigen are detected by (1) using Ca
ion dependent fluorescent dye, (2) using, as a marker, an activated
marker protein expressed on the surface of a lymphocyte specimen
that has been activated by stimulation with antigen, (3) employing,
as an indicator, the degree of polarization of fluorescence
generated by a fluorescent substance present within the lymphocyte
specimen, and (4) employing, as an indicator, the proliferation of
lymphocyte specimen cells or the generation of antibody by
them.
[0091] More specifically, for example, when antigen binds to the
antigen receptor (immunoglobulin) of a B lymphocyte, signal
transduction first occurs within the cell, after which the cell
proliferates and antibody production occurs. Accordingly, various
methods may be employed to detect signal transduction within the
cell, cell proliferation, and antibody production, thereby
detecting cells reacting to antibody. Alternatively, for example,
when antigen binds to the antigen receptor of a T lymphocyte,
signal transduction first occurs within the cell, after which the
cell proliferates and cytokine production occurs. Accordingly,
various methods may be employed to detect signal transduction
within the cell, cell proliferation, and the production of
cytokine, thereby detecting cells reacting to antigen.
[0092] The detection of signal transduction within the cell to
detect cells reacting with antigen, for example, can be conducted
by detecting change in the concentration of Ca ions within the cell
with Ca ion dependent fluorescent dyes.
[0093] When detecting change in the concentration of Ca ions within
the cell, the fluorescent dye employed may be Fura-2, Fluo-3, or
Fluo-4, and the detection device may be a fluorescence microscope
or microarray scanner.
[0094] Specifically, as shown in FIG. 1, a Ca-ion dependent
fluorescent dye such as Fura-2 or Fluo-3 is introduced into the B
lymphocyte. Next, the B lymphocyte is stimulated with antigen,
causing the Ca ion concentration within the B lymphocyte to rise.
As a result, Ca ions bind to the Ca ion dependent fluorescent dye,
and the fluorescent intensity increases. Cells with low
concentration of Ca ions are shown as bluish in color and cells
with high concentration of Ca ions are shown as reddish color. This
method permits the use of a microwell array chip to detect B
lymphocytes (antigen specificity) in which the Ca ion concentration
within the cells has increased due to stimulation with antigen.
[0095] In the detection of cell proliferation, cells reacting with
antigen can be detected by measuring, for example, the number of
cells by using a live cell-specific fluorescent dye. In this
method, specifically, B lymphocytes are stimulated with antigen and
cultured in a CO.sub.2 incubator at 37.degree. C. for three days,
causing the cells to proliferate. Once the cells have proliferated,
fluorescein diacetate (FDA) or carboxy-fluorescein diacetate
succinimidyl ester (CFSE) solution is added to the culture medium.
These reagents pass through the membranes of living cells and are
decomposed by esterase within the cells, producing a fluorescent
dye that is incapable of passing throughout the membrane. The light
emitted by this fluorescent dye is proportional to the number of
cells, so the sum of the fluorescent intensity of the living cells
within the well can be measured with a fluorescence microscope or
microarray scanner to determine the number of living cells.
[0096] It is also possible to detect cells reacting with antigen by
measuring the production of antibody. Antibody production can be
detected by immunochemically measuring the antibody.
[0097] Specifically, when B lymphocytes are stimulated with
antigen, incubated in a CO.sub.2 incubator for 37.degree. C., and
cultured for one week, they secrete antibody into the culture
medium. Antigen-specific antibody that has been secreted into the
culture medium can be detected by the ELISA method (enzyme-linked
immunosorbent assay).
[0098] Alternatively, it is also possible to employ mitogen,
lectin, antibody, cytokine, PMA, and Ca ionophore to detect signal
transduction, cell proliferation, and antibody production.
[0099] The introduction of cells onto the microwell array chip,
their stimulation with antigen, and their removal in the method
employing fluorescent dye will be described below based on FIG.
2.
[0100] (1) Cell Introduction
[0101] Single cells are introduced into each microwell.
[0102] The cells introduced into the microwells are prepared, for
example, by separating the lymphocyte fraction from peripheral
blood, followed by further separation and purification of the B
lymphocyte fraction.
[0103] Next, the cells are suspended in Fluo3/AM (2 micromole)
solution, kept standing for 30 min. at room temperature, and washed
with buffer solution to remove dye that has not been incorporated
into the cells.
[0104] The cells loaded with Fluo3 are then introduced into the
microwells. Both sides of the microwell array chip are sealed, a
glass cover is placed thereover, and the space between is filled
with buffer solution to prevent it from drying out.
(2) Measuring Fluorescence
[0105] First, the fluorescence of the unstimulated cells is
measured and at the time, fluorescence intensity (A) is calculated.
Next, an antigen solution is applied to flow between the glass
slide and the glass cover, replacing the buffer solution, and the
fluorescence of cells that have been stimulated by the antigen is
measured. One or two minutes following stimulation, the fluorescent
intensity (B) is measured. The cells in wells with a high ratio of
fluorescence intensity (B/A) before and after stimulation are
selected.
(3) Removal (Recovery) of Cells Reacting to Antibody
Stimulation
[0106] When air is introduced between the glass slide and the glass
cover, the cover glass is readily removed. Cells that have reacted
due to antigen stimulation are selected based on the ratio (B/A) of
fluorescence intensity of the cells after stimulation to the ratio
of fluorescent intensity of the cells prior to stimulation and
removed to recover antigen-specific lymphocytes.
[The Method of Cloning Antigen-Specific Antigen Receptor Genes]
[0107] In the cloning method of the present invention, a single
lymphocyte (antigen-specific lymphocyte) specifically reacting with
a certain antigen is selected, and antigen-specific antigen
receptor gene is cloned from this single antigen-specific
lymphocyte.
[0108] The cloning method of the present invention is particularly
effective when the frequency of the antigen-specific lymphocyte is
0.1 percent or less. However, it is also suited to cases where the
frequency exceeds 0.1 percent.
[0109] The antigen-specific lymphocyte may be, for example, a B
lymphocyte or T lymphocyte. Further, the antigen-specific antigen
receptor gene is an immunoglobulin gene when the antigen-specific
lymphocyte is a B lymphocyte and a T cell receptor gene when the
antigen-specific receptor gene is a T lymphocyte.
[0110] Each lymphocyte in the blood reacts with a different
antigen. Accordingly, the present invention can detect a B
lymphocyte specifically reacting with an antigen, and from this B
lymphocyte, immunoglobulin (antibody) gene reacting with an antigen
(pathogen) can be amplified by RT-PCR amplification. Similarly, a T
lymphocyte specifically reacting with an antigen can be detected
and from this T lymphocyte, T cell receptor gene reacting to
antigen (pathogen) can be amplified by RT-PCR.
[The selection of Antigen-Specific Lymphocytes]
[0111] A single antigen-specific lymphocyte can be selected by a
method employing a microwell array chip, for example. In methods
employing a microwell array chip, for example, antigen is added to
each of the microwells of a microwell array chip having multiple
microwells containing single lymphocyte specimens that is used for
detecting antigen-specific lymphocytes. Next, the lymphocytes
reacting with the antigen are detected, the detected
antigen-specific lymphocytes are removed from the microwells, and
it is possible to obtain a single antigen-specific lymphocyte. This
method will be described in greater detail.
(The Microwell Array Chip)
[0112] A microwell array chip having multiple microwells each of
which is capable of holding one lymphocyte specimen can be
employed. Holding a single lymphocyte specimen in each microwell
permits the specification of antigen-specific lymphocytes at the
cell level. That is, using such a microwell array chip, since a
single lymphocyte specimen is contained in each microwell,
lymphocyte specimens reacting with antigen can be specified as
single cells. As a result, antigen-specific lymphocytes can be
detected as single cells. The single antigen-specific lymphocyte
that is detected can be removed and the gene can be cloned.
[0113] However, cells other than lymphocytes may be contained in a
single microwell along with the lymphocyte specimen. This is
because cells other than lymphocytes do not react with antigen and
are not detected.
[0114] An example of a microwell array chip is the above-described
microwell array chip of the present invention.
[0115] A lymphocyte specimen is contained in the microwells
together with a culture medium. Examples of culture media are given
below.
[0116] 1. 137 mM NaCl, 2.7 mM KCl, 1.8 mM CaCl.sub.2, 1 mM Mg
Cl.sub.2 1 mg/mL glucose, 1 mg/mL BSA, 20 mM HEPES (pH 7.4)
[0117] 2. RPMI 1640 culture medium containing 10 percent FCS (fetal
calf serum)
[0118] 3. RPMI 1640 culture medium containing 1 mg/mL BSA
[0119] 4. Dulbecco's MEM culture medium containing 10 percent
FCS
[0120] 5. Dulbecco's MEM culture medium containing 1 mg/mL BSA.
[0121] The lymphocyte specimens may be derived from blood; for
example, they may be B lymphocytes or T lymphocytes. They may also
be lymphocytes derived from lymphoid tissues such as the tonsils
(lymph nodes) and spleen, and lymphocytes infiltrating
pathologically altered parts, such as cancer-infiltrating
lymphocytes.
(The Method of Detecting Antigen-Specific Lymphocytes)
[0122] The method of detecting antigen-specific lymphocytes
comprises the steps of adding antigen to each of the microwells of
the above-described microwell array chip, stimulating the cells,
and detecting the cells that react to the antigen.
[0123] The antigen can be added to each of the microwells in the
following manner.
[0124] 1. An antigen solution is added with a pipette in a manner
covering the entire surface of the microwell array.
[0125] 2. An antigen solution is added to each well with an
automatic spotter.
[0126] The antigen that is detected by the method of detecting
antigen-specific lymphocytes of the present invention is not
specifically limited; examples are proteins, peptides, DNA, RNA,
lipids, sugar chains, and organic macromolecular compounds. Further
examples are bacteria, viruses, autoantigens, tumor antigens,
allergens and the like.
[0127] The cell may be cultured, for example, by suspending the
lymphocytes in culture medium, pouring the medium into microwells,
and culturing at room temperature or at 37.degree. C. in air or in
a CO.sub.2 incubator.
[0128] Cells reacting with antigen may be detected in the following
manner.
[0129] For example, when antigen binds to the antigen receptor
(immunoglobulin) of a B lymphocyte, signal transduction within the
cell occurs first. This is followed by cell proliferation and
antibody production. Accordingly, cells reacting with antigen can
be detected by detection of internal cell signal transduction, cell
proliferation, and antibody production using a number of methods.
Alternatively, when antigen binds to the antigen receptor of a T
lymphocyte, signal transduction within the cell occurs first. This
is followed by cell proliferation and cytokine production.
Accordingly, cells reacting with antigen can be identified by
detection of internal cell signal transduction, cell proliferation,
and cytokine production using a number of methods.
[0130] The detection of signal transduction within the cell to
detect cells reacting with antigen, for example, can be conducted
by detecting change in the concentration of intra-cellular Ca ions
with Ca ion-dependent fluorescent dyes. When detecting change in
the concentration of intra-cellular Ca ions, the fluorescent dye
employed may be Fura-2 or Fluo-3, and the detection device employed
may be a fluorescence microscope or microarray scanner.
[0131] Specifically, as shown in FIG. 1, a Ca ion-dependent
fluorescent dye such as Fura-2 or Fluo-3 is introduced into the B
lymphocyte. Next, the B lymphocyte is stimulated with an antigen,
causing the Ca ion concentration within the B lymphocyte to rise.
As a result, Ca ions bind to the Ca ion dependent fluorescent dye,
and the fluorescent intensity increases. A cell with low
concentration of Ca ions is shown with bluish color and a cell with
high concentration of Ca ions is shown with reddish color. This
method permits the use of a microwell array chip to detect
(antigen-specific) B lymphocytes in which the Ca ion concentration
within the cells has increased due to stimulation with antigen.
[0132] In the detection of cell proliferation, cells reacting with
antigen can be detected by measuring, for example, the number of
cells by using a live cell-specific fluorescent dye. In this
method, specifically, B lymphocytes are stimulated with an antigen
and cultured in a CO.sub.2 incubator at 37.degree. C. for three
days, causing the cells to proliferate. Once the cells have
proliferated, fluorescein diacetate (FDA) or carboxy-fluorescein
diacetate succinimidyl ester (CFSE) solution is added to the
culture medium. These reagents pass through the membranes of living
cells and are decomposed by esterase within the cells, producing a
fluorescent dye that is incapable of passing through the membrane.
The light emitted by this fluorescent dye is proportional to the
number of cells, so the sum of the fluorescent intensity of the
living cells within the well can be measured with a fluorescence
microscope or microarray scanner to determine the number of living
cells.
[0133] It is also possible to detect cells reacting to antigen by
measuring antibody production. Antibody production can be detected
by immunochemical measurement of antibodies.
[0134] Specifically, when B lymphocytes are stimulated with
antigen, cultured in a CO.sub.2 incubator at 37.degree. C. for one
week, they secrete antibody into the culture medium.
Antigen-specific antibody that has been secreted into the culture
medium can be detected by the ELISA method (enzyme-linked
immunosorbent assay).
[0135] In these detection methods, it is also possible to employ
mitogen, lectin, antibody, cytokine, PMA, and Ca ionophore to
detect signal transduction, cell proliferation, and antibody
production.
[0136] The introduction of cells into a microwell array chip in the
method employing a fluorescent dye, stimulation with antigen, and
the removal of the cells will be described below based on FIG.
2.
[0137] (1) Cell Introduction
[0138] Single cells are introduced into each well.
[0139] The cells introduced into the wells are obtained, for
example, by separating the lymphocyte fraction from peripheral
blood, followed by further separation and purification of the B
lymphocyte fraction.
[0140] Next, the cells are suspended in Fluo3/AM (2 microM)
solution, kept standing for 30 min. at room temperature, and washed
with buffer solution to remove the dye that has not been
incorporated into the cells.
[0141] The cells loaded with fluorescent dye are then introduced
into the microwells.
[0142] Both sides of the microwell array chip are sealed, a cover
glass is placed thereover, and the space between microwell array
chip are sealed, a cover glass is filled with buffer solution to
prevent it from drying out.
(2) Measuring Fluorescence
[0143] First, the fluorescence of the unstimulated cells is
measured and at the time, fluorescence intensity (A) is calculated.
Next, an antigen solution is added to flow between the slide glass
and the cover glass, replacing the buffer solution, and the
fluorescence of cells that have been stimulated by the antigen is
measured. One or two minutes following stimulation, the fluorescent
intensity (B) is measured. The cells in wells with a high ratio of
fluorescent intensity (B/A) before and after stimulation are
selected.
(3) Removal (Recovery) of Cells Reacting to Antigen Stimulation
[0144] When air is introduced between the glass slide and the glass
cover, the cover glass is readily removed. Cells that have reacted
due to antigen stimulation are selected based on the ratio of
fluorescent intensity (B/A) of the cells after stimulation to the
ratio of fluorescent intensity of the cells prior to stimulation
and removed. However, antigen-specific lymphocytes that have been
selected (detected) need not be necessary removed from the
microwells, remaining there for gene amplification.
(Gene Amplification)
[0145] The antigen-specific lymphocytes that have been removed are
lysed with a cytolytic agent. RT-PCR is then employed to clone
antigen-specific immunoglobulin (antibody) gene when the
antigen-specific lymphocyte is a B lymphocyte, and to clone
antigen-specific T cell receptor gene when the antigen-specific
lymphocyte is a T lymphocyte.
[0146] Known cytolytic agents may be employed; examples are given
below.
[0147] 1.times.1.sup.st strand buffer [GIBCO-BRL, attached to
SuperScriptI], 0.2 mM of dNTP, 0.25 percent NP-40, 0.1 mg/mL BSA,
10 mM DTT, Random Primer 0.05 microM, 1 U/microliter RNasin.
[0148] The antigen receptor gene in B lymphocytes is identical to
antibody gene and, as a protein, called as immunoglobulin. The
antigen receptor is present on the surface membrane of B
lymphocytes (membrane-bound immunoglobulin), and the antibody is
produced as a common secretory protein (secretory immunoglobulin).
The difference lies on the C terminal side of the protein. Membrane
immunoglobulin has a membrane domain buried in the cell membrane
and a portion extending to the cytoplasmic side. Secretory
immunoglobulin is also produced by the same gene. However, as a
result of alternative splicing, the C terminal side of the protein
differs from membrane immunoglobulin by not having a membrane
domain. Consequently, it is produced as a secretory protein.
However, the antigen binding site of these two proteins is
identical. Accordingly, for B lymphocytes, antibody gene cloning
and antigen receptor gene cloning are identical.
[0149] In the case of T lymphocytes, there is no secretory antigen
receptor. Accordingly, there is only one clone of each antigen
receptor gene. In the case of T lymphocytes, just as in the case of
the primer designed for B lymphocytes, one designs primers. This is
because the genomic structure of the T lymphocyte antigen receptor
(TCR) is nearly identical to the genomic structure of the
immunoglobulin gene of B lymphocytes. Thus, along the same line of
thinking, it is possible to design primers. Accordingly, if one is
able to clone the antibody gene, one can clone the TCR gene by
nearly the same method.
[0150] A further example of the amplification of antigen-specific
immunoglobulin gene will be described below.
[0151] An antigen-specific lymphocyte that has been removed is
lysed with a cytolytic agent to obtain a solution, and this
solution is used to prepare cDNA with reverse transcriptase. Next,
immunoglobulin gene primer mixes are employed to conduct two cycles
of PCR, permitting amplification (cloning) of the desired
antigen-specific immunoglobulin gene.
[0152] Reverse transcribed cDNA can be prepared by the usual
methods (for example, Sambrook J., Russell, D. W., in Molecular
Cloning: A Laboratory Manual, 3.sup.rd Ed. (Cold Spring Harbor
Laboratory Press, New York, 2001).
[0153] In the present invention, the RT reaction may not be
conducted with RNA that has been extracted and purified from cells,
but is suited to be conducted directly with a single cell in the
cytolytic solution.
(Antibody Gene Amplification by PCR)
[0154] In antibody gene amplification by PCR, the PCR reaction is
implemented twice to amplify the V region gene of the antibody
gene.
[0155] An antibody molecule is comprised of an H chain and an L
chain. The H chain of the human antibody gene, in the germ-line
cell system, is comprised of about 200 types of V region gene
fragments, about 20 types of D fragments, and about 6 types of J
fragments. When differentiated into a B lymphocyte, genetic
rearrangement causes each of the V fragments, D fragments, and J
fragments to recombine (V/D/J recombination) into a single antigen
binding site. The same holds true for the L chain.
[0156] Each B lymphocyte expresses antibody molecules of a single
antigen-specificity on the cell surface. Amplification of
antigen-specific antibody gene from an antigen-specific B
lymphocyte requires the use of a primer matching the various V
fragment sequences.
[0157] Antibody molecules are comprised of a peptide chain of two H
chains and two L chains binding to the antigen with the V regions
(in the H chain, the V.sub.H chain, and in the L chain, the V.sub.K
or V.sub.lambda region) on the left side of the schematic drawing
shown in FIG. 8. The following table shows the number of
subfamilies of H chains and L chains. TABLE-US-00001 TABLE 1 V
region C region H chain 7 types 9 types* L chain Kappa chain 7
types 1 type Lambda chain 11 types 7 types**
[0158] As indicated in Table 1 above, the V region of the H chain
of human antibody gene is divided into seven subfamilies. The
sequences of the V fragments in each subfamily are quite similar,
making it possible to establish a common primer. (*In the C.sub.H
region, there are C.sub.gamma 1-4, C.sub.mu, C.sub.delta,
C.sub.alpha 1-2, and C.sub.epsilon. However, a single primer is
designed for the main types of antibodies found in blood--IgG and
IgM--and used in PCR. Since C.sub.gamma 1-4 all share a common
sequence, including C.sub.mu, two types of primer are employed.
**In the C.sub.lambda chain, although C.sub.lambda chains 1 through
7 exist, only one primer of common sequence is employed.)
[0159] Since the same way of thinking can be applied for the
individual subfamilies of V and C regions of the L chain, a primer
is established for each subfamily, and in PCR, a mixture of all the
primers of all the subfamilies of the H and L chains is employed.
That is, a family in the form of a mixture of all types of H and L
chains is employed.
[0160] Two cycles of PCR are conducted as set forth below to
amplify the antibody gene.
[0161] The number of amino acids in the V regions of the H and L
chains is about 110 to 120. Thus, the gene of the V region
comprises about 400 bp.
[0162] Accordingly, as shown in FIG. 8, in PCR1, which is the first
PCR cycle, cDNA is amplified from the leader sequence (L) to the C
region.
[0163] In PCR2, which is the second PCR cycle, cDNA of about 400 bp
inside PCR1 (from the start of the V region to the start of the C
region) is amplified.
[0164] The sequence of the cDNA amplified in the second PCR cycle
is analyzed.
[0165] This will be described in greater detail below.
[0166] In the present invention, the reason for using primer mixes
of different sequences in PCR1 and PCR2 is as follows. Although the
amplification product of PCR1 is re-amplified in PCR2, the product
of PCR1 may contain both specific and nonspecific amplification
products. If PCR2 is amplified with the same primer, both specific
and nonspecific DNA sequences may be amplified. Accordingly, a
primer of which sequence is slightly inside of the position of the
primer of PCR1 in the DNA sequence amplified in PCR1 is employed in
PCR2. In this manner, the nonspecific DNA sequences amplified in
PCR1 are not amplified, yielding a specific DNA sequence. In
addition to changing the primer and conducting a second cycle,
PCR2, to amplify a specific DNA sequence, the quantity produced by
a single PCR cycle is also inadequate when amplifying antibody gene
from a single B lymphocyte, so two PCR cycles are employed.
[0167] In the above-described method, the cDNA sequence amplified
by two PCR cycles is analyzed. In the course of the analysis, it is
unnecessary to separate the first PCR cycle product from the second
PCR cycle product. This is because the PCR1 product is normally
negligible relative to the product amplified in PCR2.
[0168] When the antigen-specific lymphocyte is a T lymphocyte,
antigen-specific T cell receptor gene is cloned. The same cloning
method can be employed as for the above-described B lymphocytes.
The subfamilies of antigen receptors (TCRs) of T lymphocytes are
given in the following table. TABLE-US-00002 TABLE 2 V region C
region Alpha chain 41 types 1 type Beta chain 30 types 2 type
[0169] In the cloning method of the present invention, when the
antigen-specific lymphocyte is a B lymphocyte, antigen-specific
immunoglobulin (antibody) gene is cloned. Then, employing the gene
that has been cloned, a monoclonal antibody can be manufactured.
The monoclonal antibody can be manufactured by the usual methods
from the cloned gene. PCR-amplified cDNA of the V region and the
gene sequence of the C region are joined and inserted into an
expression vector that is employed to obtain the antibody
molecule.
[0170] As an example, it is possible to employ the monoclonal
antibody manufacturing method described in Kanda, H., Mori K.,
Koga, H., Taniguchi, K., Kobayashi, H., Sakahara, H., Konishi, J.,
Endo, K., Watanabe, T. Construction and expression of chimeric
antibodies by a simple replacement of heavy and light chain V genes
into a single cassette vector. Hybridoma 13:359-366, 1994.
[0171] In the method of the present invention, it is unnecessary to
manufacture the entire antibody molecule; it suffices to obtain the
V region. Further, the sequence of genes obtained by PCR is the V
region and a portion of the C region. Accordingly, the gene that is
introduced into the expression vector in the method of
manufacturing monoclonal antibody need not be the (entire) antibody
molecule, but may be just the V region or the V region plus a
portion of the C region.
[0172] The H chain and L chain are usually separately cloned. In
that case, the reaction is conducted in a single tube through RT,
therafter two tubes are employed for the H chain and the L chain in
PCR. It is sometimes possible to synthesize both the H chain and
the L chain in a single tube. However, since it is often the case
where amplification of one of the chains with the ease of
amplification prevails over that of the other, it is preferred to
amplify the H chain and L chain in two separate tubes for reliable
amplification of both chains.
[0173] Expression of both the H chain and L chain is necessary to
obtain the antibody molecule. Both the H chain and the L chain are
incorporated into the above-described expression vector.
[0174] In this case, in the course of separately inserting both the
H chain and L chain into the expression vector and expressing the
protein, two methods exist. One is simultaneous incorporation of
the two expression vectors for H chain and L chain into the cell to
express both the H chain and L chain in a single cell. The other is
to construct an expression vector into which both the H chain and L
chain have been incorporated, and then introduce the expression
vector into the cell to express both the H chain and L chain in a
single cell.
[0175] When introducing an expression vector into an animal cell,
the antibody that is produced is precisely identical to the
antibody that is produced in the human or mammalian body. When
employing E. Coli, although the amino acid sequence is precisely
identical to that of the above-described antibody, there is no
sugar chain attached. Since the method of the present invention
produces antibody precisely identical to that produced in the human
or mammalian body, production of antibody with animal cells is
preferred.
[0176] In the cloning method of the present invention, when the
antigen-specific lymphocyte is a T lymphocyte, antigen-specific T
cell receptor gene is cloned. Using the cloned antigen-specific
receptor molecule, it is possible to conduct genetic therapy. For
example, it is possible to incorporate cloned T cell receptor gene
into T lymphocyte or T lymphocyte precursor cells, thereby
permitting the artificial production of T lymphocytes expressing
specific T cell receptors in pathogens. The administration of T
lymphocytes prepared in this manner to patients with diminished
immune function permits the restoration of the immune function.
EMBODIMENTS
[0177] The present invention is described in greater detail below
through embodiments.
Embodiment 1
1. Separation of B Lymphocytes
[0178] Employing Ficoll-Paque (Pharmacia, Uppsala, Sweden), the
lymphocyte fraction was separated from peripheral blood. The B
lymphocyte fraction was then further separated and purified from
the lymphocyte fraction using an AutoMACS (Miltenyi Biotec,
Bergisch Gladbach, Germany)
2. Introduction of Fluo3 into Cells (see FIG. 1)
[0179] 2.times.10.sup.6 cells of B lymphocyte were suspended in
RPMI 1640/10 percent FCS solution containing 2 micromoles of
Fluo3/AM (Dojin, Kumamoto) and incubated for 30 min at room
temperature. The cells were washed with RPMI 1640/10 percent FCS to
remove the Fluo3/AM that had not been incorporated into the cells.
Subsequently, the cells were suspended in RPMI 1640/10 percent FCS
solution.
3. Microwell Array Chip (see FIG. 2)
[0180] The microwell array chip was made of poly(dimethylsiloxane)
(PDMS) and had microwells of 10 micrometers in diameter and 32
micrometers in depth arranged horizontally and vertically at a
spacing of 30 micrometers (the center-to-center distance of the
microwells was 40 micrometers) on a 2 cm.times.2 cm chip. Seals
with a thickness of 1 mm, a width of about 1 mm, and a length of 2
cm were attached to both sides of the microwell array chip.
4. The Microarray Scanner
[0181] The device employed was basicallya Hitachi Software
Engineering (K.K.) (Yokohama-shi) Microarray Scanner (CRBIO
IIe-FITC) with the following changes: [0182] (1) One of the
built-in lasers (Cy3-use, 532 nm; Cy5-use, 635 nm) was replaced
with a 473 nm laser. [0183] (2) The original focal depth of .+-.25
micrometers was changed in this device to .+-.50 micrometers. 5.
Detection of Activated B Lymphocyte by Microwell Array Chip (see
FIG. 2)
[0184] The above-described cell suspension was added to the
above-described microwell array chip and kept standing for five
minutes. Cells that had not entered into microwells were washed
away with RPMI 1640/10 percent FCS. The diameter of the lymphocytes
was about 8 micrometers (8.+-.1 micrometer). Since the diameter of
the microwells employed was 10 micrometers, a single lymphocyte
entered into each microwell. A glass cover was placed over the
above-described seal and the space between the chip and the glass
cover was filled with RPMI 1640/10 percent FCS solution. The
microwell array chip was inserted into a microarray scanner and
scanned at a resolution of 10 micrometers. The data were stored
(data A: fluorescence prior to antigen stimulation).
[0185] Next, the RPMI 1640/10 percent FCS solution between the chip
and the glass cover was removed and the space was filled with
antigen (10 microgram/mL) dissolved in RPMI 1640/10 percent FCS
solution. One minute after the antigen was added, the microwell
array chip was inserted into the microarray scanner and scanned at
a resolution of 10 micrometers. The data were stored (data B:
fluorescence following antigen stimulation).
[0186] The ratio (B/A) of fluorescent intensity before and after
stimulation was calculated and wells with high ratios were
specified. Antigen-specific B lymphocytes were present in these
wells.
Embodiment 2
[0187] The efficiency of introduction of cells into the microwells
was examined by fluorescence microscopy or microarray scanning.
[0188] Mouse lymphocytes were fluorescently labeled with
CellTracker Orange (Molecular Probe Corp.).
[0189] The mouse lymphocytes were obtained as follows.
[0190] Spleens were extracted from mice and transferred to plastic
Petri dishes containing PBS. The spleens were sandwiched between
two pieces of mesh and crushed to remove lymphocytes. The
lymphocytes that were removed were suspended in RPMI 1640/10
percent FCS solution and the number of lymphocytes was counted.
[0191] The fluorescent labeling of the murine lymphocytes was
conducted as follows.
[0192] 2.times.10.sup.6 cells of B lymphocytes were suspended in
loading buffer (20 mM HEPES, pH 7.4, 137 mM NaCl, 2.7 mM KCl, 1.8
mM CaCl.sub.2, 1 mM MgCl.sub.2, 1 mg/mL glucose, 1 mg/mL BSA)
containing 1 micromole of CellTracker Orange (Molecular Probes,
USA), 0.02 percent of Pluronic F-127 (Molecular Probes, USA) and
incubated for 30 min with vibration at room temperature. The cells
were washed with RPMI 1640/10 percent FCS solution to remove the
CellTracker Orange that had not entered into the cells. The cells
were then suspended in RPMI 1640/10 percent FCS.
[0193] The cell suspension (100 microliters) of fluorescently
labeled mouse lymphocytes (10.sup.5/microliter) was placed on a
microwell array in a manner covering the array to seed the
cells.
[0194] The shape and dimensions of the microarray employed were as
follows.
[0195] Microwells of 10 micrometers in diameter and 12 micrometers
in depth were arranged at both vertical and horizontal spacings of
15 micrometers (with center-to-center distance of 25 micrometers
between microwells) on a chip of 2.times.2.5 cm. Seals of 1 mm
thick, about 1 mm in width, and 2 cm in length were adhered to both
sides of the microwell array chip.
[0196] After letting the cells sink into the wells, the cells that
had not entered into wells were washed away with pipetting. It was
possible to insert cells into most of the wells by repeating the
series of seeding and washing operations a number of times.
Finally, washing was conducted with buffer (RPMI 1640/10 percent
FCS solution) so that no cells remained outside the wells. The
glass cover was put in place both to prevent drying out and to
render the liquid surface uniform, thereby increasing reading
precision. This assembly was then observed with a fluorescence
microscope (BX-URA2/BX51W, Olympus Kogaku Kogyo, Japan) and
inserted into a microarray scanner (CRBIOIIe-FITC, Hitachi Software
Engineering, Japan) to read the fluorescence. The results are given
in Table 4.
[0197] The diameter of the lymphocytes was 8 micrometers and the
diameter of the microwells employed was 10 micrometers, so only one
lymphocyte entered into each microwell. FIG. 4 shows a cluster
(30.times.30 wells) in a portion of the chip.
[0198] The left figure shows the results of observation by
fluorescence microscopy; it was confirmed that cells entered about
85 percent of the wells. The right figure shows the results of
examination by microarray scanner of a different sample. Cells were
confirmed to have entered about 99 percent of the wells.
Embodiment 3
[Detection of Antigen-Specific B Lymphocytes by Microarray
Scanner]
[0199] A healthy volunteer was inoculated with hepatitis B virus
vaccine and B lymphocytes were prepared from peripheral blood on
days 4 and 6 by the usual methods. Human B lymphocytes were
suspended in buffer (loading buffer (20 mM HEPES, pH 7.4, 137 mM
NaCl, 2.7 mM KCl, 1.8 mM CaCl.sub.22H.sub.2O, 1 mM MgCl.sub.2, 1
mg/mL glucose, 1 mg/mL BSA)) containing 4 micromoles of the calcium
fluorescence indicator Fluo-4/AM (Molecular Probes Corp.), 1
micromole of CellTracker Orange (Molecular Probes Corp.), and 0.02
percent of Pluronic F-127 (Molecular Probes Corp.) to introduce
Fluo-4 and CellTracker Orange into the cytoplasm. B lymphocytes
loaded with Fluo-4 and CellTracker Orange were applied by the same
method as in Embodiment 2 onto a microwell array chip identical to
that in Embodiment 2.
[0200] Subsequently, the B lymphocytes loaded with Fluo-4 and
CellTracker Orange that had been seeded in the microwell array chip
were stimulated with hepatitis B virus antigen HBs protein.
Following stimulation, the fluorescence of the B lymphocytes was
measured with a microwell array scanner. The results are shown in
FIG. 5.
[0201] The stimulation with hepatitis B virus antigen HBs protein
was conducted as follows.
[0202] The RPMI 1640/10 percent FCS solution was extracted from the
microwell array chip after the chip had been removed from the
microwell array scanner and replaced with hepatitis B virus antigen
HBs protein solution that had been diluted to 100 micrograms/mL in
RPMI 1640/10 percent FCS solution. The chip was then reinserted
into the microarray scanner and scanned at a resolution of 2.5
micrometers about one minute later.
[0203] The left figure in FIG. 5 shows the fluorescent image prior
to stimulation of the lymphocytes. The lymphocytes into which
Fluo-4 had been introduced emitted only slight fluorescence, so the
image exhibited a pale blue color. The intensity of fluorescence
was also quite low.
[0204] By contrast, the right figure shows the fluorescent image
after stimulation of the lymphocytes with antigen (100
micrograms/mL of hepatitis B virus antigen HBs protein). Most of
the lymphocytes have undergone no change in fluorescent intensity.
However, the fluorescence of antigen-specific B lymphocytes (the
portion indicated by the arrow) has increased, appearing red in the
image.
[0205] Observation of the fluorescence of CellTracker Orange
confirmed that one cell was present in each well both before and
after stimulation, and that there was no migration of cells between
wells before and after stimulation (data not shown).
[0206] The measured values of the intensity of fluorescence of each
of the 25 (5.times.5) cells enclosed by the box in FIG. 5 are
plotted in FIG. 6.
[0207] The fluorescent intensity of the antigen-specific B
lymphocytes (indicated by the arrow) was about 77,000 (77,454)
prior to stimulation, and was about 350,000 (349,242) after
stimulation, representing a roughly 4.5-fold increase. By contrast,
the 24 lymphocytes that did not react to the stimulation had an
average value before stimulation of 52,000 (52,683.875) and an
average value after stimulation of 39,000 (38,720.833), or an
average change of 0.75-fold; no significant change in intensity of
fluorescence was observed.
[0208] In FIG. 6, the center straight (inclined) line shows the
intensity of fluorescence when there was no change in intensity of
fluorescence before and after stimulation. The two straight
(inclined) lines on either side show the intensity of fluorescence
when the intensity of fluorescence increased four-fold (straight
line above) and one-quarter-fold (straight line below) following
stimulation relative to the intensity of fluorescence prior to
stimulation. The intensity of fluorescence of antigen-specific B
lymphocytes (indicated by the arrow) is positioned somewhat above
the straight line above. The present method, where each microwell
contains a single lymphocyte, was found to be capable of detecting
a single antigen-specific B lymphocyte stimulated by hepatitis B
virus antigen HBs protein.
Embodiment 4
[Detection of Antigen-Specific B Lymphocytes with a Microwell Array
Chip]
[0209] Healthy volunteers (#1, #2) in which the antibody titer for
the HBs antigen of hepatitis B virus was high due to previous
inoculation with hepatitis B virus vaccine were inoculated by the
usual method with hepatitis B virus vaccine (10 micrograms of HBs
antigen), peripheral blood was collected both before and after
inoculation (days 4, 6, 8 and 10), the lymphocytes were separated,
and the B lymphocytes were further separated and prepared. The B
lymphocytes were labeled in the same manner as in Embodiment 3 with
4 micromoles of Fluo-4 (Molecular Probes Corp.) and 1 micromole of
CellTracker Orange (Molecular Probes Corp.), applied onto a
microwell array chip, and stimulated with hepatitis B virus antigen
(100 micrograms/mL of HBs protein). A microarray scanner was
employed to measure the fluorescence of the cells before and after
stimulation with antigen. Prior to stimulation, the Fluo-4
fluorescent signal was weak. Following stimulation, the number of
cells (antigen-specific B lymphocytes) for which the Fluo-4
fluorescent signal had increased was counted. Next, the
fluorescence of CellTracker Orange was observed and the total
number of B lymphocytes was counted. The number of cells exhibiting
increased Fluo-4 fluorescence due to reaction with antigen was
divided by the total number of B lymphocytes to calculate the
frequency (percentage) and the results were graphed. The results
are shown in FIG. 7.
[0210] The number of cells (antigen-specific B lymphocytes)
exhibiting an increased fluorescence signal following stimulation
was counted in the following manner.
[0211] A microarray scanner was employed to obtain fluorescent
images of Fluo-4 and CellTracker Orange before and after
stimulation with antigen. These were compared. In cells showing no
displacement of position before and after antigen stimulation based
on the fluorescent signal of the CellTracker Orange, cells that
exhibited a light blue fluorescent signal of Fluo-4 prior to
stimulation and in which the Fluo-4 fluorescent signal increased
following stimulation, becoming red, were counted as cells in which
the signal had increased (antigen-specific B lymphocytes). To
calculate the frequency, the number of cells in which the
fluorescent signal of Fluo-4 increased (antigen-specific B
lymphocytes) was counted in five randomly selected clusters (4,500
wells). The total number of cells contained in the same five
clusters (4,500 wells) was then counted based on the fluorescent
image of CellTracker Orange (Molecular Probe Corp.).
[0212] The following were determined based on the results shown in
FIG. 7. [0213] 1. Hepatitis B virus antigen-specific B lymphocytes
in the peripheral blood of healthy volunteers whose antibody titer
for HBs antigen of the hepatitis B virus was increased by
inoculation with hepatitis B virus vaccine accounted for only 1 to
2 percent of the total B lymphocytes. [0214] 2. Further, at the
peak 4 to 6 days after vaccine inoculation, the ratio of
antigen-specific B lymphocytes to the total number of B lymphocytes
increased, thereafter it dropped to the ratio that had existed
prior to vaccine inoculation. [0215] 3. The present method is
capable of detecting the presence or absence, frequency, and
changes in antigen-specific B lymphocytes in human peripheral
blood.
Embodiment 5
[0215] 1. Separation of B Lymphocytes
[0216] Employing Ficoll-Paque (Pharmacia, Uppsala, Sweden), the
lymphocyte fraction was separated from peripheral blood. The B
lymphocyte fraction was then further separated and purified from
the lymphocyte fraction using an AutoMACS (Miltenyi Biotec,
Bergisch Gladbach, Germany).
2. Introduction of Fluo3 into Cells (see FIG. 1)
[0217] 2.times.10.sup.6 cells of B lymphocytes were suspended in 2
micromoles of Fluo3/AM (Dojin, Kumamoto)/loading buffer (137 mM
NaCl, 2.7 mM KCl, 1.8 mM CaCl.sub.2, 1 mM MgCl.sub.2, 1 mg/mL
glucose, 1 mg/mL BSA, and 20 mM HEPES (pH 7.4)) and incubated for
30 min at room temperature. The cells were washed with loading
buffer to remove the Fluo3/AM that had not been incorporated into
the cells. Subsequently, the cells were suspended in RPMI 1640/10
percent FCS solution.
3. Microwell Array Chip (see FIG. 2)
[0218] The microwell array chip was made of poly(dimethylsiloxane)
(PDMS) and had microwells of 10 micrometers in diameter and 32
micrometers in depth arranged horizontally and vertically at a
spacing of 30 micrometers (the center-to-center distance of the
microwells was 40 micrometers) on a 2.times.2 cm chip. Seals with a
thickness of 1 mm, a width of about 1 mm, and a length of 2 cm were
adhered to both sides of the chip.
4. The Microarray Scanner
[0219] The device employed was basically a Hitachi Software
Engineering (K.K.) (Yokohamashi) Microarray Scanner (CRBIO Ile)
with the following change: one of the built-in lasers (Cy3-use, 532
nm; Cy5-use, 635 nm) was replaced with a 473 nm laser.
5. Detection of Activated B Lymphocytes Using a Microwell Array
Chip (see FIG. 2)
[0220] The above-described cell suspension was added to the
above-described microwell array chip and kept standing for five
minutes. Cells that had not entered microwells were washed away
with RPMI 1640/10 percent FCS. The diameter of the lymphocytes was
about 8 micrometers. Since the diameter of the microwells employed
was 10 micrometers, a single lymphocyte entered each microwell. A
glass cover was placed over the above-described seal and the space
between the chip and the glass cover was filled with RPMI 1640/10
percent FCS solution. The microwell array chip was inserted into a
microarray scanner and scanned at a resolution of 10 micrometers.
The data were stored (data A: fluorescence prior to antigen
stimulation).
[0221] Next, the RPMI 1640/10 percent FCS solution between the chip
and the glass cover was removed and the space was filled with
antigen (10 micrograms/mL) dissolved in RPMI 1640/10 percent FCS
solution. One minute after the antigen was added, the microwell
array chip was inserted into the microarray scanner and scanned at
a resolution of 10 micrometers. The data were stored (data B:
fluorescence following antigen stimulation).
[0222] The ratio (B/A) of fluorescent intensity before and after
stimulation was calculated, and wells with high ratios were
specified. Antigen-specific B lymphocytes were present in these
wells.
6. Separating Out Cells from the Microwells
[0223] The cells were separated out under a microscope using a
glass capillary with a micromanipulator.
7. Amplification of Antigen-Specific B Lymphocytes by PCR (see FIG.
8)
[0224] A single antigen-specific B lymphocyte was added to a PCR
tube (5 microliters). To the cell was added 15.15 microliters of
cytolytic solution (final concentration when added to 25
microliters: 1.times.1.sup.st strand buffer [GIBCO-BRL, attached to
SuperScriptII], 0.2 mM dNTP, 0.25 percent NP-40, 0.1 mg/mL BSA, 10
mM DTT, 0.05 micromole of Random Primer, 1 U/microliter RNasin
[Promega, Madison, Wis.]). To this was added the reverse
transcriptase SuperScriptII (4.85 microliters, 50 U) (GIBCO-BRL,
Rockville, Md.), the mixture was reacted for one hour at 37.degree.
C., and cDNA was synthesized from mRNA. TABLE-US-00003 RT-PCR
reaction Cell sol. (1 cell) 5.0 microliters 1.sup.st strand buffer
(5.times.) 5.0 2.5 mM dNTP 2.0 2.5% NP-40 2.5 1 mg/ml BSA 2.5 0.1 M
DTT 2.5 Random primer (50 pmol/microliters) 0.025 RNase Inhibitor
(RNasin 40 U/microliters) 0.625 Super Script II 4.85 (50 U) Total
25.0 microliters 37.degree. C. 1 h
[0225] Based on the above-described reaction, cDNA was produced
with reverse transcriptase from the mRNA of a single
lymphocyte.
Amplification of Antibody Gene:
[0226] The V region of the H chain of the human antibody gene is
divided into seven subfamilies. Since the sequences of the V
fragment in each subfamily are quite similar, it is possible to
design a common primer. Primers were established for each of the
subfamilies of the H chain and the L chain. Using a mixed primer
comprising primers for all subfamilies of the H chain and the L
chain, PCR was conducted twice as set forth below to amplify
antibody gene.
[0227] In the first reaction, PCR1, 5 microliters of the
above-described cDNA was added to 15 microliters of PCR mix (final
concentration: 1.times.TAKARA ExTaq buffer, 0.25 mM dNTP, 0.5
micromole of Primer 1 per subfamily, 0.05 U/microliter of ExTaq
[Takara, Kyoto]) and the mixture was reacted at 94.degree. C. for 3
min; (94.degree. C., 30 sec; 60.degree. C., 1 min; 72.degree. C., 1
min 30 sec).times.40 cycles; 72.degree. C., 5 min; and infinitely
at 10.degree. C. TABLE-US-00004 PCR1 cDNA (above-described RT
reaction solution) 5.0 microliters 10.times. ExTaq buffer 2.0 2.5
mM dNTP 2.0 Primer 1 5' Mix (10 micromoles each) 1.0 Primer 1 3'
Mix (10 micromoles each) 1.0 H.sub.2O 7.0 Takara ExTaq (0.5
U/microliter) 2.0 Total 20.0 microliters
94.degree. C., 3 min. 94.degree. C., 30 sec; 60.degree. C., 1 min;
72.degree. C., 1.5 min. 40 cycles 72.degree. C., 5 min. 10.degree.
C.
[0228] The PCR1 reaction amplified the DNA sequence from the leader
sequence of the immunoglobulin (antibody) gene to the constant
portion (C) region.
[0229] The sequences of the primers (for the H chain) employed in
the above-described reaction are given below. TABLE-US-00005 Primer
1 5' Mix (10 micromoles each) (primers used for the V region)
hVH17a.1 atggactgsayytggagvdtc (SEQ ID No = 1) hVH2a.1
tccacrctcctgctrctgac (SEQ ID No = 2) hVH3a.1 gggcygagstggvttttyct
(SEQ ID No = 3) hVH4a.1 tcctcctsctggtggcagct (SEQ ID No = 4) hVH5.1
tcaaccgccatcctcgccct (SEQ ID No = 5) hVR6.1 ctccttcctcatcttcctgcc
(SEQ ID No = 6) Primer 1 3' Mix (10 micromoles each) (primers used
for the C region) hIGHG1-4out agtccttgaccaggcagccca (SEQ ID No = 7)
hIGHMout attctcacaggagacgagggg (SEQ ID No = 8)
[0230] The sequences of the primers (for the L chain) employed in
the above-described reactions are given below. TABLE-US-00006 PCR1
5' primer hKV12.1 atgaggstcccygctcagctc (SEQ ID No = 9) hKV3.1
ctcttcctcctgctactctggc (SEQ ID No = 10) hKV45.1 ctsttsctytggatctctg
(SEQ ID No = 11) hKV6.1 tgggtttctgctgctctggg (SEQ ID No = 12)
hKV7.1 atagggtccggggctcctttg (SEQ ID No = 13) hLV12.1
cykctsctcctcactctcctc (SEQ ID No = 14) hLV3.1 ttctcctcctcggcctcctct
(SEQ ID No = 15) hLV4.2-2 ccagcytgtgctgactcaatc (SEQ ID No = 16)
hLV789.2 tcycagmctgtgstgacycag (SEQ ID No = 17) hLV6.1
ttttatgctgactcagcccc (SEQ ID No = 18) hLV7.1 ggcctggactcctctctttctg
(SEQ ID No = 19) hLV8.1 ggcctggatgatgcttctcctc (SEQ ID No = 20)
hLV9.1 tcctctgctcctcaccctcct (SEQ ID No = 21) hLV10.1
cctgggtcatgctcctcctga (SEQ ID No = 22) hLV11.1
gcctgggctccactacttctc (SEQ ID No = 23) 3' primer hIGK1
ctgctcatcagatggcggga (SEQ ID No = 24) hIGL1 gacacacyagtgtggccttgt
(SEQ ID No = 25)
[0231] In the PCR2 reaction, 2 microliters of the PCR1 reaction
solution were added to 18 microliters of PCR mix (final
concentration: 1.times.TAKARA ExTaq buffer, 0.25 mM dNTP, 0.5
micromole of Primer 2 per subfamily, ExTaq 0.05 U/microliter) and
the mixture was reacted at 94.degree. C. for 3 min; (94.degree. C.,
30 sec; 60.degree. C., 1 min; 72.degree. C., 1 min 30 sec).times.40
cycles; 72.degree. C., 5 min; and infinitely at 10.degree. C.
TABLE-US-00007 PCR2 PCR 1 sol. 2.0 10.times. ExTaq buffer 2.0 2.5
mM dNTP 2.0 Primer 2 5' Mix (10 micromoles each) 1.0 Primer 2 3'
Mix (10 micromoles each) 1.0 H.sub.2O 10.0 Takara ExTaq (0.5
U/microliter) 2.0 Total 20.0
94.degree. C., 3 min. 94.degree. C., 30 sec; 60.degree. C., 1 min;
72.degree. C., 1.5 min. 40 cycles 72.degree. C., 5 min. 10.degree.
C.
[0232] The PCR2 reaction amplified from its variable region
(V.sub.H) to its constant region of the DNA sequence of the
immunoglobulin (antibody) gene that had been amplified by PCR1.
[0233] The sequences of the primers (for the H chain) employed in
the above-described reaction are given below. TABLE-US-00008 Primer
2 Mix Primer 2 5' Mix (10 micromoles each) hVH17a.2
ggtgcagctkgtrcartctgg (SEQ ID No = 26) hVH2a.2
caccttgarggagtctggtcc (SEQ ID No = 27) hVH3a.2
aggtdcarctgktggagtcyg (SEQ ID No = 28) hVH4a.2
ggtcctgtcycagstgcagct (SEQ ID No = 29) hVH5a.2 gtgcagctggtgcagtctgg
(SEQ ID No = 30) hVH6.2 gcagcagtcaggtccaggact (SEQ ID No = 31)
Primer 2 3' Mix (10.mu.M each) hIGIJG1-4s aagacsgatgggcccttggtg
(SEQ ID No = 32) hIGHM aagggttgggcggatgcact (SEQ ID No = 33)
[0234] The sequences of the primers (for the L chain) employed in
the above-described reaction are given below. TABLE-US-00009 PCR2
5' primer hKV1.2 ccagatgacccagtctccatc (SEQ ID No = 34) hKV2.2
ccagtggggatattgtgatgac (SEQ ID No = 35) hKV3.2
cagtctccagccaccctgtct (SEQ ID No = 36) hKV4.2 gtgatgacccagtctccagac
(SEQ ID No = 37) hKV5.2 acactcacgcagtctccagca (SEQ ID No = 38)
hKV67.2 ttgtgctgacycagtctccag (SEQ ID No = 39) hLV1.2
agtctgtgctgacgcagccgc (SEQ ID No = 40) hLV23.2
tgactcagccwcyctcmgtgtc (SEQ ID No = 41) hLV4.2-3
caatcatcctctgcmtctgc (SEQ ID No = 42) hLV5.2-2
gactcagccaacctccctctc (SEQ ID No = 43) hLV6.2 gactcagccccactctgtgtc
(SEQ ID No = 44) hLV789.2 tcycagmctgtgstgacycag (SEQ ID No = 45)
hLV1011.2 tgactcagccmcmctckgtgtc (SEQ ID No = 46) 3' primer hIGK2
gacagatggtgcagccacagt (SEQ ID No = 47) hIGL2 cttgragctcctcagaggaggg
(SEQ ID No = 48)
[0235] The PCR product was analyzed with agarose gel, purified,
cloned with pT7Blue-T vector (Novagen, Madison, Wis.), and the
antibody gene sequence was determined. A comparison with antibody
gene sequences in existing databases is shown in FIGS. 9 and 10.
FIG. 9 shows L chain sequences and FIG. 10 shows H chain sequences.
In both of these figures, the base sequence given above is the
sequence of an actual antibody gene that was amplified by RT-PCR
from a single B lymphocyte, and the base sequence given below is an
existing sequence recorded in a database.
FIG. 9
[0236] 1.sup.st nucleotide sequence (sequenced antibody gene) File
Name: L1 (SEQ ID No.=49) [0237] 2.sup.nd nucleotide sequence
(existing sequence) File Name: L33038 (SEQ ID No.=50) FIG. 10
[0238] 1.sup.st nucleotide sequence (sequenced antibody gene) File
Name: H1 (SEQ ID No.=51) [0239] 2.sup.nd nucleotide sequence
(existing sequence) File Name: AF062204 (SEQ ID No.=52)
[0240] The 94 percent in FIG. 9 and the 98 percent in FIG. 10
indicate the homology between the sequenced antibody gene and the
existing sequence. Based on the homology values, it is presumed
that the sequenced antibody gene and the existing sequence were
antibodies corresponding to different antigens.
INDUSTRIAL APPLICABILITY
[0241] In the present invention, single lymphocytes in the blood
are added to single microwells and the lymphocytes are stimulated
with antigen. The antigen referred to here is a pathogen such as
the bacterium or virus of an infectious disease. Each of the
lymphocytes in the blood reacts with different antigens. Using the
microwell array chip of the present invention, it is possible to
detect a lymphocyte reacting with an antigen, for example. Further,
it is possible to recover the antigen-specific B lymphocyte that is
detected. Recovery of the antigen-specific lymphocyte permits the
amplification by PCR or the like of the antibody gene reacting with
an antigen (pathogen) in a separate tube from the microwell. It is
also possible to amplify the antibody gene reacting with the
antigen (pathogen) within the microwell in which the
antigen-specific B lymphocyte was detected.
[0242] The method of detecting antigen-specific lymphocytes of the
present invention employs a microwell array chip. Thus, since the
antigen-specific lymphocyte that is detected is present in a
microwell, the processing (separation and DNA/RNA preparation) of
the cell is easy. Further, the response of the cell to antigen can
be detected. It is possible to analyze the response of the cell not
just to antigen, but also to various stimuli, and to analyze the
effects of various reagents on the cell response.
[0243] By detecting pathogen-specific lymphocytes and cloning
pathogen-specific antibody genes, antibody treatment methods
employing antibodies can be anticipated for infectious diseases. By
detecting tumor-specific lymphocytes and cloning tumor-specific
antibody genes and tumor-specific T cell receptor genes, antibody
treatment methods employing antibodies and gene therapies employing
T cell receptor genes can be anticipated for cancer.
[0244] For autoimmune disease, by detecting autoreactive
lymphocytes and cloning autoantigen-specific antibody genes or T
cell receptor genes, and for allergies, by detecting
allergen-specific lymphocytes and cloning IgE genes, it will be
possible to accurately understand pathogenesis and condition of
disease, and treat patients according to pathogenesis and monitor
treatment effects.
[0245] Further, by monitoring the antibody genes and T cell
receptor genes collectively possessed by individuals in all
lymphocytes, tailored medical treatment applications become
possible through the monitoring of the immunofunctions of Japanese
and Chinese herbal medicine and anticipating immunoresponses to
pathogens.
Sequence CWU 1
1
52 1 21 DNA Artificial Sequence H chain primer sequence, hVH17a.1 1
atggactgsa yytggagvdt c 21 2 20 DNA Artificial Sequence H chain
primer sequence, hVH2a.1 2 tccacrctcc tgctrctgac 20 3 20 DNA
Artificial Sequence H chain primer sequence, hVH3a.1 3 gggcygagst
ggvttttyct 20 4 20 DNA Artificial Sequence H chain primer sequence,
hVH4a.1 4 tcctcctsct ggtggcagct 20 5 20 DNA Artificial Sequence H
chain primer sequence, hVH5.1 5 tcaaccgcca tcctcgccct 20 6 21 DNA
Artificial Sequence H chain primer sequence, hVH6.1 6 ctccttcctc
atcttcctgc c 21 7 21 DNA Artificial Sequence C chain primer
sequence, hIGHG1-4out 7 agtccttgac caggcagccc a 21 8 21 DNA
Artificial Sequence C chain primer sequence, hIGHMout 8 attctcacag
gagacgaggg g 21 9 21 DNA Artificial Sequence L chain primer
sequence, hKV12.1 9 atgaggstcc cygctcagct c 21 10 22 DNA Artificial
Sequence L chain primer sequence, hKV3.1 10 ctcttcctcc tgctactctg
gc 22 11 19 DNA Artificial Sequence L chain primer sequence,
hKV45.1 11 ctsttsctyt ggatctctg 19 12 20 DNA Artificial Sequence L
chain primer sequence, hKV6.1 12 tgggtttctg ctgctctggg 20 13 21 DNA
Artificial Sequence L chain primer sequence, hKV7.1 13 atagggtccg
gggctccttt g 21 14 21 DNA Artificial Sequence L chain primer
sequence, hLV12.1 14 cykctsctcc tcactctcct c 21 15 21 DNA
Artificial Sequence L chain primer sequence, hLV3.1 15 ttctcctcct
cggcctcctc t 21 16 21 DNA Artificial Sequence L chain primer
sequence, hLV4.2-2 16 ccagcytgtg ctgactcaat c 21 17 21 DNA
Artificial Sequence L chain primer sequence, hLV789.2 17 tcycagmctg
tgstgacyca g 21 18 20 DNA Artificial Sequence L chain primer
sequence, hLV6.1 18 ttttatgctg actcagcccc 20 19 22 DNA Artificial
Sequence L chain primer sequence, hLV7.1 19 ggcctggact cctctctttc
tg 22 20 22 DNA Artificial Sequence L chain primer sequence, hLV8.1
20 ggcctggatg atgcttctcc tc 22 21 21 DNA Artificial Sequence L
chain primer sequence, hLV9.1 21 tcctctgctc ctcaccctcc t 21 22 21
DNA Artificial Sequence L chain primer sequence, hLV10.1 22
cctgggtcat gctcctcctg a 21 23 21 DNA Artificial Sequence L chain
primer sequence, hLV11.1 23 gcctgggctc cactacttct c 21 24 20 DNA
Artificial Sequence L chain primer sequence, hIGK1 24 ctgctcatca
gatggcggga 20 25 21 DNA Artificial Sequence L chain primer
sequence, hIGL1 25 gacacacyag tgtggccttg t 21 26 21 DNA Artificial
Sequence H chain primer sequence, hVH17a.2 26 ggtgcagctk gtrcartctg
g 21 27 21 DNA Artificial Sequence H chain primer sequence, hVH2a.2
27 caccttgarg gagtctggtc c 21 28 21 DNA Artificial Sequence H chain
primer sequence, hVH3a.2 28 aggtdcarct gktggagtcy g 21 29 21 DNA
Artificial Sequence H chain primer sequence, hVH4a.2 29 ggtcctgtcy
cagstgcagc t 21 30 20 DNA Artificial Sequence H chain primer
sequence, hVH5a.2 30 gtgcagctgg tgcagtctgg 20 31 21 DNA Artificial
Sequence H chain primer sequence, hVH6.2 31 gcagcagtca ggtccaggac t
21 32 21 DNA Artificial Sequence H chain primer sequence, hIGHG1-4s
32 aagacsgatg ggcccttggt g 21 33 20 DNA Artificial Sequence H chain
primer sequence, hIGHM 33 aagggttggg cggatgcact 20 34 21 DNA
Artificial Sequence L chain primer sequence, hKV1.2 34 ccagatgacc
cagtctccat c 21 35 22 DNA Artificial Sequence L chain primer
sequence, hKV2.2 35 ccagtgggga tattgtgatg ac 22 36 21 DNA
Artificial Sequence L chain primer sequence, hKV3.2 36 cagtctccag
ccaccctgtc t 21 37 21 DNA Artificial Sequence L chain primer
sequence, hKV4.2 37 gtgatgaccc agtctccaga c 21 38 21 DNA Artificial
Sequence L chain primer sequence, hKV5.2 38 acactcacgc agtctccagc a
21 39 21 DNA Artificial Sequence L chain primer sequence, hKV67.2
39 ttgtgctgac ycagtctcca g 21 40 21 DNA Artificial Sequence L chain
primer sequence, hLV1.2 40 agtctgtgct gacgcagccg c 21 41 22 DNA
Artificial Sequence L chain primer sequence, hLV23.2 41 tgactcagcc
wcyctcmgtg tc 22 42 20 DNA Artificial Sequence L chain primer
sequence, hLV4.2-3 42 caatcatcct ctgcmtctgc 20 43 21 DNA Artificial
Sequence L chain primer sequence, hLV5.2-2 43 gactcagcca acctccctct
c 21 44 21 DNA Artificial Sequence L chain primer sequence, hLV6.2
44 gactcagccc cactctgtgt c 21 45 21 DNA Artificial Sequence L chain
primer sequence, hLV789.2 45 tcycagmctg tgstgacyca g 21 46 22 DNA
Artificial Sequence L chain primer sequence, hLV1011.2 46
tgactcagcc mcmctckgtg tc 22 47 21 DNA Artificial Sequence L chain
primer sequence, hIGK2 47 gacagatggt gcagccacag t 21 48 22 DNA
Artificial Sequence L chain primer sequence, hIGL2 48 cttgragctc
ctcagaggag gg 22 49 335 DNA Homo sapiens misc_feature (1)..(335)
Human antibody 49 cagtctccag ccaccctgtc tttgtctcca ggggcaaagt
agccaccctc tcctgcnggg 60 ccagtcagag tgttagcanc tacttagcct
ggtaccaaca gaaacactgg ccaggctccc 120 aggctcctna tctatgatgc
atctcaacag ggccactggc atcccagcca ggttaagtgg 180 cagtgggtct
gggacagact tcactctcac catcancagc ctagagcctg aagattntgc 240
agttnattac tgtcancagc gtatcaactg gcctctcact ttcggcggag ggaccaaggc
300 tggagatcaa acgaactgtg gctgcaccat ctgtc 335 50 330 DNA Homo
sapiens misc_feature (1)..(330) Human antibody 50 cagtctccag
ccaccctgtc tttgtctcca ggggaaagag ccaccctctc ctgcagggcc 60
agtcagagtg ttagcagcta cttagcctgg taccaacaga aacctggcca ggctcccagg
120 ctcctcatct atgatgcatc caacagggcc actggcatcc cagccacctt
cagtggcagt 180 gggtctggga cagacttcac tctcaccatc agcagcctag
agcctgaaga ttttgcagtt 240 tattactgtc agcagcgtag caactgggtg
ctcactttcg gcggagggac caaggtggag 300 atcaaacgaa ctgtggctgc
accatctgtc 330 51 312 DNA Homo sapiens misc_feature (1)..(312)
Human antibody 51 ggtcctgtct caggtgcagc tgcaggcagt cgggcccagt
gactggtgaa gccttcggag 60 accctgtccc tcacctgcac tgtctctggt
ggctccatca gcagtagtag ttactactgg 120 ggctggatcc gccagccccc
agggaagggg ctggagtgga ttgggagtat ctattatagt 180 gggagcacct
actacaaccc gtccctcaag agtcgagtca ccatatccgt agacacgtcc 240
aagaaccagt tctccctgaa gctgagctct gtgaccgccg cagacacggc tgtgtattac
300 tgtgcgagac ag 312 52 310 DNA Homo sapiens misc_feature
(1)..(310) Human antibody 52 ggtcctgtcc cagctgcagc tgcaggagtc
gggcccagga ctggtgaagc cttcggagac 60 cctgtccctc acctgcactg
tctctggtgg ctccatcagc agtagtagtt actactgggg 120 ctggatccgc
cagcccccag ggaaggggct ggagtggatt gggagtatct attatagtgg 180
gagcacctac tacaacccgt ccctcaagag tcgagtcacc atatccgtag acacgtccaa
240 gaaccagttc tccctgaagc tgagctctgt gaccgccgca gacacggctg
tgtattactg 300 tgcgagacag 310
* * * * *