U.S. patent application number 11/128422 was filed with the patent office on 2006-06-15 for cytokine designated 4-1bb ligand and human receptor that binds thereto.
Invention is credited to Mark R. Alderson, Raymond G. Goodwin, Craig A. Smith.
Application Number | 20060127985 11/128422 |
Document ID | / |
Family ID | 37423199 |
Filed Date | 2006-06-15 |
United States Patent
Application |
20060127985 |
Kind Code |
A1 |
Goodwin; Raymond G. ; et
al. |
June 15, 2006 |
Cytokine designated 4-1BB ligand and human receptor that binds
thereto
Abstract
Novel 4-1BB ligand (4-1BB-L) polypeptides and a human cell
surface receptor designated 4-1BB that binds 4-1BB-L are provided.
Isolated 4-1BB-L-encoding and human 4-1BB-encoding DNA sequences,
recombinant expression vectors comprising the isolated DNA
sequences, and host cells transformed with the recombinant
expression vectors are disclosed, along with methods for producing
the novel polypeptides by cultivating such transformed host cells.
Soluble forms of the 4-1BB-L or 4-1BB polypeptides are derived from
the extracellular domains thereof.
Inventors: |
Goodwin; Raymond G.;
(Seattle, WA) ; Smith; Craig A.; (Seattle, WA)
; Alderson; Mark R.; (Bainbridge Island, WA) |
Correspondence
Address: |
FINNEGAN, HENDERSON, FARABOW, GARRETT & DUNNER;LLP
901 NEW YORK AVENUE, NW
WASHINGTON
DC
20001-4413
US
|
Family ID: |
37423199 |
Appl. No.: |
11/128422 |
Filed: |
May 13, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10623808 |
Jul 22, 2003 |
|
|
|
11128422 |
May 13, 2005 |
|
|
|
09151259 |
Sep 10, 1998 |
|
|
|
10623808 |
Jul 22, 2003 |
|
|
|
08910449 |
Aug 5, 1997 |
|
|
|
09151259 |
Sep 10, 1998 |
|
|
|
08236918 |
May 6, 1994 |
5674704 |
|
|
08910449 |
Aug 5, 1997 |
|
|
|
08060843 |
May 7, 1993 |
|
|
|
08236918 |
May 6, 1994 |
|
|
|
Current U.S.
Class: |
435/69.5 ;
435/320.1; 435/325; 530/351; 536/23.5 |
Current CPC
Class: |
C07K 16/2875 20130101;
C07K 2319/30 20130101; C07K 2317/34 20130101; C07K 14/715 20130101;
C07K 2319/00 20130101; A61K 38/00 20130101; C07K 14/52 20130101;
G01N 33/6863 20130101 |
Class at
Publication: |
435/069.5 ;
530/351; 435/320.1; 435/325; 536/023.5 |
International
Class: |
C07K 14/52 20060101
C07K014/52; C07H 21/04 20060101 C07H021/04; C12P 21/02 20060101
C12P021/02 |
Claims
1-47. (canceled)
48. A method of enhancing T-cell activation comprising
administering an effective amount of a first H4-1BB receptor ligand
such that said receptor ligand comes into contact with at least one
T-cell, thereby activating it.
49. The method claim 48, wherein said H4-1BB receptor ligand
administered is an agonistic anti-4-1BB monoclonal antibody.
50. The method claim 48, wherein said H4-1BB receptor ligand
administered is an antagonistic anti-4-1BB monoclonal antibody.
51. The method of claim 48, wherein said first H4-1BB receptor
ligand is a H4-1BB protein.
52. The method of claim 48, wherein said first H4-1BB receptor
ligand is administered at a dosage range equivalent to or greater
than 0.20 .mu.mol to 2.0 .mu.mol, one to three times per day.
53. The method of claim 52, wherein the administration of said
first H4-1BB receptor ligand is accomplished through an
administration of a pharmaceutical formulation such as a tablet or
intravenous injection, wherein administration of said first H4-1BB
receptor ligand does not lessen the effectiveness of said first
H4-1BB receptor ligand in activating said at least one T-cell.
54. A method of enhancing T-cell activation of claim 48 further
comprised by administering a second stimulatory molecule, in
conjunction with said first H4-1BB receptor ligand such that each
of these compounds comes into contact with said at least one
T-cell.
55. The method of claim 54, wherein said second stimulatory
molecule is selected from the group consisting essentially of: a)
an anti-CD3 antibody; b) an anti-CD28 antibody; and c) the CD28
protein.
56. The method of claim 52, wherein said first H4-1BB receptor
ligand is administered at a dosage range equivalent to or greater
than 0.20 .mu.mol to 2.0 .mu.mol, one to three times per day, and
wherein said second stimulatory molecule is administered at a
dosage range equivalent to or greater than 0.10 .mu.mol to 2.0
.mu.mol, one to three times per day.
57. The method of claim 52 wherein the administration of said first
H4-1BB receptor ligand and said second stimulatory molecule is
accomplished through an administration of a pharmaceutical
formulation such as a tablet or intravenous injection.
58. The method of claim 56, further comprising the use of a third
stimulatory molecule, said second co-stimulatory molecule being an
anti-CD3 antibody and said third stimulatory molecule being an
anti-CD28 antibody.
59. The method of claim 58 wherein the administration of said first
H4-1BB receptor ligand, said second stimulatory molecule, and said
third stimulatory molecule is accomplished through an
administration of a pharmaceutical formulation such as a tablet or
intravenous injection.
60. A method of treating cancerous tumors such that said cancerous
tumors are reduced, comprising the administration of a first
effective amount of H4-1BB receptor ligand such that said compound
comes into contact with at least one T-cell, and wherein said
H4-1BB protein works in conjunction with a second stimulatory
molecule, such that both of these compounds come into contact with
said at least one T-cell.
61. The method of claim 60, wherein said second stimulatory
molecule is selected from the group consisting essentially of: a)
an anti-CD3 antibody; b) an anti-CD28 antibody; and c) the CD28
protein.
62. The method of claim 60, wherein said first H4-1BB receptor
ligand is administered at a dosage range equivalent to or greater
than 2.0 .mu.mol to 8.0 .mu.mol, one to three times per day, and
wherein said second stimulatory molecule is administered at a
dosage range equivalent to or greater than 0.10 .mu.mol to 2.0
.mu.mol, one to three times per day.
63. The method of claim 60, wherein the administration of said
first H4-1BB receptor ligand and said second-stimulatory molecule
is accomplished through an oral administration of a pharmaceutical
formulation such as a tablet or injection.
64. A method of enhancing cytokine production in CD+4 and CD+8
T-cells comprising: a) administering effective amounts of three
compounds contemporaneously, said three compounds comprising: i) an
anti-H4-1BB antibody; ii) an anti-CD3 antibody; iii) an anti-CD28
antibody; and wherein said administration is such that each of said
three compounds comes into contact with said at least one T
cell.
65. The method of claim 64, wherein the cytokine whose production
is enhanced is selected from the group consisting of: a) gamma
interferon (IF); b) interleukin 1 (IL-1); c) interleukin 10
(IL-10); d) B cell growth factor (BCGF); e) B cell differentiating
factor (BCDF); and f) interleukin 2 (IL-2).
66. A method of treating an autoimmune reaction comprising
administering an effective amount of an antagonist to the H4-1BB
protein, said antagonist being capable of preventing the H4-1BB
protein from binding to a H4-1BB receptor, wherein said antagonist
is itself incapable of activating CD4+ or CD8+ T cells.
67. The method of claim 66, wherein said first H4-1BB receptor
ligand is administered at a dosage range equivalent to or greater
than 0.20 .mu.mol to 2.0 .mu.mol, one to three times per day.
68. The method of claim 66, wherein the administration of said
first H4-1BB receptor ligand is accomplished through an
administration of a pharmaceutical formulation such as a tablet or
intravenous injection.
69. The method of claim 66, wherein said autoimmune reaction
treated is one associated with an autoimmune disease, wherein said
autoimmune disease is selected from the group consisting of: a)
Diabetes Melitus; b) Rheumatoid Arthritis; and c) Systemic Lupus
Erthyematosus.
70. The method of claim 66, wherein said method of preventing an
autoimmune reaction is used to suppress an autoimmune response
occurring after an organ transplantation.
71. A method for monitoring the level of progression of Acquired
Immune Deficiency caused by the pathogenic virus HIV-1 is
accomplished by measuring the level of H4-1BB expression in a known
quantity of tissue comprising: a) collecting a sample of CD8+ T
cells; b) fractionating cells and retaining the lysate to test for
the presence of the H4-1BB using a monoclonal antibody(s) directed
against said H4-1BB protein; c) attaching to said antibody(s)
another molecule capable of being detected by a scintillation
counter or fluorescent microscope or other means useful in
measuring the degree of antibody binding; and d) determining the
level of H4-1BB expression in said sample of CD8+ T cells for
comparison with a known measurement that reflects a normal level of
expression of H4-1BB expression in a same size sample of an
equivalent tissue type.
72. A method of preventing an autoimmune reaction comprising
administering an effective amount of an antagonist to the H4-1BB
protein, said antagonist being capable of preventing the H4-1BB
protein from binding to the H4-1BB receptor ligand, wherein said
antagonist is itself incapable of activating CD4+ or CD8+ T
cells.
73. A method of interfering with HIV-1progression comprising the
step of administering an effective amount of an agent capable of
binding said H4-1BB receptor protein on CD4+ T-lymphocytes, thereby
blocking it.
74. The method of claim 73 wherein said agent is selected from the
group consisting of: a) a 4-1BB-Fc molecule; b) a blocking
anti-4-1BB monoclonal antibody; and c) a fusion protein comprising
a portion of said H4-1BB protein.
75. An antibody that is immuno-reactive with a purified human 4-1BB
polypeptide comprising the N-terminal amino acid sequence
Phe-Glu-Arg-Thr-Arg-Ser-Leu-Gln-Asp-Pro-Cys-Ser-Asn-Cys-Pro-Ala-Gly-Thr.
76. A method of blocking T cell activation comprising administering
an effective amount of an H4-1BB protein antagonist such that said
protein antagonist prevents the activation of the H4-1BB
receptor.
77. A method of treating Human Acquired Immune Deficiency caused by
the viral pathogen HIV-1, comprising administering an effective
amount of a first H4-1BB receptor ligand, such that said receptor
ligand comes into contact with at least one T-cell thereby
activating at least one CD8+ T cell.
78. The method of claim 77, wherein said first H4-1BB receptor
ligand or agonistic mAb is administered at a dosage range
equivalent to or greater than 0.20 .mu.mol to 2.0 .mu.mol, one to
three times per day.
79. The method of claim 77, wherein said at least one CD8+ T cell
is capable of killing HIV-1 infected cells selected from the group
consisting of: a) CD4+ cells; b) astrocytes; c) macrophages; d)
dendritic cells; and e) microglial cells.
80. The method of claim 77, wherein the administration of said
first H4-1BB receptor ligand is accomplished through an
administration of a pharmaceutical formulation such as a tablet or
intravenous injection.
81. The method of claim 49, wherein said agonistic anti-4-1BB
monoclonal antibody is an monoclonal antibody designated BBK-1.
82. The monoclonal antibody of claim 81, further comprising a
hybridoma capable of producing said monoclonal antibody designated
BBK-1.
83. The method of using the monoclonal antibody of claim 81 to
enhance T-cell activation, comprising the step of treating T-cells
that have expressed receptor protein H4-1BB with said monoclonal
antibody designated BBK-1.
84. The method of claim 50, wherein said antagonistic anti-4-1BB
monoclonal antibody is a monoclonal antibody designated BBK-2.
85. The monoclonal antibody of claim 84, further comprising a
hybridoma capable of producing said monoclonal antibody designated
BBK-2.
86. The method of using the monoclonal antibody of claim 84 to
enhance T-cell activation, comprising the step of treating T-cells
that have expressed receptor protein H4-1BB with said monoclonal
antibody designated BBK-2.
87. The method of claim 50, wherein said antagonistic anti-4-1BB
monoclonal antibody is a monoclonal antibody designated BBK-3.
88. The monoclonal antibody of claim 87, further comprising a
hybridoma capable of producing said monoclonal antibody designated
BBK-3.
89. The method of using the monoclonal antibody of claim 87 to
enhance T-cell activation, comprising the step of treating T-cells
that have expressed receptor protein H4-1BB with said monoclonal
antibody designated BBK-3.
90. The method of claim 49, wherein said agonistic anti-4-1BB
monoclonal antibody is an monoclonal antibody designated BBK-4.
91. The monoclonal antibody of claim 90, further comprising a
hybridoma capable of producing said monoclonal antibody designated
BBK-4.
92. The method of using the monoclonal antibody of claim 90 to
enhance T-cell activation, comprising the step of treating T-cells
that have expressed receptor protein H4-1BB with said monoclonal
antibody designated BBK-4.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S.
application Ser. No. 08/060,843, filed May 7, 1993, currently
pending.
BACKGROUND OF THE INVENTION
[0002] The term "cytokines" encompasses a diverse group of soluble
proteins that are released by one type of cell and mediate a
biological effect on another cell type. Biological activities
exhibited by cytolines include control of proliferation, growth,
and differentiation of various cell types, among which are cells of
the hematopoietic or immune systems.
[0003] Examples of cytokines include the interleukins (e.g.,
interleukins 1 through 12), the interferons (IFN.alpha., IFN.beta.,
and IFN.gamma.), tumor necrosis factor (TNF.alpha. and TAN.beta.),
epidermal growth factor (EGF), platelet-derived growth factor
(PDGF), and colony stimulating factors. Examples of colony
stimulating factors (CSF), which control growth and differentiation
of hematopoietic cells, are granulocyte-CSF (G-CSF),
granulocyte-macrophage-CSF (GM-CSF), macrophage-CSF (M-CSF or
CSF-1), mast cell growth factor (MGF), and erythropoietin
(EPO).
[0004] The biological activity of cytokines generally is mediated
by binding of the cytoline to a receptor specific for that
cytokine, located on the surface of target cells. Much research has
been directed to identifying receptor(s) that bind a given cytokine
(often referred to as the "ligand" for the receptor in question),
and exploring the roles that endogenous ligands and receptors play
in vivo.
[0005] One family of cytokine receptors includes two different TNF
receptors (Type I and Type II) (Smith et al., Science 248:1019,
1990) and Schall et al., Cell 61:361, 1990); nerve growth factor
receptor (Johnson et al., Cell 47:545, 1986); B cell antigen CD40
(Stamenkovic et al., EMBO J. 8:1403, 1989); T cell antigen OX40
(Mallett et al., EMBO J. 9:1063, 1990); human Fas antigen (Itoh et
al., Cell 66:233, 1991); and murine receptor 4-1BB (Kwon et al.,
Cell. Immunol. 121:414, 1989)[Kwon et al. I] and Kwon et al., Proc.
Narl. Acad. Sci. USA 86:1963, 1989 [Kwon et al. II]).
[0006] Expression of murine 4-1BB is induced by concanavalin A (con
A) in spleen cells, cloned helper T cells, cytolytic T cells, and
cytolytic T cell hybridomas (Kwon et al. II). Murine 4-1BB cDNA was
isolated from a cDNA library made from induced RNA isolated from
both a helper T cell line and a cytotoxic T cell line (Kwon et al.
II). The nucleotide sequence of the isolated cDNA is presented in
Kwon et al. II, along with the amino acid sequence encoded thereby.
The murine 4-1BB protein comprises 256 amino acids, including a
putative leader sequence, trans-membrane domain and a number of
other features common to cell membrane bound receptor proteins.
Regarding a putative human 4-1BB protein, neither amino acid nor
nucleotide sequence information is known for any such protein.
[0007] No ligand that would bind 4-1BB and transduce a signal
through the 4-1BB receptor is known. Thus, there is a need in the
art to determine whether a novel protein functioning as a ligand
for 4-1BB exists, and, if so, to isolate and characterize the 4-1BB
ligand protein.
SUMMARY OF THE INVENTION
[0008] A novel cytokine designated 4-1BB ligand (4-1BB-L) is
disclosed herein. 4-1BB-L polypeptides bind to the cell surface
receptor designated 4-1BB. Human 4-1BB is also provided by the
present invention.
[0009] The present invention provides purified 4-1BB-L
polypeptides, exemplified by the murine and human 4-1BB-L proteins
disclosed herein, and purified human 4-1BB polypeptides. Isolated
DNA sequences encoding 4-1BB-L or human 4-1BB, recombinant
expression vectors comprising the isolated DNA, and host cells
transformed with the expression vectors are provided by the present
invention, along with methods for producing 4-1BB-L and human 4-1BB
by cultivating the transformed host cells. Antibodies that are
immunoreactive with 4-1BB-L or human 4-1BB also are provided.
BRIEF DESCRIPTION OF THE DRAWING
[0010] FIG. 1 presents the results of a competition binding assay
that demonstrated binding of a murine 4-1BB/Fc fusion protein by a
soluble murine 4-1BB-L protein produced in CV-1 (mammalian) cells.
The 4-1BB-L protein was produced as described in example 7.
[0011] FIG. 2 presents the results of the control experiment
described in example 7.
[0012] FIG. 3 presents the results of a competition binding assay
that demonstrated binding of a murine 4-1BB/Fc fusion protein by a
soluble murine 4-1BB-L protein produced in yeast cells. The 4-1BB-L
protein was produced as described in example 8.
[0013] FIG. 4 presents the results of an assay described in example
13, in which cells expressing recombinant human 4-1BB-L were
demonstrated to costimulate T-cell proliferation. Purified T cells
were cultured with a titration of fixed CV-1/EBNA cells that were
transfected with either empty vector (open circles) or vector
containing hu4-1BB-L DNA (closed circles) in the presence of
suboptimal PHA (0.1%). After 3 days, cultures were pulsed with [3H]
thymidine and incorporated radioactivity was assessed 6 hours
later. Data are representative of four experiments.
DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention provides a human cell surface receptor
designated 4-1BB. Human 4-1BB is a member of the TNF receptor
super-family, and is expressed on cells that include but are not
limited to stimulated human peripheral blood lymphocytes.
Expression of murine 4-1BB on cell types that include helper,
suppressor and cytolytic T lymphocytes has been reported (Kwon et
al. I and II), and 4-1BB has also been detected on mouse brain
tissue.
[0015] A novel cytokine designated 4-1BB ligand (4-1BB-L) is also
provided herein. 4-1BB-L polypeptides bind to the cell surface
receptor designated 4-1BB. Expression of 4-1BB-L has been detected
on stimulated T cells (e.g., the alloreactive CD4.sup.+ human T
cell clone stimulated with anti-CD3 antibodies described in example
5), a subclone of a mouse thymoma cell line, mouse brain tissue,
and (by RNA analysis) on mouse bone marrow, splenic, and thymic
tissues.
[0016] Purified 4-1BB-L polypeptides, exemplified by the murine and
human 4-1BB-L proteins disclosed herein, and purified human 4-1BB
polypeptides are encompassed by the present invention. Isolated DNA
sequences encoding 4-1BB-L or human 4-1BB, recombinant expression
vectors comprising the isolated DNA, and host cells transformed
with the expression vectors are provided by the present invention,
along with methods for producing 4-1BB-L and human 4-1BB by
cultivating the transformed host cells and purifying the
recombinant protein. Antibodies that are immunoreactive with
4-1BB-L or human 4-1BB are also disclosed.
[0017] The present invention provides full length 4-1BB-L and 4-1BB
polypeptides as well as biologically active fragments and variants
thereof. Soluble polypeptides comprising the extracellular domain
of 4-1BB-L or a receptor-binding fragment thereof are among the
biologically active fragments provided. Likewise, soluble
polypeptides derived from the extracellular domain of human 4-1BB
that are capable of binding the 4-1BB ligand are encompassed by the
present invention. Such soluble polypeptides are described in more
detail below.
[0018] 4-1BB-L refers to a genus of mammalian polypeptides that are
capable of binding 4-1BB. 4-1BB-L is a type II extracellular
membrane polypeptide with an intracellular (cytoplasmic) domain at
the N-terminus of the polypeptide, followed by a transmembrane
region, and an extracellular (receptor-binding) domain at the
C-terminus of the polypeptide. Soluble 4-1BB-L polypeptides may be
derived from the extracellular domain, as described below. While
not wishing to be bound by theory, binding of the 4-1BB ligand to
4-1BB may initiate transduction of a biological signal in a cell
bearing the receptor.
[0019] cDNA encoding murine 4-1BB-L was isolated using a direct
expression cloning technique, as described in example 4. Briefly, a
fusion protein comprising a fragment of the murine 4-1BB
extracellular (ligand-binding) domain fused to the Fc domain of a
human IgG1 antibody was prepared and used to screen an expression
cloning cDNA library derived from a subclone of a mouse thymoma
cell line. A clone expressing a protein that bound the 4-1BB/Fc
fusion protein was identified, sequenced and determined to encode a
novel protein, which is a ligand for 4-1BB. The nucleotide sequence
of the murine 4-1BB-L cDNA isolated by this procedure and the amino
acid sequence encoded thereby are presented in SEQ ID NO:1 and SEQ
ID NO:2. This murine 4-1BB-L protein comprises a cytoplasmic domain
(amino acids 1-82 of SEQ ID NO:2), a transmembrane region (amino
acids 83-103), and an extracellular domain (amino acids
104-309).
[0020] A direct expression cloning technique also was used to
isolate cDNA encoding a human 4-1BB-L, as described in example 5.
Briefly, an expression cloning cDNA library derived from an
alloreactive CD4+human T cell clone stimulated with an anti-CD3
antibody was screened with a fusion protein comprising a soluble
human 4-1BB polypeptide fused to an Fc polypeptide. The nucleotide
sequence of a human 4-1BB-L cDNA isolated by this procedure and the
amino acid sequence encoded thereby are presented in SEQ ID NO:3
and SEQ ID NO:4. This human 4-1BB-L protein comprises a cytoplasmic
domain (amino acids 1-25 of SEQ ID NO:4), a transmembrane region
(amino acids 26-48), and an extracellular domain (amino acids
49-254).
[0021] The nucleotide sequence of a human 4-1BB cDNA (isolated as
described in example 2) and the amino acid sequence encoded thereby
are presented in SEQ ID NO:7 and SEQ ID NO:8. The human 4-1BB
protein comprises an N-terminal signal sequence (amino acids -23 to
-1 of SEQ ID NO:8), an extracellular domain comprising amino acids
1-163, a transmembrane region comprising amino acids 164-190, and a
cytoplasmic domain comprising amino acids 191-232. The human 4-1BB
amino acid sequence of SEQ ID NO:8 is 60% identical to that of the
murine 4-1BB receptor described in Kwon et al. (Proc. Natl. Acad.
Sci. USA 86:1963, 1989).
[0022] Also encompassed by the present invention are isolated DNA
sequences that are degenerate as a result of the genetic code to
the nucleotide sequence of SEQ ID NOS:1, 3, or 7 (and thus encode
the amino acid sequence presented in SEQ ID NOS:2, 4, or 8). The
4-1BB-L nucleotide sequences of SEQ ID NOS:1, 3, or 7 are
understood to include the sequences complementary thereto.
[0023] Purified human 4-1BB-L proteins characterized by the
N-terminal amino acid sequence
Met-Glu-Tyr-Ala-Ser-Asp-Ala-Ser-Leu-Asp-Pro-Glu- or (beginning with
the first amino acid of the extracellular domain)
Leu-Ala-Cys-Pro-Trp-Ala-Val-Ser-Gly-Ala-Arg -Ala-Ser- are provided
herein. Purified murine 4-1BB-L proteins characterized by an
N-terminal amino acid sequence selected from the group consisting
of Met-Asp-Gln-His-Thr -Leu-Asp-Val-Glu-Asp-Thr-Ala-, or (beginning
with one of the first three amino acids of the extracellular
domain) Arg-Thr-Glu-Pro-Arg-Pro-Ala-Leu-Thr-Ee-Thr-Thr-, Thr-Glu
-Pro-Arg-Pro-Ala-Leu-Thr-Ile-Thr-Thr-, and
Glu-Pro-Arg-Pro-Ala-Leu-Thr-Ile-Thr-Thr - are also disclosed
herein.
Soluble Proteins and Multimeric Forms of the Inventive Proteins
[0024] Soluble forms of the 4-1BB-L and 4-1BB proteins are provided
herein. Soluble 4-1BB-L or 4-1BB polypeptides comprise all or part
of the extracellular domain but lack the transmembrane region that
would cause retention of the polypeptide on a cell membrane. The
soluble polypeptides that may be employed retain the ability to
bind 4-1BB. The soluble 4-1BB polypeptides that may be employed
retain the ability to bind the 4-1BB ligand. The soluble proteins
may include part of the transmembrane region or part of the
cytoplasmic domain, provided that the protein is capable of being
secreted rather than retained on the cell surface.
[0025] Since the 4-1BB-L protein lacks a signal peptide, a
heterologous signal peptide advantageously is fused to the
N-terminus of soluble 4-1BB-L polypeptides to promote secretion
thereof. The signal peptide is cleaved from the protein upon
secretion from the host cell. The need to lyse the cells and
recover the recombinant soluble protein from the cytoplasm thus is
avoided. The native signal peptide or a heterologous signal peptide
(such as one of the heterologous signal peptides described below,
chosen according to the intended expression system) advantageously
is fused to a soluble 4-1BB polypeptide.
[0026] Soluble proteins of the present invention may be identified
(and distinguished from their non-soluble membrane-bound
counterparts) by separating intact cells expressing the desired
protein from the culture medium, e.g., by centrifugation, and
assaying the medium (supernatant) for the presence of the desired
protein. The culture medium may be assayed using procedures which
are similar or identical to those described in the examples
below.
[0027] Soluble forms of the 4-1BB-L and 4-1BB proteins are
advantageous for certain applications, e.g., when the protein is to
be administered intravenously for certain therapeutic purposes.
Also, purification of the proteins from recombinant host cells is
facilitated, since the soluble proteins are secreted from the
cells. In one embodiment of the invention, a soluble fusion protein
comprises a first polypeptide derived from the extracellular domain
of 4-1BB or 4-1BB-L fused to a second polypeptide added for
purposes such as facilitating purification or effecting dimer
formation. Suitable second polypeptides do not inhibit secretion of
the soluble fusion protein.
[0028] Examples of soluble polypeptides include those comprising
the entire extracellular domain. Representative examples of the
soluble proteins of the present invention include, but are not
limited to, a polypeptide comprising amino acids x-309 of SEQ ID
NO:2, wherein x is selected from 104, 105, and 106 (murine
4-1BB-L); amino acids 49-254 of SEQ ID NO:4 (human 4-1BB-L); or
amino acids 1-163 of SEQ ID NO:8 (human 4-1BB). Preparation of
certain soluble polypeptides of the present invention is described
in the examples section.
[0029] Truncated forms of the inventive proteins, including soluble
polypeptides, may be prepared by any of a number of conventional
techniques. In the case of recombinant proteins, a DNA fragment
encoding a desired fragment may be subcloned into an expression
vector. Alternatively, a desired DNA sequence may be chemically
synthesized using known techniques. DNA fragments also may be
produced by restriction endonuclease digestion of a full length
cloned DNA sequence, and isolated by electrophoresis on agarose
gels. Linkers containing restriction endonuclease cleavage site(s)
may be employed to insert the desired DNA fragment into an
expression vector, or the fragment may be digested at cleavage
sites naturally present therein. The well known polymerase chain
reaction procedure also may be employed to isolate a DNA sequence
encoding a desired protein fragment by using oligonucleotide
primers comprising sequences that define the termini of the desired
fragment.
[0030] In another approach, enzymatic treatment (e.g., using Bal 31
exonuclease) may be employed to delete terminal nucleotides from a
DNA fragment to obtain a fragment having a particular desired
terminus. Among the commercially available linkers are those that
can be ligated to the blunt ends produced by Bal 31 digestion, and
which contain restriction endonuclease cleavage site(s).
Alternatively, oliconucleotides that reconstruct the N- or
C-terminus of a DNA fragment to a desired point may be synthesized.
The oligonucleotide may contain a restriction endonuclease cleavage
site upstream of the desired coding sequence and position an
initiation codon (ATG) at the N-terminus of the coding sequence.
Present therein. The well known polymerase chain reaction procedure
also may be employed to isolate a DNA sequence encoding a desired
protein fragment by using oligonucleotide primers comprising
sequences that define the termini of the desired fragment.
[0031] Naturally occurring soluble forms of 4-1BB-L or human 4-1BB
are also encompassed by the present invention. Such soluble
polypeptides may result from alternative splicing of mRNA during
expression, or release of a soluble polypeptide from a
membrane-bound form of the protein by proteolysis.
[0032] Oligomeric (multimeric) forms of the inventive proteins are
encompassed by the present invention. The terms "inventive
proteins" and "inventive polypeptides" as used herein refer
collectively to the 4-1BB-L and 4-1BB proteins or polypeptides of
the present invention, as defined by the appended claims. The
oligomers preferably are dimers or trimers. Dimeric and trimeric
forms of the 4-1BB-L and 4-1BB proteins may exhibit enhanced
biological activity compared to the monomeric forms. Separate
polypeptide chains may be joined by interchain disulfide bonds
formed between cysteine residues to form oligomers. Alternatively,
the multimers may be expressed as fusion proteins, with or without
spacer amino acids between the inventive protein moieties, using
recombinant DNA techniques. In one embodiment of the present
invention, two or three soluble 4-1BB-L or 4-1BB polypeptides are
joined via a polypeptide linker (e.g., one of the antibody-derived
or peptide linkers described below).
[0033] In one embodiment of the present invention, a soluble fusion
protein comprises a soluble 4-1BB or 4-1BB-L polypeptide fused to a
polypeptide derived from the constant region of an antibody.
Multimers resulting from formation of interchain disulfide bonds
between the antibody-derived moieties of such fusion proteins
are-provided.
[0034] Examples of such fusion proteins are those comprising one of
the above-described soluble 4-1BB or 4-1BB-L polypeptides fused to
an antibody Fc region polypeptide. A gene fusion encoding the
fusion protein is inserted into an appropriate expression vector
and cells transformed with the expression vector are cultured to
produce and secrete the fusion protein. The expressed fusion
proteins are allowed to assemble much like antibody molecules,
whereupon interchain disulfide bonds form between Fc polypeptides,
yielding the Fc/4-1BB-L or 4-1BB/Fc protein in dimeric form. The
preparation of certain embodiments of such fusion proteins and
dimers formed therefrom is described in more detail in the examples
section below. If two different fusion proteins are made, one
comprising an inventive protein fused to the heavy chain of an
antibody and the other comprising an inventive protein fused to the
light chain of an antibody, it is possible to form oligomers
comprising as many as four soluble inventive polypeptides.
[0035] Preparation of fusion proteins comprising heterologous
polypeptides fused to various portions of antibody-derived
polypeptides (including the Fc domain) has been described, e.g., by
Ashkenazi et al. (PNAS USA 88:10535, 1991) and Byrn et al. (Nature
344:677, 1990). The term "Fc polypeptide" includes native and
mutein forms, as well as truncated Fc polypeptides containing the
hinge region that promotes dimerization. One example is an Fc
region encoded by cDNA obtained by PCR as described by Fanslow et
al., J. Immunol. 149:65 (1992). One example of a DNA encoding a
mutein of the Fc region of a human IgG1 antibody is described in
U.S. patent application Ser. No. 08/097,827, entitled "Novel
Cytokine Which is a Ligand for OX40" filed Jul. 23, 1993, which
application is hereby incorporated by reference. The mutein DNA was
derived from a native Fc polypeptide-encoding DNA by site-directed
mutagenesis conducted essentially as described by Deng and
Nickoloff, Anal. Biochem. 200:81 (1992). The amino acid sequence of
the Fc mutein polypeptide is identical to that of the native Fc
polypeptide presented in SEQ ID NO:15 except that amino acid 32 of
SEQ ID NO:15 has been changed from Leu to Ala, amino acid 33 has
been changed from Leu to Glu, and amino acid 35 has been changed
from Gly to Ala. This mutein Fc exhibits reduced affinity for
immunoglobulin receptors.
[0036] Alternatively, one can link multiple copies of the inventive
proteins via peptide linkers. A fusion protein comprising two or
more copies of the inventive protein, separated by peptide linkers,
may be produced by recombinant DNA technology. Among the peptide
linkers that may be employed are amino acid chains that are from 5
to 100 amino acids in length, preferably comprising amino acids
selected from the group consisting of glycine, asparagine, serine,
threonine, and alanine. In one embodiment of the present invention,
a fusion protein comprises two or three soluble 4-1BB-L or 4-1BB
polypeptides linked via a peptide linker selected from
Gly.sub.4SerGly.sub.5Ser and (Gly.sub.4Ser).sub.n, wherein n is
4-12. The production of recombinant fusion proteins comprising
peptide linkers is illustrated in U.S. Pat. No. 5,073,627, for
example.
[0037] The 4-1BB-L proteins of the present invention are believed
to be capable of dimerization without having one of the
above-described antibody-derived polypeptides fused to the ligand.
Both soluble and full length recombinant 4-1BB-L proteins have been
precipitated with 4-1BB/Fc (reductive immunoprecipitation) followed
by purification by affinity chromatography on a column containing
protein G. Dimers were detected by SDS-PAGE (non-reducing gel).
Higher oligomers may have formed as well. Thus, fusing polypeptides
that promote dimerization (or formation of higher oligomers) to
4-1BB ligands may result in undesirable aggregate formation.
Variants and Derivatives
[0038] As used herein, the terms "4-1BB-L" and "human 4-1BB"
include variants and derivatives that retain a desired biological
activity of the native manmmalian polypeptides. The variant
sequences differ from a native nucleotide or amino acid sequence by
one or a plurality of substitutions, deletions, or additions, but
retain a desired biological activity such as the ability to bind
4-1BB (for variants of 4-1BB-L) or the ability to bind a 4-1BB-L
(for variants of 4-1BB, the receptor). Derivatives of the inventive
proteins may comprise moieties such as the chemical moieties
described below, attached to the inventive protein.
[0039] In one embodiment of the present invention, a variant
sequence is substantially identical to a native sequence. The term
"substantially identical" as used herein means that the amino acid
or nucleotide sequence in question is at least 80% identical,
preferably 90-100% identical, to a reference (native) sequence. The
degree of homology (percent identity) may be determined, for
example, by comparing sequence information using the GAP computer
program, version 6.0 described by Devereux et al. (Nucl. Acids Res.
12:387, 1984) and available from the University of Wisconsin
Genetics Computer Group (UWGCG). The GAP program utilizes the
alignment method of Needleman and Wunsch (J. Mol. Biol. 48:443,
1970), as revised by Smith and Waterman (Adv. Appl. Math 2:482,
1981). The preferred default parameters for the GAP program
include: (1) a unary comparison matrix (containing a value of 1 for
identities and 0 for non-identities) for nucleotides, and the
weighted comparison matrix of Gribskov and Burgess, Nucl. Acids
Res. 14:6745, 1986, as described by Schwartz and Dayhoff, eds.,
Atlas of Protein Sequence and Structure, National Biomedical
Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for
each gap and an additional 0.10 penalty for each symbol in each
gap; and (3) no penalty for end gaps.
[0040] Alterations of the native amino acid sequence may be
accomplished by any of a number of known techniques, e.g., by
mutation of the native nucleotide sequences disclosed herein.
Mutations can be introduced at particular loci by synthesizing
oligonucleotides containing a mutant sequence, flanked by
restriction sites enabling ligation to fragments of the native
sequence. Following ligation, the resulting reconstructed sequence
encodes an analog having the desired amino acid insertion,
substitution, or deletion. Alternatively, oligonucleotide-directed
site-specific mutagenesis procedures such as those described by
Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985);
Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic
Engineering: Principles and Methods, Plenum Press, 1981); and U.S.
Pat. Nos. 4,518,584 and 4,737,462, may be employed.
[0041] Isolated DNA sequences that hybridize to the murine
4-1BB-L-encoding nucleotide sequence of SEQ ID NO:1 or the human
4-1BB-L-encoding nucleotide sequence of SEQ ID NO:3 under
moderately stringent or severely stringent conditions are
encompassed by the present invention. Moderate stringency
conditions refer to conditions described in, for example, Sambrook
et al. Molecular Cloning: A Laborator, Manual, 2 ed. Vol. 1, pp.
1.101-104, Cold Spring Harbor Laboratory Press, (1989). Conditions
of moderate stringency, as defined by Sambrook et al., include
prewashing in 5.times.SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0) and
hybridization at about 55.degree. C. in 5.times.SSC overnight.
Conditions of severe stringency include higher temperatures of
hybridization and washing. The skilled artisan recognizes that the
temperature and wash solution salt concentration may be adjusted as
necessary according to factors such as the length of the probe. One
embodiment of the invention is directed to DNA sequences that will
hybridize under severely stringent conditions to a DNA sequence
comprising the coding region of a 4-1BB-L clone disclosed herein.
The severely stringent conditions include hybridization at
68.degree. C. followed by washing in 0.1.times.SSC/0.1% SDS at
63-68.degree. C.
[0042] Among the hybridizing sequences encompassed by the present
invention are those encoding a biologically active primate or
murine 4-1BB-L polypeptides. Biologically active polypeptides
encoded by DNA sequences that hybridize to the murine
4-1BB-L-encoding nucleotide sequence of SEQ ID NO:1 or the human
4-1BB-L-encoding nucleotide sequence of SEQ ID NO:3 under
moderately stringent or severely stringent conditions are
encompassed by the present invention.
[0043] In one embodiment of the present invention, a variant amino
acid sequence comprises conservative amino acid substitution(s) but
is otherwise identical to a native amino acid sequence.
Conservative substitutions refer to replacement of a given amino
acid residue with a residue having similar physiochemical
characteristics. Examples of conservative substitutions include
substitution of one aliphatic residue for another, such as Ile,
Val, Leu, or Ala for one another, or substitutions of one polar
residue for another, such as between Lys and Arg; Glu and Asp; or
Gln and Asn. Other such conservative substitutions, for example,
substitutions of entire regions having similar hydrophobicity
characteristics, are well known.
[0044] The present invention further includes the inventive
polypeptides with or without associated native-pattern
glycosylation. The recombinant proteins when expressed in yeast or
mammalian expression systems (e.g., COS-7 cells) may be similar or
significantly different in molecular weight and glycosylation
pattern than the corresponding native proteins. Expression of
mammalian 4-1BB-L polypeptides in bacterial expression systems such
as E. coli, provides non-glycosylated molecules
[0045] Variant proteins comprising inactivated N-glycosylation
sites are within the scope of the present invention. Such variants
are expressed in a more homogeneous, reduced carbohydrate form.
N-glycosylation sites in eukaryotic polypeptides are characterized
by an amino acid triplet Asn-X-Y, wherein X is any amino acid
except Pro and Y is Ser or Thr. In this sequence, carbohydrate
residues are covalently attached at the Asn side chain. Addition,
substitution, or deletion of residue(s) so that the Asn-X-Y triplet
is no longer present inactivates the site. In one embodiment, a
conservative armino acid substitution replaces the Asn residue,
with substitution of Asp, Gln, or Glu for Asn being preferred.
Known procedures for inactivating N-glycosylation sites in proteins
include those described in U.S. Pat. Nos. 5,071,972 and EP
276,846.
[0046] The murine 4-1BB-L of SEQ ID NO:2 comprises three
N-glycosylation sites, at residues 139-141, 161-163, and 293-295.
The human 4-1BB-L of SEQ DD NO:4 comprises no N-glycosylation
sites. The human 4-1BB of SEQ ID NO:8 comprises two such sites, at
residues 115-117 and 126-128.
[0047] Naturally occurring variants such as those resulting from
alternative MRNA splicing events or proteolytic cleavage are also
within the scope of the present invention. Variations attributable
to proteolysis include, for example, differences in the N- or
C-termini upon expression in different types of host cells, due to
proteolytic removal of one or more terminal amino acids (which may
occur intracellularly or during purification). In one embodiment of
the present invention, the inventive proteins lack from one to five
of the N-or C-terminal amino acids of the sequences disclosed
herein. In certain host cells, post-translational processing will
remove the methionine residue encoded by an initiation codon,
whereas the methionine residue will remain at the N-terminus of
proteins produced in other host cells.
[0048] Additional variants may be prepared by deleting terminal or
internal sequences not needed for biological activity. For example,
Cys residues can be deleted or replaced with other amino acids to
prevent formation of incorrect intramolecular disulfide bridges
upon renaturation.
[0049] Other variants are prepared by modifying KEX2 protease
processing sites in the inventive proteins to enhance expression in
yeast cells in which KEX2 protease activity is present. The
adjacent basic residue pairs that constitute KEX2 protease
processing sites, and are to be inactivated by adding, substituting
or deleting residue(s), are Arg-Arg, Arg-Lys, and Lys-Arg pairs.
Lys-Lys pairs are considerably less susceptible to KEX2 cleavage,
and conversion of Arg-Arg, Arg-Lys, and Lys-Arg pairs to a Lys-Lys
doublet is a conservative and preferred alteration that essentially
inactivates the KEX2 sites. EP 212,914 discloses the use of
site-specific mutagenesis to inactivate KEX2 protease processing
sites in a protein.
[0050] The inventive proteins may be modified by forming covalent
or aggregative conjugates with other chemical moieties, such as
glycosyl groups, lipids, phosphate, acetyl groups and the like.
Covalent derivatives are prepared by reaction of functional groups
of the chemical moiety with functional groups on amino acid side
chains or at the N-terminus or C-terminus of the inventive protein.
Also provided herein are the inventive proteins comprising
detectable labels, diagnostic or cytotoxic reagents attached
thereto, including but not limited to radionuclides, colorimetric
reagents, and the like.
[0051] Other derivatives within the scope of this invention include
covalent or aggregative conjugates of the inventive proteins or
fragments thereof with other proteins or polypeptides, such as by
synthesis in recombinant culture as N-terminal or C-terminal
fusions. The inventive proteins can comprise polypeptides added to
facilitate purification and identification (e.g., the antigenic
identification peptides described in U.S. Pat. No. 5,011,912 and
Hopp et al., Bio/Technology 6:1204, 1988; or a poly-His peptide).
One such peptide is the FLAG.RTM. peptide DYKDDDDK, which is a
highly antigenic sequence that provides an epitope reversibly bound
by a specific monoclonal antibody (e.g., the monoclonal antibody
produced by the hybridoma designated 4E11 and deposited with the
American Type Culture Collection under accession no. HB 9259) to
enable rapid assay and facilitate purification of the expressed
recombinant polypeptide fused thereto.
Assavs for Biological Activity
[0052] The 4-1BB-L and 4-1BB proteins of the present invention and
variants and derivatives thereof may be tested for biological
activity by any suitable assay procedure. The procedure will vary
according to such factors as whether the protein to be tested is
bound to a cell surface or is secreted into the culture
supernatant. Proteins may be radiolabeled for use in the assays,
e.g., using the commercially available IODO-GEN reagent described
in example 1.
[0053] Competitive binding assays can be performed using standard
methodology. For example, a 4-1BB-L variant can be tested for the
ability to compete with a radiolabeled 4-1BB-L protein for binding
to cells that express 4-1BB on the cell surface. Likewise, a 4-1BB
variant can be assayed for the ability to compete with a
radiolabeled 4-1BB for binding to cells expressing membrane-bound
4-1BB-L. Qualitative results can be obtained by competitive
autoradiocraphic plate binding assays, or Scatchard plots may be
utilized to generate quantitative results. Instead of intact cells,
one could substitute a 4-1BB or 4-1BB-L protein bound to a solid
phase such as a column chromatography matrix (e.g. a soluble
4-1BB/Fc fusion protein bound to a Protein. A or Protein G column
by interaction with the Fc region of the fusion protein).
[0054] Intact cells employed in competition binding assays may be
cells that naturally express 4-1BB-L or 4-1BB (e.g., cell types
identified in the examples below). Altematively, cells transfected
with recombinant expression vectors such that the cells express
4-1BB-L or 4-1BB.
[0055] One assay technique useful for intact cells expressing a
membrane-bound form of the protein in question is the phthalate oil
separation method (Dower et al. J. Immunol. 132:751 (1984)),
essentially as described by Park et al. (J. Biol. Chem. 261:4177
(1986)). Sodium azide (0.2%) can be included in a binding assay to
inhibit internalization of 4-1BB-L by the cells. Cells expressing
4-1BB on their surface can be tested for radiolabeled 4-1BB-L
binding by a plate binding assay as described in Sims et al.,
Science 241:585 (1988).
Expression Systems
[0056] The present invention provides recombinant expression
vectors for expression of the proteins of the present invention and
host cells transformed with the expression vectors. Any suitable
expression system may be employed.
[0057] Recombinant expression vectors of the present invention
comprise DNA encoding a 4-1BB-L polypeptide or a human 4-1BB
polypeptide, operably linked to regulatory sequence(s) suitable for
expression of said DNA sequence in a host cell. The 4-1BB-L or
4-1BB-encoding DNA may comprise cDNA, genomic DNA, chemically
synthesized DNA, DNA isolated by PCR, or combinations thereof. The
regulatory sequences may be derived from sources that include, but
are not limited to, mammalian, microbial, viral, or insect genes.
Examples of regulatory sequences include promoters, operators, and
enhancers, ribosomal binding sites, and appropriate sequences that
control transcription and translation initiation and termination.
Nucleotide sequences are operably linked when the regulatory
sequence functionally relates to the structural gene. For example,
a promoter sequence is operably linked to a coding sequence (e.g.
structural gene DNA) if the promoter controls the transcription of
the structural gene.
[0058] Suitable host cells for expression of the inventive proteins
include prokaryotes, yeast or higher eukaryotic cells, with
mammalian cells being preferred. The recombinant expression vectors
are transfected into the host cells by conventional techniques. The
transfected cells are cultivated under conditions suitable to
effect expression of the desired recombinant protein, which is
purified from the cells or culture medium, depending on the nature
of the culture system and the expressed protein. As will be readily
appreciated by the skilled artisan, cultivation conditions will
vary according to factors that include the type of host cell and
particular expression vector employed. Cell-free in vitro
translation systems could also be employed to produce the inventive
proteins by translation of mRNA complementary to a nucleotide
sequence disclosed herein.
[0059] Appropriate cloning and expression vectors for use with
bacterial, fungal, yeast, and mammalian cellular hosts are
described, for example, in Pouwels et al. Cloning Vectors: A
Laboratory Manual, Elsevier, New, York, (1985). Expression vectors
generally comprise one or more phenotypic selectable markers (e.g.,
a gene encoding a protein that confers antibiotic resistance or
that supplies an autotrophic requirement) and an origin of
replication recognized by the intended host cell to ensure
amplification within the host.
[0060] Certain prokaryotic expression vectors may be constructed by
inserting a promoter and other desired regulatory sequences into a
commercially available plasmid such as the cloning vector pBR322
(ATCC 37017). pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides simple means for identifying
transformed cells. Promoters commonly employed in prokaryotic
expression vectors include .beta.-lactamase (penicillinase), the
lactose promoter system (Chang et al., Nature 275:615, 1978;and
Goeddel et al., Nature 281:544, 1979), tryptophan (trp) promoter
system (Goeddel et al., Nucl. Acids Res. 8:4057, 1980;and
EP-A-36,776) and tac promoter (Maniatis, Molecular Cloning: A
Laborarory Manual, Cold Spring Harbor Laboratory, p. 412, 1982). A
particularly useful prokaryotic host cell expression system employs
a phage .lamda. P.sub.L promoter and a cI857ts thermolabile
repressor sequence. Plasmid vectors available from the American
Type Culture Collection which incorporate derivatives of the
.lamda. P.sub.L promoter include plasmid pHUB2 (resident in E. coli
strain JMB9 (ATCC 37092)) and pPLc28 (resident in E. coli RR1 (ATCC
53082)).
[0061] The inventive proteins may be expressed in yeast host cells,
preferably from the Saccharomyces genus (e.g., S. cerevisiae).
Other genera of yeast, such as Pichia or Kluyveromyces, may also be
employed. Yeast vectors commonly contain an origin of replication
from a 2.mu. yeast plasmid, an autonomously replicating sequence
(ARS), a promoter region, sequences for polyadenylation, sequences
for transcription termination, and a selectable marker. Suitable
promoter sequences for yeast vectors include promoters for
metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J.
Biol. Chem. 255:2073 (1980) or other glycolytic enzymes (Hess et
al., J. Adv. Enzyme Reg. 7:149 (1968) and Holland et al., Biochem.
17:4900 (1978), such as enolase, glyceraldehyde-3-phosphate
dehydrogenase, hexokinase, pyruvate decarboxylase,
phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. The ADH2
promoter has been described by Russell et al. (J. Biol. Chem.
258:2674 (1982)) and Beier et al. (Nature 300:724 (1982)). Other
suitable vectors and promoters for use in yeast expression are
further described in Hitzeman, EPA-73,657. The vector may comprise
a sequence encoding the yeast .alpha.-factor leader to direct
secretion of a heterologous protein (an inventive protein) fused
thereto. See Kudian et al., Cell 30:933, 1982; and Bitter et al.,
Proc. Natl. Acad. Sci. USA 81:5330, 1984.
[0062] Shuttle vectors replicable in more than one type of cell
comprise multiple origins of replication and selective markers. For
example, a shuttle vector that replicates in both yeast and E. coli
and functions as an expression vector in yeast may comprise DNA
sequences from pBR322 for selection and replication in E. coli
(Amp.sup.r gene and origin of replication) and yeast-derived
sequences such as a glucose-repressible ADHL promoter, an origin of
replication from a 2 .mu. yeast plasmid, and an .alpha.-factor
leader sequence.
[0063] Yeast transformation protocols are known to those of skill
in the art. One such protocol is described by Hinnen et al., Proc.
Natl. Acad. Sci. USA 75:1929 (1978). The Hinnen et al. protocol
selects for Trp.sup.+ transformants in a selective medium, wherein
the selective medium consists of 0.67% yeast nitrogen base, 0.5%
casamino acids, 2% glucose, 10 .mu.g/ml adenine and 20 .mu.g/ml
uracil.
[0064] Yeast host cells transformed by vectors containing ADH2
promoter sequence may be grown for inducing expression in a "rich"
medium. An example of a rich medium is one consisting of 1% yeast
extract, 2% peptone, and 1% glucose supplemented with 80 .mu.g/ml
adenine and 80 .mu.g/ml uracil. Derepression of the ADH2 promoter
occurs when glucose is exhausted from the medium.
[0065] Mammalian or insect host cell culture systems could also be
employed to express the recombinant proteins of the present
invention. Examples of suitable mammalian host cell lines include
the COS-7 lines of monkey kidney cells (ATCC CRL 1651) (Gluzman et
al., Cell 23:175 (1981)), L cells, C127 cells, 3T3 cells (ATCC CCL
163), Chinese hamster ovary (CHO) cells, HeLa cells, CV-1 cells,
CV-1/EBNA cells and BHK (ATCC CRL 10) cell lines. Suitable
mammalian expression vectors generally include nontranscribed
elements such as an origin of replication, a promoter sequence, an
enhancer linked to the structural gene, other 5' or 3' flanking
nontranscribed sequences, such as ribosome binding sites, a
polyadenylation site, splice donor and acceptor sites, and
transcriptional termination sequences.
[0066] Transcriptional and translational control sequences in
mammalian host cell expression vectors may be provided by viral
sources. For example, commonly used mammalian cell promoter
sequences and enhancer sequences are derived from Polyoma,
Adenovirus 2, Sirmian Virus 40 (SV40), and human cytomegalovirus.
DNA sequences derived from the SV40 viral genome, for example, SV40
origin, early and late promoter, enhancer, splice, and
polyadenylation sites may be used to provide the other genetic
elements required for expression of a structural gene sequence in a
mammalian host cell. Viral early and late promoters are
particularly useful because both are easily obtained from a viral
genome as a fragment which may also contain a viral origin of
replication (Fiers et al., Nature 273:113 (1978)). Smaller or
larger SV40 fragments may also be used, provided the approximately
250 bp sequence extending from the Hind II site toward the BglI
site located in the SV40 viral origin of replication site is
included.
[0067] Exemplary mammalian expression vectors can be constructed as
disclosed by Okayama and Berg. (Mol. Cell. Biol. 3:280 (1983)). A
useful high expression vector, PMLSV N1/N4, described by Cosman et
al., Nature 312:768 (1984) has been deposited as ATCC 39890. A
vector designated pHAVEO is described by Dower et al., J. Immunol.
142:4314 (1989). Certain useful mammalian expression vectors are
described in the examples section below.
[0068] The vectors additionally may contain a DNA sequence encoding
a signal peptide (secretory leader) fused to the 5' end of a DNA
sequence encoding one of the inventive polypeptides. The 4-1BB-L
polypeptides lack a native signal sequence. Replacement of the
native human 4-1BB signal sequence with a heterologous signal
sequence may be desirable to enhance expression levels in the
particular host cells employed. Examples of heterologous signal
peptides that may be employed are the human or murine interleukin-7
signal peptide described in U.S. Pat. No. 4,965,195; the
interleulin-2 signal peptide described in Cosman et al. Nature
312:768, 1984; and the interleukin-4 signal peptide described in EP
367,566.
Purification of Recombinant Mammalian 4-1BB-L
[0069] The present invention provides substantially homogeneous
4-1BB-L and human 4-1BB proteins, which may be produced by
recombinant expression systems or purified from naturally occurring
cellular sources. The proteins are purified to substantial
homogeneity, as indicated by a single protein band upon analysis by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE).
[0070] Recombinant 4-1BB or 4-1BB-L proteins may be produced as
follows. Host cells are transformed with an expression vector
containing DNA encoding an inventive polypeptide, wherein the DNA
is operably linked to regulatory sequences suitable for effecting
expression of said inventive polypeptide in the particular host
cells. The transformed host cells are cultured under conditions
that promote expression of the 4-1BB-L or 4-1BB polypeptide, which
is then purified from the culture media or cell extracts. The
purification procedure will vary according to such factors as the
particular host cells employed and whether the expressed protein is
secreted or membrane-bound, as the skilled artisan will readily
appreciate.
[0071] Recombinant protein produced in bacterial culture is usually
isolated by initial disruption of the host cells, centrifugation,
extraction from cell pellets if the desired protein is in the form
of an insoluble refractile body, or from the supernatant if a
soluble polypeptide, followed by one or more concentration,
salting-out, ion exchange or size exclusion chromatography steps.
Finally, RP-HPLC can be employed for final purification steps.
Microbial cells can be disrupted by any convenient method,
including freeze-thaw cycling, sonication, mechanical disruption,
or use of cell lysing agents.
[0072] Recombinant polypeptides secreted from yeast cells can be
purified by methods analogous to those disclosed by Urdal et al.
(J. Chromatog. 296:171 (1984)). Urdal et al. describe two
sequential, reversed-phase HPLC steps for purification of
recombinant human IL-2 on a preparative HPLC column.
[0073] The purification procedure may involve affinity
chromatography. A 4-1BB-L protein (or the extracellular domain
thereof) may be attached to a solid support material by standard
procedures for use in purifying a 4-1BB protein. Likewise, a 4-1BB
protein (or the extracellular domain thereof) attached to a solid
support material may be used in purifying a 4-1BB-L protein. In
addition, 4-1BB-L/Fc or 4-1BB/Fc fusion proteins may be attached to
Protein G- or Protein A-bearing chromatography columns via binding
of the Fc moiety to the Protein A or Protein G. Immunoaffinity
columns comprising an antibody that binds the desired inventive
protein (described in example 8) also may be employed.
[0074] In one purification procedure, a 4-1BB-L or 4-1BB
polypeptide is concentrated using a commercially available protein
concentration filter, for example, an Amicon or Millipore Pellicon
ultrafiltration unit Following the concentration step, the
concentrate can be applied to a purification matrix such as a gel
filtration medium. Alternatively, an anion exchange resin can be
employed, for example, a matrix or substrate having pendant
diethylaminoethyl (DEAE) groups. The matrices can be acrylamide,
agarose, dextran, cellulose or other types commonly employed in
protein purification. Alternatively, a cation exchange step can be
employed. Suitable cation exchangers include various insoluble
matrices comprising sulfopropyl or carboxymethyl groups.
Sulfopropyl groups are preferred.
[0075] Finally, one or more reverse-phase high performance liquid
chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media,
(e.g., silica gel having pendant methyl or other aliphatic groups)
can be employed to further purify 4-1BB-L. Some or all of the
foregoing purification steps, in various combinations, can also be
employed to provide a substantially homogeneous recombinant
protein.
Pharmaceutical Compositions Comprising the Inventive Polypeptides
and Uses of 4-1BB-L and 4-1BB DNA and Proteins
[0076] The 4-1BB and 4-1BB-L proteins of the present invention are
expressed on cells that include certain types of T-lymphocytes, as
discussed above and in the examples section. The inventive proteins
thus are useful in exploring mechanisms of T-cell activation.
Identifying novel proteins expressed on T-cells, such as the
inventive proteins disclosed herein, has important implications in
furthering understanding of the regulation and function of the
immune system.
[0077] Murine 4-1BB and 4-1BB-L also have been detected on brain
tissue. Northem blot analysis revealed expression of human 4-1BB-L
in brain, and human 4-1BB is expected to be expressed in the brain
as well. The inventive proteins are useful reagents for studying
neural tissue, e.g., research into growth of neural cells and
disorders of the brain.
[0078] The 4-1BB-L of the present invention also has been found to
stimulate growth of CD3.sup.31 CD4.sup.- CD8.sup.- immature
lymphocytes. Cells expressing a membrane-bound 4-1BB-L were
cultivated with CD3.sup.- CD4.sup.- CD8.sup.- immature lymphocytes,
and growth of the lymphocytes was stimulated.
[0079] As described in example 13, cells expressing recombinant
human 4-1BB-L induced a strong proliferative response in mitogen
costimulated peripheral blood T-cells. In contrast, the ligand
enhanced cytolysis seen in costimulated long-term cultured T-cell
clones.
[0080] Uses of 4-1BB-L that flow from this ligand's ability to
co-stimulate T-cell proliferation include, but are not limited to,
the following. 4-1BB-L finds use as a tissue culture reagent for
the in vitro cultivation of primary T-cells, and during the
derivation of clonal T-cell lines therefrom. The ligand also may be
employed to stimulate proliferation of activated T-cells that are
to be employed in therapeutic procedures. For example, T-cells may
be removed from a cancer patient and cultivated in the presence of
a tumor antigen in vitro by known procedures, to generate cytotoxic
T-lymphocytes (CTLs) specific for the patient's tumor cells. The
CTLs are then administered to the patient. To enhance proliferation
of the CTLs in the ex vivo stage, 4-1BB-L may be added to the
culture medium, either alone or in combination with other cytokines
such as interleukin-2.
[0081] It has been suggested that elimination of peripheral T-cells
by activation induced cytolysis may be an important mechanism of
regulating unwanted or autoreactive T-cells (Owen-Schaub et al.,
Cell. Immunol. 140:197, 1992). 4-1BB-L enhanced cell death induced
by mitogenic stimuli in a long-term cultured (chronically
activated) T-cell clone. These data suggest that 4-1BB-L may play a
role in this process by enhancing activation-induced cell
death.
[0082] The 4-1BB-L of the present invention is useful as a research
reagent in in vitro binding assays to detect cells expressing
4-1BB. For example, 4-1BB-L or a fragment thereof (e.g., the
extracellular domain) can be labeled with a detectable moiety such
as .sup.125I. Alternatively, another detectable moiety such as
biotin, avidin, or an enzyme that can catalyze a colorometric or
fluorometric reaction may be used. Cells to be tested for 4-1BB
expression are contacted with the labeled 4-1BB-L then washed to
remove unbound labeled 4-1BB-L. Cells that bound the labeled
4-1BB-L are detected via the detectable moiety. Likewise, the human
4-1BB of the present invention is useful as a research reagent in
binding assays to detect cells expressing 4-1BB-L. Identifying
additional cell types expressing 4-1BB or 4-1BB-L provides insight
into cell types that may play a role in the activation and function
of cells of the immune system, particularly T-cells.
[0083] The 4-1BB ligand proteins disclosed herein also may be
employed to measure the biological activity of 4-1BB protein in
terms of binding affinity for 4-1BB-L. To illustrate, 4-1BB-L may
be employed in a binding affinity study to measure the biological
activity of a 4-1BB protein that has been stored at different
temperatures, or produced in different cell types. The biological
activity of a 4-1BB protein thus can be ascertained before it is
used in a research study, for example.
[0084] 4-1BB-L proteins find use as reagents that may be employed
by those conducting "quality assurance" studies, e.g., to monitor
shelf life and stability of 4-1BB protein under different
conditions. 4-1BB ligands may be used in determining whether
biological activity is retained after modification of a 4-1BB
protein (e.g., chemical modification, truncation, mutation, etc.).
The binding affinity of the modified 4-1BB protein for a 4-1BB-L is
compared to that of an unmodified 4-1BB protein to detect any
adverse impact of the modifications on biological activity of
4-1BB.
[0085] A different use of a 4-1BB ligand is as a reagent in protein
purification procedures. 4-1BB-L or Fc/4-1BB-L fusion proteins may
be attached to a solid support material by conventional techniques
and used to purify 4-1BB by affinity chromatography.
[0086] Likewise, human 4-1BB may be employed to measure the
biological activity of human 4-1BB-L polypeptides in terms of
binding affinity. Human 4-1BB finds further use in purification of
human 4-1BB-L by affinity chromatography.
[0087] The present invention provides pharmaceutical compositions
comprising an effective amount of a purified 4-1BB-L or 4-1BB
polypeptide and a suitable diluent, excipient, or carrier. Such
carriers will be nontoxic to patients at the dosages and
concentrations employed. Ordinarily, the preparation of such
compositions entails combining a mammalian 4-1BB-L polypeptide or
derivative thereof with buffers, antioxidants such as ascorbic
acid, low molecular weight (less than about 10 residues)
polypeptides, proteins, amino acids, carbohydrates including
glucose, sucrose or dextrans, chelating agents such as EDTA,
glutathione and other stabilizers and excipients. Neutral buffered
saline or saline mixed with conspecific serum albumin are exemplary
appropriate diluents.
[0088] Such compositions may be used to stimulate the immune system
in view of the inventive proteins' presence and effect on certain
cells associated with the immune response. For therapeutic use, the
compositions are administered in a manner and dosage appropriate to
the indication and the size and condition of the patient.
Administration may be by injection, continuous infusion, sustained
release from implants, or other suitable mode.
Nucleic Acid Fragments
[0089] The present invention further provides fragments of the
4-1BB-L and human 4-1BB nucleotide sequences presented herein. Such
fragments desirably comprise at least about 14 nucleotides. DNA and
RNA complements of said fragments are provided herein, along with
both single-stranded and double-stranded forms of the DNA.
[0090] Among the uses of such nucleic acid fragments is use as a
probe. Such probes may be employed in cross-species hybridization
procedures to isolate 4-1BB-L or 4-1BB DNA from additional
mammalian species. As one example, a probe corresponding to the
extracellular domain of 4-1BB-L or 4-1BB may be employed. The
probes also find use in detecting the presence of 4-1BB-L or 4-1BB
nucleic acids in in vitro assays and in such procedures as Northern
and Southern blots. Cell types expressing 4-1BB-L or 4-1BB can be
identified. Such procedures are well known, and the skilled artisan
can choose a probe of suitable length, depending on the particular
intended application.
[0091] Other useful fragments of the 4-1BB-L or 4-1BB nucleic acids
are antisense or sense molecules comprising a single-stranded
nucleic acid sequence (either RNA or DNA) capable of binding to
target 4-1BB-L or 4-1BB MRNA (sense) or DNA (antisense) sequences.
In one embodiment, the antisense or sense molecule is a nucleotide
sequence corresponding or complementary to the coding region of the
4-1BB or 4-1BB-L sequences presented herein or a fragment thereof
or the RNA complement thereof. Such oligonucleotides preferably
comprise at least about 14 nucleotides, most preferably from about
17 to about 30 nucleotides. The ability to derive an antisense or a
sense oligonucleotide based upon a cDNA sequence for a given
protein is described in, for example, Stein and Cohen, Cancer Res.
48:2659, 1988 and van der Krol et al., BioTechniques 6:958,
1988.
[0092] Binding of antisense or sense oligonucleotides to target
nucleic acid sequences results in the formation of duplexes that
block translation (RNA) or transcription (DNA) by one of several
means, including enhanced degradation of the duplexes, premature
termination of transcription or translation, or by other means. The
antisense oligonucleotides thus may be used to block expression of
4-1BB-L proteins.
[0093] Antisense or sense oligonucleotides of the present invention
further comprise oligonucleotides having modified
sugar-phosphodiester backbones (or other sugar linkages, such as
those described in WO91/06629) and wherein such sugar linkages are
resistant to endogenous nucleases. Such oligonucleotides with
resistant sugar linkages are stable in vivo (i.e., capable of
resisting enzymatic degradation) but retain sequence specificity to
be able to bind to target nucleotide sequences. Other examples of
sense or antisense oligonucleotides include those oligonucleotides
which are covalently linked to organic moieties, such as those
described in WO 90/10448, and other moieties that increases
affinity of the oligonucleotide for a target nucleic acid sequence,
such as poly-(L-lysine). Further still, intercalating agents, such
as ellipticine, and alkylating agents or metal complexes may be
attached to sense or antisense oligonucleotides to modify binding
specificities of the antisense or sense oligonucleotide for the
target nucleotide sequence.
[0094] Antisense or sense oligonucleotides may be introduced into a
cell containing the target nucleic acid sequence by any gene
transfer method, including, for example, CaPO.sub.4-mediated DNA
transfection, electroporation, or other gene transfer vectors such
as Epstein-Barr virus. Antisense or sense oligonucleotides are
preferably introduced into a cell containing the target nucleic
acid sequence by insertion of the antisense or sense
oligonucleotide into a suitable retroviral vector, then contacting
the cell with the retrovirus vector containing the inserted
sequence, either in vivo or ex vivo. Suitable retroviral vectors
include, but are not limited to, vectors derived from the murine
retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV), or the
double copy vectors designated DCT5A, DCT5B and DCT5C (see PCT
Application US 90/02656).
[0095] Sense or antisense oligonucleotides may also be introduced
into a cell containing the target nucleotide sequence by formation
of a conjugate with a ligand binding molecule, as described in WO
91/04753. Suitable ligand binding molecules include, but are not
limited to, cell surface receptors, growth factors, other
cytokines, or other ligands that bind to cell surface receptors.
The ligand binding molecule should be conjugated in a manner that
does not substantially interfere with the ability of the ligand
binding molecule to bind to its corresponding molecule or receptor,
or block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
[0096] Alternatively, a sense or an antisense oligonucleotide may
be introduced into a cell containing the target nucleic acid
sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense
oligonucleotide-lipid complex is preferably dissociated within the
cell by an endogenous lipase.
[0097] The following examples are for the purposes of illustrating
certain embodiments of the invention, and are not to be construed
as limiting the scope of the invention as claimed herein.
EXAMPLE 1
Preparation of Murine 4-1BB/Fc Fusion Protein for Use in Screening
Clones
[0098] This example illustrates construction of an expression
vector encoding a fusion protein comprising a soluble murine 4-1BB
poly-peptide fused to an Fc region polypeptide derived from a human
IgG1 antibody. The fusion protein is used for detecting clones
encoding a 4-1BB ligand. One advantage of employing an
Fc-containing fusion protein is the facile purification made
possible by the Fc moiety. Other polypeptides derived from an
antibody Fc domain, and which bind with relatively high affinity to
protein A- or protein G-containing columns, may be substituted for
the Fc polypeptide employed below.
[0099] DNA encoding a portion of the extracellular (ligand binding)
domain of the murine 4-1BB receptor was isolated by polymerase
chain reaction (PCR) using primers based upon the sequence
published in Kwon et al. I and presented herein as SEQ ID NOS:5 and
6. A BD14-20 alloreactive murine T-cell clone was induced with
concanavalin A (Con A), using standard techniques (Kwon et al. II).
Total RNA was isolated from the induced cells by the guanadinium
thiocyanate method (Mosley et al., Cell 59: 335 (1989)). cDNA was
prepared by conventional techniques and used as the template in a
conventional PCR procedure (Sarki et al., Science 239:487, 1988).
The 5' primer oligonucleotide sequence was: TABLE-US-00001 (SEQ ID
NO:9) GTCACTAGTTCTGTGCAGAACTCCTGTGATAAC
[0100] SEQ ID NO:9 comprises a SpeI site (double underline) and a
signal cleavage site followed by a sequence (underlined) that
corresponds to the nucleotides encoding the first seven amino acids
of the mature murine 4-1BB protein. The 3' primer sequence was a
35-mer oligonucleotide comprising the sequence: TABLE-US-00002 (SEQ
ID NO:10) CACAAGATCTGGGCTCCTCTGGAGTCACAGAAATG
[0101] The SEQ ID NO:10 oligonucleotide contains a Bgl 2
restriction site (double underline) and a sequence (underlined)
that is complementary to nucleotides 510-528 of SEQ ID NO:5.
[0102] The PCR reaction was amplified with 30 cycles. The amplified
DNA fragment comprised a sequence encoding a soluble murine 4-1BB
polypeptide comprising amino acids 1 (Val) through 153 (Glu) of SEQ
ID NO:5, i.e., a fragment of the extracellular domain terminating
ten amino acids upstream of the transmembrane region. The resulting
PCR products were digested with SpeI and BglII restriction
enzymes.
[0103] A DNA encoding the Fc region of a human IgG1 antibody (to be
fused to the 4-1BB-encoding sequence) was isolated as follows. SEQ
ID NO:14 and SEQ ID NO:15 present the nucleotide and encoded amino
acid sequences of a human IgG1 Fc polypeptide-encoding DNA inserted
into the polylinker (multiple cloning site) of a pBluescript.RTM.SK
cloning vector (Stratagene Cloning Systems, La Jolla, Calif). Amino
acids 1-13 of SEQ ID NO:15 are encoded by the polylinker segment of
the vector, and amino acids 14 (Glu) through 245 (Lys) constitute
the Fc polypeptide. An Fc-encoding DNA fragment 699 base pairs in
length was derived by cleaving the recombinant pBluescript.RTM.SK
vector with BglII (the recognition site for which comprises
nucleotides 47-52 of SEQ ID NO:14) and SpeI (which cleaves in the
polylinker downstream of the inserted Fc sequence).
[0104] The Fc fragment and the murine 4-1BB extracellular domain
fragment isolated by PCR above were cloned into an Spel-cleaved
Smag 4 vector in a three-way ligation. The Smag 4 vector comprises
a murine interleukin-7 (IL-7) leader sequence inserted into the
mammalian high expression vector pDC201 (described in Sims et al.,
Science 241:585, 1988, and in PCT application WO 89/03884), which
is capable of replication in E. coli. E. coli cells were
transfected with the ligation mixture and the desired recombinant
vector (comprising the Fc-encoding DNA joined to the C-terminus of
the 4-1BB-encoding DNA via the BglII sites) was isolated
therefrom.
[0105] The gene fusion encoding the soluble 4-1BB/Fc fusion protein
was excised by digesting the recombinant Smag 4 vector with BamHI.
The fragment encoding the fusion protein was isolated, the ends
were filled in using the Klenow fragment of DNA polymerase I, and
the resulting blunt-ended fragment was ligated into a SalI cleaved
(blunt ended) dephosphorylated HAV-EO vector.
[0106] The gene fusion was transferred to the HAV-EO vector
(described by Dower et al., J. Immunol. 142:4314; 1989) in order to
improve expression levels. The HAV-EO vector is a derivative of
pDC201 and allows for high level expression in CV-1/EBNA cells. The
CV-1/EBNA cell line (ATCC 10478) was derived by transfecting the
African green monkey kidney cell line CV-1 (ATCC CCL-70) with a
gene encoding Epstein-Barr virus nuclear antigen-I (EBNA-1), as
described by McMahan et al. (EMBO J. 10:2821,1991). The CV-1/ EBNA
cells constitutively express EBNA-1 driven from the human
cytomegalovirus (CMV) intermediate-early enhancer/promoter. The
EBNA-1 gene allows for episomal replication of expression vectors
such as HAV-EO that contain the EBV origin of replication.
[0107] The recombinant HAV-EO vector containing the 4-1BB/Fc gene
fusion was transfected into CV-1/EBNA cells using standard
techniques. The transfected cells transiently expressed and
secreted a 4-1BB/Fc fusion protein into the culture supernatant,
which was harvested after one week of cultivation. The 4-1BB/Fc
fusion protein was purified by protein G affinity chromatography.
More specifically, one liter of culture supernatant, containing the
4-1BB/Fc fusion protein, was passed over a solid phase protein G
column, and the column was washed thoroughly with
phosphate-buffered saline (PBS). The adsorbed fusion protein was
eluted with 50 mM glycine buffer, pH 3. Purified fusion protein was
brought to pH 7 with 2 M Tris buffer, pH 9. Silyer-stained SDS gels
of the purified 4-1BB/Fc fusion protein showed it to be >98%
pure.
[0108] Purified 4-1BB/Fc fusion protein was radioiodinated with
.sup.125I using a commercially available solid phase reagent
(IODO-GEN, Pierce Chemical Co., Rockford, Ill.). In this procedure,
5 .mu.g of IODO-GEN were plated at the bottom of a 10.times.75 mm
glass tube and incubated for twenty minutes at 4.degree. C. with 75
.mu.l of 0.1 M sodium phosphate, pH 7.4 and 20 .mu.l (2 mCi)
Na.sup.125I. The solution was then transferred to a second glass
tube containing 5 .mu.g of 4-1BB/Fc in 45 .mu.l PBS (phosphate
buffered saline) and this reaction mixture was incubated for twenty
minutes at 4.degree. C. The reaction mixture was fractionated by
gel filtration on a 2 ml bed volume of Sephadex.RTM. G-25 (Sigma),
and then equilibrated in RPMI 1640 medium containing 2.5% (v/v)
bovine serum albumin (BSA), 0.2% (v/v) sodium azide and 20 mM
Hepes, pH 7.4 binding medium. The final pool of .sup.125I-4-1BB/Fc
was diluted to a working stock solution of 1.times.10.sup.-7M in
binding medium and stored for up to one month at 4.degree. C.
without detectable loss of receptor binding activity.
[0109] Approximately 50% -60% label incorporation was observed.
Radioiodination yielded specific activities in the range of
1.times.10.sup.15 to 5.times.10.sup.15 cpm/nmole (0.42-2.0 atoms of
radioactive iodine per molecule of protein). SDS polyacrylamide gel
electrophoresis (SDS-PAGE) revealed a single labeled polypeptide
consistent with expected values. The labeled fusion protein was
greater than 98% trichloroacetic acid (TCA) precipitable,
indicating that the .sup.125I was covalently bound to the
protein.
EXAMPLE 2
Isolation of cDNA Encoding Human 4-1BB
[0110] A human cDNA library was screened with a murine 4-1BB DNA
probe in an effort to isolate cDNA encoding a human 4-1BB by
cross-species hybridization. The degree of homology between murine
4-1BB and human 4-1BB DNA was not known prior to isolation and
sequencing of human 4-1BB DNA by the following procedure.
[0111] A fragment of the murine 4-1BB DNA of SEQ ID NO:5 was
isolated by polymerase chain reaction (PCR) using conventional
procedures. The template was cDNA synthesized using a first strand
cDNA synthesis kit (Stratagene Cloning Systems, La Jolla, CA) on
RNA isolated from the induced murine T cell clone BD14-20 (see
example 1). The 5' primer was the oligonucleotide presented as SEQ
ID NO:9 and described in example 1. The 3'primer was the following
oligonucleoide: TABLE-US-00003 (SEQ ID NO:11) 5'
CAGACTAGTTCACTCTGGAGTCACAGAAATG 3'
[0112] This oligonucleotide comprises an SpeI site (double
underline) and a sequence (underlined) that is complementary to
nucleotides 510-528 of SEQ ID NO:5 (murine 4-1BB). The amplified
PCR products (comprising nucleotides 70-528 of the murine 4-1BB
sequence of SEQ 1D NO:5) were ligated into a SmaI-digested
pBLUESCRIPT.RTM.SK cloning vector (Stratagene Cloning Systems, La
Jolla, Calif.). E. coli cells were transfected with the ligation
mixture, and the desired recombinant vector was recovered. The
murine 4-1BB DNA insert was excised by digesting the recombinant
vector with NotI and EcoRI. The excised DNA was labeled with
.sup.32P using a conventional random priming technique.
[0113] The labeled murine 4-1BB DNA fragment was used to screen a
human cDNA library that was constructed as described by Park et al.
(Blood 74:56, 1989). Briefly, the cDNA library was derived from
poly A.sup.+ RNA isolated from human peripheral blood T-lymphocytes
(purified by E rosetting) that had been activated for 18 hours with
phytohemagglutinin (PHA) and phorbol myristate acetate (PMA).
Blunt-ended cDNA was methylated and EcoR1 linkers were attached,
followed by ligation to .lamda.gt10 arms and packaging into phage
.lamda. extracts (Stratagene Cloning Systems, La Jolla, Cailf.)
according to the manufacturer's instructions.
[0114] Hybridization was conducted at 37.degree. C. in 50%
formamide, followed by washing in 2X SSC, 0.1% SDS at 55.degree. C.
The cDNA insert of a hybridizing clone was isolated and sequenced.
The nucleotide and encoded amino acid sequences of this human 4-1BB
cDNA are presented in SEQ ID NO:7 and SEQ ID NO:8.
[0115] The human 4-1BB protein comprises an N-terminal signal
peptide (amino acids -23 to -1 of SEQ ID NO:8), an extracellular
domain comprising amino acids 1-163, a transmembrane region
comprising amino acids 164-190, and a cytoplasmic domain comprising
amino acids 191-232. The human 4BB of SEQ ID NO:7 is 60% identical
to murine 4-1BB at the amino acid level, and 71% identical at the
DNA level.
EXAMPLE 3
Preparation of Human 4-1BB/Fc Fusion Protein for Use in Screening
Clones
[0116] This example illustrates construction of an expression
vector encoding a fusion protein comprising the extracellular
domain of human 4-1BB fused to the N-terminus of an Fc region
polypeptide derived from a human IaG1 antibody. The fusion protein
was used for detecting clones encoding a human 4-1BB ligand.
[0117] A DNA fragment encoding a soluble human 4-1BB was isolated
by PCR using the human 4-1BB cDNA synthesized in example 2 as a
template. The 5' primer was the following oligonucleotide:
TABLE-US-00004 (SEQ ID NO:12) 5' ATAGCGGCCGCTGCCAGATTTCATCATGGGAAAC
3'
[0118] This oligonucleotide comprises a NotI site (double
underlined) and a segment (underlined) corresponding to nucleotides
106-128 of SEQ ID NO:7.
[0119] The 3' primer was the following oligonucleotide:
TABLE-US-00005 (SEQ ID NO:13) 5' ACAAGATCTCTGCGGAGAGTGTCCTGGCTCTCTC
3'
[0120] The oligonucleotide comprises a Bgl II site (double
underlined) and a segment (underlined) complementary to nucleotides
653-677 of SEQ ID NO:7. The segment with a dotted underline is
complementary to nucleotides 41-46 of SEQ ID NO:14 and serves to
replace the codons for the first two amino acids of the Fc
polypeptide (amino acids 14 and 15 of SEQ ID NO:14), which are
upstream of the BglII site.
[0121] A DNA fragment encoding an antibody Fc region polypeptide
was isolated by cleaving a recombinant vector comprising
Fc-encoding DNA in pBLUESCRIPT.RTM.SK (described in example 1) with
BglII and NotI. BglII cleaves near the 5' end of the Fc DNA, as
described in example 1, and NotI cleaves in the polylinker of the
vector downstream of the inserted Fc-encoding DNA.
[0122] In a 3-way ligation, the soluble human 4-1BB
polypeptide-encoding DNA isolated by PCR above and the Fc-encoding
BglII/NotI fragment were ligated into a NotI-digested expression
vector pDC406 (described in McMahan et al., EMBO J., 10:2821,
1991). E. coli cells were transformed with the ligation mixture and
the desired recombinant vector was recovered. The fusion protein
encoded by this vector comprised amino acids -23 to 163 of SEQ ID
NO:8 (a soluble human 4-1BB polypeptide consisting of the signal
peptide and the entire extracellular domain) followed by amino
acids 14-245 of SEQ ID NO:15 (Fc polypeptide). CV1-EBNA cells
(described in example 1) were transfected with the recombinant
vector and cultured to produce and secrete the soluble human
4-1BB/Fc fusion protein. The fusion protein was purified by protein
G affinity chromatography for use in identifying clones expressing
human 4-1BB ligand, as described in example 5 below.
EXAMPLE 4
Isolation of Murine 4-1BB Ligand cDNA
[0123] This example describes the isolation of cDNA encoding a
murine 4-1BB ligand (4-1BB-L) using a direct expression cloning
technique. The procedure was as follows.
[0124] Several cell lines were screened for the ability to bind the
radioiodinated murine 4-1BB/Fc fusion protein described in Example
1. Briefly, quantitative binding studies were performed according
to standard methodology, and Scatchard plots were derived for the
various cell lines. A clonal cell line designated EL4 6.1C10 was
identified as expressing approximately 1500 molecules of a
4-1BB/Fc-binding protein per cell, with an affinity binding
constant of approximately 2.times.10.sup.9 M.sup.-. The EL4 6.1C10
cell line was derived from a subclone designated EL4 6.1 by using a
cell sorter to enrich for a cell population expressing high levels
of murine type I Interleukin-1 receptor, as described in U.S. Pat.
No. 4,968,607. EL4 6.1 had been derived from a mouse thymoma cell
line EL-4 (ATCC TIB39) as described by MacDonald et al. (J.
Immunol. 135:3944, 1985) and Lowenthal and MacDonald (J. Exp. Med.
164:1060, 1986).
[0125] A cDNA library was derived from the EL4 6.1C10 cell line
using a library construction technique substantially similar to
that described by Ausubel et al., eds., Current Protocols in
Molecular Biology, Vol. 1, (1987). Total RNA was extracted from the
EL4 6.1C10 cell line, poly (A).sup.+mRNA was isolated by oligo dT
cellulose chromatography, and double-stranded cDNA was made
substantially as described by Gubler et al., Gene 25:263 (1983).
Briefly, poly(A).sup.+mRNA fragments were converted to RNA-cDNA
hybrids by reverse transcriptase using random hexanucleotides as
primers. The RNA-cDNA hybrids were then convened into
double-stranded cDNA fragments using RNAse H in combination with
DNA polymerase I. The resulting double-stranded cDNA was
blunt-ended with T4 DNA polymerase, ligated into SmaI-cleaved,
dephosphorylated expression vector pDC201 (described in Sims et
al., Science 241:585, 1988, and in PCT application WO 89/03884),
and transformed into competent E. coli DH5.alpha. cells.
[0126] Plasmid DNA was isolated from pools consisting of
approximately 2,000 clones of transformed E. coli per pool. The
isolated plasrmid DNA was transfected into a sub-confluent layer of
COS cells using DEAE-dextran followed by chloroquine treatment
substantially according to the procedures described in Luthman et
al. (Nucl. Acids Res. 11:1295, 1983) and McCutchan et al. (J. Natl.
Cancer Inst. 41:351, 1986). Briefly, COS cells were maintained in
complete medium (Dulbecco's modified Eagles' media containing 10%
(v/v) fetal calf serum, 50 U/ml penicillin, 50 U/ml streptomycin,
and 2 mM L-glutanine and were plated to a density of approximately
2.times.10.sup.5 cells/well in single-well chambered slides
(Lab-Tek). The slides were pre-treated with 1 ml human fibronectin
(10 .mu.g/ml PBS) for 30 minutes followed by a single washing with
PBS. Media was removed from the monolayer of adherent cells and
replaced with 1.5 ml complete medium containing 66.6 .mu.M
chloroquine sulfate. About 0.2 ml of a DNA solution (2 .mu.g DNA,
0.5 mg/ml DEAE-dextran in complete medium containing chloroquine)
was added to the cells and the mixture was incubated at 37.degree.
C. for about five hours. Following incubation, media was removed
and the cells were shocked by addition of complete medium
containing 10% DMSO (dimethylsulfoxide) for 2.5-20 minutes.
Shocking was followed by replacement of the solution with fresh
complete medium. The cells were grown in culture to permit
transient expression of the inserted DNA sequences. These
conditions led to an 80% transfection frequency in surviving COS
cells.
[0127] After 48-72 hours in culture, monolayer of transfected COS
cells were assayed by slide autoradiography for expression of a
protein that binds the radioiodinated murine 4-1BB/Fc fusion
protein prepared in Example 1. The slide autoradiography technique
was essentially as described by Gearing et al. (EMBO J., 8:3667,
1989). Briefly, the transfected COS cells were washed once with
binding medium (RPMI 1640 containing 25 mg/ml bovine serum albumin
(BSA), 2 mg/ml sodium azide, 20 mM HEPES pH 7.2, and 50 mg/mi
nonfat dry milk) and incubated for 2 hours at 4.degree. C. in
binding medium containing 1.times.10.sup.-9 M .sup.125I-4-1BB/Fc
fusion protein. After incubation, cells in the chambered slides
were washed three times with binding medium, followed by two washes
with PBS, (pH 7.3) to remove unbound radiolabeled fusion
protein.
[0128] The cells were fixed by incubating in 10% glutaraldehyde in
PBS (30 minutes at room temperature), washed twice in PBS and
air-dried. The slides were dipped in Kodak GTNB-2 photographic
emulsion (6.times. dilution in water) and exposed in the dark for
four days at room temperature in a light-proof box. The slides were
developed in Kodak D19 developer, rinsed in water and fixed in Agfa
G433C fixer. The slides were individually examined under a
microscope at 25-40.times. magnification. Positive slides showing
cells expressing 4-1BB ligand were identified by the presence of
autoradiographic silyer grains against a light background.
[0129] One pool containing approximately 2120 individual clones was
identified as potentially positive for binding the 4-1BB/Fc fusion
protein. The pool was broken down into smaller pools of
approximately 250 colonies, from which DNA was isolated and
transfected into COS-7 cells. The transfectants were screened by
slide autoradiography as described above. Three positive pools were
identified. Plasmid DNA isolated from individual colonies
corresponding to the three positive pools was transfected into COS
cells and screened by the same procedure.
[0130] A single clone encoding a protein that binds murine 4-1BB/Fc
was isolated. Plasmid DNA was isolated from the clone, and the
nucleotide sequence of the cDNA insert in the recombinant vector
was determined. The cloned cDNA was found to encode a novel
protein, a murine 4-1BB ligand (4-1BB-L) protein of the present
invention. The nucleotide sequence of the isolated murine 4-1BB-L
cDNA and the amino acid sequence encoded thereby are presented in
SEQ ID NO:1 and SEQ ID NO:2. E. Coli DH5.alpha. cells transformed
with a recombinant vector comprising the murine 4-1BB-L-encoding
cDNA of SEQ ID NO:1 in the mammalian expression vector pDC201 were
deposited with the American Type Culture Collection, Rockville,
Md., on Sept. 5, 1991, under accession no. ATCC 68682. The murine
4-1BB-L is a type II protein comprising a cytoplasmic domain (amino
acids 1-82 of SEQ ID NO:1); a transmembrane region (amino acids
83-103 of SEQ ID NO:1); and an extracellular domain (amino acids
104-309 of SEQ ID NO:1).
EXAMPLE 5
Isolation of cDNA Encoding a Human 4-1BB Ligand
[0131] Different cell lines were screened by flow cytometry for the
ability to bind the human 4-1BB/Fc (hu 4-1BB/Fc) fusion protein
prepared in Example 3. Cells were initially incubated with
hu4-1BB/Fc (10 .mu.g/ml), followed by biotinylated goat anti-human
IgG, Fc-specific (Jackson ImmunoResearch Laboratories, West Grove,
Pa.) and finally streptavidin-phycoerythrin (Becton-Dickinson).
Flow cytometry w as performed using a FACScan (Becton-Dickinson)
and data were collected on 10.sup.4 viable cells. An alloreactive
CD4.sup.+human T cell clone designated PL1 stimulated with an
anti-CD3 antibody exhibited 4-1BB/Fc binding. The receptor binding
was detectable 30 minutes after stimulation and peaked 2-4 hours
post-stimulation.
[0132] Since peak production of mRNA would precede peak production
of the 4-1BB-binding protein translated therefrom, total RNA was
isolated from the PL1 cells 90 minutes after stimulation, and
poly(A.sup.+) RNA was isolated by oligo(dT) cellulose
chromatography. cDNA was synthesized on the poly(A).sup.+ RNA
template using oligo(dT) primers and a cDNA synthesis kit
(Pharmacia Biotech, Inc., Piscataway, N.J.). The resulting
double-stranded cDNA was ligated into the BglII site of the
mammalian expression vector pDC410 by a BglII adaptor method
similar to that described by Haymerle et al. (Nucl. Acids Res.
14:8615, 1986).
[0133] The pDC410 vector is similar to pDC406 (McMahan et al., EMBO
J., 10:2821, 1991). In pDC410, the EBV origin of replication of
pDC406 is replaced by DNA encoding the SV40 large T antigen (driven
from an SV40 promoter). The pDC410 multiple cloning site (mcs)
differs from that of pDC406 in that it contains additional
restriction sites and three stop codons (one in each reading
frame). A T7 polymerase promoter downstream of the mcs facilitates
sequencing of DNA inserted into the mcs. E. coli strain DH5.alpha.
cells were transfected with the cDNA library in pDC410.
[0134] Plasmid DNA was isolated from the transformed E. coli cells,
pooled, (each pool consisting of plasmid DNA from approximately
1000 individual colonies) and transfected into a sub-confluent
layer of CV-1 EBNA cells (described in example 1). The transfection
procedure was the DEAE-dextran followed by chloroquine treatment
technique essentially as described in Luthman et al., Nucl. Acids
Res. 11:1295 (1983), McCutchan et al., J. Natl. Cancer Inst. 41:351
(1986). Prior to transfection, the CV1-EBNA cells were plated in
single-well chambered slides (Lab-Tek) and grown in culture for two
to three days to permit transient expression of the inserted DNA
sequences.
[0135] The transfected cells then were assayed by slide
autoradiography for expression of 4-1BB-L. The assay procedure was
similar to that described in example 4, except that the transfected
cells were incubated with two reagents. The cells were first washed
with binding medium containing nonfat dry milk (BM-NFDM) and
incubated with the human 4-1BB/Fc fusion protein prepared in
Example 3, in non-radiolabeled form (1 .mu.g/ml in BM-NFDM) for one
hour at room temperature. After washing three times with BM-NFDM,
cells were incubated with 40 ng/ml.sup.125I-mouse anti-human Fc
antibody (a 1:50 dilution) for one hour at room temperature. The
mouse anti-human Fc antibody was obtained from Jackson
Immunoresearch Laboratories, Inc, West Grove, PA, and radiolabeled
by the chloramine T method. After washing three times with BM-NFDM
and twice with PBS, cell were fixed in glutaraldehyde and slides
were processed as described in example 4.
[0136] The pool appearing to be most strongly positive w as broken
down into smaller pools. DNA from the smaller pools was transfected
into CV1-EBNA cells and screened by slide autoradiography as
described above. Positive pools were identified, and DNA from
individual colonies corresponding to the positive pools was
screened by the foregoing procedure. Two individual clones
expressing 4-1BB-L proteins were isolated. The nucleotide sequence
of the human 4-1BB-L cDNA insert of one of the clones (clone 7A)
and the amino acid sequence encoded thereby is presented in SEQ ID
NO:3 and SEQ ID NO:4. This human 4-1BB-L protein comprises a
cytoplasmic domain (amino acids 1-25 of SEQ ID NO:4), a
trarsmembrane region (amino acids 26-46), and an extracellular
domain (amino acids 47-252).
[0137] The human 4-1BB-L amino acid sequence of SEQ ID NO:3 is
about 33% identical to the murine 4-1BB-L amino acid sequence of
SEQ ID NO:1, and the nucleotide sequences are about 50% identical.
The recombinant vector of clone 7A, i.e., human 4-1BB-L cDNA in
vector pDC410, designated hu4-1BB-L (7A)/pDC410, was deposited in
E.coli DH5.alpha. with the American Type Culture Collection,
Rockville, Md. on Apr. 16, 1993, under accession number ATCC
69285.
EXAMPLE 6
Expression of Biologically Active Soluble 4-1BB-L in Mamnmalian
Cells
[0138] Soluble 4-1BB-L was expressed in a monkey kidney cell line
designated CV-1 (ATCC CCL 70). The expressed protein was
biologically active in that it bound a 4-1BB/Fc fusion protein.
[0139] The soluble 4-1BB-L was produced as follows. DNA encoding
amino acids 106 through 309 of the murine 4-1BB-L of SEQ ID NO:1
was isolated by PCR using oligonucleotide primers based on the
nucleotide sequence presented in SEQ ID NO:1. The amplified DNA was
inserted into the mammalian expression vector designated HAV-EO
(described in example 1). cDNA encoding a heterologous (murine
interleulin-7) leader peptide, described in U.S. Pat. No. 4,965,195
which is hereby incorporated by reference, was fused to the
N-terminus of the 4-1BB-L cDNA to promote secretion of the soluble
4-1BB-L from the host cells. CV-1 cells were transformed with the
resulting recombinant expression vector by conventional
techniques.
[0140] The transformed CV-1 cells were cultured to permit
expression and secretion of the soluble 4-1BB-L into the
supernatant. Various concentrations of the supernatant were tested
in a competitive binding assay for the ability to inhibit binding
of soluble murine 4-1BB/Fc to EL4 6.1C10 cells. The soluble murine
4-1BB/Fc fusion protein was produced as described in example 1. The
murine EL4 6.1C10 cell line expresses cell surface 4-1BB-L, as
described in example 4
[0141] The results of the assay, presented in FIG. 1, demonstrate
that the soluble murine 4-1BB-L protein expressed in CV-1 cells
inhibits binding of a soluble murine 4-1BB/Fc fusion protein to EL4
6.1C10 cells. The soluble 4-1BB-L protein's ability to inhibit
binding of 4-1BB/Fc to the cells indicates that the soluble 4-1BB-L
is binding to the 4-1BB/Fc.
[0142] An expression vector encoding soluble human 4-1BB-L can be
substituted for the murine 4-1BB-L-encoding vector in the foregoing
procedure. Likewise, human 4-1BB/Fc would be substituted for murine
4-1BB/Fc, and human cells expressing 4-1BB employed in place of
murine cells, in the competitive binding assay.
[0143] FIG. 2 presents the result of a control experiment in which
CV-1 cells were transformed with an "empty" HAV-EO vector (lacking
any inserted 4-1BB-L DNA). Supematant from a culture of the
transformed cells did not inhibit binding of 4-1BB/Fc to EL4 6.1C10
cells when tested in the competitive binding assay.
EXAMPLE 7
Expression of Biologically Active Soluble 4-1BB-L in Yeast
[0144] Soluble recombinant 4-1BB-L expressed in yeast cells
(Saccharomyces cerevisiae) was shown to be biologically active in
that the expressed protein was able to bind a 4-1BB/Fc fusion
protein. The 4-1BB-L protein was produced by inserting cDNA
encoding amino acids 106 through 309 of the murine 4-1BB-L of SEQ
ID NO:1 (isolated and amplified by PCR) into an expression vector
comprising an ADH2 promoter (described above). The expression
vector also contained DNA encoding the yeast .alpha.-factor leader
peptide (described above) fused to the 5' end of DNA encoding a
FLAG.RTM. peptide DYKDDDDK, which was fused to the 5' end of the
4-1BB-L DNA. The FLAG.RTM. octapeptide constitutes an epitope
reversibly bound by a particular monoclonal antibody, which
facilitates purification of recombinant proteins (4-1BB-L in this
case), as described in U.S. Pat. No. 5,011,912. The octapeptide may
be removed using bovine mucosal enterokinase, which specifically
cleaves at the residue immediately following the DK pairing.
[0145] S. cerevisiae cells were transformed with the resulting
recombinant expression vector by conventional techniques. The
transformed cells were cultured to permit expression and secretion
of the soluble 4-1BB-L into the supernatant. Various concentrations
of the supernatant were tested in a competitive binding assay for
the ability to inhibit binding of soluble murine 4-1BB/Fc to EL4
6.1C10 cells. The soluble murine 4-1BB-/Fc fusion protein was
produced as described in example 1. Murine EL4 6.1C10 cells express
cell surface 4-1BB-L, as described in example 4.
[0146] FIG. 3 presents the results of the competitive binding
assay, which demonstrates that the soluble murine 4-1BB-L protein
expressed in S. cerevisiae cells inhibits binding of the murine
4-1BB/Fc fusion protein to EL4 6.1C10 cells. The 4-1BB-L protein
thus is able to bind 4-1BB/Fc. Although recombinant 4-1BB-L can be
expressed in yeast cells, mammalian cells are preferred as host
cells. The specific activity of 4-1BB-L produced in yeast generally
is lower than that of 4-1BB-L produced in mammalian cells such as
CV-1.
EXAMPLE8
Monoclonal Antibodies That Bind 4-1BB-L or 4-1BB
[0147] Murine 4-1BB-L or human 4-1BB-L protein may be purified by
4-1BB/Fc affinity chromatography as described above. Full length
4-1BB-L or immunogenic fragments thereof (e.g., the extracellular
domain) can be used as an immunogen to generate monoclonal
antibodies using conventional techniques, for example, those
techniques described in U.S. Pat. No. 4,411,993. Another
alternative involyes using a soluble 4-1BB-L/Fc fusion protein,
comprising the extracellular domain of a 4-1BB-L fused to an
antibody Fc polypeptide, as the immunogen.
[0148] Briefly, mice are immunized with 4-1BB-L as an immunogen
emulsified in complete Freund's adjuvant, and injected
subcutaneously or intraperitoneally in amounts ranging from 10-100
.mu.g. Ten to twelve days later, the immunized animals are boosted
with additional 4-1BB-L emulsified in incomplete Freund's adjuvant.
Mice are periodically boosted thereafter on a weekly to bi-weekly
immunization schedule. Serum samples are periodically taken by
retro-orbital bleeding or tail-tip excision for testing by dot blot
assay or ELISA (Enzyme-Linked Immunosorbent Assay), for antibodies
that bind 4-1BB-L.
[0149] Following detection of an appropriate antibody titer,
positive animals are provided one last intravenous injection of
4-1BB-L in saline. Three to four days later, the animals are
sacrificed, spleen cells harvested, and spleen cells are fused to a
murine myeloma cell line (e.g., NS1 or Ag 8.653). The latter
myeloma cell line is available from the American Type Culture
Collection as P3.times.63Ag8.653 (ATCC CRL 1580). Fusions generate
hybridoma cells, which are plated in microtiter plates in a HAT
(hypoxanthine, aminopterin and thymidine) selective medium to
inhibit proliferation of non-fused cells, myeloma hybrids, and
spleen cell hybrids.
[0150] The hybridoma cells are screened by ELISA for reactivity
against purified 4-1BB-L by adaptations of the techniques disclosed
in Engvall et al., Immunochem. 8:871 (1971) and in U.S. Pat. No.
4,703,004. A preferred screening technique is the antibody capture
technique described in Beckmann et al., (J. Immunol. 144:4212,
1990). Positive hybridoma cells can be injected intraperitoneally
into syngeneic BALB/c mice to produce ascites containing high
concentrations of anti-4-1BB-L monoclonal antibodies.
Alternatively, hybridoma cells can be grown in vitro in flasks or
roller bottles by various techniques. Monoclonal antibodies
produced in mouse ascites can be purified by ammonium sulfate
precipitation, followed by gel exclusion chromatography.
Alternatively, affinity chromatography based upon binding of
antibody to protein A or protein G can be used, as can affinity
chromatography based upon binding to 4-1BB-L.
[0151] Purified human 4-1BB or immunogenic fragments thereof (e.g.,
a fragment derived from the extracellular domain) may be
substituted for the 4-1BB-L immunogens in the foregoing procedures.
In one embodiment, a soluble human 4-1BB/Fc fusion proteir (e.g.,
as described in example 3) is employed as the immunogen. Monoclonal
antibodies that bind human 4-1BB thus are prepared.
EXAMPLE 9
Dimeric Forms of the Inventive Proteins
[0152] Preparation of fusion proteins comprising an antibody Fc
polypeptide fused to the C-terminus of a soluble human 4-1BB
polypeptide (such fusion proteins being referred to as 4-1BB/Fc
hereinafter) is described in example 3. Disulfide bonds form
between the Fc moieties, as in antibodies, resulting in dimers
comprising two 4-1BB/Fc polypeptides. Such dimers may be recovered
from cultures of cells expressing the 4-1BB/Fc fusion proteins.
[0153] Dimers comprising two 4-1BB-L/Fc polypeptides joined via
disulfide bonds may be prepared by analogous procedures. A DNA
fragment encoding a soluble 4-1BB-L polypeptide is isolated by
procedures described above (e.g., using oligonucleotides that
define the desired termini of the fragment as primers in PCR). An
expression vector comprising the isolated fragment fused to an
Fc-encoding fragment is constructed by procedures analogous to
those described in examples 1 and 3. The Fc polypeptide is
preferably fused to the N-terminus of the 4-1BB-L polypeptide,
however. Dimers of 4-1BB-L/Fc are recovered from cultures of cells
transform with the expression vector.
[0154] The dimers preferably are produced in 293 cells (ATCC CRL
1573). The 293 cell line was derived from transformed primary human
embryonal kidney cells.
EXAMPLE 10
Cross-Species Reactivity
[0155] Inhibition studies were used to investigate cross-species
binding of 4-1BB to its ligand. 2.5.times.10.sup.6 EL4 6.1 cells
(murine thymoma subclone) expressing 1800 mu4-1BB surface
ligands/cell were incubated with 0.1 nM .sup.125I-mu4-1BB/Fc
(1.times.10.sup.15 cpm/mmole) and serially diluted, unlabeled human
or murine 4-1BB/Fc in a total volume of 150 .mu.l binding media for
2 hours at 4.degree. C. Duplicate aliquots were microfuged through
a phthalate oil mixture in 400 .mu.l plastic rubes (essentially as
described in Smith et al., Cell 73:1349, 1993) to separate bound
and free 4-1BB/Fc. The rubes were cur, and top (free) and bottom
(bound) 4-1BB/Fc counted. Nonspecific binding was determined by
inclusion of a 200-fold molar excess of unlabeled mu4-1BB/Fc.
[0156] Unlabeled mu4-1BB/Fc completely inhibited
.sup.125I-mu4-1BB/Fc binding to native surface mu4-1BB-L. Unlabeled
hu4-1BB/Fc, however, showed no detectable competition with
.sup.125I-mu4-1BB/Fc for binding to native murine ligand.
[0157] Cross-species binding was also assessed qualitatively with
the sensitive slide autoradiography assay. Consistent with the
inhibition studies, hu4-1BB/Fc did not bind recombinant mu4-1BB-L
expressed on the surface of CV-1 cells, and no binding of
mu4-1BB/Fc to CV-1 cells expressing hu4-1BB-L was detected. Thus,
there appears to be no significant ligand/receptor cross-reactivity
between human and mouse species.
EXAMPLE 11
Expression of Human 4-1BB-L mRNA
[0158] Northern blot analysis demonstrated the presence of multiple
size classes of hu4-1BB-L mRNA transcripts. 4-1BB-L message was
absent in resting PL-1 cells, but was present within 30 minutes
after stimulation with immobilized anti-CD3 mAb, peaking at
approximately one hour after stimulation. A hybridoma designated
OKT3 that produces an anti-CD3 monoclonal antibody is available
from ATCC under the designation CRL 8001.
[0159] Transcripts were also observed in a variety of other human
cell lines such as the EBV-transformed human B cell line MP-1, the
monocytic cell line THP-1, the Mo-7E megakaryocytic cell line and
the neuroblastoma SK-N-SH. Human 4-1BB-L transcripts were absent in
RNA isolated from the AIL cell line KG-1. A Northern blot of RNAs
from various human tissues (Clonetech, Palo Alto, Calif.) was also
probed, which demonstrated the expression of 4-1BB-L transcripts in
brain, placenta, lung, skeletal muscle and kidney. Transcripts were
either not present, or present in very low amounts in heart, liver
and pancreas.
EXAMPLE 12
Expression of Endogenous Human 4-1BB
[0160] A monoclonal antibody reactive with human 4-1BB was
generated using the soluble human 4-1BB/Fc fusion protein of
example 3 to immunize BALB/cJ mice, and screening for reactivity
with hu4-1BB/Fc but not human IgG1 by ELISA. This monoclonal
antibody (IgG1 isotype) was employed to analyze the expression of
hu4-1BB on a variety of primary human cells and cell lines.
Northern blot analysis was also conducted. Human 4-1BB protein or
message (detected by the antibody or the blot, respectively) was
detected for activated primary T-cells, the alloreactive CD4.sup.+
T-cell clone PL-1, EBV transformed B cell lines, the pro-monocytic
cell line U937, and resting and activated peripheral blood
monocytes.
EXAMPLE 13
Effect of 4-1BB-L on T-Cell Proliferation
(a) Peripheral Blood T-Cells
[0161] The ability of human 4-1BB-L to costimulate T-cell
proliferation was assessed in a 3 day tritiated
thymidine-incorporation assay. The assay procedure was generally as
described by Goodwin et al. (Cell 73:447, 1993). Briefly, human
peripheral blood T-cells were isolated and cultured with a
titration of fixed CV-1/EBNA cells transfected with either empty
vector or an expression vector containing DNA encoding full length
hu4-1BB-L, in the presence of suboptimal PHA (0.1%) as a
costimulus. After 3 days, cultures were pulsed with [.sup.3H]
thymidine and incorporated radioactivity was assessed 6 hours
later.
[0162] The results are shown in FIG. 4. The open circles represent
the CV-1/EBNA cells transfected with the empty expression vector,
and closed circles represent the CV-1/EBNA cells transfected with
the hu4-1BB-L-encoding expression vector.
[0163] The CV-1/EBNA cells expressing recombinant hu4-1BB-L
markedly enhanced T-cell proliferation induced by sub-optimal PHA,
whereas control CV-1/EBNA cells had no effect. The hu4-1BB-L had no
effect on T-cell proliferation in the absence of a costimulus.
[0164] Another thymidine incorporation assay was conducted as
described above, except that 10.sup.4 CV-1/EBNA cells were
employed, rather than a titration. Additional controls included
soluble hu4-1BB/Fc plus the cells expressing hu4-1BB-L; and a
soluble human p80 tumor necrosis factor receptor (TNT-R)/Fc fusion
protein plus the cells expressing hu4-1BB-L. Enhanced T-cell
proliferation was again observed for T-cells cultured with PHA and
cells expressing hu4-1BB-L. This enhancement of T-cell
proliferation was specifically blocked by hu4-1BB/Fc but not by
TNF-R/Fc. (b) T-Cell Clone
[0165] The effect of hu4-1BB-L on a long term cultured T-cell clone
was also analyzed. Chronically activated T-cells, such as long-term
grown T-cell clones (TCC), are induced to undergo programmed cell
death when stimulated with mitogens such as anti-CD3 mAb or PHA in
the absence of antigen-presenting cells (Wesselborg et al., J.
Immunol. 150:4338, 1993). Since TCC express 4-1BB, we assessed the
effect of 4-1BB-L on the growth of the alloreactive CD4.sup.+human
T-cell clone designated PL-1.
[0166] PL-1 cells were cultured for 3 days in the presence or
absence of suboptimal PHA (0.1%) as costimulus and CV-1 cells
transfected with either empty vector (control) or the expression
vector containing DNA encoding full length human 4-1BB-L. Viability
was determined by trypan blue exclusion.
[0167] 4-1BB-L had no effect on PL-1 viability or growth in the
absence of a costimulus. However, in the presence of PHA, addition
of CV-1/EBNA cells expressing 4-1BB-L reduced the viability of PL-1
cells from 57% to 31%. 4-1BB-L thus enhanced activation-induced
cytolysis of the PL-1 cells.
Sequence CWU 1
1
* * * * *