U.S. patent application number 11/099856 was filed with the patent office on 2006-05-25 for epitope identification and modification for reduced allergenic activity in proteins targeted for transgenic expression.
Invention is credited to Daming Chen, Samuel Sai Man Sun.
Application Number | 20060112453 11/099856 |
Document ID | / |
Family ID | 36462366 |
Filed Date | 2006-05-25 |
United States Patent
Application |
20060112453 |
Kind Code |
A1 |
Sun; Samuel Sai Man ; et
al. |
May 25, 2006 |
Epitope identification and modification for reduced allergenic
activity in proteins targeted for transgenic expression
Abstract
Disclosed is a method for identification of key amino acids in
plant proteins critical in generating allergenic activity through
mapping the epitope(s) harboring human IgE binding activity. The
identified epitope (s) are then modified by amino acid substitution
preferably by alanine substitution, for reduced or negative
IgE-binding activity. A plant gene expression system comprising a
DNA construct placed operably under the control of a promoter
sequence that confers seed-specific expression is also disclosed
for the expression of the modified proteins. The Brazil nut 2S
sulfur-rich protein was exemplified. The method disclosed herein is
particularly useful for the production of dietary proteins with
improved nutritional quality and reduced or negative allergenicity
for human and animal consumption through genetic engineering.
Inventors: |
Sun; Samuel Sai Man; (Hong
Kong, CN) ; Chen; Daming; (Hangzhou, CN) |
Correspondence
Address: |
KNOBBE MARTENS OLSON & BEAR LLP
2040 MAIN STREET
FOURTEENTH FLOOR
IRVINE
CA
92614
US
|
Family ID: |
36462366 |
Appl. No.: |
11/099856 |
Filed: |
April 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60559732 |
Apr 6, 2004 |
|
|
|
Current U.S.
Class: |
800/288 ;
424/725; 536/23.6; 800/294 |
Current CPC
Class: |
C12N 15/8242 20130101;
C12N 15/8257 20130101; C12N 15/8251 20130101; C07K 14/415
20130101 |
Class at
Publication: |
800/288 ;
800/294; 536/023.6; 424/725 |
International
Class: |
A01H 1/00 20060101
A01H001/00; C07H 21/04 20060101 C07H021/04; C12N 15/82 20060101
C12N015/82; A61K 36/18 20060101 A61K036/18 |
Claims
1. A modified protein of a methionine- and/or cysteine-rich protein
having at least one epitope binding to human IgE comprising
arginine, wherein in the modified protein, said arginine is
substituted with alanine or a residue thereof, or with methionine
or a residue thereof.
2. The modified protein of claim 1, wherein the epitope further
comprises alanine, which is substituted with methionine or a
residue thereof.
3. The modified protein of claim 1, wherein the methionine- and/or
cysteine-rich protein is a 2S albumin.
4. The modified protein of claim 3, wherein the protein is a
BNMRP.
5. The modified protein of claim 4, wherein the epitope comprises a
fragment of Arg-Cys or Met-Arg, and in the modified protein the
Arg-Cys is substituted with Ala-Ala, and Arg in the Met-Arg is
substituted with Ala or Met.
6. The modified protein of claim 4, wherein the epitope comprises
at least one fragment selected from the group consisting of: RQQ,
CRMYMRQQ (SEQ ID NO:149), PRRGMEPH (SEQ ID NO:150), MDESCRCE (SEQ
ID NO:67), RMMMMRMQQ (SEQ ID NO:151), EMQPRGEQMRRMMR (SEQ ID
NO:152), NIPSRCN (SEQ ID NO:153), and PMRC (SEQ ID NO:154).
7. A nucleic acid sequence encoding a modified protein of claim
1.
8. The nucleic acid sequence of claim 7, wherein the sequence is
SEQ ID NO.133.
9. A transgenic plant and/or a progeny thereof comprising a
modified protein of claim 1.
10. A method for reducing or eliminating human IgE-binding activity
of a protein having at least one epitope binding to the human IgE,
comprising: mapping the epitope using recombining, overlapping
peptides of the protein; identifying amino acids critical to the
human IgE-binding within the epitope; and modifying the amino acids
in the epitope and related domains.
11. The method of claim 10, wherein the epitope comprises arginine
or alanine or a residue thereof, and the modifying comprises:
substituting arginine or a residue thereof in the epitope with
alanine or a residue thereof, or substituting alanine or a residue
thereof with methionine or a residue thereof.
12. The method of claim 11, wherein the protein is a plant
protein.
13. The method of claim 12, wherein the plant is selected from
monocot and dicot.
14. The method of claim 13, wherein the protein is a methionine-
and/or cysteine-rich protein.
15. The method of claim 14, wherein the protein is Brazil nut
methionine-rich protein (BNMRP).
16. A DNA construct comprising a nucleic acid of claim 7 operably
linked to a vector.
17. The DNA construct of claim 16, wherein the nucleic acid
sequence is SEQ ID NO.133.
18. The DNA construct of claim 16, wherein the vector comprises a
seed-specific promoter.
19. A host cell comprising a DNA construct of claim 16.
20. The host cell of claim 19, wherein the host cell is a plant
cell.
21. The host cell of claim 20, wherein the host cell is a monocot
or a dicot.
22. A method for preparing a transgenic plant comprising: a)
constructing a DNA construct comprising a nucleic acid of claim 7
operably linked to a vector; b) transfecting a plant cell with the
construct; and c) producing the transgenic plant from the plant
cell.
23. The method of claim 22, wherein the plant cell is transfected
utilizing an Agrobacterium system.
24. The method of claim 23, wherein the Agrobacterium system is an
Agrobacterium tumefaciens-Ti plasmid system.
25. The method of claim 24, wherein the vector is a binary
vector.
26. The method of claim 25, wherein the vector is a pBI.sub.121
vector.
27. Use of a modified protein of claim 1 in preparing food of an
animal.
Description
CROSS REFERENCE OF RELATED APPLICATIONS
[0001] The present application claims the benefit of U.S.
Provisional Application Ser. No. 60/559,732 filed on Apr. 6, 2004,
entitled the same, which is explicitly incorporated herein by
reference in its entirety.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention is directed to an application of an
inventive systematic strategy for mapping, identification and
thereby modification of identified allergenic epitope(s) in
proteins with significant reduction or total elimination of human
IgE-binding activity for transgenic expression.
[0004] 2. Description of Prior Art
[0005] Plants proteins are the primary source of dietary protein
for human and livestock. Most plant proteins, however, are
nutritionally incomplete, due mainly to their deficient in certain
essential amino acids. Recent advances in plant biotechnology offer
new approaches to enhance the protein quality (Sun S. S. M. and
Larkin B. A., 1992). Altenbach et al. in 1987 first demonstrated
that it was feasible to enhance the methionine content by 30%
through transferring and expressing of the heterologous Brazil nut
methionine-rich protein (BNMRP) gene in tobacco (Conceicao Ada S.
et al., 1994). Subsequently, similar approach and methionine
enhancement had been confirmed and shown in Arabidopsis (Altenbach
S. B. et al., 1989), rapeseed (Altenbach S. B. et al., 1992;
Guerche P. et al., 1990), soybean (Townsend I. A. and Thomas L. A.,
1994) and other plants (Aragao F. J. et al., 1992; Saalbach I. et
al., 1994; Tu H. M. et al., 1998) without negatively affecting
agronomic performance.
[0006] The BNMRP, abundant and water-soluble in the seed of Brazil
nut (Sun S. S. M. et al., 1987), consists of two low molecular
weight polypeptide subunit components, an 8.5-kDa polypeptide and a
3.6-kDa polypeptide, associated through disulfide linkages to form
a 12-kDa protein molecule (Sun S. S. M. et al., 1987). The mature
protein develops from a larger precursor polypeptide of 18 kDa by
multiple stepwise proteolytic cleavages post-translationally (Sun
S. S. M. et al., 1987) and is targeted to the protein storage
vacuoles in seeds through a protein sorting pathway (Saalbach G et
al., 1996). This protein contains 18% methionine as revealed by its
amino acid and cDNA sequences (Altenbach S. B. et al., 1987; Ampe
C. et al., 1986). This finding triggered the idea of using the
BNMRP gene to improve the nutritional quality of some important
crops such as legumes. It is well known that the seed protein of
legumes is nutritionally incomplete, due to its deficiency in
methionine, one of the essential amino acids of human and
livestock. By traditional plant breeding approach, improvement of
the nutritional quality of legume seeds has not been significant
(Payne P. I., 1983), presumably due to the lack of methionine-rich
protein genes in legume germplasms.
[0007] Unfortunately, during the development of this potential
improved product, the BNMRP was identified as a major allergen of
the Brazil nut, designated Ber e 1, because it could be recognized
by most of the sera from patients allergic to Brazil nut (Arshad S.
H. et al., 1991; Asero R. et al., 2002; Bartolome B. et al., 1997;
Oommen A. et al., 2000; Pastorello E. A. et al., 1998). It was also
demonstrated that a protein extract of transgenic soybeans
containing the BNMRP had allergenic activities using
radioallergosorbent testing, immunoblotting and skin prick testing
(Nordlee J. A. et al., 1996). The potential risk of anaphylaxis
hampers the use of native BNMRP for protein quality enhancement in
transgenic crops, and further efforts in developing and marketing
the methionine-enriched transgenic soybean was halted.
[0008] The reason why some particular proteins can cause allergic
reactions is not well understood. However, it is well-established
that the key step to a specific allergic reaction is the binding of
at least two IgE antibody molecules to a multivalent allergenic
protein. Binding of the allergen-IgE complex to high affinity IgE
receptors on most cells and basophils results in activation of most
cells and release of mediators responsible for triggering marked
allergic inflammatory responses. Thus, identification and
characterization of allergen-specific IgE-binding epitopes known to
be either linear or conformational appears to be of crucial
importance for the molecular approach to reduce or remove the
allergenicity of the BNMRP and a better understanding of the
allergenic nature of proteins. Most of the IgE epitopes are
supposed to be discontinuous, and are very important for the
allergenicity of allergens due to the tertiary structure of
proteins. However, our knowledge of structural characteristics of
conformational IgE binding sites is very limited (Baerga-Ortiz A.,
2002; Bredehorst R. and David K., 2001; Bufe A., 2001; Gonzalez E.
M. et al., 2002; Karisola P. et al., 2002; Sen M. et al., 2002). In
recent years, through the application of synthetic, overlapping
peptides representing the entire primary sequence of a given
allergenic protein, multiple distinct linear epitopes have been
identified for a variety of allergens including those from cow's
milk (Busse P. J. et al., 2002; Chatchatee P. et al., 2001;
Chatchatee P. et al., 2001; Jarvinen K. M. et al., 2001), soybean
(Helm R. M. et al., 2000; Helm R. M. et al., 2000; Xiang P., 2002),
shrimp (Ayuso R. et al., 2002; Reese G et al., 1999; Shanti K. N.
et al., 1993), peanut (Burks A. W. et al., 1997; Rabjohn P. et al.,
1999; Stanley J. S. et al., 1997; Xiang P. et al., 2002), walnut
(Robotham J. M. et al., 2002), pollens (Costa M. A. et al., 2000;
Hemmens V. J. et al., 1989; Sakaguchi M. et al., 2001; Schramm G.
et al., 2001; Soman K. V. et al., 2000; Suphioglu C. et al., 2001)
and other sources (Banerjee B. et al., 2000; Beezhold D. H. et al.,
2001; Hemmens V. J. et al., 1989; Kahlert H. et al., 1992;
Menendez-Arias L. et al., 1990; Mine Y. and Wei Zhang J., 2002;
Monsalve R. I. et al., 1993). There are increasing lines of
evidence that linear epitopes play a crucial role as IgE binding
sites (Bannon G. A. et al., 2001; Beehold D. H. et al., 2001; Helm
R. M. et al., 2000). Much effort had been made to identify epitopes
on a variety of allergens including those from foods and other
sources, and multiple distinct linear IgE recognition sites were
elucidated (Ayuso R. et al., 2002; Banerjee B. et al. 2000;
Beezhold D. H. et al., 2001; Burks A. W. et al., 1997; Busse P. J.
et al., 2002; Chatchatee P. et al., 2001; Chatchatee P. et al.,
2001; Costa M. A. et al., 2000; Helm R. M. et al., 2000; Helm R. M.
et al., 2000; Hemmens V. J. et al., 1989; Jarvinen K. M. et al.,
2001; Kahlert H. et al., 1992; Menendez-Arias L. et al., 1990; Mine
Y. and Wei Zhang J., 2002; Monsalve R. I. et al., 1993; Rabjohn P.
et al., 1999; Reese G. et al., 1999; Robotham J. M. et al., 2002;
Sakaguchi M. et al., 2001; Schramm G et al., 2001; Shanti K. N. et
al., Soman K. V et al., 2000; Stanley J. S. et al., 1997; Suphioglu
C. et al., 2001; Xiang P. et al., 2002). The major methods in IgE
epitope mapping are based on synthetic, overlapping peptides and
recombinant peptide libraries (Reese G. et al., 2001), which are
subsequently immunoreacted with human IgE to localize the binding
sites. For the BNMRP, the 2S albumin from Brazil nut, however,
nothing is known about the structural characteristics of both
linear and conformational IgE epitopes so far.
SUMMARY OF THE INVENTION
[0009] In the invention, the target proteins can be of diverse
origins. They may possess biological or pharmaceutical functions
and can be applied for human and livestock consumption. Taking
advantage of an exceptionally high content (18%) of methionine and
an allergenic nature, the Brazil nut methionine-rich protein
(BNMRP) was adopted as an example target protein for the production
of a sulfur-rich protein with a reduced or negative allergenic
activity.
[0010] The invention is to provide a systematic method for
obtaining a fine IgE epitope mapping of a target protein using the
inventive merged strategy of recombinant, overlapping peptides to
thereby identify amino acids important for IgE binding within the
epitope.
[0011] Accordingly, a first aspect of the invention is to provide a
modified methionine- and/or cysteine-rich protein having at least
one epitope binding to human IgE comprising arginine, in which in
the modified protein, the arginine is substituted with alanine or a
residue thereof, or with methionine or a residue thereof, so that
the modified protein has a reduced or negative allergenic
activity.
[0012] A second aspect of the invention is to provide a nucleic
acid sequence encoding a modified protein defined herein.
[0013] According to a third aspect of the invention, there is
provided a transgenic plant and/or progeny thereof comprising a
modified protein defined herein.
[0014] According to a fourth aspect of the invention, there is
provided a method for reducing or eliminating human IgE-binding
activity of a protein, the protein having at least one epitope
binding to human IgE comprising arginine or alanine, the method
comprising: [0015] identifying the epitope of the protein; and
[0016] replacing arginine in the epitope with alanine or a residue
thereof, or replacing alanine with methionine or a residue
thereof.
[0017] According to a sixth aspect of the invention, there is
provided a host cell comprising a DNA construct defined herein.
[0018] According to a seventh aspect of the invention, there is
provided a method for constructing a transgenic plant comprising:
[0019] a) constructing a DNA construct comprising a nucleic acid
defined herein operably linked to a vector; [0020] b) transfecting
a plant cell with the construct; and [0021] c) producing the
transgenic plant from the plant cell.
[0022] An eighth aspect of the invention is directed to use of a
modified protein defined herein in preparing food for animal
consumption.
[0023] The IgE-binding activity, i.e. the allergenic activity of
the modified protein according to the invention and a plant protein
produced by the method of the invention can be significantly
reduced or eliminated. Therefore, the target protein of the
invention can be applied for human and livestock consumption.
[0024] Other aspects and features of the invention will be
described in detail with reference to the drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 shows an analysis of IgG and IgE binding with
different regions of the 2S methionine-rich allergen (BNMRP) from
brazil nut, in which A: Schematic diagram of the fragments of the
12-kDa precursor of the BNMRP as generated by PCR; B: The
constructs used to produce the recombinant fusion proteins; C:
Expression and immunodetection of the deletion fragments; Lane M,
protein markers; Lanes 1-8, samples of polypeptide fragments
P1-110, P34-110, P34-85, P60-110, P34-59, P60-85, P86-110 and P1-28
(panel A) respectively; and Lane C, a control.
[0026] FIG. 2 shows an epitope mapping of BNMRP using N-terminal
deletion method, in which amino acid sequences of the deletions are
shown at the left and immunodetection results are shown in the
right.
[0027] FIG. 3a shows IgE epitope mapping of the BNMRP by using
overlapping, recombinant peptides using Set A shorter
fragments.
[0028] FIG. 3b shows determination of the length of the longest and
strongest epitope (L4) in BNMRP using Set B longer fragments.
[0029] FIG. 4 shows comparison of the epitopes identified by
deletion and overlapping peptide approaches.
[0030] FIG. 5 shows that IgE binding ability of the epitopes of
BNMRP can be reduced or removed by mutation, the native and mutated
peptides are produced as fusion proteins in E. coli and separated
on tricine SDS-PAGE and visulized by Coomassie blue staining (A),
or immunodetection with the pooled human serum of Brazil nut
allergic patients (B).
[0031] FIG. 6 shows nucleotide and amino acid sequences of the
native and modified BNMRP, in which the specific mutations are
highlighted by grayscale background.
[0032] FIG. 7 shows expression of the native and modified BNMRP in
E. coli, in which Lane M represents protein markers, and rBNMRP and
rmBNMRP are the fusion proteins containing the native and modified
BNMRP, respectively.
[0033] FIG. 8 shows a comparison of IgE binding activity between
the native and modified BNMRP, I: Schematic diagram of the fusion
proteins, II: Immunodetection of the native (rBNMRP) and modified
(rmBNMRP) BNMRP.
[0034] FIG. 9 shows constructs for transforming Arabidopsis,
tobacco and soybean, bnmrp, coding for native BNMRP; mbnmrp, coding
for modified BNMRP; mc6, coding for modified BNMRP with 6.sup.th
cysteine restored; mc7, coding for modified BNMRP with 7.sup.th
cysteine restored; mc8, coding for modified BNMRP with 8.sup.th
cysteine restored; and mc678, coding for modified BNMRP with all
cysteine residues restored.
[0035] FIG. 10 summarizes all the constructs transformed into
tobacco.
[0036] FIG. 11 shows the regeneration of tobacco after
transformation, in which (a): the regenerated tobacco shoots are
placed in rooting medium for root regeneration; and (b) the
regenerated plants carrying the target genes were planted in
greenhouse for immature and mature seeds.
[0037] FIG. 12 shows Northern blot of transgenic tobacco
plants.
[0038] FIG. 13 shows Western detection of MBNMRP and its variants,
in which (a) and (b): anti-MBNMRP antibodies ware used to detect
the expression of transgenic seeds, and (c): anti-LRP antibodies
are used.
[0039] FIG. 14 shows simulated gastric digestion of transgenic
proteins, (a): native BNMRP protein from Brazil nut, (b):
MBNMRP-WBLRP protein.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention provides a modified protein (target
protein) and a plant gene expression system which comprises a DNA
construct placed operably under the control of a promoter sequence
that confers a seed-specific expression. The DNA construct
contemplated herein encodes one or more modified proteins and their
derivatives which can significantly reduce or negative human
IgE-binding activity.
[0041] The target protein that can be used in the invention
includes those methionine- and/or cysteine-rich proteins, such as a
protein of the 2S family of albumin proteins in Brazil nut. Such a
modified protein may be used for safer human and livestock
consumption and for immunotherapy of brazil-nut allergy by reducing
its anaphylactic side effects.
[0042] The 2S albumins are storage proteins present in diverse
species. Despite high variability in amino acid sequences, the 2S
albumins share a similar structure that is heterodimeric and
consisting of a large subunit and a small subunit synthesized as a
single precursor polypeptide. All the 2S albumins are compact
globular proteins with conserved cysteine residues, which are
responsible for the disulfur bonds linking the small and the large
polypeptides and forming the whole protein. The 2S proteins are
abundant in seeds of the plant, providing reserved amino acids
during the seed germination and seedling growth.
[0043] However, many 2S albumins have been identified as major
allergens. The potential to introduce new allergenic proteins into
food through plant genetic engineering is of a great concern to
public. This issue was first highlighted by our previous study with
a 2S methionine-rich protein from Brazil nut (BNMRP). Many other
proteins with biological activities, which could have
biotechnological applications to improve food quality or to confer
improved agronomic performance or resistance to the plant, are also
known allergens.
[0044] Therefore, carefulness must be taken in choosing safe
proteins to use in plant biotechnology, and systems to assess the
allergenic potential of foods derived from genetically engineered
crop plants have to be in place and enforced to ensure that the
potential allergenic proteins are identified before entering the
food chain. An attractive alternative is to modify or to design and
generate non-allergenic proteins with similar structures and
biological properties by genetic engineering for plant
improvement.
[0045] In this invention, the inventors have adopted the BNMRP as
an example for the elucidation and characterization of the IgE
epitopes on the target protein and hence, provide significant
understanding of the allergenic nature of the 2S allergens. The
inventors have successfully demonstrated that it is feasible to
modify a protein to be one having a reduced allergenic activity or
no longer triggering allergy reactions. This opens up a new
approach to enhance the quality of legume proteins without
allergenicity, through transferring and expressing the modified
methionine-rich and/or cystine-rich protein gene(s) for animal feed
or human consumption, and restores the public confidence in
genetically modified products.
[0046] The overall strategy of this invention includes: [0047] 1)
mapping an epitope of the target protein; [0048] 2) identifying
amino acids critical to a human IgE binding within the epitope;
[0049] 3) modifying the epitope and/or related domains to reduce or
negative the IgE binding; [0050] 4) establishing a plant gene
expression system with a recombinant protein from the target
protein for the accumulation of the target protein with reduced
allergenicity; and [0051] 5) confirming the expressed recombinant
protein having a reduced or negative allergenic activity.
[0052] It is well known that the interaction between an allergen
and immune system at the molecular level plays a crucial role in
the etiology of allergy. The present invention provides a
systematic strategy to identify IgE-binding epitopes on an allergen
so that the nature of allergenicity of the allergen can be
elucidated.
[0053] The inventors have developed a new strategy to identify
epitopes on a target proteins by recombinant, overlapping peptides,
which merges the advantages of the two existing methods described
in the prior art. The recombinant, overlapping peptides, like
synthetic, overlapping peptides, ensure a systematic coverage of
the entire allergen sequence, whereas it is not possible to ensure
the entire allergen sequence is represented in the peptide library.
The peptide length of the recombinant, overlapping peptides in the
current strategy is not limited to 15 residues as in the case of
the SPOTs system, so that it may allow the identification of at
least some conformational epitopes. It is also easier to produce
and purify the recombinant peptides in large amounts for multiple
immunodetections simply by growing and inducing more E. coli cells
containing the recombinant peptide constructs. Since the
recombinant peptides may be fused to trxA at the C-terminus, it is
efficient to generate point mutations on the recombinant IgE
binding epitopes by PCR, for side-by-side comparison between an
unmodified epitope and a mutated epitope. Through this systematic
approach, the inventors have identified at least 8 IgE epitopes on
one of target proteins, BNMRP, for example, which subsequently
allowed the reduction and removal of the IgE binding ability of the
methionine-rich allergen by site-directed mutagenesis (described
below).
Construction of Recombinant Gene Fragments of Target Proteins
[0054] Gene-specific primers for amplifying the target fragments
are first designed with restriction enzyme sites for cloning into
an expression vector.
[0055] Various combinations of primers are applied for amplifying
the fragment encoding different gene fragments of the target
protein. After sequenced, the PCR products are cloned in an
expression vector through the restrictive enzyme sites designed in
the primers such as cloned into a pET-30a(+) vector (Novagen) to
create different constructs which can express different fusion
proteins such as Histag::BNMRPs::trxA::fliC. A protein without a
fragment for target protein is also amplified as a control.
Construction of N-Terminal Deletions of Target Proteins
[0056] The clones containing the above cloned fragments are used as
templates for producing deletions of the target protein. To
generate N-terminal deletions, a series of overlapping primers,
offset nine nucleotides encoding 3 amino acids of the target
protein are designed. Deletions with a progressive 3-amino acid
truncation are generated by PCR with template plasmids. The PCR
products are subsequently cloned into a expression vector to form
deletion fusion proteins such as Histag::deletions::trxA::fliC.
Construction of Overlapping, Recombinant Peptides
[0057] For generating overlapping, recombinant peptides, each 3'
primer is designed with a stop codon to truncate the 3' region of
the deletion. The recombinant peptides are constructed by PCR using
the combinations of the 3' primers and a promoter primer in the
vector (Promega). The amplified fragments are then subcloned into
an expression vector, producing small overlapping peptides fused to
the C-terminal of a tag.
[0058] The recombinant constructs can be expressed in a host cell
such as E. col. and the recombinant proteins can be purified
according to the tags in the fusion proteins. Alternatively, the
recombinant proteins can be detected using the method of SDS-PAGE
with Coomassie brilliant blue staining or immunoblotting as an
example.
Epitope Mapping of Target Proteins
[0059] Recombinant proteins containing N-terminal serially deleted
proteins, or overlapping peptides of a target protein can be
purified and immuno-detected with an anti-polyclonal antibody, or
human serum from patients allergic to the target protein. At least
8 linear epitopes have been identified in the BNMRP, one of the
preferred embodiments of the invention. An epitope with the
strongest IgE reactivity can be consequently mapped.
[0060] To define the precise position and sequences of epitopes
recognized by IgE human serum, the inventors further generates a
series of overlapping recombinant peptides covering the entire
length of the target protein where IgE binding is observed
previously by the deletion approach. In one preferred embodiment,
each peptide is 7-8 amino acids in length and progressively
offsetting from the previous peptide by 3 amino acids. This
approach allows a systematic analysis of the primary sequence of
the entire target protein to determine the exact amino acid
sequences of the IgE binding regions. For example, as shown in FIG.
3, eight epitopes, designated S0 and S1 on a small subunit and
L1-L6 on a large subunit of BNMRP, have been identified in this
manner.
Identification of Key Amino Acids Critical to IgE Binding within
Identified Epitopes
[0061] Amino acid substitution analysis of the epitopes shows that
mutation of key amino acids to alanine could significantly reduce
or eliminate IgE binding. A series of mutants are generated for the
identified epitopes by oligonucleotide-mediated mutagenesis using
PCR. In each mutant, a selected single amino acid in the native
epitope is substituted with an alanine or a residue thereof. If the
native amino acid is an alanine, it is replaced by a methionine.
This approach allows elucidation of amino acids required in ligand
binding within each epitope, since systematic substitution of amino
acids with alanine eliminates side chains binding to antibody.
[0062] Using the clones containing the native epitopes as
templates, PCR is carried out by combination of the vector promoter
primer such as a T7 primer and a primer designed to introduce the
mutation. Then the PCR products are ligated with a backbone of
expression vectors, forming a fusion protein containing the mutated
epitope.
[0063] The recombinant peptides are probed with an allergic
patient's serum to determine the effect of a single amino acid
change on the target protein-specific IgE binding. When alanine is
substituted for a wild-type amino acid at the position of Arg, the
mutated peptide is not recognized by the human serum, or a decrease
in binding is observed in the embodiment of the invention.
Therefore the mutant position could be identified as a key amino
acid critical to IgE binding within the identified epitope.
[0064] In the work leading to the present invention, the inventors
have demonstrated that arginine or a residue thereof is crucial for
IgE binding with the epitope on the target protein such as BNMRP,
since all identified epitopes on this molecule contain arginine
residues and point mutations of this amino acid within each IgE
epitope to alanine result in, without exception, a dramatic
decrease or a loss in antibody binding. This positively charged
amino acid is the second abundant amino acid (14.85%) in the BNMRP
and spreads over the whole protein molecule. The change of the
arginine residues by mutation may alter the surface charge as well
as the conformational structure of the epitopes or the whole
protein molecule, consequently leading to a reduction or a loss in
its IgE binding with IgE. This is the first report that a conserved
amino acid (Arg) in the epitopes of a food allergen involves in IgE
binding.
[0065] It is also worth to note that a common structure Arg-Cys,
and amino acid sequence Met-Arg harbor IgE binding ability. The
sequence similarities suggest the presence of a cross-reacting IgEs
capable of recognizing both epitopes on the same protein. This
helps to explain the potent nature of the methionine-rich allergen,
as in the case of Hev b 5 where in the IgE epitopes 5.7 and 5.8,
both having the sequence EKPAE, are cross-reactive (Beezhold D. H.
et al., 2001). Although common structural characteristics of linear
IgE epitopes are limited so far, the situation may change when more
epitope mapping results come in.
Modifications of Epitopes and Related Domains for Reduced Target
Protein Specific IgE Binding
[0066] The present invention encompasses a systematic method for
the generation of a derivative of the target protein with a greatly
reduced IgE reactivity by point mutation of the identified linear
epitopes.
[0067] Proteins that can be used in the invention include those
rich in methionine and/or cysteine, such as the 2S family of
proteins including a protein from Brazil nut, amongst others. Such
a modified protein may be used for a safer human and livestock
consumption and for immunotherapy.
[0068] Through the application of this systematic approach, the
present invention demonstrates that the IgE binding ability of the
epitopes can be reduced or removed by mutation of the arginine
rather than the methionine in the epitopes, providing the
possibility that a modified target protein with reduced IgE binding
ability can be generated by mutations without decreasing its
methionine content.
Generation of Gene Constructs Encoding Foreign Target Protein with
Reduced Allergenicity for Plant Expression
[0069] The present invention further encompasses a plant gene
expression system comprising a DNA construct placed operably under
the control of a promoter sequence that confer seed-specific
expression. The DNA construct contemplated herein encodes one or
more subunits of a sulfur rich-2S seeds storage protein with
significantly reduced IgE-binding activity through modifications,
more preferably, alanine substitution of the identified
epitopes.
[0070] The identified epitopes of proteins are modified by
site-directed mutagenesis using PCR to generate a specific point
mutation for alanine. The PCR products containing the mutations are
linked together through the restrictive enzyme site to generate
constructs containing a nucleic acid sequence encoding the
mutations in epitopes using a similar strategy as described above.
Alternatively, some successive overlap extension PCR reactions can
be carried out to introduce further specific point mutations in the
epitopes. The constructs containing a nucleic acid sequence
encoding at least one mutation are introduced into competent host
cells for further plant application.
[0071] In one embodiment, through the application of the inventive
strategy for oligonucleotide-directed mutagenesis, the inventors
have generated a recombinant BNMRP clone with mutated epitopes as
an example. The inventors chose amino acids in the epitopes that,
when changed, resulted in the greatest reduction in IgE binding.
Most of the selected amino acids are mutated to alanine. However,
in an illustrating engineering, some arginines encoded by the codon
AGG in the cDNA are mutated to methionine. Thus, the methionine
content of the modified BNMRP is simultaneously increased after
mutation.
[0072] The relative extent of IgE binding to the altered sequence
can be analyzed by SDS-PAGE and probe hybridization with allergic
patients' serum against target protein and assessed by densitometry
scanning and compared with that of the native one.
[0073] The present invention also extends to further engineered
variants, including modified proteins with cysteine residues
restored, and a lysine-rich protein (e.g. WBLRP) fusion, that are
constructed and transformed into target plants for expression such
as tobacco for seed-specific expressions.
[0074] Different types of plant species, including monocots and
dicots, and various transformation techniques can be adopted for
the present invention. However, it is preferred to use a plant that
can be transformed with high transformation efficiency. Expression
vectors containing the target protein expression cassettes can be
introduced into plants according to known techniques such as
Agrobacterium-mediated plant transformation, vacuum infiltration,
gene transfer into pollen or calli or protoplast transformation
(Bechtold N., et. al., 1993; Fisher D. K. and Guiltinan M. J.,
1995). An ordinary skilled person in the art can make use of
different strains of bacteria and transformation methods for the
transformation of different host plants according to known
techniques.
[0075] Plant regeneration is well known in the art. Transformants
screened for desirable gene products are used for regeneration. The
regenerated shoots (leaf-disc technique) or green plants (vacuum
infiltration) are transferred in soil and grown in a green house
for further expression analysis.
[0076] One of the objectives involves the application of a plant
seed-specific phaseolin promoter and terminator region to the
transgenes, which confines the transgenic expression only in the
plant seeds. Another characteristic of this method involves the
inclusion of an NPT II and a GUS gene, both driven by a 35S
promoter and an NOS terminator. These two genes enable selection of
positive transformants during the regeneration of new transgenic
plants from calli, and further screening of possible transformants
after the regeneration of plant leaves. In one preferred
embodiment, all the components are put together into a pBI121
vector, which is an Agrobacterium tumefaciens-Ti plasmid system.
The inventors has successfully provided in an example a method to
make constructs for the transgenic plant seed-specific expression
of different variations of MBNMRP. The modified proteins that can
be expressed in transgenic plant seeds using this method include
the various modified target proteins.
[0077] In one example, the inventors have used tobacco (Nicotiana
tabacum) as the transformation host, since it is well established
as a plant model system, and can be easily transformed via
Agrobacterium-mediated method.
[0078] To investigate whether the transgenes integration and
expression of recombinant proteins with reduced negative allergenic
activity in plants are present in the regenerated tobacco plants,
genomic PCR screening, Northern blot analysis for the RNA expressed
in the transgenic plants, Western blot analysis for the proteins
produced by the engineered variants for example, are performed in
the invention. As a result, a plant expressing foreign target
protein with reduced allergenicity has been confirmed.
[0079] To test if the allergenic activities of these transgenic
proteins are hampered, a simulated gastric digestion method is
introduced as an example. The inventors have found that MBNMRP in
one example showed a significant decrease in thermo-stability than
BNMRP, which may reflect a decrease allergenic potential produced
by the method of the invention.
[0080] The invention is further described with the following
examples.
EXAMPLE 1
Construction of N-Terminal Deletions of BNMRP and Overlapping,
Recombinant Peptides
Construction of Recombinant BNMRP Fragments
[0081] pHS-3 (Accession Number M17146, ARCO Plant Cell Research
Institute, CA, USA), a plasmid containing a cDNA encoding the BNMRP
(Altenbach S. B. et al., 1987), was used as a template for PCR
cloning of recombinant BNMRP fragments. Gene-specific primers which
were shown in Table 1, were designed with restriction enzyme sites
for cloning into a pET-30a(+) expression vector (Novagen).
TABLE-US-00001 TABLE 1 Primers Used for Fragmentation of BNMRP
Posi- Primers Sequences (5'-3') tions* BNLa5
GCCAGATCTCCCAGGCGGGGAATG 262-276 BNLa3 CGGACCTCGAGCTTCGCATCTGCAGCT
325-339 BNLb5 GCCAGATCTGGCTTAAGGATGATG 340-354 BNLb3
CGGACCTCGAGCCCTCATCATCCTTCG 403-417 BNLc5 GCCAGATCTCTGGCCGAGAATATC
418-432 BNLc3 CGGACCTCGAGCGAACCCGGCAATGGA 478-492 BNS5
GCCAGATCACAGGAGGAGTGTCGC 163-177 BNS3 CGGACCTCGAGCGCTCTCCTCCATCTG
232-246 Control 1-5 CAGACCATGGCTCGAGGTCCGTGC -- Control 1-3
CCGGGAATTCAAACAGCCCTGCGTTATA -- *The position refers to the
location of nucleotides in cDNA clone pHS-3 (accession number
M17146)
[0082] Restriction enzyme site Bgl II was introduced in the 5'
primers and Xho I in the 3' primers. Combination of primers BNS5
and BNLc3 was used to amplify the cDNA fragment encoding a 12 kDa
precursor (163-492 bp, referring -to the nucleotides of the cDNA
clone pHS-3), which contains both a 3-kDa small subunit (163-246
bp) and a 9-kDa large subunit (262-492 bp) linked by the internal
processed fragment (247-261 bp). Combination of primers BNS5 and
BNS3 was for amplifying the fragment encoding the small subunit of
BN2S, and BNLa5 and BNLc3 for the large subunit. The cDNA region
coding the large subunit was further fragmented into 3 smaller
regions, 262-339 bp, 340-417 bp and 418-492 bp, by PCR using primer
combinations BNLa5/BNLa3, BNLb5/BNLb3 and BNLc5/BNLc3,
respectively. Two overlapping fragments covering the cDNA of the
large subunit, 262-417 bp and 340-492 bp, were also generated using
primer combinations BNLa5/BNLb3 and BNLb5/BNLc3, respectively. PCR
was performed using a 10 ng DNA template in a 50 .mu.l reaction
mixture containing 0.2 .mu.M all the primers, 200 .mu.M dNTPs and 1
unit Taq DNA polymerase (Promega) in 10 mM TrisHCl, pH8.3, 2 mM
MgCl.sub.2, 50 mM KCl, 0.1 mg/mL gelatin for 30 cycles:
denaturation for 20 sec at 94.degree. C., annealing for 20 secs at
50.degree. C. and extension for 40 sec at 72.degree. C. PCR
products were first cloned in a pGEM-T vector (Promega) and
confirmed by sequencing on ABI 3100 using a T7 promoter sequencing
primer (Promega), then released with Bgl II and Xho I double
digestion and cloned into a pFliTrx vector (Invitrogen) between Bgl
II and Xho I sites. The BNMRP::trxA::fliC configurations in the
resulting recombinant plasmids were released by Bgl II and EcoR I
double digestion, and ligated with a BamH I/EcoR I backbone
fragment of a pET-30a(+) vector (Novagen) to create 8 constructs,
designated as p1-110, p34-110, p34-85, p60-110, p34-59, p60-85,
p86-110 and p1-28, forming fusion proteins
Histag::BNMRPs::trxA::fliC.
[0083] To produce the control protein, a fragment containing
trxA::fliC was amplified from the pFliTrx vector using primers
Control 1-5 and Control 1-3 (Table 2), and inserted into the
pET-30a(+) vector between the Nco I and EcoR I sites. The resulting
construct, named pControl 1, was used to produce the fusion protein
Histag::trxA::fliC as a control protein. TABLE-US-00002 TABLE 2
Primers Used for Construction of N-Terminal Deletions and
Overlapping, Recombinant Peptides of BNMRP Posi- Primers Sequences
(5'-3') tions* BNa51 AAGGCCATGGCTGGAATGGAGCCGCACATG 271-288 BNa52
AAGGCCATGGCTCCGCACATGAGCGAGTGC 280-297 BNa53
AAGGCCATGGCTAGCGAGTGCTGCGAGCAG 289-306 BNa54
AAGGCCATGGCTTGCGAGCAGCTGGAGGGG 298-315 BNa55
AAGGCCATGGCTCTGGAGGGGATGGACGAG 307-324 BNa56
AAGGCCATGGCTATGGACGAGAGCTGCAGA 316-333 BNa57
AAGGCCATGGCTAGCTGCAGATGCGAA 325-339 BNb51
AAGGCCATGGCTATGATGATGATGAGGATG 349-366 BNb52
AAGGCCATGGCTATGAGGATGCAACAGGAG 358-375 BNb53
AAGGCCATGGCTCAACAGGAGGAGATGCAA 367-384 BNb54
AAGGCCATGGCTGAGATGCAACCCCGAGGG 376-393 BNb55
AAGGCCATGGCTCCCCGAGGGGAGCAGATG 385-402 BNb56
AAGGCCATGGCTGAGCAGATGCGAAGGATG 394-411 BNb57
AAGGCCATGGCTCGAAGGATGATGAGG 403-417 BNc51
AAGGCCATGGCTAATATCCCTTCCCGCTGC 427-444 BNc52
AAGGCCATGGCTTCCCGCTGCAACCTCAGT 436-453 BNc53
AAGGCCATGGCTAACCTCAGTCCCATGAGA 445-462 BNc54
AAGGCCATGGCTCCCATGAGATGCCCCATG 454-471 BNc55
AAGGCCATGGCTTGCCCCATGGGTGGCTCC 463-480 BNc56
AAGGCCATGGCTGGTGGCTCCATTGCCGGG 472-489 BNs51
AAGGCCATGGCTCTCAGCCACTGCCGGATG 202-219 BNs52
AAGGCCATGGCTTGCCGGATGTACATGAGA 211-228 BNs53
AAGGCCATGGCTTACATGAGACAGCAGATG 220-237 BNs54
AAGGCCATGGCTCAGCAGATGGAGGAGAGC 229-246 BNs55
AAGGCCATGGCTGAGGAGAGCCCGTACCAG 238-255 BNa31
TTGGAATTCTTATTCGCATCTGCAGCA 325-339 BNa32
TTGGAATTCTTAGCAGCTCTCGTCCAT 316-330 BNa33
TTGGAATTCTTAGTCCATCCCCTCCAG 307-321 BNa34
TTGGAATTCTTACTCCAGCTGCTCGCA 298-312 BNa35
TTGGAATTCTTACTCGCAGCACTCGCT 289-303 BNa36
TTGGAATTCTTACTCGCTCATGTGCGG 280-294 BNa37
TTGGAATTCTTAGTGCGGCTCCATTCC 271-285 BNb31
TTGGAATTCTTACCTCATCATCCTTCG 403-417 BNb32
TTGGAATTCTTACCTTCGCATCTGCTC 394-408 BNb33
TTGGAATTCTTACTGCTCCCCTCGGGG 385-399 BNb34
TTGGAATTCTTATCGGGGTTGCATCTC 376-390 BNb35
TTGGAATTCTTACATCTCCTCCTGTTG 367-381 BNb36
TTGGAATTCTTACTGTTGCATCCTCAT 258-372 BNb37
TTGGAATTCTTACCTCATCATCATCAT 349-363 BNb38
TTGGAATTCTTACATCATCCTTAAGCC 340-354 BNc31
TTGGAATTCTTAGAACCCGGCAATGGA 478-492 BNc32
TTGGAATTCTTAAATGGAGCCACCCAT 469-483 BNc33
TTGGAATTCTTAACCCATGGGGCATCT 460-474 BNc34
TTGGAATTCTTAGCATCTCATGGGACT 451-465 BNc35
TTGGAATTCTTAGGGACTGAGGTTGCA 442-456 BNc36
TTGGAATTCTTAGTTGCAGCGGGAAGG 433-447 BNc37
TTGGAATTCTTAGGAAGGGATATTCTC 424-438 BNc38
TTGGAATTCTTAATTCTCGGCCAGCCT 415-429 BNs31
TTGGAATTCTTACATGGTCTGGTACGG 247-261 BNs32
TTGGAATTCTTAGTACGGGCTCTCCTC 238-252 BNs33
TTCGAATTCTTACTCCTCCATCTGCTG 229-243 BNs34
TTGGAATTCTTACTGCTGTCTCATGTA 220-234 BNs35
TTGGAATTCTTACATGTACATCCGGCA 211-225 BNs36
TTGGAATTCTTACCGGCAGTGGCTGAG 202-216 Control 2-3
TTGGAATTCTTAAGCCATGGC -- *The position refers to the location of
nucleotides in cDNA clone pHS-3 (accession number M17146)
Construction of N-Terminal Deletions of BNMRP
[0084] A clone p1-33, containing the small subunit and the internal
processed fragment (FIG. 2, peptide S0), was constructed by the
same approach as p1-28 and used as a template for producing
deletions of the small subunit, and p34-59, p60-85 and p86-110 as
templates for creating deletions of the large subunit. To generate
N-terminal deletions, a series of overlapping primers (Table 2,
BNa51-BNs55), offset nine nucleotides encoding 3 amino acids of the
BNMRP, was designed with a Nco I site at the 5' end. Deletions with
a progressive 3-amino acid truncation were generated by PCR with
combination of the overlapping primers with the primer Control 1-3
(Table 1) binding to the sites around the EcoR I site of the
template plasmids. The PCR products were digested completely or
incompletely as needed with Nco I and EcoR I and cloned into the
pET-30a(+) vector, forming deletion fusion proteins
Histag::deletions::trxA::fliC.
Construction of Overlapping, Recombinant Peptides
[0085] The deletion::trxA::fliC fragments were released from the
deletion constructs by Kpn I and EcoR I double digestion and
inserted into the pET-32a(+) vector (Novagen) between Kpn I and
EcoR I sites, forming the configuration
trxA::Histag::deletions::trxA::fliC, which were used as PCR
templates for generating overlapping, recombinant peptides. For
each template, a 3' primer (Table 2, BNa31-BNs36), in which a stop
codon and an EcoR I site after the stop codon were introduced, was
designed to truncate the 3' region of the deletion. The recombinant
peptides were constructed by PCR using the combinations of the.3'
primers and a T7 promoter primer (Promega). The amplified fragments
were digested by Xba I and EcoR I and ligated with the Xba I/EcoR I
backbone fragment of the pET-32a(+) vector, producing small
overlapping peptides fused to the C-terminal of the trxA::His tag.
To generate the control for the recombinant peptides, the original
Xba I-EcoR I fragment in pET-32a(+) vector was replaced by a Xba I
and EcoR I digested PCR product amplified from pET-32a(+) using the
T7 promoter primer and a primer Control 2-3 (Table 2) introducing a
stop codon after the restriction enzyme Nco I site of the
pET-32a(+) vector, creating pContropl 2, i.e. fusion protein
trxA::Histag.
Expression of Recombinant Peptides in E. coli
[0086] The recombinant constructs were introduced into E. coli
strain BL21 (DE3) for expression. Single colonies containing the
constructs were selected and grown at 37.degree. C. in 3 mL of an
LB medium with appropriate antibiotics. The starting cultures were
used to inoculate 100 mL of the LB medium with appropriate
antibiotics at 37.degree. C. until OD.sub.600 reached 0.4-0.6.
Cells were induced for 3 hours at 37.degree. C. by addition of IPTG
to a final concentration of 1 mM. The induced cells were harvested
by centrifugation at 6,000 rpm for 5 min at 4.degree. C. After
washing once with 20 mM Tris.HCl, pH8.0, the cells were stored at
-70.degree. C. or directly used to purify the induced fusion
proteins.
Purification of Recombinant Proteins
[0087] The induced fusion proteins were purified using Ni-NTA spin
columns (Qiagen) under denaturing conditions. The induced cells
were re-suspended in Buffer B (8M urea, 0.1M NaH.sub.2PO.sub.4,
0.01M TrisHCl, pH8.0) and incubated with shaking for 1 hour at room
temperature. The supernatants were collected after centrifuging the
lysates at 10,000.times.g for 20 min at room temperature to pellet
the cellular debris, and added to the Buffer B pre-equilibrated
Ni-NTA spin columns. The columns with the lysate supernatants were
centrifuged at 700.times.g for 2 min, and then washed twice with
Buffer C (8M urea, 0.1M NaH.sub.2PO.sub.4, 0.01M TrisHCl, pH6.3).
The fusion protein was eluted with 200 .mu.l Buffer E (8M urea,
0.1M NaH.sub.2PO.sub.4, 0.01M TrisHCl, pH4.5). The concentrations
of the purified proteins were detected by BCA method.
Tricine-Sodium Dedocylsulfate-Polyacrylamide Gel Electrophoresis
(SDS-PAGE)
[0088] Protein samples were analyzed by Tricine-SDS-PAGE according
to Schagger and Jagow (Schagger H. and Jagow G. V., 1987). Proteins
were detected by Coomassie brilliant blue staining or
immunoblotting.
[0089] The experimental process of constructions of recombinant
fusion proteins and the results were showed in the FIG. 1, A:
schematic diagram of the fragments of the 12-kDa precursor of the
BNMRP as generated by PCR; B: the constructs used to produce the
recombinant fusion proteins containing the fragments of the BNMRP
(1) and the control protein (2). T7-pro, T7 promoter; T7-ter, T7
terminator; BN2Ss, the fragments of the 12-kDa precursor of BNMRP
(panel A); trxA, E. coli thioredoxin; fliC, E. coli flagellin and
C: expression and immunodetection of the deletion fragments. The
induced E. coli lysate was separated on the tricine-SDS PAGE and
stained with Coomassie blue (I); the purified proteins stained with
Coomassie blue (II); western blot analysis of the purified proteins
with BNMRP-specific rabbit polyclonal antiserum (III) and with
pooled serum from 9 patients allergic to Brazil nut (IV). Lane M,
protein markers; lane 1-8, samples of polypeptide fragments P1-110,
P34-110, P34-85, P60-110, P34-59, P60-85, P86-110 and P1-28 (panel
A) respectively; and Lane C, a control).
EXAMPLE 2
Epitope Mapping of BNMRP
[0090] As shown schematically in FIG. 1, eight overlapping
fragments covering the small and large subunits of the BNMRP were
generated by PCR. To achieve efficient expression, the fragments
were expressed in E. coli as fusion proteins with the E. coli
thioredoxin (trxA) and flagellin (.eta.liC) of a pFlitrx vector.
Expression levels were determined by Coomassie brilliant blue
staining of proteins after separation by tricine SDS-PAGE. The
induced proteins were purified and quantified (FIG. 1c). After
separation by tricine SDS-PAGE, the fusion proteins were blotted
onto nitrocellulose membrane and analyzed for binding with a rabbit
anti-BNMRP serum and a pooled human serum from 9 patients allergic
to Brazil nut. FIG. 1c showed clearly that IgG epitopes were mapped
to the middle and C-terminal parts of the large subunit of BNMRP.
No IgG reactivity was observed in the small subunit and the
N-terminal part of the large subunit. Distribution of IgE epitopes
on BNMRP seems more complex than that of the IgG. Except in the
control protein, all tested fragments spanning the BNMRP molecule
reacted with the pooled human serum. The observation that the small
subunit and the three non-overlapping large subunit fragments all
reacted with the patients' IgE indicates that each of them harbors
at least one linear IgE-binding epitope.
[0091] To obtain information on the epitope position and sequence
in detail, the inventors established four sets of N-terminus
deletions for the small subunit and the three large non-overlapped
fragments of the large subunit as shown schematically in FIG. 2.
The deletions of the large subunit (A0-A6, B0-B6 and C0-C6) and the
small subunit (S0-S5) of BNMRP were generated as fusion proteins in
E. coli, and purified using Ni-NTA spin columns. 1 .mu.g purified
fusion protein per lane was loaded and separated on the tricine
SDS-PAGE. After transferring onto nitrocellulose membrane, the
deletions of the centre and the C-terminal regions of the large
subunit were immunodetected with a BNMRP-specific rabbit polyclonal
antiserum to localize the IgG epitope in the BNMRP (A). All
deletions of BNMRP were immunodetected with the pooled human serum
from 9 patients allergic to Brazil nut (B). Amino acid sequences of
the deletions are shown at the left and immunodetection results are
shown in the right.
[0092] The consecutive deletions were generated by truncating 3
amino acids each time at the N-terminus. For IgG epitope mapping,
western blot analysis of the deletions for the middle and
C-terminal parts of the large subunit by using the rabbit
anti-BNMRP antibody revealed that deletion B6 for the middle
fragment of the large subunit and deletions C3, C4, and C5 for the
C-terminal part of the large subunit were negative with the
antibody, whereas the other deletions for the middle and C-terminal
parts of the large subunit were positive with the rabbit antibody.
This indicates that for rabbit IgG, there are two epitopes in the
large subunit of the BNMRP, one starts with Pro-Arg-Gly in the
middle of the large subunit, and the other begins with Ser-Arg-Cys
in the C-terminal region of the large subunit.
[0093] To map the human IgE epitopes, western blot analysis of the
four BNMRP deletion sets was carried out using the pooled patients'
serum. For the small subunit, although the inventors failed to
generate some of the deletions of the small subunit (FIG. 2), no
difference in the extent of the IgE binding signal between the
small subunit peptide (S0) and its deletions S1, S2 and S3 was
found, indicating that the 13-amino acid region (QEECREQMQRQQM) at
the N-terminus of the small subunit at least does not harbor
relatively strong epitopes. However, a dramatic reduction in human
IgE binding was observed from deletions S1, S2 and S3 to S4 and S5,
suggesting that the three amino acids Glu-Met-Arg are very
important in the binding of IgE to the small subunit, and this
epitope may start with these three amino acids. For the large
subunit, all deletions at the N-terminal region showed positive
reaction and constant binding signal with the human IgE, suggesting
that one IgE epitope is localized on the smallest N-terminal
deletion, MDESCRCE, of the large subunit. For the centre region of
the large subunit, the inventors observed a significant change from
relatively strong to weak in the binding of the progressively
truncated deletions to IgE when the three amino acids Glu-Met-Gln
were removed. This indicates that the position of the epitope on
the centre region of the large subunit may begin with the three
amino acids Glu-Met-Gln. For the C-terminal region of the large
subunit, the inventors found that deletions C1, C2, C3 and C4 gave
relatively strong, while the smallest deletion (GGSIAGF) gave
reduced IgE binding signal with the pooled patients' sera,
indicating that the amino acids (PMRCPM) may be involved in the
binding of the C-terminal fragment of the large subunit to IgE and
thus an epitope containing these six amino acid can be located in
this region. In summary, through immunoblot analysis of the
progressively truncated deletions from the N-terminus of the
polypeptide, the inventors identify the approximate positions of
four epitopes dispersing on the BNMRP molecule.
[0094] To define the precise positions and sequences of epitopes
recognized by IgE in the pooled human serum, the inventors further
generated two series of overlapping recombinant peptides covering
the entire length of the small and large subunit. In set A using
shorter fragments, each recombinant peptide was 7-8 amino acids in
length and progressively offsetting from the previous peptide by 3
amino acids while in set B the peptide length was longer,
comprising 13-16 amino acids. The results from these two sets of
fragments are complementary to each other as set A peptides defines
the position of these epitopes in a higher solution while the set B
peptides aids in identifying longer epitopes which might be
fragmented in set A peptides. All peptides were produced as trxA
fusion protein in the E. coli expression system, as depicted in
FIG. 3. This approach allows systematic analysis of the entire
BNMRP primary sequence to determine the exact amino acid sequences
of the IgE binding regions.
[0095] The overlapping, recombinant peptides method and the results
were showed in FIG. 3a, A: the sequences of the 12-kDa precursor of
the BNMRP and the overlapping peptides; B: the constructs for
expressing overlapping, recombinant peptides and C: Western blot
analysis of the purified overlapping peptides (a) with a pool of
sera from 9 patients allergic to Brazil nut (b).
[0096] As shown in FIG. 3a, eight epitopes, designated S0 and S1 on
the small subunit and L1-L6 on the large subunit, were identified
in set A peptides. For the small subunit, a significant IgE
reactivity was observed with the epitope S1 encompassing three
peptides #6, 7 and 8, wherein amino acids Tyr-Met overlapped. Among
the other six epitopes spreading along the large subunit molecule,
the strongest IgE reactivity was shown by epitope L4 locating
within peptides #24, 25 and 26 as well as L6, locating within
peptides #30, 31 and 32. It is likely that
Pro-Arg-Gly-Glu-Gln-Arg-Arg-Met-Met-Arg is essential for IgE
binding to epitope L4, while Pro-Met-Arg-Cys is essential for IgE
binding to epitope L6. The observation that two epitopes, L3 and
L4, were separately localized in the two methionine-rich regions of
the large subunit caused concerns, in consideration of their
subsequent necessity of amino acid modification.
[0097] As showed in the FIG. 3b, twenty six overlapping,
recombinant 13 to 16-amino acid peptides, offset by 3-amino acids,
were generated by a PCR strategy. The amino acid sequence of the
12-kDa precursor of BNMRP was shown at the top, and the amino acid
sequences of the overlapping, recombinant peptides were shown under
that of the 12-kDa precursor in Panel I. Peptides 2-1 to 2-5 cover
the entire length of the small subunit, while peptides 2-6 to 2-26
cover the large subunit. The peptides were produced in E. coli.
(IV) and immunodetcted (III) as in FIG. 3a. Lanes 2-1 to 2-26 were
samples of the overlapping, recombinant peptides #2-1 to 2-26, as
shown in panel I, respectively. IgE binding reactivity of the
recombinant peptides was determined by densitometry and shown in
Panel II.
[0098] The inventors then fine tuned the epitope mapping by using
set B peptides (FIG. 3b). This fine tuning, while confirming the
findings of set A peptides, led to higher binding activity of the
recombinant peptides encompassing the eight identified epitopes to
IgE. And epitope L4
(Glu-Met-Gln-Pro-Arg-Gly-Glu-Gln-Arg-Arg-Met-Met-Arg), the longest
epitope with the strongest binding activity to the pooled human
antisera (FIG. 3b-II), was identified in this refinement.
[0099] The epitope positions obtained by both deletion mapping and
overlapping recombinant peptide strategies were compared in FIG. 4.
The positions of all four epitopes identified by deletion analysis
are in accordance with that identified by overlapping peptide
strategy. FIG. 4 also summarizes the epitopes identified on the
BNMRP molecule. It is worth to note that all regions containing
amino acid sequences Arg-Cys or Met-Arg on the BNMRP molecule
harbor the IgE binding ability.
[0100] At least 8 linear epitopes were thus identified in the BNMRP
(FIGS. 2-4). The epitope with the strongest IgE reactivity was
mapped to the C-terminal region of the large subunit. The
methionine-rich regions in the large subunit were also found to
harbor IgE-binding ability.
EXAMPLE 3
Identification of Key Amino Acids Critical to IgE Binding within
Identified Epitopes
Modification of Epitopes by Alanine Substitution
[0101] Using the clones containing the native epitopes as
templates, PCR was carried out using pfu DNA polymerase by
combination of the T7 promoter primer and a primer designed to
introduce the mutation, as shown in Table 3. After digestion with
Xba I, the PCR product was ligated with the Xba I/EcoR V backbone
of the pET-32a(+) vector, forming the fusion protein containing the
mutated epitope fused to the C-terminal of the trxA::Histag.
[0102] The strong epitopes L6 and S1 and the two methionine-rich
regions associated epitopes L3 and L4 were chosen to identify amino
acids that are important for IgE binding in each of the epitopes.
The native and mutated peptides were produced in E. coli as trxA
fusion proteins. Expression was quantified by Coomassie brilliant
blue staining of proteins after separation by tricine SDS-PAGE. The
recombinant peptides were probed with the pooled Brazil-nut
allergic patients' serum to determine the effect of single amino
acid change on Brazil nut-specific IgE binding. TABLE-US-00003
TABLE 3 Primers Used for Alanine Substitution Analysis of BNMRP
Epitopes Result- ing Primers Sequences (5'-3') Mutants MES1-1
CTTACATGTACATCCGGCATGCGCTGAG H16A MES1-2
CTTACATGTACATCCGTGCGTGGCTGAG C17A MES1-3
CTTACATGTACATTGCGCATTGGCTGA R18A MES1-4 CTTACATGTAAGCCCGGCATTGGCT
M19A MES1-5 CTTACATTGCCATCCGGCATTG Y20A MES1-6
CTTATGCGTACATCCGGCATTG M21A MES2-1
CTTACTCCTCCATCTGCTGTCTCATTGCAGCCAT Y20A MES2-2
CTTACTCCTCCATCTGCTGTCTTGCGTAAGC M21A MES2-3
CTTACTCCTCCATCTGCTGTGCCATGTA R22A MES2-4
CTTACTCCTCCATCTGTGCTCTCATGTA Q23A MES2-5 CTTACTCCTCCATCGCCTGTCTCAT
Q24A MES2-6 CTTACTCCTCAGCCTGCTGTCTCAT M25A MEL3-1
CTTACCTCATCATCATCATCGCTAAGCC R62A MEL3-2
CTTACCTCATCATCATCGCCCTTAAGCC M63A MEL3-3
CTTACCTCATCATCGCCATCCTTAAGCC M64A MEL3-4 CTTACCTCATCGCCATCATCCTTAA
M65A MEL3-5 CTTACCTCGCCATCATCATCCT M66A MEL3-6
CTTACGCCATCATCATCATCCT R67A MEL4-1 CTTACTGTTGCATCCTCATCGCCATCAT
M65A MEL4-2 CTTACTGTTGCATCCTCGCCATCATCAT M66A MEL4-3
CTTACTGTTGCATCGCCATCATCATCAT R67A MEL4-4 CTTACTGTTGCGCCCTCATCATCA
M68A MEL4-5 CTTACTGTGCCATCCTCATCA Q69A MEL5-1
CTTACCTTCGCATCTGCGCCCCTCG E78A MEL5-2 CTTACCTTCGCATCGCCTCCCCTCG
Q79A MEL5-3 CTTACCTTCGCGCCTGCTCCCCTCG M80A MEL5-4
CTTACCTTGCCATCTGCTCCCCTCG R81A MEL5-5 CTTACGCTCGCATCTGCTCCCC R82A
MEL6-1 CTTACTCGGCCAGCCTCATCATCGCTCGAGC R82A MEL6-2
CTTACTCGGCCAGCCTCATCGCCCTTCG M83A MEL6-3
CTTACTCGGCCAGCCTCGCCATCCTTCG M84A MEL6-4
CTTACTCGGCCAGCGCCATCATCCTTCG R85A MEL6-5
CTTACTCGGCCGCCCTCATCATCCTTCG L86A MEL6-6
CTTACTCCATCAGCCTCATCATCCTTCG A87M MEL8-1 CTTAGCATCTCATGGGAGCGAGGTT
S97A MEL8-2 CTTAGCATCTCATGGCACTGAGGTT P98A MEL8-3
CTTAGCATCTAGCGGGACTGAGGTT M99A MEL8-4 CTTAGCATGCCATGGGACTGAGGTT
R100A MEL8-5 CTTAGGCTCTCATGGGACTGAGGTT C101A
[0103] FIG. 5 showed the results of immunoblot strips containing
the wild-type and mutant peptides for epitopes L6 and S1. When
alanine was substituted for the wild-type amino acid at positions
Arg.sup.20, Arg22, Arg100 and Cys101, the mutated peptides were not
recognized by the pooled human serum, or a decrease in binding was
observed. It is interesting to note that an alanine substitution
increased IgE binding at positions Gln24. The remaining epitopes
were analyzed in the same manner. In general, the IgE binding
ability of each epitope could be largely reduced by replacing the
wild-type amino acid residue with alanine. The essential residues
for IgE binding within each tested epitope were shown in Table 4.
In fact, a reduction or loss in IgE binding was observed without
exception in all the mutants when an alanine substitution was made
at a position where the native residue is arginine. An alanine
substitution of the sequence motif Met-Arg and Arg-Cys also led to
a decrease or loss of IgE binding.
[0104] FIG. 4 showed the comparison of the epitopes identified by
deletion and overlapping peptide approaches. The 12-kDa precursor
of BNMRP is schematically represented by transverse bar. The small
(BNs) and the large (BNa,b,c) subunits of the BNMRP are marked with
white and grayscale boxes respectively; both the internal and the
C-terminal processed fragments are marked with black box. The
epitopes identified by deletion (YMRQQ . . . , MDESCRCE, EMQPRG . .
. , PMRCPM) (A) and that by combined results of overlapping peptide
set A and B (S0-S1, L1-6) (B) strategies are represented by
vertical bars with their sequences.
[0105] It was also worth to note that three of the epitopes on the
large subunit, L2, L5 and L6 in the target protein of BNMRP,
contain a common structure Arg-Cys, and all regions around the
amino acid sequence Met-Arg in the BNMRP molecule harbor IgE
binding ability. The sequence similarities suggest the presence of
a cross-reacting IgEs capable of recognizing both epitopes on the
same protein, making BNMRP a multivalent allergen. This helps to
explain the potent nature of the methionine-rich allergen, as in
the case of Hev b 5 where in the IgE epitopes 5.7 and 5.8, both
having the sequence EKPAE, are cross-reactive (Beezhold D. H. et
al., 2001). TABLE-US-00004 TABLE 4 Amino Acids in Epitopes Required
for IgE Binding Epitopes Amino Acid Sequences Positions S1
LSHCRMYMRQQMEE 14-27 L3 GLRMMMMRMQQ 60-70 L4 EMQPRGEQMRRMMRLAE
72-88 L6 NLSPMRC 95-101 The BNMRP IgE epitopes are presented by
single-letter amino acid code. The position of each peptide refers
to the location of amino acids in the 12 kDa precursor of the
BNMRP. The tested amino acids were indicated by bold letters. The
amino acids, when altered, led to a decrease in IgE binding are
underlined.
EXAMPLE 4
Modifications of Epitopes and Related Domains for Reduced Target
Protein Specific IgE Binding
[0106] The identified epitopes of target proteins were modified by
site-directed mutagenesis using PCR to generate specific point
mutation for alanine. Primers used to mutate the cDNA of the BNMRP
were adopted as listed in Table 5. First, the clone pHS-3 was used
as a template for 6 separate PCR reactions. Reaction 1 used a
primer pair MBN1 and BNF3, reaction 2, MBN2 and BNF3; reaction 3,
MBN3 and BNF5; reaction 4, BNF5 and MBN4; reaction 5, BNF3 and MBN6
and reaction 6, BNF5 and MBN7. The PCR products in the reaction
mixtures were separated from the template (pHS-3) by agarose gel
electrophoresis and recovered. The purified PCR products of
reactions 1, 2 and 3 were cloned into a pGEM-T vector to create
pGEM-mS1, pGEM-mL3 and pGEM-mL2, which contain the specific point
mutations in epitopes S1, L3 and L2 of the BNMRP, respectively. The
PCR product of reaction 4 was used as a template for another PCR
reaction using primers BNF5 and MBN5, of which the 15 nucleotides
at the 3' end overlaps with those at 5' end of a primer MBN4. The
resulting PCR product was cloned into a pGEM-T vector to create
pGEM-mL5L6. The two PCR products of reactions 5 and 6 were combined
and used as templates for an overlap extension PCR reaction (Ho S.
N. et al., 1989), using primers BNF3 and BNF5. The PCR product was
cloned into the pGEM-T vector to create pGEM-mS0. The DNA fragments
containing the point mutations in pGEM-mS0 and pGEM-mS1 were
released by double digestions of AlwN I+Sac II, and AlwN I+Apa I,
respectively, and combined and ligated with a pBluescript SK(+)
vector cleaved by Apa I and Sac II, producing pBS-mS0S1. The
inserts in pGEM-mL2 and pGEM-mL3 were first excised by Ase I+Not I
and Ase I+EcoR I digestions, respectively, then combined and
ligated with the EcoR I/Not I backbone fragment of the pBluescript
SK(+) vector to create a pBS-mL2L3. The Ase I site was introduced
between the epitopes L2 and L3 through the primers MBN2 and MBN3,
by changing the codon usage of the glycine 96 of the 18-kDa BNMRP
precursor to facilitate the combination of the mutated IgE epitopes
L2 and L3. The insert in pGEM-mL5L6 was released by Nco I and Sac
II and ligated with the Nco I/Sac II backbone fragment of pBS-mL2L3
to produce pBS-mL5L6. In this construct, a short DNA fragment after
the Nco I site at the 3' end of the BNMRP coding region from
pBS-mL2L3 was added to the 3' end of the insert from pGEM-mL5L6 to
complement the open reading frame of the mutated BNMRP cDNA. The
DNA fragments containing the mutations in pBS-mS0S1 and pBS-mL2L3
were linked together through the Pvu II site to generate
pBS-mS0S1L2L3 using a similar strategy as above. The mutations in
pBS-mL5L6 were integrated into pBS-mS0S1L2L3 through Ava I site,
resulting in pBS-mS0S1L2L3L5L6. Subsequently, two successive
overlap extension PCR reactions were carried out, using two
complementary primers pairs MBN8/MBN9 and MBN10/MBN11, to introduce
specific point mutations in epitopes L1 and L4 of mS0S1L2L3L5L6,
resulting in a final BNMRP mutant (mBNMRP). The mBNMRP was cloned
into a pGEM-T vector to create a pGEM-mBNMRP. The cDNA fragment
encoding the 12 kDa-precursor of the mBNMRP was amplified from
pGEM-mBNMRP using the following primers:
5'-CATGCCATGGCTCAGGAGGAGTGTGCC-3' and
5'-TGGGAATTCTTAGAACCCGGCAATGGA-3'. After digestion by EcoR I and
incomplete digestion by Nco I, the cDNA fragment was ligated with
Nco I/EcoR I backbone fragment of pET-32a(+) to create a
pET-mBNMRP12. Another construct, designated pET-BNMRP12, was
produced as a positive control of pET-mBNMRP12 using a cDNA
fragment coding the 12-kDa precursor of the BNMRP instead of that
of the mBNMRP in pET-mBNMRP12. pControl 2 was served as negative
control. The constructs were introduced into the competent BL21trxB
(DE3) pLysS cells for further plant application. TABLE-US-00005
TABLE 5 Primers Used for Site-Directed Mutagenesis of BNMRP Posi-
Primers Sequences (5'-3') tions* BNF5 TGGGTCTACATGGCGAAGATTTCA
55-69 BNF3 TGGGTATACTCAGAACCCGGCAAT 481-495 MBN1
CTCAGCCACTGCGCGATGGCCATGGCACAGCAG 202-234 MBN2
GGATTAATGATGATGATGATGATGATGGCACAG 340-375 GAG MBN3
CATTAATCCTTCGGCTGCGCAGCTCTC 322-348 MBN4
CATAGGACTGAGGTTGGCGGCGGAAGGGAT 430-459 MBN5
ACCCATGGGGGCTGCCATAGGACTGAGGTT 445-474 MBN6
GAGTGTGCCGAGCAGATGCAGGCACAGCAGATG 169-201 MBN7
CTGCTGTGCCTGCATCTGCTCGGCACACTCCTC 169-201 MBN8
ACCATGCCCGCGGCGGGAATGGAG 256-279 MBN9 CTCCATTCCCGCCGCGGGCATGGT
256-279 MBN10 GAGCAGATGGCAATGATGATGATGCTGGCCGAG 394-426 MBN11
CTCGGCCAGCATCATCATCATTGCCATCTGCTC 394-426 *The position of the
primer binding sites refers to the location of nucleotides in cDNA
clone pHS-3 (accession number M17146)
[0107] FIG. 5 showed that the IgE binding ability of the epitopes
of BNMRP could be reduced or removed by mutation. Epitopes S1 and
L6 were generated with an alanine residue substituted for one of
the amino acids at each position in the peptides by a PCR based
approach. The amino acid sequences of the native (WT) and the
mutated (Y20A, M21A, R22A, Q23A, Q24A and M25A for epitope S1 and
S97A, P98A, R100A and C101A for epitope L6) peptides were shown at
the left, and the mutated residues in the peptides are marked by
bold. The native and mutated peptides were produced as fusion
proteins in E. coli and separated on tricine SDS-PAGE and
visualized by Coomassie blue staining (A), or immunodetection with
the pooled human serum of Brazil nut allergic patients (B).
[0108] FIG. 6 showed the nucleotide and amino acid sequences of the
native and modified BNMRP. Specific point mutation was introduced
by site-directed mutagenesis using PCR. The nucleotide sequences of
the native (BNMRP cDNA) and the modified (mBNMRP cDNA) were
aligned. The amino acid sequence of the native BNMRP (BNMRP pro)
was shown at the top of the cDNA alignment, and the modified BNMRP
(mBNMRP pro) under the cDNA alignment. The specific mutations were
highlighted by grayscale background.
[0109] The inventors had chosen amino acids in the epitopes that,
when changed, resulted in the greatest reduction in IgE binding. As
a result, most of the selected amino acids were mutated to alanine.
However, 4 arginines encoded by the codon AGG in the cDNA were
mutated to methionine. Thus, the methionine content of the modified
BNMRP is simultaneously increased from 18 to 22% after mutation. A
total of 19 amino acids were modified and the changes were
confirmed by sequence analysis. The modified nucleic acid sequence
of BNMRP is identified as SEQ ID NO. 1.
[0110] Through the application of this systematic approach, the
present invention demonstrates that the two methionine-rich regions
in the large subunit of the illustrating protein of BNMRP possess
IgE binding activity and the IgE binding ability of the two
epitopes can be reduced or removed by mutation of the arginine
rather than the methionine in the epitopes, providing the
possibility that a modified target protein with reduced IgE binding
ability can be generated by mutations without decreasing its
methionine content.
[0111] FIG. 7 showed the expression of the native and modified
BNMRP in E. coli. The cDNA fragments encoding the 12-kDa precursor
of the native (BNMRP.sub.--12kD) and the modified
(mBNMRP.sub.--12kD) BNMRP were ligated to the 3' end of the trxA
gene in the pET-32a(+) vector, forming constructs expressing fusion
proteins containing the native and modified BNMRP (A). The fusion
proteins were generated in E. coli and separated on tricine
SDS-PAGE and stained with Coomassie blue (B). Lane M, protein
markers; rBNMRP and rmBNMRP are the fusion proteins containing the
native and modified BNMRP, respectively.
[0112] The study of recombinant 12-kDa precursors of the original
and modified BNMRP expressed in E. coli showed that almost all the
modified protein was accumulated in the insoluble fraction of the
E. coli cells, while, in comparison, a portion of the unmodified
control protein was in the soluble fraction, as shown in FIG. 7,
indicating that the conformational structure of the modified
protein, as produced in E. coli, might be different from that of
the original form.
EXAMPLE 5
Mutations in BNMRP Reducing its Reactivity with IgE as Reveal in
Bacteria Expression
[0113] After modification, a construct pET-mBNMRP12 was generated
for producing the 12-kDa precursor of the modified BNMRP in E. coli
as a trxA fusion protein. The recombinant 12-kDa precursors of the
original and modified BNMRP expressed in E. coli were purified and
separated on tricine-SDS-PAGE and visualized by Coomassie brilliant
blue staining.
[0114] After separating on a tricine SDS-PAGE, The quantified
control and mutant recombinant proteins were electroblotted onto
nitrocellulose membrane and probed with the pooled and pre-absorbed
Brazil nut allergic patients' serum. On the base of a time course
study, the films were found over-developed when the exposure time
exceeded 25 minutes as shown in FIG. 8 Comparison of IgE binding
activity between the native and modified BNMRP. I, Schematic
diagram of the fusion proteins. The 12-kDa precursors of the native
(BNMRP.sub.--12kD) and modified (mBNMRP.sub.--12kD) BNMRP were
fused to the C-terminus of E. coli thioredoxin (trxA) in pET-32a(+)
vector, forming fusion proteins rBNMRP and rmBNMRP, respectively.
The fusion proteins were produced in E. coli and purified using
Ni-TNA spin column. II, Immunodetection of the native (rBNMRP) and
modified (rmBNMRP) BNMRP. One .mu.g of each purified fusion
protein, after separated on tricine-SDS PAGEP, was electroblotted
onto nitrocellulose membrane and visualized by Ponceau S staining
(A). The proteins on the membrane, subsequently, were
immunodetected with a pooled serum from 9 patients allergic to
Brazil nut. A time course of film development was made, and the
films developed in optimal time were presented (B).
[0115] FIG. 8 (I) showed the schematic diagram of the fusion
proteins. The 12-kDa precursors of the native (BNMRP.sub.--12kD)
and modified (mBNMRP.sub.--12kD) BNMRP were fused to the C-terminus
of E. coli thioredoxin (trxA) in pET-32a(+) vector, forming fusion
proteins rBNMRP and rmBNMRP, respectively. The fusion proteins were
produced in E. coli and purified using Ni-TNA spin column. FIG. 8
(II) showed the immunodetection of the native (rBNMRP) and modified
(rmBNMRP) BNMRP. One .mu.g of each purified fusion protein, after
separated on tricine-SDS PAGEP, was electroblotted onto
nitrocellulose membrane and visualized by Ponceau S staining (A).
The proteins on the membrane, subsequently, were immunodetected
with a pooled serum from 9 patients allergic to Brazil nut and
assessed by densitometry scanning and compared with that of the
native one. A time course of film development was made, and the
films developed in optimal time were presented (B). Analysis showed
that the application of the above described modification strategy
in the epitopes of BNMRP resulted in a more than 300-fold reduction
in the IgE binding of the modified BNMRP.
[0116] Through mutating the identified epitope (FIG. 8), the
production of modified BNMRP (mBNMRP) with significantly reduced
IgE-binding activity and increased methionine content was achieved
in this invention.
EXAMPLE 6
Construction of Plant Gene Expression Systems for Accumulation of
Foreign Target Proteins with Reduced Allergenicity
[0117] To achieve a plant expression of the modified BNMRP gene,
the inventors have made use of an Agrobacterium binary vector
pBI121. It consists of a right border (RB) and a left border (LB)
of T-DNA, neomycin phosphotransferase II (NPT II) selectable marker
and .beta.-glucurondiase (GUS) screenable marker genes. RB and LB
were used to transfer the DNA region in between them to the plant
genome. NPT II gene was used to screen the plant transformants in a
culture medium containing kanamycin while GUS gene was used to
confirm the transformants by an enzyme assay.
[0118] The inventors have further extended the objective, by
generating 2 more types of variations of the modified BNMR. The
first set aims at restoring the C96, C130 and/or C137 in the MBNMRP
sequence, by point mutations. The second set is to make use of a
winged bean lysine-rich protein (WBLRP) to stabilize the expression
of MBNMRP in a plant. In attempting to put the 3 sets of modified
BNMRP genes (namely pBI-phas.sub.pro::MBNMRP::Phas.sub.ter,
pBI-phas.sub.pro::MBNMRPMC6/7/8/678::Phas.sub.ter and
pBI-Phas.sub.pro::BNSP::LRP1::MBNMRP::LRP2::Phas.sub.ter) into the
plant for protein expression, the inventors have made use of a
single method to deliver the genes from a pGEM vector to a pBI
vector.
BNMRP/MBNMRP Construct
[0119] Flanked within the pGEM-BNMRP and pGEM-mBNMRP vectors
respectively, the full length BNMRP and mBNMRP genes were released
by Acc I digestion. The fragments were ligated separately to an Acc
I/Acc I backbone fragment of pTZ-Phas-P53, containing the phaseolin
promoter and terminator sequences. The ligated products were
transformed into competent DH5.alpha. cells for subsequent
manipulation. After confirmation by cycle sequencing, the cassetted
genes, namely phas.sub.pro::BNMRP::Phas.sub.ter and
phas.sub.pro::mBNMRP::Phas.sub.ter, were released from the pTZ
backbone by Hind III digestions. The cassettes were ligated into a
Hind III cut pBI121 vector to become
pBI-phas.sub.pro::mBNMRP::Phas.sub.ter. The ligated products were
again transformed into competent DH5.alpha. cells. The copy number
of the cassettes inside pBI121 was tested by an Xba I and Apa I
combined digestion. A Sca I digestion, on the other hand, was used
to test the orientation of the cassettes in the vector. The vectors
that contained a single copy of the target cassette and an
orientation that is the same as the NPT II and GUS genes were
chosen to transform the competent LBA4404 Agrobacterium cells,
using 50 mg/L kanamycin and 25 mg/L streptomycin as the selectable
markers.
Cysteine-Restoration Constructs
[0120] The present invention also extends to further engineered
variants, including mBNMRP with cysteine residues restored, and a
lysine-rich protein (e.g. WBLRP) fusion, that were constructed and
transformed into tobacco for seed-specific expressions, as shown in
FIG. 9 and FIG. 10.
[0121] Four constructs were made to restore the 6.sup.th (C94),
7.sup.th (C130), 8.sup.th (C137), or all disulfide bond-related
cysteines in MBNMRP, aiming at conserving the disulfide bonds as
well as the 3D structure and stability of the protein. These
constructs were namely MBNMRPMC6, BNMRPMC7, MBNMRPMC8 and
MBNMRPMC678, respectively.
[0122] To construct MBNMRPMC6, primer-extension PCR was introduced
to mutate alanine (C94) back to cysteine. In the first step,
pGEM-MBNMRP was used as a template. A 50 .mu.l PCR reaction mixture
containing 2 .mu.g genomic DNA template, 1.times. Taq buffer
(Promega), 0.2 mM dNTP, 0.5 .mu.M BNF5 primer, 0.5 .mu.M M6C primer
(Table 6) and 5 units Taq DNA polymerase (Promega, 2.5 u/.mu.l) was
made to amplify the 5' fragment of MBNMRP gene, and the PCR
conditions were as follows: 94.degree. C. for 5 minutes, then 25
cycles of 94.degree. C. for 30 seconds, 58.degree. C. for 30
seconds and 72.degree. C. for 30 seconds, followed by 1 cycle of
72.degree. C. for 7 minutes. Another PCR using M6N and BNF3 primers
(Table 6) was set up to amplify the 3' fragment. Both fragments
were purified through DNA electrophoresis and gel elution. A second
PCR were used to join the two mutated fragments together, achieved
by the BNF5 and BNF3 primers (Table 6). The C94-restored MBNMRP
gene was cloned into a pGEM vector (Promega) to form pGEM-MBNMRPMC6
for the sequence analysis. The procedures for further cloning the
gene into pTZ and pBI121 vector were similar to that of the MBNMRP
construct.
[0123] For MBNMRPMC7, BNF5 and M7C, plus BNF3 and M7N (Table 6),
were used to mutate A130 to cysteine. The second stage PCR, the
cloning into a pGEM vector to form pGEM-MBNMRPMC7 and further
construction were similar to MBNMRPMC6.
[0124] To make an MBNMRPMC8 gene, a simple PCR was set up instead
of using primer-extension PCR. The primers used were BNF5 and M8C
(Table 6). The product was cloned into a pGEM vector
(pGEM-MBNMRPMC8) for sequencing. Further manipulation was similar
to that of the MBNMRP construct.
[0125] The pGEM-MBNMRPMC8 was used as a template to restore C94,
and the gene was cloned into pGEM to form a pGEM-MBNMRPMC68. After
sequence analysis, the pGEM-MBNMRPMC68 was mutated again to restore
C130. The gene which now carried all 3 restored cysteines was again
cloned into pGEM, forming a pGEM-MBNMRPMC678. After sequencing, the
gene was cut by Acc I and cloned into pTZ. Further cloning steps
were similar to that in the MBNMRP construct. TABLE-US-00006 TABLE
6 Primers Used for Plant Expression of Cysteine-restored MBNMRP
Primers Sequences (5'-3') BNF5 TGGGTCTACATGGCGAAGATTTCA BNF3
TGGGTATACTCAGAACCCGGCAAT M6N AGCTGCGCATGCGAAGGATTA M6C
TAATCCTTCGCATGCGCAGCT M7N CCTTCCGCCTGCAACCTCAGT M7C
ACTGAGGTTGCAGGCGGAAGG M8C TGGGTATACTCAGAACCCGGCAATGG
AGCCACCCATGGGGCAT GCCATAGGACTGAG
WBLRP-Fusion Construct
[0126] In this construct, an MBNMRP gene was ligated inside a
winged bean lysine-rich protein (WBLRP) gene, and the fusion
construct was transformed into plants to produce a BNMRP-WBLRP
fusion protein. WBLRP is a seed protein which can stably express in
plant seeds in an abundant amount. The inventors made use of its
stabilizing effect to enhance the expression MBNMRP.
[0127] The fusion gene was cloned from 2 parts. The first part
included a DNA sequence encoding for the BNMRP signal peptide and
the first 45 amino acids of WBLRP. The second part comprises a
sequence coding for the small and large subunits of BNMRP and the
remaining 116 amino acids of WBLRP. The two parts were joined by an
Xba I site, conferred by the primers LRP1-3Xba and BN5Xba (Table
7), respectively. To clone the two parts, primer-extension PCR
method was used. For the first part, BNF5 and SP-LRP3 primers
(Table 6) were used to amplify the DNA sequence of BNMRP signal
peptide, using pGEM-mBNMRP as a template. The sequence encoding for
the N-terminal part of WBLRP was cloned from WBLRP cDNA by SP-LRP5
and LRP1-3Xba primers (Table 7). Both fragments were gel-purified
and fused together by another PCR using BNF5 and LRP1-3Xba primers.
The product was cloned into a pGEM vector (pGEM-BNSP::LRP1) for
sequencing. The second part also involves amplification of two
fragments. The first fragment was the BNMRP (Q37 to S139),
amplified by BN5-Xba and BNLRP2-3 primers (Table 7). The second
fragment was the LRP C-terminal part, amplified by BNLRP2-5 and
LRP2-3 primers (Table 7). As in the first part, both fragments were
gel-purified and fused together by another PCR using BN5-Xba and
LRP2-3 primers. The product was cloned into a pGEM vector
(pGEM-BNMRP::LRP2) for sequencing.
[0128] The cloned fragments were released from the pGEM vector by
Acc I and Xba I digestions. They were gel-purified and ligated into
a pTZ-Phas backbone to become a
pTZ-Phas.sub.pro::BNSP::LRP1::BNMRP::LRP2::Phas.sub.ter. The whole
cassette was transformed into a pBI121
(pBI-Phas.sub.pro::BNSP::LRP1::MBNMRP::LRP2::Phas.sub.ter) similar
to that of MBNMRP. TABLE-US-00007 TABLE 7 Primers Used for Plant
Expression of WBLRP-fused MBNMRP Primers Sequences (5'-3') BNF5
TGGGTCTACATGGCGAAGATTTCA SP-LRPS GGAGGAGAACATGGGTGTTT SP-LRP3
AAACACCCATGTTCTCCTCC LRP2-3 TGGGTATACTCAATTGTATTCAGGATG BNLRP2-5
TGGGTGGCTCCGGAAATGGTGG BNLRP2-3 CCACCATTTCCGGAGCCACCCA LRP1-3Xba
CTAGTCTAGACTCAACAATTTCAAC BN5Xba CTAGTCTAGACAGGAGGAGTGTGCC
[0129] FIG. 9 showed the constructs for transforming Arabidopsis,
tobacco and soybean: bnmrp, coding for native BNMRP; mbnmrp, coding
for modified BNMRP; mc6, coding for modified BNMRP with 6.sup.th
cysteine restored; mc7, coding for modified BNMRP with 7.sup.th
cysteine restored; mc8, coding for modified BNMRP with 8.sup.th
cysteine restored; mc678, coding for modified BNMRP with all
cysteine residues restored. The restoration of cysteine codons were
achieved by overlapping extension PCR method. All constructs were
ligated into pBI 121 and transformed into the three host
plants.
Tobacco Transformation and Regeneration
[0130] Seeds of wild type tobacco (Nicotiana tabacum L. cv Xanthin.
nc) were sterilized in Clorox solution (Sodium hyprochlorite,
5.25%) for 3 minutes by vortexing and shaking, followed by washing
in 1 ml sterile distilled water for 1 minute 3 times. Then the
sterile seeds were plated on MS medium (4.3 g/L MS salts (Gibco),
1% sucrose, 0.5 g/L MES and 0.8% bacto-agar, pH5.7) in magenta box
and allowed to germinate in growth chamber under conditions of 16
hours light/8 hours dark cycles at 25.degree. C. After one month,
sterile tobacco leaves were cut from the plant and used for tobacco
transformation.
[0131] Tobacco transformation was performed using the method of
Fisher et al. (1995). A single colony of Agrobacterium harboring
the chimeric gene construct was inoculated in 3 ml LB medium (10
g/L Bacto peptone, 10 g/L yeast extract and 5 g/L NaCl) containing
25 mg/L streptomycin and 50 mg/L kanamycin. The culture was
incubated overnight at 28.degree. C. with shaking (300-350 rpm),
until the culture reaching an OD.sub.620>1.0. Then the culture
was spun down and washed with an inoculation medium [4.4 g/L MS
salts (Sigma 5519), 3% sucrose, 1 mg/L BA, 0.1 mg/L IAA and 100
.mu.M As, pH5.7] 3 times. The cell pellet was re-suspended in a 3
ml inoculation medium and was ready for tobacco transformation.
[0132] Young leaves from one-month-old tobacco were cut into small
square discs (0.5.times.0.5 cm.sup.2). Then the discs were immersed
in 10.times. diluted Agrobacterial culture for 10 minutes. The
discs were first transferred to sterile filter paper for excess
Agrobacterium removal and then transferred onto solidified
co-cultivation medium [42.4 g/L MS salt (Sigma 9274), 1 mg/L BA,
0.1 mg/L IAA and 100 .mu.M As, pH 5.7] for 2 days at 25.degree.
C.
[0133] After co-cultivation, the discs were transferred onto a
selection shooting medium [42.4 g/L MS salt (Sigma 9274), 1 mg/L
BA, 0.1 mg/L IAA, 500 mg/L carbenicilin and 100 mg/L kanamycin pH
5.7] and incubated in a growth chamber under a condition of 16
hours light/8 hours dark cycles at 25.degree. C. for callus and
shoot formation. After 2-3 weeks, calli were formed on the discs
and regenerated shoots were grown out after more than 2 weeks. Then
the regenerated shoots were cut off and transferred to a selection
rooting medium [4.3 g/L MS salts (Gibco), 3% sucrose, 0.8% agar,
pH5.7] for rooting. After 3-4 weeks, the regenerated transgenic
tobacco were transferred to soil and grown in a greenhouse for
further expression analysis.
[0134] FIG. 10 showed the summary of all the constructs that had
been transformed into tobacco, in which: [0135] 1.
pBI-phas.sub.pro::BNMRP::Phas.sub.ter [0136] 2.
pBI-phas.sub.pro::MBNMRP::Phas.sub.ter [0137] 3.
pBI-phas.sub.pro::MBNMRPMC6::Phas.sub.ter [0138] 4.
pBI-phas.sub.pro::MBNMRPMC7::Phas.sub.ter [0139] 5.
pBI-phas.sub.pro::MBNMRPMC8::Phas.sub.ter [0140] 6.
pBI-phas.sub.pro::MBNMRPMC678::Phas.sub.ter [0141] 7.
pBI-Phas.sub.pro::BNSP::LRP1::MBNMRP::LRP2::Phas.sub.ter
[0142] FIG. 11 showed the regeneration of tobacco after
transformation, in which (a) the regenerated tobacco shoots were
placed in rooting medium for root regeneration; and (b) the
regenerated plants carrying the target genes were planted in
greenhouse for immature and mature seeds.
[0143] It was found that Calli were formed successfully from the
leaf discs under strict hormonal control. The inventors have also
been able to regenerate new tobacco plants from these transformed
calli and transferred them into soil culture after root formation
(FIG. 9 and FIG. 11).
EXAMPLE 7
Detection and Analysis of Plants for Transgene Integration and
Expression of Recombinant Proteins with Reduced Negative Allergenic
Activity
PCR Screening for Gene Integration
[0144] Genomic DNA was extracted from tobacco leaves using the CTAB
protocol of Doyle et al. (1990). Fresh leaves (.about.100 mg) were
placed in an eppendorf tube and treated with liquid nitrogen. Five
drops of a CTAB extraction buffer [2% CTAB, 100 mM Tris-HCl (pH
8.0), 1.4M NaCl, 20 mM EDTA and 0.2% .beta.-mercaptoethanol] and a
pinch of sterile sand were added into the eppendorf. The leaves
were then ground into homogenate with a glass rod. Five hundred
.mu.l of the CTAB extraction buffer was added to the homogenate,
followed by 60.degree. C. incubation for 30 minutes with periodic
mixing. The plant lysate was then mixed gently with 500 .mu.l of
chloroform: isoamyl alcohol (24:1, v/v) and centrifuged at 13,000
rpm at 4.degree. C. for 5 minutes. The upper aqueous layer was
transferred to a new eppendorf tube and mixed with 330 .mu.l of
cold isopropanol. The mixture was then incubated at -20.degree. C.
for 1 hour and centrifuged at 13,000 rpm at 4.degree. C. for 15
minutes. The supernatant was discarded and the pellet was washed
with 70% ethanol. After centrifugation and removing the ethanol,
the pellet was dried under vacuum for 10 minutes at room
temperature. The dried DNA pellet was re-suspended in 50 .mu.l TE
buffer [10 mM Tris-HCl (pH8.0) and 1 mM EDTA]. The DNA
concentration was determined by OD.sub.260 measurement using a
spectrophotometer.
[0145] A 50 .mu.l PCR reaction mixture containing 2 .mu.g of a
genomic DNA template, 1.times. Taq buffer (Promega), 0.2 mM dNTP,
0.5 .mu.M of a BNF5 primer, 0.5 .mu.M of a BNF3 primer and 5 units
Taq DNA polymerase (Promega, 2.5 .mu.g/.mu.l) was prepared and a
PCR condition was set as follows: 94.degree. C. for 5 minutes, then
25 cycles of 94.degree. C. for 30 seconds, 58.degree. C. for 30
seconds and 72.degree. C. for 30 seconds, followed by 1 cycle of
72.degree. C. for 7 minutes. DNA was checked by gel electrophoresis
in a 1% agarose/TAE (0.04M Tris-acetate and 1 mM EDTA) gel.
Northern Blot Analysis
[0146] Total RNA was extracted from tobacco immature seeds (18-20
days after flowering, DAF) using the method of Altenbach et al.
(1989). Fresh developing seeds (.about.100 mg) were placed in a
mortar and ground into fine powder with a pestle by adding liquid
nitrogen. Then the powder was transferred to an eppendorf tube and
mixed with 0.5 ml of an extraction buffer [0.1M LiCl, 0.1M Tris-HCl
(pH8.0), 0.1M EDTA, 1% SDS and 1:1 (v/v) phenol]. The mixture was
incubated at 55.degree. C. for 15 minutes with periodic mixing and
then mixed with 0.25 ml of chloroform: isoamyl alcohol (24:1, v/v)
by vortexing. The mixture was centrifuged at 14,000 rpm for 5
minutes at room temperature. The upper aqueous layer was
transferred to a new eppendorf tube and mixed with equal volume of
4M LiCl. The mixture was stored at 4.degree. C. overnight and then
centrifuged at 14,000 rpm at 4.degree. C. for 10 minutes. The
supernatant was discarded and the pellet was washed with 2M LiCl.
After centrifugation and removing the supernatant, the pellet was
re-suspended in 0.25 ml DEPC-treated water and then mixed with 25
.mu.l of 3M sodium acetate (pH5.0) and two volumes of 100% ethanol.
The mixture was kept at -20.degree. C. for 1 hour and then
centrifuged at 14,000 rpm at 4.degree. C. for 30 minutes to obtain
the pellet. The pellet was washed with 70% ethanol twice and dried
under vacuum for 10 minutes. The dried RNA pellet was re-suspended
in 30 .mu.l DEPC H.sub.2O. The RNA concentration was determined by
OD.sub.260 measurement using a spectrophotometer.
[0147] For each sample, 8 .mu.g of total RNA was separated by the
formaldehyde denaturing agarose gel (1% agarose, 1.times.MOPS, 3%
formaldehyde) following the protocol as described by Lehrach
(1977). For northern blot analysis, 20.times.SSC buffer was used as
the transfer buffer, and the RNA was blotted from the gel to a
positively charged nylon membrane (Roche) by a vacuum method. The
WBMRP mRNA was detected in the samples by hybridization with the
WBMRP probe (50.degree. C.), and was visualized by using the DIG
Nucleic Acid Detection Kit (Boehringer Mannheim).
[0148] Using northern blot, the inventors successfully detected
transcriptional signals from the transgenic tobacco plants, as
shown in FIG. 12. The size of bands in all constructs were about
600-700 bp, except for the fusion construct MBNMRP-WBLRP, which
showed larger bands.
Western Blot Analysis
[0149] Total seed protein was extracted from 0.05 g of mature
tobacco seeds by grinding the seeds into powder and mixing with 1
ml protein extraction buffer [125 mM Tris-HCl, pH7.5, 7.75% SDS,
10% P-mercaptoethanol]. The homogenate was then centrifuged at
14,000 rpm for 15 minutes. The clear supernatant was transferred to
a new eppendorf tube and saved as seed total protein extract
(STPE).
[0150] STPEs (15 .mu.l) extracted were then separated by 16.5%
tricine-SDS-PAGE (Schagger and Jagow, 1987). They were mixed with
equal volume of 2.times. sample loading buffer (8% SDS, 24%
glycerol, 100 mM Tris-base, 4% .beta.-mercaptoethanol and trace
amount of bromophenol blue) and incubated at 99.degree. C. for 10
minutes. The samples were loaded separated by 16.5%
tricine-SDS-PAGE. Anode buffer (0.2M Tris-base, pH 8.9) and cathode
buffer (0.1M Tris-base, 0.1M Tricine and 0.1% SDS, pH 8.25) were
used in the gel electrophoresis. Then the tricine-gel, was
equilibrated in Towbin transfer buffer (25 mM Tris, 192 mM glycine,
20% methanol) for 10 minutes. A piece of polyvinylidene difluoride
(PVDF) membrane was first treated with 100% methanol for 1 minute
and then equilibrated in Towbin transfer buffer for 15 minutes. The
proteins in the tricine-gel were blotted onto PVDF membrane by
using Trans-blot electrophoretic transfer cell (Bio-Rad). The
transfer cell was filled with Towbin transfer buffer and placed in
an ice-bath. Electro-transfer was performed at 100V for 1 hour.
[0151] After electroblotting, the membrane was subjected to
immunodetection using AURORA Western Blot Chermiluminescent
Detection System (ICN). The membrane was incubated in blocking
buffer (1.times.PBS, 0.2% Aurora.TM. blocking reagent and 0.1%
Tween-20) for 1 hour and then for another hour in blocking buffer
containing 1:5000 anti-MBNMRP polyclonal antibody. Unbound primary
antibody was removed by washing the membrane in a blocking buffer
for 5 minutes (2 times). Then the membrane was incubated in the
blocking buffer with 1:5000 anti-goat IgG secondary
antibody-alkaline phosphatase conjugate for 1 hour. Again the
unbound secondary antibody was removed by washing the membrane in
blocking buffer for 5 minutes (3 times). Then the membrane was
washed in assay buffer [20 mM Tris-HCl (pH9.8), 1 mM MgCl.sub.2]
for 2 minutes (2 times). After adding 1 ml chemiluminescent
substrate solution, the membrane was ready for film exposure and
development.
[0152] The results were showed as in FIG. 13. In (a) and (b),
anti-MBNMRP antibodies were used to detect the expression of
transgenic seeds. Two bands sized from 13-15 kDa were found in each
positive samples. In (c), anti-LRP antibodies were used. The
protein band sizes were about 3-35 kDa. Interestingly, the
inventors detected two bands with size larger than expected, which
may be due to the resistance of the pro-peptides to be modified to
mature proteins, after mutation of the MBNMRP sequences.
Simulated Gastric Digestions
[0153] Protein was extracted from 0.05 g of mature tobacco seeds by
grinding the seeds into powder and mixing with 1 ml of a protein
extraction buffer [100 mM Tris-HCl, pH8.9, 0.3M NaCl, 8M Urea, 2%
CHAPS]. The homogenates were sonicated for 15 mins, and then
centrifuged at 14,000 rpm for 5 minutes. The clear supernatants
were transferred to new eppendorfs tube and saved.
[0154] Porcine pepsin (Sigma) was weighed and dissolved in
simulated gastric fluid (SGF) (0.03M sodium chloride, hydrochloric
acid to pH1.2) to a final concentration of 0.04 .mu.g/.mu.l.
Digestion mixtures were prepared according to those listed in Table
8. The mixtures were shaken at 37.degree. C. and the digestions
were started when pepsin was added. Digestions with different time
courses were performed, and the reactions were stopped by adding a
quenching solution to neutral pH. The same volume (33 .mu.l) of the
sample loading buffer was added to these samples, and tricine-SDS
PAGE was used to separate the proteins. For blotting, PVDF membrane
and Towbin transfer buffer were used. The immuno-detection was
carried out by an AURORA western blot chemiluminescent detection
system (ICN), using WBLRP-specific polyclonal antibodies.
TABLE-US-00008 TABLE 8 Composition of Pepsin Digestion Mixture
Components Amount SGF 20.4 .mu.l Target Protein (1 .mu.g/.mu.l) 6
.mu.l Pepsin (0.04 .mu.g/.mu.l) 6.6 .mu.l Final 33 .mu.l
[0155] The inventors compared the thermo-stability of MBNMRP-WBLRP
with native BNMRP, and the results showed as in FIG. 14: (a) Native
BNMRP protein from Brazil nut and (b) MBNMRP-WBLRP protein. The
protein bands of MBNMRP-LRP were digested within 30 mins, as
detected by anti-LRP antibodies. The results suggested that MBNMRP
showed a significant decrease in thermo-stability than BNMRP, which
may reflect a decrease in allergenic potential.
REFERENCES
[0156] 1. Altenbach S. B., Kuo C. C., Staraci L. C., Pearson K. W.,
Wainwright C., Georgescu A. and Townsend J. Accumulation of a
Brazil nut albumin in seeds of transgenic canola results in
enhanced levels of seed protein methionine. Plant Mol. Biol. 18,
235-245 (1992). [0157] 2. Altenbach S. B., Pearson K. W., Leung F.
W. & Sun S. S. M. Cloning and sequence analysis of a cDNA
encoding a Brazil nut protein exceptionally rich in methionine.
Plant Mol. Biol. 8, 239-250 (1987). [0158] 3. Altenbach S. B.,
Pearson K. W., Meeker G, Staraci L. C. & Sun S. S. M.
Enhancement of the methionine content of seed proteins by the
expression of a chimeric gene encoding a methionine-rich protein in
transgenic plants. Plant Mol. Biol. 13, 513-522 (1989). [0159] 4.
Ampe C., Van Damme J., de Castro L. A., Sampaio M. J., Van Montagu
M. & Vandekerckhove J. The amino-acid sequence of the 2S
sulfur-rich proteins from seeds of Brazil nut (Bertholletia excelsa
H.B.K.). Eur J Biochem. 159, 597-604 (1986). [0160] 5. Aragao F.
J., de Sa M. F., Almeida E. R., Gander E. S. & Rech E. L.
Particle bombardment-mediated transient expression of a Brazil nut
methionine-rich albumin in bean (Phaseolis vulgaris L.). Plant Mol.
Biol. 20, 357-359 (1992). [0161] 6. Arshad S. H., Malmberg E.,
Krapf K. & Hide D. W. Clinical and immunological
characteristics of Brazil nut allergy. Clin Exp Allergy. 21,
373-376 (1991). [0162] 7. Asero R., Mistrello G, Roncarolo D. &
Amato S. Allergy to minor allergens of Brazil nut. Allergy 57,
1080-1081 (2002). [0163] 8. Ayuso R., Lehrer S. B. & Reese G
Identification of continuous, allergenic regions of the major
shrimp allergen Pen a 1 (tropomyosin). Int. Arch. Allergy Immunol.
127, 27-37 (2002). [0164] 9. Banerjee B., Kanitpong K., Fink J. N.,
Zussman M., Sussman G. L., Kelly K. J. & Kurup V P. Unique and
shared IgE epitopes of Hev b 1 and Hev b 3 in latex allergy. Mol.
Immunol. 37, 789-798 (2000). [0165] 10. Baerga-Ortiz A., Hughes C.
A., Mandell J. G. & Komives E. A. Epitope mapping of a
monoclonal antibody against human thrombin by H/D-exchange mass
spectrometry reveals selection of a diverse sequence in a highly
conserved protein. Protein Sci. 11, 1300-1308 (2002). [0166] 11.
Bannon G. A., Cockrell G. Connaughton C., West C. M., Helm R.,
Stanley J. S., King N., Rabjohn P., Sampson H. A. & Burks A. W.
Engineering, characterization and in vitro efficacy of the major
peanut allergens for use in immunotherapy. Int. Arch. Allergy
Immunol. 124, 70-72 (2001). [0167] 12. Bartolome B., Mendez J. D.,
Armentia A., Vallverdu A. & Palacios R. Allergens from Brazil
nut: immunochemical characterization. Allergol. Immunopathol
(Madr). 25, 135-144 (1997). [0168] 13. Bechtold N., Ellis J. &
Pelletier G. In planta Agrobacterium-mediated gene transfer by
infiltration of adult Arabidopsis thaliana plants. C. R. Acad. Sci.
Paris, Life Sci. 316, 1194-1199. [0169] 14. Beezhold D. H., Hickey
V. L. & Sussman G. L. Mutational analysis of the IgE epitopes
in the latex allergen Hev b 5. J. Allergy Clin. Immunol. 107,
1069-1076 (2001). [0170] 15. Bredehorst R. & David K. What
establishes a protein as an allergen? J. Chromatogr. B 756, 33-40
(2001). [0171] 16. Bufe A. Significance of IgE-binding epitopes in
allergic disease. J. Allergy Clin. Immunol. 107, 219-221 (2001).
[0172] 17. Burks A. W., Shin D., Cockrell G. Stanley J. S., Helm R.
M. & Bannon G. A. Mapping and mutational analysis of the
IgE-binding epitopes on Ara h 1, a legume vicilin protein and a
major allergen in peanut hypersensitivity. Eur. J. Biochem. 245,
334-339 (1997). [0173] 18. Busse P. J., Jarvinen K. M., Vila L.,
Beyer K. & Sampson H. A. Identification of sequential
IgE-binding epitopes on bovine alpha(s2)-casein in cow's milk
allergic patients. Int. Arch. Allergy Immunol. 129, 93-96 (2002).
[0174] 19. Chatchatee P., Jarvinen K. M., Bardina L., Beyer K.
& Sampson H. A. Identification of IgE- and IgG-binding epitopes
on alpha(s1)-casein: differences in patients with persistent and
transient cow's milk allergy. J. Allergy Clin. Immunol. 107,
379-383 (2001). [0175] 20. Chatchatee P., Jarvinen K. M., Bardina
L., Vila L., Beyer K. & Sampson H. A. Identification of IgE and
IgG binding epitopes on beta- and kappa-casein in cow's milk
allergic patients. Clin. Exp. Allergy 31, 1256-1262 (2001). [0176]
21. Conceicao Ada S., Van Vliet A., Krebbers E. Unexpectedly higher
expression levels of a chimeric 2S albumin seed protein transgene
from a tandem array construct. Plant Mol. Biol. 26, 1001-1005
(1994). [0177] 22. Costa M. A., Duro G, Izzo V., Colombo P.,
Mirisola M. G., Locorotondo G., Cocchiara R. & Geraci D. The
IgE-binding epitopes of rPar j 2, a major allergen of Parietaria
judaica [0178] pollen, are heterogeneously recognized among
allergic subjects. Allergy 55, 246-250 (2000). [0179] 23. Doyle, J.
D., Doyle, J. J. and Bailey, L. H. 1990. Isolation of plant DNA
from fresh tissue. Focus 12, 12-15 [0180] 24. Fisher D. K. &
Guiltinan M. J. Rapid, efficient production of homozygous
transgenic tobacco plants with Agrobacterium tumefaciens: A
seed-to-seed protocol. Plant Mol. Biol. 13, 278-289 (1995). [0181]
25. Gonzalez E. M., Villalba M., Lombardero M., Aalbers M., van Ree
R. & Rodriguez R. Influence of the 3D-conformation, glycan
component and microheterogeneity on the epitope structure of Ole e
1, the major olive allergen. Use of recombinant isoforms and
specific monoclonal antibodies as immunological tools. Mol.
Immunol. 39, 93-101 (2002). [0182] 26. Guerche P, De Almeida E R,
Schwarztein M A, Gander E, Krebbers E, Pelletier G Expression of
the 2S albumin from Bertholletia excelsa in Brassica napus. Mol Gen
Genet. 221, 306-314 (1990). [0183] 27. Helm R. M., Cockrell G.,
Connaughton C., Sampson H. A., Bannon G. A., Beilinson V, Nielsen
N. C. & Burks A. W. A soybean G2 glycinin allergen. 2. Epitope
mapping and three-dimensional modeling. Int. Arch. Allergy Immunol.
123, 213-219 (2000). [0184] 28. Helm R. M., Cockrell G. Connaughton
C., West C. M., Herman E., Sampson H. A., Bannon GA. & Burks A.
W. Mutational analysis of the IgE-binding epitopes of P34/Gly m Bd
30K. J. Allergy Clin. Immunol. 105, 378-384 (2000). [0185] 29.
Hemmens V. J., Baldo B. A., Underwood P. A., Holen E. & Elsayed
S. Common antigenic and allergenic determinants on codfish proteins
detected with mouse monoclonal IgG and human IgE antibodies. Mol.
Immunol. 26, 477-484 (1989). [0186] 30. Ho S. N., Hunt H. D.,
Horton R. M., Pullen J. K. & Pease L. R. Site-directed
mutagenesis by overlap extension using the polymerase chain
reaction. Gene 77, 51-59 (1989). [0187] 31. Jarvinen K. M.,
Chatchatee P., Bardina L., Beyer K. & Sampson H. A. IgE and IgG
binding epitopes on alpha-lactalbumin and beta-lactoglobulin in
cow's milk allergy. Int. Arch. Allergy Immunol. 126, 111-118
(2001). [0188] 32. Kahlert H., Petersen A., Becker W. M. &
Schlaak M. Epitope analysis of the allergen ovalbumin (Gal d II)
with monoclonal antibodies and patients' IgE. Mol. Immunol. 29,
1191-1201 (1992). [0189] 33. Karisola P., Alenius H., Mikkola J.,
Kalkkinen N., Helin J., Pentikainen O. T., Repo S., Reunala T.,
Turjanmaa K., Johnson M. S., Palosuo T. & Kulomaa M. S. The
major conformational IgE-binding epitopes of hevein (Hev b 6.02)
are identified by a novel chimera-based allergen epitope mapping
strategy. J. Biol. Chem. 277, 22656-22661 (2002). [0190] 34.
Lehrach, H., Diamond, D., Wozney, J. M. and Boedtker, H. RNA
molecular weight determinations by gel electrophoresis under
denaturing conditions, a critical reexamination. Biochemistry 16,
4743 (1977). [0191] 35. Menendez-Arias L., Dominguez J., Moneo I.
& Rodriguez R. Epitope mapping of the major allergen from
yellow mustard seeds, Sin a I. Mol. Immunol. 27, 143-150 (1990).
[0192] 36. Menendez-Arias L., Moneo I., Dominguez J. &
Rodriguez R. Primary structure of the major allergen of yellow
mustard (Sinapis alba L.) seed, Sin a 1. Eur J. Biochem. 177,
159-166 (1988). [0193] 37. Mine Y. & Wei Zhang J.
Identification and fine mapping of IgG and IgE epitopes in
ovomucoid. Biochem. Biophys. Res. Commun. 292, 1070-1074 (2002).
[0194] 38. Monsalve R. I., Gonzalez de la Pena M. A.,
Menendez-Arias L., Lopez-Otin C., Villalba M. & Rodriguez R.
Characterization of a new oriental-mustard (Brassica juncea)
allergen, Bra j IE: detection of an allergenic epitope. Biochem. J.
293, 625-632 (1993). [0195] 39. Nordlee J. A., Taylor S. L.,
Townsend J. A., Thomas L. A. & Bush R. K. Identification of a
Brazil-nut allergen in transgenic soybeans. N. Engl. J. Med. 334,
688-692 (1996). [0196] 40. Oonunen A., Kelly J., Benson A. &
Hefle S. Identification of IgE-binding epitopes of the Brazil nut
2S albumin allergen. J. Allergy Clin. Immunol. 105 suppl., 134
(2000). [0197] 41. Pastorello E. A., Farioli L., Pravettoni V.,
Ispano M., Conti A., Ansaloni R., Rotondo F., Incorvaia C.,
Bengtsson A., Rivolta F., Trambaioli C., Previdi M. & Ortolani
C. Sensitization to the major allergen of Brazil nut is correlated
with the clinical expression of allergy. J. Allergy Clin. Immunol.
102, 1021-1027 (1998). [0198] 42. Payne P. I. Breeding for protein
quantity and protein quality in seed crops. In Seed Proteins (ed.
Daussant J., Mosse J. & Vaughan J.) 223-253 (Academic Press
Inc., London, 1983). [0199] 43. Rabjohn P., Helm E. M., Stanley J.
S., West C. M., Sampson H. A., Burks A. W. & Bannon G. A.
Molecular cloning and epitope analysis of the peanut allergen Ara h
3. J. Clin. Invest. 103, 535-542 (1999). [0200] 44. Reese G., Ayuso
R., Carle T. & Lehrer S. B. IgE-binding epitopes of shrimp
tropomyosin, the major allergen Pen a 1. Int. Arch. Allergy
Immunol. 118, 300-301 (1999). [0201] 45. Reese G., Ayuso R.,
Leong-Kee S. M., Plante M. J. & Lehrer S. B. Characterization
and identification of allergen epitopes: recombinant peptide
libraries and synthetic, overlapping peptides. J. Chromatogr. B
Biomed. Sci. Appl. 756, 157-163 (2001). [0202] 46. Robotham J. M.,
Teuber S. S., Sathe S. K. & Roux K. H. Linear IgE epitope
mapping of the English walnut (Juglans regia) major food allergen,
Jug r 1. J. Allergy Clin. Immunol. 109, 143-149 (2002). [0203] 47.
Saalbach I., Pickardt T., Machemehl F., Saalbach G, Schieder O.
& Muntz K. A chimeric gene encoding the methionine-rich 2S
albumin of the Brazil nut (Bertholletia excelsa H.B.K.) is stably
expressed and inherited in transgenic grain legumes. Mol. Gen.
Genet. 242, 226-236 (1994). [0204] 48. Saalbach G., Rosso M. &
Schumann U. The vacuolar targeting signal of the 2S albumin from
Brazil nut resides at the C terminus and involves the C-terminal
propeptide as an essential element. Plant Physiol. 112, 975-985
(1996). [0205] 49. Sakaguchi M., Masuda K., Toda M., Inouye S.,
Yasueda H., Taniguchi Y., Nagoya T., DeBoer D. J. & Tsujimoto
H. Analysis of the canine IgE-binding epitope on the major allergen
(Cry j 1) of Japanese cedar pollen with anti-Cry j 1 monoclonal
antibodies. Vet. Immunol. Immunopathol. 78, 3543 (2001). [0206] 50.
Schagger H. & Jagow, G. V. Tricine-Sodium Dodecyl
Sulfate-Polyacrylamide Gel Electrophoresis for the separation of
proteins in the range from 1 to 100 kDa. Analytical Biochemistry
166, 368-379 (1987). [0207] 51. Schramm G., Bufe A., Petersen A.,
Haas H., Merget R., Schlaak M. & Becker W. M. Discontinuous
IgE-binding epitopes contain multiple continuous epitope regions:
results of an epitope mapping on recombinant Hol 1 5, a major
allergen from velvet grass pollen. Clin. Exp. Allergy 31, 331-341
(2001). [0208] 52. Sen M., Kopper R., Pons L., Abraham E. C., Burks
A. W. & Bannon G. A. Protein structure plays a critical role in
peanut allergen stability and may determine immunodominant
IgE-binding epitopes. J. Immunol. 169, 882-887 (2002). [0209] 53.
Shanti K. N., Martin B. M., Nagpal S., Metcalfe D. D. & Rao P.
V. Identification of tropomyosin as the major shrimp allergen and
characterization of its IgE-binding epitopes. J. Immunol. 151,
5354-5363 (1993). [0210] 54. Smith A. M. & Chapman M. D.
Reduction in IgE binding to allergen variants generated by
site-directed mutagenesis: contribution of disulfide bonds to the
antigenic structure of the major house dust mite allergen Der p 2.
Mol. Immunol. 33, 399-405 (1996). [0211] 55. Soman K. V.,
Midoro-Horiuti T., Ferreon J. C., Goldblum R. M., Brooks E. G.,
Kurosky A., Braun W. & Schein C H. Homology modeling and
characterization of IgE binding epitopes of mountain cedar allergen
Jun a 3. Biophys. J. 79, 1601-1609 (2000). [0212] 56. Stanley J.
S., King N., Burks A. W., Huang S. K., Sampson H., Cockrell G, Helm
R. M., West C. M. & Bannon G. A. Identification and mutational
analysis of the immunodominant IgE binding epitopes of the major
peanut allergen Ara h 2. Arch. Biochem. Biophys. 342, 244-253
(1997). [0213] 57. Sun S. S. M., Altenbach S. B. & Leung F. W.
Properties, biosynthesis and processing of a sulfur-rich protein in
Brazil nut (Bertholletia excelsa H.B.K.). Eur J Biochem. 162,
477-483 (1987). [0214] 58. Sun S. S. M. & Larkins B. A.
Transgenic plants for improving seed storage proteins. In:
Transgenic Plants, vol. 1., Ed. S. D. Kung and R. Wu. Academic
Press, pp.317-372 (1992). [0215] 59. Sun S. S. M., Leung F. W.
& Tomic J. C. Brazil nut (Bertholletia excelsa H. B. K.)
proteins: fractionation, composition, and identification of a
sulfur-rich protein. J. Agric. Food Chem. 35, 232-235 (1987).
[0216] 60. Suphioglu C., Schappi G, Kenrick J., Levy D., Davies J.
M. & O'Hehir R. E. A novel grass pollen allergen mimotope
identified by phage display peptide library inhibits allergen-human
IgE antibody interaction. FEBS Lett. 502, 46-52 (2001). [0217] 61.
Takai T., Yokota T., Yasue M., Nishiyama C., Yuuki T., Mori A.,
Okudaira H. & Okumura Y. Engineering of the major house dust
mite allergen Der f 2 for allergen-specific immunotherapy. Nat
Biotechnol. 15, 754-758 (1997). [0218] 62. Townsend I. A., Thomas
L. A. Factors which influence the Agrobacterium-mediated
transformation of soybean. J. Cell Biochem. Suppl. 18A, 78.
abstract (1994). [0219] 63. Tu H. M., Godfrey L. W. & Sun S. S.
M. Expression of the Brazil nut methionine-rich protein and mutants
with increased methionine in transgenic potato. Plant Mol. Biol.
37, 829-838 (1998). [0220] 64. Vrtala S., Hirtenlehner K.,
Vangelista L., Pastore A., Eichler H. G., Sperr W. R., Valent P.,
Ebner C., Kraft D. & Valenta R. Conversion of the major birch
pollen allergen, Bet v 1, into two nonanaphylactic T cell
epitope-containing fragments: candidates for a novel form of
specific immunotherapy. J. Clin. Invest. 99, 1673-1681 (1997).
[0221] 65. Xiang P., Beardslee T. A., Zeece M. G., Markwell J.
& Sarath G. Identification and analysis of a conserved
immunoglobulin E-binding epitope in soybean G1a and G2a and peanut
Ara h 3 glycinins. Arch. Biochem. Biophys. 408, 51-57 (2002).
Sequence CWU 1
1
177 1 24 DNA Artificial Sequence BNMRP fragment, position 262-276 1
gccagatctc ccaggcgggg aatg 24 2 27 DNA Artificial Sequence BNMRP
fragment, position 325-339 2 cggacctcga gcttcgcatc tgcagct 27 3 24
DNA Artificial Sequence BNMRP fragment, position 340-354 3
gccagatctg gcttaaggat gatg 24 4 27 DNA Artificial Sequence BNMRP
fragment, position 403-417 4 cggacctcga gccctcatca tccttcg 27 5 24
DNA Artificial Sequence BNMRP fragment, position 418-432 5
gccagatctc tggccgagaa tatc 24 6 27 DNA Artificial Sequence BNMRP
fragment, position 478-492 6 cggacctcga gcgaacccgg caatgga 27 7 24
DNA Artificial Sequence BNMRP fragment, position 163-177 7
gccagatcac aggaggagtg tcgc 24 8 27 DNA Artificial Sequence BNMRP
fragment, position 232-246 8 cggacctcga gcgctctcct ccatctg 27 9 24
DNA Artificial Sequence control primer 9 cagaccatgg ctcgaggtcc gtgc
24 10 28 DNA Artificial Sequence control primer 10 ccgggaattc
aaacagccct gcgttata 28 11 30 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 11 aaggccatgg ctggaatgga
gccgcacatg 30 12 30 DNA Artificial Sequence primer to construct
BNMRP recombinant peptide 12 aaggccatgg ctccgcacat gagcgagtgc 30 13
30 DNA Artificial Sequence primer to construct BNMRP recombinant
peptide 13 aaggccatgg ctagcgagtg ctgcgagcag 30 14 30 DNA Artificial
Sequence primer to construct BNMRP recombinant peptide 14
aaggccatgg cttgcgagca gctggagggg 30 15 30 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 15 aaggccatgg
ctctggaggg gatggacgag 30 16 30 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 16 aaggccatgg ctatggacga
gagctgcaga 30 17 27 DNA Artificial Sequence primer to construct
BNMRP recombinant peptide 17 aaggccatgg ctagctgcag atgcgaa 27 18 30
DNA Artificial Sequence primer to construct BNMRP recombinant
peptide 18 aaggccatgg ctatgatgat gatgaggatg 30 19 30 DNA Artificial
Sequence primer to construct BNMRP recombinant peptide 19
aaggccatgg ctatgaggat gcaacaggag 30 20 30 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 20 aaggccatgg
ctcaacagga ggagatgcaa 30 21 30 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 21 aaggccatgg ctgagatgca
accccgaggg 30 22 30 DNA Artificial Sequence primer to construct
BNMRP recombinant peptide 22 aaggccatgg ctccccgagg ggagcagatg 30 23
30 DNA Artificial Sequence primer to construct BNMRP recombinant
peptide 23 aaggccatgg ctgagcagat gcgaaggatg 30 24 27 DNA Artificial
Sequence primer to construct BNMRP recombinant peptide 24
aaggccatgg ctcgaaggat gatgagg 27 25 30 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 25 aaggccatgg
ctaatatccc ttcccgctgc 30 26 30 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 26 aaggccatgg cttcccgctg
caacctcagt 30 27 30 DNA Artificial Sequence primer to construct
BNMRP recombinant peptide 27 aaggccatgg ctaacctcag tcccatgaga 30 28
30 DNA Artificial Sequence primer to construct BNMRP recombinant
peptide 28 aaggccatgg ctcccatgag atgccccatg 30 29 30 DNA Artificial
Sequence primer to construct BNMRP recombinant peptide 29
aaggccatgg cttgccccat gggtggctcc 30 30 30 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 30 aaggccatgg
ctggtggctc cattgccggg 30 31 30 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 31 aaggccatgg ctctcagcca
ctgccggatg 30 32 30 DNA Artificial Sequence primer to construct
BNMRP recombinant peptide 32 aaggccatgg cttgccggat gtacatgaga 30 33
30 DNA Artificial Sequence primer to construct BNMRP recombinant
peptide 33 aaggccatgg cttacatgag acagcagatg 30 34 30 DNA Artificial
Sequence primer to construct BNMRP recombinant peptide 34
aaggccatgg ctcagcagat ggaggagagc 30 35 30 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 35 aaggccatgg
ctgaggagag cccgtaccag 30 36 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 36 ttggaattct tattcgcatc
tgcagca 27 37 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 37 ttggaattct tagcagctct cgtccat 27 38 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
38 ttggaattct tagtccatcc cctccag 27 39 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 39 ttggaattct
tactccagct gctcgca 27 40 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 40 ttggaattct tactcgcagc
actcgct 27 41 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 41 ttggaattct tactcgctca tgtgcgg 27 42 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
42 ttggaattct tagtgcggct ccattcc 27 43 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 43 ttggaattct
tacctcatca tccttcg 27 44 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 44 ttggaattct taccttcgca
tctgctc 27 45 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 45 ttggaattct tactgctccc ctcgggg 27 46 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
46 ttggaattct tatcggggtt gcatctc 27 47 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 47 ttggaattct
tacatctcct cctgttg 27 48 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 48 ttggaattct tactgttgca
tcctcat 27 49 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 49 ttggaattct tacctcatca tcatcat 27 50 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
50 ttggaattct tacatcatcc ttaagcc 27 51 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 51 ttggaattct
tagaacccgg caatgga 27 52 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 52 ttggaattct taaatggagc
cacccat 27 53 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 53 ttggaattct taacccatgg ggcatct 27 54 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
54 ttggaattct tagcatctca tgggact 27 55 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 55 ttggaattct
tagggactga ggttgca 27 56 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 56 ttggaattct tagttgcagc
gggaagg 27 57 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 57 ttggaattct taggaaggga tattctc 27 58 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
58 ttggaattct taattctcgg ccagcct 27 59 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 59 ttggaattct
tacatggtct ggtacgg 27 60 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 60 ttggaattct tagtacgggc
tctcctc 27 61 27 DNA Artificial Sequence primer to construct BNMRP
recombinant peptide 61 ttggaattct tactcctcca tctgctg 27 62 27 DNA
Artificial Sequence primer to construct BNMRP recombinant peptide
62 ttggaattct tactgctgtc tcatgta 27 63 27 DNA Artificial Sequence
primer to construct BNMRP recombinant peptide 63 ttggaattct
tacatgtaca tccggca 27 64 27 DNA Artificial Sequence primer to
construct BNMRP recombinant peptide 64 ttggaattct taccggcagt
ggctgag 27 65 21 DNA Artificial Sequence control primer 65
ttggaattct taagccatgg c 21 66 13 PRT Artificial Sequence BNMRP
deletion set 66 Gln Glu Glu Cys Arg Glu Gln Met Gln Arg Gln Gln Met
1 5 10 67 8 PRT Artificial Sequence BNMRP deletion set 67 Met Asp
Glu Ser Cys Arg Cys Glu 1 5 68 7 PRT Artificial Sequence BNMRP
deletion set 68 Gly Gly Ser Ile Ala Gly Phe 1 5 69 6 PRT Artificial
Sequence binding domain of the C-terminal fragment of the large
subunit to IgE 69 Pro Met Arg Cys Pro Met 1 5 70 10 PRT Artificial
Sequence IgE binding domain to epitope L4 70 Pro Arg Gly Glu Gln
Arg Arg Met Met Arg 1 5 10 71 4 PRT Artificial Sequence IgE binding
domain to epitope L6 71 Pro Met Arg Cys 1 72 13 PRT Artificial
Sequence L4 epitope 72 Glu Met Gln Pro Arg Gly Glu Gln Arg Arg Met
Met Arg 1 5 10 73 28 DNA Artificial Sequence Primer Used for
Alanine Substitution Analysis of BNMRP Epitopes 73 cttacatgta
catccggcat gcgctgag 28 74 28 DNA Artificial Sequence Primers Used
for Alanine Substitution Analysis of BNMRP Epitopes 74 cttacatgta
catccgtgcg tggctgag 28 75 27 DNA Artificial Sequence Primers Used
for Alanine Substitution Analysis of BNMRP Epitopes 75 cttacatgta
cattgcgcat tggctga 27 76 25 DNA Artificial Sequence Primers Used
for Alanine Substitution Analysis of BNMRP Epitopes 76 cttacatgta
agcccggcat tggct 25 77 22 DNA Artificial Sequence Primers Used for
Alanine Substitution Analysis of BNMRP Epitopes 77 cttacattgc
catccggcat tg 22 78 22 DNA Artificial Sequence Primers Used for
Alanine Substitution Analysis of BNMRP Epitopes 78 cttatgcgta
catccggcat tg 22 79 34 DNA Artificial Sequence Primers Used for
Alanine Substitution Analysis of BNMRP Epitopes 79 cttactcctc
catctgctgt ctcattgcag ccat 34 80 31 DNA Artificial Sequence Primers
Used for Alanine Substitution Analysis of BNMRP Epitopes 80
cttactcctc catctgctgt cttgcgtaag c 31 81 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 81
cttactcctc catctgctgt gccatgta 28 82 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 82
cttactcctc catctgtgct ctcatgta 28 83 25 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 83
cttactcctc catcgcctgt ctcat 25 84 25 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 84
cttactcctc agcctgctgt ctcat 25 85 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 85
cttacctcat catcatcatc gctaagcc 28 86 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 86
cttacctcat catcatcgcc cttaagcc 28 87 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 87
cttacctcat catcgccatc cttaagcc 28 88 25 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 88
cttacctcat cgccatcatc cttaa 25 89 22 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 89
cttacctcgc catcatcatc ct 22 90 22 DNA Artificial Sequence Primers
Used for Alanine Substitution Analysis of BNMRP Epitopes 90
cttacgccat catcatcatc ct 22 91 28 DNA Artificial Sequence Primers
Used for Alanine Substitution Analysis of BNMRP Epitopes 91
cttactgttg catcctcatc gccatcat 28 92 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 92
cttactgttg catcctcgcc atcatcat 28 93 28 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 93
cttactgttg catcgccatc atcatcat 28 94 24 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 94
cttactgttg cgccctcatc atca 24 95 21 DNA Artificial Sequence Primers
Used for Alanine Substitution Analysis of BNMRP Epitopes 95
cttactgtgc catcctcatc a 21 96 25 DNA Artificial Sequence Primers
Used for Alanine Substitution Analysis of BNMRP Epitopes 96
cttaccttcg catctgcgcc cctcg 25 97 25 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 97
cttaccttcg catcgcctcc cctcg 25 98 25 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 98
cttaccttcg cgcctgctcc cctcg 25 99 25 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes 99
cttaccttgc catctgctcc cctcg 25 100 22 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes
100 cttacgctcg catctgctcc cc 22 101 31 DNA Artificial Sequence
Primers Used for Alanine Substitution Analysis of BNMRP Epitopes
101 cttactcggc cagcctcatc atcgctcgag c 31 102 28 DNA Artificial
Sequence Primers Used for Alanine Substitution Analysis of BNMRP
Epitopes 102 cttactcggc cagcctcatc gcccttcg 28 103 28 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 103 cttactcggc cagcctcgcc atccttcg 28 104 28 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 104 cttactcggc cagcgccatc atccttcg 28 105 28 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 105 cttactcggc cgccctcatc atccttcg 28 106 28 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 106 cttactccat cagcctcatc atccttcg 28 107 25 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 107 cttagcatct catgggagcg aggtt 25 108 25 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 108 cttagcatct catggcactg aggtt 25 109 25 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 109 cttagcatct agcgggactg aggtt 25 110 25 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 110 cttagcatgc catgggactg aggtt 25 111 25 DNA
Artificial Sequence Primers Used for Alanine Substitution Analysis
of BNMRP Epitopes 111 cttaggctct catgggactg aggtt 25 112 5 PRT
Artificial Sequence Deletion Epitope of BNMRP 112 Tyr Met Arg Gln
Gln 1 5 113 6 PRT Artificial Sequence Deletion Epitope of BNMRP 113
Glu Met Gln Pro Arg Gly 1 5 114 14 PRT Artificial Sequence Epitopes
for IgE Binding 114 Leu Ser His Cys Arg Met Tyr Met Arg Gln Gln Met
Glu Glu 1 5
10 115 11 PRT Artificial Sequence Epitopes for IgE Binding 115 Gly
Leu Arg Met Met Met Met Arg Met Gln Gln 1 5 10 116 17 PRT
Artificial Sequence Epitopes for IgE Binding 116 Glu Met Gln Pro
Arg Gly Glu Gln Met Arg Arg Met Met Arg Leu Ala 1 5 10 15 Glu 117 7
PRT Artificial Sequence Epitopes for IgE Binding 117 Asn Leu Ser
Pro Met Arg Cys 1 5 118 27 DNA Artificial Sequence primer for
precursor of mBNMRP 118 catgccatgg ctcaggagga gtgtgcc 27 119 27 DNA
Artificial Sequence primer for precursor of mBNMRP 119 tgggaattct
tagaacccgg caatgga 27 120 24 DNA Artificial Sequence primer for
site directed mutagenesis of BNMRP 120 tgggtctaca tggcgaagat ttca
24 121 24 DNA Artificial Sequence primer for site directed
mutagenesis of BNMRP 121 tgggtatact cagaacccgg caat 24 122 33 DNA
Artificial Sequence primer for site directed mutagenesis of BNMRP
122 ctcagccact gcgcgatggc catggcacag cag 33 123 36 DNA Artificial
Sequence primer for site directed mutagenesis of BNMRP 123
ggattaatga tgatgatgat gatgatggca caggag 36 124 27 DNA Artificial
Sequence primer for site directed mutagenesis of BNMRP 124
cattaatcct tcggctgcgc agctctc 27 125 30 DNA Artificial Sequence
primer for site directed mutagenesis of BNMRP 125 cataggactg
aggttggcgg cggaagggat 30 126 30 DNA Artificial Sequence primer for
site directed mutagenesis of BNMRP 126 acccatgggg gctgccatag
gactgaggtt 30 127 33 DNA Artificial Sequence primer for site
directed mutagenesis of BNMRP 127 gagtgtgccg agcagatgca ggcacagcag
atg 33 128 33 DNA Artificial Sequence primer for site directed
mutagenesis of BNMRP 128 ctgctgtgcc tgcatctgct cggcacactc ctc 33
129 24 DNA Artificial Sequence primer for site directed mutagenesis
of BNMRP 129 accatgcccg cggcgggaat ggag 24 130 24 DNA Artificial
Sequence primer for site directed mutagenesis of BNMRP 130
ctccattccc gccgcgggca tggt 24 131 33 DNA Artificial Sequence primer
for site directed mutagenesis of BNMRP 131 gagcagatgg caatgatgat
gatgctggcc gag 33 132 33 DNA Artificial Sequence primer for site
directed mutagenesis of BNMRP 132 ctcggccagc atcatcatca ttgccatctg
ctc 33 133 441 DNA Artificial Sequence modified nucleic acid
sequence of BNMRP 133 atggcgaaga tttcagttgc ggcagcagcc ctccttgtcc
tcatggccct cggccacgcc 60 accgccttcc gggccaccgt caccaccaca
gtggtggagg aggagaacca ggaggagtgt 120 gccgagcaga tgcaggcaca
gcagatgctc agccactgcg cgatggccat ggcacagcag 180 atggaggaga
gcccgtacca gaccatgccc gcggcgggaa tggagccgca catgagcgag 240
tgctgcgagc agctggaggg gatggacgag agctgcgcag ccgaaggatt aatgatgatg
300 atgatgatga tggcacagga ggagatgcaa ccccgagggg agcagatgcc
attgatgatg 360 atgctggccg agaatatccc ttccgccgcc aacctcagtc
ctatggcagc ccccatgggt 420 ggctccattg ccgggttctg a 441 134 24 DNA
Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 134 tgggtctaca tggcgaagat ttca 24 135 24
DNA Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 135 tgggtatact cagaacccgg caat 24 136 21
DNA Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 136 agctgcgcat gcgaaggatt a 21 137 21 DNA
Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 137 taatccttcg catgcgcagc t 21 138 21 DNA
Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 138 ccttccgcct gcaacctcag t 21 139 21 DNA
Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 139 actgaggttg caggcggaag g 21 140 57 DNA
Artificial Sequence Primer Used for Plant Expression of
Cysteine-restored MBNMRP 140 tgggtatact cagaacccgg caatggagcc
acccatgggg catgccatag gactgag 57 141 24 DNA Artificial Sequence
Primer Used for Plant Expression of WBLRP-fused MBNMRP 141
tgggtctaca tggcgaagat ttca 24 142 20 DNA Artificial Sequence Primer
Used for Plant Expression of WBLRP-fused MBNMRP 142 ggaggagaac
atgggtgttt 20 143 20 DNA Artificial Sequence Primer Used for Plant
Expression of WBLRP-fused MBNMRP 143 aaacacccat gttctcctcc 20 144
27 DNA Artificial Sequence Primer Used for Plant Expression of
WBLRP-fused MBNMRP 144 tgggtatact caattgtatt caggatg 27 145 22 DNA
Artificial Sequence Primer Used for Plant Expression of WBLRP-fused
MBNMRP 145 tgggtggctc cggaaatggt gg 22 146 22 DNA Artificial
Sequence Primer Used for Plant Expression of WBLRP-fused MBNMRP 146
ccaccatttc cggagccacc ca 22 147 25 DNA Artificial Sequence Primer
Used for Plant Expression of WBLRP-fused MBNMRP 147 ctagtctaga
ctcaacaatt tcaac 25 148 25 DNA Artificial Sequence Primer Used for
Plant Expression of WBLRP-fused MBNMRP 148 ctagtctaga caggaggagt
gtgcc 25 149 8 PRT Artificial Sequence BNMRP epitope 149 Cys Arg
Met Tyr Met Arg Gln Gln 1 5 150 8 PRT Artificial Sequence BNMRP
epitope 150 Pro Arg Arg Gly Met Glu Pro His 1 5 151 9 PRT
Artificial Sequence BNMRP epitope 151 Arg Met Met Met Met Arg Met
Gln Gln 1 5 152 14 PRT Artificial Sequence BNMRP epitope 152 Glu
Met Gln Pro Arg Gly Glu Gln Met Arg Arg Met Met Arg 1 5 10 153 7
PRT Artificial Sequence BNMRP epitope 153 Asn Ile Pro Ser Arg Cys
Asn 1 5 154 4 PRT Artificial Sequence BNMRP epitope 154 Pro Met Arg
Cys 1 155 26 PRT Artificial Sequence BNMRP epitope 155 Gly Leu Arg
Met Met Met Met Arg Met Gln Gln Glu Glu Met Trp Pro 1 5 10 15 Arg
Gly Glu Trp Met Arg Arg Met Met Arg 20 25 156 25 PRT Artificial
Sequence BNMRP epitope 156 Leu Ala Glu Asn Ile Pro Ser Arg Cys Asn
Leu Ser Pro Arg Met Cys 1 5 10 15 Pro Met Gly Gly Ser Ile Ala Gly
Phe 20 25 157 26 PRT Artificial Sequence BNMRP epitope 157 Pro Arg
Arg Gly Met Glu Pro His Met Ser Glu Cys Cys Glu Gln Leu 1 5 10 15
Glu Gly Met Asp Glu Ser Cys Arg Cys Glu 20 25 158 26 PRT Artificial
Sequence BNMRP epitope 158 Gly Leu Arg Met Met Met Met Arg Met Gln
Gln Glu Glu Met Gln Pro 1 5 10 15 Arg Gly Glu Gln Met Arg Arg Met
Met Arg 20 25 159 25 PRT Artificial Sequence BNMRP epitope 159 Leu
Ala Glu Asn Ile Pro Ser Arg Cys Asn Leu Ser Pro Met Arg Cys 1 5 10
15 Pro Met Gly Gly Ser Ile Ala Gly Phe 20 25 160 33 PRT Artificial
Sequence BNMRP epitope 160 Gln Glu Glu Cys Arg Glu Gln Met Gln Arg
Gln Gln Met Leu Ser His 1 5 10 15 Cys Arg Met Tyr Met Arg Gln Gln
Met Glu Glu Ser Pro Tyr Gln Thr 20 25 30 Met 161 110 PRT Artificial
Sequence BNMRP 12 kD precursor 161 Gln Glu Glu Cys Arg Glu Gln Met
Gln Arg Gln Gln Met Leu Ser His 1 5 10 15 Cys Arg Met Tyr Met Arg
Gln Gln Met Glu Glu Ser Pro Tyr Gln Thr 20 25 30 Met Pro Arg Arg
Gly Met Glu Pro His Met Ser Glu Cys Cys Glu Gln 35 40 45 Leu Glu
Gly Met Asp Glu Ser Cys Arg Cys Glu Gly Leu Arg Met Met 50 55 60
Met Met Arg Met Gln Gln Glu Glu Met Gln Pro Arg Gly Glu Gln Met 65
70 75 80 Arg Arg Met Met Arg Leu Ala Glu Asn Ile Pro Ser Arg Cys
His Leu 85 90 95 Ser Pro Met Arg Cys Pro Met Gly Gly Ser Ile Ala
Gly Phe 100 105 110 162 8 PRT Artificial Sequence BNMRP epitope 162
Tyr Met Arg Gln Gln Met Glu Glu 1 5 163 8 PRT Artificial Sequence
BNMRP epitope 163 Ala Met Arg Gln Gln Met Glu Glu 1 5 164 8 PRT
Artificial Sequence BNMRP epitope 164 Tyr Ala Arg Gln Gln Met Glu
Glu 1 5 165 8 PRT Artificial Sequence BNMRP epitope 165 Tyr Met Ala
Gln Gln Met Glu Glu 1 5 166 8 PRT Artificial Sequence BNMRP epitope
166 Tyr Met Arg Ala Gln Met Glu Glu 1 5 167 8 PRT Artificial
Sequence BNMRP epitope 167 Tyr Met Arg Gln Ala Met Glu Glu 1 5 168
8 PRT Artificial Sequence BNMRP epitope 168 Tyr Met Arg Gln Gln Ala
Glu Glu 1 5 169 7 PRT Artificial Sequence BNMRP epitope 169 Asn Leu
Ser Pro Met Arg Cys 1 5 170 7 PRT Artificial Sequence BNMRP epitope
170 Asn Leu Ala Pro Met Arg Cys 1 5 171 7 PRT Artificial Sequence
BNMRP epitope 171 Asn Leu Ser Ala Met Arg Cys 1 5 172 7 PRT
Artificial Sequence BNMRP epitope 172 Asn Leu Ser Pro Ala Arg Cys 1
5 173 7 PRT Artificial Sequence BNMRP epitope 173 Asn Leu Ser Pro
Met Ala Cys 1 5 174 7 PRT Artificial Sequence BNMRP epitope 174 Asn
Leu Ser Pro Met Arg Ala 1 5 175 146 PRT Brazil nut 175 Met Ala Lys
Ile Ser Val Ala Ala Ala Ala Leu Leu Val Leu Met Ala 1 5 10 15 Leu
Gly His Ala Thr Ala Phe Arg Ala Thr Val Thr Thr Thr Val Val 20 25
30 Glu Glu Glu Asn Gln Glu Glu Cys Arg Glu Gln Met Gln Arg Gln Gln
35 40 45 Met Leu Ser His Cys Arg Met Tyr Met Arg Gln Gln Met Glu
Glu Ser 50 55 60 Pro Tyr Gln Thr Met Pro Arg Arg Gly Met Glu Pro
His Met Ser Glu 65 70 75 80 Cys Cys Glu Gln Leu Glu Gly Met Asp Glu
Ser Cys Arg Cys Glu Gly 85 90 95 Leu Arg Met Met Met Met Arg Met
Gln Gln Glu Glu Met Gln Pro Arg 100 105 110 Gly Glu Gln Met Arg Arg
Met Met Arg Leu Ala Glu Asn Ile Pro Ser 115 120 125 Arg Cys Asn Leu
Ser Pro Met Arg Cys Pro Met Gly Gly Ser Ile Ala 130 135 140 Gly Phe
145 176 441 DNA Brazil nut 176 atggcgaaga tttcagttgc ggcagcagcc
ctccttgtcc tcatggccct cggccacgcc 60 accgccttcc gggccaccgt
caccaccaca gtggtggagg aggagaacca ggaggagtgt 120 cccgagcaga
tgcagacaca gcagatgctc agccactgcc ggattaccat gagacagcag 180
atggaggaga gcccgtacca gaccatgccc aggcggggaa tggagccgca catgagcgag
240 tgctgcgagc agctggaggg gatggacgag agctgcagat gcgaaggatt
aaggatgatg 300 atgatgagga tgcaacagga ggagatgcaa ccccgagggg
agcagatgcg aaggatgatg 360 aggctggccg agaatatccc ttcccgctgc
aacctcagtc ctatgagatg ccccatgggt 420 ggctccattg ccgggttctg a 441
177 146 PRT Artificial Sequence modified BNMRP 177 Met Ala Lys Ile
Ser Val Ala Ala Ala Ala Leu Leu Val Leu Met Ala 1 5 10 15 Leu Gly
His Ala Thr Ala Phe Arg Ala Thr Val Thr Thr Thr Val Val 20 25 30
Glu Glu Glu Asn Gln Glu Glu Cys Ala Glu Gln Met Gln Ala Gln Gln 35
40 45 Met Leu Ser His Cys Ala Met Ala Met Ala Gln Gln Met Glu Glu
Ser 50 55 60 Pro Tyr Gln Thr Met Pro Ala Ala Gly Met Glu Pro His
Met Ser Glu 65 70 75 80 Cys Cys Glu Gln Leu Glu Gly Met Asp Glu Ser
Cys Ala Ala Glu Gly 85 90 95 Leu Met Met Met Met Met Met Met Ala
Gln Glu Glu Met Gln Pro Arg 100 105 110 Gly Glu Gln Met Ala Met Met
Met Met Leu Ala Glu Asn Ile Pro Ser 115 120 125 Ala Ala Asn Leu Ser
Pro Met Ala Ala Pro Met Gly Gly Ser Ile Ala 130 135 140 Gly Phe
145
* * * * *