U.S. patent application number 11/304999 was filed with the patent office on 2006-05-25 for human sdf-5 protein and compositions.
This patent application is currently assigned to Genetics Institute, LLC. Invention is credited to Gary Hattersley, Edward R. LaVallie, Lisa A. Racie.
Application Number | 20060111562 11/304999 |
Document ID | / |
Family ID | 27121699 |
Filed Date | 2006-05-25 |
United States Patent
Application |
20060111562 |
Kind Code |
A1 |
LaVallie; Edward R. ; et
al. |
May 25, 2006 |
Human SDF-5 protein and compositions
Abstract
Purified human SDF-5 proteins and processes for producing them
are disclosed. DNA molecules encoding the human SDF-5 proteins are
also disclosed. The proteins may be used in regulating the binding
of Wnt genes to their receptor. In preferred embodiments, the
proteins may be used for inducing formation, growth,
differentiation, proliferation and/or maintenance of chondrocytes
and/or cartilage tissue, and for other tissue repair, such as
pancreatic tissue repair.
Inventors: |
LaVallie; Edward R.;
(Harvard, MA) ; Racie; Lisa A.; (Acton, MA)
; Hattersley; Gary; (Stow, MA) |
Correspondence
Address: |
NIXON PEABODY LP
401 9TH STREET, N.W.
SUITE 900
WASHINGTON
DC
20004
US
|
Assignee: |
Genetics Institute, LLC
Cambridge
MA
|
Family ID: |
27121699 |
Appl. No.: |
11/304999 |
Filed: |
December 16, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
08949904 |
Oct 15, 1997 |
7026445 |
|
|
11304999 |
Dec 16, 2005 |
|
|
|
08848439 |
May 8, 1997 |
|
|
|
08949904 |
Oct 15, 1997 |
|
|
|
08796153 |
Feb 6, 1997 |
|
|
|
08848439 |
May 8, 1997 |
|
|
|
Current U.S.
Class: |
536/23.5 ;
435/320.1; 435/325; 435/69.1; 530/350 |
Current CPC
Class: |
A61K 38/00 20130101;
A61P 7/02 20180101; A61P 19/08 20180101; A61P 31/04 20180101; A61P
43/00 20180101; A61P 1/18 20180101; A61P 5/06 20180101; A61P 27/02
20180101; A61P 37/06 20180101; A61P 3/10 20180101; A61P 13/12
20180101; A61P 33/00 20180101; A61P 25/24 20180101; A61P 19/04
20180101; A61P 9/00 20180101; A61P 35/00 20180101; A61P 17/02
20180101; A61P 19/02 20180101; C07K 14/52 20130101; A61P 3/02
20180101; A61P 25/02 20180101; A61P 19/00 20180101; A61P 25/14
20180101; A61P 31/10 20180101; A61P 25/28 20180101; A61P 21/04
20180101; A61P 11/00 20180101; A61P 37/08 20180101; A61P 9/10
20180101; A61P 11/06 20180101; A61P 1/00 20180101; A61P 31/00
20180101; A61P 31/12 20180101; A61P 25/16 20180101; A61P 1/04
20180101; A61P 29/00 20180101; A61P 37/02 20180101; A61P 37/04
20180101; A61P 15/16 20180101 |
Class at
Publication: |
536/023.5 ;
530/350; 435/069.1; 435/320.1; 435/325 |
International
Class: |
C07K 14/705 20060101
C07K014/705; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06 |
Claims
1. An isolated or recombinant polynucleotide comprising the
nucleotide sequence from nucleotide #328 to #1140 of SEQ ID NO:
1.
2. The polynucleotide of claim 1, wherein said polynucleotide
comprises a nucleotide sequence selected from the group consisting
of: the nucleic sequence from nucleotide #256 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #307 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #310 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #313 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #316 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #319 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #322 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #325 to #1140 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #256 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #307 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #310 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #313 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #316 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #319 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #322 to #1143 of SEQ ID
NO: 1, the nucleic sequence from nucleotide #325 to #1143 of SEQ ID
NO: 1, and the nucleic sequence from nucleotide #328 to #1143 of
SEQ ID NO: 1.
3. An isolated or recombinant polynucleotide comprising a
nucleotide sequence encoding the amino acid sequence from amino
acid #25 to #295 of SEQ ID NO: 2.
4. The polynucleotide of claim 3, wherein said polynucleotide
comprises a nucleotide sequence encoding an amino acid sequence
selected from the group consisting of: the amino acid sequence from
amino acid #1 to #295 of SEQ ID NO:2, the amino acid sequence from
amino acid #18 to #295 of SEQ ID NO:2, the amino acid sequence from
amino acid #19 to #295 of SEQ ID NO:2, the amino acid sequence from
amino acid #20 to #295 of SEQ ID NO:2, the amino acid sequence from
amino acid #21 to #295 of SEQ ID NO:2, the amino acid sequence from
amino acid #22 to #295 of SEQ ID NO:2, the amino acid sequence from
amino acid #23 to #295 of SEQ ID NO:2, and the amino acid sequence
from amino acid #24 to #295 of SEQ ID NO:2.
5. A vector comprising the polynucleotide of claim 3.
6. A vector comprising the polynucleotide of claim 3 operatively
associated with an expression control sequence.
7. A cell comprising the vector of claim 6.
8. A cell comprising the polynucleotide of claim 3.
9. An isolated or recombinant polynucleotide which is capable of
hybridizing under stringent hybridization conditions to the
polynucleotide of claim 1 and encodes a protein having Frazzled
activity.
Description
RELATED APPLICATIONS
[0001] The present application is a continuation application of
U.S. patent application Ser. No. 08/949,904, filed on Oct. 15,
1997, now pending, which is a continuation-in-part of U.S. patent
application Ser. No. 08/848,439, filed on May 8, 1997, now
abandoned, which is a continuation-in-part of U.S. patent
application Ser. No. 08/796,153, filed on Feb. 6, 1997, now
abandoned. This application incorporates by references the entire
content of U.S. patent application Ser. No. 08/949,904.
[0002] The present invention relates to novel members of the
Frazzled protein family, DNA encoding them, and processes for
obtaining them. These proteins may be used to induce expression of
factors in and/or differentiation of tissue and organs, and
particularly, inducing formation, growth, differentiation,
proliferation and/or maintenance of chondrocytes and/or cartilage
tissue. Thus, these proteins may be useful in the treatment of
cartilage disorders, such as osteoarthritis, rheumatoid arthritis
and articular cartilage defects, and in the enhancement and/or
inhibition of cellular formation, growth, differentiation,
proliferation and/or maintenance of other tissue and organs, for
example pancreatic, liver, spleen, lung, kidney and/or other
tissue. These proteins may also be used for augmenting the activity
of other tissue regenerating and differentiation factors. The
protein has been named human SDF-5 by the inventors.
BACKGROUND OF THE INVENTION
[0003] The search for the molecule or molecules responsible for the
formation, proliferation, differentiation and maintenance of tissue
and organs, such as cartilage and connective tissues, has been
extensive as there is a tremendous need for factors useful for
treating conditions involving degradation or damage to these
tissues, such as osteoarthritis.
[0004] The structures of several proteins in the family designated
as Frizzled, have previously been elucidated. The present invention
relates to a family of proteins designated as Frazzled, which
family shares homology to the ligand binding domain of the Frizzled
proteins. Frizzled protein family members have been shown to bind
to the Wingless (Wg) protein in Drosophila. Bhanot et al., Nature,
382:225-230 (1996). In mammals and other species, the Frizzled
family of proteins are membrane bound receptor molecules which have
been shown to bind to proteins produced by the family of Wnt genes.
Wang et al., J. Biol. Chem., 271:4468-4476 (1996). Wnt genes have
been determined to be expressed in tissue and organs including the
pancreas, lung, liver, kidney, and brain.
SUMMARY OF THE INVENTION
[0005] The inventors herein have surprisingly discovered that
members of the Frazzled protein family are able to induce the
formation of chondrocytes and/or cartilage tissue. Accordingly, the
present invention provides methods for inducing formation of
chondrocyte and/or cartilage tissue comprising administering to
progenitor cells a composition comprising at least one protein
which is a member of the Frazzled protein family. In preferred
embodiments, the composition may comprise a protein having the
amino acid sequence of SEQ ID NO:2 from amino acid 1, 18, 19, 20,
21, 22, 23, 24 or 25 to 295; in a preferred embodiment, the
invention comprises a protein having the amino acid sequence of SEQ
ID NO:1 from amino acid 21 to 295 or SEQ ID NO:3 from amino acid 1
to 275. In one embodiment, the method comprises administering the
composition to a patient in vivo. Alternatively, the method may
comprise administering the composition to cells in vitro and
recovering chondrocytes and/or cartilage tissue, which may
subsequently be administered to a patient. The composition may
further comprise a suitable carrier for administration.
[0006] The present invention also provides novel DNA sequences
encoding novel members of the Frazzled and Frizzled protein
families. In particular embodiments, the present invention provides
novel DNA sequences encoding the Frazzled protein known as human
SDF-5. The nucleotide sequences, and the corresponding amino acid
sequences encoded by these DNA sequences, are provided in the
Sequence Listings. In particular, the present invention comprises
isolated DNA sequence encoding a human SDF-5 protein comprising a
DNA sequence selected from the group consisting of: nucleotides
#256, 307, 310, 313, 316, 319, 322, 325 or 328 to #1140 of SEQ ID
NO: 1; or nucleotides encoding amino acids #1, 18, 19, 20, 21, 22,
23, 24 or 25 to #295 of SEQ ID NO: 2; or nucleotides encoding amino
acids #1 to #275 of SEQ ID NO: 3, as well as fragments and variants
of the above sequences which are readily obtainable from the above
and which maintain Frazzled activity. The present invention further
comprises sequences which hybridize to these sequences under
stringent hybridization conditions and encode a protein which
exhibits Frazzled activity.
[0007] In other embodiments, the present invention comprises
vectors comprising the above DNA molecules in operative association
with an expression control sequence therefor, as well as host cells
transformed with these vectors. In yet other embodiments, the
present invention comprises methods for producing purified human
SDF-5 proteins, novel human SDF-5 proteins, and compositions
containing the human SDF-5 proteins. These methods may comprise the
steps of: culturing a host cell transformed with a DNA sequence
encoding a human SDF-5 protein such as described above; and
recovering and purifying said human SDF-5 protein from the culture
medium. The present invention further comprises the purified human
SDF-5 polypeptide produced by the above methods, as well as
purified human SDF-5 polypeptides comprising an amino acid sequence
encoded by the above DNA sequences. The proteins of the present
invention may comprise the amino acid sequence from amino acid #1,
18, 19, 20, 21, 22, 23, 24 or 25 to #295 of SEQ ID NO: 2; the amino
acid sequence from amino acid #1 to #275 of SEQ ID NO: 3; or a
human SDF-5 protein having a molecular weight of about 30 to about
35 kd, said protein comprising the amino acid sequence of SEQ ID
NO: 2 or 3 and having the ability to regulate the transcription of
one or more genes.
[0008] The present invention also includes methods for inducing the
formation or maintenance of cartilaginous tissue in a patient,
comprising administering to the patient an effective amount of a
composition comprising an SDF-5 protein. Said composition may
further comprise one or more bone morphogenetic proteins (BMP),
preferably a BMP selected from BMP-2, BMP-4, BMP-7, MP52, BMP-12
and BMP-13, most preferably BMP-2. The methods may be used to treat
patients suffering from osteoarthritis, or an articular cartilage
defect or damage.
DESCRIPTION OF SEQUENCES
SEQ ID NO: 1 human SDF-5 DNA
SEQ ID NO: 2 human SDF-5 protein
SEQ ID NO: 3 human SDF-5 mature protein
DESCRIPTION OF DEPOSITS
[0009] A cDNA insert pSDF-5, which contains the human SDF-5 DNA
coding sequence was inserted into an ampicillin E. coli strain and
was deposited with the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md. 20852 on Feb. 4, 1997. This deposit
has been accorded the accession number ATCC 98314. This deposit
meets the requirements of the Budapest Treaty.
DETAILED DESCRIPTION OF THE INVENTION
[0010] As used herein, the term "Frazzled protein" refers to the
human Frazzled protein members which share sequence homology to the
extracellular binding domains of the Frizzled protein family,
including Hfz3, Hfz5, and Hfz7, as well as other human Frazzled
proteins, and Frazzled protein members found in other species and
share sequence homology to Frizzled proteins from other species,
such as those described in Wang et al., Wang et al., J. Biol.
Chem., 271:4468-4476 (1996). One specific member of the Frazzled
protein family is the human SDF-5 protein, having the amino acid
sequence specified in SEQ ID NO:2, as well as homologues of this
protein found in other species; and other proteins which are
closely related structurally and/or functionally to SDF-5. It is
also known that Frazzled related proteins also exist in other
species, including family members in Drosophila, Xenopus, C.
elegans, zebrafish, as well as in rats, mice and humans. "Frazzled
proteins" also includes variants of the Frazzled proteins, such as
allelic variants or variants induced by mutagenesis or deletions,
and fragments of Frazzled or Frizzled proteins which variants and
fragments retain Frazzled activity, preferably, the ability to bind
to proteins, such as the Wnt proteins, which would otherwise bind
to membrane bound receptors, such as the Frizzled proteins.
[0011] As used herein, the term "Frazzled activity" refers to one
or more of the activities which are exhibited by the Frazzled
proteins of the present invention. In particular, "Frazzled
activity" includes the ability to bind to Wnt proteins, and may
thus include the ability to regulate the binding of Wnt proteins to
protein receptors such as the Frizzled protein receptors. "Frazzled
activity" may further include the ability to regulate the
formation, differentiation, proliferation and/or maintenance of
cells and/or tissue, for example connective tissue, organs and
wound healing. In particular, "Frazzled activity" may include the
ability to enhance and/or inhibit the formation, growth,
proliferation, differentiation and/or maintenance of chondrocytes
and/or cartilage tissue. "Frazzled activity" also includes the
activities of Frazzled protein in the assays described herein.
[0012] Thus, the present invention includes protein variants and
functional fragments of the amino acid sequence of the human SDF-5
proteins shown in SEQ ID NO: 2 or 3 which retain Frazzled activity.
The present invention also includes antibodies to a purified human
SDF-5 protein such as the above. The compositions of the present
invention comprise a therapeutic amount of at least one of the
above human SDF-5 proteins.
[0013] It is expected that human SDF-5 protein, as expressed by
mammalian cells such as CHO cells, exists as a heterogeneous
population of active species of human SDF-5 protein with varying
N-termini. Based in part upon the Von Heginje signal peptide
prediction algorithm, the first 17 to 24 amino acids appear to be
involved in signalling for the secretion of the mature peptide. It
is expected that active species may optionally include the signal
peptide and will include amino acid sequences beginning with amino
acid residues #1, 18, 19, 20, 21, 22, 23, 24 or 25 of SEQ ID NO: 2.
Thus, it is expected that DNA sequences encoding active human SDF-5
proteins include those comprising nucleotides #256, 307, 310, 313,
316, 319, 322, 325 or 328 to #1140 of SEQ ID NO: 1. Accordingly,
active species of SDF-5 are expected to include those comprising
amino acids #1, 18, 19, 20, 21, 22, 23, 24 or 25 to #295 of SEQ ID
NO: 2.
[0014] In yet another embodiment, the present invention comprises a
method of altering the regulation of genes in a patient in need of
same comprising administering to said patient an effective amount
of the above compositions. The alteration of regulation of
pancreatic genes may be accomplished by stimulating or inhibiting
binding by Wnt proteins of receptor proteins, for example, binding
between the human SDF-5 protein of the present invention and the
Wnt protein. Thus, the human SDF-5 protein family may be capable of
regulating the binding interaction of Wnt genes to receptor
proteins, such as Frizzled receptor proteins.
[0015] The present invention also encompasses hybrid or fusion
vectors comprising the coding DNA sequences of the present
invention and other Frazzled encoding sequences, linked to a tissue
specific or inducible regulatory sequence, such as a promoter or
operator. In a preferred embodiment of the invention, the coding
sequence for human SDF-5 protein is operably linked to one or more
promoters, enhancers and/or other regulatory elements from genes
which are selectively expressed in chondrocyte cells and/or
cartilage tissue. For example, the collagen type II enhancer
promoter, which is known to be expressed in cartilage during
mesenchymal condensation and cartilage. Metsaranta et al., Dev.
Dynamics, 204:202-210 (1996); Li et al., Genes Develop.,
9:2821-2830 (1996). Another regulatory element useful in the
present invention is the tenascin C promoter. Tenascin C is
expressed in articular cartilage. Pacifici et al., Matrix Biol.,
14:689-698. Additionally, the DNA sequence encoding human SDF-5 may
be operatively linked to one or more regulatory sequences from
proteoglycan core proteins, which are selectively produced in
chondrocytes and/or cartilage tissue. In other preferred
embodiments of the invention, the coding sequence for human SDF-5
protein is operably linked to the promoter isolated from the IDX
gene. This promoter is selectively expressed in pancreatic cells
and tissue. Thus, a hybrid DNA vector in which the IDX promoter is
operably linked to a DNA sequence encoding a human SDF-5 protein is
useful for selective expression of the protein in pancreatic
tissue, for example for the treatment of a pancreatic disorder or
for altering the regulation of pancreatic genes in a patient, for
example by stimulating or inhibiting binding by Wnt proteins of its
receptor protein, for example by binding between the expressed
human SDF-5 protein and the Wnt protein. Vectors using other
tissue-selective regulatory elements and inducible regulatory
elements may also be useful for the selective or inducible
expression of the human SDF-5 proteins of the present
invention.
[0016] Another aspect of the invention provides pharmaceutical
compositions containing a therapeutically effective amount of human
SDF-5 protein, in a pharmaceutically acceptable vehicle or carrier.
These compositions of the invention may be used in the formation of
chondrocytes and/or cartilage tissue phenotype. These compositions
may further be utilized in order to enhance and/or inhibit the
formation, growth, proliferation, differentiation and/or
maintenance of beta cells, and other cell types typically found in
the islets of Langerhans or other pancreatic cells, as well as
other organ tissues such as liver, spleen, brain, lung, cardiac,
and kidney tissue. The compositions comprising human SDF-5 protein
may be used to treat precursor or stem cells, such as pancreatic
stem cells, which are able to differentiate into cells which
comprise differentiated tissue or organs, such as pancreatic cells,
in order to enhance the formation, differentiation, proliferation
and/or maintenance of such cells, tissue or organs. Methods for
forming and maintaining such cells are described, for example, in
WO93/00441, the disclosure of which is hereby incorporated herein
by reference.
[0017] The compositions of the invention may comprise, in addition
to a human SDF-5 protein, other therapeutically useful agents
including growth factors such as epidermal growth factor (EGF),
fibroblast growth factor (FGF), transforming growth factor
(TGF-.alpha. and TGF-.beta.), activins, inhibins, bone
morphogenetic proteins (BMP), and insulin-like growth factor (IGF).
The compositions may also include an appropriate matrix for
instance, for supporting the composition and providing a surface
for chondrocytic cell, and/or cartilaginous tissue growth. The
matrix may provide slow release of the human SDF-5 protein and/or
the appropriate environment for presentation thereof.
[0018] The human SDF-5 protein containing compositions may be
employed in methods for treating a number of tissue defects, and
healing and maintenance of various types of tissues and wounds. The
tissues and wounds which may be treated include cartilage, but may
also include epidermis, nerve, muscle, including cardiac muscle,
other conncective tissue, such as bone, tendon and ligament and
other tissues and wounds, and other organs such as pancreas, liver,
spleen, lung, brain, cardiac, and kidney tissue. These methods,
according to the invention, entail administering to a patient
needing such tissue formation, wound healing or tissue repair, an
effective amount of human SDF-5 protein. The human SDF-5 containing
compositions may also be used to treat or prevent such conditions
as rheumatoid arthritis, osteoarthritis, and other abnormalities of
cartilaginous, or other organs or tissues, such as pancreas, liver,
spleen, lung, cardiac, brain, and kidney tissue, and other tissues
and organs. These methods may also entail the administration of a
protein of the invention in conjunction with administration of at
least one other protein, for example growth factors including EGF,
FGF, TGF-.alpha., TGF-.beta., BMP, activin, inhibin and IGF.
[0019] Still a further aspect of the invention are DNA sequences
coding for expression of human SDF-5 protein. Such sequences
include the sequence of nucleotides in a 5' to 3' direction
illustrated in SEQ ID NO: 1, DNA sequences which, but for the
degeneracy of the genetic code, are identical to the DNA sequence
SEQ ID NO: 1, and encode the protein of SEQ ID NO: 2 or 3. Further
included in the present invention are DNA sequences which hybridize
under stringent conditions with the DNA sequence of SEQ ID NO: 1
and encode a protein having the ability to bind to one or more Wnt
proteins, and/or which have the ability to enhance and/or inhibit
the formation, growth, proliferation, differentiation, maintenance
of pancreatic cells, such as insulin-producing beta cells, or other
organ tissues such as liver, spleen, lung, cardiac, brain and
kidney tissue. Preferred DNA sequences include those which
hybridize under stringent conditions (see, T. Maniatis et al,
Molecular Cloning (A Laboratory Manual), Cold Spring Harbor
Laboratory (1982), pages 387 to 389). It is generally preferred
that such DNA sequences encode a polypeptide which is at least
about 80% homologous, and more preferably at least about 90%
homologous, to the mature human SDF-5 amino acid sequence shown in
SEQ ID NO: 2 or 3. Finally, allelic or other variations of the
sequences of SEQ ID NO: 1, whether such nucleotide changes result
in changes in the peptide sequence or not, but where the peptide
sequence still has Frazzled activity, are also included in the
present invention. The present invention also includes functional
fragments of the DNA sequence of human SDF-5 proteins shown in SEQ
ID NO: 1 which encode a polypeptide which retains the activity of
Frazzled protein. The determination whether a particular variant or
fragment of the human SDF-5 protein of the present invention, such
as those shown in SEQ ID NO: 2 or 3 maintain Frazzled activity, is
routinely performed using the assays described herein.
[0020] The DNA sequences of the present invention are useful, for
example, as probes for the detection of mRNA encoding other
Frazzled protein in a given cell population. The DNA sequences may
also be useful for preparing vectors for gene therapy applications
as described below.
[0021] A further aspect of the invention includes vectors
comprising a DNA sequence as described above in operative
association with an expression control sequence therefor. These
vectors may be employed in a novel process for producing a
recombinant human SDF-5 protein of the invention in which a cell
line transformed with a DNA sequence encoding human SDF-5 protein
in operative association with an expression control sequence
therefor, is cultured in a suitable culture medium and human SDF-5
protein is recovered and purified therefrom. This process may
employ a number of known cells both prokaryotic and eukaryotic as
host cells for expression of the polypeptide. The vectors may also
be used in gene therapy applications. In such use, the vectors may
be transfected into the cells of a patient ex vivo, and the cells
may be reintroduced into a patient. Alternatively, the vectors may
be introduced into a patient in vivo through targeted
transfection.
[0022] In a preferred embodiment of the invention, vectors are
prepared using one or more non-native regulatory elements, such as
promoters and/or enhancers operatively associated with the coding
sequence for human SDF-5, in order to achieve expression of human
SDF-5 in desired cell tissue and/or at a desired time in
development. For example, a vector may be constructed using the
promoter element from the well-characterized IDX gene, which is
known to be constitutively expressed in pancreatic cells, including
beta cells, during development. By operatively associating the
promoter from the IDX gene with the coding sequence for Frazzled,
and transforming suitable cells, such as pancreatic stem cells as
described in WO93/00441, one can express human SDF-5 in these
cells, thus promoting the desired effects of formation, growth,
proliferation, differentiation and/or maintenance of cells such as
pancreatic beta cells which are able to secrete insulin, either in
in vitro culture or in vivo.
[0023] Still a further aspect of the invention are human SDF-5
proteins or polypeptides. Such polypeptides are characterized by
having an amino acid sequence including the sequence illustrated in
SEQ ID NO: 2 or 3, variants of the amino acid sequence of SEQ ID
NO: 2 or 3, including naturally occurring allelic variants, and
other variants in which the protein retains Frazzled ability, for
example, the ability to enhance and/or inhibit the formation,
growth, proliferation, differentiation and/or maintenance of
chondrocytes and/or cartilage tissue and/or pancreatic or other
organ tissue, such as liver, spleen, lung, cardiac, brain and
kidney tissue, characteristic of Frazzled protein. Preferred
polypeptides include a polypeptide which is at least about 80% and
more preferably at least about 90% homologous to the mature human
SDF-5 amino acid sequences shown in SEQ ID NO: 2 and 3. Finally,
allelic or other variations of the sequences of SEQ ID NO: 2 or 3,
whether such amino acid changes are induced by mutagenesis,
chemical alteration, or by alteration of DNA sequence used to
produce the polypeptide, where the peptide sequence still has
Frazzled activity, are also included in the present invention. The
present invention also includes fragments of the amino acid
sequence of human SDF-5 shown in SEQ ID NO: 2 or 3 which retain the
activity of Frazzled protein. One skilled in the art can readily
produce such variations and fragments of the human SDF-5 protein
using techniques known in the art, and can readily assay them for
activity, as described in the examples herein.
[0024] The purified proteins of the present inventions may be used
to generate antibodies, either monoclonal or polyclonal, to human
SDF-5 proteins and/or other related proteins, using methods that
are known in the art of antibody production. Thus, the present
invention also includes antibodies to human SDF-5 and/or other
Frazzled proteins. The antibodies may be useful for purification of
human SDF-5 proteins, or for inhibiting or preventing the effects
of Frazzled proteins either in vitro or in vivo. The human SDF-5
proteins may be useful for inducing the growth and/or
differentiation of embryonic cells and/or stem cells. Thus, the
proteins or compositions of the present invention may also be
useful for treating cell populations, such as embryonic cells or
stem cell populations, to enhance, enrich or to inhibit the growth
and/or differentiation of the cells. For example, the human SDF-5
proteins may be useful for treating cell populations to enhance
and/or inhibit the formation, differentiation, proliferation and/or
maintenance of chondrocytes, cartilaginous tissue and/or other
cells such as cells of pancreatic or other tissue or organ
phenotype. The treated cell populations may be useful for, among
other things, gene therapy applications, as described below.
[0025] It is of particular interest that the human SDF-5 gene
appears to encode a secreted factor, thus providing soluble
receptors which may be capable of binding with the Wnt proteins,
thus initiating and/or blocking signal transduction by the Wnt
proteins. Thus, the human SDF-5 gene family may be capable of
regulating the binding interaction of Wnt genes to receptor
proteins, such as the Frizzled receptor proteins. The potential
signal transduction regulation activities of these proteins, along
with the presence and/or expression of Wnt genes in pancreas and
other organs suggests that human SDF-5 protein is an important
regulator of differentiation of tissue and organs, and may be
involved in the induction, formation, growth, differentiation,
proliferation and/or maintenance of tissues and organs. Thus, the
proteins of the present invention may be useful in wound healing,
tissue and organ repair and regeneration processes, as well as in
differentiation of tissue, for example in embryonic development. In
particular, it has been observed by the inventors that the human
SDF-5 protein may be useful for the induction, formation, growth,
differentiation, proliferation and/or maintenance and repair of
chondrocytes and/or cartilage tissue. Thus, these proteins, and
compositions containing them, may be useful in the treatment of
cartilage disorders, such as osteoarthritis, rheumatoid arthritis
and articular cartilage defects, and in the enhancement and/or
inhibition of cellular formation, growth, differentiation,
proliferation and/or maintenance, for example formation of
chondrocytes and/or cartilage tissue.
[0026] The human SDF-5 proteins provided herein include factors
encoded by the sequences similar to those of SEQ ID NO: 1, but into
which modifications or deletions are naturally provided (e.g.
allelic variations in the nucleotide sequence which may result in
amino acid changes in the polypeptide) or deliberately engineered.
For example, synthetic polypeptides may wholly or partially
duplicate continuous sequences of the amino acid residues of SEQ ID
NO: 2 or 3. These sequences, by virtue of sharing primary,
secondary, or tertiary structural and conformational
characteristics with human SDF-5 polypeptides of SEQ ID NO: 2 or 3
may possess biological properties in common therewith. Thus, these
modifications and deletions of the native human SDF-5 may be
employed as biologically active substitutes for naturally-occurring
human SDF-5 polypeptides in therapeutic processes. It can be
readily determined whether a given variant or fragment of human
SDF-5 maintains the biological activity of Frazzled by subjecting
both human SDF-5 and the variant or fragment of human SDF-5 to the
assays described herein; in addition the variant or fragment may be
used in a competitive binding assay to test for binding to the Wnt
gene.
[0027] Other specific mutations of the sequences of human SDF-5
proteins described herein involve modifications of glycosylation
sites. These modifications may involve O-linked or N-linked
glycosylation sites. For instance, the absence of glycosylation or
only partial glycosylation results from amino acid substitution or
deletion at asparagine-linked glycosylation recognition sites. The
asparagine-linked glycosylation recognition sites comprise
tripeptide sequences which are specifically recognized by
appropriate cellular glycosylation enzymes. These tripeptide
sequences are either asparagine-X-threonine or asparagine-X-serine,
where X is usually any amino acid. A variety of amino acid
substitutions or deletions at one or both of the first or third
amino acid positions of a glycosylation recognition site (and/or
amino acid deletion at the second position) results in
non-glycosylation at the modified tripeptide sequence. Such
variants of human SDF-5 are within the present invention.
Additionally, bacterial expression of human SDF-5 proteins will
result in production of a non-glycosylated protein, even if the
glycosylation sites are left unmodified. Such bacterially produced
versions of human SDF-5 are within the present invention.
[0028] The present invention also encompasses the novel DNA
sequences, free of association with DNA sequences encoding other
proteinaceous materials, and coding for expression of human SDF-5
proteins. These DNA sequences include those depicted in SEQ ID NO:
1 in a 5' to 3' direction and those sequences which hybridize
thereto under stringent hybridization conditions (for example,
0.1.times.SSC, 0.1% SDS at 65_C; see, T. Maniatis et al, Molecular
Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory
(1982), pages 387 to 389) and encode a protein having Frazzled
activity. These DNA sequences also include those which comprise the
DNA sequence of SEQ ID NO: 1 and those which hybridize thereto
under stringent hybridization conditions and encode a protein
having Frazzled activity.
[0029] Similarly, DNA sequences which code for human SDF-5 proteins
coded for by the sequences of SEQ ID NO: 1, or human SDF-5 proteins
which comprise the amino acid sequence of SEQ ID NO: 2 or 3, but
which differ in codon sequence due to the degeneracies of the
genetic code or allelic variations (naturally-occurring base
changes in the species population which may or may not result in an
amino acid change) also encode the novel factors described herein.
Variations in the DNA sequences of SEQ ID NO: 1 which are caused by
point mutations or by induced modifications (including insertion,
deletion, and substitution) to enhance the activity, half-life or
production of the polypeptides encoded are also encompassed in the
invention.
[0030] Another aspect of the present invention provides a novel
method for producing human SDF-5 proteins. The method of the
present invention involves culturing a suitable cell line, which
has been transformed with a DNA sequence encoding a human SDF-5
protein of the invention, under the control of known regulatory
sequences. The transformed host cells are cultured and the human
SDF-5 proteins recovered and purified from the culture medium. The
purified proteins are substantially free from other proteins with
which they are co-produced as well as from other contaminants.
[0031] Suitable cells or cell lines may be mammalian cells, such as
Chinese hamster ovary cells (CHO). The selection of suitable
mammalian host cells and methods for transformation, culture,
amplification, screening, product production and purification are
known in the art. See, e.g., Gething and Sambrook, Nature,
293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell.
Biol., 5(7):1750-1759 (1985) or Howley et al, U.S. Pat. No.
4,419,446. Another suitable mammalian cell line, which is described
in the accompanying examples, is the monkey COS-1 cell line. The
mammalian cell CV-1 may also be suitable.
[0032] Bacterial cells may also be suitable hosts. For example, the
various strains of E. coli (e.g., HB101, MC1061) are well-known as
host cells in the field of biotechnology. Various strains of B.
subtilis, Pseudomonas, other bacilli and the like may also be
employed in this method. For expression of the protein in bacterial
cells, DNA encoding the signal peptide of Frazzled is generally not
necessary.
[0033] Many strains of yeast cells known to those skilled in the
art may also be available as host cells for expression of the
polypeptides of the present invention. Additionally, where desired,
insect cells may be utilized as host cells in the method of the
present invention. See, e.g. Miller et al, Genetic Engineering,
8:277-298 (Plenum Press 1986) and references cited therein.
[0034] Another aspect of the present invention provides vectors for
use in the method of expression of these novel human SDF-5
polypeptides. Preferably the vectors contain the full novel DNA
sequences described above which encode the novel factors of the
invention. Additionally, the vectors contain appropriate expression
control sequences permitting expression of the Frazzled protein
sequences. Alternatively, vectors incorporating modified sequences
as described above are also embodiments of the present invention.
Additionally, the sequence of SEQ ID NO: 1 or other sequences
encoding human SDF-5 proteins could be manipulated to express a
mature human SDF-5 protein by deleting human SDF-5 signal peptide
sequences and replacing them with sequences encoding the complete
signal peptides of other Frazzled proteins or other suitable
propeptides. Thus, the present invention includes chimeric DNA
molecules encoding a signal peptide from a member of the Frazzled
family linked in correct reading frame to a DNA sequence encoding a
human SDF-5 polypeptide.
[0035] The vectors may be employed in the method of transforming
cell lines and contain selected regulatory sequences in operative
association with the DNA coding sequences of the invention which
are capable of directing the replication and expression thereof in
selected host cells. Regulatory sequences for such vectors are
known to those skilled in the art and may be selected depending
upon the host cells. Such selection is routine and does not form
part of the present invention.
[0036] In order to produce rat, human or other mammalian SDF-5
proteins, the DNA encoding it is transferred into an appropriate
expression vector and introduced into mammalian cells or other
preferred eukaryotic or prokaryotic hosts by conventional genetic
engineering techniques. The preferred expression system for
biologically active recombinant human SDF-5 is contemplated to be
stably transformed mammalian cells.
[0037] One skilled in the art can construct mammalian expression
vectors by employing the sequence of SEQ ID NO: 1, or other DNA
sequences encoding SDF-5 proteins or other modified sequences and
known vectors, such as pCD (Okayama et al., Mol. Cell Biol.,
2:161-170 (1982)), pJL3, pJL4 (Gough et al., EMBO J., 4:645-653
(1985)) and pMT2 CXM.
[0038] The mammalian expression vector pMT2 CXM is a derivative of
p91023(b) (Wong et al., Science 228:810-815, 1985) differing from
the latter in that it contains the ampicillin resistance gene in
place of the tetracycline resistance gene and further contains a
XhoI site for insertion of cDNA clones. The functional elements of
pMT2 CXM have been described (Kaufman, R. J., 1985, Proc. Natl.
Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the
SV40 origin of replication including the 72 bp enhancer, the
adenovirus major late promoter including a 5' splice site and the
majority of the adenovirus tripartite leader sequence present on
adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert,
the SV40 early polyadenylation site (SV40), and pBR322 sequences
needed for propagation in E. coli.
[0039] Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF,
which has been deposited with the American Type Culture Collection
(ATCC), Rockville, Md. (USA) under accession number ATCC 67122.
EcoRI digestion excises the cDNA insert present in pMT2-VWF,
yielding pMT2 in linear form which can be ligated and used to
transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid
pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then
constructed using loopout/in mutagenesis (Morinaga, et al.,
Biotechnology 84: 636 (1984)). This removes bases 1075 to 1145
relative to the Hind III site near the SV40 origin of replication
and enhancer sequences of pMT2. In addition it inserts the
following sequence: TABLE-US-00001 5' PO-CATGGGCAGCTCGAG-3' (SEQ ID
NO:4)
at nucleotide 1145. This sequence contains the recognition site for
the restriction endonuclease Xho I. A derivative of pMT2CXM, termed
pMT23, contains recognition sites for the restriction endonucleases
PstI, Eco RI, SalI and XhoI. Plasmid pMT2 CXM and pMT23 DNA may be
prepared by conventional methods.
[0040] pEMC2.sub.--1 derived from pMT21 may also be suitable in
practice of the invention. pMT21 is derived from pMT2 which is
derived from pMT2-VWF. As described above EcoRI digestion excises
the cDNA insert present in pMT-VWF, yielding pMT2 in linear form
which can be ligated and used to transform E. Coli HB 101 or DH-5
to ampicillin resistance. Plasmid pMT2 DNA can be prepared by
conventional methods.
[0041] pMT21 is derived from pMT2 through the following two
modifications. First, 76 bp of the 5' untranslated region of the
DHFR cDNA including a stretch of 19 G residues from G/C tailing for
cDNA cloning is deleted. In this process, a XhoI site is inserted
to obtain the following sequence immediately upstream from DHFR:
TABLE-US-00002 (SEQ ID NO:5)
5'-CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' PstI Eco RI XhoI
Second, a unique ClaI site is introduced by digestion with EcoRV
and XbaI, treatment with Klenow fragment of DNA polymerase I, and
ligation to a ClaI linker (CATCGATG). This deletes a 250 bp segment
from the adenovirus associated RNA (VAI) region but does not
interfere with VAI RNA gene expression or function. pMT21 is
digested with EcoRI and XhoI, and used to derive the vector
pEMC2B1.
[0042] A portion of the EMCV leader is obtained from pMT2-ECAT1 (S.
K. Jung, et al, J. Virol 63:1651-1660 (1989)) by digestion with Eco
RI and PstI, resulting in a 2752 bp fragment. This fragment is
digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which
is purified by electrophoresis on low melting agarose gel. A 68 bp
adapter and its complementary strand are synthesized with a 5' TaqI
protruding end and a 3' XhoI protruding end which has the following
sequence: TABLE-US-00003 TaqI (SEQ ID NO:6)
5'CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTT
CCTTTGAAAAACACGATTGC-3' XhoI
[0043] This sequence matches the EMC virus leader sequence from
nucleotide 763 to 827. It also changes the ATG at position 10
within the EMC virus leader to an ATT and is followed by a XhoI
site. A three way ligation of the pMT21 Eco RI-XhoI fragment, the
EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide
adapter TaqI-XhoI adapter resulting in the vector pEMC2.beta.1.
[0044] This vector contains the SV40 origin of replication and
enhancer, the adenovirus major late promoter, a cDNA copy of the
majority of the adenovirus tripartite leader sequence, a small
hybrid intervening sequence, an SV40 polyadenylation signal and the
adenovirus VA I gene, DHFR and .beta.-lactamase markers and an EMC
sequence, in appropriate relationships to direct the high level
expression of the desired cDNA in mammalian cells.
[0045] The construction of vectors may involve modification of the
human SDF-5 DNA sequences. For instance, human SDF-5 cDNA can be
modified by removing the non-coding nucleotides on the 5' and 3'
ends of the coding region. The deleted non-coding nucleotides may
or may not be replaced by other sequences known to be beneficial
for expression. These vectors are transformed into appropriate host
cells for expression of human SDF-5 proteins. Additionally, the
sequence of SEQ ID NO: 1 other sequences encoding human SDF-5
proteins can be manipulated to express a mature human SDF-5 protein
by deleting human SDF-5 encoding signal peptide sequences and
replacing them with sequences encoding the complete signal peptides
of other proteins.
[0046] One skilled in the art can manipulate the sequences of SEQ
ID NO: 1 by eliminating or replacing the mammalian regulatory
sequences flanking the coding sequence with bacterial sequences to
create bacterial vectors for intracellular or extracellular
expression by bacterial cells. For example, the coding sequences
could be further manipulated (e.g. ligated to other known linkers
or modified by deleting non-coding sequences therefrom or altering
nucleotides therein by other known techniques). The modified human
SDF-5 coding sequence could then be inserted into a known bacterial
vector using procedures such as described in T. Taniguchi et al.,
Proc. Natl. Acad. Sci. USA, 77:5230-5233 (1980). This exemplary
bacterial vector could then be transformed into bacterial host
cells and a protein expressed thereby. For a strategy for producing
extracellular expression of human SDF-5 proteins in bacterial
cells, see, e.g. European patent application EPA 177,343.
[0047] Similar manipulations can be performed for the construction
of an insect vector (See, e.g. procedures described in published
European patent application 155,476) for expression in insect
cells. A yeast vector could also be constructed employing yeast
regulatory sequences for intracellular or extracellular expression
of the factors of the present invention by yeast cells. (See, e.g.,
procedures described in published PCT application WO86/00639 and
European patent application EPA 123,289).
[0048] A method for producing high levels of a human SDF-5 protein
of the invention in mammalian cells may involve the construction of
cells containing multiple copies of the heterologous human SDF-5
gene. The heterologous gene is linked to an amplifiable marker,
e.g. the dihydrofolate reductase (DHFR) gene for which cells
containing increased gene copies can be selected for propagation in
increasing concentrations of methotrexate (MTX) according to the
procedures of Kaufman and Sharp, J. Mol. Biol., 159:601-629 (1982).
This approach can be employed with a number of different cell
types.
[0049] For example, a plasmid containing a DNA sequence for a human
SDF-5 protein of the invention in operative association with other
plasmid sequences enabling expression thereof and the DHFR
expression plasmid pAdA26SV(A)3 (Kaufman and Sharp, Mol. Cell.
Biol., 2:1304 (1982)) can be co-introduced into DHFR-deficient CHO
cells, DUKX-BII, by various methods including calcium phosphate
coprecipitation and transfection, electroporation or protoplast
fusion. DHFR expressing transformants are selected for growth in
alpha media with dialyzed fetal calf serum, and subsequently
selected for amplification by growth in increasing concentrations
of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5 uM MTX) as
described in Kaufman et al., Mol Cell Biol., 5:1750 (1983).
Transformants are cloned, and biologically active human SDF-5
expression is monitored by assay in one of the assays described
herein. Human SDF-5 protein expression should increase with
increasing levels of MTX resistance. Human SDF-5 polypeptides are
characterized using standard techniques known in the art such as
pulse labeling with .sup.35S methionine or cysteine and
polyacrylamide gel electrophoresis. Similar procedures can be
followed to produce other related SDF-5 proteins.
[0050] An SDF-5 protein of the present invention, which
demonstrates Frazzled activity, has application in the induction,
formation, growth, differentiation, proliferation and/or
maintenance and healing of cells and tissues such as chondrocytes
and/or cartilaginous tissue, as well as pancreatic tissue, and
other organ tissues, in humans and other animals. Such a
preparation employing human SDF-5 protein may have prophylactic use
in treatment of rheumatoid arthritis and osteoarthritis and
traumatic injury to cartilage, as well as preventing pancreatic
tumors, diabetes and other pancreatic tissue disorders. De novo
formation of beta cells, islet of Langerhans cells, and other cells
of pancreatic phenotype, induced by a Frazzled protein contributes
to the repair of congenital, trauma induced, or oncologic tissue
defects or conditions. Human SDF-5 protein may also be used in the
treatment of pancreatic disease, and in other tissue and organ
repair processes. Such agents may provide an environment to attract
suitable stem cells, stimulate growth and proliferation of
pancreas-forming cells or induce differentiation of progenitors of
pancreas-forming cells, and may also support the regeneration of
other tissues and organs. Human SDF-5 polypeptides of the invention
may also be useful in the treatment of organ disorders such as
pancreitis or diabetes.
[0051] The proteins of the invention may also be used in wound
healing and in related tissue repair. The types of wounds include,
but are not limited to burns, incisions and ulcers. (See, e.g. PCT
Publication WO84/01106 for discussion of wound healing and related
tissue repair). It is further contemplated that proteins of the
invention may increase neuronal, astrocytic and/or glial cell
survival and therefore be useful in transplantation and treatment
of conditions exhibiting a decrease in neuronal survival and
repair. The proteins of the invention may further be useful for the
treatment of conditions related to other types of tissue, such as
nerve, epidermis, muscle, connective tissue, such as bone,
cartilage, tendon and ligament, and other organs such as pancreas,
liver, spleen, lung, cardiac, brain and kidney tissue. The proteins
of the present invention may also have value as a dietary
supplement, or as additives for cell culture media. For this use,
the proteins may be used in intact form, or may be predigested to
provide a more readily absorbed supplement.
[0052] The proteins of the invention may also have other useful
properties characteristic of the Frazzled family of proteins. Such
properties include angiogenic, chemotactic and/or chemoattractant
properties, and effects on cells including differentiation
responses, cell proliferative responses and responses involving
cell adhesion, migration and extracellular matrices. These
properties make the proteins of the invention potential agents for
wound healing, reduction of fibrosis and reduction of scar tissue
formation. The proteins of the invention may also be useful for the
induction of formation of cells capable of secreting valuable
hormones, such as insulin, glucagon or other endocrine or exocrine
hormones.
[0053] A further aspect of the invention is a therapeutic method
and composition for treating disorders of cartilage and connective
tissue, as well as disorders of the pancreas, diabetes, and other
conditions related to pancreatic tissue disorders or diseases. The
invention further comprises therapeutic methods and compositions
for wound healing and tissue repair. Such compositions comprise a
therapeutically effective amount of at least one human SDF-5
protein of the present invention in admixture with a
pharmaceutically acceptable vehicle, carrier or matrix. It is
further contemplated that compositions of the invention may
increase neuronal and glial cell survival and therefore be useful
in transplantation and treatment of conditions exhibiting a
decrease in neuronal survival.
[0054] It is expected that the proteins of the invention may act in
concert with or perhaps synergistically with other related proteins
and growth factors. Further therapeutic methods and compositions of
the invention therefore comprise a therapeutic amount of at least
one human SDF-5 protein of the invention with a therapeutic amount
of at least one other protein, such as a member of the
TGF-_superfamily of proteins, which includes the bone morphogenetic
proteins (BMPs), growth and differentiation factors (GDFs) and
other proteins. BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7,
disclosed for instance in U.S. Pat. Nos. 5,108,922; 5,013,649;
5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in
PCT publication WO91/18098; and BMP-9, disclosed in PCT publication
WO93/00432, BMP-10, disclosed in PCT application WO94/26893;
BMP-11, disclosed in PCT application WO94/26892, or BMP-12 or
BMP-13, disclosed in PCT application WO95/16035, or BMP-15,
disclosed in PCT application WO96/36710 or BMP-16, disclosed in
co-pending patent application Ser. No. 08/715/202, filed Sep. 18,
1996.
[0055] Other compositions which may also be useful include Vgr-2,
and any of the growth and differentiation factors GDFs, including
those described in PCT applications WO94/15965; WO94/15949;
WO95/01801; WO95/01802; WO94/21681; WO94/15966; and others. Also
useful in the present invention may be BIP, disclosed in
WO94/01557; and MP52, disclosed in PCT application WO93/16099. The
disclosures of all of the above applications are hereby
incorporated by reference for the disclosure contained therein. In
a preferred embodiment, the SDF-5 is combined with a protein BMP-2,
BMP-7, MP52, BMP-12 or BMP-13.
[0056] The composition may include other agents and growth factors
such as epidermal growth factor (EGF), fibroblast growth factor
(FGF), platelet derived growth factor (PDGF), transforming growth
factors (TGF-.alpha. and TGF-.beta.), activins, inhibins, and
k-fibroblast growth factor (kFGF), parathyroid hormone (PTH),
leukemia inhibitory factor (LIF/HILDA/DIA), insulin-like growth
factors (IGF-I and IGF-II). Portions of these agents may also be
used in compositions of the present invention.
[0057] The preparation and formulation of such physiologically
acceptable protein compositions, having due regard to pH,
isotonicity, stability and the like, is within the skill of the
art. The therapeutic compositions are also presently valuable for
veterinary applications due to the lack of species specificity in
Frazzled proteins. Particularly domestic animals and thoroughbred
horses in addition to humans are desired patients for such
treatment with the SDF-5 proteins of the present invention.
[0058] The therapeutic method includes administering the
composition topically, systemically, or locally as by injection or
implantation. When administered, the therapeutic composition for
use in this invention is, of course, in a pyrogen-free,
physiologically acceptable form. Further, the composition may
desirably be encapsulated or injected in a viscous form for
delivery to the site of pancreatic or other tissue damage. Topical
administration may be suitable for wound healing and tissue repair.
Therapeutically useful agents other than the SDF-5 proteins which
may also optionally be included in the composition as described
above, may alternatively or additionally, be administered
simultaneously or sequentially with the SDF-5 composition in the
methods of the invention.
[0059] For implantation, the composition preferably includes a
matrix capable of delivering human SDF-5 proteins to the site of
pancreatic or other tissue damage, providing a structure for the
developing tissue and optimally capable of being resorbed into the
body. The matrix may provide slow release of human SDF-5 and/or
other protein, as well as proper presentation and appropriate
environment for cellular infiltration. Such matrices may be formed
of materials presently in use for other implanted medical
applications. The choice of matrix material is based on
biocompatibility, biodegradability, mechanical properties, cosmetic
appearance and interface properties. The particular application of
the human SDF-5 compositions will define the appropriate
formulation.
[0060] The dosage regimen will be determined by the attending
physician considering various factors which modify the action of
the human SDF-5 protein, e.g. amount of tissue desired to be
formed, the site of tissue damage, the condition of the damaged
tissue, the size of a wound, type of damaged tissue, the patient's
age, sex, and diet, the severity of any infection, time of
administration and other clinical factors. The dosage may vary with
the type of matrix used in the reconstitution and the types of
human SDF-5 proteins in the composition. The addition of other
known growth factors, such as IGF I (insulin like growth factor I),
to the final composition, may also effect the dosage.
[0061] Progress can be monitored by periodic assessment of tissue
growth and/or repair. The progress can be monitored, for example,
x-rays, histomorphometric determinations and tetracycline
labeling.
Uses and Biological Activity
[0062] The proteins of the present invention are expected to
exhibit one or more of the uses or biological activities (including
those associated with assays cited herein) identified below. Uses
or activities described for proteins of the present invention may
be provided by administration or use of such proteins or by
administration or use of polynucleotides encoding such proteins
(such as, for example, in gene therapies or vectors suitable for
introduction of DNA).
[0063] Research Uses and Utilities
[0064] The proteins provided by the present invention can similarly
be used in assay to determine biological activity, including in a
panel of multiple proteins for high-throughput screening; to raise
antibodies or to elicit another immune response; as a reagent
(including the labeled reagent) in assays designed to
quantitatively determine levels of the protein (or its receptor) in
biological fluids; as markers for tissues in which the
corresponding protein is preferentially expressed (either
constitutively or at a particular stage of tissue differentiation
or development or in a disease state); and, of course, to isolate
correlative receptors or ligands. Where the protein binds or
potentially binds to another protein (such as, for example, in a
receptor-ligand interaction), the protein can be used to identify
the other protein with which binding occurs or to identify
inhibitors of the binding interaction. Proteins involved in these
binding interactions can also be used to screen for peptide or
small molecule inhibitors or agonists of the binding
interaction.
[0065] Any or all of these research utilities are capable of being
developed into reagent grade or kit format for commercialization as
research products.
[0066] Methods for performing the uses listed above are well known
to those skilled in the art. References disclosing such methods
include without limitation "Molecular Cloning: A Laboratory
Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J.,
E. F. Fritsch and T. Maniatis eds., 1989, and "Methods in
Enzymology: Guide to Molecular Cloning Techniques", Academic Press,
Berger, S. L. and A. R. Kimmel eds., 1987.
[0067] Nutritional Uses
[0068] Proteins of the present invention can also be used as
nutritional sources or supplements. Such uses include without
limitation use as a protein or amino acid supplement, use as a
carbon source, use as a nitrogen source and use as a source of
carbohydrate. In such cases the protein of the invention can be
added to the feed of a particular organism or can be administered
as a separate solid or liquid preparation, such as in the form of
powder, pills, solutions, suspensions or capsules. In the case of
microorganisms, the protein of the invention can be added to the
medium in or on which the microorganism is cultured.
[0069] Cytokine and Cell Proliferation/Differentiation Activity
[0070] A protein of the present invention may exhibit cytokine,
cell proliferation (either inducing or inhibiting) or cell
differentiation (either inducing or inhibiting) activity or may
induce production of other cytokines in certain cell populations.
Many protein factors discovered to date, including all known
cytokines, have exhibited activity in one or more factor dependent
cell proliferation assays, and hence the assays serve as a
convenient confirmation of cytokine activity. The activity of a
protein of the present invention is evidenced by any one of a
number of routine factor dependent cell proliferation assays for
cell lines including, without limitation, 32D, DA2, DA1G, T10, B9,
B9/11, BaF3, MC9/G, M+(preB M+), 2E8, RB5, DA1, 123, T1165, HT2,
CTLL2, TF-1, Mo7e and CMK.
[0071] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0072] Assays for T-cell or thymocyte proliferation include without
limitation those described in: Current Protocols in Immunology, Ed
by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach,
W Strober, Pub. Greene Publishing Associates and Wiley-Interscience
(Chapter 3, In Vitro assays for Mouse Lymphocyte Function 3.1-3.19;
Chapter 7, Immunologic studies in Humans); Takai et al., J.
Immunol. 137:3494-3500, 1986; Bertagnolli et al., J. Immunol.
145:1706-1712, 1990; Bertagnolli et al., Cellular Immunology
133:327-341, 1991; Bertagnolli, et al., J. Immunol. 149:3778-3783,
1992; Bowman et al., J. Immunol. 152: 1756-1761, 1994.
[0073] Assays for cytokine production and/or proliferation of
spleen cells, lymph node cells or thymocytes include, without
limitation, those described in: Polyclonal T cell stimulation,
Kruisbeek, A. M. and Shevach, E. M. In Current Protocols in
Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 3.12.1-3.12.14, John
Wiley and Sons, Toronto. 1994; and Measurement of mouse and human
Interferon_, Schreiber, R. D. In Current Protocols in Immunology.
J.E.e.a. Coligan eds. Vol 1 pp. 6.8.1-6.8.8, John Wiley and Sons,
Toronto. 1994.
[0074] Assays for proliferation and differentiation of
hematopoietic and lymphopoietic cells include, without limitation,
those described in: Measurement of Human and Murine Interleukin 2
and Interleukin 4, Bottomly, K., Davis, L. S. and Lipsky, P. E. In
Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp.
6.3.1-6.3.12, John Wiley and Sons, Toronto. 1991; deVries et al.,
J. Exp. Med. 173:1205-1211, 1991; Moreau et al., Nature
336:690-692, 1988; Greenberger et al., Proc. Natl. Acad. Sci.
U.S.A. 80:2931-2938, 1983; Measurement of mouse and human
interleukin 6--Nordan, R. In Current Protocols in Immunology.
J.E.e.a. Coligan eds. Vol 1 pp. 6.6.1-6.6.5, John Wiley and Sons,
Toronto. 1991; Smith et al., Proc. Natl. Acad. Sci. U.S.A.
83:1857-1861, 1986; Measurement of human Interleukin 11--Bennett,
F., Giannotti, J., Clark, S. C. and Turner, K. J. In Current
Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1 pp. 6.15.1
John Wiley and Sons, Toronto. 1991; Measurement of mouse and human
Interleukin 9--Ciarletta, A., Giannotti, J., Clark, S. C. and
Turner, K. J. In Current Protocols in Immunology. J.E.e.a. Coligan
eds. Vol 1 pp. 6.13.1, John Wiley and Sons, Toronto. 1991.
[0075] Assays for T-cell clone responses to antigens (which will
identify, among others, proteins that affect APC-T cell
interactions as well as direct T-cell effects by measuring
proliferation and cytokine production) include, without limitation,
those described in: Current Protocols in Immunology, Ed by J. E.
Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, W
Strober, Pub. Greene Publishing Associates and Wiley-Interscience
(Chapter 3, In Vitro assays for Mouse Lymphocyte Function; Chapter
6, Cytokines and their cellular receptors; Chapter 7, Immunologic
studies in Humans); Weinberger et al., Proc. Natl. Acad. Sci. USA
77:6091-6095, 1980; Weinberger et al., Eur. J. Immun. 11:405-411,
1981; Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et al.,
J. Immunol. 140:508-512, 1988.
[0076] Immune Stimulating or Suppressing Activity
[0077] A protein of the present invention may also exhibit immune
stimulating or immune suppressing activity, including without
limitation the activities for which assays are described herein. A
protein may be useful in the treatment of various immune
deficiencies and disorders (including severe combined
immunodeficiency (SCID)), e.g., in regulating (up or down) growth
and proliferation of T and/or B lymphocytes, as well as effecting
the cytolytic activity of NK cells and other cell populations.
These immune deficiencies may be genetic or be caused by viral
(e.g., HIV) as well as bacterial or fungal infections, or may
result from autoimmune disorders. More specifically, infectious
diseases causes by viral, bacterial, fungal or other infection may
be treatable using a protein of the present invention, including
infections by HIV, hepatitis viruses, herpesviruses, mycobacteria,
Leishmania spp., malaria spp. and various fungal infections such as
candidiasis. Of course, in this regard, a protein of the present
invention may also be useful where a boost to the immune system
generally may be desirable, i.e., in the treatment of cancer.
[0078] Autoimmune disorders which may be treated using a protein of
the present invention include, for example, connective tissue
disease, multiple sclerosis, systemic lupus erythematosus,
rheumatoid arthritis, autoimmune pulmonary inflammation,
Guillain-Barre syndrome, autoimmune thyroiditis, insulin dependent
diabetes mellitis, myasthenia gravis, graft-versus-host disease and
autoimmune inflammatory eye disease. Such a protein of the present
invention may also to be useful in the treatment of allergic
reactions and conditions, such as asthma (particularly allergic
asthma) or other respiratory problems. Other conditions, in which
immune suppression is desired (including, for example, organ
transplantation), may also be treatable using a protein of the
present invention.
[0079] Using the proteins of the invention it may also be possible
to immune responses, in a number of ways. Down regulation may be in
the form of inhibiting or blocking an immune response already in
progress or may involve preventing the induction of an immune
response. The functions of activated T cells may be inhibited by
suppressing T cell responses or by inducing specific tolerance in T
cells, or both. Immunosuppression of T cell responses is generally
an active, non-antigen-specific, process which requires continuous
exposure of the T cells to the suppressive agent. Tolerance, which
involves inducing non-responsiveness or anergy in T cells, is
distinguishable from immunosuppression in that it is generally
antigen-specific and persists after exposure to the tolerizing
agent has ceased. Operationally, tolerance can be demonstrated by
the lack of a T cell response upon reexposure to specific antigen
in the absence of the tolerizing agent.
[0080] Down regulating or preventing one or more antigen functions
(including without limitation B lymphocyte antigen functions (such
as, for example, B7)), e.g., preventing high level lymphokine
synthesis by activated T cells, will be useful in situations of
tissue, skin and organ transplantation and in graft-versus-host
disease (GVHD). For example, blockage of T cell function should
result in reduced tissue destruction in tissue transplantation.
Typically, in tissue transplants, rejection of the transplant is
initiated through its recognition as foreign by T cells, followed
by an immune reaction that destroys the transplant. The
administration of a molecule which inhibits or blocks interaction
of a B7 lymphocyte antigen with its natural ligand(s) on immune
cells (such as a soluble, monomeric form of a peptide having B7-2
activity alone or in conjunction with a monomeric form of a peptide
having an activity of another B lymphocyte antigen (e.g., B7-1,
B7-3) or blocking antibody), prior to transplantation can lead to
the binding of the molecule to the natural ligand(s) on the immune
cells without transmitting the corresponding costimulatory signal.
Blocking B lymphocyte antigen function in this matter prevents
cytokine synthesis by immune cells, such as T cells, and thus acts
as an immunosuppressant. Moreover, the lack of costimulation may
also be sufficient to anergize the T cells, thereby inducing
tolerance in a subject. Induction of long-term tolerance by B
lymphocyte antigen-blocking reagents may avoid the necessity of
repeated administration of these blocking reagents. To achieve
sufficient immunosuppression or tolerance in a subject, it may also
be necessary to block the function of a combination of B lymphocyte
antigens. The efficacy of particular blocking reagents in
preventing organ transplant rejection or GVHD can be assessed using
animal models that are predictive of efficacy in humans. Examples
of appropriate systems which can be used include allogeneic cardiac
grafts in rats and xenogeneic pancreatic islet cell grafts in mice,
both of which have been used to examine the immunosuppressive
effects of CTLA4Ig fusion proteins in vivo as described in Lenschow
et al., Science 257:789-792 (1992) and Turka et al., Proc. Natl.
Acad. Sci USA, 89:11102-11105 (1992). In addition, murine models of
GVHD (see Paul ed., Fundamental Immunology, Raven Press, New York,
1989, pp. 846-847) can be used to determine the effect of blocking
B lymphocyte antigen function in vivo on the development of that
disease.
[0081] Blocking antigen function may also be therapeutically useful
for treating autoimmune diseases. Many autoimmune disorders are the
result of inappropriate activation of T cells that are reactive
against self tissue and which promote the production of cytokines
and autoantibodies involved in the pathology of the diseases.
Preventing the activation of autoreactive T cells may reduce or
eliminate disease symptoms. Administration of reagents which block
costimulation of T cells by disrupting receptor:ligand interactions
of B lymphocyte antigens can be used to inhibit T cell activation
and prevent production of autoantibodies or T cell-derived
cytokines which may be involved in the disease process.
Additionally, blocking reagents may induce antigen-specific
tolerance of autoreactive T cells which could lead to long-term
relief from the disease. The efficacy of blocking reagents in
preventing or alleviating autoimmune disorders can be determined
using a number of well-characterized animal models of human
autoimmune diseases. Examples include murine experimental
autoimmune encephalitis, systemic lupus erythmatosis in MRL/lpr/lpr
mice or NZB hybrid mice, murine autoimmune collagen arthritis,
diabetes mellitus in NOD mice and BB rats, and murine experimental
myasthenia gravis (see Paul ed., Fundamental Immunology, Raven
Press, New York, 1989, pp. 840-856).
[0082] Upregulation of an antigen function (preferably a B
lymphocyte antigen function), as a means of up regulating immune
responses, may also be useful in therapy. Upregulation of immune
responses may be in the form of enhancing an existing immune
response or eliciting an initial immune response. For example,
enhancing an immune response through stimulating B lymphocyte
antigen function may be useful in cases of viral infection. In
addition, systemic viral diseases such as influenza, the common
cold, and encephalitis might be alleviated by the administration of
stimulatory forms of B lymphocyte antigens systemically.
[0083] Alternatively, anti-viral immune responses may be enhanced
in an infected patient by removing T cells from the patient,
costimulating the T cells in vitro with viral antigen-pulsed APCs
either expressing a peptide of the present invention or together
with a stimulatory form of a soluble peptide of the present
invention and reintroducing the in vitro activated T cells into the
patient. Another method of enhancing anti-viral immune responses
would be to isolate infected cells from a patient, transfect them
with a nucleic acid encoding a protein of the present invention as
described herein such that the cells express all or a portion of
the protein on their surface, and reintroduce the transfected cells
into the patient. The infected cells would now be capable of
delivering a costimulatory signal to, and thereby activate, T cells
in vivo.
[0084] In another application, up regulation or enhancement of
antigen function (preferably B lymphocyte antigen function) may be
useful in the induction of tumor immunity. Tumor cells (e.g.,
sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma)
transfected with a nucleic acid encoding at least one peptide of
the present invention can be administered to a subject to overcome
tumor-specific tolerance in the subject. If desired, the tumor cell
can be transfected to express a combination of peptides. For
example, tumor cells obtained from a patient can be transfected ex
vivo with an expression vector directing the expression of a
peptide having B7-2-like activity alone, or in conjunction with a
peptide having B7-1-like activity and/or B7-3-like activity. The
transfected tumor cells are returned to the patient to result in
expression of the peptides on the surface of the transfected cell.
Alternatively, gene therapy techniques can be used to target a
tumor cell for transfection in vivo.
[0085] The presence of the peptide of the present invention having
the activity of a B lymphocyte antigen(s) on the surface of the
tumor cell provides the necessary costimulation signal to T cells
to induce a T cell mediated immune response against the transfected
tumor cells. In addition, tumor cells which lack MHC class I or MHC
class II molecules, or which fail to reexpress sufficient amounts
of MHC class I or MHC class II molecules, can be transfected with
nucleic acid encoding all or a portion of (e.g., a
cytoplasmic-domain truncated portion) of an MHC class I a chain
protein and .beta..sub.2 microglobulin protein or an MHC class II
.alpha. chain protein and an MHC class II .beta. chain protein to
thereby express MHC class I or MHC class II proteins on the cell
surface. Expression of the appropriate class I or class II MHC in
conjunction with a peptide having the activity of a B lymphocyte
antigen (e.g., B7-1, B7-2, B7-3) induces a T cell mediated immune
response against the transfected tumor cell. Optionally, a gene
encoding an antisense construct which blocks expression of an MHC
class II associated protein, such as the invariant chain, can also
be cotransfected with a DNA encoding a peptide having the activity
of a B lymphocyte antigen to promote presentation of tumor
associated antigens and induce tumor specific immunity. Thus, the
induction of a T cell mediated immune response in a human subject
may be sufficient to overcome tumor-specific tolerance in the
subject.
[0086] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0087] Suitable assays for thymocyte or splenocyte cytotoxicity
include, without limitation, those described in: Current Protocols
in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H.
Margulies, E. M. Shevach, W Strober, Pub. Greene Publishing
Associates and Wiley-Interscience (Chapter 3, In Vitro assays for
Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies
in Humans); Herrmann et al., Proc. Natl. Acad. Sci. USA
78:2488-2492, 1981; Herrmann et al., J. Immunol. 128:1968-1974,
1982; Handa et al., J. Immunol. 135:1564-1572, 1985; Takai et al.,
J. Immunol. 137:3494-3500, 1986; Takai et al., J. Immunol.
140:508-512, 1988; Herrmann et al., Proc. Natl. Acad. Sci. USA
78:2488-2492, 1981; Herrmann et al., J. Immunol. 128:1968-1974,
1982; Handa et al., J. Immunol. 135:1564-1572, 1985; Takai et al.,
J. Immunol. 137:3494-3500, 1986; Bowmanet al., J. Virology
61:1992-1998; Takai et al., J. Immunol. 140:508-512, 1988;
Bertagnolli et al., Cellular Immunology 133:327-341, 1991; Brown et
al., J. Immunol. 153:3079-3092, 1994.
[0088] Assays for T-cell-dependent immunoglobulin responses and
isotype switching (which will identify, among others, proteins that
modulate T-cell dependent antibody responses and that affect
Th1/Th2 profiles) include, without limitation, those described in:
Maliszewski, J. Immunol. 144:3028-3033, 1990; and Assays for B cell
function: In vitro antibody production, Mond, J. J. and Brunswick,
M. In Current Protocols in Immunology. J.E.e.a. Coligan eds. Vol 1
pp. 3.8.1-3.8.16, John Wiley and Sons, Toronto. 1994.
[0089] Mixed lymphocyte reaction (MLR) assays (which will identify,
among others, proteins that generate predominantly Th1 and CTL
responses) include, without limitation, those described in: Current
Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D.
H. Margulies, E. M. Shevach, W Strober, Pub. Greene Publishing
Associates and Wiley-Interscience (Chapter 3, In Vitro assays for
Mouse Lymphocyte Function 3.1-3.19; Chapter 7, Immunologic studies
in Humans); Takai et al., J. Immunol. 137:3494-3500, 1986; Takai et
al., J. Immunol. 140:508-512, 1988; Bertagnolli et al., J. Immunol.
149:3778-3783, 1992.
[0090] Dendritic cell-dependent assays (which will identify, among
others, proteins expressed by dendritic cells that activate naive
T-cells) include, without limitation, those described in: Guery et
al., J. Immunol. 134:536-544, 1995; Inaba et al., Journal of
Experimental Medicine 173:549-559, 1991; Macatonia et al., Journal
of Immunology 154:5071-5079, 1995; Porgador et al., Journal of
Experimental Medicine 182:255-260, 1995; Nair et al., Journal of
Virology 67:4062-4069, 1993; Huang et al., Science 264:961-965,
1994; Macatonia et al., Journal of Experimental Medicine
169:1255-1264, 1989; Bhardwaj et al., Journal of Clinical
Investigation 94:797-807, 1994; and Inaba et al., Journal of
Experimental Medicine 172:631-640, 1990.
[0091] Assays for lymphocyte survival/apoptosis (which will
identify, among others, proteins that prevent apoptosis after
superantigen induction and proteins that regulate lymphocyte
homeostasis) include, without limitation, those described in:
Darzynkiewicz et al., Cytometry 13:795-808, 1992; Gorczyca et al.,
Leukemia 7:659-670, 1993; Gorczyca et al., Cancer Research
53:1945-1951, 1993; Itoh et al., Cell 66:233-243, 1991; Zacharchuk,
Journal of Immunology 145:4037-4045, 1990; Zamai et al., Cytometry
14:891-897, 1993; Gorczyca et al., International Journal of
Oncology 1:639-648, 1992.
[0092] Assays for proteins that influence early steps of T-cell
commitment and development include, without limitation, those
described in: Antica et al., Blood 84:111-117, 1994; Fine et al.,
Cellular Immunology 155:111-122, 1994; Galy et al., Blood
85:2770-2778, 1995; Toki et al., Proc. Nat. Acad. Sci. USA
88:7548-7551, 1991.
[0093] Hematopoiesis Regulating Activity
[0094] A protein of the present invention may be useful in
regulation of hematopoiesis and, consequently, in the treatment of
myeloid or lymphoid cell deficiencies. Even marginal biological
activity in support of colony forming cells or of factor-dependent
cell lines indicates involvement in regulating hematopoiesis, e.g.
in supporting the growth and proliferation of erythroid progenitor
cells alone or in combination with other cytokines, thereby
indicating utility, for example, in treating various anemias or for
use in conjunction with irradiation/chemotherapy to stimulate the
production of erythroid precursors and/or erythroid cells; in
supporting the growth and proliferation of myeloid cells such as
granulocytes and monocytes/macrophages (i.e., traditional CSF
activity) useful, for example, in conjunction with chemotherapy to
prevent or treat consequent myelo-suppression; in supporting the
growth and proliferation of megakaryocytes and consequently of
platelets thereby allowing prevention or treatment of various
platelet disorders such as thrombocytopenia, and generally for use
in place of or complimentary to platelet transfusions; and/or in
supporting the growth and proliferation of hematopoietic stem cells
which are capable of maturing to any and all of the above-mentioned
hematopoietic cells and therefore find therapeutic utility in
various stem cell disorders (such as those usually treated with
transplantation, including, without limitation, aplastic anemia and
paroxysmal nocturnal hemoglobinuria), as well as in repopulating
the stem cell compartment post irradiation/chemotherapy, either
in-vivo or ex-vivo (i.e., in conjunction with bone marrow
transplantation or with peripheral progenitor cell transplantation
(homologous or heterologous)) as normal cells or genetically
manipulated for gene therapy.
[0095] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0096] Suitable assays for proliferation and differentiation of
various hematopoietic lines are cited above.
[0097] Assays for embryonic stem cell differentiation (which will
identify, among others, proteins that influence embryonic
differentiation hematopoiesis) include, without limitation, those
described in: Johansson et al. Cellular Biology 15:141-151, 1995;
Keller et al., Molecular and Cellular Biology 13:473-486, 1993;
McClanahan et al., Blood 81:2903-2915, 1993.
[0098] Assays for stem cell survival and differentiation (which
will identify, among others, proteins that regulate
lympho-hematopoiesis) include, without limitation, those described
in: Methylcellulose colony forming assays, Freshney, M. G. In
Culture of Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp.
265-268, Wiley-Liss, Inc., New York, N.Y. 1994; Hirayama et al.,
Proc. Natl. Acad. Sci. USA 89:5907-5911, 1992; Primitive
hematopoietic colony forming cells with high proliferative
potential, McNiece, I. K. and Briddell, R. A. In Culture of
Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 23-39,
Wiley-Liss, Inc., New York, N.Y. 1994; Neben et al., Experimental
Hematology 22:353-359, 1994; Cobblestone area forming cell assay,
Ploemacher, R. E. In Culture of Hematopoietic Cells. R. I.
Freshney, et al. eds. Vol pp. 1-21, Wiley-Liss, Inc., New York,
N.Y. 1994; Long term bone marrow cultures in the presence of
stromal cells, Spooncer, E., Dexter, M. and Allen, T. In Culture of
Hematopoietic Cells. R. I. Freshney, et al. eds. Vol pp. 163-179,
Wiley-Liss, Inc., New York, N.Y. 1994; Long term culture initiating
cell assay, Sutherland, H. J. In Culture of Hematopoietic Cells. R.
I. Freshney, et al. eds. Vol pp. 139-162, Wiley-Liss, Inc., New
York, N.Y. 1994.
[0099] Tissue Growth Activity
[0100] A protein of the present invention also may have utility in
compositions used for bone, cartilage, tendon, ligament and/or
nerve tissue growth or regeneration, as well as for wound healing
and tissue repair and replacement, and in the treatment of burns,
incisions and ulcers.
[0101] A protein of the present invention, which induces cartilage
and/or bone growth in circumstances where bone is not normally
formed, has application in the healing of bone fractures and
cartilage damage or defects in humans and other animals. Such a
preparation employing a protein of the invention may have
prophylactic use in closed as well as open fracture reduction and
also in the improved fixation of artificial joints. De novo bone
formation induced by an osteogenic agent contributes to the repair
of congenital, trauma induced, or oncologic resection induced
craniofacial defects, and also is useful in cosmetic plastic
surgery.
[0102] A protein of this invention may also be used in the
treatment of periodontal disease, and in other tooth repair
processes. Such agents may provide an environment to attract
bone-forming cells, stimulate growth of bone-forming cells or
induce differentiation of progenitors of bone-forming cells. A
protein of the invention may also be useful in the treatment of
osteoporosis or osteoarthritis, such as through stimulation of bone
and/or cartilage repair or by blocking inflammation or processes of
tissue destruction (collagenase activity, osteoclast activity,
etc.) mediated by inflammatory processes.
[0103] Another category of tissue regeneration activity that may be
attributable to the protein of the present invention is
tendon/ligament formation. A protein of the present invention,
which induces tendon/ligament-like tissue or other tissue formation
in circumstances where such tissue is not normally formed, has
application in the healing of tendon or ligament tears, deformities
and other tendon or ligament defects in humans and other animals.
Such a preparation employing a tendon/ligament-like tissue inducing
protein may have prophylactic use in preventing damage to tendon or
ligament tissue, as well as use in the improved fixation of tendon
or ligament to bone or other tissues, and in repairing defects to
tendon or ligament tissue. De novo tendon/ligament-like tissue
formation induced by a composition of the present invention
contributes to the repair of congenital, trauma induced, or other
tendon or ligament defects of other origin, and is also useful in
cosmetic plastic surgery for attachment or repair of tendons or
ligaments. The compositions of the present invention may provide an
environment to attract tendon- or ligament-forming cells, stimulate
growth of tendon- or ligament-forming cells, induce differentiation
of progenitors of tendon- or ligament-forming cells, or induce
growth of tendon/ligament cells or progenitors ex vivo for return
in vivo to effect tissue repair. The compositions of the invention
may also be useful in the treatment of tendinitis, carpal tunnel
syndrome and other tendon or ligament defects. The compositions may
also include an appropriate matrix and/or sequestering agent as a
carrier as is well known in the art.
[0104] The protein of the present invention may also be useful for
proliferation of neural cells and for regeneration of nerve and
brain tissue, i.e. for the treatment of central and peripheral
nervous system diseases and neuropathies, as well as mechanical and
traumatic disorders, which involve degeneration, death or trauma to
neural cells or nerve tissue. More specifically, a protein may be
used in the treatment of diseases of the peripheral nervous system,
such as peripheral nerve injuries, peripheral neuropathy and
localized neuropathies, and central nervous system diseases, such
as Alzheimer's, Parkinson's disease, Huntington's disease,
amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further
conditions which may be treated in accordance with the present
invention include mechanical and traumatic disorders, such as
spinal cord disorders, head trauma and cerebrovascular diseases
such as stroke. Peripheral neuropathies resulting from chemotherapy
or other medical therapies may also be treatable using a protein of
the invention.
[0105] Proteins of the invention may also be useful to promote
better or faster closure of non-healing wounds, including without
limitation pressure ulcers, ulcers associated with vascular
insufficiency, surgical and traumatic wounds, and the like.
[0106] It is expected that a protein of the present invention may
also exhibit activity for generation or regeneration of other
tissues, such as organs (including, for example, pancreas, liver,
intestine, kidney, skin, endothelium), muscle (smooth, skeletal or
cardiac) and vascular (including vascular endothelium) tissue, or
for promoting the growth of cells comprising such tissues. Part of
the desired effects may be by inhibition or modulation of fibrotic
scarring to allow normal tissue to regenerate. A protein of the
invention may also exhibit angiogenic activity.
[0107] A protein of the present invention may also be useful for
gut protection or regeneration and treatment of lung or liver
fibrosis, reperfusion injury in various tissues, and conditions
resulting from systemic cytokine damage.
[0108] A protein of the present invention may also be useful for
promoting or inhibiting differentiation of tissues described above
from precursor tissues or cells; or for inhibiting the growth of
tissues described above.
[0109] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0110] Assays for tissue generation activity include, without
limitation, those described in: International Patent Publication
No. WO95/16035 (bone, cartilage, tendon); International Patent
Publication No. WO95/05846 (nerve, neuronal); International Patent
Publication No. WO91/07491 (skin, endothelium).
[0111] Assays for wound healing activity include, without
limitation, those described in: Winter, Epidermal Wound Healing,
pps. 71-112 (Maibach, H I and Rovee, D T, eds.), Year Book Medical
Publishers, Inc., Chicago, as modified by Eaglstein and Mertz, J.
Invest. Dermatol 71:382-84 (1978).
[0112] Activin/Inhibin Activity
[0113] A protein of the present invention may also exhibit activin-
or inhibin-related activities. Inhibins are characterized by their
ability to inhibit the release of follicle stimulating hormone
(FSH), while activins and are characterized by their ability to
stimulate the release of follicle stimulating hormone (FSH). Thus,
a protein of the present invention, alone or in heterodimers with a
member of the inhibin .alpha. family, may be useful as a
contraceptive based on the ability of inhibins to decrease
fertility in female mammals and decrease spermatogenesis in male
mammals. Administration of sufficient amounts of other inhibins can
induce infertility in these mammals. Alternatively, the protein of
the invention, as a homodimer or as a heterodimer with other
protein subunits of the inhibin-.beta. group, may be useful as a
fertility inducing therapeutic, based upon the ability of activin
molecules in stimulating FSH release from cells of the anterior
pituitary. See, for example, U.S. Pat. No. 4,798,885. A protein of
the invention may also be useful for advancement of the onset of
fertility in sexually immature mammals, so as to increase the
lifetime reproductive performance of domestic animals such as cows,
sheep and pigs.
[0114] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0115] Assays for activin/inhibin activity include, without
limitation, those described in: Vale et al., Endocrinology
91:562-572, 1972; Ling et al., Nature 321:779-782, 1986; Vale et
al., Nature 321:776-779, 1986; Mason et al., Nature 318:659-663,
1985; Forage et al., Proc. Natl. Acad. Sci. USA 83:3091-3095,
1986.
[0116] Chemotactic/Chemokinetic Activity
[0117] A protein of the present invention may have chemotactic or
chemokinetic activity (e.g., act as a chemokine) for mammalian
cells, including, for example, monocytes, fibroblasts, neutrophils,
T-cells, mast cells, eosinophils, epithelial and/or endothelial
cells. Chemotactic and chemokinetic proteins can be used to
mobilize or attract a desired cell population to a desired site of
action. Chemotactic or chemokinetic proteins provide particular
advantages in treatment of wounds and other trauma to tissues, as
well as in treatment of localized infections. For example,
attraction of lymphocytes, monocytes or neutrophils to tumors or
sites of infection may result in improved immune responses against
the tumor or infecting agent.
[0118] A protein or peptide has chemotactic activity for a
particular cell population if it can stimulate, directly or
indirectly, the directed orientation or movement of such cell
population. Preferably, the protein or peptide has the ability to
directly stimulate directed movement of cells. Whether a particular
protein has chemotactic activity for a population of cells can be
readily determined by employing such protein or peptide in any
known assay for cell chemotaxis.
[0119] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0120] Assays for chemotactic activity (which will identify
proteins that induce or prevent chemotaxis) consist of assays that
measure the ability of a protein to induce the migration of cells
across a membrane as well as the ability of a protein to induce the
adhesion of one cell population to another cell population.
Suitable assays for movement and adhesion include, without
limitation, those described in: Current Protocols in Immunology, Ed
by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach,
W. Strober, Pub. Greene Publishing Associates and
Wiley-Interscience (Chapter 6.12, Measurement of alpha and beta
Chemokines 6.12.1-6.12.28; Taub et al. J. Clin. Invest.
95:1370-1376, 1995; Lind et al. APMIS 103:140-146, 1995; Muller et
al Eur. J. Immunol. 25: 1744-1748; Gruber et al. J. of Immunol.
152:5860-5867, 1994; Johnston et al. J. of Immunol. 153: 1762-1768,
1994.
[0121] Hemostatic and Thrombolytic Activity
[0122] A protein of the invention may also exhibit hemostatic or
thrombolytic activity. As a result, such a protein is expected to
be useful in treatment of various coagulation disorders (including
hereditary disorders, such as hemophilias) or to enhance
coagulation and other hemostatic events in treating wounds
resulting from trauma, surgery or other causes. A protein of the
invention may also be useful for dissolving or inhibiting formation
of thromboses and for treatment and prevention of conditions
resulting therefrom (such as, for example, infarction of cardiac
and central nervous system vessels (e.g., stroke).
[0123] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0124] Assay for hemostatic and thrombolytic activity include,
without limitation, those described in: Linet et al., J. Clin.
Pharmacol. 26:131-140, 1986; Burdick et al., Thrombosis Res.
45:413-419, 1987; Humphrey et al., Fibrinolysis 5:71-79 (1991);
Schaub, Prostaglandins 35:467-474, 1988.
[0125] Receptor/Ligand Activity
[0126] A protein of the present invention may also demonstrate
activity as receptors, receptor ligands or inhibitors or agonists
of receptor/ligand interactions. Examples of such receptors and
ligands include, without limitation, cytokine receptors and their
ligands, receptor kinases and their ligands, receptor phosphatases
and their ligands, receptors involved in cell-cell interactions and
their ligands (including without limitation, cellular adhesion
molecules (such as selecting, integrins and their ligands) and
receptor/ligand pairs involved in antigen presentation, antigen
recognition and development of cellular and humoral immune
responses). Receptors and ligands are also useful for screening of
potential peptide or small molecule inhibitors of the relevant
receptor/ligand interaction. A protein of the present invention
(including, without limitation, fragments of receptors and ligands)
may themselves be useful as inhibitors of receptor/ligand
interactions.
[0127] The activity of a protein of the invention may, among other
means, be measured by the following methods:
[0128] Suitable assays for receptor-ligand activity include without
limitation those described in:Current Protocols in Immunology, Ed
by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach,
W. Strober, Pub. Greene Publishing Associates and
Wiley-Interscience (Chapter 7.28, Measurement of Cellular Adhesion
under static conditions 7.28.1-7.28.22), Takai et al., Proc. Natl.
Acad. Sci. USA 84:6864-6868, 1987; Bierer et al., J. Exp. Med.
168:1145-1156, 1988; Rosenstein et al., J. Exp. Med. 169:149-160
1989; Stoltenborg et al., J. Immunol. Methods 175:59-68, 1994;
Stitt et al., Cell 80:661-670, 1995.
[0129] Anti-Inflammatory Activity
[0130] Proteins of the present invention may also exhibit
anti-inflammatory activity. The anti-inflammatory activity may be
achieved by providing a stimulus to cells involved in the
inflammatory response, by inhibiting or promoting cell-cell
interactions (such as, for example, cell adhesion), by inhibiting
or promoting chemotaxis of cells involved in the inflammatory
process, inhibiting or promoting cell extravasation, or by
stimulating or suppressing production of other factors which more
directly inhibit or promote an inflammatory response. Proteins
exhibiting such activities can be used to treat inflammatory
conditions including chronic or acute conditions), including
without limitation inflammation associated with infection (such as
septic shock, sepsis or systemic inflammatory response syndrome
(SIRS)), ischemia-reperfusion injury, endotoxin lethality,
arthritis, complement-mediated hyperacute rejection, nephritis,
cytokine or chemokine-induced lung injury, inflammatory bowel
disease, Crohn's disease or resulting from over production of
cytokines such as TNF or IL-1. Proteins of the invention may also
be useful to treat anaphylaxis and hypersensitivity to an antigenic
substance or material.
[0131] Tumor Inhibition Activity
[0132] In addition to the activities described above for
immunological treatment or prevention of tumors, a protein of the
invention may exhibit other anti-tumor activities. A protein may
inhibit tumor growth directly or indirectly (such as, for example,
via ADCC). A protein may exhibit its tumor inhibitory activity by
acting on tumor tissue or tumor precursor tissue, by inhibiting
formation of tissues necessary to support tumor growth (such as,
for example, by inhibiting angiogenesis), by causing production of
other factors, agents or cell types which inhibit tumor growth, or
by suppressing, eliminating or inhibiting factors, agents or cell
types which promote tumor growth.
[0133] Other Activities
[0134] A protein of the invention may also exhibit one or more of
the following additional activities or effects: inhibiting the
growth, infection or function of, or killing, infectious agents,
including, without limitation, bacteria, viruses, fungi and other
parasites; effecting (suppressing or enhancing) bodily
characteristics, including, without limitation, height, weight,
hair color, eye color, skin, fat to lean ratio or other tissue
pigmentation, or organ or body part size or shape (such as, for
example, breast augmentation or diminution, change in bone form or
shape); effecting biorhythms or caricadic cycles or rhythms;
effecting the fertility of male or female subjects; effecting the
metabolism, catabolism, anabolism, processing, utilization, storage
or elimination of dietary fat, lipid, protein, carbohydrate,
vitamins, minerals, cofactors or other nutritional factors or
component(s); effecting behavioral characteristics, including,
without limitation, appetite, libido, stress, cognition (including
cognitive disorders), depression (including depressive disorders)
and violent behaviors; providing analgesic effects or other pain
reducing effects; promoting differentiation and growth of embryonic
stem cells in lineages other than hematopoietic lineages; hormonal
or endocrine activity; in the case of enzymes, correcting
deficiencies of the enzyme and treating deficiency-related
diseases; treatment of hyperproliferative disorders (such as, for
example, psoriasis); immunoglobulin-like activity (such as, for
example, the ability to bind antigens or complement); and the
ability to act as an antigen in a vaccine composition to raise an
immune response against such protein or another material or entity
which is cross-reactive with such protein.
[0135] The following examples illustrate practice of the present
invention in recovering and characterizing human SDF-5 protein and
employing the DNA to recover other SDF-5 proteins, obtaining the
human proteins and expressing the proteins via recombinant
techniques.
EXAMPLE 1
Cloning of a Human Homologue to Murine SDF-5
[0136] The nucleotide sequence of murine SDF-5 (personal
communication, Professor Honjo) was used to query GenBank. Several
EST's whose DNA sequence had been were identified at either the 5'
or 3' end of the cDNA showed a high degree of identity with the
murine SDF-5. Some of the EST's were from human sources. The
various human EST's were aligned to the full-length murine SDF-5
nucleotide sequence, and it was determined that none of the clones
from which the EST sequences were derived contained the entire
coding sequence of SDF-5. The EST that aligned most 5' on the
murine SDF-5 nucleotide sequence was H14917. This EST represented a
5' end DNA sequence of a human cDNA from breast tissue. The
alignment with murine SDF-5 suggested that the human breast cDNA
represented by EST #H14917 was missing approximately 147
nucleotides of coding sequence at the 5' end.
[0137] In order to attempt to isolate a full-length derivative of
murine SDF-5, a biotinylated oligonucleotide probe
(5'-biotin-ATCGATGCCGTGGCACAGCTGC AGGTTG-3') (SEQ ID NO: 7) was
synthesized that represented the reverse complement of nucleotides
18 to 44 of the H14917 sequence. This probe was used in a solution
enrichment protocol with 5 separate human full-length cDNA
libraries made from the following tissues: adult lung, adult heart,
adult kidney, fetal brain, and mammary gland. After the enrichment,
about 60,000 colonies from each enriched library were plated onto
10 plates each, and subjected to standard colony hybridization
techniques using the same oligonucleotide as a probe after
labelling it with polynucleotide kinase and g-.sup.32P-ATP. Due to
a technical problem, only 4 plates (24,000 colonies) were plated
for the mammary gland library. Only the mammary gland library
appeared to contain cDNA clones that hybridized to the probe.
Twelve positive clones were picked, grown up and replated. These
replated positives were then hybridized once again to the same
probe to verify them and to assure their purity. All 12 of the
initial positives gave hybridization signals upon secondary
hybridization. Four of the candidates were subjected to DNA
sequencing. A single clone was chosen (isolate #4) which was in the
correct orientation, contained the entire coding sequence for human
SDF-5, and whose sequence was verified by comparison with other
isolates.
EXAMPLE 2
W-20 Bioassays
[0138] A. Description of W-20 Cells
[0139] Use of the W-20 bone marrow stromal cells as an indicator
cell line is based upon the conversion of these cells to
osteoblast-like cells after treatment with an osteogenic protein,
such as a BMP protein (Thies et al, Journal of Bone and Mineral
Research, 5:305 (1990); and Thies et al, Endocrinology, 130:1318
(1992)). Specifically, W-20 cells are a clonal bone marrow stromal
cell line derived from adult mice by researchers in the laboratory
of Dr. D. Nathan, Children's Hospital, Boston, Mass. Treatment of
W-20 cells with certain BMP proteins results in (1) increased
alkaline phosphatase production, (2) induction of PTH stimulated
cAMP, and (3) induction of osteocalcin synthesis by the cells.
While (1) and (2) represent characteristics associated with the
osteoblast phenotype, the ability to synthesize osteocalcin is a
phenotypic property only displayed by mature osteoblasts.
Furthermore, to date we have observed conversion of W-20 stromal
cells to osteoblast-like cells only upon treatment with BMPs. In
this manner, the in vitro activities displayed by BMP treated W-20
cells correlate with the in vivo bone forming activity known for
BMPs.
[0140] Below two in vitro assays useful in comparison of BMP
activities of novel osteoinductive molecules are described.
[0141] B. W-20 Alkaline Phosphatase Assay Protocol
[0142] W-20 cells are plated into 96 well tissue culture plates at
a density of 10,000 cells per well in 200 .mu.l of media (DME with
10% heat inactivated fetal calf serum, 2 mM glutamine and 100
Units/ml penicillin+100 .mu.g/ml streptomycin. The cells are
allowed to attach overnight in a 95% air, 5% CO.sub.2 incubator at
37.degree. C. The 200 .mu.l of media is removed from each well with
a multichannel pipettor and replaced with an equal volume of test
sample delivered in DME with 10% heat inactivated fetal calf serum,
2 mM glutamine and 1% penicillin-streptomycin. Test substances are
assayed in triplicate. The test samples and standards are allowed a
24 hour incubation period with the W-20 indicator cells. After the
24 hours, plates are removed from the 37.degree. C. incubator and
the test media are removed from the cells. The W-20 cell layers are
washed 3 times with 200 .mu.l per well of calcium/magnesium free
phosphate buffered saline and these washes are discarded. 50 .mu.l
of glass distilled water is added to each well and the assay plates
are then placed on a dry ice/ethanol bath for quick freezing. Once
frozen, the assay plates are removed from the dry ice/ethanol bath
and thawed at 37.degree. C. This step is repeated 2 more times for
a total of 3 freeze-thaw procedures. Once complete, the membrane
bound alkaline phosphatase is available for measurement. 50 .mu.l
of assay mix (50 mM glycine, 0.05% Triton X-100, 4 mM MgCl.sub.2, 5
mM p-nitrophenol phosphate, pH=10.3) is added to each assay well
and the assay plates are then incubated for 30 minutes at
37.degree. C. in a shaking waterbath at 60 oscillations per minute.
At the end of the 30 minute incubation, the reaction is stopped by
adding 100 .mu.l of 0.2 N NaOH to each well and placing the assay
plates on ice. The spectrophotometric absorbance for each well is
read at a wavelength of 405 nanometers. These values are then
compared to known standards to give an estimate of the alkaline
phosphatase activity in each sample. For example, using known
amounts of p-nitrophenol phosphate, absorbance values are
generated. This is shown in Table I. TABLE-US-00004 TABLE 1
Absorbance Values for Known Standards of P-Nitrophenol Phosphate
P-nitrophenol Mean absorbance phosphate umoles (405 nm) 0.000 0
0.006 0.261 +/- .024 0.012 0.521 +/- .031 0.018 0.797 +/- .063
0.024 1.074 +/- .061 0.030 1.305 +/- .083
[0143] Absorbance values for known amounts of BMPs can be
determined and converted to .mu.moles of p-nitrophenol phosphate
cleaved per unit time as shown in Table II. TABLE-US-00005 TABLE II
Alkaline Phosphatase Values for W-20 Cells Treating with BMP-2
BMP-2 concentration Absorbance Reading umoles substrate ng/ml 405
nmeters per hour 0 0.645 0.024 1.56 0.696 0.026 3.12 0.765 0.029
6.25 0.923 0.036 12.50 1.121 0.044 25.0 1.457 0.058 50.0 1.662
0.067 100.0 1.977 0.080
[0144] These values are then used to compare the activities of
known amounts of SDF-5 to BMP-2.
[0145] C. Osteocalcin RIA Protocol
[0146] W-20 cells are plated at 10.sup.6 cells per well in 24 well
multiwell tissue culture dishes in 2 mls of DME containing 10% heat
inactivated fetal calf serum, 2 mM glutamine. The cells are allowed
to attach overnight in an atmosphere of 95% air 5% CO.sub.2 at
37.degree. C. The next day the medium is changed to DME containing
10% fetal calf serum, 2 mM glutamine and the test substance in a
total volume of 2 ml. Each test substance is administered to
triplicate wells. The test substances are incubated with the W-20
cells for a total of 96 hours with replacement at 48 hours by the
same test medias. At the end of 96 hours, 50 .mu.l of the test
media is removed from each well and assayed for osteocalcin
production using a radioimmunoassay for mouse osteocalcin. The
details of the assay are described in the kit manufactured by
Biomedical Technologies Inc., 378 Page Street, Stoughton, Mass.
0.02072. Reagents for the assay are found as product numbers BT-431
(mouse osteocalcin standard), BT-432 (Goat anti-mouse Osteocalcin),
BT-431R (iodinated mouse osteocalcin), BT-415 (normal goat serum)
and BT-414 (donkey anti goat IgG). The RIA for osteocalcin
synthesized by W-20 cells in response to BMP treatment is carried
out as described in the protocol provided by the manufacturer.
[0147] The values obtained for the test samples are compared to
values for known standards of mouse osteocalcin and to the amount
of osteocalcin produced by W-20 cells in response to challenge with
known amounts of BMP-2. The values for BMP-2 induced osteocalcin
synthesis by W-20 cells is shown in Table III. TABLE-US-00006 TABLE
III Osteocalcin Synthesis by W-20 Cells BMP-2 Concentration
Osteocalcin Synthesis ng/ml ng/well 0 0.8 2 0.9 4 0.8 8 2.2 16 2.7
31 3.2 62 5.1 125 6.5 250 8.2 500 9.4 1000 10.0
EXAMPLE 3
Rosen Modified Sampath-Reddi Assay
[0148] A modified version of the rat bone formation assay described
in Sampath and Reddi, Proc. Natl. Acad. Sci. USA, 80:6591-6595
(1983) is used to evaluate bone and/or cartilage and/or other
connective tissue activity of novel osteoinductive or
chondroinductive proteins. This modified assay is herein called the
Rosen-modified Sampath-Reddi assay. The ethanol precipitation step
of the Sampath-Reddi procedure is replaced by dialyzing (if the
composition is a solution) or diafiltering (if the composition is a
suspension) the fraction to be assayed against water. The solution
or suspension is then equilibrated to 0.1% TFA. The resulting
solution is added to 20 mg of rat matrix. A mock rat matrix sample
not treated with the protein serves as a control. This material is
frozen and lyophilized and the resulting powder enclosed in #5
gelatin capsules. The capsules are implanted subcutaneously in the
abdominal thoracic area of 21-49 day old male Long Evans rats. The
implants are removed after 7-14 days. Half of each implant is used
for alkaline phosphatase analysis (see, Reddi et al, Proc. Natl.
Acad. Sci., 69:1601 (1972)).
[0149] The other half of each implant is fixed and processed for
histological analysis. 1_m glycolmethacrylate sections are stained
with Von Kossa and acid fuschin to score the amount of induced bone
and cartilage and other connective tissue formation present in each
implant. The terms +1 through +5 represent the area of each
histological section of an implant occupied by new bone and/or
cartilage cells and matrix. A score of +5 indicates that greater
than 50% of the implant is new bone and/or cartilage produced as a
direct result of protein in the implant. A score of +4, +3, +2, and
+1 would indicate that greater than 40%, 30%, 20% and 10%
respectively of the implant contains new cartilage and/or bone.
[0150] Alternatively, the implants are inspected for the appearance
of tissue resembling embryonic tendon, which is easily recognized
by the presence of dense bundles of fibroblasts oriented in the
same plane and packed tightly together. (Tendon/ligament-like
tissue is described, for example, in Ham and Cormack, Histology (JB
Lippincott Co. (1979), pp. 367-369, the disclosure of which is
hereby incorporated by reference). These findings may be reproduced
in additional assays in which tendon/ligament-like tissues are
observed in the SDF-5 protein containing implants. The SDF-5
proteins of this invention may be assessed for activity on this
assay.
EXAMPLE 4
Expression of SDF-5
[0151] In order to produce murine, human or other mammalian SDF-5
proteins, the DNA encoding it is transferred into an appropriate
expression vector and introduced into mammalian cells or other
preferred eukaryotic or prokaryotic hosts by conventional genetic
engineering techniques. The preferred expression system for
biologically active recombinant human SDF-5 is contemplated to be
stably transformed mammalian cells.
[0152] One skilled in the art can construct mammalian expression
vectors by employing the sequence of SEQ ID NO: 1, or other DNA
sequences encoding SDF-5 protein or other modified sequences and
known vectors, such as pCD (Okayama et al., Mol. Cell Biol.,
2:161-170 (1982)), pJL3, pJL4 (Gough et al., EMBO J., 4:645-653
(1985)) and pMT2 CXM.
[0153] The mammalian expression vector pMT2 CXM is a derivative of
p91023(b) (Wong et al., Science 228:810-815, 1985) differing from
the latter in that it contains the ampicillin resistance gene in
place of the tetracycline resistance gene and further contains a
XhoI site for insertion of cDNA clones. The functional elements of
pMT2 CXM have been described (Kaufman, R. J., 1985, Proc. Natl.
Acad. Sci. USA 82:689-693) and include the adenovirus VA genes, the
SV40 origin of replication including the 72 bp enhancer, the
adenovirus major late promoter including a 5' splice site and the
majority of the adenovirus tripartite leader sequence present on
adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert,
the SV40 early polyadenylation site (SV40), and pBR322 sequences
needed for propagation in E. coli.
[0154] Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF,
which has been deposited with the American Type Culture Collection
(ATCC), Rockville, Md. (USA) under accession number ATCC 67122.
EcoRI digestion excises the cDNA insert present in pMT2-VWF,
yielding pMT2 in linear form which can be ligated and used to
transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid
pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then
constructed using loopout/in mutagenesis (Morinaga, et al.,
Biotechnology 84: 636 (1984)). This removes bases 1075 to 1145
relative to the Hind III site near the SV40 origin of replication
and enhancer sequences of pMT2. In addition it inserts the
following sequence: TABLE-US-00007 5'-PO-CATGGGCAGCTCGAG-3' (SEQ ID
NO:4)
at nucleotide 1145. This sequence contains the recognition site for
the restriction endonuclease Xho I. A derivative of pMT2CXM, termed
pMT23, contains recognition sites for the restriction endonucleases
PstI, Eco RI, SalI and XhoI. Plasmid pMT2 CXM and pMT23 DNA may be
prepared by conventional methods.
[0155] pEMC2.sub.--1 derived from pMT21 may also be suitable in
practice of the invention. pMT21 is derived from pMT2 which is
derived from pMT2-VWF. As described above EcoRI digestion excises
the cDNA insert present in pMT-VWF, yielding pMT2 in linear form
which can be ligated and used to transform E. Coli HB 101 or DH-5
to ampicillin resistance. Plasmid pMT2 DNA can be prepared by
conventional methods.
[0156] pMT21 is derived from pMT2 through the following two
modifications. First, 76 bp of the 5' untranslated region of the
DHFR cDNA including a stretch of 19 G residues from G/C tailing for
cDNA cloning is deleted. In this process, a XhoI site is inserted
to obtain the following sequence immediately upstream from DHFR:
TABLE-US-00008 (SEQ ID NO:5)
5'-CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' PstI Eco RI XhoI
Second, a unique ClaI site is introduced by digestion with EcoRV
and XbaI, treatment with Klenow fragment of DNA polymerase I, and
ligation to a ClaI linker (CATCGATG). This deletes a 250 bp segment
from the adenovirus associated RNA (VAI) region but does not
interfere with VAI RNA gene expression or function. pMT21 is
digested with EcoRI and XhoI, and used to derive the vector pEMC2B
1.
[0157] A portion of the EMCV leader is obtained from pMT2-ECAT1 (S.
K. Jung, et al, J. Virol 63:1651-1660 (1989)) by digestion with Eco
RI and PstI, resulting in a 2752 bp fragment. This fragment is
digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which
is purified by electrophoresis on low melting agarose gel. A 68 bp
adapter and its complementary strand are synthesized with a 5' TaqI
protruding end and a 3' XhoI protruding end which has the following
sequence: TABLE-US-00009 TaqI (SEQ ID NO:6)
5'CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCAGGGGGACGTGGTTTT
CCTTTGAAAAACACGATTGC-3' XhoI
This sequence matches the EMC virus leader sequence from nucleotide
763 to 827. It also changes the ATG at position 10 within the EMC
virus leader to an ATT and is followed by a XhoI site. A three way
ligation of the pMT21 Eco RI-16hoI fragment, the EMC virus
EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter
TaqI-16hoI adapter resulting in the vector pEMC2131.
[0158] This vector contains the SV40 origin of replication and
enhancer, the adenovirus major late promoter, a cDNA copy of the
majority of the adenovirus tripartite leader sequence, a small
hybrid intervening sequence, an SV40 polyadenylation signal and the
adenovirus VA I gene, DHFR and _-lactamase markers and an EMC
sequence, in appropriate relationships to direct the high level
expression of the desired cDNA in mammalian cells.
[0159] The construction of vectors may involve modification of the
SDF-5 DNA sequences. For instance, SDF-5 cDNA can be modified by
removing the non-coding nucleotides on the 5' and 3' ends of the
coding region. The deleted non-coding nucleotides may or may not be
replaced by other sequences known to be beneficial for expression.
These vectors are transformed into appropriate host cells for
expression of SDF-5 proteins. Additionally, the sequence of SEQ ID
NO: 1 or other sequences encoding SDF-5 proteins can be manipulated
to express a mature SDF-5 protein by deleting SDF-5 propeptide
sequences and replacing them with sequences encoding the complete
propeptides of other secreted proteins.
[0160] One skilled in the art can manipulate the sequences of SEQ
ID NO: 1 by eliminating or replacing the mammalian regulatory
sequences flanking the coding sequence with bacterial sequences to
create bacterial vectors for intracellular or extracellular
expression by bacterial cells. For example, the coding sequences
could be further manipulated (e.g. ligated to other known linkers
or modified by deleting non-coding sequences therefrom or altering
nucleotides therein by other known techniques). The modified SDF-5
coding sequence could then be inserted into a known bacterial
vector using procedures such as described in T. Taniguchi et al.,
Proc. Natl. Acad. Sci. USA, 77:5230-5233 (1980). This exemplary
bacterial vector could then be transformed into bacterial host
cells and a SDF-5 protein expressed thereby. For a strategy for
producing extracellular expression of SDF-5 proteins in bacterial
cells, see, e.g. European patent application EPA 177,343.
[0161] Similar manipulations can be performed for the construction
of an insect vector (See, e.g. procedures described in published
European patent application 155,476) for expression in insect
cells. A yeast vector could also be constructed employing yeast
regulatory sequences for intracellular or extracellular expression
of the factors of the present invention by yeast cells. (See, e.g.,
procedures described in published PCT application WO86/00639 and
European patent application EPA 123,289).
[0162] A method for producing high levels of a SDF-5 protein of the
invention in mammalian cells may involve the construction of cells
containing multiple copies of the heterologous SDF-5 gene. The
heterologous gene is linked to an amplifiable marker, e.g. the
dihydrofolate reductase (DHFR) gene for which cells containing
increased gene copies can be selected for propagation in increasing
concentrations of methotrexate (MTX) according to the procedures of
Kaufinan and Sharp, J. Mol. Biol., 159:601-629 (1982). This
approach can be employed with a number of different cell types.
[0163] For example, a plasmid containing a DNA sequence for a SDF-5
protein of the invention in operative association with other
plasmid sequences enabling expression thereof and the DHFR
expression plasmid pAdA26SV(A)3 (Kaufinan and Sharp, Mol. Cell.
Biol., 2:1304 (1982)) can be co-introduced into DHFR-deficient CHO
cells, DUKX-BII, by various methods including calcium phosphate
coprecipitation and transfection, electroporation or protoplast
fusion. DHFR expressing transformants are selected for growth in
alpha media with dialyzed fetal calf serum, and subsequently
selected for amplification by growth in increasing concentrations
of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5 uM MTX) as
described in Kaufman et al., Mol Cell Biol., 5:1750 (1983).
Transformants are cloned, and biologically active SDF-5 expression
is monitored by the Rosen-modified Sampath-Reddi rat bone formation
assay described above in Example 3. SDF-5 protein expression should
increase with increasing levels of MTX resistance. SDF-5
polypeptides are characterized using standard techniques known in
the art such as pulse labeling with .sup.35S methionine or cysteine
and polyacrylamide gel electrophoresis. Similar procedures can be
followed to produce other related proteins.
EXAMPLE 5
Biological Activity of Expressed SDF-5
[0164] To measure the biological activity of the expressed SDF-5
proteins obtained in Example 4 above, the proteins are recovered
from the cell culture and purified by isolating the SDF-5 proteins
from other proteinaceous materials with which they are co-produced
as well as from other contaminants. The purified protein may be
assayed in accordance with the rat bone formation assay described
in Example 3 and other assays described herein.
[0165] Purification is carried out using standard techniques known
to those skilled in the art.
[0166] Protein analysis is conducted using standard techniques such
as SDS-PAGE acrylamide (Laemmli, Nature 227:680 (1970)) stained
with silver (Oakley, et al. Anal. Biochem. 105:361 (1980)) and by
immunoblot (Towbin, et al. Proc. Natl. Acad. Sci. USA 76:4350
(1979)).
EXAMPLE 6
[0167] Using Northern analysis, SDF-5 proteins can be tested for
their effects on various cell lines. Suitable cell lines include
cell lines derived from E13 mouse limb buds. After 10 days of
treatment with SDF-5 protein, the cell phenotype is examined
histologically for indications of tissue differentiation. In
addition, Northern analysis of mRNA from SDF-5 protein treated
cells can be performed for various markers including one or more of
the following markers for bone, cartilage and/or tendon/ligament,
as described in Table IV: TABLE-US-00010 TABLE IV Marker Bone
Cartilage Tendon/Ligament Osteocalcin + - - Alkaline Phosphatase +
- - Proteoglycan Core Protein +/-.sup.1 + +.sup.2 Collagen Type I +
+ + Collagen Type II +/-.sup.1 + +.sup.2 Decorin + + + Elastin
+/-.sup.3 ? + .sup.1Marker seen early, marker not seen as mature
bone tissue forms .sup.2Marker depends upon site of tendon;
strongest at bone interface .sup.3Marker seen at low levels
EXAMPLE 7
Expression Analysis
[0168] In situ hybridization was used to localize SDF-5 mRNA in
sections 10.5-15.5 dpc mouse embryos. SDF-5 was expressed in the
developing joints of the appendicular skeleton and in some tendons
and ligaments. No expression was detected in the bones of the axial
or appendicular skeleton or in muscle. These obvious observations
strongly implicated SDF-5 in connective tissue formation. From
these results, it seemed most likely that cartilage formation would
be regulated by SDF-5, and this information was the basis for
evaluating this protein using in vitro assays.
In Vitro Activity
[0169] Murine SDF-5 was expressed in CHO cells. MLB13MYC-clone 14
cells were grown to confluence and treated with either SDF-5,
BMP-2, a combination of SDF-5 and BMP-2, or untreated.
SDF-5-containing CHO conditioned media was used at a 1:20 dilution
(.about.10 ng/ml final concentration), and mock conditioned media
from CHO cells was added to BMP-2 and untreated cell cultures,
BMP-2 was used at 100 ng/ml. After four days, RNA was harvested and
gene expression analyzed by a GeneChip 50 Scanner (Affymetrix). In
untreated or SDF-5 treated cells there was no detectable expression
of genes characteristic of a bone or cartilage phenotype. BMP-2
induced the expression of hypertrophic cartilage and bone marker
genes, together with low cartilaginous markers. In cells treated
with a combination of both SDF-5 and BMP-2 bone (Osteocalcin;
alkaline phosphatase; PTH/PTHrP receptor) and hypertrophic
cartilage markers (Type X collagen) were significantly decreased or
absent, and markers for cartilage (Collagen Types II and IX;
decorin; aggrecan) were increased, compared with BMP-2 alone. This
effect is similar to that previously observed for combinations of
PTHrP and BMP-2, except there seems to be a greater enhancement of
cartilage phenotype with the SDF-5 combination.
EXAMPLE 8
Embryonic Stem Cell Assay
[0170] In order to assay the effects of the SDF-5 proteins of the
present invention, it is possible to assay the growth and
differentiation effects in vitro on a number of available embryonic
stem cell lines. One such cell line is ES-E14TG2, which is
available from the American Type Culture Collection in Rockville,
Md.
[0171] In order to conduct the assay, cells may be propagated in
the presence of 100 units of LIF to keep them in an
undifferentiated state. Assays are setup by first removing the LIF
and aggregating the cells in suspension, in what is known as
embryoid bodies. After 3 days the embryoid bodies are plated on
gelatin coated plates (12 well plates for PCR analysis, 24 well
plates for immunocytochemistry) and treated with the proteins to be
assayed. Cells are supplied with nutrients and treated with the
protein factor every 2-3 days. Cells may be adapted so that assays
may be conducted in media supplemented with 15% Fetal Bovine Serum
(FBS) or with CDM defined media containing much lower amounts of
FBS.
[0172] At the end of the treatment period (ranging from 7-21 days)
RNA is harvested from the cells and analyzed by quantitative
multiplex PCR for the following markers: Brachyury, a mesodermal
marker, AP-2, an ectodermal marker, and HNF-3.alpha. an endodermal
marker. Through immunocytochemistry, it is also possible to detect
the differentiation of neuronal cells (glia and neurons), muscle
cells (cardiomyocytes, skeletal and smooth muscle), and various
other phenotype markers such as proteoglycan core protein
(cartilage), and cytokeratins (epidermis). Since these cells have a
tendency to differentiate autonomously when LIF is removed, the
results are always quantitated by comparison to an untreated
control.
[0173] The foregoing descriptions detail presently preferred
embodiments of the present invention. Numerous modifications and
variations in practice thereof are expected to occur to those
skilled in the art upon consideration of these descriptions. Those
modifications and variations are believed to be encompassed within
the claims appended hereto.
Sequence CWU 1
1
7 1 2027 DNA Homo sapiens 1 gaattcggcc ttcatggcct agctcattct
gctcccccgg gtcggagccc cccggagctg 60 cgcgcgggct tgcagcgcct
cgcccgcgct cctcccggtg tcccgcttct ccgcgcccca 120 gccgccggct
gccagctttt cggggccccg agtcgcaccc agcgaagaga gcgggcccgg 180
gacaagctcg aactccggcc gcctcgccct tccccggctc cgctccctct gccccctcgg
240 ggtcgcgcgc ccacgatgct gcagggccct ggctcgctgc tgctgctctt
cctcgcctcg 300 cactgctgcc tgggctcggc gcgcgggctc ttcctctttg
gccagcccga cttctcctac 360 aagcgcagca attgcaagcc catcccggcc
aacctgcagc tgtgccacgg catcgaatac 420 cagaacatgc ggctgcccaa
cctgctgggc cacgagacca tgaaggaggt gctggagcag 480 gccggcgctt
ggatcccgct ggtcatgaag cagtgccacc cggacaccaa gaagttcctg 540
tgctcgctct tcgcccccgt ctgcctcgat gacctagacg agaccatcca gccatgccac
600 tcgctctgcg tgcaggtgaa ggaccgctgc gccccggtca tgtccgcctt
cggcttcccc 660 tggcccgaca tgcttgagtg cgaccgtttc ccccaggaca
acgacctttg catccccctc 720 gctagcagcg accacctcct gccagccacc
gaggaagctc caaaggtatg tgaagcctgc 780 aaaaataaaa atgatgatga
caacgacata atggaaacgc tttgtaaaaa tgattttgca 840 ctgaaaataa
aagtgaagga gataacctac atcaaccgag ataccaaaat catcctggag 900
accaagagca agaccattta caagctgaac ggtgtgtccg aaagggacct gaagaaatcg
960 gtgctgtggc tcaaagacag cttgcagtgc acctgtgagg agatgaacga
catcaacgcg 1020 ccctatctgg tcatgggaca gaaacagggt ggggagctgg
tgatcacctc ggtgaagcgg 1080 tggcagaagg ggcagagaga gttcaagcgc
atctcccgca gcatccgcaa gctgcagtgc 1140 tagtcccggc atcctgatgg
ctccgacagg cctgctccag agcacggctg accatttctg 1200 ctccgggatc
tcagctcccg ttccccaagc acactcctag ctgctccagt ctcagcctgg 1260
gcagcttccc cctgcctttt gcacgtttgc atccccagca tttcctgagt tataaggcca
1320 caggagtgga tagctgtttt cacctaaagg aaaagcccac ccgaatcttg
tagaaatatt 1380 caaactaata aaatcatgaa tatttttatg aagtttaaaa
atagctcact ttaaagctag 1440 ttttgaatag gtgcaactgt gacttgggtc
tggttggttg ttgtttgttg ttttgagtca 1500 gctgattttc acttcccact
gaggttgtca taacatgcaa attgcttcaa ttttctctgt 1560 ggcccaaact
tgtgggtcac aaaccctgtt gagataaagc tggctgttat ctcaacatct 1620
tcatcagctc cagactgaga ctcagtgtct aagtcttaca acaattcatc attttatacc
1680 ttcaatggga acttaaactg ttacatgtat cacattccag ctacaatact
tccatttatt 1740 agaagcacat taaccatttc tatagcatga tttcttcaag
taaaaggcaa aagatataaa 1800 ttttataatt gacttgagta ctttaagcct
tgtttaaaac atttcttact taacttttgc 1860 aaattaaacc cattgtagct
tacctgtaat atacatagta gtttaccttt aaaagttgta 1920 aaaatattgc
tttaaccaac actgtaaata tttcagataa acattatatt cttgtatata 1980
aactttacat cctgttttac ctaaaaaaaa aaaaaaaaag cggccgc 2027 2 295 PRT
Homo sapiens 2 Met Leu Gln Gly Pro Gly Ser Leu Leu Leu Leu Phe Leu
Ala Ser His 1 5 10 15 Cys Cys Leu Gly Ser Ala Arg Gly Leu Phe Leu
Phe Gly Gln Pro Asp 20 25 30 Phe Ser Tyr Lys Arg Ser Asn Cys Lys
Pro Ile Pro Ala Asn Leu Gln 35 40 45 Leu Cys His Gly Ile Glu Tyr
Gln Asn Met Arg Leu Pro Asn Leu Leu 50 55 60 Gly His Glu Thr Met
Lys Glu Val Leu Glu Gln Ala Gly Ala Trp Ile 65 70 75 80 Pro Leu Val
Met Lys Gln Cys His Pro Asp Thr Lys Lys Phe Leu Cys 85 90 95 Ser
Leu Phe Ala Pro Val Cys Leu Asp Asp Leu Asp Glu Thr Ile Gln 100 105
110 Pro Cys His Ser Leu Cys Val Gln Val Lys Asp Arg Cys Ala Pro Val
115 120 125 Met Ser Ala Phe Gly Phe Pro Trp Pro Asp Met Leu Glu Cys
Asp Arg 130 135 140 Phe Pro Gln Asp Asn Asp Leu Cys Ile Pro Leu Ala
Ser Ser Asp His 145 150 155 160 Leu Leu Pro Ala Thr Glu Glu Ala Pro
Lys Val Cys Glu Ala Cys Lys 165 170 175 Asn Lys Asn Asp Asp Asp Asn
Asp Ile Met Glu Thr Leu Cys Lys Asn 180 185 190 Asp Phe Ala Leu Lys
Ile Lys Val Lys Glu Ile Thr Tyr Ile Asn Arg 195 200 205 Asp Thr Lys
Ile Ile Leu Glu Thr Lys Ser Lys Thr Ile Tyr Lys Leu 210 215 220 Asn
Gly Val Ser Glu Arg Asp Leu Lys Lys Ser Val Leu Trp Leu Lys 225 230
235 240 Asp Ser Leu Gln Cys Thr Cys Glu Glu Met Asn Asp Ile Asn Ala
Pro 245 250 255 Tyr Leu Val Met Gly Gln Lys Gln Gly Gly Glu Leu Val
Ile Thr Ser 260 265 270 Val Lys Arg Trp Gln Lys Gly Gln Arg Glu Phe
Lys Arg Ile Ser Arg 275 280 285 Ser Ile Arg Lys Leu Gln Cys 290 295
3 275 PRT Homo sapiens 3 Ser Ala Arg Gly Leu Phe Leu Phe Gly Gln
Pro Asp Phe Ser Tyr Lys 1 5 10 15 Arg Ser Asn Cys Lys Pro Ile Pro
Ala Asn Leu Gln Leu Cys His Gly 20 25 30 Ile Glu Tyr Gln Asn Met
Arg Leu Pro Asn Leu Leu Gly His Glu Thr 35 40 45 Met Lys Glu Val
Leu Glu Gln Ala Gly Ala Trp Ile Pro Leu Val Met 50 55 60 Lys Gln
Cys His Pro Asp Thr Lys Lys Phe Leu Cys Ser Leu Phe Ala 65 70 75 80
Pro Val Cys Leu Asp Asp Leu Asp Glu Thr Ile Gln Pro Cys His Ser 85
90 95 Leu Cys Val Gln Val Lys Asp Arg Cys Ala Pro Val Met Ser Ala
Phe 100 105 110 Gly Phe Pro Trp Pro Asp Met Leu Glu Cys Asp Arg Phe
Pro Gln Asp 115 120 125 Asn Asp Leu Cys Ile Pro Leu Ala Ser Ser Asp
His Leu Leu Pro Ala 130 135 140 Thr Glu Glu Ala Pro Lys Val Cys Glu
Ala Cys Lys Asn Lys Asn Asp 145 150 155 160 Asp Asp Asn Asp Ile Met
Glu Thr Leu Cys Lys Asn Asp Phe Ala Leu 165 170 175 Lys Ile Lys Val
Lys Glu Ile Thr Tyr Ile Asn Arg Asp Thr Lys Ile 180 185 190 Ile Leu
Glu Thr Lys Ser Lys Thr Ile Tyr Lys Leu Asn Gly Val Ser 195 200 205
Glu Arg Asp Leu Lys Lys Ser Val Leu Trp Leu Lys Asp Ser Leu Gln 210
215 220 Cys Thr Cys Glu Glu Met Asn Asp Ile Asn Ala Pro Tyr Leu Val
Met 225 230 235 240 Gly Gln Lys Gln Gly Gly Glu Leu Val Ile Thr Ser
Val Lys Arg Trp 245 250 255 Gln Lys Gly Gln Arg Glu Phe Lys Arg Ile
Ser Arg Ser Ile Arg Lys 260 265 270 Leu Gln Cys 275 4 15 DNA
Artificial Sequences synthesized to include an Xho I site and
inserted at nucleotide 1145 of vector pMT2 CXM 4 catgggcagc tcgag
15 5 34 DNA Artificial Sequences synthesized to include an Xho I
site and inserted upstream from the DHFR cDNA in vector pMT21 5
ctgcaggcga gcctgaattc ctcgagccat catg 34 6 68 DNA Artificial
adapter synthesized with a 5' TaqI protruding end and a 3' XhoI
protruding end 6 cgaggttaaa aaacgtctag gccccccgaa ccacggggac
gtggttttcc tttgaaaaac 60 acgattgc 68 7 28 DNA Artificial 5' Probe 7
atcgatgccg tggcacagct gcaggttg 28
* * * * *