U.S. patent application number 11/233507 was filed with the patent office on 2006-05-11 for modulation of exon recognition in pre-mrna by interfering with the secondary rna structure.
This patent application is currently assigned to Academisch Ziekenhuis Leiden. Invention is credited to Annemieke Aartsma-Rus, Johannes Theodorus den Dunnen, Judith Christina Theodora van Deutekom, Garrit-Jan Boudewijn van Ommen.
Application Number | 20060099616 11/233507 |
Document ID | / |
Family ID | 33028995 |
Filed Date | 2006-05-11 |
United States Patent
Application |
20060099616 |
Kind Code |
A1 |
van Ommen; Garrit-Jan Boudewijn ;
et al. |
May 11, 2006 |
Modulation of exon recognition in pre-mRNA by interfering with the
secondary RNA structure
Abstract
The invention provides a method for generating an
oligonucleotide with which an exon may be skipped in a pre-mRNA and
thus excluded from a produced mRNA thereof. Further provided are
methods for altering the secondary structure of an mRNA to
interfere with splicing processes and uses of the oligonucleotides
and methods in the treatment of disease. Further provided are
pharmaceutical compositions and methods and means for inducing
skipping of several exons in a pre-mRNA.
Inventors: |
van Ommen; Garrit-Jan
Boudewijn; (Amsterdam, NL) ; van Deutekom; Judith
Christina Theodora; (Dordrecht, NL) ; den Dunnen;
Johannes Theodorus; (Rotterdam, NL) ; Aartsma-Rus;
Annemieke; (Leiden, NL) |
Correspondence
Address: |
TRASK BRITT
P.O. BOX 2550
SALT LAKE CITY
UT
84110
US
|
Assignee: |
Academisch Ziekenhuis
Leiden
Leiden
NL
|
Family ID: |
33028995 |
Appl. No.: |
11/233507 |
Filed: |
September 21, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/NL04/00196 |
Mar 22, 2004 |
|
|
|
11233507 |
Sep 21, 2005 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.15; 435/91.2 |
Current CPC
Class: |
C12Q 1/6883 20130101;
C12N 15/85 20130101; C12N 2320/30 20130101; C12N 2310/111 20130101;
A61K 38/00 20130101; A61K 48/0016 20130101; C12N 2310/314 20130101;
C12N 2320/33 20130101; C12N 2310/31 20130101; C12N 2310/3231
20130101; C12N 2310/315 20130101; C07H 21/02 20130101; C12N
2310/3181 20130101; C12N 2310/321 20130101; A61P 43/00 20180101;
C12N 2310/346 20130101; A61P 21/04 20180101; A61P 21/00 20180101;
C12N 15/113 20130101; C12N 2310/11 20130101; C12N 2310/3233
20130101; A61K 48/00 20130101; G01N 33/6887 20130101; C12N 2310/321
20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 21, 2003 |
WO |
PCT/NL03/00214 |
Claims
1. A method for generating an oligonucleotide or an equivalent
thereof comprising: determining from a secondary structure of RNA
from an exon, a region that assumes a structure that is hybridized
to another part of said RNA (closed structure) and a region that is
not hybridized in said structure (open structure); and generating
said oligonucleotide or said equivalent thereof, of which at least
part of said oligonucleotide or said equivalent thereof is
complementary to said closed structure and of which at least
another part of said oligonucleotide or said equivalent thereof is
complementary to said open structure.
2. The method according to claim 1, wherein said open and closed
structures are adjacent to each other.
3. The method according to claim 1, wherein said oligonucleotide is
complementary to a consecutive part of between 14 and 50
nucleotides of said RNA.
4. The method according to claim 1, wherein said oligonucleotide is
complementary to a consecutive part of between 14 and 50
nucleotides of said RNA.
5. The method according to claim 4, wherein said RNA contains a
modification, preferably a 2'-O-methyl modified ribose (RNA) or
deoxyribose (DNA) modification.
6. The method according to claim 1, wherein a pre-mRNA comprising
said exon exhibits undesired splicing in a subject.
7. The method according to claim 6, wherein the absence of said
exon from an mRNA produce from said pre-mRNA generates a coding
region for a protein.
8. The method according to claim 6, wherein the gene from which
said RNA comprising said exon is transcribed, encodes an aberrant
gene selected from the group consiting of Duchenne muscular
dystrophy gene (DMD), a collagen VI alpha 1 gene (COL6A1), a
myotubular myopathy 1 gene (MTM1), a dysferlin gene (DYSF), a
laminin-alpha 2 gene (LAMA2), an emery-dreyfuss muscular dystrophy
gene (EMD) and a calpain 3 gene (CAPN3).
9. The method according to claim 8, wherein said gene is the
Duchenne muscular dystrophy gene.
10. The method according to claim 9, wherein said exon comprises an
exon selected from the group consisting of exons 2, 8, 9, 17, 19,
29, 40-46, 48-53, 55 and 59.
11. The method according to claim 1, wherein an equivalent of said
oligonucleotide is generated comprising similar hybridization
characteristics in kind, but not necessarily in amount.
12. The method according to claim 11, wherein said equivalent
comprises peptide nucleic acid, locked nucleic acid and/or a
morpholino phosphorodiamidate, or a combination thereof.
13. The method according to claim 12, wherein said equivalent
comprises locked nucleic acid.
14. The method according to claim 1, wherein the oligonucleotide or
the equivalent thereof does not overlap a splice donor and/or a
splice acceptor sequence of said exon.
15. An oligonucleotide or an equivalent thereof obtainable by a
method according to claim 1.
16. A compound capable of hybridizing to at least two exons in a
pre-mRNA encoded by a gene, said compound comprising at least two
parts wherein a first part comprises an oligonucleotide having at
least 8 consecutive nucleotides that are complementary to a first
of said at least two exons, and wherein a second part comprises an
oligonucleotide having at least 8 consecutive nucleotides that are
complementary to a second of said at least two exons in said
pre-mRNA.
17. The compound according to claim 16, wherein said compound
comprises between 16 and 80 nucleotides.
18. The compound according to claim 16, wherein said first and said
second exon are separated in said pre-mRNA by at least one exon to
which said oligonucleotide is not complementary.
19. The compound according to claim 16, wherein stretches of
nucleotides complementary to said at least two exons are separated
by a linking moiety.
20. The compound according to claim 19, wherein said linking moiety
comprises between 4 and 40 nucleotides.
21. The compound according to claim 16, comprising an
oligonucleotide or equivalent thereof wherein the equivalent
comprises similar hybridization characteristics in kind, but not
necessarily in amount.
22. A method of altering recognition of an exon or exons in a
pre-mRNA, said method comprising: providing the oligonucleotide or
the equivalent thereof of claim 15; and altering recognition of
said exon or exons in a pre-mRNA.
23. A method of preparing a medicament comprising: providing the
oligonucleotide or the equivalent thereof of claim 15; and
preparing a medicament comprising the oligonucleotide or the
equivalent thereof of claim 15.
24. A pharmaceutical preparation comprising an oligonucleotide or
an equivalent thereof according to claim 15.
25. A method of preparing a medicament for the treatment of an
inherited disease comprising: providing the oligonucleotide or the
equivalent thereof of claim 15; and preparing the medicament for
the treatment of an inherited disease comprising the
oligonucleotide or the equivalent thereof of claim 15.
26. A method of inducing exon skipping in a pre-mRNA, said method
comprising: providing the oligonucleotide or the equivalent thereof
of claim 15; and inducing exon skipping in a pre-mRNA.
27. A method of altering exon recognition in a pre-mRNA, said
method comprising: providing the oligonucleotide or the equivalent
thereof of claim 15; and altering exon recognition in a
pre-mRNA.
28. A method of altering the efficiency with which a splice donor
or splice acceptor sequence is used by a splicing machinery, said
method comprising: providing the oligonucleotide or the equivalent
thereof of claim 15; and altering the efficiency with which a
splice donor or splice acceptor sequence is used by a splicing
machinery.
29. A method of inducing exon skipping of two or more exons in a
pre-mRNA, said method comprising: providing the oligonucleotide or
the equivalent thereof of claim 15; and inducing exon skipping of
two or more exons in a pre-mRNA.
30. A method of inducing exon skipping of three or more exons in a
pre-mRNA, said method comprising: providing the oligonucleotide or
the equivalent thereof of claim 15; and inducing exon skipping of
three or more exons in a pre-mRNA.
31. A method of inducing skipping of at least two exons and a
sequence located between said at least two exons (intervening
sequence) on a pre-mRNA, said method comprising: providing the
oligonucleotide or the equivalent thereof of claim 15; and inducing
skipping of at least two exons and a sequence located between said
at least two exons (intervening sequence) on a pre-mRNA.
32. The method according to claim 31, wherein said intervening
sequence comprises a further exon or exons.
33. A method for altering the efficiency with which an exon in a
pre-mRNA is recognized by a splicing machinery, said pre-mRNA being
encoded by a gene comprising at least two exons and at least one
intron, said method comprising: providing a transcription system
comprising said splicing machinery and said gene, with a first
oligonucleotide or an equivalent thereof according to claim 15;
wherein said first oligonucleotide or an equivalent thereof is
capable of hybridizing to at least one of said exons; and allowing
for transcription and splicing to occur in said transcription
system.
34. The method according to claim 33, wherein said gene comprises
at least 3 exons.
35. The method according to claim 33, further comprising providing
said transcription system with at least a second oligonucleotide,
or an equivalent thereof, according to claim 15, wherein said
second oligonucleotide, or equivalent thereof, is capable of
hybridizing to at least another of said exons.
36. The method according to claim 35, wherein said first
oligonucleotide or equivalent thereof and said second
oligonucleotide or equivalent thereof are physically linked to each
other.
37. A method of altering recognition of an exon or exons in a
pre-mRNA, said method comprising: providing the compound of claim
21; and altering recognition of said exon or exons in a
pre-mRNA.
38. A method of preparing a medicament for the treatment of an
inherited disease comprising administering to a subject a
medicament comprising: providing the compound of claim 21; and
preparing a medicament comprising the compound of claim 21.
39. A pharmaceutical preparation comprising a compound according to
according to claim 21.
40. A method of preparing a medicament for the treatment of an
inherited disease comprising administering to a subject a
medicament comprising: providing the compound of claim 21; and
preparing the medicament for the treatment of an inherited disease
comprising the compound of claim 21.
41. A method of inducing exon skipping in a pre-mRNA, said method
comprising: providing the compound of claim 21; and inducing exon
skipping in a pre-mRNA.
42. A method of altering exon recognition in a pre-mRNA, said
method comprising: providing the compound of claim 21; and altering
exon recognition in a pre-mRNA.
43. A method of altering the efficiency with which a splice donor
or splice acceptor sequence is used by a splicing machinery, said
method comprising: providing the compound of claim 21; and altering
the efficiency with which a splice donor or splice acceptor
sequence is used by a splicing machinery.
44. A method of inducing exon skipping in two or more exons in a
pre-mRNA, said method comprising: providing the compound of claim
21; and inducing exon skipping in two or more exons in a
pre-mRNA.
45. A method of inducing exon skipping in three or more exons in a
pre-mRNA, said method comprising: providing the compound of claim
21; and inducing exon skipping in three or more exons in a
pre-mRNA.
46. A method of inducing skipping of at least two exons and a
sequence located between said at least two exons (intervening
sequence) on a pre-mRNA, said method comprising: providing the
compound of claim 21; and inducing skipping of at least two exons
and a sequence located between said at least two exons (intervening
sequence) on a pre-mRNA.
47. The method according to claim 46, wherein said intervening
sequence comprises a further exon or exons.
48. A method for altering the efficiency with which an exon in a
pre-mRNA is recognized by a splicing machinery, said pre-mRNA being
encoded by a gene comprising at least two exons and at least one
intron, said method comprising: providing a transcription system
comprising said splicing machinery and said gene, with a first
compound according to claim 21; wherein said first compound is
capable of hybridizing to at least one of said exons; and allowing
for transcription and splicing to occur in said transcription
system.
49. The method according to claim 48, wherein said gene comprises
at least 3 exons.
50. The method according to claim 48, further comprising providing
said transcription system with at least a second compound according
to claim 21, wherein said second compound is capable of hybridizing
to at least another of said exons.
51. The method according to claim 50, wherein said first compound
and said second compound are physically linked to each other.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of PCT International
Patent Application No. PCT/NL2004/000196 filed on Mar. 22, 2004,
designating the United States of America, and published in English,
as PCT International Publication No. WO 2004/083446 A2 on Sep. 30,
2004, which application claims priority to PCT/NL03/00214, filed on
Mar. 21, 2003, the contents of the entirety of each of which are
incorporated herein by this reference.
STATEMENT ACCORDING TO 37 C.F.R. .sctn. 1.52(e)(5)--SEQUENCE
LISTING SUBMITTED ON COMPACT DISC
[0002] Pursuant to 37 C.F.R. .sctn. 1.52(e)(1)(iii), a compact disc
containing an electronic version of the Sequence Listing has been
submitted concomitant with this application, the contents of which
are hereby incorporated by reference. A second compact disc is
submitted and is an identical copy of the first compact disc. The
discs are labeled "copy 1" and "copy 2," respectively, and each
disc contains one file entitled "sequence listing.txt" which is 16
KB and created on Dec. 20, 2005.
TECHNICAL FIELD
[0003] The invention relates to the fields of molecular biology and
medicine. More in particular, the invention relates to the
restructuring of mRNA produced from pre-mRNA, and therapeutic uses
thereof.
BACKGROUND
[0004] The central dogma of biology is that genetic information
resides in the DNA of a cell and is expressed upon transcription of
this information, where production of the encoded protein follows
by the translation machinery of the cell. This view of the flow of
genetic information has prompted the predominantly DNA-based
approach for interfering with the protein content of a cell. This
view is slowly changing and alternatives for interfering at the DNA
level are being pursued.
[0005] In higher eukaryotes, the genetic information for proteins
in the DNA of the cell is encoded in exons which are separated from
each other by intronic sequences. These introns are in some cases
very long. The transcription machinery generates a pre-mRNA which
contains both exons and introns, while the splicing machinery,
often already during the production of the pre-mRNA, generates the
actual coding region for the protein by splicing together the exons
present in the pre-mRNA.
[0006] Although much is known about the actual processes involved
in the generation of an mRNA from a pre-mRNA, much also remains
hidden. In the present invention, it has been shown possible to
influence the splicing process such that a different mRNA is
produced. The process allows for the predictable and reproducible
restructuring of mRNA produced by a splicing machinery. An
oligonucleotide capable of hybridizing to pre-mRNA at a location of
an exon that is normally included in the mature mRNA can direct the
exclusion of the thus targeted exon or a part thereof.
SUMMARY OF THE INVENTION
[0007] In the present invention, means and methods are provided for
the design of appropriate complementary oligonucleotides. To this
end, the invention provides a method for generating an
oligonucleotide comprising determining, from a (predicted)
secondary structure of RNA from an exon, a region that assumes a
structure that is hybridized to another part of the RNA (closed
structure) and a region that is not hybridized in the structure
(open structure), and subsequently generating an oligonucleotide,
which at least in part is complementary to the closed structure and
which at least in part is complementary to the open structure. RNA
molecules exhibit strong secondary structures, mostly due to base
pairing of complementary or partly complementary stretches within
the same RNA. It has long since been thought that structures in the
RNA play a role in the function of the RNA. Without being bound by
theory, it is believed that the secondary structure of the RNA of
an exon plays a role in structuring the splicing process. Through
its structure, an exon is recognized as a part that needs to be
included in the mRNA. Herein this signalling function is referred
to as an exon inclusion signal. A complementary oligonucleotide of
the invention is capable of interfering with the structure of the
exon and thereby capable of interfering with the exon inclusion
signal of the exon. It has been found that many complementary
oligonucleotides indeed comprise this capacity, some more efficient
than others. Oligonucleotides of the invention, i.e. those with the
overlap directed toward open and closed structures in the native
exon RNA, are a selection from all possible oligonucleotides. The
selection encompasses oligonucleotides that can efficiently
interfere with an exon inclusion signal. Without being bound by
theory, it is thought that the overlap with an open structure
improves the invasion efficiency of the oligonucleotide (i.e.,
increases the efficiency with which the oligonucleotide can enter
the structure), whereas the overlap with the closed structure
subsequently increases the efficiency of interfering with the
secondary structure of the RNA of the exon, and thereby interfere
with the exon inclusion signal. It is found that the length of the
partial complementarity to both the closed and the open structure
is not extremely restricted. We have observed high efficiencies
with oligonucleotides with variable lengths of complementarity in
either structure. The term complementarity is used herein to refer
to a stretch of nucleic acids that can hybridize to another stretch
of nucleic acids under physiological conditions. It is thus not
absolutely required that all the bases in the region of
complementarity are capable of pairing with bases in the opposing
strand. For instance, when designing the oligonucleotide one may
want to incorporate for instance a residue that does not base pair
with the base on the complementary strand. Mismatches may to some
extent be allowed, if under the circumstances in the cell, the
stretch of nucleotides is capable of hybridizing to the
complementary part. In a preferred embodiment, a complementary part
(either to the open or to the closed structure) comprises at least
three, and more preferably at least four, consecutive nucleotides.
The complementary regions are preferably designed such that, when
combined, they are specific for the exon in the pre-mRNA. Such
specificity may be created with various lengths of complementary
regions as this depends on the actual sequences in other (pre-)mRNA
in the system. The risk that also one or more other pre-mRNA will
be able to hybridize to the oligonucleotide decreases with
increasing size of the oligonucleotide. It is clear that
oligonucleotides comprising mismatches in the region of
complementarity but that retain the capacity to hybridize to the
targeted region(s) in the pre-mRNA, can be used in the present
invention. However, preferably at least the complementary parts do
not comprise such mismatches as these typically have a higher
efficiency and a higher specificity, than oligonucleotides having
such mismatches in one or more complementary regions. It is thought
that higher hybridization strengths, (i.e. increasing number of
interactions with the opposing strand) are favorable in increasing
the efficiency of the process of interfering with the splicing
machinery of the system.
[0008] The secondary structure is best analyzed in the context of
the pre-mRNA wherein the exon resides. Such structure may be
analyzed in the actual RNA. However, it is currently possible to
predict the secondary structure of an RNA molecule (at lowest
energy costs) quite well using structure-modelling programs. A
non-limiting example of a suitable program is RNA mfold version 3.1
server (Mathews et al. 1999, J. Mol. Biol. 288: 911-940). A person
skilled in the art will be able to predict, with suitable
reproducibility, a likely structure of the exon, given the
nucleotide sequence. Best predictions are obtained when providing
such modelling programs with both the exon and flanking intron
sequences. It is typically not necessary to model the structure of
the entire pre-mRNA.
[0009] The open and closed structures to which the oligonucleotide
is directed, are preferably adjacent to one another. It is thought
that in this way the annealing of the oligonucleotide to the open
structure induces opening of the closed structure whereupon
annealing progresses into this closed structure. Through this
action, the previously closed structure assumes a different
conformation. The different conformation results in the disruption
of the exon inclusion signal. However, when potential (cryptic)
splice acceptor and/or donor sequences are present within the
targeted exon, occasionally a new exon inclusion signal is
generated defining a different (neo) exon, i.e. with a different 5'
end, a different 3' end, or both. This type of activity is within
the scope of the present invention as the targeted exon is excluded
from the mRNA. The presence of a new exon, containing part of the
targeted exon, in the mRNA does not alter the fact that the
targeted exon, as such, is excluded. The inclusion of a neo-exon
can be seen as a side effect which occurs only occasionally. There
are two possibilities when exon skipping is used to restore (part
of) an open reading frame that was disrupted as a result of a
mutation. One is that the neo-exon is functional in the restoration
of the reading frame, whereas in the other case the reading frame
is not restored. When selecting oligonucleotides for restoring
reading frames by means of exon-skipping it is of course clear that
under these conditions only those oligonucleotides are selected
that indeed result in exon-skipping that restores the open reading
frame, with or without a neo-exon.
[0010] Pre-mRNA can be subject to various splicing events, for
instance through alternative splicing. Such events may be induced
or catalyzed by the environment of a cell or artificial splicing
system. Thus, from the same pre-mRNA several different mRNAs may be
produced. The different mRNAs all included exonic sequences, as
that is the definition of an exon. However, the fluidity of the
mRNA content necessitates a definition of the term exon in the
present invention. An exon according to the invention is a sequence
present in both the pre-mRNA and mRNA produced thereof, wherein the
sequence included in the mRNA is, in the pre-mRNA, flanked on one
side (first and last exon) or both sides (any other exon than the
first and the last exon) by sequences not present in the mRNA. In
principle, any mRNA produced from the pre-mRNA qualifies for this
definition. However, for the present invention, so-called dominant
mRNAs are preferred, i.e. mRNA that makes up at least 5% of the
mRNA produced from the pre-mRNA under the set conditions. Human
immuno-deficiency virus in particular uses alternative splicing to
an extreme. Some very important protein products are produced from
mRNA making up even less than 5% of the total mRNA produced from
the virus. The genomic RNA of retroviruses can be seen as pre-mRNA
for any spliced product derived from it. As alternative splicing
may vary in different cell types the exons are defined as exons in
the context of the splicing conditions used in that system. As a
hypothetical example, an mRNA in a muscle cell may contain an exon
that as absent in an mRNA produced from the same pre-mRNA in a
nerve cell. Similarly, mRNA in a cancer cell may contain an exon
not present in mRNA produced from the same mRNA in a normal
cell.
[0011] Alternative splicing may occur by splicing from the same
pre-mRNA. However, alternative splicing may also occur through a
mutation in the pre-mRNA for instance generating an additional
splice acceptor and/or splice donor sequence. Such alternative
splice sequences are often referred to as cryptic splice
acceptor/donor sequences. Such cryptic splice sites can result in
new exons (neo-exons). Inclusion of neo-exons into produced mRNA
can be at least in part prevented using a method of the invention.
In case a neo-exon is flanked by a cryptic and a "normal" splice
donor/acceptor sequence, the neo-exon encompasses the old (paleo)
exon. If in this case the original splice donor/acceptor sequence,
for which the cryptic splice donor/acceptor has taken its place, is
still present in the pre-mRNA, it is possible to enhance the
production of mRNA containing the paleo-exon by interfering with
the exon-recognition signal of the neo-exon. This interference can
be both in the part of the neo-exon corresponding to the
paleo-exon, or the additional part of such neo-exons. This type of
exon skipping can be seen as splice correction.
[0012] The exon skipping technique can be used for many different
purposes. Preferably, however, exon skipping is used for
restructuring mRNA that is produced from pre-mRNA exhibiting
undesired splicing in a subject. The restructuring may be used to
decrease the amount of protein produced by the cell. This is useful
when the cell produces a particular undesired protein. In a
preferred embodiment however, restructuring is used to promote the
production of a functional protein in a cell, i.e. restructuring
leads to the generation of a coding region for a functional
protein. The latter embodiment is preferably used to restore an
open reading frame that was lost as a result of a mutation.
Preferred genes comprise a Duchenne muscular dystrophy gene, a
collagen VI alpha 1 gene (COL6A1), a myotubular myopathy 1 gene
(MTM1), a dysferlin gene (DYSF), a laminin-alpha 2 gene (LAMA2), an
emery-dreyfuss muscular dystrophy gene (EMD), and/or a calpain 3
gene (CAPN3). The invention is further delineated by means of
examples drawn from the Duchenne muscular dystrophy gene. Although
this gene constitutes a particularly preferred gene in the present
invention, the invention is not limited to this gene.
[0013] Duchenne muscular dystrophy (DMD) and Becker muscular
dystrophy (BMD) are both caused by mutations in the DMD gene, that
is located on the X chromosome and codes for dystrophin (1-6). DMD
has an incidence of 1:3500 newborn males. Patients suffer from
progressive muscle weakness, are wheelchair bound before the age of
13 and often die before the third decade of their life (7). The
generally milder BMD has an incidence of 1:20,000. BMD patients
often remain ambulant for over 40 years and have longer life
expectancies when compared to DMD patients (8).
[0014] Dystrophin is an essential component of the
dystrophin-glycoprotein complex (DGC), which amongst others
maintains the membrane stability of muscle fibers (9, 10).
Frame-shifting mutations in the DMD gene result in dystrophin
deficiency in muscle cells. This is accompanied by reduced levels
of other DGC proteins and results in the severe phenotype found in
DMD patients (11, 12). Mutations in the DMD gene that keep the
reading frame intact, generate shorter, but partly functional
dystrophins, associated with the less severe BMD (13, 14).
[0015] Despite extensive efforts, no clinically applicable and
effective therapy for DMD patients has yet been developed (15),
although a delay of the onset and/or progression of disease
manifestations can be achieved by glucocorticoid therapy (16).
Promising results have recently been reported by us and others on a
genetic therapy aimed at restoring the reading frame of the
dystrophin pre-mRNA in cells from the mdx mouse model and DMD
patients (17-23). By the targeted skipping of a specific exon, a
DMD phenotype can be converted into a milder BMD phenotype. The
skipping of an exon can be induced by the binding of antisense
oligoribonucleotides (AONs) targeting either one or both of the
splice sites, or exon-internal sequences. Since an exon will only
be included in the mRNA when both the splice sites are recognized
by the spliceosome complex, splice sites are obvious targets for
AONs. This was shown to be successful, albeit with variable
efficacy and efficiency (17, 18, 20, 21). We hypothesized that
targeting exon-internal sequences might increase specificity and
reduce interference with the splicing machinery itself. Some exons
have weak splice sites and appear to require binding of a SR
protein to an exon recognition sequence (ERS) or an exonic splicing
enhancer (ESE) to be properly recognized by the splicing machinery
(24). SR proteins are a highly conserved family of arginine/serine
rich, spliceosome associated phosphoproteins essential for pre-mRNA
splicing (50, 51). SR proteins appear to act early in splicing by
promoting splice site recognition and spliceosome assembly. SR
proteins also play a regulatory role, because they can determine
alternative splice site usage in vivo and in vitro. SR proteins
appear to be recruited from nuclear "speckles," in which they are
concentrated, to sites of transcription in order to spatially
coordinate transcription and pre-mRNA splicing within the cell
nucleus (49, 52). Disruptive point mutations or AONs that block
these sequences have been found to result in exon skipping (19, 22,
24-28). Using exon-internal AONs specific for an ERS-like sequence
in exon 46, we were previously able to modulate the splicing
pattern in cultured myotubes from two different DMD patients with
an exon 45 deletion (19). Following AON treatment, exon 46 was
skipped, which resulted in a restored reading frame and the
induction of dystrophin synthesis in at least 75% of the cells. We
have recently shown that exon skipping can also efficiently be
induced in human control muscle cells for 15 different DMD exons
using exon-internal AONs (23, unpublished results). In contrast to
the previous opinion that skipping can only be achieved with weak
splice sites or exons containing ERS-like sequences, we have seen
that of the exons that were skipped in the present invention most
do not have weak splice sites nor do they contain ERS-like
sequences. Thus binding of the AONs to the targeted exon per se is
sufficient to cause exon skipping, either by interfering with one
or more components of the splicing machinery or by altering the
secondary structure of the RNA in such a manner that the splicing
machinery no longer recognizes the exon. In a preferred embodiment,
the exon to be skipped comprises exons 2, 8, 9, 17, 19, 29, 40-46,
49-53, 55 or 59. More preferably, exons 2, 8, 9, 17, 40, 41, 42,
44, 46, 48, 49-52, 55 or 59. In yet another embodiment, the exon to
be skipped comprises exons 2, 29, 40, 41, 42, 43, 44, 45, 46, 48,
49, 50, 51, 53 or 55.
[0016] Any oligonucleotide fulfilling the requirements of the
invention may be used to induce exon skipping in the DMD gene. In a
preferred embodiment, an oligonucleotide comprises a sequence as
depicted as active in exon-skipping in Table 2, or a functional
equivalent thereof comprising a similar, preferably the same
hybridization capacity in kind, not necessarily in amount.
Preferably an oligonucleotide comprising a sequence as depicted in
Table 2, derived from the exons 2, 40, 41, 42, 43, 44, 45, 46, 48,
49, 50, 51, 53 or 55, active in exon skipping. The invention thus
further provides an oligonucleotide of Table 2, or an equivalent
thereof. Preferably the invention provides an oligonucleotide of
table capable of inducing exon skipping as depicted in Table 2. The
invention further provides an oligonucleotide of Table 2,
complementary to exons 2, 40, 41, 42, 43, 44, 45, 46, 48, 49, 50,
51, 53 or 55 of the human DMD gene.
[0017] Reading frame correction can be achieved by skipping one or
two exons flanking a deletion, by skipping in-frame exons
containing a nonsense mutation, or by skipping duplicated exons.
This results in proteins similar to those found in various BMD
patients (2, 29). A survey of the Leiden DMD mutation database
[www.dmd.nl; (30)] learns that we can thus correct over 75% of DMD
causing mutations (see Table 4). We show the actual therapeutic
effect of exon skipping for seven different mutations. In all
patient muscle cell cultures, we were able to restore dystrophin
synthesis in 75% to 80% of treated cells.
[0018] The complementary oligonucleotide generated through a method
of the invention is preferably complementary to a consecutive part
of between 13 and 50 nucleotides of the exon RNA. In another
embodiment, the complementary oligonucleotide generated through a
method of the invention is complementary to a consecutive part of
between 16 and 50 nucleotides of the exon RNA. Preferably, the
oligonucleotide is complementary to a consecutive part of between
13-25 nucleotides of the exon RNA. Preferably, between 14 and 25
nucleotides of the exon RNA. Different types of nucleic acid may be
used to generate the oligonucleotide. Preferably, the
oligonucleotide comprises RNA, as RNA/RNA hybrids are very stable.
Since one of the aims of the exon skipping technique is to direct
splicing in subjects it is preferred that the oligonucleotide RNA
comprises a modification providing the RNA with an additional
property, for instance resistance to endonucleases and RNaseH,
additional hybridization strength, increased stability (for
instance in a bodily fluid), increased or decreased flexibility,
reduced toxicity, increased intracellular transport,
tissue-specificity, etc. Preferably, modification comprises a
2'-O-methyl-phosphorothioate oligoribonucleotide modification.
Preferably, modification comprises a 2'-O-methyl-phosphorothioate
oligodeoxyribonucleotide modification. In one embodiment, the
invention provides a hybrid oligonucleotide comprising an
oligonucleotide comprising a 2'-O-methyl-phosphorothioate
oligo(deoxy)ribonucleotide modification and locked nucleic acid.
This particular combination comprises better sequence specificity
compared to an equivalent consisting of locked nucleic acid, and
comprises improved effectivity when compared with an
oligonucleotide consisting of 2'-O-methyl-phosphorothioate
oligo(deoxy)ribonucleotide modification.
[0019] With the advent of nucleic acid mimicking technology it has
become possible to generate molecules that have a similar, and
preferably the same hybridization characteristics in kind, not
necessarily in amount, as nucleic acid itself. Such equivalents are
of course also part of the invention. Examples of such mimics
equivalents are peptide nucleic acid, locked nucleic acid and/or a
morpholino phosphorodiamidate. Suitable but non-limiting examples
of equivalents of oligonucleotides of the invention can be found in
C. Wahlestedt et al., Potent and non-toxic antisense
oligonucleotides containing locked nucleic acids. Proc. Nat'l Acad.
Sci. U.S.A. 97, 5633-8 (2000); A. N. Elayadi and D. R. Corey,
Application of PNA and LNA oligomers to chemotherapy, Curr. Opin.
Investig. Drugs 2, 558-61 (2001); H. J. Larsen, T. Bentin and P. E.
Nielsen, Antisense properties of peptide nucleic acid, Biochim.
Biophys. Acta. 1489, 159-66 (1999); D. A. Braasch and D. R. Corey,
Novel antisense and peptide nucleic acid strategies for controlling
gene expression, Biochemistry 41, 4503-10 (2002); J. Summerton and
D. Weller, Morpholino antisense oligomers: design, preparation, and
properties, Antisense Nucleic Acid Drug Dev. 7, 187-95 (1997).
Hybrids between one or more of the equivalents among each other
and/or together with nucleic acid are of course also part of the
invention. In a preferred embodiment, an equivalent comprises
locked nucleic acid, as locked nucleic acid displays a higher
target affinity and reduced toxicity and, therefore, shows a higher
efficiency of exon skipping.
[0020] An oligonucleotide of the invention typically does not have
to overlap with a splice donor or splice acceptor of the exon.
[0021] An oligonucleotide of the invention, or equivalent thereof,
may of course be combined with other methods for interfering with
the structure of an mRNA. It is, for instance, possible to include
in a method at least one other oligonucleotide that is
complementary to at least one other exon in the pre-mRNA. This can
be used to prevent inclusion of two or more exons of a pre-mRNA in
mRNA produced from this pre-mRNA. In a preferred embodiment, at
least one other oligonucleotide is an oligonucleotide, or
equivalent thereof, generated through a method of the invention.
This part of the invention is further referred to as double-or
multi-exon skipping. In most cases, double-exon skipping results in
the exclusion of only the two targeted (complementary) exons from
the pre-mRNA. However, in other cases it was found that the
targeted exons and the entire region in between the exons in the
pre-mRNA were not present in the produced mRNA even when other
exons (intervening exons) were present in such region. This
multi-skipping was notably so for the combination of
oligonucleotides derived from the DMD gene, wherein one
oligonucleotide for exon 45 and one oligonucleotide for exon 51 was
added to a cell transcribing the DMD gene. Such a set-up resulted
in mRNA being produced that did not contain exons 45 to 51.
Apparently, the structure of the pre-mRNA in the presence of the
mentioned oligonucleotides was such that the splicing machinery was
stimulated to connect exons 44 and 52 to each other.
[0022] In the present invention, it was found possible to
specifically promote the skipping of also the intervening exons by
providing a linkage between the two complementary oligonucleotides.
To this end, the invention provides a compound capable of
hybridizing to at least two exons in a pre-mRNA encoded by a gene,
this compound comprising at least two parts wherein a first part
comprises an oligonucleotide having at least eight consecutive
nucleotides that are complementary to a first of at least two
exons, and wherein a second part comprises an oligonucleotide
having at least eight consecutive nucleotides that are
complementary to a second exon in the pre-mRNA. The at least two
parts are linked in the compound so as to form a single molecule.
The linkage may be through any means but is preferably accomplished
through a nucleotide linkage. In the latter case, the number of
nucleotides that do not contain an overlap between one or the other
complementary exon can be zero, but is preferably between 4 to 40
nucleotides. The linking moiety can be any type of moiety capable
of linking oligonucleotides. Currently, many different compounds
are available that mimic hybridization characteristics of
oligonucleotides. Such a compound is also suitable for the present
invention if such equivalent comprises similar hybridization
characteristics in kind, but not necessarily in amount. Suitable
equivalents were mentioned earlier in this description. One, or
preferably more, of the oligonucleotides in the compound is/are
generated by a method for generating an oligonucleotide of the
present invention. As mentioned, oligonucleotides of the invention
do not have to consist of only oligonucleotides that contribute to
hybridization to the targeted exon. There may be additional
material and/or nucleotides added.
[0023] As mentioned, a preferred gene for restructuring mRNA is the
DMD gene. The DMD gene is a large gene, with many different exons.
Considering that the gene is located on the X-chromosome, it is
mostly males that are affected, although females can also be
affected by the disease, as they may receive a bad copy of the gene
from both parents, or are suffering from a particularly biased
inactivation of the functional allele due to a particularly biased
X chromosome inactivation in their muscle cells. The protein is
encoded by a plurality of exons (79) over a range of at least 2.6
Mb. Defects may occur in any part of the DMD gene. Skipping of a
particular exon or particular exons can, very often, result in a
restructured mRNA that encodes a shorter than normal but at least
partially functional dystrophin protein. A practical problem in the
development of a medicament based on exon-skipping technology is
the plurality of mutations that may result in a deficiency in
functional dystrophin protein in the cell. Despite the fact that
already multiple different mutations can be corrected for by the
skipping of a single exon, this plurality of mutations, requires
the generation of a large number of different pharmaceuticals as
for different mutations different exons need to be skipped. An
advantage of a compound of the invention, i.e. a compound capable
of inducing skipping of two or more exons, is that more than one
exon can be skipped with a single pharmaceutical. This property is
not only practically very useful in that only a limited number of
pharmaceuticals need to be generated for treating many different
Duchenne or Becker mutations. Another option now open to the person
skilled in the art is to select particularly functional
restructured dystrophin proteins and produce compounds capable of
generating these preferred dystrophin proteins. Such preferred end
results are further referred to as mild phenotype dystrophins. The
structure of the normal dystrophin protein can be schematically
represented as two endpoints having structural function (the
beads), which are connected to each other by a long, at least
partly flexible, rod. This rod is shortened in many Becker
patients. In a particular preferred embodiment, the invention
provides a method for treating a DMD patient comprising a mutation
as depicted in Table 4, comprising providing the patient with an
oligonucleotide effective in inducing exon-skipping of the exon
mentioned in the first column of four, or an equivalent thereof. In
a preferred embodiment, the oligonucleotide comprises an
oligonucleotide effective in inducing exon-skipping mentioned in
Table 2, or an equivalent thereof.
[0024] The observations mentioned above led the field to the
conclusion that not so much the length of the rod, but the presence
of a rod and the composition thereof (with respect to particular
hinge regions in the protein), is crucial to the function per se of
the dystrophin protein. Though the size of the rod may have an
impact on the amount of functionality of the resulting (Becker)
protein, there are many notable exceptions. These exceptions will
be detailed below. There are especially benign mutations that can
have a very short rod. It was noted by the inventors that many more
different types of Becker patients should have been detected in the
patient population. However, some types of shortened dystrophin
proteins, that according to this hypothesis should have a Becker
phenotype, are not detected in human population. For some of these
"theoretical" Becker forms, this could just be a matter of chance.
However, in the present invention, it has been found that at least
some of these "potential" Becker patients have such a benign
phenotype that subjects having these types of mutations do not
present themselves to a doctor, or are not diagnosed as suffering
from Becker's disease. With a compound of the invention, it is
possible to restructure DMD pre-mRNA of many different Duchenne and
even Becker patients such that a mild phenotype dystrophin is
generated after translation of the restructured mRNA. The invention
thus provides a particularly preferred compound, wherein the parts
of the compounds at least comprise a first part comprising an
oligonucleotide or equivalent thereof, complementary to exon 17 and
a second part comprising an oligonucleotide or equivalent thereof,
complementary to exon 48. The resulting restructured mRNA encodes
an in-frame shortened dystrophin protein, lacking all exons from 17
to 48. This shortened dystrophin protein mimics a mild phenotype
dystrophin as mentioned above. The compound (referred to as the
17-48 compound) should according to current databases be able to
deal with as much as 20% of the patients having a DMD mutation
currently characterized. Another preferred compound is the 45-55
compound. This compound should according to the same calculations
be able to deal with 38% of the patients having a DMD mutation thus
far characterized. Yet another preferred embodiment the compound
comprises a 42-55 compound or a 49-59 compound, capable of dealing
with respectively 65% and 18% of the currently characterized DMD
patients. In yet another preferred embodiment, the compound
comprises a 42-55 compound. Similarly preferred are a 45-49
compound and a 45-51 compound preferably in the form as disclosed
in the experimental part, having the potential to treat
respectively 4% and 8% of the DMD patients characterized thus far.
In a preferred embodiment, the compound comprises an
oligonucleotide of Table 2, or an equivalent thereof. Preferably,
the compound comprises at least two oligonucleotides of Table 2 or
one or more equivalents thereof. In a preferred embodiment, the
compound comprises at least one oligonucleotide or equivalent
thereof of Table 2, directed against exon 42 and an oligonucleotide
or equivalent thereof of Table 2, directed against exon 55. In a
preferred embodiment, this compound comprises at least one
oligonucleotide or equivalent thereof of Table 2, directed against
exon 45 and an oligonucleotide or equivalent thereof of Table 2,
directed against exon 51.
[0025] Also part of the invention is a compound capable of
hybridizing to one exon in a pre-mRNA encoded by a gene, the
compound comprising at least two parts, wherein a first part
comprises an oligonucleotide of which at least a part of the
oligonucleotide is complementary to a closed structure and wherein
the second part comprises an oligonucleotide of which at least part
is complementary to an open structure. The open and closed
structures are of course determined from a secondary structure of
RNA from the exon. Preferably, a compound having two
distinguishable parts complementary to a single exon, comprises an
oligonucleotide, or equivalent thereof, or combination thereof as
mentioned above in the method for generating the
oligonucleotide.
[0026] The invention further provides a composition comprising a
first oligonucleotide of the invention capable of hybridizing to an
exon in a pre-mRNA of a gene or an equivalent of the first
oligonucleotide, and at least a second oligonucleotide of the
invention capable of hybridizing to another exon in a pre-mRNA of a
gene or an equivalent of the second oligonucleotide. In a preferred
embodiment, the first and at least a second oligonucleotide or
equivalent thereof are capable of hybridizing to different exons on
the same pre-mRNA. The composition can be used to induce exon
skipping of the respective exons. It has been observed that when
the composition comprises oligonucleotides or equivalents thereof
directed toward exons 45 and 51, or 42 and 55 of the human DMD
gene, that is an exception to the rule that only the targeted exons
are excluded from the resulting mRNA, instead the targeted exons
and the entire intervening region is excluded from the resulting
mRNA. In the present invention this feature is used to correct a
variety of different debilitating mutations of the DMD gene. Thus,
in one embodiment, the invention provides a method for the
treatment of a subject comprising a mutation in the human DMD gene,
wherein as a result of the mutation the DMD gene is not
appropriately translated into a functional dystrophin protein,
comprising providing the subject with a composition as mentioned
above. Mutations that can be corrected in this way are typically
mutations that lie within or adjacent to the targeted exon or in
the intervening region. However, it is also possible to correct
frame-shifting mutations that lie further outside the mentioned
exons and intervening region.
[0027] A transcription system containing a splicing system can be
generated in vitro. The art has suitable systems available.
However, the need for mRNA restructuring is of course predominantly
felt for the manipulation of living cells, preferably, cells in
which a desired effect can be achieved through the restructuring of
an mRNA. Preferred mRNAs that are restructured are listed herein
above. Preferably, genes active in muscle cells are used in the
present invention. Muscle cells (i.e., myotubes) are multinucleated
cells in which many but not all muscle cell specific genes are
transcribed via long pre-mRNA. Such long pre-mRNAs are preferred
for the present invention, as restructuring of mRNAs produced from
such long mRNAs is particularly efficient. It is thought, though it
need not necessarily be so, that the relatively long time needed to
generate the full pre-mRNA aids the efficiency of restructuring
using a method or means of the invention, as more time is allowed
for the process to proceed. The preferred group of genes of which
the mRNA is preferably restructured in a method of the invention
comprises: COL6A1 causing Bethlem myopathy, MTM1 causing myotubular
myopathy, DYSF (dysferlin causing Miyoshi myopathy and LGMD, LAMA2
(laminin alpha 2) causing Merosin-deficient muscular dystrophy, EMD
(emerin) causing Emery-Dreyfuss muscular dystrophy, the DMD gene
causing Duchenne muscular dystrophy and Becker muscular dystrophy,
and CAPN3 (calpain) causing LGMD2A. Any cell may be used, however,
as mentioned, a preferred cell is a cell derived from a DMD
patient. Cells can be manipulated in vitro, i.e. outside the
subject's body. However, ideally the cells are provided with a
restructuring capacity in vivo. Suitable means for providing cells
with an oligonucleotide, equivalent or compound of the invention
are present in the art. Improvements in these techniques are
anticipated considering the progress that has already thus far been
achieved. Such future improvements may of course be incorporated to
achieve the mentioned effect on restructuring of mRNA using a
method of the invention. At present, suitable means for delivering
an oligonucleotide, equivalent or compound of the invention to a
cell in vivo comprise, polyethylenimine (PEI) or synthetic
amphiphils (SAINT-18) suitable for nucleic acid transfections. The
amphiphils show increased delivery and reduced toxicity, also when
used for in vivo delivery, preferably, compounds mentioned in J.
Smisterova, A. Wagenaar, M. C. A. Stuart, E. Polushkin, G. ten
Brinke, R. Hulst, J. B. F. N. Engberts, and D. Hoekstra, "Molecular
shape of the Cationic Lipid Controls the Structure of the Cationic
Lipid/Dioleylphosphatidylethanolamine-DNA Complexes and the
Efficiency of Gene Delivery," J. Biol. Chem. 2001, 276, 47615. The
synthetic amphiphils preferably used are based upon the easily
synthetically available "long tailed" pyridinium head group based
materials. Within the large group of amphiphils synthesized,
several show a remarkable transfection potential combined with a
low toxicity in terms of overall cell survival. The ease of
structural modification can be used to allow further modifications
and the analysis of their further (in vivo) nucleic acid transfer
characteristics and toxicity.
[0028] An oligonucleotide, equivalent thereof, or a compound
according to the invention may be used for at least in part
altering recognition of the exon in a pre-mRNA. In this embodiment,
the splicing machinery is at least in part prevented from linking
the exon boundaries to the mRNA. The oligonucleotide, equivalent or
compound of the invention is at least in part capable of altering
exon-recognition in a pre-mRNA. This use is thus also provided in
the invention. The prevention of inclusion of a targeted exon in an
mRNA is also provided as a use for at least in part stimulating
exon skipping in a pre-mRNA. As mentioned above, the targeted exon
is not included in the resulting mRNA. However, part of the exon (a
neo-exon) may occasionally be retained in the produced mRNA. This
sometimes occurs when the targeted exon contains a potential splice
acceptor and/or splice donor sequence. In this embodiment, the
splicing machinery is redirected to utilize a previously not (or
underused) splice acceptor/donor sequence, thereby creating a new
exon (neo-exon). The neo-exon may have one end in common with the
paleo-exon, although this does not always have to be the case.
Thus, in one aspect, an oligonucleotide, equivalent or compound of
the invention is used for altering the efficiency with which a
splice donor or splice acceptor is used by a splicing
machinery.
[0029] In view of the above, the present invention further provides
the use of an oligonucleotide, an equivalent thereof or a compound
of the invention for the preparation of a medicament. Further
provided is a pharmaceutical preparation comprising an
oligonucleotide, equivalent thereof or a compound according to the
invention. The oligonucleotide, equivalent thereof or a compound of
the invention can be used for the preparation of a medicament for
the treatment of an inherited disease. Similarly provided is a
method for altering the efficiency with which an exon in a pre-mRNA
is recognized by a splicing machinery, the pre-mRNA being encoded
by a gene comprising at least two exons and at least one intron,
the method comprising providing a transcription system comprising
splicing machinery and the gene, with an oligonucleotide,
equivalent thereof or a compound according to the invention,
wherein the oligonucleotide, equivalent thereof or compound is
capable of hybridizing to at least one of the exons, and allowing
for transcription and splicing to occur in the transcription
system. Preferably, the gene comprises at least three exons.
[0030] An oligonucleotide of the invention may be provided to a
cell in the form of an expression vector wherein the expression
vector encodes a transcript comprising the oligonucleotide. The
expression vector is preferably introduced into the cell via a gene
delivery vehicle. A preferred delivery vehicle is a viral vector
such as an adenoviral vector and more preferably an
adeno-associated virus vector. The invention thus also provides
such expression vectors and delivery vehicles. It is within the
skill of the artisan to design suitable transcripts. Preferred for
the invention are PolIII driven transcripts, preferably in the form
of a fusion transcript with an U1 or U7 transcript. Such fusions
may be generated as described in references 53 and 54.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1. RT-PCR and sequence analysis of dystrophin mRNA
fragments of the AON-treated DMD patient myotube cultures, focusing
on the regions encompassing the exons targeted for skipping.
Shorter, novel transcripts were observed when compared to the
untransfected myotube cultures (NT). Sequence analysis confirmed
the precise skipping of the targeted exons. An alternatively
spliced product, detected for patient 50685.1 (C) was sequenced and
found to be derived from activation of a cryptic splice site in
exon 51. Shorter fragments, detected in untransfected myotube
cultures from DL 363.2 (B), DL 589.2 (D) and 53914.1 (E), were
sequenced and found to be the result of the spontaneous skipping of
exons 44, 50 and 53, respectively. Note that in some analyses,
additional fragments, slightly shorter than the wild-type products,
were present. This was due to heteroduplex formation. 100 bp: size
marker, --RT-PCR: negative control.
[0032] FIG. 2. Immuno-histochemical analysis of the AON-treated
myotube cultures from the six different DMD patients. Cells were
stained for myosin to identify fully differentiated myotubes (not
shown). Monoclonal antibodies MANDYS1 (middle panel) and Dys2
(right panel) were used to detect dystrophin one to four days
post-transfection. No dystrophin signals could be detected in
untreated cells stained with MANDYS1 (left panel) nor Dys2 (not
shown), whereas clear, mainly cytoplasmatic, dystrophin signals
could be detected for each patient upon the induced exon skipping.
In patients DL 363.2 (B), DL 589.2 (D) and 53914.1 (E) dystrophin
membrane signals could be observed. We note that membrane signals
were more often found for Dys2, which recognizes the full-length
dystrophin. MANDYS1 recognizes an internal part of dystrophin and
is more prone to generate cytoplasmatic signals, since it also
detects dystrophin in the first stages of synthesis. Magnification
63.times..
[0033] FIG. 3. Western blot analysis of the AON-treated myotube
cultures. Monoclonal antibody DY4 was used to detect dystrophin.
Protein extracts isolated from human control myotube cultures (HC)
were used as a positive control (C and F). To avoid overexposure,
this sample was one to ten diluted. To demonstrate equal loading of
protein samples, blots were additionally stained with an antibody
against myosin. No, or, as a result of spontaneous exon skipping,
very low (B and C) levels of dystrophin were detected in
non-transfected myotube cultures (NT). Clear dystrophin signals
were observed in AON-treated myotube cultures for each of the
patients. For 50685.1 and DL 363.2, a time-course experiment was
performed. Dystrophin could be detected 16 hours post-transfection
and was found at increasing levels at 24 hours and 48 hours
post-transfection for 50685.1 (D). For DL 363.2 dystrophin could be
detected in increasing levels up to seven days post-transfection
(B). For patients DL 515.2 (A), DL 363.2 (B) and DL 589.2 (E) the
detected dystrophin was significantly shorter than the control
dystrophin. This is due to the size of the deletions in these
patients.
[0034] FIG. 4. Immuno-histochemical analysis of four DGC proteins
from treated myotube cultures from patient DL 363.2. Cells were
stained for myosin to identify sufficiently differentiated myotubes
(not shown). Monoclonal antibodies NCL-a-SARC, NCL-b-SARC,
NCL-g-SARC and NCL-b-DG were used to detect .alpha.-sarcoglycan,
.beta.-sarcoglycan, .gamma.-sarcoglycan and .beta.-dystroglycan,
respectively. These proteins were detected in reduced percentages
(.about.40%) in untreated myotubes, and were mainly located in the
cytoplasm (A). Following AON treatment, however,
.alpha.-sarcoglycan was detected in 70%, .beta.-sarcoglycan was
detected in 90%, .gamma.-sarcoglycan was detected in 90% and
.beta.-dystroglycan was detected in 80% of the myotubes, and the
proteins were mostly membrane-bound (B). Magnification
63.times..
[0035] FIG. 5. RT-PCR analysis of human dystrophin mRNA in the
regions encompassing the exons targeted for skipping. Shorter,
novel transcript fragments were observed following transfection
with the different AONs when compared to non-transfected myotube
cultures (NT). Sequence analysis (not shown) confirmed the skipping
of the targeted exons, as indicated by the labels adjacent to the
images. Alternatively spliced products, detected in the regions
around exon 2 (b), exon 29 (c), and exon 51 (h), were sequenced and
found to be derived from either co-skipping of adjacent exons or
usage of a cryptic splice site. No specific (RT-) PCR products were
obtained. In some analyses, additional fragments, lightly shorter
than the wild-type products, were present. This was due to
heteroduplex formation.
[0036] FIG. 6. Double-exon skipping in DMD patient DL90.3 carrying
a nonsense mutation in the out-of-frame exon 43. RT-PCR analysis of
dystrophin mRNA fragments of AON-treated myotubes from this patient
showed a shorter, novel transcript not present in untransfected
myotubes (NT). Sequence analysis confirmed the precise skipping of
the targeted exons 43 and 44. Besides this double-skip, we also
detected a single exon 44 skip. Note that the additional fragment,
slightly shorter than the wild-type product, is due to heteroduplex
formation. 100 bp: size marker, -RT-PCR: negative control.
[0037] FIG. 7 Double- and multi-exon skipping in human control
myotubes (KM 109), DMD patient DL 470.2, carrying a deletion of
exons 46 to 50, and DMD patient 50685.1, carrying a deletion of
exons 48 to 50. (A) RT-PCR analysis of dystrophin mRNA fragments in
the myotube cultures treated with either a mixture of h45AON5 and
h51AON2 (mix) or with a U-linked combination of AONs (U: h45AON5
linked to h51AON2 by ten uracil nucleotides). In all samples
treated with either the mix of AONs or the U-linker AON, a shorter
transcript fragment was detected that contained exon 44 spliced to
exon 52, and that was not present in untreated myotubes (NT). This
novel, in-frame transcript arose from double-exon skipping in
patient DL 470.2 (the targeted exons 45 and 51 are directly
flanking the deletion), but from multi-exon skipping in both the
human control and patient 50685.1. In the treated patient myotube
cultures, additional shorter fragments were observed due to
single-exon 45 and single-exon 51 skipping. Note that in some
lanes, other fragments, slightly shorter than the wild-type
products, were present. This was due to heteroduplex formation. 100
bp: size marker, --RT-PCR: negative control. (B) All fragments were
quantified using the DNA 7500 labchip.RTM. and the Bioanalyzer
(Agilent). The percentage of double- or multi-exon 45 to 51
skipping was determined by the ratio of this fragment to the total
of transcript fragments. The U-combined AON seems less efficient in
DL 470.2, but more efficient in KM 109 and 50685.1, when compared
to the mixture of AONs.
[0038] FIG. 8 Schematic overview of double and multiexon skipping
in three patients with one human control. AONs are indicated by
blue lines. Primers for RT-PCR analysis are indicated by arrows. A,
Patient DL90.3 has a nonsense mutation in exon 43 (indicated by an
asterisk). The resulting out-of-frame transcript is indicated in
red. In contrast to single-exon skipping of exon 43 or 44,
double-exon skipping of both exons restores the reading frame
(in-frame transcript indicated in green). When myotubes derived
from this patient are targeted by AONs specific for exons 43 and
44, single-exon skipping of exon 43 and exon 44 (indicated by red
dotted lines) can be expected in addition to the anticipated
double-exon skipping. Patient DL470.2 carries an exon 46-50
deletion, which results in a frameshift and a stop codon in exon
51. Single-exon skipping of exon 45 or exon 51 is not frame
restoring, whereas double-exon skipping of both exons 45 and 51 is.
B, Multiexon skipping of exons 45-51 preserves the reading frame in
a control transcript (individual KM109). Patient 50685.1 has a
deletion of exons 48-50, resulting in a stop codon in exon 51.
Multiexon skipping of exons 45, 46, 47, and 51 restores the reading
frame for this patient. In addition to the skipping of exons 45-51,
single-exon skipping of exon 45 and exon 51 can also be
expected.
[0039] FIG. 9 Double-exon skipping in patient DL90.3, who carries a
nonsense mutation in the out-of-frame exon 43. A, RT-PCR analysis
of dystrophin mRNA fragments in AON-treated myotube cultures showed
a shorter, novel transcript not present in nontransfected (NT)
myotube cultures. Sequence analysis confirmed the precise skipping
of both exon 43 and exon 44. Along with the double skip, we also
detected a single skip of exon 44 but not a single-exon skip of
exon 43. Note that weak additional fragments, slightly shorter than
the wild-type products, were present. These were derived from
heteroduplex formation. 100 bppsize marker; RT-PCRpnegative
control. B, Immunohistochemical analysis of the AON-treated myotube
cultures. Cells were stained for myosin to identify fully
differentiated myotubes (lower panel). Monoclonalantibodies MANDYS1
and Dys2 were used to detect dystrophin two days after
transfection. No dystrophin signals could be detected in untreated
cells stained with MANDYS1 (left panel) or Dys2 (not shown),
whereas clear dystrophin signals could be detected in treated cells
for both dystrophin antibodies. Magnification.times.63. C, Western
blot analysis of the AON-treated myotube cultures. The monoclonal
antibody Dys1 was used to detect dystrophin. Protein extracts
isolated from MyoD-transduced human control (HC) fibroblasts were
used as a positive control. To avoid overexposure, this sample was
diluted 1:5. To confirm equal loading of protein samples, blots
were additionally stained with an antibody against myosin. No
dystrophin was detected in NT myotube cultures. Clear dystrophin
signals were observed in AON-treated myotube cultures after two
days, which were increased at four days.
[0040] FIG. 10 Double-exon skipping in patient DL470.2, who carries
a deletion of exons 46-50. A, RT-PCR analysis of dystrophin mRNA
fragments of AON-treated myotube cultures showed a shorter, novel
transcript not present in NT myotube cultures. The precise skipping
of both exon 45 and exon 51 was confirmed by sequence analysis.
Along with the double skip, we also detected a single skip of exon
51 but no single skip of exon 45. Because of heteroduplex
formation, we observed weak additional fragments, slightly shorter
than the wild-type products. 100 bp=size marker; RT-PCR=negative
control. B, Immunohistochemical analysis of the AON-treated myotube
cultures. Cells were stained for myosin to identify fully
differentiated myotubes (lower panel). Monoclonal antibodies
MANDYS1 and Dys2 were used to detect dystrophin two days after
transfection. In treated cells, clear dystrophin signals could be
detected for both antibodies, in contrast to untreated cells
stained with MANDYS1 (left panel) or Dys2 (not shown).
Magnification.times.63. C, Western blot analysis of the AON-treated
myotube cultures. Monoclonal antibody Dys1 was used to detect
dystrophin. Protein extracts isolated from human control myotubes
were used as a positive control, which was diluted 1:10 to avoid
overexposure. Blots were additionally stained with an antibody
against myosin to confirm equal loading of all samples. No
dystrophin was detected in NT myotube cultures, whereas clear
dystrophin signals were observed in AON-treated myotube cultures
after one day, which increased after two days. Note that the
dystrophin from patient DL470.2 is shorter than the control
dystrophin. This correlates with the size of the deletion.
[0041] FIG. 11 RT-PCR analysis of the entire DMD transcript from
RNA, isolated from untreated (-) and treated (+) myotubes from both
patients. The anticipated specific-exon skipping patterns are
present in the fragments containing exons 34-45 (patient DL90.3)
and 42-53 (patients DL90.3 and DL470.2). Note that because of the
deletion of exons 46-50, the wild-type fragment for this patient is
shorter than that of patient DL90.3. No unexpected splicing
anomalies were detected in other parts of the DMD gene, confirming
the sequence specificity of the AONs. "M" is the 100-bp size
marker.
[0042] FIG. 12 Double and multi-exon skipping in myotubes from the
human control (individual KM109) and from patients DL470.2
(deletion of exons 46-50) and 50685.1 (deletion of exons 48-50). A,
RT-PCR analysis of dystrophin mRNA fragments in myotube cultures
treated with either a mixture of h45AON5 and h51AON2 (mix) or a
U-linked combination of these AONs (U). In all samples treated with
either the mixture of AONs or the U-linked AON, a shorter
transcript fragment was detected that contained exon 44 precisely
spliced to exon 52 (confirmed by sequence analysis; data not
shown). This was not present in NT myotubes. The novel in-frame
transcript arose from double-exon skipping in patient DL470.2 (the
targeted exons 45 and 51 are flanking the deletion), but in both
the control and patient 50685.1 the transcript was a result of
multiexon skipping. Also observed were additional shorter
fragments, which were caused by single-exon skipping (exon 45 or
51) or partial multi-exon skipping (exons 46-51). Note that in some
lanes, other fragments, slightly shorter than the wild-type
products, were present. This was a result of heteroduplex
formation. 100 bp=size marker; RT-PCR=negative control. B,
Schematic drawing of the U-linked AON (SEQ ID NO:50). The exon
51-specific AON (h51AON2, SEQ ID NO:38) is linked to the exon
45-specific AON (h45AON5, SEQ ID NO:2) by ten uracil nucleotides.
C, All fragments were quantified using the DNA 1000 LabChip and the
Bioanalyzer (Agilent). The percentage of double or multi-exon
skipping of exons 45-51 was determined by the ratio of this
fragment to the total of transcript fragments. In contrast to
patient DL470.2, the U-linked AON was more efficient for patients
KM109 and 50685.1, when compared to the mixture of individual
AONs.
[0043] FIG. 13 Comparative analysis of DNA, 2OMePS, morpholino, LNA
and PNA AONs directed at exon 46. A) Gel mobility shift assay with
a radiolabeled exon 46 RNA fragment hybridized to the different
analogs. A clear mobility shift was observed for the AONs with the
DNA and LNA backbone, which is less prominent for the 2OMePS AON.
No shift was observed for the morpholino, the PNA or a random AON.
B) Transfection of the different AON analogs into control myotubes.
Efficiencies of over 80% were obtained for the 2OMePS, the
morpholino and the LNA AONs, whereas for the PNAs efficiencies were
60% to 70%. In contrast to the other AON analogs, the morpholino
was also abundant in the cytoplasm. C) RT-PCR analysis of
dystrophin mRNA fragments from unaffected control and DMD
patient-derived (DL279.1) myotubes following transfection of the
different AON analogs. With the exception of the PNA, exon 46
skipping was detected for each analog, both in patient and control
myotubes. The precise skipping of exon 46 was confirmed by sequence
analysis (data not shown). 100 bp is the DNA size marker. D)
Quantification of RT-PCR products. The percentage of exon 46
skipping was determined by the ratio of the shorter fragment to the
total of transcript fragments, and is shown above each column. The
LNA induced highest levels of exon skipping in both unaffected
control (85%) and patient-derived (98%) myotubes. The 2OMePS AON
was remarkably more efficient in the patient-derived myotubes when
compared to the control (75% vs. 20%, respectively). The morpholino
was only moderately effective (5-6%) both in control and
patient-derived myotubes.
[0044] FIG. 14. Concentration series of LNA8 in control and
patient-derived (DL279.1) myotube cultures. A) RT-PCR analysis of
dystrophin mRNA fragments. Significant levels of exon 46 skipping
were observed at each dose tested for the patient (DL279.1),
whereas only low levels were detected for a dose of 200 nM and 100
nM in the human control. In control myotubes, skipping of both exon
45 and 46 was sometimes observed at the highest doses (400 and 500
nM). For some DL279.1 fragments, products slightly larger than the
wild-type fragments can be observed. This is due to heteroduplex
formation of first and second PCR products. 100 bp is the DNA size
marker. B) Quantification of the RT-PCR fragments showed that the
levels of exon skipping decrease considerably at doses below 500 nM
for the human control (from 97% at 500 nM to 30% at 400 nM and
below 1% at 100 nM), but remain high (86%) at a dose of 300 nM for
the patient and still significant (10%) at a 100 nM
concentration.
[0045] FIG. 15. Analysis of LNA and 2OMePS AONs containing
mismatches in patient-derived myotubes. A) Sequences of the
different LNAs aligned to their target sequence in exon 46 (SEQ ID
NO:64, depicted at the top from 3' to 5'). In the figure, LNA 8 is
SEQ ID NO:45; LNA mm1 is SEQ ID NO:52; LNA mm2 is SEQ ID NO:53; LNA
mm3 is SEQ ID NO:54; LNA mm4 is SEQ ID NO:55; LNA mm5 is SEQ ID
NO:56; and LNA9 is SEQ ID NO:57. Mismatches to the target sequence
are underlined. LNA9 is shifted to the 3' side of the target
sequence when compared with the original LNA (LNA8) and is
completely homologous to the target sequence. B) RT-PCR analysis
and C) quantification of dystrophin mRNA fragments from LNA treated
patient (DL279.1) myotubes. The LNAs containing mismatches in the
3' end (LNAmm1 and 4) induced exon 46 skipping to levels that are
comparable to those induced by the original LNA (71%-94% vs. 100%).
The mismatches in the 5' or central part (LNAmm2, 3 and 5)
seriously reduced the skipping capacity (<8%). Fragments
slightly larger than the wild-type band were observed. This is due
to heteroduplex formation between first and second PCR products.
100 bp is the DNA size marker. D) Sequences of the different 2OMePS
AONs aligned to the target sequence in exon 46 (SEQ ID NO:58,
depicted at the top from 3' to 5'). In the figure, 20MePS is SEQ ID
NO:25; 20MePmm1 is SEQ ID NO:59; 20MePmm2 is SEQ ID NO:60; 20MePmm3
is SEQ ID NO:61; 20MePmm4 is SEQ ID NO:62; and 20MePmm5 is SEQ ID
NO:63; Mismatches to the target sequence are underlined. E) RT-PCR
analysis and F) quantification of dystrophin mRNA fragments from
2OMePS treated patient (DL279.1) myotubes. The presence of one
mismatch at the 3' side (2OMePSmm1) already results in an over 2.5
fold reduction in exon skipping levels, while even more reduced
levels are found for the AONs containing two and three mismatches
(2OMePSmm2 and 3). Virtually no skipping was induced by the AONs
that contain a single mismatch at the 5' part (2OMePSmm4) or a
single mismatch in the 3', central as well as the 5' part
(2OMePSmm5) of the oligo. 100 bp is the DNA size marker.
[0046] FIG. 16 Multi-exon 42 to 55 skipping in human control
myotubes (KM 109). RT-PCR analysis of dystrophin mRNA fragments in
the myotube cultures treated with either a mixture of h42AON1 and
h55AON1 (Lane 4: mix) or with a U-linked combination of these AONs
(Lane 3, U: h42AON1 linked to h55AON1 by ten uracil nucleotides).
In all samples treated with either the mix of AONs or the U-linker
AON, a shorter transcript fragment was detected that contained exon
42 spliced to exon 55, and that was not present in untreated
myotubes (Lane 2 "NT"). This novel, in-frame, transcript arose from
multi-exon skipping of a stretch of exons between 42 and 55.
Additional shorter fragments were observed due to additional
alternative splicing patterns. In addition, note that in some
lanes, other fragments, slightly shorter than the wild-type
products, were present. This was due to heteroduplex formation.
Lane (1)=100 bp: size marker, Lane 5=-RT-PCR: negative control.
DETAILED DESCRIPTION OF THE INVENTION
EXAMPLES
Example 1
Results
[0047] This study includes 6 DMD patients affected by different
mutations (Table 1). Patient DL 515.2 carries an exon 45-50
deletion; hence exon 51 skipping would be frame correcting. Patient
DL 363.2 has a deletion of exon 45-54; the reading frame for this
patient would be corrected by an exon 44 skip. For patient 50685.1,
who is affected by an exon 48-50 deletion, reading frame correction
requires an exon 51 skip. Patient DL 589.2 has an exon 51-55
deletion; the reading frame would be corrected by an exon 50 skip.
Patient 53914.1 carries a single exon 52 deletion. Notably, in this
case both the skipping of exon 51 or exon 53 would be frame
correcting. Finally, patient 50423.1 has a deletion of a single
base pair in exon 49, at position 7389 on cDNA level, resulting in
a frame-shift and a premature stop codon in exon 49. Since exon 49
is an in-frame exon, skipping of this exon would correct the
reading frame for this patient.
[0048] We have previously identified AONs with which the skipping
of the mentioned target exons 44, 49, 50, 51 and 53 can be induced
at concentrations of 1 .mu.M (23). In subsequent dose-response
experiments, however, we have obtained substantial skipping
efficiencies with lower concentrations of 500 nM or 200 nM, and
even 100 nM for most AONs (data not shown). This had the extra
advantageous effect of lower doses of PEI required for
transfection, which significantly reduced the levels of
cytotoxicity as found in our earlier transfection experiments.
Myotube cultures from the 6 DMD patients were transfected with the
relevant AONs. On average, 70% to 90% of cells showed specific
nuclear uptake of fluorescent AONs. RNA was isolated 24 hours
post-transfection and analyzed by RT-PCR (FIG. 1). In all patients,
the targeted exons were skipped at high efficiencies, and precisely
at the exon boundaries, as confirmed by sequence analysis of the
novel shorter transcripts (FIG. 1). For patient 50685.1, an
additional transcript fragment was found (FIG. 1C). Sequence
analysis showed that this was generated by the activation of a
cryptic splice site in exon 51. This was previously also observed
in human control cells treated with the same AON (23). Remarkably,
low levels of spontaneous exon skipping were observed in untreated
cells derived from patients DL 363.2 (exon 44 skip), DL 589.2 (exon
50 skip), and 53914.1 (exon 53 skip). RT-PCR analysis on several
larger areas of the DMD gene transcript did not reveal additional,
unexpected, aberrant splicing patterns induced by the
AON-treatment.
[0049] The resulting in-frame transcripts should restore dystrophin
synthesis. Indeed, immuno-histochemical analysis of transfected
myotube cultures detected dystrophin in the majority of myotubes
for each patient (FIG. 2). The therapeutic efficiency was
determined by double staining, using antibodies against myosin, to
identify sufficiently differentiated myotubes, and dystrophin. On
average, 75% to 80% of myosin-positive myotubes showed dystrophin
expression. We observed clear membrane-bound dystrophin for
patients DL 363.2, DL 589.2 and 53914.1 two days post-transfection
(FIG. 2, Panels B, D, E). The presence of dystrophin was confirmed
for each patient by Western blot analysis (FIG. 3). For patients
50685.1 and DL 363.2 we performed time course experiments, which
indicated that dystrophin can be detected as soon as 16 hours
post-transfection (FIG. 3, Panel D) and at increasing levels up to
seven days post-transfection (FIG. 3, Panel B). The dystrophin
proteins from patients DL515.2, DL 363.2 and DL 589.2 are
significantly shorter than the human control, which is due to the
size of the deletion.
[0050] For one patient, DL 363.2, we also assessed whether the
induction of the dystrophin synthesis resulted in the restoration
of the DGC (FIG. 4). Prior to AON treatment we found reduced,
mainly cytoplasmatic alpha, beta, gamma sarcoglycan and
beta-dystroglycan signals (30%, 30%, 40% and 80%, respectively)
(FIG. 4, Panel A). Following AON transfection, increased levels of
mainly membrane-bound alpha-, beta- and gamma-sarcoglycans and
beta-dystroglycan were detected in 70%, 90%, 90% and 80% of the
treated myotube cultures, respectively (FIG. 4, Panel B).
Discussion
[0051] The reading frame correction strategy for DMD patients is
aimed at antisense-induced, targeted exon skipping. This would
convert a severe DMD phenotype into a mostly milder BMD phenotype.
We determined the broad applicability in six patients, carrying
five different deletions and a point mutation in an exon 49 (Table
1). Following AON treatment, we show for each patient the precise
skipping of the targeted exon on RNA level, and a dystrophin
protein in 75% to 80% of the treated myotubes. In particular, we
here report, for the first time, the application of a single AON
treatment (i.e., the induced skipping of exon 51) to correct the
reading frame for several different deletions.
[0052] Interestingly, the levels of exon skipping observed in the
DMD patient cells are significantly higher than those previously
obtained in human control cells (23). Typically, the novel skip
transcript is the major product. This can be explained by the
action of the nonsense-mediated decay (NMD) process (25, 32). In
control cells, the skip of an out-of-frame exon results in an
out-of-frame transcript, which will be susceptible to NMD. In
patient cells, the skip of a target exon results in an in-frame
transcript that would be resistant to NMD and thus more stable than
the out-of-frame transcript originally present.
[0053] For three of the patients (DL 363.2, DL 589.2 and 53914.1)
we detected low levels of spontaneous skipping of exons 44, 50 and
53 in untreated cells. This phenomenon has previously also been
described for so-called revertant muscle fibers (33-35). These
dystrophin positive fibers are present in low amounts (2% to 10%)
in DMD muscles, and are considered to be the result of secondary
somatic mutations and/or alternative splicing that restore the
reading frame. The existence of revertant fibers has been suggested
to correlate with the severity of the disease (36, 37).
[0054] Restoration of the dystrophin synthesis could be detected as
soon as 16 hours post-transfection. At two days post-transfection,
dystrophin was detected at the membrane indicating that these novel
BMD-like proteins are likely in part functional. Furthermore, we
show that restoration of the dystrophin synthesis appears to
re-establish the formation of the dystrophin-glycoprotein
complex.
[0055] In patients DL 363.2 and DL 589.2, the targeted exon
skipping enlarged the deletions to span exons 44-54 and 50-55,
respectively. So far, these deletions have not been reported in DMD
or BMD patients. This means that they either do not exist, or
generate a very mild phenotype not diagnosed as BMD. Considering
both the large variety of BMD mutations and the markedly lower
incidence of BMD observed, we consider the last explanation more
plausible than the first. The out-of-frame deletions from patients
DL 515.1, 50685.1 and 50423.1 were converted into in-frame
deletions as observed in BMD patients carrying deletions of exon
45-51, exon 48-51 and exon 49 (30, 38-40). Noteworthy, the exon
48-51 deletion has even been described in an asymptomatic person
(40). On the other hand however, there are also DMD patients
carrying such deletions (38, 41-43). Since most of these
theoretically in-frame deletions have been detected on DNA level
only, we hypothesize that the dystrophin deficiency in these DMD
patients may be caused by additional aberrant splicing patterns on
RNA level, resulting in an out-of-frame transcript.
[0056] It is feasible to correct over 75% of the mutations reported
in the Leiden DMD-mutation database (30). Our results indicate that
antisense-induced reading frame correction will be a promising
therapeutic approach for many DMD patients carrying different
deletions and point mutations. Towards the establishment of
clinical trials, we are currently investigating and optimizing
delivery methods in muscle tissue of mice in vivo.
Material and Methods
AONs and Primers
[0057] The AONs applied (Table 1) were previously described (23).
They contain a 5' fluorescein group (6-FAM), a full-length
phosphorothioate backbone and 2'-O-methyl modified ribose molecules
(Eurogentec, Belgium). To avoid interference with the fluorescent
signals of the secondary antibodies, unlabelled AONs were used for
immuno-histochemical analyses. Primers for RT-PCR analysis
(sequences available upon request) were synthesized by Eurogentec
(Belgium) or by Isogen Bioscience BV (The Netherlands).
Myogenic Cell Cultures and AON Transfections
[0058] Primary human myoblasts from patients DL 515.2 (deletion
exon 45-50), DL 363.2 (deletion exon 45-54), 50685.1 (deletion exon
48-50), DL 589.2 (deletion exon 51-55) and 53914.1 (deletion exon
52) were isolated from a muscle biopsy and cultured as described
(44). Cultures were seeded in collagen pre-coated flasks and plates
(Vitrogen 100, Cohesion). Myotubes were obtained from confluent
myoblast cultures, following 7 to 14 days of serum-deprivation.
They were subsequently transfected using polyethylenimine (PEI) for
three hours in low-serum medium, according to the manufacturer's
instructions (ExGen500; MBI Fermentas), and with 3.5 .mu.l PEI
applied per .mu.g of transfected AON. For RT-PCR analysis,
concentrations of 500 nM AON were used. At this concentration
highest skipping levels can be obtained, albeit with moderate
levels of cell death. Since for immunohistochemical and western
blot analysis more viable myotubes are required, concentrations of
200 nM were applied.
[0059] For patient 50423.1, who carries a point mutation in exon
49, only fibroblasts were available. Following infection (MOI
50-100) with an adenoviral vector containing the MyoD gene
(Ad50MyoD), the fibroblasts were forced into myogenesis according
to protocols described previously (45-47). Two hours post-infection
the medium was replaced by low serum medium, and cells were
incubated for eight to ten days until myotubes were formed.
Transfection conditions were identical to those described
above.
RNA Isolation and RT-PCR Analysis
[0060] At 24 hours post-transfection, total RNA was isolated from
the myotube cultures (RNA-Bee RNA isolation solvent, Campro
Scientific, The Netherlands). 300 ng of total RNA was used for
RT-PCR analysis using C.therm polymerase (Roche Diagnostics, The
Netherlands) in a 20 .mu.l reaction at 60.degree. C. for 30
minutes, primed with different DMD gene-specific reverse primers
(Table 1). Primary PCRs were performed by 20 cycles of 94.degree.
C. (40 seconds), 60.degree. C. (40 seconds) and 72.degree. C. (60
seconds). One .mu.l of these reactions was then reamplified in
nested PCRs by 32 cycles of 94.degree. C. (40 seconds), 60.degree.
C. (40 seconds) and 72.degree. C. (60 seconds). PCR products were
analyzed on 1.5% or 2% agarose gels. Noteworthy, no evidence for a
significant preference for the amplification of shorter fragments
was obtained in PCR analyses on a defined series of mixtures of
known quantities of the normal and shorter transcript fragments
(data not shown).
Sequence Analysis
[0061] RT-PCR products were isolated from agarose gels using the
QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was
carried out by the Leiden Genome Technology Center (LGTC) using the
BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied
Biosystems) and analyzed on an ABI 3700 Sequencer (PE Applied
Biosystems).
Protein Isolation and Western Blot Analysis
[0062] Protein extracts were isolated from treated myotube cultures
(25 cm.sup.2 flasks), using 150 .mu.l of treatment buffer (75 mM
Tris-HCl pH 6.8, 15% SDS, 5% b-mercaptoethanol, 2% glycerol, 0.001%
bromophenol blue), at two to four days post-transfection depending
on the survival rate of the myotubes. For the time course
experiments, protein extracts were isolated four hours, eight
hours, 16 hours, 24 hours and 48 hours post-transfection (for
patient 50685.1) or at two days, four days and seven days
post-transfection (for patient DL 363.2).
[0063] Polyacrylamide gel electrophoresis and Western blotting were
performed as described by Anderson et al, with some minor
adjustments (48). Briefly, samples (75 .mu.l) were run overnight at
4.degree. C. on a 4% to 7% polyacrylamide gradient gel. Gels were
blotted to nitrocellulose for five to six hours at 4.degree. C.
Blots were blocked for one hour with 5% non-fat dried milk in TBST
buffer (10 mM Tris-HCl, 0.15 M NaCl, 0.5% Tween 20, pH 8) followed
by an overnight incubation with NCL-DYS2 (which recognizes
dystrophin) diluted 1:50. HRP-conjugated anti-mouse (Santa Cruz)
diluted 1:10,000 was used as a secondary antibody. Immuno-reactive
bands were visualized using Lumi-Lightplus Western Blotting
Substrate and scanned with a Lumi-Imager (Roche Diagnostics, The
Netherlands).
Immuno-Histochemical Analysis
[0064] Treated myotube cultures were fixed in -20.degree. C.
methanol at one to four days post-transfection, depending on the
survival rate of the myotubes. Prior to reaction with the different
antibodies, the cells were incubated for one hour in a blocking
solution containing 5% horse serum (Gibco BRL) and 0.05% Tween-20
(Sigma) in PBS (Gibco BRL). All antibodies used were diluted in
this blocking solution. The following antibodies were applied:
desmin polyclonal antibody (ICN Biomedicals) diluted 1:100, myosin
monoclonal antibody diluted 1:100 (MF20; Developmental Studies
Hybridoma Bank, University of Iowa), myosin polyclonal antibody L53
diluted 1:100 (a gift from Dr. M. van den Hoff, AMC, The
Netherlands), MANDYS1 (a gift from Dr. G. Morris, North East Wales
Institute, UK) diluted 1:10 and NCL-DYS2 (Novacastra Laboratories
Ltd) diluted 1:10 to detect dystrophin, NCL-a-SARC (Novacastra
Laboratories Ltd) diluted 1:75, NCL-b-SARC (Novacastra Laboratories
Ltd) diluted 1:50, NCL-g-SARC (Novacastra Laboratories Ltd) diluted
1:50 and NCL-b-DG (Novacastra Laboratories Ltd) diluted 1:50 to
detect .alpha.-sarcoglycan, .beta.-sarcoglycan, .gamma.-sarcoglycan
and .beta.-dystroglycan, respectively. After one hour incubation,
slides were rinsed and incubated for one hour with the secondary
antibodies Alexa Fluor 594 goat anti-rabbit conjugate diluted
1:1000 or Alexa Fluor 488 goat anti-mouse conjugate diluted 1:250
(Molecular Probes, Inc). The slides were analyzed using a Leica
confocal microscope equipped with epifluorescence optics. Digital
images were captured using a CCD camera (Photometrics).
Example 2
Materials and Methods
AONs and Primers
[0065] A series of AONs (two per exon, see Table 2) was designed to
bind to exon-internal target sequences showing a relatively high
purine-content and, preferably, an open secondary pre-mRNA
structure (at 37.degree. C.), as predicted by the RNA mfold version
3.1 server [22]. The AONs varied in length between 15 and 24 bp,
with G/C contents between 26 and 67%. They were synthesized with
the following chemical modifications: a 5'-fluorescein group
(6-FAM), a full-length phosphorothioate backbone and 2'-O-methyl
modified ribose molecules (Eurogentec, Belgium). The primers used
for reverse transcription-polymerase chain reaction (RT-PCR)
analysis (Table 3) were synthesized by Eurogentec (Belgium) or by
Isogen Bioscience BV (The Netherlands).
In Vitro Experiments
[0066] Primary human myoblasts were isolated from a muscle biopsy
from a non-affected individual (KM108) by enzymatic dissociation.
Briefly, the tissue was homogenized in a solution containing 5
mg/ml collagenase type VIII (Sigma), 5 mg/ml bovines albumin
fraction V (Sigma), 1% trypsin (Gibco BRL) in PBS (Gibco BRL).
Following serial incubation steps of 15 minutes at 37.degree. C.,
suspensions containing the dissociated cells were added to, and
pooled in, an equal volume of proliferation medium (Nut.Mix F-10
(HAM) with GlutaMax-1, Gibco BRL) supplemented with 20% fetal
bovine serum (Gibco BRL) and 1% penicillin/streptomycin solution
(Gibco BRL). After centrifugation, the cells were plated and
further cultured in proliferation medium, using flasks that were
pre-coated with purified bovine dermal collagen (Vitrogen 100;
Cohesion). The myogenic cell content of the culture, as determined
by the percentage of desmin-positive cells in an
immunohistochemical assay, was improved to 58% by repetitive
preplating [23]. Myotubes were obtained from confluent myoblast
cultures following seven to 14 days of incubation in low-serum
medium (DMEM (Gibco BRL), supplemented with 2% GlutaMax-1, 1%
glucose, 2% fetal bovine serum and 1% penicillin/streptomycin
solution). For transfection of the myotube cultures, we used
polyethylenimine (PEI; ExGen 500) according to the manufacturer's
instructions (MBI Fermentas). The cultures were transfected for
three hours in low-serum medium with 1 mM of each AON linked to PEI
at a ratio-equivalent of 3.5.
[0067] RNA isolation and RT-PCR analysis at 24 hours
post-transfection, total RNA was isolated from the myotube cultures
using RNAzol B according to the manufacturer's instructions (Campro
Scientific, The Netherlands). One microgram of RNA was then used
for RT-PCR analysis using C. therm polymerase (Roche Diagnostics)
in a 20 .mu.l reaction at 60.degree. C. for 30 minutes, primed with
different DMD gene-specific reverse (RT) primers (Table 3). Primary
PCRs were carried out with outer primer sets (see Table 3), for 20
cycles of 94.degree. C. (40 seconds), 60.degree. C. (40 seconds),
and 72.degree. C. (90 seconds). One microliter of this reaction was
then reamplified in nested PCRs using the appropriate primer
combinations (Table 3) for 32 cycles of 94.degree. C. (40 seconds),
60.degree. C. (40 seconds), and 72.degree. C. (60 seconds). PCR
products were analyzed on 1.5 or 2% agarose gels.
[0068] Sequence analysis RT-PCR products were isolated from agarose
gels using the QIAquick Gel Extraction kit (Qiagen). Direct DNA
sequencing was carried out by the Leiden Genome Technology Center
(LGTC) using the BigDye Terminator Cycle Sequencing Ready Reaction
kit (PE Applied Biosystems), and analyzed on an ABI 3700 Sequencer
(PE Applied Biosystems).
Results
In Vitro Exon Skipping
[0069] AONs were empirically analyzed for the induction of exon
skipping following transfection into human control myotube
cultures, using the cationic polymer polyethylenimine (PEI). As
determined by the nuclear uptake of the fluorescent AONs, average
transfection efficiencies of 60-80% were obtained. At 24 hours
post-transfection, transcripts were analyzed by RT-PCR using
different primer combinations encompassing the targeted exons
(Table 3). Of the 30 AONs tested, a total of 21 (70%) reproducibly
generated shorter transcript fragments with sizes corresponding to
the specific skipping of the targeted exons (FIG. 5 and Table 2).
In fact, as confirmed by sequence analysis of the shorter
transcripts (data not shown), we could induce the specific skipping
of 13 out of the 15 exons targeted (five out of the seven in-frame
exons, and eight out of the eight out-of-frame exons). No skipping
of exons 47 and 48 was detected (FIG. 5, Panels e, g).
[0070] In the specific transcript regions that were screened in
these experiments, we observed in the non-transfected control
myotubes alternative splicing patterns around exons 2 and 29 (FIG.
5, Panels b, c). The alternative products were sequenced and found
to be due to the skipping of exons 2-7 (in-frame), exons 3-7
(out-of-frame), exons 28-29 (in-frame), and exons 27-29 (in-frame).
This genuinely occurring exon skipping was also detected previously
in human skeletal muscle [24,25]. Remarkably, the level of the
alternative splicing was significantly enhanced by the AON
treatment of the transfected myotube cultures. Noteworthy also is
the observation that h2AON1 not only induced exon 2 skipping in the
normal transcript, but also in one of the alternative transcripts
consisting of exons 1 and 2 spliced to exon 8 (FIG. 5, Panel
b).
[0071] The majority of AONs induced the precise skipping of the
targeted exons, using the original splice sites of the adjacent
exons. However, in response to h51AON2, an in-frame cryptic splice
site was used in exon 51 (FIG. 5, Panel h). The level of this
alternatively spliced product was variable in serial transfection
experiments. Finally, in some of the transfection experiments,
additional aberrant splicing fragments were detected due to the
co-skipping of adjacent exons. Their incidence, however, was
inconsistent, and at very low levels.
[0072] References to Example 2 (numbering in this part refers
strictly to numbering maintained in Example 2). [0073] [1] E. P.
Hoffman, R. H. Brown Jr., L. M. Kunkel. Dystrophin: the protein
product of the Duchenne muscular dystrophy locus. Cell 1987;
51:919-928. [0074] [2] A. P. Monaco, C. J. Bertelson, S.
Liechti-Gallati, H. Moser, L. M. Kunkel. An explanation for the
phenotypic differences between patients bearing partial deletions
of the DMD locus. Genomics 1988; 2:90-95. [0075] [3] M. Koenig, A.
H. Beggs, M. Moyer, et al. The molecular basis for Duchenne versus
Becker muscular dystrophy: correlation of severity with type of
deletion. Am. J. Hum. Genet. 1989; 45:498-506. [0076] [4] E. E.
Zubrzycka-Gaarn, D. E. Bulman, G. Karpati, et al. The Duchenne
muscular dystrophy gene product is localized in sarcolemma of human
skeletal muscle. Nature 1988; 333:466-469. [0077] [5] M. Yoshida
and E. Ozawa. Glycoprotein complex anchoring dystrophin to
sarcolemma. J. Biochem. (Tokyo) 1990; 108:748-752. [0078] [6] J. M.
Ervasti and K. P. Campbell. Membrane organization of the
dystrophinglycoprotein complex. Cell 1991; 66:1121-1131. [0079] [7]
M. Koenig, A. P. Monaco, L. M. Kunkel. The complete sequence of
dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988;
53:219-226. [0080] [8] J. C. van Deutekom, S. S. Floyd, D. K. Booth
D K, et al. Implications of maturation for viral gene delivery to
skeletal muscle. Neuromuscul. Disord. 1998; 8:135-148. [0081] [9]
A. Mayeda, Y. Hayase, H. Inoue, E. Ohtsuka, Y. Ohshima. Surveying
cis-acting sequences of pre-mRNA by adding antisense 20-O-methyl
oligoribonucleotides to a splicing reaction. J. Biochem. (Tokyo)
1990; 108:399-405. [0082] [10] U. Galderisi, A. Cascino, A.
Giordano. Antisense oligonucleotides as therapeutic agents. J.
Cell. Physiol. 1999; 181:251-257. [0083] [11] B. F. Baker and B. P.
Monia. Novel mechanisms for antisense-mediated regulation of gene
expression. Biochim. Biophys. Acta 1999; 1489:3-18. [0084] [12] R.
Kole and P. Sazani. Antisense effects in the cell nucleus:
modification of splicing. Curr. Opin. Mol. Ther. 2001; 3:229-234.
[0085] [13] P. Sicinski, Y. Geng, A. S. Ryder-Cook, E. A. Barnard,
M G. Darlison, P. J. Barnard. The molecular basis of muscular
dystrophy in the mdx mouse: a point mutation. Science 1989;
244:1578-1580. [0086] [14] M. G. Dunckley, M. Manoharan, P.
Villiet, I. C. Eperon, G. Dickson. Modification of splicing in the
dystrophin gene in cultured Mdx muscle cells by antisense
oligoribonucleotides. Hum. Mol. Genet. 1998; 7:1083-1090. [0087]
[15] C. J. Mann, K. Honeyman, A. J. Cheng, et al. Antisense-induced
exon skipping and synthesis of dystrophin in the mdx mouse. Proc.
Natl. Acad. Sci. U.S.A. 2001; 98:42-47. [0088] [16] S. D. Wilton,
F. Lloyd, K. Carville, et al. Specific removal of the nonsense
mutation from the mdx dystrophin mRNA using anti-sense
oligonucleotides. Neuromuscul. Disord. 1999; 9:330-338. [0089] [17]
Y. Takeshima, H. Wada, M. Yagi, et al. Oligonucleotides against a
splicing enhancer sequence led to dystrophin production in muscle
cells from a Duchenne muscular dystrophy patient. Brain Dev. 2001;
23:788-790. [0090] [18] Z. A. Pramono, Y. Takeshima, H.
Alimsardjono, A. Ishii, S. Takeda, M. Matsuo. Induction of exon
skipping of the dystrophin transcript in lymphoblastoid cells by
transfecting an antisense oligodeoxynucleotide complementary to an
exon recognition sequence. Biochem. Biophys. Res. Commun. 1996;
226:445-449. [0091] [19] A. Watakabe, K. Tanaka, Y. Shimura Y. The
role of exon sequences in splice site selection. Genes Dev. 1993;
7:407-418. [0092] [20] K. Tanaka, A. Watakabe, Y. Shimura.
Polypurine sequences within a downstream exon function as a
splicing enhancer. Mol. Cell. Biol. 1994; 14:1347-1354. [0093] [21]
J. C. van Deutekom, M. Bremmer-Bout, A. A. Janson, et al.
Antisenseinduced exon skipping restores dystrophin expression in
DMD patient derived muscle cells. Hum. Mol. Genet. 2001;
10:1547-1554. [0094] [22] D. H. Mathews, J. Sabina, M. Zuker, D. H.
Turner. Expanded sequence dependence of thermodynamic parameters
improves prediction of RNA secondary structure. J. Mol. Biol. 1999;
288:911-940. [0095] [23] C. Richler and D. Yaffe. The in vitro
cultivation and differentiation capacities of myogenic cell lines.
Dev. Biol. 1970; 23:1-22. [0096] [24] A. Stirono, Y. Takeshima, T.
Wibawa, Z. A. Pramono, M. Matsuo. Six novel transcripts that remove
a huge intron ranging from 250 to 800 kb are produced by
alternative splicing of the 50 region of the dystrophin gene in
human skeletal muscle. Biochem. Biophys. Res. Commun. 1997;
239:895-899. [0097] [25] N. Shiga, Y. Takeshima, H. Sakamoto, et
al. Disruption of the splicing enhancer sequence within exon 27 of
the dystrophin gene by a nonsense mutation induces partial skipping
of the exon and is responsible for Becker muscular dystrophy. J.
Clin. Invest. 1997; 100:2204-2210. [0098] [26] D. J. Wells, K. E.
Wells, E. A. Asante, et al. Expression of human full-length and
minidystrophin in transgenic mdx mice: implications for gene
therapy of Duchenne muscular dystrophy. Hum. Mol. Genet. 1995;
4:1245-1250. [0099] [27] M. Sironi, U. Pozzoli, R. Cagliani, G. P.
Comi, A. Bardoni, N. Bresolin. Analysis of splicing parameters in
the dystrophin gene: relevance for physiological and pathogenetic
splicing mechanisms. Hum. Genet. 2001; 109:73-84. [0100] A.
Aartsma-Rus et al. /Neuromuscular Disorders 12 (2002) S71-S77.
Example 3
[0100] Results
[0101] Double-Exon Skipping in Two DMD Patients
[0102] This study includes two DMD patients affected by different
frame-disrupting mutations in the DMD gene that require the skip of
two exons for correction of the reading frame (Table 5). Patient DL
90.3 carries a nonsense mutation in exon 43. Considering that this
single exon is out-of-frame, the skipping of exon 43 would remove
the nonsense mutation but not restore the reading frame. Since the
combination with exon 44 is in-frame, we aimed in this patient at
double-exon skipping, targeting both these exons. Patient DL 470.2
is affected by a deletion of exons 46 to 50. Frame restoration
would require a double-exon skipping of both exons flanking the
deletion. Myotube cultures from both patients were transfected with
a mixture of exon 43 and 44 specific AONs (DL90.3) or exon 45 and
51 specific AONs (DL470.2). The individual AONs (Table 5) were
previously highly effective in single exon skipping. Transfection
efficiencies were typically over 80%, as indicated by the number of
cells with specific nuclear uptake of the fluorescent AONs. RT-PCR
analysis at 24 to 48 hours post-transfection, indeed demonstrated
the feasibility of specific double-exon skipping in both samples
(FIGS. 6 and 7). This was confirmed by sequence analysis (data not
shown). Additional shorter transcript fragments were obtained due
to single-exon skipping: in patient DL 90.3 exon 44 skipping (FIG.
6), and in patient DL470.2 exon 51 skipping (FIG. 7).
Multi-Exon Skipping
[0103] The splicing of exon 44 directly to exon 52 (as induced in
DL470.2) generates an in-frame transcript. We hypothesized that by
inducing the skipping of the entire stretch of exons in between,
i.e. multi-exon skipping, we would induce a BMD-like deletion
(45-51) that covers and restores several known, smaller, DMD
mutations. This would further enlarge the group of DMD patients
that would benefit from one type of frame correction. The
feasibility of multi-exon skipping was first shown in human control
myotubes that were treated with a mixture of the exon 45 and 51
specific AONs (FIG. 7; KM 109). We then applied it to myotubes from
a third DMD patient carrying an exon 48-50 deletion (50685.1). By
the AON-induced skipping of the (remaining) stretch of exons in
between, and including, exons 45 and 51, we obtained the
anticipated smaller in-frame transcript with exon 44 spliced to
exon 52 (FIG. 7).
Double- and Multi-Exon Skipping Using a U-Linked
AON-Combination
[0104] The skipping of more than one exon from one pre-mRNA
molecule requires that both AONs are present in the same nucleus,
targeting the same molecule. To enlarge this chance, we here
studied the feasibility of one combined AON carrying both AONs
specific for exons 45 and 51 (h45AON5 and h51AON2) linked by ten
uracil nucleotides (Table 5). Following transfection of this
"U-linker AON" into myotubes from human control, and the DMD
patients DL470.2 and 50685.1, RT-PCR analysis demonstrated its
efficacy to generate the anticipated in-frame transcript with exon
44 spliced to exon 52 (FIG. 7). This multi-exon skipping occurred
specifically and precisely at the exon-boundaries as confirmed by
sequence analysis (data not shown). In contrast to patient DL
470.2, the U-linker AON was slightly more efficient than the
mixture of AONs in the human control and in patient 50685.1.
Material and Methods
AONs and Primers
[0105] AONs (Table 5) targeting exons 43, 44 and 51 were previously
described (Aartsma-Rus, 2002). AONs targeting exon 45 were newly
designed (sequences upon request). All AONs contain a 5'
fluorescein group (6-FAM), a full-length phosphorothioate backbone
and 2'-O-methyl modified ribose molecules (Eurogentec, Belgium). To
avoid interference with the fluorescent signals of the secondary
antibodies, unlabelled AONs were used for immuno-histochemical
analyses. Primers for RT-PCR analysis (Table 5, sequences available
upon request) were synthesized by Eurogentec (Belgium).
RNA Isolation and RT-PCR Analysis
[0106] At 24 to 48 hours post-transfection, total RNA was isolated
from the myotube cultures (RNA-Bee RNA isolation solvent, Campro
Scientific, The Netherlands). 300 ng of total RNA were used for
RT-PCR analysis using C.therm polymerase (Roche Diagnostics, The
Netherlands) in a 20 .mu.l reaction at 60.degree. C. for 30
minutes, primed with different DMD gene-specific reverse primers
(Table 5). Primary PCRs were performed by 20 cycles of 94.degree.
C. (40 seconds), 60.degree. C. (40 seconds) and 72.degree. C. (60
seconds). One .mu.l of these reactions was then re-amplified in
nested PCRs by 32 cycles of 94.degree. C. (40 seconds), 60.degree.
C. (40 seconds) and 72.degree. C. (60 seconds). PCR products were
analyzed on 1.5% or 2% agarose gels. For quantification of the
transcript products, nested PCRs were performed using 24 cycles.
PCR products were analyzed using the DNA 7500 LabChip.RTM. Kit and
the Agilent 2100 bioanalyzer (Agilent Technologies, The
Netherlands).
Sequence Analysis
[0107] RT-PCR products were isolated from agarose gels using the
QlAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was
carried out by the Leiden Genome Technology Center (LGTC) using the
BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied
Biosystems) and analyzed on an ABI 3700 Sequencer (PE Applied
Biosystems).
Example 4
Expression Vectors Encoding a Transcript Comprising an
Oligonucleotide of the Invention.
[0108] Due to the defined turnover rate of both the dystrophin
pre-mRNA and the AONs, our DMD frame-correction therapy would
require repetitive administrations of AONs. In addition, relatively
high levels of antisense RNA will be necessary within the nucleus,
where transcription and splicing of the dystrophin pre-mRNA occur.
Therefore, we have set up a vector system in which specific AON
sequences are incorporated into a modified gene. In this example,
this embodiment is described for U7 small nuclear RNA (U7snRNA).
U7snRNA is the RNA component of the U7 ribonucleoprotein particle
(U7snRNP) that is involved in the processing of the 3' end of
histone pre-mRNAs. Inherent to its function, U7snRNA is efficiently
transported back from the cytoplasm to the nucleus in which it gets
subsequently incorporated into very stable U7snRNP complexes. A
similar approach was successfully applied in AON-based gene therapy
studies on .beta.-thalassemia (53, 54). In these studies, different
plasmids were engineered containing a modified U7snRNA gene from
which the natural antisense sequence directed to the histone
pre-mRNA was replaced with antisense sequences targeted to
different .beta.-thalassemia-associated aberrant splicing sites in
the .beta.-globin gene. Following transfection of these plasmids,
correct splicing and expression of the full-length .beta.-globin
protein could be restored with an efficiency of up to 65% in
cultured cells expressing the different mutant .beta.-globin
genes.
[0109] We have engineered various U7snRNA gene constructs as
described in reference 53 with the modification that the
.beta.-globin sequences were exactly replaced by the antisense
sequences derived from the different AONs. In this example, the
sequences were replaced by the antisense sequences of m46AON4, 6,
9, or 11 that were effective in inducing the skipping of mouse exon
46. A sense construct was included as negative control (m46SON6).
Following construct validation by sequencing, the plasmids were
tested in vitro by transfection into cultured C2C12 mouse
myoblasts. The U7snRNA-m46AON6 construct was most efficient.
[0110] To enhance delivery of the AON-U7snRNA gene constructs, we
have cloned them into recombinant adeno-associated viral (rAAV)
vectors. AAV is a single-stranded DNA parvovirus that is
non-pathogenic and shows a helper-dependent life cycle. In contrast
to other viruses (adenovirus, retrovirus, and herpes simplex
virus), rAAV vectors have demonstrated to be very efficient in
transducing mature skeletal muscle. Whereas application of rAAV in
classical DMD "gene addition" studies has been hindered by its
restricted packaging limits (<5 kb), we apply rAAV for the
efficient delivery of the much smaller U7snRNA antisense constructs
(<600 bp) to mature murine skeletal muscle.
[0111] The U7-m46AON6 construct was most effective in inducing exon
46 skipping following transfection into mouse C2C12 myotubes, and
was cloned as a NotI-fragment into a rAAV vector (Stratagene). This
vector contains the gene for green fluorescence protein (GFP-cDNA)
cloned in between AAV-derived ITR sequences. The GFP protein allows
determination of transduction efficiencies in muscle,
post-infection. We engineered various vectors, containing the
U7-AON construct, either alone, or proximal and distal of the GFP
gene. The vectors were validated for their insert content by
sequence analysis. For rAAV virus production, we co-transfected 293
cells with the U7-AON-rAAV plasmids in combination with the
packaging/helper plasmid, pDP-5. This is an improved helper
plasmid, containing all AAV and adenoviral sequences required for
amplification and packaging of AAV vectors. The pDP-5 plasmid,
obtained from Dr. J. Kleinschmidt (dkfz Heidelberg, Germany),
facilitates the production of high titers up to 10.sup.12 viral
particles/ml of infectious rAAV, and without contamination of
wild-type AAV or adenovirus. Following purification and
concentration, we subsequently tested two constructs, rAAV-U7
m46AON6 and rAAV-GFP-U7 m46AON6, by infecting C2C12 mouse myotubes
at two different MOIs (Multiplicity Of Infection). At seven days
post-infection, RNA was isolated and RT-PCR analysis performed (as
described in Material and Methods). The rAAV-m46AON6 construct was
most efficient and induced exon 46 skipping at levels of 20% (see
FIG. 17).
Example 5
Title: Double and Multi-Exon Skipping.
[0112] Using a combination of AONs, double skipping of exon 43 and
44 was induced, and dystrophin synthesis was restored in myotubes
from one patient affected by a nonsense mutation in exon 43. For
another patient, with an exon 46-50 deletion, the therapeutic
double skipping of exon 45 and 51 was achieved. Remarkably, in
control myotubes, the latter combination of AONs caused the
skipping of the entire stretch of exons from 45 through 51. This
in-frame multi-exon skipping would be therapeutic for a series of
patients carrying different DMD-causing mutations. In fact, we here
demonstrate its feasibility in myotubes from a patient with an exon
48-50 deletion. The application of multi-exon skipping provides a
more uniform methodology for a larger group of patients with
DMD.
[0113] (AONs) have recently become an attractive tool for the study
and treatment of human disease. Initially, AONs were used for the
sequence-specific inhibition of genes, either to elucidate
developmental processes or to suppress malignant or aberrant gene
expression (Dennis et al. 1998; Stevenson et al. 1999; Nasevicius
and Ekker 2000; Corey and Abrams2001; Dove 2002). In these studies,
AONs mediated RNAse H degradation of dsRNA, or they blocked
transcription or translation initiation. However, AONs are also
capable of modulating the splicing of pre-mRNA (Sierakowska et al.
1996). Since it has been estimated that at least 15% of
disease-causing point mutations resulting RNA splicing defects
(Krawczak et al. 1992; Cartegni et al. 2002; Buratti et al. 2003),
this latter application may be highly relevant for future genetic
therapies. For instance, RNAase H-resistant AONs have successfully
been used to induce the skipping of pseudo-exons by blocking
cryptic splice sites in the b-globin gene (Sierakowska et al. 1996)
and the cystic fibrosis transmembrane conductance regulator gene
(Friedman et al. 1999). Alternatively, AONs linked to ten
arginine-serine dipeptide repeats for the artificial recruitment of
splicing enhancer factors have been applied in vitro to induce
inclusion of mutated BRCA1 and SMN2 exons that otherwise would be
skipped (Cartegni and Krainer 2003). AONs have also been effective
in altering the ratio of alternative splicing, which was applied
for cancer-related genes to direct malignant toward nonmalignant
isoforms (Mercatante et al. 2001, 2002). Last, but not least, a
promising, recently developed application of AONs is to induce the
specific skipping of exons in order to correct the reading frame of
a mutated transcript so that it can be translated into a partially
functional protein. The DMD gene, which codes for dystrophin, is
well suited for this latter application. The protein consists of an
N-terminal domain that binds to actin filaments, a central rod
domain, and a C-terminal cysteine-rich domain that binds to the
dystrophin-glycoprotein complex (Hoffman et al. 1987; Koenig et al.
1988; Yoshida and Ozawa 1990). Mutations in the DMD gene that
interrupt the reading frame result in a complete loss of dystrophin
function, which causes the severe Duchenne muscular dystrophy (DMD
(MIM 310200)) (Hoffman et al. 1988; Koenig et al. 1989; Ervasti et
al. 1990). The milder Becker muscular dystrophy (BMD (MIM 300376)),
on the other hand, is the result of mutations in the same gene that
are not frameshifting and result in an internally deleted but
partially functional dystrophin that has retained its N- and
C-terminal ends (Koenig et al. 1989; Di Blasi et al. 1996). Over
two-thirds of patients with DMD and BMD have a deletion of one or
more exons (den Dunnen et al. 1989). Remarkably, patients have been
described who exhibit very mild BMD and who lack up to 67% of the
central rod domain (England et al. 1990; Winnard et al. 1993;
Mirabella et al. 1998). This suggests that, despite large
deletions, a partially functional dystrophin can be generated,
provided that the deletions render the transcript in frame. AONs to
alter splicing so that the open reading frame is restored and the
severe DMD phenotype is converted into a milder BMD phenotype.
Several studies have shown therapeutic AON-induced single-exon
skipping in cells derived from the mdx mouse model (Dunckley et al.
1998; Wilton et al. 1999; Mann et al. 2001, 2002; Lu et al. 2003)
and various DMD patients (Takeshima et al. 2001; van Deutekom et
al. 2001; Aartsma-Rus et al. 2002, 2003; De Angelis et al. 2002).
To date, we have identified a series of AONs that can be used to
induce the skipping of 20 different exons (exons 2, 8, 17, 19, 29,
40-46, 48-53, 55, and 59) (Aartsma-Rus et al. 2002). Of all
patients with DMD, more than 75% would benefit from the skipping of
these exons. So far, we have successfully applied single-exon
skipping in cells derived from eight different patients with DMD
(van Deutekom et al. 2001; Aartsma-Rus et al. 2003). In these
studies, the skipping of exons flanking out-of-frame deletions or
an in-frame exon containing a nonsense mutation restored the
reading frame and induced the synthesis of BMD-like dystrophins in
approximately 75%-80% of treated cells. These novel dystrophins
could be detected as early as 16 hours after transfection; the
dystrophins increased to significant levels within four days and
were maintained for at least seven days (Aartsma-Rus et al. 2003).
Here, we significantly extend the therapeutic applicability of this
technique by demonstrating double and multi-exon skipping (FIG. 8).
Following the simultaneous skipping of two exons (double-exon
skipping), the reading frame was restored for one patient with a
nonsense mutation in an out-of-frame exon and for another patient
with a deletion that could not be bypassed by the skipping of only
one exon. Furthermore, through the skipping of an entire stretch of
consecutive exons (multi-exon skipping), a BMD-like deletion was
generated with the potential to restore up to 14% of all known DMD
mutations.
Material and Methods
AONs and Primers
[0114] Exon-internal AONs targeting exons 44 (h44AON1) and 51
(h51AON2) were described elsewhere (Aartsma-Rus et al. 2002). The
AONs targeting exons 43 and 45 were specifically designed for this
study (h43AON5:CUGUAGCUUCACCCUUUCC (SEQ ID NO:1); h45AON5:
GCCCAAUGCCAUCCUGG (SEQ ID NO:2)). BLAST analysis of the AONs did
not reveal perfect homology to other sequences in the human genome
(maximum homology 94%, minimum E value 0.3). All AONs contain a
5'-fluorescein group (6-FAM), a full-length phosphorothioate
backbone, and 2'-O-methyl-modified ribose molecules (Eurogentec).
To avoid interference with the fluorescent signals of the secondary
antibodies, unlabeled AONs were used for immunohistochemical
analyses. Primers for RT-PCR analysis (FIG. 8) were synthesized by
Eurogentec (sequences available upon request).
Myogenic Cell Cultures and AON Transfections
[0115] Primary myoblasts from a human control and from two patients
with DMD (DL470.2 (exon 46-50 deletion) and 50685.1 (exon 48-50
deletion)) were isolated from a muscle biopsy and cultured as
described elsewhere (Aartsma-Rus et al. 2002). Myotubes were
obtained from confluent myoblast cultures, after seven to 14 days
of serum deprivation. These were transfected with mixtures of 200
nM of each AON. Polyethylenemine (PEI) was used as transfection
reagent, according to the manufacturer's instructions (ExGen 500
(Fermentas)). Separate AON-PEI dilutions were made for each AON,
with 3.5 .mu.l PEI applied per .mu.g of transfected AON. For
patient DL90.3, who has a point mutation in exon43, only
fibroblasts were available. Following infection (multiplicity of
infection (MOI) 50-100) with an adenoviral vector containing the
MyoD gene (Ad50MyoD), the fibroblasts were forced into myogenesis,
according to protocols described elsewhere (Murry et al. 1996;
Roest et al. 1996; Aartsma-Rus et al. 2002; Havenga et al. 2002).
Transfection conditions were identical to those described
above.
RNA Isolation and RT-PCR Analysis of the Skip Products
[0116] RNA isolation, RT-PCR, and sequence analysis were performed
as described elsewhere (Aartsma-Rus et al. 2002). See FIG. 8 for
the location of the primers. For quantification of the skip
products, nested PCRs were performed using 24 cycles. PCR products
were analyzed using the DNA 1000 LabChip kit and the 2100
Bioanalyzer (Agilent Technologies). To analyze the splicing of the
entire DMD gene, RTreactions were performed with 1 .mu.g RNA,
random hexamer primers, and SuperScript III (Invitrogen). PCR
analyses were performed using the protein-truncation test (PTT)
primers described elsewhere (Roest et al. 1993). Since some of the
PCR primers were located in exons that were deleted for patient
DL470.2, we specifically designed additional primers in exons 41,
42, 45, 53, and 54 (sequences available on request).
Analysis of the Dystrophin Protein
[0117] Immunohistochemical and Western blot analyses were performed
as described elsewhere (Aartsma-Rus et al. 2002). Myosin polyclonal
antibody L53 (a gift from Dr. M. van den Hoff, Amsterdam Medical
Center, The Netherlands) was used to detect myosin. MANDYS1 (a gift
from Dr. G. Morris, North East Wales Institute, United Kingdom),
NCL-DYS2 (Novacastra Laboratories), and NCL-DYS1 (Novacastra
Laboratories) were used to detect dystrophin. For the Western blot
analysis, dystrophin levels were quantified using LumiAnalyst 3.0
(Roche).
Results
Double-Exon Skipping in Two Patients with DMD
[0118] The skipping of only a single exon is not sufficient to
restore the reading frame for every mutation. In a significant
fraction of mutations, it is necessary to skip two exons
simultaneously (FIG. 8, Panel A). For instance, patient DL90.3
carries a nonsense mutation in exon 43. Considering that this
single exon is out of frame, the skipping of exon 43 removes the
nonsense mutation but does not restore the reading frame. Since the
combination of exons 43 and 44 is in frame, we aimed at the
simultaneous skipping of both exons. Patient DL470.2 is affected by
a deletion of exons 46-50. Frame restoration requires the joint
skipping of the two exons flanking the deletion (FIG. 8, Panel A).
Myotube cultures from these patients were transfected with a
mixture of either exon 43- and 44-specific AONs (patient DL90.3) or
exon 45- and 51-specific AONs (patient DL470.2). Transfection
efficiencies were typically more than 80%, as indicated by the
number of cells with specific nuclear uptake of fluorescent AONs.
RT-PCR analysis at 24 or 48 hours after transfection indeed
demonstrated the feasibility of specific double-exon skipping in
both patients (30% and 75% of total transcript fragments for
patients DL90.3 and DL470.2, respectively), which was confirmed by
sequence analysis (FIGS. 9A and 10A). As expected, in addition to
double-exon skipping, we also detected single-exon skipping in
patient DL90.3 (exon 44; 27% of total transcripts) and patient
DL470.2 (exon 51; 12% of total transcripts). To verify that no
larger or other regions of the DMD transcript were affected by the
AON treatments, we performed RT-PCR analysis on the entire DMD
gene, with consecutive sets of exons. In both treated and untreated
myotubes, we did not detect additional aberrant splicing patterns
in the DMD gene (FIG. 11). Immunohistochemical analysis using two
different antibodies directed against internal (MANDYS1) and
C-terminal (Dys2) parts of dystrophin showed that the in frame
transcripts derived from double-exon skipping produced BMD-like
dystrophins. On average, 70% of the myosin-positive myotubes showed
dystrophin expression in response to AON transfection (FIGS. 9B and
10B). Western blot analysis confirmed the presence of dystrophin
for patient DL90.3 (after four days) and patient DL470.2 (after two
days), at levels of 3.3% and 1.8%, respectively, when compared to
control myotubes (FIGS. 9C and 10C).
Multi-Exon Skipping
[0119] The splicing of exon 44 directly to exon 52 (as induced in
patient DL470.2) generates an in-frame transcript. Inducing the
skipping of this entire stretch of exons--that is, multi-exon
skipping-would generate a BMD-like deletion (exons 45-51) spanning
a range of smaller, internal DMD mutations (FIG. 8, Panel B).
Multi-exon skipping was first tested in human control myotubes
(individualKM109) treated with a mixture of 200 nM of both the exon
45- and 51-specific AONs (FIG. 12, Panel A). We observed a novel,
shorter transcript, corresponding to a size that would result from
the targeted skipping of exons 45-51. Indeed, sequence analysis
revealed that exon 44 was directly spliced to exon 52 (data not
shown). We then applied it to myotubes derived from a patient with
DMD (50685.1) carrying an exon 48-50 deletion (FIG. 8, Panel B).
The AON-induced skipping of all exons from 45 to 51 yielded the
intended in-frame transcript (FIG. 12, Panel A).
Double and Multi-exon Skipping Using a U-Linked Combination of
AONs
[0120] The skipping of more than one exon from one pre-mRNA
molecule requires both AONs to be present in the same nucleus,
targeting the same molecule. To specifically enhance this
probability, we designed a combined AON containing both the exon 45
and 51 AONs (h45AON5 and h51AON2), linked by ten uracil nucleotides
(FIG. 12, Panel B). After transfection of this "U-linked AON" into
myotubes from the human control (individual KM109) and the two
patients with DMD (DL470.2 and 50685.1), RT-PCR analysis
demonstrated its efficacy to generate the in-frame transcript with
exon 44 spliced to exon 52 (FIG. 12, Panel A). This multi-exon
skipping occurred specifically and precisely at the exon
boundaries, as confirmed by sequence analysis (data not shown).
Quantification showed that the U-linked AON was more efficient than
the mixture of AONs in myotubes from patient 50685.1 and the human
control but not in myotubes from patient DL470.2 (FIG. 12, Panel
C).
Discussion
[0121] Induced skipping of a single exon has shown therapeutic
potential to correct the reading frame and induce the synthesis of
BMD-like dystrophins in cultured muscle cells from patients with
DMD (Takeshima et al. 2001; van Deutekom et al. 2001; De Angelis et
al. 2002; Aartsma-Rus et al. 2003). Here, we demonstrate the
feasibility of targeted antisense-induced multi-exon skipping for
therapeutic purposes. The spontaneous skipping of multiple exons
frequently occurs in nature, albeit at low levels. This has been
detected both in patients with DMD and in unaffected individuals
(Sironi et al. 2002). Furthermore, this phenomenon has been
suggested to be the underlying mechanism for the occurrence of
dystrophin-positive "revertant" fibers in the mdx mouse model and
in patients with DMD (Sherratt et al. 1993; Thanh et al. 1995; Lu
et al. 2000). Multi-exon skipping has also been observed in DMD
gene-therapy studies aimed at the targeted skipping of the mutated
exon 23 in mdx-mouse muscle cells (Dunckley et al. 1998; Wilton et
al. 1999; Bertoni et al. 2003). Both AONs and chimeric DNA-RNA
oligonucleotides directed at the 3'-splice site of this exon
generated shorter in-frame or out-of-frame transcripts in which
additional exons adjacent to exon 23 were skipped. In this study,
we specifically focused on inducing multi-exon skipping. By use of
combinations of AONs, the double skipping of exons 43-44 and 45-51
was induced in patient-derived myotube cultures.
Immunohistochemical analysis of single myotubes indicated that this
allowed the synthesis of dystrophins in up to 70% of myotubes. This
percentage is not significantly lower than those obtained in our
previous single exon-skipping studies (75%-80%) (Aartsma-Rus et al.
2003). This suggests that both the transfection and the skipping
performance of two AONs simultaneously are not significantly less
efficient than those of a single AON. However, in a number of the
remaining dystrophin-negative myotubes only single-exon skipping
occurred. Western blot analysis of protein extracts from patient
derived total myotube cultures showed relatively low levels (less
than 3%) of dystrophin. Considering the high levels (70%) observed
in the immunohistochemical analysis, there seems to be a
discrepancy. However, this can be explained by the fact that in the
immunohistochemical analysis we focus on single myosin-positive
myotubes, whereas the samples in the Western blot analysis also
include a significant number of dystrophin-negative cells.
Furthermore, the control protein sample was derived from a culture
that exhibited a two-fold higher degree of myogenicity (i.e.,
approximately 40% in the patient cultures vs. more than 90% in the
control sample) and that accordingly contained a higher number of
dystrophin-producing cells. Finally, the control protein sample in
the Western blot analysis was derived from myotubes expressing
dystrophin over the entire period of differentiation (two weeks),
whereas in the patient-derived myotubes the dystrophin synthesis
was only just induced at the time of analysis (at most, four days).
Since myotubes are viable for only several days after transfection,
longer expression periods were unachievable. Different ratios of
exon 45- and 51-specific AONs were evaluated, and the highest
levels of double-exon skipping were obtained with a 1:1 ratio (data
not shown). Both AONs were apparently equally efficient at entering
the nucleus. Besides double-exon skipping, we also observed
single-exon skipping of exon 44 (patient DL90.3) and exon 51
(patient DL470.2), in particular. This suggests that the local
secondary premRNA structure was probably more affected by AONs
targeting these exons, which subsequently rendered exons 43 and 45
inaccessible. To increase the probability not only that both AONs
are taken up by the same nucleus but also that they hybridize to
the same RNA molecule, we designed an AON that consisted of two
AONs linked with ten uracil nucleotides. Compared to the mixture of
the two AONs, the U-linked AON indeed induced higher levels of
multi-exon skipping in myotubes from a human control and a patient
carrying an exon 48-50 deletion. In contrast, for yet-unknown
reasons it was less efficient in inducing double-exon skipping in
myotubes from a patient carrying an exon 46-50 deletion. In
follow-up studies, we assessed the influence of the length of the
U-linker. We did not observe significant differences (data not
shown). There are two possible explanations for the mechanism of
multi-exon skipping. First, the entire region of both exons and
introns between exon 45 and 51 may have been spliced out because of
an overall AON-induced alteration in the secondary structure of the
pre-mRNA. Second, the splicing of the individual exons 45 through
51 may have occurred earlier than that of exon 44 to exon 45 (which
is not unlikely, given that intron 44 is 270 kb long). In that
case, the splicing machinery regarded exons 45 to 51 as one large
exon and omitted it because of the AONs that hybridized to exons 45
and 51. The latter explanation suggests that multi-exon skipping
may only be effective in those areas of the DMD gene in which
downstream introns are spliced prior to upstream introns. We are
currently verifying this by using different combinations of
(U-linked) AONs in other regions of the gene. When only single-exon
skipping is taken into account, the antisense-based reading frame
correction therapy would theoretically be beneficial for more than
75% of all patients with DMD. Multi-exon skipping would
significantly extend this percentage to most DMD mutations, except
those that affect the functionally critical domains of the
N-terminus or the cysteine-rich C-terminal domain, or those that
involve the promoter region, the first exon, or translocations.
However, these latter mutations are found in less than 8% of all
patients with DMD reported in our database (den Dunnen 1996).
Multi-exon skipping not only increases the number of patients that
would benefit from this approach but, more importantly, also
decreases its mutation specificity. The multi-exon skipping of
exons 45-51 shown in this study would be frame restoring for 14% of
all the deletions and 6% of all small mutations reported in the DMD
mutation database (den Dunnen 1996). Furthermore, it offers the
therapeutic potential of generating relatively large in-frame
deletions known to be associated with mild BMD phenotypes (England
et al. 1990; Winnard et al. 1993; Mirabella et al. 1998). Its
eventual therapeutic application will largely depend on the
efficiencies in vivo. Lu and colleagues (2003) recently
demonstrated AON-induced exon 23-skipping in mdx muscle by using
the Pluronic copolymer F127 as a delivery reagent. Close-to-normal
levels of a nearly full-length dystrophin were observed in many
myofibers, which improved muscle function. Although the effect was
optimal at two to four weeks, dystrophin was still detectable three
months after injection (Lu et al. 2003). In our experience, the in
vitro and in vivo effects of AONs in muscle cells correlate
relatively well, which provides a promising basis for our current
studies on multi-exon skipping in mice.
[0122] The URL for data presented herein is as follows: Online
Mendelian Inheritance in Man (OMIM),
http://www.ncbi.nlm.nih.gov/Omim/ (for DMD and BMD).
REFERENCES TO EXAMPLE 5
[0123] A. Aartsma-Rus, M. Bremmer-Bout, A. Janson, J. den Dunnen,
G. van Ommen, J. van Deutekom (2002) Targeted exon skipping as a
potential gene correction therapy for Duchenne Muscular dystrophy.
Neuromuscul. Disord. 12:S71. [0124] A. Aartsma-Rus, A. A. Janson,
W. E. Kaman, M. Bremmer-Bout, J. T. den Dunnen, F. Baas, G. J. Van
Ommen, et al. (2003) Therapeutic antisense-induced exon skipping in
cultured muscle cells from six different DMD patients. Hum. Mol.
Genet. 12:907-914. [0125] C. Bertoni, C. Lau, T. A. Rando (2003)
Restoration of dystrophin expression in mdx muscle cells by
chimeraplast-mediated exon skipping. Hum. Mol. Genet. 12:1087-1099.
[0126] E. Buratti, F. E. Baralle, F. Pagani (2003) Can a "patch" in
a skipped exon make the pre-mRNA splicing machine run better?
Trends Mol. Med. 9:229-232. [0127] L. Cartegni, S. L. Chew, A. R.
Krainer (2002) Listening to silence and understanding nonsense:
exonic mutations that affect splicing. Nat. Rev. Genet. 3:285-298.
[0128] L. Cartegni and A. R. Krainer (2003) Correction of
disease-associated exon skipping by synthetic exon-specific
activators. Nat. Struct. Biol. 10: 120-125. [0129] D. R. Corey and
J. M. Abrams J M (2001) Morpholino antisense oligonucleotides:
tools for investigating vertebrate development. Genome Biol.
2:reviews 1015.1-reviews 1015.3. [0130] F. G. De Angelis, O.
Sthandier, B. Berarducci, S. Toso, G. Galluzzi, E. Ricci, G. Cossu,
I. Bozzini (2002) Chimeric snRNA molecules carrying antisense
sequences against the splice junctions of exon 51 of the dystrophin
pre-mRNA induce exon skipping and restoration of a dystrophin
synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. U.S.A.
99:9456-9461. [0131] J. den Dunnen (1996) The Leiden Muscular
Dystrophy pages.http://www.dmd.nl (accessed Dec. 10, 2003). [0132]
J. T. den Dunnen, P. M. Grootscholten, E. Bakker, L. A. Blonden, H.
B. Ginjaar, M. C. Wapenaar, H. M. van Paassen, C. van Broeckhoven,
P. L. Pearson, G. J. van Ommen (1989) Topography of the Duchenne
muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases
reveals 115 deletions and 13 duplications. Am. J. Hum. Genet.
45:835-847. [0133] J. U. Dennis, N. M. Dean, C. F. Bennett, J. W.
Griffith, C. M. Lang, D. R. Welch (1998) Human melanoma metastasis
is inhibited following ex vivo treatment with an antisense
oligonucleotide to protein kinase C-alpha. Cancer Lett. 128:65-70.
[0134] C. Di Blasi, L. Morandi, R. Barresi, F. Blasevich, F.
Comelio, M. Mora (1996) Dystrophin-associated protein abnormalities
in dystrophin-deficient muscle fibers from symptomatic and
asymptomatic Duchenne/Becker muscular dystrophy carriers. Acta
Neuropathol. (Berl) 92:369-377. [0135] A. Dove (2002) Anti-sense
and sensibility. Nat. Biotechnol. 20:121-124. [0136] M. G.
Dunckley, M. Manoharan, P. Villiet, I. C. Eperon, G. Dickson (1998)
Modification of splicing in the dystrophin gene in cultured Mdx
muscle cells by antisense oligoribonucleotides. Hum. Mol. Genet.
7:1083-1090. [0137] S. B. England, L. V. Nicholson, M. A. Johnson,
S. M. Forrest, D. R. Love, E. E. Zubrzycka-Gaam, D. E. Bulman, J.
B. Harris, K. E. Davies (1990) Very mild muscular dystrophy
associated with the deletion of 46% of dystrophin. Nature
343:180-182. [0138] J. M. Ervasti, K. Ohlendieck, S. D. Kahl, M. G.
Gaver, K. P. Campbell (1990) Deficiency of a glycoprotein component
of the dystrophin complex in dystrophic muscle. Nature 345:315-319.
[0139] K. J. Friedman, J. Kole, J. A. Cohn, M. R. Knowles, L. M.
Silverman, R., Kole (1999) Correction of aberrant splicing of the
cysticfibrosis transmembrane conductance regulator (CFTR) gene by
antisense oligonucleotides. J. Biol. Chem. 274:36193-36199. [0140]
M. J. Havenga, A. A. Lemckert, O. J. Ophorst, M. van Meijer, W. T.
Germeraad, J. Grimbergen, M. A. van Den Doel, R. Vogels, J. C. T.
van Deutekom, A. A. M. Janson, J. D. de Bruijn, F. Uytdehaag, P. H.
Quax, T. Logtenberg, M. Mehtali, A. Bout (2002) Exploiting the
natural diversity in adenovirus tropism for therapy and prevention
of disease. J. Virol. 76:4612-4620. [0141] E. P. Hoffman, R. H.
Brown, Jr., L. M. Kunkel (1987) Dystrophin: the protein product of
the Duchenne muscular dystrophyn locus. Cell 51:919-928. [0142] E.
P. Hoffman, K. H. Fischbeck, R. H. Brown, M. Johnson, R. Medori, J.
D. Loike, J. B. Harris, et al. (1988) Characterization of
dystrophin in muscle-biopsy specimens from patients with Duchenne's
or Becker's muscular dystrophy. N. Engl. J. Med. 318:1363-1368.
[0143] M. Koenig, A. H. Beggs, M. Moyer, S. Scherpf, K. Heindrich,
T. Bettecken, G. Meng, et al. (1989) The molecular basis for
Duchenne versus Becker muscular dystrophy: correlation of severity
with type of deletion. Am. J. Hum. Genet. 5:498-506. [0144] M.
Koenig, A. P. Monaco, L. M. Kunkel (1988) The complete sequence of
dystrophin predicts a rod-shaped cytoskeletal protein. Cell
53:219-226. [0145] M. Krawczak, J. Reiss, D. N. Cooper (1992) The
mutational spectrum of single base-pair substitutions in mRNA
splice junctions of human genes: causes and consequences. Hum.
Genet. 90:41-54. [0146] Q. L. Lu, C. J. Mann, F. Lou, G.
Bou-Gharios, G. E. Morris, S. A. Xue, S. Fletcher, T. A. Partridge,
S. D. Wilton (2003) Functional amounts of dystrophin produced by
skipping the mutated exon in the mdx dystrophic mouse. Nat. Med.
9:1009-1014. [0147] Q. L. Lu, G. E. Morris, S. D. Wilton, T. Ly, O.
V. Artem'yeva, P. Strong, T. A. Partridge (2000) Massive
idiosyncratic exon skipping corrects the nonsense mutation in
dystrophic mouse muscle and produces functional revertant fibers by
clonal expansion. J. Cell. Biol. 148:985-996. [0148] C. J. Mann, K.
Honeyman, A. J. Cheng, T. Ly, F. Lloyd, S. Fletcher, J. E. Morgan,
T. A. Partridge, S. D. Wilton (2001) Antisense-induced exon
skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl.
Acad. Sci. U.S.A. 98:42-47. [0149] C. J. Mann, K. Honeyman, G.
McClorey, S. Fletcher, S. D. Wilton (2002) Improved antisense
oligonucleotide induced exon skipping in the mdx mouse model of
muscular dystrophy. J. Gene Med. 4:644-654. [0150] D. R.
Mercatante, J. L. Mohler, R. Kole (2002) Cellular response to an
antisense-mediated shift of Bcl-x pre-mRNA splicing and anti
neoplastic agents. J. Biol. Chem. 277:49374-49382. [0151] D. R.
Mercatante, P. Sazani, R. Kole (2001) Modification of alternative
splicing by antisense oligonucleotides as a potential chemotherapy
for cancer and other diseases. Curr. Cancer Drug Targets 1:211-230.
[0152] M. Mirabella, G. Galluzzi, G. Manfredi, E. Bertini, E.
Ricci, R. DeLeo, P. Tonali, S. Servidei (1998) Giant dystrophin
deletion associated with congenital cataract and mild muscular
dystrophy. Neurology 51:592-595. [0153] C. E. Murry, M. A. Kay, T.
Bartosek, S. D. Hauschka, S. M. Schwartz (1996) Muscle
differentiation during repair of myocardial necrosis in rats via
gene transfer with MyoD. J. Clin. Invest. 98:2209-2217. [0154] A.
Nasevicius and S. C. Ekker (2000) Effective targeted gene
"knockdown" in zebrafish. Nat. Genet. 26:216-220. [0155] P. A.
Roest, R. G. Roberts, A. C. van der Tuijn, J. C. Heikoop, G. J. van
Ommen, J. T. den Dunnen (1993) Protein truncation test (PTT) to
rapidly screen the DMD gene for translation terminating mutations.
Neuromuscul. Disord. 3:391-394. [0156] P. A. Roest, A. C. van der
Tuijn, H. B. Ginjaar, R. C. Hoeben, F. B. Hoger-Vorst, E. Bakker,
J. T. den Dunnen, G. J. van Ommen (1996) Application of in vitro
Myo-differentiation of non-muscle cells to enhance gene expression
and facilitate analysis of muscle proteins. Neuromuscul. Disord.
6:195-202. [0157] T. G. Sherratt, T. Vulliamy, V. Dubowitz, C. A.
Sewry, P. N. Strong (1993) Exon skipping and translation in
patients with frameshift deletions in the dystrophin gene. Am. J.
Hum. Genet. 53:1007-1015. [0158] H. Sierakowska, M. J. Sambade, S.
Agrawal, R. Kole (1996) Repair of thalassemic human beta-globin
mRNA in mammalian cells by antisense oligonucleotides. Proc. Natl.
Acad. Sci. U.S.A. 93:12840-12844. [0159] M. Sironi, R. Cagliani, U.
Pozzoli, A. Bardoni, G. P. Comi, R. Giorda, N. Bresolin (2002) The
dystrophin gene is alternatively spliced throughout its coding
sequence. FEBS Lett. 517:163-166. [0160] J. P. Stevenson, K. S.
Yao, M. Gallagher, D. Friedland, E. P. Mitchell, A. Cassella, B.
Monia, T. J. Kwoh, R. Yu, J. Holmlund, F. A. Dorr, P. J. O'Dwyer
(1999) Phase I clinical/pharmacokinetic and pharmacodynamic trial
of the c-raf-1 antisense oligonucleotide ISIS 5132 (CGP 69846A). J.
Clin. Oncol. 17:2227-2236. [0161] Y. Takeshima, H. Wada, M. Yagi,
Y. Ishikawa, R. Minami, H. Nakamura, M. Matsuo (2001)
Oligonucleotides against a splicing enhancer sequence led to
dystrophin production in muscle cells from a Duchenne muscular
dystrophy patient. Brain Dev. 23:788-790. [0162] L. T. Thanh, M.
Nguyen Thi, S. Hori, C. A. Sewry, V. Dubowitz, G. E. Morris (1995)
Characterization of genetic deletions in Becker muscular dystrophy
using monoclonal antibodies against a deletion-prone region of
dystrophin. Am. J. Med. Genet. 58:177-186. [0163] J. C. van
Deutekom, M. Bremmer-Bout, A. A. Janson, I. B. Ginjaar, F. Baas, J.
T. den Dunnen, G. J. van Ommen (2001) Antisense induced exon
skipping restores dystrophin expression in DMD patient derived
muscle cells. Hum. Mol. Genet. 10:1547-1554. [0164] S. D. Wilton,
F. Lloyd, K. Carville, S. Fletcher, K. Honeyman, S. Agrawal, R.
Kole (1999) Specific removal of the nonsense mutation from the mdx
dystrophin mRNA using antisense oligonucleotides. Neuromuscul.
Disord. 9:330-338. [0165] A. V. Winnard, C. J. Klein, D. D.
Coovert, T. Prior, A. Papp, P. Snyder, D. E. Bulman, et al. (1993)
Characterization of translational frame exception patients in
Duchenne/Becker muscular dystrophy. Hum. Mol. Genet. 2:737-744.
[0166] M. Yoshida and E. Ozawa (1990) Glycoprotein complex
anchoring dystrophin to sarcolemma. J. Biochem. (Tokyo)
108:748-752.
Example 6
[0167] As small molecule drugs for Duchenne muscular dystrophy
(DMD), antisense oligonucleotides (AONs) have been shown to restore
the disrupted reading frame of DMD transcripts by inducing specific
exon skipping. This allows the synthesis of largely functional
BMD-like dystrophins and potential conversion of severe DMD into
milder BMD phenotypes. Thus far, we have used 2'O-methyl
phosphorothioate (2OMePS) AONs. Here, we assessed the skipping
efficiencies of different AON analogs containing
morpholino-phosphorodiamidate, locked nucleic acid (LNA) or peptide
nucleic acid (PNA) backbones. In contrast to PNAs and morpholinos,
LNAs have not yet been tested as splice modulators. Compared to the
most effective 2OMePS AON directed at exon 46, the LNA induced
higher skipping levels in myotubes from a human control (85% vs.
20%) and an exon 45 deletion DMD patient (98% vs. 75%). The
morpholino-induced skipping levels were only 5-6%, whereas the PNA
appeared to be ineffective. Further comparative analysis of LNA and
2OMePS AONs containing up to three mismatches, revealed that LNAs,
while inducing higher skipping efficiencies, show less sequence
specificity. This limitation increases the risk of adverse effects
elsewhere in the human genome. Awaiting further improvements in
oligo-chemistry, we thus consider 2OMePS AONs currently the most
favorable compounds for targeted DMD exon skipping.
[0168] Antisense oligonucleotides (AONs) have been reported to
modulate pre-mRNA splicing in several studies (1). For instance,
AONs have restored normal splicing by blocking cryptic splice sites
(2,3), altered the ratio of alternative splicing from malignant to
non-malignant isoforms (4), and induced exon inclusion for mutated
exons, that were otherwise skipped (5). In these studies, the AON
treatments aimed at the reestablishment of wild-type mRNA.
Recently, AONs have alternatively been used to restore the
disrupted reading frame of dystrophin mRNAs in Duchenne muscular
dystrophy (DMD) gene therapy studies. DMD patients suffer from
severe muscle degeneration due to frame-disrupting mutations in the
DMD gene that prematurely abort the synthesis of the dystrophin
protein (6-9). In contrast, mutations in the DMD gene that do not
affect the reading frame generate internally deleted but partly
functional dystrophins and result in less severe Becker muscular
dystrophy (BMD) (10,11). AON-induced restoration of the DMD reading
frame is based on inducing the skipping of specific exons. This was
successfully applied in cultured muscle cells from Duchenne
muscular dystrophy patients and in the mdx mouse model (12-19).
High exon skipping levels of up to .about.90% were achieved,
allowing the synthesis of significant levels of BMD-like
dystrophins in over 75% of treated cells (17). These dystrophins
located appropriately to the sarcolemma and restored the dystrophin
glycoprotein complex, a strong indication of functional
restoration.
[0169] The AONs used in these studies contained 2'O-methyl modified
ribose molecules to render them RNase-H independent, and a
full-length phosphorothioate backbone (2OMePS AONs) (Table 6).
Although 2OMePS AONs have advantages such as increased resistance
to nuclease degradation and increased uptake when compared to
phosphodiester AONs, disadvantages are that a phosphorothioate
backbone is to some extent cytotoxic, and may elicit an immunogenic
response (20,21).
[0170] Recent developments in oligo-chemistry have provided AONs
with different biophysical, biochemical and biological properties
based on various modifications to the sugar or the backbone of the
nucleotides. Modified AON analogs include
morpholino-phosphorodiamidates (morpholinos), locked nucleic acids
(LNAs) and peptide nucleic acids (PNAs) (reviewed in 21).
[0171] In morpholinos the sugar phosphate backbone of DNA is
replaced by morpholino-phosphorodiamidate oligonucleotides (Table
6) (22,23). Morpholinos are non-toxic, nuclease resistant (23),
have an increased affinity for RNA and are suggested to disrupt the
secondary structure of RNA (1,22). On the other hand, morpholinos
are uncharged and therefore difficult to transfect. Nonetheless,
reasonable to good efficiencies have been obtained with the scrape
loading technique or with ethoxylated polyethylenimine (EPEI)
(24,25). Morpholinos have been used, amongst others, to study
developmental processes by knocking down genes in zebra fish (26),
and to modulate the splicing of the .beta.-globin gene in vitro and
in vivo (25,27). Recently morpholinos have been applied in the mdx
mouse model to induce the skipping of the mutated exon 23 (28). The
morpholinos were transfected into the cells in combination with a
sense oligo (leash) to allow formation of a cationic lipoplex. This
morpholino treatment restored the dystrophin synthesis in mdx
muscle cells both in vitro and in vivo.
[0172] LNAs are DNA analogs that contain a methylene bridge, which
connects the 2'-oxygen of ribose with the 4'-carbon (Table 6). This
bridge results in a locked 3'-endo conformation, which reduces the
conformational flexibility of the ribose (1). LNAs are
nuclease-resistant, non-toxic and have the highest affinity for
complementary DNA and RNA yet reported for any DNA analog (29,30).
This high affinity offers both advantages and disadvantages: LNAs
will hybridize very efficiently to their target, but LNAs longer
than 15 base pairs have shown thermally stable self-structuring.
Furthermore, full-length LNAs seem to hybridize in a less sequence
specific manner than PNA and 2OMePS AONs (29,31). LNAs are
negatively charged and cationic lipid polymers are applied for
delivery into cells. LNAs have shown to be potent inhibitors of the
expression of a cancer related gene (31), but have not earlier been
studied as splicing modulators.
[0173] In PNAs, the sugar phosphate backbone of DNA is replaced by
an achiral polyamide backbone (Table 6) (32). Compared to the
2OMePS backbone, PNAs have a highly increased affinity for DNA and
RNA, are suggested to be more sequence specific, protease- and
nuclease-resistant, and non-toxic even at high concentrations
(1,33). A drawback of the non-ionic nature of PNA is its poor
water-solubility, which makes it complicated to transfect PNAs
(27,34). Sazani and colleagues have recently bypassed this problem
by coupling four lysine residues to the C-terminus of PNAs (27,35).
The cationic nature of the lysine highly improved the
water-solubility and allowed entrance into the cell and nucleus
without transfection reagent. PNAs have successfully been used to
modulate the splicing of the murine interleukin-5 receptor-.alpha.
chain in vitro and the .beta.-globin gene in vitro and in vivo
(27,35,36).
[0174] For future clinical studies, the preferred AON analog
induces the highest levels of exon skipping at low levels of
cytotoxicity. In this study we have compared the efficacy,
efficiency, and applicability of morpholino, LNA and PNA AON
analogs to those of a previously described 2OMePS AON (16,37)
specific for DMD exon 46 in both control and patient-derived
myotubes.
Results
Comparative Analysis of AON Analogs in Human Control Myotubes
[0175] To determine the binding affinity of the different AON
analogs (Table 6) to the target pre-mRNA, a gel mobility shift
assay was performed. DNA, 2OMePS, morpholino, LNA and PNA AONs were
hybridized to a .sup.32P-labeled exon 46 RNA fragment (FIG. 13,
Panel A). The DNA, 2OMePS and LNA AONs induced a clear mobility
shift, indicating that these analogs are able to bind to the target
RNA. No shift was detectable for the morpholino and PNA AONs. This
suggested a low affinity of these analogs for the target RNA.
However, in previous experiments we observed that some AONs, while
not inducing a notable mobility shift, nevertheless did induce exon
skipping (unpublished results). For this reason, we decided to
still include the morpholino and PNA AONs in further analyses.
[0176] Transfection conditions for the different AON-analogs, all
carrying a 5' fluorescein group, were optimized in human control
myotubes (FIG. 13, Panel B). Based on the presence of nuclear
fluorescent signals, transfection efficiencies were determined to
be typically over 80% for the 2OMePS, morpholino and LNA AONs. The
PNA transfection efficiencies were generally lower (.about.60-70%).
Notably, in contrast to the 2OMePS, LNA and PNA AONs, which showed
most of the fluorescence within the nucleus, the morpholino was
also clearly present in the cytoplasm.
[0177] Previous experiments revealed that most efficient skipping
levels, as detected by RT-PCR, were obtained at a dose of 500 nM of
2OMePS AONs (17). Here we show that also LNA and, remarkably,
morpholino AONs are effective in inducing exon 46 skipping (FIG.
13, Panel C). For the morpholino and LNA AONs, concentration series
experiments indicated highest skipping efficiencies at doses of 1
.mu.M and 500 nM, respectively. For both analogs, higher
concentrations did not result in higher levels of exon 46 skipping
(data not shown), but instead induced serious cytotoxic effects for
the morpholino AON. Only minimal levels of cytotoxicity were
present in myotube cultures transfected with 500 nM of LNA six days
post-transfection, whereas at that time-point severe cell-death was
observed for 200 nM of the 2OMePS AON (data not shown). Since more
units of PEI were applied for LNA transfection, this difference is
unlikely due to PEI-induced cytotoxicity. We occasionally observed
the skipping of both exon 45 and 46 at low levels in response to
high doses of the 2OMePS and LNA AONs (FIG. 13, Panel C). The PNA
did persistently not induce exon 46 skipping, even at a 20 .mu.M
dose (data not shown). Exon 46 skipping efficiencies of the
different analogs were assessed through quantification of the
RT-PCR fragments (FIG. 13, Panel D). In comparison with the 2OMePS
(20%), the LNA AON was more efficient (85%), whereas the skipping
levels for the morpholino were not higher than 6%.
Comparative Analysis of AON Analogs in Patient-Derived Myotubes
[0178] We have previously observed that 2OMePS AONs induced higher
levels of exon skipping in patient-derived myotubes when compared
to control samples (16,17). This effect was here confirmed in
myotubes derived from a DMD patient (DL279.1) affected by an exon
45 deletion. For this patient, exon 46 skipping generates in-frame
transcripts. We observed 75% exon 46 skipping in DL279.1 vs. 20% in
control myotubes for the 2OMePS AON (FIG. 13, Panels C and D). The
LNA and morpholino AONs were also able to induce exon skipping (98%
and 5%, respectively), whereas the PNA was not (FIG. 13, Panels C
and D). Similar to the 2OMePS AON, the LNA showed higher skipping
levels in DL279.1 when compared to those in control myotubes (98%
vs. 85%). This effect however was not significant for the
morpholino or PNA AONs.
Dose-Effects and Sequence-Specificity of LNA vs. 2OMePS AONs
[0179] Since the LNAs induced highest skipping levels, we performed
a concentration series to determine the minimally effective dose.
RT-PCR (FIG. 14, Panel a) and quantitative analysis (FIG. 14, Panel
b) showed that in human control myotubes the efficiency dropped
markedly from 97% to 30% at doses lower than 500 nM, and that very
low levels of exon 46 skipping (<1%) were detectable at 100 nM.
In patient-derived myotubes, however, the levels of exon skipping
decreased more gradually at lower doses, with exon 46 skipping
levels of 86% detectable at a dose of 300 nM, and still a
significant level (10%) at 100 nM (FIG. 14, Panels a and b).
[0180] We then analyzed the sequence-specificity of LNA and 2OMePS
AONs in patient myotubes (since they showed higher skipping levels
than control myotubes). We studied five different LNAs, which
contain one or two mismatches at the 5', 3' or center position
(LNAmm1-5, FIG. 15, Panel a), and one LNA that was shifted in the
3' direction of exon 46 (LNA9, FIG. 15, Panel a). A gel mobility
shift assay revealed that all LNAs were able to bind to the target
pre-mRNA (data not shown). The LNAs were then transfected into
patient myotubes at a dose of 500 nM. RT-PCR analysis (FIG. 15,
Panel b) and quantification (FIG. 15, Panel c) showed that the LNAs
containing one or two mismatches at the 3' end (LNAmm1 and LNAmm4)
were able to induce exon 46 skipping at high levels, comparable to
the original 100% complementary LNA8 (71%-94% vs. 100%), suggesting
that LNAs have a reduced sequence-specificity. The LNA containing a
single mismatch in the center (LNAmm2) induced low levels (8%) of
exon skipping, whereas the LNA containing two mismatches in the
center (LNAmm5) and the 5' mismatched LNA (LNAmm3) did not induce
detectable skipping. LNA9 did not induce exon 46 skipping, even
though it is completely homologous to exon 46. We also assessed the
effects of lower concentrations of the 3' mismatch-containing LNAs,
and observed exon skipping at comparably lower levels as with LNA8
(data not shown).
[0181] We similarly tested five different 2OMePS oligos containing
up to three mismatches when compared to the original 2OMePS oligo
in patient myotubes (2OMePSmm1-5, FIG. 15, Panel d). In contrast to
the LNAs, the 2OMePS AONs containing one or two mismatches at the
3' end (2OMePSmm1-2) induced exon 46 skipping at reduced levels
when compared to the original oligo (7%-17% vs. 48%) (FIG. 15,
Panels e and f). The oligos containing three mismatches at the 3'
end (2OMePSmm3) or one at the 5' end (2OMePSmm4) induced barely
detectable levels (1%-2%) of exon skipping, whereas the 2OMePS
containing three mismatches dispersed throughout the oligo
(2OMePSmm5) was unable to induce exon skipping. Transfection
experiments and RT-PCR analyses of the mismatched 2OMePS AONs and
LNAs were repeated several times and showed reproducible
efficiencies. Our results indicate that the 2OMePS AONs have a
higher sequence-specificity than the LNAs.
Discussion
[0182] In our previous studies on antisense-induced exon skipping
2OMePS AONs were applied (16,17,37). In this study, additional AON
analogs were tested for their efficacy, efficiency and
applicability in inducing DMD exon 46 skipping in control and DMD
patient-derived myotube cultures. Towards future clinical trials
the most optimal AON analog should induce high levels of exon
skipping, but also be non-toxic, easy to deliver and, preferably,
relatively inexpensive. Out of the four alternative analogs tested
here, only LNAs induced higher levels of exon skipping when
compared to 2OMePS AONs. The morpholino was less efficient in both
patient and control myotubes, whereas the PNA was completely
ineffective. For both the LNA and 2OMePS AONs, the levels of exon
skipping were higher in patient-derived cells than in control
cells. We have observed this effect previously in cells from other
DMD patients (17) and hypothesize that it is due to nonsense
mediated RNA decay (NMD), which will selectively target the
out-of-frame skip-product in control myotubes and thereby
negatively influence the relative amount of skipped product. In
patient derived cells, the original out-of-frame mRNA is subject to
NMD, whereas the in-frame skip-product is not. Another explanation
may be that AON-mediated exon skipping is actually enhanced in the
patient due to the presence of the deletion that already perturbed
local splicing. The levels of morpholino-induced exon skipping were
comparable in the patient and control samples (6% vs. 5%).
[0183] The gel mobility assay showed no shift for the morpholino
and PNA AONs, but despite its apparent low affinity for the target
pre-mRNA, the morpholino was able to induce low levels of exon 46
skipping. This may be explained by the fact that the morpholino was
hybridized to a sense DNA oligo (a "leash" allowing EPEI coupled
transfection), which may have interfered with the proper
hybridization to the target RNA fragment. After transfection into
cells, the leash detaches from the morpholino, which is then free
to hybridize to the target RNA. Schmajuk and colleagues found that
morpholinos were more effective in restoring the wild-type splicing
of the .beta.-globin gene when compared to 2OMePS AONs (25).
However, since we observed fluorescence in both the cytoplasm and
the nucleus after morpholino transfections, the low levels of exon
skipping may be the result of poor nuclear uptake rather than the
low efficiency of the morpholino. Further optimization of the
morpholino itself and the leash required for EPEI transfection may
thus increase the levels of exon 46 skipping. Indeed, Gebski and
colleagues have recently shown that levels of exon 23 skipping in
the mdx mouse varied when different leashes were used (28).
[0184] Even though the sequences of the PNA and the LNA analogs are
completely identical, the LNA induces high levels of exon 46
skipping, whereas the PNA induces no detectable skipping. PNA
oligos have been reported to induce higher levels of correctly
spliced .beta.-globin mRNA than morpholino and 2OMePS analogs
(27,35). This indicates that PNA is in fact able to modulate
splicing and suggests that the lack of exon 46 skipping in our
experiments may result from the inability of our PNA to bind to the
specific target RNA sequence, or a poor stability of the PNA-RNA
complex. Further experiments may identify PNAs with higher binding
affinities to exon 46 target sequences.
[0185] LNAs are relatively new AON analogs that have thus far only
been applied to inhibit the expression of target genes (29,31). We
show here that LNAs are also very potent modulators of pre-mRNA
splicing. In a series of experiments, the LNA induced exon 46
skipping in 85% of control transcripts and in 98% of transcripts
from a DMD patient carrying an exon 45 deletion. In comparison, the
2OMePS AONs previously used, induced 20% exon 46 skipping in
control cells and 75% skipping in exon 45-deleted transcripts.
Notably, the LNA also seemed to be less toxic than 2OMePS AONs.
[0186] Based on these results, LNA in principle may be a promising
alternative for antisense-induced exon skipping studies.
Unfortunately however, due to the shorter sequence (14-mer), it
shows complete homology to several other sequences in the human
genome. Most of these were located within non-coding regions,
either in or near genes. Increasing the length of the LNA enhances
specificity (29). Our results with LNAs containing mismatches show
that LNAs with one or two mismatches in the 3' part of the AON were
almost as potent as the specific LNA. This suggests that the
binding of only 12 base pairs is enough to induce the skipping of
exon 46, which is not surprising, given the extremely high melting
temperatures of LNA (predicted to be 131.degree. C. for our 14mer
LNA; Table 6). It does, however, imply that our exon 46 specific
LNA may also adversely bind to other sequences in the human genome
that contain these 12 base pairs. The LNA may bind to even shorter
sequences, since, for instance, a 7-mer still has a predicted
melting temperature of over 60.degree. C. We have recently injected
the human LNA into mouse muscle. With one mismatch when compared to
the mouse sequence, the human LNA was able to induce skipping of
the murine exon 46, even at low concentrations. To decrease the
affinity for RNA, chimeric LNA/2'-O-methyl RNA oligos have been
generated (38). These chimeras have lower melting temperatures than
full length LNA, but still have higher affinities for RNA than
2OMePS AONs. In fact, chimeric LNAs have been shown to block
transcription of the HIV-1 transactivating responsive element in
vitro (38).
[0187] Our results with mismatched 2OMePS AONs show that these
analogs are more sequence-specific than the LNAs. The presence of
one mismatch at the 3' end results in an almost three-fold decrease
of exon 46 skipping levels, whereas no exon skipping was left with
2OMePS AONs containing three 3' mismatches. One might have
anticipated a greater effect of a single mismatch in the shorter
14-mer LNA than in the longer 20-mer 2OMePS AON. However, the
opposite was found true for the 3' end. Furthermore, for both the
LNA and the 2OMePS analogs, mismatches at the 3' end induced higher
levels of exon 46 skipping than those at the 5' end or in the
center of the AONs. This suggests that, whether or not due to the
presence of the fluorescent label, mismatches at the 5' end reduced
the affinity for the target RNA to a larger extent.
Materials and Methods
AONs and Primers
[0188] The characteristics of the AON analogs in this study are
reviewed in Table 6. The 2OMePS AONs (sequences shown in FIG. 15,
Panel d; Eurogentec, Belgium) have a full length phosphorothioate
backbone and 2'-O-methyl modified ribose molecules, as previously
described (16,37). The morpholino (Gene-Tools, US) has a
morpholinophosphoroamidate backbone and is linked to a sense DNA
oligo for EPEI transfection. The LNAs (sequences shown in FIG. 15,
Panel a; Proligo, France) have full length locked nucleic acid
backbones. The PNA (Eurogentec, Belgium) has a peptide nucleic acid
backbone and four lysine residues at the C-terminal end to improve
water solubility and facilitate transfection into cells. All AONs
contain a 5' fluorescein group (6-FAM).
Gel Mobility Shift Assay
[0189] Human dystrophin exon 46 RNA was in vitro transcribed as
described previously (16). The binding affinity of the individual
AONs (at a dose of 0.5 pmol) was determined by overnight incubation
in a hybridization buffer (1 mM Tris-HC pH 7.4, 50 nM NaCl, 5 mM
MgCl2) at 37.degree. C., followed by 8% PAGE and PhosphoImager
analysis (Molecular Dynamics).
Myogenic Cell Cultures and Transfection
[0190] Primary human myoblasts from an unaffected control and a DMD
patient (DL279.1; carrying a deletion of exon 45) were isolated
from muscle biopsies and cultured as described previously (37).
Myotubes were obtained from confluent myoblast cultures, following
7 to 14 days of serum-deprivation. For the 2OMePS and LNA AONs, PEI
was used for transfection, according to the manufacturer's
instructions (ExGen500; MBI Fermentas), with 3.5 .mu.l PEI per
.mu.g of transfected AON (i.e., 12.9 .mu.l (70 .mu.M) for the
2OMePS and 9.2 .mu.l (50 .mu.M) for the LNA oligo). EPEI was used
to transfect the morpholino AON according to the manufacturer's
instructions, with 1 .mu.l of 200 .mu.M EPEI (Gene-Tools, USA) for
each 200 nmol of morpholino. PNAs were applied to 1 ml culture
medium, without any transfection reagent. Three hours
post-transfection 2 ml medium was added.
RNA Isolation, RT-PCR and Sequence Analysis
[0191] RNA isolation, RT-PCR analysis and direct sequencing were
performed as described (17). Primary PCRs included primers in exon
43 (CCTGTGGAAAGGGTGAAGC, (SEQ ID NO:3)) and 48
(CTGAACGTCAAATGGTCCTTC, (SEQ ID NO:4)); nested PCRs included
primers in exon 44 (CGATTTGACAGATCTGTTGAG, (SEQ ID NO:5)) and 47
(GAGCACTTACAAGCACGGG, (SEQ ID NO:6)). All primers were synthesized
by Eurogentec (Belgium). For quantification, the skip-products were
analyzed using the DNA 1000 LabChip.RTM. Kit on the Agilent 2100
bioanalyzer (Agilent Technologies, USA).
REFERENCES TO EXAMPLE 6
[0192] 1 D. A. Braasch and D. R. Corey. Novel antisense and peptide
nucleic acid strategies for controlling gene expression.
Biochemistry 2002; 41: 4503-4510. [0193] 2 T. Suwanmanee et al.
Repair of a Splicing Defect in Erythroid Cells from Patients with
beta-Thalassemia/HbE Disorder. Mol. Ther. 2002; 6: 718-726. [0194]
3 K. J. Friedman et al. Correction of aberrant splicing of the
cystic fibrosis transmembrane conductance regulator (CFTR) gene by
antisense oligonucleotides. J. Biol. Chem. 1999; 274: 36193-36199.
[0195] 4 D. R. Mercatante, P. Sazani, R. Kole R. Modification of
alternative splicing by antisense oligonucleotides as a potential
chemotherapy for cancer and other diseases. Curr. CancerDrug
Targets 2001; 1: 211-230. [0196] 5 L. Cartegni and A. R. Krainer.
Correction of disease-associated exon skipping by synthetic
exon-specific activators. Nat. Struct. Biol. 2003; 10: 120-125.
[0197] 6 E. P. Hoffman, R. H. Brown, Jr., L. M. Kunkel. Dystrophin:
the protein product of the Duchenne muscular dystrophy locus. Cell
1987; 51: 919-928. [0198] 7 E. P. Hoffman et al. Characterization
of dystrophin in muscle-biopsy specimens from patients with
Duchenne's or Becker's muscular dystrophy. N. Engl. J. Med. 1988;
318: 1363-1368. [0199] 8 M. Koenig et al. The molecular basis for
Duchenne versus Becker muscular dystrophy: correlation of severity
with type of deletion. Am. J. Hum. Genet. 1989; 45: 498-506. [0200]
9 J. M. Ervasti et al. Deficiency of a glycoprotein component of
the dystrophin complex in dystrophic muscle. Nature 1990; 345:
315-319. [0201] 10 C. Di Blasi et al. Dystrophin-associated protein
abnormalities in dystrophin-deficient muscle fibers from
symptomatic and asymptomatic Duchenne/Becker muscular dystrophy
carriers. Acta Neuropathol. (Berl) 1996; 92: 369-377. [0202] 11 M.
Koenig, A. P. Monaco, L. M. Kunkel L M. The complete sequence of
dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988;
53: 219-226. [0203] 12 M. G. Dunckley et al. Modification of
splicing in the dystrophin gene in cultured Mdx muscle cells by
antisense oligoribonucleotides. Hum. Mol. Genet. 1998; 7:
1083-1090. [0204] 13 S. D. Wilton et al. Specific removal of the
nonsense mutation from the mdx dystrophin mRNA using antisense
oligonucleotides. Neuromuscul. Disord. 1999; 9: 330-338. [0205] 14
F. G. De Angelis et al. Chimeric snRNA molecules carrying antisense
sequences against the splice junctions of exon 51 of the dystrophin
pre-mRNA induce exon skipping and restoration of a dystrophin
synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. U.S.A.
2002; 99: 9456-9461. [0206] 15 Y. Takeshima et al. Oligonucleotides
against a splicing enhancer sequence led to dystrophin production
in muscle cells from a Duchenne muscular dystrophy patient. Brain
Dev. 2001; 23: 788-790. [0207] 16 J. C. van Deutekom et al.
Antisense-induced exon skipping restores dystrophin expression in
DMD patient derived muscle cells. Hum. Mol. Genet. 2001; 10:
1547-1554. [0208] 17 A. Aartsma-Rus et al. Therapeutic
antisense-induced exon skipping in cultured muscle cells from six
different DMD patients. Hum. Mol. Genet. 2003; 12: 907-914. [0209]
18 A. Aartsma-Rus et al. Antisense-induced multiexon skipping for
Duchenne muscular dystrophy makes more sense. Am. J. Hum. Genet.
2004; 74: 83-92. Epub 2003 December 2016. [0210] 19 Q. L. Lu et al.
Functional amounts of dystrophin produced by skipping the mutated
exon in the mdx dystrophic mouse. Nat. Med. 2003; 6: 6. [0211] 20
S. Agrawal. Importance of nucleotide sequence and chemical
modifications of antisense oligonucleotides. Biochim. Biophys.
Acta. 1999; 1489: 53-68. [0212] 21 M. Manoharan. Oligonucleotide
conjugates as potential antisense drugs with improved uptake,
biodistribution, targeted delivery, and mechanism of action.
Antisense Nucleic Acid Drug Dev. 2002; 12: 103-128. [0213] 22 S. C.
Ekker and J. D. Larson. Morphant technology in model developmental
systems. Genesis 2001; 30: 89-93. [0214] 23 J. Summerton.
Morpholino antisense oligomers: the case for an RNase H independent
structural type. Biochim. Biophys. Acta. 1999; 1489: 141-158.
[0215] 24 P. A. Morcos. Achieving efficient delivery of morpholino
oligos in cultured cells. Genesis 2001; 30: 94-102. [0216] 25 G.
Schmajuk, H. Sierakowska, R. Kole. Antisense oligonucleotides with
different backbones. Modification of splicing pathways and efficacy
of uptake. J. Biol. Chem. 1999; 274: 21783-21789. [0217] 26 A.
Nasevicius and S. C. Ekker. Effective targeted gene "knockdown" in
zebrafish. Nat. Genet. 2000; 26: 216-220. [0218] 27 P. Sazani et
al. Systemically delivered antisense oligomers upregulate gene
expression in mouse tissues. Nat. Biotechnol. 2002; 20: 1228-1233.
[0219] 28 B. L. Gebski et al. Morpholino antisense oligonucleotide
induced dystrophin exon 23 skipping in mdx mouse muscle. Hum. Mol.
Genet. 2003; 12: 1801-1811. [0220] 29 D. A. Braasch, Y. Liu, D. R.
Corey. Antisense inhibition of gene expression in cells by
oligonucleotides incorporating locked nucleic acids: effect of mRNA
target sequence and chimera design. Nucleic Acids Res. 2002; 30:
5160-5167. [0221] 30 C. J. Leumann C J. DNA analogues: from
supramolecular principles to biological properties. Bioorg. Med.
Chem. 2002; 10: 841-854. [0222] 31 K. Fluiter et al. In vivo tumor
growth inhibition and biodistribution studies of locked nucleic
acid (LNA) antisense oligonucleotides. Nucleic Acids Res. 2003; 31:
953-962. [0223] 32H. J. Larsen, T. Bentin, P. E. Nielsen. Antisense
properties of peptide nucleic acid. Biochim. Biophys. Acta. 1999;
1489: 159-166. [0224] 33 L. Mologni et al. Additive antisense
effects of different PNAs on the in vitro translation of the
PML/RARalpha gene. Nucleic Acids Res. 1998; 26: 1934-1938. [0225]
34 A. Ray and B. Norden. Peptide nucleic acid (PNA): its medical
and biotechnical applications and promise for the future. Faseb. J
2000; 14: 1041-1060. [0226] 35 P. Sazani et al. Nuclear antisense
effects of neutral, anionic and cationic oligonucleotide analogs.
Nucleic Acids Res. 2001; 29: 3965-3974. [0227] 36 J. G. Karras et
al. Deletion of individual exons and induction of soluble murine
interleukin-5 receptor-alpha chain expression through antisense
oligonucleotide-mediated redirection of pre-mRNA splicing. Mol.
Pharmacol. 2000; 58: 380-387. [0228] 37 A. Aartsma-Rus et al.
Targeted exon skipping as a potential gene correction therapy for
Duchenne muscular dystrophy. Neuromuscul. Disord. 2002; 12: S71.
[0229] 38 A. Arzumanov et al. Inhibition of HIV-1 Tat-dependent
trans activation by steric block chimeric 2'-O-methyl/LNA
oligoribonucleotides. Biochemistry 2001; 40: 14645-14654.
Example 7
[0229] Multi-Exon Skipping
[0230] Other examples of frame-restoring multi-exon skipping may
include the stretches between exons 17 and 48 (an exon 17-48
deletion is a very large mutation known to be associated with a
mild BMD-like phenotype) which would be therapeutic for .about.20%
of DMD mutations, exons 19 to 51 (35% applicability), 48 to 59 (18%
applicability), or 42 to 55 (65% applicability). Especially the
latter combination, included here as another example (FIG. 8),
would thus apply to large set of patients. We demonstrated the
feasibility of multi-exon 42-55 skipping in human control myotubes
that were either treated with a mixture h42AON1 and h55AON1 (see
Table 2), or with one combined AON carrying both these AONs linked
by 10 uracil nucleotides. Following transfection of these mixed or
"U-linked AONs" into the myotubes, RT-PCR analysis demonstrated
similar efficiencies in inducing the anticipated in-frame
transcript with exon 42 spliced to exon 55 (FIG. 16). Sequence
analysis confirmed that this particular multi-exon skipping
occurred specifically and precisely at the exon-boundaries (data
not shown).
[0231] These experiments were performed as described for the
multi-exon 45-51 skip (see Material and Methods to Example 5).
REFERENCES (TO THE GENERAL PART, EXCLUDING EXAMPLES 2, 5 And 6)
[0232] 1. E. P. Hoffman, R. H. Brown, Jr., L. M. Kunkel (1987)
Dystrophin: the protein product of the Duchenne muscular dystrophy
locus. Cell 51, 919-928. [0233] 2. E. P. Hoffman, K. H. Fischbeck,
R. H. Brown, M. Johnson, R. Medori, J. D. Loike, J. B. Harris, R.
Waterston, M. Brooke, L. Specht, et al. (1988) Characterization of
dystrophin in muscle-biopsy specimens from patients with Duchenne's
or Becker's muscular dystrophy. N. Engl. J. Med. 318, 1363-1368.
[0234] 3. J. T. Den Dunnen, P. M. Grootscholten, E. Bakker, L. A.
Blonden, H. B. Ginjaar, M. C. Wapenaar, H. M. van Paassen, C. van
Broeckhoven, P. L. Pearson, G. J. van Ommen (1989) Topography of
the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis
of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum.
Genet. 45, 835-847. [0235] 4. M. Koenig, A. H. Beggs, M. Moyer, S.
Scherpf, K. Heindrich, T. Bettecken, G. Meng, C. R. Muller, M.
Lindlof, H. Kaariainen, et al. (1989) The molecular basis for
Duchenne versus Becker muscular dystrophy: correlation of severity
with type of deletion. Am. J. Hum. Genet. 45, 498-506. [0236] 5. S.
Tuffery-Giraud, S. Chambert, J. Demaille, M. Claustres (1999) Point
mutations in the dystrophin gene: evidence for frequent use of
cryptic splice sites as a result of splicing defects. Hum. Mutat.
14, 359-368. [0237] 6. T. W. Prior, C. Bartolo, D. K. Pearl, A. C.
Papp, P. J. Snyder, M. S. Sedra, A. H. Burghes, J. R. Mendell
(1995) Spectrum of small mutations in the dystrophin coding region.
Am. J. Hum. Genet. 57, 22-33. [0238] 7. H. Moser (1984) Duchenne
muscular dystrophy: pathogenetic aspects and genetic prevention.
Hum. Genet. 66, 17-40. [0239] 8. A. E. Emery (2002) The muscular
dystrophies. Lancet 359, 687-695. [0240] 9. M. Yoshida and E. Ozawa
(1990) Glycoprotein complex anchoring dystrophin to sarcolemma. J.
Biochem. (Tokyo), 108, 748-752. [0241] 10. J. M. Ervasti and K. P.
Campbell (1991) Membrane organization of the
dystrophin-glycoprotein complex. Cell 66, 1121-1131. [0242] 11. C.
Di Blasi, L. Morandi, R. Barresi, F. Blasevich, F. Cornelio, M.
Mora (1996) Dystrophin-associated protein abnormalities in
dystrophin-deficient muscle fibers from symptomatic and
asymptomatic Duchenne/Becker muscular dystrophy carriers. Acta.
Neuropathol. (Berl.) 92, 369-377. [0243] 12. J. M. Ervasti, K.
Ohlendieck, S. D. Kahl, M. G. Gaver, K. P. Campbell (1990)
Deficiency of a glycoprotein component of the dystrophin complex in
dystrophic muscle. Nature 345, 315-319. [0244] 13. K. Matsumura, A.
H. Burghes, M. Mora, F. M. Tome, L. Morandi, F. Cornello, F.
Leturcq, M. Jeanpierre, J. C. Kaplan, P. Reinert, et al. (1994)
Immunohistochemical analysis of dystrophin-associated proteins in
Becker/Duchenne muscular dystrophy with huge in-frame deletions in
the NH2-terminal and rod domains of dystrophin. J. Clin. Invest.
93, 99-105. [0245] 14. A. P. Monaco, C. J. Bertelson, S.
Liechti-Gallati, H. Moser, L. M. Kunkel (1988) An explanation for
the phenotypic differences between patients bearing partial
deletions of the DMD locus. Genomics 2, 90-95. [0246] 15. P. R.
Clemens and F. J. Duncan (2001) Progress in gene therapy for
Duchenne muscular dystrophy. Curr. Neurol. Neurosci. Rep. 1, 89-96.
[0247] 16. M. A. Khan (1993) Corticosteroid therapy in Duchenne
muscular dystrophy. J. Neurol. Sci. 120, 8-14. [0248] 17. F. G. De
Angelis, O. Sthandier, B. Berarducci, S. Toso, G. Galluzzi, E.
Ricci, G. Cossu, I. Bozzoni (2002) Chimeric snRNA molecules
carrying antisense sequences against the splice junctions of exon
51 of the dystrophin pre-mRNA induce exon skipping and restoration
of a dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl.
Acad. Sci. U.S.A. 99, 9456-9461. [0249] 18. C. J. Mann, K.
Honeyman, A. J. Cheng, T. Ly, F. Lloyd, S. Fletcher, J. E. Morgan,
T. A. Partridge, S. D. Wilton (2001) Antisense-induced exon
skipping and synthesis of dystrophin in the mdx mouse. Proc. Natl.
Acad. Sci. U.S.A. 98, 42-47. [0250] 19. J. C. van Deutekom, M.
Bremmer-Bout, A. A. Janson, I. B. Ginjaar, F. Baas, J. T. den
Dunnen, G. J. van Ommen (2001) Antisense-induced exon skipping
restores dystrophin expression in DMD patient derived muscle cells.
Hum. Mol. Genet. 10, 1547-1554. [0251] 20. S. D. Wilton, F. Lloyd,
K. Carville, S. Fletcher, K. Honeyman, S. Agrawal, R. Kole (1999)
Specific removal of the nonsense mutation from the mdx dystrophin
mRNA using antisense oligonucleotides. Neuromuscul. Disord. 9,
330-338. [0252] 21. M. G. Dunckley, M. Manoharan, P. Villiet, I. C.
Eperon, G. Dickson (1998) Modification of splicing in the
dystrophin gene in cultured Mdx muscle cells by antisense
oligoribonucleotides. Hum. Mol. Genet. 7, 1083-1090. [0253] 22. Y.
Takeshima, H. Wada, M. Yagi, Y. Ishikawa, R. Minami, H. Nakamura,
M. Matsuo (2001) Oligonucleotides against a splicing enhancer
sequence led to dystrophin production in muscle cells from a
Duchenne muscular dystrophy patient. Brain Dev. 23, 788-790. [0254]
23. A. Aartsma-Rus, M. Bremmer-Bout, A. Janson, J. den Dunnen, G.
van Ommen, J. van Deutekom (2002) Targeted exon skipping as a
potential gene correction therapy for Duchenne muscular dystrophy.
Neuromuscul. Disord. 12, S71. [0255] 24. N. Shiga, Y. Takeshima, H.
Sakamoto, K. Inoue, Y. Yokota, M. Yokoyama, M. Matsuo (1997)
Disruption of the splicing enhancer sequence within exon 27 of the
dystrophin gene by a nonsense mutation induces partial skipping of
the exon and is responsible for Becker muscular dystrophy. J. Clin.
Invest. 100, 2204-2210. [0256] 25. L. Cartegni, S. L. Chew, A. R.
Krainer (2002) Listening to silence and understanding nonsense:
exonic mutations that affect splicing. Nat. Rev. Genet. 3, 285-298.
[0257] 26. T. D. Schaal and T. Maniatis (1999) Multiple distinct
splicing enhancers in the protein-coding sequences of a
constitutively spliced pre-mRNA. Mol. Cell. Biol. 19, 261-273.
[0258] 27. Y. Takeshima, H. Nishio, H. Sakamoto, H. Nakamura, M.
Matsuo (1995) Modulation of in vitro splicing of the upstream
intron by modifying an intra-exon sequence which is deleted from
the dystrophin gene in dystrophin Kobe. J. Clin. Invest. 95,
515-520. [0259] 28. Z. A. Pramono, Y. Takeshima, H. Alimsardjono,
A. Ishii, S. Takeda, M. Matsuo (1996) Induction of exon skipping of
the dystrophin transcript in lymphoblastoid cells by transfecting
an antisense oligodeoxynucleotide complementary to an exon
recognition sequence. Biochem. Biophys. Res. Commun. 226, 445-449.
[0260] 29. M. Koenig, A. P. Monaco, L. M. Kunkel (1988) The
complete sequence of dystrophin predicts a rod-shaped cytoskeletal
protein. Cell 53, 219-226. [0261] 30. J. Den Dunnen (1996) The
Leiden Muscular Dystrophy pages; http://www.dmd.nl. [0262] 31. C.
J. Mann, K. Honeyman, G. McClorey, S. Fletcher, S. D. Wilton (2002)
Improved antisense oligonucleotide induced exon skipping in the mdx
mouse model of muscular dystrophy. J. Gene Med. 4, 644-654. [0263]
32. T. P. Kerr, C. A. Sewry, S. A. Robb, R. G. Roberts (2001) Long
mutant dystrophins and variable phenotypes: evasion of
nonsense-mediated decay? Hum. Genet. 109, 402-407. [0264] 33. C. J.
Klein, D. D. Coovert, D. E. Bulman, P. N. Ray, J. R. Mendell, A. H.
Burghes (1992) Somatic reversion/suppression in Duchenne muscular
dystrophy (DMD): evidence supporting a frame-restoring mechanism in
rare dystrophin-positive fibers. Am. J. Hum. Genet. 50, 950-959.
[0265] 34. T. G. Sherratt, T. Vulliamy, V. Dubowitz, C. A. Sewry,
P. N. Strong, (1993) Exon skipping and translation in patients with
frameshift deletions in the dystrophin gene. Am. J. Hum. Genet. 53,
1007-1015. [0266] 35. Q. L. Lu, G. E. Morris, S. D. Wilton, T. Ly,
O. V. Artem'yeva, P. Strong, T. A. Partridge (2000) Massive
idiosyncratic exon skipping corrects the nonsense mutation in
dystrophic mouse muscle and produces functional revertant fibers by
clonal expansion. J. Cell. Biol. 148, 985-996. [0267] 36. L. V.
Nicholson, M. A. Johnson, K. M. Bushby, D. Gardner-Medwin (1993)
Functional significance of dystrophin positive fibres in Duchenne
muscular dystrophy. Arch. Dis. Child. 68, 632-636. [0268] 37. M.
Vainzof M. R. Passos-Bueno R. I. Takata C. Pavanello Rde, M. Zatz
(1993) Intrafamilial variability in dystrophin abundance correlated
with difference in the severity of the phenotype. J. Neurol. Sci.
119, 38-42. [0269] 38. V. Singh, S. Sinha, S. Mishra, L. S.
Chaturvedi, S. Pradhan, R. D. Mittal, B. Mittal (1997) Proportion
and pattern of dystrophin gene deletions in north Indian Duchenne
and Becker muscular dystrophy patients. Hum. Genet. 99, 206-208.
[0270] 39. P. Melacini, M. Fanin, G. A. Danieli, G. Fasoli, C.
Villanova, C. Angelini, L. Vitiello, M. Miorelli, G. F. Buja, M. L.
Mostacciuolo, et al. (1993) Cardiac involvement in Becker muscular
dystrophy. J. Am. Coll. Cardiol. 22, 1927-1934. [0271] 40. M. A.
Melis, M. Cau, F. Muntoni, A. Mateddu, R. Galanello, L. Boccone, F.
Deidda, D. Loi, A. Cao (1998) Elevation of serum creatine kinase as
the only manifestation of an intragenic deletion of the dystrophin
gene in three unrelated families. Europ. J. Paediatr. Neurol. 2,
255-261. [0272] 41. S. Onengut, G. N. Kavaslar, E. Battaloglu, P.
Serdaroglu, F. Deymeer, C. Ozdemir, F. Calafell, A. Tolun (2000)
Deletion pattern in the dystrophin gene in Turks and a comparison
with Europeans and Indians. Ann. Hum. Genet. 64, 33-40. [0273] 42.
C. Rosenberg, L. Navajas, D. F. Vagenas, E. Bakker, M. Vainzof, M.
R. Passos-Bueno, R. I. Takata, G. J. Van Ommen, M. Zatz, J. T. Den
Dunnen (1998) Clinical diagnosis of heterozygous dystrophin gene
deletions by fluorescence in situ hybridization. Neuromuscul.
Disord. 8, 447-452. [0274] 43. J. Sertic, N. Barisic, M. Sostarko,
Z. Brzovic, A. Stavljenic-Rukavina (1997) Deletion screening of the
Duchenne/Becker muscular dystrophy gene in Croatian population.
Coll. Antropol. 21, 151-156. [0275] 44. T. A. Rando and H. M. Blau
(1994) Primary mouse myoblast purification, characterization, and
transplantation for cell-mediated gene therapy. J. Cell. Biol. 125,
1275-1287. [0276] 45. C. E. Murry, M. A. Kay, T. Bartosek, S. D.
Hauschka, S. M. Schwartz (1996) Muscle differentiation during
repair of myocardial necrosis in rats via gene transfer with MyoD.
J. Clin. Invest. 98, 2209-2217. [0277] 46. P. A. Roest, A. C. van
der Tuijn, H. B. Ginjaar, R. C. Hoeben, F. B. Hoger-Vorst, E.
Bakker, J. T. den Dunnen, G. J. van Ommen (1996) Application of in
vitro Myo-differentiation of non-muscle cells to enhance gene
expression and facilitate analysis of muscle proteins. Neuromuscul.
Disord. 6, 195-202. [0278] 47. M. J. Havenga, A. A. Lemckert, O. J.
Ophorst, M. van Meijer, W. T. Germeraad, J. Grimbergen, M. A. van
Den Doel, R. Vogels, J. van Deutekom, A. A. Janson, et al. (2002)
Exploiting the natural diversity in adenovirus tropism for therapy
and prevention of disease. J. Virol. 76, 4612-4620. [0279] 48. L.
V. Anderson and K. Davison (1999) Multiplex Western blotting system
for the analysis of muscular dystrophy proteins. Am. J. Pathol.
154, 1017-1022. [0280] 49. K. M. Neugebauer, et al., J. Cell. Biol.
129:899-908 (1995). [0281] 50. R. Tacke and J. L. Manley, Proc.
Soc. Exp. Biol. Med. 220:59-63 (1999). [0282] 51. B. R. Graveley et
al., Curr. Biol. 9:R6-7 (1999). [0283] 52. T. Misteli et al.,
Nature 387:523-527 (1997). [0284] 53. L. Gorman, D. Suter, V.
Emerick, et al. Stable alteration of pre mRNA splicing patterns by
modified U7 small nuclear RNAs. Proc. Natl. Acad. Sci. U.S.A. 1998;
95:4929 4934.
[0285] 54. D. Suter, R. Tomasini, U. Reber, et al. Double target
antisense U7 snRNAs promote efficient skipping of an aberrant exon
in three human beta thalassemic mutations. Hum. Mol. Genet. 1999;
8:2415 2423. TABLE-US-00001 TABLE 1 Overview of the patients, the
AONs and the primer sets used in this study Targeted Primary PCR
Nested PCR Patients Mutations exons AONs.sup.a RT-primers.sup.b
sets.sup.b sets.sup.b DL 515.2 Deletion exon 45-50 Exon 51 h51AON1
h53r h41f-h53r h42f-h52r DL 363.2 Deletion exon 45-54 Exon 44
h44AON1 h55r2 h42f-h55r2 h44f-h55r 50685.1 Deletion exon 48-50 Exon
51 h51AON1 h53r h46f-h53r h47f-h52r DL 589.2 Deletion exon 51-55
Exon 50 h50AON1 h58r h47f-h58r h49f-h57r 53914.1 Deletion exon 52
Exon 51 h51AON1 h55r h49f-h55r h50f-h54r '' Exon 53 h53AON1 '' ''
'' 50423.1 Point mutation exon 49 Exon 49 h49AON1 h52r h46f-h52r
h47f-h51r .sup.aAON sequences were published previously (23).
.sup.bPrimer sequences available upon request.
[0286] TABLE-US-00002 TABLE 2 Characteristics of the AONs used to
study the targeted skipping of 15 different DMD exons.sup.a Length
Exon Name Antisense sequence (5'-3') (bp) G/C % U/C % skip
Transcript h2AON 1 (SEQ ID NO:7) cccauuuugugaauguuuucuuuu 24 29 75
+ OF h2AON 2 (SEQ ID NO:8) uugugcauuuacccauuuugug 22 36 68 - OF
h17AON1 (SEQ ID NO:9) ccauuacaguugucuguguu 20 + h17AON2 (SEQ ID
NO:10) uaaucugccucuucuuuugg 20 + h29AON 1 (SEQ ID NO:11)
uauccucugaaugucgcauc 20 45 65 + IF h29AON 2 (SEQ ID NO:12)
gguuauccucugaaugucgc 20 50 60 + IF h4OAON 1 (SEQ ID NO:13)
gagccuuuuuucuucuuug 19 37 79 + IF h4OAON 2 (SEQ ID NO:14)
uccuuucgucucugggcuc 19 58 79 + IF h41AON 1 (SEQ ID NO:15)
cuccucuuucuucuucugc 19 47 95 + IF h41AON 2 (SEQ ID NO:16)
cuucgaaacugagcaaauuu 20 35 50 + IF h42AON 1 (SEQ ID NO:17)
cuugugagacaugagug 17 47 41 + IF h42AON 2 (SEQ ID NO:18)
cagagacuccucuugcuu 18 50 67 + IF h43AON 1 (SEQ ID NO:19)
ugcugcugucuucuugcu 18 50 78 - OF h43AON 2 (SEQ ID NO:20)
uuguuaacuuuuucccauu 19 26 79 + OF h43AON5 (SEQ ID NO:1)
cuguagcuucacccuuucc 19 + h44AON 1 (SEQ ID NO:21)
cgccgccauuucucaacag 19 58 63 + OF h44AON 2 (SEQ ID NO:22)
uuuguauuuagcauguuccc 20 35 70 + OF h45AON 1 (SEQ ID NO:23)
gcugaauuauuucuucccc 19 42 74 - OF h45AON S (SEQ ID NO:2)
gcccaaugccauccugg 17 65 58 + OF h46AON 4b (SEQ ID NO:24)
cugcuuccuccaacc 15 60 80 + OF h46AON 8b (SEQ ID NO:25)
gcuuuucuuuuaguugcugc 20 40 75 + OF h46AON26: (SEQ ID NO:26)
agguucaagugggauacua 19 42 37 + OF h47AON 1 (SEQ ID NO:27)
ucuugcucuucugggcuu 18 50 78 - IF h47AON 2 (SEQ ID NO:28)
cuugagcuuauuuucaaguuu 21 29 67 - IF h48AON 1 (SEQ ID NO:29)
uuucuccuuguuucuc 16 38 94 - IF h48AON 2 (SEQ ID NO:30)
ccauaaauuuccaacugauuc 21 33 62 - IF h48AON6 (SEQ ID NO:31)
gcuucaauuucuccuuguu 19 + h48AON7 (SEQ ID NO:32) uuuauuugagcuucaauuu
19 + h49AON 1 (SEQ ID NO:33) cuuccacauccgguuguuu 19 47 74 + IF
h49AON 2 (SEQ ID NO:34) guggcugguuuuuccuugu 19 47 68 + IF h50AON 1
(SEQ ID NO:35) cucagagcucagaucuu 17 47 59 + OF h50AON 2 (SEQ ID
NO:36) ggcugcuuugcccuc 15 67 73 - OF h51AON 1 (SEQ ID NO:37)
ucaaggaagauggcauuucu 20 40 45 + OF h51AON 2 (SEQ ID NO:38)
ccucugugauuuuauaacuugau 23 30 65 + OF h53AON 1 (SEQ ID NO:39)
cuguugccuccgguucug 18 61 72 + OF h53AON 2 (SEQ ID NO:40)
uuggcucuggccuguccu 18 61 72 - OF h55AON1 (SEQ ID NO:41)
cuguugcaguaaucuaugag 20 + h55AON6 (SEQ ID NO:42) gagucuucuaggagccuu
18 + h59AON2 (SEQ ID NO:43) uugaaguuccuggagucuu 19 + .sup.aTwo AONs
were tested per exon. Their different lengths and G/C contents (%)
did not correlate to their effectivity in exon skipping (1, induced
skipping, 2, no skipping). The AONs were directed to purine (A/G)
-rich sequences as indicated by their (antisense) U/C content (%).
Skipping of the target exons resulted in either an in-frame (IF) or
an out-of-frame (OF) transcript. .sup.bvan Deutekom et al., 2001
[21].
[0287] TABLE-US-00003 TABLE 3 Primer sets used for the RT-PCR
analyses to detect the skipping of the targeted exons.sup.a Primary
PCR Nested PCR Target exon RT-primer primer set primer set 2 h4r
h1f1-h4r h1f2-h3r 2 h9r h1f1-h9r h1f2-h8r 29 h31r h25f-h31r
h26f-h30r 40 h44r h38f-h44r h39f-h43r 41 h44r h38f-h44r h39f-h43r
42 h44r h38f-h44r h39f-h43r 43 h47r h41f-h47r h42f-h46r 44 h47r
h41f-h47r h42f-h46r 45 h47r h41f-h47r h42f-h46r 46 h48r h44f-h48r
h45f-h47r 47 h52r h44f-h52r h46f-h51r 48 h52r h44f-h52r h46f-h51r
49 h52r h44f-h52r h46f-h51r 50 h52r h44f-h52r h46f-h51r 51 h53r
h47f-h53r h49f-h52r 53 h55r h50f-h55r h51f-h54r .sup.aPrimer
sequences are available upon request.
[0288] TABLE-US-00004 TABLE 4 Overview and frequency of the
DMD-causing mutations in the Leiden DMD (LDMD) Database,
theoretically correctable by skipping one of the 12 exons
successfully targeted in this study Therapeutic for DMD-mutations:
Deletions No. of nonsense (exons) % of deletions Duplications % of
duplications mutations in Skippable exon (exons) in LDMD Database
(exons) in LDMD Database LDMD Database 2 3-7, 3-19, 3-21 2.9 2 9.0
29 5 40 1 41 4 42 0 43 44, 44-47, 44-49, 3.7 43 3.0 44-51 44 5-43,
14-43, 19-43, 7.8 44 3.0 30-43, 35-43, 36-43, 40-43, 42-43, 45,
45-54 46 21-45, 45, 47-54, 5.6 47-56 49 1 50 51, 51-53, 51-55 5.2
50 3.0 51 45-50, 47-50, 48-50, 17.5 51 1.5 49-50, 50, 52, 52-63 53
10-52, 45-52, 46-52, 7.5 47-52, 48-52, 49-52, 50-52, 52
[0289] TABLE-US-00005 TABLE 5 Overview of the patients, the AONs
and the primer sets used in Example 3 Targeted Primary PCR Nested
PCR Patients Mutations exons AONs RT-primers.sup.b primer
sets.sup.b primer sets.sup.b DL 90.3 Nonsense mutation exon 43 Exon
43 h43AON2.sup.a h48r h41f-h48r h42f-h47r Exon 44 h44AON1.sup.a
DL470.2 Deletion exon 46-50 Exon 45 h45AON5 h53r h42f-h53r h43-h52r
Exon 51 h51AON2.sup.a Exon 45 U-linker h53r h42f-h53r h43f-h52r
Exon 51 AON.sup.c .sup.aSeperate AON sequences were published
previously [Aartsma-Rus, 2002]. .sup.bPrimer sequences available
upon request. .sup.cU linker AON consists of h45AON5 linked to
h51AON2 by 10 uracils.
* * * * *
References