U.S. patent application number 11/303896 was filed with the patent office on 2006-05-11 for methods for delivering dna to muscle cells using recombinant adeno-associated virus virions vectors.
Invention is credited to Barry J. Byrne, Paul D. Kessler, Gary J. Kurtzman, Gregory M. Podsakoff.
Application Number | 20060099184 11/303896 |
Document ID | / |
Family ID | 27080262 |
Filed Date | 2006-05-11 |
United States Patent
Application |
20060099184 |
Kind Code |
A1 |
Podsakoff; Gregory M. ; et
al. |
May 11, 2006 |
Methods for delivering DNA to muscle cells using recombinant
adeno-associated virus virions vectors
Abstract
The use of recombinant adeno-associated virus (AAV) virions for
delivery of DNA molecules to muscle cells and tissue is disclosed.
The invention allows for the direct, in vivo injection of
recombinant AAV virions into muscle tissue, e.g., by intramuscular
injection, as well as for the in vitro transduction of muscle cells
which can subsequently be introduced into a subject for treatment.
The invention provides for sustained, high-level expression of the
delivered gene and for in vivo secretion of the therapeutic protein
from transduced muscle cells such that systemic delivery is
achieved.
Inventors: |
Podsakoff; Gregory M.;
(Fullerton, CA) ; Kessler; Paul D.; (Baltimore,
MD) ; Byrne; Barry J.; (Baltimore, MD) ;
Kurtzman; Gary J.; (Menlo Park, CA) |
Correspondence
Address: |
ROBINS & PASTERNAK LLP
1731 EMBARCADERO ROAD
SUITE 230
PALO ALTO
CA
94303
US
|
Family ID: |
27080262 |
Appl. No.: |
11/303896 |
Filed: |
December 15, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10445088 |
May 23, 2003 |
|
|
|
11303896 |
Dec 15, 2005 |
|
|
|
09969204 |
Oct 1, 2001 |
6610290 |
|
|
10445088 |
May 23, 2003 |
|
|
|
09406362 |
Sep 28, 1999 |
6335011 |
|
|
09969204 |
Oct 1, 2001 |
|
|
|
08784757 |
Jan 16, 1997 |
5962313 |
|
|
09406362 |
Sep 28, 1999 |
|
|
|
08588355 |
Jan 18, 1996 |
5858351 |
|
|
08784757 |
Jan 16, 1997 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/456 |
Current CPC
Class: |
C07K 14/505 20130101;
C12Y 302/0102 20130101; A01K 2217/05 20130101; C12N 2750/14143
20130101; A61K 48/00 20130101; C12Y 302/01023 20130101; A61K
38/1816 20130101; C12N 15/86 20130101; C12N 2840/44 20130101; A61K
48/0075 20130101; C12N 9/2408 20130101; C12N 2799/025 20130101;
C12N 2830/42 20130101; A61K 38/47 20130101 |
Class at
Publication: |
424/093.2 ;
435/456 |
International
Class: |
A61K 48/00 20060101
A61K048/00; C12N 15/861 20060101 C12N015/861 |
Claims
1. A method of delivering a selected gene to a muscle cell or
tissue, said method comprising: (a) providing a recombinant
adeno-associated virus (AAV) virion which comprises an AAV vector,
said AAV vector comprising said selected gene operably linked to
control elements capable of directing the in vivo transcription and
translation of said selected gene; and (b) introducing said
recombinant AAV virion into said muscle cell or tissue.
2. The method of claim 1, wherein said muscle cell or tissue is
derived from skeletal muscle.
3. The method of claim 1, wherein said muscle cell or tissue is
derived from smooth muscle.
4. The method of claim 1, wherein said muscle cell or tissue is
derived from cardiac muscle.
5. The method of claim 1, wherein said muscle cell is a skeletal
myoblast.
6. The method of claim 1, wherein said muscle cell is a skeletal
myocyte.
7. The method of claim 1, wherein said muscle dell is a
cardiomyocyte.
8. The method of claim 1, wherein said recombinant AAV virion is
introduced into said muscle cell in vivo.
9. The method of claim 8, wherein said recombinant AAV virion is
introduced by intramuscular injection.
10. The method of claim 1, wherein said recombinant AAV virion is
introduced into said muscle cell in vitro.
11. The method of claim 1, wherein said selected gene encodes a
therapeutic protein.
12. The method of claim 11, wherein said protein is acid
.alpha.-glucosidase.
13. A muscle cell or tissue transduced with a recombinant AAV
virion which comprises an AAV vector, said AAV vector comprising a
selected gene operably linked to control elements capable of
directing the in vivo transcription and translation of said
selected gene.
14. The muscle cell of claim 13, wherein said cell is a skeletal
myoblast.
15. The muscle cell of claim 13, wherein said cell is a skeletal
myocyte.
16. The muscle cell of claim 13, wherein said cell is a
cardiomyocyte.
17. The muscle cell of claim 13, wherein said selected gene encodes
a therapeutic protein.
18. The muscle cell of claim 17, wherein said selected gene encodes
acid .alpha.-glucosidase.
19. A method of treating an acquired or inherited disease in a
mammalian subject comprising introducing into a muscle cell or
tissue of said subject a therapeutically effective amount of a
pharmaceutical composition which comprises (a) a pharmaceutically
acceptable excipient; and (b) recombinant AAV virions, wherein said
recombinant AAV virions comprise an AAV vector, said AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of said
selected gene when present in said subject, wherein said
introducing is done in vivo.
20. A method of treating an acquired or inherited disease in a
mammalian subject comprising: (a) introducing a recombinant AAV
virion into a muscle cell or tissue in vitro to produce a
transduced muscle cell, wherein said recombinant AAV virion
comprises an AAV vector, said AAV vector comprising a selected gene
operably linked to control elements capable of directing the
transcription and translation of said selected gene when present in
said subject; and (b) administering to said subject a
therapeutically effective amount of a composition comprising a
pharmaceutically acceptable excipient and the transduced muscle
cells from step (a).
21. A method for delivering a therapeutically effective amount of a
protein systemically to a mammalian subject comprising introducing
into a muscle dell or tissue of said subject a pharmaceutical
composition which comprises (a) a pharmaceutically acceptable
excipient; and (b) recombinant AAV virions, wherein said
recombinant AAV virions comprise an AAV vector, said AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of said
selected gene when present in said subject, wherein said
introducing is done in vivo.
22. A method for delivering a therapeutically effective amount of a
protein systemically to a mammalian subject comprising: (a)
introducing a recombinant AAV virion into a muscle cell or tissue
in vitro to produce a transduced muscle cell, wherein said
recombinant AAV virion comprises an AAV vector, said AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of said
selected gene when present in said subject; and (b) administering
to said subject a therapeutically effective amount of a composition
comprising a pharmaceutically acceptable excipient and the
transduced muscle cells from step (a).
23. An adeno-associated virus (AAV) vector comprising a gene
encoding acid .alpha.-glucosidase operably linked to control
elements capable of directing the in vivo transcription and
translation of said gene.
24. A recombinant adeno-associated virus (AAV) virion which
comprises the AAV vector of claim 23.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of pending U.S.
application Ser. No. 10/445,088, filed May 23, 2003, which is a
continuation of U.S. application Ser. No. 09/969,204, filed Oct. 1,
2001 (U.S. Pat. No. 6,610,290), which is a continuation of U.S.
application Ser. No. 09/406,362, filed Sep. 28, 1999 (U.S. Pat. No.
6,335,011), which is a continuation of U.S. application Ser. No.
08/784,757, filed Jan. 16, 1997 (U.S. Pat. No. 5,962,313), which is
a continuation-in-part of U.S. application Ser. No. 08/588,355,
filed Jan. 18, 1996 (U.S. Pat. No. 5,858,351), from which priority
is claimed pursuant to 35 USC .sctn.120 and which applications are
incorporated herein by reference in their entireties.
TECHNICAL FIELD
[0002] The present invention relates generally to DNA delivery
methods. More particularly, the invention relates to the use of
recombinant adeno-associated virus (AAV) virions for delivery of a
selected gene to muscle cells and tissue. The method provides for
sustained, high-level expression of the delivered gene.
BACKGROUND OF THE INVENTION
[0003] Gene delivery is a promising method for the treatment of
acquired and inherited diseases. Muscle tissue is an appealing gene
delivery target because it is readily accessible,
well-differentiated and nondividing. Barr and Leiden (1991) Science
254:1507-1509. These properties are important in the selection of
appropriate delivery strategies to achieve maximal gene
transfer.
[0004] Several experimenters have demonstrated the ability to
deliver genes to muscle cells with the subsequent systemic
circulation of proteins encoded by the delivered genes. See, e.g.,
Wolff et al. (1990) Science 247:1465-1468; Acsadi et al. (1991)
Nature 352:815-818; Barr and Leiden (1991) Science 254:1507-1509;
Dhawan et al. (1991) Science 254:1509-1512; Wolff et al. (1992)
Human Mol. Genet. 1:363-369; Eyal et al. (1993) Proc. Natl. Acad.
Sci. USA 90:4523-4527; Davis et al. (1993) Hum. Gene Therapy
4:151-159.
[0005] Genes have been delivered to muscle by direct injection of
plasmid DNA, such as described by Wolff et al. (1990) Science
247:1465-1468; Acsadi et al. (1991) Nature 352:815-818; Barr and
Leiden (1991) Science 254:1507-1509. However, this mode of
administration generally results in sustained but low levels of
expression. Low but sustained expression levels may be effective in
certain situations, such as for providing immunity.
[0006] Viral based systems have also been used for gene delivery to
muscle. For example, human adenoviruses are double-stranded DNA
viruses which enter cells by receptor-mediated endocytosis. These
viruses have been considered well suited for gene transfer because
they are easy to grow and manipulate and they exhibit a broad host
range in vivo and in vitro. Adenoviruses are able to infect
quiescent as well as replicating target cells and persist
extrachromosomally, rather than integrating into the host
genome.
[0007] Despite these advantages, adenovirus vectors suffer from
several drawbacks which make them ineffective for long term gene
therapy. In particular, adenovirus vectors express viral proteins
that may elicit an immune response which may decrease the life of
the transduced cell. This immune reaction may preclude subsequent
treatments because of humoral and/or T cell responses. Furthermore,
the adult muscle cell may lack the receptor which recognizes
adenovirus vectors, precluding efficient transduction of this cell
type using such vectors. Thus, attempts to use adenoviral vectors
for the delivery of genes to muscle cells has resulted in poor
and/or transitory expression. See, e.g., Quantin et al. (1992)
Proc. Natl. Acad. Sci. USA 89:2581-2584; Acsadi et al. (1994) Hum.
Mol. Genetics 3:579-584; Acsadi et al. (1994) Gene Therapy
1:338-340; Dai et al. (1995) Proc. Natl. Acad. Sci. USA
92:1401-1405; Descamps et al. (1995) Gene Therapy 2:411-417;
Gilgenkrantz et al. (1995) Hum. Gene Therapy 6:1265-1274.
[0008] Gene therapy methods based upon surgical transplantation of
myoblasts has also been attempted. See, e.g., International
Publication no. WO 95/13376; Dhawan et al. (1991) Science
254:1509-1512; Wolff et al. (1992) Human Mol. Genet. 1:363-369; Dai
et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hamamori
et al. (1994) Hum. Gene Therapy 5:1349-1356; Hamamori et al. (1995)
J. Clin. Invest. 95:1808-1813; Blau and Springer (1995) New Eng. J.
Med. 333:1204-1207; Leiden, J. M. (1995) New Eng. J. Med.
333:871-872; Mendell et al. (1995) New Eng. J. Med. 333:832-838;
and Blau and Springer (1995) New Eng. J. Med. 333:1554-1556.
However, such methods require substantial tissue culture
manipulation and surgical expertise, and, at best, show
inconclusive efficacy in clinical trials. Thus, a simple and
effective method of gene delivery to muscle, resulting in long-term
expression of the delivered gene, would be desirable.
[0009] Recombinant vectors derived from an adeno-associated virus
(AAV) have been used for gene delivery. AAV is a helper-dependent
DNA parvovirus which belongs to the genus Dependovirus. AAV
requires infection with an unrelated helper virus, such as
adenovirus, a herpesvirus or vaccinia, in order for a productive
infection to occur. The helper virus supplies accessory functions
that are necessary for most steps in AAV replication. In the
absence of such infection, AAV establishes a latent state by
insertion of its genome into a host cell chromosome. Subsequent
infection by a helper virus rescues the integrated copy which can
then replicate to produce infectious viral progeny. AAV has a wide
host range and is able to replicate in cells from any species so
long as there is also a successful infection of such cells with a
suitable helper virus. Thus, for example, human AAV will replicate
in canine cells coinfected with a canine adenovirus. AAV has not
been associated with any human or animal disease and does not
appear to alter the biological properties of the host cell upon
integration. For a review of AAV, see, e.g., Berns and Bohenzky
(1987) Advances in Virus Research (Academic Press, Inc.)
32:243-307.
[0010] The AAV genome is composed of a linear, single-stranded DNA
molecule which contains approximately 4681 bases (Berns and
Bohenzky, supra). The genome includes inverted terminal repeats
(ITRs) at each end which function in cis as origins of DNA
replication and as packaging signals for the virus. The internal
nonrepeated portion of the genome includes two large open reading
frames, known as the AAV rep and cap regions, respectively. These
regions code for the viral proteins involved in replication and
packaging of the virion. For a detailed description of the AAV
genome, see, e.g., Muzyczka, N. (1992) Current Topics in Microbiol.
and Immunol. 158:97-129.
[0011] The construction of recombinant AAV (rAAV) virions has been
described. See, e.g., U.S. Pat. Nos. 5,173,414 and 5,139,941;
International Publication Numbers WO 92/01070 (published 23 Jan.
1992) and WO 93/03769 (published 4 Mar. 1993); Lebkowski et al.
(1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990)
Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J.
(1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N.
(1992) Current Topics in Microbiol. and Immunol. 158:97-129; and
Kotin, R. M. (1994) Human Gene Therapy 5:793-801.
[0012] Recombinant AAV virion production generally involves
cotransfection of a producer cell with an AAV vector plasmid and a
helper construct which provides AAV helper functions to complement
functions missing from the. AAV vector plasmid. In this manner, the
producer cell is capable of expressing the AAV proteins necessary
for AAV replication and packaging. The AAV vector plasmid will
include the DNA of interest flanked by AAV ITRs which provide for
AAV replication and packaging functions. AAV helper functions can
be provided via an AAV helper plasmid that includes the AAV rep
and/or cap coding regions but which lacks the AAV ITRs.
Accordingly, the helper plasmid can neither replicate nor package
itself. The producer cell is then infected with a helper virus to
provide accessory functions, or with a vector which includes the
necessary accessory functions. The helper virus transactivates the
AAV promoters present on the helper plasmid that direct the
transcription and translation of AAV rep and cap regions. Upon
subsequent culture of the producer cells, recombinant AAV virions
harboring the DNA of interest, are produced.
[0013] Recombinant AAV virions have been shown to exhibit tropism
for respiratory epithelial cells (Flotte et al. (1992) Am. J.
Respir. Cell Mol. Biol. 7:349-356; Flotte et al. (1993) J. Biol.
Chem. 268:3781-3790; Flotte et al. (1993) Proc. Natl. Acad. Sci.
USA 90:10613-10617) and neurons of the central nervous system
(Kaplitt et al. (1994) Nature Genetics 8:148-154). These cell types
are well-differentiated, slowly-dividing or postmitotic. Flotte et
al. (1993) Proc. Natl. Acad. Sci. USA 90:10613-10617; Kaplitt et
al. (1994) Nature Genetics 8:148-154. The ability of AAV vectors to
transduce nonproliferating cells (Podsakoff et al. (1994) J. Virol.
68:5656-5666; Russell et al. (1994) Proc. Natl. Acad. Sci. USA
91:8915-8919; Flotte et al. (1994) Am. J. Respir. Cell Mol. Biol.
11:517-521) along with the attributes of being inherently defective
and nonpathogenic, place AAV in a unique position among gene
therapy viral vectors.
[0014] Despite these advantages, the use of recombinant AAV virions
to deliver genes to muscle cells in vivo has not heretofore been
disclosed.
SUMMARY OF THE INVENTION
[0015] Accordingly, the present invention is based on the
surprising and unexpected discovery that recombinant AAV (rAAV)
virions provide for efficient delivery of genes and sustained
production of therapeutic proteins in various muscle cell types.
The invention allows for in vivo secretion of the therapeutic
protein from transduced muscle cells such that systemic delivery of
therapeutic levels of the protein is achieved. These results are
seen with both in vivo and in vitro modes of DNA delivery. Hence,
rAAV virions allow delivery of DNA directly to muscle tissue. The
ability to deliver and express genes in muscle cells, as well as to
provide for secretion of the produced protein from transduced
cells, allows the use of gene therapy approaches to treat and/or
prevent a wide variety of disorders.
[0016] Furthermore, the ability to deliver DNA to muscle cells by
intramuscular administration in vivo provides a more efficient and
convenient method of gene transfer.
[0017] Thus, in one embodiment, the invention relates to a method
of delivering a selected gene to a muscle cell or tissue. The
method comprises:
[0018] (a) providing a recombinant AAV virion which comprises an
AAV vector, the AAV vector comprising the selected gene operably
linked to control elements capable of directing the in vivo
transcription and translation of the selected gene; and
[0019] (b) introducing the recombinant AAV virion into the muscle
cell or tissue.
[0020] In particularly preferred embodiments, the selected gene
encodes a therapeutic protein, such as erythropoietin (EPO), or the
lysosomal enzyme, acid .alpha.-glucosidase (GAA).
[0021] In another embodiment, the invention is directed to a muscle
cell or tissue transduced with a recombinant AAV virion which
comprises an AAV vector, the AAV vector comprising a selected gene
operably linked to control elements capable of directing the in
vivo transcription and translation of the selected gene.
[0022] In still further embodiments, the invention is directed to a
method of treating an acquired or inherited disease in a mammalian
subject comprising introducing into a muscle cell or tissue of the
subject, in vivo, a therapeutically effective amount of a
pharmaceutical composition which comprises (a) a pharmaceutically
acceptable excipient; and (b) recombinant AAV virions. The
recombinant AAV virions comprise an AAV vector, the AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of the
selected gene when present in the subject.
[0023] In yet another embodiment, the invention is directed to a
method of treating an acquired or inherited disease in a mammalian
subject comprising:
[0024] (a) introducing a recombinant AAV virion into a muscle cell
or tissue in vitro to produce a transduced muscle cell. The
recombinant AAV virion comprises an AAV vector, the AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of the
selected gene when present in the subject; and
[0025] (b) administering to the subject a therapeutically effective
amount of a composition comprising a pharmaceutically acceptable
excipient and the transduced muscle cells from step (a).
[0026] In a further embodiment, the invention relates to a method
for delivering a therapeutically effective amount of a protein
systemically to a mammalian subject comprising introducing into a
muscle cell or tissue of the subject a pharmaceutical composition
which comprises (a) a pharmaceutically acceptable excipient; and
(b) recombinant AAV virions, wherein the recombinant AAV virions
comprise an AAV vector, the AAV vector comprising a selected gene
operably linked to control elements capable of directing the
transcription and translation of the selected gene when present in
the subject, wherein the introducing is done in vivo.
[0027] In another embodiment, the invention is directed to a method
for delivering a therapeutically effective amount of a protein
systemically to a mammalian subject comprising:
[0028] (a) introducing a recombinant AAV virion into a muscle cell
or tissue in vitro to produce a transduced muscle cell, wherein the
recombinant AAV virion comprises an AAV vector, the AAV vector
comprising a selected gene operably linked to control elements
capable of directing the transcription and translation of the
selected gene when present in the subject; and
[0029] (b) administering to the subject a therapeutically effective
amount of a composition comprising a pharmaceutically acceptable
excipient and the transduced muscle cells from step (a).
[0030] In other embodiments, the invention is directed to an AAV
vector comprising a gene encoding either erythropoietin (EPO), or
acid .alpha.-glucosidase (GAA), operably linked to control elements
capable of directing the in vivo transcription and translation of
the gene, as well as a recombinant AAV (rAAV) virion comprising the
vector.
[0031] These and other embodiments of the subject invention will
readily occur to those of ordinary skill in the art in view of the
disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
[0032] FIG. 1 shows in situ histochemical detection of
.beta.-galactosidase expression in murine muscle cells following
transduction with rAAV-LacZ as described in Example 3, Part A. In
the study, the tibialis anterior muscle of adult Balb/c mice was
injected with 8.times.10.sup.9 rAAV-LacZ. Animals were sacrificed
(a) 2, (b) 4, (c) 8, (d) 12, (e) 24, of (f) 32 weeks after
injection. The tibialis anterior was excised, and 10 mm sections
were stained by X-gal for .beta.-galactosidase histochemistry. The
stained tissue samples were photographed at 25.times..
[0033] FIG. 2 shows a section of skeletal muscle two months after
injection with rAAV-LacZ as described in Example 3, Part A. The
tibialis anterior muscle was processed for in situ detection of
.beta.-galactosidase expression, and photographed with
diffraction-interference contrast optics at 400.times..
[0034] FIG. 3 depicts .beta.-galactosidase expression in Balb/c
mice tibialis anterior muscle transduced in vivo with rAAV-LacZ as
described in Example 3, Part B. Adult Balb/c mice were injected
intramuscularly (IM) with various doses of rAAV-LacZ. At 2 and 8
weeks post injection, tissue was harvested for analysis of
beta-galactosidase (.beta.-gal). .beta.-gal expression was analyzed
by measurement of relative light units (RLU) emitted from muscle
homogenates, as detected by luminometer.
[0035] FIG. 4 shows the secretion of human erythropoietin (hEPO)
from transduced myotubes and myoblasts, as described in Example 4.
Myotubes (differentiated cells) or myoblasts (actively dividing
cells) were transduced with rAAV-hEPO at a ratio of approximately
10.sup.5 per target cell. Levels of secreted hEPO were analyzed in
supernatants at various time points. Baseline levels of hEPO prior
to transduction were below the level of detection in both cell
populations; the values at each time point represent replicate
values .+-.standard deviation.
[0036] FIG. 5 shows the secretion of human erythropoietin (hEPO) by
C2C12 myotubes transduced with rAAV-hEPO as described in Example 4.
Confluent C2C12 myoblasts were differentiated into myotubes and
transduced with 3.times.10.sup.8 (open bar), 3.times.10.sup.9
(cross-hatched bar), or 3.times.10.sup.10 (solid bar) rAAV-hEPO.
Secretion of EPO was measured 3, 8, and 14 days after transduction.
Control rAAV-LacZ myotubes secreted <2.5 mU/mL EPO. The bar
graph depicts mean production of EPO/well/24 hour as determined in
triplicate cultures .+-.the standard error of mean (SEM).
[0037] FIG. 6 shows the secretion of human erythropoietin (hEPO) by
primary human myotubes transduced with rAAV-hEPO as described in
Example 5. Confluent human myoblasts were differentiated into
myotubes by culture for 14 days in reduced-serum media, then
transduced with 3.times.10.sup.8 (open bar), 3.times.10.sup.9
(cross-hatched bar), or 3.times.10.sup.10 (solid bar) rAAV-hEPO.
Secretion of EPO was measured 3, 8 and 14 days after transduction.
Control myotubes transduced with rAAV-LacZ secreted <2.5 mU/mL
EPO. The bar graph depicts mean production of EPO/well/24 hour as
determined in triplicate cultures .+-.SEM.
[0038] FIG. 7 depicts the time course of EPO secretion in Balb/c
mice after IM injection with rAAV-hEPO. Adult Balb/c mice were
injected IM with 1.times.10.sup.10 (), 3.times.10.sup.10
(.tangle-solidup.), 1.times.10.sup.11 (.box-solid.), or
3.times.10.sup.11 (.circle-solid.) purified rAAV-LacZ at day=0, and
serum EPO levels measured at various time points after injection.
Reported values represent means (n=4) .+-.SEM.
[0039] FIG. 8 shows high level expression of acid
.alpha.-glucosidase (GAA) in human skeletal muscle transduced in
vitro with rAAV-hGAA as described in Example 8, Part A. In the
study, differentiated human myoblasts were exposed to rAAV-hGAA
virions at a MOI of 2.times.10.sup.5. Cells were collected at the
time points indicated, and GAA activity measured by enzymatic
assay. Non-transduced control cells (open bar) and cells transduced
with rAAV-LacZ (cross-hatched bar) showed no significant expression
of GAA, while cells transduced with rAAV-hGAA (solid bar) showed
high levels of GAA activity. The bar graph represents mean GAA
activity determined in triplicate cultures .+-.SEM.
[0040] FIG. 9 shows expression of acid .alpha.-glucosidase in
Balb/c mice tibialis anterior muscle cells that were transduced in
vivo with rAAV-hGAA, as described in Example 8, Part B. Adult
Balb/c mice were injected intramuscularly (IM) with
4.times.10.sup.10 rAAV-hGAA (solid bar) or the same dose of
rAAV-LacZ (open bar). At various time points after injection,
muscle tissue was harvested for analysis of GAA activity by
enzymatic assay. The bar graph shows mean GAA activity determined
in five animals (weeks 1 and 4), or in four animals (week 10)
.+-.SEM.
DETAILED DESCRIPTION OF THE INVENTION
[0041] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of virology,
microbiology, molecular biology and recombinant DNA techniques
within the skill of the art. Such techniques are explained fully in
the literature. See, e.g., Sambrook, et al. Molecular Cloning: A
Laboratory Manual (Current Edition); DNA Cloning: A Practical
Approach, vol. I & II (D. Glover, ed.); Oligonucleotide
Synthesis (N. Gait, ed., Current Edition); Nucleic Acid
Hybridization (B. Hames & S. Higgins, eds., Current Edition);
Transcription and Translation (B. Hames & S. Higgins, eds.,
Current Edition); CRC Handbook of Parvoviruses, vol. I & II (P.
Tijssen, ed.); Fundamental Virology, 2nd Edition, vol. I & II
(B. N. Fields and D. M. Knipe, eds.)
[0042] All publications, patents and patent applications cited
herein, whether supra or infra, are hereby incorporated by
reference in their entirety.
[0043] As used in this specification and the appended claims, the
singular forms "a," "an" and "the" include plural references unless
the content clearly dictates otherwise.
A. Definitions
[0044] In describing the present invention, the following terms
will be employed, and are intended to be defined as indicated
below.
[0045] The phrase "gene delivery" or "gene transfer" refers to
methods or systems for reliably inserting foreign DNA into target
cells, such as into muscle cells. Such methods can result in
transient or long term expression of genes. Gene transfer provides
a unique approach for the treatment of acquired and inherited
diseases. A number of systems have been developed for gene transfer
into mammalian cells. See, e.g., U.S. Pat. No. 5,399,346.
[0046] The term "therapeutic protein" refers to a protein which is
defective or missing from the subject in question, thus resulting
in a disease state or disorder in the subject, or to a protein
which confers a benefit to the subject in question, such as an
antiviral, antibacterial or antitumor function. A therapeutic
protein can also be one which modifies any one of a wide variety of
biological functions, such as endocrine, immunological and
metabolic functions. Representative therapeutic proteins are
discussed more fully below.
[0047] By "vector" is meant any genetic element, such as a plasmid,
phage, transposon, cosmid, chromosome, virus, virion, etc., which
is capable of replication when associated with the proper control
elements and which can transfer gene sequences between cells. Thus,
the term includes cloning and expression vehicles, as well as viral
vectors.
[0048] By "AAV vector" is meant a vector derived from an
adeno-associated virus serotype, including without limitation,
AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. AAV vectors can have
one or more of the AAV wild-type genes deleted in whole or part,
preferably the rep and/or cap genes (described below), but retain
functional flanking ITR sequences (also described below).
Functional ITR sequences are necessary for the rescue, replication
and packaging of the AAV virion. Thus, an AAV vector is defined
herein to include at least those sequences required in cis for
replication and packaging (e.g., functional ITRs) of the virus. The
ITRs need not be the wild-type nucleotide sequences, and may be
altered, e.g., by the insertion, deletion or substitution of
nucleotides, so long as the sequences provide for functional
rescue, replication and packaging.
[0049] By "recombinant virus" is meant a virus that has been
genetically altered, e.g., by the addition or insertion of a
heterologous nucleic acid construct into the particle.
[0050] By "AAV virion" is meant a wild-type (wt) AAV virus particle
(comprising a linear, single-stranded AAV nucleic acid genome
associated with an AAV capsid protein coat). In this regard,
single-stranded AAV nucleic acid molecules of either complementary
sense, e.g., "sense" or "antisense" strands, can be packaged into
any one AAV virion and both strands are equally infectious.
[0051] A "recombinant AAV virion," or "rAAV virion" is defined
herein as an infectious, replication-defective virus composed of an
AAV protein shell, encapsidating a DNA molecule of interest which
is flanked on both sides by AAV ITRs. An rAAV virion is produced in
a suitable producer cell which has had an AAV vector, AAV helper
functions and accessory functions introduced therein. In this
manner, the producer cell is rendered capable of encoding AAV
polypeptides that are required for packaging the AAV vector
(containing a recombinant nucleotide sequence of interest) into
recombinant virion particles for subsequent gene delivery.
[0052] The term "transfection" is used to refer to the uptake of
foreign DNA by a mammalian cell. A cell has been "transfected" when
exogenous DNA has been introduced inside the cell membrane. A
number of transfection techniques are known in the art. See, e.g.,
Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989)
Molecular Cloning, a laboratory manual, Cold Spring Harbor
Laboratories, New York, Davis et al. (1986) Basic Methods in
Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13:197.
Such techniques can be used to introduce one or more exogenous DNA
moieties, such as a plasmid vector and other nucleic acid
molecules, into suitable cells. The term refers to both stable and
transient uptake of the genetic material.
[0053] The term "transduction" denotes the delivery of a DNA
molecule to a recipient cell either in vivo or in vitro, via a
replication-defective viral vector, such as via a recombinant AAV
virion.
[0054] By "muscle cell" or "tissue" is meant a cell or group of
cells derived from muscle, including but not limited to cells and
tissue derived from skeletal muscle; smooth muscle, e.g., from the
digestive tract, urinary bladder and blood vessels; and cardiac
muscle. The term captures muscle cells both in vitro and in vivo.
Thus, for example, an isolated cardiomyocyte would constitute a
"muscle cell" for purposes of the present invention, as would a
muscle cell as it exists in muscle tissue present in a subject in
vivo. The term also encompasses both differentiated and
nondifferentiated muscle cells, such as myocytes, myotubes,
myoblasts, cardiomyocytes and cardiomyoblasts.
[0055] The term "heterologous" as it relates to nucleic acid
sequences such as gene sequences and control sequences, denotes
sequences that are not normally joined together, and/or are not
normally associated with a particular cell. Thus, a "heterologous"
region of a nucleic acid construct or a vector is a segment of
nucleic acid within or attached to another nucleic acid molecule
that is not found in association with the other molecule in nature.
For example, a heterologous region of a nucleic acid construct
could include a coding sequence flanked by sequences not found in
association with the coding sequence in nature. Another example of
a heterologous coding sequence is a construct in which the coding
sequence itself is not found in nature (e.g., synthetic sequences
having codons different from the native gene). Similarly, a cell
transformed with a construct which is not normally present in the
cell would be considered heterologous for purposes of this
invention. Allelic variation or naturally occurring mutational
events do not give rise to heterologous DNA, as used herein.
[0056] By "DNA" is meant a polymeric form of deoxyribonucleotides
(adenine, guanine, thymine, or cytosine) in double-stranded or
single-stranded form, either relaxed and supercoiled. This term
refers only to the primary and secondary structure of the molecule,
and does not limit it to any particular tertiary forms. Thus, this
term includes single- and double-stranded DNA found, inter alia, in
linear DNA molecules (e.g., restriction fragments), viruses,
plasmids, and chromosomes. In discussing the structure of
particular DNA molecules, sequences may be described herein
according to the normal convention of giving only the sequence in
the 5' to 3' direction along the nontranscribed strand of DNA
(i.e., the strand having the sequence homologous to the mRNA). The
term captures molecules that include the four bases adenine,
guanine, thymine, or cytosine, as well as molecules that include
base analogues which are known in the art.
[0057] A "gene" or "coding sequence" or a sequence which "encodes"
a particular protein, is a nucleic acid molecule which is
transcribed (in the case of DNA) and translated (in the case of
mRNA) into a polypeptide in vitro or in vivo when placed under the
control of appropriate regulatory sequences. The boundaries of the
gene are determined by a start codon at the 5' (amino) terminus and
a translation stop codon at the 3' (carboxy) terminus. A gene can
include, but is not limited to, cDNA from prokaryotic or eukaryotic
mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and
even synthetic DNA sequences. A transcription termination sequence
will usually be located 3' to the gene sequence.
[0058] The term "control elements" refers collectively to promoter
regions, polyadenylation signals, transcription termination
sequences, upstream regulatory domains, origins of replication,
internal ribosome entry sites ("IRES"), enhancers, and the like,
which collectively provide for the replication, transcription and
translation of a coding sequence in a recipient cell. Not all of
these control elements need always be present so long as the
selected coding sequence is capable of being replicated,
transcribed and translated in an appropriate host cell.
[0059] The term "promoter region" is used herein in its ordinary
sense to refer to a nucleotide region comprising a DNA regulatory
sequence, wherein the regulatory sequence is derived from a gene
which is capable of binding RNA polymerase and initiating
transcription of a downstream (3'-direction) coding sequence.
[0060] "Operably linked" refers to an arrangement of elements
wherein the components so described are configured so as to perform
their usual function. Thus, control elements operably linked to a
coding sequence are capable of effecting the expression of the
coding sequence. The control elements need not be contiguous with
the coding sequence, so long as they function to direct the
expression thereof. Thus, for example, intervening untranslated yet
transcribed sequences can be present between a promoter sequence
and the coding sequence and the promoter sequence can still be
considered "operably linked" to the coding sequence.
[0061] For the purpose of describing the relative position of
nucleotide sequences in a particular nucleic acid molecule
throughout the instant application, such as when a particular
nucleotide sequence is described as being situated "upstream,"
"downstream," "3'," or "5'" relative to another sequence, it is to
be understood that it is the position of the sequences in the
"sense" or "coding" strand of a DNA molecule that is being referred
to as is conventional in the art.
[0062] "Homology" refers to the percent of identity between two
polynucleotide or two polypeptide moieties. The correspondence
between the sequence from one moiety to another can be determined
by techniques known in the art. For example, homology can be
determined by a direct comparison of the sequence information
between two polypeptide molecules by aligning the sequence
information and using readily available computer programs.
Alternatively, homology can be determined by hybridization of
polynucleotides under conditions which form stable duplexes between
homologous regions, followed by digestion with
single-stranded-specific nuclease(s), and size determination of the
digested fragments. Two DNA, or two polypeptide sequences are
"substantially homologous" to each other when at least about 80%,
preferably at least about 90%, and most preferably at least about
95% of the nucleotides or amino acids match over a defined length
of the molecules, as determined using the methods above.
[0063] By "mammalian subject" is meant any member of the class
Mammalia including, without limitation, humans and nonhuman
primates such as chimpanzees and other apes and monkey species;
farm animals such as cattle, sheep, pigs, goats and horses;
domestic mammals such as dogs and cats; laboratory animals
including rodents such as mice, rats and guinea pigs, and the like.
The term does not denote a particular age or sex. Thus, adult and
newborn subjects, as well as fetuses, whether male or female, are
intended to be covered.
B. General Methods
[0064] The present invention provides for the successful transfer
of a selected gene to a muscle cell using recombinant AAV virions.
The method allows for the direct, in vivo injection of recombinant
AAV virions into muscle tissue, e.g., by intramuscular injection,
as well as for the in vitro transduction of muscle cells which can
subsequently be introduced into a subject for treatment. The
invention also provides for secretion of the produced protein in
vivo, from transduced muscle cells, such that systemic delivery can
be achieved.
[0065] Muscle provides a desirable target for gene therapy since
muscle cells are readily accessible and nondividing. However, the
present invention also finds use with nondifferentiated muscle
cells, such as myoblasts, which can be transduced in vitro, and
subsequently introduced into a subject.
[0066] Since muscle has ready access to the circulatory system, a
protein produced and secreted by muscle cells and tissue in vivo
will enter the bloodstream for systemic delivery. Furthermore,
since sustained, therapeutic levels of protein secretion from
muscle is achieved in vivo using the present invention, repeated
parenteral delivery is avoided or reduced in frequency such that
therapy can be accomplished using only one or few injections. Thus,
the present invention provides significant advantages over prior
gene delivery methods.
[0067] The recombinant AAV virions of the present invention,
including the DNA of interest, can be produced using standard
methodology, known to those of skill in the art. The methods
generally involve the steps of (1) introducing an AAV expression
vector into a producer cell; (2) introducing an AAV helper
construct into the producer cell, where the helper construct
includes AAV coding regions capable of being expressed in the
producer cell to complement AAV helper functions missing from the
AAV vector; (3) introducing one or more helper viruses and/or
accessory function vectors into the producer cell, wherein the
helper virus and/or accessory function vectors provide accessory
functions capable of supporting efficient recombinant AAV ("rAAV")
virion production in the cell; and (4) culturing the producer cell
to produce rAAV virions. The AAV expression vector, AAV helper
construct and the helper virus or accessory function vector(s) can
be introduced into the producer cell, either simultaneously or
serially, using standard transfection techniques.
1. AAV Expression Vectors
[0068] AAV expression vectors are constructed using known
techniques to at least provide as operatively linked components in
the direction of transcription, control elements including a
transcriptional initiation region, the DNA of interest and a
transcriptional termination region. The control elements are
selected to be functional in a mammalian muscle cell. The resulting
construct which contains the operatively linked components is
bounded (5' and 3') with functional AAV ITR sequences.
[0069] The nucleotide sequences of AAV ITR regions are known. See,
e.g., Kotin, R. M. (1994) Human Gene Therapy 5:793-801; Berns, K.
I. "Parvoviridae and their Replication" in Fundamental Virology,
2nd Edition, (B. N. Fields and D. M. Knipe, eds.) for the AAV-2
sequence. AAV ITRs used in the vectors of the invention need not
have a wild-type nucleotide sequence, and may be altered, e.g., by
the insertion, deletion or substitution of nucleotides.
Additionally, AAV ITRs may be derived from any of several AAV
serotypes, including without limitation, AAV-1, AAV-2, AAV-3,
AAV-4, AAV-5, AAVX7, etc. Furthermore, 5' and 3' ITRs which flank a
selected nucleotide sequence in an AAV expression vector need not
necessarily be identical or derived from the same AAV serotype or
isolate, so long as they function as intended, i.e., to allow for
packaging of virions.
[0070] Suitable DNA molecules for use in AAV vectors will be less
than about 5 kilobases (kb) in size and will include, for example,
a gene that encodes a protein that is defective or missing from a
recipient subject or a gene that encodes a protein having a desired
biological or therapeutic effect (e.g., an antibacterial, antiviral
or antitumor function).
[0071] Suitable DNA molecules include, but are not limited to,
those encoding for proteins used for the treatment of endocrine,
metabolic, hematologic, cardiovascular, neurologic,
musculoskeletal, urologic, pulmonary and immune disorders,
including such disorders as inflammatory diseases, autoimmune,
chronic and infectious diseases, such as AIDS, cancer,
hypercholestemia, insulin disorders such as diabetes, growth
disorders, various blood disorders including various anemias,
thalassemias and hemophilia; genetic defects such as cystic
fibrosis, Gaucher's Disease, Hurler's Disease, adenosine deaminase
(ADA) deficiency, emphysema, or the like.
[0072] To exemplify the invention, the gene encoding erythropoietin
(EPO) can be used. EPO is a glycoprotein hormone produced in fetal
liver and adult kidney which acts on progenitor cells in the bone
marrow and other hematopoietic tissue to stimulate the formation of
red blood cells. Genes encoding human and other mammalian EPO have
been cloned, sequenced and expressed, and show a high degree of
sequence homology in the coding region across species. Wen et al.
(1993) Blood 82:1507-1516. The sequence of the gene encoding native
human EPO, as well as methods of obtaining the same, are described
in, e.g., U.S. Pat. Nos. 4,954,437 and 4,703,008, incorporated
herein by reference in their entirety, as well as in Jacobs et al.
(1985) Nature 313:806-810; Lin et al. (1985) Proc. Natl. Acad. Sci.
USA 82:7580; International Publication Number WO 85/02610; and
European Patent Publication Number 232,034 B1. In addition, the
sequences of the genes encoding native feline, canine and porcine
EPO are known and readily available (GenBank Accession Nos.:
L10606; L13027; and L10607, respectively), and the sequence of the
gene encoding monkey (Macaca mulatta) is also known and available
(GenBank Accession No.: L10609). The term "EPO" as used herein
refers to the native, full-length secreted form of EPO, as well as
to analogs or derivatives thereof comprising single or multiple
amino acid substitutions, deletions or additions which retain EPO
function or activity. In this regard, a number of small peptides
have been identified which bind to and activate the receptor for
EPO. Wrighton et al. (1996) Science 273:458-463; Livnah et al.
(1996) Science 273:464-471. The recombinant AAV virions described
herein which include a gene encoding EPO, or encoding an analog or
derivative thereof having the same function, are particularly
useful in the treatment of blood disorders characterized by
defective red blood cell formation, such as in the treatment of
anemia. Increased red blood cell production due to the production
of EPO can be readily determined by an appropriate indicator, such
as by comparing hematocrit measurements pre- and post-treatment,
measuring increases in red blood cell count, hemoglobin
concentration, or in reticulocyte counts. As described above, the
EPO gene is flanked by AAV ITRs.
[0073] Alternatively, a nucleotide sequence encoding the lysosomal
enzyme acid .alpha.-glucosidase (GAA) can be used. GAA functions to
cleave .alpha.-1,4 and .alpha.-1,6 linkages of lysosomal glycogen
to release monosaccharides. The sequence of the gene encoding human
GAA, as well as methods of obtaining the same, have been previously
described (GenBank Accession Numbers: M34424 and Y00839; Martiniuk
et al. (1990) DNA Cell Biol. 9:85-94; Martiniuk et al. (1986) Proc.
Natl. Acad. Sci. USA 83:9641-9644; Hoefsloot et al. (1988) Eur.
Mol. Biol. Organ. 7:1697-1704). Thus, the recombinant AAV virions
described herein can include a nucleotide sequence encoding GAA, or
encoding an analog or derivative thereof having GAA activity.
[0074] The selected nucleotide sequence, such as EPO or another
gene of interest, is operably linked to control elements that
direct the transcription or expression thereof in the subject in
vivo. Such control elements can comprise control sequences normally
associated with the selected gene. Alternatively, heterologous
control sequences can be employed. Useful heterologous control
sequences generally include those derived from sequences encoding
mammalian or viral genes. Examples include, but are not limited to,
the SV40 early promoter; mouse mammary tumor virus LTR promoter;
adenovirus major late promoter (Ad MLP); herpes simplex virus (HSV)
promoters; a cytomegalovirus (CMV) promoter such as the CMV
immediate early promoter region (CMVIE); a rous sarcoma virus (RSV)
promoter; synthetic promoters; hybrid promoters; and the like. In
addition, sequences derived from nonviral genes, such as the murine
metallothionein gene, will also find use herein. Such promoter
sequences are commercially available from, e.g., Stratagene (San
Diego, Calif.).
[0075] For purposes of the present invention, control elements,
such as muscle-specific and inducible promoters, enhancers and the
like, will be of particular use. Such control elements include, but
are not limited to, those derived from the actin and myosin gene
families, such as from the myoD gene family (Weintraub et al.
(1991) Science 251:761-766); the myocyte-specific enhancer binding
factor MEF-2 (Cserjesi and Olson (1991) Mol. Cell Biol.
11:4854-4862); control elements derived from the human skeletal
actin gene (Muscat et al. (1987) Mol. Cell Biol. 7:4089-4099) and
the cardiac actin gene; muscle creatine kinase sequence elements
(Johnson et al. (1989) Mol. Cell Biol. 9:3393-3399) and the murine
creatine kinase enhancer (mCK) element; control elements derived
from the skeletal fast-twitch troponin C gene, the slow-twitch
cardiac troponin C gene and the slow-twitch troponin I gene;
hypoxia-inducible nuclear factors (Semenza et al. (1991) Proc.
Natl. Acad. Sci. USA 88:5680-5684; Semenza et al. J. Biol. Chem.
269:23757-23763); steroid-inducible elements and promoters, such as
the glucocorticoid response element (GRE) (Mader and White (1993)
Proc. Natl. Acad. Sci. USA 90:5603-5607); the fusion consensus
element for RU486 induction; elements that provide for tetracycline
regulated gene expression (Dhawan et al. (1995) Somat. Cell. Mol.
Genet. 21:233-240; Shockett et al. (1995) Proc. Natl. Acad. Sci.
USA 92:6522-6526; and inducible, synthetic humanized promoters
(Rivera et al. (1996) Nature Med. 2:1028-1032).
[0076] These and other regulatory elements can be tested for
potential in vivo efficacy using the in vitro myoblast model, which
mimics quiescent in vivo muscle physiology, described in the
examples below.
[0077] The AAV expression vector which harbors the DNA molecule of
interest bounded by AAV ITRs, can be constructed by directly
inserting the selected sequence(s) into an AAV genome which has had
the major AAV open reading frames ("ORFs") excised therefrom. Other
portions of the AAV genome can also be deleted, so long as a
sufficient portion of the-ITRs remain to allow for replication and
packaging functions. Such constructs can be designed using
techniques well known in the art. See, e.g., U.S. Pat. Nos.
5,173,414 and 5,139,941; International Publication Nos. WO 92/01070
(published 23 Jan. 1992) and WO 93/03769 (published 4 Mar. 1993);
Lebkowski et al. (1988) Molec. Cell. Biol. 8:3988-3996; Vincent et
al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press);
Carter, B. J. (1992) Current Opinion in Biotechnology 3:533-539;
Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol.
158:97-129; Kotin, R. M. (1994) Human Gene Therapy 5:793-801;
Shelling and Smith (1994) Gene Therapy 1:165-169; and Zhou et al.
(1.sub.994) J. Exp. Med. 179:1867-1875.
[0078] Alternatively, AAV ITRs can be excised from the viral genome
or from an AAV vector containing the same and fused 5' and 3' of a
selected nucleic acid construct that is present in another vector
using standard ligation techniques, such as those described in
Sambrook et al., supra. For example, ligations can be accomplished
in 20 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM DTT, 33 .mu.g/ml
BSA, 10 mM-50 mM NaCl, and either 40 .mu.M ATP, 0.01-0.02 (Weiss)
units T4 DNA ligase at 0.degree. C. (for "sticky end" ligation) or
1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14.degree. C. (for
"blunt end" ligation). Intermolecular "sticky end" ligations are
usually performed at 30-100 .mu.g/ml total DNA concentrations
(5-100 nM total end concentration). AAV vectors which contain ITRs
have been described in, e.g., U.S. Pat. No. 5,139,941. In
particular, several AAV vectors are described therein which are
available from the American Type Culture Collection ("ATCC") under
Accession Numbers 53222, 53223, 53224, 53225 and 53226.
[0079] Additionally, chimeric genes can be produced synthetically
to include AAV ITR sequences arranged 5' and 3' of one or more
selected nucleic acid sequences. Preferred codons for expression of
the chimeric gene sequence in mammalian muscle cells can be used.
The complete chimeric sequence is assembled from overlapping
oligonucleotides prepared by standard methods. See, e.g., Edge,
Nature (1981) 292:756; Nambair et al. Science (1984) 223:1299; Jay
et al. J. Biol. Chem. (1984) 259:6311.
[0080] In order to produce rAAV virions, an AAV expression vector
is introduced into a suitable producer cell using known techniques,
such as by transfection. A number of transfection techniques are
generally known in the art. See, e.g., Graham et al. (1973)
Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a
laboratory manual, Cold Spring Harbor Laboratories, New York, Davis
et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu
et al. (1981) Gene 13:197. Particularly suitable transfection
methods include calcium phosphate co-precipitation (Graham et al.
(1973) Virol. 52:456-467), direct micro-injection into cultured
cells (Capecchi, M. R. (1980) Cell 22:479-488), electroporation
(Shigekawa et al. (1988) BioTechniques 6:742-751), liposome
mediated gene transfer (Mannino et al. (1988) BioTechniques
6:682-690), lipid-mediated transduction (Felgner et al. (1987)
Proc. Natl. Acad. Sci. USA 84:7413-7417), and nucleic acid delivery
using high-velocity microprojectiles (Klein et al. (1987) Nature
327:70-73).
[0081] For the purposes of the invention, suitable producer cells
for producing rAAV virions include microorganisms, yeast cells,
insect cells, and mammalian cells, that can be, or have been, used
as recipients of a heterologous DNA molecule. The term includes the
progeny of the original cell which has been transfected. Thus, a
"producer cell" as used herein generally refers to a cell which has
been transfected with an exogenous DNA sequence. Cells from the
stable human cell line, 293 (readily available through, e.g., the
American Type Culture Collection under Accession Number ATCC
CRL1573) are preferred in the practice of the present invention.
Particularly, the human cell line 293 is a human embryonic kidney
cell line that has been transformed with adenovirus type-5 DNA
fragments (Graham et al. (1977) J. Gen. Virol. 36:59), and
expresses the adenoviral E1a and E1b genes (Aiello et al. (1979)
Virology 94:460). The 293 cell line is readily transfected, and
provides a particularly convenient platform in which to produce
rAAV virions.
2. AAV Helper Functions
[0082] Producer cells containing the above-described AAV expression
vectors must be rendered capable of providing AAV helper functions
in order to replicate and encapsidate the nucleotide sequences
flanked by the AAV. ITRs to produce rAAV virions. AAV helper
functions are generally AAV-derived coding sequences which can be
expressed to provide AAV gene products that, in turn, function in
trans for productive AAV replication. AAV helper functions are used
herein to complement necessary AAV functions that are missing from
the AAV expression vectors. Thus, AAV helper functions include one,
or both of the major AAV ORFs, namely the rep and cap coding
regions, or functional homologues thereof.
[0083] By "AAV rep coding region" is meant the art-recognized
region of the AAV genome which encodes the replication proteins Rep
78, Rep 68, Rep 52 and Rep 40. These Rep expression products have
been shown to possess many functions, including recognition,
binding and nicking of the AAV origin of DNA replication, DNA
helicase activity and modulation of transcription from AAV (or
other heterologous) promoters. The Rep expression products are
collectively required for replicating the AAV genome. For a
description of the AAV rep coding region, see, e.g., Muzyczka, N.
(1992) Current Topics in Microbiol. and Immunol. 158:97-129; and
Kotin, R. M. (1994) Human Gene Therapy 5:793-801. Suitable
homologues of the AAV rep coding region include the human
herpesvirus 6 (HHV-6) rep gene which is also known to mediate AAV-2
DNA replication (Thomson et al. (1994) Virology 204:304-311).
[0084] By "AAV cap coding region" is meant the art-recognized
region of the AAV genome which encodes the capsid proteins VP1,
VP2, and VP3, or functional homologues thereof. These cap
expression products are the capsid proteins which are collectively
required for packaging the viral genome. For a description of the
AAV cap coding region, see, e.g., Muzyczka, N. and Kotin, R. M.
(supra).
[0085] AAV helper functions are introduced into the producer cell
by transfecting the cell with an AAV helper construct either prior
to, or concurrently with, the transfection of the AAV expression
vector. AAV helper constructs are thus used to provide at least
transient expression of AAV rep and/or cap genes to complement
missing AAV functions that are necessary for productive AAV
infection. AAV helper constructs lack AAV ITRs and can neither
replicate nor package themselves. These constructs can be in the
form of a plasmid, phage, transposon, cosmid, virus, or virion. A
number of AAV helper constructs have been described, such as the
commonly used plasmids pAAV/Ad and pIM29+45 which encode both Rep
and Cap expression products. See, e.g., Samulski et al. (1989) J.
Virol. 63:3822-3828; and McCarty et al. (1991) J. Virol.
65:2936-2945. A number of other vectors have been described which
encode Rep and/or Cap expression products. See, e.g., U.S. Pat. No.
5,139,941.
[0086] Both AAV expression vectors and AAV helper constructs can be
constructed to contain one or more optional selectable markers.
Suitable markers include genes which confer antibiotic resistance
or sensitivity to, impart color to, or change the antigenic
characteristics of those cells which have been transfected with a
nucleic acid construct containing the selectable marker when the
cells are grown in an appropriate selective medium. Several
selectable marker genes that are useful in the practice of the
invention include the hygromycin B resistance gene (encoding
Aminoglycoside phosphotranferase (APH)) that allows selection in
mammalian cells by conferring resistance to G418 (available from
Sigma, St. Louis, Mo.). Other suitable markers are known to those
of skill in the art.
3. Accessory Functions
[0087] The producer cell must also be rendered capable of providing
non AAV derived functions, or "accessory functions," in order to
produce rAAV virions. Accessory functions are non AAV derived viral
and/or cellular functions upon which AAV is dependent for its
replication. Thus, accessory functions include at least those non
AAV proteins and RNAs that are required in AAV replication,
including those involved in activation of AAV gene transcription,
stage specific AAV mRNA splicing, AAV DNA replication, synthesis of
Cap expression products and AAV capsid assembly. Viral-based
accessory functions can be derived from any of the known helper
viruses.
[0088] Particularly, accessory functions can be introduced into and
then expressed in producer cells using methods known to those of
skill in the art. Commonly, accessory functions are provided by
infection of the producer cells with an unrelated helper virus. A
number of suitable helper viruses are known, including
adenoviruses; herpesviruses such as herpes simplex virus types 1
and 2; and vaccinia viruses. Nonviral accessory functions will also
find use herein, such as those provided by cell synchronization
using any of various known agents. See, e.g., Buller et al. (1981)
J. Virol. 40:241-247; McPherson et al. (1985) Virology 147:217-222;
Schlehofer et al. (1986) Virology 152:110-117.
[0089] Alternatively, accessory functions can be provided using an
accessory function vector. Accessory function vectors include
nucleotide sequences that provide one or more accessory functions.
An accessory function vector is capable of being introduced into a
suitable producer cell in order to support efficient AAV virion
production in the cell. Accessory function vectors can be in the
form of a plasmid, phage, transposon or cosmid. Accessory vectors
can also be in the form of one or more linearized DNA or RNA
fragments which, when associated with the appropriate control
elements and enzymes, can be transcribed or expressed in a producer
cell to provide accessory functions.
[0090] Nucleic acid sequences providing the accessory functions can
be obtained from natural sources, such as from the genome of an
adenovirus particle, or constructed using recombinant or synthetic
methods known in the art. In this regard, adenovirus-derived
accessory functions have been widely studied, and a number of
adenovirus genes involved in accessory functions have been
identified and partially characterized. See, e.g., Carter, B. J.
(1990) "Adeno-Associated Virus Helper Functions," in CRC Handbook
of Parvoviruses, vol. I (P. Tijssen, ed.), and Muzyczka, N. (1992)
Curr. Topics. Microbiol. and Immun. 158:97-129. Specifically, early
adenoviral gene regions E1a, E2a, E4, VAI RNA and, possibly, E1b
are thought to participate in the accessory process. Janik et al.
(1981) Proc. Natl. Acad. Sci. USA 78:1925-1929. Herpesvirus-derived
accessory functions have been described. See, e.g., Young et al.
(1979) Prog. Med. Virol. 25:113. Vaccinia virus-derived accessory
functions have also been described. See, e.g., Carter, B. J.
(1990), supra., Schlehofer et al. (1986) Virology 152:110-117.
[0091] As a consequence of the infection of the producer cell with
a helper virus, or transfection of the producer cell with an
accessory function vector, accessory functions are expressed which
transactivate the AAV helper construct to produce AAV Rep and/or
Cap proteins. The Rep expression products excise the recombinant
DNA (including the DNA of interest) from the AAV expression vector.
The Rep proteins also serve to duplicate the AAV genome. The
expressed Cap proteins assemble into capsids, and the recombinant
AAV genome is packaged into the capsids. Thus, productive AAV
replication ensues, and the DNA is packaged into rAAV virions.
[0092] Following recombinant AAV replication, rAAV virions can be
purified from the producer cell using a variety of conventional
purification methods, such as CsCl gradients. Further, if infection
is employed to express the accessory functions, residual helper
virus can be inactivated, using known methods. For example,
adenovirus can be inactivated by heating to temperatures of
approximately 60.degree. C. for, e.g., 20 minutes or more. This
treatment effectively inactivates only the helper virus since AAV
is extremely heat stable while the helper adenovirus is heat
labile.
[0093] The resulting rAAV virions are then ready for use for DNA
delivery, such as in gene therapy applications, for the production
of transgenic animals, in vaccination, and particularly for the
delivery of genes to a variety of muscle cell types.
4. In vitro and In vivo Delivery of rAAV Virions
[0094] Generally, rAAV virions are introduced into a muscle cell
using either in vivo or in vitro transduction techniques. If
transduced in vitro, the desired recipient muscle cell will be
removed from the subject, transduced with rAAV virions and
reintroduced into the subject. Alternatively, syngeneic or
xenogeneic muscle cells can be used where those cells will not
generate an inappropriate immune response in the subject.
[0095] Suitable methods for the delivery and introduction of
transduced cells into a subject have been described. For example,
cells can be transduced in vitro by combining recombinant AAV
virions with muscle cells e.g., in appropriate media, and screening
for those cells harboring the DNA of interest using conventional
techniques such as Southern blots and/or PCR, or by using
selectable markers. Transduced cells can then be formulated into
pharmaceutical compositions, described more fully below, and the
composition introduced into the subject by various techniques, such
as by intramuscular, intravenous, subcutaneous and intraperitoneal
injection, or by injection into smooth and cardiac muscle, using
e.g., a catheter.
[0096] For in vivo delivery, the rAAV virions will be formulated
into pharmaceutical compositions and will generally be administered
parenterally, e.g., by intramuscular injection directly into
skeletal or cardiac muscle.
[0097] Pharmaceutical compositions will comprise sufficient genetic
material to produce a therapeutically effective amount of the
protein of interest, i.e., an amount sufficient to reduce or
ameliorate symptoms of the disease state in question or an amount
sufficient to confer the desired benefit. The pharmaceutical
compositions will also contain a pharmaceutically acceptable
excipient. Such excipients include any pharmaceutical agent that
does not itself induce the production of antibodies harmful to the
individual receiving the composition, and which may be administered
without undue toxicity. Pharmaceutically acceptable excipients
include, but are not limited to, liquids such as water, saline,
glycerol and ethanol. Pharmaceutically acceptable salts can be
included therein, for example, mineral acid salts such as
hydrochlorides, hydrobromides, phosphates, sulfates, and the like;
and the salts of organic acids such as acetates, propionates,
malonates, benzoates, and the like. Additionally, auxiliary
substances, such as wetting or emulsifying agents, pH buffering
substances, and the like, may be present in such vehicles. A
thorough discussion of pharmaceutically acceptable excipients is
available in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co.,
N.J. 1991).
[0098] Appropriate doses will depend on the mammal being treated
(e.g., human or nonhuman primate or other mammal), age and general
condition of the subject to be treated, the severity of the
condition being treated, the particular therapeutic protein in
question, its mode of administration, among other factors. An
appropriate effective amount can be readily determined by one of
skill in the art.
[0099] Thus, a "therapeutically effective amount" will fall in a
relatively broad range that can be determined through clinical
trials. For example, for in vivo injection, i.e., injection
directly to skeletal or cardiac muscle, a therapeutically effective
dose will be on the order of from about 10.sup.6 to 10.sup.15 of
the rAAV virions, more preferably 10.sup.8 to 10.sup.14 rAAV
virions. For in vitro transduction, an effective amount of rAAV
virions to be delivered to muscle cells will be on the order of
10.sup.8 to 10.sup.13 of the rAAV virions. The amount of transduced
cells in the pharmaceutical compositions will be from about
10.sup.4 to 10.sup.10 muscle cells, more preferably 10.sup.5 to
10.sup.8 muscle cells. When the transduced cells are introduced to
vascular smooth muscle, a lower dose may be appropriate. Other
effective dosages can be readily established by one of ordinary
skill in the art through routine trials establishing dose response
curves.
[0100] Dosage treatment may be a single dose schedule or a multiple
dose schedule. Moreover, the subject may be administered as many
doses as appropriate. One of skill in the art can readily determine
an appropriate number of doses.
C. Experimental
[0101] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way.
[0102] Efforts have been made to ensure accuracy with respect to
numbers used (e.g., amounts, temperatures, etc.), but some
experimental error and deviation should, of course, be allowed
for.
Materials and Methods
Vector Constructs
[0103] A. Construction of p1909adhlacZ.
[0104] Plasmid p1909adhlacZ was used as the helper construct in the
following examples and was constructed from plasmid pWadhlacZ.
Plasmid pWadhlacZ was constructed by partially digesting plasmid
pUC119 (GeneBank Reference Name: U07649, GeneBank Accession Number:
U07649) with AflIII and BspHI, blunt-end modifying with the klenow
enzyme, and then ligating to form a circular 1732 bp plasmid
containing the bacterial origin and the amp gene only (the
polylinker and F1 origin was removed). The blunted and ligated
AflIII and BspHI junction forms a unique NspI site. The 1732 bp
plasmid was cut with NspI, blunt-end modified with T4 polymerase,
and a 20 bp HinDIII-HinCII fragment (blunt-end modified with the
klenow enzyme) obtained from the pUC119 polylinker was ligated into
the blunted NspI site of the plasmid. The HinDIII site from the
blunted polylinker was regenerated, and then positioned adjacent to
the bacterial origin of replication. The resulting plasmid was then
cut at the unique PstI/Sse8387I site, and an
Sse8387I-PvuII-Sse8387I oligonucleotide, having the sequence:
5'-GGCAGCTGCCTGCA-3' (SEQ ID NO.:1), was ligated therein. The
remaining unique BspHI site was cut, blunt-end modified with klenow
enzyme, and an AscI linker oligonucleotide, having the sequence:
5'-GAAGGCGCGCCTTC-3' (SEQ ID NO.:2) was ligated therein,
eliminating the BspHI site. The resulting plasmid was called
pWee.
[0105] In order to create the pWadhlacZ construct, a CMVlacZ
expression cassette (comprising a nucleotide sequence flanked 5'
and 3' by AAV ITRs, containing the following elements: a CMV
promoter, the hGH 1st intron, an adhlacz fragment and an SV40 early
polyadenylation site) was inserted into the unique PvuII site of
pWee using multiple steps such that the CMV promoter was arranged
proximal to the bacterial amp gene of pwee.
[0106] More particularly, a CMVlacZ expression cassette was derived
from the plasmid psub201CMV, which was constructed as follows. An
oligonucleotide encoding the restriction enzyme sites:
NotI-MluI-SnaBI-AgeI-BstBI-BssHII-NcoI-HpaI-BspEI-PmlI-RsrII-NotI
and having the following nucleotide sequence:
5'-GCGGCCGCACGCGTACGTACCGGTTCGAAGCGCGCACGGCCGACCATGGTTAACTCCGGACACGTGCGGA-
CCGCGGCCGC-3' (SEQ ID No.:3) was synthesized and cloned into the
blunt-end modified KasI-EarI site (partial) of pUC119 to provide a
2757 bp vector fragment. A 653 bp SpeI-SacII fragment containing a
nucleotide sequence encoding a CMV immediate early promoter was
cloned into the SnaBI site of the 2757 bp vector fragment. Further,
a 269 bp PCR-produced BstBI-BstBI fragment containing a nucleotide
sequence encoding the hGH 1st intron which was derived using the
following primers: 5'-AAAATTCGAACCTGGGGAGAAACCAGAG-3' (SEQ ID
NO.:4) and 3'-aaaattcgaacaggtaagcgcccctTTG-5' (SEQ ID NO.:5), was
cloned into the BstBI site of the 2757 bp vector fragment, and a
135 bp HpaI-BamHI (blunt-end modified) fragment containing the SV40
early polyadenylation site from the pCMV-.beta. plasmid (CLONETECH)
was cloned into the HpaI site of the subject vector fragment. The
resulting construct was then cut with NotI to provide a first CMV
expression cassette.
[0107] Plasmid pW1909adhlacZ was constructed as follows. A 4723 bp
SpeI-EcoRV fragment containing the AAV rep and cap encoding region
was obtained from the plasmid pGN1909 (ATCC Accession Number
69871). The pGN1909 plasmid is a high efficiency AAV helper plasmid
having AAV rep and cap genes with an AAV p5 promoter region that is
arranged in the construct to be downstream from its normal position
(in the wild type AAV genome) relative to the rep coding region.
The 4723 bp fragment was blunt-end modified, and AscI linkers were
ligated to the blunted ends. The resultant fragment was then
ligated into the unique AscI site of pWadhlacZ and oriented such
that the AAV coding sequences were arranged proximal to the
bacterial origin of replication in the construct.
[0108] Plasmid pW1909adhlacZ includes the bacterial
beta-galactosidase (.beta.-gal) gene under the transcriptional
control of the cytomegalovirus immediate early promoter
(CMVIE).
[0109] B. Construction of pW1909EPO.
[0110] Plasmid pW1909adhlacZ was modified to express human
erythropoietin (EPO) by replacing the adhlacz gene with a 718 base
pair PpuMI-NcoI fragment of human EPO cDNA (Wen et al. (1993) Blood
5:1507-1516) and by cloning a 2181 bp ClaI-EcoRI lacZ spacer
fragment (noncoding) into the PmlI site of the vector.
[0111] C. Construction of pAAV-GAA.
[0112] A plasmid containing the human lysosomal enzyme acid
.alpha.-glucosidase (GAA) coding region was constructed as follows.
A 3.2 kB cDNA clone containing the coding sequence for human GAA
beginning 207 bps downstream from the initiation codon (GenBank
Accession Numbers: M34424 and Y00839; Martiniuk et al. (1990) DNA
Cell Biol. 9:85-94) was cloned into the EcoRI site of Bluescript KS
(Stratagene). Additional 5' sequence was generated using polymerase
chain reaction (PCR) with reverse-transcribed poly-A mRNA (obtained
from normal human fibroblasts) as the template. The 5' primer was
constructed with a KpnI restriction site and bps -3 to 12 of the
published sequence (Martiniuk et al. (1986) Proc. Natl. Acad. Sci.
USA 83:9641-9644; Hoefsloot et al. (1988) Eur. Mol. Biol. Organ.
7-:1697-1704). The 3' primer was synthesized from basepairs 1001 to
1018. Using KpnI and the unique internal StuI site at position 776,
the PCR product was ligated to the partial cDNA to form the
full-length GAA-encoding plasmid. The full length cDNA was
truncated at a unique SphI restriction site, and cloned into the
expression vector p1.1c to result in the pAAV-GAA construct having
the GAA coding region under transcriptional control of the C4V-IE
promoter.
[0113] The p1.1c expression vector was constructed as follows.
pUC119 was partially digested with KasI and EarI, and a 2713 bp
vector fragment containing the ampicillin resistance gene, the coli
1 origin of replication and the M13 origin of replication, was
isolated, blunt end modified, and ligated to a synthetic DNA
polylinker encoding the restriction enzyme sites
NotI-MluI-SnaBI-AgeI-SfuI-BsHII-EagI-NcoI-PmeI-BspEI-PmnlI-RsrII-NotI,
and having the following nucleotide sequence:
5'-GCGGCCGCACGCGTTGTTAACAACCGGTTCGAAGCGCGCAGCGGCCGACCATGGGTTTAAACTCCGGACC-
ACGTGCGGACCGAGCGGCCGC-3' (SEQ ID NO.:6). The ligation was conducted
such that the MluI end of the polylinker was ligated to the KasI
side of the plasmid. A 653 bp SpeI-SacII fragment encoding the CMV
immediate-early promoter, a 269 bp PCR-produced SfuI-SfuI produced
fragment encoding the hGH 1st intron (derived using the following
primers: 5'-AAAATTCGAACAGGTAAGCGCCCCTTTG-3' (SEQ ID NO.:7) and
3'-AAAATTCGAACCTGGGGAGAAACCAGAG-5' (SEQ ID NO.:8), a 183 bp
BssHII-BssHII polylinker fragment from pBluescript II SK-, and a
135 bp HpaI-BamHI (blunted) fragment containing the SV40 early
polyadenylation site from pCMV-.beta. (Stratagene), were cloned
into the SnaBI, SfuI, BssHII, and PmeI sites, respectively, of the
aforementioned plasmid. The orientation of the polylinker relative
to the intron and polyadenylation site was intron-polylinker
(5'SacI-3'KpnI)-polyadenylation site. The polylinker was further
modified by removing the 88 bp SacI-XhoI polylinker fragment and
replacing it with the following synthetic SacI to XhoI fragment
encoding the restriction enzyme sites
SacI-ClaI-EcoRI-SmaI-BamHI-XbaI-SalI-PstI-BstXI-EcoRV-BstXI-olmeganucleas-
e-HinDIII-XhoI, having the following nucleotide sequence:
TABLE-US-00001 (SEQ ID NO.:9)
5'-GAGCTCAATCGATTGAATTCCCCGGGGATCCTCTAGAGTCGACCTGC
AGCCACTGTGTTGGATATCCAACACACTGGTAGGGATAACAGGGTAATCT CGAG-3'.
Viruses and Cell Lines
[0114] Adenovirus type 2 (Ad2), available from the American Type
Culture Collection, ATCC, Catalogue Number VR846, was used as
helper virus to encapsidate vectors.
[0115] The human 293 cell line (Graham et al. (1977) J. Gen. Virol.
36:59-72, available from the ATCC under Accession no. CRL1573),
which has adenovirus E1a and E1b genes stably integrated in its
genome, was cultured in complete Dulbecco's modified Eagle's media
(DMEM; Bio-Whittaker, Walkersville, Md.) containing 4.5 g/L
glucose, 10% heat-inactivated fetal bovine serum (FBS; Hyclone,
Logan, Utah) 2 mM glutamine, and 50 units/mL penicillin and 50
.mu.g/mL streptomycin.
[0116] The C2C12 murine myoblast cell line, available from the
ATCC, Catalogue Number CRL1772, was cultured in DMEM with 20% fetal
calf serum (FCS), 1% chick embryo extract and 5 .mu.g/mL
gentamicin.
[0117] Fetal human skeletal myoblasts (Clonetics) were cultured in
Hams F-12 human growth medium, containing 20% FCS and 5 .mu.g/mL
gentamicin.
[0118] The above cell lines were incubated at. 37.degree. C. in 5%
CO.sub.2, and were routinely tested and found free of mycoplasma
contamination.
Production of Recombinant AAV Virions
[0119] Recombinant AAV virions were produced in human 293 cells as
follows. Subconfluent 293 cells were cotransfected by standard
calcium phosphate precipitation (Wigler et al. (1979) Proc. Natl.
Acad. Sci USA 76:1373-1376) with one of the AAV vector/helper
plasmid constructs, pW1909adhLacZ or pW1909EPO; or with pAAV-GAA
and the pW1909 helper plasmid. After 6 hours, the transfected cells
were infected with Ad2 in fresh medium at a multiplicity of
infection (MOI) of 2, and incubated at 37.degree. C. in 5% CO.sub.2
for 70 hours prior to harvest. Pelleted cells were lysed in Tris
buffer (10 mM Tris, 150 mM NaCl, pH 8.0) by three cycles of
freeze-thaw. The lysate was clarified of cell debris by
centrifugation at 12,000.times.g, and the crude-cell lysate was
layered onto a cesium chloride cushion for isopyknic gradient
centrifugation. Recombinant AAV virions (rAAV-LacZ, rAAV-hEPO, or
rAAV-hGAA virions) were extracted from the resulting gradient by
isolating the fractions with an average density of approximately
1.38 g/mL, resuspended in Hepes buffered saline (HBS) containing 50
mM Hepes (pH 7.4) and 150 mM NaCl. The preparations were then
heated at 56.degree. C. for approximately 1 hour to inactivate
Ad2.
Assay of rAAV by Dot-Blot Hybridization
[0120] Recombinant AAV virions were DNase I digested, proteinase K
treated, phenol-chloroform extracted, and DNA precipitated with
sodium acetate-glycogen (final concentrations=0.3 M sodium acetate
and 160 .mu.g/mL, respectively). DNA samples were denatured (200
.mu.L of 2.times. alkaline solution (0.8 M NaOH, 20 mM EDTA) added
to DNA sample) for 10 minutes, then added to appropriate wells in a
dot-blot apparatus, and blotted onto wet Zeta Probe membrane
(BioRad), by applying suction until wells were empty. Then, 400
.mu.L of 1' alkaline solution was added; after 5 minutes, wells
were emptied by suction. The membrane was rinsed in 2.times.SSC
(Sambrook et al., supra) for 1 min, drained, air dried on filter
paper, then baked in vacuum at 80.degree. C. for 30 min. The
membrane was then prehybridized for 30 min at 65.degree. C. with 10
mL hybridization buffer (7% SDS, 0.25 M Sodium Phosphate, pH 7.2, 1
mM EDTA). Buffer was replaced with 10 mL fresh solution, freshly
boiled probe added, and hybridized overnight at 65.degree. C. The
membrane was washed twice with 25 mL of wash-1 buffer (5% SDS, 40
mM sodium phosphate, pH 7.2, 1 mM EDTA) for 20 min at 65.degree. C.
and twice with wash-2 buffer (1% SDS, 40 mM sodium phosphate, pH
7.2, 1 mM EDTA). The membrane was wrapped in plastic film, exposed
to radiographic film, and appropriate dots excised from the
membrane to determine radioactivity by scintillation counting, and
quantitated by comparison with standards. Titers of rAAV virion
were routinely in the range of approximately 10.sup.13
genomes/mL.
Assay for Contaminating Helper Adenovirus
[0121] Contaminating infectious adenovirus was assayed as follows.
Samples from the purified rAAV virion stocks were added to 50%
confluent 293 cells (cultured in 12 well dishes at 1.times.10.sup.5
cells/well), and the cultures were passaged for 30 days (e.g., the
cultures were split 1 to 5, every 3 days) or until the culture
exhibited 100% cytopathic effect (CPE) due to adenovirus infection.
Cultures were examined daily for CPE, and the day upon which each
experimental culture showed 100% CPE was noted. Reference 293 cell
cultures infected with a range of known amounts of adenovirus
type-2 (from 0 to 1.times.10.sup.7 plaque forming units
(pfu)/culture) were also prepared and treated in the same manner. A
standard curve was then prepared from the data obtained from the
reference cultures, where the adenovirus pfu number was plotted
against the day of 100% CPE. The titer of infectious adenovirus
type-2 in each experimental culture was then readily obtained as
determined from the standard curve. The limit of detection of the
assay was 100 pfu/mL. The presence of wild-type AAV contamination,
analyzed by dot-blot hybridization, was approximately 7 logs lower
than recombinant virion concentration.
Differentiation of Myoblasts
[0122] C2C12 myoblasts were transduced either while actively
dividing, or as a differentiated cell culture. Differentiation was
induced by placing subconfluent myoblasts in murine differentiation
medium (DMEM containing 2% horse serum and standard concentrations
of glutamine and penicillin-streptomycin) for an interval of four
days prior to transduction in order to induce myoblast fusion and
formation of differentiated myotubes.
[0123] Fetal human skeletal myoblasts were differentiated in human
differentiation medium (DMEM containing 10% horse serum and 5
.mu.g/mL gentamicin). Verification of differentiation was performed
by microscopic analysis to determine the presence of multinucleated
myotubes in culture.
EXAMPLE 1
Expression of rAAV-LacZ in Terminally Differentiated Adult Rat
Cardiomyocytes
[0124] The ability of recombinant AAV virions to transduce
terminally differentiated adult cardiomyocytes was established in
vitro. Cardiomyocytes were harvested by coronary perfusion with
collagenase of adult rat hearts (Fischer 344, Harlan Sprague
Dawley, Indianapolis, Ind.). Cardiomyocytes were grown on
laminin-coated glass coverslips and exposed to rAAV-LacZ virions
for 4 hours. After 72 hours, the cells were stained for
.beta.-galactosidase activity. AAV expression was detected by blue
staining of the binucleated cells. These studies demonstrated the
ability of rAAV virions to transduce terminally differentiated
cells. The transduction efficiency in vitro was 30% of adult cells
at a multiplicity of infection (MOI) of 10.sup.4 genomes per
cell.
EXAMPLE 2
Stability of rAAV-LacZ Expression In Vivo
[0125] Adult Fischer rats were used to analyze expression of
transgenes in vivo. Incremental doses of rAAV-LacZ virions were
injected into the left ventricular apex of the heart using either a
subxyphoid or lateral thoracotomy approach. More particularly,
experimental animals were anesthetized with Metofane followed by a
subxyphoid incision to expose the diaphragmatic surface of the
heart. Apical cardiac injections were performed with a glass
micropipette. Recombinant virion was diluted in normal saline and
injected at a volume of 20-50 .mu.L.
[0126] At varying times post-injection, hearts were harvested and
examined for .beta.-galactosidase production and for the presence
of infiltrating mononuclear cells. For 5-Bromo-4-chloro-3-indolyl
.beta.-D-galactoside histochemical determination, frozen sections
(6 .mu.m) were fixed in 0.5% glutaraldehyde and stained for
.beta.-galactosidase activity as described (Sanes et al. (1986)
"Use of Recombinant Retrovirus to Study Post-Implantation Cell
Lineage in Mouse Embryos," EMBO J 5:3133-3142). Paraffin sections
(5 .mu.m) were stained with hematoxylin/eosin. Sections were
examined for infiltrating mononuclear cells.
[0127] The above-described histochemical studies showed greater
than 50% transduction of cardiomyocytes in the region of injection
at each time point examined. Further, there was no inflammatory
cell infiltrate noted during the course of analysis.
.beta.-galactosidase staining was observed to persist in cardiac
muscle for at least two months following gene transfer.
EXAMPLE 3
In vivo Transduction of Murine Skeletal Muscle using rAAV-LacZ
Virions
[0128] Recombinant AAV-LacZ virions were injected into muscle
tissue of mice, and transduction assessed by .beta.-gal activity.
Particularly, in vivo transduction was performed by intramuscular
(IM) injection of recombinant AAV virions into the skeletal muscle
of healthy 6-8 week old Balb/c mice (Jackson Laboratories, Bar
Harbor, Me., Simonsen Laboratories, Gilroy, Calif., or Harlan
Laboratories) under either Metofane (Pitman-Moore, Mundelein, Ill.)
or ketamine-xylazine anesthesia. The mid-portion of each tibialis
anterior muscle was exposed via a 1 cm incision. Injections into
the tibialis anterior were carried out using a micro-capillary tube
attached to a Hamilton syringe to administer the following
formulations at a depth of 2 mm: phosphate-buffered saline. (PBS)
alone (negative control); or PBS containing either rAAV-LACZ
virions or pW1909adhlacZ plasmids.
[0129] Tissue samples of tibialis anterior muscle, forelimb muscle,
heart, brain and liver were obtained for analysis of
.beta.-galactosidase expression. One tibialis anterior muscle from
each animal was processed for cross-sectional .beta.-galactosidase
analysis, and total .beta.-galactosidase was determined from a
crude homogenate of the other muscle using a chemiluminescent
assay.
[0130] For histochemical detection of .beta.-galactosidase, muscle
samples were snap-frozen in dry ice-cooled isopentane, followed by
serial transverse sectioning (10 .mu.m) and processing according to
previously described methods (Sanes et al. (1986) EMBO J
5:3133-3142). The cross-sectional area of the tibialis anterior
expressing .beta.-galactosidase was determined as follows: after
counter-staining with nuclear fast red (Vector Labs), the X-gal
stained tissue was digitally photographed and the cross-sectional
area of stored images was determined using NIH Image software.
[0131] The GALACTO-LIGHT.TM. (Tropix, Bedford, Mass.)
chemiluminescent reporter assay kit was used to detect total
.beta.-galactosidase activity in the entire tibialis anterior
muscle. Standard curves were prepared from known amounts of
purified .beta.-galactosidase (Sigma, St. Louis, Mo.) resuspended
in non-transduced muscle homogenate. .beta.-galactosidase activity
is expressed as either: nanograms of .beta.-galactosidase,
normalized for the entire muscle, minus background activity; or in
terms of relative light units (RLU) as quantified by luminometer.
Forelimb muscle, cardiac muscle, brain tissue and liver samples
were assayed in an identical fashion.
[0132] A. Time Course of .beta.-galactosidase Expression.
[0133] A single intramuscular injection into the left and right
tibialis anterior muscles (under direct vision) was used to deliver
8.times.10.sup.9 rAAV-LacZ in a PBS vehicle. Four animals were
injected with PBS alone. Animals were sacrificed at 2, 4, 8, 12, 24
and 32 weeks after injection, and the tibialis anterior muscle was
excised and analyzed for the presence of bacterial
.beta.-galactosidase (n=5 for each group) as described above.
[0134] Efficiency of the LacZ gene transfer was assessed by
cross-sectional tissue staining and chemiluminescent assay. As can
be seen in FIG. 1 and in Table I below, gene expression persisted
for at least 32 weeks. In addition, two weeks after injection of
the recombinant virions, 18% of the muscle cross-sectional area
expressed .beta.-galactosidase, while at 32 weeks, 24% of the
muscle cross-sectional area expressed .beta.-galactosidase.
Negative control tibialis anterior muscle (obtained from the
animals injected with PBS alone) showed no background staining.
Muscle .beta.-galactosidase activity was also determined in the
contralateral injected muscle. This study also revealed persistent
expression for at least 32 weeks, in agreement with the
cross-sectional fiber analysis (Table I). Further, the observed
.beta.-galactosidase was sustained with minimal inflammatory cell
infiltrate. These data demonstrate that rAAV-LacZ virion
administration into muscle results in stable expression of the
transgene for at least 8 months.
[0135] Upon histological examination, positive staining filled the
cytoplasm of the transduced myofibers and was observed through
large contiguous portions of the muscle. Serial transverse sections
revealed that blue staining extended throughout the length of the
muscle fiber. Diffraction-interference contrast microscopy revealed
a clear delineation between positively and negatively stained
myofibers (FIG. 2), suggesting that recombinant virion delivery was
limited by structural barriers such as epimyseal or perimyseal
connective tissue. Homogenates prepared from brain, heart, liver,
and forelimb muscle displayed no .beta.-galactosidase activity when
compared with the background activity of the negative control
animals. TABLE-US-00002 TABLE I Time Course of .beta.-galactosidase
Expression Following Single Injection with rAAV-LacZ.
.beta.-galactosidase Percent cross-sectional Time expression area
expressing .beta.- (weeks) (ng/muscle) galactosidase (%) 2 1441
.+-. 458 18 .+-. 6 4 951 .+-. 176 20 .+-. 4 8 839 .+-. 436 24 .+-.
3 12 1878 .+-. 521 29 .+-. 5 24 2579 .+-. 1165 22 .+-. 3 32 1242
.+-. 484 24 .+-. 3 The left and right tibialis anterior muscles
were injected with 8 .times. 10.sup.9 rAAV-lacZ. One member of the
pair of injected muscles was processed for .beta.-galactosidase
expression (n = 5 .+-. SEM). The other muscle was processed for
histochemical detection of .beta.-galactosidase and determination
of the cross-sectional area of the tibialis anterior expressing
.beta.-galactosidase. Mean cross-sectional areas .+-. SEM are
shown.
[0136] B. Dose-Response Assay.
[0137] To determine the effective dose range for rAAV-LacZ in vivo,
recombinant virions were injected into the tibialis anterior muscle
of 6-8 week old Balb/c mice, and transduction assessed by
.beta.-galactosidase activity as measured by GLACTO-LIGHT.TM.
relative light units (RLU). As can be seen in FIG. 3, at two weeks
post-injection, the observed RLU ranged from approximately
0.2.times.10.sup.7 RLU/muscle (injected with 8.times.10.sup.8
rAAV-LacZ) to approximately 1.1.times.10.sup.9 RLU/muscle (injected
with 3.6.times.10.sup.11 rAAV-LacZ).
[0138] The levels of expression of .beta.-galactosidase measured in
RLU correspond to the percentage of .beta.-galactosidase-positive
muscle fibers on cross-sectional analysis. For example,
0.2.times.10.sup.7 RLU corresponds to approximately 1%
.beta.-galactosidase positive muscle fibers and 1.1.times.10.sup.9
RLU corresponds to approximately 60% .beta.-galactosidase positive
muscle fibers.
[0139] C. Comparison of .beta.-galactosidase Expression
Efficiency.
[0140] A comparison of .beta.-galactosidase expression efficiency
obtained by in vivo transduction of mice using either rAAV-LacZ
virions, or plasmid DNA containing the same LacZ expression
cassette (pW1909adhlacZ) was carried out as follows. Either
8.times.10.sup.9 rAAV-LacZ, or 100 .mu.g of pW1909adhlacZ, was
injected into the tibialis anterior muscle of 6-8 week old Balb/c
mice. Two weeks post-injection, .beta.-galactosidase activity was
assessed using the GALACTO-LIGHT.TM. chemiluminescent reporter
assay kit, as described above. Administration of the recombinant
virions resulted in 1441 ng .beta.-galactosidase/muscle (n=5),
while administration of 100 .mu.g of the plasmid DNA, a typical in
vivo plasmid DNA dosage (Whalen et al. (1995) Hum. Gene Ther.
4:151-159), resulted in 12 ng .beta.-galactosidase/muscle (n=4).
This dosage of pW1909adhlacZ plasmid DNA is equivalent to
2.2.times.10.sup.13 single stranded genomes, demonstrating that
gene delivery by the recombinant virions was substantially more
efficient than delivery of an equal molar quantity of vector
DNA.
EXAMPLE 4
In vitro Transduction of Murine Myotubes and Myoblasts
[0141] In order to determine if differentiated cultured muscle
cells are appropriate targets for recombinant AAV virion
transduction, and to assess the ability of such cells to express a
transduced gene, the following study was carried out. Murine C2C12
cells were selected since these cells have been extensively studied
as a model for mammalian myogenesis (Blau et al. (1993) Trends
Genet. 9:269-274), and can be induced to differentiate by growth in
reduced serum medium.
[0142] In the study, C2C12 myoblasts (dividing cells) were seeded
in cell culture plates at a density of 2.times.10.sup.4
cells/cm.sup.2, maintained in growth media (GM) until confluent,
split, and then either cultured in GM or cultured for 5 days in
murine DM. Differentiation was verified by the microscopic presence
of multinucleate myotubes, representing fused myoblasts
(differentiated C2C12 cells).
[0143] The C2C12 myotubes and myoblasts were transduced in culture
with purified rAAV-hEPO virions at a MOI of 10.sup.5 in OptiMEM
(Gibco BRL). In the myotube cultures, DM was added after virion
adsorption. The culture media of the transduced cells was changed
24 hours prior to collection of supernatants at 3, 8 and 14 days
following transduction. Secretion of hEPO was assessed by ELISA
using the human erythropoietin Quantikine IVD kit (available from R
and D Systems, Minneapolis, Minn.) according to manufacturer's
recommendations.
[0144] The results of the study show that hEPO is secreted from
both the transduced myotubes and myoblasts. The levels of hEPO
secretion increased in the myotubes over the first seven days
post-transduction (FIG. 4). As can be seen by reference to FIG. 5,
a dose-dependent increase in the secretion of hEPO was also
observed in the transduced C2C12 myotubes. Eight days
post-transduction of the myotubes, hEPO levels peaked at >3400
mU/mL. These data demonstrate that transduction with rAAV-hEPO of
both myotubes or myoblasts results in hEPO secretion by the
transduced cells, and that in short-term myotube cultures, hEPO is
synthesized and secreted in a dose-dependent manner.
EXAMPLE 5
In vitro Transduction of Human Myotubes Using rAAV-hEPO Virions
[0145] To determine if differentiated primary human muscle cells
are able to express hEPO following transduction with rAAV-hEPO, the
following study was carried out. Primary fetal human skeletal
myoblasts were seeded in cell culture plates at a density of
2.times.10.sup.4 cells/cm.sup.2, grown to confluence in appropriate
growth media, and then cultured for. 14 days in human DM.
Differentiation was verified by microscopic examination for
multinucleate cells. In vitro transduction was carried out by
adding purified rAAV-hEPO virions to the cultured myotubes in
OptiMEM medium (Gibco BRL). DM was added to the cultures after
virion adsorption. Control cultures were transduced with
rAAV-LacZ.
[0146] Culture media was changed 24 hours prior to collection of
supernatants at day 3, 8 and 14 post transduction. Secreted EPO
levels were assayed by ELISA as described above in Example 4.
[0147] As can be seen in FIG. 6, the transduced human myotubes
secreted hEPO into the culture in a dose-dependent manner. No
detectable EPO activity was measured in the control cultures.
Secretion of EPO increased over the 14-day interval
post-transduction. These data demonstrate that primary human
myotubes transduced by recombinant AAV virions are capable of
expressing and secreting erythropoietin.
EXAMPLE 6
Systemic Delivery of Human Erythropoietin In vivo by Intramuscular
Administration of rAAV-hEPO
[0148] Recombinant AAV virions encoding hEPO were administered to
adult healthy Balb/c mice in vivo to determine if a systemic level
of hEPO can be produced, and a biological response obtained. At
various time points after administration, blood was obtained from
the orbital venous plexus under anesthesia. Serum hEPO levels were
determined by ELISA as described above. Red cell counts were done
by hemocytometer, hematocrit was determined by centrifugation of
blood in micro-capillary tubes, and hemoglobin concentration was
analyzed by cyanmethemoglobin assay (DMA, Arlington, Tex.)
according to manufacturer's specifications and compared with a
standard (Stanbio Laboratory, San Antonio, Tex.) analyzed at 570 nm
on a spectrophotometer. Reticulocytes were analyzed by either new
methylene blue stain, or by FACS analysis of thiazole orange
stained peripheral blood samples (RETIC-COUNT.RTM.
Becton-Dickinson, Mountain View, Calif.); the results of data
obtained by either of these methods were similar.
[0149] An initial experiment revealed that high levels of HEPO and
elevated hematocrits were maintained for >100 days in mice
injected IM with 6.5.times.10.sup.11 rAAV-hEPO. Next, adult female
Balb/c mice were injected IM in both hind limbs with a single
administration of rAAV-hEPO at dosages ranging from
3.times.10.sup.9 to 3.times.10.sup.11 particles. Control animals
were injected with rAAV-LacZ. The resulting serum HEPO levels were
analyzed and are reported below in Table II. As can be seen, a
well-defined dose-response was obtained 20, 41, 62 and 83 days post
injection.
[0150] The time course of hEPO secretion by animals receiving
rAAV-hEPO is depicted in FIG. 7. As can be seen, serum levels of
hEPO increased with time to plateau at from 6 to 8 weeks after
injection.
[0151] The biological activity of secreted hEPO can be monitored by
elevation of hematocrit in the experimental animals. A comparison
of circulating hEPO levels versus hematocrit is shown in Table II.
The comparison shows that hematocrit increased with time and
increasing recombinant virion dose. Further, stable elevation in
hematocrit has been observed for up to 40 weeks in a group of
experimental animals injected with rAAV-hEPO. Control animals had
undetectable levels of hEPO (<2.5 mU/mL, the lower limit of
detection for the assay).
[0152] These results indicate that persistent and stable high-level
secretion of hEPO, with a corresponding elevation in hematocrit, is
established following a single IM administration of rAAV-hEPO.
[0153] In addition, comparison of the expression of hEPO by animals
injected IM with rAAV-hEPO (3.times.10.sup.11 single-stranded
genomes) and animals injected IM with the pW1909EPO plasmid
(1.4.times.10.sup.13 double-stranded genomes in 100 .mu.g DNA)
shows that the recombinant virions gave rise to significantly
greater levels of EPO expression. As reported in Table II, 20 days
post-injection, recombinant virion-injected animals had serum
levels of 445.+-.98 mU/mL, while the plasmid-injected animals had
levels of 8.+-.10 mU/mL. At 41 days post-injection, levels in the
recombinant virion-treated animals had risen to 725.+-.112 mU/mL,
while the levels in the plasmid-treated animals had dropped below
the level of detection. The animals receiving rAAV-hEPO exhibited
approximately 60-fold more circulating hEPO with 100-fold less
input genomes at 20 days post-injection, or approximately 6000-fold
greater secretion per genome. At 41 days post-injection, this
difference was even greater, since the plasmid expression was below
the level of detection. TABLE-US-00003 TABLE II EPO Expression and
Hematocrit: rAAV-hEPO Dose-Response Days after Administration 20
days 41 days 62 days 83 days Dose EPO HCT EPO HCT EPO HCT EPO HCT 3
.times. 10.sup.11 445 .+-. 98 74.2 .+-. 1.2 725 .+-. 112 82.3 .+-.
1.2 769 .+-. 61 86.5 .+-. 1.4 723 .+-. 253 88.5 .+-. 0.7 1 .times.
10.sup.11 85 .+-. 14 72.8 .+-. 1.5 212 .+-. 23 79.5 .+-. 1.7 234
.+-. 75 83.2 .+-. 0.2 220 .+-. 51 83.2 .+-. 2 3 .times. 10.sup.10
17 .+-. 5 60.0 .+-. 3.5 34 .+-. 17 74.7 .+-. 3.2 55 .+-. 28 78.7
.+-. 2.0 73 .+-. 45 80.0 .+-. 3 1 .times. 10.sup.10 3 .+-. 1 52.9
.+-. 1.8 11 .+-. 3 61.5 .+-. 1.9 12 .+-. 8 68.4 .+-. 4.6 15 .+-. 5
70.8 .+-. 8 3 .times. 10.sup.9 <2.5 49.9 .+-. 1.4 <2.5 53.5
.+-. 2.5 <2.5 57.0 .+-. 2.4 4 .+-. 4 57.5 .+-. 3 i.v. 7 .+-. 3
54.7 .+-. 3.2 13 .+-. 2.0 <64.4 .+-. 5.3 10.1 .+-. 0.7 70.8 .+-.
8 21 .+-. 10 74.6 .+-. 7 Control <2.5 48.9 .+-. 1.0 <2.5 49.1
.+-. 0.8 <2.5 48.1 .+-. 0.7 <2.5 48.2 .+-. 9 Plasmid 8 .+-.
10 50 .+-. 3.0 <2.5 50.2 .+-. 1.0 <2.5 47.8 .+-. 0.9 N.D.
N.D. Values representing means .+-. standard deviation (SD). EPO =
serum levels of human EPO (mU/mL) in Balb/c mice; HCT = hematocrit
(%); N.D. = not done; i.v. = intravenous injection with 3 .times.
10.sup.11 rAAV-hEPO; Plasmid = injection with 100 .mu.g plasmid DNA
(1.4 .times. 10.sup.13 double-stranded plasmid molecules); Control
= injection with 3 .times. 10.sup.11 particles of rAAV-lacZ.
EXAMPLE 7
A Comparison of hEPO Secretion from rAAV-hEPO Administered by IM or
IV Routes
[0154] A comparison of the circulating levels of hEPO resulting
from IM and IV routes of administration was analyzed to determine
which method of gene delivery results in higher levels of systemic
hEPO. Balb/c mice were injected with 3.times.10.sup.11 rAAV-hEPO
using either the IM route as described above, or intravenously (IV)
in PBS in a total volume of 50 .mu.L via the lateral tail vein.
Serum hEPO levels were determined by ELISA using the methods
described above.
[0155] As shown in Table II, hEPO levels resulting from the IV
administrations were significantly lower than the group that
received the virions by the IM route. In particular, at 20 days
post-injection, the IM route resulted in levels of hEPO of
445.+-.98 mU/mL, while the IV route produced 7.+-.3.0 mU/mL. At 41
days post-injection, the EPO level observed with the IM route was
725.+-.112 as compared with 13.+-.2.0 mU/mL by IV, or approximately
60-fold more efficacious. These data demonstrate that the IM route
of injection resulted in higher systemic levels of hEPO, and
suggest that interstitial delivery in muscle results in improved
transduction by the recombinant AAV virions.
EXAMPLE 8
In vitro and In vivo Transduction of Muscle Cells Using rAAV-GAA
Virions
[0156] Cardiomyopathy in infancy is frequently due to inherited
metabolic disease. One such metabolic disease, glycogen storage
disease type II (Pompe's disease) is an inherited cardiomyopathy
caused by a deficiency in the lysosomal enzyme, acid
.alpha.-glucosidase (GAA). GAA functions to cleave .alpha.-1,4 and
.alpha.-1,6 linkages of lysosomal glycogen to release
monosaccharides. Loss of enzyme activity results in accumulation of
lysosomal glycogen in striated muscle, and is characterized by
lysosomal rupture, contractile apparatus disruption and glycogen
infiltration. Currently, no effective treatment is available.
[0157] Accordingly, the following studies were carried out to
determine whether the recombinant AAV virions of the present
invention can be used to obtain long-term expression of GAA in
transduced muscle cells.
[0158] A. In vitro Transduction of Human Skeletal Muscle Cells with
rAAV-hGAA Virions.
[0159] Human skeletal myoblasts were seeded in cell culture plates
at a density of 2.times.10.sup.4 cells/cm.sup.2, grown to
confluence in appropriate growth media, and then cultured for 14
days in human DM. Differentiation was verified by microscopic
examination for multinucleate cells. In vitro transduction was
carried out by adding purified rAAV-hGAA virions at an MOI of
2.times.10.sup.5 to the cultured myotubes in OptiMEM medium (Gibco
BRL). DM was added to the cultures after virion adsorption.
Transduced control cultures were established by transducing the
myotubes with rAAV-LacZ at the same MOI, and negative controls were
established by culturing non-transduced myotubes.
[0160] Culture media was changed 24 hours prior to collection of
supernatants at day 3, 8 and 14 post transduction. hGAA expression
was determined by enzymatic assay. Specifically, cell monolayers
were harvested with 0.05% trypsin in Puck's saline A containing
0.02% ethylenediaminetetraacetic acid. After quenching the trypsin
with growth media, cells were centrifuged, the cell pellet washed
with PBS, and resuspended in distilled water. Following three
freeze-thaw cycles, the samples were microfuged at 10,000.times.g.
Protein in the supernatant was determined using the Bicinchoninic
acid method (Pierce) with bovine serum albumin (BSA) as the
standard. GAA activity was measured using cleavage of the glycogen
analog 4-methylumbelliferyl-.alpha.-D-glucoside, by a modification
of a previously described method (Galjaard et al. (1973) Clin.
Chim. Acta. 49:361-375; Galjaard, H. (1973) Pediatr. Res. 7:56).
Assays contained 30 .mu.g protein in 125 .mu.L water. Two volumes
of 200 TnM sodium acetate (pH 4.3) and 750 nM
4-methyumbelliferyl-.alpha.-D-glucoside (from a stock solution of
200 mM in dimethylsulfoxide) were added and the samples incubated
at 37.degree. C. for one hour. Reactions were stopped with 625
.mu.L sodium carbonate (pH 10.7). Once cleaved and alkalinized, the
4-methyumbelliferyl fluoresces. Measurements were made with a
fluorescence spectrophotometer with excitation at 365 nm and
emission at 448 nm. Assay measurements were compared against
4-methyumbelliferone (Sigma, St. Louis, Mo.) standards. Zero
protein and zero time blanks were used.
[0161] The observed GAA activity is reported in FIG. 8 which
demonstrates that in vitro transduction of the human myotubes
results in high level GAA expression at day 8 and 14 post
transduction.
[0162] B. In vivo Transduction of Skeletal Muscle Using rAAV-GAA
Virions.
[0163] Recombinant AAV virions encoding human GAA were administered
to adult Balb/c mice in vivo to determine if systemic levels of GAA
can be produced by the transduced cells. Muscle tissue was isolated
at various time points after administration, and processed for GAA
activity using an enzymatic assay.
[0164] In the study, tibialis anterior muscle in Balb/c mice was
surgically exposed, and a single intramuscular injection into the
left and right muscles (under direct vision) was used to administer
the following formulations: phosphate-buffered saline (PBS) alone
(negative control); or PBS containing either 2.times.10.sup.10
rAAV-hGAA or rAAV-LacZ (for a total of 4.times.10.sup.10
virions/animal).
[0165] Tissue samples of tibialis anterior muscle were obtained at
1, 4 and 10 weeks following transduction. The tissue samples were
prepared by homogenization in water followed by three freeze-thaw
cycles. Freeze-thaw lysates were microcentrifuged, and the
resultant supernatant assayed for GAA activity as described above.
The results of the study are depicted in FIG. 9. As can be seen,
stable expression of GAA in the transduced mouse muscle cells was
observed for ten weeks, demonstrating that the recombinant AAV
virions of the present invention are able to establish efficient
expression of a functional lysosomal protein in transduced cells,
and thus provide a therapeutic approach for the treatment of
glycogen storage disease.
[0166] Accordingly, novel methods for transferring genes to muscle
cells have been described. Although preferred embodiments of the
subject invention have been described in some detail, it is
understood that obvious variations can be made without departing
from the spirit and the scope of the invention as defined by the
appended claims.
Deposits of Strains Useful in Practicing the Invention
[0167] A deposit of biologically pure cultures of the following
strain was made with the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md., under the provisions of the
Budapest Treaty. The accession number indicated was assigned after
successful viability testing, and the requisite fees were paid.
Access to said cultures will be available during pendency of the
patent application to one determined by the Commissioner to be
entitled thereto under 37 CFR 1.14 and 35 USC 122. All restriction
on availability of said cultures to the public will be irrevocably
removed upon the granting of a patent based upon the application.
Moreover, the designated deposits will be maintained for a period
of thirty (30) years from the date of deposit, or for five (5)
years after the last request for the deposit; or for the
enforceable life of the U.S. patent, whichever is longer. Should a
culture become nonviable or be inadvertently destroyed, or, in the
case of plasmid-containing strains, lose its plasmid, it will be
replaced with a viable culture(s) of the same taxonomic
description.
[0168] This deposit is provided merely as a convenience to those of
skill in the art, and is not an admission that a deposit is
required. A license may be required to make, use, or sell the
deposited materials, and no such license is hereby granted.
TABLE-US-00004 Strain Deposit Date ATCC No. pGN1909 Jul. 20, 1995
69871
[0169]
Sequence CWU 1
1
* * * * *