U.S. patent application number 10/918905 was filed with the patent office on 2006-05-11 for retroviral delivery system.
Invention is credited to Fiona M. Ellard, Alan J. Kingsman, Susan M. Kingsman, Kyriacos A. Mitrophanous, Deva Patil.
Application Number | 20060099180 10/918905 |
Document ID | / |
Family ID | 33424562 |
Filed Date | 2006-05-11 |
United States Patent
Application |
20060099180 |
Kind Code |
A1 |
Mitrophanous; Kyriacos A. ;
et al. |
May 11, 2006 |
Retroviral delivery system
Abstract
A retroviral delivery system capable of transducing a target
site is described. The retroviral delivery system comprises a first
nucleotide sequence coding for at least a part of an envelope
protein; and one or more other nucleotide sequences derivable from
a retrovirus that ensure transduction of the target site by the
retroviral delivery system; wherein the first nucleotide sequence
is heterologous with respect to at least one of the other
nucleotide sequences; and wherein the first nucleotide sequence
codes for at least a part of a rabies G protein or a mutant,
variant, derivative or fragment thereof that is capable or
recognising the target site.
Inventors: |
Mitrophanous; Kyriacos A.;
(Oxford, GB) ; Patil; Deva; (Oxford, GB) ;
Kingsman; Alan J.; (Oxford, GB) ; Kingsman; Susan
M.; (Oxford, GB) ; Ellard; Fiona M.; (Oxford,
GB) |
Correspondence
Address: |
FROMMER LAWRENCE & HAUG
745 FIFTH AVENUE- 10TH FL.
NEW YORK
NY
10151
US
|
Family ID: |
33424562 |
Appl. No.: |
10/918905 |
Filed: |
August 16, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09701014 |
Nov 22, 2000 |
6818209 |
|
|
PCT/GB99/01607 |
May 21, 1999 |
|
|
|
10918905 |
Aug 16, 2004 |
|
|
|
60093149 |
Jul 17, 1998 |
|
|
|
Current U.S.
Class: |
424/93.2 ;
424/224.1; 435/456 |
Current CPC
Class: |
A61K 48/00 20130101;
C12N 2740/15045 20130101; C12N 2740/16045 20130101; C12N 2740/13045
20130101; C12N 2810/60 20130101; C12N 2740/16043 20130101; C12N
2740/15043 20130101; C12N 15/86 20130101; C12N 2740/13043
20130101 |
Class at
Publication: |
424/093.2 ;
435/456; 424/224.1 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 39/205 20060101 A61K039/205; C12N 15/867 20060101
C12N015/867 |
Foreign Application Data
Date |
Code |
Application Number |
May 22, 1998 |
GB |
9811153.7 |
Claims
1. A retroviral delivery system capable of transducing a target
site, wherein the retroviral delivery system comprises a first
nucleotide sequence coding for at least a part of an envelope
protein; and one or more other nucleotide sequences derivable from
a retrovirus that ensure transduction of the target site by the
retroviral delivery system; wherein the first nucleotide sequence
is heterologous with respect to at least one of the other
nucleotide sequences; and wherein the first nucleotide sequence
codes for at least a part of a rabies G protein or a mutant,
variant, derivative or fragment thereof that is capable of
recognising the target site.
2. The retroviral delivery system according to claim 1, wherein the
first nucleotide sequence codes for all of a rabies G protein or a
mutant, variant, derivative or fragment thereof.
3. The retroviral delivery system according to claim 1, wherein at
least one of the other nucleotide sequences is derivable from a
lentivirus or an oncoretrovirus.
4. The retroviral delivery system according to claim 1, wherein the
other nucleotide sequences are derivable from a lentivirus or an
oncoretrovirus.
5. The retroviral delivery system according to claim 1, wherein the
other nucleotide sequences are derivable from MLV, HIV or EIAV.
6. The retroviral delivery system according to claim 1, wherein the
retroviral delivery system comprises at least one NOI.
7. The retroviral delivery system according to claim 6, wherein the
NOI has a therapeutic effect or codes for a protein that has a
therapeutic effect.
8. The retroviral delivery system according to claim 1, wherein the
target site is a cell.
9. A viral particle obtained from the retroviral delivery system
according to claim 1.
10. A retroviral vector which is the retroviral delivery system
according to claim 1, or is obtained therefrom.
11. A cell transduced with the retroviral delivery system according
claim 1.
12. (canceled)
13. A method for delivering an NOI to a target cell comprising
contacting the target cell with the retroviral delivery system
according to claim 1.
14. A method for transducing a cell comprising contacting the cell
with the retroviral delivery system according to claim 1.
15. A vector for preparing a retroviral delivery system according
to claim 1, wherein the vector comprises a nucleotide sequence
coding for at least a part of the rabies G protein or a mutant,
variant, derivative or fragment thereof.
16. A plasmid for preparing a retroviral delivery system according
to claim 1, wherein the plasmid comprises a nucleotide sequence
coding for at least a part of the rabies G protein or a mutant,
variant, derivative or fragment thereof.
17. A plurality of plasmids, wherein at least one plasmid is a
plasmid according to claim 16 and wherein at least one other
plasmid comprises one or more nucleotide sequences derivable from a
retrovirus.
18. A method of modifying the infectious profile of a retrovirus,
retroviral vector or retroviral particle comprising pseudotyping
the retrovirus, retroviral vector or retroviral particle with a
rabies G protein.
19. A method of modifying host range or cell tropism of a
retrovirus, retroviral vector or retroviral particle comprising
pseudotyping the retrovirus, retroviral vector or retroviral
particle with a rabies G protein.
20. A retrovirus or a retroviral vector or a retroviral particle
pseudotyped with a rabies G protein.
21. A retroviral delivery system comprising a heterologous env
region, wherein the heterologous env region comprises at least a
part of a nucleotide sequence coding for a rabies G protein.
22. The retroviral delivery system according claim 21, wherein the
heterologous env region comprises a nucleotide sequence coding for
a rabies G protein.
23. (canceled)
24. A cell transduced with the viral particle according to claim
9.
23. A cell transduced with the retroviral vector according to claim
10.
Description
[0001] The present invention relates to a delivery system. In
particular, the present invention relates to a retroviral vector
capable of delivering a nucleotide sequence of interest hereinafter
abbreviated to "NOI")--or even a plurality of NOIs--to a site of
interest.
[0002] More in particular, the present invention relates to a
retroviral vector useful in gene therapy.
[0003] Gene therapy includes any one or more of: the addition, the
replacement, the deletion, the supplementation, the manipulation
etc. of one or more nucleotide sequences in, for example, one or
more targetted sites--such as targetted cells. If the targetted
sites are targetted cells, then the cells may be part of a tissue
or an organ. General teachings on gene therapy may be found in
Molecular Biology (Ed Robert Meyers, Pub VCH, such as pages
556-558).
[0004] By way of further example, gene therapy also provides a
means by which any one or more of: a nucleotide sequence, such as a
gene, can be applied to replace or supplement a defective gene; a
pathogenic gene or gene product can be eliminated; a new gene can
be added in order, for example, to create a more favourable
phenotype; cells can be manipulated at the molecular level to treat
cancer (Schmidt-Wolf and Schmidt-Wolf, 1994, Annals of Hematology
69;273-279) or other conditions--such as immune, cardiovascular,
neurological, inflammatory or infectious disorders; antigens can be
manipulated and/or introduced to elicit an immune response--such as
genetic vaccination.
[0005] In recent years, retroviruses have been proposed for use in
gene therapy. Essentially, retroviruses are RNA viruses with a life
cycle different to that of lytic viruses. In this regard, when a
retrovirus infects a cell, its genome is converted to a DNA form.
In otherwords, a retrovirus is an infectious entity that replicates
through a DNA intermediate. More details on retroviral infection
etc. are presented later on.
[0006] There are many retroviruses and examples include: murine
leukemia virus (MLV), human inmnunodeficiency virus (HIV), equine
infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV),
Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney
murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR
MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine
leukemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), and
Avian erythroblastosis virus (AEV).
[0007] A detailed list of retroviruses may be found in Coffin et al
("Retroviruses" 1997 Cold Spring Harbour Laboratory Press Eds: J M
Coffin, S M Hughes, H E Varmus pp 758-763).
[0008] Details on the genomic structure of some retroviruses may be
found in the art. By way of example, details on HIV may be found
from the NCBI Genbank (i.e. Genome Accession No. AF033819).
[0009] All retroviruses contain three major coding domains, gag,
pol, env, which code for essential virion proteins. Nevertheless,
retroviruses may be broadly divided into two categories: namely,
"simpler" and "complex". These categories are distinguishable by
the organisation of their genomes. Simple retroviruses usually
carry only this elementary information. In contrast, complex
retroviruses also code for additional regulatory proteins derived
from multiple spliced messages.
[0010] Retroviruses may even be further divided into seven groups.
Five of these groups represent retroviruses with oncogenic
potential. The remaining two groups are the lentiviruses and the
spumaviruses. A review of these retroviruses presented in
"Retroviruses" (1997 Cold Spring Harbour Laboratory Press Eds: J M
Coffin, S M Hughes, H E Varmus pp 1-25).
[0011] All oncogenic members except the human T-cell leukemia
virus-bovine leukemia virus (HTLV-BLV) are simple retroviruses.
HTLV, BLV and the lentiviruses and spumaviruses are complex. Some
of the best studied oncogenic retroviruses are Rous sarcoma virus
(RSV), mouse mammary tumour virus (MMTV) and murine leukemia virus
(MLV) and the human T-cell leukemia virus (HTLV).
[0012] The lentivirus group can be split even further into
"primate" and "non-primate". Examples of primate lentiviruses
include the human immunodeficiency virus (HIV), the causative agent
of human auto-immunodeficiency syndrome (AIDS), and the simian
immunodeficiency virus (SIV). The non-primate lentiviral group
includes the prototype "slow virus" visna/maedi virus (VMV), as
well as the related caprine arthritis-encephalitis virus (CAEV),
equine infectious anaemia virus (EIAV) and the more recently
described feline immunodeficiencey virus (FIV) and bovine
immunodeficiencey virus (BIV).
[0013] A critical distinction between the lentivirus family and
other types of retroviruses is that lentiviruses have the
capability to infect both dividing and non-dividing cells (Lewis et
al 1992 EMBO. J 11; 3053-3058, Lewis and Emerman 1994 J. Virol. 68:
510-516). In contrast, other retroviruses--such as MLV--are unable
to infect non-dividing cells such as those that make up, for
example, muscle, brain, lung and liver tissue.
[0014] During the process of infection, a retrovirus initially
attaches to a specific cell surface receptor. On entry into the
susceptible host cell, the retoviral RNA genome is then copied to
DNA by the virally encoded reverse transcriptase which is carried
inside the parent virus. This DNA is transported to the host cell
nucleus where it subsequently integrates into the host genome. At
this stage, it is typically referred to as the provirus. The
provirus is stable in the host chromosome during cell division and
is transcribed like other cellular proteins. The provirus encodes
the proteins and packaging machinery required to make more virus,
which can leave the cell by a process sometimes called
"budding".
[0015] As already indicated, each retroviral genome comprises genes
called gag, pol and env which code for virion proteins and enzymes.
These genes are flanked at both ends by regions called long
terminal repeats (LTRs). The LTRs are responsible for proviral
integration, and transcription. They also serve as
enhancer-promoter sequences. In other words, the LTRs can control
the expression of the viral gene. Encapsidation of the retroviral
RNAs occurs by virtue of a psi sequence located at the 5' end of
the viral genome.
[0016] The LTRs themselves are indentical sequences that can be
divided into three elements, which are called U3, R and U5. U3 is
derived from the sequence unique to the 3' end of the RNA. R is
derived from a sequence repeated at both ends of the RNA and U5 is
derived from the sequence unique to the 5' end of the RNA. The
sizes of the three elements can vary considerably among different
retroviruses.
[0017] For ease of understanding, a simple, generic diagram (not to
scale) of a retroviral genome showing the elementary features of
the LTRs, gag, pol and env is presented in FIG. 6.
[0018] For the viral genome, the site of transcription initiation
is at the boundary between U3 and R in the left hand side LTR (as
shown in FIG. 6) and the site of poly (A) addition (termination) is
at the boundary between R and U5 in the right hand side LTR (as
shown in FIG. 6). U3 contains most of the transcriptional control
elements of the provirus, which include the promoter and multiple
enhancer sequences responsive to cellular and in some cases, viral
transcriptional activator proteins. Some retroviruses have any one
or more of the following genes that code for proteins that are
involved in the regulation of gene expression: tat, rev, tax and
rex.
[0019] With regard to the structural genes gag, pol and env
themselves, gag encodes the internal structural protein of the
virus. Gag is proteolytically processed into the mature proteins MA
(matrix), CA (capsid), NC (nucleocapsid). The gene pol encodes the
reverse transcriptase (RT), which contains both DNA polymerase, and
associated RNase H activities and integrase (IN), which mediates
replication of the genome. The gene env encodes the surface (SU)
glycoprotein and the transmembrane (TM) protein of the virion,
which form a complex that interacts specifically with cellular
receptor proteins. This interaction leads ultimately to fusion of
the viral membrane with the cell membrane.
[0020] The envelope glycoprotein complex of retroviruses includes
two polypeptides: an external, glycosylated hydrophilic polypeptide
(SU) and a membrane-spanning protein (TM). Together, these form an
oligomeric "knob" or "knobbed spike" on the surface of a virion.
Both polypeptides are encoded by the env gene and are synthesised
in the form of a polyprotein precursor that is proteolytically
cleaved during its transport to the cell surface. Although
uncleaved Env proteins are able to bind to the receptor, the
cleavage event itself is necessary to activate the fusion potential
of the protein, which is necessary for entry of the virus into the
host cell. Typically, both SU and TM proteins are glycosylated at
multiple sites. However, in some viruses, exemplified by MLV, TM is
not glycosylated.
[0021] Although the SU and TM proteins are not always required for
the assembly of enveloped virion particles as such, they do play an
essential role in the entry process. In this regard, the SU domain
binds to a receptor molecule--often a specific receptor
molecule--on the target cell. It is believed that this binding
event activates the membrane fusion-inducing potential of the TM
protein after which the viral and cell membranes fuse. In some
viruses, notably MLV, a cleavage event--resulting in the removal of
a short portion of the cytoplasmic tail of TM--is thought to play a
key role in uncovering the full fusion activity of the protein
(Brody et al 1994 J. Virol. 68: 4620-4627, Rein et al 1994 J.
Virol. 68: 1773-1781). This cytoplasmic "tail", distal to the
membrane-spanning segment of TM remains on the internal side of the
viral membrane and it varies considerably in length in different
retroviruses.
[0022] Thus, the specificity of the SU/receptor interaction can
define the host range and tissue tropism of a retrovirus. In some
cases, this specificity may restrict the transduction potential of
a recombinant retroviral vector. For this reason, many gene therapy
experiments have used MLV. A particular MLV that has an envelope
protein called 4070A is known as an amphotropic virus, and this can
also infect human cells because its envelope protein "docks" with a
phosphate transport protein that is conserved between man and
mouse. This transporter is ubiquitous and so these viruses are
capable of infecting many cell types. In some cases however, it may
be beneficial, especially from a safety point of view, to
specifically target restricted cells. To this end, several groups
have engineered a mouse ecotropic retrovirus, which unlike its
amphotropic relative normally only infects mouse cells, to
specifically infect particular human cells. Replacement of a
fragment of an envelope protein with an erythropoietin segement
produced a recombinant retrovirus which then bound specifically to
human cells that expressed the erythropoietin receptor on their
surface, such as red blood cell precursors (Maulik and Patel 1997
"Molecular Biotechnology: Therapeutic Applications and Strategies"
1997. Wiley-Liss Inc. pp 45.).
[0023] In addition to gag, pol and env, the complex retroviruses
also contain "accessory" genes which code for accessory or
auxillary proteins. Accessory or auxillary proteins are defined as
those proteins encoded by the accessory genes in addition to those
encoded by the usual replicative or structural genes, gag, pol and
env. These accessory proteins are distinct from those involved in
the regulation of gene expression, like those encoded by tat, rev,
tax and rex. Examples of accessory genes include one or more of
vif, vpr, vpx, vpu and nef. These accessory genes can be found in,
for example, HIV (see, for example pages 802 and 803 of
"Retroviruses" Ed. Coffin et al Pub. CSHL 1997). Non-essential
accessory proteins may function in specialised cell types,
providing functions that are at least in part duplicative of a
function provided by a cellular protein. Typically, the accessory
genes are located between pol and env, just downstream from env
including the U3 region of the LTR or overlapping portions of the
env and each other.
[0024] The complex retroviruses have evolved regulatory mechanisms
that employ virally encoded transcriptional activators as well as
cellular transcriptional factors. These trans-acting viral proteins
serve as activators of RNA transcription directed by the LTRs. The
transcriptional trans-activators of the lentiviruses are encoded by
the viral tat genes. Tat binds to a stable, stem-loop, RNA
secondary structure, referred to as TAR, one function of which is
to apparently optimally position Tat to trans-activate
transcription.
[0025] As mentioned earlier, retroviruses have been proposed as a
delivery system (other wise expressed as a delivery vehicle or
delivery vector) for inter alia the transfer of a NOI, or a
plurality of NOIs, to one or more sites of interest. The transfer
can occur in vitro, ex vivo, in vivo, or combinations thereof. When
used in this fashion, the retroviruses are typically called
retroviral vectors or recombinant retroviral vectors. Retroviral
vectors have even been exploited to study various aspects of the
retrovirus life cycle, including receptor usage, reverse
transcription and RNA packaging (reviewed by Miller, 1992 Curr Top
Microbiol Immunol 158:1-24).
[0026] In a typical recombinant retroviral vector for use in gene
therapy, at least part of one or more of the gag, pol and env
protein coding regions may be removed from the virus. This makes
the retroviral vector replication-defective. The removed portions
may even be replaced by a NOI in order to generate a virus capable
of integrating its genome into a host genome but wherein the
modified viral genome is unable to propagate itself due to a lack
of structural proteins. When integrated in the host genome,
expression of the NOI occurs--resulting in, for example, a
therapeutic effect. Thus, the transfer of a NOI into a site of
interest is typically achieved by: integrating the NOI into the
recombinant viral vector; packaging the modified viral vector into
a virion coat; and allowing transduction of a site of
interest--such as a targetted cell or a targetted cell
population.
[0027] It is possible to propagate and isolate quantities of
retroviral vectors (e.g. to prepare suitable titres of the
retroviral vector) for subsequent transduction of, for example, a
site of interest by using a combination of a packaging or helper
cell line and a recombinant vector.
[0028] In some instances, propagation and isolation may entail
isolation of the retroviral gag, pol and env genes and their
separate introduction into a host cell to produce a "packaging cell
line". The packaging cell line produces the proteins required for
packaging retroviral DNA but it cannot bring about encapsidation
due to the lack of a psi region. However, when a recombinant vector
carrying a NOI and a psi region is introduced into the packaging
cell line, the helper proteins can package the psi-positive
recombinant vector to produce the recombinant virus stock. This can
be used to infect cells to introduce the NOI into the genome of the
cells. The recombinant virus whose genome lacks all genes required
to make viral proteins can infect only once and cannot propagate.
Hence, the NOI is introduced into the host cell genome without the
generation of potentially harmful retrovirus. A summary of the
available packaging lines is presented in "Retroviruses" (1997 Cold
Spring Harbour Laboratory Press Eds: J M Coffin, S M Hughes, H E
Varmus pp 449).
[0029] However, this technique can be problematic in the sense that
the titre levels are not always at a satisfactory level.
Nevertheless, the design of retroviral packaging cell lines has
evolved to address the problem of inter alia the spontaneous
production of helper virus that was frequently encountered with
early designs. As recombination is greatly facilitated by homology,
reducing or eliminating homology between the genomes of the vector
and the helper has reduced the problem of helper virus
production.
[0030] More recently, packaging cells have been developed in which
the gag, pol and env viral coding regions are carried on separate
expression plasmids that are independently transfected into a
packaging cell line so that three recombinant events are required
for wild type viral production. This strategy is sometimes referred
to as the three plasmid transfection method (Soneoka et al 1995
Nucl. Acids Res. 23: 628-633).
[0031] Transient transfection can also be used to measure vector
production when vectors are being developed. In this regard,
transient transfection avoids the longer time required to generate
stable vector-producing cell lines and is used if the vector or
retroviral packaging components are toxic to cells. Components
typically used to generate retroviral vectors include a plasmid
encoding the Gag/Pol proteins, a plasmid encoding the Env protein
and a plasmid containing a NOI. Vector production involves
transient transfection of one or more of these components into
cells containing the other required components. If the vector
encodes toxic genes or genes that interfere with the replication of
the host cell, such as inhibitors of the cell cycle or genes that
induce apotosis, it may be difficult to generate stable
vector-producing cell lines, but transient transfection can be used
to produce the vector before the cells die. Also, cell lines have
been developed using transient infection that produce vector titre
levels that are comparable to the levels obtained from stable
vector-producing cell lines (Pear et al 1993, PNAS
90:8392-8396).
[0032] In view of the toxicity of some HIV proteins--which can make
it difficult to generate stable HIV-based packaging cells--HIV
vectors are usually made by transient transfection of vector and
helper virus. Some workers have even replaced the HIV Env protein
with that of vesicular stomatis virus (VSV). Insertion of the Env
protein of VSV facilitates vector concentration as HIV/VSV-G
vectors with titres of 5.times.10.sup.5 (10.sup.8 after
concentration) were generated by transient transfection (Naldini et
al 1996 Science 272: 263-267). Thus, transient transfection of HIV
vectors may provide a useful strategy for the generation of high
titre vectors (Yee et al 1994 PNAS. 91: 9564-9568). A drawback,
however, with this approach is that the VSV-G protein is quite
toxic to cells.
[0033] Replacement of the env gene with a heterologous env gene is
an example of a technique or strategy called pseudotyping.
Pseudotyping is not a new phenomenon and examples may be found in
WO-A-98/05759, WO-A-98/05754, WO-A-97/17457, WO-A-96/09400,
WO-A-91/00047 and Mebatsion et al 1997 Cell 90, 841-847.
[0034] Pseudotyping can confer one or more advantages. For example,
with the lentiviral vectors, the env gene product of the HIV based
vectors would restrict these vectors to infecting only cells that
express a protein called CD4. But if the env gene in these vectors
has been substituted with env sequences from other RNA viruses,
then they may have a broader infectious spectrum (Verma and Somia
1997 Nature 389:239-242). As just described--and by way of
example--workers have pseudotyped an HIV based vector with the
glycoprotein from VSV (Verma and Somia 1997 ibid).
[0035] Also, and by way of example, the relative fragility of the
rettoviral Env protein may limit the ability to concentrate
retroviral vectors--and concentrating the virus may result in a
poor viral recovery. To some extent, this problem may be overcome
by substitution of the retroviral Env protein with the more stable
VSV-G protein allowing more efficient vector concentration with
better yields (Naldini et al 1996. Science 272:263-267).
[0036] However, pseudotyping with VSV-G protein may not always be
desirable. This is because the VSV-G protein is cytotoxic (Chen et
al 1996, Proc. Natl. Acad. Sci. 10057 and references cited
therein).
[0037] Hence, it is desirable to find other proteins which are
non-toxic and which can be used to pseudotype a retroviral
vector.
[0038] Thus, the present invention seeks to provide an improved
retroviral vector.
[0039] According to a first aspect of the present invention there
is provided a retroviral delivery system capable of transducing a
target site, wherein the retroviral delivery system comprises a
first nucleotide sequence coding for at least a part of an envelope
protein; and one or more other nucleotide sequences derivable from
a retrovirus that ensure transduction of the target site by the
retroviral delivery system; wherein the first nucleotide sequence
is heterologous with respect to at least one of the other
nucleotide sequences; and wherein the first nucleotide sequence
codes for at least a part of a rabies G protein or a mutant,
variant, derivative or fragment thereof that is capable of
recognising the target site.
[0040] The retroviral delivery system of the present invention can
comprise one entity. Alternatively, the retroviral delivery system
of the present invention can comprise a plurality of entities which
in combination provide the retroviral delivery system of the
present invention. Examples of these viral delivery systems can
include but are not limited to herpesviruses and adenoviruses as
described in Savard et al 1997, J Virol 71(5): 4111-4117; Feng et
al 1997, Nat Biotechnol 15(9): 866-870; and UK Patent Application
No. 9720465.5.
[0041] The term "derivable" is used in its normal sense as meaning
the sequence need not necessarily be obtained from a retrovirus but
instead could be derived therefrom. By way of example, the sequence
may be prepared synthetically or by use of recombinant DNA
techniques.
[0042] According to a second aspect of the present invention there
is provided a viral particle obtainable from the retroviral
delivery system according to the present invention.
[0043] According to a third aspect of the present invention there
is provided a retroviral vector wherein the retroviral vector is
the retroviral delivery system according to the first aspect of the
present invention or is obtainable therefrom.
[0044] According to a fourth aspect of the present invention there
is provided a cell transduced with a retroviral delivery system
according to the present invention, or a viral particle according
to the present invention, or a retroviral vector according to the
present invention.
[0045] According to a fifth aspect of the present invention there
is provided a retroviral delivery system according to the present
invention, or a viral particle according to the present invention,
or a retroviral vector according to the present invention, for use
in medicine.
[0046] According to a sixth aspect of the present invention there
is provided the use of a retroviral delivery system according to
the present invention, or a viral particle according to the present
invention, or a retroviral vector according to the present
invention in the manufacture of a pharmaceutical composition to
deliver a NOI to a target site in need of same.
[0047] According to a seventh aspect of the present invention there
is provided a method comprising contacting a cell with a retroviral
delivery system according to the present invention, or a viral
particle according to the present invention, or a retroviral vector
according to the present invention.
[0048] According to an eighth aspect of the present invention there
is provided a vector for preparing a retroviral delivery system
according to the present invention, or a viral particle according
to the present invention, or a retroviral vector according to the
present invention, wherein the vector comprises a nucleotide
sequence coding for at least a part of the rabies G protein or a
mutant, variant, derivative or fragment thereof.
[0049] According to a ninth aspect of the present invention there
is provided a plasmid for preparing a retroviral delivery system
according to the present invention, or a viral particle according
to the present invention, or a retroviral vector according to the
present invention, wherein the plasmid comprises a nucleotide
sequence coding for at least a part of the rabies G protein or a
mutant, variant, derivative or fragment thereof.
[0050] According to a tenth aspect of the present invention there
is provided a plurality of plasmids, wherein at least one plasmid
is a plasmid according to the present invention and wherein at
least one other plasmid comprises one or more nucleotide sequences
derivable from a retrovirus.
[0051] According to an eleventh aspect of the present invention
there is provided the use of a rabies G protein to pseudotype a
retrovirus or a retroviral vector or a retroviral particle in order
to affect the infectious profile of the retrovirus or the
retroviral vector or the retroviral particle.
[0052] According to a twelth aspect of the present invention there
is provided the use of a rabies G protein to pseudotype a
retrovirus or a retroviral vector or a retroviral particle in order
to affect the host range and/or cell tropism of the retrovirus or
the retroviral vector or the retroviral particle.
[0053] According to a thirteenth aspect of the present invention
there is provided a retrovirus or a retroviral vector or a
retroviral particle pseudotyped with a rabies G protein.
[0054] According to a fourteenth aspect of the present invention
there is provided a retroviral delivery system comprising a
heterologous env region, wherein the heterologous env region
comprises at least a part of a nucleotide sequence coding for a
rabies G protein.
[0055] According to a fifteenth aspect of the present invention
there is provided a retroviral delivery system comprising a
heterologous env region, wherein the heterologous env region
comprises a nucleotide sequence coding for a rabies G protein.
[0056] Preferably the first nucleotide sequence codes for all of a
rabies G protein or a mutant, variant, derivative or fragment
thereof.
[0057] Preferably at least one of the other nucleotide sequences is
derivable from a lentivirus or an oncoretrovirus.
[0058] Preferably the other nucleotide sequences are derivable from
a lentivirus or an oncoretrovirus.
[0059] Preferably the other nucleotide sequences are derivable from
MLV, HIV or EIAV.
[0060] Preferably the retroviral delivery system comprises at least
one NOI.
[0061] Preferably the NOI has a therapeutic effect or codes for a
protein that has a therapeutic effect.
[0062] Preferably the target site is a cell.
[0063] Thus the present invention provides a retroviral vector
having a heterologous envelope protein. This retroviral vector is
useful in gene therapy.
[0064] An important aspect of the present invention is the
pseudotyping of a retrovirus, and/or a retroviral vector derivable
or based on same, with a nucleotide sequence coding for a rabies
protein, especially the rabies G protein. Here, the term
pseudotyping means incorporating in at least a part of, or
substituting a part of, or replacing all of, an env gene of a viral
genome, or of a viral vector, a protein from another virus.
[0065] Teachings on the rabies G protein, as well as mutants
thereof, may be found in Rose et al., 1982 J. Virol. 43: 361-364,
Hanham et al., 1993 J. Virol., 67, 530-542, Tuffereau et al., 1998
J. Virol., 72, 1085-1091, Kucera et al., 1985 J. Virol 55, 158-162,
Dietzschold et al., 1983 PNAS 80, 70-74, Seif et al., 1985
J.Virol., 53, 926-934, Coulon et al., 1998 J. Virol., 72, 273-278,
Tuffereau et al., 1998 J. Virol., 72, 1085-10910, Burger et al.,
1991 J.Gen. Virol. 72. 359-367, Gaudin et al 1995 J Virol 69,
5528-5534, Benmansour et al 1991 J Virol 65, 4198-4203, Luo et al
1998 Microbiol Immunol 42, 187-193, Coll 1997 Arch Virol 142,
2089-2097, Luo et al 1997 Virus Res 51, 35-41, Luo et al 1998
Microbiol Immunol 42, 187-193, Coll 1995 Arch Virol 140, 827-851,
Tuchiya et al 1992 Virus Res 25, 1-13, Morimoto et al 1992 Virology
189, 203-216, Gaudin et al 1992 Virology 187, 627-632, Whitt et al.
1991 Virology 185, 681-688, Dietzschold et al 1978 J Gen Virol 40,
131-139, Dietzschold et al 1978 Dev Biol Stand 40, 45-55,
Dietzschold et al 1977 J Virol 23, 286-293, and Otvos et al 1994
Biochim Biophys Acta 1224, 68-76. A rabies G protein is also
described in EP-A-0445625.
[0066] The use of rabies G protein according to the invention
provides vectors which in vivo preferentially transduce targetted
cells which rabies virus preferentially infects. This includes in
particular neuronal target cells in vivo. For a neuron-targeted
vector, rabies G from a pathogenic strain of rabies such as ERA may
be particularly effective. On the other hand rabies G protein
confers a wider target cell range in vitro including nearly all
mammalian and avian cell types tested (Seganti et al., 1990 Arch
Virol. 34,155-163; Fields et al., 1996 Fields Virology, Third
Edition, vol. 2, Lippincott-Raven Publishers, Philadelphia, New
York). It is likely that it will be found also to confer an ability
to infect other cell types which will be of interest. Thus, the use
of rabies G protein according to the invention also enables the
provision of vectors which transduce a wide variety of cell types
in vitro and also in vivo. The different tropism of rabies virus in
vivo and in vitro is thought to be due to the ability of rabies G
to bind to a series of receptors, some of which are only active in
vitro.
[0067] Alternatively, the tropism of the pseudotyped vector
particles according to the invention may be modified by the use of
a mutant rabies G which is modified in the extracellular domain.
Rabies G protein has the advantage of being mutatable to restrict
target cell range. The uptake of rabies virus by target cells in
vivo is thought to be mediated by the acetylcholine receptor (AchR)
but there may be other receptors to which in binds in vivo (Hanham
et al., 1993 J. Virol., 67, 530-542; Tuffereau et al., 1998 J.
Virol., 72, 1085-1091). The effects of mutations in antigenic site
III of the rabies G protein on virus tropism have been
investigated, this region is not thought to be involved in the
binding of the virus to the acetylcholine receptor (Kucera et al.,
1985 J. Virol 55, 158-162; Dietzschold et al., 1983 Proc Natl Acad
Sci 80, 70-74; Seif et al., 1985 J.Virol., 53, 926-934; Coulon et
al., 1998 J. Virol., 72, 273-278; Tuffereau et al., 1998 J. Virol.,
72, 1085-10910). For example a mutation of the arginine at amino
acid 333 in the mature protein to glutamine can be used to restrict
viral entry to olfactory and peripheral neurons in vivo while
reducing propagation to the central nervous system. These viruses
were able to penetrate motorneurons and sensory neurons as
efficiently as the wt virus, yet transneuronal transfer did not
occur (Coulon et al., 1989, J. Virol. 63, 3550-3554). Viruses in
which amino acid 330 has been mutated are further attenuated, being
unable to to infect either motorneurons or sensory neurons after
intramuscular injection (Coulon et al., 1998 J. Virol., 72,
273-278).
[0068] Alternatively or additionally, rabies G proteins from
laboratory passaged strains of rabies may be used. These can be
screened for alterations in tropism. Such strains include the
following: TABLE-US-00001 Genbank accession number Rabies Strain
J02293 ERA U52947 COSRV U27214 NY 516 U27215 NY771 U27216 FLA125
U52946 SHBRV M32751 HEP-Flury
[0069] By way of example, the ERA strain is a pathogenic strain of
rabies and the rabies G protein from this strain can be used for
transduction of neuronal cells. The sequence of rabies G from the
ERA strains is in the GenBank database (accession number J02293).
This protein has a signal peptide of 19 amino acids and the mature
protein begins at the lysine residue 20 amino acids from the
translation initiation methionine. The HEP-Flury strain contains
the mutation from arginine to glutamineat amino acid position 333
in the mature protein which correlates with reduced pathogenicity
and which can be used to restrict the tropism of the viral
envelope.
[0070] An example of a rabies G protein is shown as SEQ ID No. 2
and its coding sequence is presented as SEQ ID No. 1. The present
invention covers variants, homologues or derivatives of those
sequences.
[0071] The terms "variant", "homologue" or "fragment" in relation
to the amino acid sequence for the preferred enzyme of the present
invention include any substitution of, variation of, modification
of, replacement of, deletion of or addition of one (or more) amino
acid from or to the sequence providing the resultant protein has G
protein activity and/or G protein characteristics or profile,
preferably being at least as biologically active as the G protein
shown as SEQ ID No. 2. In particular, the term "homologue" covers
homology with respect to structure and/or function. With respect to
sequence homology, preferably there is at least 75%, more
preferably at least 85%, more preferably at least 90% homology to
the sequence shown as SEQ ID No. 2. More preferably there is at
least 95%, more preferably at least 98%, homology to the sequence
shown as SEQ ID No. 2.
[0072] The terms "variant", "homologue" or "fragment" in relation
to the nucleotide sequence coding for the preferred enzyme of the
present invention include any substitution of, variation of,
modification of, replacement of, deletion of or addition of one (or
more) nucleic acid from or to the sequence providing the resultant
nucleotide sequence codes for or is capable of coding for a protein
having G protein activity and/or G protein characteristics or
profile, preferably being at least as biologically active as the G
protein encoded by the sequences shown as SEQ ID No. 1. In
particular, the term "homologue" covers homology with respect to
structure and/or function providing the resultant nucleotide
sequence codes for or is capable of coding for a protein having G
protein activity and/or G protein characteristics or profile. With
respect to sequence homology, preferably there is at least 75%,
more preferably at least 85%, more preferably at least 90% homology
to the sequence shown as SEQ ID No. 1. More preferably there is at
least 95%, more preferably at least 98%, homology to the sequence
shown as SEQ ID No. 1.
[0073] In particular, the term "homology" as used herein may be
equated with the term "identity". Relative sequence homology (i.e.
sequence identity) can be determined by commercially available
computer programs that can calculate % homology between two or more
sequences. A typical example of such a computer program is
CLUSTAL.
[0074] The terms "variant", "homologue" or "fragment" are
synonymous with allelic variations of the sequences.
[0075] The term "variant" also encompasses sequences that are
complementary to sequences that are capable of hybridising to the
nucleotide sequence presented herein. Preferably, the term
"variant" encompasses sequences that are complementary to sequences
that are capable of hybridising under stringent conditions (e.g.
65.degree. C. and 0.1 SSC {1.times.SSC=0.15 M NaCl, 0.015 Na.sub.3
citrate pH 7.0}) to the nucleotide sequence presented herein.
[0076] The present invention also covers nucleotide sequences that
can hybridise to the nucleotide sequence of the present invention
(including complementary sequences of those presented herein). In a
preferred aspect, the present invention covers nucleotide sequences
that can hybridise to the nucleotide sequence of the present
invention under stringent conditions (e.g. 65.degree. C. and 0.1
SSC) to the nucleotide sequence presented herein (including
complementary sequences of those presented herein).
[0077] A major advantage of using the rabies glycoprotein in
comparison to the VSV glycoprotein is the detailed knowledge of its
toxicity to man and other animals due to the extensive use of
rabies vaccines. In particular phase 1 clinical trials have been
reported on the use of rabies glycoprotein expressed from a
canarypox recombinant virus as a human vaccine (Fries et al., 1996
Vaccine 14, 428-434), these studies concluded that the vaccine was
safe for use in humans.
[0078] The retroviral vectors of the present invention are useful
for the delivery of one or more NOIs to cells in vivo and in vitro,
in particular the delivery of therapeutically active NOI(s). One or
more selected NOI(s) may be incorporated in the vector genome for
expression in the target cell. The NOI(s) may have one or more
expression control sequences of their own, or their expression may
be controlled by the vector LTRs. For appropriate expression of the
NOI(s), a promoter may be included in or between the LTRs which is
preferentially active under certain conditions or in certain cell
types. The NOI may be a sense sequence or an antisense sequence.
Furthermore, if there is a plurality of NOIs then those NOIs may be
sense sequences or antisense sequences or combinations thereof.
[0079] The retroviral vector genome of the present invention may
generally comprise LTRs at the 5' and 3' ends, one or more NOI(s)
including therapeutically active genes and/or marker genes, or
suitable insertion sites for inserting one or more NOI(s), and a
packaging signal to enable the genome to be packaged into a vector
particle in a producer cell. There may even be suitable primer
binding sites and integration sites to allow reverse transcription
of the vector RNA to DNA, and integration of the proviral DNA into
the target cell genome. In a preferred embodiment, the retroviral
vector particle has a reverse transcription system (compatible
reverse transcription and primer binding sites) and an integration
system (compatible integrase and integration sites).
[0080] Thus, in accordance with the present invention, it is
possible to manipulate the viral genome or the retroviral vector
nucleotide sequence, so that viral genes are replaced or
supplemented with one or more NOIs. The NOI(s) may be any one or
more of selection gene(s), marker gene(s) and therapeutic gene(s).
Many different selectable markers have been used successfully in
retroviral vectors. These are reviewed in "Retroviruses" (1997 Cold
Spring Harbour Laboratory Press Eds: J M Coffin, S M Hughes, H E
Varmus pp 444) and include, but are not limited to, the bacterial
neomycin and hygromycin phosphotransferase genes which confer
resistance to G418- and hygromycin respectively; a mutant mouse
dihydrofolate reductase gene which confers resistance to
methotrexate; the bacterial gpt gene which allows cells to grow in
medium containing mycophenolic acid, xanthine and aminopterin; the
bacterial hisD gene which allows cells to grow in medium without
histidine but containing histidinol; the multidrug resistance gene
(mdr) which confers resistance to a variety of drugs; and the
bacterial genes which confer resistance to puromycin or phleomycin.
All of these markers are dominant selectable and allow chemical
selection of most cells expressing these genes.
[0081] In accordance with the present invention, the NOI can be a
therapeutic gene--in the sense that the gene itself may be capable
of eliciting a therapeutic effect or it may code for a product that
is capable of eliciting a therapeutic effect.
[0082] Non-limiting examples of therapeutic NOIs include genes
encoding tumour supressor proteins, cytokines, anti-viral proteins,
immunomodulatory molecules, antibodies, engineered
immunoglobulin-like molecules, fusion proteins, hormones, membrane
proteins, vasoactive proteins or peptides, growth factors,
ribozymes, antisense RNA, enzymes, pro-drugs, such as pro-drug
activating enzymes, cytotoxic agents, and enzyme inhibitors.
[0083] Examples of prodrugs include but are not limited to
etoposide phosphate (used with alkaline phosphatase;
5-fluorocytosine (with cytosine deaminase);
Doxorubin-N-p-hydroxyphenoxyacetamide (with Penicillin-V-Amidase);
Para-N-bis (2-chloroethyl)aminobenzoyl glutamate (with
Carboxypeptidase G2); Cephalosporin nitrogen mustard carbamates
(with B-lactamase); SR4233 (with p450 reductase); Ganciclovir (with
HSV thymidine kinase); mustard pro-drugs with nitroreductase and
cyclophosphamide or ifosfamide (with cytochrome p450).
[0084] Diseases which may be treated include, but are not limited
to cancer, heart disease, stroke, neurodegenerative disease,
arthritis, viral infection, bacterial infection, parasitic
infection, diseases of the immune system, viral infection, tumours,
blood clotting disorders, and genetic diseases--such as chronic
granulomatosis, Lesch-Nyhan sysndrome, Parkinson's disease,
empysema, phenylketonuria, sickle cell anaemia, .alpha.-thalasemia,
.beta.-thalasemia, Gaucher disease.
[0085] Target cells for gene therapy using retroviral vectors
include but are not limited to haematopoietic cells, (including
monocytes, macrophages, lymphocytes, granulocytes, or progenitor
cells of any of these); endothelial cells, tumour cells, stromal
cells, astrocytes, or glial cells, muscle cells, epithelial cells,
neurons, fibroblasts, hepatocyte. astrocyte, and lung cells.
[0086] Within the retroviral vector of the present invention, the
one or more NOIs can be under the transcriptional control of the
viral LTRs. Alternatively, a combination of enhancer-promoter
elements can be present in order to achieve higher levels of
expression. The promoter-enhancer elements are preferably strongly
active or capable of being strongly induced in the target cells. An
example of a strongly active promoter-enhancer combination is a
human cytomegalovirus (HCMV) major intermediate early (MIE)
promoter/enhancer combination. The promoter-enhancer combination
may be tissue or temporally restricted in their activity. Examples
of a suitable tissue restricted promoter-enhancer combinations are
those which are highly active in tumour cells such as a
promoter-enhancer combination from a MUC1 gene or a CEA gene.
[0087] Hypoxia or ischaemia regulatable expression may also be
particularly useful under certain circumstances. Hypoxia is a
powerful regulator of gene expression in a wide range of different
cell types and acts by the induction of the activity of
hypoxia-inducible transcription factors such as hypoxia inducible
factor-1 (HIF-1) (Wang and Semenza 1993 PNAS. (USA) 90: 430) which
bind to cognate DNA recognition sites, the hypoxia responsive
elements (HREs) on various gene promoters. A multirmeric form of
HRE from the mouse phosphoglycerate kinase-1 (PGK-1) gene has been
used to control expression of both marker and therapeutic genes by
human fibrosarcoma cells in response to hypoxia in vitro and within
solid tumours in vivo (Firth et al 1994, PNAS 91(14): 6496-6500;
Dachs et al 1997 Nature Med. 5: 515). Alternatively, the fact that
glucose deprivation is also present in ischaemic areas of tumours
can be used to activate heterologous gene expression, especially in
tumours. A truncated 632 base pair sequence of the grp 78 gene
promoter, known to be activated specifically by glucose
deprivation, has been shown to be capable of driving high level
expression of a reporter gene in murine tumours in vivo (Gazit et
al 1995 Cancer Res. 55: 1660.).
[0088] The retroviral vector genomes of the present invention for
subsequent use in gene therapy preferably contain the minimum
retroviral material necessary to function efficiently as vectors.
The purpose of this is to allow space for the incorporation of the
NOI(s), and for safety reasons. Retroviral vector genomes are
preferably replication defective due to the absence of functional
genes encoding one or more of the structural (or packaging)
components encoded by the gag-pol and env genes. The absent
components required for particle production are provided in trans
in the producer cell. The absence of virus structural components in
the genome also means that undesirable immune responses generated
against virus proteins expressed in the target cell are reduced or
avoided. Furthermore, possible reconstruction of infectious viral
particles is preferably avoided where in vivo use is contemplated.
Therefore, the viral structural components are preferably excluded
from the genome as far as possible, in order to reduce the chance
of any successful recombination.
[0089] The retroviral vector particles of the present invention are
typically generated in a suitable producer cell. Producer cells are
generally mammalian cells but can be for example insect cells. A
producer cell may be a packaging cell containing the virus
structural genes, normally integrated into its genome. The
packaging cell is then transfected with a nucleic acid encoding the
vector genome, for the production of infective, replication
defective vector particles. Alternatively the producer cell may be
co-transfected with nucleic acid sequences encoding the vector
genome and the structural components, and/or with the nucleic acid
sequences present on one or more expression vectors such as
plasmids, adenovirus vectors, herpes viral vectors or any method
known to deliver functional DNA into target cells.
[0090] In accordance with a highly preferred embodiment of the
present invention, we surprisingly discovered that the envelope
protein from rabies virus, the rabies G protein, can efficiently
pseudotype a wide variety of retroviral vectors. These include not
only vectors constructed from murine oncoretroviruses such as MLV,
but also vectors constructed from primate lentiviruses such as HIV
and from non-primate lentiviruses such as equine infectious anaemia
virus (EIAV).
[0091] In one embodiment, the vector of the present invention is
constructed from or is derivable from a lentivirus. This has the
advantage that the vector may be capable of transducing
non-dividing cells and dividing cells.
[0092] Thus, the preferred retroviral vectors for pseudotyping
according to the invention are lentivirus vectors such as HIV or
EIAV vectors. These have the advantages noted above. In particular
a rabies G pseudotyped lentivirus vector having rabies virus target
cell range will be capable of transducing non-dividing cells of the
central nervous system such as neurons.
[0093] The findings of the present invention are highly surprising.
In this respect, although rabies and VSV are Rhabdoviridae, which
is a very large family containing five diverse sub-groups, they
(i.e. VSV and rabies) are in different sub-groups. Moreover, the
rabies G protein has little homology with VSV-G (Rose et al., 1982
J. Virol. 43: 361-364). The rabies G protein also has a much longer
cytoplasmic domain than VSV-G, of normally about 44 amino acids (in
length) compared with the 28 to 31 amino acid VSV-G cytoplasmic
domain. The finding that the rabies G protein is able to pseudotype
MLV is therefore unexpected, given that truncation of the 144 amino
acid HIV-1 cytoplasmic tail was required for efficient pseudotyping
of MLV particles (Mammano et al., 1997 J. Virol. 71:3341-3345). It
is also surprising that the rabies G protein can additionally
pseudotype other retroviruses such as viruses in the lentivirus
group.
[0094] The invention therefore provides in one aspect a retroviral
vector particle pseudotyped with a rabies virus G protein.
[0095] In anothet aspect, the invention provides a retroviral
vector production system comprising a nucleic acid sequence which
encodes a rabies virus G protein, a nucleic acid sequence which
encodes a retrovirus vector genome and optionally one or more
further nucleic acid sequences which encode packaging components
required for the generation of infective retroviral vector
particles containing the genome.
[0096] In a further aspect, the invention provides the use of a
rabies virus G protein to alter the target cell range of a
retroviral vector.
[0097] In another aspect, the invention provides a method of
producing retroviral vector particles having an envelope comprising
rabies virus G protein, which method comprises providing a
retroviral vector production system as described herein, in a
producer cell, subjecting the producer cell to conditions suitable
for the expression of vector particle components and the production
of vector particles, and harvesting the vector particles from the
supernatant.
[0098] In yet another aspect, the invention provides a method of
transducing a target cell with a NOI, which method comprises
contacting the cell with a retroviral vector particle as described
herein, carrying the NOI, under conditions to allow attachment to
and entry of the vector into the cell such that the NOI enters the
target cell genome.
[0099] In addition to the rabies G protein present in the envelope
of a vector according to the invention, one or more other envelope
proteins may also be present. This may include for example a native
envelope protein of the retrovirus. The use of a native envelope
protein in addition to a pseudotyping protein can be beneficial to
the stability and/or function of the envelope. It may even broaden
the infectious profile of the vector.
[0100] The present invention also provides a pharmaceutical
composition for treating an individual by gene therapy, wherein the
composition comprises a therapeutically effective amount of a
retroviral vector according to the present invention. The
pharmaceutical composition may be for human or animal usage.
Typically, a physician will determine the actual dosage which will
be most suitable for an individual subject and it will vary with
the age, weight and response of the particular patient.
[0101] The composition may optionally comprise a pharmaceutically
acceptable carrier, diluent, excipient or adjuvant. The choice of
pharmaceutical carrier, excipient or diluent can be selected with
regard to the intended route of administration and standard
pharmaceutical practice. The pharmaceutical compositions may
comprise as--or in addition to--the carrier, excipient or diluent
any suitable binder(s), lubricant(s), suspending agent(s), coating
agent(s), solubilising agent(s), and other carrier agents that may
aid or increase the viral entry into the target site (such as for
example a lipid delivery system).
[0102] Where appropriate, the pharmaceutical compositions can be
administered by any one or more of: inhalation, in the form of a
suppository or pessary, topically in the form of a lotion,
solution, cream, ointment or dusting powder, by use of a skin
patch, orally in the form of tablets containing excipients such as
starch or lactose, or in capsules or ovules either alone or in
admixture with excipients, or in the form of elixirs, solutions or
suspensions containing flavouring or colouring agents, or they can
be injected parenterally, for example intracavernosally,
intravenously, intramuscularly or subcutaneously. For parenteral
administration, the compositions may be best used in the form of a
sterile aqueous solution which may contain other substances, for
example enough salts or monosaccharides to make the solution
isotonic with blood. For buccal or sublingual administration the
compositions may be administered in the form of tablets or lozenges
which can be formulated in a conventional manner.
[0103] Thus, in summation, the present invention relates to a
retroviral vector having a heterologous envelope protein, in
particular a rabies virus G protein. The present invention also
relates to a retroviral vector production system for the production
of retroviral vectors having an envelope comprising a rabies virus
G protein, as well as to methods of producing the vector and the
systems, and to methods involving the use of the vector and the
systems.
[0104] The present invention will now be described by way of
example only, and with reference to the following Figures--in
which:
[0105] FIG. 1 presents a plasmid mnap;
[0106] FIG. 2 presents a photograph of a gel;
[0107] FIG. 3 presents a set of schematic diagrams;
[0108] FIG. 4 presents a graph;
[0109] FIG. 5 presents two graphs; and
[0110] FIG. 6 presents a schematic diagram.
EXAMPLE 1
Production of Vectors Expressing Rabies G Protein and Details of
Other Vectors Used
[0111] An expression vector for rabies G was constructed by cloning
1.7 kbp Bg/II rabies G fragment (strain ERA) from pSG5rabgp (Burger
et al., 1991 J.Gen. Virol. 72. 359-367) into pSA91 (FIG. 1), a
derivative of pGW1HG (Soneoka et al 1995 Nucl. Acids Res. 23:
628-633) from which the gpt gene has been removed by digestion with
BamHI and re-ligation. This construct, pSA91RbG, allows expression
of rabies G from the human cytomegalovirus (HCMV) immediate early
gene promoter-enhancer. The plasmid was transfected, in conjunction
with pONY3 (see details for construction later) and pONY2.1nlsLacZ
(see details for construction later), into 293T cells by the method
described by Soneoka et al 1995 (ibid) and expression of rabies G
in transfected cells was confirmed by Western blotting. A VSV-G
expression plasmid, in which VSV-G was expressed under the control
of HCMV, in place of rabies G in pSA91 was used as a negative
control. Transfected cells were washed with PBS, lysed in RIPA
buffer containing 1 mM freshly prepared PMSF and total protein
concentration determined using BCA protein quantification reagent
kit (BCA Inc., USA) as per the manufacturer's specifications. 50
.mu.g of cell lysate was run on 10% SDS/PAGE. The gels were
electroblotted onto the immobilon membrane (Millipore Inc). Western
blot analysis was carried out with 17D2, a mouse monoclonal
antibody against rabies G at a dilution of 1:3000 and rabbit
pedroxidase conjugated anti-mouse IgG at a dilution of 1:1000
(Vector Laboratories, Peterborough, UK). Detection by
chemiluminescence was performed using ECL kit (Amersham
International, UK). A 68 kD band corresponding to the reported size
for rabies G is apparent in cells transfected with pSA91RbG (FIG.
2).
[0112] In all of the following examples the three plasmid
transfection method as described previously (Soneoka et al., 1995,
ibid) was used to generate pseudotyped vectors. The plasmids used
in these experiments were as follows. pHIT111 and pHIT60 express an
MLV vector containing the E.coli lacZ marker gene and MLV gag-pol
respectively (Soneoka et al., 1995). pH3Z and pGP-RRE3 are the
corresponding HIV vector components (Kim et al., 1998 J. Virol.
72:811-816). pONY2.1nlsLacZ and pONY3 are the corresponding EIAV
vector components (GB patent application 9727135.7). The important
features of these vectors are shown in FIG. 3, which includes
features of the EIAV vectors.
[0113] The description of abbreviations and labels used in FIG. 3
are as follows: TABLE-US-00002 CMV human cytomegalovirus
immediate-early enhancer/promoter region SV40 simian virus 40
enhancer and early promoter region LTR long terminal repeat R
repeat region of the LTR U3 3 prime unique sequence of the LTR
.DELTA.U3 an incomplete U3 sequence. U5 5 prime unique sequence of
the LTR .psi. genome packaging signal tat regulatory protein rev
regulatory protein RRE rev response element env gene encoding for
the envelope protein .DELTA.env env gene containing a deletion such
that a truncated protein product is produced gag region encoding
for the capsid proteins .DELTA.gag gag region containing a deletion
such that an incomplete series of capsid proteins are produced pol
region encoding for the enzymatic proteins vif viral infectivity
factor pA polyadenlyation signal lacZ gene encoding for
.beta.-galactosidase neo gene encoding for neomycin
phosphotransferase
[0114] Construction of the EIAV vectors was as follows.
[0115] An infectious proviral clone, pSPEIAV19, as described by
Payne et al. (1994, J.Gen. Virol. 75:425-9) was used as a starting
point. A plasmid, pSPEIAV.DELTA.H, was constructed by the deletion
of a HindIII fragment, 5835-6571, from the region of the plasmid
encoding for the envelope protein. A vector genome plasmid was
constructed by inserting the EIAV LTR, amplified by PCR from
pSPEIAV19, into pBluescript II KS+(Stratagene). The MluI/MluI
(216/814) fragment of pSPEIAV.DELTA.H was then inserted into the
LTR/Bluescript plasmid to generate pONY2. In addition, a BglII/NcoI
fragment within pol (1901/4949) was deleted and a nuclear
localising .beta.-galactosidase gene driven by the HCMV IE
enhancer/promoter was inserted in its place. This was designated
pONY2.1nlsLacZ.
[0116] An EIAV plasmid (pONY3) encoding the gagpol genes was then
made by inserting the MluI/MluI fragment from pONY2.DELTA.H into
the mammalian expression plasmid pCI-neo (Promega) such that the
gag-pol protein is expressed from the HCMV IE enhancer/promoter.
TABLE-US-00003 Gag-pol expression vector lacZ-containing vector
Viral vector type pHIT60 pHIT111 MLV pGP-RRE1 pH3Z HIV pONY3
pONY2.1nlsLacZ EIAV
EXAMPLE 2
Pseudotyping Retroviral Vectors With Rabies G Protein
[0117] The three plasmid transfection method as described
previously (Soneoka et al 1995) was used to generate pseudotyped
vectors. In initial experiments, 10 .mu.g of pSA91RbG was
co-transfected with 10 .mu.g each of a gag-pol expressing plasmid
and a retroviral vector capable of expression of the E. coli lac-Z
gene per well of a 6-well tissue culture dish. Pseudotyping with
VSV-G was used as a positive control for these experiments by using
10 .mu.g of pRV67, a VSV-G expression plasmid in which VSV-G was
expressed under the control of human cytomegalovirus
promoter/enhancer, in place of rabies G in pSA91.
[0118] Transfections were carried out in the human kidney cell line
293T (as described in Soneoka et al., 1995) to produce the vector
virions. Culture supernatants were harvested 36 h post transfection
and filtered through 0.45 mm pore-size filters (Millipore).
[0119] In contrast with the neuronal specificity of rabies in vivo,
it is known that laboratory strains of rabies virus can interact
with a wider variety of cell lines in vitro (Reagan and Wunner 1985
Arch. Virol. 84:277-282). Two cell lines, BHK21 cells, a baby
hamster kidney cell line and D17 cells, a dog melanoma cell line
were therefore evaluated for use as target cells for retroviral
vectors pseudotyped with rabies G.
[0120] Cells were seeded into 6-well tissue culture plates the day
before infection at 3.times.10.sup.5 cells per well. Viral
supernatant prepared by transfecting 293T cells with appropriate
plasmids to pseudotype EIAV, HIV-1 and MLV vectors as described
above was added to these cells. Polybrene (8 .mu.g/ml) was added to
each well at the time of transduction into 1 ml of the culture
supernatant used for infection. 12 hours post infection, the
culture supernatant was replaced by fresh medium. To measure the
viral titre, cells are washed, fixed and stained 48 hours post
infection.
[0121] We could observe .beta.-galactosidase positive colonies of
D17 cells in case of transfections with pSA91RbG and pRV67 with all
of the three retroviral vector constructs. There were no
.beta.-galactosidase positive colonies in transfections without
either pSA91RbG or pRV67 indicating that an envelope is required
for transduction to occur. In case of infections with BHK21 cells
we could observe .beta.-galactosidase positive colonies only in
case of MLV pseudotypes but not with the EIAV and HIV-1
pseudotypes. This inability could be due to post-binding blocks for
EIAV and HIV-1. in this cell type. These results establish that
rabies G can pseudotype EIAV, HIV and MLV vectors.
[0122] The efficiency of pseudotyping was studied by comparing the
viral titres for these pseudotyped vectors. Viral titres were
estimated from the number of .beta.-galactosidase positive colonies
(Table 1). TABLE-US-00004 TABLE 1 Relative efficiencies of
pseudotyping retroviral vectors with rabies G protein Viral
components Number of transducing Retro Corresponding Gag-pol
Envelope Resulting particles per ml as assessed viral plasmid
expression expression pseudotyped on the following cells vector
construct plasmid plasmid vectors D17 BHK-21 1 EIAV pONY2.1nlsLacZ
pONY3 pRV67 EIAV-VSVG 8.4 .times. 10.sup.4 <10.sup.1 2 EIAV
pONY2.1nlsLacZ pONY3 pSA91RbG EIAV-RbG 3.2 .times. 10.sup.4
<10.sup.1 3 HIV pH4Z pGP-RRE1 pRV67 HIV-VSVG 3.0 .times.
10.sup.4 <10.sup.1 4 HIV pH4Z pGP-RRE1 pSA91RbG HIV-RbG 6.4
.times. 10.sup.3 <10.sup.1 5 MLV pHIT111 pHIT60 pRV67 MLV-VSVG
6.3 .times. 10.sup.6 4.8 .times. 10.sup.6 6 MLV pHIT111 pHIT60
pSA91RbG MLV-RbG 1.6 .times. 10.sup.6 7.8 .times. 10.sup.6 7 Mock
-- -- -- -- <10.sup.1 <10.sup.1
[0123] Viral titre for MLV pseudotyped with rabies G is comparable
to that observed for VSV-G pseudotypes in both the cell lines
tested (4.8.times.10.sup.6 and 7.8.times.10.sup.6, in BHK21 for
VSV-G and rabies G respectively; 6.3.times.10.sup.6 and
1.6.times.10.sup.6 in D17 cells for VSV-G and rabies G
respectively).
[0124] Similar results were obtained in the case of EIAV and HIV-L
pseudotyped with VSV-G and rabies G in D17 cells. In the case of
EIAV viral titres for the vector pseudotyped with VSV-G and rabies
G were 8.4.times.10.sup.4 and 3.2.times.10.sup.4 respectively. In
HIV-1, viral titres were 3.0.times.10.sup.4 and 6.4.times.10.sup.3
in the case of pseudotypes with VSV-G and rabies G respectively.
These results indicate that rabies G is essentially as efficient as
VSV-G in pseudotyping with all of the three retroviral vectors.
[0125] Our results demonstrate that rabies G protein can pseudotype
retroviral vectors EIAV, HIV-1 and MLV with very high titres
comparable to those obtained with VSV-G.
EXAMPLE 3
Production and Characterisation of a Rabies G Protein With an
Altered Amino Acid 333
[0126] The coding sequence of the rabies glycoprotein gene in
pSA91RbG was engineered, using overlap PCR, so that the resultant
protein possesses a glutamate at position 333 rather than an
arginine. This change has been reported to cause attenuation and
altered cell tropism in rabies viruses. The primers used for
mutagenesis were as follows: TABLE-US-00005 forward primer
.sup.5'GATGCTCACTACAAGTCAGTCCAGACTTGGAATGAGA .sup.3TCCTCCC reverse
primer .sup.5'GGGAGGATCTCATTCCAAGTCTGGACTGACTTGTAG
.sup.3CAGCATC
[0127] The engineered fragment was reintroduced into pSA91Rg as a
SphI BglII fragment, the resultant plasmid being pSA91RM. The
engineered rabies G protein produced from this vector was tested
for its ability to pseudotype MLV particles. The plasmid was
transfected, in conjunction with pHIT60 and pHIT111, into 293T
cells as described by Soneoka et al 1995; pSA91Rg was used as a
positive control. The supernatants from these transfections were
harvested as previously described, and the ability of the two
envelopes to pseudotype MLV particles was assessed by their ability
to transduce either BHK-21 or a murine neuroblastoma cell line,
C-1300 clone NA (Table 2). TABLE-US-00006 TABLE 2 Characterisation
of the ability of a rabies G protein with an altered amino acid 333
to pseudotype MLV particles Viral components Number of transducing
Retro Corresponding Gag-pol Envelope Resulting particles per ml as
assessed viral plasmid expression expression pseudotyped on the
following cells vector construct plasmid plasmid vectors BHK21
C-1300 1 MLV pHIT111 pHIT60 pSA91RbG MLV-RbG 4.2 .times. 10.sup.6
6.1 .times. 10.sup.6 2 MLV pHIT111 pHIT60 pSA91RM MLV-RMG 3.1
.times. 10.sup.5 7.2 .times. 10.sup.6 3 Mock -- -- -- -- <1
<1
[0128] Although the titre obtained on BHK-21 cells, a cell line
that is commonly used to produce rabies vaccines, was lower with
engineered rabies G protein than with the wt, comparable titres
were obtained for the two envelopes on C-1300 cells. These results
indicate that the engineered protein is efficiently capable of
pseudotyping MLV particles.
EXAMPLE 4
Optimisation of Titre of Rabies G Pseudotyped Retroviral
Vectors
[0129] The amount of pSA91RbG DNA added to the 3-plasmid
transfection system was titrated against the other two components
in order to determine the optimum viral titre.
[0130] In this experiment, COS-1 cells were transfected using
CaPO.sub.4 precipitation with the plasmids, pSA91RbG, pHIT111, and
pHIT60. The latter two plasmids were used in equal amounts (8 .mu.g
per transfection per 35 mm tissue culture dish) whilst the amount
of pSA91RbG was serially reduced. The supernatants from the
transfections were harvested at 36 hours post transfection and the
number of transducing particles present was determined on HT1080
cells. The results are shown in FIG. 4. An eight-fold reduction in
the amount of pSA91RbG DNA in comparison to the other plasmids was
found to produce the highest titres. Titres overall were lower than
obtained from 293T cells in Example 1.
[0131] Titration of pSA91RbG against the two components required to
produce EIAV-based vectors was also carried out. In this case, 293T
cells were transfected using CaPO.sub.4 precipitation with 8 .mu.g
plasmid encoding the gag/pol (pONY3) and 8 .mu.g plasmid expressing
the EIAV vector encoding for .beta.-galactosidase (pONY2.1nlacZ).
Varying amounts of pSA91RbG or pRV67 were added as above to provide
vectors pseudotyped with rabies G or VSV-G respectively. The
supernatants from the transfections were harvested at 36 hours post
transfection and the numbers of transducing particles present was
determined on D17 cells. The results are shown in FIG. 5. A two- to
four-fold reduction in the amount of pSA91RbG DNA in comparison to
the other plasmids was found to produce the highest titres. No
significant reduction in titre was observed when pRV67 was used in
equal amounts to the other two plasmids.
[0132] These results show that it is possible to obtain improved
titres of rabies G pseudotyped retroviral vectors by adjusting the
relative armounts of rabies G and other vector components expressed
in the producer cell.
EXAMPLE 5
Concentration of Rabies G Pseudotyped Retroviral Vectors
[0133] We have further investigated whether we can increase the
viral titre by concentrating the viral supernatant using
ultracentrifugation (Burns et al., 1993 PNAS 90:8033-8037) obtained
a viral titre of 10.sup.9 transducing particles per ml with VSV-G
pseudotyped MLV based vector upon ultracentrifugation.
[0134] The three plasmid transfection method as described
previously (Soneoka et al., 1995) was used to generate particles
pseudotyped with either rabies G or VSV-G. Transducing particles
were harvested 36 hours after transfection, concentrated by
ultracentrifugation and titred on D17 cells. 48 hours later these
cells were stained for .beta.-galactosidase. Titres mere averaged
from three independent experiments and calculated as
.beta.-galactosidase producing units per ml. There was no more than
10% variation between experiments. It proved possible to decrease
the volume of the harvests by 130 fold with out an appreciable loss
of transducing particles for both EIAV and MLV particles
pseudotyped with either of the two envelopes (Table 3).
TABLE-US-00007 TABLE 3 The effect of concentration on rabies G
pseudotyped retroviral vectors. Viral components Retro-
Corresponding Gag-pol Envelope Resulting Titre Titre Fold Fold
viral plasmid expression expression pseudotyped before after
decrease increase Recovery vector construct plasmid plasmid vectors
concentration concentration in volume in titre (%) EIAV
pONY2.1nlsLacZ pONY3 pRV67 EIAV-VSVG 2.0 .times. 10.sup.5 2.5
.times. 10.sup.7 130 125 96 EIAV pONY2.1nlsLacZ pONY3 pSA91RbG
EIAV-RbG 1.0 .times. 10.sup.5 1.2 .times. 10.sup.7 130 120 96 EIAV
pONY2.1nlsLacZ pONY3 Mock <1 <1 130 N.A. N.A. MLV pHIT111
pHIT60 pRV67 MLV-VSVG 4.0 .times. 10.sup.5 4.8 .times. 10.sup.7 130
119 92 MLV pHIT111 pHIT60 pSA91RbG MLV-RbG 3.5 .times. 10.sup.5 4.5
.times. 10.sup.7 130 128 98 MLV pHIT111 pHIT60 Mock <1 <1 130
N.A. N.A.
[0135] These results indicated that vectors pseudotyped with rabies
G can be concentrated upon ultracentrifugation with an increase in
the vector titre comparable to that observed for VSV-G.
[0136] These properties together with the in vivo specificity of
the rabies G for neuronal cells make pseudotyping with the rabies G
an attractive proposal for easy targeting of retroviral vectors
carrying any therapeutic gene to the nervous system.
EXAMPLE 6
Selectivity of the Ability of Rabies G Pseudotypes to Transduce
Cultured Human Target Cells
[0137] The cell specificity of vectors pseudotyped with rabies G
was determined using human cell lines of neuronal and non-neuronal
origin. Pseudotyping with VSV-G was used as a positive control.
Viral supernatant prepared from three plasmid transfection was used
to infect IMR-32, a human neuroblastoma cell line and CEM-A, a
human T cell line. Viral titres are estimated from
.beta.-galactosidase positive colonies (Table 4). TABLE-US-00008
TABLE 4 Selectivity of the ability of rabies pseudotypes to
transduce cultured human target cells Viral components Number of
transducing Retro Corresponding Gag-pol Envelope Resulting
particles per ml as assessed viral plasmid expression expression
pseudotyped on the following cells vector construct plasmid plasmid
vectors IMR32 CEM-A 1 MLV pHIT111 pHIT60 pRV67 MLV-VSVG 4.9 .times.
10.sup.2 7.3 .times. 10.sup.2 2 MLV pHIT111 pHIT60 pSA91RbG MLV-RbG
3.1 .times. 10.sup.5 1.7 .times. 10.sup.1 3 Mock -- -- -- -- 0
0
[0138] MLV vector pseudotyped with rabies G and VSV-G could infect
the IMR-32 cells. However MLV vector pseudotyped with rabies G
produced titres 100 times higher (3.1.times.10.sup.5) than the same
with VSV-G (4.9.times.10.sup.3). In CEM-A cells, MLV vector
pseudotyped with rabies G gave a low titre of 1.7.times.10.sup.1.
This low efficiency was not due to the inability of MLV to
transduce these cells. This is evident by the comparatively higher
titre for the same vector when pseudotyped with VSV-G
(7.3.times.10.sup.2).
[0139] Our results demonstrate that unlike VSV-G, rabies G
pseudotypes show selectivity in their ability to transduce human
target cells, with higher transduction efficiencies in neuronal
cells than in the T-cell line.
EXAMPLE 7
The Ability of Rabies G Pseudotypes to Transduce Brain Cells in
Vitro (Primary Cultures) and in Vivo (Rat/Mouse Model Systems)
[0140] There is evidence to suggest that at least two different
receptors are used by rabies virus in vivo (Hanham et al., 1993 J.
Virol. 67:530-542; Tuffereau et al., J. Virol. 72:1085-1091), one
of these receptors may be the nicotinic acetylcholine receptor.
Detailed studies on the types of neuronal cells infected and the
spread of the virus throughout the nervous system have been carried
out with wt rabies (CVS strain) and with a double mutant of this
strain (altered at amino acids 330 and 333) in mouse model systems
(Coulon et al., 1989 J. Virol. 63:3550-3554; Lafay et al., 1991
Virology 183;320-330). These studies have shown that the spread and
range of the mutated virus is significantly restricted in
comparison to the wt.
[0141] To determine the tropism of EIAV vectors pseudotyped with
rabies G protein, the following analyses are undertaken. Adult
female AO rats are anaesthetized and stereotaxically injected with
2.times.1 .mu.l of viral stock into striatum or other brain
regions. 7 or 30 days post-injection the rats are anaesthetized and
perfused intracardially with 4% paraformaldehyde. The brains are
removed, postfixed for 24 hours, saturated in 30% sucrose and
sectioned on a freezing cryostat (50 .mu.m). Sections are strained
with X-gal solution for 3 hours to overnight, mounted on to glass
slides and analyzed with the light microscope. Identification of
specific cell types transduced is made by immunofluorescence triple
labeling using antibodies specific to neurons (NeuN or others),
astrocytes (GFAP) or oligodendrocytes (GalC) and
.beta.-galactosidase in combination with species-specific secondary
antibodies. Imaging of transduced brain regions are analyzed using
confocal microscopy.
[0142] For in vitro transduction experiments primary neurons are
put in culture from rat embryos and are grown until fully
differentiated. Viral vectors are added for 5 hours using polybrene
at 4 .mu.g/ml. Media are changed and expression analysis is carried
out 2 days later either using X-gal staining or antibodies.
EXAMPLE 8
Concentration of Rabies G Pseudotyped HIV-1 Vectors and Comparison
Between the Use of the VSV-G and Rabies Envelopes to Produce Such
Vectors
[0143] Example 5 demonstrates that EIAV vectors pseudotyped with
rabies-G can be efficiently concentrated by ultracentrifugation in
the same manner as has been reported with VSV-G pseudotyped
vectors. We have extended these observations to show that rabies G
can be used to pseudotype HIV-1 vectors, that these particles may
be efficiently concentrated by ultracentrifugation and that titres
obtained on D17 cells may be obtained that are equivalent to those
obtained with VSV-G pseudotyped vectors.
[0144] The three plasmid transfection method as described
previously (Soneoka et al., 1995) was used to generate particles
pseudotyped with either rabies G or VSV-G. The HIV-1 plasmids, pH4Z
and pGP-RRE3, used in this experiment have been discribed in Kim et
al. (1998 Journal of Virology 72: 811-816). The ratio of the
components used in this experiment was 1:1:1,
gag/pol:genome:envelope for rabies G and 1:1:0.5,
gag/pol:genome:envelope for VSV-G; this is at variance with the
ratios used for COS 1 cells, since we have found that 293T cells
are more resistant to the expression of the rabies G protein than
COS cells. Transducing particles were harvested 48 hours after
transfection, concentrated by ultracentrifugation and titred on D17
cells. 48 hours later these cells were stained for b-galactosidase.
It proved possible to increase the titre of the harvests by
approximately 100 with HIV-1 particles pseudotyped with either of
the two envelopes (Table 5). The tires obtained for vectors
pseudotyped with either of the envelopes were not significantly
different. These results indicated that vectors pseudotyped with
rabies G can be concentrated upon ultracentrifugation with an
increase in the vector titre comparable to that observed for VSV-G
and, that the two envelopes are similarly effective on D17 cells.
TABLE-US-00009 TABLE 5 Mean titre Preparation. LacZ colony forming
units per 0.5 ml. per ml. Rabies pseudotyped 3.4 .times. 10.sup.5
4.1 .times. 10.sup.5 7.5 .times. 10.sup.6 HIV-1 before
concentration. Rabies pseudotyped 3.5 .times. 10.sup.8 3.3 .times.
10.sup.8 3.6 .times. 10.sup.8 6.9 .times. 10.sup.8 HIV-1 after
concentration. VSV-G pseudotyped 3.7 .times. 10.sup.6 4.0 .times.
10.sup.6 7.7 .times. 10.sup.6 HIV-1 before concentration. VSV-G
pseudotyped 4.8 .times. 10.sup.8 4.6 .times. 10.sup.8 3.9 .times.
10.sup.8 8.9 .times. 10.sup.8 HIV-1 after concentration.
DISCUSSION AND SUMMARY
[0145] As indicated earlier, retroviruses and vectors derived from
them require a specific envelope protein in order to efficiently
transduce a target cell. The envelope protein is expressed in the
cell producing the virus or vector and becomes incorporated into
the virus or vector particles. Retrovirus particles are composed of
a proteinaceous core dervived from the gag gene that encases the
viral RNA. The core is then encased in a portion of cell membrane
that contains an envelope protein derived from the viral env gene.
The envelope protein is produced as a precursor, which is processed
into two or three units. These are the surface protein (SU) which
is completely external to the envelope, the transmembrane protein
(TM) which interacts with the SU and contains a membrane spanning
region and a cytoplasmic tail (Coffin 1992 In The Retroviridae,
Pleum Press, ed Levy). In some retroviruses a small peptide is
removed from the TM. In order to act as an effective envelope
protein, capable of binding to a target cell surface and mediating
viral entry, the envelope protein has to interact in a precise
manner with the appropriate receptor or receptors on the target
cell in such a way as to result in internalisation of the viral
particle in an appropriate manner to deliver the genome to the
correct compartment of the cell to allow a productive infection to
occur.
[0146] There have been many attempts to use the envelope derived
from one virus to package a different virus, this is known as
pseudotyping. The efficiency of pseudotyping is highly variable and
appears to be strongly influenced by interactions between the
cytoplasmic tail of the envelope and the core proteins of the viral
particle. The process by which envelope proteins are recruited into
budding virions is poorly understood, although it is known that the
process is selective since most cellular proteins are excluded from
retroviral particles (Hunter 1994 Semin. Virol. 5:71-83) and it has
been recorded in some retroviruses that budding may occur in the
absence of envelope proteins (Einfeld 1996 Curr. Top. Microbiol.
Immunol. 214:133-176; Krausslich and Welker 1996 Curr. Top.
Microbiol. Immunol. 214:25-63). There is evidence for a precise
molecular interaction between a cytoplasmic domain of the envelope
protein and the viral core in some retroviruses. Januszeski et al
(1997 J. Virol. 71: 3613-3619) have shown that minor deletions or
substitutions in the cytoplasmic tail of the murine leukemia virus
(MLV) envelope protein strongly inhibit incorporation of the
envelope protein into viral particles. In the case of HIV-1, Cosson
(1996 EMBO J. 15:5783-5788) has shown a direct interaction between
the matrix protein of HIV-1 and the cytoplasmic domain of its
envelope protein. This interaction between the matrix and envelope
protein plays a key role in the incorporation of the envelope
protein into budding HIV-1 virions. This is shown by the fact that
visna virus can only be efficiently pseudotyped with HIV-1 Env if
the amino terminus of the matrix domain of the visna virus gag
polyprotein is replaced by the equivalent HIV-1 matrix domain
(Dorfman et al., 1994 J. Virol. 68:1689-1696). However the
situation is complex, since truncation of the HIV-1 Env is required
for efficient psuedotyping of Molony murine leukemia virus (Mammano
et al., 1997 J. Virol. 71:3341-3345), whilst truncation of the
human foamy virus envelope protein reduced its ability to
pseudotype murine leukemia virus (Lindemann et al., 1997 J. Virol.
71:4815-4820). There is also an environmental component to the
interaction between the core of a retrovirus and the cytoplasmic
tail of its envelope protein. Prolonged passage of EIAV in some
cell lines results in a truncation of the glycoprotein, suggesting
that host cell factors can select for a virus on the basis of the
C-terminal domain of the envelope protein (Rice et al., 1990 J.
Virol. 1990 64: 3770-3778).
[0147] These studies and those of many other workers indicate that
it is not possible to predict that even closely related
retroviruses may be able to pseudotype each other. Further more, if
a given envelope fails to pseudotype a particular virus, it is not
possible to predict the molecular changes that would confer the
ability to pseudotype. Pseudotyping has met with some success, but
is clearly constrained by the need for compatibility between the
virus components and the heterologous envelope protein.
[0148] In the construction of retroviral vectors it is desirable to
engineer vectors with different target cell specificities to the
native virus, to enable the delivery of genetic material to an
expanded or altered range of cell types. One manner in which to
achieve this is by engineering the virus envelope protein to alter
its specificity. Another approach is to introduce a heterologous
envelope protein into the vector to replace or add to the native
envelope protein of the virus.
[0149] The MLV envelope protein is capable of pseudotyping a
variety of different retroviruses. MLV envelope protein from an
amphotropic virus allows transduction of a broad range of cell
types including human cells. However, it may not always be
desirable to have a retroviral vector which infects a large number
of cell types.
[0150] The envelope glycoprotein (G) of Vesicular stomatis virus
(VSV), a rhabdovirus, is another envelope protein which has been
shown to be capable of pseudotyping certain retroviruses. The
retrovirus MLV was successfully pseudotyped (Burns et al 1993 Proc.
Natl. Acad. Sci. USA 90: 8033-7) and resulted in a vector having an
altered host range compared to MLV in its native form. VSV-G
pseudotyped vectors have been shown to infect not only mammalian
cells, but also cell lines derived from fish, reptiles and insects
(Burns et al 1993). VSV-G protein can be used to pseudotype certain
retroviruses because its cytoplasmic tail is capable of interacting
with the retroviral cores. VSV-G and MLV envelope proteins, both
have short cytoplasmic tails, 28 to 31 and 32 amino acids
respectively, and are thus of very similar length.
[0151] The provision of a non-retroviral pseudotyping envelope such
as VSV-G protein gives the advantage that vector particles can be
concentrated to a high titre without loss of infectivity (Akkina et
al 1996 J. Virol., 70: 2581-5). Retrovirus envelope proteins are
apparently unable to withstand the shearing forces during
ultracentrifugation, probably because they consist of two
non-covalently linked subunits. The interaction between the
subunits may be disrupted by the centrifugation. In comparison the
VSV glycoprotein is composed of a single unit.
[0152] VSV-G protein pseudotyping can therefore offer potential
advantages. However, target cell specificities other than those
achieved using VSV-G protein may also be desirable. Attempts have
been made to alter the target cell range of VSV-G by engineering
target sites into the protein. These attempts (Chen et al.)
reported at the 1997 meeting on vector targeting strategies for
therapeutic gene delivery (Cold Spring Harbor, USA), have not been
successful. Other ways of altering retroviral vector target cell
range are therefore needed.
[0153] Some attempts have been made to efficiently pseudotype
retroviruses with other rhabdovirus envelopes. A single report
(Reiser et al.), at the 1997 meeting on vector targeting strategies
for therapeutic gene delivery (Cold Spring Harbor, USA), claimed
that the glycoproteins of rabies virus and Mokola virus could
pseudotype HIV-1 particles, but that "the titres obtained were far
below the ones obtained with the VSV G protein".
[0154] The present invention seeks to overcome these problems by
providing a retroviral delivery system that has been phenotyped
with a rabies protein, in particular a rabies G protein.
[0155] All publications mentioned in the above specification are
herein incorporated by reference. Various modifications and
variations of the described methods and system of the invention
will be apparent to those skilled in the art without departing from
the scope and spirit of the invention. Although the invention has
been described in connection with specific preferred embodiments,
it should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention
which are obvious to those skilled in molecular biology or related
fields are intended to be within the scope of the following claims.
Sequence CWU 1
1
4 1 1650 DNA Artificial Sequence Description of Artificial Sequence
rabies virus strain ERA 1 aggaaagatg gttcctcagg ctctcctgtt
tgtacccctt ctggtttttc cattgtgttt 60 tgggaaattc cctatttaca
cgatactaga caagcttggt ccctggagcc cgattgacat 120 acatcacctc
agctgcccaa acaatttggt agtggaggac gaaggatgca ccaacctgtc 180
agggttctcc tacatggaac ttaaagttgg atacatctta gccataaaaa tgaacgggtt
240 cacttgcaca ggcgttgtga cggaggctga aacctacact aacttcgttg
gttatgtcac 300 aaccacgttc aaaagaaagc atttccgccc aacaccagat
gcatgtagag ccgcgtacaa 360 ctggaagatg gccggtgacc ccagatatga
agagtctcta cacaatccgt accctgacta 420 ccgctggctt cgaactgtaa
aaaccaccaa ggagtctctc gttatcatat ctccaagtgt 480 agcagatttg
gacccatatg acagatccct tcactcgagg gtcttcccta gcgggaagtg 540
ctcaggagta gcggtgtctt ctacctactg ctccactaac cacgattaca ccatttggat
600 gcccgagaat ccgagactag ggatgtcttg tgacattttt accaatagta
gagggaagag 660 agcatccaaa gggagtgaga cttgcggctt tgtagatgaa
agaggcctat ataagtcttt 720 aaaaggagca tgcaaactca agttatgtgg
agttctagga cttagactta tggatggaac 780 atgggtcgcg atgcaaacat
caaatgaaac caaatggtgc cctcccgatc agttggtgaa 840 cctgcacgac
tttcgctcag acgaaattga gcaccttgtt gtagaggagt tggtcaggaa 900
gagagaggag tgtctggatg cactagagtc catcatgaca accaagtcag tgagtttcag
960 acgtctcagt catttaagaa aacttgtccc tgggtttgga aaagcatata
ccatattcaa 1020 caagaccttg atggaagccg atgctcacta caagtcagtc
agaacttgga atgagatcct 1080 cccttcaaaa gggtgtttaa gagttggggg
gaggtgtcat cctcatgtga acggggtgtt 1140 tttcaatggt ataatattag
gacctgacgg caatgtctta atcccagaga tgcaatcatc 1200 cctcctccag
caacatatgg agttgttgga atcctcggtt atcccccttg tgcaccccct 1260
ggcagacccg tctaccgttt tcaaggacgg tgacgaggct gaggattttg ttgaagttca
1320 ccttcccgat gtgcacaatc aggtctcagg agttgacttg ggtctcccga
actgggggaa 1380 gtatgtatta ctgagtgcag gggccctgac tgccttgatg
ttgataattt tcctgatgac 1440 atgttgtaga agagtcaatc gatcagaacc
tacgcaacac aatctcagag ggacagggag 1500 ggaggtgtca gtcactcccc
aaagcgggaa gatcatatct tcatgggaat cacacaagag 1560 tgggggtgag
accagactgt gaggactggc cgtcctttca acgatccaag tcctgaagat 1620
cacctcccct tggggggttc tttttaaaaa 1650 2 524 PRT Artificial Sequence
Description of Artificial Sequence rabies virus strain ERA 2 Met
Val Pro Gln Ala Leu Leu Phe Val Pro Leu Leu Val Phe Pro Leu 1 5 10
15 Cys Phe Gly Lys Phe Pro Ile Tyr Thr Ile Leu Asp Lys Leu Gly Pro
20 25 30 Trp Ser Pro Ile Asp Ile His His Leu Ser Cys Pro Asn Asn
Leu Val 35 40 45 Val Glu Asp Glu Gly Cys Thr Asn Leu Ser Gly Phe
Ser Tyr Met Glu 50 55 60 Leu Lys Val Gly Tyr Ile Leu Ala Ile Lys
Met Asn Gly Phe Thr Cys 65 70 75 80 Thr Gly Val Val Thr Glu Ala Glu
Thr Tyr Thr Asn Phe Val Gly Tyr 85 90 95 Val Thr Thr Thr Phe Lys
Arg Lys His Phe Arg Pro Thr Pro Asp Ala 100 105 110 Cys Arg Ala Ala
Tyr Asn Trp Lys Met Ala Gly Asp Pro Arg Tyr Glu 115 120 125 Glu Ser
Leu His Asn Pro Tyr Pro Asp Tyr Arg Trp Leu Arg Thr Val 130 135 140
Lys Thr Thr Lys Glu Ser Leu Val Ile Ile Ser Pro Ser Val Ala Asp 145
150 155 160 Leu Asp Pro Tyr Asp Arg Ser Leu His Ser Arg Val Phe Pro
Ser Gly 165 170 175 Lys Cys Ser Gly Val Ala Val Ser Ser Thr Tyr Cys
Ser Thr Asn His 180 185 190 Asp Tyr Thr Ile Trp Met Pro Glu Asn Pro
Arg Leu Gly Met Ser Cys 195 200 205 Asp Ile Phe Thr Asn Ser Arg Gly
Lys Arg Ala Ser Lys Gly Ser Glu 210 215 220 Thr Cys Gly Phe Val Asp
Glu Arg Gly Leu Tyr Lys Ser Leu Lys Gly 225 230 235 240 Ala Cys Lys
Leu Lys Leu Cys Gly Val Leu Gly Leu Arg Leu Met Asp 245 250 255 Gly
Thr Trp Val Ala Met Gln Thr Ser Asn Glu Thr Lys Trp Cys Pro 260 265
270 Pro Asp Gln Leu Val Asn Leu His Asp Phe Arg Ser Asp Glu Ile Glu
275 280 285 His Leu Val Val Glu Glu Leu Val Arg Lys Arg Glu Glu Cys
Leu Asp 290 295 300 Ala Leu Glu Ser Ile Met Thr Thr Lys Ser Val Ser
Phe Arg Arg Leu 305 310 315 320 Ser His Leu Arg Lys Leu Val Pro Gly
Phe Gly Lys Ala Tyr Thr Ile 325 330 335 Phe Asn Lys Thr Leu Met Glu
Ala Asp Ala His Tyr Lys Ser Val Arg 340 345 350 Thr Trp Asn Glu Ile
Leu Pro Ser Lys Gly Cys Leu Arg Val Gly Gly 355 360 365 Arg Cys His
Pro His Val Asn Gly Val Phe Phe Asn Gly Ile Ile Leu 370 375 380 Gly
Pro Asp Gly Asn Val Leu Ile Pro Glu Met Gln Ser Ser Leu Leu 385 390
395 400 Gln Gln His Met Glu Leu Leu Glu Ser Ser Val Ile Pro Leu Val
His 405 410 415 Pro Leu Ala Asp Pro Ser Thr Val Phe Lys Asp Gly Asp
Glu Ala Glu 420 425 430 Asp Phe Val Glu Val His Leu Pro Asp Val His
Asn Gln Val Ser Gly 435 440 445 Val Asp Leu Gly Leu Pro Asn Trp Gly
Lys Tyr Val Leu Leu Ser Ala 450 455 460 Gly Ala Leu Thr Ala Leu Met
Leu Ile Ile Phe Leu Met Thr Cys Cys 465 470 475 480 Arg Arg Val Asn
Arg Ser Glu Pro Thr Gln His Asn Leu Arg Gly Thr 485 490 495 Gly Arg
Glu Val Ser Val Thr Pro Gln Ser Gly Lys Ile Ile Ser Ser 500 505 510
Trp Glu Ser His Lys Ser Gly Gly Glu Thr Arg Leu 515 520 3 44 DNA
Artificial Sequence Description of Artificial Sequence primer 3
gatgctcact acaagtcagt ccagacttgg aatgagatcc tccc 44 4 44 DNA
Artificial Sequence Description of Artificial Sequence primer 4
gggaggatct cattccaagt ctggactgac ttgtagtgag catc 44
* * * * *