U.S. patent application number 11/296832 was filed with the patent office on 2006-04-27 for systematic evolution of ligands by exponential enrichment: chemi-selex.
This patent application is currently assigned to GILEAD SCIENCES, INC.. Invention is credited to Bruce Eaton, Larry Gold, Kirk Jensen, Drew Smith, Matthew Wecker.
Application Number | 20060088877 11/296832 |
Document ID | / |
Family ID | 27574842 |
Filed Date | 2006-04-27 |
United States Patent
Application |
20060088877 |
Kind Code |
A1 |
Gold; Larry ; et
al. |
April 27, 2006 |
Systematic evolution of ligands by exponential enrichment:
Chemi-SELEX
Abstract
This application provides methods for identifying nucleic acid
ligands capable of covalently interacting with targets of interest.
The nucleic acids can be associated with various functional units.
The method also allows for the identification of nucleic acids that
have facilitating activities as measured by their ability to
facilitate formation of a covalent bond between the nucleic acid,
including its associated functional unit, and its target.
Inventors: |
Gold; Larry; (Boulder,
CO) ; Eaton; Bruce; (Longmont, CO) ; Smith;
Drew; (Boulder, CO) ; Wecker; Matthew;
(Lafayette, CO) ; Jensen; Kirk; (Boulder,
CO) |
Correspondence
Address: |
SWANSON & BRATSCHUN L.L.C.
1745 SHEA CENTER DRIVE
SUITE 330
HIGHLANDS RANCH
CO
80129
US
|
Assignee: |
GILEAD SCIENCES, INC.
Foster City
CA
|
Family ID: |
27574842 |
Appl. No.: |
11/296832 |
Filed: |
December 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09974330 |
Oct 9, 2001 |
|
|
|
11296832 |
Dec 6, 2005 |
|
|
|
09412017 |
Oct 4, 1999 |
6300074 |
|
|
09974330 |
Oct 9, 2001 |
|
|
|
08460888 |
Jun 5, 1995 |
5962219 |
|
|
09412017 |
Oct 4, 1999 |
|
|
|
08400440 |
Mar 8, 1995 |
5705337 |
|
|
08460888 |
Jun 5, 1995 |
|
|
|
07714131 |
Jun 10, 1991 |
5475096 |
|
|
08400440 |
Mar 8, 1995 |
|
|
|
07536428 |
Jun 11, 1990 |
|
|
|
07714131 |
Jun 10, 1991 |
|
|
|
08117991 |
Sep 8, 1993 |
|
|
|
11296832 |
Dec 6, 2005 |
|
|
|
08123935 |
Sep 17, 1993 |
|
|
|
11296832 |
Dec 6, 2005 |
|
|
|
08199507 |
Feb 22, 1994 |
5472841 |
|
|
11296832 |
Dec 6, 2005 |
|
|
|
08234997 |
Apr 28, 1994 |
5683867 |
|
|
11296832 |
Dec 6, 2005 |
|
|
|
08309245 |
Sep 20, 1994 |
5723289 |
|
|
11296832 |
Dec 6, 2005 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12; 435/91.2; 536/24.3 |
Current CPC
Class: |
C07K 14/001 20130101;
G01N 2333/976 20130101; G01N 2333/96455 20130101; C12N 2310/53
20130101; C12Q 1/6811 20130101; G01N 2333/575 20130101; C12N
2310/322 20130101; C12Q 1/6876 20130101; G01N 2333/9726 20130101;
G01N 33/76 20130101; C12Q 1/37 20130101; C12Q 1/6804 20130101; C12P
19/34 20130101; G01N 2333/96433 20130101; C12Q 1/6811 20130101;
F02B 2075/027 20130101; G01N 2333/62 20130101; C12Q 2525/101
20130101; C12Q 2521/101 20130101; C07H 21/00 20130101; C12Q
2541/101 20130101; C12Q 2525/155 20130101; C12Q 2525/101 20130101;
C12Q 2541/101 20130101; C12Q 2525/179 20130101; C12N 15/115
20130101; G01N 33/56988 20130101; C12N 15/1048 20130101; C12N
9/1276 20130101; B82Y 5/00 20130101; G01N 33/68 20130101; C12Q 1/70
20130101; C40B 40/00 20130101; G01N 2333/163 20130101; G01N
2333/8125 20130101; C07H 19/10 20130101; A61K 47/547 20170801; G01N
33/531 20130101; G01N 2333/974 20130101; C12Q 1/6811 20130101; C12Q
1/6811 20130101; C12Q 1/6811 20130101; G01N 33/535 20130101; A61K
47/549 20170801; G01N 2333/966 20130101; G01N 33/532 20130101; C07H
19/06 20130101; C12N 2310/13 20130101 |
Class at
Publication: |
435/006 ;
435/091.2; 536/024.3 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34; C07H 21/04 20060101
C07H021/04 |
Claims
1. A method for preparing nucleic acid ligands that bind covalently
with a target compound comprising: a) identifying a nucleic acid
ligand of a target compound from a candidate mixture of nucleic
acids by a method comprising: i) contacting the candidate mixture
with the target, wherein nucleic acids having an increased affinity
to the target relative to the candidate mixture may be partitioned
from the remainder of the candidate mixture; ii) partitioning the
increased affinity nucleic acids from the remainder of the
candidate mixture, and iii) amplifying the increased affinity
nucleic acids to yield a ligand-enriched mixture of nucleic acids,
whereby nucleic acid ligands of the target may be identified; and
b) attaching at least one chemically reactive functional unit which
covalently binds to a target to said nucleic acid ligand to yield a
nucleic acid ligand of the target compound.
2. The method of claim 1 wherein said chemically reactive
functional unit is selected from the group consisting of
photoreactive groups, active site directed compounds and
peptides.
3. A nucleic acid ligand prepared according to the method of claim
1.
4. The nucleic acid ligand of claim 3 wherein said at least one
functional unit is attached to an oligonucleotide capable of
hybridizing to said nucleic acid ligand, and wherein step b) is
accomplished by hybridizing said oligonucleotide to said nucleic
acid ligand.
5. A method for identifying a diagnostic reagent of a target from a
candidate mixture comprised of nucleic acids each having at least
one nucleic acid region and at least one chemically reactive
functional unit, said method comprising: a) contacting said
candidate mixture with said target molecule, wherein nucleic acids
which bind covalently with said target molecule form nucleic
acid-target molecule complexes; b) partitioning the nucleic
acid-target molecule complexes from the remainder of the candidate
mixture, whereby nucleic acid ligands that bind covalently with the
target molecule are identified.
6. The method of claim 5 wherein after step b), the nucleic acid is
amplified and steps a ) and b) are repeated until a mixture of
nucleic acids enriched in sequences that bind covalently with the
target molecule is obtained.
7. The method of claim 5 wherein said chemically reactive
functional unit is selected from the group consisting of
photoreactive groups, active site directed compounds and
peptides.
8. The method of claim 5 wherein at least one nucleic acid region
is comprised of a fixed region and a randomized region.
9. The method of claim 8 wherein at least one said chemically
reactive functional unit is attached to an oligonucleotide
hybridized to said fixed region.
10. The method of claim 5 further comprising adding a reporter
molecule to the diagnostic reagent.
11. A diagnostic reagent identified according to the method of
claim 5.
12. A method for preparing a diagnostic reagent, wherein said
diagnostic reagent comprises a nucleic acid ligand that binds
covalently with a target compound and a reporter molecule,
comprising: a) identifying a nucleic acid ligand of a target
compound from a candidate mixture of nucleic acids by a method
comprising: i) contacting the candidate mixture with the target,
wherein nucleic acids having an increased affinity to the target
relative to the candidate mixture may be partitioned from the
remainder of the candidate mixture; ii) partitioning the increased
affinity nucleic acids from the remainder of the candidate mixture,
and iii) amplifying the increased affinity nucleic acids to yield a
ligand-enriched mixture of nucleic acids, whereby nucleic acid
ligands of the target may be identified; and b) attaching at least
one chemically reactive functional unit which covalently binds to a
target to said nucleic acid ligand to yield a nucleic acid ligand
of the target compound; and c) attaching at least one reporter
molecule to said nucleic acid ligand, whereby a diagnostic reagent
is prepared.
13. The method of claim 12 wherein said chemically reactive
functional unit is selected from the group consisting of
photoreactive groups, active site directed compounds and
peptides.
14. A diagnostic reagent prepared by the method of claim 12.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 09/974,330, filed Oct. 9, 2001, which is a
continuation of U.S. patent application Ser. No. 09/412,017, filed
Oct. 4, 1999, now U.S. Pat. No. 6,300,074, which is a continuation
of U.S. patent application Ser. No. 08/460,888, filed Jun. 5, 1995,
now U.S. Pat. No. 5,962,219, which is a continuation of U.S. patent
application Ser. No. 08/400,440, filed Mar. 8, 1995, now U.S. Pat.
No. 5,705,337, each entitled "Systematic Evolution of Ligands by
Exponential Enrichment: Chemi-Selex," which is a
continuation-in-part of U.S. patent application Ser. No.
07/714,131, filed Jun. 10, 1991, entitled "Nucleic Acid Ligands,"
now U.S. Pat. No. 5,475,096, which was filed as a
continuation-in-part of U.S. patent application Ser. No.
07/536,428, filed Jun. 11, 1990, entitled "Systematic Evolution of
Ligands by Exponential Enrichment," now abandoned. This application
is also a continuation-in-part of U.S. patent application Ser. No.
08/117,991, filed Sep. 8, 1993, entitled "High Affinity Nucleic
Acid Ligands Containing Modified Nucleotides," now abandoned, U.S.
patent application Ser. No. 08/123,935, filed Sep. 17, 1993,
entitled "Photoselection of Nucleic Acid Ligands," now abandoned,
U.S. patent application Ser. No. 08/199,507, filed Feb. 22, 1994,
entitled "Methods for Identifying Nucleic Acid Ligands of Human
Neutrophil Elastase," now U.S. Pat. No. 5,472,841, U.S. patent
application Ser. No. 08/234,997, filed Apr. 28, 1994, entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Blended
SELEX," now U.S. Pat. No. 5,683,867 and U.S. patent application
Ser. No. 08/309,245, filed Sep. 20, 1994, entitled "Parallel
SELEX", now U.S. Pat. No. 5,723,282. Each of these references is
incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] Described herein is a method for generating nucleic acid
ligands having various desirable properties. The desirable
properties include, but are not limited to, the ability to attach a
nucleic acid to its target covalently; the ability to attach a
nucleic acid to its target non-covalently with a very high
specificity; the ability to facilitate an interaction between a
functional unit associated with the nucleic acid and a desirable
target; and the ability to subtractively partition a nucleic acid
having desirable properties from the remainder of a candidate
mixture.
[0003] The method of this invention takes advantage of the method
for identifying nucleic acid ligands referred to as SELEX. SELEX is
an acronym for Systematic Evolution of Ligands by EXponential
enrichment. The method of identifying nucleic acids, preferably
associated with other functional units, which have the facilitative
activity described herein is termed Chemi-SELEX. The nucleic acid
ligands of the present invention consist of at least one nucleic
acid region and not necessarily, but preferably at least one
functional unit. The nucleic acid region(s) of the nucleic acid
ligand serve in whole or in part as ligands to a given target.
Conversely, the nucleic acid region may serve to facilitate a
covalent interaction between the attached functional unit and a
given target. The functional unit(s) can be designed to serve in a
large variety of functions. For example, the functional unit may
independently or in combination with the nucleic acid unit have
specific affinity for the target, and in some cases may be a ligand
to a different site of interaction with the target than the nucleic
acid ligand. Functional unit(s) may be added which covalently react
and couple the ligand to the target molecule, catalytic groups may
be added to aid in the selection of protease or nuclease activity,
and reporter molecules such as biotin or fluorescein may be added
for use as diagnostic reagents. Examples of functional units that
may be coupled to nucleic acids include chemically-reactive groups,
photoreactive groups, active site directed compounds, lipids,
biotin, proteins, peptides and fluorescent compounds. Particularly
preferred functional units are chemically-reactive groups,
including photoreactive groups.
BACKGROUND OF THE INVENTION
[0004] A method for the in vitro evolution of nucleic acid
molecules with highly specific binding to target molecules has been
developed. This method, Systematic Evolution of Ligands by
EXponential enrichment, termed SELEX, is described in U.S. patent
application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled
"Systematic Evolution of Ligands by Exponential Enrichment," now
abandoned, U.S. Pat. No. 5,475,096, filed Jun. 10, 1991, entitled
"Nucleic Acid Ligands," U.S. Pat. No. 5,270,163, filed Aug. 17,
1992, entitled "Methods for Identifying Nucleic Acid Ligands," (see
also PCT/US91/04078 (WO 91/19813)), each of which is herein
specifically incorporated by reference. Each of these applications,
collectively referred to herein as the SELEX Patent Applications,
describes a fundamentally novel method for making a nucleic acid
ligand to any desired target molecule. The SELEX process provides a
class of products which are referred to as nucleic acid ligands,
such ligands having a unique sequence, and which have the property
of binding specifically to a desired target compound or molecule.
Each SELEX-identified nucleic acid ligand is a specific ligand of a
given target compound or molecule. SELEX is based on the unique
insight that nucleic acids have sufficient capacity for forming a
variety of two- and three-dimensional structures and sufficient
chemical versatility available within their monomers to act as
ligands (form specific binding pairs) with virtually any chemical
compound, whether monomeric or polymeric. Molecules of any size can
serve as targets.
[0005] The SELEX method involves selection from a mixture of
candidate oligonucleotides and step-wise iterations of binding,
partitioning and amplification, using the same general selection
scheme, to achieve virtually any desired criterion of binding
affinity and selectivity. Starting from a mixture of nucleic acids,
preferably comprising a segment of randomized sequence, the SELEX
method includes steps of contacting the mixture with the target
under conditions favorable for binding, partitioning unbound
nucleic acids from those nucleic acids which have bound
specifically to target molecules, dissociating the nucleic
acid-target complexes, amplifying the nucleic acids dissociated
from the nucleic acid-target complexes to yield a ligand-enriched
mixture of nucleic acids, then reiterating the steps of binding,
partitioning, dissociating and amplifying through as many cycles as
desired to yield highly specific high affinity nucleic acid ligands
to the target molecule.
[0006] It has been recognized by the present inventors that the
SELEX method demonstrates that nucleic acids as chemical compounds
can form a wide array of shapes, sizes and configurations, and are
capable of a far broader repertoire of binding and other functions
than those displayed by nucleic acids in biological systems.
[0007] The dogma for many years was that nucleic acids had
primarily an informational role. Through the application of SELEX
it has become clear to the present inventors that nucleic acids
have three dimensional structural diversity not unlike proteins. As
such, the present inventors have recognized that SELEX or
SELEX-like processes could be used to identify nucleic acids which
can facilitate any chosen reaction in a manner similar to that in
which nucleic acid ligands can be identified for any given target.
In theory, within a candidate mixture of approximately 10.sup.3to
10.sup.18 nucleic acids, the present inventors postulate that at
least one nucleic acid exists with the appropriate shape to
facilitate a broad variety of physical and chemical
interactions.
[0008] Studies to date have identified only a few nucleic acids
which have only a narrow subset of facilitating capabilities. A few
RNA catalysts are known (Cech (1987) Science 236:1532-1539 and
McCorkle and Altman (1987) J. of Chemical Education 64:221-226).
These naturally occurring RNA enzymes (ribozymes) have to date only
been shown to act on oligonucleotide substrates. Further, these
molecules perform over a narrow range of chemical possibilities,
which are thus far related largely to phosphodiester bond
condensation/hydrolysis, with the exception of the possible
involvement of RNA in protein biosynthesis. Despite intense recent
investigation to identify RNA or DNA catalysts, few successes have
been identified. Phosphodiester cleavage (Beaudry and Joyce (1992)
Science 257:635), hydrolysis of aminoacyl esters (Piccirilli et al.
(1992) Science 256:1420-1424), self-cleavage (Pan et al. (1992)
Biochemistry 31:3887), ligation of an oligonucleotide with a 3' OH
to the 5' triphosphate end of the catalyst (Bartel et al. (1993)
Science 261:1411-1418), biphenyl isomerase activity (Prudent et al.
(1994) Science 264:1924-1927), and polynucleotide kinase activity
(Lorsch et al. (1994) Nature 371:31-36) have been observed. The
nucleic acid catalysts known to date have certain shortcomings
associated with their effectiveness in bond forming/breaking
reactions. Among the drawbacks are that they act slowly relative to
protein enzymes, and as described above, they perform over a
somewhat narrow range of chemical possibilities.
[0009] The basic SELEX method has been modified to achieve a number
of specific objectives. For example, U.S. patent application Ser.
No. 07/960,093, filed Oct. 14, 1992, entitled "Method for Selecting
Nucleic Acids on the Basis of Structure," describes the use of
SELEX in conjunction with gel electrophoresis to select nucleic
acid molecules with specific structural characteristics, such as
bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep.
17, 1993, entitled "Photoselection of Nucleic Acid Ligands,"
describes a SELEX based method for selecting nucleic acid ligands
containing photoreactive groups capable of binding and/or
photocrosslinking to and/or photoinactivating a target molecule.
U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993,
entitled "High-Affinity Nucleic Acid Ligands That Discriminate
Between Theophylline and Caffeine," describes a method for
identifying highly specific nucleic acid ligands able to
discriminate between closely related molecules, termed
Counter-SELEX. U.S. Pat. No. 5,567,588, filed Oct. 25, 1993,
entitled "Systematic Evolution of Ligands by EXponential
Enrichment: Solution SELEX," describes a SELEX-based method which
achieves highly efficient partitioning between oligonucleotides
having high and low affinity for a target molecule.
[0010] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or improved delivery characteristics. Examples of
such modifications include chemical substitutions at the ribose
and/or phosphate and/or base positions. SELEX-identified nucleic
acid ligands containing modified nucleotides are described in U.S.
patent application Ser. No. 08/117,991, filed Sep. 8, 1993,
entitled "High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides," that describes oligonucleotides containing nucleotide
derivatives chemically modified at the 5- and 2'-positions of
pyrimidines. U.S. patent application Ser. No. 08/134,028, supra,
describes highly specific nucleic acid ligands containing one or
more nucleotides modified with 2'-amino (2'-NH.sub.2), 2'-fluoro
(2'-F), and/or 2'-O-methyl (2'-OMe). U.S. patent application Ser.
No. 08/264,029, filed Jun. 22, 1994, entitled "Novel Method of
Preparation of Known and Novel 2' Modified Nucleosides by
Intramolecular Nucleophilic Displacement," describes
oligonucleotides containing various 2'-modified pyrimidines.
[0011] The SELEX method encompasses combining selected
oligonucleotides with other selected oligonucleotides and
non-oligonucleotide functional units as described in U.S. Pat. No.
5,637,459, filed Aug. 2, 1994, entitled "Systematic Evolution of
Ligands by Exponential Enrichment: Chimeric SELEX" and U.S. Pat.
No. 5,683,867, filed Apr. 28, 1994, entitled "Systematic Evolution
of Ligands by Exponential Enrichment: Blended SELEX," respectively.
These applications allow the combination of the broad array of
shapes and other properties, and the efficient amplification and
replication properties, of oligonucleotides with the desirable
properties of other molecules. Each of the above described patent
applications which describe modifications of the basic SELEX
procedure are specifically incorporated by reference herein in
their entirety.
BRIEF SUMMARY OF THE INVENTION
[0012] The present invention describes the use of a SELEX-like
process where the enrichment and identification of nucleic acids is
based on the ability of the nucleic acid to facilitate a chemical
reaction. Nucleic acids having facilitative properties are capable
of mediating chemical reactions such as bond formation. In the
primary embodiment of this invention, the reaction being
facilitated is between the nucleic acid and a target. In this
embodiment, the nucleic acid candidate mixture preferably is made
up of nucleic acids that are associated with one or more functional
units. In this aspect, the invention requires that the facilitative
nucleic acids direct an interaction between the nucleic acid or its
attached functional unit and a given target. When the method of the
present invention is used to identify nucleic acid sequences that
facilitate the reaction between a functional group associated with
the nucleic acid and the target, the process is referred to as
Chemi-SELEX.
[0013] The functional unit can be added to provide the nucleic acid
region with additional functional capabilities. The functional
capabilities imparted by the functional unit include additional
binding affinity between the nucleic acid ligand and the target in
the form of a covalent interaction or a non-covalent interaction,
ability to crosslink the functional unit with the target in a
covalent or non-covalent manner, and ability to interact with the
target in a reversible or irreversible manner.
[0014] The present invention provides a method for identifying
nucleic acids having facilitative abilities. The ability of the
nucleic acids to facilitate a chemical reaction being considered
may arise from one or a combination of factors. In some instances,
the nucleic acid may simply be selected based on its ability to
bind the target species thereby allowing the functional unit
spatial access to the target. In other instances, the nucleic acid
may be selected due to its ability to present the functional unit
in a particular orientation and environment which allows the
functional unit to either react with the target or to have its
facilitative effect on the target.
[0015] The present invention encompasses nucleic acid ligands
coupled to a non-nucleic acid functional unit. The nucleic acid and
functional unit interact with the target in a synergistic
manner.
[0016] In another embodiment, this invention provides a method for
the subtractive separation of desirable ligands from less desirable
ligands. This embodiment takes advantage of the strong interaction
between the nucleic acid and/or it associated functional unit and
the target to partition the covalently attached or strongly
non-covalently attached nucleic acid-target complexes from free
nucleic acids.
[0017] In another embodiment, subtractive separation is further
exploited to automate the entire selection process. This embodiment
makes the selection process much less labor intensive and provides
the methods and apparatus to accomplish said automation.
DETAILED DESCRIPTION OF THE INVENTION
[0018] The present invention provides a method for identifying
nucleic acids which have the ability to facilitate a chemical
reaction. In the most preferred embodiment, the nucleic acids
comprise a nucleic acid region and a functional unit. However,
unmodified nucleic acids are within the scope of the present
invention. The desirable properties that the nucleic acids derived
by this method display are numerous and include, but are not
limited to, the ability to facilitate a covalent interaction or
strong non-covalent interaction between the nucleic acid or its
associated functional unit and a given target, the ability to
enhance the interaction between a nucleic acid ligand and a given
target, and the ability to subtractively partition the nucleic acid
ligand from the remainder of the nucleic acid candidate
mixture.
[0019] The methods herein described are based on the SELEX method.
SELEX is described in U.S. patent application Ser. No. 07/536,428,
entitled "Systematic Evolution of Ligands by EXponential
Enrichment," now abandoned, U.S. Pat. No. 5,475,096, filed Jun. 10,
1991, entitled "Nucleic Acid Ligands," and U.S. Pat. No. 5,270,163,
filed Aug. 17, 1992, entitled "Methods for Identifying Nucleic Acid
Ligands," (see also PCT/US91/04078 (WO 91/19813)). These
applications, each specifically incorporated herein by reference,
are collectively called the SELEX Patent Applications.
[0020] In its most basic form, the SELEX process may be defined by
the following series of steps:
[0021] 1) A candidate mixture of nucleic acids of differing
sequence is prepared. The candidate mixture generally includes
regions of fixed sequences (i.e., each of the members of the
candidate mixture contains the same sequences in the same location)
and regions of randomized sequences. The fixed sequence regions are
selected either: a) to assist in the amplification steps described
below; b) to mimic a sequence known to bind to the target; or c) to
enhance the concentration of a given structural arrangement of the
nucleic acids in the candidate mixture. The randomized sequences
can be totally randomized (i.e., the probability of finding a base
at any position being one in four) or only partially randomized
(e.g., the probability of finding a base at any location can be
selected at any level between 0 and 100 percent).
[0022] 2) The candidate mixture is contacted with the selected
target under conditions favorable for binding between the target
and members of the candidate mixture. Under these circumstances,
the interaction between the target and the nucleic acids of the
candidate mixture can be considered as forming nucleic acid-target
pairs between the target and those nucleic acids having the
strongest affinity for the target.
[0023] 3) The nucleic acids with the highest affinity for the
target are partitioned from those nucleic acids with lesser
affinity to the target. Because only an extremely small number of
sequences (and possibly only one molecule of nucleic acid)
corresponding to the highest affinity nucleic acids exist in the
candidate mixture, it is generally desirable to set the
partitioning criteria so that a significant amount of the nucleic
acids in the candidate mixture (approximately 5-50%) are retained
during partitioning.
[0024] 4) Those nucleic acids selected during partitioning as
having the relatively higher affinity to the target are then
amplified to create a new candidate mixture that is enriched in
nucleic acids having a relatively higher affinity for the
target.
[0025] 5) By repeating the partitioning and amplifying steps above,
the newly formed candidate mixture contains fewer and fewer unique
sequences, and the average degree of affinity of the nucleic acids
to the target will generally increase. Taken to its extreme, the
SELEX process will yield a candidate mixture containing one or a
small number of unique nucleic acids representing those nucleic
acids from the original candidate mixture having the highest
affinity to the target molecule.
[0026] The SELEX patent applications describe and elaborate on this
process in great detail. Included are targets that can be used in
the process; methods for the preparation of the initial candidate
mixture; methods for partitioning nucleic acids within a candidate
mixture; and methods for amplifying partitioned nucleic acids to
generate enriched candidate mixtures. The SELEX patent applications
also describe ligand solutions obtained to a number of target
species, including both protein targets wherein the protein is and
is not a nucleic acid binding protein.
[0027] The basic SELEX method has been modified to achieve specific
objectives. U.S. patent application Ser. No. 08/123,935, filed Sep.
17, 1993, entitled "Photoselection of Nucleic Acid Ligands,"
describes a SELEX-based method for selecting nucleic acid ligands
containing photoreactive groups capable of binding and/or
photocrosslinking to and/or photoinactivating a target molecule.
U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993,
entitled "High-Affinity Nucleic Acid Ligands That Discriminate
Between Theophylline and Caffeine," describes a method for
identifying highly specific nucleic acid ligands able to
discriminate between closely related molecules, termed
"Counter-SELEX." U.S. patent application Ser. No. 08/143,564, filed
Oct. 25, 1993, entitled "Systematic Evolution of Ligands by
EXponential Enrichment: Solution SELEX," describes a SELEX-based
method which achieves highly efficient partitioning between
oligonucleotides having high and low affinity for a target
molecule.
[0028] The SELEX method encompasses the identification of
high-affinity nucleic acid ligands containing modified nucleotides
conferring improved characteristics on the ligand, such as improved
in vivo stability or delivery. Examples of such modifications
include chemical substitutions at the ribose and/or phosphate
and/or base positions. Specific SELEX-identified nucleic acid
ligands containing modified nucleotides are described in U.S.
patent application Ser. No. 08/117,991, filed Sep. 8, 1993,
entitled "High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides," that describes oligonucleotides containing nucleotide
derivatives chemically modified at the 5- and 2'-positions of
pyrimidines, as well as specific RNA ligands to thrombin containing
2'-amino modifications. U.S. patent application Ser. No.
08/134,028, supra, describes highly specific nucleic acid ligands
containing one or more nucleotides modified with 2'-amino
(2'-NH.sub.2), 2'-fluoro (2'-F), and/or 2'-O-methyl (2'-OMe). The
above-mentioned SELEX improvement patent applications are herein
incorporated by reference.
[0029] An example of Chemi-SELEX was described in co-pending
PCT/US94/10562 (WO 95/08003), filed Sep. 19, 1994, which is a CIP
of U.S. patent application Ser. No. 08/123,935, filed Sep. 17,
1993, entitled "Photoselection of Nucleic Acid Ligands." In that
application, specifically incorporated by reference, certain
nucleic acid sequences that contained 5-iodouracil residues were
identified that covalently bind to HIV-1 Rev protein. In that
example of Chemi-SELEX, the functional group associated with all of
the members of the candidate mixture was 5-iodouracil.
[0030] In an additional embodiment of the present invention, the
nucleic acid sequences identified will be selected on the basis of
the ability of the functional unit associated with the nucleic
acids to facilitate a reaction to the target. Such a reaction might
be a bond cleavage or the reaction of the target with another
chemical species. An example of the embodiment of the present
invention is described in co-pending and commonly assigned patent
application U.S. Pat. No. 5,683,867, filed Apr. 28, 1994, entitled
"Systematic Evolution of Ligands by Exponential Enrichment: Blended
SELEX." In that application, specifically incorporated by
reference, a nucleic acid ligand to human neutrophil elastase was
identified wherein a functional unit was associated with the
nucleic acid ligand. In this instance, the functional unit was a
valyl phosphonate that bound covalently to the elastase target.
Another example of this embodiment is described in co-pending and
commonly assigned patent application U.S. Pat. No. 5,723,289, filed
Sep. 20, 1994, entitled "Parallel SELEX." In that application,
specifically incorporated herein by reference, the covalent
reaction between two reactants to form a product is specifically
facilitated by the nucleic acid attached to one of the
reactants.
[0031] The present invention includes the Chemi-SELEX method for
generating nucleic acid ligands to specific target molecules with
various desirable properties. The desirable properties associated
with the nucleic acid ligands of the present invention include, but
are not limited to, high affinity binding, specific binding, high
potency (even when associated with a moderate to modest affinity),
high specificity inhibition or potentiation, etc. The method
generates nucleic acid molecules preferably comprising at least one
functional unit. The functional unit is associated with the nucleic
acid region of the nucleic acid by any number of the methods
described below. The generation of the nucleic acid ligands
generally follows the SELEX process described above, however, the
functional unit can impart enhanced functionalities to the ligand
that the nucleic acid alone is not capable of.
[0032] In another embodiment, facilitative nucleic acids are
provided. Nucleic acids having facilitative properties are capable
of mediating chemical reactions such as bond formation or bond
cleavage. The nucleic acids can be modified in various ways to
include other chemical groups that provide additional charge,
polarizability, hydrogen bonds, electrostatic interaction, and
fluxionality which assist in chemical reaction mediation. The other
chemical groups can include, inter alia, alkyl groups, amino acid
side chains, various cofactors, and organometallic moieties. The
invention requires that the facilitative nucleic acids direct an
interaction between the attached functional unit and a given
target. The interaction is either covalent or non-covalent. The
preferred interaction is a covalent bond formed between the nucleic
acid (with or without an associated functional unit) and its
target.
I. DEFINITIONS
[0033] Certain terms used to describe the invention herein are
defined as follows:
[0034] "Nucleic acid" means either DNA, RNA, single-stranded or
double-stranded and any chemical modifications thereof. Many of the
modifications of the nucleic acid include the association of the
nucleic acid with a functional unit as described herein. However,
some modifications are directed to properties other than covalent
attachment (i.e., stability, etc.). Modifications include, but are
not limited to, those which provide other chemical groups that
incorporate additional charge, polarizability, hydrogen bonding,
electrostatic interaction, and fluxionality to the individual
nucleic acid bases or to the nucleic acid as a whole. Such
modifications include, but are not limited to, modified bases such
as 2'-position base modifications, 5-position pyrimidine
modifications, 8-position purine modifications, modifications at
cytosine exocyclic amines, substitution of 5-bromo-uracil; backbone
modifications, methylations, unusual base-pairing combinations such
as the isobases isocytidine and isoguanidine and the like.
Modifications can also include 3' and 5' modifications such as
capping. Modifications that occur after each round of amplification
are also compatible with this invention. Post-amplification
modifications can be reversibly or irreversibly added after each
round of amplification. Virtually any modification of the nucleic
acid is contemplated by this invention.
[0035] A nucleic acid can take numerous forms including, but not
limited to, those in which a nucleic acid region has 1) a single
modification or functional unit attached at either the 5' or 3' end
of nucleic acid sequence, 2) modifications or functional units at
both the 5' and 3' ends of the nucleic acid sequence, 3)
modifications or functional units added to individual nucleic acid
residues, 4) modifications or functional units attached to all or a
portion of all pyrimidine or purine residues, or modifications or
functional units attached to all or a portion of all nucleotides of
a given type, and 5) no modifications at all. The modifications or
functional units may also be attached only to the fixed or to the
randomized regions of each nucleic acid sequence of the candidate
mixture. Another embodiment of this invention for introducing a
non-nucleic acid functional unit at random positions and amounts is
by use of a template-directed reaction with non-traditional base
pairs. This method uses molecular evolution to select the best
placement of the non-nucleic acid group on the SELEX identified
ligand. For example, a X-dY base pair could be used, where X is a
derivatizable ribonucleotide and the deoxynucleotide dY would pair
only with X. The X-RNA would contain the non-nucleic acid
functional unit only at positions opposite dY in the dY-DNA
template; the derivatized X base could be positioned in either the
fixed or random regions or both, and the amount of X at each
position could vary between 0-100%. The sequence space of
non-evolved SELEX ligands would be increased from N.sup.4 to
N.sup.5 by substituting this fifth base without requiring changes
in the SELEX protocol. The attachment between the nucleic acid
region and the functional unit can be covalent or non-covalent,
direct or with a linker between the nucleic acid and the functional
unit. The methods for synthesizing the nucleic acid, i.e.,
attaching such functional units to the nucleic acid, are well known
to one of ordinary skill in the art.
[0036] Incorporation of non-nucleic acid functional units to
produce nucleic acid ligands increases the repertoire of structures
and interactions available to produce high affinity binding
ligands. Various types of functional units can be incorporated to
produce a spectrum of molecular structures. At one end of this
structural spectrum are normal polynucleic acids where the ligand
interactions involve only nucleic acid functional units. At the
other, are fully substituted nucleic acid ligands where ligand
interactions involve only non-nucleic acid functional units. Since
the nucleic acid topology is determined by the sequence, and
sequence partitioning and amplification are the basic SELEX steps,
the best ligand topology is selected by nucleic acid evolution.
[0037] "Nucleic acid test mixture" or "Nucleic acid candidate
mixture" is a mixture of nucleic acids comprising differing,
randomized sequence. The source of a "nucleic acid test mixture"
can be from naturally-occurring nucleic acids or fragments thereof,
chemically synthesized nucleic acids, enzymatically synthesized
nucleic acids or nucleic acids made by a combination of the
foregoing techniques, including any of the modifications described
herein. In a preferred embodiment, each nucleic acid has fixed
sequences surrounding a randomized region to facilitate the
amplification process. The length of the randomized section of the
nucleic acid is generally between 8 and 250 nucleotides, preferably
between 8 and 60 nucleotides.
[0038] "Functional unit" refers to any chemical species not
naturally associated with nucleic acids, and may have any number of
functions as enumerated herein. Specifically, any moiety not
associated with the five standard DNA and RNA nucleosides can be
considered a functional unit. Functional units that can be coupled
to nucleotides or oligonucleotides include chemically-reactive
groups, such as, photoreactive groups, active site directed
compounds, lipids, biotin, proteins, peptides and fluorescent
compounds. Often, the functional unit is recognizable by the target
molecule. These non-nucleic acid components of oligonucleotides may
fit into specific binding pockets to form a tight binding via
appropriate hydrogen bonds, salt bridges, or van der Waals
interactions. In one aspect, functional unit refers to any chemical
entity that could be involved in a bond forming reaction with a
target which is compatible with the thermal and chemical stability
of nucleic acids, including the modifications described above. A
functional unit may or may not be amplifiable with the nucleic acid
region during the amplification step of the SELEX process. A
functional unit typically has a molecular weight in the range of 2
to 1000 daltons, preferably about 26 to 500. Particularly preferred
functional units include small organic molecules such as alkenes,
alkynes, alcohols, aldehydes, ketones, esters, carboxylic acids,
aromatic carbocycles, heterocycles, dienes, thiols, sulfides,
disulfides, epoxides, ethers, amines, imines, phosphates, amides,
thioethers, thioates, sulfonates and halogenated compounds.
Inorganic functional units are also contemplated by this invention.
However, in some embodiments of the invention, larger functional
units can be included, such as polymers or proteins.
[0039] "Nucleic acid having facilitating properties" or
"facilitating nucleic acid" or "facilitative nucleic acid" or
"nucleic acid facilitator" refers to any nucleic acid which is
capable of mediating or facilitating a chemical reaction. The
chemical reaction can be a bond formation or bond cleavage
reaction. The preferred embodiments of this invention are directed
to bond formation reactions. The nucleic acid does not necessarily
need to show catalytic turnover to be considered to have
facilitating properties. The reaction rate of product formation can
be increased by the presence of the nucleic acid, however,
increased reaction rate is not a requirement for facilitating
properties. A facilitating nucleic acid folds such that its
three-dimensional structure facilitates a specific chemical
reaction. The nucleic acid can mediate the chemical reaction either
alone, in combination with another catalytic moiety coupled
directly with the nucleic acid, or in combination with another
catalytic moiety which could be found in solution. The other
catalytic moieties can include organometallic moieties, metal ions,
etc. The nucleic acid can cause different stereoisomers to be
formed. The nucleic acid can mediate formation or cleavage of a
variety of bond types, including, but not limited to,
condensation/hydrolysis reactions, cycloaddition reactions (such as
the Diels-Alder and Ene reaction), 1,3 dipolar conjugate addition
to .alpha., .beta.-unsaturated compounds, Aldol condensations,
substitution reactions, elimination reactions, glycosylation of
peptides, sugars and lipids.
[0040] "Target" refers to any compound upon which a nucleic acid
can act in a predetermined desirable manner. A target molecule can
be a protein, peptide, nucleic acid, carbohydrate, lipid,
polysaccharide, glycoprotein, hormone, receptor, antigen, antibody,
virus, pathogen, toxic substance, substrate, metabolite, transition
state analog, cofactor, inhibitor, drug, dye, nutrient, growth
factor, cell, tissue, etc., without limitation. Virtually any
biological effector would be a suitable target. Molecules of any
size can serve as targets. A target can also be modified in certain
ways to enhance the likelihood of an interaction between the target
and the nucleic acid.
[0041] "Covalent interaction" between a target and a nucleic acid
means that a covalent bond is formed between the nucleic acid (with
or without an associated functional unit) and its target. A
covalent bond is a chemical bond formed between atoms by the
sharing of electrons. A covalent interaction is not easily
disrupted.
[0042] "Partitioning" means any process whereby members of the
nucleic acid test mixture can be separated from the bulk of the
test mixture based on the ability of the nucleic acid to bind to or
interact with the target, the ability of the nucleic acid to
facilitate a reaction involving its associated functional unit.
Partitioning can be accomplished by various methods known in the
art. Filter binding, affinity chromatography, liquid-liquid
partitioning, HPLC, filtration, gel shift, density gradient
centrifugation are all examples of suitable partitioning methods.
The choice of partitioning method will depend on properties of the
target and the product and can be made according to principles and
properties known to those of ordinary skill in the art.
[0043] "Subtractive partitioning" refers to partitioning the bulk
of the test mixture away from the nucleic acids involved in the
interaction with the target. The desirable nucleic acids remain
involved in the interaction with the target while the uninteracted
nucleic acids are partitioned away. The uninteracted nucleic acids
can be partitioned away based on a number of characteristics. These
characteristics include, but are not limited to, the fact that the
nucleic acids did not bind to the target, the fact the nucleic acid
still has a functional unit that did not interact with the target
and therefore that functional unit is still available for
additional interaction, etc. This partitioning method is
particularly useful for automating the selection process.
[0044] "Amplifying" means any process or combination of process
steps that increases the amount or number of copies of a molecule
or class of molecules. In preferred embodiments, amplification
occurs after members of the test mixture have been partitioned, and
it is the facilitating nucleic acid associated with a desirable
product that is amplified. For example, amplifying RNA molecules
can be carried out by a sequence of three reactions: making cDNA
copies of selected RNAs, using the polymerase chain reaction to
increase the copy number of each cDNA, and transcribing the cDNA
copies to obtain RNA molecules having the same sequences as the
selected RNAs. Any reaction or combination of reactions known in
the art can be used as appropriate, including direct DNA
replication, direct RNA amplification and the like, as will be
recognized by those skilled in the art. The amplification method
should result in the proportions of the amplified mixture being
essentially representative of the proportions of different
sequences in the mixture prior to amplification. It is known that
many modifications to nucleic acids are compatible with enzymatic
amplification. Modifications that are not compatible with
amplification can be made after each round of amplification, if
necessary.
[0045] "Randomized" is a term used to describe a segment of a
nucleic acid having, in principle, any possible sequence over a
given length. Randomized sequences will be of various lengths, as
desired, ranging from about eight to more than one hundred
nucleotides. The chemical or enzymatic reactions by which random
sequence segments are made may not yield mathematically random
sequences due to unknown biases or nucleotide preferences that may
exist. The term "randomized" is used instead of "random" to reflect
the possibility of such deviations from non-ideality. In the
techniques presently known, for example sequential chemical
synthesis, large deviations are not known to occur. For short
segments of 20 nucleotides or less, any minor bias that might exist
would have negligible consequences. The longer the sequences of a
single synthesis, the greater the effect of any bias.
[0046] A bias may be deliberately introduced into a randomized
sequence, for example, by altering the molar ratios of precursor
nucleoside (or deoxynucleoside) triphosphates in the synthesis
reaction. A deliberate bias may be desired, for example, to affect
secondary structure, to introduce bias toward molecules known to
have facilitating activity, to introduce certain structural
characteristics, or based on preliminary results.
[0047] "SELEX" methodology involves the combination of selection of
nucleic acid ligands which interact with a target in a desirable
manner, for example binding to a protein, with amplification of
those selected nucleic acids. Iterative cycling of the
selection/amplification steps allows selection of one or a small
number of nucleic acids which interact most strongly with the
target from a pool which contains a very large number of nucleic
acids. Cycling of the selection/amplification procedure is
continued until a selected goal is achieved. In the present
invention, the SELEX methodology is employed to amplify the nucleic
acid associated with a desirable product.
[0048] "Chemi-SELEX" is a method wherein nucleic acids in a nucleic
acid test mixture are capable of facilitating an interaction with a
target. Preferably, but not necessarily, the nucleic acids are
associated with a functional unit and the interaction is a covalent
bond. The nucleic acid is contacted with a target under conditions
favorable for ligand binding either directly or through facilitated
bond formation. The functional unit must interact with the target
in order to fall within the scope of Chemi-SELEX. The nucleic acid
ligands having predetermined desirable characteristics are then
identified from the test mixture. The nucleic acid can be
identified by its ability to act on a given target in the
predetermined manner (e.g., bind to the target, modify the target
in some way, etc.). The desirable nucleic acids can then be
partitioned away from the remainder of the test mixture. The
nucleic acid, with or without its associated functional unit, can
be amplified as described in the SELEX method. The amplified
nucleic acids are enriched for the nucleic acids which have
desirable properties. If a functional unit was associated with the
nucleic acid, the amplified nucleic acids are then recoupled to the
functional unit (if the functional unit is non-amplifiable),
recontacted with the target, and the iterative cycling of the
selection/amplification steps of the SELEX process are incorporated
to synthesize, select and identify desirable nucleic acids.
[0049] In one aspect, the present invention depends on the ability
of a nucleic acid to mediate an interaction between the functional
unit and the target of interest. The method requires the initial
preparation of a nucleic acid test mixture. In general, the
rationale and methods for preparing the nucleic acid test mixture
are as outlined in the SELEX Patent Applications described earlier
which are herein incorporated by reference. Briefly, a nucleic acid
test mixture of differing sequences is prepared. Each nucleic acid
in the test mixture generally includes regions of fixed sequences
(i.e., each of the members of the test mixture contains the same
sequences in the same location) and regions of randomized
sequences. The fixed sequence regions are selected either: (a) to
assist in the amplification steps described in detail in the SELEX
patents, (b) to mimic a sequence known to mediate a reaction, or
(c) to enhance the concentration of nucleic acids of a given
structural arrangement in the test mixture. The randomized
sequences can be totally randomized (i.e., the probability of
finding a base at any position being one in four) or only partially
randomized (e.g., the probability of finding a base at any location
can be selected at any level between 0 and 100 percent). The
nucleic acids found in the nucleic acid test mixture will include
those capable of proper folding in order to specifically facilitate
various chemical reactions, such as reactions between the target
and the associated functional unit; those capable of interacting
directly with the target, the specificity of which will be enhanced
by the associated functional unit.
[0050] The nucleic acid test mixture can be modified in various
ways to enhance the probability of the nucleic acids having
facilitating properties or other desirable properties, particularly
those which enhance the interaction between the nucleic acid and
the target. The modifications contemplated by this invention are
any modifications which introduce other chemical groups (functional
units) that have the correct charge, polarizability, hydrogen
bonding, electrostatic interaction, or fluxionality and overall can
adopt the shape needed to stabilize the reaction transition state
and facilitate specific chemical reactions, without limitation. The
modifications that may enhance the active site of the nucleic acid
include hydrophilic moieties, hydrophobic moieties, metal atoms in
various oxidation states, rigid structures, functional groups found
in protein enzyme active sites such as imidazoles, primary
alcohols, carboxylates, guanidinium groups, amino groups, thiols
and the like. Additionally, organometallic and inorganic metal
catalysts can be incorporated as the other chemical group of the
nucleic acid, as can redox reactants.
[0051] The individual components of a nucleic acid test mixture can
be modified in various ways. Suitable modifications include, but
are not limited to, modifications on every residue of the nucleic
acid, on random residues, on all pyrimidines or purines, or all
specific bases (i.e., G, C, A, T or U), or one modification per
nucleic acid. It is also recognized that certain molecules (e.g.,
metal catalysts and the like) can be in solution, not attached to
the nucleic acid, and be useful in mediating the reaction in
concert with the mediating action of the nucleic acid. It is
believed that as long as the nucleic acid coupled to the functional
unit is in some way associated with the interaction between the
nucleic acid and the target, that the method and resulting nucleic
acids fall within the scope of this invention. It is also
recognized that modification is not a prerequisite for facilitating
activity or binding ability of the nucleic acids of the
invention.
[0052] As described earlier, the nucleotides can be modified in any
number of ways, including modifications of the ribose and/or
phosphate and/or base positions. Certain modifications are
described in U.S. patent applications Ser. No. 08/117,991 entitled
"High Affinity Nucleic Acid Ligands Containing Modified
Nucleotides," U.S. Pat. No. 5,428,149, entitled "Method for
Palladium Catalyzed Carbon-Carbon Coupling and Products," U.S.
patent application Ser. No.08/264,029, entitled "Novel Method of
Preparation of Known and Novel 2' Modified Nucleosides by
Intramolecular Nucleophilic Displacement," and U.S. Pat. No.
5,580,972, entitled "Purine Nucleoside Modifications by Palladium
Catalyzed Methods," which are herein incorporated by reference. In
one embodiment, modifications are those wherein another chemical
group is attached to the 5-position of a pyrimidine, the 8-position
of a purine, or the 2' position of a sugar. There is no limitation
on the type of other chemical group that can be incorporated on the
individual nucleotides. In the preferred embodiments, the resulting
modified nucleotide is amplifiable or can be modified subsequent to
the amplification steps.
[0053] As an example, which is not meant to limit the invention in
any way, one can envision a biomimetic nucleic acid. One choice for
modification of the nucleic acids includes modification which would
make certain bases appear more like proteins in their chemical and
physical properties. Certain modifications of pyrimidine and purine
nucleotide bases can be made to make the nucleic acid appear to
have "side chains" similar to the amino acid side chains of
proteins.
[0054] Several synthetic methods are available to attach other
chemical groups, in this case amino acid derivatives, to the
5-position of a pyrimidine or the 8-position of a purine. Methods
for modifying pyrimidines at the 5-position have been described in
U.S. Pat. No. 5,428,149, as well as other published procedures.
Numerous published procedures are known for modifying nucleic acids
including, but not limited to the following (Limbach et al. (1994)
Nucleic Acids Res. 22:2183-2196 and references cited therein;
Hayakawa et al. (1985) Tetrahedron 41:1675-83; Crouch et al. (1994)
Nucleosides & Nucleotides 13:939-44; Scheit (1966) Chem. Ber.
98:3884; Bergstrom et al. (1976) J. Am. Chem. Soc. 98:1587-89;
Bergstrom et al. (1978) J. Am. Chem. Soc. 100:8106-12; Ruth and
Bergstrom (1978) J. Org. Chem. 43:2870; Bergstrom et al. (1981) J.
Org. Chem. 46:1432-41; Bergstrom (1982) Nucleosides &
Nucleotides 1:1-34; Crisp et al. (1990) Tetrahedron Lett.
31:1347-50; Hobbs (1989) J Org. Chem. 54:3420-22; Hirota et al.
(1993) Synthesis 213-5; Nagamachi et al. (1974) J. Med. Chem.
17:403-6; Barton et al. (1979) Tetrahedron Lett. 3:279-80; Hirota
et al. (1992) J. Org. Chem. 57:5268; Mamos et al. (1992)
Tetrahedron Lett. 33:2413-16; Sessler et al. (1993) J. Am. Chem.
Soc. 115:10418-19; Long et al. (1967) J. Org. Chem. 32:2751-56;
Prakash et al. (1993) Tetrahedron 49:4035; Jankowski et al. (1989)
Nucleosides & Nucleotides 8:339; Kumar and Buncel et al. (1984)
J. Inorg. Biochem. 22:11-20; Moffatt (1979) in Nucleoside
Analogues, eds. R T Walker, E De Clercq, F Eckstein pp. 71-163 NY:
Plenum Press; Townsend (1988) in Chemistry of Nucleosides and
Nucleotides pp.59-67 NY: Plenum Press; Verheyden et al. (1971) J.
Org. Chem. 36:250-54; Wagner et al. (1972) J. Org.Chem. 37:1876-78;
Sproat et al. (1991) in Oligonucleoitdes and Analogues A Practical
Approach, ed. F. Eckstein pp.49-86 NY: Oxford University Press;
Lesnik et al. (1993) Biochemistry 32:7832-38; Sproat et al. (1991)
Nucleic Acids Res. 19:733-38; Matsuda et al. (1991) J. Med. Chem.
34:234-39; Schmit (1994) Synlett 238-40; Imazawa et al. (1979) J.
Org. Chem. 44:2039-4; Schmit (1994) Synlett 241-42; McCombie et al.
(1987) Tetrahedron Lett. 28:383-6; Imazawa et al. (1975) Chem.
Pharm. Bull. 23:604-10; Divakar et al. (1990) J. Chem. Soc., Perkin
Trans.1 969-74; Marriott et al. (1991) Carbohydrate Res.
216:257-69; Divakar et al. (1982). J. Chem. Soc., Perkin Trans. 1
1625-28; Marriott et al. (1990) Tetrahedron Lett. 31:2646-57)
[0055] Nucleotides modified with other chemical groups in place of
the above-described amino acids are also contemplated by this
invention. Oftentimes, a working assumption can be made about which
modified nucleotides would be most desirable for addition to the
nucleic acid test mixture.
[0056] The methods described herein do not include all of the
schemes for introducing non-nucleic acid functional units, such as
peptides, into an oligonucleotide. However, such methods would be
well within the skill of those ordinarily practicing in the art.
Putting a peptide on every uridine, for example, has several
advantages as compared with other methods for use in the SELEX
procedure. First, the peptide is introduced throughout both the
random and fixed regions, so that evolved RNA ligands could bind
close to the peptide binding site. Second, distributing the peptide
at multiple sites does not restrict the geometry of RNA and does
not interfere with SELEX identification of the optimal peptide
position. Third, one can use pre-derivatized nucleotides with
SELEX. Post-transcription modification may require additional time
and expertise and introduces the additional variable of coupling
efficiency.
[0057] In one embodiment of the invention, referred to as splint
SELEX, the functional unit is attached to a nucleic acid by first
attaching the functional unit to a nucleic acid that is
complementary to a region of the nucleic acid sequence of the
ligand and then allowing the nucleic acid with functional unit to
hybridize to the nucleic acid. This splint nucleic acid is then
subjected to the SELEX process. In the preferred embodiment, the
functional unit oligonucleotide is DNA, and hybridizes to the fixed
region of the nucleic acid ligand or at least a region of the
nucleic acid ligand that is not involved in the binding or
facilitating reaction to the target.
[0058] In one variation of this embodiment, the SELEX process is
accomplished by the preparation of a candidate mixture of nucleic
acid sequences comprised of fixed and randomized regions. The
candidate mixture also contains an oligonucleotide attached to a
selected functional group. The oligonucleotide is complementary to
the fixed region of the nucleic acid candidate mixture, and is able
to hybridize under the conditions employed in SELEX for the
partitioning of high affinity ligands from the bulk of the
candidate mixture. Following partitioning, the conditions can be
adjusted so that the oligo-functional unit dissociates from the
nucleic acid sequences.
[0059] Advantages to this embodiment include the following: 1) it
places a single functional unit, such as a peptide analog, at a
site where it is available for interaction with the random region
of nucleic acid sequences of the candidate mixture; 2) because the
functional unit is coupled to a separate molecule, the coupling
reaction must only be performed once, whereas when the functional
unit is coupled directly to the SELEX ligand, the coupling reaction
must be performed at every SELEX cycle. (aliquots from this
reaction can be withdrawn for use at every cycle of SELEX); 3) the
coupling chemistry between the functional unit and the
oligonucleotide need not be compatible with RNA integrity or
solubility--thus simplifying the task of coupling; 4) in cases
where the functional unit forms a covalent complex with the target,
the SELEX derived nucleic acid ligand portion of the selected
members of the candidate mixture can be released from the target
for amplification or identification; and 5) following the
successful identification of a nucleic ligand, the tethered portion
of nucleic acid can be made into a hairpin loop to covalently
attach the two portions of the nucleic acid ligand.
[0060] Due to the nature of the strong interaction between the
nucleic acid and the target (i.e., covalent bond), the entire
selection procedure can be accomplished in a single tube, thereby
allowing the process (including partitioning) to be automated.
[0061] The ligands identified by the method of the invention have
various therapeutic, prophylactic and diagnostic purposes. They are
useful for the diagnosis and/or treatment of diseases, pathological
or toxic states.
[0062] The examples below describe methods for generating the
nucleic acid ligands of the present invention. As these examples
establish, nucleotides and oligonucleotides containing a new
functional unit are useful in generating nucleic acid ligands to
specific sites of a target molecule.
EXAMPLE 1
5'-phosphorothioate-modified RNA binding to
N-bromoacetyl-bradykinin
[0063] This example describes a Chemi-SELEX procedure wherein RNA
is modified with a 5' guanosine monophosphorothioate (GMPS)
functional unit and the target for which a ligand is obtained is
N-bromoacetylated-bradykinin (BrBK). This example describes the
selection and analysis of a 5' guanosine
monophosphorothioate-substituted RNA (GMPS-RNA) which specifically
recognizes N-bromoacetylated-bradykinin (BrBK) and accelerates the
formation of a thioether bond between the RNA and the BrBK peptide.
Previous work in this area showed that it was difficult to obtain
ligands to bradykinin both in free solution and conjugated to a
support matrix. As will be described below, RNA showing a 6700-fold
increase in k.sub.cat/K.sub.m and a 100-fold increase in binding
affinity for N-bromoacetyl-bradykinin relative to the starting pool
was identified. This RNA binds its substrate with high specificity,
requiring both the amino- and carboxy-terminal arginine residues of
the peptide for optimal activity.
A. The Chemi-SELEX
[0064] The Chemi-SELEX reaction was carried out using 5' guanosine
monophosphorothioate (GMPS) as the functional unit attached to an
RNA test mixture and bromoacetylated bradykinin (BrBK) as the
target. GMPS-RNA is selected for the ability to rapidly substitute
the thioate group of the RNA for the bromide group of BrBK. The
product, BK-S-RNA, is then partitioned subtractively from the
remaining unreacted GMPS-RNA and re-amplified prior to continuing
with another selection cycle.
[0065] 1. GMPS-RNA
[0066] The Chemi-SELEX was performed with an initial random
repertoire of approximately 5.times.10.sup.3 GMPS-RNA molecules of
length 76 nucleotides having a central region of 30 randomized
nucleotides (30N1) (SEQ ID NO: 1), described in detail by Schneider
et al. (FASEB 7:201 (1993)), with the non-random regions serving as
templates for amplification. The nucleic acid was formed by
inclusion of GMPS in the initial and all subsequent transcription
reactions such that it was preferentially utilized over equimolar
GTP in the priming of transcription by T7 RNA polymerase such that
approximately 80% of the full length product was initiated by GMPS.
GMPS-RNA was transcribed and purified by Amicon Microcon-50 spin
separation to remove excess GMPS. GMPS-RNA is purified away from
non-GMPS RNA using Thiopropyl Sepharose 6B , eluted from the matrix
with dithiothreitol (DTT) and purified from the DTT with another
Microcon-50 spin separation. Thiopropyl sepharose 6B (Pharmacia)
was pre-washed in column buffer (500 mM NaCl, 20 mM HEPES pH 7.0)
and then spun dry at 12,000 g prior to use. For GMPS-RNA
purification, Microcon-50 column-purified RNA was brought to a
final concentration of 500 mM NaCl, 10 mM EDTA and 20 mM HEPES pH
7.0 and added to matrix at a measure of 25 .mu.L per 60 .mu.L void
volume. The mix was then reacted at 70.degree. C. for 5 minutes,
spun at 12,000 g, spin-washed with four column volumes of 90%
formamide, 50 mM MES pH 5.0 at 70.degree. C., spin-washed with four
column volumes of 500 mM NaCl in 50 mM MES, pH 5.0 and spin-eluted
with four column volumes of 100 mM DTT in 50 mM MES, pH 5.0. These
conditions were optimized for the retention and subsequent elution
of only GMPS-RNA.
[0067] 2. Bromoacetylated Bradykinin
[0068] Bromoacetylated bradykinin (BrBK) was used as the target in
this example. BrBK was synthesized by reacting 50 .mu.L of 5 mM
bradykinin with three successive 250 .mu.L portions of 42 mM
bromoacetic acid N-hydroxysuccinimide ester at 12 minute intervals
at room temperature. Excess bromoacetic acid N-hydroxysuccinimide
ester was removed by filtration over 5 mL of aminoethyl acrylamide
(five minutes of reaction at room temperature), followed by
separation of the BrBK over GS-10 sepharose. BrBK concentration was
determined at 220 nm using an absorption coefficient of 12,000
cm.sup.-1M.sup.-1.
[0069] 3. The Selection Reaction
[0070] Those species of GMPS-RNA which are most capable of carrying
out the reaction with BrBK are selected iteratively through
multiple rounds of SELEX. Rounds of selection were carried out in
reaction buffer with 1.1 mM BrBK and with the GMPS-RNA
concentrations for the given times and temperatures indicated in
Table I. During the selection, the BrBK peptide concentration was
kept at 1.1 mM, a concentration 12-fold lower than the K.sub.m of
the round 0 pool with BrBK. Proceeding through the selection,
reaction time was restricted and temperature of the reaction was
decreased in order to limit the reaction to 5% or less of the total
GMPS-RNA. The object was to maintain second-order reaction
conditions in order to select for improvements in both binding and
chemistry. Activity of the BrBK was assayed at 12.5 .mu.M BrBK with
25 .mu.M GMPS-RNA; when the reaction was carried out to completion,
50% of the RNA was covalently bound by BrBK indicating that
bromoacetylation of the peptide was essentially complete.
[0071] Reactions were quenched with a final concentration of either
235 mM sodium thiophosphate (rounds 1-8) or sodium thiosulfate
(rounds 9-12) and subtractively partitioned either on denaturing 7
M urea 8% polyacrylamide APM gels (rounds 1-6) or by affinity
chromatography (rounds 7-12). % RNA reacted refers to the percent
of the total GMPS-RNA present as BK-S-RNA from acrylamide gel
partitioning, or, as freely eluting BK-S-RNA in affinity column
partitioning. Background was subtracted from the recovered RNA in
both of these cases; background refers to the amount of RNA
recovered from a control treatment where the reaction was quenched
prior to the addition of the BrBK. The background ratio is the
ratio of reacted RNA to that present as background. An attempt was
made to keep this ratio between 2 and 10 throughout the rounds of
SELEX by adjusting the reaction time.
[0072] The subtractive partitioning was accomplished either by
subtraction of the GMPS-RNA upon Thiopropyl Sepharose 6B, or by
separation of the two species on an APM polyacrylamide gel.
[(N-Acryloylamino)phenyl]mercuric chloride (APM) was synthesized
and used at a concentration of 25 .mu.M in denaturing
polyacrylamide gel electrophoresis for the retardation of
thiol-containing RNA as reported by Igloi (1988) Biochemistry
27:3842. GMPS-RNA was purified from APM-polyacrylamide by elution
in the presence of 100 mM DTT. In concurrence with the cited
literature, it was found that freshly purified, APM-retarded
GMPS-RNA when re-run on an APM gel gave a free band of non-retarded
RNA consisting of approximately three percent of the total GMPS-RNA
applied. Free-running RNA was problematic in that it ran very
closely to BK-RNA (regardless of the percent acrylamide used in the
gel) and thus increased the background during partitioning. When
this free-running RNA was purified from the gel and rerun on an APM
gel, approximately 50% of this RNA remained free-running, with the
balance of RNA running as GMPS-RNA. The amount of free-running RNA
was proportional to the amount of time spent during precipitation,
but was not dependent on the effect of pH, the presence or absence
of either DTT, magnesium acetate, formamide, urea, or heat.
[0073] Reverse transcription and polymerase chain reaction were
carried out as reported by Schneider et al. (FASEB 7:201 (1993)).
The k.sub.obs value of the GMPS-RNA pool increased 100-fold between
rounds 4 and 6, increasing only 2-fold with further rounds.
Reactions to determine k.sub.obs values were carried out at
0.degree. C. in reaction buffer (50 mM HEPES, pH 7.0, 5 mM
MgCl.sub.2, 150 mM NaCl) at 2 .mu.M GMPS-RNA and 130 .mu.M BrBK,
with monitoring at 0, 1, 3, 10, 30, and 90 minutes. GMPS-RNA was
denatured at 70.degree. C. for 3 minutes and allowed to slow cool
at room temperature prior to dilution to final reaction buffer
conditions, transfer to ice, and addition of BrBK. Reactions were
quenched on ice with 235 mM sodium thiosulfate and run on a
denaturing 7 M urea 8% polyacrylamide APM gel. k.sub.obs values
were determined as the negative slope of the linear range of data
points from plots relating the concentration of unreacted GMPS-RNA
vs. time. Round 10 and round 12 pools were used for cloning and
sequencing.
B. The Clones
[0074] Fifty six independent clones were sequenced, which resulted
in 29 different sequences shown in Table II (SEQ ID NOs:2-37).
Approximately 1/3 of the total sequences have the core consensus 5'
UCCCC(C)G 3' (SEQ ID NO:38) positioned freely along the length of
the randomized region. Computer modeling of sequences containing
this motif invariably had this consensus region base paired with
the 5' terminal GGGA (see reactant 12.16, (SEQ ID NO:3)).
Conceivably, such base-pairing fixes the terminal GMPS nucleotide,
coordinating the thioate group for reaction with the acetyl
.alpha.-carbon of BrBK. Clones which did not contain the 5'
UCCCC(C)G 3' motif, such as reactant 12.1 (SEQ ID NO:33), did not
usually have the 5'GMPS base-paired in computer-generated
structures. Sixteen reactants were compared with the 30N1 bulk pool
for reactivity with BrBK; all tested reactants show a 10- to
100-fold increase in k.sub.obs relative to the original pool.
Reactant 12.1 was chosen for further kinetic analysis based on
three criteria: (i) in a preliminary study of reaction inhibition
with competing bradykinin it had the lowest K.sub.i for bradykinin
(data not shown); (ii) it was the most frequently represented
molecule in the round 12 population; and (iii), it had the second
fastest k.sub.obs of the reactants tested.
[0075] The selected increase in k.sub.obs of reactant 12.1 is
attributable to increases in both reactivity and binding. In
reaction with BrBK, reactant 12.1 shows a 67-fold increase in
k.sub.cat over that of bulk 30N1 GMPS-RNA, with a 100-fold
reduction in K.sub.m, giving an overall 6700-fold increase in
k.sub.cat/K.sub.m (seeTable 1).
C. Specificity
[0076] Structural elements of BrBK required for optimal binding by
reactant 12.1 were studied through inhibition of the reaction by
bradykinin analogs. While inhibition by BK is not measurable in the
reaction of bulk 30N1 GMPS-RNA with BrBK (data not shown), native
bradykinin (BK) has a K.sub.i of 140.+-.60 .mu.M for the reaction
between reactant 12.1 and BrBK. This value is nearly identical to
the K.sub.m of the uninhibited reaction. Des-Arg.sup.9-BK (a BK
analog lacking the carboxyl terminal arginine) has a K.sub.i of
2.6.+-.0.5 mM. Thus, the lack of the carboxy terminal arginine
decreases the binding between BK and reactant 12.1 approximately
18-fold. Furthermore, des-Arg.sup.1-BK (a BK analog lacking the
amino terminal arginine) does not show any measurable inhibition of
the reaction between reactant 12.1 and BrBK, indicating that the
amino-terminal arginine is absolutely required for the observed
binding between reactant 12.1 and BrBK. Recognition of arginine
must be in the context of the peptide, however, since free
L-arginine alone does not measurably inhibit the reaction. Thus,
the increase in affinity of reactant 12.1 over that of the bulk
30N1 GMPS-RNA for BrBK is in part attributable to reactant
recognition of the amino terminal arginine of BrBK, and to a lesser
extent the carboxy terminal arginine.
[0077] The intrinsic reaction activity of reactant 12.1 was studied
using N-bromoacetamide (BrAcNH.sub.2) as a minimal bromoacetyl
structure. As shown in Table III, the K.sub.m and k.sub.cat values
in the reactions of reactant 12.1 and the 30N1 RNA pool with
BrAcNH.sub.2 are approximately the same. Therefore, the enhanced
reaction rate of reactant 12.1 with BrBK is apparently due not to
increased nucleophilicity of the thioate group, but is rather a
result of steric and/or entropic factors in the positioning of the
two substrates.
Example 2
Splint SELEX to Identify Elastase Inhibitors
[0078] Highly potent and specific inhibitors of human neutrophil
elastase were produced by an approach that incorporates the
technologies of medicinal and combinatorial chemistry. A
small-molecule covalent inhibitor of elastase (the valyl
phosphonate functional unit) was coupled to a randomized pool of
RNA, and this assembly was iteratively selected for sequences that
promote a covalent reaction with the elastase target active site.
The winning sequences increase both the binding affinity and
reactivity over that of the small molecule functional unit alone;
the overall increase in the second-order rate of inactivation was
.about.10.sup.4-fold. The rate of cross-reaction with another
serine protease, cathepsin G, was reduced>100-fold. These
compounds inhibit elastase expressed from induced human
neutrophils, and prevent injury in an isolated rat lung model of
ARDS. This strategy is generally useful for increasing the potency
and specificity of small molecule ligands.
[0079] The splint SELEX process was performed by preparing a
standard SELEX candidate mixture and a single compound containing a
valyl phosphonate functional unit attached to a nucleic acid
sequence that hybridizes to a portion of the fixed region of the
candidate mixture of nucleic acid sequences.
[0080] Functional Unit Synthesis
[0081] The diphenylphosphonovaline co-ligand 3 may be synthesized
from the known Cbz-protected diphenylphosphonovaline 1 as outlined
in Scheme 1. Condensation of isobutyraldehyde, benzyl carbamate and
triphenylphosphite gave compound 1 in 55% yield. The Cbz group was
removed with 30% HBr/AcOH and the resulting HBr salt converted to
the free amine 2 in 86% overall yield. Treatment of 2 with
N,N'-disuccinimidyl carbonate (DSC) in acetonitrile provides the
desired co-ligand 3 which may be conjugated to the amino-DNA splint
via the NHS ester moiety. ##STR1## Synthesis of
N-Benzyloxycarbonyl-O,O'-Diphenylphosphonovaline(1):
[0082] Benzyl carbamate (30.23 g, 0.20 mol), isobutyraldehyde
(27.25 mL, 0.30 mol) and triphenylphosphite (52.4 mL, 0.20 mol)
were dissolved in 30 mL of glacial acetic acid in a 250 mL round
bottom flask. After stirring at room temperature for 5 minutes, the
solution was heated to 80-85.degree. C. in an oil bath for 3 hours.
The mixture was concentrated to an oil on a rotary evaporator
equipped with a vacuum pump and using a bath temperature of
90-95.degree. C. The oil was subsequently dissolved in 250 mL of
boiling methanol, filtered and chilled to -15.degree. C. to promote
crystallization. The crystalline solid was filtered, washed with
cold methanol, air dried and then dried overnight in a vacuum
desiccator to give 48.2 g (55%) of the product: .sup.1H NMR
(d.sub.6-DMSO) d 1.05 (d, 6 H, J=6.7 Hz), 2.28 (dq, 1 H, J=6.2, 6.7
Hz), 4.22 (ddd, 1 H, J.sub.HH=6.2, 10.2 Hz, J.sub.HP=17 Hz), 5.13
(d, 1 H, J=12.6 Hz), 5.13 (d, 1 H, J=12.6 Hz), 7.11-7.42 (ArH, 15
H), 8.09 (d, 1 H, J=10.2 Hz).
Synthesis of O,O'-Diphenylphosphonovaline(2):
[0083] N-Benzyloxy-carbonyl-O,O'-diphenylphosphonovaline (21.97 g,
50.0 mmol) was treated with 18 mL of 30% HBr/HOAc. After 1 hour,
the solidified reaction mixture was suspended in 25 mL of glacial
acetic acid and concentrated to an orange solid. The solid was
triturated with 50 mL of ether overnight, filtered and washed with
ether until off-white. A total of 17.5 g (91%) of the HBr salt was
obtained. This salt was suspended in 150 mL of ether and gaseous
ammonia bubbled through the suspension for 15 minutes. The ammonium
bromide was filtered off and washed with ether. The filtrate was
concentrated and the solid residue dried under vacuum to give 13.05
g (86% overall) of the desired free amine 2: .sup.1H NMR
(d.sub.6-DMSO) d 1.03 (d, 3 H, J=7.0 Hz), 1.06 (d, 3 H, J=7.1 Hz),
1.93 (br, 2 H, -NH.sub.2), 2.16-2.21 (m, 1 H), 3.21 (dd, 1 H,
J.sub.HH=3.7 Hz, J.sub.HP=14.5 Hz), 7.17-7.23 (ArH, 6 H), 7.33-7.41
(ArH, 4 H).
Synthesis of
N-Succinimidyloxycarbonyl-O,O'-Diphenylphosphonovaline(3):
[0084] N,N'-Disuccinimidyl carbonate (243 mg, 0.95 mmol) was
dissolved in 5 mL of dry acetonitrile. A solution of
O,O'-diphenylphosphonovaline (289 mg, 0.95 mmol) in 5 mL of dry
acetonitrile was added and the mixture stirred at room temperature
for 2 hours. The precipitated product was filtered, washed with dry
acetonitrile and dried under vacuum to give 229 mg (54%) of a white
solid: .sup.1H NMR (d.sub.6-DMSO) d 1.06 (d, 3 H, J=6.5 Hz), 1.08
(d, 3 H, J=6.7 Hz), 2.25-2.39 (m, 1 H), 2.81 (br s, 4 H), 4.12
(ddd, 1 H, J.sub.HH=6.0, 10.0 Hz, J.sub.HP=18 Hz), 7.14-7.29 (ArH,
6 H), 7.36-7.45 (ArH, 4 H), 9.18 (d, 1 H, J=10.0 Hz); .sup.13C NMR
(d.sub.6-DMSO) d 18.28 (d, J.sub.CP=7.4 Hz), 19.82 (d,
J.sub.CP=10.4 Hz), 25.21, 28.69 (d, J.sub.CP=4.3 Hz), 54.61 (d,
J.sub.CP=56.1 Hz), 120.43, 120.48, 125.16, 125.33, 129.73, 129.85,
149.54 (d, J.sub.CP=9.6 Hz), 149.70 (d, J.sub.CP=10.1 Hz), 152.72,
170.56; .sup.31P NMR (d.sub.6-DMSO, 85% H.sub.3PO.sub.4 reference)
d 18.02 ppm; Anal Calcd for C.sub.21,H.sub.23N.sub.2O.sub.7P: C,
56.50; H, 5.19; N, 6.28; P, 6.94. Found: C, 56.35; H, 5.16; N,
6.29; P, 6.52.
[0085] Ligand Selection
[0086] The valyl phosphonate was activated via an NHS ester. This
compound was coupled to the 5' hexyl amine linker of a 19-mer DNA
oligo complementary to the 5'-fixed region of 40N7.1 (SEQ ID NO:38)
candidate mixture.
[0087] Synthesis of the starting RNA pool used 70pmol of 40N7.1 DNA
as template. This DNA was produced by PCR amplification from 10
pmol of synthetic DNA. The transcription buffer is 80 mM HEPES pH
7.5, 12 mM MgCl.sub.2, 2 mM spermidine, 40 mM DTT, 1 mM GTP, 0.5 mM
ATP, 1.5 .mu.M .alpha..sup.32P-ATP (800 Ci/mmol, New England
Nuclear), 2 mM each uridine- and cytosine-2'-amino nucleoside
triphosphate, 0.01 unit/.mu.L inorganic pyrophosphatase (Sigma),
.about.0.5 .mu.M T7 RNA polymerase. Transcription was at 37.degree.
C. for 10-14 hours. Full-length transcripts were purified by
electrophoresis on an 8% acrylamide/7 M urea TBE-buffered
polyacrylamide gel.
[0088] Purified RNA was mixed with a 1.1-fold excess of splint DNA,
and annealed by heating to 65.degree. C. followed by cooling to
35.degree. C. over 5 minutes. This hybrid was mixed with hNE
(Calbiochem) at a 5- to 20-fold excess of RNA, and allowed to react
for 5-15 minutes at 37.degree. C. The reaction was quenched by
addition of sodium dodecyl sulfate (SDS) to 0.1%. Volumes less than
200 .mu.L were loaded directly on a 4% polyacrylamide gel with SDS
added to 0.025%, and buffered with TBE. Larger volumes were
concentrated by ultrafiltration through a Centripor 50K MWCO filter
cartridge centrifuged at 3000.times.g at 10.degree. C., then loaded
on the gel. The gel was run at 300V for 2 hours, and the bands of
conjugated and unconjugated RNA were visualized by autoradiography.
The band corresponding to the RNA:splint DNA:hNE complex was
excised, crushed, and eluted in a buffer of 50 mM Tris pH 7.5/4M
guanidinium isothiocyanate/10 mM EDTA/2% sodium sarcosyl/1%
.beta.-mercaptoethanol at 70.degree. C. for 30 minutes. The eluate
was recovered by centrifugation through Spin-X 0.45 .mu.m cellulose
acetate microcentrifuge filter cartridges. The RNA was then ethanol
precipitated and resuspended in 50 .mu.L H.sub.2O.
[0089] To the 50 .mu.L RNA, 6 .mu.L of IOX RT buffer (1.times.=50
mM HEPES pH 7.5/50 mM NaCl/10 mM MgCl.sub.2/5 mM DTT), 100 pmol
each of the 5' and 3' primers, and 0.67 mM each dNTP were added.
The mixture was heated to 65.degree. C., then cooled to 35.degree.
C. over 5 minutes. The reaction was initiated by addition of 40
units AMV reverse transcriptase (Life Sciences), and incubation
continued at 35.degree. C. for 5 minutes. The temperature was then
raised by 2.degree. C. per minute for 15 minutes to 65.degree. C.
At 52-55.degree. C., another 40 units of reverse transcriptase was
added.
[0090] The polymerase chain reaction was initiated by adding 2
.mu.L 1 M potassium acetate, 10 .mu.L 40% acetamide, 30 .mu.L
H.sub.2O, and 2.5 units TaqDNA polymerase (Promega). 16 cycles were
carried out at 92.degree. C./30 sec.fwdarw.62.degree.
C./(20+n.times.10) sec (where n is the cycle
number).fwdarw.72.degree. C./40 sec. The DNA was ethanol
precipitated and resuspended in 100 .mu.L H.sub.2O. 10 .mu.L of
this reaction was used as a transcription template in the next
round of SELEX. Ten cycles of SELEXion were carried out using this
protocol.
[0091] Sequence/Structure of Ligands
[0092] The sequences of 64 RNAs from the round 10 pool were
determined and shown in Table IV. 12 of these are clones, or
"psuedo-clones" of other sequences. Pseudo-clones are sequences
that differ at only one or two positions from other sequences, and
probably arose by errors in replication or transcription. Three
features of these sequences are apparent by inspection. First, the
mononucleotide composition of the randomized regions are not biased
toward G (0.19 mol fraction G). PolyG is known to bind and inhibit
elastase. Second, virtually all clones (61/64) extend the length of
the splint helix by 2 or 3 base-pairs, usually with the sequence
"CA" or "CAG". Third, 23/64 clones share the sequence "GUGCC" at
the 3' end of the random region. Because of the positioning of this
sequence, it is expected that it forms a structure with the 3'
fixed region.
[0093] Computer-assisted RNA folding studies suggest a common
structural motif. About half of the sequences studied (19/39) are
capable of forming a perfect (i.e., without bulges or internal
loops) hairpin at the 5' end of the random region, immediately 3'
to the splint helix, or separated from the splint helix by a U
(5/19). The stems of these potential hairpins range in length from
4 to 9 base-pairs, with 7 base-pairs being the most common length.
There is no apparent sequence conservation in the stem. The loops
of these hairpins range in size from 4 to 7 bases, with no apparent
sequence conservation. The conserved position of these hairpins
suggest they form a coaxial stack on the splint helix.
[0094] Most of the computer-generated foldings suggest base-pairing
with the 5' end of the splint DNA. The formation of some structure
in this region is to be expected, since it contains the active-site
reagent. However, the likelihood of finding a 3-base complement to
the 5' sequence (i.e. GRY) within a 40 nt random region by chance
is high, and so the significance of the pairings generated is
problematic. There are two types of evidence for some interaction
with this region. The 5' end of the DNA is protected from digestion
by S1 nuclease by several of the selected RNAs, as compared to the
unselected pool. Second, removing the valyl phosphonate from the
splint oligo reduces the T.sub.M of RNA 10.14 by 3 .degree. C. This
indicates an interaction between the valyl phosphonate and RNA that
stabilizes the RNA secondary or tertiary structure.
[0095] Activity Assays
[0096] Protease Inhibition Assay
[0097] A colorimetric assay was used to monitor the peptide
hydrolysis activity of human neutrophil elastase. 34 of the
selected RNAs were surveyed for hNE inhibitory activity using the
peptide hydrolysis assay. An excess of RNA:splint DNA hybrid, at a
series of concentrations is added to hNE, and hydrolysis of a
chromogenic peptide is monitored by absorbance at 405 nm. The slope
of the plot of A.sub.405 vs. time represents elastase activity. As
the inhibitor reacts with hNE over time, the slope approaches
0.
[0098] The concentrations of the reactants were:
N-methoxysuccinyl-Ala-Ala-Pro-Val-p-nitroanilide (AAPV-NA, Sigma),
200 or 300 .mu.M; hNE, 2-5 nM; RNA, 10-250 nM; N-Boc-valine
phosphonate diphenyl ester, 2-50 .mu.M. The reactions were buffered
with Hank's buffered saline (Sigma) plus 20 mM Tris pH 7.5 and
0.01% human serum albumin (Sigma). Reaction volumes were 200 or 300
.mu.L. Reactions were mixed in polystyrene 96-well microtiter
plates, and monitored at 405 nm in a BioTek EL312e microtiter plate
reader at 37.degree. C. After a 2 minute delay, readings were taken
every minute for 30 minutes. A plot of A.sub.405 vs. time was
fitted to equation (1) (Kaleidagraph, Synergy Software).
A.sub.405=v.sub.0(1-e.sup.[k.sub.obs.sup.t])+A.sub.t (1) v.sub.0 is
the steady-state rate of peptide hydrolysis by elastase, k.sub.obs
is the observed rate of inactivationof elastase by inhibitor, and
A.sub.t is a displacement factor which corrects for the delay
between the reaction start and data collection. The second-order
rate constant for inhibition, k.sub.obs/[I], was obtained from the
slope of a replot of k.sub.obs vs. inhibitor concentration.
V.sub.max and K.sub.M values for peptide hydrolysis were obtained
from plots of v.sub.0 vs. [AAPV-NA], fitted to equation (2) v 0 = V
max .function. [ AAPV NA ] K M + [ AAPV NA ] ( 2 ) ##EQU1##
Thrombin and cathepsin G inhibition were measured by a similar
assay. Thrombin (Enzyme Research, Inc.) was at 0.5nM, and its
substrate, S-2238, was at 75 .mu.M. Cathepsin G (Calbiochem) was at
40 nM, and its substrate,
N-methoxysuccinyl-Ala-Ala-Pro-Phe-p-nitroanilide (Sigma) was at 200
.mu.M.
[0099] Preparation of Human Neutrophils
[0100] 25 mL of blood from volunteers was withdrawn into
EDTA-treated vacuum tubes. This blood was immediately layered on a
double-density gradient of 15 mL Histopaque (Sigma) 1.119 g/mL and
10 mL 1.077 g/mL in a 50 mL Falcon disposable conical tube. The
tube was centrifuged for 30 minutes at 2000 g in a Beckman TJ-6
centrifuge at room temperature. Granulocytes, which are>80%
neutrophils, are held up at the interface between the two layers of
Histopaque. This layer was withdrawn and washed three times in 25
mL HBSS by centrifugation at 700 g for 10 minutes at room
temperature. Between washes, contaminating red blood cells were
lysed by resuspending the cell pellet in 5 mL cold distilled water,
and vortexing for 30 seconds, after which 25 mL HBSS was added, and
the cells pelleted. Live cells were counted by trypan blue
exclusion in a hemocytometer.
[0101] Elastase activity was determined by adding 10.sup.5-10.sup.6
cells to a well of a microtiter plate in 0.3 mL HBSS, inducing with
0.1 .mu.g/mL phorbol myristyl acetate (Sigma), and monitoring
AAPV-NA hydrolysis as described above. The results of this assay
are provided in Table V.
[0102] Denaturing Gel Assay
[0103] The covalent reaction between elastase and the splint DNA
was assayed by denaturing gel electrophoresis. The splint oligo,
modified with the valine phosphonate, was 3' end-labelled using
terminal deoxynucleotidyl transferase and .alpha.-.sup.32P
cordycepin (New England Nuclear). The labelled splint oligo and RNA
were mixed and annealed as described above, and the reaction was
initiated by adding a.gtoreq.five-fold excess of hNE. Reactions
were at 37.degree. C. for 10-60 seconds. 2-5 time points were taken
for each elastase concentration. The reaction was quenched by
addition of an aliquot to 2.5 volumes of 0.1 M MES pH 6.3/10 M
urea/1% SDS at 50.degree. C. The elastase-oligo conjugate was
resolved from the free oligo by denaturing electrophoresis in a
TBE/7M urea/0.05% SDS polyacrylamide gel. A Fuji Phosphor Imager
was used to visualize dried gels, and quantify the conjugated and
free oligo.
[0104] k.sub.obs for each elastase concentration was calculated by
linear regression of a plot of ln(S.sub.t/S.sub.0) vs. time, where
S.sub.t is the amount of free oligo remaining at a given time, and
S.sub.0 is the total amount of reactive oligo. S.sub.0 is
calculated as the maximum extent of the reaction from an extended
time course at high elastase concentration. The extent varied
between 0.42 and 0.45 of total oligo. Because the valine
phosphonate used was a racemate, and the elastase active site is
specific for (L)-valine, a maximum extent of 0.5 is expected. The
kinetic constants k.sub.cat and K.sub.M for the covalent reaction
of oligo with hNE were obtained by replotting k.sub.obs vs. [hNE],
and fitting to equation (2).
EXAMPLE 3
Nucleic Acid Ligands That Bind to HIV-1 Rev Protein
[0105] A target protein chosen to illustrate photo-SELEX process
described in copending PCT/US94/10562 (WO 95/08003), filed Sep. 16,
1994, which is herein incorporated by reference was theRev protein
from HIV-1. The example provided herein describes that ligands were
identified which bound covalently to the Rev protein both with and
without irradiation.
[0106] Rev's activity in vivo is derived from its association with
the Rev-responsive element (RRE), a highly structured region in the
HIV-1 viral RNA. Previous RNA SELEX experiments of Rev have allowed
the isolation of very high affinity RNA ligands. The highest
affinity ligand, known as "Rev 6a," (SEQ ID NO: 103) has a K.sub.d
of approximately 1 nM. The sequence of Rev 6a is TABLE-US-00001
(SEQ ID NO: 103) GGGUGCAUUGAGAAACACGUUUGUGGACUCUGUAUCU.
The secondary structure of 6a, and its interaction with Rev, have
been well characterized.
[0107] The construction of the nucleic acid test mixture for
photo-SELEX was based upon the Rev 6a sequence (SEQ ID NO: 103).
During the synthesis of the deoxyoligonucleotide templates for
SELEX, the random region of the template was substituted by a
"biased randomization" region, in which the ratio of the four input
bases was biased in favor of the corresponding base in the Rev 6a
sequence. (Actual ratios were 62.5:12.5:12.5:12.5). For example, if
the Rev 6a base for a particular position is G, then the base input
mixture for this synthesis step is 62.5% G, and 12.5% of the other
three bases. The photoreactive uracil analogue 5-iodouracil (iU),
which has been used to generate high-yield, region-specific
crosslinks between singly-substituted iU nucleic acids and protein
targets (Willis et al. (1993) Science 262:1255) was used for this
example. In this case, the 5-iodo acts as a functional unit. This
"biased randomization" nucleic acid test mixture contains
approximately 10.sup.4 unique sequences. This template was used for
in vitro T7 transcription with 5-iUTP to generate fully-substituted
iU RNA for selection.
[0108] The iU chromophore is reactive under long-wavelength
ultraviolet radiation, and may photocouple to the aromatic amino
acids of protein targets by the same mechanism as 5-bromouracil
(Dietz et al. (1987) J. Am. Chem. Soc. 109:1793). As discussed
above, the target for this study is the HIV-1 Rev protein, which is
necessary for productive infection of the virus (Feinberg et al.
(1986) Cell 46:807) and the expression of the viral structural
genes gag, pol and env (Emerman et al. (1989) Cell 57:1155). The
interaction of Rev with high affinity RNA ligands is well
characterized. A single, high-affinity site within the RRE (the IIB
stem) has been identified (Heaphy et al. (1991) Proc. Natl. Acad.
Sci. USA 88:7366). In vitro genetic selection experiments have
generated RNA ligands that bind with high affinity to Rev and have
helped determine the RNA structural elements necessary for Rev:RNA
interactions (Bartel et al. (1991) Cell 67:529; Tuerk et al. In The
Polymerase Chain Reaction (1994) pp.233-243; Jensen et al. (1994)
J. Mol. Biol. 235:237).
[0109] The SELEX procedure alternated between affinity selection
for Rev using nitrocellulose partitioning and monochromatic UV
irradiation of the nucleoprotein complexes with denaturing
polyacrylamide gel partitioning of the crosslinked complexes away
from non-crosslinked RNA sequences. The final procedure utilized a
simultaneous selection for affinity and crosslinking using
competitor tRNA. Each round constitutes a selection followed by the
conversion of recovered RNA to cDNA, polymerase chain reaction
(PCR) amplification of the DNA, and in vitro transcription to
generate a new pool of iU-RNA. To amplify RNA's recovered as
covalent nucleoprotein complexes, the appropriate gel slice was
isolated and proteinase K treated.
[0110] The RNA pool was first subjected to three rounds of affinity
selection with Rev protein, with partitioning of the higher
affinity sequences by nitrocellulose filters. Next, the evolving
RNA pool was subjected to UV laser irradiation in the presence of
excess Rev protein to allow those RNA sequences with the ability to
crosslink with the protein to do so. Crosslinked RNA sequences were
then partitioned using polyacrylamide gel electrophoresis (PAGE).
These crosslinked RNAs were recovered from the gel material, the
linked Rev protein digested away, and the RNAs used for cDNA
synthesis and further amplification for the next round of
photo-SELEX. A 308 nm XeCl excimer laser was used for the first
round of photocrosslinking; thereafter, a 325 nm HeCd laser was
employed.
[0111] Following four rounds of selection for laser-induced
crosslinking, the RNA pool was again put through three rounds of
affinity selection. Finally, the RNA pool was selected
simultaneously for its ability to bind Rev with high affinity and
to crosslink to the protein. This was accomplished by using high
concentrations of a non-specific nucleic acid competitor in the
photocrosslinking reaction.
[0112] Crosslinked product increased approximately 30-fold from the
starting pool to round 13. Under these conditions, the greatest
increase in crosslinking is correlated with the greatest increase
in affinity--from round 7 to round 10.
[0113] After 13 rounds of selection, the PCR products were cloned
and 52 isolates sequenced and described in copending
PCT/US94/10562. Several of the ligands isolated by this procedure
were able to form a stable complex with the target protein
resistant to denaturing gel electrophoresis in the absense of UV
irradiation. One of these ligands was termed Trunc24 (SEQ ID NO:
104) and has the sequence TABLE-US-00002
GGGGAUUAACAGGCACACCUGUUAACCCU.
[0114] Trunc24 (SEQ ID NO: 104) photo-independent crosslinking with
HIV-1 Rev in the presence of human nuclear extracts was determined
as follows: Trunc24 RNA, nuclear extracts, and Rev protein were
combined and incubated on ice for 10 minutes. Samples were mixed
1:1 with 8 M urea loading buffer and placed on a 7 M urea, 8%
polyacrylamide gel for analysis. The experiment showed that the
ligand covalently bound to the target protein without
photocrosslinking. TABLE-US-00003 TABLE 1 Temp. (.degree. C.) 37 30
30 24 24 20 0 0 0 0 0 0 Reaction time (s) 60 60 30 60 30 30 60 60
120 60 30 60 [RNA] (.mu.M) 40 40 40 40 40 40 20 20 20 20 20 20 %
RNA reacted 1.3 0.7 0.8 0.7 1.9 2.5 1.2 3.4 4.5 5.0 2.5 2.8
Background ratio 3.2 3.2 3.4 1.7 2.5 3.9 3.1 4.0 4.9 10.1 9.0
4.5
[0115] TABLE-US-00004 TABLE II GGGAGCUCAGAAUAAACGCUCAA [30N]
UUCGACAUGAGGCCCGGAUCCGGC (SEQ ID NO: 1) K.sub.obs Ligand #
-----------30N region--------- Freq (s.sup.-1) Seq. ID No. Class I:
12.48 CUCCCCCGUGCUGCCUUAGCGCGUAGUUCG 1 2 12.16
CUCCCCGUUAGCGCCUCACUGACGUGUCGA 4 1.34e.sup.-3, 1.4e.sup.-3 3 10.25
CUGAGUCAUGCGGCAGCUCCCCGCCACGC 1 4 12.2
UGCCUUGUUCUUUUACUCCCCCGACGCCUC 2 5 10.28
CGUUUAGGACUCCCCCGUUCGUCGAGCGAA 2 1.8e.sup.-3 6 12.19
CGUUUAGGUCUCCCCCGUCCGUCGAGCGAA 1 7 12.25
CUGCGUUACUCCCCCGGACAACUGUUCGUUA 1 8 12.8
UCUUCGUGUUCCCCGUGCUGUGUCGUCACG 2 9 12.14
ACGUCAUUCCGAGUCGGGUUCGUUCCCCGC 1 1.7e.sup.-3 10 12.47
UGUGUGAGUGGAUCCGUUCCCCGCCUGGUG 1 1.49e.sup.-3 11 Class II 10.19
UGGACACAACUCCGUUAUCUCGCUCUCAGC 1 12 10.21
UGAACACAACUUCAUAUCUCGGGACUCACAG 1 13 12.31
UCGACACAACUCGAUCUCCGUGGCUGUCAC 2 8.9e.sup.-4, 1.5e.sup.-3 14 12.23
UCGACACAACUCGAUCUCCGUGUCUGUCAC 1 15 12.46
UGGACACAACUCCAUUCAUCCCGGGACCGCUG 1 6.7e.sup.-4 16 12.28
UGGUCACAACUCCAUUAGCUGAGGCCCGUG 1 17 12.41
GCGACACAACUCGAUCUCCGUGGCUGUCAC 1 18 12.40
GUCUCACAACUGGCUUAUCCGGUGCGCACG 1 1.4e.sup.-3, 1.9e.sup.-3 19 12.21
GCCACACAACUGGCUUAUCCUGAACGCGGC 1 20 12.32
CCAUCACAACUUGGUUAUCCGGUACUCUGUG 1 21 12.39
CAUCACAACUUGUUAUCCGCUUCACCGCUC 1 22 12.3
CAUCACAACUUGUUGUCCUGGUCGAUGUCC 3 7.5e.sup.-4 23 10.26
CAUCACAACUUGUUGUCCCGGUACUUGUGU 1 24 10.23
UGUCACAACUCAUUGUUCGGGAAUUGUGCCA 1 25 12.24
CGUCAGCGGAUCUCCAUUGCGUUAUACGGG 1 1.44e.sup.-3 26 12.4
CGAAUCAAUGCGCGGAUCUCAGGAUAUUCG 5 1.7e.sup.-3 27 12.6
GCGGUAACAUGCUGGAUCUCAGGAAACCGC 3 2.2e.sup.-3 28 12.45
GCGGUAACAUGCUGGAUCUCAGGAAACCGU 1 5.1e.sup.-3 29 12.22
UGCCACUUUUGUUCGGAUCUUAGGAAGGCA 1 1.2e.sup.-3 30 12.42
UCAUCAUUUGUACCGGAUCUCAGUGUGAUG 1 31 10.24
AGCUGUUGGCAGCCCGGAUCUACGCAUGGGA 1 32 12.1
AGCUGUUGGCAGCGCUGGUGAAGGGAUAGGC 6 3.0e.sup.-4, 2.6e.sup.-3 33 Class
III 12.17 UGAGAACUCCGUGAUUGAGUCAGGUACGCGC 1 34 12.30
UCCGUGUUGCCACUCCAGUUACUGGACGCC 1 5.4e.sup.-4, 9.4e.sup.-4 35 12.9
GUGGAGCUUCGUGACUUGGUCGGAGCCGUG 1 1.28e.sup.-3 36 12.35
UCGUGUCGCCACCAGCCUUUCUCGUGCGCC 1 37
[0116] TABLE-US-00005 TABLE III GMPS BrAc sub- sub-
k.sub.cat/K.sub.m strate strate k.sub.cat (sec.sup.-1) K.sub.m (M)
(M.sup.-1 sec.sup.-1) 30N1 BrBK 2.1 .+-. 0.4 .times. 10.sup.-4 1.3
.+-. 0.3 .times. 10.sup.-2 1.6 .times. 10.sup.-2 reactant BrBK 1.4
.+-. 0.1 .times. 10.sup.-2 1.3 .+-. 0.3 .times. 10.sup.-4 1.1
.times. 10.sup.2 12.1 30N1 BrAcNH.sub.2 -- -- -- reactant
BrAcNH.sub.2 1.1 .+-. 0.1 .times. 10.sup.-4 2.1 .+-. 0.3 .times.
10.sup.-2 5.2 .times. 10.sup.-3 12.1
[0117] TABLE-US-00006 TABLE IV SPLINT-ELASTASE LIGANDS SeqI Lig
Sequence 39 10.1
gggaggacgaugcggCAUGAUCUAGGUAAAGACAUAUCACUAACCUGAUUGUGCCcagacgacgag-
cggga 40 10.2
gggaggacgaugcggCAGUAAUCUUUGGUAUCAAGAUUACUGGGAUGUCCGUGCCcagacgacgag-
cggga 41 10.3
gggaggacgaugcggCAGUAAUCUUUGGUAUCAAGAUUACUGGGAUGUGCGUGCCcagacgacgag-
cggga 42 10.4
gggaggacgaugcggCAAACCAUCUAAGCUGUGAUAUGACUCCUAAGACAGUGCCcagacgacgag-
cggga 43 10.6
gggaggacgaugcggCAUCGUCAAUGUAGUAGUACUACGUAAGUCACGUGGUCCCcagacgacgag-
cggga 44 10.7
gggaggacgaugcggCGAUAAUCUUGGUAUCAAGAUUACUGGGAUGUCGCGUGCCcagacgacgag-
cggga 45 10.8
gggaggacgaugcggCAUAUCUACAUGUAGGUCCUAAUCGAAAUCCAGUUGUGCCcagacgacgag-
cggga 46 10.10
gggaggacgaugcggCAUUAGUCCGUAGCAUAGCACUAUCUAAACCAGUUGGGGAcagacgacga-
gcggga 47 10.11
gggaggacgaugcggCUACAUAGGUUAAGAUUACCUAACCGAAUUAACAUGCAGCcagacgacga-
gcggga 48 10.13
gggaggacgaugcggUAAGUUACUACCGAUACAACCGAAGUCCUCUACCCGUGGcagacgacgag-
cggga 49 10.14
gggaggacgaugcggCAUUACUAAGAUUAACAGCUUAGUAUAACAGCCUCCUGUGcagacgacga-
gcggga 50 10.16
gggaggacgaugcggCACGUACAGUCUAAAAGUGUGUUAGUGUAGCGGUGGUGUGcagacgacga-
gcggga 51 10.17
gggaggacgaugcggCAGUAGCAAUAAGACUACUGUAGGGUUGAAUCCGUGCUGcagacgacgag-
cggga 52 10.18
gggaggacgaugcggCAUUACUAAGAUUAACAGCUUAGUAUAACAGCCUCCUGUGcagacgacga-
gcggga 53 10.19
gggaggacgaugcggUGCAUGCGUACCAGUAUCCUAAACUAAACCUAGCGUGCCCcagacgacga-
gcggga 54 10.21
gggaggacgaugcggGCAGUGUGUAUUGAAGUAUAACUCUGUGAUCACCUGCUGcagacgacgag-
cggga 55 10.22
gggaggacgaugcggCACUAAGUAUCGUCACUAGCAUCAUGACGGAACCCGUGCCcagacgacga-
gcggga 56 10.23
gggaggacgaugcggCAGUCCAAAUGUAUAACAAGUAGCUGGUCAAACCCUUGGCcagacgacga-
gcggga 57 10.25
gggaggacgaugcggCAUGUCAAUACAAGCAUGUAAUCCACUAAGCAUCUGUCCCcagacgacga-
gcggga 58 10.27
gggaggacgaugcggCAGUAGUCUAGCAGUAUCGUCCCUGAAGGAUCAGGGUGUGcagacgacga-
gcggga 59 10.29
gggaggacgaugcggCAGUAGAUUGAAUGCAUCGUCACGUAAACUGCGUGGUCCCcagacgacga-
gcggga 60 10.30
gggaggacgaugcggCACUAAACCUGUAUAGCCGUACUAACAACCUCACCGUGCCcagacgacga-
gcggga 61 10.31
gggaggacgaugcggCAGAUGUCCUAGAUUUGGAUGUGUAACUAAGGUUGUGGUGcagacgacga-
gcggga 62 10.32
gggaggacgaugcggCAAUAGCUAGACUCUCAAAGAUGUGUAAAACACCGUUGGCcagacgacga-
gcggga 63 10.33
gggaggacgaugcggCAGCAUCGACUCUGUAAUCAGAUAAAUCAGGUGGGUGUGcagacgacgag-
cggga 64 10.34
gggaggacgaugcggCAACAAGUAUCAAUCAAACGUCGUCAUAGGUUACCUUGGCcagacgacga-
gcggga 65 10.36
gggaggacgaugcggCAGCAUGUAAUCAAUACUGCAGCAUAAACUCCGUGUGCCcagacgacgag-
cggga 66 10.37
gggaggacgaugcggCAGUAAUCUUGGUAUCAAGAUUACUGGGAUGUGCGUGCCcagacgacgag-
cggga 67 10.38
gggaggacgaugcggCAUAUCAUGGUGAUCUUGAUCCAAUAACCGUGAUUGUGCCcagacgacga-
gcggga 68 10.39
gggaggacgaugcggCAGUGUGAUUAACAUAGCGGAUUAACAACACUGUCGUGGGcagacgacga-
gcggga 69 10.40
gggaggacgaugcggGCAAGAUCAAUCGGAUCAACACAACGUUGAUCCGCCUGCCcagacgacga-
gcggga 70 10.41
gggaggacgaugcggCAGAUCUACAAUCAGAUUGACUAAUCAUGAUCCGCCUGCCcagacgacga-
gcggga 71 10.42
gggaggacgaugcggCAUGAACUGAUAAUAAGGUUCAUAGCUUGAGGGUGUUGGCcagacgacga-
gcggga 72 10.43
gggaggacgaugcggCUAAUGAGCUUGAUAACAGGAUGUUAUCAAGCCGGCUGUAcagacgacga-
gcggga 73 10.44
gggaggacgaugcggCAUGUACAUAGUAUGACUCGUGAUCUGCCUCCAUGGUCCcagacgacgag-
cggga 74 10.45
gggaggacgaugcggCAGUGGUACCUGAGUACCACUAUAGCUGGAUAUAUGUGUCcagacgacga-
gcggga 75 10.46
gggaggacgaugcggAUUUUUCAACGCUUUACACGCACACUGAUUUAGUUAUGGGcagacgacga-
gcggga 76 10.47
gggaggacgaugcggCAUAGCUAAAUAACACUAACUAUGCCAAACGUCCGUGUAcagacgacgag-
cggga 77 10.48
gggaggacgaugcggCAUGAACUGAUAAUAAGGUUCAUAGCUUGAGGGUGUUGGCcagacgacga-
gcggga 78 10.50
gggaggacgaugcggUAGGACGAAACAUAGUCUACCAGCAGCCUCCAAGCCCCCCcagacgacga-
gcggga 79 10.51
gggaggacgaugcggCAGUAAUCUUGGUAUCAAGAUUACUGGGAUCUGUCGUGCCcagacgacga-
gcggga 80 10.52
gggaggacgaugcggCAAGUAGUGUACAUACAAUGCCAAGUCUCCCGGGUGUAcagacgacgagc-
ggga 81 10.54
gggaggacgaugcggCAGUAAUCUUGGUAUCAAGAUUACUGGGAUCUGUCGUGCCcagacgacga-
gcggga 82 10.55
gggaggacgaugcggCAGUAGGGAUCUUGAGAAGUACUACUGCAGCCCUGUGCCcagacgacgag-
cggga 83 10.56
gggaggacgaugcggCAUGAUAAUGGAUUACAUCAUGAAGCUUAAGACUCCUGUGcagacgacga-
gcggga 84 10.57
gggaggacgaugcggAAUCAAUACCGUAAGUCCCUGUAACUAGUUAGGUUGUGCCcagacgacga-
gcggga 85 10.58
gggaggacgaugcggCAUGCCAUAGUUAUACCAAUGAUGUGAUGUAGGUGUGCCUcagacgacga-
gcggga 86 10.59
gggaggacgaugcggCAAUAGAUAUCAAGCAACCUCCUAGUGAUGGACAUGUUCCcagacgacga-
gcggga 87 10.60
gggaggacgaugcggCUAAUGAGCUUGAUAACAGGAUGUUAUCAAGCCGGCUGUGcagacgacga-
gcggga 88 10.61
gggaggacgaugcggCAGUAAUCUUGGUAUCAAGAUUACUGGGAUGUGCGUGCCcagacgacgag-
cggga 89 10.62
gggaggacgaugcggCACCUAUAUGUGCAUAGUUGCAUGAUCUAACCAUGUGCCCcagacgacga-
gcggga 90 10.63
gggaggacgaugcggCAUAGUCACAAUUGAUUAGCUAGCUGCAUAGGGUGUUGGAcagacgacga-
gcggga 91 10.64
gggaggacgaugcggCAUAAGCAUAUGUACAUCCUAACCUCCUGAUGUUGUGCCcagacgacgag-
cggga 92 10.65
gggaggacgaugcggCAUAUGAAGAGCUUGCAAGUUACCUCCGAAUAAGUGUCCCcagacgacga-
gcggga 93 10.66
gggaggacgaugcggCAUAGUGUAGUAGAUAUGGAUGCCUGUACGUCCCUGCCcagacgacgagc-
ggga 94 10.67
gggaggacgaugcggCAUAGCUGUAUACCUGAAGUCGAUAAGUACUCCCGUGCCCcagacgacga-
gcggga 95 10.68
gggaggacgaugcggCAAUACUAACAUAGCGUCCUAGGAUUAGGUCUCCCAUGGCcagacgacga-
gcggga 96 10.69
gggaggacgaugcggCAUAACGUGAAUAUCUGAGUACUAACCGUGUCGUUGUGCCcagacgacga-
gcggga 97 10.70
gggaggacgaugcggCAUAUGUGUGUAUAGUCCUACACAUAUGCGUGUGUGUGcagacgacgagc-
ggga 98 10.71
gggaggacgaugcggCAUCCAUAAUACUCCUAAAGACCUCAUCAACUCCUGCUGcagacgacgag-
cggga 99 10.73
gggaggacgaugcggCAUAAGAUCAGUAUACAGAUAACCGAUAAGACCUUCCCCCcagacgacga-
gcggga 100 10.72
gggaggacgaugcggCACUGAGAGUGUAAGUAGAUAACCAAGUCCUCUGGGUGCCcagacgacg-
agcggga 101 10.74
gggaggacgaugcggCUAGUAACCAUGACUAGCUAAUAGGGCUAUCCGUCCUGGCcagacgacg-
agcggga 102 10.75
gggaggacgaugcggCACAAUUCAAUAAGUGCACCACUAACUAAUAUCGUGCUAcagacgacga-
gcggga
[0118] TABLE-US-00007 TABLE V SEQ Inhibitor kinact/[I] nPhe val P
1.6E+04 DNA:valP 7.4E+04 38 rd0 RNA:DNA:valP 2.9E+05 39 10.1
RNA:DNA:valP 1.9E+06 40 10.2 RNA:DNA:valP 1.9E+06 43 10.6
RNA:DNA:valP 3.1E+06 44 10.7 RNA:DNA:valP 2.9E+06 46 10.10
RNA:DNA:valP 2.8E+06 47 10.11 RNA:DNA:valP 5.1E+06 48 10.13
RNA:DNA:valP 1.8E+06 49 10.14 RNA:DNA:valP 4.8E+06 50 10.16
RNA:DNA:valP 5.4E+06 51 10.17 RNA:DNA:valP 1.4E+06 53 10.19
RNA:DNA:valP 2.5E+06 54 10.21 RNA:DNA:valP 3.4E+06 55 10.22
RNA:DNA:valP 3.5E+06 56 10.23 RNA:DNA:valP 3.6E+06 57 10.25
RNA:DNA:valP 2.9E+06 58 10.27 RNA:DNA:valP 3.0E+06 59 10.29
RNA:DNA:valP 4.1E+06 60 10.30 RNA:DNA:valP 1.3E+06 61 10.31
RNA:DNA:valP 1.2E+06 62 10.32 RNA:DNA:valP 1.1E+06 63 10.33
RNA:DNA:valP 1.2E+06 64 10.34 RNA:DNA:valP 9.9E+05 65 10.36
RNA:DNA:valP 2.6E+06 67 10.38 RNA:DNA:valP 2.2E+06 68 10.39
RNA:DNA:valP 1.3E+06 72 10.43 RNA:DNA:valP 1.0E+06 74 10.45
RNA:DNA:valP 9.9E+05 75 10.46 RNA:DNA:valP 1.0E+06 76 10.47
RNA:DNA:valP 1.2E+06 78 10.50 RNA:DNA:valP 9.4E+05 79 10.51
RNA:DNA:valP 1.4E+06 80 10.52 RNA:DNA:valP 1.2E+06 84 10.57
RNA:DNA:valP 1.2E+06 85 10.58 RNA:DNA:valP 1.9E+06 93 10.66
RNA:DNA:valP 1.0E+06 100 10.72 RNA:DNA:valP 1.2E+06
[0119]
Sequence CWU 1
1
* * * * *