U.S. patent application number 11/113311 was filed with the patent office on 2006-04-20 for method for treating respiratory distress syndrome.
This patent application is currently assigned to The Nemours Foundation. Invention is credited to Vicky L. Funanage, Sandra G. Hassink, Susan M. Kirwin, Darlise O'Connor.
Application Number | 20060084601 11/113311 |
Document ID | / |
Family ID | 24857494 |
Filed Date | 2006-04-20 |
United States Patent
Application |
20060084601 |
Kind Code |
A1 |
Funanage; Vicky L. ; et
al. |
April 20, 2006 |
Method for treating respiratory distress syndrome
Abstract
The invention provides a method for treating infants, children
or adults suffering from pulmonary distress caused by low or
insufficient production of surfactant. It is particularly suitable
for treating premature infants suffering from Respiratory Distress
Syndrome. The method comprises administering a leptin compound to
an individual with impaired surfactant production for a time and in
an amount sufficient to enhance surfactant production. The method
may be used for treatment of any mammal with impaired lung
surfactant production.
Inventors: |
Funanage; Vicky L.;
(Wilmington, DE) ; Hassink; Sandra G.;
(Wilmington, DE) ; Kirwin; Susan M.; (Thornton,
PA) ; O'Connor; Darlise; (Newark, DE) |
Correspondence
Address: |
MCGUIREWOODS, LLP
1750 TYSONS BLVD
SUITE 1800
MCLEAN
VA
22102
US
|
Assignee: |
The Nemours Foundation
|
Family ID: |
24857494 |
Appl. No.: |
11/113311 |
Filed: |
April 25, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09711295 |
Nov 14, 2000 |
6884777 |
|
|
11113311 |
Apr 25, 2005 |
|
|
|
Current U.S.
Class: |
514/4.9 ;
514/1.5; 514/5.3; 514/5.8 |
Current CPC
Class: |
A61P 11/00 20180101;
A61K 38/2264 20130101 |
Class at
Publication: |
514/012 |
International
Class: |
A61K 38/17 20060101
A61K038/17 |
Claims
1-16. (canceled)
17. A method for regulating appetite activity in a subject
comprising administering an effective dose of a non-recombinant
biologically active fragment of leptin to the subject.
Description
BACKGROUND
[0001] I. Field of Invention
[0002] The present invention provides a new method for treating
pulmonary distress caused by low or insufficient surfactant
production in infants, children or adults. More particularly, the
method of the invention utilizes leptin to treat individuals with
impaired lung surfactant production and is particularly useful for
treating Respiratory Distress Syndrome (RDS) in premature
infants.
[0003] II. Background of Invention
[0004] Premature infants are at increased risk for developing
Respiratory Distress Syndrome (RDS), the leading cause of neonatal
morbidity and mortality in developed countries (Mendelson et al.,
Bailliere's Clin. Endocrinol. Metab. 4:351-78, 1990). This
condition is caused by a deficiency of lung surfactant, a complex
material consisting of phospholipids, neutral lipids, carbohydrate
and proteins. These infants require assisted ventilation and
supplemental oxygen for prolonged periods of time. Often these
infants develop Bronchopulmonary Dysplasia (BPD), a chronic lung
disease associated with neurodevelopmental delay, poor growth, and
late mortality (Bader et al., J. Pediatr. 110(5):693-9, 1987;
Gibson et al., Am. J. Dis. Child. 143(7):721-5, 1988; Kurzner et
al., Pediatrics 81(3):379-84, 1988; Vohr et al., Dev. Med. Child.
Neurol. 33(8):690-7, 1991). Inflammation, primarily due to
oxygen-induced free radical formation, positive pressure
ventilation, and infection, is thought to be a key factor in the
lung injury observed in these infants (Pierce and Bancalari,
Pediatr. Pulmonol. 19(6):371-8, 1995).
[0005] Strategies aimed at treating the pulmonary inflammation in
BPD through the use of systemic steroids have not shown a favorable
outcome in decreasing the overall incidence of this disease. Three
large multicenter trials, which enrolled a total of 1348 infants,
independently showed no significant benefit to early administration
(within 72 hours of life) of steroids on the incidence of BPD
(Halliday et al., In: Hot Topics in Neonatology, Ross Laboratories,
pp. 267-75, 1999; Soll et al., Pediatr. Res. 45: 226A, 1999; Stark
et al., Pediatrics Supplement 104: 739A, 1999). Two of these trials
were stopped prematurely due to concerns of significant detrimental
side effects, including gastrointestinal perforation,
periventricular leukomalacia, poor weight gain, gastrointestinal
hemorrhage, and hypertension. Long term follow-up studies have
shown a significant detrimental effect on somatic growth (Gibson et
al., Arch. Dis. Child 69: 505-9, 1993, Yeh et al., Pediatrics
101(5):E7, 1998; O'Shea et al., Pediatrics 104(1 part 1):15-21,
1999). These adverse effects may be related to the catabolic
effects of steroids on growing tissues (Tsai et al., Act. Paediatr.
85(12):1487-90, 1996). Efforts to reduce the incidence of BPD using
other strategies such as inhaled steroids, high-frequency
ventilation, and treatment of RDS with surfactant have also shown
mixed results. There has been some success in reducing the
incidence of RDS by enhancing surfactant production in utero via
glucocorticoid administration to mothers in preterm labor (Liggins
and Howie, Pediatrics 59:515-25, 1972). However, this treatment
strategy is dependent on accurate identification of those mothers
at risk for preterm delivery, and thus, is only effective for a
small subset of premature infants affected with RDS. Furthermore,
despite significant advances in neonatal care during the past three
decades, the incidence of RDS and BPD has not changed
significantly. There remains a clear need to identify alternative
treatment strategies for this disease.
[0006] As more fully described below, the present invention
overcomes the problems associated with previous forms of RDS
therapy and includes a novel method of treating RDS that can be
administered to premature infants as well as infants, children or
adult subjects who have deficient lung surfactant.
SUMMARY OF THE INVENTION
[0007] The present invention includes a method for treating
respiratory distress by treatment with leptin. According to the
invention, leptin may be administered orally as well as by
intravenously, intramuscularly, and other parenteral and enteral
means. In one embodiment, the invention includes a method for
treating RDS and BPD in premature infants. Another aspect of this
invention is its usefulness for treating infants, children or
adults suffering from pulmonary distress caused by low or
insufficient production of surfactant. The present invention
overcomes the problems associated with previous forms of RDS
therapy, particularly the use of steroids.
[0008] The method of the invention provides for improving lung
surfactant production in an individual with impaired surfactant
production by administering a leptin compound to the individual for
a time and in an amount sufficient to enhance surfactant
production. The individual may be any mammal. Further, while the
invention may be used for the treatment of any individual with
impaired lung surfactant production, it is particularly useful for
treating infants with intrauterine development of less than nine
months. The leptin compound may comprise at least a biologically
active fragment of leptin that is capable of binding to the leptin
receptor and eliciting a biological effect such as increased
surfactant production, and may be derived from any source of leptin
or a biologically active fragment of leptin including recombinant
protein.
[0009] In the method of the invention, the leptin compound is
administered in a dosage from about 0.1 ng/kg body weight to about
100 mg/kg body weight and by a method selected from the group
consisting of subcutaneously, intradermally, intravenously,
intramuscularly, intraperitoneally, transdermally, orally, enteral
tube feeding, pulmonary delivery, intranasal delivery, controlled
release delivery and pump delivery.
[0010] Leptin may be administered with nutritional supplements,
growth factors, and steroids, such as dexamethasone, that increase
lung function. In a preferred embodiment, the growth factors may be
selected from the group consisting of epidermal growth factor,
fibroblast growth factor, insulin-like growth factor, thyroid
hormone, and platelet derived growth factor.
[0011] Further, the method of the invention which comprises
administering a leptin compound to an individual with impaired lung
surfactant production for a time and in an amount sufficient to
enhance surfactant production is particularly suitable for the
treatment of individuals with Respiratory Distress Syndrome (RDS)
and/or Bronchopulmonary Dysplasia (BPD). For treating RDS or BPD,
the leptin compound comprises at least a biologically active
fragment of leptin which is administered in a dosage from about 0.1
ng/kg body weight to about 100 mg/kg body weight. The leptin
compound is administered by a method selected from the group
consisting of subcutaneously, intradermally, intravenously,
intramuscularly, intraperitoneally, transdermally, orally, enteral
tube feeding, pulmonary delivery, intranasal delivery, controlled
release delivery and pump delivery.
BRIEF DESCRIPTION OF THE FIGURES
[0012] FIG. 1 is a Western blot analysis of SP-B (surfactant
protein-B) from 21-day gestation, fetal rat lung explants cultured
in the presence or absence of leptin. Fetal lung explants were
exposed to either (A) 1 ng/ml or (B) 10 ng/ml leptin from
initiation of culture (day 0). Explants were harvested and protein
extracts were prepared on days (d) 1, 2, and 3 of culture. Western
blots were probed with an antibody specific to rat SP-B.
[0013] FIG. 2 shows RT-PCR analysis of surfactant protein A (SP-A),
surfactant protein B (SP-B), surfactant protein C(SP-C), and
.beta.-actin mRNA expression in day 17 fetal lung explant cultures.
Cultures were exposed to 1 ng/ml leptin (lanes 3, A-C) or control
medium (lanes 2, A-C), and total RNA was isolated at the indicated
day of culture. Total RNA was reverse transcribed and amplified
with both .beta.-actin and leptin PCR primers. In each figure, lane
1 is the time of initiation of culture (day 0). Low levels of all
surfactant RNAs were detected in the uncultured cells (lanes 1,
A-C). The size of the .beta.-actin RT/PCR product is 492 bp; the
size of SP-A is 352 bp; SP-B is 201 bp, and SP-C is 284 bp.
[0014] FIG. 3 shows RT-PCR results of an experiment that determines
the relative levels of the surfactant mRNAs to that of 18S rRNA in
day 17 fetal lung explants. Qualitative RT/PCR detection of
surfactant mRNA was performed using the Ambion QuantumRNA kit
(Ambion, Austin, Tex.) and 1 .mu.g of total RNA isolated from
explants cultured for 3 days in culture. Lanes 1, 3, 5: control day
3; lanes 2, 4, 6: 1 ng/ml leptin day 3.
[0015] FIG. 4 depicts RT-PCR analysis of leptin receptor expression
in day 17 fetal lung explant cultures. Total RNA was reverse
transcribed and amplified with either the short (OB-Ra) or the long
(OB-Rb) form of the leptin receptor. Day 0 (Cd0) represents the
time of initiation of culture. The fetal lung explants were exposed
for 3 days to either control medium (Cd3), 1 ng/ml leptin (Ld3), or
10 nM dexamethasone (Dexd3). The size of the OB-Ra RT/PCR product
is 479 bp and OB-Rb is 262 bp.
[0016] FIG. 5 depicts RT-PCR analysis of surfactant and GADPH
(glyceraldehyde phosphate dehydrogenase) mRNA expression in
cultured isolated type II alveolar cells. Cells were exposed to
either 1 ng/ml leptin (1 L) or 10 ng/ml leptin (10 L). Control
cells were not exposed to leptin.
[0017] FIG. 6 depicts the effect of antenatal treatment with leptin
or dexamethasone on fetal lung morphology. Fetal lung sections were
stained with a histochemical stain for alkaline phosphatase, which
identifies type II cells. Control, no leptin; dexamethasone (6
mg/ml for 48 h); leptin (0.25 mg/ml for 48 h).
DETAILED DESCRIPTION OF THE INVENTION
[0018] The present invention includes a method for treating RDS by
treatment with leptin. The invention is based on studies that show
that leptin is produced by the placenta, that leptin levels in cord
blood are correlated with newborn birth weights, that leptin is
produced by the mammary gland and is found in breast milk, that
leptin levels are higher in female as compared to male newborns,
and that leptin augments surfactant production in fetal lung
explant cultures. The combination of this role in fetal lung
development with the known facts that the incidence of RDS
mortality is lower in female as opposed to male infants and lower
in breast-fed than in formula-fed infants points to an important
role of leptin in maturation and function of the lung and forms the
basis of the method of this invention.
[0019] Recent studies on the hormone leptin have outlined its role
in energy homeostasis, regulating such diverse processes as
satiety, fetal and neonatal growth, and immune function (reviewed
in Campfield, Smith, and Burn, Science 280: 1383-7, 1998). Leptin,
a 167 amino acid cytokine hormone produced by the obesity (ob)
gene, was initially thought to be adipocyte-specific (Zhang et al.,
Nature 372: 425-32, 1994). However, Hassink et al. (Pediatrics 100:
e1-e6, 7, 1997) have discovered high level expression of leptin
mRNA and protein in human placenta, and speculated that leptin was
produced by the syncytiotrophoblasts. This was subsequently
confirmed by Masuzaki et al. (Nat. Med. 3:1029-33, 1997).
Additionally, leptin has been shown to be produced by gastric
epithelium (Bado et al., J. Clin. Endo. Metab. 82: 1642-5, 1998)
and the mammary gland (Smith-Kirwin et al., J. Clin. Endo. Metab.
83: 1810-3, 1998). Furthermore, under conditions of nutrient
deprivation, leptin is also produced in skeletal muscle and induces
its own expression in this tissue (Wang et al., Nature 393: 684-8,
1998; Nat. Med 5: 895-9, 1999).
[0020] Leptin regulates appetite and metabolic activity in mice
(Rohner-Jeanreanaud and Jeanreanaud, N. Engl. J. Med. 344: 324-5,
1996) by acting through the long form of the leptin receptor
(OB-Rb) in the hypothalamus (Campfield, Smith, and Burn, Science
280: 1383-7, 1998). Recently, additional roles for leptin have been
suggested. Leptin has been demonstrated to have angiogenic activity
in vivo and in vitro (Sierra-Honigmann et al., Science 281: 1683-6,
1988). These studies showed that leptin induces neovascularization
in cornea from normal rats but not fa/fa Zucker rats, which lack a
functional leptin receptor. In leptin-deficient (ob/ob) mice,
puberty and pregnancy cannot be established without leptin
administration (Chehab, Lim, and Lu, Nature Gen. 12: 318-20, 1996),
indicating that leptin may have a role in sexual maturation and
development (Hassink et al., Pediatrics 98: 201-5, 1996). Other
roles for leptin include a regulator of hematopoeisis (Cioffi et
al., Nature Medicine 2: 585-9, 1996; Gainsford et al., Proc. Natl.
Acad. Sci. USA 93: 14564-8, 1996), glucose metabolism (Kamohara et
al., Nature 389: 374-7, 1997), and proinflammatory immune responses
(Loffreda et al., FASEB J. 12: 57-65, 1998; Lord et al., Nature
394: 897-901, 1998). Leptin-deficient ob/ob mice were also noted to
have a specific respiratory phenotype of alveolar hyperventilation
and chronic hypercapnia (Tankersley et al., J. Appl. Physiol. 81:
716-23, 1996). These phenotypic abnormalities were noted in age and
weight-matched ob/ob mice before pronounced obesity. In a
subsequent study, Tankersley et al. (J. Appl. Physiol. 85: 2261-9,
1998) demonstrated that leptin administration to ob/ob mice
ameliorated the volume-dependent decrease in lung compliance in
these animals. leptin has also recently been shown to prevent
respiratory depression in ob/ob mice (O'Donnell et al., Am. J.
Resp. Crit. Care Med. 159: 1477-84, 1999). Because these ob/ob mice
were born to either wild type or ob/+ mothers, the fetuses were
exposed to placental and possibly, maternal, leptin in utero. Thus,
it was not possible to ascertain whether leptin affects fetal lung
development in utero.
[0021] The observation that leptin is synthesized and secreted by
human (Hassink et al., Pediatrics 100: e1-e6, 1997), rat (Chien et
al., Biochem. Biophys. Commun. 237: 476-80, 1997) and mouse
(Hoggard et al., Proc Nat Acad. Sci. 94: 1073-8, 1997) placental
tissue has important implications, since it suggests a novel role
for leptin in fetal growth and development. Because leptin
expression was observed in human placenta from near-term
pregnancies and in mouse placenta from 14.5 day but not from 12 day
of gestation (Tomimatsui et al., Biochem. Biophys. Res. Comm.
240:213-5, 1997; Hoggard et al., Proc. Nat. Acad. Sci. 94:1073-8,
1997), it is suggested that leptin regulates some aspect of
developmental growth in the fetus during the second half of
gestation. In the human, leptin has been detected in cord blood as
early as 18 weeks of gestation (Jaquet et al., J. Clin. Endo.
Metab. 83:1243-6, 1998). Leptin levels in cord blood increase with
gestation (Jaquet et al., J. Clin. Endo. Metab. 83:1243-6, 1998)
and show a good correlation with the birth weight of the newborn
(Hassink et al., Pediatrics 100:e1-e6, 1997; Matsuda et al., J.
Clin. Endo. Metab. 82:1642-4, 1997), further supporting the
hypothesis that leptin regulates fetal growth. Premature infants
are delivered before the late pregnancy rise in leptin occurs
(Masuzaki et al., Nat. Med. 3:1029-33, 1997) and have low cord
blood leptin levels (Highman et al., Am. J. Obstet. Gynecol.
178:1010-5, 1998).
[0022] Without intending to be bound by theory, it is believed that
leptin is important for lung growth and/or maturation and that the
lack of leptin exposure late in pregnancy when the type II alveolar
cells are maturing and producing surfactant could contribute to the
respiratory distress suffered by many premature infants. Since
leptin has been found in amniotic fluid, leptin may have a direct
effect on type II alveolar cell maturation and growth, thereby
increasing surfactant production.
[0023] The inadequacy and/or absence of pulmonary surfactant
production at birth is one of the most serious and life threatening
problems faced by the premature infant. Surfactant production is a
maturation-dependent process, and deficiency results in RDS, which
is characterized by inability to expand the alveoli and sustain
adequate ventilation. Currently, treatment of RDS involves
administering prenatal steroids to the mother in an attempt to
increase surfactant production prior to delivery, administration of
exogenous surfactant to the premature infant after birth, and
supportive treatment with artificial ventilation until the
premature infant's lungs mature. RDS accounts for a substantial
burden of morbidity and mortality in premature infants, as well as
significant emotional and financial burdens on the family. Although
steroids increase serum leptin levels, there is recent evidence
that glucocorticoids interfere with leptin's interaction with its
receptor (Ur et al., Horm. Metab. Res. 28:4744-7, 1996; Zakrzewska
et al., Diabetes 46:717-9, 1997). Furthermore, glucocorticoids may
contribute to the development of central leptin resistance
(Zakrzewska et al., Diabetes 46:717-9, 1997). These effects of
glucocorticoids may contribute to the poor growth observed in
premature infants treated with steroids. Therefore, it is desirable
to provide a method for treating RDS that does not involve the use
of steroids.
[0024] The method of the present invention, which consists of
administration of a leptin compound to a patient, avoids the use of
steroids while providing effective treatment for premature infants
who suffer from conditions in which there is insufficient
production of surfactant. The method is also effective for
treatment of newborns, infants, children, and adults who suffer
from any condition caused by insufficient surfactant production as
administration of the leptin compound is expected to increase
surfactant production and improve lung function.
[0025] More particularly, the present invention provides a method
for restoring pulmonary function in a patient who suffers from a
lung disease characterized by insufficient surfactant production.
Abnormalities of surfactant production have been described in
obstructive lung diseases, such as asthma, bronchitis, chronic
obstructive pulmonary disease, and following lung transplantation
(reviewed in Grise, Eur. Resp. J. 13(6): 1455-76, 1999). Abnormal
surfactant production has also been seen in infectious and
suppurative lung diseases, such as cystic fibrosis, pneumonia, and
AIDS. Finally, insufficient surfactant also characterizes diseases
such as acute respiratory distress syndrome (ARDS), pulmonary
edema, interstitial lung diseases, pulmonary alveolar proteinosis,
following cardiopulmonary bypass, and in smokers. The method
comprises administering a leptin compound to the host for a time
and in an amount sufficient to restore or enhance respiratory
function. Typically, the leptin compound will be administered in a
dosage from about 0.1 ng per kg body weight to about 100 mg per kg
body weight, for example. Effective amounts are determined by such
factors as the leptin composition, the mode of administration, the
weight and general health of the patient, and the judgment of the
prescribing physician, for example. Considerations associated with
such factors are well known by those persons skilled in the
art.
[0026] Further, the present invention, which has been discussed in
the context of human patients, is not limited to use in humans, but
is also effective in treating respiratory conditions caused by
inadequate surfactant production in other mammalian species
[0027] In the treatment of premature infants, the leptin compound
is typically administered to any premature infant at increased risk
of developing RDS from the onset of birth to the time when the
infant would have reached full gestational age. For example, an
infant born 4 months prematurely is typically treated with leptin
for 4 months or until lung function is restored. For individuals
that develop respiratory distress after birth, the individual is
treated with leptin for a period of time until lung function is
restored, as ascertained by clinical measurements that are known to
those skilled in the art.
[0028] The leptin compound may be administered subcutaneously,
intradermally, intravenously, intramuscularly, intraperitoneally,
via enteral tube feeding, via pulmonary delivery, via intranasal
delivery, transdermally, orally, via controlled release, via pump,
or by any other conventional route of administration for
polypeptide drugs. Typically, the leptin compound will be
administered continuously during the period of administration,
i.e., being delivered at least once per day or via controlled
release techniques, such as via transdermal patches or leptin in
milk fat globules. Furthermore, leptin may be administered
antenatally to those mothers at increased risk of delivering
prematurely. Leptin may also be administered antenatally with
glucocorticoids. The administration of leptin has been described in
U.S. patent application Ser. No. 09/302,117 which is incorporated
herein by reference in its entirety.
[0029] Leptin may be derived from any mammal. Preferably human
leptin is used for the treatment of humans. A leptin compound may
include, but is not limited to, either the full active peptide or a
biologically active fragment that is capable of binding to the
leptin receptor and eliciting a biological effect such as increased
surfactant production. Methods for purification of leptin,
production of the recombinant form, and active biological fragments
have been described in U.S. Pat. Nos. 5,552,524; 5,552,523;
5,552,522; 5,521,283; 5,5908,830, incorporated herein by reference
in their entireties.
[0030] In some embodiments, the invention provides compositions for
administration which comprises a solution of leptin dissolved or
suspended in an acceptable carrier, preferably an aqueous carrier.
A variety of aqueous carriers may be used, e.g., water, buffered
water, 0.8% saline, 0.3% glycine, hyaluronic acid and the like.
These compositions may be sterilized by conventional, well-known
sterilization techniques, or may be filter-sterilized. The
resulting aqueous solutions may be packaged for use as is, or
lyophilized, the lyophilized preparation being combined with a
sterile solution prior to administration. The compositions may
contain pharmaceutically acceptable auxiliary substances as
required to approximate physiological conditions, such as pH
adjustments and buffering agents, adjusting agents, wetting agents
and the like, for example, sodium acetate, sodium lactate, sodium
chloride, potassium chloride, calcium chloride, sorbitan
monolaurate, triethanolamine oleate, etc.
[0031] The concentration of leptin in the pharmaceutical
formulations can vary widely, i.e., from less than about 0.1% to as
much as 20% to 50% or more by weight, and will be selected
primarily by fluid volumes, viscosities, etc., in accordance with a
particular mode of administration selected. A value of about 2% is
common for many formulations, for example.
[0032] For solid compositions, conventional nontoxic solid carriers
may be used which include for example, pharmaceutical grades of
mannitol, lactose, starch, magnesium sterate, sodium saccharin,
talcum, cellulose, glucose, sucrose, magnesium carbonate, and the
like. For oral administration, a pharmaceutically acceptable
nontoxic composition is formed by incorporating any of the normally
employed excipients, such as those carriers previously listed, and
generally 10% to 95% of active ingredient, that is one or more
leptin compounds of the invention, and more preferably at a
concentration of 25% to 75%.
[0033] For aerosol administration, leptin is preferably supplied in
finely divided form along with an aerosol surfactant and
propellant. Typical percentages of leptin are 0.01% to 20% by
weight preferably 1%-10%. The aerosol surfactant must, of course be
nontoxic, and preferably suitable to the propellant. Representative
of such agents are the esters or partial esters of fatty acids
containing from 6 to 22 carbon atoms such as caproic, octanoic,
lauric, palmatic, stearic linoleic, linolenic, olesteric and oleic
acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
Mixed esters, such as mixed or natural glycerides may be employed.
The aerosol surfactant may constitute 0.1% to 20% by weight of the
composition, preferably 0.25-5%. The balance of the composition is
ordinarily propellant. A carrier can also be included, as desired,
as with, e.g., lecithin for intranasal delivery.
[0034] The leptin compositions of the invention can additionally be
delivered in a controlled release system encapsulated form, or an
implant by techniques well known in the art. The compositions of
the invention can also be delivered via a pump, such as a minipump,
or by administration of milk fat globules containing leptin as
disclosed in co-pending U.S. patent application Ser. No.
09/302,117.
EXAMPLES
[0035] 1. Effects of Leptin on Surfactant Production in the Fetal
Lung Explant Model
[0036] We have used a fetal lung explant model to mimic the
conditions of the premature lung. Lungs from d21 rat fetuses, term
being 22 days, were dissected free of heart, trachea and bronchi
and placed in ice-cold serum free Waymouth medium and cut into 1
mm.sup.3 pieces on a McIlwain tissue chopper. The lung explants
were placed in tissue culture dishes that were scratched (along
each half) to facilitate attachment of explants. The excess medium
was aspirated and fresh medium (2 ml for 60 mm plate) was gently
placed on the explants. The 17-21 d explants were incubated in 95%
O.sub.2-5% CO.sub.2, since incubation of these explants in 5%
CO.sub.2 in air can cause compression of airways (Gross and Wilson,
J. Appl. Physiol. 55: 1725-32, 1983). The petri dishes were placed
on a tilting platform and allowed to rest for 90 min in a
humidified atmosphere in a CO.sub.2 incubator. Thereafter, the
plates were tilted at 3-4 cycles per minute so that during each
cycle, one half of the petri dish was exposed to gas phase and the
other half was covered with the medium. Leptin at either 1 or 10
ng/ml was added to the explant cultures on the day of establishment
of the culture (day 0). The explants were cultured for varying
periods of time for up to 3 days, and protein extracts were
prepared to establish a time course for leptin effects on the fetal
lung. Surfactant proteins were separated by electrophoresis on 15%
polyacrylamide-SDS gels, and transferred to nitrocellulose
membranes by electroblotting. The membranes were blocked with 2%
gelatin (BioRad), treated overnight with anti-SP-B, and then with
secondary antibody (goat anti-rabbit HRP-conjugated antibody). The
blots were then reacted with a chemiluminescent substrate solution
(SuperSignalR, Pierce Chemical Co.) and exposed to X-ray films to
detect proteins that are recognized by the primary antibody. A set
of known concentrations of protein was run in parallel to ascertain
that the amount of sample protein is within the linear range of
density.
[0037] FIG. 1 shows that 1 ng/ml leptin increases SP-B production
above that of the control cultures after either 48 or 72 h of
leptin exposure. A higher concentration of leptin (10 ng/ml)
increases SP-B production after 24 h, but decreases SP-B levels
after 48 and 72 h.
[0038] To explore the effect of gestational age on surfactant
production in response to leptin, we exposed younger lung explant
cultures (d17) to 1 ng/ml leptin. Total RNA was extracted by
homogenizing the explants in 4M guanidine thiocyanate, applying the
lysate on a Qiagen RNeasy column (Qiagen, Chatsworth, Calif.), and
recovering total RNA according to the manufacturer's instructions.
RNA was quantified by measurement of absorbancy at 260 nm
(A.sub.260). The quality of RNA was assessed by the
A.sub.260/A.sub.280 ratio and by separation on agarose gels. Total
RNA (1 .mu.g) was brought up to 10 .mu.l in DEPC-treated water. The
sample was heated to 75.degree. C. for 3 min, placed on ice, and
cDNA synthesis was performed by reverse transcription for 15 min at
42.degree. C. in a 20 .mu.l reaction containing 1.times.PCR buffer
II (Perkin-Elmer), 5 mM MgCl.sub.2, 1.25 mM each dNTP, 1 U/.mu.l
RNasin (Promega), 12.5 .mu.g/.mu.l oligo (dT) 15, and 2.5 U/.mu.l
AMV reverse transcriptase (Promega Madison, Wis.). Subsequent
amplification of the cDNA sequence was performed with 10 .mu.l of
the reverse transcription reaction in 1.times. Taq buffer, 5% DMSO,
25 pmol each primer (Table 1), and 1.25 U Taq polymerase in a 50
.mu.l reaction volume. TABLE-US-00001 TABLE 1 Sequence of PCR
primers used in the RT/PCR experiments Primer Gene Sequence RSPAF
Rat SP-A 5'CCTCTTCTTGACTGTTGTCGCTGG3' RSPAR Rat SP-A
5'GCTGAGGACTCCCATTGTTTGCAG3' RSPBF Rat SP-B
5'GGAGCTAATGACCTGTGCCAAGAG3' RSPBR Rat SP-B
5'CTGGCCCTGGAAGTAGTCGATAAC3' RSPBR2 Rat SP-B
5'AAGTACTGTGTAACGCTCAGCCAG3' RSPCF Rat SP-C
5'GATGGAGAGCCCACCGGATTACTC3' RSPCR Rat SP-C
5'GAACGATGCCAGTGGAGCCAATAG ROBRaF Rat OB-Ra
5'AGTGAATGCTGTGCAGTCACTCAG3' ROBRaR Rat OB-Ra
5'CAAAGAGTGTCCGCTCTCTTTTGG3' ROBRbF Rat OB-Rb
5'GGATGAGTGTCAGAGTCAACCCTC3' ROBRbR Rat OB-Rb
5'CAGTTCCAAAAGCTCATCCAACCC3' ACTF1 Rat .beta.-actin
5'TGTATGCCTCTGGTCGTACCAC3' ACTR1 Rat .beta.-actin
5'ACAGAGTACTTGCGCTCAGGAG3' GAPDHF Rat GAPDH
5'GGTCGGTGTCAACGGATTTG3' GAPDHR Rat GAPDH
5'GAGATGATGACCCTTTTGGC3'
[0039] For assessment of the relative levels of SP-A, SP-B and SP-C
transcripts, a multiplex RT/PCR reaction with .beta.-actin was
used. The temperature profile for the PCR reactions consisted of a
2 min melting step at 95.degree. C., then 30 cycles of 30 s at
94.degree. C., 30 s at 55.degree. C., and 60 sec at 65.degree. C.,
followed by a final extension step of 5 min at 72.degree. C. RT-PCR
products were separated by size on a 4% agarose gel and stained
with ethidium bromide. Gel visualization and quantitative analysis
of relative band intensities was performed using Eagle Eye II
hardware and software (Stratagene, La Jolla, Calif.).
[0040] FIG. 2 shows that leptin significantly increases SP-A and
SP-C mRNA levels. However, leptin also increases the levels of
.beta.-actin in fetal lung explant cultures. This results in an
underestimation of the actual increase in surfactant mRNA levels.
Therefore, we chose to use 18S rRNA to determine the relative
levels of surfactant mRNA because of the invariant expression of
18S rRNA across tissues and treatments. Since 18S rRNA is much more
abundant than any mRNA species, modified 18S rRNA primers called
competimers (Ambion) are used that cannot be extended by Taq
polymerase. By adjusting the ratio of competimers to normal 18S
rRNA primers, the RT/PCR signal for 18S rRNA can be decreased to
the level of even rare messages, as described by the manufacturer.
FIG. 3 shows the results of such an experiment for determining the
relative levels of the surfactant mRNAs to 18S rRNA. FIG. 3 shows
that leptin increases the mRNA levels for SP-A, SP-B, and SP-C
relative to the levels of 18S rRNA by 1.6-, 5-, and 2-fold,
respectively, in d17 lung explant cultures after 3 days in culture.
These experiments support the hypothesis that leptin has an effect
on the maturation of type II alveolar cells.
[0041] 2. Changes in Leptin Receptor Gene Expression in Relation to
Lung Maturation
[0042] Both the long (OB-Rb) and short (OB-Ra) forms of the leptin
receptor are expressed in fetal lung explant cultures (FIG. 4). As
the fetal lung cells mature in culture, the expression of OB-Ra
mRNA increases, whereas OB-Rb mRNA levels decrease. Leptin
administration similarly decreases expression of OB-Rb mRNA,
whereas dexamethasone increases OB-Rb mRNA levels in fetal lung
explants (FIG. 4). Taken together, these data demonstrate the
presence of OB-Ra and OB-Rb mRNA in rat fetal explant lung
cultures. As type II alveolar cells mature in culture, mRNA levels
of OB-Ra increase and OB-Rb decrease; leptin administration further
decreases OB-Rb mRNA levels, whereas dexamethasone increases OB-Rb
mRNA expression.
[0043] 3. Leptin Increases mRNA Levels of Surfactant Proteins in
Isolated Fetal Alveolar Type II Cells
[0044] To determine if the leptin effect on surfactant production
was due to a direct effect of leptin on the type II alveolar cell,
we determined whether the effects of leptin could be reproduced in
isolated type II alveolar cells in culture. Alveolar type II cells
were obtained from the lungs of 19-d gestation fetal rats by the
method described by Bhandari et al., (Pediatr. Res. 41:166-71,
1997). In brief, lungs of 19-day gestation fetal rats were removed,
dissected free of connective tissue and nonparenchymal pulmonary
tissue, and cultured as explants for 40-48 h in serum free Waymouth
MB 752/1 medium with penicillin and streptomycin in humidified 95%
O.sub.2/5% CO.sub.2 at 37.degree. C. During this time, endothelial
and blood cells do not survive, which is a crucial step in the
enrichment of primary cultures of Type II cells from fetal lung.
The explant cells were then harvested and the cells dissociated
using a solution of collagenase, trypsin and DNase. The mixed cell
suspension was subjected to three differential adhesions to remove
fibroblasts. The non-adherent suspension containing an enriched
population of fetal type II cells was plated at 2.times.10.sup.6
cells/35 mm dish in 2 ml of minimum essential medium containing
penicillin (100 U/ml), kanamycin (100 .mu.g/ml) and 2% fetal bovine
serum. The cells were cultured for 20-22 h at 37.degree. C. in 5%
CO.sub.2/room air (Bhandari et al., Pediatr. Res. 41:166-71, 1997).
Cultures contain 90-95% type II cells of which >99% are viable
as determined by exclusion of the vital dye, trypan blue. The usual
yield of type II cells from the lungs of the fetuses (10-16) per
pregnant rat is approximately 10.sup.7 cells.
[0045] Type II cells from d19 fetal lungs were cultured for 24 h
and then exposed to either 1 or 10 ng/ml leptin for 24 h. Total RNA
was isolated from these cells and then examined for SP-A, SP-B,
SP-C, and GAPDH (housekeeping gene) mRNA expression. FIG. 5 shows
that a 24 h treatment with 1 ng/ml leptin increased SP-A, SP-B, and
SP-C, but not GAPDH, mRNA levels after 24 h. These data suggest
that leptin acts directly on the type II cell and that the effects
of leptin on SP-A, SP-B, and SP-C mRNA levels are most likely
exerted at the transcriptional level.
[0046] Taken together, these data demonstrate that leptin
administration both in fetal lung explant cultures and isolated
type II alveolar cultures results in increases in SP-A, SP-B, and
SP-C mRNA. Lung explants from day 21 fetuses produced increased
surfactant proteins with leptin administration, possibly indicating
an effect on maturation of type II alveolar cells. Thus, leptin
provides a means to increase surfactant production in immature
lungs, ultimately resulting in an additional treatment modality for
premature infants with RDS and for other conditions characterized
by insufficient surfactant production.
[0047] 4. Antenatal Treatment of Pregnant Rats with Leptin
[0048] Leptin (1 mg/kg body weight) was administered to pregnant
rats at d16 of gestation and 24 h later by intraperitoneal
injection. Dexamethasone at 6 mg per kg body weight was
administered at similar time intervals as leptin. In addition, the
effect of a combination of leptin and dexamethasone treatment was
tested. After 48 h of leptin, dexamethasone or leptin/dexamethasone
exposure, premature delivery of the rat pups was induced at d18,
which is similar to 30 weeks of gestation in the human. The fetuses
from each litter were pooled and weighed, and various tissues from
both the rat fetuses and mothers were also dissected and weighed.
Table 2 shows that antenatal treatment with leptin increased the
average weight of the fetal lungs in relation to their body weight
by 51%. Antenatal treatment with dexamethasone increased fetal lung
weight by 41%. Interestingly, combined therapy with leptin and
dexamethasone increased fetal lung weight by 62%. TABLE-US-00002
TABLE 2 Effect of antenatal treatment with dexamethasone, leptin,
or dexamethasone and leptin on weight of maternal and fetal lungs
Control Dexamethasone Leptin Dex + Leptin Maternal lung 1.07 0.99
1.21 1.16 weight (g) Average weight 0.61 0.79 0.87 0.95 fetal lungs
(g) (n = 9) (n = 9) (n = 9) (n = 9) Average weight 0.47 0.43 0.45
0.47 fetal head (g) (n = 9) (n = 9) (n = 9) (n = 9) Average weight
1.64 1.52 1.56 1.59 fetus (g) (n = 9) (n = 9) (n = 9) (n = 9)
Weight fetal 0.37 0.52 0.56 0.60 lung (g)/g fetus
[0049] Histologic analysis of the lung tissue was done to determine
the basis for the increased fetal lung weight. Type II cells were
identified by alkaline phosphatase staining as previously described
(Post and Smith, Am. Rev. Respir. Dis. 137: 525-30, 1988). Unfixed
frozen 5 .mu.m sections of fetal lung tissue were stained
histochemically with alkaline phosphatase at pH 8.74 to identify
type II alveolar cells. Slides were incubated for 60 minutes at
37.degree. C. in 25 ml of 0.2M Tris-HCl buffer and 25 ml of
deionized water, 5 mg of Naphthol AS-BI phosphate, 0.1 ml
dimethylformamide, and 30 mg of fast red TR. The slides were then
rinsed in 3 changes of deionized water, counterstained for 30
seconds in Harris hematoxylin and blued in running water for 3-5
minutes. Slides were mounted from water in Advantage.TM.. The
histologic analysis revealed that the increase in fetal lung weight
in both the leptin- and dexamethasone-treated rats was paralleled
by an increase in the number of type II alveolar cells (FIG.
6).
[0050] It will be readily understood by those persons skilled in
the art that the present invention is susceptible to broad utility
and application. Many embodiments and adaptations of the present
invention other than those herein described, as well as many
variations, modifications and equivalent arrangements, will be
apparent from or reasonably suggested by the present invention and
foregoing description thereof, without departing from the substance
or scope of the invention.
[0051] Accordingly, while the present invention has been described
here in detail in relation to its preferred embodiment, it is to be
understood that this disclosure is only illustrative and exemplary
of the present invention and is made merely for the purposes of
providing full and enabling disclosure of the invention. The
foregoing disclosure is not intended to be construed or to limit
the present invention or otherwise to exclude any other such
embodiments, adaptations, variations, modifications and equivalent
arrangements, the present invention being limited by the claims and
the equivalents thereof.
* * * * *