U.S. patent application number 11/184678 was filed with the patent office on 2006-04-20 for anti-hypersensitive inflammation and anti-allergy activities of zingiber zerumbet (l.) smith.
This patent application is currently assigned to Wholesome Life Science Co., Ltd.. Invention is credited to Hso-Chi Chaung, Chung-Sheng Huang, Fun-Ya Lee, Tsung-Chung Lin.
Application Number | 20060083799 11/184678 |
Document ID | / |
Family ID | 35907729 |
Filed Date | 2006-04-20 |
United States Patent
Application |
20060083799 |
Kind Code |
A1 |
Chaung; Hso-Chi ; et
al. |
April 20, 2006 |
Anti-hypersensitive inflammation and anti-allergy activities of
Zingiber zerumbet (L.) Smith
Abstract
The present invention provides for a method of preparing a
nutraceutical formulation comprising the step of solvent extraction
from the root of Zingiber zerumbet Sm, and the use of this
formulation to regulate the immune system, and more specifically to
prevent or to treat an allergic disorder.
Inventors: |
Chaung; Hso-Chi; (PingTung,
TW) ; Huang; Chung-Sheng; (Taipei, TW) ; Lee;
Fun-Ya; (Taipei, TW) ; Lin; Tsung-Chung;
(Fullerton, CA) |
Correspondence
Address: |
COHEN, PONTANI, LIEBERMAN & PAVANE
551 FIFTH AVENUE
SUITE 1210
NEW YORK
NY
10176
US
|
Assignee: |
Wholesome Life Science Co.,
Ltd.
|
Family ID: |
35907729 |
Appl. No.: |
11/184678 |
Filed: |
July 18, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60590552 |
Jul 23, 2004 |
|
|
|
Current U.S.
Class: |
424/756 |
Current CPC
Class: |
A61P 11/02 20180101;
A61P 37/02 20180101; A61P 17/04 20180101; A61P 37/08 20180101; A61P
11/06 20180101; A61P 43/00 20180101; A61K 36/9068 20130101 |
Class at
Publication: |
424/756 |
International
Class: |
A61K 36/9068 20060101
A61K036/9068 |
Claims
1. A method of preparing a nutraceutical formulation comprising the
step of solvent extraction from the root of Zingiber zerumbet Sm,
wherein the extraction solvent has a polarity that is equal to or
lower than water.
2. The method of claim 1, wherein the solvent is ethanol or water
or a mixture of ethanol and water of any ratio.
3. A method of regulating the immune system comprising
administering a nutraceutical formulation comprising a solvent
extract from the root of Zingiber zerumbet Sm.
4. The method of claim 3 of regulating the immune system to prevent
or to treat an allergic disorder.
5. The method of claim 4 wherein the allergic disorder is selected
from the group consisting of allergic rhinitis, asthma and
eczema.
6. The method of claim 3 for regulating the balance between Th1 and
Th2 immune responses.
7. The method of claim 6 for up-regulating the concentration of
IFN-.gamma. or down-regulating inflammatory mediators TNF-.alpha.,
IL-4, and eotaxin.
8. The method of claim 7, where the solvent extract comprises
zerumbone as the active immune modulating compound.
9. The method of inhibiting leukotrienes syntheses comprising
administering a nutraceutical formulation comprising a solvent
extract from the root of Zingiber zerumbet Sm.
10. The method of claim 9, wherein LTC4 synthesis is inhibited.
11. The method of claim 9, wherein the extract comprises
7-Dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one.
12. A method of preventing or treating an allergic disorder
comprising administering an effective amount of
5,7-Dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one.
13. The method of claim 12 wherein the allergic disorder is
anaphylaxis.
14. The method of claim 12 further comprising administering an
effective amount of zerumbone.
15. The method of claim 14 wherein the allergic disorder is
anaphylaxis.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention provides for a novel nutraceutical
formulation comprising an extract of the root zingiber zerumbet Sm,
and the use of the same to regulate the immune system.
[0003] 2. Description of the Related Art
[0004] Leukotrienes (LT), specifically the cysteinyl LTs, LTC4,
LTD4 and LTE4, have been implicated in the clinical course,
physiologic changes, and pathogenesis of asthma (1). LTC4, LTD4 and
LTE4 are potent bronchoconstrictors and involve in additional
effects on blood vessels, mucociliary clearance and eosinophilic
inflammation (2). In addition, the cysteinyl LTs are formed from
cells commonly associated with asthma, including eosinophils and
mast cells (3). Therefore, leukotriene receptor antagonists are
being used widely in the treatment of bronchial asthma. However,
the published data regarding liver injury related to a novel group
of asthma drugs, typically leukotriene receptor antagonists, are in
heightened awareness of hepatotoxicity (4). Thus, herbs open a new
window for having medicative potential on long-term therapy of
asthma. The T.sub.h cell cytokines by peripheral blood T cells have
been found to correlate with asthma severity. Recent research
showed that interleukin-4.quadrature.lL-4.quadrature.binding to its
receptor (IL-4R) is essential for the development of airway
inflammation present in asthma (5). A significantly lower ratio of
IFN-gamma-/lL-4-producing CD4+ T cells after
12-O-tetradecanoylphorbol-13-acetate (TPA)/ionomycin stimulation
was found in patients with atopic cough and atopic asthma compared
with normal subjects, and the proportion of IL-4-producing CD4+ T
cells was significantly higher in patients with atopic asthma than
in normal control subjects (6). As compared with control human
subjects, acute asthmatics had significantly increased levels of
circulating IL-4 (p<0.001), IL-5 (p<0.001), and IL-13
(p<0.001), although the differences were of borderline
significance in serum IFN-gamma (p=0.069) (7). However, the
extremely low serum levels of these cytokines were merely
detectable in animal studies. A new cheap biotech examination,
quantitative competitive reverse transcriptase-polymerase chain
reaction (qc-RT-PCR), was therefore developed in our lab to
quantify gene expressions of cytokines in immune cells in order to
precisely evaluate the therapeutic indications of traditional
herbs. As searching potential medicative herb, competitive
cysteinyl leukotriene receptor antagonist has been considered as a
new class of asthma medications (8). Zingiber zerumbet Smith has
recently been found to have anti-tumor promoter activity (9) and
markedly diminished inducible nitric oxide synthase (iNOS) and
cyclooxygenase 2 (COX-2), together with the release of tumor
necrosis factor-alpha (TNF-.alpha.) in mouse macrophages (10).
SUMMARY OF THE INVENTION
[0005] Here we demonstrate that Zingiber zerumbet has beneficial
effects of inhibiting the release of inflammatory mediators and
influencing the gene expressions of cytokine network. Examples of
human use of extracts of Zingiber zerumbet to treat allergic
disorders were also described.
[0006] The potentials of the aqueous crude extract (ACE) of
Zingiber zerumbet (L.) Smith (ZZ) in anti-hypersensitivity and
anti-inflammation were demonstrated in mice. Leukotriene C4 (LTC4)
release was measured from lung tissue of mice treated with ZZ-ACE.
Results showed that ZZ-ACE effectively suppressed LTC4 release from
the lung tissue. An active compound was identified as
5,7-Dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one for the
effect of suppressing LTC4.
[0007] Ova-albumin was used to induce asthmatic allergy reactions
in mice. Mice treated with ZZ-ACE had higher ratios of splenocyte
IFN-.gamma./IL-4 gene expressions levels (p<0.05) as compared
with those of the control groups. Zerumbone was identified as an
active ingredient to increase the IFN-.gamma./IL-4 gene expression
ratio.
[0008] Anti-allergic effects were also observed when human
volunteers were administrated with ZZ-ACE in liquid or in capsule
form.
[0009] These results indicate that extracts of ZZ, using ethanol,
water, or a mixture of ethanol and water as solvent, contains
components that have potentials in preventing or treating allergic
inflammation.
[0010] Other objects and features of the present invention will
become apparent from the following detailed description considered
in conjunction with the accompanying drawings. It is to be
understood, however, that the drawings are designed solely for
purposes of illustration and not as a definition of the limits of
the invention, for which reference should be made to the appended
claims. It should be further understood that the drawings are not
necessarily drawn to scale and that, unless otherwise indicated,
they are merely intended to conceptually illustrate the structures
and procedures described herein.
BRIEF DESCRIPTION OF THE FIGURES
[0011] FIG. 1 is the chemical structure of
5,7-Dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one.
[0012] FIG. 2 is the DNA sequence of mIFN-.gamma.gene (GeneBank
accession number NM.sub.--008337). The sequences corresponding to
the primers used are underlined.
[0013] FIG. 3 is the DNA sequences mIL-4 (GeneBank accession number
BC027514). The sequences corresponding to the primers used in
qc-RT-PCR are underlined.
[0014] FIG. 4 is the gel electrophoresis of qc-RT-PCR products for
determination of IFN-.gamma.mRNA expression level in mice
splenocytes. Lanes 1-8 are PCR products using slenocytes cDNA
samples and competitor plasmid as DNA templates. Lane M is markers
(100 bp lader). Lanes S1-S5 are PCR products using Stander and
Competitor Plasmid as DNA templates, for establishing a standard
curve.
[0015] FIG. 5 is the gel electrophoresis of qc-RT-PCR products for
determination of IL-4 mRNA expression level in mice splenocytes.
Detection of IL-4 mRNA by qc-RT-PCR in mice splenocytes. Lanes 1-9
are PCR products using slenocytes cDNA samples and competitor
plasmid as DNA templates. Lane M is markers (100 bp lader). Lanes
S1-S7 are PCR products using Stander and Competitor Plasmid as DNA
templates, for establishing a standard curve.
[0016] FIG. 6 is the chemical structure of Zerumbone
DETAILED DESCRIPTION OF THE PRESENTLY PREFERRED EMBODIMENTS
Materials and Methods
[0017] Equipment: Silica gel (Merck Kieselgel 60, 230-400 mesh
ASTM) for column chromatography, and PLC (0.5 mm, Merck Kieselgel
60 F254) were from Merck; proton NMR spectrum was measured by
Varians 500 and Mass spectrum by Applied LC-MS.
[0018] ZZ-ACE as a water extraction: 50 g of dried root of Zingiber
zerumbet (L.) Smith was mixed with 500 ml distilled water (10 folds
weight) and refluxed for 4 hours at 100.degree. C. The extract was
filtered and concentrated to 100 ml and was then freeze-dried. The
freeze-dried powder was stored as aqueous crude extract (ACE) of
Zingiber zerumbet (L.) Smith, or ZZ-ACE.
[0019] Ethanol extraction: Dried ZZ was crushed and mixed with 10
fold of ethanol (10 ml ethanol per gZZ) and refluxed at 60.degree.
C. for 4 hrs. The extract was filtered and concentrated to 1/10
volume before was freeze-dried and stored as Ethanol Extract. The
Ethanol Extract was further partially purified using silica gel
column.
[0020] Column Chromatography: The ethanol extract (65 g) was
concentrated and applied onto the column chromatography (SiO.sub.2,
7.5 cm ID.times.20 cm H). The solvent step-gradient was initiated
with n-Hexane/ethyl acetate (or n-Hex/EA) (1000 ml/200 ml),
followed by n-Hex/EA (600 ml/400 ml), n-Hex/EA (400 ml/600 ml), EA
(1000 ml), and finally methanol (1000 ml), consectively. The eluent
was collected 500 ml/flask from the beginning and the flow rate was
about 30 ml/min. Twelve fractions were collected and named as NP1
to NP12 following the elution order.
[0021] Isolation of zerumbone: Content in fraction NP2 was
re-crystallized with methanol to obtain a pure crystal. Results
form proton NMR and MS spectra experiment determined the chemical
as zerumbone (0.8 g). Fraction NP2 was named as Crude
Zerumbone.
[0022] Preparation of a Crude Flavnoid fraction: NP12 (5 g) was
applied onto another column (SiO.sub.2, 2.5 cm ID.times.12 cm H).
The eluent was collected 200 ml per fraction from the beginning and
the flow rate was about 10 ml/min. The solvent gradient was n-Hex
(100 ml), n-Hex/EA (100 ml/100 ml), n-Hex/EA (100 ml/150 ml), EA
(100 ml), and EA/MeOH (100 ml/50 ml), consectively. Seven flasks
were collected and named as NP12-1 to NP12-7. Fraction NP12-3 was
named as Crude Flavnoid.
[0023] Isolation of
5,7-dihvdroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one: NP12-3
(30.2 mg) was isolated and applied onto the PLC developed with
dichloromethane/methanol (30/1) to obtain eight strips (NP12-3-1 to
NP12-3-8). Materials from strip NP12-3-3 (3.4 mg, named as PLC
Purified Flavnoid, 90% pure) was isolated and re-crystallized with
n-Hex/acetone. The pure flavone analogue (1.5 mg) was obtained and
identified with proton NMR (Varians 500) and LC-Mass spectra as
5,7-dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one.
Experiment 1: Anti-pulmonary Inflammatory Activities of an Aqueous
Crude Extract (ACE) of Zinqiber zerumbet (L.) Smith in Mice
Methods of Experiment 1:
[0024] Animal handling, drug treatment, and lung tissue sample
collection: A total of 20 female ICR mice, 4 weeks old, were
obtained from the National Laboratory Animal Center (Taipei,
Taiwan). Mice were randomized into two groups, the control group
and the ZZ-ACE group. Mice in the control group drank water and
those in the ZZ-ACE group drank aqueous crude extract (ACE) of
Zingiber zerumbet (L.) Smith (ZZ-ACE, 28.8 mg/ml) filtered with
0.22 .mu.m filter. All mice were fed ad lib. After 28 days of
feeding, all mice were anesthetized with sodium pentobarbital. 20
ml of Tyrode's buffer was used to perfuse the lung. After the
perfusion, 0.5 g of lung tissue was taken from the same portion of
each lung. Lung tissues were chopped with No.11 surgical blade, and
then incubated in 10 ml Tyrode's buffer with 95% O.sub.2 at
37.degree. C. for 45 minutes. After the incubation, leukotriene
C.sub.4 in the medium was purified with a C18 cartridge and then
quantified by a leukotriene C.sub.4 EIA kit (Cayman Chemical
Company, MI, USA).
Results of Experiment 1: Anti-pulmonary Inflammatory Activities of
ZZ-ACE
[0025] Anti-pulmonary inflammatory activities of ZZ-ACE in mice:
Lung tissue of mice in ZZ-ACE group released significantly lower
amount of Leukotriene C.sub.4 (Table1). Since LTC4 was named as the
"slow-reactant of anaphylaxis", the reduced production of
Leukotriene C.sub.4 indicates the medicative effects of ZZ-ACE.
TABLE-US-00001 TABLE 1 Level of LTC4-release from the lung tissue
of mice fed with or without ZZ-ACE Control ZZ-ACE P-value LTC4
(pg/lung) 429 (100%) 261 (61%) 0.027* *compared to control,
significantly different (P < 0.05).
Experiment 2: Identification of an Anti-Inflammation Compound as
5,7- dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one Method
of Experiment 2: Identification of an Anti-Inflammation
Compound
[0026] Cell culture and drug treatment: Rat Basophilic Leukemia-1
(RBL-1) was purchased from Food Industry Research and Development
Institute (CCRC 60198, ATCC CRL-1378), and cultured in MEM-alpha
medium (Gibco, 12000). All trans-retinoic acid (1 .mu.g/ml) was
added to a 3.5 cm diameter well (6-well plate) at 2.times.10.sup.6
cells/2 ml/well. Plates were then incubated at 37.degree. C. with
5% CO.sub.2 in air for 16 hr. Various volumes of ZZ samples were
added to the wells to make the appropriate final concentrations (0,
0.5, 5, 50 .mu.g/ml) and incubated for 2 more hours. A23187
(calcium ionophore) was added to each well to reach the final
concentration of 10 .mu.M to stimulate RBL-1 cells to release
LTC4/cLTs for 15 min. The mediums in the wells were centrifuged at
5000 rpm for 10 min to obtain the supernatant for ELISA assay.
[0027] LTC4/cLTs ELISA assay: The supernatants of the cell cultures
were diluted into appropriate concentrations before the EIA
analysis for LTC4/cLTs. Analysis was performed according to the
procedures provided by the manufacturer.
[0028] MTT [3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium
bromidel assay: To determine cell viability, cultured medium were
removed, and cells were washed with 1.times.PBS. Then MTT (Sigma,
M2128) added to the 96-well plate to reach a concentration of 0.5
mg/ml. After 4 h incubation at 37.degree. C., the plate was added
with 150 .mu.l of acidic isopropanol (0.1 N HCl) per well to
dissolve purple crystal. After overnight incubation, OD was
determined by using a micro plate reader at 560 nm.
Results of Experiment 2: Identification of an Anti-Inflammation
Compound
[0029] Both Crude Flanvoid Fraction and an Identified Flavnoid
reduce CLTs/LTC4 secretion by A23187 stimulated Rat Basophilic
Leukemia-1 (RBL-1) cell: Tables 2A and 2B showed that compared to
control, both the ZZ Ethanol Extract and Crude Flavnoid fractions
effectively reduced the CLTs and CLT4 secretion of leukemia cells
tested. The fraction which showed to have the highest activity was
identified to contain a major flavnoid, about 90% pure. The
structure of the flavnoid was determined to be:
5,7-dihydroxy-2-(4-hydroxy-phenyl)-3-methoxy-chromen-4-one. (see
FIG. 1). TABLE-US-00002 TABLE 2A Effects of ZZ samples on cell
viability and level of CLTs released by A23187 stimulated leukemia
cells Ethanol Extract Crude Flavnoid Control, no ZZ (0.5 .mu.g/ml)
(5 .mu.g/ml) % CLTs vs. control 100 46 17 Viability (MTT %) 100 90
74
[0030] TABLE-US-00003 TABLE 2B Effects of ZZ samples on cell
viability and level of LTC4 released by A23187 stimulated leukemia
cells Crude Crude PLC Purified Control, no Flavnoid Flavnoid
Flavnoid ZZ (5 .mu.g/ml) (50 .mu.g/ml) (50 .mu.g/ml) % LTC4 vs.
control 100 63 36 6 Viability (MTT %) 100 83 87 65
Experiment 3: Anti-Allergic Activities of ZZ-ACE. Using Mice Model
Methods of Experiment 3: Anti-Allergic Activities of ZZ-ACE, Mice
Model, ex vivo
[0031] Animal handling, treatment, and spleen cell harvesting: A
total of 24 female ICR mice from the National Laboratory Animal
Center (Taipei, Taiwan) were randomized into three groups: the
negative control group (n=4), the parallel control group (n=7) and
the ZZ-ACE group (n=10). Mice in the negative control group were
fed ad lib without any treatment. Mice in the parallel control
group and the ZZ-ACE group were fed with water or ZZ-ACE,
respectively, for 56 days, while undergone a scheduled induced
asthmatic reaction. Asthmatic reaction was induced by first
sensitizing the mice with I.P. administration of 20 .mu.g ovalbumin
and 2 mg aluminum hydroxide in 100 .mu.l of 0.9% saline per mouse,
starting on day 42 for three consecutive days, and then the
allergic asthma was induced by dropping 10 .mu.l of aerosol with 1%
ovalbumin into the trachea of each mouse. Twenty minutes after
asthma was induced, mice were sacrificed. Mice spleen cells were
isolated by mechanical disruption, and hypotonic lysis of
erythrocytes was undertaken in cell suspension. Spleen cells were
stimulated with or without 12 .mu.g Con A/2.times.10.sup.6
cells/well (Sigma Chemical, St. Louis, Mo., USA) at 37.degree. C.
for 24 hours. Total RNA samples were isolated from cultured
splenocytes, and were evaluated by quantitative competitive-RT-PCR
(qc-RT-PCR) to determine their gene expression levels.
[0032] Primer designs in qc-RT-PCR for measuring gene expressions
of IFN-.gamma. and IL-4: The primers for interferon-.gamma. and
interleukin-4 were designed according to the sequences of GeneBank
accession numbers NM.sub.--008337 and BC027514, respectively (Table
3A). For each gene, two pairs of primers, sharing the same 3'
reverse primer but with different 5' forward primers were designed.
In the first pair of primers, the DNA sequences of the 5' forward
primer (called Standard Primer) are identical to a segment of the
target gene. This pair of primers was used in PCR amplification to
synthesize a nature length of DNA fragment (Standard Fragment). The
Standard Fragment was cloned to form a "Standard Plasmid". In the
second pair of primers, the 5' forward primer (called Competitor
Primer) had a DNA sequences comprised of the Standard Primer
immediately followed by a short segment of sequences that were
identical to the gene sequences more than 100 base pairs
downstream. This second pair of primers was used in PCR
amplification to obtain a DNA fragment (Competitor Fragment) that
had the same 5' and 3' sequence of the Standard Fragment, but was
shorten by more than 100 base pairs. The Competitive Fragment was
used to construct a Competitor Plasmid. The DNA sequences of
mIFN-.gamma. (see FIG. 2) and mIL-4 (see FIG. 3) are shown below.
Primer designs, the predicted PCR product lengths are shown in
Table 3A. TABLE-US-00004 TABLE 3A Primers used in qc-RT-PCR assay
to determine levels of mIFN-.gamma. and mIL-4 gene expression PCR
product 3' reverse length (DNA 5' forward primer primer sequences)
IFN-.gamma. Standard gctctgagacaatgaac cgactccttttccgc 473 b.p.
plasmid gcta ttcc (99 to 570) Competit gctctgagacaatgaac As
Standard 367 b.p. or gctacaagtggcatagat (99 to 119, 225 to plasmid
gtgg 570) IL-4 Standard gctagttgtcatcctgctctt tcagtgatgtggac 356
b.p. plasmid c ttggac (56 to 411) Competit Gctagttgtcatcctgctct As
Standard 231 b.p. or tcggagatggatg (56 to 77, 182 to plasmid
411)
[0033] Preparation of Standard Plasmid and Competitor Plasmid: Mice
CDNA fragments of interferon-.gamma. or interleukin-4, amplified
with PCR kits and the Primers, were cloned into pGEM-T vectors
(Promega, Madison, Wis.) to construct Standard Plasmids and
Competitor Plasmids of these two genes. The Standard Plasmids and
the Competitor Plasmids were all sequenced to confirm the accuracy
of the inserted sequences.
[0034] Establish a standard curve: Following the principles of
qc-RT-PCR method, known amounts of Competitor Plasmid were mixed
into a series dilutions of known amount of Standard Plasmid, and
the mixtures were used as DNA templates with a pair of Standard
Primer and 3' reverse primer for PCR amplification. Both the
Standard Fragment and the Competitor Fragment obtained from the PCR
reactions were then used for ethidium-bromide gel electrophoresis.
The correlations between the ratios of band intensities of the
fragments and the ratios of the amount of plasmids used in each
mixture were calculated of to establish a standard curve.
[0035] Gene expressions of interferon-.gamma. and interleukin-4 in
splenocytes determined bv quantitative competitive-RT-PCR
(qc-RT-PCR): After centrifugation, cell pellet of splenocytes was
mixed with 1 ml Trizol reagent and then Trizol RNA Extract Kit
isolated total RNA (Gibco, Life Technologies). The purity of total
RNA of each sample was evaluated by the ratio of A.sub.260
nm/A.sub.280 nm. The mRNA was converted to CDNA with reverse
transcriptase, and then analyzed by qc-PCR. The qc-PCR reaction was
performed in a mixture of 1 .mu.l standard primers (0.5 .mu.g each
of forward and reverse primers), 2.5 .mu.l of 10.times.PCR buffer,
2.5 .mu.l dNTP (2 mM), 0.1 .mu.l DNA polymerase (5U/.mu.l), 0.5
.mu.l sample cDNA and 0.5 .mu.l of Competitor Plasmid, after the
mixture was adjusted to a total volume of 25 .mu.l with pure water.
The PCR products were then analyzed with gel electrophoresis. The
ethidium bromide density of each band in the gel was read with an
Image Quant Densitometer, and the results were compared with the
established standard curves to calculate the copy numbers of cDNA
in the splenocyte samples.
Results of Experiment 3: Anti-Allergic Activities of ZZ-ACE, Mice
Model, ex vivo
[0036] Anti-allergic activities of ZZ-ACE bv Balancing Th1/Th2
immune response: After mice were treated with ZZ-ACE, splenocytes
were harvested from the treated mice, and expression levels of
IFN-.gamma. and IL-4 genes were analyzed using qc-PCR. The results
(Table 3B) showed that, in comparison to control, the gene
expression level of IFN-.gamma. (p<0.05) significantly increased
and the gene expression level of IL-4 (p<0.05) significantly
reduced in splenocytes of treated mice, with or without ConA
stimulation. Since the ratio of gene expression of IFN-.gamma. to
IL-4 was significantly increased, ZZ-ACE may act beneficially to
eliminate allergic reactions by modulating the Th1/Th2 balance.
Thus, the results of this experiment indicated ZZ-ACE as having the
potential to diminish allergic reactions by modulating the cytokine
gene expressions in immune cells in mice, after 60-day's
continuative administration of ZZ-ACE. Examples of gel
electrophoresis pictures of PCR products of qc-RT-PCR for
IFN-.gamma. (FIG. 4) and IL-4 (FIG. 5) gene expression are shown
below. TABLE-US-00005 TABLE 3B Level.sup.1 of gene expression of
IFN-.gamma.and IL-4, with or without ConA stimulation, in
splenocytes harvested from mice that were with or without drinking
ZZ-ACE, and with or without asthma induction Water, no Water,
ZZ-ACE, asthma asthma asthma IFN-.gamma. w/o ConA (copy/2 .times.
.sup.a6.28 .times. 10.sup.3 .sup.b1.19 .times. 10.sup.5 .sup.c2.04
.times. 10.sup.5 10.sup.6 cell) IL-4 w/o ConA (copy/2 .times.
10.sup.6 .sup.a2.04 .times. 10.sup.5 .sup.b24.9 .times. 10.sup.5
.sup.c8.61 .times. 10.sup.5 cell) .sup.2IFN-.gamma./IL-4 w/o ConA
.sup.a0.039 .sup.a0.046 .sup.b0.242 IFN-.gamma. w/ Con A (copy/2
.times. .sup.a1.26 .times. 10.sup.4 .sup.a1.59 .times. 10.sup.5
.sup.b6.34 .times. 10.sup.5 10.sup.6 cell) IL-4 w/ Con A (copy/2
.times. 10.sup.6 .sup.a5.29 .times. 10.sup.5 .sup.b5.68 .times.
10.sup.6 .sup.a1.49 .times. 10.sup.6 cell) .sup.2IFN-.gamma./IL-4
w/ ConA .sup.a0.026 .sup.a0.032 .sup.b0.378 .sup.1different
superscripts in the same row indicate significant difference (p
< 0.05). .sup.2values were calculated by first calculating the
ratio of IFN-.gamma./IL-4 from each mouse, then the ratios were
averaged.
Experiment 4: Identification of Zerumbone as an Active Compound
Modulates the Balance of Th1/Th2 Immune Responses Methods of
Experiment 4:
[0037] Active Compound Identification: Dried ZZ root was first
extracted with ethanol (Ethanol Extract), than the extract was
chromatographically further purified with Silica gel and PLC, and
assayed with in vitro bioactive screening (procedures described
below in Experiments 4A to 4E) to identify purification fraction
that contains strong anti-allergic activities (results described
below in Experiments 4A to 4E). Active compound was then isolated
from the identified active fractions.
Result of Experiment 4: Identification of Zerumbone as an Active
Compound Modulates the Balance of Th1/Th2 Immune Responses
[0038] Active Compound Identification: The compound in the active
fractions was identified as zerumbone. See FIG. 6 for the structure
of zerumbone.
4A: Effects of ZZ samples on Level of Eotaxin Secretion by
IL-13/TNF-.alpha. Stimulated Human BEAS-2B Cells
Methods of Experiment 4A:
[0039] Cell culture, treatment with ZZ samples, and stimulation for
eotaxin expression: SV40 transformed human bronchial epithelial
cells BEAS-2B were seeded in 96-well plates with F12/DMEM medium
and incubated at 37.degree. C. to confluence. Cells were then
treated with different concentrations of ZZ samples. After 20
minutes treatment, cells were stimulated with 50 ng/ml of human
IL-13 (Peprotech, 200-13) and 100 ng/ml of human TNF-.alpha.
(Peprotech, 300-01A) at 37.degree. C. for 22 hours. Culture media
were collected and their eotaxin concentrations were measured.
[0040] ELISA Assay for Cytokine Eotaxin: Eotaxin concentration was
determined by using Opt EIA Set; human eotaxin was from Pharmingen;
2623KI. 96-well plates were from IWAKI, 3801-096. Assays were
performed according to the instructions provided by the
manufacturer.
Results of Experiment 4A:
[0041] After SV40 transformed human bronchial epithelial cells
BEAS-2B were treatment with ZZ samples, and stimulated with human
TNF-.alpha. to express eotaxin, the culture media were collected
and their eotaxin concentrations were measured with an ELISA kit.
The results were summarized in Table 4A. Eotaxin inhibition
activity was found to be rich in Ethanol Extract fraction, and was
even richer in a fraction with Zerumbone. TABLE-US-00006 TABLE 4A
Effects of ZZ samples on level of Eotaxin secretion by
IL-13/TNF-.alpha. stimulated human BEAS-2B cells Control, Crude no
ZZ Ethanol Extract Zerumbone treatment (50 .mu.g/ml) (50 .mu.g/ml)
Eotaxin released, as % of 100 23 12 control
4B: Effects of ZZ Samples on Level of TNF-.alpha. Secretion by
Murine Peritoneal Macrophages Method of Experiment 4B:
[0042] Cell culture: Mouse peritoneal macrophages were elicited by
i.p. (intraperitoneally) injection of 1 ml of 4% Brewer's
thioglycolate medium (Sigma, B2551) into peritoneal cavity of male
BALB/c mice (aged 6-10 wk). Peritoneal cells were obtained 7 days
after injection by peritoneal lavage with ice-cold RPMI-1640
medium.
[0043] Drug treatment: Murine peritoneal macrophages
(1.times.10.sup.5) were seeded in flat-bottom 96-well plates with
RPMI-1640 medium. Cells were treated with different concentrations
of ZZ-ACE samples for 20 minutes, then were stimulated with 1.5
.mu.g/ml of LPS (Lipopolysaccharide) (Sigma, L-2880) for further 22
hours, before media were collected for TNF.alpha. assay.
[0044] TNF-.alpha. ELISA assay: TNF-.alpha. was determined using
R&D mouse TNF-.alpha. ELISA (Duoset, DY410) following the
procedures recommended by the manufacturer.
Results of Experiment 4B:
[0045] When mouse peritoneal macrophages were treated with
different concentrations of ZZ-ACE samples in vitro, then
stimulated LPS before media were collected for TNF.alpha. assay,
the results showed that both the ZZ-ACE and a purification fraction
that is rich in Zerumbone have inhibition activities on TNF.alpha.
released. TABLE-US-00007 TABLE 4B Effects of ZZ samples on level of
TNF-.alpha. secretion by LPS stimulated murine peritoneal
macrophages. Crude Control, ZZ-ACE Zerumbone no ZZ treatment (5
.mu.g/ml) (5 .mu.g/ml) TNF-.alpha. released, as % of 100 63 55
control
4C: In vitro Effects of ZZ Samples on Level of B Cell Proliferation
of LPS Stimulated Mouse Splenocytes Method of Experiment 4C:
[0046] Preparation of splenocytes: Mouse spleens were collected
from BALB/c male mice (8 to 12 week of age). Spleens were grinded
with a plunger of a 10-ml syringe, in 10 ml of RPMI-1640 medium
(GIBCO Cat. No. 23400-013) supplemented with 10% (v/v) fetal calf
serum (FCS; Biological Industries, 04-001-1B), 5 .mu.g/ml of
Gentamycine (Biological Industries, 03-035-1B), 1 .mu.g/ml of
kanamycine (Biological Industries, 03-049-1B), 1.2 mM of sodium
pyruvate (Gibco, 11360-070), 0.12 mM of non-essential amino acid
(Gibco, 11140-050), 0.2 mM of 2-mercaptoethanol (Sigma, M7522), and
2 g/l of sodium bicarbonate (Sigma, S5761). Then 15 ml of ACK lysis
buffer (0.15 M NH.sub.4Cl, 10 mM KHCO3, 0.1 mM Na.sub.2EDTA, pH
7.2) was added to lyse the red blood cells. After ACK lysis buffer
treatment, the splenocytes were collected by centrifugation at 1500
rpm for 10 min at 4.quadrature., then were washed with 10 ml cell
culture medium, and finally resuspended into cultured medium.
The Drug Effect on B Cell Proliferation of Splenocytes from BALB/c
Mouse
[0047] Drug treatment on slenocytes, and stimulation for B cell
proliferation: Splenocytes (1.5.times.10.sup.5) were seeded in
flat-bottom 96-well plates with RPMI-1640 medium with 10% FCS.
Splenocytes were treated with the various concentrations of ZZ
samples for 2 h at 37.degree. C., then were stimulated with 15
.mu.g/ml of LPS (Sigma, L2880) in RPMI-1640 medium containing
10%(v/v) fetal calf serum at 37.degree. C. for 66 h to encourage B
cells proliferation, before assay.
[0048] Proliferation assay for B cells: Proliferation was
determined using Roche BrdU ELISA kit (Roche, 1647229). Cells in
96-well plate were first treated with 100 .mu.M of BrdU at
37.degree. C. for 6 h. The plates were then centrifuged at 1500 rpm
for 10 min at 4.quadrature.. Supernatants were moved without
disturbing the cells. Plates were incubated at 60.quadrature. for 1
h, and then 200 .mu.l per well of FixDenat were added. After 30 min
incubation at RT, FixDenat was discarded, 300 .mu.l per well of
blocking solution was added. The plates were kept at RT for 1 h,
washed three times with 300 .mu.l per well of washing buffer, and
then 100 .mu.l per well of anti-BrdU-POD was added. After
incubation at RT for 1 h the plates were washed four times with
washing buffer and then added 100 .mu.l per well of substrate and
cultured at RT for 5 min in the dark. Reactions were terminated by
addition of 25 .mu.l of stock solution/well and OD was measured by
using a microplate reader at 450 nm.
[0049] Results of Experiment 4C: TABLE-US-00008 TABLE 4C In vitro
Effects of ZZ samples on level of B cell proliferation of LPS
stimulated mouse splenocytes Control, Crude no ZZ Water Extract
Zerumbone treatment (5 .mu.g/ml) (5 .mu.g/ml) B cell proliferation,
as % of 100 62 60 control
4D: In vitro Effects of ZZ Samples on Level of INF-.gamma.
Secretion bv ConA Stimulated Mouse Splenocvtes Methods of
Experiment 4D:
[0050] Splenocyte preparation and Drug treatment: Splenocytes being
prepared (see experiment 4C) and diluted to 6.times.10.sup.5
cells/100 .mu.l, were seeded in flat-bottom 96-well plates with
RPMI-1640 medium with 10% FCS. Splenocytes were then treated with
various concentrations of ZZ samples (30 .mu.l) for 2 hr at
37.degree. C., and finally stimulated with 1 .mu.g/ml of
concanavalin A (conA) for 18 h. IFN-v concentrations in the media
were determined by ELISA assay, and cell viability was measured by
MTT assay.
[0051] IFN-gamma ELISA: Mouse IFN-gamma was determined by using
R&D mouse IFN-gamma (Duoset, DY485) kit. Elisa assay was
performed according to the procedures recommended by the
manufacturer.
Results of Experiment 4D:
[0052] The Effects ZZ samples on the level of INF-.gamma. secretion
by ConA stimulated mouse splenocytes were summarized in Table 4D.
Both ZZ-ACE and the Ethanol Extraction fractions showed ability to
increase IFN-y concentration in the culture media. TABLE-US-00009
TABLE 4D In vitro effects of ZZ samples on level of INF-.gamma.
secretion by ConA stimulated mouse splenocytes Control, ZZ-ACE
Ethanol Extract no ZZ treatment (50 .mu.g/ml) (50 .mu.g/ml)
IFN-.gamma. released as % of 100 132 127 control
4E: Effects of ZZ Samples on Level of IL-4 Secretion by PMA/A23187
Stimulated Mouse EL-4 Cell Methods of Experiment 4E:
[0053] Cell culture: EL-4 cells were cultured in 75-cm.sup.2
culture flask in RPMI-1640 medium supplemented with 10% (v/v) fetal
calf serum, 5 .mu.g/ml of Gentamycine (Biological Industries), 1
.mu.g/ml of kanamycine (Biological Industries), 1.2 mM of sodium
pyruvate, 0.12 mM of non-essential amino acid, 0.2 mM of
2-mercaptoethanol, 2 g/l of sodium bicarbonate in 5% CO.sub.2 at
37.degree. C.
[0054] Drug treatment: EL-4 cells (1.times.10.sup.4 cells/100
.mu.l) were seeded in flat-bottom 96-well plates with RPMI-1640
medium with 10% FCS. Cells were treated with various concentrations
of ZZ-ACE sample (30 .mu.l) for 2 hours at 37.degree. C., then were
stimulated with 1.5 ng/well of PMA and 15 ng/well of A23187 in
RPMI-1640 medium with 10% (v/v) fetal calf serum (total volume 150
.mu.l) at 37.degree. C. for 22 hours. Levels of IL-4 secretion in
the cell-free supernatants were determined by ELISA assay and cell
viability was measured by MTT assay.
[0055] IL-4 ELISA: IL-4 was determined using R&D mouse IL-4
ELISA (Duoset, DY404). 96-well plates (IWAKI, 3801-096) were coated
with 100 .mu.l/well of the capture antibody (4 .mu.g/ml in PBS) and
incubated overnight at room temperature. The plates were then
washed three times with washing buffer (PBS containing 0.05% Tween
20) and blocked by incubating with 300 .mu.l of blocking
buffer/well (PBS containing 1% bovine serum albumin and 5% sucrose)
at room temperature for 1 h. The plates were washed three times
with washing buffer before 100 .mu.l of test or standards were
added to the wells. The plates were incubated at room temperature
for 2 h, washed, and incubated with detection antibody [100 .mu.l
of 200 ng/ml in Reagent Diluent (PBS containing 1% bovine serum
albumin)/well] at room temperature for 2 h. After washing, 100
.mu.l of Streptavidin-HRP was added to each well, incubated at room
temperature for 20 min, and, after washing, incubated with 100
.mu.l of TMB (Clinical) per well for 20 min. Reactions were
terminated by addition of 100 .mu.l of 1N HCl/well, and measured OD
by using a microplate reader at 450 nm.
[0056] Results of Experiment 4E: TABLE-US-00010 TABLE 4E Effects of
ZZ samples on IL-4 secretion by PMA/A23187 stimulated mouse EL-4
cell Ethanol Crude Control, Extract Zerumbone no ZZ treatment (50
.mu.g/ml) (50 .mu.g/ml) IL-4 released as % of 100 25 12 control
Experiment 5: Human Volunteers Using ZZ-ACE for Allergic
Rhinitis
[0057] Five volunteers took ZZ-ACE to treat allergic rhinitis.
Their experiences are summarized here.
Volunteer A:
[0058] Mr. Wen had severe allergic rhinitis for years. To treat his
rhinitis, daily, freshly harvested ZZ root (before drying) 300 gm
was cooked in water and the soup was taken. The treatment was
repeated for seven days as one treatment course. His symptoms were
significantly reduced at the end of the treatment. Three months
later, when symptoms returned, the treatment course was repeated
successfully.
Volunteer B:
[0059] Another Mr. Wen (father of volunteer A), followed the
treatment course of Volunteer A, has successfully reduced his
allergic rhinitis symptoms. Treatment courses were repeated later
whenever allergy seasons arrived.
Volunteer C:
[0060] Mr. Lee cooked 1000 gm of wet fresh ZZ root, and
refrigerated the soup in sealed containers. He drank about 1/4 of
the soup daily for four days to treat his allergic rhinitis. The
result was satisfactory. He repeated the same treatment course
successfully again when the symptoms returned later.
Volunteer D:
[0061] Mr. Du took ZZ capsules for two months, 6 capsules in the
morning and 6 capsules in the evening, daily, to treat very severe
allergic rhinitis successfully.
[0062] The ZZ capsules were prepared by the following procedures.
Dried ZZ root was cooked in 10 times of water (weight to weight
ratio). The soup was concentrated approximately 5 fold then dried
down as granules using starch as excipient. The granules were used
to fill capsules. Each capsule contains 0.5 gm of granules that is
equivalent to about 2.0 gm of dried ZZ root, or about 20 gm of
freshly harvested ZZ root.
Volunteer E:
[0063] The same batch of ZZ capsules used by Volunteer D was also
used to treat Volunteer E, Mr. Huang for about 180 day, 3 capsules
per day. During the 180 days, the volunteer experienced less
allergic problem than before.
[0064] The invention is not limited by the embodiments described
above which are presented as examples only but can be modified in
various ways within the scope of protection defined by the appended
patent claims.
REFERENCES
[0065] 1. Wenzel S E. The role of leukotrienes in asthma.
Prostaglandins Leukot Essent Fatty Acids 2003;69:145-55.
[0066] 2. Leff A R. Regulation of leukotrienes in the management of
asthma: biology and clinical therapy. Annu Rev Med
2001;52:1-14.
[0067] 3. Aizawa T, Tamura G, Ohtsu H, Takishima T. Eosinophil and
neutrophil production of leukotriene C4 and B4: comparison of cells
from asthmatic subjects and healthy donors. Ann Allergy 1990;
64:287-92.
[0068] 4. Davern T J, Bass N M. Leukotriene antagonists. Clin Liver
Dis 2003;7(2):501-12, viii.
[0069] 5. Beghe B, Barton S, Rorke S, Peng Q, Sayers I, Gaunt T,
Keith T, Clough J, Holgate S, Holloway J. Polymorphisms in the
interleukin-4 and interleukin-4 receptor alpha chain genes confer
susceptibility to asthma and atopy in a Caucasian population. Clin
Exp Allergy 2003; 33:1111-1117.
[0070] 6. Shirai T, Suzuki K, Inui N, Suda T, Chida K, Nakamura H.
Th1/Th2 profile in peripheral blood in atopic cough and atopic
asthma. Clin Exp Allergy 2003;33:84-9.
[0071] 7. Lee Y C, Lee K H, Lee H B, Rhee Y K. Serum levels of
interleukins (IL)-4, IL-5, IL-13, and interferon-gamma in acute
asthma. J Asthma 2001; 38:665-71.
[0072] 8. Kalin P. The Common Butterbur (Petasites
hybridus)--Portrait of a Medicinal Herb. Forsch Komplementarmed
Klass Naturheilkd 2003; 10 Suppl 1:41-4.
[0073] 9. Vimala S, Norhanom A W, Yadav M. Anti-tumour promoter
activity in Malaysian ginger rhizobia used in traditional medicine.
Br J Cancer 1999; 80:110-6.
[0074] 10. Murakami A, Takahashi D, Kinoshita T, Koshimizu K, Kim H
W, Yoshihiro A, Nakamura Y, Jiwajinda S, Terao J, Ohigashi H.
Zerumbone, a Southeast Asian ginger sesquiterpene, markedly
suppresses free radical generation, proinflammatory protein
production, and cancer cell proliferation accompanied by apoptosis:
the alpha,beta-unsaturated carbonyl group is a prerequisite.
Carcinogenesis 2002; 23:795-802. Comment in: Carcinogenesis 2002;
23:1961; author reply 1963.
Sequence CWU 1
1
8 1 1208 DNA Mus musculus 1 gatagctgcc atcggctgac ctagagaaga
cacatcagct gatcctttgg accctctgac 60 ttgagacaga agttctgggc
ttctcctcct gcggcctagc tctgagacaa tgaacgctac 120 acactgcatc
ttggctttgc agctcttcct catggctgtt tctggctgtt actgccacgg 180
cacagtcatt gaaagcctag aaagtctgaa taactatttt aactcaagtg gcatagatgt
240 ggaagaaaag agtctcttct tggatatctg gaggaactgg caaaaggatg
gtgacatgaa 300 aatcctgcag agccagatta tctctttcta cctcagactc
tttgaagtct tgaaagacaa 360 tcaggccatc agcaacaaca taagcgtcat
tgaatcacac ctgattacta ccttcttcag 420 caacagcaag gcgaaaaagg
atgcattcat gagtattgcc aagtttgagg tcaacaaccc 480 acaggtccag
cgccaagcat tcaatgagct catccgagtg gtccaccagc tgttgccgga 540
atccagcctc aggaagcgga aaaggagtcg ctgctgattc ggggtgggga agagattgtc
600 ccaataagaa taattctgcc agcactattt gaatttttaa atctaaacct
atttattaat 660 atttaaaact atttatatgg agaatctatt ttagatgcat
caaccaaaga agtatttata 720 gtaacaactt atatgtgata agagtgaatt
cctattaata tatgtgttat ttataatttc 780 tgtctcctca actatttctc
tttgaccaat taattattct ttctgactaa ttagccaaga 840 ctgtgattgc
ggggttgtat ctgggggtgg gggacagcca agcggctgac tgaactcaga 900
ttgtagcttg tacctttact tcactgacca ataagaaaca ttcagagctg cagtgacccc
960 gggaggtgct gctgatggga ggagatgtct acactccggg ccagcgcttt
aacagcaggc 1020 cagacagcac tcgaatgagt caggtagtaa caggctgtcc
ctgaaagaaa gcagtgtctc 1080 aagagacttg acacctggtg cttccctata
cagctgaaaa ctgtgactac acccgaatga 1140 caaataactc gctcatttat
agtttatcac tgtctaattg catatgaata aagtatacct 1200 ttgcaacc 1208 2
584 DNA Mus musculus 2 cttaattgtc tctcgtcact gacggcacag agctattgat
gggtctcaac ccccagctag 60 ttgtcatcct gctcttcttt ctcgaatgta
ccaggagcca tatccacgga tgcgacaaaa 120 atcacttgag agagatcatc
ggcattttga acgaggtcac aggagaaggg acgccatgca 180 cggagatgga
tgtgccaaac gtcctcacag caacgaagaa caccacagag agtgagctcg 240
tctgtagggc ttccaaggtg cttcgcatat tttatttaaa acatgggaaa actccatgct
300 tgaagaagaa ctctagtgtt ctcatggagc tgcagagact ctttcgggct
tttcgatgcc 360 tggattcatc gataagctgc accatgaatg agtccaagtc
cacatcactg aaagacttcc 420 tggaaagcct aaagagcatc atgcaaatgg
attactcgta gtactgagcc accatgcttt 480 aacttatgaa tttttaatgg
ttttattttt aatatttata tatttataat tcataaaata 540 aaatatttgt
ataatgtaac agaaaaaaaa aaaaaaaaaa aaaa 584 3 21 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 3
gctctgagac aatgaacgct a 21 4 19 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 4 cgactccttt tccgcttcc 19 5
39 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 5 gctctgagac aatgaacgct acaagtggca tagatgtgg 39 6
22 DNA Artificial Sequence Description of Artificial Sequence
Synthetic primer 6 gctagttgtc atcctgctct tc 22 7 20 DNA Artificial
Sequence Description of Artificial Sequence Synthetic primer 7
tcagtgatgt ggacttggac 20 8 33 DNA Artificial Sequence Description
of Artificial Sequence Synthetic primer 8 gctagttgtc atcctgctct
tcggagatgg atg 33
* * * * *