U.S. patent application number 11/175021 was filed with the patent office on 2006-04-13 for regulated transcription of targeted genes and other biological events.
Invention is credited to Peter Belshaw, Gerald R. Crabtree, Steffan N. Ho, Stuart L. Schreiber, David M. Spencer, Thomas J. Wandless.
Application Number | 20060078969 11/175021 |
Document ID | / |
Family ID | 35431804 |
Filed Date | 2006-04-13 |
United States Patent
Application |
20060078969 |
Kind Code |
A1 |
Crabtree; Gerald R. ; et
al. |
April 13, 2006 |
Regulated transcription of targeted genes and other biological
events
Abstract
Dimerization and oligomerization of proteins are general
biological control mechanisms that contribute to the activation of
cell membrane receptors, transcription factors, vesicle fusion
proteins, and other classes of intra- and extracellular proteins.
We have developed a general procedure for the regulated (inducible)
dimerization or oligomerization of intracellular proteins. In
principle, any two target proteins can be induced to associate by
treating the cells or organisms that harbor them with cell
permeable, synthetic ligands. To illustrate the practice of this
invention, we have induced: (1) the intracellular aggregation of
the cytoplasmic tail of the .zeta. chain of the T cell receptor
(TCR)-CD3 complex thereby leading to signaling and transcription of
a reporter gene, (2) the homodimerization of the cytoplasmic tail
of the Fas receptor thereby leading to cell-specific apoptosis
(programmed cell death) and (3) the heterodimerization of a
DNA-binding domain (Gal4) and a transcription-activation domain
(VP16) thereby leading to direct transcription of a reporter gene.
Regulated intracellular protein association with our cell
permeable, synthetic ligands offers new capabilities in biological
research and medicine, in particular, in gene therapy. Using gene
transfer techniques to introduce our artificial receptors, one can
turn on or off the signaling pathways that lead to the
overexpression of therapeutic proteins by administering orally
active "dimerizers" or "de-dimerizers", respectively. Since cells
from different recipients can be configured to have the pathway
overexpress different therapeutic proteins for use in a variety of
disorders, the dimerizers have the potential to serve "universal
drugs". They can also be viewed as cell permeable, organic
replacements for therapeutic antisense agents or for proteins that
would otherwise require intravenous injection or intracellular
expression (e.g., the LDL receptor or the CFTR protein).
Inventors: |
Crabtree; Gerald R.;
(Woodside, CA) ; Schreiber; Stuart L.; (Boston,
MA) ; Spencer; David M.; (Houston, TX) ;
Wandless; Thomas J.; (Palo Alto, CA) ; Ho; Steffan
N.; (San Diego, CA) ; Belshaw; Peter;
(Somerville, MA) |
Correspondence
Address: |
FISH & NEAVE IP GROUP;ROPES & GRAY LLP
ONE INTERNATIONAL PLACE
BOSTON
MA
02110-2624
US
|
Family ID: |
35431804 |
Appl. No.: |
11/175021 |
Filed: |
July 5, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09466568 |
Dec 17, 1999 |
6972193 |
|
|
11175021 |
Jul 5, 2005 |
|
|
|
09157753 |
Sep 16, 1998 |
6043082 |
|
|
09466568 |
Dec 17, 1999 |
|
|
|
08388653 |
Feb 14, 1995 |
5869337 |
|
|
09157753 |
Sep 16, 1998 |
|
|
|
08196043 |
Feb 11, 1994 |
|
|
|
08388653 |
Feb 14, 1995 |
|
|
|
08179748 |
Jan 7, 1994 |
|
|
|
08196043 |
Feb 11, 1994 |
|
|
|
08092977 |
Jul 16, 1993 |
|
|
|
08179748 |
Jan 7, 1994 |
|
|
|
08017931 |
Feb 12, 1993 |
|
|
|
08092977 |
Jul 16, 1993 |
|
|
|
08292597 |
Aug 18, 1994 |
5834266 |
|
|
09466568 |
|
|
|
|
08179143 |
Jan 7, 1994 |
|
|
|
08292597 |
Aug 18, 1994 |
|
|
|
08093499 |
Jul 16, 1993 |
|
|
|
08179143 |
Jan 7, 1994 |
|
|
|
Current U.S.
Class: |
435/69.7 ;
435/320.1; 435/325; 530/350; 536/23.5 |
Current CPC
Class: |
C07K 14/71 20130101;
C07K 2319/035 20130101; A61P 43/00 20180101; C07K 2319/42 20130101;
C07K 2319/09 20130101; C07K 2319/715 20130101; C07K 2319/90
20130101; C07K 2319/00 20130101; C07K 2319/60 20130101; A61K 38/00
20130101; C07K 2319/20 20130101; C07K 2319/43 20130101; C07K
2319/81 20130101; C12N 15/1055 20130101; C07D 498/18 20130101; C07K
7/645 20130101; C12N 15/63 20130101; C07F 5/025 20130101; C07K
2319/32 20130101; C07K 14/395 20130101; C07K 2319/02 20130101; C12N
15/62 20130101; C07K 2319/71 20130101; C12N 15/67 20130101; A61K
47/6425 20170801; C07K 14/7051 20130101; C07K 2319/03 20130101;
C07K 14/705 20130101; C07H 19/01 20130101; C12P 15/00 20130101 |
Class at
Publication: |
435/069.7 ;
435/320.1; 435/325; 530/350; 536/023.5 |
International
Class: |
C07K 14/705 20060101
C07K014/705; C07H 21/04 20060101 C07H021/04; C12P 21/04 20060101
C12P021/04 |
Claims
1. A DNA construct encoding a chimeric protein comprising (a) at
least one receptor domain, capable of binding to a selected ligand,
fused to (b) a heterologous additional protein domain capable of
initiating a biological process upon exposure to the ligand, said
ligand being capable of binding to two or more chimeric protein
molecules.
2. A DNA construct of claim 1 wherein the chimeric protein further
comprises an intracellular targeting domain capable of directing
the chimeric protein to a desired cellular compartment.
3. A DNA construct of claim 2 wherein the intracellular targeting
domain comprises a secretory leader sequence, a membrane spanning
domain, a membrane binding domain or a sequence directing the
protein to associate with vesicles or with the nucleus.
4. A DNA construct of claim 1 wherein the chimeric protein has a Kd
value for binding to the selected ligand of less than or equal to
about 10.sup.-6M.
5. A DNA construct of claim 1 wherein the selected ligand is less
than about 5 kDa in molecular weight
6. A DNA construct of claim 1 wherein the heterologous additional
protein domain comprises: (a) a protein domain capable, upon
exposure to the ligand, of initiating a detectable intracellular
signal; (b) a DNA-binding protein; or (c) a transcriptional
activation domain.
7. A DNA construct of claim 6 wherein the intracellular signal is
capable of activating transcription of a gene under the
transcriptional control of transcriptional control element
responsive to said oligomerization.
8. A DNA construct of claim 7 wherein the additional protein domain
the zeta subunit of CD3.
9. A DNA construct of claim 1 wherein the chimeric protein is
capable of binding to an FK506-type ligand, a cyclosporin A-type
ligand, tetracycline or a steroid ligand.
10. A DNA construct encoding a target gene under the
transcriptional control of an transcription control element
responsive to the oligomerization of a chimeric protein of claim
1.
11. A DNA construct of claim 10 in which the target gene is not
naturally under the transcriptional control of the responsive
transcriptional control element.
12. A DNA construct containing (a) a transcriptional control
element responsive to the oligomerization of a chimeric protein of
claim 1 and (b) flanking DNA sequence from a target gene permitting
the homologous recombination of the transcriptional control element
into a host cell in association with the target gene.
13. A DNA construct of claim 10 wherein the target gene encodes a
surface membrane protein, a secreted protein, a cytoplasmic protein
or a ribozyme or an antisense sequence.
14. A DNA vector containing a DNA construct of any of claim 1 and a
selectable marker permitting transfection of the DNA construct into
host cells and selection of transfectants containing the
construct.
15. A DNA vector of claim 14 wherein the vector is a viral
vector.
16. A viral vector of claim 15 which is an adeno-, adeno
associated- or retroviral vector.
17. A chimeric protein encoded by a DNA construct of claim 1.
18. A cell containing and capable of expressing at least one DNA
construct of claim 1.
19. A cell of claim 18 which is a mammalian cell.
20. A cell of claim 18 which contains (a) a first DNA construct
encoding a chimeric protein comprising (i) at least one receptor
domain capable of binding to a selected ligand and (ii) another
protein domain, heterologous with respect to the receptor domain,
but capable, upon oligomerization with one or more other like
domains, of triggering the activation of transcription of a target
gene under the transcriptional control of a transcriptional control
element responsive to said oligomerization; and (b) a target gene
under the expresssion control of a transcriptional control element
responsive to said oligomerization; and which following exposure to
the selected ligand expresses the target gene.
21. A cell of claim 18 which contains a first set of DNA constructs
encoding (a) a first chimeric protein containing a DNA-binding
domain and at least one receptor domain capable of binding to a
first selected ligand moiety; and (b) a second chimeric protein
containing a transcriptional activating domain and at least one
receptor domain capable of binding to a second selected ligand
(which may be the same or different from the first selected ligand
moiety); and and a second DNA construct encoding a target gene
under the transcriptional control of a heterologous transcriptional
control sequence which binds with the DNA-binding domain and is
responsive to the transcriptional activating domain; which cell
expresses the target gene following exposure to a substance
containing the selected ligand moiety(ies).
22. A DNA composition comprising (a) a first DNA construct encoding
a chimeric protein comprising (i) at least one receptor domain,
capable of binding to a selected ligand, fused to (ii) a
heterologous additional protein domain capable of initiating a
biological process upon exposure to the ligand; and (b) a second
DNA construct encoding a target gene under the transcriptional
control of an transcription control element responsive to the
oligomerization of a chimeric protein.
23. A DNA composition comprising (a) a DNA construct encoding a
first chimeric protein comprising (i) at least one first receptor
domain, capable of binding to a selected first ligand moiety, fused
to (ii) a heterologous additional protein domain capable of
initiating a biological process upon exposure to the ligand in the
presence of a second chimeric protein; and, (b) a DNA construct
encoding the second chimeric protein comprising (i) at least one
receptor domain, capable of binding to a selected second ligand
moiety, fused to (ii) a heterologous additional protein domain
capable of initiating a biological process upon exposure to the
ligand in the presence of the first chimeric protein; wherein the
first and second receptor moieties may be the same or different and
the first and second selected ligand moieties may be the same or
different; and (c) a target DNA construct encoding a target gene
under the transcriptional control of a transcriptional control
element responsive to the oligomerization of a chimeric
protein.
24-46. (canceled)
Description
TECHNICAL FIELD
[0001] This invention concerns materials, methods and applications
relating to the oligomerizing of chimeric proteins with a dimeric
or multimeric, preferably non-peptidic, organic molecule. Aspects
of the invention are exemplified by recombinant modifications of
host cells and their use in gene therapy or other applications of
inducible gene expression.
INTRODUCTION
[0002] Biological specificity usually results from highly specific
interactions among proteins. This principle is exemplified by
signal transduction, the process by which extracellular molecules
influence intracellular events. Many pathways originate with the
binding of extracellular ligands to cell surface receptors. In many
cases receptor dimerization leads to transphosphorylation and the
recruitment of proteins that continue the signaling cascade. The
realization that membrane receptors could be activated by
homodimerization resulted from the observation that receptors could
be activated by antibodies that cross linked two receptors.
Subsequently, many receptors were found to share those properties.
The extracellular and transmembrane regions of many receptors are
believed to function by bringing the cytoplasmic domains of the
receptors in close proximity by a ligand-dependent dimerization or
oligomerization, while the cytoplasmic domains of the receptor
convey specific signals to internal compartments of the cell.
[0003] Others have investigated ligand-receptor interactions in
different systems. For example, Clark, et al., Science (1992) 258,
123 describe cytoplasmic effectors of the B-cell antigen receptor
complex. Durand, et al., Mol. Cell. Biol. (1988) 8, 1715, Verweij,
et al., J. Biol. Chem. (1990) 265, 15788 and Shaw, et al., Science
(1988) 241, 202 report that the NF-AT-directed transcription is
rigorously under the control of the antigen receptor. Inhibition of
NF-AT-directed transcription by cyclosporin A and FK506 is reported
by Emmel, et al., Science (1989) 246, 1617 and Flanagan, et al.,
Nature (1991) 352, 803. Durand, et al., Mol. Cell. Biol. (1988) 8,
1715 and Mattila, et al., EMBO J. (1990) 9,4425 describe the NF-AT
binding sites. References describing the .zeta. chain include
Orloff, et al., Nature (1990) 347, 189-191; Kinet, et al., Cell
(1989) 57, 351-354; Weissman, et al., Proc. Natl. Acad. Sci. USA
(1988) 85, 9709-9713 and Lanier, Nature (1989) 342, 803-805. A CD4
immunoadhesin is described by Byrn, et al. Nature (1990) 344,
667-670. A CD8-.zeta.-fused protein is described by Irving, et al.,
Cell (1992) 64, 891. See also, Letourner and Klausner, Science
(1992) 255, 79.
[0004] Illustrative articles describing transcriptional factor
association with promoter regions and the separate activation and
DNA binding of transcription factors include: Keegan et al., Nature
(1986) 231, 699; Fields and Song, ibid (1989) 340, 245; Jones, Cell
(1990) 61, 9; Lewin, Cell (1990) 61, 1161; Ptashne and Gann, Nature
(1990) 346, 329; Adams and Workman, Cell (1993) 72, 306.
[0005] Illustrative articles describing vesicle targeting and
fusion include: Sollner et al. (1993) Nature 362, 318-324; and
Bennett and Scheller (1993) Proc. Natl. Acad. Sci. USA 90,
2559-2563.
[0006] Illustrative articles describing regulated protein
degradation include: Hochstrasser et al (1990) Cell 61, 697;
Scheffner, M. et al (1993) Cell 75, 495; Rogers et al (1986)
Science 234, 364-368.
[0007] Illustrative publications providing additional information
concerning synthetic techniques and modifications relevant to FK506
and related compounds include: GB 2 244 991 A; EP 0 455 427 A1; WO
91/17754; EP 0 465 426 A1, U.S. Pat. No. 5,023,263 and WO
92/00278.
[0008] However, as will be clear from this disclosure, none of the
foregoing authors describe or suggest the present invention. Our
invention, which is disclosed in detail hereinafter, involves a
generally applicable method and materials for utilizing protein
homodimerization, heterodimerization and oligomerization in living
cells. Chimeric responder proteins are intracellularly expressed as
fusion proteins with a specific receptor domain. Treatment of the
cells with a cell permeable multivalent ligand reagent which binds
to the receptor domain leads to dimerization or oligomerization of
the chimera. In analogy to other chimeric receptors (see e.g.
Weiss, Cell (1993) 73,209), the chimeric proteins are designed such
that oligomerization triggers the desired subsequent events, e.g.
the propagation of an intracellular signal via subsequent
protein-protein interactions and thereby the activation of a
specific subset of transcription factors. The initiation of
transcription can be detected using a reporter gene assay.
Intracellular crosslinking of chimeric proteins by synthetic
ligands has potential in basic investigation of a variety of
cellular processes and in regulating the synthesis of proteins of
therapeutic or agricultural importance. Furthermore, ligand
mediated oligomerization now permits regulated gene therapy. In so
doing, it provides a fresh approach to increasing the safety,
expression level and overall efficacy obtained with gene
therapy.
SUMMARY OF THE INVENTION
[0009] This invention provides novel chimeric (or "fused") proteins
and small organic molecules capable of oligomerizing the chimeric
proteins. The chimeric proteins contain at least one ligand-binding
(or "receptor") domain fused to an additional ("action") domain, as
described in detail below. As will also be described, the chimeric
proteins may contain additional domains as well. These chimeric
proteins are recombinant in the sense that the various domains are
derived from different sources, and as such, are not found together
in nature (i.e., are heterologous).
[0010] Genes, i.e., RNA or preferably DNA molecules referred to
herein as "genetic" or "DNA" constructs) which encode the novel
chimeric proteins, and optionally target genes, are provided for
the genetic engineering of host cells. Also provided are methods
and compositions for producing and using such modified cells. The
engineered cells of this invention contain at least one such
chimeric protein or a first series of genetic constructs encoding
the chimeric protein(s). These constructs are recombinant in the
sense that the component portions, e.g. encoding a particular
domain or expression control sequence, are not found directly
linked to one another in nature (i.e., are heterologous).
[0011] One DNA construct of this invention encodes a chimeric
protein comprising (a) at least one receptor domain (capable of
binding to a selected ligand) fused to (b) a heterologous
additional ("action") protein domain. Significantly, the ligand is
capable of binding to two (or more) receptor domains, i.e. to
chimeric proteins containing such receptor domains, in either order
or simultaneously, preferably with a Kd value below about
10.sup.-6, more preferably below about 10.sup.-7, even more
preferably below about 10.sup.-8, and in some embodiments below
about 10.sup.-9 M. The ligand preferably is a non-protein and has a
molecular weight of less than about 5 kDa. The receptor domains of
the chimeric proteins so oligomerized may be the same or different.
The chimeric proteins are capable of initiating a biological
process upon exposure to the ligand, i.e., upon oligomerization
with each other. The encoded chimeric protein may further comprises
an intracellular targeting domain capable of directing the chimeric
protein to a desired cellular compartment. The targeting domain can
be a secretory leader sequence, a membrane spanning domain, a
membrane binding domain or a sequence directing the protein to
associate with vesicles or with the nucleus, for instance.
[0012] The action domains of the chimeric proteins may be selected
from a broad variety of protein domains capable of effecting a
desired biological result upon oligomerization of the chimeric
protein(s). For instance, the action domain may comprise a protein
domain such as a CD3 zeta subunit capable, upon exposure to the
ligand and subsequent oligomerization, of initiating a detectable
intracellular signal; a DNA-binding protein such as Gal 4; or a
transcriptional activation domain such as VP16. Numerous other
examples are provided herein. One example of a detectable
intracellular signal is a signal activating the transcription of a
gene under the transcriptional control of a transcriptional control
element (e.g. enhancer/promoter elements and the like) which is
responsive to the oligomerization.
[0013] As is discussed in greater detail later, in various
embodiments of this invention the chimeric protein is capable of
binding to an FK506-type ligand, a cyclosporin A-type ligand,
tetracycline or a steroid ligand. Such binding leads to
oligomerization of the chimeric protein with other chimeric protein
molecules which may be the same or different.
[0014] Optionally the cells further contain a second recombinant
genetic construct, or second series of such construct(s),
containing a target gene under the transcriptional control of a
transcriptional control element (e.g. promoter/enhancer) responsive
to a signal triggered by ligand-mediated oligomerization of the
chimeric proteins, i.e. to exposure to the ligand. These constructs
are recombinant in the sense that the target gene is not naturally
under the transcriptional control of the responsive transcriptional
control element.
[0015] In one aspect of the invention the DNA construct contains
(a) a transcriptional control element responsive to the
oligomerization of a chimeric protein as described above, and (b)
flanking DNA sequence from a target gene permitting the homologous
recombination of the transcriptional control element into a host
cell in association with the target gene. In other embodiments the
construct contains a desired gene and flanking DNA sequence from a
target locus permitting the homologous recombination of the target
gene into the desired locus. The construct may also contain the
responsive transcriptional control element, or the responsive
element may be provided by the locus. The target gene may encodes a
surface membrane protein, a secreted protein, a cytoplasmic protein
or a ribozyme or an antisense sequence.
[0016] The constructs of this invention may also contain a
selectable marker permitting transfection of the constructs into
host cells and selection of transfectants containing the construct.
This invention further encompasses DNA vectors containing such
constructs, whether for episomal transfection or for integration
into the host cell chromosomes. The vetor may be a viral vector,
including for example an adeno-, adeno associated- or retroviral
vector.
[0017] This invention further encompasses a chimeric protein
encoded by any of our DNA constructs, as well as cells containing
and/or expressing them, including procaryotic and eucaryotic cells
and in particular, yeast, worm, insect, mouse or other rodent, and
other mammalian cells, including human cells, of various types and
lineages, whether frozen or in active growth, whether in culture or
in a whole organism containing them.
[0018] For example, in one aspect, this invention provides cells,
preferably but not necessarly mammalian, which contain a first DNA
construct encoding a chimeric protein comprising (i) at least one
receptor domain capable of binding to a selected oligomerizing
ligand of this invention and (ii) another protein domain,
heterologous with respect to the receptor domain, but capable, upon
oligomerization with one or more other like domains, of triggering
the activation of transcription of a target gene under the
transcriptional control of a transcriptional control element
responsive to said oligomerization. The cells further contain a
target gene under the expresssion control of a transcriptional
control element responsive to said oligomerization ligand.
Following exposure to the selected ligand expresses the target
gene.
[0019] In another aspect, the invention provides cells which
contain a first set of DNA constructs encoding a first chimeric
protein containing a DNA-binding domain and at least one receptor
domain capable of binding to a first selected ligand moiety. The
cell further a second chimeric protein containing a transcriptional
activating domain and at least one receptor domain capable of
binding to a second selected ligand (which may be the same or
different from the first selected ligand moiety). The cell
additional contains a DNA construct encoding a target gene under
the transcriptional control of a heterologous transcriptional
control sequence which binds with the DNA-binding domain and is
responsive to the transcriptional activating domain such that the
cell expresses the target gene following exposure to a substance
containing the selected ligand moiety(ies).
[0020] Also provided are A DNA composition comprising a first DNA
construct encoding a chimeric protein comprising at least one
receptor domain, capable of binding to a selected ligand, fused to
a heterologous additional protein domain capable of initiating a
biological process upon exposure to the oligomerizing ligand, i.e.
upon oligomerization of the chimeric protein; and a second DNA
construct encoding a target gene under the transcriptional control
of a transcription control element responsive to the
oligomerization ligand.
[0021] Another exemplary DNA composition of this invention
comprises a first series of DNA constructs encoding a first and
second chimeric protein and a second DNA construct encoding a
target gene under the transcriptional control of an transcription
control element responsive to the oligomerization of the chimeric
protein molecules. The DNA construct encoding the first chimeric
protein comprises (a) at least one first receptor domain, capable
of binding to a selected first ligand moiety, fused to (b) a
heterologous additional protein domain capable of initiating a
biological process upon [exposure to the oligomerization ligand,
i.e. upon oligomerization of the first chimeric protein to a second
chimeric protein molecule. The DNA construct encoding the second
chimeric protein comprises (i) at least one receptor domain,
capable of binding to a selected second ligand moiety, fused to
(ii) a heterologous additional protein domain capable of initiating
a biological process upon exposure to the oligomerization ligand,
i.e., upon oligomerization to the first chimeric protein. The first
and second receptor moieties in such cases may be the same or
different and the first and second selected ligand moieties may
likewise be the same or different.
[0022] Our ligands are molecules capable of binding to two or more
chimeric protein molecules of this invention to form an oligomer
thereof, and have the formula: linker-{rbm.sub.1, rbm.sub.2, . . .
rbm.sub.n} wherein n is an integer from 2 to about 5,
rbm.sub.(1)-rbm.sub.(n) are receptor binding moieties which may be
the same or different and which are capable of binding to the
chimeric protein(s). The rbm moieties are covalently attached to a
linker moiety which is a bi- or multi-functional molecule capable
of being covalently linked ("-") to two or more rbm moieties.
Preferably the ligand has a molecular weight of less than about 5
kDa and is not a protein. Examples of such ligands include those in
which the rbm moieties are the same or different and comprise an
FK506-type moiety, a cyclosporin-type moiety, a steroid or
tetracycline. Cyclosporin-type moieties include cyclosporin and
derivatives thereof which are capable of binding to a cyclophilin,
naturally occurring or modified, preferably with a Kd value below
about 10.sup.-6 M. In some embodiments it is preferred that the
ligand bind to a naturally occurring receptor with a Kd value
greater than about 10.sup.-6M and more preferably greater than
about 10.sup.-5 M. Illustrative ligands of this invention are those
in which at least one rbm comprises a molecule of FK506, FK520,
rapamycin or a derivative thereof modified at C9, C10 or both,
which ligands bind to a modified receptor or chimeric molecule
containing a modified receptor domain with a Kd value at least one,
and preferably 2, and more preferably 3 and even more preferably 4
or 5 or more orders of magnitude less than their Kd values with
respect to a naturally occurring receptor protein. Linker moiteies
are also described in detail later, but for the sake of
illustration, include such moieties as a C2-C20 alkylene, C4-C18
azalkylene, C6-C24 N-alkylene azalkylene, C6-C18 arylene, C8-C24
ardialkylene or C8-C36 bis-carboxamido alkylene moiety.
[0023] The monomeric rbm's of this invention, as well as compounds
containing sole copies of an rbm, which are capable of binding to
our chimeric proteins but not effecting dimerization or higher
order oligomerization thereof (in view of the monomeric nature of
the individual rbm) are oligomerization antagonists.
[0024] In one embodiment, genetically engineered cells of this
invention can be used for regulated production of a desired
protein. In that embodiment the cells, engineered in accordance
with this invention to express a desired gene under ligand-induced
regulation, are grown in culture by conventional means. Addition of
the ligand to the culture medium leads to expression of the desired
gene and production of the desired protein. Expression of the gene
and production of the protein can then be turned off by adding to
the medium an oligomerization antagonist reagent, as is described
in detail below. Alternatively, this invention can be used to
engineer ligand-inducable cell death characteristics into cells.
Such engineered cells can then be eliminated from a cell culture
after they have served their intended purposed (e.g. production of
a desired protein or other product) by adding the ligand to the
medium. Engineered cells of this invention can also be used in
vivo, to modify whole organisms, preferably animals, including
humans, e.g. such that the cells produce a desired protein or other
result within the animal containing such cells. Such uses include
gene therapy. Alternatively, the chimeric proteins and
oligomerizing molecules can be used extracellularly to bring
together proteins which act in concert to initiate a physiological
action.
[0025] This invention thus provides materials and methods for
achieving a biological effect in cells in response to the addition
of an oligomerizing ligand. The method involves providing cells
engineered in accordance with this invention and exposing the cells
to the ligand.
[0026] For example, one embodiment of the invention is a method for
activating transcription of a target gene in cells. The method
involves providing cells containing and capable of expressing (a)
at least one DNA construct encoding a chimeric protein of this
invention and (b) a target gene. The chimeric protein comprises at
least one receptor domain capable of binding to a selected
oligomerization ligand. The receptor domain is fused to an action
domain capable--upon exposure to the oligomerizing ligand, i.e.,
upon oligomerization with one or more other chimeric proteins
containing another copy of the action domain--of initiating an
intracellular signal. That signal is capable of activating
transcription of a gene, such as the target gene in this case,
which is under the transcriptional control of a transcriptional
control element responsive to that signal. The method thus involves
exposing the cells to an oligomerization ligand capable of binding
to the chimeric protein in an amount effective to result in
expression of the target gene. In cases in which the cells are
growing in culture, exposing them to the ligand is effected by
adding the ligand to the culture medium. In cases in which the
cells are present within a host organism, exposing them to the
ligand is effected by administering the ligand to the host
organism. For instance, in cases in which the host organism is an
animal, in particular, a mammal (including a human), the ligand is
administered to the host animal by oral, bucal, sublingual,
transdermal, subcutaneous, intramuscular, intravenous, intra-joint
or inhalation administration in an appropriate vehicle
therefor.
[0027] This invention further encompasses a pharmaceutical
composition comprising an oligomerization ligand of this invention
in admixture with a pharmaceutically acceptable carrier and
optionally with one or more pharmaceutically acceptable excipients
for activating the transcription of a target gene, for example, or
effecting another biological result of this invention, in a subject
containing engineered cells of this invention. The oligomerization
ligand can be a homo-oligomerization reagent or a
hetero-oligomerization reagent as described in detail elsewhere.
Likwise, this invention further encompasses a pharmaceutical
composition comprising an oligomerization antagonist of this
invention admixture with a pharmaceutically acceptable carrier and
optionally with one or more pharmaceutically acceptable excipients
for reducing, in whole or part, the level of oligomerization of
chimeric proteins in engineered cells of this invention in a
subject, and thus for de-activating the transcription of a target
gene, for example, or turning off another biological result of this
invention. Thus, the use of the oligomerization reagents and of the
oligomerization antagonist reagents to prepare pharmaceutical
compositions is encompassed by this invention.
[0028] This invention also offers a method for providing a host
organism, preferably an animal, and in many cases a mammal,
responsive to an oligomerization ligand of this invention. The
method involves introducing into the organism cells which have been
engineered in accordance with this invention, i.e. containing a DNA
construct encoding a chimeric protein hereof, and so forth.
Alternatively, one can introduce the DNA constructs of this
invention into a host organism, e.g. mammal under conditions
permitting transfection of one or more cells of the host
mammal.
[0029] We further provide kits for producing cells responsive to a
ligand of this invention. One kit contains at least one DNA
construct encoding one of our chimeric proteins containing at least
one receptor domain and an action domain (as they are described
elsewhere). The kit may contain a quantity of a ligand of this
invention capable of oligomerizing the chimeric protein molecules
encoded by the DNA constructs of the kit, and may contain in
addition a quantity of an oligomerization antagonist, e.g.
monomeric ligand reagent. Where a sole chimeric protein is encoded
by the construct(s), the oligomerization ligand is a
homo-oligomerization ligand. Where more than one such chimeric
protein is encoded, a hetero-oligomerization ligand may be
included. The kit may further contain a "second series" DNA
construct encoding a target gene and/or transcription control
element responsive to oligomerization of the chimeric protein
molecules. The DNA constructs will preferably be associated with
one or more selection markers for convenient selection of
transfectants, as well as other conventional vector elements useful
for replication in prokaryotes, for expression in eukaryotes, and
the like. The selection markers may be the same or different for
each different DNA construct, permitting the selection of cells
which contain each such DNA construct(s).
[0030] For example, one kit of this invention contains a first DNA
construct encoding a chimeric protein containing at least one
receptor domain (capable of binding to a selected ligand), fused to
a transcriptional activator domain; a second DNA construct encoding
a second chimeric protein containing at least one receptor domain
(capable of binding to a selected ligand), fused to a DNA binding
domain; and a third DNA construct encoding a target gene under the
control of a transcriptional control element containing a DNA
sequence to which the DNA binding domain binds and which is
transcriptionally activated by exposure to the ligand in the
presence of the first and second chimeric proteins.
[0031] Alternatively, a DNA construct for introducing a target gene
under the control of a responsive transcriptional control element
may contain a cloning site in place of a target gene to provide a
kit for engineering cells to inducably express a gene to be
provided by the practitioner.
[0032] Other kits of this invention may contain one or two (or
more) DNA constructs for chimeric proteins in which one or more
contain a cloning site in place of an action domain
(transcriptional initiation signal generator, transcriptional
activator, DNA binding protein, etc.), permitting the user to
insert whichever action domain s/he wishes. Such a kit may
optionally include other elements as described above, e.g. DNA
construct for a target gene under responsive expression control,
oligomerization ligand, antagonist, etc.
[0033] Any of the kits may also contain positive control cells
which were stably transformed with constructs of this invention
such that they express a reporter gene (for CAT, beta-galactosidase
or any conveniently detectable gene product) in response to
exposure of the cells to the ligand. Reagents for detecting and/or
quantifying the expression of the reporter gene may also be
provided.
BRIEF DESCRIPTION OF THE FIGURES
[0034] FIG. 1 is a diagram of the plasmid pSXNeo/IL2 (IL2-SX). In
NF-AT-SX, the HindIII-ClaI DNA fragment from IL2-SX containing the
IL2 enhancer/promoter, is replaced by a minimal IL-2 promoter
conferring basal transcription and an inducible element containing
three tandem NFAT-binding sites (described below).
[0035] FIG. 2 is a flow diagram of the preparation of the
intracellular signaling chimera plasmids p#MXFn and p#MFnZ, where n
indicates the number of binding domains.
[0036] FIGS. 3A and 3B are a flow diagram of the preparation of the
extracellular signalling chimera plasmid p#1FK3/pBJ5.
[0037] FIGS. 4A, 4B and 4C are sequences of the primers used in the
constructions of the plasmids employed in the subject
invention.
[0038] FIG. 5 is a chart of the response of reporter constructs
having different enhancer groups to reaction of the receptor
TAC/CD3 .zeta. with a ligand.
[0039] FIG. 6 is a chart of the activity of various ligands with
the TAg Jurkat cells described in Example 1.
[0040] FIG. 7 is a chart of the activity of the ligand FK1012A (8,
FIG. 9B) with the extracellular receptor 1FK3 (FKBPx3/CD3
.zeta.).
[0041] FIG. 8 is a chart of the activation of an NFAT reporter via
signalling through a myristoylated CD3 .zeta./FKBP12 chimera.
[0042] FIGS. 9A and 9B are the chemical structures of the
allyl-linked FK506 variants and the cyclohexyl-linked FK506
variants, respectively.
[0043] FIG. 10 is a flow diagram of the synthesis of derivatives of
FK520.
[0044] FIGS. 11 A and B are a flow diagram of a synthesis of
derivatives of FK520 and chemical structures of FK520, where the
bottom structures are designed to bind to mutant FKBP12.
[0045] FIG. 12 is a diagrammatic depiction of mutant FKBP with a
modified FK520 in the putative cleft.
[0046] FIG. 13 is a flow diagram of the synthesis of heterodimers
of FK520 and cyclosporin.
[0047] FIG. 14 is a schematic representation of the oligomerization
of chimeric proteins, illustrated by chimeric proteins containing
an immunophilin moiety as the receptor domain.
[0048] FIG. 15 depicts ligand-mediated oligomerization of chimeric
proteins, schowing schematically the triggering of a
transcriptional initiation signal.
[0049] FIG. 16 depicts synthetic schemes for HED and HOD reagents
based on FK-506-type moieties.
[0050] FIG. 17 depicts the synthesis of (CsA)2 beginning with
CsA.
[0051] FIG. 18 is an overview of the fusion cDNA construct and
protien MZF3E.
[0052] FIG. 19 depicts co-immunoprecipitation of MZF1E.sub.h with
MZF1E.sub.f in the presence of FK1012 (E.sub.h: Flu-epitop-tag,
E.sub.f: Flag-epitop-tag).
[0053] FIG. 20 shows FK1012-induced cell death of the Jurkat T-cell
line transfected with a myristoylated Fas-FKBP12 fusion protein
(MFF3E), as indicated by the decreased transcriptional activity of
the cells.
[0054] FIG. 21A is an analysis of cyclophilin-Fas (and
Fas-cyclophilin) fusion constructs in the transient transfection
assay. MC3FE was shown to be the most effective in this series.
[0055] FIG. 21B depicts Immunphilin-Fas antigen chimeras and
results of transient expression experiments in Jurkat T cells
stably transformed with large T-antigen. Myr: the myristylation
sequence taken from pp60.sup.c-src encoding residues 1-14 (Wilson
et al, Mol & Cell Biol 9 4 (1989): 1536-44); FKBP: human
FKBP12; CypC: murine cyclophilin C sequence encoding residues
36-212 (Freidman et al, Cell 66 4 (1991): 799-806); Fas:
intracellular domain of human Fas antigen encoding residues 179-319
(Oehm et al, J Biol Chem 267 15 (1992): 10709-15). Cells were
electroporated with a plasmid encoding a secreted alkaline
phosphatase reporter gene under the control of 3 tandem AP1
promoters along with a six fold molar excess of the immunophilin
fusion construct. After 24 h the cells were stimulated with PMA (50
ng/mL), which stimulates the synthesis of the reporter gene, and
(CsA).sub.2. At 48 h the cells were assayed for reporter gene
activity. Western blots were performed at 24 h using anti-HA
epitope antibodies.
[0056] FIG. 22 depicts CAT assay results from Example 8.
[0057] FIG. 23 depicts the synthesis of modified FK-506 type
compounds.
DESCRIPTION
I. Generic Discussion
[0058] This invention provides chimeric proteins, organic molecules
for oligomerizing the chimeric proteins and a system for using
them. The fused proteins have a binding domain for binding to the
(preferably small) organic oligomerizing molecules and an action
domain, which can effectuate a physiological action or cellular
process as a result of oligomerization of the chimeric
proteins.
[0059] The basic concept for inducible protein association is
illustrated in FIG. 14. Ligands which can function as
heterodimerization (or hetero-oligomerization, "HED") and
homodimerization (or homo-oligomerization, "HOD") agents are
depicted as dumbell-shaped structures.
[0060] (Homodimerization and homo-oligomerization refer to the
association of like components to form dimers or oligomers, linked
as they are by the ligands of this invention. Heterodimerization
and hetero-oligomerization refer to the association of dissimilar
components to form dimers or oligomers. Homo-oligomers thus
comprise an association of multiple copies of a particular
component while hetero-oligomers comprise an association of copies
of different components. "Oligomerization", "oligomerize" and
"oligomer", as the terms are used herein, with or without prefixes,
are intended to encompass "dimerization", "dimerize" and "dimer",
absent an explicit indication to the contrary.)
[0061] Also depicted in FIG. 14 are fusion protein molecules
containing a target protein domain of interest ("action domain")
and one or more receptor domains that can bind to the ligands. For
intracellular chimeric proteins, i.e., proteins which are located
within the cells in which they are produced, a cellular targeting
sequence (including organelle targeting amino acid sequences) will
preferably also be present. Binding of the ligand to the receptor
domains hetero- or homodimerizes the fusion proteins.
Oligomerization brings the action domains into close proximity with
one another thus triggering cellular processes normally associated
with the respective action domain--such as TCR-mediated signal
transduction, for example.
[0062] Cellular processes which can be triggered by oligomerization
include a change in state, such as a physical state, e.g.
conformational change, change in binding partner, cell death,
initiation of transcription, channel opening, ion release, e.g.
Ca.sup.+2 etc. or a chemical state, such as a chemical reaction,
e.g. acylation, methylation, hydrolysis, phosphorylation or
dephosphorylation, change in redox state, rearrangement, or the
like. Thus, any such process which can be triggered by
ligand-mediated oligomerization is included within the scope of
this invention.
[0063] As a first application of the subject invention, cells are
modified so as to be responsive to the oligomerizing molecules. The
modified cells can be used in gene therapy, as well as in other
applications where inducible transcription or translation (both are
included under the term expression) is desired. The cells are
characterized by a genome containing at least a first or first
series (the series may include only one construct) of genetic
constructs, and desirably a second or second series (the series may
include only one construct) of constructs.
[0064] The nature and number of such genetic constructs will depend
on the nature of the chimeric protein and the role it plays in the
cell. For instance, in embodiments where the chimeric protein is to
be associated with expression of a gene (and which may contain an
intracellular targeting sequence or domain which directs the
chimeric protein to be associated with the cellular surface
membrane or with an organelle e.g. nucleus or vesicle), then there
will normally be at least two series of constructs: a first series
encoding the chimeric protein(s) which upon ligand-mediated
oligomerization initiate a signal directing target gene expression,
and desirably a second series which comprise the target gene and/or
expression control elements therefor which are responsive to the
signal.
[0065] Only a single construct in the first series will be required
where a homooligomer, usually a homodimer, is involved, while two
or more, usually not more than three constructs may be involved,
where a heterooligomer is involved. The chimeric proteins encoded
by the first series of constructs will be associated with actuation
of gene transcription and will normally be directed to the surface
membrane or the nucleus, where the oligomerized chimeric protein is
able to initiate, directly or indirectly, the transcription of one
or more target genes. A second series of additional constructs will
be required where an exogenous gene(s) is introduced, or where an
exogenous or recombinant expression control sequence is introduced
(e.g. by homologous recombination) for expression of an endogenous
gene, in either case, whose transcription will be activated by the
oligomerizing of the chimeric protein.
[0066] A different first series of constructs are employed where
the chimeric proteins are intracellular and can act directly
without initiation of transcription of another gene. For example,
proteins associated with exocytosis can be expressed inducibly or
constitutively, where the proteins will not normally complex except
in the presence of the oligomerizing molecule. By employing
proteins which have any or all of these properties which do not
complex in the host cell; are inhibited by complexation with other
proteins, which inhibition may be overcome by oligomerization with
the ligand; require activation through a process which is not
available in the host cell; or by modifying the proteins which
direct fusion of a vesicle with the plasma membrane to form
chimeric proteins, where the extent of complex formation and
membrane fusion is enhanced in the presence of the oligomerizing
molecule, exocytosis is or has the ability to be induced by the
oligomerizing molecule.
[0067] Other intracellular proteins, such as kinases, phosphatases
and cell cycle control proteins can be similarly modified and
used.
[0068] Various classes of genetic constructs of this invention are
described as follows:
[0069] (1) constructs which encode a chimeric protein comprising a
binding domain and an action domain, where the binding domain is
extracellular or intracellular and the action domain is
intracellular such that ligand-mediated oligomerization of the
chimeric protein, by itself (to form a homo-oligomer) or with a
different fused protein comprising a different action domain (to
form a hetero-oligomer), induces a signal which results in a series
of events resulting in transcriptional activation of one or more
genes;
[0070] (2) constructs which encode a chimeric protein having a
binding domain and an action domain, where the binding domain and
action domain are in the nucleus, such that ligand-mediated
oligomerization of the protein, by itself (to form a homo-oligomer)
or with a different fused protein comprising a different action
domain (to form a hetero-oligomer), induces initiation of
transcription directly via complexation of the oligomer(s) with the
DNA transcriptional initiation region;
[0071] (3) constructs which encode a chimeric protein containing a
binding domain and an action domain, where the binding domain and
the action domain are cytoplasmic, such that ligand-mediated
oligomerization of the protein, by itself (to form a homo-oligomer)
or with a different fused protein comprising a different action
domain (to form a hetero-oligomer), results in exocytosis; and
[0072] (4) constructs which encode a chimeric protein containing a
binding domain and an action domain, where the binding domain and
action domain are extracellular and the action domain is associated
with initiating a biological activity (by way of non-limiting
illustration, the action domain can itself bind to a substance,
receptor or other membrane protein yielding, upon ligand-mediated
oligomerization of the chimeras, the bridging of one or more
similar or dissimilar molecules or cells); and,
[0073] (5) constructs which encode a destabilizing, inactivating or
short-lived chimeric protein having a binding domain and an action
domain, such that ligand-mediated oligomerization of the protein
with a target protein comprising a different action domain leads to
the destabilization and/or degradation or inactivation of said
oligomerized target protein.
II. Transcription Regulation
[0074] The construct(s) of Groups (1) and (2), above, will be
considered first. Group (1) constructs differ from group (2)
constructs in their effect. Group (1) constructs are somewhat
pleiotropic, i.e. capable of activating a number of wild-type
genes, as well as the target gene(s). In addition, the response of
the expression products of group (1) genes to the ligand is
relatively slow. Group (2) constructs can be directed to a specific
target gene and are capable of limiting the number of genes which
will be transcribed. The response of expression products of group
(2) constructs to the ligand is very rapid.
[0075] The subject system for groups (1) and (2) will include a
first series of constructs which comprise DNA sequences encoding
the chimeric proteins, usually involving from one to three, usually
one to two, different constructs. The system usually will also
include a second series of constructs which will provide for
expression of one or more genes, usually an exogenous gene. By
"exogenous gene" is meant a gene which is not otherwise normally
expressed by the cell, e.g. because of the nature of the cell,
because of a genetic defect of the cell, because the gene is from a
different species or is a mutated or synthetic gene, or the like.
Such gene can encode a protein, antisense molecule, ribozyme etc.,
or can be a DNA sequence comprising an expression control sequence
linked or to be linked to an endogenous gene with which the
expression control sequence is not normally associated. Thus, as
mentioned before, the construct can contain an exogenous or
recombinant expression control sequence for ligand-induced
expression of an endogenous gene.
[0076] The chimeric protein encoded by a construct of groups (1),
(2) and (3) can have, as is often preferred, an intracellular
targeting domain comprising a sequence which directs the chimeric
protein to the desired compartment, e.g. surface membrane, nucleus,
vesicular membrane, or other site, where a desired physiological
activity can be initiated by the ligand-mediated oligomerization,
at least dimerization, of the chimeric protein.
[0077] The chimeric protein contains a second ("binding" or
"receptor") domain which is capable of binding to at least one
ligand molecule. Since the ligand can contain more than one binding
site or epitope, it can form dimers or higher order homo- or
hetero-oligomers with the chimeric proteins of this invention. The
binding domain of the chimeric protein can have one or a plurality
of binding sites, so that homooligomers can be formed with a
divalent ligand. In this way the ligand can oligomerize the
chimeric protein by having two or more epitopes to which the second
domain can bind, thus providing for higher order oligomerization of
the chimeric protein.
[0078] The chimeric protein also contains a third ("action") domain
capable of initiating a biological activity upon ligand-mediated
oligomerization of chimeric protein molecules via the binding
domains. Thus, the action domain may be associated with
transduction of a signal as a result of the ligand-mediated
oligomerization. Such signal, for instance, could result in the
initiation of transcription of one or more genes, depending on the
particular intermediate components involved in the signal
transduction. See FIG. 15 which depicts an illustrative chimeric
protein in which the intracellular targeting/domain comprises a
myristate moiety; the receptor domain comprises three FKBP12
moieties; and the action domain comprises a zeta subunit In other
chimeric proteins the action domains may comprise transcription
factors, which upon oligomerization, result in the initiation of
transcription of one or more target genes, endogenous and/or
exogenous. The action domains can comprise proteins or portions
thereof which are associated with fusion of vesicle membranes with
the surface or other membrane, e.g. proteins of the SNAP and SNARE
groups (See, Sollner et al. (1993) 362, 318 and 353; Cell (1993)
72, 43).
A. Surface Membrane Receptor
[0079] Chimeric proteins of one aspect of this invention are
involved with the surface membrane and are capable of transducing a
signal leading to the transcription of one or more genes. The
process involves a number of auxiliary proteins in a series of
interactions culminating in the binding of transcription factors to
promoter regions associated with the target gene(s). In cases in
which the transcription factors bind to promoter regions associated
with other genes, transcription is initiated there as well. A
construct encoding a chimeric protein of this embodiment can encode
a signal sequence which can be subject to processing and therefore
may not be present in the mature chimeric protein. The chimeric
protein will in any event comprise (a) a binding domain capable of
binding a pre-determined ligand, (b) an optional (although in many
embodiments, preferred) membrane binding domain which includes a
transmembrane domain or an attached lipid for translocating the
fused protein to the cell surface/membrane and retaining the
protein bound to the cell surface membrane, and, (c) as the action
domain, a cytoplasmic signal initiation domain. The cytoplasmic
signal initiation domain is capable of initiating a signal which
results in transcription of a gene having a recognition sequence
for the initiated signal in the transcriptional initiation
region.
[0080] The gene whose expression is regulated by the signal from
the chimeric protein is referred to herein as the "target" gene,
whether it is an exogenous gene or an endogenous gene under the
expression control of an endogenous or exogenous (or hybrid)
expression control sequence. The molecular portion of the chimeric
protein which provides for binding to a membrane is also referred
to as the "retention domain". Suitable retention domains include a
moiety which binds directly to the lipid layer of the membrane,
such as through lipid participation in the membrane or extending
through the membrane, or the like. In such cases the protein
becomes translocated to and bound to the membrane, particularly the
cellular membrane, as depicted in FIG. 15.
B. Nuclear Transcription Factors
[0081] Another first construct encodes a chimeric protein
containing a cellular targeting sequence which provides for the
protein to be translocated to the nucleus. This ("signal
consensus") sequence has a plurality of basic amino acids, referred
to as a bipartite basic repeat (reviewed in Garcia-Bustos et al,
Biochimica et Biophysica Acta (1991) 1071, 83-101). This sequence
can appear in any portion of the molecule internal or proximal to
the N- or C-terminus and results in the chimeric protein being
inside the nucleus. The practice of one embodiment of this
invention will involve at least two ("first series") chimeric
proteins: (1) one having an action domain which binds to the DNA of
the transcription initiation region associated with a target gene
and (2) a different chimeric protein containing as an action
domain, a transcriptional activation domain capable, in association
with the DNA binding domain of the first chimeric protein, of
initiating transcription of a target gene. The two action domains
or transcription factors can be derived from the same or different
protein molecules.
[0082] The transcription factors can be endogenous or exogenous to
the cellular host. If the transcription factors are exogenous, but
functional within the host and can cooperate with the endogenous
RNA polymerase (rather than requiring an exogenous RNA polymerase,
for which a gene could be introduced), then an exogenous promoter
element functional with the fused transcription factors can be
provided with a second construct for regulating transcription of
the target gene. By this means the initiation of transcription can
be restricted to the gene(s) associated with the exogenous promoter
region, i.e., the target gene(s).
[0083] A large number of transcription factors are known which
require two subunits for activity. Alternatively, in cases where a
single transcription factor can be divided into two separate
functional domains (e.g. a transcriptional activator domain and a
DNA-binding domain), so that each domain is inactive by itself, but
when brought together in dose proximity, transcriptional activity
is restored. Transcription factors which can be used include yeast
GAL4, which can be divided into two domains as described by Fields
and Song, supra. The authors use a fusion of GAL4 (1-147)-SNF1 and
SNF4-GAL4(768-881), where the SNF1 and -4 may be replaced by the
subject binding proteins as binding domains. Combinations of GAL4
and VP16 or HNF-1 can be employed. Other transcription factors are
members of the Jun, Fos, and AT-F/CREB families, Oct1, Sp1, HNF-3,
the steriod receptor superfamily, and the like.
[0084] As an alternative to using the combination of a DNA binding
domain and a naturally occurring activation domain or modified form
thereof, the activation domain may be replaced by one of the
binding proteins associated with bridging between a transcriptional
activation domain and an RNA polymerase, including but not limited
to RNA polymerase II. These proteins include the proteins referred
to as TAF's, the TFII proteins, particularly B and D, or the like.
Thus, one can use any one or combination of proteins, for example,
fused proteins or binding motifs thereof, which serve in the bridge
between the DNA binding protein and RNA polymerase and provide for
initiation of transcription. Preferably, the protein closest to the
RNA polymerase will be employed in conjunction with the DNA binding
domain to provide for initiation of transcription. If desired, the
subject constructs can provide for three or more, usually not more
than about 4, proteins to be brought together to provide the
transcription initiation complex.
[0085] Rather than have a transcriptional activation domain as an
action domain, an inactivation domain, such as ssn-6/TUP-1 or
Kruppel-family suppressor domain, can be employed. In this manner,
regulation results in turning off the transcription of a gene which
is constitutively expressed. For example, in the case of gene
therapy one can provide for constitutive expression of a hormone,
such as growth hormone, blood proteins, immunoglobulins, etc. By
employing constructs encoding one chimeric protein containing a DNA
binding domain joined to a ligand binding domain and another
chimeric protein containing an inactivation domain joined to a
ligand binding domain, the expression of the gene can be inhibited
via ligand-mediated oligomerization.
[0086] Constructs encoding a chimeric protein containing inter alia
a ligand-binding domain fused to a transcriptional activating
domain or subunit, transcriptional inactivating domain or
DNA-binding domain are designed and assembled in the same manner as
described for the other constructs. Frequently, the N-terminus of
the transcription factor will be bound to the C-terminus of the
ligand-binding domain, although in some cases the reverse will be
true, for example, where two individual domains of a single
transcription factor are divided between two different
chimeras.
III. Exocytosis
[0087] Another use for the ligand-mediated oligomerization
mechanism is exocytosis, where export of a protein rather than
transcription is controlled by the ligand. This can be used in
conjunction with the expression of one or more proteins of
interest, as an alternative to providing for secretion of the
protein(s) of interest via a secretory signal sequence. This
embodiment involves two different first constructs. One construct
encodes a chimeric protein which directs the protein to the vesicle
to be integrated into the vesicular membrane as described by
Sollner et al., supra. Proteins which may be used as the vesicle
binding protein include VAMP (synaptobrevin), SNC2, rab3, SEC4,
synaptotagmin, etc., individually or in combination. The cellular
membrane protein may include syntaxin, SSO1, SSO2, neurexin, etc.,
individually or in combination. The other construct provides for
transport to the surface membrane and employs the myristoyl signal
sequence, other plasma membrane targeting sequence (e.g. for
prenylation) or transmembrane retention domain, as described above.
The encoded proteins are described in the above references and, all
or functional part, may serve as the action domains. These
constructs could be used in conjunction with the expression of an
exogenous protein, properly encoded for transport to a vesicle or
for an endocytotic endogenous protein, to enhance export of the
endogenous protein.
[0088] Various mechanisms can be employed for exocytosis. Depending
on the cell type and which protein is limiting for endocytosis in
the cell, one or more of the vesicle bound proteins or cellular
proteins may be encoded by one or more constructs having a response
element which is activated by the ligand. Of particular interest is
the combination of VAMP and syntaxin. Alternatively, one can
provide for constitutive expression of non-limiting proteins
controlling exocytosis and provide for ligand regulated expression
of the exocytosis limiting protein. Finally, one can provide for
constitutive expression of the chimeric proteins associated with
exocytosis, so that exocytosis is controlled by oligomerizing the
chimeric proteins with the ligand. By employing appropriate binding
domains, one can provide for different chimeric proteins to be
oligomerized on the vesicle surface to form an active complex,
and/or linking of the vesicle protein(s) with the cell membrane
surface protein through the ligand. The chimeric proteins may not
provide for exocytosis in the absence of the ligand due to
modifications in the ligand which substantially reduce the binding
affinity between the proteins governing exocytosis, such as
deletions, mutations, etc. These modifications can be readily
determined by employing overlapping fragments of the individual
proteins and determining which fragments retain activity. The
fragments can be further modified by using alanine substitutions to
determine the individual amino acids which substantially affect
binding. (Beohncke et al., J. Immunol. (1993) 150, 331-341; Evavold
et al., ibid (1992) 148, 347-353).
[0089] The proteins assembled in the lumen of the vesicle, as well
as the fused proteins associated with exocytosis can be expressed
constitutively or inducibly, as described above. Depending on the
purpose of the exocytosis, whether endogenous or exogenous proteins
are involved, whether the proteins to be exported are expressed
constitutively or inducibly, whether the same ligand can be used
for initiating transcription of the fused proteins associated with
exocytosis and the proteins to be exported, or whether the
different proteins are to be subject to different inducible
signals, may determine the manner in which expression is
controlled. In one aspect, the exocytosis mechanism would be the
only event controlled by the ligand. In other aspects, both
expression of at least one protein and exocytosis may be subject to
ligand control.
[0090] Various proteins may be modified by introduction of a
cellular targeting sequence for translocation of the protein to a
vesicle without loss of the physiological activity of the protein.
By using exocytosis as the delivery mechanism, relatively high
dosages may be delivered within a short period of time to produce a
high localized level of the protein or a high concentration in the
vascular system, depending on the nature of the host. Proteins of
interest include e.g. insulin, tissue plasminogen activator,
cytokines, erythropoietin, colony stimulating factors, growth
factors, inflammatory peptides, cell migration factors.
[0091] Coding sequences for directing proteins to a vesicle are
available from the vesicle binding proteins associated with
exocytosis. See, for example, Sollner, et al. supra.
[0092] Another use of the oligomerization mechanism is the control
of protein degradation or inactivation. For example, a relatively
stable or long-lived chimeric protein of this invention can be
destabilized or targeted for degradation by ligand-mediated
oligomerization with a different chimeric protein of this invention
which has a relatively short half-life or which otherwise
destabilizes or targets the oligomer for degradation. In this
embodiment, ligand-mediated oligomerization regulates biological
functioning of a protein by conferring upon it in trans a shortened
half-life. The latter chimeric protein may contain a domain
targeting the protein to the lysosome or a domain rendering the
protein susceptible to proteolytic cleavage in the cytosol or
nucleus or non-lysosomal organelle.
[0093] The half-life of proteins within cells is determined by a
number of factors which include the presence of short amino acid
sequences within said protein rich in the amino acid residues
proline, glutamic acid, serine and threonine, hence "PEST", other
sequences with similar function, protease sensitive cleavage sites
and the state of ubiquitinization. Ubiquitinization is the
modification of a protein by one or more units of the short
polypeptide chain, ubiquitin, which targets proteins for
degradation. The rate of ubiquitinization of proteins is considered
to be determined primarily by the identity of the N-terminal amino
acid of the processed protein and one or more unique lysine
residues near the amino terminus.
IV. Other Regulatory Systems
[0094] Other biological functions which can be controlled by
oligomerization of particular activities associated with individual
proteins are protein kinase or phosphatase activity, reductase
activity, cyclooxygenase activity, protease activity or any other
enzymatic reaction dependent on subunit association. Also, one may
provide for association of G proteins with a receptor protein
associated with the cell cycle, e.g. cyclins and cdc kinases,
multiunit detoxifying enzymes.
V. Components of Constructs
[0095] The second or additional constructs (target genes)
associated with group (1) and (2) chimeric proteins comprise a
transcriptional initiation region having the indicated target
recognition sequence or responsive element, so as to be responsive
to signal initiation from the activated receptor or activated
transcription factors resulting in at least one gene of interest
being transcribed to a sequence(s) of interest, usually mRNA, whose
transcription and, as appropriate, translation may result in the
expression of a protein and/or the regulation of other genes, e.g.
antisense, expression of transcriptional factors, expression of
membrane fusion proteins, etc.
[0096] For the different purposes and different sites, different
binding domains and different cytoplasmic domains will be used. For
chimeric protein receptors associated with the surface membrane, if
the ligand-binding domain is extracellular, the chimeric protein
can be designed to contain an extracellular domain selected from a
variety of surface membrane proteins. Similarly, different
cytoplasmic or intracellular domains of the surface membrane
proteins which are able to transduce a signal can be employed,
depending on which endogenous genes are regulated by the
cytoplasmic portion. Where the chimeric protein is internal,
internal to the surface membrane protein or associated with an
organelle, e.g. nucleus, vesicle, etc., the ligand-binding domain
protein will be restricted to domains which can bind molecules
which can cross the surface membrane or other membrane, as
appropriate. Therefore, these binding domains will generally bind
to small naturally occurring or synthetic ligand molecules which do
not involve proteins or nucleic acids.
A. Cytoplasmic Domains
[0097] A chimeric protein receptor of Group (1) can contain a
cytoplasmic domain from one of the various cell surface membrane
receptors, including muteins thereof, where the recognition
sequence involved in initiating transcription associated with the
cytoplasmic domain is known or a gene responsive to such sequence
is known. Mutant receptors of interest will dissociate
transcriptional activation of a target gene from activation of
genes which can be associated with harmful side effects, such as
deregulated cell growth or inappropriate release of cytokines. The
receptor-associated cytoplasmic domains of particular interest will
have the following characteristics: receptor activation leads to
initiation of transcription for relatively few (desirably fewer
than 100) and generally innocuous genes in the cellular host; the
other factors necessary for transcription initated by receptor
activation are present in the cellular host; genes which are
activated other than the target genes will not affect the intended
purpose for which these cells are to be used; oligomerization of
the cytoplasmic domain or other available mechanism results in
signal initiation; and joining of the cytoplasmic domain to a
desired ligand-binding domain will not interfere with signalling. A
number of different cytoplasmic domains are known. Many of these
domains are tyrosine kinases or are complexed with tyrosine
kinases, e.g. CD3 .zeta., IL-2R, IL-3R, etc. For a review see
Cantley, et al., Cell (1991) 64, 281. Tyrosine kinase receptors
which are activated by cross-linking, e.g. dimerization (based on
nomenclature first proposed by Yarden and Ulrich, Annu. Rev.
Biochem. (1988) 57, 443; include subclass I: EGF-R, ATR2/neu,
HER2/neu, HER3/c-erbB-3, Xmrk; subclass II: insulin-R, IGF-1-R
[insulin-like growth factor receptor], IRR; subclass III: PDGF-R-A,
PDGF-R-B, CSF-1-R (M-CSF/c-Fms), c-kit, STK-1/Flk-2; and subclass
IV: FGF-R, flg [acidic FGF], bek [basic FGF]); neurotrophic
tryosine kinases: Trk family, includes NGF-R, Ror1,2. Receptors
which associate with tyrosine kinases upon cross-linking include
the CD3 .zeta.-family: CD3 .zeta. and CD3 .eta. (found primarily in
T cells, associates with Fyn); .beta. and .gamma. chains of
Fc.sub..epsilon. RI (found primarily in mast cells and basophils);
.gamma. chain of Fc.sub..gamma. RIII/CD16 (found primarily in
macrophages, neutrophils and natural killer cells); CD3 .gamma.,
-.delta., and -.epsilon. (found primarily in T cells);
Ig-.alpha./MB-1 and Ig-.beta./B29 (found primarily in B cell). Many
cytokine and growth factor receptors associate with common .beta.
subunits which interact with tyrosine kinases and/or other
signalling molecules and which can be used as cytoplasmic domains
in chimeric proteins of this invention. These include (1) the
common .beta. subunit shared by the GM-CSF, IL-3 and IL-5
receptors; (2) the .beta. chain gp130 associated with the IL-6,
leukemia inhibitory factor (LIF), ciliary neurotrophic factor
(CNTF), oncostatin M, and IL-11 receptors; (3) the IL-2 receptor
.gamma. subunit associated also with receptors for IL-4, IL-7 and
IL-13 (and possibly IL-9); and (4) the .beta. chain of the IL-2
receptor which is homologous to the cytoplasmic domain of the G-CSF
receptor.
[0098] The interferon family of receptors which include interferons
.alpha./.beta. and .gamma. (which can activate one or more members
of the JAK, Tyk family of tyrosine kinases) as well as the
receptors for growth hormone, erythropoietin and prolactin (which
also can activate JAK2) can also be used as sources for cytoplasmic
domains.
[0099] Other sources of cytoplasmic domains include the TGF-.beta.
family of cell surface receptors (reviewed by Kingsley, D., Genes
and Development 1994 8 133). This family of receptors contains
serine/threonine kinase activity in their cytoplasmic domains,
which are believed to be actiated by crosslinking.
[0100] The tyrosine kinases associated with activation and
inactivation of transcription factors are of particular interest in
providing specific pathways which can be controlled and can be used
to initiate or inhibit expression of an exogenous gene.
[0101] The following table provides a number of receptors and
characteristics associated with the receptor and their nuclear
response elements that activate genes. The list is not exhaustive,
but provides exemplary systems for use in the subject
invention.
[0102] In many situations mutated cytoplasmic domains can be
obtained where the signal which is transduced may vary from the
wild type, resulting in a restricted or different pathway as
compared to the wild-type pathway(s). For example, in the case of
growth factors, such as EGF and FGF, mutations have been reported
where the signal is uncoupled from cell growth but is still
maintained with c-fos (Peters, et at., Nature (1992) 358, 678).
[0103] The tyrosine kinase receptors can be found on a wide variety
of cells throughout the body. In contrast, the CD3 .zeta.-family,
the Ig family and the lymphokine .beta.-chain receptor family are
found primarily on hematopoietic cells, particularly T-cells,
B-cells, mast cells, basophils, macrophages, neutrophils, and
natural killer cells. The signals required for NF-AT transcription
come primarily from the zeta (.zeta.) chain of the antigen receptor
and to a lesser extent CD3.gamma., .delta., .epsilon..
TABLE-US-00001 TABLE 1 DNA Binding Ligand Element Factor(s) Gene
Reference Insulin cAMP LRFI jun-B Mol. Cell Biol. (1992), and
others responsive many 12, 4654 element genes PNAS, 83, 3439 (cre)
PDGF, SRE SRF/SR c-fos Mol. Cell Biol. (1992), FGF, TGF EBP 12,
4769 and others EGF VL30 RVL-3 Mol. Cell. Biol. (1992), RSRF virus
12, 2793 c-jun Mol. Cell. Biol. (1992), 12, 4472 IFN-.alpha. ISRE
ISGF-3 Gene Dev. (1989) 3, 1362 IFN-.gamma. GAS GAF GBP Mol. Cell.
Biol. (1991) 11, 182 PMA and AP-1 many Cell (1987) 49, TCR genes
729-739 TNF NF.kappa.B many Cell (1990) 62, genes 1019-1029 Antigen
ARRE-1 OAP/O many Mol. Cell. Biol. (1988) ct-1 genes 8, 1715
Antigen ARRE-2 NFAT IL-2 Science (1988) 241, enhancer 202
[0104] The cytoplasmic domain, as it exists naturally or as it may
be truncated, modified or mutated, will be at least about 10,
usually at least about 30 amino acids, more usually at least about
50 amino acids, and generally not more than about 400 amino acids,
usually not more than about 200 amino acids. (See Romeo, et al.,
Cell (1992) 68, 889-893.) While any species can be employed, the
species endogenous to the host cell is usually preferred. However,
in many cases, the cytoplasmic domain from a different species can
be used effectively. Any of the above indicated cytoplasmic domains
may be used, as well as others which are presently known or may
subsequently be discovered.
[0105] For the most part, the other chimeric proteins associated
with transcription factors, will differ primarily in having a
cellular targeting sequence which directs the chimeric protein to
the internal side of the nuclear membrane and having transcription
factors or portions thereof as the action domains. Usually, the
transcription factor action domains can be divided into "DNA
binding domains" and "activation domains." One can provide for a
DNA binding domain with one or more ligand binding domains and an
activation domain with one or more ligand binding domains. In this
way the DNA binding domain can be coupled to a plurality of binding
domains and/or activation domains. Otherwise, the discussion for
the chimeric proteins associated with the surface membrane for
signal transduction is applicable to the chimeric proteins for
direct binding to genomic DNA. Similarly, the chimeric protein
associated with exocytosis will differ primarily as to the proteins
associated with fusion of the vesicle membrane with the surface
membrane, in place of the transducing cytoplasmic proteins.
B. Cellular Targeting Domains
[0106] A signal peptide or sequence provides for transport of the
chimeric protein to the cell surface membrane, where the same or
other sequences can encode binding of the chimeric protein to the
cell surface membrane. While there is a general motif of signal
sequences, two or three N-terminal polar amino acids followed by
about 15-20 primarily hydrophobic amino acids, the individual amino
acids can be widely varied. Therefore, substantially any signal
peptide can be employed which is functional in the host and may or
may not be associated with one of the other domains of the chimeric
protein. Normally, the signal peptide is processed and will not be
retained in the mature chimeric protein. The sequence encoding the
signal peptide is at the 5-end of the coding sequence and will
include the initiation methionine codon.
[0107] The choice of membrane retention domain is not critical to
this invention, since it is found that such membrane retention
domains are substantially fungible and there is no critical amino
acid required for binding or bonding to another membrane region for
activation. Thus, the membrane retention domain can be isolated
from any convenient surface membrane or cytoplasmic protein,
whether endogenous to the host cell or not.
[0108] There are at least two different membrane retention domains:
a transmembrane retention domain, which is an amino acid sequence
which extends across the membrane; and a lipid membrane retention
domain, which lipid associates with the lipids of the cell surface
membrane.
[0109] For the most part, for ease of construction, the
transmembrane domain of the cytoplasmic domain or the receptor
domain can be employed, which may tend to simplify the construction
of the fused protein. However, for the lipid membrane retention
domain, the processing signal will usually be added at the 5' end
of the coding sequence for N-terminal binding to the membrane and,
proximal to the 3' end for C-terminal binding. The lipid membrane
retention domain will have a lipid of from about 12 to 24 carbon
atoms, particularly 14 carbon atoms, more particularly myristoyl,
joined to glycine. The signal sequence for the lipid binding domain
is an N-terminal sequence and can be varied widely, usually having
glycine at residue 2 and lysine or arginine at residue 7 (Kaplan,
et al., Mol. Cell. Biol. (1988) 8, 2435). Peptide sequences
involving post-translational processing to provide for lipid
membrane binding are described by Carr, et al., PNAS USA (1988) 79,
6128; Aitken, et al., FEBS Lett. (1982) 150, 314; Henderson, et
al., PNAS USA (1983) 80, 319; Schulz, et al., Virology (1984), 123,
2131; Dellman, et al., Nature (1985) 314, 374; and reviewed in Ann.
Rev. of Biochem. (1988) 57, 69. An amino acid sequence of interest
includes the sequence MG-S-S-K-S-K-P-K-D-P-S-Q-R. Various DNA
sequences can be used to encode such sequence in the fused receptor
protein.
[0110] Generally, the transmembrane domain will have from about
18-30 amino acids, more usually about 20-30 amino acids, where the
central portion will be primarily neutral, non-polar amino acids,
and the termini of the domain will be polar amino acids, frequently
charged amino acids, generally having about 1-2 charged, primarily
basic amino acids at the termini of the transmembrane domain
followed by a helical break residue, e.g. pro- or gly-.
C. Ligand Binding Domain
[0111] The ligand binding ("dimerization") domain of a chimeric
protein of this invention can be any convenient domain which will
allow for induction using a natural or unnatural ligand, preferably
an unnatural synthetic ligand. The binding domain can be internal
or external to the cellular membrane, depending upon the nature of
the construct and the choice of ligand. A wide variety of binding
proteins, including receptors, are known, including binding
proteins associated with the cytoplasmic regions indicated above.
Of particular interest are binding proteins for which ligands
(preferably small organic ligands) are known or may be readily
produced. These receptors or ligand binding domains include the
FKBPs and cyclophilin receptors, the steriod receptors, the
tetracycline receptor, the other receptors indicated above, and the
like, as well as "unnatural" receptors, which can be obtained from
antibodies, particularly the heavy or light chain subunit, mutated
sequences thereof, random amino acid sequences obtained by
stochastic procedures, combinatorial syntheses, and the like. For
the most part, the receptor domains will be at least about 50 amino
acids, and fewer than about 350 amino acids, usually fewer than 200
amino acids, either as the natural domain or truncated active
portion thereof. Preferably the binding domain will be small
(<25 kDa, to allow efficient transfection in viral vectors),
monomeric (this rules out the avidin-biotin system),
nonimmunogenic, and should have synthetically accessible, cell
permeable, nontoxic ligands that can be configured for
dimerization.
[0112] The receptor domain can be intracellular or extracellular
depending upon the design of the construct encoding the chimeric
protein and the availability of an appropriate ligand. For
hydrophobic ligands, the binding domain can be on either side of
the membrane, but for hydrophilic ligands, particularly protein
ligands, the binding domain will usually be external to the cell
membrane, unless there is a transport system for internalizing the
ligand in a form in which it is available for binding. For an
intracellular receptor, the construct can encode a signal peptide
and transmembrane domain 5' or 3' of the receptor domain sequence
or by having a lipid attachment signal sequence 5' of the receptor
domain sequence. Where the receptor domain is between the signal
peptide and the transmembrane domain, the receptor domain will be
extracellular.
[0113] The portion of the construct encoding the receptor can be
subjected to mutagenesis for a variety of reasons. The mutagenized
protein can provide for higher binding affinity, allow for
discrimination by the ligand of the naturally occurring receptor
and the mutagenized receptor, provide opportunities to design a
receptor-ligand pair, or the like. The change in the receptor can
involve changes in amino acids known to be at the binding site,
random mutagenesis using combinatorial techniques, where the codons
for the amino acids associated with the binding site or other amino
acids associated with conformational changes can be subject to
mutagenesis by changing the codon(s) for the particular amino acid,
either with known changes or randomly, expressing the resulting
proteins in an appropriate prokaryotic host and then screening the
resulting proteins for binding. Illustrative of this situation is
to modify FKBP12's Phe36 to Ala and/or Asp37 to Gly or Ala to
accommodate a substituent at positions 9 or 10 of FK506 or FK520.
In particular, mutant FKBP12 moieties which contain Val, Ala, Gly,
Met or other small amino acids in place of one or more of Tyr26,
Phe36, Asp37, Tyr82 and Phe99 are of particular interest as
receptor domains for FK506-type and FK-520-type ligands containing
modifications at C9 and/or C10.
[0114] Antibody subunits, e.g. heavy or light chain, particularly
fragments, more particularly all or part of the variable region, or
fusions of heavy and light chain to create high-affinity binding,
can be used as the binding domain. Antibodies can be prepared
against haptenic molecules which are physiologically acceptable and
the individual antibody subunits screened for binding affinity. The
cDNA encoding the subunits can be isolated and modified by deletion
of the constant region, portions of the variable region,
mutagenesis of the variable region, or the like, to obtain a
binding protein domain that has the appropriate affinity for the
ligand. In this way, almost any physiologically acceptable haptenic
compound can be employed as the ligand or to provide an epitope for
the ligand. Instead of antibody units, natural receptors can be
employed, where the binding domain is known and there is a useful
ligand for binding.
[0115] The ability to employ in vitro mutagenesis or combinatorial
modifications of sequences encoding proteins allows for the
production of libraries of proteins which can be screened for
binding affinity for different ligands. For example, one can
totally randomize a sequence of 1 to 5, 10 or more codons, at one
or more sites in a DNA sequence encoding a binding protein, make an
expression construct and introduce the expression construct into a
unicellular microorganism, and develop a library. One can then
screen the library for binding affinity to one or desirably a
plurality of ligands. The best affinity sequences which are
compatible with the cells into which they would be introduced can
then be used as the binding domain. The ligand would be screened
with the host cells to be used to determine the level of binding of
the ligand to endogenous proteins. A binding profile could be
defined weighting the ratio of binding affinity to the mutagenized
binding domain with the binding affinity to endogenous proteins.
Those ligands which have the best binding profile could then be
used as the ligand. Phage display techniques, as a non-limiting
example, can be used in carrying out the foregoing.
D. Multimerization
[0116] The transduced signal will normally result from
ligand-mediated oligomerization of the chimeric protein molecules,
i.e. as a result of oligomerization following ligand binding,
although other binding events, for example allosteric activation,
can be employed to initiate a signal. The construct of the chimeric
protein will vary as to the order of the various domains and the
number of repeats of an individual domain. For the extracellular
receptor domain in the 5'-3' direction of transcription, the
construct will encode a protein comprising the signal peptide, the
receptor domain, the transmembrane domain and the signal initiation
domain, which last domain will be intracellular (cytoplasmic).
However, where the receptor domain is intracellular, different
orders may be employed, where the signal peptide can be followed by
either the receptor or signal initiation domain, followed by the
remaining domain, or with a plurality of receptor domains, the
signal initiation domain can be sandwiched between receptor
domains. Usually, the active site of the signal initiation domain
will be internal to the sequence and not require a free carboxyl
terminus. Either of the domains can be multimerized, particularly
the receptor domain, usually having not more than about 5 repeats,
more usually not more than about 3 repeats.
[0117] For multimerizing the receptor, the ligand for the receptor
domains of the chimeric surface membrane proteins will usually be
multimeric in the sense that it will have at least two binding
sites, with each of the binding sites capable of binding to the
receptor domain. Desirably, the subject ligands will be a dimer or
higher order oligomer, usually not greater than about tetrameric,
of small synthetic organic molecules, the individual molecules
typically being at least about 150 D and fewer than about 5 kD,
usually fewer than about 3 kD. A variety of pairs of synthetic
ligands and receptors can be employed. For example, in embodiments
involving natural receptors, dimeric FK506 can be used with an FKBP
receptor, dimerized cyclosporin A can be used with the cyclophilin
receptor, dimerized estrogen with an estrogen receptor, dimerized
glucocorticoids with a glucocorticoid receptor, dimerized
tetracycline with the tetracycline receptor, dimerized vitamin D
with the vitamin D receptor, and the like. Alternatively higher
orders of the ligands, e.g. trimeric can be used. For embodiments
involving unnatural receptors, e.g. antibody subunits, modified
antibody subunits or modified receptors and the like, any of a
large variety of compounds can be used. A significant
characteristic of these ligand units is that they bind the receptor
with high affinity (preferably with a K.sub.d.ltoreq.10.sup.-8 M)
and are able to be dimerized chemically.
[0118] The ligand can have different receptor binding molecules
with different epitopes (also referred to as "HED" reagents, since
they can mediate hetero-dimerization or hetero-oligomerization of
chimeric proteins having the same or different binding domains. For
example, the ligand may comprise FK506 or an FK506-type moiety and
a CsA or a cyclosporin type moiety. Both moieties are covalently
attached to a common linker moiety. Such a ligand would be useful
for mediating the oligomerization of a first and second chimeric
protein where the first chimeric protein contains a receptor domain
such as an FKBP12 which is capable of binding to the FK506-type
moiety and the second chimeric protein contains a receptor domain
such as cyclophilin which is capable of binding to the cyclosporin
A-type moiety.
VI. Cells
[0119] The cells may be procaryotic, but are preferably eucaryotic,
including plant, yeast, worm, insect and mammalian. At present it
is especially preferred that the cells be mammalian cells,
particularly primate, more particularly human, but can be
associated with any animal of interest, particularly domesticated
animals, such as equine, bovine, murine, ovine, canine, feline,
etc. Among these species, various types of cells can be involved,
such as hematopoietic, neural, mesenchymal, cutaneous, mucosal,
stromal, muscle, spleen, reticuloendothelial, epithelial,
endothelial, hepatic, kidney, gastrointestinal, pulmonary, etc. Of
particular interest are hematopoietic cells, which include any of
the nucleated cells which may be involved with the lymphoid or
myelomonocytic lineages. Of particular interest are members of the
T- and B-cell lineages, macrophages and monocytes, myoblasts and
fibroblasts. Also of particular interest are stem and progenitor
cells, such as hematopoietic neural, stromal, muscle, hepatic,
pulmonary, gastrointestinal, etc.
[0120] The cells can be autologous cells, syngeneic cells,
allogenic cells and even in some cases, xenogeneic cells. The cells
may be modified by changing the major histocompatibility complex
("MHC") profile, by inactivating .beta..sub.2-microglobulin to
prevent the formation of functional Class I MHC molecules,
inactivation of Class II molecules, providing for expression of one
or more MHC molecules, enhancing or inactivating cytotoxic
capabilities by enhancing or inhibiting the expression of genes
associated with the cytotoxic activity, or the like.
[0121] In some instances specific clones or oligoclonal cells may
be of interest, where the cells have a particular specificity, such
as T cells and B cells having a specific antigen specificity or
homing target site specificity.
VII. Ligands
[0122] A wide variety of ligands, including both naturally
occurring and synthetic substances, can be used in this invention
to effect oligomerization of the chimeric protein molecules.
Applicable and readily observable or measurable criteria for
selecting a ligand are: (A) the ligand is physiologically
acceptable (i.e., lacks undue toxicity towards the cell or animal
for which it is to be used), (B) it has a reasonable therapeutic
dosage range, (C) desirably (for applications in whole animals,
including gene therapy applications), it can be taken orally (is
stable in the gastrointestinal system and absorbed into the
vascular system), (D) it can cross the cellular and other
membranes, as necessary, and (E) binds to the receptor domain with
reasonable affinity for the desired application. A first desirable
criterion is that the compound is relatively physiologically inert,
but for its activating capability with the receptors. The less the
ligand binds to native receptors and the lower the proportion of
total ligand which binds to nature receptors, the better the
response will normally be. Particularly, the ligand should not have
a strong biological effect on native proteins. For the most part,
the ligands will be non-peptide and non-nucleic acid.
[0123] The subject compounds will for the most part have two or
more units, where the units can be the same or different, joined
together through a central linking group. The "units" will be
individual moieties (e.g., FK506, FK520, cyclosporin A, a steroid,
etc.) capable of binding the receptor domain. Each of the units
will usually be joined to the linking group through the same
reactive moieties, at least in homodimers or higher order
homo-oligomers.
[0124] As indicated above, there are a variety of
naturally-occurring receptors for small non-proteinaceous organic
molecules, which small organic molecules fulfill the above
criteria, and can be dimerized at various sites to provide a ligand
according to the subject invention. Substantial modifications of
these compounds are permitted, so long as the binding capability is
retained and with the desired specificity. Many of the compounds
will be macrocyclics, e.g. macrolides. Suitable binding affinities
will be reflected in Kd values well below 10.sup.-4, preferably
below 10.sup.-6, more preferably below about 10.sup.-7, although
binding affinities below 10.sup.-9 or 10.sup.-10 are possible, and
in some cases will be most desirable.
[0125] Currently preferred ligands comprise oligomers, usually
dimers, of compounds capable of binding to an FKBP protein and/or
to a cyclophilin protein. Such ligands includes homo- and
heteromultimers (usually 2-4, more usually 2-3 units) of
cyclosporin A, FK506, FK520, and rapamycin, and derivatives
thereof, which retain their binding capability to the natural or
mutagenized binding domain. Many derivatives of such compounds are
already known, including synthetic high affinity FKBP ligands,
which can be used in the practice of this invention. See e.g. Holt
et al, J Am Chem Soc 1993, 115, 9925-9935. Sites of interest for
linking of FK506 and analogs thereof include positions involving
annular carbon atoms from about 17 to 24 and substituent positions
bound to those annular atoms, e.g. 21 (allyl), 22, 37, 38, 39 and
40, or 32 (cyclohexyl), while the same positions except for 21 are
of interest for FK520. For cyclosporin, sites of interest include
MeBmt, position 3 and position 8.
[0126] Of particular interest are modifications to the ligand which
change its binding characteristics, particularly with respect to
the ligand's naturally occurring receptor. Concomitantly, one would
change the binding protein to accommodate the change in the ligand.
For example, one can modify the groups at position 9 or 10 of FK506
(see Van Duyne et al (1991) Science 252, 839), so as to increase
their steric requirement, by replacing the hydroxyl with a group
having greater steric requirements, or by modifying the carbonyl at
position 10, replacing the carbonyl with a group having greater
steric requirements or functionalizing the carbonyl, e.g. forming
an N-substituted Schiff's base or imine, to enhance the bulk at
that position. Various functionalities which can be conveniently
introduced at those sites are alkyl groups to form ethers,
acylamido groups, N-alkylated amines, where a 2-hydroxyethylimine
can also form a 1,3-oxazoline, or the like. Generally, the
substituents will be from about 1 to 6, usually 1 to 4, and more
usually 1 to 3 carbon atoms, with from 1 to 3, usually 1 to 2
heteroatoms, which will usually be oxygen, sulfur, nitrogen, or the
like. By using different derivatives of the basic structure, one
can create different ligands with different conformational
requirements for binding. By mutagenizing receptors, one can have
different receptors of substantially the same sequence having
different affinities for modified ligands riot differing
significantly in structure.
[0127] Other ligands which can be used are steroids. The steroids
can be oligomerized, so that their natural biological activity is
substantially diminished without loss of their binding capability
with respect to a chimeric protein containing one or more steroid
receptor domains. By way of non-limiting example, glucocorticoids
and estrogens can be so used. Various drugs can also be used, where
the drug is known to bind to a particular receptor with high
affinity. This is particularly so where the binding domain of the
receptor is known, thus permitting the use in chimeric proteins of
this invention of only the binding domain, rather than the entire
native receptor protein. For this purpose, enzymes and enzyme
inhibitors can be used.
A. Linkers
[0128] Various functionalities can be involved in the linking, such
as amide groups, including carbonic acid derivatives, ethers,
esters, including organic and inorganic esters, amino, or the like.
To provide for linking, the particular monomer can be modified by
oxidation, hydroxylation, substitution, reduction, etc., to provide
a site for coupling. Depending on the monomer, various sites can be
selected as the site of coupling.
[0129] The multimeric ligands can be synthesized by any convenient
means, where the linking group will be at a site which does not
interfere with the binding of the binding site of a ligand to the
receptor. Where the active site for physiological activity and
binding site of a ligand to the receptor domain are different, it
will usually be desirable to link at the active site to inactivate
the ligand. Various lining groups can be employed, usually of from
1-30, more usually from about 1-20 atoms in the chain between the
two molecules (other than hydrogen), where the linking groups will
be primarily composed of carbon, hydrogen, nitrogen, oxygen,
sulphur and phosphorous. The linking groups can involve a wide
variety of functionalities, such as amides and esters, both organic
and inorganic, amines, ethers, thioethers, disulfides, quaternary
ammonium salts, hydrazines, etc. The chain can include aliphatic,
alicyclic, aromatic or heterocyclic groups. The chain will be
selected based on ease of synthesis and the stability of the
multimeric ligand. Thus, if one wishes to maintain long-term
activity, a relatively inert chain will be used, so that the
multimeric ligand link will not be cleaved. Alternatively, if one
wishes only a short half-life in the blood stream, then various
groups can be employed which are readily cleaved, such as esters
and amides, particularly peptides, where circulating and/or
intracellular proteases can cleave the linking group.
[0130] Various groups can be employed as the linking group between
ligands, such as alkylene, usually of from 2 to 20 carbon atoms,
azalkylene (where the nitrogen will usually be between two carbon
atoms), usually of from 4 to 18 carbon atoms), N-alkylene
azalkylene (see above), usually of from 6 to 24 carbon atoms,
arylene, usually of from 6 to 18 carbon atoms, ardialkylene,
usually of from 8 to 24 carbon atoms, bis-carboxamido alkylene of
from about 8 to 36 carbon atoms, etc. Illustrative groups include
decylene, octadecylene, 3-azapentylene, 5-azadecylene, N-butylene
5-azanonylene, phenylene, xylylene, p-dipropylenebenzene,
bis-benzoyl 1,8-diaminooctane and the like. Multivalent or other
(see below) ligand molecules containing linker moieties as
described above can be evaluated with chimeric proteins of this
invention bearing corresponding receptor domains using materials
and methods described in the examples which follow.
B. Ligand Characteristics
[0131] For intracellular binding domains, the ligand will be
selected to be able to be transferred across the membrane in a
bioactive form, that is, it will be membrane permeable. Various
ligands are hydrophobic or can be made so by appropriate
modification with lipophilic groups. Particularly, the linking
bridge can serve to enhance the lipophilicity of the ligand by
providing aliphatic side chains of from about 12 to 24 carbon
atoms. Alternatively, one or more groups can be provided which will
enhance transport across the membrane, desirably without endosome
formation.
[0132] In some instances, multimeric ligands need not be employed.
For example, molecules can be employed where two different binding
sites provide for dimerization of the receptor. In other instances,
binding of the ligand can result in a conformational change of the
receptor domain, resulting in activation, e.g. oligomerization, of
the receptor. Other mechanisms may also be operative for inducing
the signal, such as binding a single receptor with a change in
conformation resulting in activation of the cytoplasmic domain.
C. Ligand Antagonists
[0133] Monomeric ligands can be used for reversing the effect of
the multimeric ligand, i.e., for inhibiting or disrupting oligomer
formation or maintenance. Thus, if one wishes to rapidly terminate
the effect of cellular activation, a monomeric ligand can be used.
Conveniently, the parent ligand moiety can be modified at the same
site as the multimer, using the same procedure, except substituting
a monofunctional compound for the polyfunctional compound. Instead
of the polyamines, monoamines, particularly of from 2 to 20
(although they can be longer), and usually 2 to 12, carbon atoms
can be used, such as ethylamine, hexylamine, benzylamine, etc.
Alternatively, the monovalent parent compound can be used, in cases
in which the parent compound does not have undue undesirable
physiological activity (e.g. immunosuppression, mitogenesis,
toxicity, etc.)
D. Illustrative Hetero-Oligomerizing (HED) and Homo-Oligomerizing
(HOD) Reagents with "Bumps" that can Bind to Mutant Receptors
Containing Compensatory Mutations
[0134] As discussed above, one can prepare modified HED/HOD
reagents that will fail to bind appreciably to their wildtype
receptors (e.g., FKBP12) due to the presence of substituents
("bumps") on the reagents that sterically clash with sidechain
residues in the receptor's binding pocket. One may also make
corresponding receptors that contain mutations at the interfering
residues ("compensatory mutations") and therefore gain the ability
to bind ligands with bumps. Using "bumped" ligand moieties and
receptor domains bearing compensatory mutations should enhance the
specificity and thus the potency of our reagents. Bumped reagents
should not bind to the endogenous, wildtype receptors, which can
otherwise act as a "buffer" toward dimerizers based on natural
ligand moieties. In addition, the generation of novel
receptor-ligand pairs should simultaneously yield the HED reagents
that will be used when heterodimerization is required. For example,
regulated vesicle fusion may be achieved by inducing the
heterodimerization of syntaxin (a plasma membrane fusion protein)
and synaptobrevin (a vesicle membrane fusion protein) using a HED
reagent. This would not only provide a research tool, but could
also serve as the basis of a gene therapy treatment for diabetes,
using appropriately modified secretory cells.
[0135] As an illustration of "Bumped FK1012s" we prepared C10
acetamide and formamide derivatives of FK506. See FIG. 16A and our
report, Spencer et al, "Controlling Signal Transduction with
Synthetic Ligands," Science 262 5136 (1993): 1019-1024 for
additional details concerning the syntheses of FK1012s A-C and
FK506M. We chose to create two classes of bumped FK1012s: one with
a bump at C10 and one at C9. The R- and S-isomers of the C10
acetamide and formamide of FK506 have been synthesized according to
the reaction sequence in FIG. 05B. These bumped derivatives have
lost at least three orders of magnitude in their binding affinity
towards FKBP12 (FIG. 16B). The affinities were determined by
measuring the ability of the derivatives to inhibit FKBP12's
rotamase activity.
[0136] An illustrative member of a second class of C9-bumped
derivatives is the spiro-epoxide (depicted in FIG. 16C), which has
been prepared by adaptation of known procedures. See e.g. Fisher et
al, J Org Chem 56 8(1991): 2900-7 and Edmunds et al, Tet Lett 32 48
(1991):819-820. A particularly interesting series of C9 derivatives
are characterized by their sp3 hybridization and reduced oxidation
state at C9. Several such compounds have been synthesized according
to the reactions shown in FIG. 16C.
[0137] It should be appreciated that heterodimers (and other
hetero-oligomerizers) must be constructed differently than the
homodimers, at least for applications where homodimer contamination
could adversely affect their successful use. One illustrative
synthetic strategy developed to overcome this problem is outlined
in FIG. 16D. Coupling of mono alloc-protected 1,6-hexanediamine
(Stahl et al, J Org Chem 43 11 (1978): 2285-6) with a derivatized
form of FK506 in methylene chloride with an excess of triethylamine
gave an alloc-amine-substituted FK506 in 44% yield. This
intermediate can now be used in the coupling with any activated
FK506 (or bumped-FK506) molecule. Deprotection with catalytic
tetrakis-triphenylphosphine palladium in the presence of dimedone
at rt in THF removes the amine protecting group. Immediate
treatment with an activated FK506 derivative, followed by
desilylation leads to a dimeric product. This technique has been
used to synthesize the illustrated HOD and HED reagents.
E. Illustrative Cyclosporin-Based Reagents
[0138] Cyclosporin A (CsA) is a cyclic undecapeptide that binds
with high affinity (6 nM) to its intracellular receptor
cyclophilin, an 18 kDa monomeric protein. The resulting complex,
like the FKBP12-FK506 complex, binds to and inactivates the protein
phosphatase calcineurin resulting in the immunosuppressive
properties of the drug. As a further illustration of this
invention, we have dimerized CsA via its MeBmt1 sidechain in 6
steps and 35% overall yield to give (CsA)2 (FIG. 17, steps 1-4 were
conducted as reported in Eberle et al, J Org Chem 57 9 (1992):
2689-91). As with FK1012s, the site for dimerization was chosen
such that the resulting dimer can bind to two molecules of
cyclophilin yet cannot bind to calcineurin following
cyclophilin-binding. We have demonstrated that (CsA)2 binds to
cyclophilin A with 1:2 stoichiometry. Hence, (CsA)2, like FK1012s,
does not inhibit signaling pathways and is thus neither
immunosuppressive nor toxic.
VIII. Target Gene
A. Transcription Initiation Region
[0139] The second construct or second series of constructs will
have a responsive element in the 5 region, which responds to
ligand-mediated oligomerization of the chimeric receptor protein,
presumably via the generation and transduction of a transcription
initiation signal as discussed infra. Therefore, it will be
necessary to know at least one transcription initiation system,
e.g. factor, which is activated either directly or indirectly, by
the cytoplasmic domain or can be activated by association of two
domains. It will also be necessary to know at least one promoter
region which is responsive to the resulting transcription
initiation system. Either the promoter region or the gene under its
transcriptional control need be known. In other words, an action
domain can be selected for the chimeric proteins (encoded by a
"first" series construct) based on the role of that action domain
in initiating transcription via a given promoter or responsive
element. See e.g. Section V(A) "Cytoplasmic domains", above.
[0140] Where the responsive element is known, it can be included in
the target gene construct to provide an expression cassette for
integration into the genome (whether episomally or by chromosomal
incorporation). It is not necessary to have isolated the particular
sequence of the responsive element, so long as a gene is known
which is transcriptionally activated by the cytoplasmic domain upon
natural ligand binding to the protein comprising the cytoplasmic
domain. Homologous recombination could then be used for insertion
of the gene of interest downstream from the promoter region to be
under the transcriptional regulation of the endogenous promoter
region. Where the specific responsive element sequence is known,
that can be used in conjunction with a different transcription
initiation region, which can have other aspects, such as a high or
low activity as to the rate of transcription, binding of particular
transcription factors and the like.
[0141] The expression construct will therefore have at its 5' end
in the direction of transcription, the responsive element and the
promoter sequence which allows for induced tanscription initiation
of a target gene of interest, usually a therapeutic gene. The
transcriptional termination region is not as important, and can be
used to enhance the lifetime of or make short half-lived mRNA by
inserting AU sequences which serve to reduce the stability of the
mRNA and, therefore, limit the period of action of the protein. Any
region can be employed which provides for the necessary
transcriptional termination, and as appropriate, translational
termination.
[0142] The responsive element can be a single sequence or can be
oligomerized, usually having not more than about 5 repeats, usually
having about 3 repeats.
[0143] Homologous recombination can also be used to remove or
inactivate endogenous transcriptional control sequences, including
promoter and/or responsive elements, which are responsive to the
oligomerization event, and/or to insert such responsive
transcriptional control sequences upstream of a desired endogenous
gene.
B. Product
[0144] A wide variety of genes can be employed as the target gene,
including genes that encode a protein of interest or an antisense
sequence of interest or a ribozyme of interest. The target gene can
be any sequence of interest which provides a desired phenotype. The
target gene can express a surface membrane protein, a secreted
protein, a cytoplasmic protein, or there can be a plurality of
target genes which can express different types of products. The
target gene may be an antisense sequence which can modulate a
particular pathway by inhibiting a transcriptional regulation
protein or turn on a particular pathway by inhibiting the
translation of an inhibitor of the pathway. The target gene can
encode a ribozyme which may modulate a particular pathway by
interfering, at the RNA level, with the expression of a relevant
transcriptional regulator or with the expression of an inhibitor of
a particular pathway. The proteins which are expressed, singly or
in combination, can involve homing, cytotoxicity, proliferation,
immune response, inflammatory response, dotting or dissolving of
dots, hormonal regulation, or the like. The proteins expressed
could be naturally-occurring, mutants of naturally-occurring
proteins, unique sequences, or combinations thereof.
[0145] The gene can be any gene which is secreted by a cell, so
that the encoded product can be made available at will, whenever
desired or needed by the host. Various secreted products include
hormones, such as insulin, human growth hormone, glucagon,
pituitary releasing factor, ACTH melanotropin, relaxin, etc.;
growth factors, such as EGF, IGF-1, TGF-.alpha., -.beta., PDGF,
G-CSF, M-CSF, GM-CSF, FGF, erythropoietin, megakaryocytic
stimulating and growth factors, etc.; interleukins, such as IL-1 to
-13; TNF-.alpha. and -.beta., etc.; and enzymes, such as tissue
plasminogen activator, members of the complement cascade, performs,
superoxide dismutase, coagulation factors, antithrombin-III, Factor
VIIIc, Factor VIIIvW, .alpha.-anti-trypsin, protein C, protein S,
endorphins, dynorphin, bone morphogenetic protein, CFTR, etc.
[0146] The gene can be any gene which is naturally a surface
membrane protein or made so by introducing an appropriate signal
peptide and transmembrane sequence. Various proteins include homing
receptors, e.g. L-selectin (Mel-14), blood-related proteins,
particularly having a kringle structure, e.g. Factor VIIIc, Factor
VIIIvW, hematopoietic cell markers, e.g. CD3, CD4, CD8, B cell
receptor, TCR subunits .alpha., .beta., .gamma., .delta., CD10,
CD19, CD28, CD33, CD38, CD41, etc., receptors, such as the
interleukin receptors IL-2R, IL-4R, etc., channel proteins, for
influx or efflux of ions, eg. H+, Ca.sup.+2, K.sup.+, Na.sup.+,
Cl.sup.-, etc., and the like; CFTR, tyrosine activation motif,
.zeta. activation protein, etc.
[0147] Proteins may be modified for transport to a vesicle for
exocytosis. By adding the sequence from a protein which is directed
to vesicles, where the sequence is modified proximal to one or the
other terminus, or situated in an analogous position to the protein
source, the modified protein will be directed to the Golgi
apparatus for packaging in a vesicle. This process in conjunction
with the presence of the chimeric proteins for exocytosis allows
for rapid transfer of the proteins to the extracellular medium and
a relatively high localized concentration.
[0148] Also, intracellular proteins can be of interest, such as
proteins in metabolic pathways, regulatory proteins, steroid
receptors, transcription factors, etc., particularly depending upon
the nature of the host cell. Some of the proteins indicated above
can also serve as intracellular proteins.
[0149] The following are a few illustrations of different genes. In
T-cells, one may wish to introduce genes encoding one or both
chains of a T-cell receptor. For B-cells, one could provide the
heavy and light chains for an immunoglobulin for secretion. For
cutaneous cells, e.g. keratinocytes, particularly stem cells
keratinocytes, one could provide for infectious protection, by
secreting .alpha.-, .beta.- or -.gamma. interferon, antichemotactic
factors, proteases specific for bacterial cell wall proteins,
etc.
[0150] In addition to providing for expression of a gene having
therapeutic value, there will be many situations where one may wish
to direct a cell to a particular site. The site can include
anatomical sites, such as lymph nodes, mucosal tissue, skin,
synovium, lung or other internal organs or functional sites, such
as clots, injured sites, sites of surgical manipulation,
inflammation, infection, etc. By providing for expression of
surface membrane proteins which will direct the host cell to the
particular site by providing for binding at the host target site to
a naturally-occurring epitope, localized concentrations of a
secreted product can be achieved. Proteins of interest include
horning receptors, e.g. L-selectin, GMP140, CLAM-1, etc., or
addressing, e.g. ELAM-1, PNAd, LNAd, etc., clot binding proteins,
or cell surface proteins that respond to localized gradients of
chemotactic factors. There are numerous situations where one would
wish to direct cells to a particular site, where release of a
therapeutic product could be of great value.
[0151] In many situations one may wish to be able to kill the
modified cells, where one wishes to terminate the treatment, the
cells become neoplastic, in research where the absence of the cells
after their presence is of interest, or other event. For this
purpose one can provide for the expression of the Fas antigen or
TNF receptor fused to a binding domain. (Watanable-Fukunaga et al.
Nature (1992) 356, 314-317) In the original modification, one can
provide for constitutive expression of such constructs, so that the
modified cells have such proteins on their surface or present in
their cytoplasm. Alternatively, one can provide for controlled
expression, where the same or different ligand can initiate
expression and initiate apoptosis. By providing for the cytoplasmic
portions of the Fas antigen or TNF receptor in the cytoplasm joined
to binding regions different from the binding regions associated
with expression of a target gene of interest, one can kill the
modified cells under controlled conditions.
C. Illustrative Exemplifications
[0152] By way of illustration, cardiac patients or patients
susceptible to stroke may be treated as follows. Cells modified as
described herein may be administered to the patient and retained
for extended periods of time. Illustrative cells include plasma
cells, B-cells, T-cells, or other hematopoietic cells. The cell
would be modified to express a protein which binds to a blood clot,
e.g. having a kringle domain structure or an adhesive interactive
protein, e.g. CD41, and to express a clot dissolving protein, e.g.
tissue plasminogen activator, streptokinase, etc. In this way, upon
ligand-mediated oligomerization, the cells would accumulate at the
site of the clot and provide for a high localized concentration of
the thrombolytic protein.
[0153] Another example is reperfusion injury. Cells of limited
lifetime could be employed, e.g. macrophages or polymorphonuclear
leukocytes ("neutrophils"). The cells would have a neutrophil
homing receptor to direct the cells to a site of reperfusion
injury. The cell would also express superoxide dismutase, to
destroy singlet oxygen and inhibit radical attack on the
tissue.
[0154] A third example is autoimmune disease. Cells of extended
lifetime, e.g. T cells could be employed. The constructs would
provide for a homing receptor for homing to the site of autoimmune
injury and for cytotoxic attack on cells causing the injury. The
therapy would then be directed against cells causing the injury.
Alternatively, one could provide for secretion of soluble receptors
or other peptide or protein, where the secretion product would
inhibit activation of the injury causing cells or induce anergy.
Another alternative would be to secrete an antiinflammatory
product, which could serve to diminish the degenerative
effects.
[0155] A fourth example involves treatment of chronic pain with
endorphin via encapsulation. A stock of human fibroblasts is
transfected with a construct in which the chimeric transcriptional
regulatory protein controls the transcription of human endorphin.
The DNA construct consists of three copies of the binding site for
the HNF-1* transcription factor GTTAAGTTAAC upstream of a TATAAA
site and a transcriptional initiation site. The endorphin cDNA
would be inserted downstream of the initiation site and upstream of
a polyadenylation and termination sequences. Optionally, the
endorphin cDNA is outfitted with "PEST" sequences to make the
protein unstable or AUUA sequences in the 3' nontranslated region
of the mRNA to allow it to be degraded quickly.
[0156] The fibroblasts are also transfected with a construct having
two transcription units, one of which would encode the HNF-1* cDNA
truncated to encode just the DNA binding sequences from amino acids
1 to 250 coupled to a trimeric FKBP binding domain under the
transcriptional and translational control of regulatory initiation
and termination regions functional in the fibroblasts. The
construct would include an additional transcription unit driven by
the same regulatory regions directing the production of a
transcriptional activation domain derived from HNF-4 coupled to
trimeric FKBP'. (The prime intends an altered FKBP that binds at nM
concentration to a modified FK506. The modification inhibits
binding to the endogenous FKBP.)
[0157] These genetically modified cells would be encapsulated to
inhibit immune recognition and placed under the patient's skin or
other convenient internal site. When the patient requires pain
medication, the patient administers a dimeric ligand FK506-FK506',
where about 1 .mu.g to 1 mg would suffice. In this manner one could
provide pain relief without injections or the danger of
addiction.
[0158] A fifth example is the treatment of osteoporosis.
Lymphocytes can be clonally developed or skin fibroblasts grown in
culture from the patient to be treated. The cells would be
transfected as described above, where a bone morphogenic factor
cDNA gene would replace the endorphin gene. For lymphocytes,
antigen specific clones could be used which would allow their
destruction with antibodies to the idiotype of the sIg. In
addition, administration of the antigen for the sIg would expand
the cell population to increase the amount of the protein which
could be delivered. The lymphocyte clones would be infused and the
ligand administered as required for production of the bone
morphogenic factor. By monitoring the response to the ligand, one
could adjust the amount of bone morphogenic factor which is
produced, so as to adjust the dosage to the required level.
[0159] A sixth situation has general application in conjunction
with gene therapies involving cells which may be required to be
destroyed. For example, a modified cell may become cancerous or
result in another pathologic state. Constructs would be transfected
into the modified cells having the necessary transcriptional and
translational regulatory regions and encoding a protein which upon
oligomerization results in cell death, e.g. apoptosis. For example,
the fas antigen or Apo-1 antigen induces apoptosis in most cell
types (Trauth et al. (1989) Science 245, 30'-305; Watanaba-Fukunaga
et al. (1992) Nature 356, 314) In this manner by co-transfecting
the protective constructs into cells used for gene therapy or other
purpose, where there may be a need to ensure the death of a portion
or all of the cells, the cells may be modified to provide for
controlled cytotoxicity by means of the ligand.
[0160] Another situation is to modify antigen specific T cells,
where one can activate expression of a protein product to activate
the cells. The T cell receptor could be directed against tumor
cells, pathogens, cells mediating autoimmunity, and the like. By
providing for activation of the cells, for example, an interleukin
such as IL-2, one could provide for expansion of the modified T
cells in response to a ligand. Other uses of the modified T cells
would include expression of horning receptors for directing the T
cells to specific sites, where cytotoxicity, upregulation of a
surface membrane protein of target cells, e.g. endothelial cells,
or other biological event would be desired.
[0161] Alternatively one may want to deliver high doses of
cytotoxic factors to the target site. For example, upon recognition
of tumor antigens via a homing receptor, tumor-infiltrating
lymphocytes (TILs) may be triggered to deliver toxic concentrations
of TNF or other similar product.
[0162] Another alternative is to export hormones or factors which
are exocytosed. By providing for enhanced exocytosis, a greater
amount of the hormone or factor will be exported; in addition, if
there is a feedback mechanism based on the amount of the hormone or
factor in the cytoplasm, increased production of the hormone or
factor will result. Or, one may provide for induced expression of
the hormone or factor, so that expression and export may be induced
concomitantly.
[0163] One may also provide for proteins in retained body fluids,
e.g. vascular system, lymph system, cerebrospinal fluid, etc. By
modifying cells which can have an extended lifetime in the host,
e.g. hematopoietic cells, keratinocytes, muscle cells, etc.
particularly, stem cells, the proteins can be maintained in the
fluids for extended periods of time. The cells may be modified with
constructs which provide for secretion or endocytosis. The
constructs for secretion would have as the translocation domain, a
signal peptide, and then as in the case of the other chimeric
proteins, a binding domain and an action domain. The action domains
may be derived from the same or different proteins. For example,
with tissue plasminogen activator, one could have the clot binding
region as one action domain and the plasminogen active site as a
different action domain. Alternatively, one could provide enhanced
blockage of homing, by having a binding protein, such as LFA-1 as
one action domain and a selection as a second action domain. By
modifying subunits of proteins, e.g. integrins, T-cell receptor,
sIg, or the like, one could provide soluble forms of surface
membrane proteins which could be brought together to bind to a
molecule. Other opportunities are complement proteins, platelet
membrane proteins involved in clotting, autoantigens on the surface
of cells, and pathogenic molecules on the surface of infectious
agents.
IX. Introduction of Constructs into Cells
[0164] The constructs can be introduced as one or more DNA
molecules or constructs, where there will usually be at least one
marker and there may be two or more markers, which will allow for
selection of host cells which contain the construct(s). The
constructs can be prepared in conventional ways, where the genes
and regulatory regions may be isolated, as appropriate, ligated,
cloned in an appropriate cloning host, analyzed by restriction or
sequencing, or other convenient means. Particularly, using PCR,
individual fragments including all or portions of a functional unit
may be isolated, where one or more mutations may be introduced
using "primer repair", ligation, in vitro mutagensis, etc. as
appropriate. The construct(s) once completed and demonstrated to
have the appropriate sequences may then be introduced into the host
cell by any convenient means. The constructs may be integrated and
packaged into non-replicating, defective viral genomes like
Adenovirus, Adeno-associated virus (AAV), or Herpes simplex virus
(HSV) or others, including retroviral vectors, for infection or
transduction into cells. The constructs may include viral sequences
for transfection, if desired. Alternatively, the construct may be
introduced by fusion, electroporation, biolistics, transfection,
lipofection, or the like. The host cells will usually be grown and
expanded in culture before introduction of the construct(s),
followed by the appropriate treatment for introduction of the
construct(s) and integration of the construct(s). The cells will
then be expanded and screened by virtue of a marker present in the
construct. Various markers which may be used successfully include
hprt, neomycin resistance, thymidine kinase, hygromycin resistance,
etc.
[0165] In some instances, one may have a target site for homologous
recombination, where it is desired that a construct be integrated
at a particular locus. For example,) can knock-out an endogenous
gene and replace it (at the same locus or elswhere) with the gene
encoded for by the construct using materials and methods as are
known in the art for homologous recombination. Alternatively,
instead of providing a gene, one may modify the transcriptional
initiation region of an endogenous gene to be responsive to the
signal initiating domain. aIn such embodiments, transcription of an
endogenous gene such as EPO, tPA, SOD, or the like, would be
controlled by administration of the ligand. For homologous
recombination, one may use either .OMEGA. or O-vectors. See, for
example, Thomas and Capecchi, Cell (1987) 51, 503-512; Mansour, et
al., Nature (1988) 336, 348-352; and Joyner, et al., Nature (1989)
338, 153-156.
[0166] The constructs may be introduced as a single DNA molecule
encoding all of the genes, or different DNA molecules having one or
more genes. The constructs may be introduced simultaneously or
consecutively, each with the same or different markers. In an
illustrative example, one construct would contain a therapeutic
gene under the control of a specific responsive element (e.g.
NFAT), another encoding the receptor fusion protein comprising the
signaling region fused to the ligand receptor domain (e.g. as in
MZF3E). A third DNA molecule encoding a homing receptor or other
product that increases the efficiency of delivery of the
therapeutic product may also be introduced.
[0167] Vectors containing useful elements such as bacterial or
yeast origins of replication, selectable and/or amplifiable
markers, promoter/enhancer elements for expression in procaryotes
or eucaryotes, etc. which may be used to prepare stocks of
construct DNAs and for carrying out transfections are well known in
the art, and many are commercially available.
X. Administration of Cells and Ligands
[0168] The cells which have been modified with the DNA constructs
are then grown in culture under selective conditions and cells
which are selected as having the construct may then be expanded and
further analyzed, using, for example; the polymerase chain reaction
for determining the presence of the construct in the host cells.
Once the modified host cells have been identified, they may then be
used as planned, e.g. grown in culture or introduced into a host
organism.
[0169] Depending upon the nature of the cells, the cells may be
introduced into a host organism, e.g. a mammal, in a wide variety
of ways. Hematopoietic cells may be administered by injection into
the vascular system, there being usually at least about 10.sup.4
cells and generally not more than about 10.sup.10, more usually not
more than about 10.sup.8 cells. The number of cells which are
employed will depend upon a number of circumstances, the purpose
for the introduction, the lifetime of the cells, the protocol to be
used, for example, the number of administrations, the ability of
the cells to multiply, the stability of the therapeutic agent, the
physiologic need for the therapeutic agent, and the like.
Alternatively, with skin cells which may be used as a graft, the
number of cells would depend upon the size of the layer to be
applied to the burn or other lesion. Generally, for myoblasts or
fibroblasts, the number of cells will at least about 10.sup.4 and
not more than about 10.sup.8 and may be applied as a dispersion,
generally being injected at or near the site of interest. The cells
will usually be in a physiologically-acceptable medium.
[0170] Instead of ex vivo modification of the cells, in many
situations one may wish to modify cells in vivo. For this purpose,
various techniques have been developed for modification of target
tissue and cells in vivo. A number of virus vectors have been
developed, such as adenovirus and retroviruses, which allow for
transfection and random integration of the virus into the host.
See, for example, Dubensky et al. (1984) Proc. Natl. Acad. Sci. USA
81, 7529-7533; Kaneda et al., (1989) Science 243,375-378; Hiebert
et al. (1989) Proc. Natl. Acad. Sci. USA 86, 3594-3598; Hatzoglu et
al. (1990) J. Biol. Chem. 265, 17285-17293 and Ferry, et al. (1991)
Proc Natl. Acad. Sci. USA 88, 8377-8381. The vector may be
administered by injection, e.g. intravascularly or intramuscularly,
inhalation, or other parenteral mode.
[0171] In accordance with in vivo genetic modification, the manner
of the modification will depend on the nature of the tissue, the
efficiency of cellular modification required, the number of
opportunities to modify the particular cells, the accessibility of
the tissue to the DNA composition to be introduced, and the like.
By employing an attenuated or modified retrovirus carrying a target
transcriptional initiation region, if desired, one can activate the
virus using one of the subject transcription factor constructs, so
that the virus may be produced and transfect adjacent cells.
[0172] The DNA introduction need not result in integration in every
case. In some situations, transient maintenance of the DNA
introduced may be sufficient. In this way, one could have a short
term effect, where cells could be introduced into the host and then
turned on after a predetermined time, for example, after the cells
have been able to home to a particular site.
[0173] The ligand providing for activation of the cytoplasmic
domain may then be administered as desired. Depending upon the
binding affinity of the ligand, the response desired, the manner of
administration, the half-life, the number of cells present, various
protocols may be employed. The ligand may be administered
parenterally or orally. The number of administrations will depend
upon the factors described above. The ligand may be taken orally as
a pill, powder, or dispersion; bucally; sublingually; injected
intravascularly, intraperitoneally, subcutaneously; by
inhalation,/or the like. The ligand (and monomeric compound) may be
formulated using conventional methods and materials well known in
the art for the various routes of administration. The precise dose
and particular method of administration will depend upon the above
factors and be determined by the attending physician or human or
animal healthcare provider. For the most part, the manner of
administration will be determined empirically.
[0174] In the event that the activation by the ligand is to be
reversed, the monomeric compound may be administered or other
single binding site compound which can compete with the ligand.
Thus, in the case of an adverse reaction or the desire to terminate
the therapeutic effect, the monomeric binding compound can be
administered in any convenient way, particularly intravascularly,
if a rapid reversal is desired. Alternatively, one may provide for
the presence of an inactivation domain with a DNA binding domain,
or apoptosis by having Fas or TNF receptor present as
constitutively expressed constructs.
[0175] The particular dosage of the ligand for any application may
be determined in accordance with the procedures used for
therapeutic dosage monitoring, where maintenance of a particular
level of expression is desired over an extended period of times,
for example, greater than about two weeks, or where there is
repetitive therapy, with individual or repeated doses of ligand
over short periods of time, with extended intervals, for example,
two weeks or more. A dose of the ligand within a predetermined
range would be given and monitored for response, so as to obtain a
time-expression level relationship, as well as observing
therapeutic response. Depending on the levels observed during the
time period and the therapeutic response, one could provide a
larger or smaller dose the next time, following the response. This
process would be iteratively repeated until one obtained a dosage
within the therapeutic range. Where the ligand is chronically
administered, once the maintenance dosage of the ligand is
determined, one could then do assays at extended intervals to be
assured that the cellular system is providing the appropriate
response and level of the expression product.
[0176] It should be appreciated that the system is subject to many
variables, such as the cellular response to the ligand, the
efficiency of expression and, as appropriate, the level of
secretion, the activity of the expression product, the particular
need of the patient, which may vary with time and circumstances,
the rate of loss of the cellular activity as a result of loss of
cells or expression activity of individual cells, and the like.
Therefore, it is expected that for each individual patient, even if
there were universal cells which could be administered to the
population at large, each patient would be monitored for the proper
dosage for the individual.
[0177] The subject methodology and compositions may be used for the
treatment of a wide variety of conditions and indications. For
example, B- and T-cells may be used in the treatment of cancer,
infectious diseases, metabolic deficiencies, cardiovascular
disease, hereditary coagulation deficiencies, autoimmune diseases,
joint degenerative diseases, e.g. arthritis, pulmonary disease,
kidney disease, endocrine abnormalities, etc. Various cells
involved with structure, such as fibroblasts and myoblasts, may be
used in the treatment of genetic deficiencies, such as connective
tissue deficiencies, arthritis, hepatic disease, etc. Hepatocytes
could be used in cases where large amounts of a protein must be
made to complement a deficiency or to deliver a therapeutic product
to the liver or portal circulation.
[0178] The following examples are offered by way illustration and
not by way limitation.
EXAMPLES
Cellular Transformations and Evaluation
Example 1
Induction of Isolated IL-2 Enhancer-Binding Transcription Factors
by Cross-Linking the CD3 Chain of the T-Cell Receptor
[0179] The plasmid pSXNeo/IL2 (IL2-SX) (FIG. 1), which contains the
placental secreted alkaline phosphatase gene under the control of
human IL-2 promoter (-325 to +47; MCB(86) 6, 3042), and related
plasmid variants (i.e. NFAT-SX, NF B-SX, OAP/Oct1-SX, and AP-1-SX)
in which the reporter gene is under the transcriptional control of
the minimal IL-2 promoter (-325 to -294 and -72 to +47) combined
with synthetic oligomers containing various promoter elements (i.e.
NFAT, NK B, OAP/Oct-1, and AP1, respectively), were made by three
piece ligations of 1) pPL/SEAP (Berger, et al., Gene (1988) 66,1)
cut with SspI and HindIII; 2) pSV2/Neo (Southern and Berg, J. Mol.
Appl. Genet. (1982) 1, 332) cut with NdeI, blunted with Klenow,
then cut with PvuI; and 3) various promoter-containing plasmids
(i.e. NFAT-CD8, B-CD8, cx12lacZ-Oct-1, AP1-LUCIF3H, or cx15IL2)
(described below) cut with PvuI and HindIII. NFAT-CD8 contains 3
copies of the NFAT-binding site (-286 to -257; Genes and Dev.
(1990) 4, 1823) and cx12lacZ-Oct contains 4 copies of the
OAP/Oct-1/(ARRE-1) binding site (MCB, (1988) 8, 1715) from the
human IL-2 enhancer; B-CD8 contains 3 copies of the NF B binding
site from the murine light chain (EMBO (1990) 9, 4425) and
AP1-LUCIF3H contains 5 copies of the AP-1 site (5'-TGA-CTCAGCGC-3')
from the metallothionen promoter.
[0180] In each transfection, 5 .mu.g of expression vector, pCDL-SR
(MCB 8, 466-72) (Tac-IL2 receptor-chain), encoding the chimeric
receptor TAC/TAC/Z (TTZ) (PNAS 88, 8905-8909), was co-transfected
along with various secreted alkaline phosphatase-based reporter
plasmids (see map of pSXNeo/mL in FIG. 1) in TAg Jurkat cells (a
derivative of the human Tell leukemia line Jurkat stably
transfected with the SV40 large T antigen (Northrup, et al., J.
Biol. Chem. [1993]). Each reporter plasmid contains a multimerized
oligonucleotide of the binding site for a distinct IL-2
enhancer-binding transcription factor within the context of the
minimal IL-2 promoter or, alternatively, the intact IL-2
enhancer/promoter upstream of the reporter gene. After 24 hours,
aliquots of cells (approximately 10.sup.5) were placed in
microtiter wells containing log dilutions of bound anti-TAC (CD25)
mAb (33B3.1; AMAC, Westbrook, Me.). As a positive control and to
control for transfection efficiency, ionomycin (1 .mu.m) and PMA
(25 ng/ml) were added to aliquots from each transfection. After an
additional 14 hour incubation, the supernatants were assayed for
the alkaline phosphatase activity and these activities were
expressed relative to that of the positive control samples. The
addition of 1 ng/ml FK506 dropped all activity due to NFAT to
background levels, demonstrating that deactivations are in the same
pathway as that blocked by FK506. Each data point obtained was the
average of two samples and the experiment was performed several
times with similar results. See FIG. 5. The data show that with a
known extracellular receptor, one obtains an appropriate response
with a reporter gene and different enhancers. Similar results were
obtained when a MAb against the TcR complex (i.e. OKT3) was
employed.
Example 2
Inhibitory Activity of the Immunosuppressant Drugs FK506 and
Cyclosporin A (CsA) or the Dimeric Derivative Compounds FK1012A
(8), FK1012B (5), and CsA Dimer (PB-1-218)
[0181] Ionomycin (1 .mu.m) and PMA (25 ng/rnl) were added to
10.sup.5 TAg-Jurkat cells. In addition, titrations of the various
drugs were added. After 5 hours the cells were lysed in mild
detergent (i.e. Triton X-100) and the extracts were incubated with
the .beta.-galactosidase substrate, MUG (methyl galactosidyl
umbelliferone) for 1 hour. A glycine/EDTA stop buffer was added and
the extracts assayed for fluorescence. Each data point obtained was
the average of two samples and the experiment was performed several
times with similar results. Curiously, FK1012B appears to augment
mitogen activity slightly at the highest concentration (i.e. 5
.mu.g/ml); however, a control experiment shows that FK1012B is not
stimulatory by itself. See FIG. 6.
Example 3
Activity of the Dimeric FK506 Derivative, FK101A, on the Chimeric
FKBP12/CD3 (1FK3) Receptor
[0182] 5 .mu.g of the eukaryotic expression vector, pBJ5, (based on
pCDL-SR with a polylinker inserted between the 16S splice site and
the poly A site), containing the chimeric receptor (1FK3), was
co-transfected with 4 .mu.g of the NFAT-inducible secreted alkaline
phosphatase reporter plasmid, NFAT-SX. As a control, 5 .mu.g of
pBJ5 was used, instead of 1FK3/pBJ5, in a parallel transfection.
After 24 hours, aliquots of each transfection containing
approximately 10.sup.5 cells were incubated with log dilutions of
the drug, FK1012A, as indicated. As a positive control and to
control for transfection efficiency, ionomycin (1 .mu.m) and PMA
(25 ng/ml) were added to aliquots from each transfection. After an
additional 14 hour incubation, the supernatants were assayed for
alkaline phosphatase activity and these activities were expressed
relative to that of the positive control samples. The addition of 2
ng/ml FK506 dropped all stimulations to background levels,
demonstrating that the activations are in the same pathway as that
blocked by FK506. Hence, FK506 or cyclosporin will serve as
effective antidotes to the use of these compounds. Each data point
obtained was the average of two samples and the experiment was
performed several times with similar results. See FIG. 7.
Example 4A
Activity of the Dimeric FK506 Derivative, FK1012B, on the
Myristoylated Chimeric CD3/FKBP12 (MZF3E) Receptor
[0183] We have successfully demonstrated a number of approaches to
ligand design and syntheses, including positive results with
FK506-based HOD reagents named "FK1012"s. We have found that
FK1012s achieve high affinity, 2:1 binding stoichiometry
(K.sub.d(1)=0.1 nM; K.sub.d(2)=0.8 nM) and do not inhibit
calcineurin-mediated TCR signaling. The ligands are neither
"immunosuppressive" nor toxic (up to 0.1 mM in cell culture).
Similarly, we have prepared a cyclosporin A-based homodimerizing
agent, "(CsA)2" which binds to the CsA receptor, cyclophylin, with
1:2 stoichiometry, but which does not bind to calcineurin. Thus,
like FK1012s, (CsA)2 does not inhibit signalling pathways and is
thus neither immunosuppressive nor toxic.
[0184] These and other of our examples of ligand-mediated protein
association resulted in the control of a signal transduction
pathway. In an illustrative case, this was accomplished by creating
an intracellular receptor comprised of a small fragment of Src
sufficient for posttranslational myristoylation (M), the
cytoplasmic tail of zeta (Z; a component of the B cell receptor was
also used), three consecutive FKBP12s (F3) and a flu epitope tag
(E). Upon expressing the construct MZF3E (FIG. 18) in human
(Jurkat) T cells, we confirmed that the encoded chimeric protein
underwent FK1012-mediated oligomerization. The attendant
aggregation of the zeta chains led to signaling via the endogenous
TCR-signaling pathway (FIG. 15), as evidenced by secretion of
alkaline phosphatase (SEAP) in response to an FK1012 (EC.sub.50=50
nM). The promoter of the SEAP reporter gene was constructed to be
transcriptionally activated by nuclear factor of activated T cells
(NFAT), which is assembled in the nucleus following TCR-signaling.
FK1012-induced signaling can be terminated by a deaggregation
process induced by a nontoxic, monomeric version of the ligand
called FK506-M.
[0185] Specifically, 5 .mu.g of the eukaryotic expression vector,
pBJ5, containing a myristoylated chimeric receptor was
co-transfected with 4 .mu.g NFAT-SX. MZE, MZF1E, MZF2E and MZF3E
contain 0, 1, 2, or 3 copies of FKBP12, respectively, downstream of
a myristoylated CD3 cytoplasmic domain (see FIG. 2). As a control,
5 .mu.g of pBJ5 was used in a parallel transfection. After 24
hours, aliquots of each transfection containing approximately
10.sup.5 cells were incubated with log dilutions of the drug,
FK1012B, as indicated. As a positive control and to control for
transfection efficiency, ionomycin (1 .mu.m) and PMA (25 ng/ml)
were added to aliquots from each transfection. After an additional
12 hour incubation, the supernatants were assayed for alkaline
phosphatase activity and these activities were expressed relative
to that of the positive control samples. The addition of 1 ng/ml
FK506 dropped all stimulations to near background levels,
demonstrating that the activations are in the same pathway as that
blocked by FK506. This result is further evidence of the
reversibility of the subject cell activation. Each data point
obtained was the average of two samples and the experiment was
performed several times with similar results. See FIG. 8. The
myristoylated derivatives respond to lower concentrations of the
ligand by about an order of magnitude and activate NF-AT dependent
transcription to comparable levels, but it should be noted that the
ligands are different. Compare FIGS. 7 and 8.
[0186] In vivo FK1012-induced protein dimerization We next wanted
to confirm that intracellular aggregation of the MZF3E receptor is
indeed induced by the FK1012. The influenza haemagglutinin
epitope-tag (flu) of the MZF3E-construct was therefore exchanged
with a different epitope-tag (flag-M2). The closely related
chimeras, MZF3E.sub.flu and MZF3E.sub.flag, were coexpressed in
Jurkat T cells. Immunoprecipitation experiments using
anti-Flag-antibodies coupled to agarose beads were performed after
the cells were treated with FK1012A. In the presence of FK1012A (1
.mu.M) the protein chimera MZF3E.sub.flag interacts with
MZF3E.sub.flu and is coimmunoprecipitated with MZF3E.sub.flag. In
absence of FK1012A, no coimmunoprecipitation of MZF3E.sub.flu is
observed. Related experiments with FKBP monomer constructs
MZF1E.sub.flu and MZF1E.sub.flag, which do not signal, revealed
that they are also dimerized by FK1012A (FIG. 19A). This reflects
the requirement for aggregation observed with both the endogenous T
cell receptor and our artificial receptor MZF3E.
[0187] FK1012-induced protein-tyrosine phosphorylation The
intracellular domains of the TCR, CD3 and zeta-chains interact with
cytoplasmic protein tyrosine kinases following antigen stimulation.
Specific members of the Src family (lck and/or fyn) phosphorylate
one or more tyrosine residues of activation motifs within these
intracellular domains (tyrosine activation motif, TAM). The
tyrosine kinase ZAP-70 is recruited (via its two SH2 domains) to
the tyrosine phosphorylated T-cell-receptor, activated, and is
likely to be involved in the further downstream activation of
phospholipase C. Addition of either anti-CD3 MAb or FK1012A to
Jurkat cells stably transfected with MZF3E resulted in the
recruitment of kinase activity to the zeta-chain as measured by an
in vitro kinase assay following immunoprecipitation of the
endogenous T cell receptor zeta chain and the MZF3E-construct,
respectively. Tyrosine phosphorylation after treatment of cells
with either anti-CD3 MAb or FK1012 was detected using monoclonal
alpha-phosphotyrosine antibodies. Whole cell lysates were analysed
at varying times after stimulation. A similar pattern of
tyrosine-phosphorylated proteins was observed after stimulation
with either anti-CD3 MAb or FK1012. The pattern consisted of a
major band of 70 kDa, probably ZAP-70, and minor bands of 120 kDa,
62 kDa, 55 kDa and 42 kDa.
Example 4(B)
Regulation of Programmed Cell Death with Immunophilin-Fas Antigen
Chimeras
[0188] The Fas antigen is a member of the nerve growth factor
(NGF)/tumor necrosis factor (TNF) receptor superfamily of cell
surface receptors. Crosslinking of the Fas antigen with antibodies
to its extracellular domain activates a poorly understood signaling
pathway that results in programmed cell death or apoptosis. The Fas
antigen and its associated apoptotic signaling pathway are present
in most cells including possibly all tumor cells. The pathway leads
to a rapid and unique cell death (2 h) that is characterized by
condensed cytoplasm, the absence of an inflammatory response and
fragmentation of nucleosomal DNA, none of which are seen in
necrotic cell death.
[0189] We have also developed a second, inducible signaling system
that leads to apoptotic cell death. Like the MZF3E pathway, this
one is initiated by activating an artificial receptor that is the
product of a constitutively expressed "responder" gene. However,
the new pathway differs from the first in that our HOD reagents
induce the synthesis of products of an endogenous pathway rather
than of the product of a transfected, inducible (e.g., reporter)
gene.
[0190] Gaining control over the Fas pathway could have important
implications for biological research and medicine in the future.
Transgenic animals might be created with "death" responder genes
under the control of cell-specific promoters. Target cells could
then be chemically ablated in the adult animal by treating it with
a HOD reagent. In this way, the role of specific brain cells in
memory or cognition or immune cells in the induction and
maintenance of autoimmune disorders could be assessed. Death
responder genes might be introduced into tumors using the human
gene therapy technique developed by M. Blaese and co-workers
(Culver et al, Science 256 5063 (1992): 1550-2) and then
subsequently activated by treating the patient with a HOD reagent
(in analogy to the "gancyclovir" gene therapy clinical trials
recently reported for the treatment of brain tumors). Finally, we
contemplate a component of gene therapy in the future that would
involve the coadministration of a death-responder gene together
with the therapeutic gene. This would provide a "failsafe"
component to gene therapy. If something were to go awry (a commonly
discussed concern is an integration-induced loss of a tumor
suppressor gene leading to cancer), the gene therapy patient could
take a "failsafe" pill that would kill all transfected cells. This
concept caused us to focus on the development of an orthogonal
system of HOD reagents. Thus, we desired a second set of reagents
that have no possibility of cross-reacting with the first, which
would be used to turn on or off the transcription of therapeutic
genes.
[0191] A chimeric cDNA has been constructed consisting of three
FKBP12 domains fused to the cytoplasmic signaling domain of the Fas
antigen FIG. 20). This construct, when expressed in human Jurkat
and murine D10 T cells, can be induced to dimerize by an FK1012
reagent and initiate a signaling cascade resulting in
FK1012-dependent apoptosis. The LD.sub.50 for FK1012A-mediated
death of cells transiently transfected with MFF3E is 15 nM as
determined by a loss of reporter gene activity (FIG. 20; for a
discussion of the assay, see legend to FIG. 21). These data
coincide with measurements of cell death in stably transfected cell
lines. Since the stable transfectants represent a homogeneous
population of cells, they have been used to ascertain that death is
due to apoptosis rather than necrosis (membrane blebbing,
nucleosomal DNA fragmentation). However, the transient transfection
protocol requires much less work and has therefore been used as an
initial assay system, as described below.
Example 4(C)
Regulation of Programmed Cell Death with Cyclophilin-Fas Antigen
Chimeras
[0192] We have also prepared a series of cyclophilin C-Fas antigen
constructs and assayed their ability to induce (CsA)2-dependent
apoptosis in transient expression assays (FIG. 21A). In addition,
(CsA)2-dependent apoptosis has been demonstrated with human Jurkat
T cells stably transfected with the most active construct in the
series, MC3FE (M=myristoylation domain of Src, C=cyclophilin
domain, F=cytoplasmic tail of Fas, E=flu epitope tag). The
cytoplasmic tail of Fas was fused either before of after 1, 2, 3,
or 4 consecutive cyclophilin domains. Two control constructs were
also prepared that lack the Fas domain. In this case we observed
that the signaling domain functions only when placed after the
dimerization domains. (The zeta chain constructs signal when placed
either before or after the dimerization domains.) Both the
expression levels of the eight signaling constructs, as ascertained
by Western blotting, and their activities differed quantitatively
(FIG. 21B). The optimal system has thus far proved to be MC3FE. The
LD.sub.50 for (CsA)2-mediated cell death with MC3FE is .about.200
nM. These data demonstrate the utility of the
cyclophilin-cyclosporin interactions for regulating intracellular
protein association and illustrate an orthogonal reagent system
that will not cross-react with the FKBP12-FK1012 system. Further,
in this case, the data show that only dimerization and not
aggregation is required for initiation of signal transduction by
the Fas cytoplasmic tail.
[0193] Mutation of the N-terminal glycine of the myristoylation
signal to an alanine prevents myristoylation and hence membrane
localization. We have also observed that the mutated construct
(.DELTA.MFF3E) was equally potent as an inducer of FK1012-dependent
apoptosis, indicating that membrane localization is not necessary
for Fas-mediated cell death.
Example 5
Construction of Murine Signalling Chimeric Protein
[0194] The various fragments were obtained by using primers
described in FIG. 4. In referring to primer numbers, reference
should be made to FIG. 4.
[0195] An approximately 1.2 kb cDNA fragment comprising the I-E
chain of the murine class II MHC receptor (Cell, 32, 745) was used
as a source of the signal peptide, employing P#6048 and P#6049 to
give a 70 bp SacII-XhoI fragment using PCR as described by the
supplier (Promega). A second fragment was obtained using a plasmid
comprising Tac (IL2 receptor chain) joined to the transmembrane and
cytoplasmic domains of CD3 (PNAS, 88, 8905). Using P#6050 and
P#6051, a 320 bp XhoI-EcoRI fragment was obtained by PCR comprising
the transmembrane and cytoplasmic domains of CD3. These two
fragments were ligated and inserted into a SacII-EcoRI digested
pBluescript (Stratagene) to provide plasmid, SPZ/KS.
[0196] To obtain the binding domain for FK506, plasmid rhFKBP
(provided by S. Schreiber, Nature (1990) 346, 674) was used with
P#6052 and P#6053 to obtain a 340 bp XhoI-SalI fragment containing
human FKBP12. This fragment was inserted into pBluescript digested
with XhoI and SalI to provide plasmid FK12/KS, which was the source
for the FKBP12 binding domain. SPZ/KS was digested with XhoI,
phosphatased (cell intestinal alkaline phosphatase; CIP) to prevent
self-annealing, and combined with a 10-fold molar excess of the
XhoI-SalI FKBP12-containing fragment from FK12/KS. Clones were
isolated that contained monomers, dimers, and trimers of FKBP12 in
the correct orientation. The clones 1FK1/KS, 1FK2/KS, and 1FK3/KS
are comprised of in the direction of transcription; the signal
peptide from the murine HC class II gene I-E, a monomer, dimer or
trimer, respectively, of human FKBP12, and the transmembrane and
cytoplasmic portions of CD3. Lastly, the SacII-EcoRI fragments were
excised from pBluescript using restriction enzymes and ligated into
the polylinker of pBJ5 digested with SacII and EcoRI to create
plasmids 1FK1/pBJ5, 1FK2/pBJ5, and 1FK3/pBJ5, respectively. See
FIGS. 3 and 4.
Example 6
A. Construction of Intracellular Signaling Chimera.
[0197] A myristoylation sequence from c-src was obtained from
Pellman, et al., Nature 314, 374, and joined to a complementary
sequence of CD3 to provide a primer which was complementary to a
sequence 3' of the transmembrane domain, namely P#8908. This primer
has a SacII site adjacent to the 5' terminus and a XhoI sequence
adjacent to the 3' terminus of the myristoylation sequence. The
other primer P#8462 has a SalI recognition site 3' of the sequence
complementary to the 3' terminus of CD3, a stop codon and an EcoRI
recognition site. Using PCR, a 450 bp SacII-EcoRI fragment was
obtained, which was comprised of the myristoylation sequence and
the CD3 sequence fused in the 5' to 3' direction. This fragment was
ligated into SacII/EcoRI-digested pBJ5(XhoI)(SalI) and cloned,
resulting in plasmid MZ/pBJ5. Lastly, MZ/pBJ5 was digested with
SalI, phosphatased, and combined with a 10-fold molar excess of the
XhoI-SalI FKBP12-containing fragment from FK12/KS and ligated.
After cloning, the plasmids comprising the desired constructs
having the myristoylation sequence, CD3 and FKBP12 multimers in the
5'-3' direction were isolated and verified as having the correct
structure. See FIGS. 2 and 4.
B. Construction of Expression Cassettes for Intracellular Signaling
Chimeras
[0198] The construct MZ/pBJ5 (MZE/pBJ5) is digested with
restriction enzymes XhoI and SalI, the TCR .zeta. fragment is
removed and the resulting vector is ligated with a 10 fold excess
of a monomer, dimer, trimer or higher order multimer of FKBP12 to
make MF1E, MF2E, MF3E or MF.sub.nE/pBJ5. Active domains designed to
contain compatible flanking restriction sites (i.e. XhoI and SalI)
can then be cloned into the unique XhoI or SalI restriction sites
of MF.sub.nE/pBJ5.
Example 7
Construction of Nuclear Chimera
[0199] A. GAL4 DNA binding domain--FKBP domain(s)--epitope tag. The
GAL4 DNA binding domain (amino acids 1-147) was amplified by PCR
using a 5' primer (#37) that contains a SacII site upstream of a
Kozak sequence and a translational start site, and a 3' primer
(#38) that contains a SalI site. The PCR product was isolated,
digested with SacII and SaII, and ligated into pBluescript II KS
(+) at the SacII and SalI Sites, generating the construct pBS-GAL4.
The construct was verified by sequencing. The SacII/SaII fragment
from pBS-GAL4 was isolated and ligated into the IFK1/pBJ5 and
IFK3/pBJ5 constructs (containing the myristoylation sequence, see
Example 6) at the SacII and Xhol sites, generating constructs GF1E,
GF2E and GF3E.
[0200] 5' end of PCR amplified product: TABLE-US-00002 SacII
|----Gal4 (1-147) --->> .sub.------------ M K L L S S I 5'
CGACACCGCGGCCACCATGAAGCTACTGTCTTCTATCG .sub.-------- Kozak
[0201] 3' end of PCR amplified product: TABLE-US-00003
<<----Gal4 (1-147----) | R Q L T V S 5'
GACAGTTGACTGTATCGGTCGACTGTCG 3' CTGTCAACTGACATAGCCAGCTGACAGC
.sub.-------------- SalI
[0202] B. HNF1 dimerization/DNA binding domain--FKBP
domain(s)--tag. The HNF1a dimerization/DNA binding domain (amino
acids 1-282) was amplified by PCR using a 5' primer (#39) that
contains a SacII site upstream of a Kozak sequence and a
translational start site, and a 3' primer (#40) that contains a
SalI site. The PCR product was isolated, digested with SacII and
SalI, and ligated into pBluescript II KS (+) at the SacII and SalI
sites, generating the construct pBS-HNF. The construct was verified
by sequencing. The SacII/SalI fragment from pBS-HNF was isolated
and ligated into the IFK1/pBJ5 and IFK3/pBJ5 constructs at the
SacII and XhoI sites, generating constructs HF1E, HF2E and
HF3E.
[0203] 5' end of PCR amplified product: TABLE-US-00004 SacII
|--HNF1 (1-281) -->> .sub.------------ M V S K L S 5'
CGACACCGCGGCCACCATGGTTTCTAAGCTGAGC .sub.-------- Kozak
[0204] 3' end of PCR amplified product: TABLE-US-00005 <<----
HNF1 (1-282) ----| A F R H K L 5' CCTTCCGGCACAAGTTGGTCGACTGTCG 3'
GGAAGGCCGTGTTCAACCAGCTGACAGC .sub.------------ SalI
[0205] C. FKBP domain(s)-VP16 transcrip. activation
domain(s)-epitope tag.
[0206] These constructs were made in three steps: (i) a construct
was created from IFK3/pBJ5 in which the myristoylation sequence was
replaced by a start site immediately upstream of an XhoI site,
generating construct SF3E; (ii) a nuclear localization sequence was
inserted into the XhoI site, generating construct NF3E; (iii) the
VP16 activation domain was cloned into the SalI site of NF3E,
generating construct NF3V1E.
[0207] (i). Complementary oligonucleotides (#45 and #46) encoding a
Kozak sequence and start site flanked by SacII and XhoI sites were
annealed, phosphorylated and ligated into the SacII and XhoI site
of MF3E, generating construct SF3E.
[0208] Insertion of Generic Start Site TABLE-US-00006 Kozak
.sub.--------M L E 5' GGCCACCATGC 3' CGCCGGTGGTACGAGCT .sub.----
.sub.-------- SacII XhoI overhang overhang
[0209] (ii). Complementary oligonucleotides (#47 and #48) encoding
the SV40 T antigen nuclear localization sequence flanked by a 5'
SalI site and a 3' XhoI site were annealed, phosphorylated and
ligated into the XhoI site of SF1E, generating the construct NF1E.
The construct was verified by DNA sequencing. A construct
containing the mutant or defective form of the nuclear localization
sequence, in which a threonine is substituted for the lysine at
position 128, was also isolated. This is designated NF1E-M.
Multimers of the FKBP12 domain were obtained by isolating the
FKBP12 sequence as an XhoI/SalI fragment from pBS-FKBP12 and
ligating this fragment into NF1E linearized with XhoI. This
resulted in the generation of the constructs NF2E and NF3E.
[0210] Insertion of NLS into Generic Start Site TABLE-US-00007 T
(ACN) 126 132 L D P K K K R K V L E 5' TCGACCCTAAGAAGAAGAGAAAGGTAC
3' GGGATTCTTCTTCTCTTTCCATGAGCT .sub.---------- .sub.---------- SalI
XhoI
[0211] Threonine at position 128 results in a defective NLS.
[0212] (iii). The VP16 transcriptional activation domain (amino
acids 413-490) was amplified by PCR using a 5' primer (#43) that
contains SalI site and a 3' primer (#44) that contains an XhoI
site. The PCR product was isolated, digested with SalI and XhoI,
and ligated into MF3E at the XhoI and SalI sites, generating the
construct MV1E. The construct was verified by sequencing.
Multimerized VP16 domains were created by isolating the single VP16
sequence as a XhoI/SalI fragment from MV1E and ligating this
fragment into MV1E linearized with XhoI. Constructs MV2E, MV3E and
MV4E were generated in this manner. DNA fragments encoding one or
more multiple VP16 domains were isolated as XhoI/SalI fragments
from MV1E or MV2E and ligated into NF1E linearized with SalI,
generating the constructs NF1V1E and NF1V3E. Multimers of the
FKBP12 domain were obtained by isolating the FKBP12 sequence as an
XhoI/SalI fragment from pBS-FKBP12 and ligating this fragment into
NF1V1E linearized with XhoI. This resulted in the generation of the
constructs NF2V1E and NF3V1E.
[0213] 5' end of PCR amplified product: TABLE-US-00008 SalI |--VP16
(413-490) --->> .sub.------------ A P P T D V 5'
CGACAGTCGACGCCCCCCCGACCGATGTC
[0214] 3' end of PCR amplified product: TABLE-US-00009 <<--
VP16 (413-490) ----| D E Y G G 5' GACGAGTACGGTGGGCTCGAGTGTCG 3'
CTGCTCATGCCACCCGAGCTCACAGC .sub.------------ Xhol
[0215] Oligonucleotides: TABLE-US-00010 #37 38mer/0.2
5'CGACACCGCGGCCACCATGAAGCTACTGTCTT um/OFF CTATCG #38 28mer/0.2
5'CGACAGTCGACCGATACAGTCAACTGTC um/OFF #39 34mer/0.2
5'CGACACCGCGGCCACCATGGTTTCTAAGCTGAGC um/OFF #40 28mer/0.2
5'CGACAGTCGACCAACTTGTGCCGGAAGG um/OFF #43 29mer/0.2
5'CGACAGTCGACGCCCCCCCGACCGATGTC um/OFF #44 26mer/0.2
5'CGACACTCGAGCCCACCGTACTCGTC um/OFF #45 26mer/0.2 5'GGCCACCATGC
um/OFF #46 18mer/0.2 5'TCGAGCATGGTGGCCGC um/OFF #47 27mer/0.2
5'TCGACCCTAAGA-(C/A)-GAAGAGAAAGGTAC um/OFF #48 27mer/0.2
5'TCGAGTACCTTTCTCTTC-(G/T)-TCTTAGGG um/OFF
Example 8
Demonstration of Transcriptional Induction
[0216] Jurkat TAg cells were transfected with the indicated
constructs (5 .mu.g of each construct) by electroporation (960
.mu.F, 250 v). After 24 hours, the cells were resuspended in fresh
media and aliquoted. Half of each transfection was incubated with
the dimeric FK506 derivative, (Example 14) at a final concentration
of 1 .mu.M. After 12 hours, the cells were washed and cellular
extracts were prepared by repeated freeze-thaw. Chloramphenicol
acetyltransferase (CAT) activity was measured by standard
protocols. Molecular Cloning: A Laboratory Manual, Sambrook et al.
eds. (1989) CSH Laboratory, pp. 16-59 ff. The data (FIG. 22)
demonstrates CAT activity present in 70 .mu.L of extract (total
extract volume was 120 .mu.L) after incubation at 37.degree. C. for
18 hours. The samples employed in the assays are as follows: [0217]
1. G5E4TCAT (GAL4-CAT reporter plasmid) [0218] 2. G5E4TCAT,
GAL4-VP16 [0219] 3. G5E4TCAT, NF3V1E [0220] 4. G5E4TCAT, GF2E
[0221] 5. G5E4TCAT, GF2E, NF3V1E [0222] 6. G5E4TCAT, GF3E, NF3V1E
Synthetic Chemistry Examples
[0223] As indicated elsewhere, compounds of particular interest at
present as oligomerization agents have the following structure:
linker-{rbm.sub.1,rbm.sub.2, . . . rbm.sub.n}.
[0224] wherein "linker" is a linker moiety such as described herein
which is covalently linked to "n" (an integer from 2 to about 5,
ususally 2 or 3) receptor binding moieties ("rbm"'s) which may be
the same or different. As discussed elsewhere herein, the receptor
binding moiety is a ligand (or analog thereof) for a known
receptor, such as are enumerated in Section V(C), and including
FK506, FK520, rapamycin and analogs thereof which are capable of
binding to an FKBP; as well as cyclosporins, tetracyclines, other
antibiotics and macrolides and steroids which are capable of
binding to respective receptors.
[0225] The linker is a bi- or multi-functional molecule capable of
being covalently linked ("-") to two or more receptor binding
moieties. Illustrative linker moieties are disclosed in Section
VI(A) and in the various Examples and include among others C2-C20
alkylene, C4-C18 azalkylene, C6-C24 N-alkylene azalkylene, C6-C18
arylene, C8-C24 ardialkylene and C8-C36 bis-carboxamido
alkylene.
[0226] These compounds may be prepared using commercially available
materials and/or procedures known in the art. Engineered receptors
for these compounds may be obtained as described infra. Compounds
of particular interest are those which bind to a receptor with a Kd
of less than 10.sup.-6, preferably less than about 10.sup.-7 and
even more preferably, less than 10.sup.-8.
[0227] One subclass of oligomerizing agents of interest are those
in which one or more of the receptor binding moieties is FK506, an
FK-506-type compound or a derivative thereof, wherein the receptor
binding moieties are covalently attached to the linker moiety
through the allyl group at C21 (using FK506 numbering) as per
compound 5 or 13 in FIG. 23A, or through the cyclohexyl ring
(C29-C34), e.g. through the C32 hydroxyl as per compounds 8, 16, 17
in FIG. 23B. Compounds of this class may be prepared by adaptation
of methods disclosed herein, including in the examples which
follow.
[0228] Another subclass of oligomerizing agents of interest are
those in which at least one of the receptor binding moieties is
FK520 or a derivative thereof, wherein the molecules of FK520 or
derivatives thereof are covalently attached to the linker moiety as
in FK1040A or FK 1040B in FIG. 10. Compounds of this class may be
prepared by adaptation of Scheme 1 in FIG. 10, Scheme 2 in FIGS.
11A and 11B or Scheme 3 in FIG. 12 and FIG. 13.
[0229] A further subclass of oligomerizing agents of interest are
those in which at least one of the receptor binding moieties is
cyclosporin A or a derivative.
[0230] It should be appreciated that these and other oligomerizing
agents of this invention may be homo-oligomerizing reagents (where
the rbm's are the same) or hetero-oligomerizing agents (where the
rbm's are different). Hetero-oligomerizing agents may be prepard by
analogy to the procedures presented herein, including Scheme 3 in
FIG. 13 and as discussed elsewhere herein.
[0231] The following synthetic examples are intended to be
illustrative.
[0232] A. General Procedures. All reactions were performed in
oven-dried glassware under a positive pressure of nitrogen or
argon. Air and moisture sensitive compounds were introduced via
syringe or cannula through a rubber septum.
[0233] B. Physical Data. Proton magnetic resonance spectra (.sup.1H
NMR) were recorded on Bruker AM-500 (500 MHz), and AM400 (400 MHz)
spectrometers. Chemical shifts are reported in ppm from
tetramethylsilane using the solvent resonance as an internal
standard (chloroform, 7.27 ppm). Data are reported as follows:
chemical shift, multiplicity (s=singlet, d=doublet, t=triplet,
q=quartet, br=broadened, m=multiplet), coupling constants (Hz),
integration. Low and high-resolution mass spectra were
obtained.
[0234] C Chromatography. Reactions were monitored by thin layer
chromatography (TLC) using E. Merck silica gel 60F glass plates
(0.25 mm). Components were visualized by illumination with long
wave ultraviolet light, exposed to iodine vapor, and/or by dipping
in an aqueous ceric ammonium molybdate solution followed by
heating. Solvents for chromatography were HPLC grade. Liquid
chromatography was performed using forced flow (flash
chromatography) of the indicated solvent system on E. Merck silica
gel 60 (230-400 mesh).
[0235] D. Solvents and Reagents. All reagents and solvents were
analytical grade and were used as received with the following
exceptions. Tetrahydrofuran (THF), benzene, toluene, and diethyl
ether were distilled from sodium metal benzophenone ketyl.
Triethylamine and acetonitrile were distilled from calcium hydride.
Dichloromethane was distilled from phosphorous pentoxide.
Dimethylformamide (DMF) was distilled from calcium hydride at
reduced pressure and stored over 4 .ANG. molecular sieves.
Preparation of FK506 Derivatives
Example 9
Hydroboration/Oxidation of FK506-TBS.sub.2 (1 to 2)
[0236] The hydroboration was performed according to the procedure
of Evans (Evans, et al., JACS (1992) 114, 6679; ibid. (1992)
6679-6685). (See Harding, et al., Nature (1989) 341, 758 for
numbering.) A 10-mL flask was charged with
24,32-bis[(tert-butyldimethylsilyl)oxy]-FK506 (33.8 mg, 0.033 mmol)
and [Rh(nbd)(diphos-4)]BF.sub.4(3.1 mg, 0.004 mmol, 13 mol %). The
orange mixture was dissolved in toluene (2.0 mL) and the solvent
was removed under reduced pressure over four hours. The flask was
carefully purged with nitrogen and the orangish oil was dissolved
in THF (3.0 mL, 10 mM final concentration) and cooled to 0.degree.
C. with an ice water bath. Catecholborane (98 .mu.L, 0.098 mmol,
1.0 M solution in THF, 3.0 equiv.) was added via syringe and the
resulting solution was stirred at 0.degree. C. for 45 min. The
reaction was quenched at 0.degree. C. with 0.2 mL of THF/EtOH (1:1)
followed by 0.2 mL of pH 7.0 buffer (Fisher; 0.05 M phosphate) then
0.2 mL of 30% H.sub.2O.sub.2. The solution was stirred at room
temperature for at least 12 h. The solvent was removed under
reduced pressure and the remaining oil was dissolved in benzene (10
mL) and washed with saturated aqueous sodium bicarbonate solution
(10 mL). The phases were separated and the aqueous phase was
back-extracted with benzene (2.times.10 mL). The organic phases
were combined and washed once with saturated aqueous sodium
bicarbonate solution (10 mL). The benzene phase was dried with
MgSO.sub.4, concentrated, and subjected to flash chromatography
(2:1 hexane:ethyl acetate) providing the desired primary alcohol as
a clear, colorless oil (12.8 mg, 0.012 mmol, 37%).
[0237] Preparation of Mixed Carbonate (2 to 3). The preparation of
the mixed carbonate was accomplished by the method of Ghosh (Ghosh,
et al., Tetrahedron Lett. (1992) 33, 2781-2784). A 10-mL flask was
charged with the primary alcohol (29.2 mg, 0.0278 mmol) and benzene
(4 mL). The solvent was removed under reduced pressure over 60 min.
The oil was dissolved in acetonitrile (2.0 mL, 14 mM final
concentration) and stirred at 20.degree. C. as triethylamine (77
.mu.L, 0.56 mmol) was added. N,N'-disuccinimidyl carbonate (36 mg,
0.14 mmol) was added in one portion and the solution was stirred at
20.degree. C. for 46 h. The reaction mixture was diluted with
dichloromethane and washed with saturated aqueous sodium
bicarbonate solution (10 mL). The phases were separated and the
aqueous layer was back-extracted with dichloromethane (2.times.10
mL). The organic phases were combined and dried (MgSO.sub.4),
concentrated, and subjected to flash chromatography (3:1 to 2:1 to
1:1 hexane:ethyl acetate). The desired mixed carbonate was isolated
as a clear, colorless oil (16.8 mg, 0.014 mmol, 51%).
[0238] Dimerization of FK506 (3 to 4). A dry, 1-mL conical glass
vial (Kontes Scientific Glassware) was charged with the mixed
carbonate (7.3 mg, 0.0061 mmol) and acetonitrile (250 .mu.L, 25 mM
final concentration). Triethylamine (10 .mu.L, 0.075 mmol) was
added followed by p-xylylenediamine (8.3 .mu.L, 0.0027 mmol, 0.32 M
solution in DMF). The reaction stirred 22 h at 20.degree. C. and
was quenched by dilution with dichloromethane (10 mL). The solution
was washed with saturated aqueous sodium bicarbonate solution (10
mL). The phases were separated and the aqueous layer was
back-extracted with dichloromethane (2.times.10 mL). The organic
phases were combined and dried (MgSO.sub.4), concentrated, and
subjected to flash chromatography (3:1 to 2:1 to 1:1 hexane:ethyl
acetate) providing the desired protected dimer as a clear,
colorless oil (4.3 mg, 1.9 .mu.mol, 70%).
[0239] Deprotection of the FK506 Dimer (4 to 5). The protected
dimer (3.3 mg, 1.4 .mu.mol) was placed in a 1.5-mL polypropylene
tube fitted with a spin vane. Acetonitrile (0.5 mL, 3 mM final
concentration) was added and the solution stirred at 20.degree. C.
as HF (55 .mu.L, 48% aqueous solution; Fisher) was added. The
solution was stirred 18 h at room temperature. The deprotected
FK506 derivative was then partitioned between dichloromethane and
saturated aqueous sodium bicarbonate in a 15-mL test tube. The tube
was vortexed extensively to mix the phases and, after separation,
the organic phase was removed with a pipet. The aqueous phase was
back-extracted with dichloro-methane (4.times.2 mL), and the
combined organic phases were dried (MgSO.sub.4), concentrated and
subjected to flash chromatography (1:1:1 hexane:THF:ether to 1:1
THF:ether) providing the desired dimer as a clear, colorless oil
(1.7 mg, 0.93 .mu.mol, 65%).
[0240] Following the above procedure, other monoamines and diamines
may be used, such as benzylamine (14) octamethylenediamine,
decamethylenediamine, etc.
Example 10
Reduction of FK506 with L-Selectride (FK506 to 6)
[0241] Danishefsky and coworkers have shown that the treatment of
FK506 with L-Selectride provides 22-dihydro-FK506 with a boronate
ester engaging the C24 and C22 hydroxyl groups (Coleman and
Danishefsky, Heterocycles (1989) 28, 157-161; Fisher, et al., J.
Org. Chem. (1991) 56, 2900-2907).
[0242] Preparation of the Mixed Carbonate (6 to 7). A 10-mL flask
was charged with 22-dihydro-FK506-sec-butylboronate (125.3 mg,
0.144 mmol) and acetonitrile (3.0 mL, 50 mM final concentration)
and stirred at room temperature as triethylamine (200 .mu.L, 1.44
mmol, 10 equiv.) was added to the clear solution.
N,N'-disuccinimidyl carbonate (184.0 mg, 0.719 mmol) was added in
one portion, and the clear solution was stirred at room temperature
for 44 h. The solution was diluted with ethyl acetate (20 mL) and
washed with saturated aqueous sodium bicarbonate (10 mL) and the
phases were separated. The aqueous phase was then back-extracted
with ethyl acetate (2.times.10 mL), and the organic phases were
combined, dried (MgSO.sub.4), and the resulting oil was subjected
to flash chromatography (1:1 to 1:2 hexane:ethyl acetate) providing
the desired mixed carbonate as a clear, colorless oil (89.0 mg,
0.088 mmol, 61%).
[0243] Dimerization of FK506 Mixed Carbonate (7 to 8). A dry, 1-mL
conical glass vial (Kontes Scientific Glassware) was charged with
the mixed carbonate (15.0 mg, 0.0148 mmol) and dichloromethane (500
.mu.L, 30 mM final concentration). The solution was stirred at room
temperature as triethylamine (9 .mu.L, 0.067 mmol, 10 equiv.) was
added followed by p-xylylenediamine (0.8 mg, 0.0059 mmol). The
reaction stirred 16 h at 20.degree. C. and was quenched by dilution
with dichloromethane (5 mL). The solution was washed with saturated
aqueous sodium bicarbonate solution (5 mL). The phases were
separated and the aqueous layer was back-extracted with
dichloromethane (2.times.5 mL). The organic phases were combined
and dried (MgSO.sub.4), concentration, and subjected to flash
chromatography (1:1 to 1:2 hexane:ethyl acetate) providing the
desired dimer as a clear, colorless oil (7.4 mg, 3.8 .mu.mol,
65%).
[0244] Following the above procedure, other, monoamines, diamines
or triamines may be used in place of the xylylenediamine, such as
benzylamine (15), octylenediamine, decamethylenediamine (16),
bis-p-dibenzylamine, N-methyl diethyleneamine, tris-aminoethylamine
(17), tris-aminopropylamine, 1,3,5-triaminomethylcyclohexane,
etc.
Example 11
[0245] Oxidative Cleavage and Reduction of FK506 (1 to 9). The
osmylation was performed according to the procedure of Kelly
(VanRheenen, et al., Tetrahedron Lett. (1976) 17, 1973-1976). The
cleavage was performed according to the procedure of Danishefsky
(Zell, et al., J. Org. Chem. (1986) 51, 5032-5036). The aldehyde
reduction was performed according to the procedure of Krishnamurthy
(J. Org. Chem., (1981) 46, 4628-4691). A 10 mL flask was charged
with 24,32-bis[tert-butyldimethylsilyl)oxy]-FK506 (84.4 mg, 0.082
mmol), 4-methylmorpholine N-oxide (48 mg, 0.41 mmol, 5 equiv), and
THF (2.0 mL, 41 mM final concentration). Osmium tetroxide (45
.mu.L, 0.008 mmol, 0.1 equiv) was added via syringe. The clear,
colorless solution was stirred at room temperature for 5 hr. The
reaction was then diluted with 50% aqueous methanol (1.0 mL) and
sodium periodate (175 mg, 0.82 mmol, 10 equiv) was added in one
portion. The cloudy mixture was stirred 40 min at room temperature,
diluted with ether (10 mL), and washed with saturated aqueous
sodium bicarbonate solution (5 mL). The phases were separated and
the aqueous layer was back-extracted with ether (2.times.5 mL). The
combined organic layers were dried (MgSO.sub.4) and treated with
solid sodium sulfite (50 mg). The organic phase was then filtered
and concentrated and the oil was subjected to flash chromatography
(3:1 to 2:1 hexane:ethyl acetate) providing the intermediate,
unstable aldehyde (53.6 mg) as a clear, colorless oil. The aldehyde
was immediately dissolved in THF (4.0 mL) and cooled to -78.degree.
C. under an atmosphere of nitrogen, and treated with lithium
tris[(3-ethyl-3-pentyl)oxy]aluminum hydride (0.60 mL, 0.082 mmol,
0.14 M solution in THF, 1.0 equiv). The clear solution was allowed
to stir for 10 min at -78.degree. C. then quenched by dilution with
ether (4 mL) and addition of saturated aqueous ammonium chloride
(0.3 mL). The mixture was allowed to warm to room temperature and
solid sodium sulfate was added to dry the solution. The mixture was
then filtered and concentrated and the resulting oil was subjected
to flash chromatography (2:1 hexane:ethyl acetate) giving the
desired alcohol as a clear, colorless oil (395 mg, 0.038 mmol,
47%).
[0246] Preparation of Mixed Carbonate (9 to 10). The preparation of
the mixed carbonate was accomplished by the method of Ghosh, et
al., Tetrahedron Lett. (1992) 33, 2781-2784). A 10 mL flask was
charged with the primary alcohol (38.2 mg, 0.0369 mmol) and
acetonitrile (2.0 mL, 10 mM final concentration) and stirred at
room temperature as 2,6-lutidine (43 .mu.L, 0.37 mmol, 10 equiv)
was added. N,N'-disuccinimidyl carbonate (48 mg, 0.18 mmol) was
added in one portion and the solution was stirred at room
temperature for 24 h. The reaction mixture was diluted with ether
(10 mL) and washed with saturated aqueous sodium bicarbonate
solution (10 mL). The phases were separated and the aqueous layer
was back-extracted with ether (2.times.10 mL). The organic phases
were combined and dried (MgSO.sub.4), concentrated, and subjected
to flash chromatography (2:1 to 1:1 hexane:ethyl acetate). The
desired mixed carbonate was isolated as a clear, colorless oil
(32.6 mg, 0.028 mmol, 75%).
[0247] Preparation of Benzyl Carbamate (10 to 11). A dry, 1 mL
conical glass vial (Kontes Scientific Glassware) was charged with
the mixed carbonate 10 (8.7 mg, 0.0074 mmol) and acetonitrile (500
.mu.L, 15 mM final concentration). The solution was stirred at room
temperature as triethylamine (10 .mu.L, 0.074 mmol, 10 equiv) was
added followed by benzylamine (1.6 .mu.L, 0.015 mmol, 2 equiv). The
reaction stirred 4 h at room temperature. The solvent was removed
with a stream of dry nitrogen and the oil was directly subjected to
flash chromatography (3:1 to 2:1 hexane:ethyl acetate) providing
the desired protected monomer as a clear, colorless oil (6.2 mg,
5.3 .mu.mol, 72%).
[0248] The protected monomer (0.2 mg, 5.3 .mu.mol) was placed in a
1.5 mL polypropylene tube fitted with a spin vane. Acetonitrile
(0.5 mL, 11 mM final concentration) was added and the solution
stirred at room temperature as HF (55 .mu.L, 48% aqueous solution;
Fisher, 3.0 N final concentration) was added. The solution was
stirred 18 h at room temperature. The deprotected FK506 derivative
was then partitioned between dichloromethane and saturated aqueous
sodium bicarbonate in a 15 mL test tube. The tube was vortexed
extensively to mix the phases and, after separation, the organic
phase was removed with a pipet. The aqueous phase was
back-extracted with dichloromethane (4.times.2 mL), and the
combined organic phases were dried (MgSO.sub.4), concentrated and
subjected to flash chromatography (1:1 to 0:1 hexane:ethyl acetate)
providing for the desired deprotected benzylcarbamate as a clear,
colorless oil (3.9 mg, 4.1 .mu.mol, 78%).
[0249] By replacing the benzylamine with a diamine such as
xylylenediamine (12), hexamethylenediamine, octamethylenediamine,
decamethylenediamine (13) or other diamines, dimeric compounds of
the subject invention are prepared.
Example 12
Preparation of the Mixed Carbonate of FK506 (12)
[0250] A 10-mL flask was charged with 24, 32-bis
[(tert-butyldimethylsilyl)oxy]-FK506 (339.5 mg., 0.329 mmol),
4-methylmorpholine N-oxide (193 mg, 1.64 mmol, 5 equiv), water
(0.20 mL) and THF (8.0 mL, 41 mN final concentration). Osmium
tetroxide (0.183 mL, 0.033 mmol, 0.1 equiv, 0.18 M soln in water)
was added via syringe. The clear, colorless solution was stirred at
room temperature for 4.5 h. The reaction was diluted with 50%
aqueous methonol (4.0 mL) and sodium periodate (700 mg, 3.29 mmol,
10 equiv) was added in one portion. The cloudy mixture was stirred
25 min at room temperture, diluted with ether (20 mL), and washed
with saturated aqueous sodium bicarbonate solution (10 mL). The
phases were separated and the aqueous layer was back-extracted with
ether (2.times.10 mL). The combined organic layers were dried over
MgSO.sub.4 and solid sodium sulfite (50 mg). The organic phase was
then filtered and concentrated and the resulting aldehyde was
immediately dissolved in THF (8.0 mL) and cooled to -78.degree. C.
under an atmosphere of nitrogen, and treated with lithium tris
[(3-ethyl-3-pentyl)oxy]aluminum hydride (2.35 mL, 0.329 mmol, 0.14
M solution of THF, 1.0 equiv). The clear solution was allowed to
stir for 60 min at -78.degree. C. (monitored closely by TLC) then
quenched at -78.degree. C. by dilution with ether (5 mL) and
addition of saturated aqueous ammonium chloride (0.3 mL). The
mixture was allowed to warm to room temperature and solid sodium
sulfate was added to dry the solution. The mixture was stirred 20
min, filtered, concentrated, and the resulting oil was immediately
dissolved in acetonitrile (10 mL). To the solution of the resulting
primary alcohol in CH.sub.3CN was added 2,6-lutidine (0.380 mL,
3.3. mmol, 10 equiv) and N,N'-disuccinimidyl carbonate (420 mg,
1.65 mmol, 5 equiv). The heterogenous mixture was stirred at room
temperature for 19 h, at which time the solution was diluted with
ether (30 mL) and washed with saturated aqueous sodium bicarbonate
(20 mL). The aqueous phase was back-extracted with ether
(2.times.10 mL). The organic phases were combined and dried
(MgSO.sub.4), concentrated, and subjected to flash chromatography
(3:1 to 2:1 to 1:1 hexane/ethyl acetate). The desired mixed
carbonate 12 was isolated as a clear, colorless oil (217 mg, 0.184
mmol, 56% overall for 4 steps)
Example 13
Preparation of 24, 24', 32, 32'-tetrakis
[(tert-butyldimethylsilyl)oxy]-FK1012-A
[0251] (p-xylylenediamine bridge) A dry, 1-mL conical glass vial
was charged with the mixed carbonate (23.9 mg, 0.0203 mmol) and
acetonitrile (500 .mu.L, 41 mM final concentration). Triethylamine
(28 .mu.L, 0.20 mmol, 10 equiv) was added followed by
p-xylylenediamine (46 .mu.L, 0.0101 mmol, 0.22 M solution in DMF).
The reaction stirred 18 h at room temperature, the solvent was
removed with a stream of dry nitrogen, and the oil was directly
subjected to flash chromatography (3:1 to 2:1 to 1:1 hexane/ethyl
acetate) affording the desired protected dimer as a clear,
colorless oil (11.9 mg, 5.3 .mu.mol, 52%)
Example 14
Preparation of FK1012-A (p-xylylenediamine bridge) (13)
[0252] The protected dimer (11.0 mg, 4.9 .mu.mol) was placed in a
1.5-mL polypropylene tube fitted with a spin vane. Acetonitrile
(0.50 mL, 10 mM final concentration) was added, and the solution
stirred at 20.degree. C. as HF (55 .mu.L, 48% aqueous solution;
Fisher, 3.0 N final concentration) was added. The solution was
stirred 16 h at room temperature. The deprotected FK506 derivative
was then partitioned between dichloromethane and saturated aqueous
sodium bicarbonate in a 15-mL test tube. The tube was vortexed
extensively to mix the phases and, after separation, the organic
phase was removed with a pipet The aqueous phase was back-extracted
with dichloromethane (4.times.2 mL), and the combined organic
phases were dried (MgSO.sub.4), concentrated and subjected to flash
chromatography (1:1:1 hexane/THF/ether to 1:1 THF/ether) providing
FK1012-A as a clear, colorless oil (5.5 mg, 3.0 .mu.mol, 63%).
Example 15
Preparation of 24, 24', 32,
32'-tetrakis[(ter-butyldimethylsilyl)oxy]-FK1012-B (diaminodecane
bridge)
[0253] A dry, 1-mL conical glass vial was charged with the mixed
carbonate (53.3 mg, 0.0453 mmol) and acetonitrile (2.0 mL, 11 m M
final concentration). Triethylamine (16 .mu.L, 0.11 mmol, 5 equiv)
was added followed by diaminodecane (61 .mu.L, 0.0226 mmol, 0.37 M
solution in DMF). The reaction stirred 12 h at room temperature,
the solvent was removed with a stream of dry nitrogen, and the oil
was directly subjected to flash chromatography (3:1 to 2:1 to 1:1
hexane/ethyl acetate) affording the desired protected dimer as a
clear, colorless oil (18.0 mg, 7.8 .mu.mol, 35%).
Example 16
Preparation of FK1012-B (diaminodecane-1,10 bridge) (14)
[0254] The protected dimer (18.0 mg, 7.8 .mu.mol) was placed in a
1.5-mL polypropylene tube fitted with a stirring flea. Acetonitrile
(0.45 mL, 16 mM final concentration) was added, and the solution
sitrred at room temperature as HF (55 .mu.L, 48% aqueous solution;
Fisher, 3.6 N final concentration) was added. The solution was
stirred 17 h at 23.degree. C. The product FK1012-B was then
partitioned between dichloromethane and saturated aqueous sodium
bicarbonate in a 15-mL test tube. The tube was vortexed extensively
to mix the phases and, after separation, the organic phase was
removed with a pipet. The aqueous phase was back-extracted with
dichloromethane (4.times.2 mL), and the combined organic phases
were dried (MgSO.sub.4), concentrated and subjected to flash
chromatography (100% ethyl acetate to 20:1 ethyl acetate/methanol)
affording FK1012-B as a clear, colorless oil (5.3 mg, 2.9 .mu.mol,
37%).
Example 17
Preparation of 24, 24', 32,
32'-tetrakis[(tert-butyldimethylsilyl)oxy]-FK112-C
(his-p-aminomethylbenzoyl diaminodecane bridge)
[0255] A dry 25-mL tear-shaped flask was charged with the diamine
linker (15.1 mg, 0.0344 mmol) and 1.0 mL of DMF. In a separate
flask, the mixed carbonate and triethylamine (0.100 mL, 0.700 mmol,
20 equiv) were dissolved in 2.0 mL of dichloromethane then added
slowly (4.times.0.50 mL) to the stirring solution of
his-p-aminomethylbenzoyl, diaminodecane-1,10. The flask containing
the mixed carbonate 12 was washed with dichloromethane
(2.times.0.50 mL) to ensure complete transfer of the mixed
carbonate 12. The reaction stirred 16 h at 23.degree. C., the
solvent was removed with a stream of dry nitrogen, and the oil was
directly subjected to flash chromatography (1:1 to 1:2 hexane/ethyl
acetate) to afford the desired protected dimer as a clear,
colorless oil (29.6 mg, 11.5 .mu.mol, 34%).
Example 18
Preparation of FK1012-C (15)
[0256] The protected dimer (29.6 mg, 11.5 .mu.mol) (17) was placed
in a 1.5-mL polypropylene tube fitted with a stirring flea.
Acetonitrile (0.45 mL, 23 mM final concentration) was added, and
the solution stirred at room temperature as HF (55 .mu.L, 48%
aqueous solution; Fisher, 3.6 N final concentration) was added. The
solution was stirred 17 h at room temperature. The desired
symmetrical dimer was then partitioned between dichloromethane and
saturated aqueous sodium bicarbonate in a 15-mL test tube. The tube
was vortexed extensively to mix the phases and, after separation,
the organic phase was removed with a pipet. The aqueous phase was
back-extracted with dichloromethane (4.times.2 mL), and the
combined organic phases were dried (MgSO.sub.4), concentrated and
subjected to flash chromatography (100% ethyl acetate to 15:1 ethyl
acetate/methanol) affording FK1012-C as a clear, colorless oil
(11.5 mg, 5.5 .mu.mol, 47%).
Preparation of CsA Derivatives
Example 19
MeBmt(OAc) --OH.sup.1CsA (2)
[0257] MeBmt(OAc) --OAc.sup.1-CsA (1) (161 mg, 124 nmol) (see
Eberle and Nuninger, J. Org. Chem. (1992) 57, 2689) was dissolved
in Methanol (10 mL). KOH (196 mg) was dissolved in water (8 mL).
297 mL of the KOH solution (0.130 mmol, 1.05 eq.) was added to the
solution of (1) in MeOH. This new solution was stirred at room
temperature under an inert atmosphere for 4 hours at which time the
reaction was quenched with acetic acid (2 mL). The reaction mixture
was purified by reversed phase HPLC using a 5 cm.times.25 cm,
12.mu., 100 A, C18 column at 70.degree. C. eluting with 70%
acetonitrile/H.sub.2O containing 0.1% (v/v) Trifluoroacetic acid to
give 112 mg (72%) of the desired monoacetate (2).
[0258] MeBmt(OAc) --OCOIm.sup.1CsA (3). MeBmt(OAc) --OH.sup.1-CsA
(2) (57 mg, 45.5 .mu.mol) and carbonyldiimidazole (15 mg, 2 eq., 91
.mu.mol.) were transferred into a 50 mL round bottom flask and
dissolved in dry ThF (6 mL). Diisopropylethylamine (32 .mu.L, 4
eq., 182 .mu.mol) was added and then the solvent was removed on a
rotary evaporator at room temperature. The residue was purified by
flash chromatography on silica gel using ethyl acetate as eluent to
give 45 mg (73%) of the desired carbamate (3).
[0259] Tris-2-aminoethyl)amine CsA Trimer Triacetate (6).
MeBmt(OAc) --OCOIm.sup.1-CsA (3) (7.5 mg, 5.54 .mu.mol, 3.1 eq.)
was dissolved in THF (100 .mu.L). Diisopropylethylamine (62 .mu.L,
5 eq., 8.93 .mu.mol of a solution containing 100 .mu.L of amine in
4 mL THF) was added followed by tris(2-aminoethyl)amine (26 .mu.L,
1.79 mmol, 1 eq. of a solution containing 101 mg of tris-amine in
10 mL THF). This solution was allowed to stir under N.sub.2
atmosphere for 5 days. The reaction mix was evaporated and then
purified by flash chromatography on silica gel using 0-5% methanol
in chloroform to give 4.1 mg of desired product (6).
Example 20
Diaminodecane CsA Dimer (8)
[0260] Solid Na metal (200 mg, excess) was reacted with dry
methanol (10 mL) at 0.degree. C. Diaminodecane CsA Dimer Diacetate
(5) (4.0 mg) was dissolved in MeOH (5 mL). 2.5 mL of the NaOMe
solution was added to the solution of (5). After 2.5 hours of
stirring at room temperature under an inert atmosphere, the
solution was quenched with acetic acid (2 mL) and the product was
purified by reversed phase HPLC using a 5 mm.times.25 mm, 12.mu.,
100 A, C18 column at 70.degree. C. eluting with 70-95%
acetonitrile/H.sub.2O over 20 minutes containing 0.1% (v/v)
Trifluoroacetic acid to give 25 mg (60%) of the desired diol.
[0261] The diaminodecane CsA Dimer Diacetate (5) was prepared by
replacing the tris(2-aminoethyl)amine with 0.45 eq. of
1,10-diaminodecane.
Example 21
p-Xylylenediamine CsA Dimer (4)
[0262] The p-xylene diamine CsA Dimer (4) was prepared by replacing
the tris(2-aminoethyl)amino with 0.45 eq. of p-xylylene
diamine.
[0263] Following procedures described in the literature other
derivatives of cyclophilin are prepared by linking at a site other
than the 1(MeBmt 1) site.
[0264] Position 8 D-isomer analogues are produced by feeding the
producing organism with the D-amino analogue to obtain
incorporation specifically at that site. See Patchett, et al., J.
Antibiotics (1992) 45, 943 (.beta.-MeSO)D-Ala.sup.8-CsA); Traber,
et al., ibid. (1989) 42, 591). The position 3 analogues are
prepared by poly-lithiation/alkylation of CsA, specifically at the
-carbon of Sac3. See Wenger, Transplant Proceeding (1986) 18, 213,
supp. 5 (for cyclophilin binding and activity profiles,
particularly D-MePhe.sup.3-CsA); Seebach, U.S. Pat. No. 4,703,033,
issued Oct. 27, 1987 (for preparation of derivatives).
[0265] Instead of cyclosporin A, following the above-described
procedures, other naturally-occurring variants of CsA may be
multimerized for use in the subject invention.
Example 22
(A) Structure-Based Design and Synthesis of FK1012-"Bump" Compounds
and FKBP12s with Compensatory Mutations
[0266] Substituents at C9 and C10 of FK506, which can be and have
been accessed by synthesis, clash with a distinct set of FKBP12
sidechain residues. Thus, one class of mutant receptors for such
ligands should contain distinct modifications, one creating a
compensatory hole for the C10 substituent and one for the C9
substituent. Carbon 10 was selectively modified to have either an
N-acetyl or N-formyl group projecting from the carbon (vs. a
hydroxyl group in FK506). The binding properties of these
derivatives dearly reveal that these C10 bumps effectively abrogate
binding to the native FKBP12. FIG. 23 depicts schemes for the
synthesis of FK506-type moieties containing additional C9 bumps. By
assembling such ligands with linker moieties of this invention one
can construct HED and HOD (and antagonist) reagents for chimeric
proteins containing corresponding binding domains bearing
compensatory mutations. An illustrative HED reagent is depicted in
FIG. 23 that contains modifications at C9 and C10'.
[0267] This invention thus encompasses a class of FK-506-type
compounds comprising an FK-506-type moiety which contains, at one
or both of C9 and C10, a functional group comprising --OR, --R,
--(CO)OR, --NH(CO)H or --NH(CO)R, where R is substituted or
unsubstituted, alkyl or arylalkyl which may be straightchain,
branched or cyclic, including substituted or unsubstituted
peroxides, and carbonates. "FK506-type moieties" include FK506,
FK520 and synthetic or naturally occurring variants, analogs and
derivatives thereof. (including rapamycin) which retain at least
the (substituted or unsubstituted) C2 through C15 portion of the
ring structure of FK-506 and are capable of binding with a natural
or modified FKBP, preferably with a Kd value below about
10.sup.-6.
[0268] This invention further encompasses homo- and hetero-dimers
and higher order oligomers containing one or more of such
FK-506-type compounds covalently linked to a linker moiety of this
invention. Monomers of these FK-506-type compounds are also of
interest, whether or not covalently attached to a linker moiety or
otherwise modified without abolishing their binding affinity for
the corresponding FKBP. Such monomeric compounds may be used as
oligomerization antagonist reagents, i.e., as antagonists for
oligomerizing reagents based on a like FK-506-type compound.
Preferably the compounds and oligomers comprising them in
accordance with this invention bind to natural, or preferably
mutant, FKBPs with an affinity at least 0.1% and preferably at
least about 1% and even more preferably at least about 10% as great
as the affinity of FK506 for FKBP12. See e.g. Holt et al,
infra.
[0269] Receptor domains for these and other ligands of this
invention may be obtained by structure-based, site-directed or
random mutagenesis methods. We contemplate a family of FKBP12
moieties which contain Val, Ala, Gly, Met or other small amino
acids in place of one or more of Tyr26, Phe36, Asp37, Tyr82 and
Phe99 as receptor domains for FK506-type and FK-520-type ligands
containing modifications at C9 and/or C10.
[0270] Site-directed mutagenesis may be conducted using the
megaprimer mutagenesis protocol (see e.g., Sakar and Sommer,
BioTechniques 8 4 (1990): 404-407). cDNA sequencing is performed
with the Sequenase kit. Expression of mutant FKBP12s may be carried
out in the plasmid pHN1.sup.+ in the E. coli strain XA90 since many
FKBP12 mutants have been expressed in this system efficiently.
Mutant proteins may be conveniently purified by fractionation over
DE52 anion exchange resin followed by size exclusion on Sepharose
as described elsewhere. See e.g. Aldape et al, J Biol Chem 267 23
(1992): 16029-32 and Park et al, J Biol Chem 267 5 (1992):
3316-3324. Binding constants may be readily determined by one of
two methods. If the mutant FKBPs maintain sufficient rotamase
activity, the standard rotamase assay may be utilized. See e.g.,
Galat et al, Biochemistry 31 (1992): 2427-2434. Otherwise, the
mutant FKBP12s may be subjected to a binding assay using LH20 resin
and radiolabeled T2-dihydroFK506 and T2-dihyroCsA that we have used
previously with FKBPs and cyclophilins. Bierer et al, Proc. Natl.
Acad. Sci. U.S.A. 87 4 (1993): 555-69.
(B) Selection of Compensatory Mutations in FKBP12 for Bump-FK506s
Using the Yeast Two-Hybrid System
[0271] One approach to obtaining variants of receptor proteins or
domains, including of FKBP12, is the powerful yeast "two-hybrid" or
"interaction trap" system. The two-hybrid system has been used to
detect proteins that interact with each other. A "bait" fusion
protein consisting of a target protein fused to a transcriptional
activation domain is co-expressed with a cDNA library of potential
"hooks" fused to a DNA-binding domain. A protein-protein
(bait-hook) interaction is detected by the appearance of a reporter
gene product whose synthesis requires the joining of the
DNA-binding and activation domains. The yeast two-hybrid system
mentioned here was originally developed by Elledge and co-workers.
Durfee et al, Genes & Development 74 (1993): 555-69 and Harper
et al, Cell 75 4 (1993): 805-816.
[0272] Since the two-hybrid system per se cannot provide insights
into receptor-ligand interactions involving small molecule, organic
ligands, we have developed a new, FK1012-inducible transcriptional
activation system (discussed below). Using that system one may
extend the two hybrid system so that small molecules (e.g., FK506s
or FK1012s or FK506-type molecules of this invention) can be
investigated. One first generates a cDNA library of mutant FKBPs
(the hooks) with mutations that are regionally localized to sites
that surround C9 and C10 of FK506. For the bait, two different
strategies may be pursued. The first uses the ability of FK506 to
bind to FKBP12 and create a composite surface that binds to
calcineurin. The sequence-specific transcriptional activator is
thus comprised of: DNA-binding domain-mutant
FKBP12--bump-FK506--calcineurin A-activation domain (where--refers
to a noncovalent binding interaction). The second strategy uses the
ability of FK1012s to bind two FKBPs simultaneously. A HED version
of an FK1012 may be used to screen for the following ensemble:
DNA-binding domain-mutant FKBP12--bump-FK506-normal FK506--wildtype
FKBP12-activation domain.
[0273] 1. Calcineurin-Gal4 activation domain fusion as a bait: A
derivative of pSE1107 that contains the Gal4 activation domain and
calcineurin A subunit fusion construct has been constructed. Its
ability to act as a bait in the proposed manner has been verified
by studies using the two-hybrid system to map out calcineurin's
FKBP-FK506 binding site.
[0274] 2. hFKBP12-Gal4 activation domain fusion as a bait: hFKBP12
cDNA may be excised as an EcoRI-HindIII fragment that covers the
entire open reading frame, blunt-ended and ligated to the
blunt-ended Xho I site of pSE1107 to generate the full-length
hFKBP-Gal4 activation domain protein fusion.
[0275] 3. Mutant hFKBP12 cDNA libraries hFKBP12 may be digested
with EcoRI and HindIII, blunted and cloned into pAS1 (Durfee et al,
supra) that has been cut with NcoI and blunted. This plasmid is
further digested with NdeI to eliminate the NdeI fragment between
the NdeI site in the polylinker sequence of pAS1 and the 5' end of
hFKBP12 and religated. This generated the hFKBP12-Gal4 DNA binding
domain protein fusion. hFKBP was reamplified with primers #11206
and #11210, Primer Table: TABLE-US-00011 11206 NdeI 5NdFK:
5'-GGAATTC CAT ATG GGC GTG CAG G-3' H H G V Q 11207 SmaI 35mFK37:
5'-CTGTC CCG GGA NNN NNN NNN TTT CTT TCC ATC TTC AAG C-3' R S X X X
K K G D E L 11208 SmaI 35mFK27: 5'-CTGTC CCG GGA GGA ATC AAA TTT
CTT TCC ATC TTC AAG CAT R S S D F K K G D E L H NNN NNN NNN GTG CAC
CAC GCA GG-3' X X X H V V C 11209 BamHI 38mFK98: 5'-CGC GGA TCC TCA
TTC CAG TTT TAG AAG CTC CAC ATC NNN END E L K L L E V D X NNN NNN
AGT GGC ATG TGG-3' X X T A H P 11210 BamHI 3BmFK: 5'-CGC GGA TCC
TCA TTC CAG TTT TAG AAG C-3' END E L K L L
[0276] Primer Table: Primers used in the construction of a
regionally localized hFKBP12 cDNA library for use in screening for
compensatory mutations.
[0277] Mutant hFKBP12 cDNA fragments were then prepared using the
primers listed below that contain randomized mutant sequences of
hFKBP at defined positions by the polymerase chain reaction, and
were inserted into the Gal4 DNA binding domain-hFKBP(NdeI/BamHI)
construct.
[0278] 4. Yeast strain S. cerevisiae Y153 carries two selectable
marker genes (his3/.beta.-galctosidase) that are integrated into
the genome and are driven by Gal4 promoters. (Durfee, supra.)
[0279] Using Calcineurin-Gal4 Activation Domain as Bait The
FKBP12-FK506 complex binds with high affinity to calcineurin, a
type 2B protein phosphatase. Since we use C9- or C10-bumped ligands
to serve as a bridge in the two-hybrid system, only those FKBPs
from the cDNA library that contain a compensatory mutation generate
a transcriptional activator. For convenience, one may prepare at
least three distinct libraries (using primers 11207-11209, Primer
Table) that will each contain 8,000 mutant FKBP12s. Randomized
sites were chosen by inspecting the FKBP12-FK506 structure, which
suggested clusters of residues whose mutation might allow binding
of the offending C9 or C10 substituents on bumped FK506s. The
libraries are then individually screened using both C9- and
C10-bumped FK506s. The interaction between a bumped-FK506 and a
compensatory hFKBP12 mutant can be detected by the ability of host
yeast to grow on his drop-out medium and by the expression of
.beta.-galactosidase gene. Since this selection is dependent on the
presence of the bumped-FK506, false positives can be eliminated by
substractive screening with replica plates that are supplemented
with or without the bumped-FK506 ligands.
[0280] Using hFKBP12-Gal4 Activation Domain as Bait Using the
calcineurin A-Gal4 activation domain to screen hFKBP12 mutant cDNA
libraries is a simple way to identify compensatory mutations on
FKBP12. However, mutations that allow bumped-FK506s to bind hFKBP12
may disrupt the interaction between the mutant FKBP12--bumped-FK506
complex and calcineurin. If the initial screening with calcineurin
as a bait fails, the wildtype hFKBP12-Gal4 activation domain will
instead be used. An FK1012 HED reagent consisting of:
native-FK506-bumped-FK506 (FIG. 16) may be synthesized and used as
a hook. The FK506 moiety of the FK1012 can bind the FKBP12-Gal4
activation domain. An interaction between the bumped-FK506 moiety
of the FK1012 and a compensatory mutant of FKBP12 will allow host
yeast to grow on his drop-out medium and to express
.beta.-galactosidase. In this way, the selection is based solely on
the ability of hFKBP12 mutant to interact with the bumped-FK506.
The same substractive screening strategy can be used to eliminate
false positives.
[0281] In addition to the in vitro binding assays discussed
earlier, an in vivo assay may be used to determine the binding
affinity of the bumped-FK506s to the compensatory hFKBP12 mutants.
In the yeast two-hybrid system, .beta.-gal activity is determined
by the degree of interaction between the "bait" and the "prey".
Thus, the affinity between the bumped-FK506 and the compensatory
FKBP12 mutants can be estimated by the corresponding
.beta.-galactosidase activities produced by host yeasts at
different HED (native-FK506-bumped-FK506) concentrations.
[0282] Using the same strategy, additional randomized mutant FKBP12
cDNA libraries may be created in other bump-contact residues with
low-affinity compensatory FKBP12 mutants as templates and may be
screened similarly.
Phage Display Screening for High-Affinity Compensatory FKBP
Mutations
[0283] Some high-affinity hFKBP12 mutants for bump-FK506 may
contain several combined point mutations at discrete regions of the
protein. The size of the library that contains appropriate combined
mutations can be too large for the yeast two-hybrid system's
capacity (e.g., >10.sup.8 mutations). The use of bacteriophage
as a vehicle for exposing whole functional proteins should greatly
enhance the capability for screening a large numbers of mutations.
See e.g. Bass et al, Proteins: Structure, Function & Genetics 8
4 (1990): 309-14; McCafferty et al, Nature 348 6301 (1990): 552-4;
and Hoogenboom, Nucl Acids Res 19 15 (1991): 4133-7. If the desired
high-affinity compensatory mutants is not be identified with the
yeast two-hybrid system, a large number of combined mutations can
be created on hFKBP12 with a phage vector as a carrier. The mutant
hFKBP12 fusion phages can be screened with bumped-FK506-Sepharose
as an affinity matrix, which can be synthesized in analogy to our
original FK506-based affinity matrices. Fretz et al, J Am Chem Soc
113 4 (1991): 1409-1411. Repeated rounds of binding and phage
amplification should lead to the identification of high-affinity
compensatory mutants.
(C) Synthesis of "Bumped (CsA)2s": Modification of MeVal(11)CsA
[0284] As detailed above, we have demonstrated the feasibility of
using cyclophilin as a dimerization domain and (CsA)2 as a HOD
reagent in the context of the cell death signaling pathway.
However, to further optimize the cellular activity of the (CsA)2
reagent one may rely upon similar strategies as described with
FK1012s. Thus, modified (bumped) CsA-based oligomerizing reagents
should be preferred in applications where it is particularly
desirable for the reagent to be able to differentiate its target,
the artificial protein constructs, from endogenous
cyclophilins.
[0285] One class of modified CsA derivatives of this invention are
CsA analogs in which (a) NMeVal11 is replaced with NMePhe (which
may be substituted or unsubstituted) or NMeThr (which may be
unsubstituted or substituted on the threonine betahydroxyl group)
or (b) the pro-S methyl group of NMeVal11 is replaced with a bulky
group of at least 2 carbon atoms, preferably three or more, which
may be straight, branched and/or contain a cyclic moiety, and may
be alkyl (ethyl, or preferably propyl, butyl, including t-butyl,
and so forth), aryl, or arylalkyl. These compounds include those
CsA analogs which contain NMeLeu, NMeIle, NMePhe or specifically
the unnatural NMe[betaMePhe], in place of MeVal11. The "(b)" CsA
compounds are of formula 2 where R represents a functional group as
discussed above. ##STR1## ##STR2##
[0286] This invention further encompasses homo- and hetero-dimers
and higher order oligomers containg one or more such CsA analogs.
Preferably the compounds and oligomers comprising them in
accordance with this invention bind to natural, or preferably
mutant, cyclophilin proteins with an affinity at least 0.1% and
preferably at least about 1% and even more preferably at least
about 10% as great as the affinity of CsA for cyclophilin.
[0287] A two step strategy may be used to prepare the modified
[MeVal.sup.11]CsA derivatives starting from CsA. In the first step
the residue MeVal11 is removed from the macrocycle. In the second
step a selected amino acid is introduced at the (former) MeVal11
site and the linear peptide is cyclized. The advantage of this
strategy is the ready access to several modified [MeVal.sup.11]CsA
derivatives in comparison with a total synthesis. The synthetic
scheme is as follows: ##STR3##
[0288] To differentiate the amide bonds, an N,O shift has been
achieved between the amino and the hydroxyl groups from MeBmt1 to
give IsoCsA (Ruegger et al, Helv Chim Acta 59 4 (1976): 1075-92)
(see scheme above) The reaction was carried out in THF in the
presence of methanesulfonic acid. (Oliyai et al, Pharm Res 9 5
(1992): 617-22). The free amine was protected with an acetyl group
with pyridine and acetic anhydride in a one-pot procedure. The
overall yield of the N-acetyl protected IsoCsA is 90%. The ester
MeBmt1-MeVal11 bond is then reduced selectively in the presence of
the N-methyl amide bonds, e.g. using DIBAL-H. The resulting diol is
then transformed to the corresponding di-ester with another
acid-induced N,O shift. This will prepare both the N-acetyl group
and MeVal11 residues for removal through hydrolysis of the newly
formed esters with aqueous base.
[0289] After protection of the free amino group the new amino acid
residue is introduced e.g. with the PyBrop coupling agent.
Deprotection and cyclization of the linear peptide with BOP in
presence of DMAP (Alberg and Schreiber, Science 262 5131 (1993):
248-250) completes the synthesis of 2. The binding of bumped-CsAs
to cyclophilins can be evaluated by the same methods described for
FK506s and FK1012s. Once cyclophilins are identified with
compensatory mutations, bumped (CsA)2 HED and HOD reagents may be
synthesized according to the methods discussed previously. Of
particular interest are bumped CsA compounds which can form dimers
which themselves can bind to a cyclophilin protein with 1:2
stoichiometry. Homo dimers and higher order homo-oligomers,
heterodimers and hetero-higher order oligomers containing at least
one such CsA or modified CsA moiety may be designed and evaluated
by the methods developed for FK1012A and (CsA)2, and optimize the
linker element in analogy to the FK1012 studies.
[0290] Mutant cyclophilins that bind our position 11 CsA variants
(2) by accomodating the extra bulk on the ligand may be now be
prepared. Cyclophilins with these compensatory mutations may be
identified through the structure-based site-directed and random
mutagenesis/screening protocols described in the FK1012
studies.
[0291] It is evident from the above results, that the subject
method and compositions provide for great versatility in the
production of cells for a wide variety of purposes. By employing
the subject constructs, one can use cells for therapeutic purposes,
where the cells may remain inactive until needed, and then be
activated by administration of a safe drug. Because cells can have
a wide variety of lifetimes in a host, there is the opportunity to
treat both chronic and acute indications so as to provide short- or
long-term protection. In addition, one can provide for cells which
will be directed to a particular site, such as an anatomic site or
a functional site, where therapeutic effect may be provided.
[0292] Cells can be provided which will result in secretion of a
wide variety of proteins, which may serve to correct a deficit or
inhibit an undesired result, such as activation of cytolytic cells,
to inactivate a destructive agent, to kill a restricted cell
population, or the like. By having the cells present in the host
over a defined period of time, the cells may be readily activated
by taking the drug at a dose which can result in a rapid response
of the cells in the host. Cells can be provided where the expressed
chimeric receptor is intracellular, avoiding any immune response
due to a foreign protein on the cell surface. Furthermore, the
intracellular chimeric receptor protein provides for efficient
signal transduction upon ligand binding, apparently more
efficiently than the receptor binding at an extracellular receptor
domain.
[0293] By using relatively simple molecules which bind to chimeric
membrane bound receptors, resulting in the expression of products
of interest or inhibiting the expression of products, one can
provide for cellular therapeutic treatment. The compounds which may
be administered are safe, can be administered in a variety of ways,
and can ensure a very specific response, so as not to upset
homeostasis.
[0294] All publications and patent applications cited in this
specification are herein incorporated by reference as if each
individual publication or patent application were specifically and
individually indicated to be incorporated by reference.
[0295] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be readily apparent to those of ordinary
skill in the art in light of the teachings of this invention that
certain changes and modifications may be made thereto without
departing from the spirit or scope of the appended claims.
Sequence CWU 1
1
* * * * *