Novel sulfurylase-luciferase fusion proteins and thermostable sulfurylase

Abstract

The present invention relates to the field of DNA recombinant technology. More specifically, this invention relates to fusion proteins comprising an ATP generating polypeptide joined to a polypeptide that converts ATP into a detectable entity. Accordingly, this invention focuses on sulfurylase-luciferase fusion proteins. This invention also relates to pharmaceutical compositions containing the fusion proteins and methods for using them.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a Continuation of U.S. patent application Ser. No. 10/154,515, filed May 23, 2002, which is a continuation in part of U.S. patent application Ser. No. 10/122,706 filed Apr. 11, 2002 which claims the benefit of priority to U.S. Patent Application 60/335,949 filed Oct. 30, 2001 and U.S. Patent Application 60/349,076 filed Jan. 16, 2002. All patents, patent applications and references cited in this specification is hereby incorporated by reference.

FIELD OF THE INVENTION

[0002] The invention relates generally to fusion proteins that are useful as reporter proteins, in particular to fusion proteins of ATP sulfurylase and luciferase which are utilized to achieve an efficient conversion of pyrophosphate (PPi) to light. This invention also relates to a novel thermostable sulfurylase which can be used in the detection of inorganic pyrophosphate, particularly in the sequencing of nucleic acid.

BACKGROUND OF THE INVENTION

[0003] ATP sulfurylase has been identified as being involved in sulfur metabolism. It catalyzes the initial reaction in the metabolism of inorganic sulfate (SO.sub.4.sup.-2); see e.g., Robbins and Lipmann, 1958. J. Biol. Chem. 233: 686-690; Hawes and Nicholas, 1973. Biochem. J. 133: 541-550). In this reaction SO.sub.4.sup.-2 is activated to adenosine 5'-phosphosulfate (APS). ATP sulfurylase is also commonly used in pyrophosphate sequencing methods. In order to convert pyrophosphate (PPi) generated from the addition of dNMP to a growing DNA chain to light, PPi must first be converted to ATP by ATP sulfurylase.

[0004] ATP produced by an ATP sulfurylase can also be hydrolyzed using enzymatic reactions to generate light. Light-emitting chemical reactions (i.e., chemiluminescence) and biological reactions (i.e., bioluminescence) are widely used in analytical biochemistry for sensitive measurements of various metabolites. In bioluminescent reactions, the chemical reaction that leads to the emission of light is enzyme-catalyzed. For example, the luciferin-luciferase system allows for specific assay of ATP. Thus, both ATP generating enzymes, such as ATP sulfurylase, and light emitting enzymes, such as luciferase, could be useful in a number of different assays for the detection and/or concentration of specific substances in fluids and gases. Since high physical and chemical stability is sometimes required for enzymes involved in sequencing reactions, a thermostable enzyme is desirable.

[0005] Because the product of the sulfurylase reaction is consumed by luciferase, proximity between these two enzymes by covalently linking the two enzymes in the form of a fusion protein would provide for a more efficient use of the substrate. Substrate channeling is a phenomenon in which substrates are efficiently delivered from enzyme to enzyme without equilibration with other pools of the same substrates. In effect, this creates local pools of metabolites at high concentrations relative to those found in other areas of the cell. Therefore, a fusion of an ATP generating polypeptide and an ATP converting peptide could benefit from the phenomenon of substrate channeling and would reduce production costs and increase the number of enzymatic reactions that occur during a given time period.

[0006] All patents and publications cited throughout the specification are hereby incorporated by reference into this specification in their entirety in order to more fully describe the state of the art to which this invention pertains.

SUMMARY OF THE INVENTION

[0007] The invention provides a fusion protein comprising an ATP generating polypeptide bound to a polypeptide which converts ATP into an entity which is detectable. In one aspect, the invention provides a fusion protein comprising a sulfurylase polypeptide bound to a luciferase polypeptide. This invention provides a nucleic acid that comprises an open reading frame that encodes a novel thermostable sulfurylase polypeptide. In a further aspect, the invention provides for a fusion protein comprising a thermostable sulfurylase joined to at least one affinity tag.

[0008] In another aspect, the invention provides a recombinant polynucleotide that comprises a coding sequence for a fusion protein having a sulfurylase poylpeptide sequence joined to a luciferase polypeptide sequence. In a further aspect, the invention provides an expression vector for expressing a fusion protein. The expression vector comprises a coding sequence for a fusion protein having: (i) a regulatory sequence, (ii) a first polypeptide sequence of an ATP generating polypeptide and (iii) a second polypeptide sequence that converts ATP to an entity which is detectable. In an additional embodiment, the fusion protein comprises a sulfurylase polypeptide and a luciferase polypeptide. In another aspect, the invention provides a transformed host cell which comprises the expression vector. In an additional aspect, the invention provides a fusion protein bound to a mobile support. The invention also includes a kit comprising a sulfurylase-luciferase fusion protein expression vector.

[0009] The invention also includes a method for determining the nucleic acid sequence in a template nucleic acid polymer, comprising: (a) introducing the template nucleic acid polymer into a polymerization environment in which the nucleic acid polymer will act as a template polymer for the synthesis of a complementary nucleic acid polymer when nucleotides are added; (b) successively providing to the polymerization environment a series of feedstocks, each feedstock comprising a nucleotide selected from among the nucleotides from which the complementary nucleic acid polymer will be formed, such that if the nucleotide in the feedstock is complementary to the next nucleotide in the template polymer to be sequenced said nucleotide will be incorporated into the complementary polymer and inorganic pyrophosphate will be released; (c) separately recovering each of the feedstocks from the polymerization environment; and (d) measuring the amount of PPi with an ATP generating polypeptide-ATP converting polypeptide fusion protein in each of the recovered feedstocks to determine the identity of each nucleotide in the complementary polymer and thus the sequence of the template polymer. In one embodiment, the amount of inorganic pyrophosphate is measured by the steps of: (a) adding adenosine-5'-phosphosulfate to the feedstock; (b) combining the recovered feedstock containing adenosine-5'-phosphosulfate with an ATP generating polypeptide-ATP converting polypeptide fusion protein such that any inorganic pyrophosphate in the recovered feedstock and the adenosine-5'-phosphosulfate will react to the form ATP and sulfate; (c) combining the ATP and sulfate-containing feedstock with luciferin in the presence of oxygen such that the ATP is consumed to produced AMP, inorganic pyrophosphate, carbon dioxide and light; and (d) measuring the amount of light produced.

[0010] In another aspect, the invention includes a method wherein each feedstock comprises adenosine-5'-phosphosulfate and luciferin in addition to the selected nucleotide base, and the amount of inorganic pyrophosphate is determined by reacting the inorganic pyrophosphate feedstock with an ATP generating polypeptide-ATP converting polypeptide fusion protein thereby producing light in an amount proportional to the amount of inorganic pyrophosphate, and measuring the amount of light produced.

[0011] In another aspect, the invention provides a method for sequencing a nucleic acid, the method comprising; (a) providing one or more nucleic acid anchor primers; (b) providing a plurality of single-stranded circular nucleic acid templates disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m; (c) annealing an effective amount of the nucleic acid anchor primer to at least one of the single-stranded circular templates to yield a primed anchor primer-circular template complex; (d) combining the primed anchor primer-circular template complex with a polymerase to form an extended anchor primer covalently linked to multiple copies of a nucleic acid complementary to the circular nucleic acid template; (e) annealing an effective amount of a sequencing primer to one or more copies of said covalently linked complementary nucleic acid; (f) extending the sequencing primer with a polymerase and a predetermined nucleotide triphosphate to yield a sequencing product and, if the predetermined nucleotide triphosphate is incorporated onto the 3' end of said sequencing primer, a sequencing reaction byproduct; and (g) identifying the sequencing reaction byproduct with the use of a ATP generating polypeptide-ATP converting polypeptide fusion protein, thereby determining the sequence of the nucleic acid.

[0012] In one aspect, the invention provides a method for sequencing a nucleic acid, the method comprising: (a) providing at least one nucleic acid anchor primer; (b) providing a plurality of single-stranded circular nucleic acid templates in an array having at least 400,000 discrete reaction sites; (c) annealing a first amount of the nucleic acid anchor primer to at least one of the single-stranded circular templates to yield a primed anchor primer-circular template complex; (d) combining the primed anchor primer-circular template complex with a polymerase to form an extended anchor primer covalently linked to multiple copies of a nucleic acid complementary to the circular nucleic acid template; (e) annealing a second amount of a sequencing primer to one or more copies of the covalently linked complementary nucleic acid; (f) extending the sequencing primer with a polymerase and a predetermined nucleotide triphosphate to yield a sequencing product and, when the predetermined nucleotide triphosphate is incorporated onto the 3' end of the sequencing primer, to yield a sequencing reaction byproduct; and (g) identifying the sequencing reaction byproduct with the use of a ATP generating polypeptide-ATP converting polypeptide fusion protein, thereby determining the sequence of the nucleic acid at each reaction site that contains a nucleic acid template.

[0013] In another aspect, the invention includes a method of determining the base sequence of a plurality of nucleotides on an array, the method comprising the steps of: (a) providing a plurality of sample DNAs, each disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, (b) adding an activated nucleotide 5'-triphosphate precursor of one known nitrogenous base to a reaction mixture in each reaction chamber, each reaction mixture comprising a template-directed nucleotide polymerase and a single-stranded polynucleotide template hybridized to a complementary oligonucleotide primer strand at least one nucleotide residue shorter than the templates to form at least one unpaired nucleotide residue in each template at the 3'-end of the primer strand, under reaction conditions which allow incorporation of the activated nucleoside 5'-triphosphate precursor onto the 3'-end of the primer strands, provided the nitrogenous base of the activated nucleoside 5'-triphosphate precursor is complementary to the nitrogenous base of the unpaired nucleotide residue of the templates; (c) determining whether or not the nucleoside 5'-triphosphate precursor was incorporated into the primer strands through detection of a sequencing byproduct with a ATP generating polypeptide-ATP converting polypeptide fusion protein, thus indicating that the unpaired nucleotide residue of the template has a nitrogenous base composition that is complementary to that of the incorporated nucleoside 5'-triphosphate precursor; and (d) sequentially repeating steps (b) and (c), wherein each sequential repetition adds and, detects the incorporation of one type of activated nucleoside 5'-triphosphate precursor of known nitrogenous base composition; and

(e) determining the base sequence of the unpaired nucleotide residues of the template in each reaction chamber from the sequence of incorporation of said nucleoside precursors.

[0014] In one aspect, the invention includes a method for determining the nucleic acid sequence in a template nucleic acid polymer, comprising: (a) introducing a plurality of template nucleic acid polymers into a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, each reaction chamber having a polymerization environment in which the nucleic acid polymer will act as a template polymer for the synthesis of a complementary nucleic acid polymer when nucleotides are added; (b) successively providing to the polymerization environment a series of feedstocks, each feedstock comprising a nucleotide selected from among the nucleotides from which the complementary nucleic acid polymer will be formed, such that if the nucleotide in the feedstock is complementary to the next nucleotide in the template polymer to be sequenced said nucleotide will be incorporated into the complementary polymer and inorganic pyrophosphate will be released; (c) detecting the formation of inorganic pyrophosphate with an ATP generating polypeptide-ATP converting polypeptide fusion protein to determine the identify of each nucleotide in the complementary polymer and thus the sequence of the template polymer.

[0015] In one aspect, the invention provides a method of identifying the base in a target position in a DNA sequence of sample DNA including the steps comprising: (a) disposing sample DNA within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, said DNA being rendered single stranded either before or after being disposed in the reaction chambers, (b) providing an extension primer which hybridizes to said immobilized single-stranded DNA at a position immediately adjacent to said target position; (c) subjecting said immobilized single-stranded DNA to a polymerase reaction in the presence of a predetermined nucleotide triphosphate, wherein if the predetermined nucleotide triphosphate is incorporated onto the 3' end of said sequencing primer then a sequencing reaction byproduct is formed; and

(d) identifying the sequencing reaction byproduct with a ATP generating polypeptide-ATP converting polypeptide fusion protein, thereby determining the nucleotide complementary to the base at said target position.

[0016] The invention also includes a method of identifying a base at a target position in a sample DNA sequence comprising: (a) providing sample DNA disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, said DNA being rendered single stranded either before or after being disposed in the reaction chambers; (b) providing an extension primer which hybridizes to the sample DNA immediately adjacent to the target position; (c) subjecting the sample DNA sequence and the extension primer to a polymerase reaction in the presence of a nucleotide triphosphate whereby the nucleotide triphosphate will only become incorporated and release pyrophosphate (PPi) if it is complementary to the base in the target position, said nucleotide triphosphate being added either to separate aliquots of sample-primer mixture or successively to the same sample-primer mixture; (d) detecting the release of PPi with an ATP generating polypeptide-ATP converting polypeptide fusion protein to indicate which nucleotide is incorporated.

[0017] In one aspect, the invention provides a method of identifying a base at a target position in a single-stranded sample DNA sequence, the method comprising: (a) providing an extension primer which hybridizes to sample DNA immediately adjacent to the target position, said sample DNA disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 um, said DNA being rendered single stranded either before or after being disposed in the reaction chambers; (b) subjecting the sample DNA and extension primer to a polymerase reaction in the presence of a predetermined deoxynucleotide or dideoxynucleotide whereby the deoxynucleotide or dideoxynucleotide will only become incorporated and release pyrophosphate (PPi) if it is complementary to the base in the target position, said predetermined deoxynucleotides or dideoxynucleotides being added either to separate aliquots of sample-primer mixture or successively to the same sample-primer mixture, (c) detecting any release of PPi with an ATP generating polypeptide-ATP converting polypeptide fusion protein to indicate which deoxynucleotide or dideoxynucleotide is incorporated;characterized in that, the PPi-detection enzyme(s) are included in the polymerase reaction step and in that in place of deoxy- or dideoxy adenosine triphosphate (ATP) a dATP or ddATP analogue is used which is capable of acting as a substrate for a polymerase but incapable of acting as a substrate for a said PPi-detection enzyme.

[0018] In another aspect, the invention includes a method of determining the base sequence of a plurality of nucleotides on an array, the method comprising: (a) providing a plurality of sample DNAs, each disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, (b) converting PPi into light with an ATP generating polypeptide-ATP converting polypeptide fusion protein; (c) detecting the light level emitted from a plurality of reaction sites on respective portions of an optically sensitive device; (d) converting the light impinging upon each of said portions of said optically sensitive device into an electrical signal which is distinguishable from the signals from all of said other regions; (e) determining a light intensity for each of said discrete regions from the corresponding electrical signal; (f) recording the variations of said electrical signals with time.

[0019] In one aspect, the invention provides a method for sequencing a nucleic acid, the method comprising:(a) providing one or more nucleic acid anchor primers; (b) providing a plurality of single-stranded circular nucleic acid templates disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m;(c) converting PPi into a detectable entity with the use of an ATP generating polypeptide-ATP converting polypeptide fusion protein; (d) detecting the light level emitted from a plurality of reaction sites on respective portions of an optically sensitive device; (e) converting the light impinging upon each of said portions of said optically sensitive device into an electrical signal which is distinguishable from the signals from all of said other regions; (f) determining a light intensity for each of said discrete regions from the corresponding electrical signal; (g) recording the variations of said electrical signals with time.

[0020] In another aspect, the invention includes a method for sequencing a nucleic acid, the method comprising: (a) providing at least one nucleic acid anchor primer; (b) providing a plurality of single-stranded circular nucleic acid templates in an array having at least 400,000 discrete reaction sites; (c) converting PPi into a detectable entity with an ATP generating polypeptide-ATP converting polypeptide fusion protein; (d) detecting the light level emitted from a plurality of reaction sites on respective portions of an optically sensitive device; (e) converting the light impinging upon each of said portions of said optically sensitive device into an electrical signal which is distinguishable from the signals from all of said other regions; (f) determining a light intensity for each of said discrete regions from the corresponding electrical signal; (g) recording the variations of said electrical signals with time.

[0021] In another aspect, the invention includes an isolated polypeptide comprising an amino acid sequence selected from the group consisting of: (a) a mature form of an amino acid sequence of SEQ ID NO: 2; (b) a variant of a mature form of an amino acid sequence of SEQ ID NO: 2; an amino acid sequence of SEQ ID NO: 2; (c) a variant of an amino acid sequence of SEQ ID NO: 2, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 5% of amino acid residues from said amino acid sequence; (d) and at least one conservative amino acid substitution to the amino acid sequences in (a), (b), (c) or (d). The invention also includes an antibody that binds immunospecifically to the polypeptide of (a), (b), (c) or (d).

[0022] In another aspect, the invention includes an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of: (a) a mature form of an amino acid sequence of SEQ ID NO: 2; (b) a variant of a mature form of an amino acid sequence of SEQ ID NO: 2, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 5% of the amino acid residues from the amino acid sequence of said mature form; (c) an amino acid sequence of SEQ ID NO: 2; (d) a variant of an amino acid sequence of SEQ ID NO: 2, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 15% of amino acid residues from said amino acid sequence; a nucleic acid fragment encoding at least a portion of a polypeptide comprising an amino acid sequence of SEQ ID NO: 2, or a variant of said polypeptide, wherein one or more amino acid residues in said variant differs from the amino acid sequence of said mature form, provided that said variant differs in no more than 5% of amino acid residues from said amino acid sequence; (e) and a nucleic acid molecule comprising the complement of (a), (b), (c), (d) or (e).

[0023] In a further aspect, the invention provides a nucleic acid molecule wherein the nucleic acid molecule comprises nucleotide sequence selected from the group consisting of: (a) a first nucleotide sequence comprising a coding sequence differing by one or more nucleotide sequences from a coding sequence encoding said amino acid sequence, provided that no more than 20% of the nucleotides in the coding sequence in said first nucleotide sequence differ from said coding sequence; an isolated second polynucleotide that is a complement of the first polynucleotide; (b) and a nucleic acid fragment of (a) or (b). The invention also includes a vector comprising the nucleic acid molecule of (a) or (b). In another aspect, the invention includes a cell comprising the vector.

[0024] In a further aspect, the invention includes a method for determining the nucleic acid sequence in a template nucleic acid polymer, comprising: (a) introducing the template nucleic acid polymer into a polymerization environment in which the nucleic acid polymer will act as a template polymer for the synthesis of a complementary nucleic acid polymer when nucleotides are added; (b) successively providing to the polymerization environment a series of feedstocks, each feedstock comprising a nucleotide selected from among the nucleotides from which the complementary nucleic acid polymer will be formed, such that if the nucleotide in the feedstock is complementary to the next nucleotide in the template polymer to be sequenced said nucleotide will be incorporated into the complementary polymer and inorganic pyrophosphate will be released; (c) separately recovering each of the feedstocks from the polymerization environment; and (d) measuring the amount of PPi with an ATP sulfurylase and a luciferase in each of the recovered feedstocks to determine the identity of each nucleotide in the complementary polymer and thus the sequence of the template polymer.

[0025] In another aspect, the invention provides a method for sequencing a nucleic acid, the method comprising: (a) providing one or more nucleic acid anchor primers; (b) providing a plurality of single-stranded circular nucleic acid templates disposed within a plurality of cavities in an array on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m and at least 400,000 discrete sites; (c) annealing an effective amount of the nucleic acid anchor primer to at least one of the single-stranded circular templates to yield a primed anchor primer-circular template complex; (d) combining the primed anchor primer-circular template complex with a polymerase to form an extended anchor primer covalently linked to multiple copies of a nucleic acid complementary to the circular nucleic acid template; (e) annealing an effective amount of a sequencing primer to one or more copies of said covalently linked complementary nucleic acid; (f) extending the sequencing primer with a polymerase and a predetermined nucleotide triphosphate to yield a sequencing product and, if the predetermined nucleotide triphosphate is incorporated onto the 3' end of said sequencing primer, a sequencing reaction byproduct; and (g) identifying the sequencing reaction byproduct with the use of an ATP sulfurylase and a luciferase, thereby determining the sequence of the nucleic acid.

[0026] In another aspect, the invention provides a method for sequencing a nucleic acid, the method comprising: (a) providing at least one nucleic acid anchor primer; (b) providing a plurality of single-stranded circular nucleic acid templates in an array having at least 400,000 discrete reaction sites; (c) annealing a first amount of the nucleic acid anchor primer to at least one of the single-stranded circular templates to yield a primed anchor primer-circular template complex; (d) combining the primed anchor primer-circular template complex with a polymerase to form an extended anchor primer covalently linked to multiple copies of a nucleic acid complementary to the circular nucleic acid template; (e) annealing a second amount of a sequencing primer to one or more copies of the covalently linked complementary nucleic acid; (f) extending the sequencing primer with a polymerase and a predetermined nucleotide triphosphate to yield a sequencing product and, when the predetermined nucleotide triphosphate is incorporated onto the 3' end of the sequencing primer, to yield a sequencing reaction byproduct; and (g) identifying the sequencing reaction byproduct with the use of a thermostable sulfurylase and a luciferase, thereby determining the sequence of the nucleic acid at each reaction site that contains a nucleic acid template.

[0027] In a further aspect, the invention includes a method of determining the base sequence of a plurality of nucleotides on an array, the method comprising: (a) providing a plurality of sample DNAs, each disposed within a plurality of cavities on a planar surface, each cavity forming an analyte reaction chamber, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, (b) adding an activated nucleotide 5'-triphosphate precursor of one known nitrogenous base to a reaction mixture in each reaction chamber, each reaction mixture comprising a template-directed nucleotide polymerase and a single-stranded polynucleotide template hybridized to a complementary oligonucleotide primer strand at least one nucleotide residue shorter than the templates to form at least one unpaired nucleotide residue in each template at the 3'-end of the primer strand, under reaction conditions which allow incorporation of the activated nucleoside 5'-triphosphate precursor onto the 3'-end of the primer strands, provided the nitrogenous base of the activated nucleoside 5'-triphosphate precursor is complementary to the nitrogenous base of the unpaired nucleotide residue of the templates; (c) detecting whether or not the nucleoside 5'-triphosphate precursor was incorporated into the primer strands through detection of a sequencing byproduct with a thermostable sulfurylase and luciferase, thus indicating that the unpaired nucleotide residue of the template has a nitrogenous base composition that is complementary to that of the incorporated nucleoside 5'-triphosphate precursor; and (d) sequentially repeating steps (b) and (c), wherein each sequential repetition adds and, detects the incorporation of one type of activated nucleoside 5'-triphosphate precursor of known nitrogenous base composition; and (e) determining the base sequence of the unpaired nucleotide residues of the template in each reaction chamber from the sequence of incorporation of said nucleoside precursors.

BRIEF DESCRIPTION OF THE DRAWINGS

[0028] FIG. 1 is one embodiment for a cloning strategy for obtaining the luciferase-sulfurylase sequence.

[0029] FIG. 2A and 2B show the preparative agarose gel of luciferase and sulfurylase as well as sulfurylase-luciferase fusion genes.

[0030] FIG. 3 shows the results of experiments to determine the activity of the luciferase-sulfurylase fusion protein on NTA-agarose and MPG-SA solid supports.

DETAILED DESCRIPTION OF THE INVENTION

[0031] This invention provides a fusion protein containing an ATP generating polypeptide bound to a polypeptide which converts ATP into an entity which is detectable. As used herein, the term "fusion protein" refers to a chimeric protein containing an exogenous protein fragment joined to another exogenous protein fragment. The fusion protein could include an affinity tag to allow attachment of the protein to a solid support or to allow for purification of the recombinant fusion protein from the host cell or culture supernatant, or both.

[0032] In a preferred embodiment, the ATP generating polypeptide and ATP converting polypeptide are from a eukaryote or a prokaryote. The eukaryote could be an animal, plant, fungus or yeast. In some embodiments, the animal is a mammal, rodent, insect, worm, mollusk, reptile, bird and amphibian. Plant sources of the polypeptides include but are not limited to Arabidopsis thaliana, Brassica napus, Allium sativum, Amaranthus caudatus, Hevea brasiliensis, Hordeum vulgare, Lycopersicon esculentum, Nicotiana tabacum, Oryza sativum, Pisum sativum, Populus trichocarpa, Solanum tuberosum, Secale cereale, Sambucus nigra, Ulmus americana or Triticum aestivum. Examples of fungi include but are not limited to Penicillum chrysogenum, Stachybotrys chartarum, Aspergillus fumigatus, Podospora anserina and Trichoderma reesei. Examples of sources of yeast include but are not limited to Saccharomyces cerevisiae, Candida tropicalis, Candida lypolitica, Candida utilis, Kluyveromyces lactis, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida spp., Pichia spp. and Hansenula spp.

[0033] The prokaryote source could be bacteria or archaea. In some embodiments, the bacteria is E. coli, B. subtilis, Streptococcus gordonii, flavobacteria or green sulfur bacteria. In other embodiments, the archaea is Sulfolobus, Thermococcus, Methanobacterium, Halococcus, Halobacterium or Methanococcus jannaschii.

[0034] The ATP generating polypeptide can be a ATP sulfurylase, hydrolase or an ATP synthase. In a preferred embodiment, the ATP generating polypeptide is ATP sulfurylase. In one embodiment, the ATP sulfurylase is a thermostable sulfurylase cloned from Bacillus stearothermophilus (Bst) and comprising the nucleotide sequence of SEQ ID NO:1. This putative gene was cloned using genomic DNA acquired from ATCC (Cat. No. 12980D). The gene is shown to code for a functional ATP sulfurylase that can be expressed as a fusion protein with an affinity tag. The disclosed Bst sulfurylase nucleic acid (SEQ ID NO:1) includes the 1247 nucleotide sequence. An open reading frame (ORF) for the mature protein was identified beginning with an ATG codon at nucleotides 1-3 and ending with a TAA codon at nucleotides 1159-1161. The start and stop codons of the open reading frame are highlighted in bold type. The putative untranslated regions are underlined and found upstream of the initiation codon and downstream from the termination codon. TABLE-US-00001 Bst Thermostable Sulfurylase Nucleotide Sequence (SEQ ID NO: 1) GTTATGAACATGAGTTTGAGCATTCCGCATGGCGGCACATTGATCAACCGTTGGAATCGG 60 GATTACCCAATGGATGAAGCAACGAAAACGATGGAGGTGTCCAAAGCCGAAGTAAGCGAC 120 CTTGAGCTGATCGGCACAGGCGCCTACAGCCCGCTCACCGGGTTTTTAAGGAAAGCCGAT 180 TACGATGCGGTCGTAGAAACGATGCGCCTCGCTGATGGCACTGTCTGGAGCATTCCGATC 240 ACGCTGGCGGTGACGGAAGAAAAAGCGAGTGAACTCACTGTCGGCGACAAAGCGAAACTC 300 GTTTATGGCGGCGACGTCTAGGGCGTCATTGAAATCGCCGATATTTACCGCCCGGATAAA 360 ACGAAAGAAGCCAAGCTCGTCTATAAAACCGATGAACTCGCTCACCCGGGCGTGGGCAAG 420 CTGTTTGAAAAACCAGATGTGTAGGTCGGCGGAGCGGTTAGGCTCGTCAAACGGAGCGAC 480 AAAGGCCAGTTTGCTCCGTTTTATTTCGATCCGGCCGAAACGCGGAAACGATTTGCCGAA 540 CTCGGCTGGAATACCGTCGTGGGCTTCCAAACACGCAACCCGGTTCACCGGGCCCATGAA 600 TACATTCAAAAATGCGCGCTTGAAATCGTGGACGGCTTGTTTTTAAACCCGCTCGTCGGC 660 GAAACGAAAGCGGACGATATTCCGGCCGACATCCGGATGGAAAGCTATCAAGTGCTGCTG 720 GAAAACTATTATCCGAAAGACCGCGTTTTCTTGGGCGTCTTCCAAGCTGCGATGCGGTAT 780 GCCGGTCCGCGCGAAGCGATTTTCCATGCCATGGTGCGGAAAAACTTCGGCTGCACGCAC 840 TTCATCGTCGGCCGGGACCATGCGGGCGTCGGCAACTATTACGGCACGTATGATGCGCAA 900 AAAATCTTCTCGAACTTTACAGCCGAAGAGCTTGGCATTACACCGCTCTTTTTCGAACAC 960 AGCTTTTATTGCAGGAAATGCGAAGGGATGGCATCGAGGAAAACATGCCCGCACGACGCA 1020 CAATATCACGTTGTCCTTTCTGGCACGAAAGTCCGTGAAATGTTGCGTAACGGCCAAGTG 1080 CCGCCGAGCACATTCAGCCGTCCGGAAGTGGCCGGCGTTTTGATCAAAGGGCTGCAAGAA 1140 CGCGAAACGGTCACCCCGTCGACACGCTAAAGGAGGAGCGAGATGAGCACGAATATCGTT 1200 TGGCATCATACATCGGTGACAAAAGAAGATCGCCGCCAACGCAACGG 1247

[0035] The Bst sulfurylase polypeptide (SEQ ID NO:2) is 386 amino acid residues in length and is presented using the three letter amino acid code. TABLE-US-00002 Bst Sulfurylase Amino Acid Sequence (SEQ ID NO: 2) Met Ser Leu Ser Ile Pro His Gly Gly Thr Leu Ile 1 5 10 Asn Arg Trp Asn Pro Asp Tyr Pro Ile Asp Glu Ala 15 20 Thr Lys Thr Ile Glu Leu Ser Lys Ala Glu Leu Ser 25 30 35 Asp Leu Glu Leu Ile Gly Thr Gly Ala Tyr Ser Pro 40 45 Leu Thr Gly Phe Leu Thr Lys Ala Asp Tyr Asp Ala 50 55 Val Val Glu Thr Met Arg Leu Ala Asp Gly Thr Val 60 65 70 Trp Ser Ile Pro Ile Thr Leu Ala Val Thr Glu Glu 75 80 Lys Ala Ser Glu Leu Thr Val Gly Asp Lys Ala Lys 85 90 95 Leu Val Tyr Gly Gly Asp Val Tyr Gly Val Ile Glu 100 105 Ile Ala Asp Ile Tyr Arg Pro Asp Lys Thr Lys Glu 110 115 Ala Lys Leu Val Tyr Lys Thr Asp Glu Leu Ala His 120 125 130 Pro Gly Val Arg Lys Leu Phe Glu Lys Pro Asp Val 135 140 Tyr Val Gly Gly Ala Val Thr Leu Val Lys Arg Thr 145 150 155 Asp Lys Gly Gln Phe Ala Pro Phe Tyr Phe Asp Pro 160 165 Ala Glu Thr Arg Lys Arg Phe Ala Glu Leu Gly Trp 170 175 Asn Thr Val Val Gly Phe Gln Thr Arg Asn Pro Val 180 185 190 His Arg Ala His Glu Tyr Ile Gln Lys Cys Ala Leu 195 200 Glu Ile Val Asp Gly Leu Phe Leu Asn Pro Leu Val 205 210 215 Gly Glu Thr Lys Ala Asp Asp Ile Pro Ala Asp Ile 220 225 Arg Met Glu Ser Tyr Gln Val Leu Leu Glu Asn Tyr 230 235 Tyr Pro Lys Asp Arg Val Phe Leu Gly Val Phe Gln 240 245 250 Ala Ala Met Arg Tyr Ala Gly Pro Arg Glu Ala Ile 255 260 Phe His Ala Met Val Arg Lys Asn Phe Gly Cys Thr 265 270 275 His Phe Ile Val Gly Arg Asp His Ala Gly Val Gly 280 285 Asn Tyr Tyr Gly Thr Tyr Asp Ala Gln Lys Ile Phe 290 295 Ser Asn Phe Thr Ala Glu Glu Leu Gly Ile Thr Pro 300 305 310 Leu Phe Phe Glu His Ser Phe Tyr Cys Thr Lys Cys 315 320 Glu Gly Met Ala Ser Thr Lys Thr Cys Pro His Asp 325 330 335 Ala Gln Tyr His Val Val Leu Ser Gly Thr Lys Val 340 345 Arg Glu Met Leu Arg Asn Gly Gln Val Pro Pro Ser 350 355 Thr Phe Ser Arg Pro Glu Val Ala Ala Val Leu Ile 360 365 370 Lys Gly Leu Gln Glu Arg Glu Thr Val Thr Pro Ser 375 380 Thr Arg 385

[0036] In one embodiment, the thermostable sulfurylase is active at temperatures above ambient to at least 50.degree. C. This property is beneficial so that the sulfurylase will not be denatured at higher temperatures commonly utilized in polymerase chain reaction (PCR) reactions or sequencing reactions. In one embodiment, the ATP sulfurylase is from a thermophile. The thermostable sulfurylase can come from thermophilic bacteria, including but not limited to, Bacillus stearothermophilus, Thermus thermophilus, Bacillus caldolyticus, Bacillus subtilis, Bacillus thermoleovorans, Pyrococcus furiosus, Sulfolobus acidocaldarius, Rhodothermus obamensis, Aquifex aeolicus, Archaeoglobus fulgidus, Aeropyrum pernix, Pyrobaculum aerophilum, Pyrococcus abyssi, Penicillium chrysogenum, Sulfolobus solfataricus and Thermomonospora fusca.

[0037] The homology of twelve ATP sulfurylases can be shown graphically in the ClustalW analysis in Table 1. The alignment is of ATP sulfurylases from the following species: Bacillus stearothermophilus (Bst), University of Oklahoma--Strain 10 (Univ of OK), Aquifex aeolicus (Aae), Pyrococcus furiosus (Pfu), Sulfolobus solfataricus (Sso), Pyrobaculum aerophilum (Pae), Archaeoglobus fulgidus (Afu), Penicillium chrysogenum (Pch), Aeropyrum pernix (Ape), Saccharomyces cerevisiae (Sce), and Thermomonospora fusca (Tfu).

[0038] A thermostable sulfurylase polypeptide is encoded by the open reading frame ("ORF") of a thermostable sulfurylase nucleic acid. An ORF corresponds to a nucleotide sequence that could potentially be translated into a polypeptide. A stretch of nucleic acids comprising an ORF is uninterrupted by a stop codon. An ORF that represents the coding sequence for a full protein begins with an ATG "start" codon and terminates with one of the three "stop" codons, namely, TAA, TAG, or TGA. For the purposes of this invention, an ORF may be any part of a coding sequence, with or without a start codon, a stop codon, or both. For an ORF to be considered as a good candidate for coding for a bona fide cellular protein, a minimum size requirement is often set, e.g., a stretch of DNA that would encode a protein of 50 amino acids or more.

[0039] The invention further encompasses nucleic acid molecules that differ from the nucleotide sequences shown in SEQ ID NO:1 due to degeneracy of the genetic code and thus encode the same thermostable sulfurylase proteins as that encoded by the nucleotide sequences shown in SEQ ID NO:1. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO:2. In addition to the thermostable sulfurylase nucleotide sequence shown in SEQ ID NO:1 it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of the thermostable sulfurylase polypeptides may exist within a population (e.g., the bacterial population). Such genetic polymorphism in the thermostable sulfurylase genes may exist among individuals within a population due to natural allelic variation. As used herein, the terms "gene" and "recombinant gene" refer to nucleic acid molecules comprising an open reading frame encoding a thermostable sulfurylase protein. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of the thermostable sulfurylase genes. Any and all such nucleotide variations and resulting amino acid polymorphisms in the thermostable sulfurylase polypeptides, which are the result of natural allelic variation and that do not alter the functional activity of the thermostable sulfurylase polypeptides, are intended to be within the scope of the invention.

[0040] Moreover, nucleic acid molecules encoding thermostable sulfurylase proteins from other species, and thus that have a nucleotide sequence that differs from the sequence SEQ ID NO:1 are intended to be within the scope of the invention. Nucleic acid molecules corresponding to natural allelic variants and homologues of the thermostable sulfurylase cDNAs of the invention can be isolated based on their homology to the thermostable sulfurylase nucleic acids disclosed herein using the human cDNAs, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. The invention further includes the nucleic acid sequence of SEQ ID NO:1 and mature and variant forms thereof, wherein a first nucleotide sequence comprising a coding sequence differing by one or more nucleotide sequences from a coding sequence encoding said amino acid sequence, provided that no more than 11% of the nucleotides in the coding sequence differ from the coding sequence.

[0041] Another aspect of the invention pertains to nucleic acid molecules encoding a thermostable sulfurylase protein that contains changes in amino acid residues that are not essential for activity. Such thermostable sulfurylase proteins differ in amino acid sequence from SEQ ID NO:2 yet retain biological activity. In separate embodiments, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 96%, 97%, 98% or 99% homologous to the amino acid sequence of SEQ ID NO:2. An isolated nucleic acid molecule encoding a thermostable sulfurylase protein homologous to the protein of SEQ ID NO: 2 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO:1 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein.

[0042] Mutations can be introduced into SEQ ID NO:2 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted, non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined within the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted non-essential amino acid residue in the thermostable sulfurylase protein is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of a thermostable sulfurylase coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for thermostable sulfurylase biological activity to identify mutants that retain activity. Following mutagenesis of SEQ ID NO:1, the encoded protein can be expressed by any recombinant technology known in the art and the activity of the protein can be determined.

[0043] The relatedness of amino acid families may also be determined based on side chain interactions. Substituted amino acids may be fully conserved "strong" residues or fully conserved "weak" residues. The "strong" group of conserved amino acid residues may be any one of the following groups: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF, HY, FYW, wherein the single letter amino acid codes are grouped by those amino acids that may be substituted for each other. Likewise, the "weak" group of conserved residues may be any one of the following: CSA, ATV, SAG, STNK, STPA, SGND, SNDEQK, NDEQHK, NEQHRK, VLIM, HFY, wherein the letters within each group represent the single letter amino acid code.

[0044] The thermostable sulfurylase nucleic acid of the invention includes the nucleic acid whose sequence is provided herein, or fragments thereof. The invention also includes mutant or variant nucleic acids any of whose bases may be changed from the corresponding base shown herein while still encoding a protein that maintains its sulfurylase-like activities and physiological functions, or a fragment of such a nucleic acid. The invention further includes nucleic acids whose sequences are complementary to those just described, including nucleic acid fragments that are complementary to any of the nucleic acids just described. The invention additionally includes nucleic acids or nucleic acid fragments, or complements thereto, whose structures include chemical modifications. Such modifications include, by way of nonlimiting example, modified bases, and nucleic acids whose sugar phosphate backbones are modified or derivatized. These modifications are carried out at least in part to enhance the chemical stability of the modified nucleic acid, such that they may be used, for example, as antisense binding nucleic acids in therapeutic applications in a subject.

[0045] A thermostable sulfurylase nucleic acid can encode a mature thermostable sulfurylase polypeptide. As used herein, a "mature" form of a polypeptide or protein disclosed in the present invention is the product of a naturally occurring polypeptide or precursor form or proprotein. The naturally occurring polypeptide, precursor or proprotein includes, by way of nonlimiting example, the full-length gene product, encoded by the corresponding gene. Alternatively, it may be defined as the polypeptide, precursor or proprotein encoded by an ORF described herein. The product "mature" form arises, again by way of nonlimiting example, as a result of one or more naturally occurring processing steps as they may take place within the cell, or host cell, in which the gene product arises. Examples of such processing steps leading to a "mature" form of a polypeptide or protein include the cleavage of the N-terminal methionine residue encoded by the initiation codon of an ORF, or the proteolytic cleavage of a signal peptide or leader sequence. Thus a mature form arising from a precursor polypeptide or protein that has residues 1 to N, where residue 1 is the N-terminal methionine, would have residues 2 through N remaining after removal of the N-terminal methionine. Alternatively, a mature form arising from a precursor polypeptide or protein having residues 1 to N, in which an N-terminal signal sequence from residue 1 to residue M is cleaved, would have the residues from residue M+1 to residue N remaining. Further as used herein, a "mature" form of a polypeptide or protein may arise from a step of post-translational modification other than a proteolytic cleavage event. Such additional processes include, by way of non-limiting example, glycosylation, myristoylation or phosphorylation. In general, a mature polypeptide or protein may result from the operation of only one of these processes, or a combination of any of them.

[0046] The term "isolated" nucleic acid molecule, as utilized herein, is one, which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. Preferably, an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5'- and 3'-termini of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated thermostable sulfurylase nucleic acid molecules can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell/tissue from which the nucleic acid is derived (e.g., brain, heart, liver, spleen, etc.). Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or of chemical precursors or other chemicals when chemically synthesized.

[0047] A nucleic acid molecule of the invention, e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1 or a complement of this aforementioned nucleotide sequence, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or a portion of the nucleic acid sequence of SEQ ID NO:1 as a hybridization probe, thermostable sulfurylase molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, et al., (eds.), MOLECULAR CLONING: A LABORATORY MANUAL 2.sup.nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; and Ausubel, et al., (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1993.)

[0048] A nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to thermostable sulfurylase nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.

[0049] As used herein, the term "complementary" refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule, and the term "binding" means the physical or chemical interaction between two polypeptides or compounds or associated polypeptides or compounds or combinations thereof. Binding includes ionic, non-ionic, van der Waals, hydrophobic interactions, and the like. A physical interaction can be either direct or indirect. Indirect interactions may be through or due to the effects of another polypeptide or compound. Direct binding refers to interactions that do not take place through, or due to, the effect of another polypeptide or compound, but instead are without other substantial chemical intermediates.

[0050] Fragments provided herein are defined as sequences of at least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino acids, a length sufficient to allow for specific hybridization in the case of nucleic acids or for specific recognition of an epitope in the case of amino acids, respectively, and are at most some portion less than a full length sequence. Fragments may be derived from any contiguous portion of a nucleic acid or amino acid sequence of choice. Derivatives are nucleic acid sequences or amino acid sequences formed from the native compounds either directly or by modification or partial substitution. Analogs are nucleic acid sequences or amino acid sequences that have a structure similar to, but not identical to, the native compound but differs from it in respect to certain components or side chains. Analogs may be synthetic or from a different evolutionary origin and may have a similar or opposite metabolic activity compared to wild type. Homologs are nucleic acid sequences or amino acid sequences of a particular gene that are derived from different species.

[0051] Derivatives and analogs may be full length or other than full length, if the derivative or analog contains a modified nucleic acid or amino acid, as described below. Derivatives or analogs of the nucleic acids or proteins of the invention include, but are not limited to, molecules comprising regions that are substantially homologous to the nucleic acids or proteins of the invention, in various embodiments, by at least about 89% identity over a nucleic acid or amino acid sequence of identical size or when compared to an aligned sequence in which the alignment is done by a computer homology program known in the art, or whose encoding nucleic acid is capable of hybridizing to the complement of a sequence encoding the aforementioned proteins under stringent, moderately stringent, or low stringent conditions. See e.g. Ausubel, et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1993, and below.

[0052] A "homologous nucleic acid sequence" or "homologous amino acid sequence," or variations thereof, refer to sequences characterized by a homology at the nucleotide level or amino acid level as discussed above. Homologous nucleotide sequences encode those sequences coding for isoforms of thermostable sulfurylase polypeptides. Isoforms can be expressed in different tissues of the same organism as a result of, for example, alternative splicing of RNA. Alternatively, isoforms can be encoded by different genes. In the invention, homologous nucleotide sequences include nucleotide sequences encoding for a thermostable sulfurylase polypeptide of species other than humans, including, but not limited to: vertebrates, and thus can include, e.g., frog, mouse, rat, rabbit, dog, cat cow, horse, and other organisms. Homologous nucleotide sequences also include, but are not limited to, naturally occurring allelic variations and mutations of the nucleotide sequences set forth herein. Homologous nucleic acid sequences include those nucleic acid sequences that encode conservative amino acid substitutions in SEQ ID NO:1, as well as a polypeptide possessing thermostable sulfurylase biological activity. Various biological activities of the thermostable sulfurylase proteins are described below.

[0053] The thermostable sulfurylase proteins of the invention include the sulfurylase protein whose sequence is provided herein. The invention also includes mutant or variant proteins any of whose residues may be changed from the corresponding residue shown herein while still encoding a protein that maintains its sulfurylase-like activities and physiological functions, or a functional fragment thereof. The invention further encompasses antibodies and antibody fragments, such as F.sub.ab or (F.sub.ab)2, that bind immunospecifically to any of the proteins of the invention. This invention also includes a variant or a mature form of the amino acid sequence of SEQ ID NO:2, wherein one or more amino acid residues in the variant differs in no more than 4% of the amino acic residues from the amino acid sequence of the mature form.

[0054] Several assays have been developed for detection of the forward ATP sulfurylase reaction. The colorimetric molybdolysis assay is based on phosphate detection (see e.g., Wilson and Bandurski, 1958. J. Biol. Chem. 233: 975-981), whereas the continuous spectrophotometric molybdolysis assay is based upon the detection of NADH oxidation (see e.g., Seubert, et al., 1983. Arch. Biochem. Biophys. 225: 679-691; Seubert, et al., 1985. Arch. Biochem. Biophys. 240: 509-523). The later assay requires the presence of several detection enzymes.

[0055] Suitable enzymes for converting ATP into light include luciferases, e.g., insect luciferases. Luciferases produce light as an end-product of catalysis. The best known light-emitting enzyme is that of the firefly, Photinus pyralis (Coleoptera). The corresponding gene has been cloned and expressed in bacteria (see e.g., de Wet, et al., 1985. Proc. Natl. Acad. Sci. USA 80: 7870-7873) and plants (see e.g., Ow, et al., 1986. Science 234: 856-859), as well as in insect (see e.g., Jha, et al., 1990. FEBS Lett. 274: 24-26) and mammalian cells (see e.g., de Wet, et al., 1987. Mol. Cell. Biol. 7: 725-7373; Keller, et al., 1987. Proc. Natl. Acad. Sci. USA 82: 3264-3268). In addition, a number of luciferase genes from the Jamaican click beetle, Pyroplorus plagiophihalamus (Coleoptera), have recently been cloned and partially characterized (see e.g., Wood, et al., 1989. J. Biolumin. Chemilumin. 4: 289-301; Wood, et al., 1989. Science 244: 700-702). Distinct luciferases can sometimes produce light of different wavelengths, which may enable simultaneous monitoring of light emissions at different wavelengths. Accordingly, these aforementioned characteristics are unique, and add new dimensions with respect to the utilization of current reporter systems.

[0056] Firefly luciferase catalyzes bioluminescence in the presence of luciferin, adenosine 5'-triphosphate (ATP), magnesium ions, and oxygen, resulting in a quantum yield of 0.88 (see e.g., McElroy and Selinger, 1960. Arch. Biochem. Biophys. 88: 136-145). The firefly luciferase bioluminescent reaction can be utilized as an assay for the detection of ATP with a detection limit of approximately 1.times.10.sup.-13 M (see e.g., Leach, 1981. J. Appl. Biochem. 3: 473-517). In addition, the overall degree of sensitivity and convenience of the luciferase-mediated detection systems have created considerable interest in the development of firefly luciferase-based biosensors (see e.g., Green and Kricka, 1984. Talanta 31: 173-176; Blum, et al., 1989. J. Biolumin. Chemilumin. 4: 543-550).

[0057] The development of new reagents have made it possible to obtain stable light emission proportional to the concentrations of ATP (see e.g., Lundin, 1982. Applications of firefly luciferase In; Luminescent Assays (Raven Press, New York). With such stable light emission reagents, it is possible to make endpoint assays and to calibrate each individual assay by addition of a known amount of ATP. In addition, a stable light-emitting system also allows continuous monitoring of ATP-converting systems.

[0058] In a preferred embodiment, the ATP generating-ATP converting fusion protein is attached to an affinity tag. The term "affinity tag" is used herein to denote a peptide segment that can be attached to a polypeptide to provide for purification or detection of the polypeptide or provide sites for attachment of the polypeptide to a substrate. In principal, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include a poly-histidine tract or a biotin carboxyl carrier protein (BCCP) domain, protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et al., Methods Enzymol. 198:3, 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988), substance P, Flag..TM.. peptide (Hopp et al., Biotechnology 6:1204-1210, 1988; available from Eastman Kodak Co., New Haven, Conn.), streptavidin binding peptide, or other antigenic epitope or binding domain. See, in general Ford et al., Protein Expression and Purification 2: 95-107, 1991. DNAs encoding affinity tags are available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, N.J.).

[0059] As used herein, the term "poly-histidine tag," when used in reference to a fusion protein refers to the presence of two to ten histidine residues at either the amino- or carboxy-terminus of a protein of interest. A poly-histidine tract of six to ten residues is preferred. The poly-histidine tract is also defined functionally as being a number of consecutive histidine residues added to the protein of interest which allows the affinity purification of the resulting fusion protein on a nickel-chelate or IDA column.

[0060] In some embodiments, the fusion protein has an orientation such that the sulfurylase polypeptide is N-terminal to the luciferase polypeptide. In other embodiments, the luciferase polypeptide is N-terminal to the sulfurylase polypeptide. As used herein, the term sulfurylase-luciferase fusion protein refers to either of these orientations. The terms "amino-terminal" (N-terminal) and "carboxyl-terminal" (C-terminal) are used herein to denote positions within polypeptides and proteins. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide or protein to denote proximity or relative position. For example, a certain sequence positioned carboxyl-terminal to a reference sequence within a protein is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete protein.

[0061] The fusion protein of this invention can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, e.g. by employing blunt-ended or "sticky"-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Ausubel et al. (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, 1992). The two polypeptides of the fusion protein can also be joined by a linker, such as a unique restriction site, which is engineered with specific primers during the cloning procedure. In one embodiment, the sulfurylase and luciferase polypeptides are joined by a linker, for example an ala-ala-ala linker which is encoded by a Notl restriction site.

[0062] In one embodiment, the invention includes a recombinant polynucleotide that comprises a coding sequence for a fusion protein having an ATP generating polypeptide sequence and an ATP converting polypeptide sequence. In a preferred embodiment, the recombinant polynucleotide encodes a sulfurylase-luciferase fusion protein. The term "recombinant DNA molecule" or "recombinant polynucleotide" as used herein refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques. The term "recombinant protein" or "recombinant polypeptide" as used herein refers to a protein molecule which is expressed from a recombinant DNA molecule.

[0063] In one aspect, this invention discloses a sulfurylase-luciferase fusion protein with an N-terminal hexahistidine tag and a BCCP tag. The nucleic acid sequence of the disclosed N-terminal hexahistidine-BCCP luciferase-sulfurylase gene (His6-BCCP L-S) gene is shown below: TABLE-US-00003 His6-BCCP L-S Nucleotide Sequence (SEQ ID NO: 3): ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGGAAGCGCCAGCAGCA 60 GCGGAAATCAGTGGTCACATCGTACGTTCCCCGATGGTTGGTAGTTTCTACCGCACCCCA 120 AGCCCGGACGCAAAAGCGTTCATCGAAGTGGGTCAGAAAGTCAACGTGGGCGATACCCTG 180 TGCATCGTTGAAGCCATGAAAATGATGAACCAGATCGAAGCGGACAAATCCGGTACCGTG 240 AAAGCAATTCTGGTCGAAAGTGGACAACCGGTAGAATTTGACGAGCCGCTGGTCGTCATC 300 GAGGGATCCGAGCTCGAGATCCAAATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCG 360 CCATTCTATCCTCTAGAGGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGA 420 TACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCACG 480 TACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTG 540 AATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTG 600 TTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGT 660 GAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTCCAAAAAGGGG 720 TTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAATTATTATCATG 780 GATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTGATCTA 840 CCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGACAAAACAATT 900 GCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGCAT 960 AGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATT 1020 CCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACA 1080 CTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTG 1140 TTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAACCCTATTT 1200 TCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATT 1260 GCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAAACGCTTCCAT 1320 CTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACA 1380 CCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAG 1440 GTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGAATTATGTGTC 1500 AGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATT 1560 GACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTC 1620 TTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCGCT 1680 GAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCAGGTCTT 1740 CCCGACGATGACGCCGGTGAACTTCCCGGCGCCGTTGTTGTTTTGGAGCACGGAAAGACG 1800 ATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTG 1860 CGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCA 1920 AGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGTCCAAATTGGCGGCC 1980 GCTATGCCTGCTCCTCACGGTGGTATTCTACAAGACTTGATTGCTAGAGATGCGTTAAAG 2040 AAGAATGAATTGTTATCTGAAGCGCAATCTTCGGACATTTTAGTATGGAACTTGACTCCT 2100 AGACAACTATGTGATATTGAATTGATTCTAAATGGTGGGTTTTCTCCTCTGACTGGGTTT 2160 TTGAACGAAAACGATTACTCCTCTGTTGTTACAGATTCGAGATTAGCAGACGGCACATTG 2220 TGGACCATCCCTATTACATTAGATGTTGATGAAGCATTTGCTAACCAAATTAAACCAGAC 2280 ACAAGAATTGCCCTTTTCCAAGATGATGAAATTCCTATTGCTATACTTACTGTCCAGGAT 2340 GTTTACAAGCCAAACAAAACTATCGAAGCCGAAAAAGTCTTCAGAGGTGACCCAGAACAT 2400 CCAGCCATTAGCTATTTATTTAACGTTGCCGGTGATTATTACGTCGGCGGTTCTTTAGAA 2460 GCGATTCAATTACCTCAACATTATGACTATCCAGGTTTGCGTAAGACACCTGCCCAACTA 2520 AGACTTGAATTCCAATCAAGACAATGGGACCGTGTCGTAGCTTTCCAAACTCGTAATCCA 2580 ATGCATAGAGCCCACAGGGAGTTGACTGTGAGAGCCGCCAGAGAAGCTAATGCTAAGGTG 2640 CTGATCCATCCAGTTGTTGGACTAACCAAACCAGGTGATATAGACCATCACACTCGTGTT 2700 CGTGTCTACCAGGAAATTATTAAGCGTTATCCTAATGGTATTGCTTTCTTATCCCTGTTG 2760 CCATTAGCAATGAGAATGAGTGGTGATAGAGAAGCCGTATGGCATGCTATTATTAGAAAG 2820 AATTATGGTGCCTCCCACTTCATTGTTGGTAGAGACCATGCGGGCCCAGGTAAGAACTCC 2880 AAGGGTGTTGATTTCTACGGTCCATACGATGCTCAAGAATTGGTCGAATCCTACAAGCAT 2940 GAACTGGACATTGAAGTTGTTGCATTCAGAATGGTCACTTATTTGCCAGACGAAGACCGT 3000 TATGCTCCAATTGATCAAATTGACACCACAAAGACGAGAACCTTGAACATTTCAGGTACA 3060 GAGTTGAGACGCCGTTTAAGAGTTGGTGGTGAGATTCCTGAATGGTTCTCATATCCTGAA 3120 GTGGTTAAAATCCTAAGAGAATCCAACCCACCAAGACCAAAACAAGGTTTTTCAATTGTT 3180 TTAGGTAATTCATTAACCGTTTCTCGTGAGCAATTATCCATTGCTTTGTTGTCAACATTC 3240 TTGCAATTCGGTGGTGGCAGGTATTACAAGATCTTTGAACACAATAATAAGACAGAGTTA 3300 CTATCTTTGATTCAAGATTTCATTGGTTCTGGTAGTGGACTAATTATTCCAAATCAATGG 3360 GAAGATGACAAGGACTCTGTTGTTGGCAAGCAAAACGTTTACTTATTAGATACCTCAAGC 3420 TCAGCCGATATTCAGCTAGAGTCAGCGGATGAACCTATTTCACATATTGTACAAAAAGTT 3480 GTCCTATTCTTGGAAGACAATGGCTTTTTTGTATTTTAA 3519

[0064] The amino acid sequence of the disclosed His6-BCCP L-S polypeptide is presented using the three letter amino acid code (SEQ ID NO:4). TABLE-US-00004 His6-BCCP L-S Amino Acid Sequence (SEQ ID NO: 4) Met Arg Gly Ser His His His His His His Gly Met 1 5 10 Ala Ser Met Glu Ala Pro Ala Ala Ala Glu Ile Ser 15 20 Gly His Ile Val Arg Ser Pro Met Val Gly Thr Phe 25 30 35 Tyr Arg Thr Pro Ser Pro Asp Ala Lys Ala Phe Ile 40 45 Glu Val Gly Gln Lys Val Asn Val Gly Asp Thr Leu 50 55 60 Cys Ile Val Glu Ala Met Lys Met Met Asn Gln Ile 65 70 Glu Ala Asp Lys Ser Gly Thr Val Lys Ala Ile Leu 75 80 Val Glu Ser Gly Gln Pro Val Glu Phe Asp Glu Pro 85 90 95 Leu Val Val Ile Glu Gly Ser Glu Leu Glu Ile Gln 100 105 Met Glu Asp Ala Lys Asn Ile Lys Lys Gly Pro Ala 110 115 120 Pro Phe Tyr Pro Leu Glu Asp Gly Thr Ala Gly Glu 125 130 Gln Leu His Lys Ala Met Lys Arg Tyr Ala Leu Val 135 140 Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu 145 150 155 Val Asn Ile Thr Tyr Ala Glu Tyr Phe Glu Met Ser 160 165 Val Arg Leu Ala Glu Ala Met Lys Arg Tyr Gly Leu 170 175 180 Asn Thr Asn His Arg Ile Val Val Cys Ser Glu Asn 185 190 Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu 195 200 Phe Ile Gly Val Ala Val Ala Pro Ala Asn Asp Ile 205 210 215 Tyr Asn Glu Arg Glu Leu Leu Asn Ser Met Asn Ile 220 225 Ser Gln Pro Thr Val Val Phe Val Ser Lys Lys Gly 230 235 240 Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro 245 250 Ile Ile Gln Lys Ile Ile Ile Met Asp Ser Lys Thr 255 260 Asp Tyr Gln Gly Phe Gln Ser Met Tyr Thr Phe Val 265 270 275 Thr Ser His Leu Pro Pro Gly Phe Asn Glu Tyr Asp 280 285 Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile 290 295 300 Ala Leu Ile Met Asn Ser Ser Gly Ser Thr Gly Leu 305 310 Pro Lys Gly Val Ala Leu Pro His Arg Thr Ala Cys 315 320 Val Arg Phe Ser His Ala Arg Asp Pro Ile Phe Gly 325 330 335 Asn Gln Ile Ile Pro Asp Thr Ala Ile Leu Ser Val 340 345 Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr 350 355 360 Leu Gly Tyr Leu Ile Cys Gly Phe Arg Val Val Leu 365 370 Met Tyr Arg Phe Glu Glu Glu Leu Phe Leu Arg Ser 375 380 Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val 385 390 395 Pro Thr Leu Phe Ser Phe Phe Ala Lys Ser Thr Leu 400 405 Ile Asp Lys Tyr Asp Leu Ser Asn Leu His Glu Ile 410 415 420 Ala Ser Gly Gly Ala Pro Leu Ser Lys Glu Val Gly 425 430 Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile 435 440 Arg Gln Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala 445 450 455 Ile Leu Ile Thr Pro Glu Gly Asp Asp Lys Pro Gly 460 465 Ala Val Gly Lys Val Val Pro Phe Phe Glu Ala Lys 470 475 480 Val Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val 485 490 Asn Gln Arg Gly Glu Leu Cys Val Arg Gly Pro Met 495 500 Ile Met Ser Gly Tyr Val Asn Asn Pro Glu Ala Thr 505 510 515 Asn Ala Leu Ile Asp Lys Asp Gly Trp Leu His Ser 520 525 Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe 530 535 540 Phe Ile Val Asp Arg Leu Lys Ser Leu Ile Lys Tyr 545 550 Lys Gly Tyr Gln Val Ala Pro Ala Glu Leu Glu Ser 555 560 Ile Leu Leu Gln His Pro Asn Ile Phe Asp Ala Gly 565 570 575 Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu 580 585 Pro Ala Ala Val Val Val Leu Glu His Gly Lys Thr 590 595 600 Met Thr Glu Lys Glu Ile Val Asp Tyr Val Ala Ser 605 610 Gln Val Thr Thr Ala Lys Lys Leu Arg Gly Gly Val 615 620 Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly 625 630 635 Lys Leu Asp Ala Arg Lys Ile Arg Glu Ile Leu Ile 640 645 Lys Ala Lys Lys Gly Gly Lys Ser Lys Leu Ala Ala 650 655 660 Ala Met Pro Ala Pro His Gly Gly Ile Leu Gln Asp 665 670 Leu Ile Ala Arg Asp Ala Leu Lys Lys Asn Glu Leu 675 680 Leu Ser Glu Ala Gln Ser Ser Asp Ile Leu Val Trp 685 690 695 Asn Leu Thr Pro Arg Gln Leu Cys Asp Ile Glu Leu 700 705 Ile Leu Asn Gly Gly Phe Ser Pro Leu Thr Gly Phe 710 715 Leu Asn Glu Asn Asp Tyr Ser Ser Val Val Thr Asp 720 725 730 Ser Arg Leu Ala Asp Gly Thr Leu Trp Thr Ile Pro 735 740 Ile Thr Leu Asp Val Asp Glu Ala Phe Ala Asn Gln 745 750 755 Ile Lys Pro Asp Thr Arg Ile Ala Leu Phe Gln Asp 760 765 Asp Glu Ile Pro Ile Ala Ile Leu Thr Val Gln Asp 770 775 Val Tyr Lys Pro Asn Lys Thr Ile Glu Ala Glu Lys 780 785 790 Val Phe Arg Gly Asp Pro Glu His Pro Ala Ile Ser 795 800 Tyr Leu Phe Asn Val Ala Gly Asp Tyr Tyr Val Gly 805 810 815 Gly Ser Leu Glu Ala Ile Gln Leu Pro Gln His Tyr 820 825 Asp Tyr Pro Gly Leu Arg Lys Thr Pro Ala Gln Leu 830 835 Arg Leu Glu Phe Gln Ser Arg Gln Trp Asp Arg Val 840 845 850 Val Ala Phe Gln Thr Arg Asn Pro Met His Arg Ala 855 860 His Arg Glu Leu Thr Val Arg Ala Ala Arg Glu Ala 865 870 875 Asn Ala Lys Val Leu Ile His Pro Val Val Gly Leu 880 885 Thr Lys Pro Gly Asp Ile Asp His His Thr Arg Val 890 895 Arg Val Tyr Gln Glu Ile Ile Lys Arg Tyr Pro Asn 900 905 910 Gly Ile Ala Phe Leu Ser Leu Leu Pro Leu Ala Met 915 920 Arg Met Ser Gly Asp Arg Glu Ala Val Trp His Ala 925 930 935 Ile Ile Arg Lys Asn Tyr Gly Ala Ser His Phe Ile 940 945 Val Gly Arg Asp His Ala Gly Pro Gly Lys Asn Ser 950 955 Lys Gly Val Asp Phe Tyr Gly Pro Tyr Asp Ala Gln 960 965 970 Glu Leu Val Glu Ser Tyr Lys His Glu Leu Asp Ile 975 980

Glu Val Val Pro Phe Arg Met Val Thr Tyr Leu Pro 985 990 995 Asp Glu Asp Arg Tyr Ala Pro Ile Asp Gln Ile Asp 1000 1005 Thr Thr Lys Thr Arg Thr Leu Asn Ile Ser Gly Thr 1010 1015 Glu Leu Arg Arg Arg Leu Arg Val Gly Gly Glu Ile 1020 1025 1030 Pro Glu Trp Phe Ser Tyr Pro Glu Val Val Lys Ile 1035 1040 Leu Arg Glu Ser Asn Pro Pro Arg Pro Lys Gln Gly 1045 1050 1055 Phe Ser Ile Val Leu Gly Asn Ser Leu Thr Val Ser 1060 1065 Arg Glu Gln Leu Ser Ile Ala Leu Leu Ser Thr Phe 1070 1075 Leu Gln Phe Gly Gly Gly Arg Tyr Tyr Lys Ile Phe 1080 1085 1090 Glu His Asn Asn Lys Thr Glu Leu Leu Ser Leu Ile 1095 1100 Gln Asp Phe Ile Gly Ser Gly Ser Gly Leu Ile Ile 1105 1110 1115 Pro Asn Gln Trp Glu Asp Asp Lys Asp Ser Val Val 1120 1125 Gly Lys Gln Asn Val Tyr Leu Leu Asp Thr Ser Ser 1130 1135 Ser Ala Asp Ile Gln Leu Glu Ser Ala Asp Glu Pro 1140 1145 1150 Ile Ser His Ile Val Gln Lys Val Val Leu Phe Leu 1155 1160 Glu Asp Asn Gly Phe Phe Val Phe 1165 1170

[0065] Accordingly, in one aspect, the invention provides for a fusion protein comprising a thermostable sulfurylase joined to at least one affinity tag. The nucleic acid sequence of the disclosed N-terminal hexahistidine-BCCP Bst ATP Sulfurylase (His6-BCCP Bst Sulfurylase) gene is shown below: TABLE-US-00005 His6-BCCP Bst Sulfurylase Nucleotide Sequence (SEQ ID NO: 5) ATGCGGGGTTCTCATGATCATCATCATCATGGTATGGCTAGCATGGAAGGGCCAGCAGCA 60 GCGGAAATCAGTGGTCACATCGTACGTTCCCCGATGGTTGGTACTTTCTACCGCACCCCA 120 AGCCCGGACGCAAAAGCGTTCATCGAAGTGGGTCAGAAAGTCAACGTGGGCGATACCCTG 180 TGCATCGTTGAAGCCATGAAAATGATGAACCAGATCGAAGCGGACAAATCCGGTACCGTG 240 AAAGCAATTCTGGTCGAAAGTGGACAACCGGTAGAATTTGACGAGCCGCTGGTCGTCATC 300 GAGGGATCCGAGCTCGAGATCTGCAGCATGAGCGTAAGCATCCCGCATGGCGGCACATTG 360 ATCAACCGTTGGAATCCGGATTACCCAATCGATGAAGCAACGAAAACGATCGAGCTGTCC 420 AAAGCCGAACTAAGCGACCTTGAGCTGATCGGCACAGGCGCCTACAGCCCGCTCACCGGG 480 TTTTTAACGAAAGCCGATTACGATGCGGTCGTAGAAACGATGCGCCTCGCTGATGGCACT 540 GTCTGGAGCATTCCGATCACGCTGGCGGTGACGGAAGAAAAAGCGAGTGAACTCACTGTC 600 GGCGACAAAGCGAAACTCGTTTATGGCGGCGACGTCTACGGCGTCATTGAAATCGCCGAT 660 ATTTACCGCCCGGATAAAACGAAAGAAGCCAAGCTCGTCTATAAAACCGATGAACTCGCT 720 CACCCGGGCGTGCGCAAGCTGTTTGAAAAACCAGATGTGTACGTCGGCGGAGCGGTTACG 780 CTCGTCAAACGGACCGACAAAGGCCAGTTTGCTCCGTTTTATTTCGATCCGGCCGAAACG 840 CGGAAACGATTTGCCGAACTCGGCTGGAATACCGTCGTCGGCTTCCAAACACGCAACCCG 900 GTTCACCGCGCCCATGAATACATTCAAAAATGCGCGCTTGAAATCGTGGACGGCTTGTTT 960 TTAAACCCGCTCGTCGGCGAAACGAAAGCGGACGATATTCCGGCCGACATCCGGATGGAA 1020 AGCTATCAAGTGCTGCTGGAAAACTATTATCCGAAAGACCGCGTTTTCTTGGGCGTCTTC 1080 CAAGCTGCGATGCGCTATGCCGGTCCGCGCGAAGCGATTTTCCATGCCATGGTGCGGAAA 1140 AACTTCGGCTGCACGCACTTCATCGTCGGCCGCGACCATGCGGGCGTCGGCAACTATTAC 1200 GGCACGTATGATGCGCAAAAAATCTTCTCGAACTTTACAGCCGAAGAGCTTGGCATTACA 1260 CCGCTCTTTTTCGAACACAGCTTTTATTGCACGAAATGCGAAGGCATGGCATCGACGAAA 1320 ACATGCCCGCACGACGCACAATATCACGTTGTCCTTTCTGGCACGAAAGTCCGTGAAATG 1380 TTGCGTAACGGCCAAGTGCCGCCGAGCACATTCAGCCGTCCGGAAGTGGCCGCCGTTTTG 1440 ATCAAAGGGCTGCAAGAACGCGAAACGGTCGCCCCGTCAGCGGGCTAA 1488

[0066] The amino acid sequence of the His6-BCCP Bst Sulfurylase polypeptide is presented using the three letter amino acid code in Table 6 (SEQ ID NO:6).

Sequence CWU 1

1

31 1 1247 DNA Bacillus stearothermophilus 1 gttatgaaca tgagtttgag cattccgcat ggcggcacat tgatcaaccg ttggaatccg 60 gattacccaa tcgatgaagc aacgaaaacg atcgagctgt ccaaagccga actaagcgac 120 cttgagctga tcggcacagg cgcctacagc ccgctcaccg ggtttttaac gaaagccgat 180 tacgatgcgg tcgtagaaac gatgcgcctc gctgatggca ctgtctggag cattccgatc 240 acgctggcgg tgacggaaga aaaagcgagt gaactcactg tcggcgacaa agcgaaactc 300 gtttatggcg gcgacgtcta cggcgtcatt gaaatcgccg atatttaccg cccggataaa 360 acgaaagaag ccaagctcgt ctataaaacc gatgaactcg ctcacccggg cgtgcgcaag 420 ctgtttgaaa aaccagatgt gtacgtcggc ggagcggtta cgctcgtcaa acggaccgac 480 aaaggccagt ttgctccgtt ttatttcgat ccggccgaaa cgcggaaacg atttgccgaa 540 ctcggctgga ataccgtcgt cggcttccaa acacgcaacc cggttcaccg cgcccatgaa 600 tacattcaaa aatgcgcgct tgaaatcgtg gacggcttgt ttttaaaccc gctcgtcggc 660 gaaacgaaag cggacgatat tccggccgac atccggatgg aaagctatca agtgctgctg 720 gaaaactatt atccgaaaga ccgcgttttc ttgggcgtct tccaagctgc gatgcgctat 780 gccggtccgc gcgaagcgat tttccatgcc atggtgcgga aaaacttcgg ctgcacgcac 840 ttcatcgtcg gccgcgacca tgcgggcgtc ggcaactatt acggcacgta tgatgcgcaa 900 aaaatcttct cgaactttac agccgaagag cttggcatta caccgctctt tttcgaacac 960 agcttttatt gcacgaaatg cgaaggcatg gcatcgacga aaacatgccc gcacgacgca 1020 caatatcacg ttgtcctttc tggcacgaaa gtccgtgaaa tgttgcgtaa cggccaagtg 1080 ccgccgagca cattcagccg tccggaagtg gccgccgttt tgatcaaagg gctgcaagaa 1140 cgcgaaacgg tcaccccgtc gacacgctaa aggaggagcg agatgagcac gaatatcgtt 1200 tggcatcata catcggtgac aaaagaagat cgccgccaac gcaacgg 1247 2 386 PRT Bacillus stearothermophilus 2 Met Ser Leu Ser Ile Pro His Gly Gly Thr Leu Ile Asn Arg Trp Asn 1 5 10 15 Pro Asp Tyr Pro Ile Asp Glu Ala Thr Lys Thr Ile Glu Leu Ser Lys 20 25 30 Ala Glu Leu Ser Asp Leu Glu Leu Ile Gly Thr Gly Ala Tyr Ser Pro 35 40 45 Leu Thr Gly Phe Leu Thr Lys Ala Asp Tyr Asp Ala Val Val Glu Thr 50 55 60 Met Arg Leu Ala Asp Gly Thr Val Trp Ser Ile Pro Ile Thr Leu Ala 65 70 75 80 Val Thr Glu Glu Lys Ala Ser Glu Leu Thr Val Gly Asp Lys Ala Lys 85 90 95 Leu Val Tyr Gly Gly Asp Val Tyr Gly Val Ile Glu Ile Ala Asp Ile 100 105 110 Tyr Arg Pro Asp Lys Thr Lys Glu Ala Lys Leu Val Tyr Lys Thr Asp 115 120 125 Glu Leu Ala His Pro Gly Val Arg Lys Leu Phe Glu Lys Pro Asp Val 130 135 140 Tyr Val Gly Gly Ala Val Thr Leu Val Lys Arg Thr Asp Lys Gly Gln 145 150 155 160 Phe Ala Pro Phe Tyr Phe Asp Pro Ala Glu Thr Arg Lys Arg Phe Ala 165 170 175 Glu Leu Gly Trp Asn Thr Val Val Gly Phe Gln Thr Arg Asn Pro Val 180 185 190 His Arg Ala His Glu Tyr Ile Gln Lys Cys Ala Leu Glu Ile Val Asp 195 200 205 Gly Leu Phe Leu Asn Pro Leu Val Gly Glu Thr Lys Ala Asp Asp Ile 210 215 220 Pro Ala Asp Ile Arg Met Glu Ser Tyr Gln Val Leu Leu Glu Asn Tyr 225 230 235 240 Tyr Pro Lys Asp Arg Val Phe Leu Gly Val Phe Gln Ala Ala Met Arg 245 250 255 Tyr Ala Gly Pro Arg Glu Ala Ile Phe His Ala Met Val Arg Lys Asn 260 265 270 Phe Gly Cys Thr His Phe Ile Val Gly Arg Asp His Ala Gly Val Gly 275 280 285 Asn Tyr Tyr Gly Thr Tyr Asp Ala Gln Lys Ile Phe Ser Asn Phe Thr 290 295 300 Ala Glu Glu Leu Gly Ile Thr Pro Leu Phe Phe Glu His Ser Phe Tyr 305 310 315 320 Cys Thr Lys Cys Glu Gly Met Ala Ser Thr Lys Thr Cys Pro His Asp 325 330 335 Ala Gln Tyr His Val Val Leu Ser Gly Thr Lys Val Arg Glu Met Leu 340 345 350 Arg Asn Gly Gln Val Pro Pro Ser Thr Phe Ser Arg Pro Glu Val Ala 355 360 365 Ala Val Leu Ile Lys Gly Leu Gln Glu Arg Glu Thr Val Thr Pro Ser 370 375 380 Thr Arg 385 3 3519 DNA Escherichia coli 3 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatggaagc gccagcagca 60 gcggaaatca gtggtcacat cgtacgttcc ccgatggttg gtactttcta ccgcacccca 120 agcccggacg caaaagcgtt catcgaagtg ggtcagaaag tcaacgtggg cgataccctg 180 tgcatcgttg aagccatgaa aatgatgaac cagatcgaag cggacaaatc cggtaccgtg 240 aaagcaattc tggtcgaaag tggacaaccg gtagaatttg acgagccgct ggtcgtcatc 300 gagggatccg agctcgagat ccaaatggaa gacgccaaaa acataaagaa aggcccggcg 360 ccattctatc ctctagagga tggaaccgct ggagagcaac tgcataaggc tatgaagaga 420 tacgccctgg ttcctggaac aattgctttt acagatgcac atatcgaggt gaacatcacg 480 tacgcggaat acttcgaaat gtccgttcgg ttggcagaag ctatgaaacg atatgggctg 540 aatacaaatc acagaatcgt cgtatgcagt gaaaactctc ttcaattctt tatgccggtg 600 ttgggcgcgt tatttatcgg agttgcagtt gcgcccgcga acgacattta taatgaacgt 660 gaattgctca acagtatgaa catttcgcag cctaccgtag tgtttgtttc caaaaagggg 720 ttgcaaaaaa ttttgaacgt gcaaaaaaaa ttaccaataa tccagaaaat tattatcatg 780 gattctaaaa cggattacca gggatttcag tcgatgtaca cgttcgtcac atctcatcta 840 cctcccggtt ttaatgaata cgattttgta ccagagtcct ttgatcgtga caaaacaatt 900 gcactgataa tgaattcctc tggatctact gggttaccta agggtgtggc ccttccgcat 960 agaactgcct gcgtcagatt ctcgcatgcc agagatccta tttttggcaa tcaaatcatt 1020 ccggatactg cgattttaag tgttgttcca ttccatcacg gttttggaat gtttactaca 1080 ctcggatatt tgatatgtgg atttcgagtc gtcttaatgt atagatttga agaagagctg 1140 tttttacgat cccttcagga ttacaaaatt caaagtgcgt tgctagtacc aaccctattt 1200 tcattcttcg ccaaaagcac tctgattgac aaatacgatt tatctaattt acacgaaatt 1260 gcttctgggg gcgcacctct ttcgaaagaa gtcggggaag cggttgcaaa acgcttccat 1320 cttccaggga tacgacaagg atatgggctc actgagacta catcagctat tctgattaca 1380 cccgaggggg atgataaacc gggcgcggtc ggtaaagttg ttccattttt tgaagcgaag 1440 gttgtggatc tggataccgg gaaaacgctg ggcgttaatc agagaggcga attatgtgtc 1500 agaggaccta tgattatgtc cggttatgta aacaatccgg aagcgaccaa cgccttgatt 1560 gacaaggatg gatggctaca ttctggagac atagcttact gggacgaaga cgaacacttc 1620 ttcatagttg accgcttgaa gtctttaatt aaatacaaag gatatcaggt ggcccccgct 1680 gaattggaat cgatattgtt acaacacccc aacatcttcg acgcgggcgt ggcaggtctt 1740 cccgacgatg acgccggtga acttcccgcc gccgttgttg ttttggagca cggaaagacg 1800 atgacggaaa aagagatcgt ggattacgtc gccagtcaag taacaaccgc gaaaaagttg 1860 cgcggaggag ttgtgtttgt ggacgaagta ccgaaaggtc ttaccggaaa actcgacgca 1920 agaaaaatca gagagatcct cataaaggcc aagaagggcg gaaagtccaa attggcggcc 1980 gctatgcctg ctcctcacgg tggtattcta caagacttga ttgctagaga tgcgttaaag 2040 aagaatgaat tgttatctga agcgcaatct tcggacattt tagtatggaa cttgactcct 2100 agacaactat gtgatattga attgattcta aatggtgggt tttctcctct gactgggttt 2160 ttgaacgaaa acgattactc ctctgttgtt acagattcga gattagcaga cggcacattg 2220 tggaccatcc ctattacatt agatgttgat gaagcatttg ctaaccaaat taaaccagac 2280 acaagaattg cccttttcca agatgatgaa attcctattg ctatacttac tgtccaggat 2340 gtttacaagc caaacaaaac tatcgaagcc gaaaaagtct tcagaggtga cccagaacat 2400 ccagccatta gctatttatt taacgttgcc ggtgattatt acgtcggcgg ttctttagaa 2460 gcgattcaat tacctcaaca ttatgactat ccaggtttgc gtaagacacc tgcccaacta 2520 agacttgaat tccaatcaag acaatgggac cgtgtcgtag ctttccaaac tcgtaatcca 2580 atgcatagag cccacaggga gttgactgtg agagccgcca gagaagctaa tgctaaggtg 2640 ctgatccatc cagttgttgg actaaccaaa ccaggtgata tagaccatca cactcgtgtt 2700 cgtgtctacc aggaaattat taagcgttat cctaatggta ttgctttctt atccctgttg 2760 ccattagcaa tgagaatgag tggtgataga gaagccgtat ggcatgctat tattagaaag 2820 aattatggtg cctcccactt cattgttggt agagaccatg cgggcccagg taagaactcc 2880 aagggtgttg atttctacgg tccatacgat gctcaagaat tggtcgaatc ctacaagcat 2940 gaactggaca ttgaagttgt tccattcaga atggtcactt atttgccaga cgaagaccgt 3000 tatgctccaa ttgatcaaat tgacaccaca aagacgagaa ccttgaacat ttcaggtaca 3060 gagttgagac gccgtttaag agttggtggt gagattcctg aatggttctc atatcctgaa 3120 gtggttaaaa tcctaagaga atccaaccca ccaagaccaa aacaaggttt ttcaattgtt 3180 ttaggtaatt cattaaccgt ttctcgtgag caattatcca ttgctttgtt gtcaacattc 3240 ttgcaattcg gtggtggcag gtattacaag atctttgaac acaataataa gacagagtta 3300 ctatctttga ttcaagattt cattggttct ggtagtggac taattattcc aaatcaatgg 3360 gaagatgaca aggactctgt tgttggcaag caaaacgttt acttattaga tacctcaagc 3420 tcagccgata ttcagctaga gtcagcggat gaacctattt cacatattgt acaaaaagtt 3480 gtcctattct tggaagacaa tggctttttt gtattttaa 3519 4 1172 PRT Escherichia coli 4 Met Arg Gly Ser His His His His His His Gly Met Ala Ser Met Glu 1 5 10 15 Ala Pro Ala Ala Ala Glu Ile Ser Gly His Ile Val Arg Ser Pro Met 20 25 30 Val Gly Thr Phe Tyr Arg Thr Pro Ser Pro Asp Ala Lys Ala Phe Ile 35 40 45 Glu Val Gly Gln Lys Val Asn Val Gly Asp Thr Leu Cys Ile Val Glu 50 55 60 Ala Met Lys Met Met Asn Gln Ile Glu Ala Asp Lys Ser Gly Thr Val 65 70 75 80 Lys Ala Ile Leu Val Glu Ser Gly Gln Pro Val Glu Phe Asp Glu Pro 85 90 95 Leu Val Val Ile Glu Gly Ser Glu Leu Glu Ile Gln Met Glu Asp Ala 100 105 110 Lys Asn Ile Lys Lys Gly Pro Ala Pro Phe Tyr Pro Leu Glu Asp Gly 115 120 125 Thr Ala Gly Glu Gln Leu His Lys Ala Met Lys Arg Tyr Ala Leu Val 130 135 140 Pro Gly Thr Ile Ala Phe Thr Asp Ala His Ile Glu Val Asn Ile Thr 145 150 155 160 Tyr Ala Glu Tyr Phe Glu Met Ser Val Arg Leu Ala Glu Ala Met Lys 165 170 175 Arg Tyr Gly Leu Asn Thr Asn His Arg Ile Val Val Cys Ser Glu Asn 180 185 190 Ser Leu Gln Phe Phe Met Pro Val Leu Gly Ala Leu Phe Ile Gly Val 195 200 205 Ala Val Ala Pro Ala Asn Asp Ile Tyr Asn Glu Arg Glu Leu Leu Asn 210 215 220 Ser Met Asn Ile Ser Gln Pro Thr Val Val Phe Val Ser Lys Lys Gly 225 230 235 240 Leu Gln Lys Ile Leu Asn Val Gln Lys Lys Leu Pro Ile Ile Gln Lys 245 250 255 Ile Ile Ile Met Asp Ser Lys Thr Asp Tyr Gln Gly Phe Gln Ser Met 260 265 270 Tyr Thr Phe Val Thr Ser His Leu Pro Pro Gly Phe Asn Glu Tyr Asp 275 280 285 Phe Val Pro Glu Ser Phe Asp Arg Asp Lys Thr Ile Ala Leu Ile Met 290 295 300 Asn Ser Ser Gly Ser Thr Gly Leu Pro Lys Gly Val Ala Leu Pro His 305 310 315 320 Arg Thr Ala Cys Val Arg Phe Ser His Ala Arg Asp Pro Ile Phe Gly 325 330 335 Asn Gln Ile Ile Pro Asp Thr Ala Ile Leu Ser Val Val Pro Phe His 340 345 350 His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu Ile Cys Gly Phe 355 360 365 Arg Val Val Leu Met Tyr Arg Phe Glu Glu Glu Leu Phe Leu Arg Ser 370 375 380 Leu Gln Asp Tyr Lys Ile Gln Ser Ala Leu Leu Val Pro Thr Leu Phe 385 390 395 400 Ser Phe Phe Ala Lys Ser Thr Leu Ile Asp Lys Tyr Asp Leu Ser Asn 405 410 415 Leu His Glu Ile Ala Ser Gly Gly Ala Pro Leu Ser Lys Glu Val Gly 420 425 430 Glu Ala Val Ala Lys Arg Phe His Leu Pro Gly Ile Arg Gln Gly Tyr 435 440 445 Gly Leu Thr Glu Thr Thr Ser Ala Ile Leu Ile Thr Pro Glu Gly Asp 450 455 460 Asp Lys Pro Gly Ala Val Gly Lys Val Val Pro Phe Phe Glu Ala Lys 465 470 475 480 Val Val Asp Leu Asp Thr Gly Lys Thr Leu Gly Val Asn Gln Arg Gly 485 490 495 Glu Leu Cys Val Arg Gly Pro Met Ile Met Ser Gly Tyr Val Asn Asn 500 505 510 Pro Glu Ala Thr Asn Ala Leu Ile Asp Lys Asp Gly Trp Leu His Ser 515 520 525 Gly Asp Ile Ala Tyr Trp Asp Glu Asp Glu His Phe Phe Ile Val Asp 530 535 540 Arg Leu Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro Ala 545 550 555 560 Glu Leu Glu Ser Ile Leu Leu Gln His Pro Asn Ile Phe Asp Ala Gly 565 570 575 Val Ala Gly Leu Pro Asp Asp Asp Ala Gly Glu Leu Pro Ala Ala Val 580 585 590 Val Val Leu Glu His Gly Lys Thr Met Thr Glu Lys Glu Ile Val Asp 595 600 605 Tyr Val Ala Ser Gln Val Thr Thr Ala Lys Lys Leu Arg Gly Gly Val 610 615 620 Val Phe Val Asp Glu Val Pro Lys Gly Leu Thr Gly Lys Leu Asp Ala 625 630 635 640 Arg Lys Ile Arg Glu Ile Leu Ile Lys Ala Lys Lys Gly Gly Lys Ser 645 650 655 Lys Leu Ala Ala Ala Met Pro Ala Pro His Gly Gly Ile Leu Gln Asp 660 665 670 Leu Ile Ala Arg Asp Ala Leu Lys Lys Asn Glu Leu Leu Ser Glu Ala 675 680 685 Gln Ser Ser Asp Ile Leu Val Trp Asn Leu Thr Pro Arg Gln Leu Cys 690 695 700 Asp Ile Glu Leu Ile Leu Asn Gly Gly Phe Ser Pro Leu Thr Gly Phe 705 710 715 720 Leu Asn Glu Asn Asp Tyr Ser Ser Val Val Thr Asp Ser Arg Leu Ala 725 730 735 Asp Gly Thr Leu Trp Thr Ile Pro Ile Thr Leu Asp Val Asp Glu Ala 740 745 750 Phe Ala Asn Gln Ile Lys Pro Asp Thr Arg Ile Ala Leu Phe Gln Asp 755 760 765 Asp Glu Ile Pro Ile Ala Ile Leu Thr Val Gln Asp Val Tyr Lys Pro 770 775 780 Asn Lys Thr Ile Glu Ala Glu Lys Val Phe Arg Gly Asp Pro Glu His 785 790 795 800 Pro Ala Ile Ser Tyr Leu Phe Asn Val Ala Gly Asp Tyr Tyr Val Gly 805 810 815 Gly Ser Leu Glu Ala Ile Gln Leu Pro Gln His Tyr Asp Tyr Pro Gly 820 825 830 Leu Arg Lys Thr Pro Ala Gln Leu Arg Leu Glu Phe Gln Ser Arg Gln 835 840 845 Trp Asp Arg Val Val Ala Phe Gln Thr Arg Asn Pro Met His Arg Ala 850 855 860 His Arg Glu Leu Thr Val Arg Ala Ala Arg Glu Ala Asn Ala Lys Val 865 870 875 880 Leu Ile His Pro Val Val Gly Leu Thr Lys Pro Gly Asp Ile Asp His 885 890 895 His Thr Arg Val Arg Val Tyr Gln Glu Ile Ile Lys Arg Tyr Pro Asn 900 905 910 Gly Ile Ala Phe Leu Ser Leu Leu Pro Leu Ala Met Arg Met Ser Gly 915 920 925 Asp Arg Glu Ala Val Trp His Ala Ile Ile Arg Lys Asn Tyr Gly Ala 930 935 940 Ser His Phe Ile Val Gly Arg Asp His Ala Gly Pro Gly Lys Asn Ser 945 950 955 960 Lys Gly Val Asp Phe Tyr Gly Pro Tyr Asp Ala Gln Glu Leu Val Glu 965 970 975 Ser Tyr Lys His Glu Leu Asp Ile Glu Val Val Pro Phe Arg Met Val 980 985 990 Thr Tyr Leu Pro Asp Glu Asp Arg Tyr Ala Pro Ile Asp Gln Ile Asp 995 1000 1005 Thr Thr Lys Thr Arg Thr Leu Asn Ile Ser Gly Thr Glu Leu Arg Arg 1010 1015 1020 Arg Leu Arg Val Gly Gly Glu Ile Pro Glu Trp Phe Ser Tyr Pro Glu 1025 1030 1035 1040 Val Val Lys Ile Leu Arg Glu Ser Asn Pro Pro Arg Pro Lys Gln Gly 1045 1050 1055 Phe Ser Ile Val Leu Gly Asn Ser Leu Thr Val Ser Arg Glu Gln Leu 1060 1065 1070 Ser Ile Ala Leu Leu Ser Thr Phe Leu Gln Phe Gly Gly Gly Arg Tyr 1075 1080 1085 Tyr Lys Ile Phe Glu His Asn Asn Lys Thr Glu Leu Leu Ser Leu Ile 1090 1095 1100 Gln Asp Phe Ile Gly Ser Gly Ser Gly Leu Ile Ile Pro Asn Gln Trp 1105 1110 1115 1120 Glu Asp Asp Lys Asp Ser Val Val Gly Lys Gln Asn Val Tyr Leu Leu 1125 1130 1135 Asp Thr Ser Ser Ser Ala Asp Ile Gln Leu Glu Ser Ala Asp Glu Pro 1140 1145 1150 Ile Ser His Ile Val Gln Lys Val Val Leu Phe Leu Glu Asp Asn Gly 1155 1160 1165 Phe Phe Val Phe 1170 5 1488 DNA Escherichia coli 5 atgcggggtt ctcatcatca tcatcatcat ggtatggcta gcatggaagc gccagcagca 60 gcggaaatca gtggtcacat cgtacgttcc ccgatggttg gtactttcta ccgcacccca 120 agcccggacg caaaagcgtt catcgaagtg ggtcagaaag tcaacgtggg cgataccctg 180 tgcatcgttg aagccatgaa aatgatgaac cagatcgaag cggacaaatc cggtaccgtg 240 aaagcaattc tggtcgaaag tggacaaccg gtagaatttg acgagccgct ggtcgtcatc 300 gagggatccg agctcgagat ctgcagcatg agcgtaagca tcccgcatgg cggcacattg 360 atcaaccgtt ggaatccgga ttacccaatc gatgaagcaa cgaaaacgat cgagctgtcc 420 aaagccgaac taagcgacct tgagctgatc ggcacaggcg cctacagccc gctcaccggg 480 tttttaacga aagccgatta cgatgcggtc gtagaaacga tgcgcctcgc tgatggcact 540

gtctggagca ttccgatcac gctggcggtg acggaagaaa aagcgagtga actcactgtc 600 ggcgacaaag cgaaactcgt ttatggcggc gacgtctacg gcgtcattga aatcgccgat 660 atttaccgcc cggataaaac gaaagaagcc aagctcgtct ataaaaccga tgaactcgct 720 cacccgggcg tgcgcaagct gtttgaaaaa ccagatgtgt acgtcggcgg agcggttacg 780 ctcgtcaaac ggaccgacaa aggccagttt gctccgtttt atttcgatcc ggccgaaacg 840 cggaaacgat ttgccgaact cggctggaat accgtcgtcg gcttccaaac acgcaacccg 900 gttcaccgcg cccatgaata cattcaaaaa tgcgcgcttg aaatcgtgga cggcttgttt 960 ttaaacccgc tcgtcggcga aacgaaagcg gacgatattc cggccgacat ccggatggaa 1020 agctatcaag tgctgctgga aaactattat ccgaaagacc gcgttttctt gggcgtcttc 1080 caagctgcga tgcgctatgc cggtccgcgc gaagcgattt tccatgccat ggtgcggaaa 1140 aacttcggct gcacgcactt catcgtcggc cgcgaccatg cgggcgtcgg caactattac 1200 ggcacgtatg atgcgcaaaa aatcttctcg aactttacag ccgaagagct tggcattaca 1260 ccgctctttt tcgaacacag cttttattgc acgaaatgcg aaggcatggc atcgacgaaa 1320 acatgcccgc acgacgcaca atatcacgtt gtcctttctg gcacgaaagt ccgtgaaatg 1380 ttgcgtaacg gccaagtgcc gccgagcaca ttcagccgtc cggaagtggc cgccgttttg 1440 atcaaagggc tgcaagaacg cgaaacggtc gccccgtcag cgcgctaa 1488 6 495 PRT Escherichia coli 6 Met Arg Gly Ser His His His His His His Gly Met Ala Ser Met Glu 1 5 10 15 Ala Pro Ala Ala Ala Glu Ile Ser Gly His Ile Val Arg Ser Pro Met 20 25 30 Val Gly Thr Phe Tyr Arg Thr Pro Ser Pro Asp Ala Lys Ala Phe Ile 35 40 45 Glu Val Gly Gln Lys Val Asn Val Gly Asp Thr Leu Cys Ile Val Glu 50 55 60 Ala Met Lys Met Met Asn Gln Ile Glu Ala Asp Lys Ser Gly Thr Val 65 70 75 80 Lys Ala Ile Leu Val Glu Ser Gly Gln Pro Val Glu Phe Asp Glu Pro 85 90 95 Leu Val Val Ile Glu Gly Ser Glu Leu Glu Ile Cys Ser Met Ser Val 100 105 110 Ser Ile Pro His Gly Gly Thr Leu Ile Asn Arg Trp Asn Pro Asp Tyr 115 120 125 Pro Ile Asp Glu Ala Thr Lys Thr Ile Glu Leu Ser Lys Ala Glu Leu 130 135 140 Ser Asp Leu Glu Leu Ile Gly Thr Gly Ala Tyr Ser Pro Leu Thr Gly 145 150 155 160 Phe Leu Thr Lys Ala Asp Tyr Asp Ala Val Val Glu Thr Met Arg Leu 165 170 175 Ala Asp Gly Thr Val Trp Ser Ile Pro Ile Thr Leu Ala Val Thr Glu 180 185 190 Glu Lys Ala Ser Glu Leu Thr Val Gly Asp Lys Ala Lys Leu Val Tyr 195 200 205 Gly Gly Asp Val Tyr Gly Val Ile Glu Ile Ala Asp Ile Tyr Arg Pro 210 215 220 Asp Lys Thr Lys Glu Ala Lys Leu Val Tyr Lys Thr Asp Glu Leu Ala 225 230 235 240 His Pro Gly Val Arg Lys Leu Phe Glu Lys Pro Asp Val Tyr Val Gly 245 250 255 Gly Ala Val Thr Leu Val Lys Arg Thr Asp Lys Gly Gln Phe Ala Pro 260 265 270 Phe Tyr Phe Asp Pro Ala Glu Thr Arg Lys Arg Phe Ala Glu Leu Gly 275 280 285 Trp Asn Thr Val Val Gly Phe Gln Thr Arg Asn Pro Val His Arg Ala 290 295 300 His Glu Tyr Ile Gln Lys Cys Ala Leu Glu Ile Val Asp Gly Leu Phe 305 310 315 320 Leu Asn Pro Leu Val Gly Glu Thr Lys Ala Asp Asp Ile Pro Ala Asp 325 330 335 Ile Arg Met Glu Ser Tyr Gln Val Leu Leu Glu Asn Tyr Tyr Pro Lys 340 345 350 Asp Arg Val Phe Leu Gly Val Phe Gln Ala Ala Met Arg Tyr Ala Gly 355 360 365 Pro Arg Glu Ala Ile Phe His Ala Met Val Arg Lys Asn Phe Gly Cys 370 375 380 Thr His Phe Ile Val Gly Arg Asp His Ala Gly Val Gly Asn Tyr Tyr 385 390 395 400 Gly Thr Tyr Asp Ala Gln Lys Ile Phe Ser Asn Phe Thr Ala Glu Glu 405 410 415 Leu Gly Ile Thr Pro Leu Phe Phe Glu His Ser Phe Tyr Cys Thr Lys 420 425 430 Cys Glu Gly Met Ala Ser Thr Lys Thr Cys Pro His Asp Ala Gln Tyr 435 440 445 His Val Val Leu Ser Gly Thr Lys Val Arg Glu Met Leu Arg Asn Gly 450 455 460 Gln Val Pro Pro Ser Thr Phe Ser Arg Pro Glu Val Ala Ala Val Leu 465 470 475 480 Ile Lys Gly Leu Gln Glu Arg Glu Thr Val Ala Pro Ser Ala Arg 485 490 495 7 45 DNA Artificial Sequence Description of Artificial Sequence primer 7 cccttctgca gcatgagcgt aagcatcccg catggcggca cattg 45 8 47 DNA Artificial Sequence Description of Artificial Sequence primer 8 cccgtaagct tttagcgcgc tgacggggcg accgtttcgc gttcttg 47 9 48 DNA Artificial Sequence Description of Artificial Sequence primer 9 ccccctcgag atccaaatgg aagacgccaa aaacataaag aaaggccc 48 10 45 DNA Artificial Sequence Description of Artificial Sequence primer 10 ccccctcgag atccaaatgg ctgacaaaaa catcctgtat ggccc 45 11 67 DNA Artificial Sequence Description of Artificial Sequence primer 11 ttgtagaata ccaccgtgag gagcaggcat agcggccgcc aatttggact ttccgccctt 60 cttggcc 67 12 64 DNA Artificial Sequence Description of Artificial Sequence primer 12 ttgtagaata ccaccgtgag gagcaggcat agcggccgca ccgttggtgt gtttctcgaa 60 catc 64 13 37 DNA Artificial Sequence Description of Artificial Sequence primer 13 gcggccgcta tgcctgctcc tcacggtggt attctac 37 14 49 DNA Artificial Sequence Description of Artificial Sequence primer 14 ccccaagctt ttaaaataca aaaaagccat tgtcttccaa gaataggac 49 15 49 DNA Artificial Sequence Description of Artificial Sequence primer 15 ccccggatcc atccaaatgc ctgctcctca cggtggtatt ctacaagac 49 16 62 DNA Artificial Sequence Description of Artificial Sequence primer 16 gggcctttct ttatgttttt ggcgtcttcc atagcggccg caaatacaaa aaagccattg 60 tc 62 17 41 DNA Artificial Sequence Description of Artificial Sequence primer 17 gcggccgcta tggaagacgc caaaaacata aagaaaggcc c 41 18 41 DNA Artificial Sequence Description of Artificial Sequence primer 18 ccccccatgg ttacaatttg gactttccgc ccttcttggc c 41 19 59 DNA Artificial Sequence Description of Artificial Sequence primer 19 gggccataca ggatgttttt gtcagccata gcggccgcaa atacaaaaaa gccattgtc 59 20 38 DNA Artificial Sequence Description of Artificial Sequence primer 20 gcggccgcta tggctgacaa aaacatcctg tatggccc 38 21 44 DNA Artificial Sequence Description of Artificial Sequence primer 21 ccccaagctt ctaaccgttg gtgtgtttct cgaacatctg acgc 44 22 386 PRT Bacillus stearothermophilus 22 Met Ser Val Ser Ile Pro His Gly Gly Thr Leu Ile Asn Arg Trp Asn 1 5 10 15 Pro Asp Tyr Pro Leu Asp Glu Ala Thr Lys Thr Ile Glu Leu Ser Lys 20 25 30 Ala Glu Leu Ser Asp Leu Glu Leu Ile Gly Thr Gly Ala Tyr Ser Pro 35 40 45 Leu Thr Gly Phe Leu Thr Lys Thr Asp Tyr Asp Ala Val Val Glu Thr 50 55 60 Met Arg Leu Ser Asp Gly Thr Val Trp Ser Ile Pro Val Thr Leu Ala 65 70 75 80 Val Thr Glu Glu Lys Ala Lys Glu Leu Ala Val Gly Asp Lys Ala Lys 85 90 95 Leu Val Tyr Arg Gly Asp Val Tyr Gly Val Ile Glu Ile Ala Asp Ile 100 105 110 Tyr Arg Pro Asp Lys Thr Lys Glu Ala Lys Leu Val Tyr Lys Thr Asp 115 120 125 Glu Leu Ala His Pro Gly Val Arg Lys Leu Phe Glu Lys Pro Asp Val 130 135 140 Tyr Val Gly Gly Glu Ile Thr Leu Val Lys Arg Thr Asp Lys Gly Gln 145 150 155 160 Phe Ala Ala Phe Tyr Phe Asp Pro Ala Glu Thr Arg Lys Lys Phe Ala 165 170 175 Glu Phe Gly Trp Asn Thr Val Val Gly Phe Gln Thr Arg Asn Pro Val 180 185 190 His Arg Ala His Glu Tyr Ile Gln Lys Cys Ala Leu Glu Ile Val Asp 195 200 205 Gly Leu Phe Leu Asn Pro Leu Val Gly Glu Thr Lys Ser Asp Asp Ile 210 215 220 Pro Ala Asp Ile Arg Met Glu Ser Tyr Gln Val Leu Leu Glu Asn Tyr 225 230 235 240 Tyr Pro Lys Asp Arg Val Phe Leu Gly Val Phe Gln Ala Ala Met Arg 245 250 255 Tyr Ala Gly Pro Arg Glu Ala Ile Phe His Ala Met Val Arg Lys Asn 260 265 270 Phe Gly Cys Thr His Phe Ile Val Gly Arg Asp His Ala Gly Val Gly 275 280 285 Asn Tyr Tyr Gly Thr Tyr Asp Ala Gln Lys Ile Phe Leu Asn Phe Thr 290 295 300 Ala Glu Glu Leu Gly Ile Thr Pro Leu Phe Phe Glu His Ser Phe Tyr 305 310 315 320 Cys Thr Lys Cys Glu Gly Met Ala Ser Thr Lys Thr Cys Pro His Asp 325 330 335 Ala Lys Tyr His Val Val Leu Ser Gly Thr Lys Val Arg Glu Met Leu 340 345 350 Arg Asn Gly Gln Val Pro Pro Ser Thr Phe Ser Arg Pro Glu Val Ala 355 360 365 Ala Val Leu Ile Lys Gly Leu Gln Glu Arg Glu Thr Val Ala Pro Ser 370 375 380 Ala Arg 385 23 546 PRT Aquifex aeolicus 23 Met Glu Lys Ile Lys Tyr Leu Lys Ser Ile Gln Ile Ser Gln Arg Ser 1 5 10 15 Val Leu Asp Leu Lys Leu Leu Ala Val Gly Ala Phe Thr Pro Leu Asp 20 25 30 Arg Phe Met Gly Glu Glu Asp Tyr Arg Asn Val Val Glu Ser Met Arg 35 40 45 Leu Lys Ser Gly Thr Leu Phe Pro Ile Pro Ile Thr Leu Pro Met Glu 50 55 60 Lys Glu Ile Ala Lys Asp Leu Lys Glu Gly Glu Trp Ile Val Leu Arg 65 70 75 80 Asp Pro Lys Asn Val Pro Leu Ala Ile Met Arg Val Glu Glu Val Tyr 85 90 95 Lys Trp Asn Leu Glu Tyr Glu Ala Lys Asn Val Leu Gly Thr Thr Asp 100 105 110 Pro Arg His Pro Leu Val Ala Glu Met His Thr Trp Gly Glu Tyr Tyr 115 120 125 Ile Ser Gly Glu Leu Lys Val Ile Gln Leu Pro Lys Tyr Tyr Asp Phe 130 135 140 Pro Glu Tyr Arg Lys Thr Pro Lys Gln Val Arg Glu Glu Ile Lys Ser 145 150 155 160 Leu Gly Leu Asp Lys Ile Val Ala Phe Gln Thr Arg Asn Pro Met His 165 170 175 Arg Val His Glu Glu Leu Thr Lys Arg Ala Met Glu Lys Val Gly Gly 180 185 190 Gly Leu Leu Leu His Pro Val Val Gly Leu Thr Lys Pro Gly Asp Val 195 200 205 Asp Val Tyr Thr Arg Met Arg Ile Tyr Lys Val Leu Tyr Glu Lys Tyr 210 215 220 Tyr Asp Lys Lys Lys Thr Ile Leu Ala Phe Leu Pro Leu Ala Met Arg 225 230 235 240 Met Ala Gly Pro Arg Glu Ala Leu Trp His Gly Ile Ile Arg Arg Asn 245 250 255 Tyr Gly Ala Thr His Phe Ile Val Gly Arg Asp His Ala Ser Pro Gly 260 265 270 Lys Asp Ser Lys Gly Lys Pro Phe Tyr Asp Pro Tyr Glu Ala Gln Glu 275 280 285 Leu Phe Lys Lys Tyr Glu Asp Glu Ile Gly Ile Lys Met Val Pro Phe 290 295 300 Glu Glu Leu Val Tyr Val Pro Glu Leu Asp Gln Tyr Val Glu Ile Asn 305 310 315 320 Glu Ala Lys Lys Arg Asn Leu Lys Tyr Ile Asn Ile Ser Gly Thr Glu 325 330 335 Ile Arg Glu Asn Phe Leu Lys Gln Gly Arg Lys Leu Pro Glu Trp Phe 340 345 350 Thr Arg Pro Glu Val Ala Glu Ile Leu Ala Glu Thr Tyr Val Pro Lys 355 360 365 His Lys Gln Gly Phe Cys Val Trp Leu Thr Gly Leu Pro Cys Ala Gly 370 375 380 Lys Ser Thr Ile Ala Glu Ile Leu Ala Thr Met Leu Gln Ala Arg Gly 385 390 395 400 Arg Lys Val Thr Leu Leu Asp Gly Asp Val Val Arg Thr His Leu Ser 405 410 415 Arg Gly Leu Gly Phe Ser Lys Glu Asp Arg Ile Thr Asn Ile Leu Arg 420 425 430 Val Gly Phe Val Ala Ser Glu Ile Val Lys His Asn Gly Val Val Ile 435 440 445 Cys Ala Leu Val Ser Pro Tyr Arg Ser Ala Arg Asn Gln Val Arg Asn 450 455 460 Met Met Glu Glu Gly Lys Phe Ile Glu Val Phe Val Asp Ala Pro Val 465 470 475 480 Glu Val Cys Glu Glu Arg Asp Val Lys Gly Leu Tyr Lys Lys Ala Lys 485 490 495 Glu Gly Leu Ile Lys Gly Phe Thr Gly Val Asp Asp Pro Tyr Glu Pro 500 505 510 Pro Val Ala Pro Glu Val Arg Val Asp Thr Thr Lys Leu Thr Pro Glu 515 520 525 Glu Ser Ala Leu Lys Ile Leu Glu Phe Leu Lys Lys Glu Gly Phe Ile 530 535 540 Lys Asp 545 24 259 PRT Pyrococcus furiosus 24 Met Val Ser Lys Pro His Gly Gly Lys Leu Ile Arg Arg Ile Ala Ala 1 5 10 15 Pro Arg Thr Arg Glu Arg Ile Leu Ser Glu Gln His Glu Tyr Pro Arg 20 25 30 Val Gln Ile Asp His Gly Arg Ala Ile Asp Leu Glu Asn Ile Ala His 35 40 45 Gly Val Tyr Ser Pro Leu Lys Gly Phe Leu Thr Arg Glu Asp Phe Glu 50 55 60 Ser Val Leu Asp Tyr Met Arg Leu Ser Asp Asp Thr Pro Trp Thr Ile 65 70 75 80 Pro Ile Val Leu Asp Val Gly Glu Pro Thr Phe Glu Gly Gly Asp Ala 85 90 95 Ile Leu Leu Tyr Tyr Glu Asn Pro Pro Ile Ala Arg Met His Val Glu 100 105 110 Asp Ile Tyr Thr Tyr Asp Lys Lys Glu Phe Ala Val Lys Val Phe Lys 115 120 125 Thr Asp Asp Pro Asn His Leu Gly Val Ala Arg Val Tyr Ser Met Gly 130 135 140 Lys Tyr Leu Val Gly Gly Gly Ile Glu Leu Leu Asn Glu Leu Pro Asn 145 150 155 160 Pro Phe Ala Lys Tyr Thr Leu Arg Pro Val Glu Thr Arg Ile Leu Phe 165 170 175 Lys Glu Arg Gly Trp Lys Thr Ile Val Ala Phe Gln Thr Arg Asn Val 180 185 190 Pro His Leu Gly His Glu Tyr Val Gln Lys Ala Ala Leu Thr Phe Val 195 200 205 Asp Gly Leu Phe Ile Asn Pro Val Leu Gly Arg Lys Lys Lys Gly Asp 210 215 220 Tyr Lys Asp Glu Val Ile Ile Lys Ala Tyr Tyr Leu Ile Met Lys Tyr 225 230 235 240 Cys Ser Asn Thr Thr His His Ala Ile Met Arg Lys Thr Ser Thr Ser 245 250 255 Ser Gln Thr 25 406 PRT Sulfolobus solfataricus 25 Met Asn Leu Ile Gly His Gly Lys Val Glu Ile Val Glu Arg Ile Lys 1 5 10 15 Thr Ile Ser Asp Phe Lys Glu Leu His Arg Ile Glu Val Lys Arg Gln 20 25 30 Leu Ala His Glu Ile Val Ser Ile Ala Tyr Gly Phe Leu Ser Pro Leu 35 40 45 Lys Gly Phe Met Asn Tyr Glu Glu Val Asp Gly Val Val Glu Asn Met 50 55 60 Arg Leu Pro Asn Gly Val Leu Trp Pro Ile Pro Leu Val Phe Asp Tyr 65 70 75 80 Ser Gln Asn Glu Lys Val Lys Glu Gly Asp Thr Ile Gly Ile Thr Tyr 85 90 95 Leu Gly Lys Pro Leu Ala Ile Met Lys Val Lys Glu Ile Phe Lys Tyr 100 105 110 Asp Lys Leu Lys Ile Ala Glu Lys Val Tyr Lys Thr Lys Asp Ile Lys 115 120 125 His Pro Gly Val Lys Arg Thr Leu Ser Tyr Ala Asp Ala Phe Leu Ala 130 135 140 Gly Asp Val Trp Leu Val Arg Glu Pro Gln Phe Asn Lys Pro Tyr Ser 145 150 155 160 Glu Phe Trp Leu Thr Pro Arg Met His Arg Thr Val Phe Glu Lys Lys 165 170 175 Gly Trp Lys Arg Val Val Ala Phe Gln Thr Arg Asn Val Pro His Thr 180 185 190 Gly His Glu Tyr Leu Met Lys Phe Ala Trp Phe Ala Ala Asn Glu Asn 195 200 205 Gln Lys Val Asp Glu Pro Arg Thr Gly Ile Leu Val Asn Val Val Ile 210 215 220 Gly Glu Lys Arg Val Gly Asp Tyr Ile Asp Glu Ala Ile Leu Leu Thr 225 230 235 240 His Asp Ala Leu Ser Lys Tyr Gly Tyr Ile Ser Pro Lys Val

His Leu 245 250 255 Leu Ser Phe Thr Leu Trp Asp Met Arg Tyr Ala Gly Pro Arg Glu Ala 260 265 270 Leu Leu His Ala Ile Ile Arg Ser Asn Leu Gly Cys Thr His His Val 275 280 285 Phe Gly Arg Asp His Ala Gly Val Gly Asn Tyr Tyr Ser Pro Tyr Glu 290 295 300 Ala His Glu Ile Phe Asp Ser Ile Asn Glu Glu Asp Leu Leu Ile Lys 305 310 315 320 Pro Ile Phe Leu Arg Glu Asn Tyr Tyr Cys Pro Arg Cys Gly Ser Ile 325 330 335 Glu Asn Glu Ile Leu Cys Asp His Lys Asp Glu Lys Gln Glu Phe Ser 340 345 350 Gly Ser Leu Ile Arg Ser Ile Ile Leu Asp Glu Val Lys Pro Thr Lys 355 360 365 Met Val Met Arg Pro Glu Val Tyr Asp Val Leu Met Lys Ala Ala Glu 370 375 380 Gln Tyr Gly Phe Gly Ser Pro Phe Val Thr Glu Glu Tyr Leu Glu Lys 385 390 395 400 Arg Gln Ser Ile Leu Gly 405 26 455 PRT Pyrobaculum aerophilum 26 Met Pro Met Pro Ala Pro Leu Glu Pro His Gly Gly Arg Leu Val Tyr 1 5 10 15 Asn Val Ile Glu Asp Arg Asp Lys Ala Ala Ala Met Ile Gln Gly Leu 20 25 30 Pro Ser Ile Glu Ile Glu Pro Thr Leu Gly Pro Asp Gly Ser Pro Ile 35 40 45 Arg Asn Pro Tyr Arg Glu Ile Met Ser Ile Ala Tyr Gly Phe Phe Ser 50 55 60 Pro Val Glu Gly Phe Met Thr Arg Asn Glu Val Glu Ser Ile Leu Lys 65 70 75 80 Glu Arg Arg Leu Leu Asn Gly Trp Leu Phe Pro Phe Pro Leu Ile Tyr 85 90 95 Asp Val Asp Glu Glu Lys Ile Lys Gly Ile Lys Glu Gly Asp Ser Val 100 105 110 Leu Leu Lys Leu Lys Gly Lys Pro Leu Ala Val Leu Asn Val Glu Glu 115 120 125 Ile Trp Arg Leu Pro Asp Arg Lys Glu Leu Ala Asp Ala Val Phe Gly 130 135 140 Thr Pro Glu Arg Asn Lys Glu Val Val Lys Lys Arg Phe Asp Glu Lys 145 150 155 160 His Pro Gly Trp Leu Ile Tyr Arg Ser Met Arg Pro Met Ala Leu Ala 165 170 175 Gly Lys Ile Thr Val Val Asn Pro Pro Arg Phe Lys Glu Pro Tyr Ser 180 185 190 Arg Phe Trp Met Pro Pro Arg Val Ser Arg Glu Tyr Val Glu Lys Lys 195 200 205 Gly Trp Arg Ile Val Val Ala His Gln Thr Arg Asn Val Pro His Ile 210 215 220 Gly His Glu Met Leu Met Lys Arg Ala Met Phe Val Ala Gly Gly Glu 225 230 235 240 Arg Pro Gly Asp Ala Val Leu Val Asn Ala Ile Ile Gly Ala Lys Arg 245 250 255 Pro Gly Asp Tyr Val Asp Glu Ala Ile Leu Glu Gly His Glu Ala Leu 260 265 270 Asn Lys Ala Gly Tyr Phe His Pro Asp Arg His Val Val Thr Met Thr 275 280 285 Leu Trp Asp Met Arg Tyr Gly Asn Pro Leu Glu Ser Leu Leu His Gly 290 295 300 Ile Ile Arg Gln Asn Met Gly Ala Thr His His Met Phe Gly Arg Asp 305 310 315 320 His Ala Ala Thr Gly Asp Tyr Tyr Asp Pro Tyr Ala Thr Gln Tyr Leu 325 330 335 Trp Thr Arg Gly Leu Pro Ser Tyr Gly Leu Asn Glu Pro Pro His Met 340 345 350 Thr Asp Lys Gly Leu Arg Ile Lys Pro Val Asn Leu Gly Glu Phe Ala 355 360 365 Tyr Cys Pro Lys Cys Gly Glu Tyr Thr Tyr Leu Gly Met Ser Tyr Glu 370 375 380 Gly Tyr Lys Glu Val Ala Leu Cys Gly His Thr Pro Glu Arg Ile Ser 385 390 395 400 Gly Ser Leu Leu Arg Gly Ile Ile Ile Glu Gly Leu Arg Pro Pro Lys 405 410 415 Val Val Met Arg Pro Glu Val Tyr Asp Val Ile Val Lys Trp Trp Arg 420 425 430 Val Tyr Gly Tyr Pro Tyr Val Thr Asp Lys Tyr Leu Arg Ile Lys Glu 435 440 445 Gln Glu Leu Glu Val Glu Leu 450 455 27 456 PRT Archaeoglobus fulgidus 27 Met Pro Leu Ile Lys Thr Pro Pro Pro His Gly Gly Lys Leu Val Glu 1 5 10 15 Arg Val Val Lys Lys Arg Asp Ile Ala Glu Lys Met Ile Ala Gly Cys 20 25 30 Pro Thr Tyr Glu Leu Lys Pro Thr Thr Leu Pro Asp Gly Thr Pro Ile 35 40 45 Arg His Val Tyr Arg Glu Ile Met Ser Val Cys Tyr Gly Phe Phe Ser 50 55 60 Pro Val Glu Gly Ser Met Val Gln Asn Glu Leu Glu Arg Val Leu Asn 65 70 75 80 Glu Arg Arg Leu Leu Ser Glu Trp Ile Phe Pro Tyr Pro Ile Leu Phe 85 90 95 Asp Ile Ser Glu Glu Asp Tyr Lys Ala Leu Asp Val Lys Glu Gly Asp 100 105 110 Arg Leu Leu Leu Met Leu Lys Gly Gln Pro Phe Ala Thr Leu Asp Ile 115 120 125 Glu Glu Val Tyr Lys Ile Asp Pro Val Asp Val Ala Thr Arg Thr Phe 130 135 140 Gly Thr Pro Glu Lys Asn Pro Glu Val Val Arg Glu Pro Phe Asp Asp 145 150 155 160 Lys His Pro Gly Tyr Val Ile Tyr Lys Met His Asn Pro Ile Ile Leu 165 170 175 Ala Gly Lys Tyr Thr Ile Val Asn Glu Pro Lys Phe Lys Glu Pro Tyr 180 185 190 Asp Arg Phe Trp Phe Pro Pro Ser Lys Cys Arg Glu Val Ile Lys Asn 195 200 205 Glu Lys Lys Trp Arg Thr Val Ile Ala His Gln Thr Arg Asn Val Pro 210 215 220 His Val Gly His Glu Met Leu Met Lys Cys Ala Ala Tyr Thr Gly Asp 225 230 235 240 Ile Glu Pro Cys His Gly Ile Leu Val Asn Ala Ile Ile Gly Ala Lys 245 250 255 Arg Arg Gly Asp Tyr Pro Asp Glu Ala Ile Leu Glu Gly His Glu Ala 260 265 270 Val Asn Lys Tyr Gly Tyr Ile Lys Pro Glu Arg His Met Val Thr Phe 275 280 285 Thr Leu Trp Asp Met Arg Tyr Gly Asn Pro Ile Glu Ser Leu Leu His 290 295 300 Gly Val Ile Arg Gln Asn Met Gly Cys Thr His His Met Phe Gly Arg 305 310 315 320 Asp His Ala Ala Val Gly Glu Tyr Tyr Asp Met Tyr Ala Thr Gln Ile 325 330 335 Leu Trp Ser Gln Gly Ile Pro Ser Phe Gly Phe Glu Ala Pro Pro Asn 340 345 350 Glu Val Asp Tyr Gly Leu Lys Ile Ile Pro Gln Asn Met Ala Glu Phe 355 360 365 Trp Tyr Cys Pro Ile Cys Gln Glu Ile Ala Tyr Ser Glu Asn Cys Gly 370 375 380 His Thr Asp Ala Lys Gln Lys Phe Ser Gly Ser Phe Leu Arg Gly Met 385 390 395 400 Val Ala Glu Gly Val Phe Pro Pro Arg Val Val Met Arg Pro Glu Val 405 410 415 Tyr Lys Gln Ile Val Lys Trp Trp Lys Val Tyr Asn Tyr Pro Phe Val 420 425 430 Asn Arg Lys Tyr Leu Glu Leu Lys Asn Lys Glu Leu Glu Ile Asp Leu 435 440 445 Pro Ala Met Glu Val Pro Lys Ala 450 455 28 573 PRT Penicillium chrysogenum 28 Met Ala Asn Ala Pro His Gly Gly Val Leu Lys Asp Leu Leu Ala Arg 1 5 10 15 Asp Ala Pro Arg Gln Ala Glu Leu Ala Ala Glu Ala Glu Ser Leu Pro 20 25 30 Ala Val Thr Leu Thr Glu Arg Gln Leu Cys Asp Leu Glu Leu Ile Met 35 40 45 Asn Gly Gly Phe Ser Pro Leu Glu Gly Phe Met Asn Gln Ala Asp Tyr 50 55 60 Asp Arg Val Cys Glu Asp Asn Arg Leu Ala Asp Gly Asn Val Phe Ser 65 70 75 80 Met Pro Ile Thr Leu Asp Ala Ser Gln Glu Val Ile Asp Glu Lys Lys 85 90 95 Leu Gln Ala Ala Ser Arg Ile Thr Leu Arg Asp Phe Arg Asp Asp Arg 100 105 110 Asn Leu Ala Ile Leu Thr Ile Asp Asp Ile Tyr Arg Pro Asp Lys Thr 115 120 125 Lys Glu Ala Lys Leu Val Phe Gly Gly Asp Pro Glu His Pro Ala Ile 130 135 140 Val Tyr Leu Asn Asn Thr Val Lys Glu Phe Tyr Ile Gly Gly Lys Ile 145 150 155 160 Glu Ala Val Asn Lys Leu Asn His Tyr Asp Tyr Val Ala Leu Arg Tyr 165 170 175 Thr Pro Ala Glu Leu Arg Val His Phe Asp Lys Leu Gly Trp Ser Arg 180 185 190 Val Val Ala Phe Gln Thr Arg Asn Pro Met His Arg Ala His Arg Glu 195 200 205 Leu Thr Val Arg Ala Ala Arg Ser Arg Gln Ala Asn Val Leu Ile His 210 215 220 Pro Val Val Gly Leu Thr Lys Pro Gly Asp Ile Asp His Phe Thr Arg 225 230 235 240 Val Arg Ala Tyr Gln Ala Leu Leu Pro Arg Tyr Pro Asn Gly Met Ala 245 250 255 Val Leu Gly Leu Leu Gly Leu Ala Met Arg Met Gly Gly Pro Arg Glu 260 265 270 Ala Ile Trp His Ala Ile Ile Arg Lys Asn His Gly Ala Thr His Phe 275 280 285 Ile Val Gly Arg Asp His Ala Gly Pro Gly Ser Asn Ser Lys Gly Glu 290 295 300 Asp Phe Tyr Gly Pro Tyr Asp Ala Gln His Ala Val Glu Lys Tyr Lys 305 310 315 320 Asp Glu Leu Gly Ile Glu Val Val Glu Phe Gln Met Val Thr Tyr Leu 325 330 335 Pro Asp Thr Asp Glu Tyr Arg Pro Val Asp Gln Val Pro Ala Gly Val 340 345 350 Lys Thr Leu Asn Ile Ser Gly Thr Glu Leu Arg Arg Arg Leu Arg Ser 355 360 365 Gly Ala His Ile Pro Glu Trp Phe Ser Tyr Pro Glu Val Val Lys Ile 370 375 380 Leu Arg Glu Ser Asn Pro Pro Arg Ala Thr Gln Gly Phe Thr Ile Phe 385 390 395 400 Leu Thr Gly Tyr Met Asn Ser Gly Lys Asp Ala Ile Ala Arg Ala Leu 405 410 415 Gln Val Thr Leu Asn Gln Gln Gly Gly Arg Ser Val Ser Leu Leu Leu 420 425 430 Gly Asp Thr Val Arg His Glu Leu Ser Ser Glu Leu Gly Phe Thr Arg 435 440 445 Glu Asp Arg His Thr Asn Ile Gln Arg Ile Ala Phe Val Ala Thr Glu 450 455 460 Leu Thr Arg Ala Gly Ala Ala Val Ile Ala Ala Pro Ile Ala Pro Tyr 465 470 475 480 Glu Glu Ser Arg Lys Phe Ala Arg Asp Ala Val Ser Gln Ala Gly Ser 485 490 495 Phe Phe Leu Val His Val Ala Thr Pro Leu Glu His Cys Glu Gln Ser 500 505 510 Asp Lys Arg Gly Ile Tyr Ala Ala Ala Arg Arg Gly Glu Ile Lys Gly 515 520 525 Phe Thr Gly Val Asp Asp Pro Tyr Glu Thr Pro Glu Lys Ala Asp Leu 530 535 540 Val Val Asp Phe Ser Lys Gln Ser Val Arg Ser Ile Val His Glu Ile 545 550 555 560 Ile Leu Val Leu Glu Ser Gln Gly Phe Leu Glu Arg Gln 565 570 29 389 PRT Aeropyrum pernix 29 Met Gly Cys Ser Val Gly Leu Val Ser Arg Pro His Gly Gly Arg Leu 1 5 10 15 Val Arg Arg Val Leu Ser Gly Arg Arg Arg Glu Ile Phe Glu Ser Gln 20 25 30 Tyr Arg Glu Met Pro Arg Leu Glu Val Pro Leu Glu Arg Ala Ile Asp 35 40 45 Ala Glu Asp Leu Ala Arg Gly Val Phe Ser Pro Leu Glu Gly Phe Met 50 55 60 Val Glu Asp Asp Tyr Leu Ser Val Leu Ser Arg Met Arg Leu Ser Asn 65 70 75 80 Asp Leu Pro Trp Thr Ile Pro Ile Val Leu Asp Ala Asn Arg Glu Trp 85 90 95 Val Leu Asn Glu Gly Val Ser Ala Gly Asp Asp Ile Ile Leu Thr Tyr 100 105 110 His Gly Leu Pro Ile Ala Val Leu Thr Leu Glu Asp Ile Tyr Ser Trp 115 120 125 Asp Lys Gly Leu His Ala Glu Lys Val Phe Lys Thr Arg Asp Pro Asn 130 135 140 His Pro Gly Val Glu Ala Thr Tyr Lys Arg Gly Asp Ile Leu Leu Gly 145 150 155 160 Gly Arg Leu Glu Leu Ile Gln Gly Pro Pro Asn Pro Leu Glu Arg Tyr 165 170 175 Thr Leu Trp Pro Val Glu Thr Arg Val Leu Phe Lys Glu Lys Gly Trp 180 185 190 Arg Thr Val Ala Ala Phe Gln Thr Arg Asn Val Pro His Leu Gly His 195 200 205 Glu Tyr Val Gln Lys Ala Ala Leu Thr Phe Val Asp Gly Leu Leu Val 210 215 220 His Pro Leu Ala Gly Trp Lys Lys Arg Gly Asp Tyr Arg Asp Glu Val 225 230 235 240 Ile Ile Arg Ala Tyr Glu Ala Leu Ile Thr His Tyr Tyr Pro Arg Gly 245 250 255 Val Val Val Leu Ser Val Leu Arg Met Asn Met Asn Tyr Ala Gly Pro 260 265 270 Arg Glu Ala Val His His Ala Ile Val Arg Lys Asn Phe Gly Ala Thr 275 280 285 His Phe Ile Val Gly Arg Asp His Ala Gly Val Gly Ser Tyr Tyr Gly 290 295 300 Pro Tyr Glu Ala Trp Glu Ile Phe Arg Glu Phe Pro Asp Leu Gly Ile 305 310 315 320 Thr Pro Leu Phe Val Arg Glu Ala Tyr Tyr Cys Arg Arg Cys Gly Gly 325 330 335 Met Val Asn Glu Lys Val Cys Pro His Gly Asp Glu Tyr Arg Val Arg 340 345 350 Ile Ser Gly Thr Arg Leu Arg Glu Met Leu Gly Arg Gly Glu Arg Pro 355 360 365 Pro Glu Tyr Met Met Arg Pro Glu Val Ala Asp Ala Ile Ile Ser His 370 375 380 Pro Asp Pro Phe Ile 385 30 511 PRT Saccharomyces cerevisiae 30 Met Pro Ala Pro His Gly Gly Ile Leu Gln Asp Leu Ile Ala Arg Asp 1 5 10 15 Ala Leu Lys Lys Asn Glu Leu Leu Ser Glu Ala Gln Ser Ser Asp Ile 20 25 30 Leu Val Trp Asn Leu Thr Pro Arg Gln Leu Cys Asp Ile Glu Leu Ile 35 40 45 Leu Asn Gly Gly Phe Ser Pro Leu Thr Gly Phe Leu Asn Glu Asn Asp 50 55 60 Tyr Ser Ser Val Val Thr Asp Ser Arg Leu Ala Asp Gly Thr Leu Trp 65 70 75 80 Thr Ile Pro Ile Thr Leu Asp Val Asp Glu Ala Phe Ala Asn Gln Ile 85 90 95 Lys Pro Asp Thr Arg Ile Ala Leu Phe Gln Asp Asp Glu Ile Pro Ile 100 105 110 Ala Ile Leu Thr Val Gln Asp Val Tyr Lys Pro Asn Lys Thr Ile Glu 115 120 125 Ala Glu Lys Val Phe Arg Gly Asp Pro Glu His Pro Ala Ile Ser Tyr 130 135 140 Leu Phe Asn Val Ala Gly Asp Tyr Tyr Val Gly Gly Ser Leu Glu Ala 145 150 155 160 Ile Gln Leu Pro Gln His Tyr Asp Tyr Pro Gly Leu Arg Lys Thr Pro 165 170 175 Ala Gln Leu Arg Leu Glu Phe Gln Ser Arg Gln Trp Asp Arg Val Val 180 185 190 Ala Phe Gln Thr Arg Asn Pro Met His Arg Ala His Arg Glu Leu Thr 195 200 205 Val Arg Ala Ala Arg Glu Ala Asn Ala Lys Val Leu Ile His Pro Val 210 215 220 Val Gly Leu Thr Lys Pro Gly Asp Ile Asp His His Thr Arg Val Arg 225 230 235 240 Val Tyr Gln Glu Ile Ile Lys Arg Tyr Pro Asn Gly Ile Ala Phe Leu 245 250 255 Ser Leu Leu Pro Leu Ala Met Arg Met Ser Gly Asp Arg Glu Ala Val 260 265 270 Trp His Ala Ile Ile Arg Lys Asn Tyr Gly Ala Ser His Phe Ile Val 275 280 285 Gly Arg Asp His Ala Gly Pro Gly Lys Asn Ser Lys Gly Val Asp Phe 290 295 300 Tyr Gly Pro Tyr Asp Ala Gln Glu Leu Val Glu Ser Tyr Lys His Glu 305 310 315 320 Leu Asp Ile Glu Val Val Pro Phe Arg Met Val Thr Tyr Leu Pro Asp 325 330 335 Glu Asp Arg Tyr Ala Pro Ile Asp Gln Ile Asp Thr Thr Lys Thr Arg 340 345 350 Thr Leu Asn Ile Ser Gly Thr Glu Leu Arg Arg Arg Leu Arg Val Gly 355 360 365 Gly Glu Ile Pro Glu Trp Phe Ser Tyr Pro Glu Val Val Lys Ile Leu 370 375 380 Arg Glu Ser Asn Pro Pro Arg Pro Lys Gln Gly Phe Ser Ile Val Leu 385 390

395 400 Gly Asn Ser Leu Thr Val Ser Arg Glu Gln Leu Ser Ile Ala Leu Leu 405 410 415 Ser Thr Phe Leu Gln Phe Gly Gly Gly Arg Tyr Tyr Lys Ile Phe Glu 420 425 430 His Asn Asn Lys Thr Glu Leu Leu Ser Leu Ile Gln Asp Phe Ile Gly 435 440 445 Ser Gly Ser Gly Leu Ile Ile Pro Asn Gln Trp Glu Asp Asp Lys Asp 450 455 460 Ser Val Val Gly Lys Gln Asn Val Tyr Leu Leu Asp Thr Ser Ser Ser 465 470 475 480 Ala Asp Ile Gln Leu Glu Ser Ala Asp Glu Pro Ile Ser His Ile Val 485 490 495 Gln Lys Val Val Leu Phe Leu Glu Asp Asn Gly Phe Phe Val Phe 500 505 510 31 309 PRT Thermomonospora fusca 31 Met Ser Gln Val Ser Asp Ala Val Gly Arg Tyr Gln Leu Ser Gln Leu 1 5 10 15 Asp Phe Leu Glu Ala Glu Ala Ile Phe Ile Met Arg Glu Val Ala Ala 20 25 30 Glu Phe Glu Arg Pro Val Leu Leu Phe Ser Gly Gly Lys Asp Ser Val 35 40 45 Val Met Leu Arg Ile Ala Glu Lys Ala Phe Trp Pro Ala Pro Ile Pro 50 55 60 Phe Pro Val Met His Val Asp Thr Gly His Asn Phe Pro Glu Val Ile 65 70 75 80 Glu Phe Arg Asp Lys Arg Val Ala Glu Leu Gly Val Arg Leu Ile Val 85 90 95 Ala Ser Val Gln Asp Leu Ile Asp Ala Gly Lys Val Val Glu Pro Lys 100 105 110 Gly Arg Trp Ala Ser Arg Asn Arg Leu Gln Thr Ala Ala Leu Leu Glu 115 120 125 Ala Ile Glu Lys Tyr Gly Phe Asp Ala Ala Phe Gly Gly Ala Arg Arg 130 135 140 Asp Glu Glu Lys Ala Arg Ala Lys Glu Arg Val Phe Ser Phe Arg Asp 145 150 155 160 Glu Phe Gly Gln Trp Asp Pro Lys Asn Gln Arg Pro Glu Leu Trp Asn 165 170 175 Leu Tyr Asn Thr Arg Val His Arg Gly Glu Asn Ile Arg Val Phe Pro 180 185 190 Leu Ser Asn Trp Thr Glu Leu Asp Val Trp His Tyr Ile Arg Arg Glu 195 200 205 Gly Leu Arg Leu Pro Ser Ile Tyr Phe Ala His Arg Arg Arg Val Phe 210 215 220 Glu Arg Asp Gly Ile Leu Leu Pro Asp Ser Pro Tyr Val Thr Arg Asp 225 230 235 240 Glu Asp Glu Glu Val Phe Glu Ala Ser Val Arg Tyr Arg Thr Val Gly 245 250 255 Asp Met Thr Cys Thr Gly Ala Val Leu Ser Thr Ala Thr Thr Leu Asp 260 265 270 Glu Val Ile Ala Glu Ile Ala Ala Thr Arg Ile Thr Glu Arg Gly Gln 275 280 285 Thr Arg Ala Asp Asp Arg Gly Ser Glu Ala Ala Met Glu Glu Arg Lys 290 295 300 Arg Glu Gly Tyr Phe 305

Claims

1-221. (canceled)

222. A method of determining the base sequence of a plurality of single stranded template nucleotides on an array, the method comprising: (a) providing a planar surface comprises at least 400,000 discrete cavities, wherein each cavity forms a reaction chamber containing single-stranded nucleic acid templates of a single species, wherein the reaction chambers have a center to center spacing of between 5 to 200 .mu.m, wherein each reaction chamber contains a reaction mixture comprising a template-directed nucleotide polymerase and said one of said plurality of single-stranded template nucleotides hybridized to a complementary oligonucleotide primer strand at least one nucleotide residue shorter than the single-stranded template nucleotides to form at least one unpaired nucleotide residue in each template at the 3'-end of the primer strand; (b) adding an activated nucleotide 5'-triphosphate precursor of one known nitrogenous base to the reaction chambers under conditions which allow incorporation of the activated nucleoside 5'-triphosphate precursor onto the 3'-end of the primer strand, provided the nitrogenous base of the activated nucleoside 5'-triphosphate precursor is complementary to the nitrogenous base of the unpaired nucleotide residue of the templates; (c) detecting whether or not the nucleoside 5'-triphosphate precursor was incorporated into the primer strands in each reaction chamber by detecting a sequencing byproduct with an ATP generating polypeptide-ATP converting polypeptide fusion protein or an ATP generating protein and an ATP converting protein, thus indicating that the unpaired nucleotide residue of the template has a nitrogenous base composition that is complementary to that of the incorporated nucleoside 5'-triphosphate precursor in each reaction chamber; (d) sequentially repeating steps (b) and (c), wherein each sequential repetition adds and, detects the incorporation of one type of activated nucleoside 5'-triphosphate precursor of known nitrogenous base composition; and (e) determining the base sequence of the unpaired nucleotide residues of the template in each reaction chamber from the sequence of incorporation of said nucleoside precursors.

223. The method of claim 222 wherein said sequencing byproduct is pyrophosphate.

224. The method of claim 222 wherein the ATP generating polypeptide-ATP converting polypeptide fusion protein comprises an ATP generating polypeptide portion with an amino acid sequence which is at least 96% homologous to SEQ ID NO:2.

225. The method of claim 222 wherein the ATP generating polypeptide-ATP converting polypeptide fusion protein comprises an ATP generating polypeptide portion with an amino acid sequence which is SEQ ID NO:6.

226. The method of claim 222 wherein the ATP generating polypeptide-ATP converting polypeptide fusion protein comprises an amino acid sequence of SEQ ID NO:4.

227. The method of claim 222 wherein the ATP generating protein comprises an amino acid sequence which is at least 96% homologous to SEQ ID NO:2.

228. The method of claim 222 wherein the ATP generating protein comprises an amino acid sequence of SEQ ID NO:2 or SEQ ID NO:6.

229. The method of claim 222 wherein said ATP generating polypeptide-ATP converting polypeptide fusion protein comprise an amino acid sequence encoded by a polynucleotide with an open reading frame of SEQ ID NO:3.

230. The method of claim 222 wherein said ATP generating polypeptide comprise an amino acid sequence encoded by a polynucleotide with an open reading frame which is no more than 11% different from an open reading frame of SEQ ID NO:1.

231. The method of claim 222 wherein said ATP generating polypeptide comprises an amino acid sequence encoded by an open reading frame of SEQ ID NO:1 or SEQ ID NO:5.

232. The method of claim 222 wherein said ATP generating polypeptide-ATP converting polypeptide fusion protein or said ATP generating protein further comprises an affinity tag.

233. The method of claim 222 wherein said ATP generating polypeptide-ATP converting polypeptide fusion protein, said ATP generating protein, or said ATP converting polypeptide is bound to a bead.

234. A method of identifying a base at a target position in a sample nucleic acid sequence, comprising providing a sample nucleic acid and a primer which hybridizes to the sample nucleic acid immediately adjacent to the target position, subjecting the sample nucleic acid and primer to a polymerase reaction in the presence of a nucleotide whereby the nucleotide will only become incorporated if it is complementary to the base in the target position, and detecting said incorporation of the nucleotide by monitoring the release of inorganic pyrophosphate, whereby detection of incorporation of said nucleotide is indicative of identification of a base at a target position that is complementary to said nucleotide, and wherein the release of inorganic pyrophosphate is detected using a thermostable sulfurylase-luciferase fusion protein or a thermostable sulfurylase.

235. The method of claim 234 wherein the thermostable sulfurylase-luciferase fusion protein or the thermostable sulfurylase comprises an amino acid of at least 96% homology to SEQ ID NO:2, SEQ ID NO:4 or SEQ ID NO:6.

236. The method of claim 234 wherein the thermostable sulfurylase-luciferase fusion protein or the thermostable sulfurylase is encoded by an open reading frame of SEQ ID NO: 1, 3 or 5.

237. The method of claim 234 wherein the thermostable sulfurylase-luciferase fusion protein or the thermostable sulfurylase further comprises an affinity tag.

238. The method of claim 234 wherein said the thermostable sulfurylase-luciferase fusion protein or the thermostable sulfurylase is bound to a bead.