U.S. patent application number 11/195353 was filed with the patent office on 2006-04-06 for muir-torre-like syndrome in fhit deficient mice.
Invention is credited to Carlo M. Croce, Frances Kay Huebner.
Application Number | 20060075511 11/195353 |
Document ID | / |
Family ID | 22725790 |
Filed Date | 2006-04-06 |
United States Patent
Application |
20060075511 |
Kind Code |
A1 |
Croce; Carlo M. ; et
al. |
April 6, 2006 |
Muir-Torre-like syndrome in Fhit deficient mice
Abstract
The invention provides nonhuman transgenic animals with a
disrupted FHIT gene. The invention further provides transgenic mice
in which one or both Fhit alleles have been inactivated.
Preferably, the Fhit-deficient mice develop multiple tumors of both
visceral and sebaceous origin, similar to those of Muir-Torre
familial cancer syndrome. The present invention further relates to
the generation of these transgenic mice and their use as model
systems to study the effects of carcinogenic agents in promoting
clonal expansion of neoplastic cells in cancers, preferably
gastrointestinal cancers of which Muir-Torre syndrome is a subset.
The invention further relates to testing therapeutic agents for
their efficacy in the prevention and treatment of cancer,
preferably gastrointestinal cancer.
Inventors: |
Croce; Carlo M.;
(Philadelphia, PA) ; Huebner; Frances Kay;
(Philadelphia, PA) |
Correspondence
Address: |
HAMILTON, BROOK, SMITH & REYNOLDS, P.C.
530 VIRGINIA ROAD
P.O. BOX 9133
CONCORD
MA
01742-9133
US
|
Family ID: |
22725790 |
Appl. No.: |
11/195353 |
Filed: |
August 1, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09832424 |
Apr 11, 2001 |
6924414 |
|
|
11195353 |
Aug 1, 2005 |
|
|
|
60196534 |
Apr 11, 2000 |
|
|
|
Current U.S.
Class: |
800/18 ;
435/354 |
Current CPC
Class: |
A01K 2217/20 20130101;
A01K 2267/0331 20130101; C12N 2503/02 20130101; C12N 2510/00
20130101; A01K 2217/075 20130101; C07K 14/4703 20130101; C12N
2517/02 20130101; A01K 67/0276 20130101; C07K 14/82 20130101; C12N
2800/30 20130101; C12N 15/8509 20130101; A01K 2227/105
20130101 |
Class at
Publication: |
800/018 ;
435/354 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 5/06 20060101 C12N005/06 |
Goverment Interests
[0002] This invention was made in part with government support
under Grant numbers CA21124 and CA56336 awarded by the National
Cancer Institute, USPHS; Grant number 97B115-REV from the American
Institute for Cancer Research and Grant number ME99-105 from the
Pennsylvania Department of Health. The Government has certain
rights in the invention.
Claims
1. An embryonic stem cell containing a disruption in a FHIT gene,
wherein said disruption affects one or more exons of said FHIT
gene.
2-22. (canceled)
23. A transgenic non-human animal having a genome containing a
disruption in the FHIT gene of said animal.
24. The transgenic non-human animal of claim 23, wherein said
disruption comprises a termination codon in an exon of the FHIT
gene.
25. The transgenic non-human animal of claim 23, wherein said
disruption in the FHIT gene is selected from the group consisting
of an insertion, a deletion, a substitution, a rearrangement, a
point mutation, an ablation of a gene regulatory sequence and a
combination thereof.
26. The transgenic non-human animal of claim 23, wherein said
disruption in the FHIT gene is a homozygous disruption.
27. The transgenic non-human animal of claim 23, wherein said
disruption in the FHIT gene is a heterozygous disruption.
28. The transgenic non-human animal of claim 23, wherein said
disruption in the FHIT gene is present in both germline and somatic
cells.
29. The transgenic non-human animal of claim 23, wherein said
animal has increased susceptibility to visceral and sebaceous
tumors relative to a FHIT +/+ animal.
30. The transgenic non-human animal of claim 23, wherein said
animal exhibits increased tumor formation upon being exposed to
N-nitrosomethylbenzlamine relative to a FHIT +/+ animal that has
been exposed to N-nitrosomethylbenzlamine.
31. The transgenic non-human animal of claim 23, wherein said
animal is a mammal.
32. The transgenic non-human animal of claim 31, wherein said
mammal is a mouse.
33. A transgenic non-human animal, wherein said animal is chimeric
for a disruption in the FHIT gene of said animal.
34. The transgenic non-human animal of claim 33, wherein said
animal has increased susceptibility to visceral and sebaceous
tumors relative to a FHIT +/+ non-human animal.
35. The transgenic non-human animal of claim 33, wherein said
animal exhibits increased tumor formation upon being exposed to
N-nitrosomethylbenzlamine relative to a FHIT +/+non-human animal
that has been exposed to N-nitrosomethylbenzlamine.
36. The transgenic non-human animal of claim 33, wherein said
animal is a mammal.
37. The transgenic non-human animal of claim 36, wherein said
mammal is a mouse.
38. The transgenic non-human animal of claim 33, wherein said
disruption comprises a termination codon in an exon of the FHIT
gene.
39. The transgenic non-human animal of claim 33, wherein said
disruption in the FHIT gene is selected from the group consisting
of an insertion, a deletion, a substitution, a rearrangement, a
point mutation, an ablation of a gene regulatory sequence and a
combination thereof.
40. A cell culture prepared with cells from the transgenic
non-human animal of claim 23.
41. A method of testing carcinogenicity of a molecule, comprising:
(a) administering said molecule to the transgenic non-human animal
of claim 23; and (b) comparing the rate of tumor formation in said
transgenic non-human animal with a control non-human animal of the
same genotype to which said molecule is not administered; wherein
an increased rate of tumor formation in said transgenic non-human
animal following administration of said test molecule, as compared
to the rate of tumor formation in said control non-human animal, is
indicative that said molecule is a carcinogen.
42. A method of testing the therapeutic efficacy of a molecule in
treating and/or preventing cancer comprising: (a) administering
said molecule to the transgenic non-human animal of claim 23; and
(b) comparing the rate of tumor formation in said transgenic
non-human animal with a control non-human animal of the same
genotype to which said molecule is not administered; wherein a
reduced rate of tumor formation in said transgenic non-human animal
following administration of said molecule, as compared to the rate
of tumor formation in said control non-human animal, is indicative
that said molecule has therapeutic efficacy for treating and/or
preventing cancer.
43. The method of claim 42, wherein said cancer is a
gastrointestinal cancer.
44. The method of claim 42, wherein said cancer is a Muir-Torre
Syndrome-related cancer.
45. The method of claim 42, wherein said cancer is hereditary
non-polyposis colorectal cancer.
Description
[0001] This application claims the benefit of U.S. Provisional
Application No. 60/196,534 filed Apr. 11, 2000, which is
incorporated by reference herein in its entirety.
1. FIELD OF THE INVENTION
[0003] The present invention relates to the field of cancer
biology, more particularly to transgenic animal that are
predisposed to the development of multiple tumors and are useful as
models for Muir-Torre familial cancer syndrome.
2. BACKGROUND OF THE INVENTION
[0004] Since it was first noted that human chromosomal fragile
sites mapped to chromosome bands that were nonrandomly altered by
translocations or deletions in neoplasias, it has been proposed
that the recombinogenicity of fragile sites, possibly enhanced by
environmental carcinogens, could lead to altered expression of
oncogenes or tumor suppressor genes at fragile sites (Yunis and
Soreng, 1984, Science 226:1199-1204). The corollary of the proposal
is that alterations to expression of genes at fragile sites
contribute to clonal expansion of the neoplastic cells. FHIT is
thus far the only example of a gene at a constitutive fragile
region and shows many hallmarks of a tumor suppressor gene (Ohta et
al., 1996, Cell 84:587-597).
[0005] The FHIT gene is altered by deletion or translocation in a
large fraction of many types of cancers, including lung, cervical,
gastric and pancreatic (Ohta et al., 1996, Cell 84:587-597; Sozzi
et al., 1996, Cell 85:17-26; Hendricks et al., 1997, Cancer Res.
57:2112-2115; Greenspan et al., 1997, Cancer Res. 57:4692-4698;
Baffa et al., 1998, Cancer Res. 58:4708-4714; Simon et al., 1998
Cancer Res. 58:1538-1587; Sorio et al., 1999, Cancer Res.
59:1308-1314). FHIT protein is lost or reduced in the majority of
these cancers, in a large fraction of other cancer types (Hadaczek
et al., 1998, Cancer Res. 58:2946-295; Ingvarsson et al., 1999,
Cancer Res. 59:2682-2689; van Heerden et al., 1999, J. Oral Path.
Med. 28:433-437), and preneoplastic lesions in the lung (Sozzi et
al., 1998, Cancer Res. 58:5032-5037). Nevertheless, acceptance of
FHIT as a tumor suppressor has not been universal (Le Beau et al.,
1998, Genes Chromosomes Cancer 21:281-289), with some reports
suggesting that fragility of the locus alone could account for the
occurrence of clonal or oligoclonal genetic alterations at FHIT in
cancers. To define the role of FHIT protein in cancer development,
a strain of Fhit-deficient mice was established. Surprisingly,
these mice develop symptoms analogous to those seen in humans with
Muir-Torre Syndrome (MTS), which is characterized by a
predisposition for developing a combination of sebaceous and
visceral tumors. The Fhit-deficient mice of the invention afford
the opportunity for studying Muir-Torre Syndrome in a nonhuman
animal.
[0006] Citation or discussion of a reference herein shall not be
construed as an admission that such is prior art to the present
invention.
3. SUMMARY OF THE INVENTION
[0007] The present invention provides an embryonic stem cell
containing a disruption of the FHIT locus, wherein said disruption
comprises a termination codon in an exon 5 coding region. The
invention further provides a transgenic mammal comprising cells
that contain a disruption of the FHIT locus, wherein said
disruption comprises a termination codon in an exon 5 coding
region. The FHIT disruption can be homozygous or heterozygous. In a
preferred embodiment, the transgenic mammal is a mouse. In one
embodiment, the mouse is chimeric for the disruption of the FHIT
locus. In another embodiment, the germline and somatic cells of the
mouse contain the disruption of the FHIT locus. Preferably, the
mouse comprising the FHIT disruption is characterized by a
predisposition to developing a spectrum of visceral and skin
tumors, and/or by hypersensitivity to NMBA. In a specific
embodiment, the mouse comprising the FHIT disruption further
comprises a disruption in the MSH2 gene.
[0008] The present invention further provides cell culture prepared
from cells of a transgenic mouse that is homozygous or heterozygous
for the FHIT disruption
[0009] The present invention yet further provides a method of
testing carcinogenicity of a molecule, comprising administering
said molecule to a Fhit-disrupted transgenic mouse and comparing
the rate of tumor formation in said transgenic mouse with a control
mouse of the same genotype to which the molecule is not
administered, wherein an increased rate of tumor formation
following administration of the molecule is indicative that the
molecule is a carcinogen.
[0010] Alternatively, the invention provides a method of testing
carcinogenicity of a molecule, comprising contacting the cell
culture generated from a mouse homozygous or heterozygous for a
Fhit disruption with said molecule and comparing the rate of
proliferation of said cell culture with an untreated cell culture;
wherein an increased rate of proliferation following exposure to
the molecule is indicative that the molecule is a carcinogen.
[0011] The present invention further provides a method of testing
the therapeutic efficacy of a molecule in treating or preventing
cancer comprising administering said molecule to a Fhit-disrupted
transgenic mouse and comparing the rate of tumor formation in said
transgenic mouse with a control mouse of the same genotype to which
the molecule is not administered, wherein a reduced rate of tumor
formation following administration of the molecule is indicative
that the molecule has therapeutic value for cancer.
[0012] Alternatively, the present invention provides a method of
testing the therapeutic efficacy of a molecule in treating or
preventing cancer comprising contacting the cell culture generated
from a mouse homozygous or heterozygous for a Fhit disruption with
said molecule and comparing the rate of proliferation of said cell
culture with an untreated cell culture; wherein a reduced rate of
cell proliferation following exposure to the molecule is indicative
that the molecule has therapeutic value for cancer.
3.1 Abbreviations
[0013] NMBA: N, nitrosomethylbenzylamine
[0014] H & E: hematoxylin and eosin
[0015] MTS: Muir-Torre syndrome
[0016] MSI: Microsatellite instability
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1: Murine FHIT genomic locus, targeting and screening
strategy. The top line represents the FHIT genomic locus
surrounding exon 5. The middle line depicts the targeting vector
with a 6.6 kb HindIII (H)-Pst1 (P) fragment with a termination
codon introduced into exon 5. The targeted locus after homologous
recombination is shown at the bottom with the probe used for
Southern blot screening of ES colony and progeny DNA after BamHI
(B) cleavage. Positions of the primers used for PCR-amplification
of progeny DNA, to identify wild-type (F,R) and targeted (N,R)
alleles, are shown. Restriction enzyme sites are shown for EcoRV
(EV), EcoRI (E1), Sph1 (Sp), Sac1 (S), Not1 (N), Nco1 (Nc), Pme1
(Pm). The 5'.RTM.3' sequences of the three primers F, R and N are,
respectively: CTTGAATCTAGGCTGCATTCTAGCGAG (SEQ. ID. NO.: 1),
GATTCCTTGCTTACCTTTTGGGGATGG (SEQ. ID. NO.: 2), and
TGGGCTCTATGGCTTCTGAGGC (SEQ. ID. NO.: 3). The first reaction
product is a wild-type fragment of .about.450 bp containing exon 5;
the second product is a mutant fragment of .about.280 bp spanning
from the Neo selection gene to intron 5. PCR conditions were:
denaturation 94.degree. C., 30 s; annealing 62.degree. C., 30 s;
elongation 72.degree. C., 30 s; 35 cycles.
[0018] FIG. 2: Absence of FHIT protein in the Fhit -/- mice.
Lysates from tissues of Fhit -/- mice were tested for expression of
FHIT by immunoblot analysis of mouse tissue lysates: lane 1, FHIT
+/+ lung; lane 2, +/+ liver; lane 3, +/+ kidney; lane 4, Fhit -/-
liver; lane 5, -/- kidney.
[0019] FIG. 3: Immunohistochemical detection of FHIT expression. A,
FHIT expression in normal esophageal epithelium (200.times.) of
FHIT +/+ mouse 23 at ten weeks post NMBA; the brown chromogen
represents the FHIT protein. B, lack of FHIT expression in a
squamous papilloma of the forestomach (200.times.) in Fhit +/-
mouse 33 at ten weeks post NMBA; C, absence of FHIT expression in a
squamous papilloma of the junction (200.times.) in FHIT +/+ mouse
25 at ten weeks post NMBA; D, lack of FHIT expression in an
invasive squamous carcinoma of the forestomach (100.times.) in Fhit
+/- mouse 31 at ten weeks post NMBA; E, lack of FHIT expression in
a sebaceous tumor (100.times.) in Fhit +/- mouse 27 at ten weeks
post NMBA; F, absence of FHIT protein in a sebaceous tumor
(100.times.) in Fhit +/- mouse 21 at ten weeks post NMBA.
[0020] FIG. 4: Immunohistochemical detection of human FHIT in MTS
tumors. A, FHIT expression in normal hair follicle (200.times.);
note that dense keratin horn shows nonspecific staining; B, FHIT
expression in normal sebaceous gland (200.times.); C, hematoxylin
and eosin (H&E) staining of a Muir-Torre Syndrome case 1
sebaceous tumor; D, lack of FHIT expression in most cells of the
case 1 sebaceous tumor.
[0021] FIG. 5: Integrity of FHIT loci in murine tumors. DNA from
tails and sebaceous tumors was cleaved with XbaI, electrophoresed,
transferred to a membrane and hybridized to a .sup.32P-labelled
full length FHIT cDNA probe. FHIT exons are indicated on the left;
the asterisk indicates the inactivated Fhit exon 5. Lanes 1, 3 and
4 contained DNAs from sebaceous tumors from Fhit +/- mice 21, 27
and 31; lane 2 contained DNA from the tail of FHIT +/+ mouse 25 and
lane 5 contained DNA from a Swiss mouse 3T3 cell line, which
exhibits a variant-sized exon 3 (obscured by another fragment) due
to a polymorphism. The FHIT +/+ and +/- mice are B6129F1s which
exhibit two different alleles of exon 8. The right panel shows the
agarose gel prior to blotting of the digested DNAs to the membrane;
this gel illustrates that amounts of DNA loaded in individual lanes
varied from .about.1 .mu.g (lane 4) to .about.10 .mu.g (lane
2).
[0022] FIG. 6: Assessment of MSI in tumors. DNA templates from
mouse and human tumors and controls were amplified using primers
flanking microsatellite alleles. Labeled amplified products were
run on PAGE gels, dried and exposed. The D6Mit59, D19Mit36 and
D17Mit123 panels represent murine alleles amplified from Fhit +/-
mouse 27 forestomach tumor (lane 1), FHIT +/+ mouse 25 forestomach
tumor (lane 2), FHIT +/+mouse 25 tail (lane 3), Fhit +/- mouse 21
sebaceous tumor (lane 4), Fhit +/- mouse 27 sebaceous tumor (lane
5), Fhit +/- mouse 27 second sebaceous tumor (lane 6), Fhit +/-
mouse 31 sebaceous tumor (lane 7), K1735 mouse melanoma cell line
(lane 8), NP3 mouse cell line (lane 9), negative control (no DNA)
(lane 10). No MSI was observed in the mouse tumors for the three
markers shown. The D18535 and D351295 panels represent germline and
tumor DNA from a human MTS case: DNA from peripheral blood
lymphocytes (lane 1), DNA from sebaceous tumor 185 from the same
individual (lane 2), lymphocyte DNA (lane 3) and DNA from sebaceous
tumors 185 (lane 4) and 9029 (lane 5) from the same individual.
These sebaceous tumors showed MSI at each allele successfully
amplified.
[0023] FIG. 7: A map of the murine genomic FHIT locus, indicating
the relative positioning of exon sequences to yeast and bacterial
artificial chromosomes (YACs and BACs, respectively). The regions
of the mouse genomic FHIT locus whose sequences have been deposited
in GenBank are indicated on the map by their GenBank accession
numbers.
5. DETAILED DESCRIPTION OF THE INVENTION
[0024] The murine FHIT locus (FIG. 7; Pekarsky et al., 1998, Cancer
Res. 58:3401-3408; Glover et al., 1998, Cancer Res. 58:3409-3414)
is similar to its human homolog (U.S. Pat. No. 5,928,884),
encompasses a common fragile site, and is altered in murine cancer
cell lines. To define the role of FHIT protein in cancer
development, a strain of Fhit +/- mice was established. The
frequency of carcinogen-induced tumor formation in FHIT +/+ and +/-
mice was compared using the established N-nitrosomethylbenzylamine
(NMBA) esophageal/gastric cancer model (Fong and Magee, 1999,
Cancer Letters 143:63-69).
[0025] Upon bioactivation, NMBA produces benzaldehyde and an
electrophilic methylating agent (Labuc and Archer, 1982, Cancer
Res. 42:3181-3186), which methylates DNA, resulting in the
formation of the promutagenic, adduct 06-methylguanine (O6-meG)
(Fong et al., 1979, Int. J. Cancer 23:679-682). NMBA was reported
to induce both esophageal and forestomach tumors when administered
by gavage or in the drinking water (Fong and Magee, 1999, Cancer
Letters 143:63-69; Sander et al., 1973, 19:157-161). Fong and
colleague have developed a model system that requires low doses of
NMBA, based on their series of studies on esophageal tumor
induction by NMBA in rats and mice (Fong and Magee, 1999, Cancer
Letters 143:63-69; Fong et al., 1984, J. Natl. Cancer Inst.
72:419-425; Fong et al., 1997, Carcinogenesis 18:1477-1484). This
model system was used to test the effects of NMBA administration on
Fhit +/- mice. By ten weeks after NMBA exposure, all the Fhit +/-
mice developed a spectrum of visceral and skin tumors similar to
those observed in a human cancer syndrome, Muir-Torre Syndrome
(MTS), a disease that is caused by deficiency in a mismatch repair
gene.
[0026] Accordingly, the present is directed to the production of
Fhit-deficient cells and Fhit-deficient nonhuman animals. The
present invention is further directed to the use of the
Fhit-deficient nonhuman animals as experimental models for the
study of Muir-Torre Syndrome, and for testing potential
carcinogenic and therapeutic agents.
[0027] The nonhuman transgenic animals contemplated by the present
invention generally include any vertebrates, and preferably
mammals, which encode a FHIT gene or homolog thereof. Such nonhuman
transgenic animals may include, for example, transgenic pigs,
transgenic rats, transgenic rabbits, transgenic cattle, transgenic
goats, and other transgenic animal species, particularly mammalian
species, known in the art. Additionally, other members of the
rodent family, e.g. rat, and guinea pig, and nonhuman primates,
such as chimpanzee, may be used to practice the present invention.
Most preferred animals for the practice of the invention are
mice.
[0028] With respect to a FHIT gene, the terms "functional
disruption" or "functionally disrupted" as used herein mean that a
FHIT locus comprises at least one mutation or structural alteration
such that the functionally disrupted gene is substantially
incapable of directing the efficient expression of functional gene
product. By way of example but not limitation, an endogenous FHIT
gene that has a stop codon introduced (optionally followed by a neo
or other marker gene cassette) integrated into a coding exon (e.g.,
the fifth exon) that is not capable of encoding a functional FHIT
protein, is therefore a functionally disrupted FHIT gene locus.
Functional disruption can include the complete substitution of a
FHIT gene by another gene, for example a reporter gene such as
galactosidase, so that, for example, a targeting transgene that
replaces the entire mouse FHIT open reading frame with a
.beta.-galactosidase open reading frame, is said to have
functionally disrupted the endogenous murine .beta.-galactosidase
locus by displacing it. Deletion or interruption of essential
transcriptional regulatory elements, polyadenylation signal(s),
splicing site sequences will also yield a functionally disrupted
gene. Functional disruption of an FHIT gene, may also be produced
by other methods (e.g., antisense polynucleotide gene suppression).
Also with respect to a FHIT gene, the term "structurally disrupted"
refers to a targeted FHIT gene wherein at least one structural
(i.e., exon) sequence has been altered by homologous gene targeting
(e.g., by insertion, deletion, point mutation(s), and/or
rearrangement). Typically, FHIT genes are functionally disrupted as
a consequence of a disruption of the coding sequence; however FHIT
genes may also be functionally disrupted without concomitantly
being structurally disrupted, i.e., by targeted alteration of a
non-coding sequence such as ablation of a promoter. An allele
comprising a targeted alternation that interferes with the
efficient expression of a functional geneproduct fom the allele is
referred to in the art as a "null allele".
[0029] With respect to a FHIT nucleic acid, the term "corresponds
to" is used herein to mean that a polynucleotide sequence is
homologous (i.e., is identical, not strictly evolutionarily
related) to all or a portion of a reference polynucleotide
sequence, or that a polypeptide sequence is identical to a
reference polypeptide sequence. In contradistinction, the term
"complementary to", with respect to a FHIT gene, is used herein to
mean that the complementary sequence is homologous to all or a
portion of a reference FHIT polynucleotide sequence.
[0030] The terms "substantially corresponds to", "substantially
homologous", or "substantial identity", when used in the context of
a FHIT nucleic acid sequence, denotes a characteristic of the
nucleic acid sequence, wherein a nucleic acid sequence has at least
about 70 percent sequence identity as compared to a reference
sequence, typically at least about 85 percent sequence identity,
and preferably at least about 95 percent sequence identity as
compared to a reference sequence. The percentage of sequence
identity is calculated excluding small deletions or additions which
total less than 25 percent of the reference sequence. The reference
sequence may be a subset of a larger sequence, such as a portion of
a gene or flanking sequence, or a repetitive portion of a
chromosome. However, the reference sequence is at least 18
nucleotides long, typically at least about 30 nucleotides long, and
preferably at least about 50 to 100 nucleotides long.
"Substantially complementary" as used herein refers to a sequence
that is complementary to a sequence that substantially corresponds
to a reference sequence. In general, targeting efficiency increases
with the length of the targeting transgene portion (i.e., homology
region) that is substantially complementary to a reference sequence
present in the target DNA (i.e., crossover target sequence). In
general, targeting efficiency is optimized with the use of isogenic
DNA homology clamps, although it is recognized that the presence of
various recombinases may reduce the degree of sequence identity
required for efficient recombination.
[0031] The term "nonhomologous sequence", as used herein in
reference to a FHIT nucleic acid, generally indicates that a
sequence that is not substantially identical to a specified FHIT
nucleic acid sequence.
[0032] "Specific hybridization" with reference to a FHIT nucleic
acid sequence is defined herein as the formation of hybrids between
a FHIT targeting transgene sequence (e.g., a FHIT polynucleotide
which may include substitutions, deletion, and/or additions) and a
specific target DNA sequence (e.g., a FHIT gene sequence). Specific
hybridization can be tested with a labeled FHIT targeting transgene
sequence to determine whether it preferentially hybridizes to the
FHIT target such that, for example, a single band corresponding to
a restriction fragment of a genomic FHIT gene can be identified on
a Southern blot of DNA prepared from cells using said labeled
targeting FHIT transgene sequence as a probe. It is evident that
optimal hybridization conditions will vary depending upon the FHIT
sequence composition and length(s) of the FHIT targeting
transgene(s) and endogenous target(s), and the experimental method
selected by the practitioner. Various guidelines may be used to
select appropriate hybridization conditions (see, Maniatis et al.,
Molecular Cloning: A Laboratory Manual, 1989, 2nd Ed., Cold Spring
Harbor, N.Y. and Berger and Kimmel, Methods in Enzymology, Volume
152. Guide to Molecular Cloning Techniques, 1987, Academic Press,
Inc., San Diego, Calif.).
[0033] The term "naturally-occurring", in general and as used
herein, as applied to an object refers to the fact that an object
can be found in nature. For example, a polypeptide or
polynucleotide sequence that is present in an organism (including
viruses) that can be isolated from a source in nature and which has
not been intentionally modified by man in the laboratory is
naturally-occurring. As used herein, laboratory strains of rodents
which may have been selectively bred according to classical
genetics are considered naturally-occurring animals.
[0034] The term "targeting construct", when used herein in
reference to a FHIT nucleic acid, generally refers to a
polynucleotide which comprises: (1) at least one FHIT homology
region having a sequence that is substantially identical to or
substantially complementary to a sequence present in a host cell
endogenous FHIT gene locus, and (2) a targeting region which
becomes integrated into an host cell endogenous FHIT gene locus by
homologous recombination between a targeting construct homology
region and said endogenous FHIT gene locus sequence. If the
targeting construct is a "hit-and-run" or "in-and-out" type
construct (Valancius and Smithies, 1991, Mol. Cell. Biol. 11: 1402;
Donehower et al., 1992, Nature 356: 215; Donehower, et al., 1991,
J. NIH Res. 3: 59, the FHIT targeting region is only transiently
incorporated into the endogenous FHIT gene locus and is eliminated
from the host genome by selection. A FHIT targeting region may
comprise a sequence that is substantially homologous to an
endogenous FHIT gene sequence and/or may comprise a nonhomologous
sequence, such as a selectable marker (e.g., neo, tk, gpt). The
term "targeting construct" does not necessarily indicate that the
polynucleotide comprises a gene which becomes integrated into the
host genome, nor does it necessarily indicate that the
polynucleotide comprises a complete structural gene sequence. As
used in the art, the term "targeting construct" is synonymous with
the term "targeting transgene" as used herein.
[0035] The terms "homology region" and "homology clamp" as used
herein in reference to a FHIT nucleic acid, refer to a segment
(i.e., a portion) of a FHIT targeting construct having a sequence
that substantially corresponds to, or is substantially
complementary to, a predetermined endogenous FHIT gene sequence,
which can include sequences flanking said FHIT gene. A homology
region is generally at least about 100 nucleotides long, preferably
at least about 250 to 500 nucleotides long, typically at least
about 1000 nucleotides long or longer. Although there is no
demonstrated theoretical minimum length for a homology clamp to
mediate homologous recombination, it is believed that homologous
recombination efficiency generally increases with the length of the
homology clamp. Similarly, the recombination efficiency increases
with the degree of sequence homology between a targeting construct
homology region and the endogenous target sequence, with optimal
recombination efficiency occurring when a homology clamp is
isogenic with the endogenous target sequence. The terms "homology
clamp" and "homology region" are interchangeable as used herein. A
homology clamp does not necessarily connote formation of a
base-paired hybrid structure with an endogenous sequence.
Endogenous FHIT gene sequences that substantially correspond to, or
are substantially complementary to, a transgene homology region are
referred to herein as "crossover target sequences" or "endogenous
target sequences."
[0036] As used herein, the term "correctly targeted construct",
when used in reference to a FHIT construct, refers to a portion of
the targeting construct which is integrated within or adjacent to
an endogenous crossover FHIT target sequence, such as a portion of
an endogenous FHIT gene locus. By way of example but not
limitation, a portion of a FHIT targeting transgene encoding neo
and flanked by homology regions having substantial identity with
endogenous FHIT gene sequences flanking the first exon, is
correctly targeted when said transgene portion is integrated into a
chromosomal location so as to replace, for example, the first exon
of the endogenous FHIT gene. In contrast and also by way of
example, if the targeting transgene or a portion thereof is
integrated into a nonhomologous region and/or a region not within
about 50 kb of a FHIT gene sequence, the resultant product is an
incorrectly targeted FHIT transgene. It is possible to generate
cells having both a correctly targeted FHIT transgene(s) and an
incorrectly targeted FHIT transgene(s). Cells and animals having a
correctly targeted FHIT transgene(s) and/or an incorrectly targeted
FHIT transgene(s) may be identified and resolved by PCR and/or
Southern blot analysis of genomic DNA.
[0037] As used herein, the term "targeting region", when used in
reference to a FHIT targeting region, refers to a portion of a FHIT
targeting construct that becomes integrated into an endogenous FHIT
chromosomal location following homologous recombination between a
homology clamp and an endogenous FHIT gene sequence. Typically, a
FHIT targeting region is flanked on each side by a FHIT homology
clamp, such that a double-crossover recombination between each of
the homology clamps and their corresponding endogenous FHIT gene
sequences results in replacement of the portion of the endogenous
FHIT gene locus by the targeting region; in such double-crossover
gene replacement targeting constructs the targeting region can be
referred to as a "FHIT replacement region". However, some targeting
constructs may employ only a single FHIT homology clamp (e.g., some
"hit-and-run"-type vectors, see, Bradley et al., 1992,
BioTechnology 10: 534).
[0038] As used herein, the term "replacement region", when used in
the context of a FHIT transgene, refers to a portion of a FHIT
targeting construct flanked by FHIT homology regions. Upon
double-crossover homologous recombination between flanking homology
regions and their corresponding endogenous FHIT gene crossover
target sequences, the replacement region is integrated into the
host cell chromosome between the endogenous crossover FHIT target
sequences. Replacement regions can be homologous (e.g., have a
sequence similar to the endogenous FHIT gene sequence but having a
point mutation or missense mutation), nonhomologous (e.g., a neo
gene expression cassette), or a combination of homologous and
nonhomologous regions.
[0039] As used herein, the term "minigene", when used in reference
to a FHIT minigene, refers to a heterologous gene construct wherein
one or more nonessential segments of a FHIT gene are deleted with
respect to the naturally-occurring FHIT gene. Typically, deleted
segments are intronic sequences of at least about 500 basepairs to
several kilobases, and may span up to several tens of kilobases or
more. Isolation and manipulation of large (i.e., greater than about
30-100 kilobases) targeting onstructs is frequently difficult and
may reduce the efficiency of transferring the targeting construct
into a host cell. Thus, it is frequently desirable to reduce the
size of a targeting construct by deleting one or more nonessential
portions of a FHIT gene. Typically, intronic sequences that do not
encompass essential regulatory elements may be deleted. For
example, a FHIT minigene may comprise a deletion of an intronic
segment between the fifth and sixth exons of the human FHIT gene.
Frequently, if convenient restriction sites bound a nonessential
intronic sequence of a cloned FHIT gene sequence, a deletion of the
intronic sequence may be produced by: (1) digesting the cloned DNA
with the appropriate restriction enzymes, (2) separating the
restriction fragments (e.g., by electrophoresis), (3) isolating the
restriction fragments encompassing the essential exons and
regulatory elements, and (4) ligating the isolated restriction
fragments to form a minigene wherein the exons are in the same
linear order as is present in the germline copy of the
naturally-occurring FHIT gene. Alternate methods for producing a
minigene will be apparent to those of skill in the art (e.g.,
ligation of partial genomic clones which encompass essential exons
but which lack portions of intronic sequence). Most typically, the
gene segments comprising a minigene will be arranged in the same
linear order as is present in the germline FHIT gene, however, this
will not always be the case. Some desired regulatory elements
(e.g., enhancers, silencers) may be relatively
position-insensitive, so that the regulatory element will function
correctly even if positioned differently in a minigene than in the
corresponding germline gene. For example, an enhancer may be
located at a different distance from a promoter, in a different
orientation, and/or in a different linear order. For example, an
enhancer that is located 3' to a promoter in germline configuration
might be located 5' to the promoter in a minigene. Similarly, some
FHIT genes may have exons which are alternatively spliced at the
RNA level, and thus a minigene may have fewer exons and/or exons in
a different linear order than the corresponding germline FHIT gene
and still encode a functional gene product. A cDNA encoding a FHIT
gene product may also be used to construct a minigene.
[0040] As used herein, Fhit-deficient means that at least one of
the two wild-type FHIT chromosomal alleles has been mutated such
that less than wild-type levels of FHIT activity are produced. The
term "Fhit deficient" includes both homozygous FHIT mutant cells
and animals, as well as cells that are heterozygous for the FHIT
mutant genotype.
[0041] Generally, the nomenclature used herein and the laboratory
procedures in cell culture, molecular genetics, and nucleic acid
chemistry and hybridization described below are those well known
and commonly employed in the art. Standard techniques are used for
recombinant nucleic acid methods, polynucleotide synthesis, cell
culture, and transgene incorporation (e.g., electroporation,
microinjection, lipofection). Generally enzymatic reactions,
oligonucleotide synthesis, and purification steps are performed
according to the manufacturer's specifications. The techniques and
procedures are generally performed according to conventional
methods in the art and various general references which are
provided throughout this document.
[0042] Preferred embodiments of the present invention include
diploid mouse cells, mouse embryos, and mice that contain two
chromosomal alleles of the FHIT gene, wherein at least one of the
FHIT alleles contains a mutation such said cell produces less than
wild-type levels of FHIT activity. Such FHIT deficient animals and
cells are deemed to be useful as, inter alia, disease models for
the analysis and testing of therapeutic agents, and the effects of
mutagenic stimuli such as radiation and chemical mutagens. In a
preferred embodiment, the FHIT mutation is a substitution mutation
that results in a stop codon in the open reading frame of exon
5.
[0043] Mismatch repair is a process common to cells that probably
functions as a control against tumor formation. Given that FHIT
deficient animals are predisposed to the development of multiple
tumors similar to those seen in Muir-Torre Syndrome, the presently
described cells and animals are also deemed to be useful for the
study of Muir-Torre Syndrome, and agents for treating the same.
[0044] In particular, methods are contemplated for screening for
conditions that rescue the proliferation abnormalities of FHIT
deficient cells or organisms. Examples of such conditions include,
but are not limited to, the presence of exogenously added protein
or chemical factors, the over expression of transfected genes or
endogenous genes, or the ectopic expression of transfected genes or
endogenous genes, or the mutagenesis of genes and the like.
[0045] The mutation, or targeted disruption, in the FHIT gene may
be engineered using any of a number of well established mutations
that are well known in the art. Preferably, the mutation shall be a
substitution mutation, most preferably a subsitution mutation that
results in a termination codon of the FHIT open reading frame,
although deletion mutations and/or insertion mutations are included
within the scope of the present invention. Substitution mutations
can be prepared by site directed mutagenesis, as described by
(Hasty et al., 1991, Nature 350:243-246), that introduces a stop
codon or other mutation near the 5' end of the FHIT gene such that
abortive production of FHIT protein results, or the production of a
mutant protein which lacks FHIT activity. Similarly, insertion
mutations can be introduced within the FHIT gene by taking
advantage of the convenient restriction sites therein, such as any
of the exonic restrictions sites or other sites which are easily
identified by exonic sequencing of the FHIT gene and restriction
mapping, and the techniques described by (Hasty et al., 1991,
Molecular and Cellular Biology 11:4509-4517; Joyner et al., 1989,
Nature 338:153-156). Another method of introducing an insertion or
other mutation consists of infecting with a retrovirus which
integrates in the FHIT locus, thereby creating a mutated Fhit
allele as described by von Melchner et al., Genes and Development
6:919-927. In other embodiments, the mutants of the present
invention preferably lack part of the DNA sequence coding for the
FHIT protein (i.e., deletion mutants) so that a defective FHIT
allele is more likely made. An additional feature of deletion
mutants are that, relative to the insertion mutants taught by von
Melchner, there is a drastically reduced possibility of reversion
to the non-mutant allele. Deletion mutants can be produced by
eliminating a DNA fragment from a coding region of the FHIT gene so
that proper folding or substrate binding of the FHIT protein is
prevented. The size of the deletion may vary, but in general a
larger deletion is preferable to a smaller deletion since the
larger deletions are more likely to result in a deficiency in FHIT
activity. Typically, deletion mutations shall involve the excision
of 1 base or up to essentially all of the bases of a given gene
(including non-coding flanking regions). Alternatively, deleting a
single base pair or two base pairs or any number of base pairs not
divisible by 3 from the coding region would result in a frameshift
mutation which would most likely be deleterious to making a
functional FHIT protein. In the latter instance, a truncated
polypeptide may be produced because polypeptide synthesis is
aborted due to a frame shift-induced stop codon. For a general
review of mutagenesis and mutation see "An Introduction to Genetic
Analysis", 4th edition, 1989 (D. Suzuki, A. Griffiths, J. Miller,
and R. Lewontin, eds.), W.H. Freeman & Co., N.Y., N.Y.
[0046] Changing a single base pair (or multiple base pairs) in the
coding region of the FHIT gene may also cause a mutation which, if
resulting in an amino acid change, may alter the proper folding of
the FHIT protein and thereby create a Fhit deficiency. A single
amino acid change so generated could also alter the activity of a
FHIT protein. Another alternative would be to generate a deletion
or other mutation in the non-coding region of the FHIT gene which
affected the proper splicing of the FHIT messenger RNA. Such a
mutation could effectively create a mutant FHIT transcript which
was missing an entire exon or several exons as compared to the wild
type FHIT message. Another alternative is to delete a non-coding
regulatory region to decrease expression of the FHIT gene. The
preferred size of the deletion is about several hundred nucleotides
near the 5' end of the gene. Preferably, such a deletion would
eliminate a number of nucleotides from the coding region not evenly
divisible by 3, thereby creating a frameshift mutation as well.
Alternatively, promoter sequences could be deleted or altered that
would diminish transcription of the FHIT gene.
[0047] It is also possible to alter the expression of a given gene
by altering the codon usage in the gene. Alterations of this sort
preserve the amino acid sequence of the product while increasing or
decreasing the levels of expression.
[0048] Antisense transgenes comprising antisense polynucleotides
may also be employed to partially or totally knock-out expression
of specific genes (Helene and Toulme, 1990, Biochimica Bioshys.
Acta 1049:99; Pepin et al., 1991, Nature 355:725; Stout and Caskey,
1990, Somat. Cell Mol. Genet. 16:369; and Munir et al., 1990,
Somat. Cell Mol. Genet. 16:383)
[0049] "Antisense polynucleotides" are polynucleotides that: (1)
are complementary to all or part of a reference target sequence,
such as the sequence of the FHIT gene, and specifically hybridize
to a complementary target sequence, such as a chromosomal gene
locus mRNA. Such complementary antisense polynucleotides may
include nucleotide substitutions, additions, deletions, or
transpositions, so long as specific hybridization to the relevant
target sequence is retained as a functional property of the
polynucleotide. Complementary antisense polynucleotides include
antisense RNA which can hybridize specifically to individual mRNA
species and hinder or prevent transcription and/or RNA processing
of the mRNA species and/or translation of the encoded polypeptide
(Ching et al., 1989, Proc. Natl. Acad. Sci. USA 86:10006-10010;
Broder et al., Ann. Int. Med. 113:604-618; Loreau et al., 1990,
FEBS Letters 274:53-56; Holcenberg et al., WO91/11535; WO91/09865;
WO91/04753; WO90/13641; and EP 386563). An antisense sequence is a
polynucleotide sequence of at least about 15 contiguous nucleotides
in length, typically at least 20 to 30 nucleotides in length, and
preferably more than about 30 nucleotides in length that is
substantially complementary to a target gene sequence, or
sequences, in a cell. In some embodiments, antisense sequences may
have substitutions, additions, or deletions as compared to the
complementary target sequence but as long as specific hybridization
is retained, the polynucleotide will generally function as an
antisense inhibitor of gene expression.
[0050] For the purposes of the present invention, the antisense
sequence is complementary to an endogenous FHIT target gene
sequence. In some cases, sense sequences corresponding to the FHIT
target region sequence may function to suppress expression,
particularly by interfering with transcription. Alternatively, an
antisense polynucleotide will generally suppress FHIT expression at
a post transcriptional level.
[0051] Given that antisense polynucleotides inhibit the production
of the polypeptide(s) in cells, they may further alter a nonhuman
transgenic animal's capacity to produce FHIT protein.
[0052] Antisense polynucleotides may be produced from a
heterologous expression cassette inserted into transgenic
pluripotent embryonic stem cells which may subsequently be used to
generate the presently described Fhit-deficient animals.
5.1 FHIT Gene Sequences
[0053] The invention encompasses methods to produce nonhuman
animals (e.g., non-primate mammals) that have at least one FHIT
locus inactivated by gene targeting with a homologous recombination
targeting construct. Any FHIT gene can be functionally disrupted
according to the methods of the invention, provided that
polynucleotide sequences that can be used as homology clamps in a
targeting construct can be obtained (e.g., from GenBank database,
in literature publications, or by routine cloning and sequencing,
etc.). Typically, a FHIT gene sequence is used as a basis for
producing PCR primers that flank a region that will be used as a
homology clamp in a targeting construct. The PCR primers are then
used to amplify, by high fidelity PCR amplification (Mattila et
al., 1991, Nucleic Acids Res. 19: 4967; Eckert and Kunkel, 1991,
PCR Methods and Applications 1: 17; U.S. Pat. No. 4,683,202, a
genomic sequence from a genomic clone library or from a preparation
of genomic DNA, preferably from the strain of nonhuman animal that
is to be targeted with the targeting construct. The amplified DNA
is then used as a homology clamp and/or targeting region. Thus,
homology clamps for targeting essentially any FHIT gene may be
readily produced on the basis of nucleotide sequence information
available in the art and/or by routine cloning. General principles
regarding the construction of targeting constructs and selection
methods are reviewed in Bradley et al., 1992, Bio Technology 10:
534.
5.2 Fhit Mutations for Targeting Construct
[0054] Targeting constructs can be transferred into pluripotent
stem cells, such as murine embryonal stem cells, wherein the
targeting constructs homologously recombine with a portion of an
endogenous FHIT gene locus and create mutation(s) (i.e.,
insertions, deletions, rearrangements, sequence replacements,
and/or point mutations) which prevent the functional expression of
the endogenous FHIT gene. A preferred method of the invention is to
delete, by targeted homologous recombination, essential structural
elements of an endogenous FHIT gene. For example, a targeting
construct can homologously recombine with an endogenous FHIT gene
and delete a portion spanning substantially all of one or more of
the exons to create an exon-depleted allele, typically by inserting
a replacement region lacking the corresponding exon(s). Transgenic
animals homozygous for the exon-depleted allele (e.g., by breeding
of heterozygotes to each other) are essentially incapable of
expressing a functional endogenous FHIT molecule. Similarly,
homologous gene targeting can be used, if desired, to functionally
disrupt a FHIT gene by deleting only a portion of an exon of an
endogenous FHIT gene. Targeting constructs can also be used to
delete essential regulatory elements of a FHIT gene, such as
promoters, enhancers, splice sites, polyadenylation sites, and
other regulatory sequences, including sequences that occur upstream
or downstream of the FHIT structural gene but which participate in
FHIT gene expression. Deletion of regulatory elements is typically
accomplished by inserting, by homologous double-crossover
recombination, a replacement region lacking the corresponding
regulatory element(s).
[0055] An alternative preferred method of the invention is to
interrupt essential structural and/or regulatory elements of an
endogenous FHIT gene by targeted insertion of a polynucleotide
sequence, and thereby functionally disrupt the endogenous FHIT
gene. For example, a targeting construct can homologously recombine
with an endogenous FHIT gene and insert a nonhomologous sequence,
such as a neo expression cassette, into a structural element (e.g.,
an exon) and/or regulatory element (e.g., enhancer, promoter,
splice site, polyadenylation site) to yield a targeted FHIT allele
having an insertional interruption. The inserted sequence can range
in size from about 1 nucleotide (e.g., to produce a frameshift in
an exon sequence) to several kilobases or more, as limited by
efficiency of homologous gene targeting with targeting constructs
having a long nonhomologous replacement region.
[0056] Targeting constructs of the invention can also be employed
to replace a portion of an endogenous FHIT gene with an exogenous
sequence (i.e., a portion of a targeting transgene); for example,
the fifth exon of a FHIT gene may be replaced with a substantially
identical portion that contains a nonsense or missense
mutation.
[0057] Inactivation of a FHIT locus is achieved by targeted
disruption of the gene by homologous recombination in mouse
embryonic stem cells. For inactivation, any targeting construct
that produces a genetic alteration in the target FHIT gene locus
resulting in the prevention of effective expression of a functional
gene product of that locus may be employed. If only regulatory
elements are targeted, some low-level expression of the targeted
gene may occur (i.e., the targeted allele is "leaky"), however the
level of expression may be sufficiently low that the leaky targeted
allele is functionally disrupted.
5.3 Gene Targeting
[0058] Gene targeting, which is a method of using homologous
recombination to modify a mammalian genome, can be used to
introduce changes into cultured cells. By targeting a gene of
interest in embryonic stem (ES) cells, these changes can be
introduced into the germlines of laboratory animals to study the
effects of the modifications on whole organisms, among other uses.
The gene targeting procedure is accomplished by introducing into
tissue culture cells a DNA targeting construct that has a segment
homologous to a target locus and which also comprises an intended
sequence modification (e.g., insertion, deletion, point mutation).
The treated cells are then screened for accurate targeting to
identify and isolate those which have been properly targeted. A
common scheme to disrupt gene function by gene targeting in ES
cells is to construct a targeting construct which is designed to
undergo a homologous recombination with its chromosomal counterpart
in the ES cell genome. The targeting constructs are typically
arranged so that they insert additional sequences, such as a
positive selection marker, into coding elements of the target gene,
thereby functionally disrupting it. Targeting constructs usually
are insertion-type ("knock in") or replacement-type constructs
("knock out"; Hasty et al., 1991, Mol. Cell. Biol. 11: 4509).
[0059] The Fhit-deficient animals and cells of the present
invention can be prepared by any of several techniques that are
well established in the art including but not limited to those
cited above. For example, techniques similar to those taught in
U.S. Pat. No. 5,464,764 to Capecchi may be used. In general, Fhit
defective cells may be engineered using the following steps:
[0060] (1) Constructing a targeting vector comprising a cloning
vector and a DNA fragment containing at least one positively
selectable marker gene (positive selection marker), flanked by two
regions of the animal's FHIT gene or genomic locus which are in the
same 5' to 3' orientation to one another (referred to as the
regions of homology);
[0061] (2) Included in the targeting vector is a negatively
selectable marker gene (negative selection marker) adjacent to one
of the regions of homology. This negatively selectable marker may
increase the likelihood of recovering the desired homologous
recombination event (deleting a portion of the FHIT gene) but it is
not required;
[0062] (3) Transfecting FHIT +/+ animal cells with the targeting
vector of step (2);
[0063] (4) Selecting the transfected cells from step 3 for the
marker(s) on the vector; and
[0064] (5) Screening for Fhit-deficient animal cells from those
cells in step (4) which are found to contain or express said
positive selection marker(s), and not express said negative
selection marker(s).
5.4 Targeting Constructs
[0065] The precise FHIT gene or gene locus sequences which must be
present in the targeting vector of step (1) will depend on the
sequences chosen for the modification of the FHIT locus, and (2)
the restriction nucleases to be employed in the engineering of the
mutant.
[0066] The specific regions of homology required in step (1) depend
on the specifics of the deletion in the targeting vector. In
general, the homology regions used in the targeting vector will
preferably comprise at least about 100 bp, more preferably at least
about 250 to 500 bp, more preferably at least 1000 bp, and most
preferably at least about 1.5 kb or greater to insure a high degree
of targeting efficiency.
[0067] Wherein the Fhit mutation created is a deletion mutation,
the size of the deletion may also vary and depends on the regions
of homology used in the targeting vector. Since non-contiguous
regions of homology are used in the deletion targeting vector, that
region in the wild-type allele which is located between the regions
of homology constitutes the region to be deleted after homologous
recombination with the targeting vector. Generally, it is
preferable to delete at least a portion of an exon of the FHIT
gene, or an entire exon, which results in a correspondingly mutated
FHIT messenger RNA.
[0068] The particular positive and negative selection markers
employed in the present invention are not critical to the practice
of the invention. The positive selectable marker are located
between the regions of homology and the negative marker, if one is
used, are outside the regions of homology. The regions of homology
are generally present in the vector in the same 5' to 3'
orientation relative to one another. Conversely, the relative
orientations of the positive and negative selectable markers are
not critical. While it is not necessary to include a negative
selectable marker, the presence of a negative marker may improve
selection for targeted clones.
[0069] Preferably, the positive selectable marker is expressed in
the cells that are targeted for gene modification. Positive and/or
negative selection markers are deemed to be functional in the
transfected cells if the DNA sequences encoding the selectable
markers are capable of conferring either a positive or negative
phenotypic selection characteristic to cells expressing the
sequences. In general, the marker will be operably linked to a
regulatory sequence that mediates the expression of the marker. A
nucleic acid marker is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
instance, a promoter or enhancer is operably linked to a coding
sequence if it affects the transcription of the sequence. With
respect to transcription regulatory sequences, operably linked
means that the DNA sequences being linked are contiguous.
[0070] Additionally, the means by which the positive selectable
marker gene is made functional is not critical to the present
invention. Positive selection is accomplished by exposing the cells
to an appropriate agent which kills or otherwise selects against
cells that do not contain or express an integrated positive
selection marker. The positive selectable marker gene may have a
promoter driving its expression or it may be driven by the
juxtaposition of transcriptional elements at the target locus with
the positive selectable marker. The latter gene organization
requires that the transcriptional elements are active in the
transfected cells.
[0071] In addition to a positive selection marker, the mutation
engineered into the targeting vector may contain DNA sequence,
e.g., an oligonucleotide linker, between the regions of FHIT gene
homology in place of the deleted FHIT DNA. The oligonucleotide
linker is generally about 8-10 nucleotides in length, but can be
longer, e.g. about 50 nucleotides, or shorter, e.g. 4, 5 or 7
nucleotides. The preferred length of the oligonucleotide linker is
about 20 to 40 nucleotides in length. The DNA sequence of the
oligonucleotide linker is not critical.
[0072] The method of inserting the oligonucleotide between the
regions of homology in the targeting vector DNA will depend upon
the type of oligonucleotide linker used. Palindromic double
stranded linkers containing one or more restriction nuclease sites
in the oligonucleotide sequence (New England Biolabs) may be
inserted by well known procedures (Maniatis et al., 1982, Molecular
Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor Press,
N.Y.)
[0073] Oligonucleotide linkers may also be inserted into deletions
in plasmid DNA by tailing ends with complementary homopolymers
using terminal transferase (Maniatis et al., supra), or a single
stranded oligonucleotide linker may be inserted into a deletion in
a plasmid by bridging, through annealing of an oligonucleotide
containing ends complementary, to a cleaved plasmid's 3'-recessed
and 3'-protruding cohesive ends, followed by filling-in the gap
complementary to the oligonucleotide sequence with DNA polymerase
(Klenow fragment). After subsequent ligation with T4 DNA ligase,
closed circular DNA molecules can be regenerated.
[0074] Alternatively, site-directed mutagenesis may be used to
simultaneously construct a specific deletion and insert a linker
sequence by using a single stranded oligonucleotide to "loop-out"
the desired region of the target gene (Krogstad and Champoux, 1990,
J. Virol. 64(6):2796-2801.
[0075] If the targeting vector is designed such that the deleted
region interrupts an exon, by the judicious choice of
oligonucleotide linker length and sequence, frame shift mutations
and/or stop codons may be produced in the FHIT gene in addition to
the deletion within the FHIT gene.
[0076] The mutation engineered in the targeting vector may contain
DNA sequences between the regions of FHIT gene homology in addition
to the positive selection marker, for example, splice acceptor
sequences. Such sequences have been shown to result in aberrant,
and hence nonfunctional, mRNAs.
[0077] The DNA sequences used in the regions of homology are
generally derived from FHIT gene sequence, sequences that flank the
FHIT gene locus, or a combination thereof. Where an Fhit-deficient
mouse is desired, the strain of mouse from which the FHIT DNA is
derived is not critical, but preferably the gene is from the same
as the strain of mouse as the cells targeted for gene transfer.
Using DNA (in the regions of homology) that is isogenic to the
target cells will generally enhance the efficiency of gene
targeting. The regions of homology may be derived from genomic
libraries of mouse DNA which may be cloned into a variety of
cloning vectors such as lambda phage vectors, cosmid vectors,
plasmid vectors, p1 phage vectors, yeast artificial chromosome
vectors, and the like. Regions of homology to be incorporated into
the targeting vector may also be derived from genomic DNA using
polymerase chain reaction (PCR). Regions of homology so derived
could be subcloned directly into the targeting vector.
Alternatively, the regions of homology may be derived from an
appropriate cDNA library.
5.4.1 Targeting Vectors
[0078] Any of a wide variety of cloning vectors may be used to
construct the FHIT-targeting vectors of the present invention.
Examples of such cloning vectors include, but are not limited to,
pBR322 and pBR322-based vectors (Sekiguchi, 1983, Gene 21:267),
pMB9, pBR325, pKH47 (Bethesda Research Laboratories), pBR328,
pHC79, phage Charon 28 (Bethesda Research Laboratories, Boehringer
Mannheim Biochemicals), pKB11, pKSV-10 (P-L Biochemicals), and
oligonucleotide (dg)-tailed pBR322 (Bethesda Research
Laboratories), pBluescript or similar plasmids (Stratagene), pK19
or related plasmids (New England Biolabs), the pUC series of
plasmids (New England Biolabs), the pGEM series of plasmids
(Promega), and the like.
[0079] As discussed above, the targeting vector will generally
comprise two regions of FHIT homology separated by a positive
selectable marker, and, optionally, a flanking negative selectable
marker that is not critical as long as the cloning vector contains
a gene expressing a selectable trait, e.g. drug resistance. The
targeting vector may also be cloned into other cloning vectors such
as such as lambda phage vectors, cosmid vectors, plasmid vectors,
p1 phage vectors, yeast artificial chromosome vectors, and the
like.
[0080] Another option is to prepare the components of the targeting
vector synthetically by PCR and simply ligating each component such
that the positive selectable marker is placed between the regions
of homology, and the homology regions are place in the proper
orientation relative to one another.
[0081] Any of a variety of restriction nucleases may be employed to
produce fragments containing a FHIT gene. Thus, a FHIT gene
restriction map provides guidance as to which of a wide variety of
cloning vectors may be used to conveniently practice the present
invention. In fact, many combinations of restriction endonucleases
could be used to generate an FHIT targeting vector to mutate the
FHIT gene. For example, a suitable restriction site in the murine
FHIT gene is BamH1.
[0082] The specific host employed for growing the targeting vectors
of the present invention is not critical, but the host will
preferable have a functional hsd modification system. Examples of
such hosts include E. coli K12 RR1 (Bolivar et al., 1977, Gene
2:95); E. coli K12 HB101 (ATCC No. 33694); E. coli MM21 (ATCC No.
336780); and E. coli DH1 (ATCC No. 33849). The preferred host in
the present invention is E. coli strain DH5.alpha. (Life
Technologies). Similarly, alternative vector/cloning systems could
be employed such as targeting vectors which grow in E. coli or
Saccharomyces cerevisiae, or both, or plasmid vectors which grow in
B. subtilus (Ure et al., 1983, Methods in Enzymology, "Recombinant
DNA", vol. 101, Part C, Academic Press, N.Y.).
5.5 Inducible and Tissue- and Developmental Stage-Specific
Targeting of FHIT
[0083] In certain embodiments of the present invention, the
Fhit-deficiency in FHIT transgenic animals is limited to specific
developmental stages or to specific tissues. In another embodiment,
Fhit-deficiency in FHIT transgenic animals or cells derived from
FHIT transgenic animals is inducible.
[0084] Wherein the Fhit-deficiency is desired to be temporally or
developmentally regulated, the Cre-Lox system may be employed. The
Cre-Lox system may be used to activate or inactivate the FHIT gene
at a specific developmental stage or in a particular tissue.
Generally, methods utilizing Cre-Lox technology are carried out as
described by Torres and Kuhn, 1997, "Laboratory Protocols for
Conditional Gene Targeting", Oxford University Press. Methodology
similar to that described for the Cre-Lox system can be employed
utilizing the FLP-FRT system
[0085] For inactivation of FHIT gene expression at a specific stage
in development or a particular tissue, the FHIT coding region is
replaced by a cassette comprising the coding region flanked by LoxP
cites according to the methods described herein. The LoxP sites are
targets for the Cre recombinase. The resulting transgenic animal is
crossed to another transgenic animal in which the Cre recombinase
is expressed under the control of a spatially and/or temporally
regulated promoter. When Cre expression is activated, the LoxP
sites undergo recombination to excise the FHIT coding region,
resulting in Fhit-deficient tissues.
[0086] For activation of FHIT expression in a selected tissue and
or at a particular stage of development, the regions of homology in
the targeting construct are promoter sequences, comprising
insertion fragment which contains multiple stop codons in all
reading frames flanked by LoxP sites. Upon insertion of this
targeting construct into the FHIT promoter, no FHIT protein is
produced. The resulting transgenic animal is crossed to another
transgenic animal in which the Cre recombinase is expressed under
the control of a spatially and/or temporally regulated promoter.
When Cre expression is activated, the LoxP sites undergo
recombination to excise the stop codons and restore the FHIT gene
to its undisrupted state.
[0087] For inducible FHIT activation or inactivation, the Tet
operator can replace or be inserted iton the native FHIT regulatory
elements, so that the FHIT gene falls under the control of the
tetracycline-controllable transactivator (tTA) and
tetracycline-controllable repressor (TetR), which can only activate
or repress transcription, respectively, in the presence of
tetracycline. Transgenic animals comprising the Tet promoter in the
FHIT gene are then crossed to animals which express rTA or TetR,
constitutively for example, and FHIT expression induced or
repressed by administering tetracycline to the animals.
Alternatively, cultured cells from the transgenic animals can be
produced, the cells transfected with a rTA or TetR expression
construct, and the culture contacted with tetracycline to induce or
inhibit FHIT expression. For further details, see U.S. Pat. No.
5,922,927.
5.6 Precursor Cells
[0088] The specific nonhuman animal cell which is mutated in the
present invention is not critical; however, it is preferably a
precursor cell or at least pluripotent cell. The term precursor
means that the pluripotent cell is a precursor of the desired
transfected pluripotent cell of the present invention. Using
established techniques, pluripotent cells may be cultured in vivo
to form a mutant animal (Evans et al., 1981, Nature
292:292-156).
[0089] Wherein the cell which is mutated is a murine cell, examples
of murine cells that may be employed in the present invention
include, but are not limited to, embryonic stem (ES) cells
(preferably primary isolates of ES cells), such as RW4, AB 1 (an
hprt.sup.- cell line) or AB 2.1 (AB 1, an hprt.sup.+ cell
line).
[0090] Primary isolates of ES cells may be obtained directly from
embryos, essentially as described for the EK.CCE cell line or for
ES cells in general. The particular embryonic stem cell employed in
the present invention is not critical.
[0091] ES cells are preferably cultured on stromal cells, e.g., STO
cells and/or primary embryonic fibroblast cells as described by
Robertson, 1987, In "Teratocarcinomas and embryonic stem cells: a
practical approach", E. J. Robertson, ed. (Oxford: IRL Press), pp.
71-112. The stromal (and/or fibroblast) cells serve to reduce the
clonal outgrowth of abnormal ES cells.
[0092] ES cells harboring a mutant FHIT gene, such as a FHIT gene
comprising a substitution mutation resulting in an in-frame stop
codon, may be selected in several ways. First, a selectable marker
(e.g., neo, gpt, tk) may be linked to the heterologous FHIT gene
(e.g., in an intron or flanking sequence) in the targeting
construct so that cells having a replacement allele may be selected
for. Most usually, a FHIT gene targeting construct will comprise
both a positive selection expression cassette and a negative
selection expression cassette, so that homologously targeted cells
can be selected for with a positive-negative selection scheme.
(Mansour et al., 1988, Nature 336: 348). Generally, a positive
selection expression cassette is positioned in an intron region of
the heterologous FHIT gene replacement region, while a negative
selection expression cassette is positioned distal to a homology
clamp, such that double-crossover homologous recombination will
result in the integration of the positive selection cassette and
the loss of the negative selection cassette.
[0093] In other embodiments, introduction of the targeting
constructs is achieved by pronuclear injection. The preferred
precursor cell type for pronuclear injection is a fertilized
oocyte.
5.7 Targeting Constructs
[0094] Several gene targeting techniques have been described,
including but not limited to: co-electroporation, "hit-and-run",
single-crossover integration, and double-crossover recombination
(Bradley et al., 1992, Bio Technology 10: 534. The invention can be
practiced using essentially any applicable homologous gene
targeting strategy known in the art. The configuration of a
targeting construct depends upon the specific targeting technique
chosen. For example, a targeting construct for single-crossover
integration or "hit-and-run" targeting need only have a single
homology clamp linked to the targeting region, whereas a
double-crossover replacement-type targeting construct requires two
homology clamps, one flanking each side of the replacement
region.
[0095] For example and not limitation, a preferred embodiment is a
targeting construct comprising, in order: (1) a first homology
clamp having a sequence substantially identical to a sequence
within about 3 kilobases upstream (i.e., in the direction opposite
to the translational reading frame of the FHIT gene exons) of an
exon of an endogenous FHIT gene, (2) a replacement region
comprising a positive selection cassette having a pgk promoter
driving transcription of a neo gene, (3) a second homology clamp
having a sequence substantially identical to a sequence within
about 3 kilobases downstream of said exon of said endogenous FHIT
gene, and (4) a negative selection cassette, comprising a HSV tk
promoter driving transcription of an HSV tk gene. Such a targeting
construct is suitable for double-crossover replacement
recombination which deletes a portion of the endogenous FHIT locus
spanning said exon and replaces it with the replacement region
having the positive selection cassette. If the deleted exon is
essential for expression of a functional FHIT gene product, the
resultant exon-depleted allele is functionally disrupted and is
termed a null allele.
[0096] Targeting constructs of the invention comprise at least one
homology clamp linked in polynucleotide linkage (i.e., by
phosphodiester bonds) to a targeting region. A homology clamp has a
sequence which substantially corresponds to, or is substantially
complementary to, a predetermined endogenous FHIT gene sequence of
a nonhuman host animal, and may comprise sequences flanking the
predetermined FHIT gene.
[0097] Although no lower or upper size boundaries for
recombinogenic homology clamps for gene targeting have been
conclusively determined in the art, the best mode for homology
clamps is believed to be in the range between about 50 basepairs
and several tens of kilobases. Consequently, targeting constructs
are generally at least about 50 to 100 nucleotides long, preferably
at least about 250 to 500 nucleotides long, more preferably at
least about 1000 to 2000 nucleotides long, or longer. Construct
homology regions (homology clamps) are generally at least about 50
to 100 bases long, preferably at least about 100 to 500 bases long,
and more preferably at least about 750 to 2000 bases long. It is
believed that homology regions of about 7 to 8 kilobases in length
are preferred, with one preferred embodiment having a first
homology region of about 7 kilobases flanking one side of a
replacement region and a second homology region of about 1 kilobase
flanking the other side of said replacement region. The length of
homology (i.e., substantial identity) for a homology region may be
selected at the discretion of the practitioner on the basis of the
sequence composition and complexity of the predetermined endogenous
FHIT gene target sequence(s) and guidance provided in the art
(Hasty et al., 1991, Mol. Cell. Biol. 11: 5586; Shulman et al.,
1990, Mol. Cell. Biol. 10: 4466). Targeting constructs have at
least one homology region having a sequence that substantially
corresponds to, or is substantially complementary to, a
predetermined endogenous FHIT gene sequence (e.g., an exon
sequence, an enhancer, a promoter, an intronic sequence, or a
flanking sequence within about 3-20 kb of a FHIT gene), such as a
FHIT gene sequence. Such a targeting transgene homology region
serves as a template for homologous pairing and recombination with
substantially identical endogenous FHIT gene sequence(s). In
targeting constructs, such homology regions typically flank the
replacement region, which is a region of the targeting construct
that is to undergo replacement with the targeted endogenous FHIT
gene sequence (Berinstein et al., 1992, Mol. Cell. Biol. 12: 360,
which is incorporated herein by reference). Thus, a segment of the
targeting construct flanked by homology regions can replace a
segment of an endogenous FHIT gene sequence by double-crossover
homologous recombination. Homology regions and targeting regions
are linked together in conventional linear polynucleotide linkage
(5' to 3' phosphodiester backbone). Targeting constructs are
generally double-stranded DNA molecules, most usually linear.
[0098] Without wishing to be bound by any particular theory of
homologous recombination or gene conversion, it is believed that in
such a double-crossover replacement recombination, a first
homologous recombination (e.g., strand exchange, strand pairing,
strand scission, strand ligation) between a first targeting
construct homology region and a first endogenous FHIT gene sequence
is accompanied by a second homologous recombination between a
second targeting construct homology region and a second endogenous
FHIT gene sequence, thereby resulting in the portion of the
targeting construct that was located between the two homology
regions replacing the portion of the endogenous FHIT gene that was
located between the first and second endogenous FHIT gene
sequences. For this reason, homology regions are generally used in
the same orientation (i.e., the upstream direction is the same for
each homology region of a transgene to avoid rearrangements).
Double-crossover replacement recombination thus can be used to
delete a portion of an endogenous FHIT gene and concomitantly
transfer a nonhomologous portion (e.g., a neo gene expression
cassette) into the corresponding chromosomal location.
Double-crossover recombination can also be used to add a
nonhomologous portion into an endogenous FHIT gene without deleting
endogenous chromosomal portions. However, double-crossover
recombination can also be employed simply to delete a portion of an
endogenous gene sequence without transferring a nonhomologous
portion into the endogenous FHIT gene (see Jasin et al., 1988,
Genes Devel. 2:1353). Upstream and/or downstream from the
nonhomologous portion may be a gene which provides for
identification of whether a double-crossover homologous
recombination has occurred; such a gene is typically the HSV tk
gene which may be used for negative selection.
[0099] Typically, targeting constructs of the invention are used
for functionally disrupting endogenous FHIT genes and comprise at
least two homology regions separated by a nonhomologous sequence
which contains an expression cassette encoding a selectable marker,
such as neo (Smith and Berg, 1984, Cold Spring Harbor Symp. Quant.
Biol. 49: 171; Sedivy and Sharp, 1989, Proc. Natl. Acad. Sci.
(U.S.A.) 86: 227; Thomas and Capecchi, 1987, cell 51:503, which are
incorporated herein by reference). However, some targeting
transgenes of the invention may have the homology region(s)
flanking only one side of a nonhomologous sequence. Targeting
transgenes of the invention may also be of the type referred to in
the art as "hit-and-run" or "in-and-out" transgenes (Valancius and
Smithies, 1991, Mol. Cell. Biol. 11: 1402; Donehower et al. (1992)
Nature 356: 215; (1991) J. NIH Res. 3: 59; which are incorporated
herein by reference).
[0100] The positive selection expression cassette encodes a
selectable marker which affords a means for selecting cells which
have integrated targeting transgene sequences spanning the positive
selection expression cassette. The negative selection expression
cassette encodes a selectable marker which affords a means for
selecting cells which do not have an integrated copy of the
negative selection expression cassette. Thus, by a combination
positive-negative selection protocol, it is possible to select
cells that have undergone homologous replacement recombination and
incorporated the portion of the transgene between the homology
regions (i.e., the replacement region) into a chromosomal location
by selecting for the presence of the positive marker and for the
absence of the negative marker. Selectable markers typically are
also be used for hit-and-run targeting constructs and selection
schemes (Valancius and Smithies, 1991, Mol. Cell. Biol. 11:
1402.
[0101] An expression cassette typically comprises a promoter which
is operational in the targeted host cell (e.g., ES cell) linked to
a structural sequence that encodes a protein or polypeptide that
confers a selectable phenotype on the targeted host cell, and a
polyadenylation signal. A promoter included in an expression
cassette may be constitutive, cell type-specific, stage-specific,
and/or modulatable (e.g., by hormones such as glucocorticoids; MMTV
promoter), but is expressed prior to and/or during selection. An
expression cassette can optionally include one or more enhancers,
typically linked upstream of the promoter and within about 3-10
kilobases. However, when homologous recombination at the targeted
endogenous site(s) places the nonhomologous sequence downstream of
a functional endogenous promoter, it may be possible for the
targeting construct replacement region to comprise only a
structural sequence encoding the selectable marker, and rely upon
the endogenous promoter to drive transcription (Doetschman et al.,
1988, Proc. Natl. Acad. Sci. (U.S.A.) 85: 8583. Similarly, an
endogenous enhancer located near the targeted endogenous site may
be relied on to enhance transcription of transgene sequences in
enhancerless transgene constructs. Preferred expression cassettes
of the invention encode and express a selectable drug resistance
marker and/or a HSV thymidine kinase enzyme. Suitable drug
resistance genes include, for example: gpt (xanthine-guanine
phosphoribosyltransferase), which can be selected for with
mycophenolic acid; neo (neomycin phosphotransferase), which can be
selected for with G418 or hygromycin; and DFHR (dihydrofolate
reductase), which can be selected for with methotrexate (Mulligan
and Berg (1981) Proc. Natl. Acad. Sci. (U.S.A.) 78: 2072; Southern
and Berg (1982) J. Mol. Appl. Genet. 1: 327; which are incorporated
herein by reference).
[0102] Selection for correctly targeted recombinants will generally
employ at least positive selection, wherein a nonhomologous
expression cassette encodes and expresses a functional protein
(e.g., neo or gpt) that confers a selectable phenotype to targeted
cells harboring the endogenously integrated expression cassette, so
that, by addition of a selection agent (e.g., G418 or mycophenolic
acid) such targeted cells have a growth or survival advantage over
cells which do not have an integrated expression cassette.
[0103] It is preferable that selection for correctly targeted
homologous recombinants also employ negative selection, so that
cells bearing only nonhomologous integration of the transgene are
selected against. Typically, such negative selection employs an
expression cassette encoding the herpes simplex virus thymidine
kinase gene (HSV tk) positioned in the transgene so that it would
integrate only by nonhomologous recombination. Such positioning
generally is accomplished by linking the HSV tk expression cassette
(or other negative selection cassette) distal to the recombinogenic
homology regions so that double-crossover replacement recombination
of the homology regions transfers the positive selection expression
cassette to a chromosomal location but does not transfer the HSV tk
gene (or other negative selection cassette) to a chromosomal
location. A nucleoside analog, gancyclovir, which is preferentially
toxic to cells expressing HSV tk, can be used as the negative
selection agent, as it selects for cells which do not have an
integrated HSV tk expression cassette. FIAU may also be used as a
selective agent to select for cells lacking HSV tk.
[0104] In order to reduce the background of cells having
incorrectly integrated targeting construct sequences, a combination
positive-negative selection scheme can be used (Mansour et al.,
1988, Nature 366: 348. Positive-negative selection involves the use
of two active selection cassettes: (1) a positive one (e.g., the
neo gene), that can be stably expressed following either random
integration or homologous targeting, and (2) a negative one (e.g.,
the HSV tk gene), that can only be stably expressed following
random integration, and cannot be expressed after correctly
targeted double-crossover homologous recombination. By combining
both positive and negative selection steps, host cells having the
correctly targeted homologous recombination between the transgene
and the endogenous FHIT gene can be obtained.
[0105] Generally, targeting constructs of the invention preferably
include: (1) a positive selection expression cassette flanked by
two homology regions that are substantially identical to host cell
endogenous FHIT gene sequences, and (2) a distal negative selection
expression cassette. However, targeting constructs which include
only a positive selection expression cassette can also be used.
Typically, a targeting construct will contain a positive selection
expression cassette which includes a neo gene linked downstream
(i.e., towards the carboxy-terminus of the encoded polypeptide in
translational reading frame orientation) of a promoter such as the
HSV tk promoter or the pgk promoter. More typically, the targeting
transgene will also contain a negative selection expression
cassette which includes an HSV tk gene linked downstream of a HSV
tk promoter. For example, but not to limit the invention, a
schematic representation of a typical positive-negative FHIT
targeting construct of the invention is shown in FIG. 4.
[0106] It is preferred that targeting constructs of the invention
have homology regions that are highly homologous to the
predetermined target endogenous DNA sequence(s), preferably
isogenic (i.e., identical sequence). Isogenic or nearly isogenic
sequences may be obtained by genomic cloning or high-fidelity PCR
amplification of genomic DNA from the strain of nonhuman animals
which are the source of the ES cells used in the gene targeting
procedure. Typically, targeting polynucleotides of the invention
have at least one homology region that is at least about 50
nucleotides long, and it is preferable that homology regions are at
least about 75 to 100 nucleotides long, and more preferably at
least about 200-2000 nucleotides long, although the degree of
sequence homology between the homology region and the targeted
sequence and the base composition of the targeted sequence will
determine the optimal and minimal homology region lengths (e.g.,
G-C rich sequences are typically more thermodynamically stable and
will generally require shorter homology region length). Therefore,
both homology region length and the degree of sequence homology can
only be determined with reference to a particular predetermined
sequence, but homology regions generally must be at least about 50
nucleotides long and must also substantially correspond or be
substantially complementary to a predetermined endogenous target
sequence. Preferably, a homology region is at least about 100
nucleotides long and is identical to or complementary to a
predetermined target sequence in or flanking a FHIT gene. If it is
desired that correctly targeted homologous recombinants are
generated at high efficiency, it is preferable that at least one
homology region is isogenic (i.e., has exact sequence identity with
the crossover target sequence(s) of the endogenous FHIT gene), and
is more preferred that isogenic homology regions flank the
exogenous targeting construct sequence that is to replace the
targeted endogenous FHIT sequence.
[0107] Generally, any predetermined endogenous FHIT locus can be
altered by homologous recombination (which includes gene
conversion) with an targeting transgene that has at least one
homology region which substantially corresponds to or is
substantially complementary to a predetermined endogenous FHIT gene
locus sequence in a mammalian cell having said predetermined
endogenous FHIT gene sequence. Typically, a targeting transgene
comprises a portion having a sequence that is not present in the
preselected endogenous targeted FHIT sequence(s) (i.e., a
nonhomologous portion) which may be as small as a single mismatched
nucleotide or may span up to about several kilobases or more of
nonhomologous sequence. Generally, such nonhomologous portions are
flanked on each side by homology regions, although a single
flanking homology region may be used (e.g., in insertion
transgenes). Nonhomologous portions are used to make insertions,
deletions, and/or replacements in a predetermined endogenous
targeted FHIT gene sequence, and/or to make single or multiple
nucleotide substitutions in a predetermined endogenous target DNA
sequence so that the resultant recombined sequence (i.e., a
functionally disrupted endogenous FHIT gene) incorporates the
sequence information of the nonhomologous portion of the targeting
construct(s). Substitutions, additions, and deletions may be as
small as 1 nucleotide or may range up to about 2 to 10 kilobases or
more. A preferred nonhomologous portion of a targeting transgene is
a selectable drug resistance marker (e.g., the neo gene), which may
be transferred to a chromosomal location, stably replicated, and
selected for with a selection agent (e.g., G418). Targeting
transgenes can be used to inactivate one or more FHIT genes in a
cell, such as in a murine ES cell, and transgenic nonhuman animals
harboring such inactivated genes may be produced.
[0108] Once the specific FHIT gene(s) to be modified are selected,
their sequences will be scanned for possible disruption sites
(e.g., a segment of the murine FHIT gene spanning the second and
third exons). Plasmids are engineered to contain an appropriately
sized construct replacement sequence with a deletion or insertion
in the FHIT gene of interest and at least one flanking homology
region which substantially corresponds or is substantially
complementary to an endogenous target DNA sequence. Typically two
flanking homology regions are used, one on each side of the
replacement region sequence. For example, but not to limit the
invention, one homology region may be substantially identical to a
sequence upstream (i.e., the direction towards the transcription
start site(s) of the murine FHIT second exon and a second homology
region may be substantially identical to a sequence downstream of
the murine FHIT third exon. A preferred method of the invention is
to transfer a targeting transgene into a pluripotent stem cell line
which can be used to generate transgenic nonhuman animals following
injection into a host blastocyst. A particularly preferred
embodiment of the invention is a FHIT gene targeting construct
containing both positive (e.g., neo) and, optionally, negative
(e.g., HSV tk) selection expression cassettes. The FHIT targeting
transgene is transferred into mouse ES cells (e.g., by
electroporation) under conditions suitable for the continued
viability of the electroporated ES cells. The electroporated ES
cells are cultured under selective conditions for positive
selection (e.g., a selective concentration of G418), and optionally
are cultured under selective conditions for negative selection
(e.g., a selective concentration of gancyclovir or FIAU), either
simultaneously or sequentially. Selected cells are then verified as
having the correctly targeted transgene recombination by PCR
analysis according to standard PCR or Southern blotting methods
known in the art (U.S. Pat. No. 4,683,202; Erlich et al., 1991,
Science 252: 1643. Correctly targeted ES cells are then transferred
into suitable blastocyst hosts for generation of chimeric
transgenic animals according to methods known in the art (Capecchi,
M., 1989, Trends Genet. 5: 70.
[0109] Briefly, the invention involves the inactivation of an FHIT
gene, most usually a FHIT gene, by homologous recombination in a
pluripotent cell line that is capable of differentiating into germ
cell tissue. A DNA construct that contains an altered, copy of a
mouse FHIT gene (e.g., a FHIT gene) is introduced into the nuclei
of embryonic stem cells. In a portion of the cells, the introduced
DNA recombines with the endogenous copy of the mouse gene,
replacing it with the altered copy. Cells containing the newly
engineered genetic lesion are injected into a host mouse embryo,
which is reimplanted into a recipient female. Some of these embryos
develop into chimeric mice that possess germ cells derived from the
mutant cell line. Therefore, by breeding the chimeric mice it is
possible to obtain a new line of mice containing the introduced
genetic lesion (reviewed by Capecchi, M., 1989, Trends Genet. 5:
70.
[0110] To disrupt the murine FHIT gene, a targeting construct based
on the design employed by Jaenisch and co-workers (Zjilstra, et
al., 1989, Nature 342: 435-438 for the successful disruption of the
mouse .beta.2-microglobulin gene can be used. The neomycin
resistance gene (neo), from the plasmid pMCINEO is inserted into
the coding region of the target FHIT gene. The pMCIneo insert uses
a hybrid viral promoter/enhancer sequence to drive neo expression.
This promoter is active in embryonic stem cells. Therefore, neo can
be used as a selectable marker for integration of the targeting
construct. The HSV thymidine kinase (tk) gene is added to the end
of the construct as a negative selection marker against random
insertion events (Zjilstra et al., 1989, Nature 342: 435-438.
[0111] Vectors containing a targeting construct are typically grown
in E. coli and then isolated using standard molecular biology
methods, or may be synthesized as oligonucleotides. Direct targeted
inactivation which does not require prokaryotic or eukaryotic
vectors may also be done. Targeting transgenes can be transferred
to host cells by any suitable technique, including microinjection,
electroporation, lipofection, biolistics, calcium phosphate
precipitation, and viral-based vectors, among others. Other methods
used to transform mammalian cells include the use of Polybrene,
protoplast fusion, and others (see, generally, Sambrook et al.
Molecular Cloning: A Laboratory Manual, 2d ed., 1989, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0112] It is preferable to use a transfection technique with
linearized transgenes containing only modified target gene
sequence(s) and without vector sequences. The modified gene site is
such that a homologous recombinant between the exogenous targeting
construct and the endogenous DNA target sequence can be identified
by using carefully chosen primers and PCR or by Southern blot
analysis, followed by analysis to detect if PCR products or
Southern blot bands specific to the desired targeted event are
present (Erlich et al., 1991, Science 252: 1643. For example, as
described in Section 6.2 below and in FIG. 1, a targeted disruption
of the murine FHIT locus gives rise to an 8.7 kb BamH1 fragment, in
contrast with its 5 kb wild-type counterpart. Southern blot
analysis of genomic DNA digested with BamH1 can identify the
differences. In addition, as shown in FIG. 1, a targeted locus can
be identified by virtue of a change in size of a given PCR product
(for example, amplification of genomic DNA with primers F and R
produces fragments of different lengths in targeted and
non-targeted cells), or the production of a PCR product from the
genome of the targeted cell that is not amplifiable in non-targeted
cells (e.g., by amplification of genomic DNA with primers N and
R).
[0113] Several studies have already used PCR to successfully
identify the desired transfected cell lines (Zimmer and Gruss,
1989, Nature 338: 150; Mouellic et al., 1990, Proc. Natl. Acad.
Sci. (U.S.A.) 87: 4712; Shesely et al., 1991, Proc. Natl. Acad.
Sci. USA 88: 4294. This approach is very effective when the number
of cells receiving exogenous targeting transgene(s) is high (i.e.,
with electroporation or with liposomes) and the treated cell
populations are allowed to expand (Capecchi, 1989, Trends Genet.
5:70).
[0114] For making transgenic non-human animals (which include
homologously targeted non-human animals), embryonic stem cells (ES
cells) are preferred. Embryonic stem cells are manipulated
according to published procedures (Teratocarcinomas and Embryonic
Stem Cells: A Practical Approach, E. J. Robertson, ed., IRL Press,
Washington, D.C., 1987; Zjilstra et al., Nature 342: 435-438, 1989;
and Schwartzberg et al., 1989, Science 246: 799-803.
[0115] Wherein the transgenic nonhuman animal is a mouse, murine ES
cells are used, such as AB-1 line grown on mitotically inactive
SNL76/7 cell feeder layers (McMahon and Bradley, 1990, Cell
62:1073-1085). Other suitable ES lines include, but are not limited
to, the E14 line (Hooper et al., 1987, Nature 326: 292-295), the D3
line (Doetschman et al., 1985, J. Embryol. Exp. Morph. 87: 27-45),
and the CCE line (Robertson et al., 1986, Nature 323: 445-448). In
a preferred embodiment the ES cell line is RW4 (Gnome Systems).
[0116] The success of generating a mouse line from ES cells bearing
a specific targeted mutation depends on the pluripotence of the ES
cells (i.e., their ability, once injected into a host blastocyst,
to participate in embryogenesis and contribute to the germ cells of
the resulting animal). The blastocysts containing the injected ES
cells are allowed to develop in the uteri of pseudopregnant
nonhuman females and are born as chimeric mice. The resultant
transgenic mice are chimeric for cells having an inactivated
endogenous FHIT loci and are backcrossed and screened for the
presence of the correctly targeted transgene(s) by PCR or Southern
blot analysis on tail biopsy DNA of offspring so as to identify
transgenic mice heterozygous for the inactivated FHIT locus/loci.
By performing the appropriate crosses, it is possible to produce a
transgenic nonhuman animal homozygous for a disrupted FHIT locus.
Fhit-deficient animals may also be crossed to mice carrying other
mutations, such as Msh2-deficient mice (U.S. Pat. No.
5,907,079).
5.8 Generation of Fhit-Deficient Mice
[0117] Most usually, a targeting construct is transferred by
electroporation or microinjection into a totipotent embryonal stem
(ES) cell line, such as the murine RW4, AB-1 or CCE lines. The
targeting construct homologously recombines with endogenous
sequences in or flanking a FHIT gene locus and functionally
disrupts at least one allele of the FHIT gene. Typically,
homologous recombination of the targeting construct with endogenous
FHIT locus sequences results in integration of a nonhomologous
sequence encoding and expressing a selectable marker, such as neo,
usually in the form of a positive selection cassette (infra). The
functionally disrupted allele is termed a FHIT null allele. ES
cells having at least one FHIT null allele are selected for by
propagating the cells in a medium that permits the preferential
propagation of cells expressing the selectable marker. Selected ES
cells are examined by PCR analysis and/or Southern blot analysis to
verify the presence of a correctly targeted FHIT allele.
[0118] In order to obtain the FHIT deficient mice of the present
invention, the mutant embryonic stems cells are injected into mouse
blastocysts as described by Bradley, 1987, In "Teratocarcinomas and
embryonic stem cells: a practical approach", E. Robertson, ed.
(Oxford: IRL Press), pp. 113-151. The particular mouse blastocysts
employed in the present invention are not critical. Examples of
such blastocysts include those derived from C57BL6 mice,
C57BL6Albino, Swiss outbred, CFLP, MFI, and the like. Chimeric
targeted mice are derived according to Hogan, et al., Manipulating
the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor
Laboratory, 1988; and Teratocarcinomas and Embryonic Stem Cells: A
Practical Approach, E. J. Robertson, ed., IRL Press, Washington,
D.C., 1987.
[0119] Breeding of nonhuman animals which are heterozygous for a
null allele may be performed to produce nonhuman animals homozygous
for said null allele, so-called "knockout" animals (Donehower et
al., 1992, Nature 256: 215; Travis, 1992, Science 256: 1392.
Alternatively, ES cells homozygous for a null allele having an
integrated selectable marker can be produced in culture by
selection in a medium containing high levels of the selection agent
(e.g., G418 or hygromycin). Heterozygosity and/or homozygosity for
a correctly targeted null allele can be verified with PCR analysis
and/or Southern blot analysis of DNA isolated from an aliquot of a
selected ES cell clone and/or from tail biopsies.
[0120] In alternative embodiments, the targeting construct is
introduced into the germline of a nonhuman animal by other methods,
e.g., by pronuclear injection of recombinant genes into pronuclei
of one-cell embryos, incorporating an artificial yeast chromosome
into embryonic stem cells, gene targeting methods, embryonic stem
cell methodology. See, e.g., U.S. Pat. Nos. 4,736,866; 4,873,191;
4,873,316; 5,082,779; 5,304,489; 5,174,986; 5,175,384; 5,175,385;
5,221,778; Gordon et al., 1980, Proc. Natl. Acad. Sci.
77:7380-7384; Palmiter et al., 1985, Cell 41:343-345 (1985);
Palmiter et al., 1986, Ann. Rev. Genet, 20:465-499; Askew et al.,
1993, Mol. Cell. Bio., 13:4115-4124; Games et al., 1995, Nature,
373:523-527; Valancius and Smithies, 1991, Mol. Cell. Bio., 11:
1402-1408; Stacey et al., Mol. Cell. Bio., 1994, 14:1009-1016;
Hasty et al., 1995, Nature, 350:243-246; Rubinstein et al., 1993,
Nucl. Acid Res., 21:2613-2617.
[0121] The mutant mice of the present invention may be intercrossed
to obtain embryos homozygous for the mutation in the FHIT gene,
and/or may be crossed with other mice strains to transfer the Fhit
mutation into these other strains. In one embodiment, Fhit mutant
mice are crossed to MSH2 mutant mice.
5.9 Assaying FHIT Expression or Activity in Fhit-Deficient Mice
[0122] The extent of Fhit deficiency can easily be measured by
using standard molecular biology methods. For instance, one can
measure for a deficiency in FHIT messenger RNA levels by using
reverse transcriptase mediated polymerase chain reaction
(RT-PCR).
[0123] In other embodiments, the extent of Fhit deficiency in a
Fhit-deficient animal of the invention can be assayed by measuring
protein levels or activity by various methods. For example, in one
embodiment, protein extracts from Fhit-deficient cells and tissues
are assayed for their levels of FHIT protein by ability to various
immunoassays known in the art. Such immunoassays include but are
not limited to competitive and non-competitive assay systems using
techniques such as radioimmunoassays, ELISA (enzyme linked
immunosorbent assay), "sandwich" immunoassays, immunoradiometric
assays, gel diffusion precipitin reactions, immunodiffusion assays,
in situ immunoassays (using colloidal gold, enzyme or radioisotope
labels, for example), western blots, precipitation reactions,
agglutination assays (e.g., gel agglutination assays,
hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and
immunoelectrophoresis assays, etc. In one mode of the embodiment,
antibody binding is detected by detecting a label on the primary
antibody. In another mode of embodiment, the primary antibody is
detected by detecting binding of a secondary antibody or reagent to
the primary antibody. Optionally, the secondary antibody can be
labeled. Many means are known in the art for detecting binding in
an immunoassay and are within the scope of the present
invention.
[0124] For the purposes of the present invention, a cell or animal
that has been engineered to be FHIT deficient shall generally
express at least about 20 percent less FHIT than a corresponding
wild type cell or animal, and preferably at least about 50 percent
less FHIT than a corresponding wild type cells or animals. In other
embodiments, a cell or animal that is FHIT deficient expresses at
least about 90 percent less FHIT than a corresponding wild type
cell or animal, more preferably less than 1.0 percent of the FHIT
protein found in wild type cells or animals, and in a specifically
preferred embodiment the Fhit deficient cells or animals will
produce undetectable levels of full-length (wild type) FHIT
transcript.
5.10 Drug Screening Assays
[0125] As shown in section 6, infra, Fhit-deficient animals are
predisposed to developing diseases or disorders involving cell
overproliferation (e.g., malignancy). In particular, Fhit-deficient
mice developed sebaceous and visceral tumors reminiscent of those
seen in humans with Muir-Torre Syndrome. The mice are of use as
animal models of Muir-Torre Sybdrome e.g., to screen for or test
molecules (e.g., potential anti-cancer therapeutics) for the
ability to inhibit overproliferation (e.g., tumor formation) and
thus treat or prevent such diseases or disorders. Of particular
interest are screening assays for agents that have a low toxicity
for human cells.
[0126] A wide variety of assays may be used for this purpose, such
as those described below. Depending on the particular assay, whole
animals may be used, or cells derived therefrom. Cells may be
freshly isolated from an animal, or may be immortalized in culture.
Cells of particular interest include visceral and sebaceous tissues
of the transgenic animals of the invention, and cultures derived
therefrom.
[0127] The term "agent" as used herein describes any molecule, e.g.
protein or non-protein organic pharmaceutical, with the capability
of affecting any aspect of the biological actions of FHIT activity.
Generally a plurality of assay mixtures are run in parallel with
different agent concentrations to obtain a differential response to
the various concentrations. Typically, one of these concentrations
serves as a negative control, i.e. at zero concentration or below
the level of detection.
[0128] Candidate agents encompass numerous chemical classes, though
typically they are organic molecules, preferably small organic
compounds having a molecular weight of more than 50 and less than
about 2,500 daltons. Candidate agents comprise functional groups
necessary for structural interaction with proteins, particularly
hydrogen bonding, and typically include at least an amine,
carbonyl, hydroxyl or carboxyl group, preferably at least two of
the functional chemical groups. The candidate agents often comprise
cyclical carbon on heterocyclic structures and/or aromatic or
polyaromatic structures substituted with one or more of the above
functional groups. Candidate agents are also found among
biomolecules including, but not limited to: peptides, saccharides,
fatty acids, steroids, purines, pyrimidines, derivatives,
structural analogs or combinations thereof.
[0129] Candidate agents are obtained from a wide variety of sources
including libraries of synthetic or natural compounds. For example,
numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including
expression of randomized oligonucleotides and oligopeptides.
Alternatively, libraries of natural compounds in the form of
bacterial, fungal, plant and animal extracts are available or
readily produced. Additionally, natural or synthetically produced
libraries and compounds are readily modified through conventional
chemical, physical and biochemical means, and may be used to
produce combinatorial libraries. Known pharmacological agents may
be subjected to directed or random chemical modifications, such as
acylation, alkylation, esterification, amidification, etc. to
produce structural analogs. New potential therapeutic agents may
also be created using methods such as rational drug design or
computer modelling.
[0130] Screening may be directed to known pharmacologically active
compounds and chemical analogs thereof, or to new agents with
unknown properties such as those created through rational drug
design. Candidate agents for arresting and/or reversing tumor
growth may be used.
[0131] Where the screening assay is a binding assay, one or more of
the molecules may be joined to a label, where the label can
directly or indirectly provide a detectable signal. Various labels
include radioisotopes, fluorescers, chemiluminescers, enzymes,
specific binding molecules, particles, e.g. magnetic particles, and
the like. Specific binding molecules include pairs, such as biotin
and streptavidin, digoxin and antidigoxin etc. For the specific
binding members, the complementary member would normally be labeled
with a molecule that provides for detection, in accordance with
known procedures.
[0132] A variety of other reagents may be included in the screening
assay. These include reagents like salts, neutral proteins, e.g.
albumin, detergents, etc that are used to facilitate optimal
protein-protein binding and/or reduce non-specific or background
interactions. Reagents that improve the efficiency of the assay,
such as protease inhibitors, nuclease inhibitors, anti-microbial
agents, etc. may be used. The mixture of components are added in
any order that provides for the requisite binding. Incubations are
performed at any suitable temperature, typically between 4 and
40.degree. C. Incubation periods are selected for optimum activity,
but may also be optimized to facilitate rapid high-throughput
screening. Typically between 0.1 and 1 hours will be
sufficient.
[0133] The insoluble supports may be any compositions to which
polypeptides can be bound, which is readily separated from soluble
material, and which is otherwise compatible with the overall
method. The surface of such supports may be solid or porous and of
any convenient shape. Examples, of suitable insoluble supports to
which the receptor is bound include beads, e.g. magnetic beads,
membranes and microtiter plates. These are typically made of glass,
plastic (e.g. polystyrene), polysaccharides, nylon or
nitrocellulose. Microtiter plates are especially convenient because
a large number of assays can be carried out simultaneously, using
small amounts of reagents and samples.
[0134] A number of assays are known in the art for determining the
effects of a test molecule on cancer cells. Such assays may use
cells of a cancer cell line, e.g., a cell line derived from a Fhit
mutant mouse. Many assays well-known in the art can be used to
assess such survival and/or growth; for example, cell proliferation
can be assayed by measuring (.sup.3H)-thymidine incorporation, by
direct cell count, by detecting changes in transcription,
translation or activity of known genes such as proto-oncogenes
(e.g., fos, myc) or cell cycle markers (Rb, cdc2, cyclin A, D1, D2,
D3, E, etc): The levels of such protein and mRNA and activity can
be determined by any method well known in the art. For example,
protein can be quantitated by known immunodiagnostic methods such
as Western blotting or immunoprecipitation using commercially
available antibodies (for example, many cell cycle marker
antibodies are from Santa Cruz Inc.). mRNA can be quantitated by
methods that are well known and routine in the art, for example by
Northern analysis, RNase protection, the polymerase chain reaction
in connection with the reverse transcription, etc. Cell viability
can be assessed by using trypan-blue staining or other cell death
or viability markers known in the art. Differentiation can be
assessed visually based on changes in morphology, etc.
[0135] The present invention provides methods for screening for
inhibitors of the proliferation Fhit mutant cells by a variety of
techniques known in the art, including but not limited to the
following methods of measuring cellular prolifeation:
[0136] As one example, bromodeoxyuridine (BRDU) incorporation may
be used as an assay to identify proliferating cells. The BRDU assay
identifies a cell population undergoing DNA synthesis by
incorporation of BRDU into newly synthesized DNA. Newly synthesized
DNA may then be detected using an anti-BRDU antibody (see Hoshino
et al., 1986, Int. J. Cancer 38, 369; Campana et al., 1988, J.
Immunol. Meth. 107, 79).
[0137] Cell proliferation may also be examined using
(.sup.3H)-thymidine incorporation (see e.g., Chen, J., 1996,
Oncogene 13:1395-403; Jeoung, J., 1995, J. Biol. Chem.
270:18367-73). This assay allows for quantitative characterization
of S-phase DNA synthesis. In this assay, cells synthesizing DNA
will incorporate (.sup.3H)-thymidine into newly synthesized DNA.
Incorporation may then be measured by standard techniques in the
art such as by counting of radioisotope in a Scintillation counter
(e.g. Beckman LS 3800 Liquid Scintillation Counter).
[0138] Detection of proliferating cell nuclear antigen (PCNA) may
also be used to measure cell proliferation. PCNA is a 36 kilodalton
protein whose expression is elevated in proliferating cells,
particularly in early G1 and S phases of the cell cycle and
therefore may serve as a marker for proliferating cells. Positive
cells are identified by immunostaining using an anti-PCNA antibody
(see Li et al., 1996, Curr. Biol. 6:189-199; Vassilev et al., 1995,
J. Cell Sci. 108:1205-15).
[0139] Cell proliferation may be measured by counting samples of a
cell population over time (e.g. daily cell counts). Cells may be
counted using a hemacytometer and light microscopy (e.g. HyLite
hemacytometer, Hausser Scientific). Cell number may be plotted
against time in order to obtain a growth curve for the population
of interest. In a preferred embodiment, cells counted by this
method are first mixed with the dye Trypan-blue (Sigma), such that
living cells exclude the dye, and are counted as viable members of
the population.
[0140] DNA content and/or mitotic index of the cells may be
measured, for example, based on the DNA ploidy value of the cell.
For example, cells in the G1 phase of the cell cycle generally
contain a 2N DNA ploidy value. Cells in which DNA has been
replicated but have not progressed through mitosis (e.g. cells in
S-phase) will exhibit a ploidy value higher than 2N and up to 4N
DNA content. Ploidy value and cell-cycle kinetics may be further
measured using propidum iodide assay (see e.g. Turner, T., et al.,
1998, Prostate 34:175-81). Alternatively, the DNA ploidy may be
determined by quantitation of DNA Feulgen staining (which binds to
DNA in a stoichiometric manner) on a computerized
microdensitometrystaining system (see e.g., Bacus, S., 1989, Am. J.
Pathol. 135:783-92). In an another embodiment, DNA content may be
analyzed by preparation of a chromosomal spread (Zabalou, S., 1994,
Hereditas. 120:127-40; Pardue, 1994, Meth. Cell Biol.
44:333-351).
[0141] The expression of cell-cycle proteins (e.g., CycA. CycB,
CycE, CycD, cdc2, Cdk4/6, Rb, p21, p27, etc.) provide crucial
information relating to the proliferative state of a cell or
population of cells. For example, identification in an
anti-proliferation signaling pathway may be indicated by the
induction of p21.sup.cip1. Increased levels of p21 expression in
cells results in delayed entry into G1 of the cell cycle (Harper et
al., 1993, Cell 75:805-816; Li et al., 1996, Curr. Biol.
6:189-199). p21 induction may be identified by immunostaining using
a specific anti-p21 antibody available commercially (e.g. Santa
Cruz). Similarly, cell-cycle proteins may be examined by Western
blot analysis using commercially available antibodies. In another
embodiment, cell populations are synchronized prior to detection of
a cell cycle protein. Cell cycle proteins may also be detected by
FACS (fluorescence-activated cell sorter) analysis using antibodies
against the protein of interest.
[0142] Detection of changes in length of the cell cycle or speed of
cell cycle may also be used to measure inhibition of Fhit mutant
cell proliferation by test molecules. In one embodiment the length
of the cell cycle is determined by the doubling time of a
population of cells (e.g., using cells contacted or not contacted
with one or more test compounds). In another embodiment, FACS
analysis is used to analyze the phase of cell cycle progression, or
purify G1, S, and G2/M fractions (see e.g., Delia, D. et al., 1997,
Oncogene 14:2137-47).
[0143] Lapse of cell cycle checkpoint(s), and/or induction of cell
cycle checkpoint(s), may be examined by the methods described
herein, or by any method known in the art. Without limitation, a
cell cycle checkpoint is a mechanism which ensures that a certain
cellular events occur in a particular order. Checkpoint genes are
defined by mutations that allow late events to occur without prior
completion of an early event (Weinert, T., and Hartwell, L., 1993,
Genetics, 134:63-80). Induction or inhibition of cell cycle
checkpoint genes may be assayed, for example, by Western blot
analysis, or by immunostaining, etc. Lapse of cell cycle
checkpoints may be further assessed by the progression of a cell
through the checkpoint without prior occurrence of specific events
(e.g. progression into mitosis without complete replication of the
genomic DNA).
[0144] In addition to the effects of expression of a particular
cell cycle protein, activity and post-translational modifications
of proteins involved in the cell cycle can play an integral role in
the regulation and proliferative state of a cell. The invention
provides for assays involved detected post-translational
modifications (e.g. phosphorylation) by any method known in the
art. For example, antibodies that detect phosphorylated tyrosine
residues are commercially available, and may be used in Western
blot analysis to detect proteins with such modifications. In
another example, modifications such as myristylation, may be
detected on thin layer chromatography or reverse phase h.p.l.c.
(see e.g. Glover, C., 1988, Biochem. J. 250:485-91; Paige, L.,
1988, Biochem J.; 250:485-91).
[0145] Activity of signaling and cell cycle proteins and/or protein
complexes is often mediated by a kinase activity. The present
invention provides for analysis of kinase activity by assays such
as the histone HI assay (see e.g., Delia, D. et al., 1997, Oncogene
14:2137-47).
[0146] To test the ability of a test compound to inhibit tumor
development in Fhit deficient cells, the compound can also be
demonstrated to inhibit cell transformation (or progression to
malignant phenotype) in vitro. In this embodiment Fhit deficient
cells with a transformed cell phenotype are contacted with one or
more test compounds, and examined for change in characteristics
associated with a transformed phenotype (a set of in vitro
characteristics associated with a tumorigenic ability in vivo), for
example, but not limited to, colony formation in soft agar, a more
rounded cell morphology, looser substratum attachment, loss of
contact inhibition, loss of anchorage dependence, release of
proteases such as plasminogen activator, increased sugar transport,
decreased serum requirement, or expression of fetal antigens, etc.
(see Luria et al., 1978, General Virology, 3d Ed., John Wiley &
Sons, New York, pp. 436-446).
[0147] Loss of invasiveness or increased adhesion may also be used
to demonstrate the anti-cancer effects of a test compound on Fhit
deficient cells. For example, a critical aspect of the formation of
a metastatic cancer is the ability of a precancerous or cancerous
cell to detach from primary site of disease and establish a novel
colony of growth at a secondary site. The ability of a cell to
invade peripheral sites is reflective of a potential for a
cancerous state. Loss of invasiveness may be measured by a variety
of techniques known in the art including, for example, induction of
E-cadherin-mediated cell-cell adhesion. Such E-cadherin-mediated
adhesion can result in phenotypic reversion and loss of
invasiveness (Hordijk et al., 1997, Science 278:1464-66).
[0148] Loss of invasiveness may further be examined by inhibition
of cell migration. A variety of 2-dimensional and 3-dimensional
cellular matrices are commercially available
(Calbiochem-Novabiochem Corp. San Diego, Calif.). Cell migration
across or into a matrix may be examined by microscopy, time-lapsed
photography or videography, or by any method in the art allowing
measurement of cellular migration. In a related embodiment, loss of
invasiveness is examined by response to hepatocyte growth factor
(HGF). HGF-induced cell scattering is correlated with invasiveness
of cells such as Madin-Darby canine kidney (MDCK) cells and may be
used to test the invasiveness of other neoplastic cell types. This
assay identifies a cell population that has lost cell scattering
activity in response to HGF (Hordijk et al., 1997, Science
278:1464-66).
[0149] Alternatively, loss of invasiveness may be measured by cell
migration through a chemotaxis chamber (Neuroprobe/Precision
Biochemicals Inc. Vancouver, BC). In such assay, a chemo-attractant
agent is incubated on one side of the chamber (e.g., the bottom
chamber) and cells are plated on a filter separating the opposite
side (e.g., the top chamber). In order for cells to pass from the
top chamber to the bottom chamber, the cells must actively migrate
through small pores in the filter. Checkerboard analysis of the
number of cells that have migrated may then be correlated with
invasiveness (see e.g., Ohnishi, T., 1993, Biochem. Biophys. Res.
Commun. 193:518-25).
[0150] For example, lead compound identified by the in vitro
screening methods described herein can be administered to a Fhit
deficient or null mouse and the mouse subsequently examined for a
decreased incidence of visceral and/or sebaceous tumor formation in
comparison with controls not administered the lead compound.
Alternatively, lead compound can be administered to a Fhit
deficient or null mouse that has developed tumors and subsequently
examining the tumors in the mouse for tumor regression in
comparison to controls not administered the lead compound.
[0151] Lead compounds can then be demonstrated to inhibit tumor
formation in vivo.
[0152] Preferably, the screen will include control values (e.g.,
the incidence of tumors in the test animal or the rate of
proliferation in culture and cancerous cells derived from the test
animal in the absence of test compound(s)). Test substances which
are considered positive, i.e., inhibit tumor growth in vivo or cell
proliferation in vitro, are likely to be beneficial in the
treatment of Muir-Torre associated cancers, and will be considered
useful lead candidates for drug development.
5.11 Carcinogenicity Testing
[0153] The transgenic animals of the present invention and cells
cultured therefrom can be used to assay the carcinogenicity of a
test agent according to standard methods known in the art. Such
methods include but are not limited the method described in Section
6.1, infra, and those described in DiPaolo et al., 1969, J. Natl.
Cancer Inst. 42:867; Reznikoff, et al., 1973, Cancer Res. 33:3231;
Kakunaga, 1973, Intl. J. Cancer, 12:463; U.S. Pat. No. 4,753,874;
U.S. Pat. No. 5,273,880; U.S. Pat. No. 4,885,238; U.S. Pat. No.
4,302,535; U.S. Pat. No. 5,506,131; U.S. Pat. No. 5,429,948; and
U.S. Pat. No. 5,180,666. The agent suspected to be a carcinogen may
be a molecule, for example a chemical carcinogen, ionizing
radiation, or an electromagnetic field. The carcinogen may also be
capable of inducing free radical formation.
[0154] In a specific embodiment, assaying the carcinogenicity of a
test molecule is done according to the methods of U.S. Pat. No.
6,020,146, which discloses an in vitro method comprising exposing a
cell sample to a test molecule for a period of time up to about
seven days, agglomerating the cell sample, administrating a
halogenated deoxyuridine analog (which is incorporated by cells
transformed by a carcinogen and is not incorporated by
untransformed spheroid cells) and a thymidilate synthetase
inhibitor to the agglomerated cell sample, and dispersing the
agglomerated cell sample on a growth surface of a culture vessel.
The cell sample is then contacted with an antibody which
specifically binds to the halogenated deoxyuridine and the amount
of antibody binding is detected and quantitated by standard
immunoassay. A test compound is said to be a carcinogen if the
amount of halogenated deoxyuridine is at least twice as much in
cells contacted with the test molecule as cells not contacted with
the test molecule.
[0155] In another specific embodiment, the carcinogenicity of a
test molecule is correlated with the level of tyrosylphosphorylated
cyclin dependent kinase (CDK), such as p34.sup.cdc2, according to
the method of U.S. Pat. No. 5,955,289.
[0156] In yet another specific embodiment, tissue-specific
carcinogenicity (e.g. carcinogenicity towards sebaceous tissue
versus hepatic tissue) of a test compound is measured, for example
as described in U.S. Pat. No. 5,925,524.
[0157] Optionally, a test molecule is incubated with liver extracts
prior to its exposure to the Fhit-deficient animal or cell, in
order to test the molecule as may be chemically altered by the
liver (Ames et al., 1975, Mut. Res. 31:347-364).
[0158] For whole-animal testing, the test compound suspected of
having carcinogenic activity is introduced into the animal by any
suitable method, including but not limited to injection, or
ingestion or topical administration.
[0159] Alternative embodiments for implementing the methods and
producing the cells and animals of the present invention will be
apparent to one of skill in the art and are intended to be
comprehended within the accompanying claims. The following
experimental examples are offered by way of illustration and not by
way of limitation.
6. EXAMPLES
6.1 Materials and Methods
Immunoblot Analysis of Murine Fhit Protein
[0160] A glutathione S-transferase (GST) gene-fused murine FHIT
cDNA recombinant was cloned into a bacterial expression vector. In
the resulting construct, pGEX4T 1-mFhit, the murine Fhit protein
coding sequence was placed downstream of the GST gene. GST-mFhit
fusion protein was produced in the BL21 bacterial strain (Druck et
al., 1977, Cancer Res. 57:504-512), and after purification
GST-mFhit was cleaved with thrombin protease. Polyclonal antiserum
against purified mouse Fhit protein was raised commercially
(Cocalico Biologicals, Reamstown, Pa.) and used at 1:8000 dilution
in immunoblot and 1:4000 in immunohistochemistry experiments.
Specificity was tested on protein lysates from murine cells and
tissues with and without endogenous or exogenous Fhit protein
expression.
Immunohistochemistry
[0161] After antigen retrieval endogenous peroxidase was inhibited
with 3% hydrogen peroxide, and nonspecific binding sites were
blocked with normal goat serum (Fong et al., 1997, Carcinogenesis
18:1477-1484). Slides were incubated with primary rabbit
anti-murine Fhit (1:4000 dilution, overnight), followed by
incubation with biotinylated goat anti-rabbit antibody. Slides were
then incubated with strepavidin horseradish peroxidase (Dako,
1:1000 dilution). Fhit protein was localized by a final incubation
with 3,3'-diaminobenzidine tetrahydrochloride (DAB, Sigma). Slides
were counterstained with hematoxylin, dehydrated and
coverslipped.
Carcinogenicity Study
[0162] (C57BL/6J X 129/SvJ) F1 mice (B6129F1s) that were Fhit +/+
or +/- were produced. 18 Fhit +/+ and 22 Fhit +/- mice (30-46
weeks) were given 8 intragastric doses of NMBA (Ash Stevens,
Detroit, Mich.) over the course of 3 weeks at 2 mg/kg body weight.
About half the mice were sacrificed six weeks after the final NMBA
dose and the remaining mice at ten weeks. Tumor incidence
differences were analyzed by two-tailed Fisher's exact test
(Armitage and Berry, 1987, Statistical Methods in Medical Research,
2.sup.nd Ed., Blackwell Scientific, Oxford). For comparison, four
untreated Fhit +/- mice (54-59 weeks old) and one untreated Fhit
+/+ mouse (59 weeks old) were similarly autopsied. At autopsy,
whole esophagi and stomachs were removed and opened longitudinally.
Other tissues with apparent tumors were also examined. The number
of animals bearing tumors in the esophagus, forestomach,
squamocolumnar junction with the glandular stomach (SCJ) and other
tissues were scored. Tissues were fixed in buffered formalin and
examined histologically after hematoxylin and eosin (H&E)
staining for the presence of hyperkeratosis, parakeratosis,
dysplasia, papillomas, adenomas and carcinomas.
MTS Cases
[0163] Archival paraffin blocks for two cases of MTS were available
from the Surgical Pathology archives of Thomas Jefferson University
Hospital (case 1) and the Christiana Hospital (case 2). For case 1,
paraffin blocks for two sebaceous tumors were available, and for
case 2 one sebaceous tumor block. Normal and tumor cells were
microdissected from the paraffin blocks and DNA prepared. Tissue
sections were analysed for Fhit expression by immunohistochemistry
as described (Hadaczek et al., 1998, Cancer Res. 58:2946-2951).
Germline DNA was prepared from peripheral blood lymphocytes of the
MTS patients.
Microsatellite Instability Analysis (MSI)
[0164] Portions of the large sebaceous tumors were lysed in buffer
containing 0.6% SDS and 50 .mu.g/ml proteinase K and tumor DNAs
prepared by standard phenol-chloroform extraction and ethanol
precipitation. MSI was assayed by PCR amplification with primers
for D1Mit4, D2Mit13, D3Mit1, D3Mit203, D6Mit59, D8Mit14, D10Mit2,
D14Nds1, D17Mit123 and D19Mit36 for murine alleles (Reitmair et
al., 1996, Cancer Res. 56:3842-3849) and primers D2S123, D3S1298,
D18S35, BAT25 and BAT26.(Kruse et al., 1998, Am. J. Hum. Genet.
63:63-70; Bocker et al., 1997, Cancer Res. 57:4739-4743) for human
alleles were purchased from Research Genetics or the Kimmel Cancer
Center Nucleic Acid Facility at Thomas Jefferson University.
Samples were amplified in a reaction mixture containing 50 ng
template DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.11 mg/ml
gelatin, 1.5 mM MgCl.sub.2, 12.5 .mu.M each dNTP, 0.5 units Taq
polymerase, 20 ng primers and 1 .mu.Ci [.sup.32p] dCTP, for 30
cycles of 94.degree. C. for 30 s, 57.degree. C. for 30 s and
72.degree. C. for 30 s. PCR product (1 ml) was mixed with 9 ml
sequencing stop buffer (95% formamide, 0.05% bromphenol blue, 0.05%
xylene cyanol FF and 10 mM NaOH) and denatured at 94.degree. C. for
8 min. Seven .mu.l of this mixture was loaded onto a 6% acrylamide:
bis (19:1), 8 M urea gel for electrophoresis at 80 watts for 2-3 h.
The gel was dried and exposed to X-ray film overnight.
Fhit Sequence Analysis
[0165] Primer pairs flanking each of the human FHIT exons (Druck et
al., 1977, Cancer Res. 57:504-512) and the mouse FHIT coding exons
were used in PCR amplification of DNA from MTS cases or mouse
tumors, respectively. Primer pairs surrounding the mouse FHIT exons
were previously published (Pekarsky et al., 1998, Cancer Res.
58:3401-3408) for exons 5 and 6 or newly designed for exon 4
(mfiex4F: GTGTTCTTCACAGTTACG (SEQ. ID. NO.: 4),); mfiex4R:
CAATTCTATACATTCTTTGC (SEQ. ID. NO.: 5), exon 7 (mfiex7F:
GGCCTGCTGGATAATTCATA (SEQ. ID. NO.: 6), mfiex7R:
AGATAACATAATGAAAGAGC (SEQ. ID. NO.: 7)), exon 8 (mfiex8F:
CACTGTCAAGTCAAAATATAG (SEQ. ID. NO.: 8), mfiex8R(2):
GGCCTTGTGACTAAATAATAA (SEQ. ID. NO.: 9)), and exon 9 (mfiex9F:
CTCTCTCCTCCAATGTTAT (SEQ. ID. NO.: 10), mfiex9R: AAGGTTAGCAGAAAGAGG
(SEQ. ID. NO.: 11)). The products were purified with a PCR
purification kit (Qiagen) before sequencing using Taq DyeDeoxy
Terminator Cycle Sequencing Kits (ABI). Sequencing reaction
products were electrophoresed and recorded on a 377 DNA sequencer
(ABI).
Southern Blot Analysis
[0166] To examine the integrity of the murine Fhit alleles in
tumors, DNA from several sebaceous tumors was digested with
restriction enzyme XbaI, electrophoresed on 0.8% agarose gels and
transferred to nylon membranes. After drying, membrane-bound DNAs
were hybridized to .sup.32P-labeled full-length murine Fhit cDNA or
to exons 1-4, 4-10 or 7-9, to determine if portions of Fhit alleles
were deleted. Densitometry analysis of specific lanes of Southern
blot autoradiographs was performed. Quantitation of signals was
performed using ImageQuant software (Molecular Dynamics, Inc.
Sunnyvale, Calif.).
6.2 Results
Production of Fhit.sup.tm2KCC Mice
[0167] A 129/SvJ mouse genomic fragment encompassing Fhit exon 5
was cloned and a termination codon introduced into the exon 5
coding region. Exon 5 is the first protein coding exon, so that the
termination codon prevents translation of a protein. There are no
downstream Met codons that can initiate translation of a stable
protein (Huebner et al., 1998, Ann. Rev. Genet. 32:7-31). This
altered genomic clone was inserted into a derivative of the Mc1-TK
vector along with the PGK Neo bpa gene (FIG. 1). RW4 ES cells
(Genome Systems) were transfected with this Fhit targeting vector
and ES cell clones selected with the vector integrated through
homologous recombination into an endogenous Fhit allele (FIG. 1).
The targeted ES cell clones were introduced into 3.5 day
blastocysts to generate chimeras. Each of the chimeras transmitted
the defective Fhit allele to offspring, as determined by Southern
blot analysis of tail DNA from agouti pups. Progeny from one
chimera (+/Fhit.sup.tm2KCC referred to as Fhit +/- mice) were
intercrossed and genotyping revealed that all three genotypes were
represented, with a ratio close to the expected Mendelian
distribution
[0168] Disruption of the Fhit locus in the knockout mice was
further verified by PCR analysis, as illustrated in FIG. 1. Results
from Southern and PCR analysis confirmed that the Fhit -/- mice do
not carry a wild-type Fhit locus. PCR analysis was used in routine
typing of pups from the intercross.
[0169] To confirm absence of a functional Fhit gene in Fhit -/-
mice, weanling mice were sacrified and organs removed for
assessment of Fhit protein expression by immunoblot analysis and
immunohistochemistry. Immunoblot analysis showed that Fhit -/-
mouse tissues were entirely negative for Fhit protein (FIG. 2);
immunohistochemical detection of Fhit protein in Fhit +/+, +/- and
-/- kidney sections showed absence of Fhit protein in Fhit -/-
sections and reduced expression in Fhit +/- sections.
NMBA Induction of Tumors
[0170] At six weeks after the final NMBA dose, there was no visible
difference in the Fhit +/+ and +/- mice. By ten weeks after the
final dose, three of the Fhit +/- mice showed tumors in the
subcutis of the abdomen. On autopsy at 10 weeks, more than 50% of
the Fhit +/+ mice exhibited one or more of these tumors in the
abdominal, mammary or axial area, sometimes invading muscle tissue;
the tumors varied in color from yellow to white. The tumors were
removed for fixation prior to examination of the
esophagus/forestomach. Extragastric tumors were not observed in the
Fhit +/+ mice.
[0171] On inspection of whole esophagus and stomach tissues at six
weeks after treatment, seven of ten Fhit +/- mice showed one or
more small tumors, while two of ten Fhit +/+ mice showed a very
small tumor of the esophagus or forestomach. At ten weeks, eleven
of twelve Fhit +/- mice showed apparent tumors, usually multiple,
in the forestomach, the squamocolumnar junction with the hind
stomach and/or in other tissues (Table 1); two of eight Fhit +/+
mice exhibited tumors.
[0172] An untreated Fhit +/+ mouse (59 weeks) showed no
abnormalities of skin, esophagus, forestomach, or junction. Other
internal organs appeared normal. Three of four untreated Fhit +/-
mice (54-59 wks) showed a small abdominal tumor in the skin and one
Fhit +/- mouse showed a slightly enlarged spleen. Otherwise, the
four +/- and one +/+ untreated animals were normal and healthy.
Histological and Immunohistochemical Analyses
[0173] Esophageal tumors were not observed on autopsy, but
histological examination revealed an esophageal squamous papilloma
in 1/10 Fhit +/+ mice at six weeks after NMBA and in Fhit +/- mice
33 and 36 at ten weeks post NMBA (Table 1). At six weeks post NMBA
treatment Fhit +/- mice had more tumors than Fhit +/+ mice (70% vs
20%; summarized in Table 2). At ten weeks post NMBA treatment the
difference between tumor burden in Fhit +/- mice (100%) compared to
+/+ mice (25%) was highly significant (Tables 1 and 2). Most of the
tumors were in the forestomach and squamocolumnar junction with the
glandular stomach, as observed previously in B6 mice (Fong and
Magee, 1999, Cancer Letters 143:63-69). Histological examination of
the abdominal tumors of the Fhit +/- mice showed that they derived
from sebaceous glands (Table 1, FIG. 3) and were identical to the
sebaceous tumors that are the hallmark of Muir-Torre Syndrome
(MTS), a variant of hereditary nonpolyposis colorectal cancer
(HNPCC) syndrome. A small sebaceous tumor was observed in three of
four untreated Fhit +/+ mice, implying that very small sebaceous
tumors occur spontaneously at a frequency similar to that of
sebaceous tumors in the NMBA treated mice. Other tissues of the
untreated mice were normal, including the esophagus, forestomach
and squamocolumnar junction with the glandular stomach.
[0174] Sections from the fixed tissues were analysed by
immunohistochemical detection of Fhit protein expression, to
determine if the remaining Fhit allele had been inactivated in
tumors. Epithelial cells lining the esophagus, forestomach and
junction with the glandular stomach were positive for Fhit
expression. In the esophagus, the basal epithelial cells stain less
strongly than the overlying squamous cells (see FIG. 3A). All of
the squamous papillomas and other tumors were Fhit negative, as
illustrated in the examples shown in FIG. 3, B-F. Note especially
the lack of Fhit expression in the sebaceous tumors shown in FIG.
3, E and F.
[0175] To compare the mouse sebaceous tumors to sebaceous tumors
from Muir-Torre Syndrome cases, sebaceous tumor sections from two
Muir-Torre Syndrome cases were analysed for expression of human
Fhit. Fhit protein was detected in normal human hair follicle and
sebaceous gland (FIGS. 4A and B) from the Muir-Torre Syndrome tumor
sections. Fhit protein was not expressed in two human sebaceous
tumors from case 1 (see FIG. 4D for example) but was expressed in
the sebaceous tumor from case 2.
6.3 Genotypic Analysis
Murine Tissues
[0176] DNA was prepared from tail biopsies, as well as portions of
the larger tumors of Fhit +/+ and +/- mice, in order to examine the
integrity of the Fhit loci in tumors. To determine if the wild-type
Fhit allele was deleted or rearranged in tumors, the DNA was typed
for the presence of wild-type or targeted Fhit alleles by PCR
amplification and both exon 5 alleles were detected. Tail and tumor
DNAs were also digested with restriction enzymes and typed for
presence of wild-type or altered Fhit alleles by Southern blot. The
results shown in FIG. 5 reveal the presence of both wild-type and
targeted Fhit exons 5 in tumors 21, 27 and 31 (FIG. 5, lanes 1, 3,
4). At least one copy of all other Fhit exons is retained in the
tumors (compare lanes 1 and 2). Additional analyses of BamHI or
XbaI digested tumor DNAs hybridized to probes for mouse exons 1-4,
7-9, and 4-10 did not reveal rearrangements or homozygous deletions
of Fhit loci, although hemizygous deletions could not be ruled out.
For example, densitometry analysis to compare intensity of bands
for specific Fhit exons in lanes 1, 2 and 3 of FIG. 5 showed that
the signal for exon 1 in lane 1 (tumor from mouse 21) was half as
strong as the signal for exon 1 in lanes 2 and 3 relative to other
exons. The signal for exon 5 in lanes 1 and 3 (tumor from mouse 21
and 27) is split into two bands, one near the top and one at the
bottom of the lanes, representing the wild-type and mutant exons 5,
respectively.
[0177] The Fhit protein is inactivated in all the NMBA-induced
tumors through alteration of wild-type Fhit alleles within the
mouse fragile site. To determine if NMBA had induced mutations in
the wild-type Fhit allele, DNA from sebaceous tumors from mice 21,
27 and 31 and from squamous papillomas in mice 25 and 27 were also
examined for mutations within Fhit exons 4 through 9. Primers
flanking exons were used to amplify and sequence exons 4 through 9
in these tumors. No mutations were detected.
[0178] Human MTS syndrome is usually, if not always, caused by
inactivation of mismatch repair genes and Muir-Torre syndrome
tumors usually exhibit microsatellite instability (MSI). Tail and
tumor DNAs were used as templates in PCR amplifications of ten
microsatellite loci in a search for microsatellite instability.
Results for three of these loci are shown in FIG. 6. Microsatellite
instability was not observed at any of the mouse loci tested,
demonstrating that the mouse MTS-like disease does not have an
underlying mismatch repair defect.
Human Tissues
[0179] Not all Muir-Torre Syndrome cases have been shown to exhibit
germline mutations of MSH2 or MLH1, nor do all Muir-Torre Syndrome
tumors exhibit microsatellite instability, the hallmark of mismatch
repair deficiency. It is possible that some Muir-Torre Syndrome
cases with Fhit negative tumors are caused by germline mutation in
the FHIT gene. The Muir-Torre Syndrome cases used in this study
were analyzed for the presence of wild-type germline FHIT alleles.
Restriction enzyme digestion of germline DNA from the two
Muir-Torre Syndrome cases did not reveal alterations of the FHIT
locus. Each FHIT exon was amplified from the two Muir-Torre
Syndrome cases and the products sequenced. All germline FHIT exons
from both cases showed wild-type sequences.
[0180] The majority of Muir-Torre Syndrome cases are due to
germline mutations of the mismatch repair gene MSH2. Thus,
Muir-Torre Syndrome tumors would be expected to show microsatellite
instability. DNA from the two Fhit negative sebaceous tumors of
Muir-Torre Syndrome case 1 and the Fhit positive tumor from case 2
did exhibit microsatellite instability with several of the five
markers tested (for examples, see FIG. 6, lower panel).
TABLE-US-00001 TABLE 1 Tumor induction in Fhit +/+ and +/- mice at
10 weeks after NMBA treatment Phenotype Mouse #, Age body Fore
Genotype (wks) wt. (g) Esoph. stomach SCJ Subcutis Comments (by
histology) ++ 40M 46 13 - sm. T - - adenoma 37F 39 12 - - - - 35F
39 11 - - - - 29M 39 14 - - thick - 25F 39 14 - - 7T.sub.+3 mm - sq
papillomas 24F 38 16 thick thick - - papillary hyperplasia,
esophagus 22M 34 13 - - - - 23M 30 14 - - - - +/- 41M 46 13 - 2T
few T - sq. carcinoma forestomach, sq. pap. SCJ 39M 46 12 - + few T
- sq. pap. forestomach, Barretts-like gastric mucosa SCJ 38M 46 14
- few sm. T - - sq. pap. and adenoma forestomach 31M 39 14 -
multiple T - T.sub.+8 .times. 6 sq. pap. and sq. carcinoma
forestomach 36F 39 14 + multiple T multiple T T sq. pap. esoph,
forestomach, SCJ 30M 39 12 - + - - sq. pap. forestomach 34M 38 18 -
- - T.sub.+9 .times. 5 sebaceous adnexal tumor 33M 38 18 + multiple
T - T.sub.+7 .times. 6 sq. pap. esoph and forestomach, seb. tumor
32m 38 16 - T - T.sub.+5 .times. 6 sq. pap. forestomach, sebaceous
tumor 28M 38 13 - - few T - sq. pap. 27M 38 14 - T.4 .times. 4 few
T 2T.sub.+7 .times. 5.sub.+2 .times. 3 hyperplastic gastric mucosa,
SCJ sq. pap. seb. tumor 21M 34 12 - T.2-3 mm - T.sub.+7 .times. 4
forestomach sq. papillomas; sebaceous tumor T. tumors. Some tumors
were photographed, measaurd or samples taken for DNA for LOH
analysis. 92% of +/- animals and 25% of +/+ animals showed evidence
of tumorigenesis by visual inspection. Average age of +/+ group 38
weeks, average age of +/- group 39.9 weeks; body wt. column shows
amount of wt. change during the experiment. sq. squamous; pap,
papilloma; seb, sebaceous; SCJ, squamocolumar junction; esoph,
esophagus. Untreated mice were examined for comparison. One
untreated Fhit +/+ mouse showed no age matched abnormalities. three
of four untreated fhit +/- mice showed an abdominal skin tumor and
a second Fhit +/- mouse had an enlarged spleen.
[0181] TABLE-US-00002 TABLE 2 Incidence of tumors induced by
multiple low NMBA doses in Fhit +/+ and +/- mice Fraction of tumor
bearing animals Tumor Bearing Week post-treatment Fhit Esoph.sup.a
Fore stomach.sup.a SCJ.sup.a Sebaceous.sup.a Mice.sup.a 6 wk ++
1/10 1/10 0/10 ND 2/10 6 wk +/- .sup. 0/10.sup.b 5/10 4/10 ND 7/10
Fisher's exact test, P = 1.0 P = 0.14 P = 0.09 p = 0.07 2-tailed 10
wk +/+ 0/8 1/8 1/8 0/8 2/8 10 wk +/- 2/12 10/12 5/12 7/12 12/12
Fisher's exact test, P = 0.49 P = .005 P = 0.32 P = 0.015 P =
0.0007 2-tailed .sup.anumber of mice with tumors/respective number
of mice. .sup.b1 esophagus showed dysplasia. The tumors of six
weeks were mainly squamous papillomas. The tumors at ten weeks in
the +/- mice were mostly squamous papillomas but two Fhit +/- mice
had squamous carcinomas of the forestomach or junction; one Fhit
+/+ and one +/- mouse at ten weeks showed a small adenoma of the
forestomach. ND, non detected.
6.4 Discussion
The Fhit +/- Phenotype
[0182] The present invention relates to the inactivation of one
Fhit allele in mice. Inactivation of one Fhit allele causes a tumor
phenotype; this tumor phenotype is further influenced by carcinogen
treatment. Observation of sebaceous tumors in 3 of 4 untreated Fhit
+/- mice by one year of age revealed that inactivation of one Fhit
allele in mice results in a tumor phenotype, although the full
spectrum of tumors that will develop spontaneously in Fhit +/- and
Fhit -/- mice is not yet known. 100% of NMBA treated Fhit +/- mice
exhibited tumors compared to 25% of the treated Fhit +/+ mice, a
highly significant difference, and none of the +/+ mice developed
sebaceous tumors. Thus, absence of one Fhit allele caused
susceptibility to sebaceous tumors and carcinogen induction of
gastric tumors. As shown in Table 1, 5 of 12 Fhit +/- mice (under 1
yr. of age) showed large (>5.times.5 mm) sebaceous tumors, 3 of
which were noted before autopsy. Sebaceous tumors have not been
observed in untreated mice except by autopsy, which revealed small
subcutaneous tumors (<2.times.2 mm) in 3 of 4 mice over 1 yr.
old.
[0183] The tumors in both mouse strains do not express Fhit
protein. NMBA treatment resulted in inactivation of both fragile
Fhit alleles in the Fhit +/+ mice. It was necessary to inactivate
only one Fhit allele in the +/- mice, thereby enhancing the
frequency of tumor development, analogous to the 2-hits vs 1-hit
required in human sporadic versus familial cancers. Because the
only genetic difference between the Fhit +/+ and +/- mice is the
targeted Fhit allele in the +/- mice, the second Fhit allele acts
as the gatekeeper in tumor development, although the carcinogen has
undoubtedly caused mutations of other suppressor genes in tumors of
both mouse strains. Because Fhit +1- and -/- mice are fertile,
long-lived and sensitive to carcinogen they will serve as useful
models for carcinogen-induction of tumors of various organs.
The Role of NMBA
[0184] Although carcinogen treatment increases the frequency of
occurrence of tumors in Fhit +/- mice, spontaneous tumors do occur.
The carcinogen NMBA produces a disease in Fhit haploinsufficient
mice that is similar to the Muir-Torre syndrome in humans. The
carcinogen fulfills a role similar to the role of mismatch repair
deficiency in human Muir-Torre Syndrome cases--both carcinogen and
mismatch repair deficiency increase the frequency of alteration of
the fragile Fhit locus, allowing selective growth of Fhit negative
tumors. In the presence of the O6-meG mispairs, the Msh2-Msh6
complexes delay the already late replicating Fhit locus, so that
replication is still incomplete in G2/M, leading to deletions in
the fragile Fhit locus.
[0185] The organ specificity of NMBA is due to the presence of
esophageal cytochrome P450 enzymes which bioactivate the carcinogen
(Labuc and Archer, 1982, Cancer Res. 42:3181-3186). Although the
N-7 position of guanine in DNA is the major site of alkylation,
methylation at the 0-6 position is more relevant for the biological
activity (Fong et al., 1979, Int. J. Cancer 23:679-682), because
the O-6-methylguanine adduct is associated with base mispairing and
mutagenesis. As discussed above, Fhit +/- mice develop sebaceous
tumors spontaneously, although the sebaceous tumors in the NMBA
treated Fhit +/- mice were larger and more numerous. The affect of
NMBA treatment on the development or progression of the sebaceous
tumors will require further study.
Muir-Torre Syndrome
[0186] Muir described the coexistence of one or more sebaceous
tumors with one or more visceral carcinomas; since then more than
150 cases have been reported (Kruse et al., 1998, Am. J. Hum.
Genet. 63:63-70). Muir-Torre Syndrome is familial (Lynch et al.,
1981, Arch. Intern. Med. 141:607-611) and has been found in
families with hereditary nonpolyposis colorectal carcinoma (HNPCC)
(Lynch et al., 1993, Gastroenterology 104:1535-1549). The most
frequently observed internal neoplasm is colorectal carcinoma;
thus, the syndrome shares clinical and pathological characteristics
with hereditary nonpolyposis colorectal carcinoma. A large subgroup
of Muir-Torre Syndrome cases exhibit microsatellite instability and
germline mutations in MSH2 or MLH1 genes (Kruse et al., 1998, Am.
J. Hum. Genet. 63:63-70). The Fhit deficient mouse tumors do not
show microsatellite instability and loss of Fhit expression plays a
role in their MTS-like disease; thus it is unlikely that the mouse
syndrome involves mismatch repair deficiency.
[0187] In the mouse tumors the second Fhit allele was inactivated
through deletion of one or more exons. This loss of Fhit protein
resulted in a loss of a gatekeeper role, thereby resulting in tumor
formation. It is known from studies of the human FHIT locus that
biallelic deletions are observed and characterized by scanning the
.about.1.5 Mb locus by PCR-amplification using primer pairs spaced
at 10-50 kb pair intervals. In the case of the mouse tumors,
partial deletion of only the wild-type allele is necessary because
the mutant allele is inactive. This type of deletion is difficult
to observe in DNA from small tumors with noncancerous cells
intermixed.
[0188] For a sebaceous tumor from Fhit +/- mouse 21, the exon 1
signal was diminished by half on Southern blot, implying the
absence of one Fhit exon 1 from the wild-type allele. This is
consistent with a shift in the epicenter of mouse Fhit fragility
toward the 5' end of the gene (Glover et al., 1998, Cancer Res.
58:3409-3414) rather than being centered between exons 3 and 6 as
in the human FRA3B (Huebner et al., 1998, Ann. Rev. Genet.
32:7-31).
[0189] If human and mouse Muir-Torre Syndrome cases arise through
similar mechanisms, then the FHIT gene may be a target of damage in
a fraction of mismatch repair deficient tumors, especially those
with MSH2 deficiency, leading to Fhit protein loss and clonal
expansion of Fhit negative cells. If Fhit inactivation is a
frequent result of mismatch repair deficiency, and a frequent
pathway to Muir-Torre Syndrome, then Fhit +/- mice will be
predisposed to Muir-Torre Syndrome. The frequency of inactivation
of the FHIT gene in human mismatch repair deficiency syndromes
would be determined by examination of colon and other tumors with
microsatellite instability for Fhit protein expression.
Interestingly, Msh2 (Reitmair et al., 1996, Cancer Res.
56:3842-3849) and Msh6 (Edelmann et al., 1997, Cell 91:467-477)
null mice exhibit sebaceous tumors at a low frequency, implying
that crossing Fhit deficient mice with Msh2 deficient mice would
lead to increased frequency of sebaceous and other tumors, compared
to the spontaneous tumor frequency of either parental mouse
strain.
[0190] Msh2 has been shown to form a complex with Msh3 or Msh6,
these complexes have different mispair recognition specificities.
The Msh2-Msh6 complex functions in repair of single base mispairs
and small insertion/deletion mispairs. De Wind, et al. (1995) has
reported that Msh2 mediates the toxicity of methylating agents,
such as NMBA, and is required to suppress homologous recombination
between slightly diverged DNA sequences. The types of chromosomal
rearrangements observed in the human FHIT locus in cancer cells
most often involves homologous recombination between slightly
diverged sequences (Inoue, et al., 1997; Mimori, et al., 1999).
Therefore, the absence of Msh2 in tumors will lead to increased
chromosomal rearrangement at the FRA3B/FHIT fragile locus and
result in loss of Fhit protein. In fact, it was previously observed
that two of three human pancreatic cancer cell lines with high
microsatellite instability had homozygous deletions within
FHIT(Hilgers and Kern, 1999, Genes Chrom. Cancer 26:1-12).
Transgenic Mice as a Model for Muir-Torre Syndrome
[0191] The development of transgenic animals has provided
biological and medical scientists with models that are useful in
the study of disease. These animals are useful in testing
pharmaceutical agents for utility in treating the disease, as well
as in testing compounds that might cause or promote the development
of the disease. In addition, transgenic animals are sources of
cells, either tumor cells or non-tumor cells, for tissue culture
that are useful in studying causes of a particular disease.
[0192] The present invention is not to be limited in scope by the
specific embodiments described herein. Indeed, various
modifications of the invention in addition to those described
herein will become apparent to those skilled in the art from the
foregoing description and accompanying figures. Such modifications
are intended to fall within the scope of the appended claims.
[0193] Various publications, including patents and scientific
literature, are cited herein, the disclosures of which are
incorporated by reference in their entireties for all purposes.
Sequence CWU 1
1
11 1 27 DNA Artificial Sequence Primer 1 cttgaatcta ggctgcattc
tagcgag 27 2 27 DNA Artificial Sequence Primer 2 gattccttgc
ttaccttttg gggatgg 27 3 22 DNA Artificial Sequence Primer 3
tgggctctat ggcttctgag gc 22 4 18 DNA Artificial Sequence Primer 4
gtgttcttca cagttacg 18 5 20 DNA Artificial Sequence Primer 5
caattctata cattctttgc 20 6 20 DNA Artificial Sequence Primer 6
ggcctgctgg ataattcata 20 7 20 DNA Artificial Sequence Primer 7
agataacata atgaaagagc 20 8 21 DNA Artificial Sequence Primer 8
cactgtcaag tcaaaatata g 21 9 21 DNA Artificial Sequence Primer 9
ggccttgtga ctaaataata a 21 10 19 DNA Artificial Sequence Primer 10
ctctctcctc caatgttat 19 11 18 DNA Artificial Sequence Primer 11
aaggttagca gaaagagg 18
* * * * *