U.S. patent application number 11/201774 was filed with the patent office on 2006-04-06 for neisseria meningitidis serogroup a capsular polysaccharide acetyltransferase, methods and compositions.
Invention is credited to Russell W. Carlson, Anup K. Datta, Seshu K. Gudlavalleti, David S. Stephens, Yih-Ling Tzeng.
Application Number | 20060073168 11/201774 |
Document ID | / |
Family ID | 36125819 |
Filed Date | 2006-04-06 |
United States Patent
Application |
20060073168 |
Kind Code |
A1 |
Stephens; David S. ; et
al. |
April 6, 2006 |
Neisseria meningitidis serogroup a capsular polysaccharide
acetyltransferase, methods and compositions
Abstract
Provided are recombinant DNA molecules that do not occur in
nature encoding an O-acetyltransferase, vectors that direct
expression of an O-acetyltransferase, recombinant host cells which
express an O-acetyltransferase, methods for recombinant production
of an O-acetyltransferase, methods for acetylating capsular
polysaccharides, especially those of a Serogroup A Neisseria
meningitidis using a recombinant O-acetyltransferase, and
immunogenic compositions comprising the acetylated capsular
polysaccharide.
Inventors: |
Stephens; David S.; (Stone
Mountain, GA) ; Gudlavalleti; Seshu K.; (Atlanta,
GA) ; Tzeng; Yih-Ling; (Atlanta, GA) ; Datta;
Anup K.; (La Jolla, CA) ; Carlson; Russell W.;
(Athens, GA) |
Correspondence
Address: |
GREENLEE WINNER AND SULLIVAN P C
4875 PEARL EAST CIRCLE
SUITE 200
BOULDER
CO
80301
US
|
Family ID: |
36125819 |
Appl. No.: |
11/201774 |
Filed: |
August 11, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60600862 |
Aug 11, 2004 |
|
|
|
Current U.S.
Class: |
424/249.1 ;
435/101; 435/193; 435/252.3; 435/471; 435/69.1; 536/23.2 |
Current CPC
Class: |
A61K 39/00 20130101;
C12P 19/44 20130101; A61P 31/04 20180101; A61K 39/095 20130101;
C12N 9/1029 20130101 |
Class at
Publication: |
424/249.1 ;
435/069.1; 435/252.3; 435/193; 435/471; 536/023.2; 435/101 |
International
Class: |
A61K 39/095 20060101
A61K039/095; C07H 21/04 20060101 C07H021/04; C12P 21/06 20060101
C12P021/06; C12N 9/10 20060101 C12N009/10; C12N 15/74 20060101
C12N015/74; C12P 19/04 20060101 C12P019/04; C12N 1/21 20060101
C12N001/21 |
Goverment Interests
ACKNOWLEDGMENT OF FEDERAL RESEARCH SUPPORT
[0002] This invention was made, at least in part, with funding from
the National Institutes of Health (Grant No. AI40247) and the
Department of Energy (Grant No. DE-FG02-93ER20097). Accordingly,
the United States Government has certain rights in this invention.
Claims
1. A DNA molecule comprising a Serogroup A Neisseria meningitidis
O-acetyltransferase coding sequence and transcriptional control
sequences with which said O-acetyltransferase coding sequence is
not associated in nature, said coding sequence and said
transcriptional control sequences being operably linked.
2. The DNA molecule of claim 1, wherein said O-acetyltransferase
consists of the amino acid sequence of SEQ ID NO:2.
3. The DNA molecule of claim 2, wherein said O-acetyltransferase
coding sequence is as given in SEQ ID NO:1.
4. The DNA molecule of claim 1, further comprising a sequence
encoding an affinity tag and fused in frame selected from the group
consisting of a streptavidin tag, a flagellar antigen epitope tag,
a polyhistidine tag, a glutathione-S-transferase tag or a
calmodulin tag or a streptactin tag.
5. The DNA molecule of claim 1, further comprising vector sequences
functional in a bacterial cell.
6. The DNA molecule of claim 5, wherein the vector sequences are
functional in Escherichia coli.
7. A bacterial host cell in which the DNA molecule of claim 1 is
stably maintained.
8. A method for recombinantly producing an O-acetyltransferase
comprising the step of culturing the bacterial host cell of claim 6
under conditions such that the O-acetyltransferase is
expressed.
9. The method of claim 7 further comprising recovering the
O-acetyltransferase.
10. A method for acetylating Serogroup A capsular polysaccharide
prepared from Neisseria meningitidis, said method comprising the
step of contacting an isolated capsular polysaccharide with the
O-acetyltransferase produced by the method of claim 9.
11. An improved immunogenic composition comprising an acetylated
capsular polysaccharide of Neisseria meningitidis, wherein the
improvement comprises acetylation of the capsular polysaccharide
according to the method of claim 10.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional
Application No. 60/600,862, filed Aug. 11, 2004, which application
is incorporated by reference herein.
BACKGROUND OF THE INVENTION
[0003] The field of this invention is the area of molecular
biology, in particular as related to recombinant expression of an
acetyltransferase of Serogroup A Neisseria meningitidis, and
immunogenic compositions, especially immunogenic compositions
comprising fully acetylated capsule of Neisseria meningitidis,
Serogroup A.
[0004] Neisseria meningitidis is a leading worldwide cause of
meningitis and rapidly fatal sepsis in otherwise health individuals
(Apicella, M. A. (1995) in Principles and Practice of Infectious
Diseases, eds. Mandell, G. L., Douglas, R. G., and Bennett, J. E.,
Churchill Livingstone, New York, pp. 1896-1909). In excess of
350,000 cases of meningococcal disease were estimated to have
occurred in 1995 (WHO Report (1996) WHO, Geneva, ISBN 92 4
1561823). The problem of meningococcal disease is emphasized by the
recurrence of major epidemics due to serogroups A, B, and C N.
meningitidis over the last 20 years, such as: the devastating
serogroup A outbreak in sub-Saharan Africa in 1996 (WHO (1996)
Meningitis in Africa. The constant challenge of epidemics. WHO
21:15 March); the recent dramatic increases in the incidence of
serogroup B and C meningococcal disease in parts of North America
(CDC (1995) MMWR 44:121-134; Jackson, L. A. et al. (1995) JAMA
273:390-394; Wahlen, C. M. et al. (1995) JAMA 273:383-389); and the
emergence in Europe and elsewhere of meningococci with decreased
susceptibility to antibiotics (Campos, J. et al. (1992) J. Infect.
Dis. 166:173-177).
[0005] Differences in capsular polysaccharide chemical structure
determine the meningococcal serogroups (Liu, T. Y. et al. (1971) J.
Biol. Chem. 246:2849-58; Liu, T. Y. et al. (1971) J. Biol. Chem.
246:4703-12). Meningococci of serogroups B, C, Y, and W-135 express
capsules composed entirely of polysialic acid or sialic acid linked
to glucose or galactose (Liu, T. Y. et al. (1971) J. Biol. Chem.
246:4703-12; Bhattacharjee, A. K. et al. (1976) Can. J. Biochem.
54:1-8), while the capsule of group A N. meningitidis is composed
of N-acetyl mannosamine-1-phosphate (Liu, T. Y. et al. (1971) J.
Biol. Chem. 246:2849-58). The currently available capsular
polysaccharide vaccines for serogroups A, C, Y, or W-135 N.
meningitidis are effective for control of meningococcal outbreaks
in older children and adults. However, because of poor
immunogenicity in young children and short-lived immunity
(Zollinger, W. D. and Moran, E. (1991) Trans. R. Soc. Trop. Med.
Hyg. 85:37-43), these vaccines are not routinely used for long-term
prevention of meningococcal disease.
[0006] In some epidemic settings, simultaneous or closely-linked
meningococcal outbreaks have occurred in the same population due to
different serogroups (Sacchi, C. T. et al. (1994) J. Clin.
Microbiol. 32:1783-1787; CDC (1995) MMWR 44:121-134; Krizova, P.
and Musilek, M. (1994) Centr. Eur. J. PubL Hlth 3:189-194).
Further, Caugant et al., (Caugant, D. A. et al. (1986) Proc. Natl.
Acad. Sci. USA 83:4927-4931; Caugant, D. A. et al. (1987) J.
Bacteriol. 169:2781-2792) and others have noted that meningococcal
isolates of different serogroups may be members of the same enzyme
type (ET)-5, ET-37 or ET-4 clonal complexes.
[0007] Neisseria meningitidis serogroup A is responsible for the
massive epidemics of meningococcal meningitis and septicemia that
periodically affect sub-Saharan Africa, China, South America and
other parts of the world. The serogroup A capsular polysaccharide
(CPS) that confers serogroup specificity is composed of repeating
units of (.alpha.1.fwdarw.6) linked
N-acetyl-D-mannosamine-1-phosphate that is O-acetylated (1).
Although there is evidence of other glycosidic linkages (2), the
principal linkage between monomer ManNAc residues in this
polysaccharide is the (.alpha.1.fwdarw.6) phosphodiester bond
involving the hemiacetal group of carbon 1 and the alcohol group of
carbon 6 of the mannosamine residues. Serogroup A CPS is
structurally distinct from other disease-causing meningococcal
serogroups B, C, Y and W-135 which are composed of, or contain
sialic acid (1,3,4).
[0008] There is a long felt need in the art for improved
immunogenic compositions useful for generating a protective immune
response to Neisseria meningitidis, which is highly contagious and
causes serious illness.
SUMMARY OF THE INVENTION
[0009] The present invention provides recombinant DNA molecules
which do not occur in nature, recombinant host cells and methods of
using the foregoing to recombinantly produce an O-acetyltransferase
derived from Neisseria meningitidis. This acetyltransferase
transfers acetyl moieties to capsular polysaccharides, especially
those of Serogroup A N. meningitidis. The acetyltransferase of the
present invention can be purified using specific antibody in an
immunoaffinity column, for example, or an affinity tag can be
engineered into the recombinant protein by the use of appropriate
tag (especially a polyhistidine or His tag) coding sequences fused
in frame. Other oligopeptide "tags" which can be fused to a protein
of interest by such techniques include, without limitation,
strep-tag (Sigma-Genosys, The Woodlands, TX) which directs binding
to streptavidin or its derivative streptactin (Sigma-Genosys); a
glutathione-S-transferase gene fusion system which directs binding
to glutathione coupled to a solid support (Amersham Pharmacia
Biotech, Uppsala, Sweden); a calmodulin-binding peptide fusion
system which allows purification using a calmodulin resin
(Stratagene, La Jolla, Calif.); a maltose binding protein fusion
system allowing binding to an amylose resin (New England Biolabs,
Beverly, Mass.); and an oligo-histidine fusion peptide system which
allows purification using a Ni.sup.2+-NTA column (Qiagen, Valencia,
Calif.).
[0010] The present invention further encompasses the acetylation
(in vitro) of Serogroup A capsular polysaccharides isolated from N.
meningitidis using acetyltransferase recombinantly produced using
the recombinant host cells of the present invention.
[0011] The present invention also provides for improved immunogenic
compositions comprising capsular polysaccharides of N.
meningitidis, where the improvement comprises more complete
acetylation of the capsular polysaccharides than is currently
possible in the absence of the enzymatic acetylation by using the
acetyltransferase of the present invention, especially those from
Serogroup A N. meningitidis, with the result that a stronger immune
response results. The immunogenic compositions of the present
invention can comprise a pharmaceutically acceptable carrier and
optionally can further comprise at least one immunological adjuvant
or cytokine. These immunogenic compositions are useful as vaccines
and as vaccine components. Desirably, the CPS is 90-95% acetylated
for eliciting a robust immune response
DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1 shows the genetic organization and location of the
Neisseria meningitidis serogroup A capsule biosynthetic locus
mynA-mynD (sacA-sacD), and the sites of polar (.gradient.) and
nonpolar (.diamond.) mutations in these genes. ctrA is the first
gene of the capsule transport operon and galE encodes the
UDP-glucose-4-epimerase.
[0013] FIG. 2A-2C provide .sup.1H NMR spectra of capsular
polysaccharides (CPSs) purified from the wild type serogroup A
meningococcal strain F8229 (FIG. 2A) the mynC::aphA-3 mutant (FIG.
2B) and the mynC::aphA-3 mutant complemented with pGS205 (mynC),
with IPTG induction (FIG. 2C). Insets are the enlargements of the
N/O-Ac methyl proton regions.
[0014] FIG. 3 demonstrates over-expression and purification of MynC
of serogroup A N. meningitidis. Lane 1, molecular weight marker; 2,
cell lysate before IPTG induction; 3, cell lysate after IPTG
induction; 4, cell lysate on the nickel-nitrilotriacetic acid
(Ni-NTA) column 5, flow through of the Ni-NTA column; 6, wash 1; 7,
wash 2; 8, wash 3; 9, elution using 250 mM imidazole containing
buffer. Arrow indicates the .about.26 kDa His tagged MynC
protein.
[0015] FIG. 4 is an autoradiogram showing the in vitro
O-acetyltransferase activity of MynC. .sup.14C-labeled acetyl
coenzyme A and meningococcal CPSs were the substrates. Lanes (1)
sample buffer alone, lanes 24 reactions from various acceptor
polymers plus 5 .mu.g MynC (2) serogroup B CPS, (3) serogroup C
CPS, (4) CPS of the serogroup A wild type strain F8229, (5) and (6)
partially purified CPS of F8229/mynC::aphA-3 mutant at 5 and 10
.mu.g MynC respectively, (7) and (8) Sephacryl 200 gel filtration
column purified CPS of F8229/mynC::aphA-3 mutant with 5 and 10
.mu.g MynC respectively, (9) column purified CPS of
F8229/mynC::aphA-3 mutant with proteins eluted from a lysate of the
E. coli strain carrying the pET20b vector without insert, and (10)
column purified CPS of the F8229/mynC::aphA-3 mutant alone. Each
reaction was performed with 50 .mu.g of CPS and 10 .mu.g of MynC,
and analyzed as described in experimental procedures.
[0016] FIGS. 5A-5C characterize O-acetyltransferase activity of
purified MynC as measured by .sup.14C incorporation. FIG. 5A
demonstrates concentration-dependent incorporation of the
.sup.14C-labeled acetyl moiety by MynC into the mynC:: aphA-3 CPS.
FIG. 5B shows time kinetics of the incorporation of the
.sup.14C-labeled acetyl moiety into the mynC:: aphA-3 CPS by MynC.
FIG. 5C shows the pH optima of MynC activity in citrate (4.5 to
6.5), phosphate (5.8 to 8) and borate (8.5 to 10.5) buffers.
[0017] FIG. 6A shows whole cell ELISA with mAb 14-1-A. 1, wild type
parent F8229; 2, unencapsulated strain F8239; 3, mynC::aphA-3
nonpolar mutant; 4, mynC::aphA-3 nonpolar mutant complemented with
pGS205 (mynC) in the absence of IPTG induction; and 5 mynC::aphA-3
nonpolar mutant complemented with pGS205 (mynC) in the presence of
IPTG induction. FIG. 6B illustrates Western blot analysis with
whole cell lysates demonstrating the His-tagged MynC in the
presence (+) or absence (-) of IPTG. Lanes 1, M.W. marker (32.3
KDa); 2, wild type strain F8229; 3 and 4, overexpressed wild type
strain NmAwtc1; 5 and 6, complemented nonpolar mutant NmAnpc1.
[0018] FIG. 7A shows the cellular localization of MynC. Western
blot analysis of sub-cellular fractions of mynC complemented strain
NmAnpc1 using (His).sub.5 mAb. The loadings of individual fractions
were standardized based on a set amount of cells obtained from 500
ml culture. FIG. 7B demonstrates peripheral and strong membrane
association of MynC. Total membrane obtained from NmAnpc1 cells was
extracted with buffer alone, 1 M NaCl, 6M urea or buffer with 1%
TX-100 as described in the Materials and Methods. After
centrifugation, soluble fraction (S) were concentrated by
precipitation with trichloroacetic acid, pellets (P) were
resuspended directly in sample buffer. Fractions were subjected to
10% SDS-PAGE gels and analyzed by western blots using
(His).sub.5-specific mAb.
[0019] FIGS. 8A and 8B show the coding and amino acid sequences for
the N. meningitidis mynC, respectively. See also SEQ ID NO:1 and
SEQ ID NO:2, respectively.
[0020] FIG. 9 shows the results of a normal human serum (10% v/v)
bactericidal activity assay with the OAc+/CAP+N. meningitidis
wild-type parent F8229 (lane 1), the serogroup A CAP- strain F8239
(lane 2), the CAP- mutants of strain F8229 (mynA, lane 3; mynB,
lane 4) and the OAc-/CAP+ mynC::aphA3 (lane 5) mutant of F8229.
Percentage of meningococcal survival in the presence of normal
human serum (black bars) and in the presence of heat inactivated
(56.degree. C., 30 min) serum (gray bars) is shown.
[0021] FIGS. 10A and 10B show the results of competitive inhibition
ELISAs performed using purified CPS of the serogroup A N.
meningitidis OAc+/CAP+ wild-type parent F8229 (FIG. 11A) and the
OAc-/CAP+ mynC::aphA3 mutant (FIG. 11B), and sera obtained from six
different individuals (numbered in side legend) previously
vaccinated with a licensed vaccine containing the serogroup A
polysaccharide.
[0022] FIGS. 11A-11B provide a comparison of .sup.1H NMR spectra of
the anomeric and the ring proton regions of serogroup A N.
meningitidis wild type parent strain F8229 using the isolated CPS
at 500 MHz (FIG. 11A) and whole cells by HR-MAS at 600 MHz (FIG.
11B).
[0023] FIGS. 12A-12C provide comparisons of whole cell HR-MAS
.sup.1H NMR patterns in the anomeric and ring proton regions of
serogroup A N. meningitidis wild type parent F8229 (FIG. 12A),
capsule O-acetylation negative mutant strain NMA001 (FIG. 12B) and
capsule negative serogroup A strain F8239 (FIG. 12C). Figd. 12D-12F
provide a comparison of whole cell HR-MAS .sup.1H NMR patterns in
the O-Ac, N-Ac methyl proton region of serogroup A N. meningitidis
wild type parent F8229(FIG. 12D), capsule O-acetylation negative
mutant strain NMA001 (FIG. 12E) and capsule negative serogroup A
strain F8239 (FIG. 12F).
DETAILED DESCRIPTION OF THE INVENTION
[0024] The abbreviations used herein are CPS, capsular
polysaccharide; O-Ac CPS, O-acetylated capsular polysaccharide;
PCR, polymerase chain reaction; GC-MS, gas-liquid
chromatography-mass spectrometry; COSY, .sup.1H-.sup.1H correlation
spectroscopy; TOCSY, total correlation spectroscopy; High
Resolution Magic Angle Spinning NMR Spectoroscopy, HR-MAS NMR; mAb,
monoclonal antibody; ELISA: enzyme linked immunosorbant assay;
SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel
electrophoresis; DOC-PAGE, deoxycholate-polyacrylamide gel
electrophoresis; ManNAc, N-acetyl mannosamine.
[0025] Capsular polysaccharide is the critical virulence
determinant in N. meningitidis and Four (A, C, Y, and W-135) of the
five clinically important meningococcal disease causing serogroups
express O-acetylated capsules (1,3,30,31). We describe herein the
identification of the serogroup A CPS biosynthetic gene mynC and
its gene product MynC. MynC is required for serogroup A
meningococcal capsular O-acetylation; it is the O-3 and O-4
N-acetyl mannosamine acetyltransferase. MynC represents a new class
of O-acetyltransferase with no homology with known
O-acetyltransferases or the proposed sialic acid capsular serogroup
C, Y, and W-135 meningococcal O-acetyltransferases OatC or OatWY
reported recently (5). MynC is an inner membrane-associated protein
with no transmembrane domains. It seems to be a peripheral protein
having tight association with the inner membrane and could be
disrupted only by stringent 6 M urea wash and not by a more mild 1
M NaCl wash. The inability of TX-100 condition to extract the MynC
off the membrane, confirms that this protein is not an integral
membrane protein as also indicated by transmembrane domain search.
The strong association of MynC with the membrane suggests that this
protein could be a component of multi-protein complex engaged in
capsule biosynthesis.
[0026] O-acetylation of bacterial surface polysaccharides such as
capsular polysaccharides, exopolysaccharides, peptidoglycans and
lipooligosaccharides is common in pathogens and in symbionts,
O-acetylation has immunogenic and functional importance. N.
meningitidis, K1 E. coli, S. pneumoniae, Salmonella enterica,
Staphylococcus aureus and Pseudomonas aeruginosa can express
O-acetylated CPS (31,32). In S. enterica serovar typhi (7) and in
E. coli K1 (6), the loss of O-acetylation from CPS results in loss
of immunogenicity, whereas for meningococcal serogroup C (30) and
pneumococcal type 9V (33) capsules, O-acetylation is not required
for the induction of protective antibodies. In the extracellular
polysaccharide alginate polymer, produced by isolates of P.
aeruginosa from patients with cystic fibrosis, D-mannuronic acid is
O-acetylated at O-2 and at O-3 by three genes algI, algJ, and algF
(34). Alginate O-acetylation had been shown to contribute to
biofilm architecture, microcolony formation (35) and resistance to
opsonic phagocytosis (36). O-acetylation is also important for
rhizobium-legume symbiosis. The rhizobial Nod factors may be
O-acetylated at distinct sites to define the host specificity and
the formation of the pre-infection thread and the root nodule
(37-39). In Proteus mirabilis, N. gonorrhoeae and N. meningitidis
(40), C-6 hydroxyl of N-acetyl muramyl residues in peptidoglycans
are O-acetylated to confer both intrinsic and complete resistance
to lysozyme hydrolysis. These peptidoglycan motifs are
pathogen-associated molecular patterns recognized by the innate
immune system (41,42).
[0027] A number of acetyltransferases that transfer an acetyl group
from acetyl-CoA to O-acetylate dissimilar substrates have been
identified in prokaryotic and eukaryotic systems but these proteins
share limited sequence homology. Two families of proteins that
O-acetylate exported carbohydrate moieties have been reported. The
NodL-LacA-CysE family (43-47) that include the lipochitin
acetyltransferase (NodL) of Rhizobium leguminosarum, galactoside
acetyltransferases (GAT) such as LacA, the cysteine biosynthetic
enzyme (CysE), also known as the serine acetyltransferase of E.
coli, are cytoplasmic proteins that use acetyl coenzyme A as the
acetyl donor. Interestingly, the proposed sialic acid
O-acetyltransferases of meningococcal serogroups W-135 and Y
(OatWY) but not of serogroup C (OatC) show sequence homology to the
NodL-LacA-CysE family. The second family comprises integral
membrane proteins. Members of this family include the
O-acetyltransferases that O-acetylate macrolide antibiotics
(Streptomyces spp.) (48), LPS O-antigen (Legionella pneumophila
Lag-1, (49) Salmonella typhimurium OafA (50), Shigella flexneri
bacteriophage SF6 OAc (51) and Nod factors (Rhizobium leguminosarum
NodX (52). However, the putative capsule O-acetyltransferases (50)
of Streptococcus pneumoniae serotype 9V, Cps9vM and Cps9vO the S.
aureus serotype 5 O-acetyltransferase (53) and alginate
O-acetylation proteins AlgI, AlgJ and AlgF of P. aeruginosa share
no homology with the above mentioned families of
O-acetyltransferases. Similarly, MynC represents a novel subclass
of acetyltransferases.
[0028] The enzymatic activity for capsular polysialic acid
O-acetylation from K1 E. coli was reported by Higa and Varki (54),
but the respective gene and the protein have not been identified.
MynC does show sequence homology with several proteins (Table 2),
including the acetyl esterase (acetyl xylosidase) that degrades
xylan from the thermophile, Caldicellulosiruptor saccharolyticus.
These proteins share with MynC a semi-conserved motif GSSKGG (SEQ
ID NO:12) in the N-terminal region. Typically, serine esterases
contain a conserved GSSSG (SEQ ID NO:13) motif (assumed to be the
catalytic N-terminal domain), where the middle S residue is the
active site nucleophile (55). MynC also has homology (25% identity
and 46% homology) with capsule biosynthesis enzyme Cap8I (464 aa)
of S. aureus subsp. aureus MW2 (27) and to a hypothetical
esterase/lipase/thioesterase family protein (265 aa) of Arabidopsis
thaliana. The S. aureus serotype 8 capsule has O-acetylation in the
mannuronic acid component of the capsule.
[0029] A BLAST search performed with the deduced MynC (247 aa)
amino acid sequence (SEQ ID NO:2), identified five proteins in the
Gen Bank with .gtoreq.25% sequence identity (Table 2). Among these
were EpsK of Lactococcus lactis subsp. cremoris, acetyl
esterase/xylosidase (EC 3.1.1.6, 266 aa) XynC of
Caldicellulosiruptor saccharolyticus (26), and a capsular
polysaccharide synthesis protein, Cap8I (464 aa), from
Staphylococcus aureus subsp. aureus MW2 (27). Interestingly, these
five proteins shared with MynC a semi-conserved motif (GSSKGG) of
mostly hydrophobic small amino acids in the N-terminal region.
Repeated search and pairwise comparison of known
O-acetyltransferases from prokaryotes and eukaryotes revealed no
significant homology with MynC.
[0030] A motif scan search of the MynC sequence at ISREC (Swiss
Institute for Experimental Cancer Research) and SIB (Swiss
Institute for Bioinformatics) sites revealed no matches. Search
results using the SIB-PROSITE database of protein families and
domains showed no similarity. Using a Markov model for
transmembrane domain prediction, TMHMM (Centre for Biological
Sequence Analysis, Technical University of Denmark, Lyngby,
Denmark) MynC has no transmembrane domains. EMBL-EBI (European
Bioinformatics Institute) InterProScan predicted MynC as a member
of alpha/beta-hydrolases super-family that includes
acetylcholinesterases, carboxylesterases, mycobacterial antigens,
and acetylesterases.
[0031] Growth of the mynC nonpolar mutant was not different in GC
medium when compared with the wild type parent. However, when the
pellets from one liter cultures of similar growth (OD.sub.600 of
1.0) were compared for CPS yields, the mynC mutant consistently
yielded 25-30% less CPS compared to the wild type parent, probably
due to some polarity of the insertion mutant or due to a decrease
of transcript stability. Capsular polysaccharides from the wild
type strain F8229 and the nonpolar mynC mutant NMA001 were
prepared, purified and subjected to compositional and structural
analysis. The GC-MS analysis of the alditol acetate derivatives,
after removal of the phosphate groups by HF treatment, revealed
ManNAc as the sole component of capsular polysaccharides isolated
from both the wild type strains and the mynC mutant.
[0032] In order to investigate the extent of O-acetylation and the
location of the O-acetyl groups, the CPSs were subjected to 1-D and
2-D .sup.1H NMR spectroscopic analyses. Assignments of the various
protons could be made from the COSY and TOCSY NMR analyses. The
wild type CPS 3-O-Ac proton assignments (Table 3) were compared to
published values (28,29) and were highly consistent with these
values. However, the mynC mutant CPS spectrum was quite
distinct.
[0033] In the wild type CPS .sup.1H NMR spectrum shown in FIG. 2A,
the H-3 proton of ManNAc was observed at 5.20 ppm when the moiety
had acetylation at O-3 due to the de-shielding effect of the acetyl
group. The absence of this peak in the spectrum of the mutant CPS
(FIG. 2B) indicated the lack of acetylation at O-3 on the ManNAc
residue. The H-2 resonance at 4.61 ppm was observed in the wild
type CPS indicating 3-O acetylation, whereas in the mynC mutant
spectrum this peak was missing (comparing FIGS. 2A-2B). In the
region between 2.05 to 2.10 ppm where N-- and O acetyl methyl
protons were observed (inset, FIG. 2A, and Table 3) three peaks
were identified in the wild type CPS spectrum. Two of these peaks
corresponded to O-acetyl methyl protons, while the other was due to
N-acetyl methyl protons. However, in the spectra (inset, FIG. 2B
and Table 3) of the mynC mutant CPS only one peak corresponding to
the N-acetyl methyl proton resonance at 2.08 ppm was observed,
suggesting the absence of O-acetylation. These differences in 1-D
NMR spectra indicated the absence of O-acetylation in the mynC
mutant CPS.
[0034] The relative percentages of the CPS populations (Table 4)
from the wild type parent and mync mutant were calculated using
integration values of the H2 resonance (28,29). Integration of the
ManNAc H2 resonances for the various CPSs revealed that wild type
CPS consisted of 3-O-Ac (4.59 ppm), 4-O-Ac (4.54 ppm when adjacent
to 3-O-Ac-ManNAc and 4.50 ppm when adjacent to non-O-acetylated
ManNAc) and Non-O-Ac (4.45 ppm) forms in the ratio of 4:2.7:3:3,
and this value was found to be consistent among different batch
preparations. CPS of the mync mutant showed a 100% non-O-Ac form
(peak at 4.45 ppm). In conclusion, absence of both 3 and 4
O-acetylation in mutant CPS suggested that MynC was responsible for
the O-acetylation at both positions.
[0035] To further confirm the NMR data, a colorimetric estimation
(25) of O-acetylation of triplicate samples of 400 and 1000 .mu.g
amounts of purified CPS from the wild type parent and mynC mutant
was performed. The wild type CPS showed significant O-acetylation
(at 500 nm OD.+-.S.D of 0.2138.+-.0.015 and 0.4896.+-.0.003,
respectively) whereas the CPS of the mynC mutant yielded minimal
absorbance (at 500 nm OD.+-.S.D of 0.0553.+-.0.014 and
0.1400.+-.0.028 respectively) likely due to N-acetylation.
[0036] In further studies of Serogroup A capsular polysaccharides,
N. meningitidis cells were grown, and HR-MAS NMR analysis was
performed following the methods described previously (68). Briefly,
bacteria grown overnight on GC-agar plates (-10.sup.10 cells) were
harvested and killed in 1 ml of 10 mM potassium-phosphate buffer
(pH 7.4) in D.sub.2O containing 10% sodium azide (w/v). The
suspension was incubated for 1 h at room temperature. The bacteria
were pelleted by centrifugation (9700.times.g for 2 min) and washed
once with 10 mM potassium phosphate buffer in D.sub.2O. The pellet
was mixed with 20 .mu.l of D.sub.2O containing 0.75% (w/v) TSP
(3-(trimethylsilyl)-propionic acid-D4, sodium salt) as an internal
standard (0 ppm) prior to being loaded into a 40 .mu.L nano NMR
probe (Varian, Palo Alto, USA). HR-MAS experiments were performed
using a Varian Inova 600-MHz spectrometer. Spectra were spun at 3
kHz and recorded at ambient temperature (21.degree. C.). The
experiments were performed with suppression of the HOD signal at
4.8 ppm by presaturation. Proton spectra of bacterial cells were
acquired with the Carr-Purcell-Meiboom-Gill (CPMG) pulse sequence
(90-(.tau.-180-.tau.).sub..eta.-- acquisition) to remove broad
lines arising from lipids and solid-like-material. The total
duration of the CPMG pulse (n*2.tau.) was 10 ms with .tau. set to
(1/MAS spin rate). Typically spectra were acquired each with 400
acquisitions in approximately 15 min. with a recycle delay of 2.5
sec.
[0037] Purified meningococcal CPSs have been extensively
investigated using .sup.1H and .sup.13C NMR spectroscopy (3, 61,
28) and O-acetylation patterns of CPSs have been validated using
NMR techniques (29) for meningococcal polysaccharide containing
vaccines. We have described purified serogroup A CPS by .sup.1H NMR
to identify the serogroup A O-acetyltransferase encoding gene mynC.
When the O-3, O-4, OAc+ serogroup A wild type F8229 meningococci
were subjected to HR-MAS analysis (FIG. 12A), reproducible
serogroup A CPS derived proton resonances were noted. The
respective CPS derived HR-MAS proton signals were easily correlated
with the .sup.1H NMR signals obtained from purified CPS (FIG. 12B)
with identical chemical shifts. The characteristic anomeric peaks
corresponding to 3-O-acetyl ManNAc H1 and ManNAc H1 were observed
at 5.46 and 5.44 ppm, respectively and the 3-O-acetyl ManNAc H2 and
ManNAc H2 observed at 4.61 ppm and 4.4 ppm, respectively. Wild type
3-O-acetylated ManNAc H3 signal was observed at 5.20 ppm and
O-acetyl methyl protons were observed at 2.10 and at 2.06 ppm (see
FIGS. 12D-12F). To further validate these data, the wild type
stain, a capsule O-acetylation deficient mutant of this strain and
a capsule defective stain were studied by HR-MAS (FIG. 12A-12C).
When compared to the wild type parent (FIG. 12A), the mynC mutant
meningococci gave a profile (FIG. 12B) lacking the peaks at 5.20
ppm, 4.59 ppm, 2.10 ppm and 2.06 ppm typical of a non-O-acetylated
serogroup A CPS. A comparison of an enlarged high field region,
2-2.18 ppm (FIG. 12D-12F), confirmed the lack of OAc methyl proton
signals in the mynC mutant spectrum (FIG. 12B) that showed a single
N-acetyl methyl proton resonance at 2.08 ppm. The capsule-negative
strain F8239 showed no resonance characteristic of CPS indicating
the lack of capsule on the surface (e.g., FIGS. 12C and 12F).
[0038] The degree of 3-O acetylation was estimated from peak
integrals obtained using the standard Varian software. The relative
amount of the 3-O-Ac form of the CPS was calculated from integrals
of the H-1 resonances at 5.46 ppm (3-O-Ac ManNAc) and 5.41 ppm
(ManNAc) and found to be 1.6:1 (i.e. 57+/-3%). Additionally,
comparison of the 3-O-Ac ManNAc H-3 integral with that of the
combined anomeric region gave 50+/-3% of the 3-O-Ac form. These
results agree well with the 50% 3-O acetylation described herein.
See also Gudlavalleti et al. (69). The H-2 resonance of the ManNAc
residue was shown previously (28) to be sensitive to not only 3-O
acetylation but also to acetylation at O-4 in the purified capsular
polysaccharide. Peaks at 4.59 ppm, 4.54 ppm and 4.50 ppm in the
HR-MAS spectrum of whole cells are consistent with those reported
for purified CPS H2 of 3-O-acetylated ManNAc, 4-O-Ac-ManNAc
adjacent to a 3-O-acetylated ManNAc residue, and 4-O-Ac-ManNAc
adjacent to a non-acetylated ManNAc residue, respectively. Although
the peak integration was less precise, the degree of
4-O-acetylation was estimated to be half of the level of 3-O
acetylation (i.e., approximately 25% of the CPS). This result is in
agreement with the level of 27% acetylation at the 4-O position of
ManNAc in purified serogroup A CPS determined in an independent
experiment. These studies indicate that HR-MAS NMR technique can be
applied to directly determine and quantitate the structures of CPS
that are surface expressed.
[0039] To confirm the acetyltransferase activity in an in vitro
assay, MynC was His-tagged at its C-terminus, over-expressed in E.
coli and purified in native conditions using Ni-NTA affinity
chromatography (FIG. 3). The column was washed with buffer
containing 10, 20 and 40 mM imidazole respectively. A 40 mM
imidazole wash was required to remove high molecular weight
contaminating bands (lane 8, FIG. 3). Elution of MynC with 250 mM
imidazole containing buffer yielded a purified protein (lane 9,
FIG. 3).
[0040] Purified MynC was used in in vitro assays containing the
serogroup A wild type or mynC mutant CPS as the substrate and
(acetyl-1-.sup.14C)-coenzyme A as the acetyl donor. Autoradiography
of the CPSs (FIG. 4) revealed that MynC transferred the .sup.14C
labeled acetyl group from acetyl CoA to the non-acetylated CPS of
the mync mutant (lanes 5-8, FIG. 4). Interestingly, MynC was also
capable of further O-acetylating the wild type CPS (lane 4, FIG.
4). MynC recognized the serogroup A CPS but not serogroup B or
serogroup C CPSs (lanes 2 and 3, FIG. 4). Finally, the
acetyltransferase activity was not due to minor contaminating E.
coli proteins left after purification, as the lysate of the vector
construct alone did not exhibit activity (lanes 9 and 10, FIG. 4).
MynC activity was concentration-dependent (FIG. 5A) when the amount
of CPS substrate and the acetyl donor were constant. The decrease
in the estimated activity over 2-3 h time point could be due to the
possible degradation of the CPS polymer at the reaction condition
that had been removed in 80% ethanol washes. The enzyme seems to be
inactive in the extreme pH conditions of less than 5 and greater
than 10. The optimal pH for the MynC activity was 5.8 to 7.0 (FIG.
5C). The Mg.sup.+2 ions present in the in vitro O-acetyltransferase
reaction buffer may not be essential for the enzyme activity, as
revealed by the assay using citrate, phosphate and borate buffers
without these ions, for optimal pH measurements.
[0041] An intact copy of mynC under the control of a lac promoter
was constructed and sub-cloned into the meningococcal shuttle
vector, pYT250, as described in Example 5. The plasmid was
transformed into the mync mutant and the wild type strain to
generate strains NmAnpc1 and NmAwtc1, respectively. The wild type
strain and the wild type strain over-expressing MynC (NmAwtc1), the
mynC mutant, and the complemented strain (NmAnpc1) were grown on GC
agar plates with or without IPTG and analyzed by colony immunoblots
and ELISAs (FIG. 6A) using the serogroup A capsule-specific
monoclonal antibody 14-1-A. The unencapsulated strain F8239, a
serogroup A strain which contains point mutations and deletions in
mynA (11) was used as a negative control. The wild type and NmAwtc1
meningococci were strongly recognized by mAb 14-1-A, whereas the
uncomplemented mynC nonpolar mutant and the capsule negative
control strain F8239 did not react with this antibody. The
complemented nonpolar mynC mutant strain NmAnpc1 reacted strongly,
and the intensity was increased with IPTG induction. These data
indicated that a O-acetyl group was a component of the epitope
specificity of the monoclonal antibody 14-1-A. The CPS isolated
from complemented strain NmAnpc1 was subjected to .sup.1H NMR
analyses which revealed (FIG. 2C) the restoration of O-acetylation
in the polymer. When compared by the relative integration values of
H2 resonances of 3-O-Ac and non-O-Ac forms, the level of
O-acetylation in the complemented strain, even with IPTG, was less
than wild type levels, although the relative ratio (5:1:2) of the
acetylated species O-3: O4: O-3 and 4 was similar to the wild type
ratio (4:1:1.7) (Table 4). The mynC mutant CPS O-acetylated in
vitro by MynC was recognized by the monoclonal antibody 14-1-A,
confirming the importance of O-acetylation in defining the epitope
recognized by the antibody.
[0042] In summary, quantitative ELISA, .sup.1H NMR and colorimetric
assays on the CPS from complemented strain NmAnpc1 revealed that
O-acetylation was restored by genetic complementation. Western blot
analysis (FIG. 6B) on the whole cell lysates of the MynC
over-expressed wild type strain (NmAwtc1), and the complemented
mynC mutant (NmAnpc1), using the anti penta-His mAb, was also
performed. His-tagged MynC (lanes 4 and 6, FIG. 6B) was visualized
in the complemented meningococci under IPTG and this result was
correlated with the restoration of O-acetylation in the NmA mutant
CPS.
[0043] The MynC-complemented strain NmAnpc1 was used to assess the
cellular location of MynC in serogroup A meningococci. Western blot
analysis of the sub-cellular fractions loaded on the basis of a set
amount of starting cells, using (His).sub.5 mAb revealed (FIG. 7A)
that MynC was inner membrane-associated. The total membrane and
inner membrane components gave strong reactivity, whereas the
cytosolic fraction showed weak reaction and outer membrane showed
no reaction. To explore the possibility MynC that did not possess
any transmembrane domains to be a peripheral protein, various
extraction procedures were performed. Treatment of membranes with
6M urea partially stripped off the protein, whereas the other
conditions with 1M NaCl or with 1% Tx-100 did not extract the MynC
(FIG. 7B) from the total membranes.
[0044] Cell surface hydrophobicity, a marker of capsular
expression, was measured by hydrophobic interaction column
chromatography (23). Approximately 4% of the wild type serogroup A
strain F8229 and about 5% of the mynC mutant were retained on the
hydrophobic column, indicating overall low cell surface
hydrophobicity of both the wild type and the mutant. In contrast,
the unencapsulated variant F8239 (>60%) and mynA and mynB
mutants (>90%) were retained on the column, indicating high cell
surface hydrophobicity. A bactericidal assay using 10% normal human
sera was used to assess expression of a functional capsule. Both
the wild type parent and the mynC nonpolar mutant were protected
from killing. In contrast, the unencapsulated strain F8239 and the
mutants of mynA, mynB and mynD were completely killed under these
conditions.
[0045] O-acetylation is critical for serogroup A N. meningitidis
CPS immunogenicity and antibody formation (8). The major protective
epitope recognized by antibodies induced following vaccination with
serogroup A polysaccharide requires O-acetylation. Berry et al. (8)
found that bactericidal anti-serogroup A antibodies in the sera of
serogroup A polysaccharide vaccinated individuals were specific for
O-Ac CPS. The importance of O-Ac in serogroup A capsule
immunogenicity was confirmed using O-Ac and non-O-Ac PS and
PS-protein conjugates in immunogenicity studies with mice.
Interestingly, the serogroup A capsule with or without
O-acetylation protected the meningococcus against killing by a low
concentration (10%) of normal human serum, e.g.
antibody-independent complement mediated killing. O-acetylation may
also have a role in the initial stages of colonization and
infection by serogroup A N. meningitidis. In studies of
meningococcal colonization in a mouse model (56), an OAc- mynC
mutant showed significantly lower ability to establish colonization
compared to the wild type OAc+ strain.
[0046] MynC is specific for meningococcal serogroup A
{(.alpha.1.fwdarw.6) linked N-acetyl-D-mannosamine-1-phosphate}
CPS. MynC did not acetylate the sialic acid CPSs of either
serogroup B or serogroup C N. meningitidis. The in vitro
O-acetylation studies indicate that MynC recognized non
O-acetylated or the partly O-acetylated CPS assembled polymer as a
substrate. Therefore O-acetylation appears to be a near final step
of decorating the serogroup A capsule polymer. The cell surface
hydrophobicity data and the resistance to killing by normal human
sera of the mynC mutant and the wild type parent indicate that the
OAc- capsular polymer is surface expressed and functional. Thus,
serogroup A capsule expression, transport or prevention of killing
by normal human sera does not require O-acetylation.
[0047] In summary, MynC is the capsular polysaccharide O-3 and O-4
acetyltransferase of serogroup A of N. meningitidis. This
approximately 25 kDa inner membrane associated enzyme utilizes
acetyl CoA for its activity and belongs to a new subclass of
O-acetyltransferases. Study of the OAc deficient mutant confirmed
the importance of O-acetylation in serogroup A polysaccharide
immunogenicity, but O-acetylation was not required for capsular
expression or to protect the meningococcus from killing by normal
human sera. O-acetylation by MynC may be important for vaccine
development against serogroup A N. meningitidis. The ability to
achieve O-acetylation of serogroup A polysaccharides used for new
and existing meningococcal conjugate and polysaccharide vaccines
may be enhanced by this enzyme.
[0048] Neisseria meningitidis serogroup A capsular polysaccharide
(CPS) is composed of a homopolymer of O-acetylated, (a16) linked
N-acetyl-D-mannosamine (ManNAc)-1-phosphate that is distinct from
the capsule structures of the other meningococcal disease causing
serogroups B, C, Y and W-135. The serogroup A capsule biosynthetic
genetic cassette consists of four ORFs, mynA-D (sacA-D) that are
specific to serogroup A, but the function of these genes has not
been well characterized. We found that mynC encoded an
acetyltransferase that was responsible for the O-acetylation of the
CPS of serogroup A. The wild type CPS as revealed by .sup.1H NMR
had 60 to 70% O-acetylated ManNAc residues that contained acetyl
groups at O-3, with some species acetylated at 04 and O-3 and O-4.
A nonpolar mync mutant, generated by introducing an aphA-3
kanamycin resistance cassette, produced CPS with no O-acetylation.
A serogroup A capsule-specific monoclonal antibody was shown to
recognize the wild type O-acetylated CPS but not the CPS of the
mynC mutant, which lacked O-acetylation. MynC was C-terminally
His-tagged and overexpressed in E. coli to obtain the predicted
.about.26 kDa protein. The acetyltransferase activity of purified
MynC was demonstrated in vitro using .sup.14C labeled acetyl CoA.
MynC, O-acetylated the OAc- CPS of the mynC mutant, and further
acetylated the wild type CPS of serogroup A but not the CPS of
serogroup B or serogroup C meningococci. Genetic complementation of
the mynC mutant confirmed the function of MynC as the serogroup A
CPS O-3 and O-4 acetyltransferase. MynC is an inner
membrane-associated protein of a new subclass of
O-acetyltransferases and utilizes acetyl CoA to decorate the
D-mannosamine capsule of serogroup A N. meningitidis.
[0049] Meningococcal serogroups C, Y, W-135 and H also express
O-acetylated capsules. Interestingly, the serogroup B CPS is not
O-acetylated. The genes indispensable for encoding the putative
capsular polysaccharide O-acetyltransferases (OatC, OatWY)
responsible for the O-acetylation of meningococcal serogroups C,
W-135 and Y, respectively, have been recently identified (5). Other
pathogens such as pneumococcal serotype 9V, Salmonella enterica
serovar typhi Vi, Staphylococcus aureus serotypes 5, 8 and E. coli
K1 (6) express O-acetylated capsules. The biological importance of
O-acetylation of CPS appears species or subspecies dependent but in
some pathogens O-acetylation of capsule is involved in immune
recognition (6,7). For serogroup A CPS there is a dramatic
reduction in immunogenicity of the polysaccharide observed with
removal of the O-acetyl groups by chemical treatment (8).
[0050] The general genetic organization of capsular polysaccharide
genes of N. meningitidis is similar to other bacterial systems such
as Haemophilus influenzae, E. coli K1, etc. that are classified
(9,10) as group 11 capsules. It is composed of unique biosynthesis
gene cassette flanked by conserved genes involved in translocation
of the CPS. The genetic cassette responsible for the biosynthesis
of the serogroup A capsule is comprised of a .about.5 kb nucleotide
sequence located (FIG. 1) between ctrA, the outer membrane capsule
transporter, and galE, the UDP-glucose-4-epimerase (11). Four open
reading frames (ORFs 1 to 4 designated as myn A-D or sacA-D) are
co-transcribed as an operon (11) and are not found in the genomes
of other meningococcal serogroups or in Neisseria gonorrhoeae.
Separated from ctrA by a 218-bp intergenic region, mynA is
predicted to encode a 372-amino acid protein that has homology with
the E. coli UDP-N-acetyl-D-glucosamine 2-epimerase, MynB is
hypothesized to be the capsular polymerase, linking individual
UDP-ManNAc monomers together and MynD was predicted to be involved
either in CPS transport assembly or in cross-linking of the capsule
to the meningococcal cell surface (11). See also U.S. Pat. No.
6,403,306. In the present study we demonstrate that mync (744-bp)
encodes an O-acetyltransferase (247 aa) that transfers acetyl
groups to the ManNAc residues of the serogroup A CPS.
[0051] Serogroup A Neisseria meningitidis is a major cause of
endemic meningococcal disease as well as epidemics and pandemics of
meningococcal meningitis and meningococcemia in many developing
parts of the world. Capsular polysaccharide (CPS) of serogroup A N.
meningitidis is composed of O-3 or O-4 acetylated a (1.fwdarw.6)
linked phospho-ManNAc polymers (1) and is distinct from the
chemical structures of the other meningococcal capsular
polysaccharides. In serogroup A meningococcal polysaccharide
vaccines, O-acetylation of the serogroup A CPS is believed to be
important for immunogenicity and protection (8). Other roles of CPS
O-acetylation in serogroup A meningococcal pathogenesis have not
been defined. This applications discloses the serogroup A CPS
O-acetyltransferase gene; and the genes involved in meningococcal
sialic acid capsule O-acetylation have also been identified (5).
Further, O-acetylation in serogroup A and the other meningococcal
serogroups' CPS patterns have been extensively elucidated and
investigated by .sup.13C NMR and .sup.1H NMR experiments (3, 61,
28).
[0052] The N. meningitidis serogroup A CPS biosynthesis genetic
cassette is comprised of a .about.4.7 kb (11) region containing
four ORFs--mynA, mynB, mynC and mynD also known as sacA-D. MynC is
responsible for the O-3 and O-4 acetylation of ManNAc CPS. A
nonpolar mutation in mync, generated by insertion of the aphA-3
kanamycin resistance cassette, yielded a CPS devoid of
O-acetylation. Colony immunoblots, cell surface hydrophobicity
studies and capsule precipitation procedures revealed that the
nonpolar mync mutant (mynC::aphA-3) surface expressed similar
amounts of capsular polysaccharide to the wild-type parent. In this
study, the serogroup A encapsulated wild-type parent F8229 (11), an
isogenic OAc- nonpolar encapsulated mutant mynC::aphA3 and the
unencapsulated mynA or mynB mutants of this strain and the
serogroup A capsule deficient strain F8239 were used.
[0053] The role of O-acetylation and CPS in the ability of
serogroup A meningococci to colonize the nasopharynx of outbred
adult Swiss Webster mice was tested. This model has previously been
used to define a role of serogroup B capsule in meningococcal
colonization. Mice (5/group) were inoculated with 10.sup.7 CFU of
meningococci intra-nasally and were followed for five days with
nasopharyngeal washes and cultures of these washes. The wild-type
parent (F8229 CAP+/OAc+) effectively colonized 75% of mice, whereas
the mynC CAP+/OAc- mutant initially colonized 50%. By day 2,15% of
mice remained colonized with the mynC CAP+/OAc- mutant, whereas
with the CAP+/OAc+ wild-type parent, 60% of mice remained
colonized. By day 3, colonization of all mice inoculated with the
mynC CAP+/OAc- mutant was lost. In contrast, 22-30% of mice
inoculated with the wild-type parent remained colonized through the
five days of observation (p=0.031 paired Student's t-Test). The
unencapsulated serogroup A strain F8239 (23) and the unencapsulated
mynA mutant failed to colonize the mice at any time point,
indicating a requirement of serogroup A CPS in establishing
colonization. Further, the mynC CAP+/OAc- mutant was impaired in
the ability to maintain nasopharyngeal colonization when compared
to the wild-type parent, suggesting that O-acetylation of the
serogroup A CPS may play a role in promoting persistent
meningococcal colonization.
[0054] The role of serogroup A CPS O-acetylation in protecting the
meningococci from killing by pooled normal human sera was also
investigated. In serum bactericidal activity assays (24), the
wild-type parent and the mynC CAP+/OAc- mutant survived in 10%
normal human sera (final concentration, v/v). In contrast, the
unencapsulated mynA and mynB mutants of this strain were rapidly
and completely killed (FIG. 9) by the same 10% normal human serum.
In complement inactivated normal human serum (56.degree. C., 30
min), both encapsulated and unencapsulated meningococci survived
(grey bars). Both the CAP+/OAc+ wild-type and the CAP+/OAc- mync
mutant were sensitive (>99% killing) to 25% and 50% (v/v) normal
human sera. These results indicated that the O-acetylation did not
enhance or diminish the protection provided to meningococci by the
serogroup A capsule against complement-mediated bactericidal
activity of normal human sera.
[0055] To investigate the role of O-acetylation of capsule in
serogroup A meningococcal vaccines, CPS of the CAP+/OAc+ wild-type
parent and the CAP+/OAc- mynC mutant were prepared and
standardized. These preparations were used in inhibition ELISAs in
which six well-standardized post vaccine sera (designated 242, 243,
268, 274, 414, 415) from serogroup A polysaccharide vaccinated
individuals (Menimmune.RTM.) were tested. OAc- serogroup A CPS
competitively inhibited significantly less antibody than the
wild-type CPS (FIG. 10A-10B) in five of the six sera tested. At the
highest concentrations of capsule used for inhibition (100 .mu.g),
OAc- CPS was unable to inhibit one sera (274) did inhibit one serum
(243), and only incompletely inhibited (40-74%) four of the other
sera (242, 268, 414, 415). In contrast, the OAc+CPS inhibited 75%
to 100% of serum bactericidal activity of all six samples. These
data confirmed the importance of O-acetylation as a major epitope
of the serogroup A meningococcal polysaccharide-containing vaccines
for most but not all individuals.
[0056] The importance of serogroup A CPS O-3, O-4 acetylation as a
factor in meningococcal colonization, in resistance to killing by
normal human sera and in serogroup A polysaccharide containing
meningococcal vaccines was addressed in this study. The
identification of the serogroup A CPS O-acetyltransferase gene,
mynC, has facilitated the generation of an encapsulated mutant
devoid of O-acetylation. The OAc- mutant, its parent and other
isogenic mutants of this strain permitted insights into the role of
O-acetylation in serogroup A biology.
[0057] Colonization of the human nasopharynx is an essential step
in meningococcal pathogenesis (62). The complete failure to
establish nasopharyngeal colonization of mice by serogroup A
unencapsulated mutants indicates a role of the serogroup A capsule
in the initial pathogenic events after meningococcal acquisition in
the upper respiratory tract. A similar advantage in promoting
nasopharyngeal colonization has been previously shown for the
serogroup B capsule. Both of these results may be correlated with a
protective role of capsule against elimination of meningococci by
human host defenses at mucosal surfaces at the time of initial
acquisition. The impaired ability of the mync CAP+/OAc- to maintain
colonization, compared to the wild-type parent suggests an
additional role of serogroup A capsule O-acetylation in
meningococcal nasopharyngeal colonization of the nasopharynx. The
bulky O-acetyl groups might facilitate initial adherence
interactions with the nasopharyngeal mucosal epithelial surface or
further enhance resistance to mucosal host defenses. O-acetylation
of the exopolysaccharide alginate in Pseudomonas aeruginosa has
been shown to contribute to biofilm and microcolony formation and
to facilitate resistance to opsonic phagocytosis (35, 36). Also,
O-acetylation of rhizobial Nod factors defines host specificity and
is critical for the formation of the preinfection thread and the
root nodule in Rhizobium-legume symbiosis (37, 38, 39).
[0058] The presence of capsule expressed on the surface of
serogroup A meningococci was important for protection against
complement-mediated bactericidal activity of normal human sera.
Mutants such as mynA and mynB that lack CPS were rapidly killed by
all concentrations of normal human sera. However, serogroup A
capsule O-acetylation was not required for or enhanced this
protection. Both the encapsulated parent and OAc- mutant survived
similarly in low concentrations of human sera. Low concentrations
of sera (10% or less) are usually associated with antibody-mediated
classical complement pathway activation (63) rather than
alternative or possibly MBL lectin pathway activation requiring
higher concentrations of human sera.
[0059] Despite the disappearance of exposure to serogroup A N.
meningitidis in the United States and other industrialized
countries, many individuals from these areas have serum
bactericidal activity against serogroup A meningococci. This may be
due to antibodies directed at cross-reactive serogroup A
capsule-like epitopes present on Bacillus pumilus, Enterococcus
faecalis and other commensal bacteria (64) or antibodies to
noncapsular outer membrane epitopes, or components of the
meningococcal surface that lead to complement activation. In a
recent study, Granoff and Amir (65) found a high prevalence of
cross-reacting serogroup A capsular antibodies in bactericidal sera
from North America but only a small number of these bactericidal
sera were directly inhibited by purified group A CPS. Complement
activation by mannose-binding lectin (MBL) attachment to the Opa
and PorB proteins of N. meningitidis has been reported. Thus, in
our study, serogroup A CPS, regardless of O-3 or O-4 acetylation,
was protective against low levels of classical pathway complement
activation, but serogroup A meningococci, regardless of
O-acetylation, were killed by higher concentrations of normal human
sera.
[0060] Berry et al. (8) previously studied the effects of N.
meningitidis serogroup A capsular O-acetylation on development of
immune responses to serogroup A CPS. Using chemical removal of
O-acetyl groups, they found that a majority of antibodies generated
by vaccination with serogroup A CPS were specific for epitopes
involving O-acetyl groups and that a dramatic reduction in
immunogenicity was associated with removal of these groups.
Similarly monoclonal antibodies against the O-acetylated serotype 5
capsule of S. aureus are specific for the O-acetyl epitope (66).
Among the meningococcal sialic acid capsules, serogroup B
meningococci lack O-acetylation, serogroup C meningococci can
express O-7 or O-8 acetylation and serogroups W-135 and Y have
variable O-7 or O-9 acetylation. In contrast to serogroup A
meningococcal O-acetylation, O-acetylation of capsule in
meningococcal serogroup C (32), pneumococcal serotype 9V (33) and
E. coli K1 (67) do not appear essential for the induction of
protective antibodies.
[0061] Our data indicate that the O-acetyl group is a dominant
epitope on the serogroup A CPS in individuals. Other capsular
polysaccharides with immuno-dominant O-acetyl epitopes are S.
aureus serotype 5 (ManANAc O-3) and Salmonella typhi VI (GalANAc
O-3). Interestingly, in capsules with immuno-dominant acetylation
epitopes, the acetylation sites are within the hexose sugar ring
(endo-cyclic). In contrast, the O-acetyl epitopes of other capsules
including the meningococcal sialic acid C, Y or W-135 capsules (at
positions O-7, O-8 or O-9), E. coli K1 (at positions O-7, O-9), and
the S. pneumoniae serotype 9V capsule (ManNAc O-6) that do not
contribute to protective immunity are positioned in the exocyclic
side chain. Thus, the endo-cyclic position of O-acetylation, may
have less mobility compared to an exo-cyclic side chain location
and appears to position the O-acetyl group as a dominant epitope
recognized by the human immune system.
[0062] In the present study, serogroup A O-acetylation did not
enhance or diminish resistance of meningococci to
complement-mediated bactericidal activity of normal human serum.
However, O-acetylation of the meningococcal serogroup A CPS
contributed in an animal model to nasopharyngeal colonization by
this serogroup and was a major epitope for antibodies generated by
serogroup A CPS vaccination.
[0063] Expression refers to the transcription and translation of a
structural gene (coding sequence) so that a protein (i.e.,
expression product) having the biological activity of the
O-acetyltransferase of the present invention is synthesized. It is
understood that post-translational modification(s) in certain types
of recombinant host cells may remove portions of the polypeptide
which are not essential to enzymatic activity.
[0064] The term expression control sequences refer to DNA sequences
that control and regulate the transcription and translation of
another DNA sequence (i.e., a coding sequence). A coding sequence
is operatively linked to an expression control sequence when the
expression control sequence controls and regulates the
transcription and translation of that coding sequence. Expression
control sequences include, but are not limited to, promoters,
enhancers, promoter-associated regulatory sequences, transcription
termination and polyadenylation sequences, and their positioning
and use is well understood by the ordinary skilled artisan. The
term "operatively linked" includes having an appropriate start
signal (e.g., ATG) in front of the DNA sequence to be expressed and
maintaining the correct reading frame to permit expression of the
DNA sequence under the control of the expression control sequence
and production of the desired product encoded by the DNA sequence.
If a gene that one desires to insert into a recombinant DNA
molecule does not contain an appropriate start signal, such a start
signal can be inserted in front of the gene. The combination of the
expression control sequences and the O-acetyltransferase coding
sequence form the O-acetyltransferase expression cassette.
[0065] As used herein, an exogenous or heterologous nucleotide
sequence is one which is not in nature covalently linked to a
particular nucleotide sequence, e.g., an O-acetyltransferase coding
sequence. Examples of exogenous nucleotide sequences include, but
are not limited to, plasmid vector sequences, expression control
sequences not naturally associated with particular
O-acetyltransferase coding sequences, and viral or other vector
sequences. A non-naturally occurring DNA molecule is one which does
not occur in nature, and it is thus distinguished from a
chromosome, or example. As used herein, a non-naturally occurring
DNA molecule comprising a sequence encoding an expression product
with O-acetyltransferase activity is one which comprises said
coding sequence and sequences which are not associated therewith in
nature.
[0066] Similarly, as used herein an exogenous gene is one which
does not naturally occur in a particular recombinant host cell but
has been introduced in using genetic engineering techniques well
known in the art. An exogenous gene as used herein can comprise an
O-acetyltransferase coding sequence expressed under the control of
an expression control sequence not associated in nature with said
coding sequence.
[0067] Another feature of this invention is the expression of the
sequences encoding O-acetyltransferase. As is well-known in the
art, DNA sequences may be expressed by operatively linking them to
an expression control sequence in an appropriate expression vector
and employing that expression vector to transform an appropriate
host cell.
[0068] A wide variety of host/expression vector combinations may be
employed in expressing the DNA sequences of this invention. Useful
expression vectors, for example, may consist of segments of
chromosomal, nonchromosomal and synthetic DNA sequences. Suitable
vectors include derivatives of SV40 and known bacterial plasmids,
e.g., Escherichia coli plasmids colE1, pCR1, pBR322, pMB9 and their
derivatives, plasmids such as RP4; phage DNAs, e.g., M13
derivatives, the numerous derivatives of phage .lamda., e.g.,
Agt11, and other phage DNA; yeast plasmids derived from the 2.mu.
circle; vectors useful in eukaryotic cells, such as insect or
mammalian cells; vectors derived from combinations of plasmids and
phage DNAs, such as plasmids that have been modified to employ
phage DNA or other expression control sequences; baculovirus
derivatives; and the like. For mammalian cells there are a number
of well-known expression vectors available to the art.
[0069] Any of a wide variety of expression control sequences may be
used in these vectors to express the DNA sequences of this
invention. Such useful expression control sequences include, for
example, the early and late promoters of SV40 or adenovirus for
expression in mammalian cells, the lac system, the trp system, the
tac or trc system, the major operator and promoter regions of phage
.lamda., the control regions of fd coat protein, the promoter for
3-phosphoglycerate kinase of phosphatase (e.g., pho5), the
promoters of the yeast .alpha.-mating factors, and other sequences
known to control the expression of genes of prokaryotic or
eukaryotic cells or their viruses, and various combinations
thereof. The skilled artisan understands which expression control
sequences are appropriate to particular vectors and host cells.
[0070] A wide variety of host cells are also useful in expressing
the DNA sequences of this invention. These hosts may include
well-known prokaryotic and eukaryotic hosts, such as strains of E.
coli, Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts,
and animal cells, such as Chinese Hamster Ovary (CHO), R1.1, B-W
and L-M cells, African Green Monkey kidney cells (e.g., COS 1,
COS-7, BSC1, BSC40, and BMT10), insect cells (e.g., Sf9), and human
cells and plant cells in culture.
[0071] It is understood that not all combinations of vector,
expression control sequence and host cell will function equally
well to express the DNA sequences of this invention. However, one
skilled in the art will be able to select the proper vector,
expression control sequence, and host cell combination without
undue experimentation to accomplish the desired expression without
departing from the scope of this invention.
[0072] In selecting a suitable expression control sequence, a
variety of factors will normally be considered. These include, for
example, the relative strength of the promoter, its
controllability, and its compatibility with the particular DNA
sequence or gene to be expressed, e.g., with regard to potential
secondary structure. Suitable hosts will be selected by
consideration of factors including compatibility with the chosen
vector, secretion characteristics, ability to fold proteins
correctly, and fermentation requirements, as well as any toxicity
to the host of the product encoded by the DNA sequences to be
expressed, and the ease of purification of the expression products.
The practitioner will be able to select the appropriate host cells
and expression mechanisms for a particular purpose.
[0073] Several strategies are available for the isolation and
purification of recombinant O-acetyltransferase after expression in
a host system. One method involves expressing the proteins in
bacterial cells, lysing the cells, and purifying the protein by
conventional means. Alternatively, one can engineer the DNA
sequences for secretion from cells. An O-acetyltransferase protein
can be readily engineered to facilitate purification and/or
immobilization to a solid support of choice. For example, a stretch
of 6-8 histidines can be engineered through polymerase chain
reaction or other recombinant DNA technology to allow purification
of expressed recombinant protein over a nickel-charged
nitrilotriacetic acid (NTA) column using commercially available
materials. Other oligopeptide "tags" which can be fused to a
protein of interest by such techniques include, without limitation,
strep-tag (Sigma-Genosys, The Woodlands, Tex.) which directs
binding to streptavidin or its derivative streptactin
(Sigma-Genosys); a glutathione-S-transferase gene fusion system
which directs binding to glutathione coupled to a solid support
(Amersham Pharmacia Biotech, Uppsala, Sweden); a calmodulin-binding
peptide fusion system which allows purification using a calmodulin
resin (Stratagene, La Jolla, Calif.); a maltose binding protein
fusion system allowing binding to an amylose resin (New England
Biolabs, Beverly, Mass.); and an oligo-histidine fusion peptide
system which allows purification using a Ni.sup.2+-NTA column
(Qiagen, Valencia, Calif.).
[0074] Coding sequences which are synonymous to the coding sequence
provided in SEQ ID NO:1 are within the scope of the present
invention, as are sequences encoding O-acetyltransferases carrying
out the same O-3 and O-4 acetylations of Neisseria meningitidis
capsular polysaccharides, and where those sequences encode an
O-acetyltransferases with at least 80% amino acid sequence identity
with that of SEQ ID NO:2. All integers between 80 and 100% are
included within the scope of the present invention in this context.
In calculations of amino acid sequence identify, gaps inserted to
optimize alignment are treated as mismatches.
[0075] O-acetyltransferase coding sequences from various N.
meningitidis strains have significant sequence homology to the
exemplified O-acetyltransferase coding sequences, and the encoded
enzymes have a high degree of amino acid sequence identity as
disclosed herein. It is obvious to one normally skilled in the art
that nonexemplified clones and PCR amplification products can be
readily isolated using standard procedures and the sequence
information provided herein. The ordinary skilled artisan can
utilize the exemplified sequences provided herein, or portions
thereof, preferably at least 25-30 bases in length, in
hybridization probes to identify cDNA (or genomic) clones encoding
O-acetyltransferase, where there is at least 70% sequence homology
to the probe sequence using appropriate art-known hybridization
techniques. The skilled artisan understands that the capacity of a
cloned cDNA to encode functional O-acetyltransferase enzyme can be
readily tested as taught herein.
[0076] Hybridization conditions appropriate for detecting various
extents of nucleotide sequence homology between probe and target
sequences and theoretical and practical consideration are given,
for example in B. D. Hames and S. J. Higgins (1985) Nucleic Acid
Hybridization, IRL Press, Oxford, and in Sambrook et al. (1989)
supra. Under particular hybridization conditions the DNA sequences
of this invention will hybridize to other DNA sequences having
sufficient homology, including homologous sequences from different
species. It is understood in the art that the stringency of
hybridization conditions is a factor in the degree of homology
required for hybridization. The skilled artisan knows how to
manipulate the hybridization conditions so that the stringency of
hybridization is at the desired level (high, medium, low). If
attempts to identify and isolate the O-acetyltransferase gene from
another N. meningitidis strain fail using high stringency
conditions, the skilled artisan will understand how to decrease the
stringency of the hybridization conditions so that a sequence with
a lower degree of sequence homology will hybridize to the sequence
used as a probe. The choice of the length and sequence of the probe
is readily understood by the skilled artisan.
[0077] The DNA sequences of this invention refer to DNA sequences
prepared or isolated using recombinant DNA techniques. These
include cDNA sequences, sequences isolated using PCR, DNA sequences
isolated from their native genome, and synthetic DNA sequences. As
used herein, this term is not intended to encompass
naturally-occurring chromosomes or genomes. These sequences can be
used to direct recombinant synthesis of O-acetyltransferase for
enzymatic acetylation of isolated capsular polysaccharide,
especially from N. meningitidis Serogroup A strains.
[0078] Isolated capsular polysaccharide is separated from the cells
and culture medium from which it was produced. Further purification
is optional and within the realm of the skilled artisan.
[0079] In the present context, an in vitro enzymatic reaction,
especially O-3 and O-4 acetylation of Serogroup A N. meningitides
capsular polysaccharide, is carried out in the absence of whole,
live cells. The enzyme source can be a purified or partly purified
enzyme or it can be present in a cell extract, recombinantly
produced or otherwise, although greater amounts per cell are
produced through recombinant DNA technology.
[0080] It is well-known in the biological arts that certain amino
acid substitutions can be made within a protein without affecting
the functioning of that protein. Preferably such substitutions are
of amino acids similar in size and/or charge properties. For
example, Dayhoff et al. (1978) in Atlas of Protein Sequence and
Structure, Volume 5, Supplement 3, Chapter 22, pages 345-352, which
is incorporated by reference herein, provides frequency tables for
amino acid substitutions which can be employed as a measure of
amino acid similarity. Dayhoff et al.'s frequency tables are based
on comparisons of amino acid sequences for proteins having the same
function from a variety of evolutionarily different sources.
[0081] It will be a matter of routine experimentation for the
ordinary skilled artisan to use the DNA sequence information
presented herein to optimize O-acetyltransferase expression in a
particular expression vector and cell line for a desired purpose. A
cell line genetically engineered to contain and express an
O-acetyltransferase coding sequence is useful for the recombinant
expression of protein products with the characteristic enzymatic
activity of the specifically exemplified enzyme. Any means known to
the art can be used to introduce an expressible O-acetyltransferase
coding sequence into a cell to produce a recombinant host cell,
i.e., to genetically engineer such a recombinant host cell.
Recombinant host cell lines which express high levels of
O-acetyltransferase are useful as sources for the purification of
this enzyme, especially for in vitro acetylation of isolated
capsular polysaccharides, desirably those from N. meningitidis
Serogroup A. The amino acids which occur in the various amino acid
sequences referred to in the specification have their usual three-
and one-letter abbreviations routinely used in the art: A, Ala,
Alanine; C, Cys, Cysteine; D, Asp, Aspartic Acid; E, Glu, Glutamic
Acid; F, Phe, Phenylalanine; G, Gly, Glycine; H, His, Histidine; I,
Ile, Isoleucine; K, Lys, Lysine; L, Leu, Leucine; M, Met,
Methionine; N, Asn, Asparagine; P, Pro, Proline; Q, Gin, Glutamine;
R, Arg, Arginine; S, Ser, Serine; T, Thr, Threonine; V, Val,
Valine; W, Try, Tryptophan; Y, Tyr, Tyrosine.
[0082] A protein is considered an isolated protein if it is a
protein isolated from a host cell in which it is recombinantly
produced. It can be purified or it can simply be free of other
proteins and biological materials with which it is associated in
nature.
[0083] An isolated nucleic acid is a nucleic acid the structure of
which is not identical to that of any naturally occurring nucleic
acid or to that of any fragment of a naturally occurring genomic
nucleic acid spanning more than three separate genes. The term
therefore covers, for example, a DNA which has the sequence of part
of a naturally occurring genomic DNA molecule but is not flanked by
both of the coding or noncoding sequences that flank that part of
the molecule in the genome of the organism in which it naturally
occurs; a nucleic acid incorporated into a vector or into the
genomic DNA of a prokaryote or eukaryote in a manner such that the
resulting molecule is not identical to any naturally occurring
vector or genomic DNA; a separate molecule such as a cDNA, a
genomic fragment, a fragment produced by polymerase chain reaction
(PCR), or a restriction fragment; and a recombinant nucleotide
sequence that is part of a hybrid gene, i.e., a gene encoding a
fusion protein. Specifically excluded from this definition are
nucleic acids present in mixtures of DNA molecules, transformed or
transfected cells, and cell clones, e.g., as these occur in a DNA
library such as a cDNA or genomic DNA library.
[0084] In the present context, a promoter is a DNA region which
includes sequences sufficient to cause transcription of an
associated (downstream) sequence. The promoter may be regulated,
i.e., not constitutively acting to cause transcription of the
associated sequence. If inducible, there are sequences present
which mediate regulation of expression so that the associated
sequence is transcribed only when an inducer molecule is present in
the medium in or on which the organism is cultivated.
[0085] One DNA portion or sequence is downstream of second DNA
portion or sequence when it is located 3' of the second sequence.
One DNA portion or sequence is upstream of a second DNA portion or
sequence when it is located 5' of that sequence.
[0086] One DNA molecule or sequence and another are heterologous to
another if the two are not derived from the same ultimate natural
source. The sequences may be natural sequences, or at least one
sequence can be designed by man, as in the case of a multiple
cloning site region. The two sequences can be derived from two
different species or one sequence can be produced by chemical
synthesis provided that the nucleotide sequence of the synthesized
portion was not derived from the same organism as the other
sequence.
[0087] An isolated or substantially pure nucleic acid molecule or
polynucleotide is an O-acetyltransferase-encoding polynucleotide
which is substantially separated from other polynucleotide
sequences which naturally accompany it on the N. meningitidis
chromosome. The term embraces a polynucleotide sequence which has
been removed from its naturally occurring environment, and includes
recombinant or cloned DNA isolates, chemically synthesized
analogues and analogues biologically synthesized by heterologous
systems.
[0088] A polynucleotide is said to encode a polypeptide if, in its
native state or when manipulated by methods known to those skilled
in the art, it can be transcribed and/or translated to produce the
polypeptide or a fragment thereof. The anti-sense strand of such a
polynucleotide is also said to encode the sequence.
[0089] A nucleotide sequence is operably linked when it is placed
into a functional relationship with another nucleotide sequence.
For instance, a promoter is operably linked to a coding sequence if
the promoter effects its transcription or expression. Generally,
operably linked means that the sequences being linked are
contiguous and, where necessary to join two protein coding regions,
contiguous and in reading frame. However, it is well known that
certain genetic elements, such as enhancers, may be operably linked
even at a distance, i.e., even if not contiguous.
[0090] The term recombinant polynucleotide refers to a
polynucleotide which is made by the combination of two otherwise
separated segments of sequence accomplished by the artificial
manipulation of isolated segments of polynucleotides by genetic
engineering techniques or by chemical synthesis. In so doing one
may join together polynucleotide segments of desired functions to
generate a desired combination of functions.
[0091] Polynucleotide probes include an isolated polynucleotide
attached to a label or reporter molecule and may be used to
identify and isolate other O-acetyltransferase coding sequences,
for example, those from others strains of N. meningitidis. Probes
comprising synthetic oligonucleotides or other polynucleotides may
be derived from naturally occurring or recombinant single or double
stranded nucleic acids or be chemically synthesized. Polynucleotide
probes may be labeled by any of the methods known in the art, e.g.,
random hexamer labeling, nick translation, or the Klenow fill-in
reaction, or with fluors or other detectable moieties.
[0092] Large amounts of the polynucleotides may be produced by
replication in a suitable host cell. Natural or synthetic DNA
fragments coding for a protein of interest are incorporated into
recombinant polynucleotide constructs, typically DNA constructs,
capable of introduction into and replication in a prokaryotic or
eukaryotic cell, especially cultured mammalian cells, wherein
protein expression is desired. Usually the construct is suitable
for replication in a host cell, such as cultured mammalian cell or
a bacterium, but a multicellular eukaryotic host may also be
appropriate, with or without integration within the genome of the
host cell. Commonly used prokaryotic hosts include strains of
Escherichia coli, although other prokaryotes, such as Bacillus
subtilis or a pseudomonad, may also be used. Eukaryotic host cells
include mammalian cells, yeast, filamentous fungi, plant, insect,
amphibian and avian cell lines. Such factors as ease of
manipulation, ability to appropriately glycosylate expressed
proteins, degree and control of recombinant protein expression,
ease of purification of expressed proteins away from cellular
contaminants or other factors influence the choice of the host
cell.
[0093] The polynucleotides may also be produced by chemical
synthesis, e.g., by the phosphoramidite method described by
Beaucage and Caruthers (1981) Tetra. Letts. 22: 1859-1862 or the
triester method according to Matteuci et al. (1981) J. Am. Chem.
Soc. 103: 3185, and may be performed on commercial automated
oligonucleotide synthesizers. A double-stranded fragment may be
obtained from the single stranded product of chemical synthesis
either by synthesizing the complementary strand and annealing the
strand together under appropriate conditions or by adding the
complementary strand using DNA polymerase with an appropriate
primer sequence. DNA constructs prepared for introduction into a
prokaryotic or eukaryotic host will typically comprise a
replication system (i.e. vector) recognized by the host, including
the intended DNA fragment encoding the desired polypeptide, and
will preferably also include transcription and translational
initiation regulatory sequences operably linked to the
polypeptide-encoding segment. Expression systems (expression
vectors) may include, for example, an origin of replication or
autonomously replicating sequence (ARS) and expression control
sequences, a promoter, an enhancer and necessary processing
information sites, such as ribosome-binding sites, RNA splice
sites, polyadenylation sites, transcriptional terminator sequences,
and mRNA stabilizing sequences. Signal peptides may also be
included where appropriate from secreted polypeptides of the same
or related species, which allow the protein to cross and/or lodge
in cell membranes or be secreted from the cell.
[0094] An appropriate promoter and other necessary vector sequences
will be selected so as to be functional in the host. Examples of
workable combinations of cell lines and expression vectors are
described in Sambrook et al. (1989) vide infra; Ausubel et al.
(Eds.) (1995) Current Protocols in Molecular Biology, Greene
Publishing and Wiley Interscience, New York; and Metzger et al.
(1988) Nature, 334: 31-36. Many useful vectors for expression in
bacteria, yeast, fungal, mammalian, insect, plant or other cells
are well known in the art and may be obtained from such vendors as
Stratagene, New England Biolabs, Promega Biotech, and others. In
addition, the construct may be joined to an amplifiable gene (e.g.,
DHFR) so that multiple copies of the gene may be made. For
appropriate enhancer and other expression control sequences, see
also Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor
Press, N.Y. (1983). While such expression vectors may replicate
autonomously, they may less preferably replicate by being inserted
into the genome of the host cell.
[0095] Expression and cloning vectors will likely contain a
selectable marker, that is, a gene encoding a protein necessary for
the survival or growth of a host cell transformed with the vector.
Although such a marker gene may be carried on another
polynucleotide sequence co-introduced into the host cell, it is
most often contained on the cloning vector. Only those host cells
into which the marker gene has been introduced will survive and/or
grow under selective conditions. Typical selection genes encode
proteins that (a) confer resistance to antibiotics or other toxic
substances, e.g., ampicillin, neomycin, methotrexate, etc.; (b)
complement auxotrophic deficiencies; or (c) supply critical
nutrients not available from complex media. The choice of the
proper selectable marker will depend on the host cell; appropriate
markers for different hosts are known in the art.
[0096] Recombinant host cells, in the present context, are those
which have been genetically modified to contain an isolated DNA
molecule of the instant invention. The DNA can be introduced by any
means known to the art which is appropriate for the particular type
of cell, including without limitation, transfection,
transformation, lipofection or electroporation.
[0097] It is recognized by those skilled in the art that the DNA
sequences may vary due to the degeneracy of the genetic code and
codon usage. All (synonymous) DNA sequences which code for the
O-acetyltransferase protein are included in this invention,
including the DNA sequence as given in FIG. 8A. Also contemplated
are coding sequences which encode an O-acetyltransferase as taught
herein with at least 80% amino acid sequence identity to that of
SEQ ID NO:2.
[0098] Additionally, it will be recognized by those skilled in the
art that allelic variations may occur in the DNA sequences which
will not significantly change activity of the amino acid sequences
of the peptides which the DNA sequences encode. All such equivalent
DNA sequences are included within the scope of this invention and
the definition of the regulated promoter region. The skilled
artisan will understand that the sequence of the exemplified
O-acetyltransferase protein and the nucleotide sequence encoding it
can be used to identify and isolate additional, nonexemplified
nucleotide sequences which are functionally equivalent to the
sequences given FIG. 8A.
[0099] Hybridization procedures are useful for identifying
polynucleotides with sufficient homology to the subject coding
sequence to be useful as taught herein. The particular
hybridization technique is not essential to the subject invention.
As improvements are made in hybridization techniques, they can be
readily applied by one of ordinary skill in the art.
[0100] A probe and sample are combined in a hybridization buffer
solution and held at an appropriate temperature until annealing
occurs. Thereafter, the membrane is washed free of extraneous
materials, leaving the sample and bound probe molecules typically
detected and quantified by autoradiography and/or liquid
scintillation counting. As is well known in the art, if the probe
molecule and nucleic acid sample hybridize by forming a strong
non-covalent bond between the two molecules, it can be reasonably
assumed that the probe and sample are essentially identical, or
completely complementary if the annealing and washing steps are
carried out under conditions of high stringency. The probe's
detectable label provides a means for determining whether
hybridization has occurred.
[0101] In the use of the oligonucleotides or polynucleotides as
probes, the particular probe is labeled with any suitable label
known to those skilled in the art, including radioactive and
non-radioactive labels. Typical radioactive labels include
.sup.32P, .sup.35S, or the like. Non-radioactive labels include,
for example, ligands such as biotin or thyroxine, as well as
enzymes such as hydrolases or peroxidases, or a chemiluminescent
reagent such as luciferin, or fluorescent compounds like
fluorescein and its derivatives. Alternatively, the probes can be
made inherently fluorescent as described in International
Application No. WO 93/16094.
[0102] Various degrees of stringency of hybridization can be
employed. The more stringent the conditions, the greater the
complementarity that is required for duplex formation. Stringency
can be controlled by temperature, probe concentration, probe
length, ionic strength, time, and the like. Preferably,
hybridization is conducted under moderate to high stringency
conditions by techniques well know in the art, as described, for
example in Keller, G. H., M. M. Manak (1987) DNA Probes, Stockton
Press, New York, N.Y., pp. 169-170, hereby incorporated by
reference.
[0103] As used herein, moderate to high stringency conditions for
hybridization are conditions which are particularly advantageous.
An example of high stringency conditions are hybridizing at
68.degree. C. in 5.times.SSC/5.times. Denhardt's solution/0.1% SDS,
and washing in 0.2.times.SSC/0.1% SDS at room temperature. An
example of conditions of moderate stringency are hybridizing at
68.degree. C. in 5.times.SSC/5.times. Denhardt's solution/0.1% SDS
and washing at 42.degree. C. in 3.times.SSC. The parameters of
temperature and salt concentration can be varied to achieve the
desired level of sequence identity between probe and target nucleic
acid. See, e.g., Sambrook et al. (1989) vide infra or Ausubel et
al. (1995) Current Protocols in Molecular Biology, John Wiley &
Sons, NY, N.Y., for further guidance on hybridization
conditions.
[0104] Specifically, hybridization of immobilized DNA in Southern
blots with .sup.32P_labeled gene specific probes is performed
according to standard methods (Maniatis et al.) In general,
hybridization and subsequent washes were carried out under moderate
to high stringency conditions that allowed for detection of target
sequences with homology to the exemplified sequence. For
double-stranded DNA gene probes, hybridization can be carried out
overnight at 20-25.degree. C. below the melting temperature (Tm) of
the DNA hybrid in 6.times.SSPE 5.times. Denhardt's solution, 0.1%
SDS, 0.1 mg/ml denatured DNA. The melting temperature is described
by the following formula (Beltz, G. A., Jacobe, T. H., Rickbush, P.
T., Chorbas, and F. C. Kafatos (1983) Methods of Enzymology, R. Wu,
L, Grossman and K Moldave (eds) Academic Press, New York
100:266-285).
[0105] Tm=81.5.degree. C.+16.6 Log[Na+]+0.41(+G+C)-0.61(%
formamide)-600/length of duplex in base pairs.
[0106] Washes are typically carried out as follows: twice at room
temperature for 15 minutes in 1.times.SSPE, 0.1% SDS (low
stringency wash), and once at TM-20.degree. C. for 15 minutes in
0.2.times.SSPE, 0.1% SDS (moderate stringency wash).
[0107] For oligonucleotide probes, hybridization is carried out
overnight at 10-20.degree. C. below the melting temperature (Tm) of
the hybrid 6.times.SSPE, 5.times. Denhardt's solution, 0.1% SDS,
0.1 mg/ml denatured DNA. Tm for oligonucleotide probes is
determined by the following formula: TM(.degree. C.)=2(number T/A
base pairs+4(number G/C base pairs) (Suggs, S. V. et al. (1981)
ICB-UCLA Symp. Dev. Biol. Using Purified Genes, D. D. Brown (ed.),
Academic Press, New York, 23:683-693).
[0108] Washes are typically carried out as follows: twice at room
temperature for 15 minutes 1.times.SSPE, 0.1% SDS (low stringency
wash), and once at the hybridization temperature for 15 minutes in
1.times.SSPE, 0.1% SDS (moderate stringency wash).
[0109] In general, salt and/or temperature can be altered to change
stringency. With a labeled DNA fragment >70 or so bases in
length, the following conditions can be used: Low, 1 or
2.times.SSPE, room temperature; Low, 1 or 2.times.SSPE, 42.degree.
C.; Moderate, 0.2.times. or 1.times.SSPE, 65.degree. C.; and High,
0.1.times.SSPE, 65.degree. C.
[0110] Duplex formation and stability depend on substantial
complementarity between the two strands of a hybrid, and, as noted
above, a certain degree of mismatch can be tolerated. Therefore,
the probe sequences of the subject invention include mutations
(both single and multiple), deletions, insertions of the described
sequences, and combinations thereof, wherein said mutations,
insertions and deletions permit formation of stable hybrids with
the target polynucleotide of interest. Mutations, insertions, and
deletions can be produced in a given polynucleotide sequence in
many ways, and those methods are known to an ordinarily skilled
artisan. Other methods may become known in the future.
[0111] Thus, mutational, insertional, and deletional variants of
the disclosed nucleotide sequences can be readily prepared by
methods which are well known to those skilled in the art. These
variants can be used in the same manner as the exemplified primer
sequences so long as the variants have substantial sequence
homology with the original sequence. As used herein, substantial
sequence homology refers to homology which is sufficient to enable
the variant polynucleotide to function in the same capacity as the
polynucleotide from which the probe was derived. Preferably, this
homology is greater than 80%, more preferably, this homology is
greater than 85%, even more preferably this homology is greater
than 90%, and most preferably, this homology is greater than 95%.
The degree of homology or identity needed for the variant to
function in its intended capacity depends upon the intended use of
the sequence. It is well within the skill of a person trained in
this art to make mutational, insertional, and deletional mutations
which are equivalent in function or are designed to improve the
function of the sequence or otherwise provide a methodological
advantage.
[0112] Polymerase Chain Reaction (PCR) is a repetitive, enzymatic,
primed synthesis of a nucleic acid sequence. This procedure is well
known and commonly used by those skilled in this art (see, e.g.,
Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki
et al. (1985) Science 230:1350-1354). PCR is based on the enzymatic
amplification of a DNA fragment of interest that is flanked by two
oligonucleotide primers that hybridize to opposite strands of the
target sequence. The primers are oriented with the 3' ends pointing
towards each other. Repeated cycles of heat denaturation of the
template, annealing of the primers to their complementary
sequences, and extension of the annealed primers with a DNA
polymerase result in the amplification of the segment defined by
the 5' ends of the PCR primers. Since the extension product of each
primer can serve as a template for the other primer, each cycle
essentially doubles the amount of DNA template produced in the
previous cycle. This results in the exponential accumulation of the
specific target fragment, up to several million-fold in a few
hours. By using a thermostable DNA polymerase such as the Taq
polymerase, which is isolated from the thermophilic bacterium
Thermus aquaticus, the amplification process can be completely
automated. Other enzymes which can be used are known to those
skilled in the art.
[0113] It is well known in the art that the polynucleotide
sequences of the present invention can be truncated and/or mutated
such that certain of the resulting fragments and/or mutants of the
original full-length sequence can retain the desired
characteristics of the full-length sequence. A wide variety of
restriction enzymes which are suitable for generating fragments
from larger nucleic acid molecules are well known. In addition, it
is well known that Bal31 exonuclease can be conveniently used for
time-controlled limited digestion of DNA. See, for example,
Maniatis (1982) Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory, New York, pages 135-139, incorporated herein by
reference. See also Wei et al. (1983 J. Biol. Chem.
258:13006-13512. By use of Ba/31 exonuclease (commonly referred to
as "erase-a-base" procedures), the ordinarily skilled artisan can
remove nucleotides from either or both ends of the subject nucleic
acids to generate a wide spectrum of fragments which are
functionally equivalent to the subject nucleotide sequences. One of
ordinary skill in the art can, in this manner, generate hundreds of
fragments of controlled, varying lengths from locations all along
the original O-acetyltransferase coding sequence. The ordinarily
skilled artisan can routinely test or screen the generated
fragments for their characteristics and determine the utility of
the fragments as taught herein. It is also well known that the
mutant sequences of the full length sequence, or fragments thereof,
can be easily produced with site directed mutagenesis. See, for
example, Larionov, O. A. and Nikiforov, V. G. (1982) Genetika
18(3):349-59; Shortle, D, DiMaio, D., and Nathans, D. (1981) Annu.
Rev. Genet. 15:265-94; both incorporated herein by reference. The
skilled artisan can routinely produce deletion-, insertion-, or
substitution-type mutations and identify those resulting mutants
which contain the desired characteristics of the full length
wild-type sequence, or fragments thereof, i.e., those which retain
O-acetyltransferase activity as determined herein.
[0114] DNA sequences having at least 80, 90, or at least 95% (and
all integers and ranges between 80 and 100%) identity to the
recited DNA sequence of FIG. 8A and functioning to encode an
O-acetyltransferase protein are within the scope of this invention.
Such functional equivalents are included in the definition of an
O-acetyltransferase coding sequence. Following the teachings herein
and using knowledge and techniques well known in the art, the
skilled worker will be able to make a large number of operative
embodiments having equivalent DNA sequences to those listed herein
without the expense of undue experimentation.
[0115] As used herein percent sequence identity of two nucleic
acids is determined using the algorithm of Altschul et al. (1997)
Nucl. Acids Res. 25: 3389-3402; see also Karlin and Altschul (1990)
Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and
Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an
algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215:402-410. BLAST nucleotide
searches are performed with the NBLAST program, score=100,
wordlength=12, to obtain nucleotide sequences with the desired
percent sequence identity. To obtain gapped alignments for
comparison purposes, Gapped BLAST is used as described in Altschul
et al. (1997) Nucl. Acids. Res. 25:3389-3402. When utilizing BLAST
and Gapped BLAST programs, the default parameters of the respective
programs (NBLAST and XBLAST) are used. See the National Center for
Biotechnology Information on the internet.
[0116] In another embodiment, immunogenic compositions for
producing polyclonal and/or monoclonal antibodies capable of
specifically binding to O-acetyltransferase, O-3 and or O-4
acetylated capsular polysaccharide from N. meningitidis, especially
Serogroup A, (or fragments thereof) are provided. The term antibody
is used to refer both to a homogenous molecular entity and a
mixture such as a serum product made up of a plurality of different
molecular entities. Monoclonal or polyclonal antibodies, preferably
monoclonal, specifically reacting with a particular epitope in a
molecule of interest may be made by methods known in the art. See,
e.g., Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold
Spring Harbor Laboratories; Goding (1986) Monoclonal Antibodies:
Principles and Practice, 2d ed., Academic Press, New York; and
Ausubel et al. (1993) supra. Also, recombinant immunoglobulins may
be produced by methods known in the art, including but not limited
to, the methods described in U.S. Pat. No. 4,816,567, incorporated
by reference herein. Monoclonal antibodies with affinities of
10.sup.8 M.sup.-1, preferably 10.sup.9 to 10.sup.10 or more are
preferred.
[0117] Antibodies generated against a molecule of interest are
useful, for example, as probes for screening DNA expression
libraries or for detecting the presence of particular neisserial
strains or their isolated capsular polysaccharides in a test
sample. Hydrophilic regions of the O-acetyltransferase of the
present invention can be identified by the skilled artisan, and
peptide antigens can be synthesized and conjugated to a suitable
carrier protein (e.g., bovine serum albumin or keyhole limpet
hemocyanin) for use in vaccines or in raising antibody specific for
LOS biosynthetic proteins. Frequently, the polypeptides and
antibodies will be labeled by joining, either covalently or
noncovalently, a substance which provides a detectable signal.
Suitable labels include but are not limited to radionuclides,
enzymes, substrates, cofactors, inhibitors, fluorescent agents,
chemiluminescent agents, magnetic particles and the like. United
States Patents describing the use of such labels include but are
not limited to Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345;
4,277,437; 4,275,149; and 4,366,241.
[0118] Antibodies specific for the O-3 and/or O-4 acetylated
capsular polysaccharide from N. meningitidis are useful in
preventing disease resulting from neisseriae, especially N.
meningitidis infections. Such antibodies can be obtained by the
methods described above. Because there is some loss of acetyl
residues during isolation of the capsular polysaccharide and
because there is some loss of immunogenicity of an unacetylated or
a poorly acetylated capsular polysaccharide, the quality of a N.
meningitidis capsular polysaccharide-containing immunogenic
composition, it is advantageous to treat a capsular polysaccharide
preparation with the O-acetyltransferase of the present invention
prior to use in immunogenic compositions, including vaccine
compositions.
[0119] Compositions and immunogenic preparations, including vaccine
compositions comprising in vitro acetylated capsular polysaccharide
from N. meningitidis, especially Serogroup A N. meningitides, and a
suitable carrier therefor are provided. Immunogenic compositions
are those which result in specific antibody production when
injected into a human or an animal. Such immunogenic compositions
are useful, for example, in immunizing a human, against infection
by neisserial pathogenic strains, especially those of Serogroup A
N. meningitidis. The immunogenic preparations comprise an
immunogenic amount of an in vitro acetylated capsular
polysaccharide preparation derived from a N. meningitidis strain,
especially Serogroup A, and a suitable carrier.
[0120] The immunogenic compositions advantageously further comprise
lipooligosaccharide(s), proteins and/or neisserial cells of
Serogroup A N. meningitidis and optionally, one or more other
serological types, including but not limited to any known to the
art. It is understand that where whole cells are formulated into
the immunogenic composition, the cells are preferably inactivated,
especially if the cells are of a virulent strain. Such immunogenic
compositions may comprise one or more LOS preparations, or another
protein or other immunogenic cellular component. By "immunogenic
amount" is meant an amount capable of eliciting the production of
antibodies directed against neisserial capsular polysaccharides in
an animal or human to which the vaccine or immunogenic composition
has been administered.
[0121] Immunogenic carriers may be used to enhance the
immunogenicity of a component of the immunogenic composition as
known to the art. Such carriers include, but are not limited to,
proteins and polysaccharides, liposomes, and bacterial cells and
membranes. Protein carriers may be joined to the molecule(s) of
interest to form fusion proteins by recombinant or synthetic means
or by chemical coupling. Useful carriers and means of coupling such
carriers to polypeptide antigens are known in the art. The art
knows how to administer immunogenic compositions so as to generate
protective immunity on the mucosal surfaces of the upper
respiratory system, especially the mucosal epithelium of the
nasopharynx, where immunity is specific for N. meningitidis, as
well as protecting other parts of the body.
[0122] The immunogenic compositions of the present invention may be
formulated by any of the means known in the art. Such vaccines are
typically prepared as injectables, either as liquid solutions or
suspensions. Solid forms suitable for solution in, or suspension
in, liquid prior to injection may also be prepared. The preparation
may also, for example, be emulsified, or the protein encapsulated
in liposomes.
[0123] The active immunogenic ingredients are often mixed with
excipients or carriers which are pharmaceutically acceptable and
compatible with the active ingredient. Suitable excipients include
but are not limited to water, saline, dextrose, glycerol, ethanol,
or the like and combinations thereof. The concentration of the
immunogenic polypeptide in injectable formulations is usually in
the range of 0.2 to 5 mg/ml.
[0124] In addition, if desired, the vaccines may contain minor
amounts of auxiliary substances such as wetting or emulsifying
agents, pH buffering agents, and/or adjuvants which enhance the
effectiveness of the vaccine. Examples of adjuvants which may be
effective include but are not limited to: aluminum hydroxide;
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP);
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred
to as nor-MDP);
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-s-
n-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A referred
to as MTP-PE); and RIBI, which contains three components extracted
from bacteria, monophosphoryl lipid A, trehalose dimycolate and
cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80
emulsion. The effectiveness of an adjuvant may be determined by
measuring the amount of antibodies directed against the immunogen
resulting from administration of the immunogen in vaccines which
are also comprised of the various adjuvants. Such additional
formulations and modes of administration as are known in the art
may also be used.
[0125] In vitro acetylated capsular polysaccharide from N.
meningitidis and advantageously containing cells of N. meningitidis
may be formulated into immunogenic compositions as neutral or salt
forms. Preferably, when cells are used they are of attenuated or
avirulent strains, or the cells are killed before use.
Pharmaceutically acceptable salts include but are not limited to
the acid addition salts (formed with free amino groups of the
peptide) which are formed with inorganic acids, e.g., hydrochloric
acid or phosphoric acids; and organic acids, e.g., acetic, oxalic,
tartaric, or maleic acid. Salts formed with the free carboxyl
groups may also be derived from inorganic bases, e.g., sodium,
potassium, ammonium, calcium, or ferric hydroxides, and organic
bases, e.g., isopropylamine, trimethylamine, 2-ethylamino-ethanol,
histidine, and procaine.
[0126] The immunogenic preparations of the present invention are
administered in a manner compatible with the dosage formulation,
and in such amount as will be prophylactically and/or
therapeutically effective. The quantity to be administered, which
is generally in the range of about 100 to 1,000 .mu.g of in vitro
acetylated polysaccharide per dose, more generally in the range of
about 1 to 500 .mu.g per dose, depends on the subject to be
treated, the capacity of the individual's immune system to
synthesize antibodies, and the degree of protection desired.
Precise amounts of the active ingredient required to be
administered may depend on the judgment of the physician and may be
peculiar to each individual, but such a determination is within the
skill of such a practitioner.
[0127] The vaccine or other immunogenic composition may be given in
a single dose or multiple dose schedule. A multiple dose schedule
is one in which a primary course of vaccination may include 1 to 10
or more separate doses, followed by other doses administered at
subsequent time intervavb Is as required to maintain and or
reinforce the immune response, e.g., at 1 to 4 months for a second
dose, and if needed, a subsequent dose(s) after several months.
[0128] As used herein, "comprising" is synonymous with "including,"
"containing," or "characterized by," and is inclusive or open-ended
and does not exclude additional, unrecited elements or method
steps. As used herein, "consisting of" excludes any element, step,
or ingredient not specified in the claim element. As used herein,
"consisting essentially of" does not exclude materials or steps
that do not materially affect the basic and novel characteristics
of the claim. Any recitation herein of the term "comprising",
particularly in a description of components of a composition or in
a description of elements of a device, is understood to encompass
those compositions and methods consisting essentially of and
consisting of the recited components or elements. The invention
described herein may be practiced in the absence of any element or
elements, limitation or limitations which is not specifically
disclosed herein, provided that there would be no anticipation by
or obviousness over prior art.
[0129] The terms and expressions which have been employed are used
as terms of description and not of limitation, and there is no
intention that in the use of such terms and expressions of
excluding any equivalents of the features shown and described or
portions thereof, but it is recognized that various modifications
are possible within the scope of the invention claimed. Thus, it
should be understood that although the present invention has been
specifically disclosed by preferred embodiments and optional
features, modification and variation of the concepts herein
disclosed may be resorted to by those skilled in the art, and that
such modifications and variations are considered to be within the
scope of this invention as defined by the appended claims.
[0130] In general the terms and phrases used herein have their
art-recognized meaning, which can be found by reference to standard
texts, journal references and contexts known to those skilled in
the art. The following definitions are provided to clarify their
specific use in the context of the invention. Changes therein and
other uses will occur to those skilled in the art, which are
encompassed within the spirit of the invention, are defined by the
scope of the claims.
[0131] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the invention pertains, and all references cited herein
are hereby incorporated by reference to the extent that there is no
inconsistency with the present specification.
[0132] Monoclonal or polyclonal antibodies, preferably monoclonal,
specifically reacting with a polypeptide or protein of interest may
be made by methods known in the art. See, e.g., Harlow and Lane
(1988) Antibodies: A Laboratory Manual, Cold Spring Harbor
Laboratories; Goding (1986) Monoclonal Antibodies: Principles and
Practice, 2d ed., Academic Press, New York; and Ausubel et al.
(1993) Current Protocols in Molecular Biology, Wiley Interscience,
New York, N.Y.
[0133] Standard techniques for cloning, DNA isolation,
amplification and purification, for enzymatic reactions involving
DNA ligase, DNA polymerase, restriction endonucleases and the like,
and various separation techniques are those known and commonly
employed by those skilled in the art. A number of standard
techniques are described in Sambrook et al. (1989) Molecular
Cloning, Second Edition, Cold Spring Harbor Laboratory, Plainview,
N.Y.; Maniatis et al. (1982) Molecular Cloning, Cold Spring Harbor
Laboratory, Plainview, N.Y.; Wu (ed.) (1993) Meth. Enzymol. 218,
Part I; Wu (ed.) (1979) Meth. Enzymol. 68; Wu et al. (eds.) (1983)
Meth. Enzymol. 100 and 101; Grossman and Moldave (eds.) Meth.
Enzymol. 65; Miller (ed.) (1972) Experiments in Molecular Genetics,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Old and
Primrose (1981) Principles of Gene Manipulation, University of
California Press, Berkeley; Schleif and Wensink (1982) Practical
Methods in Molecular Biology; Glover (ed.) (1985) DNA Cloning Vol.
I and II, IRL Press, Oxford, UK; Hames and Higgins (eds.) (1985)
Nucleic Acid Hybridization, IRL Press, Oxford, UK; Setlow and
Hollaender (1979) Genetic Engineering: Principles and Methods,
Vols. 1-4, Plenum Press, New York; and Ausubel et al. (1992)
Current Protocols in Molecular Biology, Greene/Wiley, New York,
N.Y. Abbreviations and nomenclature, where employed, are deemed
standard in the field and commonly used in professional journals
such as those cited herein.
[0134] The specifically exemplified compounds and methods and
accessory methods described herein are representative of particular
embodiments of the present invention; they are not intended to
limit the scope of the invention. Thus, additional embodiments are
within the scope of the invention and within the following
claims.
EXAMPLES
Example 1
Materials and Bacterial Strains
[0135] Bacterial strains, plasmids and primers used in this study
are described in Table 1. The serogroup A meningococcal strains
were originally isolated during an outbreak in Nairobi, Kenya in
1989 (12) and were provided by the Centers for Disease Control and
Prevention (CDC), Atlanta, Ga. Strain F8229 (CDC1750) is
encapsulated and was isolated from the cerebrospinal fluid of a
patient with meningitis. Strain F8239 (CDC16N3) is an
unencapsulated variant originally isolated as a serogroup A strain
from the pharynx of an asymptomatic carrier. These strains belong
to clonal group III-I and are closely related to strains that have
caused epidemics in Saudi Arabia, Chad, Ethiopia and other parts of
the world.
[0136] Monoclonal antibody 14-1-A (13) against meningococcal
serogroup A capsular polysaccharide was provided by Dr. Wendell
Zollinger, Walter Reed Army Institute of Research.
[0137] Restriction enzymes were purchased from New England Biolabs
(Beverly, Mass.). Ni-NTA agarose gravity flow matrix and the
Anti-Penta-His monoclonal antibodies were purchased from Qiagen
Inc. (Valencia, Calif.). The B-PER 6X-His Fusion protein
purification kit was purchased from Pierce (Rockford, Ill.).
.sup.14C-labeled acetyl coenzyme A was purchased from Sigma (St.
Louis, Mo.). Automated DNA sequence analysis was performed with the
Prism Dye-Deoxy Terminator Cycle Sequencing Kit (Applied
Biosystems, Foster City, Calif.), and completed reactions were run
on an ABI model 377 automated DNA sequencer.
Example 2
Growth Conditions
[0138] Meningococcal strains were grown with 3.5% CO2 at 37.degree.
C. on GC base agar (Difco, Detroit, Mich.), supplemented with 0.4%
glucose and 0.68 mM Fe (NO3).sub.3, or in GC broth containing the
same supplements and 0.043% NaHCO3. BHI medium (37 g/liter brain
heart infusion) with 1.25% fetal bovine serum was used when
kanamycin selection was required. Antibiotic concentrations (in
.mu.g/ml) used for E. coli strains were ampicillin, 100, kanamycin,
50, and erythromycin, 300; and for N. meningitidis were kanamycin,
80, spectinomycin, 60, erythromycin, 3. E. coli DH5.alpha. strain,
cultured on Luria Bertani (LB) medium, was used for cloning and
propagation of plasmids. Meningococci were transformed by the
procedure of Janik et al. (14). E. coli strains were transformed by
electroporation (Gene-pulser Bio-Rad, Hercules, Calif., according
to the manufacturer's protocol).
Example 3
Construction of Meningococcal mynC Nonpolar Mutant NmA001
[0139] An internal 745-bp fragment of mynC, produced by PCR
amplification using primers SE57 and SE61 (11) and the chromosomal
DNA of strain F8229 as a template, was cloned into pCR2.1 to yield
pGS201. The aphA-3 fragment obtained from pUC18K with EcoR I and
HinC II digestion and filled in with Klenow polymerase was inserted
into the unique Sspl site of mynC in pGS201 to generate pGS202. The
correct orientation of aphA-3 was confirmed by colony PCR and
direct sequencing analysis of pGS202. A ScaI-linearized pGS202
plasmid was used to transform serogroup A meningococcal strain
F8229 to generate NmA001. The correct homologous recombination of
the aphA-3 cassette into the mynC coding sequence was confirmed by
PCR with cassette-specific primers and chromosomal-specific
primers.
Example 4
Overexpression and Purification of Meningococcal MynC
[0140] The complete coding sequence of mynC was obtained by PCR
amplification using SG005 (NdeI) and SG0061 (XhoI) primers (Table
1). The PCR product, digested with NdeI and XhoI, was subsequently
cloned into pET20b(+) cut with the same enzymes to yield pGS203
that resulted in a C-terminal (His).sub.6 fusion. pGS203 plasmid
was purified and subjected to DNA sequence analysis to confirm the
intact mynC sequence and the C-terminal His tag fusion. pGS203 was
then transformed into the E. coli expression strain BLR21 (DE3)
pLysS. One liter of LB culture of the MynC overexpression strain
was induced with 1 mM IPTG for 5 h. The harvested cells were
resuspended in 15 ml of lysis buffer (50 mM sodium phosphate, pH
8.0; 300 mM NaCl; 10 mM imidazole; 1% (v/v final concentration)
Tween 20, 1 mM phenylmethylsulfonyl fluoride and 1 mg/ml lysozyme)
left on ice for 30 min and sonicated 10 times for 30 s with 30 s
cooling intervals. The cell debris was removed by centrifugation at
14,000.times.g for 15 min at 4.degree. C. The over-expressed
protein was purified under native conditions on Ni-NTA
(nickel-nitrilotriacetic acid) (Qiagen) matrices following the
supplier's protocol with modification in column washing. Briefly,
the crude extract was incubated with 2 ml of 50% suspension of
Ni-NTA agarose for 1 h before packing into a column. The column was
washed with 5 ml each of 10, 20 and 40 mM imidazole in lysis buffer
(wash 1, wash 2 and wash 3, respectively) and then eluted with 5 ml
of 250 mM imidazole containing buffer. The MynC protein was also
extracted and purified, using a Pierce B-PER protein extraction kit
(15), containing a lysis reagent with a mild nonionic detergent in
20 mM Tris.HCl (pH 7.5), following the manufacturer's instructions.
The purified MynC fractions of either methods were concentrated
separately by Centricon YM-3 centrifugal filters (Millipore
Corporation, Bedford, Mass.) after SDS-PAGE analysis and dialyzed
in storage buffer (50 mM HEPES, pH 7.05, 5 mM MgCl.sub.2, 100 mM
NaCl and 1 mM EDTA). The protein concentration was determined with
BCA protein assay kit (Pierce, Rockford, Ill.) using BSA as the
standard.
Example 5
Complementation of the NmA001 Mutant
[0141] An intact copy of mynC coding sequence under the control of
the tac promoter was constructed on a meningococcal shuttle vector.
Full-length mync with a C-terminal His tag was amplified from
pGS203 using primers SG007 (HindIII) and SG008 (EcoRI) (Table1).
The amplified PCR product was cloned in pCR 2.1 to yield pGS204.
The mynC insert was subsequently released from pGS204 with HindIII
and EcoRV digestion and ligated into the HindIII and SmaI sites of
pFlag-CTC to generate pGS205, with mynC under the control of the
lac promoter. The construct was confirmed by PCR using YT79 and
YT80 vector-specific primers. The pGS205 plasmid was then cut with
BglI, filled in with Klenow, and ligated into the EcoRV site of the
meningococcal shuttle vector, pYT250 (Erm.sup.R), yielding pGS206.
The pGS206 construct was methylated with HaeIII methylase and the
reaction mixture used directly to transform the wild type strain
F8229 and the mynC nonpolar mutant NmA001, yielding NmAwtc1 and
NmAnpc1, respectively.
Example 6
Meningococcal Membrane and Cytosolic Preparations
[0142] Meningococcal membranes and cytosols were separated by the
method of Clark et al. (16) from the mynC-complemented
meningococcal strain NmAnpc1. Briefly, the 500 ml culture pellet of
NmAnpc1 carrying pGS205 (mynC), induced overnight with 1 mM IPTG,
was used to produce the inner and outer membrane and cytosol
preparations. The pellet was suspended in 2 ml of lysis buffer (1
mM EDTA, 50 mM Tris, 20% sucrose, pH 8.0 with 1 mg/ml lysozyme) and
incubated for 30 min at 4.degree. C. Spheroplasts were diluted with
20 ml Tris buffer and were sonicated for three times, each for 30
seconds, in an ice bath with 30 second resting intervals. The cell
debris was removed by centrifuging at 10K for 15 min at 4.degree.
C. The supernatant was freeze-thawed once at -70.degree. C. before
ultracentrifugation at 100,000.times.g for 90 min at 4.degree. C.
The pellet, containing the meningococcal membrane fraction, was
washed with Tris buffer. The level of contamination of membrane
fraction with cytoplasmic components was assessed by determining
the activity of the cytoplasmic enzyme malate dehydrogenase (17)
for both fractions. The membrane fractions were 97-98% pure. The
cytosolic proteins were precipitated using 5% trichloroacetic acid
and suspended in 2 ml of 1 M Tris (pH 6.8). Total membrane was
solubilized with 2 ml of 2% N-lauroylsarcosine (sarcosyl) in 10 mM
HEPES buffer pH 7.4 and stabilized for 1 h at room temperature
using an orbital shaker.
[0143] Soluble inner membrane components and insoluble outer
membrane components were separated by ultracentrifugation at
100,000.times.g for 2 h at 4.degree. C. The outer membrane pellet
was suspended in 500 .mu.l of 1M Tris (pH 6.8). The diluted inner
membrane components were precipitated using 5% trichloroacetic
acid, and the pellet thus obtained was suspended in 500 .mu.l of 1
M Tris (pH 6.8). Sub-cellular fractions were loaded on PAGE gels
based on a set amount of starting 500 ml cell culture pellet
(.about.1.times.10.sup.11 cells) and analyzed by western blots.
[0144] Membrane solubilization experiments were performed as
described (18). Briefly, the membrane pellets were extracted with 5
ml of phosphate buffer (pH 7.6) containing 0.2 mM dithiothreitol,
20% sucrose, 0.2 M KCl, and either 1% Triton X-100, 1 M NaCl, or 6
M urea for 30 min at room temperature (urea), at 30.degree. C.
(Tx-100), or on ice (buffer alone, buffer with NaCl). Samples were
centrifuged for 1 h at 130,000.times.g (4.degree. C.) after the
extraction. Proteins in the soluble fractions were precipitated
using 5% trichloroacetic acid, and the precipitates obtained were
washed two times in acetone, dried and re-suspended in 1M Tris (pH
6.8) before an equal volume of 2.times.SDS-PAGE sample buffer was
added.
Example 7
CPS Extraction and Structural Characterization
[0145] Capsular polysaccharide was extracted from two liters of
meningococcal cultures using the method of Gotschlich et al. (19).
Briefly, the overnight cultures were treated with a final
concentration of 1% Cetavlon, a polycationic detergent that
precipitates the polyanionic polysaccharides. The precipitate was
collected by centrifugation and resuspended in water, and
CaCl.sub.2 was then added to a final concentration of 1 mM in order
to separate the polysaccharide from the detergent. Nucleic acids
were precipitated from the solution by adding 25% (v/v) of ethanol
followed by centrifugation. CPS in the supernatant was subsequently
precipitated using ethanol at a final concentration of 80% (v/v).
Contaminating protein, traces of Cetavlon and other low molecular
weight contaminants were removed with proteinase K digestion and
extensive dialysis against a buffer composed of 10% ethanol, 50 mM
NaCl, 5 mM Tris. CPS was further purified using a Sephacryl 200
(gel filtration) column with 50 mM ammonium formate elution. Column
fractions were tested for neutral sugar using the phenol sulfuric
acid assay (20). Void volume fractions were pooled and concentrated
by speed vacuuming and analyzed by DOC-PAGE and Alcian blue
staining (21).
Example 8
Compositional and NMR Analysis of Capsular Polysaccharides
[0146] Compositional analysis of purified CPS was performed on the
alditol acetate derivatives of the sugars after removal of the
phosphate groups by the HF treatment of the purified NmA CPS. The
alditol acetate derivatives were analyzed by the combined gas
chromatography/mass spectrometry using 30-m SP2330 capillary column
(Supelco) (22).
[0147] Lyophilized wild type or mutant capsular polysaccharide
powder (5 mg) was dissolved in D.sub.2O (Sigma, 99.999% atom D) to
a uniform concentration of 5 mg/ml. Solutions were agitated by
vortexing for 10 minutes at room temperature. Low speed
centrifugation (7200.times.g for 10 min) removed undissolved
material. Aliquots (600 .mu.l) of the supernatant were transferred
to 5 mm NMR tubes and placed in a sonication bath for 10 minutes to
eliminate air bubbles trapped on the inner wall of the NMR
tubes.
[0148] NMR spectra were acquired on a Varian Unity 500 NMR
spectrometer equipped with a 5 mm PFG triple resonance probe, high
precision temperature controller (+0.1.degree. C.), and under the
control of VNMR version 6.1B, or a Varian Inova 500 spectrometer
equipped with a 5 mm PFG inverse detection hetero nuclear probe,
running under VNMR version 6.1C and Solaris 2.8. One-dimensional
(1-D) proton NMR spectra were collected at 25.degree. C. using a
standard one-pulse experiment. The transmitter was set at the HDO
frequency (4.78 ppm). Standard spectral acquisition conditions are
to collect 64 K data points over a spectral window of 8000 Hz. The
acquisition time is 4.096 s and a relaxation delay of 26 s is
included, giving a recycle time of 30 s. Typically, 64 scans were
averaged. Spectra were Fourier-transformed after applying a 0.2 Hz
line broadening function. Integrations were performed using
subroutines built into the VNMR software.
Example 9
Hydrophobic Interaction Chromatography
[0149] The cell surface hydrophobicity of meningococcal strains was
tested using a modified method of Field et al. (23). Disposable
plastic columns packed with octyl agarose (Sepharose CL-4B, Sigma)
to a height of 2 cm were washed with 10 ml of Buffer A (0.2 M
ammonium sulphate in 10 mM sodium phosphate buffer, pH 6.8).
Meningococci collected from overnight plate cultures were suspended
in phosphate, buffered saline (PBS) to an optical density of 10,
and a 100 .mu.L aliquot was gently pipetted onto the surface of the
column and eluted with 5 ml Buffer A. A 100 .mu.l cell suspension
diluted directly into 5 ml of Buffer A was also prepared as a
control. The OD.sub.600 values of both the column flow through and
control samples were determined. Results were calculated as the
OD.sub.600 of the flow through divided by that of the control and
expressed as a percentage of cells adsorbed to the column.
Example 10
Serum Bactericidal Assay
[0150] A serum bactericidal assay was performed as previously
described (24) using pooled normal human serum at 10% final
concentration (v/v) with 30 min incubation at 37.degree. C.
Heat-inactivated normal human serum was used as a control.
Example 11
Immunoblots
[0151] Capsular polysaccharides of the serogroup A wild type and
mynC mutant NmA001 were resolved on 15% DOC-PAGE gels and
transferred onto PVDF membrane using transfer buffer (25 mM Tris,
192 mM glycine, pH 8.3, 20% methanol). An identical gel was stained
with Alcian blue to visualize capsule. Membranes were blocked with
3% BSA in Tris-Tween buffer (0.5 M Tris, pH7.5, 0.9% NaCl, 0.05%
Tween-20). Serogroup A capsule-specific monoclonal antibody 14-1-A
(13) was used as the primary antibody at a 1:1,000 dilution, while
alkaline phosphatase conjugated goat anti-mouse IgG+IgM (Organon
Teknika Corporation, West Chester, Pa.) was used at 1:5,000
dilution. All incubations were done at room temperature for 1 hour.
Blots were developed in 20 ml of alkaline phosphatase buffer (0.1 M
Tris, pH 9.5, 0.1 M NaCl, 0.5 mM MgCl.sub.2) containing 40 .mu.l of
10% NBT in 70% DMF and 30 .mu.l of BCIP (50 mg/ml in DMF). Colony
immunoblots were processed similarly using nitrocellulose
membranes. After the meningococci were lifted, the membranes were
allowed to air-dry for 30 min at room temperature and then blocked
for 1 hour with 5% BSA in Tris-Tween buffer. Protein samples for
western blots were resolved by 10% SDS-PAGE and transferred to PVDF
membranes as described. Anti-penta-His monoclonal antibodies were
used as primary antibodies at 1:1,000 dilutions.
Example 12
Whole Cell ELISA
[0152] ELISAs were performed as described (11) with the following
modifications: 50 .mu.l aliquots of a 1:9 dilution of meningococcal
suspensions (OD.sub.550=0.1) were applied to microtiter plates and
dried overnight at 37.degree. C. Monoclonal antibody 14-1-A was
used at a 1:30,000 dilution and alkaline phosphatase-conjugated
goat-anti mouse secondary antibody (Organon Teknika Corp. West
Chester, Pa.) was used at a 1:10,000 dilution. All incubations were
performed at 37.degree. C.
Example 13
Colorimetric Estimation of Capsule O-Acetylation
[0153] O-acetylation of purified CPSs was measured colorimetrically
as described by Hestrin (25). Aliquots of CPS samples (500 .mu.l)
were incubated with equal volume of 0.035 M hydroxylamine in 0.75 M
NaOH for 10 min at 25.degree. C., and then 1 M of perchloric acid
(500 .mu.l) and 70 mM ferric perchlorate in 0.5 M perchloric acid
(500 .mu.l) were added. The pink color resulting from the presence
of O-acetyl groups was quantified at 500 nm with a known amount of
ethyl acetate as the standard.
Example 14
In Vitro O-Acetyltransferase Activity
[0154] O-acetyltransferase enzyme activity was determined by
autoradiography using .sup.14C labeled acetyl co-enzyme A as acetyl
donor and purified meningococcal CPSs as substrate. In a typical 50
.mu.l reaction volume, 50 .mu.g of CPS, 10 .mu.g of the MynC
protein and 0.5 .mu.Ci of [.sup.14C]-acetyl-CoA (0.05 .mu.Ci/.mu.l,
specific activity 47 .mu.Ci/.mu.mol) were incubated in a buffer
composed of 10 mM Tris, pH 7.4, 20 mM NaCl, 1 mM MgCl.sub.2, and 25
mM EDTA. The reaction mixtures were concentrated to near-dryness
after 1 hour incubation at 37.degree. C. and then re-suspended in
10 .mu.l of water and 10 .mu.l of 2.times. sample buffer. The
samples were resolved with 15% DOC-PAGE gels. Gels were incubated
with intensifying solution (Dupont) for 30 min before drying under
vacuum. The dried gels were exposed to X-ray films at -80.degree.
C.
Example 15
Concentration, Time and pH Dependence
[0155] A typical 25 .mu.l reaction containing 1 to 6 .mu.g of
purified MynC, 0.25 .mu.Ci of .sup.14C acetyl CoA and 25 .mu.g of
OAc- CPS purified from mynC nonpolar mutant in the Tris MgCl.sub.2
EDTA buffer noted above were incubated for 1 h at 37.degree. C.
After the reaction, the CPS was precipitated with 80% (v/v final
concentration) ethanol, and the pellet was washed 3 times with 80%
ethanol and air-dried. .sup.14C acetyl incorporations were measured
using liquid scintillant (ScintiSafe Econo 1 Fisher Scientific) and
a liquid scintillation analyzer (Packard Tricarb 2500 TR). The
amount of .sup.14C acetyl incorporation into CPS by MynC was
determined at 5, 15, 30, 60, 120 and 180 min. At the respective
time points, 100 .mu.l of ethanol was added to the 25 .mu.l
reaction mixtures (see above) containing 5 .mu.g of purified MynC
protein, to precipitate the CPS. The pellets were washed three
times with 80% ethanol, air-dried, and the incorporation measured
by scintillation counts. The stability of 50 .mu.g triplicate
samples of mutant CPS substrate was tested in the reaction
condition without the enzyme along these time points by estimating
the neutral sugar (20) in the pellets after respective washes. In
order to determine the optimal pH for the MynC activity, citrate
buffer ranging 4.5 to 6.5, phosphate buffer from pH 5.8 to 8.0 and
borate buffer from 8.5 to 10.5 with final salt concentration of 20
mM were used in the 25 .mu.l reaction (see above) noted above with
5 .mu.g of purified MynC. The reaction was incubated for 1 h at
37.degree. C. TABLE-US-00001 TABLE 1 Strains, plasmids, and primers
used in this study Strains/plasmids/ Reference/ Primers Description
or sequence Source N. meningitidis F8229 N. meningitidis serogroup
A (11) strain (CDC1750) NmA001 NmA with chromosomal mynC::aphA-3
mutation NmAwtc1 F8229 carrying pGS205 (mynC) NmAnpc1 NmA001
carrying pGS205 (mynC) E. coli DH5.alpha. Cloning strain (57)
BLR21(DE3) pLysS Expression strain Novagen Plasmids pCR 2.1 TA
cloning Stratagene pUC18 Cloning vector, Amp.sup.r (58) pUC18K
Source of aphA-3 (km.sup.r) (59) cassette pFlag-CTC Cloning vector
for FLAG Sigma fusion pYT250 Meningococcal shuttle vector (60)
(Em.sup.r) pGS201 SE57-SE61 PCR product cloned into pCR2.1 pGS202
aphA-3 cloned into blunted SspI site of pGS201 pGS203 Full length
mynC obtained from SG005 (NdeI) and SG006 (xhoI) PCR product cloned
into NdeI- XhoI digested pET20b pGS204 Full length mynC with
His-tag obtained from SG007 (HindIII) and SG008 (EcoRI) PCR product
cloned into pCR2.1 pGS205 HindIII-EcoRV digested fragment of pGS204
ligated with
[0156] TABLE-US-00002 HindIII-SmaI digested fragment of pFlag-CTC
BglI digested pGS206 fragment of pGS205 subcloned Pri- into EcoRV
site of pYT250 mers 5' .fwdarw. 3' SE56 AATCATTTCAATATCTTCACAGCC;
SEQ ID NO: 3 SE57 TTACCTGAATTTGAGTTGAATGGC; SEQ ID NO: 4 SE61
CAAAGGAAGTTACTGTTGTCTGC; SEQ ID NO: 5 YT79
CATCATAACGGTTCTGGCAAATATTC; SEQ ID NO: 6 YT80
CTGTATCAGGCTGAAAATCTTCTCTC; SEQ ID NO: 7 SG005
GAACATATGTTATCTAATTTAAAAAAC; SEQ ID NO: 8 SG006
TTACTCGAGATATATATTTTGGATTATGGT; SEQ ID NO: 9 SG007
GGAGATATACATAAGCTTTCTAATTTAAAA; SEQ ID NO: 10 SG008
AGCGAATTCTCAGTGGTGGTGGTGGTGGTG; SEQ ID NO: 11
[0157] TABLE-US-00003 TABLE 2 Homology of MynC (247aa) Identity
Similarity Organism Protein (aa) Function (%) (%) Range
Caldicellulosiruptor XynC, Acetyl Xylan degradation 27 45 208
saccharolyticus esterase (266) Actinobacillus suis Hypothetical
Unknown 33 49 133 protein (410) Bacillus anthracis Conserved
Unknown 26 45 184 protein (896) Lactococcus lactis EpsK (152) EPS
biosynthesis 30 44 130 Staphylococcus Cap8I (464) CPS biosynthesis
25 46 119 aureus
[0158] TABLE-US-00004 TABLE 3 Proton assignments in ppm of the
3-O-Ac and non-O-Ac CPSs. CPS CH.sub.3--NAc CH.sub.3--OAc H-1 H-2
H-3 H-4 H-5 H6/6' 3-O-Ac 2.08 2.06/2.10 5.46 4.61 5.20 4.01 4.14
4.20/4.30 Non OAc 2.08 -- 5.44 4.45 4.14 3.82 4.01 4.18/4.24
[0159] TABLE-US-00005 TABLE 4 Relative percentages* of the various
CPSs from wild type, mynC 3-O-Ac 4-O-Ac 4-OAc Non-OAc Strain
CPS.sup.a CPS.sup.b CPS.sup.c CPS Wild type 40 10 17 33 mynC::aphA3
0 0 0 100 NmAnpc1 26 4.8 8.4 61 *Calculated from the integration
values of the H2 resonances. .sup.aO-Ac, O-acetylated. .sup.bBased
on the assignment of the resonance of the H2 of 4-O-Ac-ManNAc when
it is adjacent to a 3-O-Ac-ManNAc residue. .sup.cBased on the
assignment of the resonance of the H2 of 4-O-Ac-ManNAc when it is
adjacent to a non-O-Ac-ManNAc residue.
[0160] References Cited in the Specification [0161] 1. Liu, T. Y.,
Gotschlich, E. C., Jonssen, E. K., and Wysocki, J. R. (1971) J.
Biol. Chem. 246, 2849-2858. [0162] 2. Bundle, D. R., Smith. I. C.
P., and Jennings. H. J. (1974) J. Biol. Chem. 249, 2275-2281.
[0163] 3. Bhattacharjee, A. K., Jennings, H. J., Kenny, C. P.,
Martin, A., and Smith, I. C. (1976) Can. J. Biochem. 54, 1-8.
[0164] 4. Bhattacharjee, A. K., Jennings, H. J., Kenny, C. P.,
Martin, A., and Smith, I. C. P. (1975) J. Biol. Chem.
250,1926-1932. [0165] 5. Claus, H., Borrow, R., Achtman, M.,
Morelli, G., Kantelberg, C., Longworth, E., Frosch, M., and Vogel,
U. (2004) Mol. Microbiol. 51, 227-239. [0166] 6. Orskov, F.,
Orskov, I., Sutton, A., Schneerson, R., Lin, W., Egan, W., Hoff, G.
E., and Robbins, J. B. (1979) J. Exp. Med. 149, 669-685. [0167] 7.
Szu, S. C., Li, X. R., Stone, A. L., and Robbins, J. B. (1991)
Infect. Immun. 59, 4555-4561. [0168] 8. Berry, D. S., Lynn, F.,
Lee, C. H., Frasch, C. E., and Bash, M. C. (2002) Infect Immun. 70,
3707-3713. [0169] 9. Roberts, I. S. (1996) Annu. Rev. Microbiol.
50, 285-315. [0170] 10. Whitfield, C., and Roberts, I. S. (1999)
Mol. Microbiol. 31,1307-1319. [0171] 11. Swartley, J. S., Liu, L.
J., Miller, Y. K., Martin, L. E., Edupuganti, S., and Stephens, D.
S. (1998) J. Bacteriol. 180,1533-1539. [0172] 12. Pinner, R. W.,
Onyango, F., Perkins, B. A., Mirza, N. B., Ngacha, D. M., Reeves,
M., DeWitt, W., Njeru, E., Agata, N. N., and Broome, C. V. (1992)
J. Infect. Diseases 166, 359-364. [0173] 13. Zollinger, W. D.,
Boslego, J., Froholm, L. O., Ray, J. S., Moran, E. E., and Brandt,
B. L. (1987) Antonie Van Leeuwenhoek 53, 403-411. [0174] 14. Janik,
A., Juni, E., and Heym, G. A. (1976) J. Clin. Microbiol. 4,71-81.
[0175] 15. Dorsey, C. W., Tolmasky, M. E., Crosa, J. H., and Actis,
L. A. (2003) Microbiology 149, 1227-1238. [0176] 16. Clark, V. L.,
Campbell, L. A., Palermo, D. A., Evans, T. M., and Klimpel, K. W.
(1987) Infect. & Immun. 55,1359-1364. [0177] 17. de Maagd, R.
A., and Lugtenberg, B. (1986) J Bacteriol 167,1083-1085. [0178] 18.
Finberg, K. E., Muth, T. R., Young, S. P., Maken, J. B.,
Heitritter, S. M., Binns, A. N., and Banta, L. M. (1995) J.
Bacteriol. 177,4881-4889. [0179] 19. Gotschlich, E. C., Liu, T. Y.,
and Artenstein, M. S. (1969) J. Exp. Med. 129, 1349-1365. [0180]
20. Dubois, M. (1956) Anal. Chem. 28, 350-356. [0181] 21. Reuhs, B.
L., Carlson, R. W., and Kim, J. S. (1993) J. Bacteriol. 175,
3570-3580. [0182] 22. Stevenson, T. T., and Furneaux, R. H. (1991)
Carbohydr. Res. 11,195-211. [0183] 23. Karlyshev, A. V., Linton,
D., Gregson, N. A., Lastovica, A. J., and Wren, B. W. (2000) Mol.
Microbiol. 35, 529-541. [0184] 24. Kahler, C. M., Martin, L. E.,
Shih, G. C., Rahman, M. M., Carlson, R. W., and Stephens, D. S.
(1998) Infect. Immun. 66, 5939-5947. [0185] 25. Hestrin, S. (1949)
J. Biol. Chem. 180, 249-261. [0186] 26. Luthi, E., Love, D. R.,
McAnulty, J., Wallace, C., Caughey, P. A., Saul, D., and Bergquist,
P. L. (1990) Appl. Environ. Microbiol. 56,1017-1024. [0187] 27.
Sau, S., Sun, J., and Lee, C. Y. (1997) J. Bacteriol. 179,
1614-1621. [0188] 28. Lemercinier, X., and Jones, C. (1996)
Carbohydr. Res. 296, 83-96. [0189] 29. Jones, C., and Lemercinier,
X. (2002) J. Pharm. Biomed. Anal. 30, 1233-1247. [0190] 30.
Richmond, P., Borrow, R., Findlow, J., Martin, S., Thornton, C.,
Cartwright, K., and Miller, E. (2001) Infect. Immun. 69, 2378-2382.
[0191] 31. Longworth, E., Fernsten, P., Mininni, T. L., Vogel, U.,
Claus, H., Gray, S., Kaczmarski, E., and Borrow, R. (2002) FEMS.
Immunol. Med. Microbiol. 32,119-123. [0192] 32. Richmond, P.,
Goldblatt, D., Fusco, P. C., Fusco, J. D., Heron, I., Clark, S.,
Borrow, R., and Michon, F. (1999) Vaccine 18, 641-646. [0193] 33.
McNeely, T. B., Staub, J. M., Rusk, C. M., Blum, M. J., and
Donnelly, J. J. (1998) Infect. Immun. 66, 3705-3710. [0194] 34.
Franklin, M. J., and Ohman, D. E. (2002) J. Bacteriol. 184,
3000-3007. [0195] 35. Nivens, D. E., Ohman, D. E., Williams, J.,
and Franklin, M. J. (2001) J. Bacteriol. 183,1047-1057. [0196] 36.
Pier, G. B., Coleman, F., Grout, M., Franklin, M., and Ohman, D. E.
(2001) Infect. Immun. 69,1895-1901. [0197] 37. Bloemberg, G. V., J.
E. Thomas-Oates, B. J. J. Lugtenberg, and H. P. Spaink. (1994) Mol.
Microbiol. 11, 793-804. [0198] 38. Lopez-Lara, I. M., van den Berg,
J. D., Thomas-Oates, J. E., Glushka, J., Lugtenberg, B. J., and
Spaink, H. P. (1995) Mol. Microbiol. 15, 627-638. [0199] 39.
Spaink, H. P., Sheeley, D. M., van Brussel, A. A., Glushka, J.,
York, W. S., Tak, T., Geiger, O., Kennedy, E. P., Reinhold, V. N.,
and Lugtenberg, B. J. (1991) Nature 354, 125-130. [0200] 40.
Antignac, A., Ducos-Galand, M., Guiyoule, A., Pires, R., Alonso, J.
M., and Taha, M. K. (2003) Clin. Infect. Dis. 37, 912-920. [0201]
41. Girardin, S. E., Travassos, L. H., Herve, M., Blanot, D.,
Boneca, I. G., Philpott, D. J., Sansonetti, P. J., and
Mengin-Lecreulx, D. (2003) J Biol. Chem. 278, 41702-41708. [0202]
42. Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F.,
Crespo, J., Fukase, K., Inamura, S., Kusumoto, S., Hashimoto, M.,
Foster, S. J., Moran, A. P., Fernandez-Luna, J. L., and Nunez, G.
(2003) J. Biol. Chem. 278, 5509-5512. [0203] 43. Hindson, V. J.,
Moody, P. C., Rowe, A. J., and Shaw, W. V. (2000) J. Biol. Chem.
275, 461-466. [0204] 44. Hindson, V. J., Dunn, S. O., Rowe, A. J.,
and Shaw, W. V. (2000) Biochim. Biophys. Acta 1479, 203-213. [0205]
45. Lewendon, A., Ellis, J., and Shaw, W. V. (1995) J. Biol. Chem.
270, 26326-26331. [0206] 46. Denk, D., and Bock, A. (1987) J. Gen.
Microbiol. 133 (Pt 3), 515-525. [0207] 47. Wigley, D. B., Derrick,
J. P., and Shaw, W. V. (1990) FEBS Lett. 277, 267-271. [0208] 48.
Hara, O., and Hutchinson, C. R. (1992) J. Bacteriol. 174,
5141-5144. [0209] 49. Luck, P. C., Freier, T., Steudel, C., Knirel,
Y. A., Luneberg, E., Zahringer, U., and Helbig, J. H. (2001) Int.
J. Med. Microbiol. 291, 345-352. [0210] 50. Slauch, J. M., Lee, A.
A., Mahan, M. J., and Mekalanos, J. J. (1996) J. Bacteriol. 178,
5904-5909. [0211] 51. Verma, N. K., Brandt, J. M., Verma, D. J.,
and Lindberg, A. A. (1991) Mol. Microbiol. 5, 71-75. [0212] 52.
Firmin, J. L., Wilson, K. E., Carlson, R. W., Davies, A. E., and
Downie, J. A. (1993) Mol. Microbiol. 10, 351-360. [0213] 53.
Bhasin, N., Albus, A., Michon, F., Livolsi, P. J., Park, J. S., and
Lee, J. C. (1998) Mol. Microbiol. 27, 9-21. [0214] 54. Higa, H. H.,
and Varki, A. (1988) J. Biol. Chem. 263, 8872-8878. [0215] 55.
Kroon, P. A., Williamson, G., Fish, N. M., Archer, D. B., and
Belshaw, N. J. (2000) Eur. J. Biochem. 267, 6740-6752. [0216] 56.
Yi, K., Stephens, D. S., and Stojiljkovic, I. (2003) Infect. Immun.
71, 1849-1855. [0217] 57. Hanahan, D. (1983) J. Mol. Biol. 166,
557-580. [0218] 58. Yanisch-Perron, C., Vieira, J., and Messing, J.
(1985) Gene 33,103-119. [0219] 59. Menard, R., Sansonetti, P. J.,
and Parsot, C. (1993) J. Bacteriol. 175, 5899-5906. [0220] 60.
Tzeng, Y. L., Datta, A., Kolli, V. K., Carlson, R. W., and
Stephens, D. S. (2002) J. Bacteriol. 184, 2379-2388. [0221] 61.
Jennings, H. J., A. K. Bhattacharjee, D. R. Bundle, C. P. Kenny, A.
Martin, and 1. C. Smith. 1977. Journal of Infectious Diseases 136
Suppl:S78-83. [0222] 62. Stephens, D. S., L. H. Hoffman, and Z. A.
McGee. 1983. J. Infect. Dis. 148:369-76. [0223] 63.
Drogari-Apiranthitou, M., E. J. Kuijper, N. Dekker, and J. Dankert.
2002. Infect Immun 70:3752-8. [0224] 64. Filice, G. A., P. S.
Hayes, G. W. Counts, J. M. Griffiss, and D. W. Fraser. 1985. J Clin
Microbiol 22:152-6. [0225] 65. Amir, J., L. Louie, and D. M.
Granoff. 2005. Vaccine 23:977-83. [0226] 66. Fattom, A. I., J.
Sarwar, L. Basham, S. Ennifar, and R. Naso. 1998. Infect Immun
66:4588-92. [0227] 67. Orskov, F., I. Orskov, A. Sutton, R.
Schneerson, W. Lin, W. Egan, G. E. Hoff, and J. B. Robbins. 1979. J
Exp Med 149:669-85. [0228] 68. Szymanski C. M., Michael F. S.,
Jarrell H. C., et al. 2003. J. Biol. Chem. 278:24509-20. [0229] 69.
Gudlavalleti S. K., Datta A. K., Tzeng Y. L., Noble C., Carlson R.
W., Stephens D. S. 2004. J. Biol. Chem. 279:42765-73.
Sequence CWU 1
1
13 1 744 DNA Neisseria meningitidis 1 atgttatcta atttaaaaac
aggaaataat atcttaggat tacctgaatt tgagttgaat 60 ggctgccgat
tcttatataa aaaaggtata gaaaaaacaa ttattacttt ttcagcattt 120
cctcctaaag atattgctca aaaatataat tatataaaag attttttaag ttctaattat
180 acttttttag cattcttaga taccaaatat ccagaagatg atgctagagg
cacttattac 240 attactaatg agttagataa tggatattta caaaccatac
attgtattat tcaattatta 300 tcgaatacaa atcaagaaga tacctacctt
ttgggttcaa gtaaaggtgg cgttggcgca 360 cttctactcg gtcttacata
taattatcct aatataatta ttaatgctcc tcaagccaaa 420 ttagcagatt
atatcaaaac acgctcgaaa accattcttt catatatgct tggaacctct 480
aaaagatttc aagatattaa ttacgattat atcaatgact tcttactatc taaaattaag
540 acttgcgact cctcacttaa atggaatatt catataactt gcggaaaaga
tgattcatat 600 catttaaatg aattagaaat tctaaaaaat gaatttaata
taaaagctat tacgattaaa 660 accaaactaa tttctggcgg gcatgataat
gaagcaattg cccactatag agaatacttt 720 aaaaccataa tccaaaatat ataa 744
2 247 PRT Neisseria meningitidis 2 Met Leu Ser Asn Leu Lys Thr Gly
Asn Asn Ile Leu Gly Leu Pro Glu 1 5 10 15 Phe Glu Leu Asn Gly Cys
Arg Phe Leu Tyr Lys Lys Gly Ile Glu Lys 20 25 30 Thr Ile Ile Thr
Phe Ser Ala Phe Pro Pro Lys Asp Ile Ala Gln Lys 35 40 45 Tyr Asn
Tyr Ile Lys Asp Phe Leu Ser Ser Asn Tyr Thr Phe Leu Ala 50 55 60
Phe Leu Asp Thr Lys Tyr Pro Glu Asp Asp Ala Arg Gly Thr Tyr Tyr 65
70 75 80 Ile Thr Asn Glu Leu Asp Asn Gly Tyr Leu Gln Thr Ile His
Cys Ile 85 90 95 Ile Gln Leu Leu Ser Asn Thr Asn Gln Glu Asp Thr
Tyr Leu Leu Gly 100 105 110 Ser Ser Lys Gly Gly Val Gly Ala Leu Leu
Leu Gly Leu Thr Tyr Asn 115 120 125 Tyr Pro Asn Ile Ile Ile Asn Ala
Pro Gln Ala Lys Leu Ala Asp Tyr 130 135 140 Ile Lys Thr Arg Ser Lys
Thr Ile Leu Ser Tyr Met Leu Gly Thr Ser 145 150 155 160 Lys Arg Phe
Gln Asp Ile Asn Tyr Asp Tyr Ile Asn Asp Phe Leu Leu 165 170 175 Ser
Lys Ile Lys Thr Cys Asp Ser Ser Leu Lys Trp Asn Ile His Ile 180 185
190 Thr Cys Gly Lys Asp Asp Ser Tyr His Leu Asn Glu Leu Glu Ile Leu
195 200 205 Lys Asn Glu Phe Asn Ile Lys Ala Ile Thr Ile Lys Thr Lys
Leu Ile 210 215 220 Ser Gly Gly His Asp Asn Glu Ala Ile Ala His Tyr
Arg Glu Tyr Phe 225 230 235 240 Lys Thr Ile Ile Gln Asn Ile 245 3
24 DNA Artificial Oligonucleotide useful as a primer 3 aatcatttca
atatcttcac agcc 24 4 24 DNA Artificial Oligonucleotide useful as a
primer 4 aatcatttca atatcttcac agcc 24 5 23 DNA Artificial
Oligonucleotide useful as a primer 5 caaaggaagt tactgttgtc tgc 23 6
26 DNA Artificial Oligonucleotide useful as a primer 6 catcataacg
gttctggcaa atattc 26 7 26 DNA Artificial Oligonucleotide useful as
a primer 7 ctgtatcagg ctgaaaatct tctctc 26 8 27 DNA Artificial
Oligonucleotide useful as a primer 8 gaacatatgt tatctaattt aaaaaac
27 9 30 DNA Artificial Oligonucleotide useful as a primer 9
ttactcgaga tatatatttt ggattatggt 30 10 30 DNA Artificial
Oligonucleotide useful as a primer 10 ggagatatac ataagctttc
taatttaaaa 30 11 30 DNA Artificial Oligonucleotide useful as a
primer 11 agcgaattct cagtggtggt ggtggtggtg 30 12 6 PRT Artificial
Partially conserved sequence motif in certain acetyl transferases
12 Gly Ser Ser Lys Gly Gly 1 5 13 5 PRT Artificial Conserved
sequence motif in serine esterases 13 Gly Ser Ser Ser Gly 1 5
* * * * *