U.S. patent application number 10/921286 was filed with the patent office on 2006-03-30 for gene discovery through comparisons of networks of structural and functional relationships among known genes and proteins.
Invention is credited to Carol Friedman, Sergey Kalachikov, Pauline Kra, Michael O. Krauthammer, Andrey Rzhetsky.
Application Number | 20060069512 10/921286 |
Document ID | / |
Family ID | 26827600 |
Filed Date | 2006-03-30 |
United States Patent
Application |
20060069512 |
Kind Code |
A1 |
Rzhetsky; Andrey ; et
al. |
March 30, 2006 |
Gene discovery through comparisons of networks of structural and
functional relationships among known genes and proteins
Abstract
The present invention relates to methods for identifying novel
genes comprising: (i) generating one or more specialized databases
containing information on gene/protein structure, function and/or
regulatory interactions; and (ii) searching the specialized
databases for homology or for a particular motif and thereby
identifying a putative novel gene of interest. The invention may
further comprise performing simulation and hypothesis testing to
identify or confirm that the putative gene is a novel gene of
interest. The present invention also relates to natural language
processing and extraction of relational information associated with
genes and proteins that are found in genomics journal articles. To
enable access to information in textual form, the natural language
processing system of the present invention provides a method for
extracting and structuring information found in the literature in a
form appropriate for subsequent applications.
Inventors: |
Rzhetsky; Andrey; (New York,
NY) ; Kalachikov; Sergey; (New York, NY) ;
Krauthammer; Michael O.; (New York, NY) ; Friedman;
Carol; (Larchmont, NY) ; Kra; Pauline; (Forest
Hills, NY) |
Correspondence
Address: |
BAKER & BOTTS
30 ROCKEFELLER PLAZA
NEW YORK
NY
10112
US
|
Family ID: |
26827600 |
Appl. No.: |
10/921286 |
Filed: |
August 18, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09549827 |
Apr 14, 2000 |
6950753 |
|
|
10921286 |
Aug 18, 2004 |
|
|
|
09327983 |
Jun 8, 1999 |
6633819 |
|
|
09549827 |
Apr 14, 2000 |
|
|
|
60129469 |
Apr 15, 1999 |
|
|
|
Current U.S.
Class: |
702/19 |
Current CPC
Class: |
G16B 20/00 20190201;
G16B 5/00 20190201; G16H 70/60 20180101; G16B 30/00 20190201; G16B
40/00 20190201; G16B 50/00 20190201; Y02A 90/10 20180101; G16B
10/00 20190201 |
Class at
Publication: |
702/019 |
International
Class: |
G06F 19/00 20060101
G06F019/00 |
Claims
1. A method for identifying a novel nucleic acid molecule encoding
a protein of interest comprising: (i) selecting a specific protein
from a first species involved in a regulatory network of interest;
(ii) identifying known proteins that act upstream and downstream in
the regulatory network of interest with respect to the specific
protein selected; (iii) constructing the regulatory network of
interest from the proteins identified in step (ii); (iv) for each
identified protein, select a domain or motif and search by homology
for related proteins in a second species, wherein a related protein
is defined as a protein having a homologous domain or motif; (v)
producing a regulatory network for the second species, wherein said
regulatory network incorporates the identified related proteins;
(vi) comparing the regulatory network from the first species to the
regulatory network of said second species; (v) identifying a
protein present in a regulatory network for one species but absent
in the regulatory network of the other species; and (vi) isolating
a nucleic acid molecule encoding the protein identified in step (v)
in the species in which it is missing.
2. The method of claim 1 wherein the nucleic acid molecule encodes
human protein.
3. The method of claim 1 wherein the related proteins are
orthologs.
4. The method of claim 1 wherein the regulatory pathway is involved
in apoptosis.
5. The method of claim 1 wherein the specific protein from the
first species is involved in tumor suppression.
6. A method for identifying the affect of a gene knockout on a
regulatory pathway comprising the following steps: (i)
identification of the shortest non-oriented pathway connecting two
gene products; (ii) assigning an initial sign value of "-" to the
knockout since the knockout gene product is inactive; (iii) moving
along the shortest pathway between the two gene products
multiplying the sign with the sign of the next gene product in the
pathway, wherein "-" stands for inhibition, "+" stands for
induction or activation, and "0" stands for the lack of interaction
between two proteins in the specified direction; and (iv)
determining the final sign at the end of the pathway, wherein "-"
indicates inhibition and "+" indicates induction or activation of
the pathway.
7. A method for identifying a novel nucleic acid molecule encoding
a protein of interest comprising: (i) selecting a gene of interest
and searching a database for homologous sequences; (ii) aligning
the homologous sequences identified in step (i); (iii) constructing
a gene tree using the sequence alignment; (iv) constructing a
species tree; (v) imputing the species tree and gene tree into an
algorithm which integrates the species tree and the gene tree into
a reconciled tree; and (vi) identifying orthologous genes present
in one species but missing in another.
8. The method of claim 7 wherein the following algorithm is used to
integrate the species tree and the gene tree into a reconciled
tree: (i) computing the similarity .sigma.(S.sub.gi,S.sub.sj) for
each pair of interior nodes from trees T.sub.g and T.sub.s, (ii)
finding the maximum .sigma.(S.sub.gi,S.sub.sj); (iii) saving
S.sub.gi as a new cluster of orthologs, save {S.sub.gi}-{S.sub.sj }
as a set of species that are likely to have gene of this kind (or
lost it in evolution); (iv) eliminating S.sub.gi from T.sub.g;
T.sub.g:=T.sub.g\S.sub.gi; (v) repeating step (ii)-(iv) until
T.sub.g is non-empty.
9. A method for identifying a novel gene comprising the following
steps: (i) defining a motif or domain composition of a gene of
interest; (ii) searching for sequences which correspond to
nucleotide sequences in an expression sequence tag database or
other cDNA databases using a program such as BLAST and retrieving
the identified sequences; (iii) searching additional databases for
expressed sequence tags containing the domains and motifs
characteristic for the gene of interest with Hidden Markov Model of
domains and motifs identified in step (i); (iv) identifying
nucleotide sequences comprising the gene of interest.
10. The method of claim 9 further comprising using each identified
expression sequence tag to search sequence databases for
overlapping sequences for the purpose of assembling longer
overlapping stretches of DNA.
11-21. (canceled)
22. A computer system for extracting information on biological
entities from natural-language text data, comprising: (i) means for
parsing the natural-language text data; and (ii) means for
regularizing the parsed text data to form structured word
terms.
23. The system according to claim 22, further comprising means for
preprocessing the data prior to parsing, with the preprocessing
means comprising identifying biological entities.
24. The system according to claim 22, further comprising means for
referring to an additional parameter which is indicative of the
degree to which subphrase parsing is to be carried out.
25. The system according to claim 22, wherein said parsing means
further comprises means for segmenting the text data by
sentences.
26. The system according to claim 22, wherein said parsing means
further comprises: means for segmenting the text data by sentences;
and means for segmenting each of the sentences at identified words
or phrases.
27. The system according to claim 22, wherein said parsing means
further comprises: means for segmenting the text data by sentences;
and means for segmenting each of the sentences at a prefix.
28. The system according to claim 22, wherein said parsing means
further comprises means for skipping undefined words.
29. The system according to claim 22, wherein said parsing means
further comprises: means for identifying one or more binary actions
and their relationships; and means for identifying one or more
arguments associated with the actions.
30. The system according to claim 22, further comprising means for
performing error recovery when parsing of the text data is
unsuccessful.
31. The system according to claim 22, wherein said error recovery
means comprises: means for segmenting the text data; and means for
analyzing the segmented text data to achieve at least a partial
parsing of the unsuccessfully parsed text data.
32. The system according to claim 22, wherein said tagging means
comprises means for providing the structured data component in a
Standard Generalized Markup Language (SGML) compatible format.
Description
STATEMENT REGARDING MATERIAL SUBJECT TO COPYRIGHT
[0001] A portion of the disclosure of this patent document contains
material which is subject to copyright protection. The copyright
owner has no objection to the facsimile reproduction by anyone of
any portion of the patent document, as it appears in any patent
granted from the present application or in the Patent and Trademark
Office file or records available to the public, but otherwise
reserves all copyright rights whatsoever.
[0002] An appendix containing source code listing utilized in
practicing an exemplary embodiment of the invention is included as
part of the Specification.
1. INTRODUCTION
[0003] The present invention relates to methods for identifying
novel genes comprising: (i) generating one or more specialized
databases containing information on gene/protein structure,
function and/or regulatory interactions; and (ii) searching the
specialized databases for homology or for a particular motif and
thereby identifying a putative novel gene of interest. The
invention may further comprise performing simulation and hypothesis
testing to identify or confirm that the putative gene is a novel
gene of interest.
[0004] The present invention relates to natural language processing
and extraction of relational information associated with genes and
proteins that are found in genomics journal articles. To enable
access to information in textual form, the natural language
processing system of the present invention provides a method for
extracting and structuring information found in the literature in a
form appropriate for subsequent applications. Specifically, the
present invention provides for the generation of specialized
databases containing information on gene/protein structure,
function and regulatory interactions based on the retrieval of such
information from research articles and databases, and computer
representation of such information in a manner that allows
efficient access to the extracted information.
[0005] The invention further provides for the use of the
specialized databases for identifying novel genes based on
detection of sequence similarities and domain/motif matches between
genes/proteins, computation and interpretation of phylogenetic
trees for multigene families, and analysis of homologous regulatory
networks. The methods of the invention are based on the observation
that functionally similar regulatory systems are generated during
evolution by genetic duplication of ancestral genes. Thus, a
comparison of homologous/similar networks within the same organism
and between different species will allow the identification of
genes absent in one of the systems under comparison. In this way
genes that contribute to the phenotype of a specific disease
associated with a particular biological system under analysis may
be identified.
2. BACKGROUND OF THE INVENTION
[0006] 2.1. Natural Language Processing
[0007] Researchers working in molecular biology must constantly
consider the information present in the literature relating to
their regulatory systems of interest and the genes and proteins
that operate within those systems. Unfortunately, to remain
up-to-date on the relevant literature, the researcher is required
to perform laborious reading and manual integration of research
articles, each of which may address a narrow subject. Therefore,
technology that enables rapid retrieval of information from
literature and manipulation of derived functional data should have
a dramatic effect on the accesss of the researcher to important
facts and ultimately should facilitate the discovery of novel human
genes.
[0008] Natural language processing is an automated system that
provides for a complex of programs for automatic retrieval of
information from text analysis and for the computer representation
of that information in a form that allows efficient access and
extraction of that information. MedLee (Medical Language Extraction
and Encoding System) has recently been successfully used for
processing different types of medical texts as described in
co-pending U.S. patent application Ser. No. 09/370,329,
incorporated herein in its entirety by reference (see also,
Friedman et al., 1994, J. Amer. Med. Inf. Assoc. 1:161-174;
Hripcsak et al. 1995, Ann. Intern. Med. 122:681-688; Hripcsak et
al., 1998, Meth. Inform. Med.; Jain et al., 1996, Proc. AMIA Annu.
Fall Symp. 542-546; Knirsch et al., 1998). When tested, MedLEE was
on average as successful in retrieving reports associated with
specified clinical connections as twelve medical experts invited
for evaluation of the system.
[0009] Another text analysis technique has recently been developed
that combines finite-state machines with statistical machine
learning approaches. These models extract detailed semantic
information from texts (e.g., see Hatzivassiloglou 1996, In
Klavens, J. L., and Resnick, P. S. (eds) The Balancing Act:
Combining Symbolic and Statistical Approaches to Language, MIT
Press, Cambridge, Mass.) when extensive prior knowledge about the
domain is not available. The techniques have been subsequently
applied to the tasks of (i) automatically identifying medical terms
for the automated summarization of research articles reporting on
clinical studies and (ii) sanitizing sensitive information in
patient records so that they can be widely disseminated for
research purposes.
[0010] A number of projects have also been developed as statistical
information extraction tools that operate with limited or no prior
knowledge about the application domain. These earlier efforts
include XTRACT, a tool that recovers collocational restrictions
between words that has been licensed to more than thirty sites
worldwide (Smadja, F., 1993, J. Comp. Ling. 19:143-177),
CHAMPOLLION, a system that retrieves bilingual mappings between
words and phrases in parallel texts from different languages
(Smadja, F. et al. 1996, J. Computational Linguistics 22:1-38), and
a system that automatically aligns noisy, semi-parallel texts from
different languages (Fung, P. and McKeown, K. R., 1997, Machine
Translation 11:23-29).
[0011] 2.2. Identification of Novel Genes
[0012] A variety of different methods are currently utilized for
the identification and characterization of novel genes. Perhaps the
most widely used method for generating large quantities of sequence
information is via high throughput nucleotide sequencing of random
DNA fragments. A disadvantage associated with this gene discovery
technique is that in most instances when genes are identified their
function is unknown.
[0013] For identification of specific disease genes, positional
cloning is currently the most widely used method. The positional
cloning approach combines methods of formal genetics, physical
mapping and mutation analysis and usually starts with a precise
description of the disease phenotype and a tracing of the disease
through families of affected individuals. Genetic linkage data
obtained from the analysis of affected families frequently allows
the determination of an approximate genomic localization of the
candidate disease gene with a precision of several millions of
nucleotides. Once localized, the genetically defined chromosomal
region is then recovered from genomic libraries as a contiguous set
of genomic fragments. Genes residing in the disease-related region
are determined by analysis of transcripts that are transcribed from
the genomic fragment. From this analysis an initial set of
candidate genes for a particular disease are identified based on
the presence of the gene product in the biological system affected
by disease and a correlation between its expression pattern and the
pattern of disease progression.
[0014] Important information for selection of candidate genes also
comes from analysis of their homology with genes known to be part
of the same or related biological system. Finally, the ultimate
proof of association between a gene and a genetic disorder comes
from mutational analysis of a gene in patients affected by the
disorder and from demonstration of a statistical correlation
between occurrence of mutation and the disease phenotype.
[0015] Although positional cloning is a powerful method for gene
discovery, the experimental method is extremely tedious and
expensive. Moreover, disease genes implicated in genetically
complex disorders, i.e., those controlled by multiple loci, can
hardly be found using this strategy because of the complications
associated with multiple loci linkage analysis.
[0016] Specialized databases for homology searches have also been
utilized in disease gene discovery projects. In recent years a
number of efficient sequence comparison tools have been developed
such as the BLAST (Basic Local Alignment Search Tool) family of
programs designed for comparison of a single "search sequence" with
a database (see Altschul et al., 1990, J. Mol. Biol. 215:403-410;
Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402), the family
of Hidden Markov Model methods for comparison of a set of aligned
sequences that usually represent a protein motif or domain with a
database (e.g., Krogh et al., 1994, J. Mol. Biol. 235:1501-1531;
Grundy et al., 1997, Biochem Biophys. Res. Commun. 231:760-6) and
various other comparison tools (Wu et al., 1996, Comput. Appl.
Biosci 12:109-118; Neuwald et al., 1995, Protein Sci. 4:1618-1632;
Neuwald, 1997, Nucleic Acids Res. 25:1665-1677).
[0017] When used in disease gene discovery projects, homology
searches can be enhanced by creating specialized databases that
utilize statistical analysis for evaluating significance of
sequence similarities in comparison of new sequences with a
database of known sequence. Such databases are fine-tuned to the
size of the database used (Altschul et al., 1990, J. Mol. Biol.
215:403-410; Altschul et al., 1997, Nucleic Acids Res.
25:3389-3402), so that the same level of homology between a search
sequence and a database sequence can be determined to be highly
significant if the search sequence is compared with a smaller
database, or insignificant and thus undetectable, if the search
sequence is compared with a larger database.
[0018] In alternatives to standard homology searches, in projects
oriented towards gene discovery, researchers usually have some a
priori knowledge about the set of genes/proteins that might display
important similarity to the unknown new gene. Therefore, selecting
an a priori defined set of genes/proteins for comparison with new
experimental sequences is a feasible and useful strategy. This
strategy was successfully applied to search for homologs of disease
genes in yeast and nematode genomes by Mushegian et al. (1997,
Proc. Natl. Acad. Sci USA 94:5831-5836).
[0019] Two homologous genes taken from different species that
originate from the nearest common ancestor by speciation are
referred to as orthologs, while any two genes that originate from a
common ancestor via a series of events involving intragenomic
duplications are call paralogs. Tatusov et al. (1994, Proc. Nat.l,
Acad. Sci USA 91:12091-12095) describe comparisons of proteins
encoded by the genomes of different phylogenetic lineages and
elucidation of consistent patterns of sequence similarities
permitting the delineation of clusters of orthologous groups
(COGs). Each COG consists of individual orthologous genes or
orthologous groups of paralogs from different phylogenetic
lineages. Since orthologs typically have the same function, the
classification of known genes and proteins into clusters of
orthologous groups permits the assignment of a function to a newly
discovered gene or protein by merely classifying it into a COG.
Although Tatusov describes a method for assigning a function to a
newly discovered gene, he does not describe a method for predicting
the existence of undiscovered genes. In addition, Yuan, et al.
attempted simultaneous reconstruction of a species tree and
identification of paralogous groups of sequences and detection of
orthologs in sequence databases (Yuan et al., 1998, Bioinformatics
143:285-289).
[0020] Other groups have aimed at capturing interactions among
molecules through the use of programs designed to compare
structures and functions of proteins (Kazic 1994, In: Molecular
Modeling: From Virtual Tools to Real Problems, Kumosinski, T. and
Liebman, M. N. (Eds.), American Chemical Society, Washington, D.C.
pp. 486-494; Kazic, 1994, In: New Data Challenges in Our
Information Age, Glaesar, P. S. and Millward, M. T. L. (Eds.).
Proceedings of the Thirteenth International CODATA Secretariat,
Paris pp. C133-C140; Goto et al., 1997, Pac. Symp. Biocomput. p.
175-186; Bono et al., 1998, Genome Res. 8:203-210; Selkov et al.,
1996, Nucleic Acids Res. 24:26-28). These projects are
significantly different from the inventive methods described herein
because they do not describe methods for deducing the existence of
as yet unknown genes based on comparisons of regulatory pathways
and gene structure between one or more species. The present
invention provides a method for increasing the sensitivity of
analysis methods through the generation of specialized
databases.
3. SUMMARY OF THE INVENTION
[0021] In accordance with the present invention there is provided
methods for identification of novel genes comprising (i) generating
one or more specialized databases containing information on
gene/protein structure, function and/or regulatory interactions;
and (ii) searching the specialized databases for homology or for a
particular motif and thereby identifying a putative novel gene of
interest. The invention may further comprise performing simulation
and hypothesis testing to identify or confirm that the putative
gene is a novel gene of interest.
[0022] The invention is based, in part, on the observation that
functionally similar regulatory systems are generated during
evolution by genetic duplication of ancestral genes. Thus, by
comparing phylogenetic trees or regulatory networks and identifying
genes and/or proteins absent in one system under comparison, the
existence of as yet unidentified genes and/or proteins can be
predicted. To make meaningful comparisons of phylogenetic trees it
is necessary to distinguish between orthologs and paralogs. The
present invention provides a method useful for discriminating
between orthologs and paralogs and inferring the existence of as
yet unidentified genes and/or proteins.
[0023] The present invention relates to natural language processing
and extraction of relational information associated with genes and
proteins that are found in genomics journal articles. Specifically,
the natural language processing system of the invention is used to
parse the articles published in biological journals focusing on
structure and interactions among genes and proteins followed by
computer representation of such interactions.
[0024] In accordance with the present invention, specialized
databases are developed that contain information on gene/protein
structure and interactions based on information derived from
preexisting databases and/or research articles including
information on interactions among genes and proteins, their
domain/motif structure and their subcellular and tissue
expression/distribution patterns.
[0025] The invention relates to a sequence analysis program which
utilizes the specialized database for comparison of a single
sequence, processing the output into a sequence alignment,
computing phylogenetic trees, and analyzing these trees to predict
undiscovered genes. This program also includes a set of tools for
generating motif/domain models from multiple sequence alignments of
known genes and for using these models for extraction of
structurally and/or functionally homologous sequences from
databases which contain raw sequence data.
[0026] The invention further provides for a simulation and
hypothesis testing program which relies on the specialized
databases of gene/protein interactions for identifying potentially
undiscovered members of multigene families through comparisons of
regulatory networks for different species and testing hypotheses
with regard to regulatory cascades. A comparison of homologous
regulatory networks within the same organism and between different
species of organisms will allow the identification of genes absent
in one of the systems under comparison, thus providing a set of
candidate genes. In this way, genes that contribute to the
phenotype of a specific disease associated with a particular
biological system under analysis may be identified, mapped and
subjected to mutational analysis and functional studies.
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] FIG. 1 is a block diagram illustrating the three major
programs of the method according to the present invention: (i) the
generation of specialized databases based on information on
gene/protein structure, function and regulatory interactions
derived from research papers and databases; (ii) sequence analysis;
and (iii) simulation and hypothesis testing;
[0028] FIG. 2 is a block diagram of an information extraction
system in accordance with a preferred embodiment of the present
invention;
[0029] FIG. 3 is a diagram illustrating the object representation
of molecules and relations between them;
[0030] FIG. 4 shows a set of keywords defining proteins involved in
apoptosis pathways, these keywords having been utilized for
generating a specialized sequence database Apoptosis3, this list
having been compiled manually for testing the concept of
specialized databases;
[0031] FIG. 5 shows a "species tree," which is a graph depicting
the correct order of speciation events leading to a set of present
day species; a "gene tree," which is a graph depicting a history of
a few genes from the same species, where each species can be
represented by multiple paralogous genes (because the set of known
genes is incomplete for most genomes, and there are often multiple
representations of the same gene family in the same genome, the
gene tree can be drastically different from the corresponding
species tree); and a "reconciled tree", which is the gene tree that
would be obtained if gene deletions were completely forbidden and
all genes were known for all species under analysis;
[0032] FIG. 6 shows the original tree of ALDH sequences, indicating
sequence clusters where bacterial, plant, fungal and nematode
orthologous genes are present, but a human ortholog was not yet
known;
[0033] FIG. 7 shows the same phylogenetic tree as in FIG. 6 with an
additional human protein, referred to as antiquitin which was
discovered by the method of the invention;
[0034] FIG. 8 is a schematic diagram illustrating functional
network-based gene discovery in accordance with the present
invention;
[0035] FIG. 9A presents diagrams depicting the regulatory
relationships among hypothetical proteins (denoted with Arabic
numerals) of hypothetical species A and B. Proteins in different
species denoted with the same numeral are considered orthologous.
The diagrams show that regulatory relationships between a pair of
proteins can be of three different kinds;
[0036] FIGS. 9B, 9C, and 9D are diagrams representing Boolean
operations OR, AND, and XOR, on arcs of the two oriented graphs of
FIG. 9A, the same operations being applicable to the set of
vertices of the two oriented graphs;
[0037] FIG. 10 is a diagram representing a hypothetical example of
defining homologous protein networks in two different species using
protein motifs, the diagram showing only two hypothetical proteins
(1 and 2) for species A and three hypothetical proteins (1, 3, and
4) for species B. Protein 1 in both species has motifs .alpha. and
.beta., protein 2 has motifs .delta., .epsilon., and .zeta., and
proteins 3 and 4 have motifs .delta. and .zeta., and .epsilon.,
respectively. The motif analysis can indicate that proteins 3 and 4
in species B may collectively perform the same function as protein
2 in species A;
[0038] FIGS. 11A and 11B are diagrams respectively representing
hypothetical examples of evaluating the impact of a "knockout" of
hypothetical gene A on the expression of a hypothetical gene B. The
effect of knock-out of gene A calculated by multiplication along
the shortest pathway connecting genes A and B is inhibition of gene
B, the resulting effect being zero if the orientation of only one
arc in the same pathway is reversed;
[0039] FIG. 12 is a flow chart representing the scheme of gene
discovery analysis involving motif/domain analysis in accordance
with the present invention; and
[0040] FIG. 13 Identification of genes in C. elegans containing
either POZ or kelch domains. The protein excession numbers are
indicated adjacent to the different protein domains. The protein
corresponding to accession number gi/1132541 contains a POZ domain,
death domain, kinase domain and heat repeat.
[0041] FIG. 14A. Two human sequences with the closest homology to
the C. elegans sequence gi/1132541.
[0042] FIG. 14B. Computed gene tree indicating that the identified
human gene represents an ortholog of the C. elegans gene
gi/1132541.
[0043] FIG. 14C. Nucleotide sequence of the death domain gene.
[0044] FIG. 14D. Deduced amino acid sequence of the death domain
protein.
[0045] FIG. 15. Identification of candidate gene implicated in the
etiology of Chronic Lymphocytic Leukemia (CLL). Sequence homology
between a CLL region open reading frame and mouse Rpt1
(sp/P15533/RPT1) is presented.
[0046] FIG. 16A-B. Model of regulatory functions of Rpt1. FIG. 16A
indicates that in mouse T lymphocytes Rpt1 serves as a repressor of
the gene for interleukin 2 receptor (IL-2R). FIG. 16B demonstrates
that when Rpt1 is knocked out, the regulatory effect is manifested
as a block of the apoptotic pathway for T-lymphocytes resulting in
accumulation of T-lymphocytes in blood.
[0047] FIG. 17A. Two EST sequences identified by searching a
protein dbEST using the mouse Mad3 protein as a query.
[0048] FIG. 17B. Nucleotide sequence of the human Mad3 gene.
[0049] FIG. 17C. Complete sequence of the human Mad3 protein. A
search was conducted to identify overlapping sequences. The
complete sequence of the gene was assembled and the amino acid
sequence deduced. The translated human Mad3 sequence consists of
206 amino acid residues 81% of which are identical to the mouse
Mad3 protein.
[0050] FIG. 17D. Multiple alignment of the human Mad3 amino acid
sequence with known Mad proteins.
[0051] FIG. 18A. Phylogenetic tree indicating relationship between
three known mouse Mad genes and their two human homologs.
[0052] FIG. 18B. Phylogenetic tree including new human Mad3
sequence. The phylogenetic tree indicates that the new human gene
belongs to the family of Mad proteins and is an ortholog of mouse
Mad3.
5. DETAILED DESCRIPTION OF THE INVENTION
[0053] The present invention provides methods for identification of
novel genes comprising: (i) generating specialized databases
containing information on gene/protein structure, function and
regulatory interactions and, (ii) sequence analysis which includes
homology searches and motif analysis thereby identifying a putative
novel gene of interest. The invention may further comprise
performing simulation and hypothesis testing to identify or confirm
that the putative gene is a novel gene of interest.
[0054] The specialized databases are constructed utilizing
information concerning gene/protein structure or function derived
from unpublished data, research articles and/or existing databases.
The specialized databases can be used to identify novel genes by:
(i) searching for motif/domain combinations characteristic for a
putative gene of interest; (ii) phylogenetic tree analysis of
homologous genes for predicting the existence of yet undiscovered
genes; (iii) comparing members of interactive gene/protein networks
from different species for predicting the existence of yet
undiscovered genes; and (iv) testing a hypothesis with regard to
known interactions of homologs from other species in regulatory
pathways.
[0055] 5.1. The Natural Language Processing
[0056] The present invention relates to a natural language
processing system that is designed to parse the electronic versions
of articles published in journals that report on structural
interactions among genes and proteins. The system provides a method
for extracting information on interactions among genes and
proteins, their domain/motif structure, and/or their sub-cellular
and tissue expression/distribution patterns, followed by computer
representation of such information.
[0057] The general natural language-processing system of the
invention is schematically depicted in FIG. 2. The collection phase
automatically collects articles from appropriate literature, and
selects articles that contain relevant information using Keyword
search techniques. In the next phase, the preprocessor standardizes
the selected articles so that they consist of tagged ASCII text
where the tags delineate critical components of the article. The
next phase, termed the extraction phase, retrieves and classifies
biological entities, i.e., as names of proteins, genes and small
molecules. In addition, the relationship extraction phase recovers
structural relationships between the entities. This phase is
followed by a phase which performs an analysis of the sequence of
events.
[0058] The final phase of the system processes the output extracted
from an article to remove redundancies, inconsistencies and to
incorporate implicit information before adding the extracted
knowledge consisting of biological entities, their attributes,
conditional constraints, and relationships between them, for
subsequent use in analysis and hypothesis testing. The information
extraction system as depicted in FIG. 2, referred to herein as
"GENIE," is designed for use as a general processor within the
domain of genomics literature although the system may also be used
in other specialized domains. GENIE is an adaptation of MedLEE
developed for the medical domain. GENIE uses the same source code
as MedLEE but the Lexicons and grammar were adapted for genomics
literature.
[0059] The information extraction system of the present invention
is described below, by way of example, with reference to the
genomics domain uses of GENIE. It is written in Quintus Prolog and
uses the Unix or Windows operating systems, as described in detail
below.
[0060] A natural-language phrase included in text document is
understood as a delimited string comprising natural-language terms
or words. The string is computer readable as obtained, e.g., from a
pre-existing database, a keyboard input, optical scanning of typed
or handwritten text, or processed voice input. The delimiter may be
a period, a semicolon, an end-of-message signal, a new-paragraph
signal, or any other suitable symbol recognizable for this purpose.
Within the phrase, the terms may be separated by another type of
delimiter such as a blank or another suitable symbol.
[0061] As a result of phrase parsing, terms in a natural-language
phrase are classified, (e.g., as referring to a gene, a protein, or
their interactions) and the relationships between the interactions
are established and represented in a standard form. For example, in
the sentence "Rap inhibited fyn", the structured form would be:
[action,inactivate,[protein,rap],[protein,fyn]]. In such an
example, the interaction is "inactivate", the agent is "Rap" and
the target is "fyn." More complex sentences consisting of nested
relationships, such as "The activation of BAD was suppressed by the
phosphorylation of JNK" can also be parsed and represented
appropriately. The structured output form for this sentence would
be:
[action,inactivate,[action,phosphorylate,x,[protein,jnk],[action,activate-
,x,[protein,bad]] In the first example, the primary interaction is
"inactivate"; in the second example, an interaction "phosphorylate"
is the agent where the protein "jnk" is its target (the agent of
"phosyphorylate" in not specified and thus is represented as "x").
In this example, the target of "inactivate" is also an interaction
"activate" where the target is the protein "bad" and the agent is
unknown.
[0062] While parsing is based on both syntactic and semantic
grammatical patterns, the substances in a domain are normally only
semantic categories such as "protein", "gene", and "small
molecule." There are no corresponding syntactic categories needed
for these substances because they are normally all nouns. However,
each action can be categorized both semantically and syntactically.
An action, which is a semantic category, can generally occur
syntactically as a verb "inactivate" or as a noun "inactivation."
Therefore there are two sets of lexical entries for the actions:
syntactic and semantic. The syntactic lexicon for actions specifies
the main syntactic category such as "v" for verb, "ving" for
progressive form of verb, and "activation" for noun. The semantic
entries for actions not only categorize the actions, but also
specify features for each action. For example, one feature provides
the number of arguments that are expected for the action, i.e.,
some actions are associated with two arguments because they have an
agent and a target as "inactivate", and others just have an agent
"mutate." The lexicon of substances and structures appears as
Appendix A; the syntactic lexicon for actions appears as Appendix
B; and the semantic lexicon of actions appears as Appendix C.
[0063] A second feature specifies whether or not the arguments
should be reversed when obtaining the target form. For example the
arguments of "attributable to" should be reversed, i.e., in "the
phosphorylation of jnk is attributable to the activation of bad",
the underlying action is "cause" (from "attributable to"), the
agent is the "activation of bad" and the target is "the
phoshorylation of jnk"), whereas the arguments of "activates" is
not(i.e. in "jnk activates bad", the agent is "jnk" and the target
is "bad").
[0064] FIG. 2 shows a preprocessor module of GENIE by which
natural-language input text is received. The preprocessor thus
performs lexical lookup to identify and categorize multi-word and
single word phases within each sentence. The output of this
component consists of a list of word elements where each element is
associated with a word or multi-word phrase in the report. For
example, assuming that the sentence "bad functions as a negative
regulator of the activation of jnk" is at the beginning of the
report, it would be represented as a list of elements where each
element is a word or phrase. For example, element 1 is associated
with "bad", element 2 with the multi-word phrase "functions as a
negative regulator of", element 8 with "the", and element 9 with
"activation". The remainder of the list of word positions would be
associated with the remaining words in the report. Some of the
phrases may not need lexical lookup because they already have been
tagged by a previous component. Such a tagging system is described
below in Section 5.2.
[0065] The second component of the GENIE system is the parser. It
utilizes the grammar and categories assigned to the phrases of a
sentence to recognize well-formed syntactic and semantic patterns
in the sentence and to generate structured output forms. The parser
proceeds by starting at the beginning of the sentence element list
and following the grammar rules. When a semantic or syntactic
category is reached in the grammar, the lexical item corresponding
to the next available unmatched element is obtained and its
corresponding lexical definition is checked to see whether or not
it matches the grammar category. If it does match, the word or
phrase is removed from the unmatched sentence list, and the parsing
proceeds. If a match is not obtained, an alternative grammar rule
is tried. If no analysis can be obtained, an error recovery
procedure is followed so that a partial analysis is attempted. The
actual grammar used for GENIE appears as Appendix D.
[0066] The parser module of GENIE uses the lexicon, and a grammar
module to generate target forms. Thus, in addition to parsing of
complete phrases, subphrase parsing can be used to an advantage
where highest accuracy is not required. In case a phrase cannot be
parsed in its entirety, one or several attempts can be made to
parse a portion of the phrase for obtaining useful information in
spite of a possible loss of information.
[0067] Conveniently, each module is software-implemented and stored
in random-access memory of a suitable computer, e.g., a
work-station computer. The software can be in the form of
executable object code, obtained, e.g., by compiling from source
code. Source code interpretation is not precluded. Source code can
be in the form of sequence-controlled instructions as in Fortran,
Pascal or "C", for example. Alternatively, a rule-based system can
be used such a Prolog, where suitable sequencing is chosen by the
system at run-time.
[0068] An illustrative portion of the GENIE system is shown in the
Appendix D in the form of a Prolog source listing with comments.
The following is further to the comments.
[0069] Process_sents with get_inputsents, process_sects and
outputresults reads in an input stream, processes sections of the
input stream according to parameter settings, and produces output
according to the settings, respectively. Among parameters supplied
to Process_sents are the following: Mode (specifying the parsing
mode) and Protocol (html or plain). Process_sents is called by
another predicate, after user-specified parameters have been
processed.
[0070] The parsing modes are selected by GENIE so as to parse a
sentence or phrase structure using a grammar that includes one or
more patterns of semantic and syntactic categories that are
well-formed. For example, for the phrase "bad inactivates jnk", a
legitimate pattern can be substance1 action substance2, wherein
substance1=protein bad, action="inactivates" and substance2="jnk."
However, if parsing fails, various error recovery modes are
utilized in order to achieve robustness. The error recovery
techniques use methods such as segmenting the sentence, processing
large chunks of the sentence, and processing local phrases. Each
recovery technique is likely to increase sensitivity but decrease
specificity and precision. Sensitivity is the performance measure
equal to the true positive rate of the natural language processing,
i.e., the ratio of information extracted by the natural language
processing system that should have been extracted. Specificity is
the performance measure equal to the true negative information rate
of the system, i.e., the ratio of information not extracted by the
NLP system that should not have been extracted. Precision is the
reliability of the system, i.e., the ratio of information extracted
correctly compared to all the information that was extracted. In
processing a report, the most specific mode is attempted first, and
successive less specific modes are used only if needed.
[0071] In accordance with the preferred embodiments of the present
invention, the parser of FIG. 2 includes five parsing modes, Modes
1 through 5, for parsing sentences or phrases. Nominally, the
parser is configured to first select Mode 1. If Mode 1 is not
possible, the program continues with Mode 2 and so forth until
parsing is complete. With Mode 1, the initial segment is the entire
sentence and all words in the segment must be defined. This mode
requires a well-formed pattern for the complete segment.
[0072] Mode 2 requires that the sentence or phrase be segmented at
certain types of words or phrases, e.g., "is attributable to."
Here, an attempt is made to recognize each segment independently,
i.e., a first segment ending with the word "is " and a second
segment beginning with the word after "to." The segmenting process
is repeated until an analysis of each segment is obtained or until
segmenting is no longer possible.
[0073] Mode 3 requires a well-formed pattern for the "largest"
prefix of the segment, i.e., usually at the beginning of the
segment. This occurs when a sentence contains a pattern at the end
which is not in the grammar but a beginning portion that is
included. For example, in "bad inactivates jnk at this time", the
beginning of the sentence "bad inactivates jnk" will be parsed and
the remainder will be skipped.
[0074] Mode 4 requires that undefined words be skipped and an
analysis be attempted in accordance with Mode 1. Mode 4 is useful
where there are typographical errors and unknown words. For
example, in the phrase "abc bad inactivates jnk", the word abc is
unknown to the system and will be ignored but the remainder of the
phrase will be parsed.
[0075] Mode 5 first requires that the first word or phrase in the
segment associated with an action be found. Next, an attempt is
made to recognize the phrase starting with the leftmost
recognizable argument. For example, in "during bad inactivates jnk
on the fifth day," the phrase "bad inactivates jnk" will be parsed
and the remaining words will not be. If no analysis is found,
recognition is retried at the next possible argument to the right.
This process continues until an analysis is found.
[0076] Process_sects with get_section and parse_sentences gets each
section and generates intermediate output for the sentences in each
section.
[0077] Write produces the output as a list consisting of relations
and interactions
[0078] Setargs sets arguments or parameter values based on user
input or by default.
[0079] The structured output generated by the GENIE program uses a
frame-based representation. Each frame specifies the informational
type, the value, and arguments or modifier slots which are also
frames. Consider the text data input "bad inactivates the
phosphorylation of jnk." A corresponding output, as shown below, is
a frame denoting an action, which has the value inactivate; in
addition, there are two arguments. The first argument is a protein
bad and the second argument is an action with the value
phosphorylate, which has two arguments. The first argument is x
signifying that the agent has not been specified; the second
argument is a protein with the value jnk. The second argument is
the target:
[action,inactive,[protein,bad],[action,phosphorylate,x,[protein,jnk
[0080] In summary, a computer system has been disclosed that
generates structured information concerning protein and gene
interactions and relationships.
[0081] 5.2. Use of Blast for Finding Gene and Protein Names in
Journal Articles
[0082] In a specific embodiment of the invention, an exhaustive
list of gene and protein names, extracted from GeneBank, is
translated into a different alphabet system by substituting each
character in the name with a predetermined unique nucleotide
combination. The encoded names are then imported into the BLAST
database using the FASTA format. The scientific journals are
translated, using the same nucleotide combinations, into a
continuous string of nucleotides. A query is then used to match the
translated journals against the nucleotide representation of gene
and protein names in the BLAST database. Significant alignments
associated with gene and protein names are listed in the BLAST
output file, which is subsequently processed using Perl-scripts:
The final result consists of the original journal article with XML
tags surrounding the gene and protein names.
[0083] To adapt the problem to BLAST's statistical foundation,
different measures were undertaken to limit the output to the most
relevant gene and protein names. In addition, in order to fine-tune
the matching process, different BLAST parameters were adjusted,
such as the word size (which sets the size of the high scoring
words, thus influencing the sensitivity of finding HSPs) and
mismatch penalty (exact vs approximate matching).
[0084] In a specific embodiment of the invention, gene and protein
names are extracted from GeneBank's gene symbol index file. The
following is an excerpt of the file after discarding entries that
are either composed of only numbers or of less than two alphabetic
letters: [0085] gfap gamma [0086] hox a10 [0087] hox a1 [0088] wac
3'-end [0089] pit-1/ghf-1 variant [0090] [. . . ]
[0091] This list of gene and protein names is translated into a
different alphabet system by substituting each character in the
name with a predetermined unique nucleotide combination. The
conversion chart is listed in Appendix E. The encoded names are
then imported into the BLAST database using the FASTA format. For
example, the first entry in the list above is "gfap gamma." After
translation using the conversion chart, the same name appears as
follows: TABLE-US-00001 AGCAACTAAACACCCATCCAAGCAAACACACACACAAAC
[0092] Thus, the complete FASTA entry looks like this:
TABLE-US-00002 >gi|1 species, gp, gfap gamma
AAGCAACTAAACACCCATCCAAGCAAACACACACACAAAC
[0093] In FASTA, the definition line (marked with `>`) contains
information about the database entry. This line can contain any
kind of information. The information important for this particular
example is the third entry in the definition line, `gp`, that
specifies that the name can represent a gene or a protein. If the
name is unambigous, then the definition line states that the name
is only associated with a gene (`g`) or protein (`p`). The fourth
entry in the definition line is the name of the protein or gene,
"gfap gamma" in this case.
[0094] The second line in the FASTA format normally contains the
actual sequence of the protein/gene. In the example presented, the
second line contains the translated protein or gene name.
[0095] All gene and protein names are translated into the
nucleotide representation and converted into the FASTA format.
Then, the database containing these FASTA entries are specially
compiled for use in BLAST queries using a program that is included
in the BLAST package called "formatdb".
[0096] Thus, the scientific journals are translated, using the same
nucleotide combinations, into a continuous string of nucleotides.
For example, the sentence "In the absence of costimulation, T cells
activated through their antigen . . . " is translated into
TABLE-US-00003 "AAGTACAGATCCACGGAAGGAACGATCCAAACAAAGACGCAACGACAGAA
ATAACGATCCACATAACTATCCAAATACATACGCACGGAAGTACACACGTAA
TTAAACACGGAAGTACATACAGATCCATCCACGGATCCAAATAACGAATTAA
TTACGCATCCAAACAAATACGGAAGTACTCAAACACGGAACGAACCATCCAC
GGAAGGACCTACATACGTAAGCAAGGATCCACGGAAGGAACGAAGTACCTA
TCCAAACACAGACGGAAGTAAGCAACGACAGATCC"
[0097] A query is then used to match the translated journals
against the nucleotide representation of gene and protein names in
the BLAST database. The query is executed using the blastall
program that is included in the BLAST package. The query line looks
like: blastall -p blastn -d FASTA.dat -i query.txt
[0098] The flag `p` denotes the sub-program (blastn is a
sub-program of blastall that performs nucleotide matches), `d`
denotes the file that contains the FASTA entries and `i` denotes
the translated query text.
[0099] Significant alignments associated with gene and protein
names are listed in the BLAST output file. This is an excerpt from
a BLAST output file: TABLE-US-00004 gi|63624 species, gp, ner
Length = 12 Score = 24.4 bits (12), Expect = 3e-05 Identities =
12/12 (100%) Strand = Plus/Plus Query: 729 acagaacgacct 740 Sbjct:
1 acagaacgacct 12
[0100] The first line denotes the database entry. The second line
denotes the database sequence length, followed by the alignment
score and the E-value. The next line indicates paired matches,
mismatches and gapped alignment (the latter two are not shown in
this example). The lines `Query` and `Sbjct` show the actual
alignment between the query and database sequence. This output file
is subsequently processed using a Perl-script (see Appendix F). The
script shown in Appendix G scans the output file, which is
sometimes several megabytes long, for any segments that start at
position 1 of the database sequence (thus disregarding any segments
that are only part of the sequence). In addition, the script allows
for 10% mismatches between the aligned sequences for long sequences
(as shown in the script of Appendix E), or 0% mismatches for short
sequences. After scanning the output file, an intermediary file
that lists the candidate sequences is created: [0101]
tran|365|381|gp|18493 [0102] tran|1|17|gp|18493 [0103]
peci|549|565|gp|58106 [0104] il-2|621|637|gp|82396 [0105]
il-2|325|341|gp|82396 [0106] gati|193|209|gp|92088 [0107]
prod|641|657|gp|52292 [0108] rap1|105|121|gp|49898 [0109]
spec|545|561|gp|33183 [0110] crip|385|401|gp|18905 [0111]
crip|21|37|gp|18905 [0112] as|161|177|gp|133961 [0113]
her|65|77|gp|88411
[0114] The intermediary file lists the name of the sequence,
followed by the starting and end point in the query sequence
(corresponds to where the two sequences matched), the semantic
class of the name (protein, gene or protein/gene). The last number
is not considered.
[0115] The intermediary file is then scanned by another Perl
program (Appendix G). This program compares the starting end points
with the actual text, making sure that the matched name is an
`autonomous` entity in the query text. For example, while "per" in
"per gene" should be recognized as a gene name, "per" in "personal"
should not be recognized as a gene name. The program recognizes
other characters than the space character delimiting an
`autonomous` gene or protein name. In addition, the script looks
for plurals of words. For example, "interleukins" should be
recognized as a protein name, although only the singular form,
"interleukin", is in the database.
[0116] The final result consists of the original journal article
with XML tags surrounding the gene and protein names. This is done
using the same script as in Appendix G: blocked <phr
sem="gp">T cell antigen receptor </phr>(TCR)- and <phr
sem="gp">CD28</phr>-mediated <phr
sem="gp">IL-2</phr>gene transcription. Therefore, <phr
sem="gp">Rap1</phr>functions as a negative regulator of .
. .
[0117] To adapt the problem to BLAST's statistical foundation,
different measures were undertaken to limit the output to the most
relevant gene and protein names.
[0118] BLAST is sensitive to the search space the program works in.
Thus, given a long query sequence and a large sequence database,
matches have a lower statistical significance because the chances
are higher that the matches could have occurred by chance alone. In
addition, matches with few letters have a lower statistical
significance than matches with many letters. In order to find all
true matches with any significance level, some measures were
undertaken to address this problem. For example, (i) the query
sequence was divided into 10 equal length parts, i.e., the journal
article was divided into 10 parts and 10 different queries are run
on each part separately; (ii) the sequence database (with the gene
and protein names) is separated into 5 databases, each containing
protein/gene names of different length; (iii) gene and protein
names with less than 3 letters in the database were `expanded`,
i.e., spaces were added at the beginning and the end of the name.
Doing so, the statistical significance of a match containing a
short name was higher. A space does not only include an empty
character. For example, a gene name "k4" could occur in a journal
article as "kinin 4 (k4)". It was therefore important to define
several characters as substitutes for a space character. The
alphabet in Appendix E defines the nucleotide combination ATCC as
such a substitute.
[0119] Working with nucleotides implies that errors involving
reading frames must be addressed. For example, working with a code
of four letters, the nucleotide combination ATCTGTCACG could mean
ATCT/GTCA or TCTG/TCAC or CTGT/CACG . Since the text is translated
into a nucleotide combination, only one of these possibilities is
correct. But BLAST can not distinguish between these solutions,
i.e., BLAST would potentially match a database sequence to a wrong
reading frame in the query sequence, producing many nonsense
results that could compromise the significance of true results.
[0120] The solution to this problem is a comma-free code. A comma
free code knows only one correct reading frame. BLAST therefore
does not produce any nonsense results. A comma-free code consists
of only one permutation of a nucleotide combination. For example,
given the nucleotide combination ATCC and its permutations CATC,
CCAT and TCCA, only ONE of these permutations would be included in
a comma-free code. The code in Appendix E does represent a comma
free code. Comma-free codes were discussed in the early days of DNA
research (Crick et al., Proc. Natl. Acad. Sci. 43:416-421).
[0121] In order to fine-tune the matching process, different BLAST
parameters must be adjusted, for example: word size (which sets the
size of the high scoring words, thus influencing the sensitivity of
finding HSPs); mismatch penalty (exact vs approximate matching);
numbers of alignments to show (true matches of low significance can
sometimes be at the very end of the BLAST output, therefore many
alignments have to be shown); and expectation value (which sets the
significance value for matches in the output file).
[0122] 5.3. Generation of Specialized Databases
[0123] In accordance with the present invention, specialized
databases may be developed that contain information derived from
unpublished data, publications such as research articles, theses,
posters, abstracts, etc. and/or databases concerning interactions
among genes and proteins, their domain/motif structure, and their
biological functions.
[0124] For example, but not by way of limitation, a specialized
database may be prepared as follows. Protein and gene sequences may
be provided, for example, by the Java program PsiRetrieve which
allows for quick retrieval of protein or nucleotide sequences from
binary BLAST databases by sequence accession number, keyword or
groups of keywords, or species name. In addition, using the program
PsiRetriever, sequences encoding the proteins of interest may be
retrieved from the non-redundant (NCBI) database of protein
sequences and stored as a FASTA file. The FASTA file is then
converted into a binary blast database using the program FORMATDB
from the BLAST suit of programs.
[0125] Known motifs/domains for proteins may also be collected
using the flat file versions of major protein databases, such as
SwissProt (http://expasy.hcage.ch/sprot) and the non-redundant
database of NCBI (http://www3.ncbi.nlm.nih.gov). The databases can
be downloaded and searched for the keywords "motif" and "domain" in
the feature tables of proteins. In addition, existing databases of
motifs and domains, such as
BLOCKS(http://dupsas.Weizmann.ac.il/bcd/bcdparent//databanksblocks/hfml)
and pfam(http://www.sanger.ac.uk//software/pfam;
http://pfm.wustl.edu), can be downloaded (Henikoff et al., 1991,
NAR 19:6565-6572). Still further, it is understood that any
publically available database containing gene/protein sequences may
be utilized to generate the specialized databases for use in the
practice of the present invention.
[0126] Homologous sequences may be aligned using, for example, the
CLUSTALW program (Higgins, et al. 1996 Methods in Enzymology 266:
383-402). A protein's sequence corresponding to each domain/motif
can be identified, saved and used for building a Hidden Markov
Model (HMM) of the domain/motif using a HMMER and HMMER2 packages
(see, Durbin, R. et al. 1998 in Biological Sequence Analysis:
Probablistic Models of Proteins and Nucleic Acids). HMMER and
HMMER2 packages are useful for (i) building HMMs from sets of
aligned protein or nucleotide sequences, and (ii) comparing the
HMMs with sequence databases aimed at identifying significant
similarities of HMMs with database sequences. Both nucleotide and
protein databases can be used for this purpose. Alternatives to the
Hidden Markov Model method for building domain/motif models include
neural network motif analysis (Wu, C. H. et al., 1996, Comput Appl
Biosci 12, 109-18; Hirst, J. D., 1991, Protein Eng 4:615-23) and
positional weight matrix analysis (Claverie, J. M., 1994, Comput
Chem 18:287-94; Venezia, D., 1993, Comput Appl Biosci 9:65-9;
Bucher, P. 1996, Comput Chem, 20:3-23; Tatusov, R. L., 1994, Proc
Natl Acad Sci USA 91:12091-5).
[0127] Once a comprehensive collection of motifs/domains is
created, each particular protein may be compared against a complete
database of HMMs to identify known motifs and domains.
The Hidden Markov Model (HMM) is built using the following
steps:
[0128] A1. Start with a motif/domain name and a single amino acid
sequence representing a domain or motif. [0129] A2. Do PSI-BLAST
(BLASTPGP) search with the motif/domain sequence against a protein
non-redundant database. [0130] A3. Retrieve the sequences
identified in the database search from the protein sequence
database. Exclude low-complexity sequences, short or incomplete
sequences and sequences with similarity score above a selected
threshold of PPD value<0.001 [0131] A4. Align the set of
sequences with CLUSTALW (or other multiple sequence alignment
program). [0132] A5. Use the set of aligned sequences for building
HMM with the programs provided with HMMER and HMMER2 packages (see
Hughey and Krogh 1996, J. Mol. Biol. 235:1501-1531). [0133] A6. Do
a new database search comparing new HMM with the non-redundant
protein database. [0134] A7. Continue steps A3-A6 until the
convergence of the Markov model i.e., until no new sequences are
identified, or the maximum allowed number of iterations as defined
by the user is reached. (Hugh R. and Krogh A., 1996, Comput. Appl.
Biosci. 12: 95-107).
[0135] In addition, in yet another embodiment of the invention, a
specialized database may be designed to contain a semantic model of
proteins and of the possible interactions between them. Such
databases are particularly useful for computation and analysis of
regulatory networks between proteins. The semantic model is
designed for representing substances, such as proteins and actions
between them, and is based on widely accepted principles of
object-oriented programming languages such as Java. FIG. 3 is a
diagram illustrating the object representation of molecules and
relations between them. As indicated in FIG. 3 there are six major
classes, corresponding to the top-level classification of objects
and actions: (i) a substance; (ii) a state of a substance; (iii) a
similarity between substances; (iv) an action between substances;
(v) a result of the action; and (vi) a mechanism that enables an
action.
[0136] FIG. 3 presents the class design graphically, listing the
variables that represent the properties of each class or class
object in the implementation. Classes can be made nested via the
mechanism of "inheritance", i.e., classes are defined starting with
the most general ones and moving towards more specific classes.
Definition of more specific classes is simplified because the
properties of the general classes are "inherited" by the specific
classes and need not be redefined each time (see, Flanagan 1997,
Java in a Nutshell, Second Edition. O'Reilley & Associates,
Inc. Sebastopol, Calif.).
[0137] As shown in FIG. 3, the two key object types in this scheme
are substances (nodes of the graph representing regulatory
networks) and actions (oriented edges connecting pairs of nodes),
while result and mechanism objects are auxiliary to object action.
Each substance object is characterized with a state. In this
scheme, action is the most complicated object; each action object
is characterized by a specific pair of substances participating in
the action, one of which can be active and is referred to as
Subject Substance and the second of which can serve as a substrate
for the former and is referred to as Object Substance. Furthermore,
for each action the initial and final states corresponding to
interacting substances are defined. The property Time Required of
each Action Object allows the setting of different durations for
different actions (time is measured in relative units; see Rene
Thomas and Richard D'Ari, 1990, "Biological Feedback," CRC Press
Boca Raton, Ann Arbor, Boston).
[0138] Once developed, the specialized databases can be used to
identify novel genes based on computation and analysis of
phylogenetic trees for multigene families and analysis of
homologous regulatory networks.
[0139] In a specific embodiment of the invention, a specialized
database was generated using a set of keywords defining proteins
involved in apoptosis (see, FIG. 4). The specialized sequence
database was referred to as Apoptosis 3. As a first step in
generating the specialized database, a comprehensive set of
articles describing the system of apoptosis or programmed cell
death was compiled. The articles were analyzed and information on
regulatory pathways characterizing apoptosis from a variety of
different organisms was extracted. Such pathways included those
involved in MHC-T cell receptor interactions, inflammatory cytokine
signal transduction, induction by light, .gamma.-radiation,
hyperosmolarity or heat shock, pathways involving immunoregulatory
receptors or receptors having cytoplasmic domains, integrin-related
pathways and perforin/granzyme.beta. related pathways. The
collected information was stored using Powerpoint (Microsoft) as a
collection of graph/plots depicting the regulatory pathway. In
addition, a list of proteins relevant to regulation of apoptosis
was compiled.
[0140] Using the program Psi Retriever, sequences encoding the
proteins relevant to regulation of apoptosis were retrieved from
the non-redundant (NCBI) database of protein sequences and stored
as a FASTA file. The FASTA file was then converted to a binary
blast database using the program FORMATDB from the BLAST suit of
programs. The BLAST suit of programs provides a set of programs for
very fast comparisons of a single sequence to a large database.
Both the database and the search or query sequence can be any
combination of nucleotide and/or amino acid sequences.
[0141] In a working example described herein, the Apoptosis 3
database was used to compare genomic and cDNA sequences derived
from the 13q region of human chromosome 13. This region of the
chromosome is associated with Chronic Lymphocytic Leukemia (CLL).
Using this method of analysis a human gene with significant
homology to the mouse Rpt1 gene was identified. When the activity
of Rpt1 is knocked out in mice, the regulatory effect is manifested
as a block in T-lymphocyte apoptosis. This result indicates that
the identified human Rpt1 homology may represent the gene in which
genetic defects lead to CLL.
[0142] The amino acid sequence of the human Rpt1 gene is presented
in FIG. 15. The present invention relates to nucleic acid molecules
encoding the human Rpt1 protein shown in FIG. 15. The invention
also relates to nucleic acid molecules capable of hybridizing to a
nucleic acid molecule encoding the human Rpt1 protein presented in
FIG. 15 under conditions of high stringency. By way of example and
not limitation, procedures using such conditions of high stringency
are as follows: Prehybridization of filters containing DNA is
carried out for 8 hours to overnight at 65.degree. C. in buffer
composed of 6.times.SSC, 50 mM Tris-HCl (pH7.5), 1 mM EDTA, 0.02%
PVP, 0.02% Ficoll, 0.02% BSA and 500 mg/ml denatured salmon sperm
DNA. Filters are hybridized for 48 h at 65.degree. C. in
prehybridization mixture containing 100 mg/ml denatured salmon
sperm DNA and 5-20.times.10.sup.6 CpM of .sup.32P-labeled probe.
Washing of filters is done at 37.degree. C. for 1 hr in a solution
containing 2.times.SSC, 0.01% PVP, 0.01% Ficoll and 0.01% BSA. This
is followed by a wash in 0.1.times.SSC at 50.degree. C. for 45
minutes before autoradiography. Other conditions of high stringency
which may be used are well known in the art.
[0143] 5.4. Gene Discovery through Phylogenetic Analysis of Gene
Families
[0144] The present invention provides a method for identifying
novel genes comprising the following steps: (i) comparing a single
sequence with a database; (ii) processing the output into a
sequence alignment; (iii) computing gene trees; and (iv) analyzing
the trees to predict the existence of undiscovered genes.
[0145] FIG. 5 shows a "species tree," a "gene tree" and a
"reconciled tree". A "species tree", as defined herein, is a graph
depicting the correct order of speciation events leading to a set
of present day species as defined by taxonomy. A "gene tree" is a
graphical representation of the evolution of a gene from a single
ancestral sequence in a common progenitor to a set of present-day
sequences in different species. Where gene duplication has
occurred, a branch is bifurcated. The branch lengths of a gene tree
are most frequently measured either in terms of the number of amino
acid or nucleotide replacements per site or in terms of millions of
years (absolute geological time). In the former case, the average
replacement rate in the majority of the published trees varies
among tree branches, and the root-to-tip distances are different
for different present day sequences. In the latter case, all
root-to-tip distances are equal and the height of each interior
node of the tree corresponds to the absolute geological time passed
since the gene duplication corresponding to the interior node took
place.
[0146] If a gene is unique, i.e., represented with a single copy
per genome rather than being a member of a family of similar genes,
the correct gene tree depicting the origin of this gene in a few
different species is identical to the species tree. In many
instances, a single ancestral gene has been duplicated repeatedly
during evolution to form a multigene family. A gene tree is
constructed from a gene as it occurs in several species and
reflects both speciation events and gene duplications within the
same genome. Two homologous genes taken from different species that
originated from the nearest common ancestor by speciation are
referred to as orthologs, while any two genes that originated from
the common ancestor via a series of events involving intragenomic
duplications, or conversions, are called paralogs. The terms
"ortholog" and "paralog" are applied to both nucleic acid and
proteins herein.
[0147] If gene deletions are forbidden and all genes for all
species represented in the tree are known, the gene tree can be
reconfigured to recapitulate the species tree, such that each
subtree contains only orthologous genes. This tree is referred to
as a reconciled tree and is shown in FIG. 5. Imperfect gene trees
which contain incorrect or partial species subtrees can be used to
build reconciled trees that indicate events of speciation, gene
loss, and gene duplication.
[0148] Orthologs from different species in gene trees are usually
clustered together, so that if all the existing homologous genes
from different species were known, the same relationship of species
would be recapitulated in each cluster of orthologous genes. Since
in reality a considerable number of genes are not yet identified,
the real gene trees contain incomplete clusters of orthologs that
can be used for identification of the missing genes.
[0149] By applying phylogenetic analysis, i.e., reconstruction of
gene trees of gene/protein sequences, one can predict the existence
of undiscovered genes in humans and other species in addition to
identifying the function of a gene. Such a technique is a
significantly more powerful tool for identification of new genes
than mere sequence comparisons.
[0150] Methods of computing gene trees from a set of aligned
sequences include the : (i) heuristic method based on an
optimization principle which is not directly motivated by a
probability model (Fitch, 1974 J. Mol. Evol. 3:263-268)), (ii) the
maximum likelihood method (Goldman, 1990, Syst. Zool. 30:345-361;
Yang et al., 1995, Syst. Biol. 44:384-399; Felsenstein, J., 1996,
Methods Enzymol. 266-418-427); and (iii) the distance matrix tree
making method (Saito, N. and Nei, M., 1987, Mol. Biol. Evol.
4:406-425). Since the data analyses of orthologs and paralogs often
involve very distantly related sequences, the maximum likelihood
method is preferably used for small data sets and the
distance-matrix method in other instances.
[0151] To construct a reconciled tree according to the invention,
the first step comprises a search for homologs in a publicly or
privately available database such as, for example, GenBank, Incyte,
binary BLAST databases, Swiss Prot and NCBI databases. Following
the identification of homologous sequences a global alignment is
performed using, for example, the CLUSTALW program. From the
sequence alignment a gene tree is constructed using, for example,
the computer program CLUSTLAW which utilizes the neighbor-joining
method of Saito and Nei (1997, Mol. Biol. Evol. 4:406-425).
Construction of a species tree is then retrieved from, for example,
the following web site:
http://www.3.NCBI.NLM.NIH.GOV//taxomy.tax.html.
[0152] The species tree and gene tree are given as input into the
algorithm described below, which integrates both trees into a
reconciled tree. Agreement between the gene tree and the
corresponding species tree for any given set of sequences indicates
the identification of orthologs. In contrast, disagreement between
the species and gene tree suggest a gene duplication that resulted
in the formation of a paralog. Thus, through generation of a
reconciled tree one can identify orthologs present in one species
but missing in another. These can be deduced by forming subtrees of
orthologs in a gene tree, and then comparing the subtree in the
gene tree with a species tree. A missing gene appears as a branch
present in the species tree but absent in the gene tree. The
algorithm for defining an orthologous gene subtree and predicting
the undiscovered, or lost in evolution, genes is as follows:
[0153] Let T.sub.g be the most likely gene tree identified with one
of consistent tree-making methods from a set of properly aligned
homologous genes {1, 2, . . . , s}, such that one or more
homologous genes from every species corresponds to pending vertices
of T.sub.g. Each gene is labeled with the species it comes from (1,
. . . ,s) adding subscripts to distinguish homologous genes from
the same species whenever it is necessary. Let T.sub.g be the true
species tree (tree correctly reflecting speciation events which we
assume to be known) for species {1, 2, . . . , s}. Due to the
biological meaning of T.sub.s each species in this tree is
represented only once. It is assumed that both T.sub.s and T.sub.g
are binary, although it is straightforward to extend the algorithm
described here to the case of multifurcated trees.
Algorithm
[0154] A1. For each pair of interior nodes from trees T.sub.g and
T.sub.s, compute similarity .sigma.(S.sub.gi,S.sub.sj) [0155] A2.
Find the maximum .sigma.(S.sub.gi,S.sub.sj). [0156] A3. Save
S.sub.gi as a new subtree of orthologs, save {S.sub.gi}-{S.sub.sj}
as a set of species that are likely to have gene of this kind (or
lost it in evolution). [0157] A4. Eliminate S.sub.gi from T.sub.g;
T.sub.g:=T\S.sub.gi. [0158] A5. Continue A2-A4 until T.sub.g is
non-empty. The following definitions apply:
[0159] Let S.sub.gi be an ith subtree of T.sub.g (corresponding to
the ith interior node), correspondingly, let S.sub.sj be jth
subtree of tree T.sub.g.
[0160] Let {S.sub.gi} stand for an unordered set of species
represented in S.sub.gi such that each species is represented
exactly once, and let |{S.sub.gi}| and {|S.sub.gi|} be the number
of entries in {S.sub.gi} and the number of pending vertices in
S.sub.gi, respectively. Define by S.sub.sj(S.sub.gi) the unique
subtree of S.sub.sj that has leaves labeled exclusively with
species from |{S.sub.gi}|, so that each element of |{S.sub.gi}| is
used i.e., that is, the unique subtree obtained by eliminating from
S.sub.sj all species that are not present in |{S.sub.gi}|.
[0161] Then define similarity measure, .sigma., between S.sub.gi
and S.sub.sj in the following way: .sigma.(S.sub.gi,S.sub.sj)=0 if
|S.sub.gi|.noteq.|{S.sub.gi}|, or
S.sub.sj(S.sub.gi).noteq.S.sub.gi; and
.sigma.(S.sub.gi,S.sub.gi)=|S.sub.gi| The support of tree clusters
by data can be measured using the bootstrap technique described in
Felsenstein (1985, Evolution 39:783-791).
[0162] In an embodiment of the invention, the human antiquitin gene
was identified using phylogenetic analysis. The aldehyde
dehydrogenase gene family in humans can be subdivided into at least
ten ancient subtrees characterized by different functions of
corresponding proteins. These genes probably arose from a series of
gene duplications of an ancestral gene which took place before the
divergence of a common ancestor of Eukaryotes and Eubacteria.
[0163] The aldehyde dehydrogenase gene cluster is highlighted in
FIG. 6 which shows the original tree of ALDH sequences, the circled
area indicating a sequence cluster where bacterial (Bacillus
subtilis), plant (Brassica napus), and nematode (Caenorhabditis
elegans) ortholog is present, but a human ortholog is not known. A
random screening of cDNA libraries showed that a human ortholog,
referred to as antiquitin, does exist. FIG. 7 shows the same gene
tree as in FIG. 6 with an additional human protein referred to as
antiquitin present in the tree.
[0164] In yet another embodiment of the invention, a human ortholog
of the murine Max-interacting transcriptional repressor Mad3 was
identified through phylogenetic analysis of a gene family. The gene
tree was constructed as follows. The protein sequences of known
members of the Mad gene family were extracted from GenBank
database. The extracted sequences were aligned using multiple
alignment program CLUSTALW running on Sun SPARC station. Redundant
and non-homologous sequences as well as distant homologs from S.
cerevisiae, C. elegans, D. melanogaster etc. were removed from the
alignment. The refined set of sequences were realigned with
CLUSTALW and a gene tree as presented in FIG. 18A was computed. To
identify a human ortholog of the Mad3 protein, a human dbEST at
NCBI was searched with program TBLASTN using mouse Mad3 protein
sequences as a query. Two highly homologous ESTs were identified
and are presented in FIG. 17A. To obtain a complete coding sequence
a search was conducted to obtain overlapping sequences in dbEST.
The search for overlapping sequences was performed using the
program Iterate with EST Zs77e55.rl (gb/AA278224) as the search
query. The search identified a single overlapping sequence. The
search for overlapping sequences was performed using program
Iterate with EST zs77e55.rl (gb/AA278224) serving as a query. The
search returned a single overlapping sequence, namely HUMGS0012279
(dbj/C02407), thus showing that the two EST sequences found during
the initial TBLASTIN search belong to the same gene. The complete
sequence of the gene was assembled from the two ESTs using
commercially available sequence assembly program SeqMan11(DNASTAR
Inc., WI). The nucleotide sequence of the human Mad3 gene is
presented in FIG. 17B. The deduced amino acid sequence of which is
presented in FIG. 17C. The complete DNA sequence is also shown.
[0165] The present invention relates to nucleic acid molecules
encoding the human Mad3 protein shown in FIG. 17C. The invention
also relates to nucleic acid molecules that hybridize to the
nucleic acid molecule of FIG. 17B under conditions of high
stringency and encode a Mad3 protein. By way of example and not
limitation, procedures using such conditions of high stringency are
as follows: Prehybridization of filters containing DNA is carried
out for 8 hours to overnight at 65.degree. C. in buffer composed of
6.times.SSC, 50 mM Tris-HCl (pH7.5), 1 mM EDTA, 0.02% PVP, 0.02%
Ficoll, 0.02% BSA and 500 mg/ml denatured salmon sperm DNA. Filters
are hybridized for 48 hours at 65.degree. C. in prehybridization
mixture containing 100 mg/ml denatured salmon sperm DNA and
5-20.times.10.sup.6 CpM of .sup.32P-labeled probe. Washing of
filters is done at 37.degree. C. for 1 hour in a solution
containing 2.times.SSC, 0.01% PVP, 0.01% Ficoll and 0.01% BSA. This
is followed by a wash in 0.1.times.SSC at 50.degree. C. for 45
minutes before autoradiography. Other conditions of high stringency
which may be used are well known in the art.
[0166] 5.5. Simulation and Hypotheses Testing
[0167] The simulation and hypothesis testing methods of the
invention, described in the subsections below, utilize specialized
databases of gene/protein structures and interactions for
identifying potentially undiscovered members of multigene families
through comparisons of regulatory networks for different species,
searching expressed sequence tag (EST) databases, and simulation of
regulatory cascades.
[0168] 5.5.1. Gene Discovery through Analysis of Regulatory
Networks
[0169] The present invention provides a method for identifying
undiscovered genes through comparisons of regulatory networks for
different species where functionally similar regulatory systems are
conserved. The amount of information available concerning
regulatory genes and/or proteins in different organisms and their
functional relationships allows one to reconstruct and compare
regulatory networks. Since in most cases, the knowledge of all
genes involved in almost any particular regulatory system is
incomplete, a comparison of homologous networks within the same
organism and between different species permits the identification
of genes absent in a system under comparison.
[0170] The identified genes, being part of a regulatory network,
are implicated as potentially contributing to a phenotype of a
disease associated with the system under analysis. Using the
methods of the present invention these putative disease genes can
be cloned, mapped and analyzed for mutations directly, thereby
omitting the expensive and time-consuming steps of positional
cloning and sequencing of genomic regions. Gene discovery by
analysis of regulatory networks is outlined in FIG. 8. The analysis
is initiated starting with a biological system (e.g., signaling
pathway of genes involved in Bcl-2-regulated apoptosis in
lymphocytes), a single gene (e.g., Bcl-2) or a gene family (e.g.,
caspases).
[0171] Initially, a specialized database is generated for
comparison of regulatory networks between different species. For
example, starting with a single candidate gene in a single species,
a typical iteration in this process begins with identification of
all known proteins and genes that are upstream and downstream with
respect to it in regulatory hierarchies and the reconstruction of a
network of interacting genes and proteins. Next, for each protein,
a set of key domains and motifs is identified and this information
is used to search for related proteins in humans and other species.
The identified sequences are compared and for each pair of
sequences showing similarity above a certain threshold, a
similarity object is generated. A similarity object is generated if
two sequences, nucleotide or amino acid, show significant
similarity in database searches (p value<0.001). The object
retains the following information: (i) reference to similar
substances i.e., genes or proteins; (ii) significance of the
similarity, similarity score and percent of identity; and (iii)
coordinates of the similarity region within two compared sequences.
"Orthology objects" constitute a subset of "similarity objects"
which satisfies one additional requirement, i.e., that two similar
sequences should be identified as orthologs by the tree-based
algorithm described above. In identifying orthologs, if gene A is
orthologous to gene B, and gene B is orthologous to gene C, gene A
is necessarily orthologous to gene C.
[0172] In a specific embodiment of the invention, for each species
under analysis, orthologous proteins or genes are identified. In a
further embodiment of the invention, small orthologous molecules
participating in a regulatory network for two or more species may
also be identified. Where proteins, genes, or molecules are
orthologs, the action of the protein, gene or molecule between
species may be interchangeable. If more than two species are
involved in the analysis, subtrees of orthologous substances and
subtrees of orthologous actions are identified.
[0173] Once orthologous genes, proteins or molecules are identified
in two or more species, by forming a reconciled tree, for example,
a set of orthologous or paralogous regulatory networks can be
analyzed and visualized using graph theory where arcs represent
actions and vertices represent substances. Thus, the method of the
invention may further comprise the following steps: (i)
superimposing the orthologous regulatory networks from two or more
species and searching for the actions (arcs) and substances
(vertices) in the homologous networks that are represented in some
taxa but absent in others; (ii) superimposing paralogous regulatory
networks from the same taxa and searching for paralogous genes that
are missing in some taxa; and (iii) computing a general regulatory
network that summarizes common regulatory sequence relationships
known for more than one species.
[0174] In a specific embodiment of the invention a set of
regulatory networks from different species, relating to the same
biological system, apoptosis, for example, can be analyzed and
visualized utilizing the following methods: (i) for each species
functional information is collected relating to apoptosis; (ii)
using the functional information, regulatory networks for each
species comprised of interacting proteins and/or the genes involved
in apoptosis are generated; (iii) the sequences of the interacting
proteins and genes of each of the regulatory network are compared
and for sequences showing similarity above a predetermined
threshold range; and (iv) distinguishing between orthologs and
paralogs using the methods set forth above.
[0175] An analysis similar to that performed using subtrees of
sequences may be applied to classify protein functions as
orthologous or paralogous actions. A "generalized" regulatory
network maybe represented as a network wherein a substance as it
occurs in a particular species is substituted with a cluster (i.e.,
subtree) of orthologous substances among species. In the final step
of the analysis the clusters within each species are compared to
one another, to identify missing genes.
[0176] FIG. 11 depicts the regulatory relationships among
hypothetical proteins (denoted with Arabic numerals) of
hypothetical species A and B. As indicated in FIG. 11A, an overlay
of regulatory data for two species overlaps, but not completely. As
indicated, protein 5 is known only for species B while protein 3 is
known only for species A. The proteins in different species denoted
with the same numeral are considered orthologous. As indicated, the
regulatory relationships between a pair of proteins can be of three
different kinds. FIGS. 9B, 9C, and 9D represent Boolean operations,
OR, AND, and XOR, as arcs of the two regulatory relationships
depicted in FIG. 9A, the same operations being applicable to the
set of vertices of the two regulatory relationships. In some
instances, orthologous networks in two distantly related taxa may
have the same domains but arrangement of the domains between the
related taxa may be different. In such a case, a one-to-one
correspondence between orthologous proteins in closely related
species has to be substituted with a one-to-many relationship among
domains comprised within the proteins. For this purpose, a
similarity object may be defined operating on pairs of
motifs/domains in two proteins, and substitute pairs of orthologous
proteins with pairs of orthologous domains. After this correction,
homologous networks are compared as described above.
[0177] FIG. 10 is a diagram representing a hypothetical example of
defining homologous protein networks in two different species using
protein motifs, the diagram showing only two hypothetical proteins
(lane 2) for species A and three hypothetical proteins (lanes 1, 3,
and 4) for species B. Protein 1 in both species has motifs .alpha.
and .beta., protein 2 has motifs .delta., .epsilon., and .zeta.,
and proteins 3 and 4 have motifs .delta. and .zeta., and .epsilon.,
respectively. The motif analysis indicates that proteins 3 and 4 in
species B may collectively perform the same function as protein 2
in species A.
[0178] 5.5.2 Gene Discovery Based on Protein Motif/Domain
Searches
[0179] The present invention provides yet another method for
identifying genes that are homologous and perform the same or an
analogous function in different species. The method of the
invention comprises the following steps: (i) creating a database of
sequences which comprise a motif or domain composition of a gene of
interest using, for example, HMMER software; and (ii) searching
additional databases for expressed sequence tags (ESTs) containing
the domains and motifs characteristic for the gene of interest with
HMMs of domains and motifs identified in step (i). In yet another
embodiment of the invention, sequences may be searched which
correspond to nucleotide sequences in an EST database or other cDNA
databases using a program such as BLAST and retrieving the
identified sequences. In an optional step, for each EST identified,
sequence databases can be searched for overlapping sequences for
the purpose of assembling longer overlapping stretches of DNA. Once
identified, the ESTs can be used to isolate full length nucleotide
sequences comprising the gene of interest using methods such as
those described in Section 5.4, infra.
[0180] The general flowchart scheme for gene discovery analysis
based on motif/domain search is shown in FIG. 11. In a specific
embodiment of the invention, the method referred to as the
"phylogenetic reflection technique"comprises, first, defining the
motif or domain composition of a gene of interest involved in a
biological system of interest. Second, protein-coding genes from
other species, including for example yeast and/or nematode genes,
that bear a significant similarity to the gene of interest or a
specified domain of the corresponding protein are collected. Third,
the identified genes are in turn subjected to a "domain analysis"
to establish protein motifs which might suggest a function of these
genes using, for example, HMMER software. Fourth, the selected
genes are in turn used for database searches in EST databases
(dbEST) and/or a non-redundant (nr) database to identify unknown
genes that are potentially orthologous to the selected yeast and
nematode genes. Once identified ESTs having different tumor
suppressor domains may be linked using multiple PCR primers. Using
routine cloning techniques, well known to those of skill in the
art, a full length cDNA representing the gene of interest can be
obtained.
[0181] Once new genes are identified by domain/motif analysis
experimental searches may be carried out to isolate complete coding
sequences and evaluate their tissue- and disease-specific
expression patterns. In parallel their position with respect to
regulatory networks can be identified as described below.
[0182] In a specific embodiment of the invention, an apoptosis
related human gene was identified using the method described above.
As a first step C. elegans genes containing either POZ or Kelch
domains were identified. A Hidden Markov Model was developed using
POZ and Kelch sequences from the Drosophila Kelch protein and any
identified homologs. The resulting Hidden Marker Model was used to
search through the collection of C. elegans protein sequences. One
of the identified C. elegans genes contained a POZ domain, death
domain, kinase domain and heat repeat. The presence of both a death
domain and a kinase domain suggested that the protein functions as
a regulatory protein.
[0183] A human EST database was searched using the protein sequence
of the identified C. elegans gene and two sequences were identified
(FIG. 14A). A gene tree was computed to determine whether the
identified human sequences were orthologs of the C. elegans gene.
As depicted in FIG. 14B, the human EST AA481214 appears to be a
true ortholog of the C. elegans gene. FIG. 14C presents the
nucleotide sequence of the identified death domain gene. FIG. 14D
presents the amino acid sequence of the death domain protein.
[0184] The present invention encompasses the nucleic acid molecule
of FIG. 14C, comprising the sequence of EST AA481214 and proteins
encoded by said nucleic acid molecule. The invention also relates
to nucleic acid molecules capable of hybridizing to such a nucleic
acid molecule under conditions of high stringency. By way of
example and not limitation, procedures using such conditions of
high stringency are as follows: Prehybridization of filters
containing DNA is carried out for 8 hours to overnight at
65.degree. C. in buffer composed of 6.times.SSC, 50 mM Tris-HCl
(pH7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA and 500
mg/ml denatured salmon sperm DNA. Filters are hybridized for 48
hours at 65.degree. C. in prehybridization mixture containing 100
mg/ml denatured salmon sperm DNA and 5-20.times.10.sup.6 CpM of
.sup.32P-labeled probe. Washing of filters is done at 37.degree. C.
for 1 hour in a solution containing 2.times.SSC, 0.01% PVP, 0.01%
Ficoll and 0.01% BSA. This is followed by a wash in 0.1.times.SSC
at 50.degree. C. for 45 minutes before autoradiography. Other
conditions of high stringency which may be used are well known in
the art.
[0185] 5.5.3. Simulation of Regulatory Cascades
[0186] In an embodiment of the invention, an interactive graphical
program is utilized for visualizing the scheme of regulatory
relationships, "current" states of the substances, and active and
inactive actions between pairs of substances. Such a program can be
utilized for identification of genes which are associated with a
specific disease. Currently, disease associated genes are
discovered through positional cloning methods which combine methods
of genetics and physical mapping with mutational analysis. The
present invention provides a novel method for discovering disease
associated genes. For simulating regulatory cascades, it is assumed
that the time in a simulated regulatory system advances in discrete
"quanta," or periods of time. The "state of substances" of the
system for each discrete period of time is computed by: creating a
set of substance objects, where a set of interactions between each
created substance object is known, an initial state is specified.
The time is initially set to zero. All defined actions are observed
to confirm that the substances corresponding to the actions (i)
exist, and (ii) are in the right initial states. Action is defined
by a pair of substances that are in suitable states. The "subject"
substance is in the inactive state, while the "object" substance
can be in either active, or inactive, state depending on the action
type. For example, the action "dephosphorylation" requires an
active phosphatase ("subject" substance) and a pliosphorylated
substitute protein ("object" substance) in phosphorylated form. If
both conditions are satisfied, the action is recorded as in
progress. At termination, the substances must change their states
as specified by the action. On each following "quantum" of time,
the simulation proceeds in the same way while maintaining the
"bookkeeping" of the remaining time for each action and the
remaining lifespan of each substance. The simulation stops when
there are no more active actions available. The program allows
editing of the properties of the objects, changing the scale and
focus of the visualized simulation, and experimenting with the
systems output.
[0187] In a specific embodiment of the invention a "knock out" of a
gene can be simulated to model the regulatory system that normally
includes hypothetical gene A. One of the typical questions related
to the gene knock out is how does the knock out affect a biological
pathway of interest. A hypothetical example of evaluating the
impact of a knock out of hypothetical gene A on the expression of a
hypothetical gene B is shown in FIG. 12. The answer to such a
question could be "gene B will be inhibited" or "gene B will be
induced" or "no effect".
[0188] In the practice of the present invention, a simple algorithm
involving multiplication of gene interaction "signs" along the
shortest pathway between the genes can be used to determine the
outcome. The algorithm involves the following steps: (i)
identification of the shortest non-oriented pathway connecting
genes A and B involved in a pathway of interest; (ii) assigning
sign "-" to gene A since it is knocked out and taking this sign as
the initial sign value; (iii) moving along the shortest pathway
between genes A and B, multiplying the current value of the sign
with the sign of the next arc, where "-" stands for inhibition, "+"
stands for induction or activation, and "0" stands for the lack of
interaction between two proteins in the specified direction; (iv)
determining if the final result of multiplication is "0", if so
eliminating the zero arc and trying to find the shortest oriented
bypass pathway between A and B in the remaining network; otherwise
stop. The final value of the sign at the moment of arriving at
vertex B would indicate the most likely effect of the knock out of
gene A which can be any one of the following: inhibition of gene B,
induction/activation of gene B, or none. In addition to the
"electronic knock out", an "electronic knock in" of a particular
gene can be simulated. In such a computer simulation, the
artificial addition of a gene and its effect on a regulatory system
may be analyzed.
[0189] 5.6. Identification and Isolation of Novel Genes
[0190] The present invention relates to identification of novel
genes, i.e., missing orthologs or paralogs, and the isolation of
nucleic acid molecules encoding novel genes. In a specific
embodiment, a nucleic acid molecule encoding a missing ortholog or
paralog can be isolated using procedures well known to those
skilled in the art (See, for example, Sambrook et al., 1989,
Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. Glover, D. M. (ed.),
1985, DNA Cloning: A Practical Approach MRL Press, Ltd., Oxford,
U.K. Vol. I, II.).
[0191] For example, genomic and/or cDNA libraries may be screened
with labeled DNA fragments derived from a known ortholog or paralog
from a specific species and hybridized to the genomic or cDNA
libraries generated from a different species. For cross species
hybridization, low stringency conditions are preferred. For same
species hybridization, moderately stringent conditions are
preferred. Any eukaryotic cell potentially can serve as the nucleic
acid source for the molecular cloning of the gene of interest. The
DNA may be obtained by standard procedures known in the art from
cloned DNA (e.g., a DNA "library"), by cDNA cloning, or by the
cloning of genomic DNA, or fragments thereof, purified from the
desired cell.
[0192] By way of example and not limitation, procedures using
conditions of low stringency are as follows (see also Shilo and
Weinberg, 1981, Proc. Natl. Acad. Sci. USA 78:6789-6792; and
Sambrook et al. 1989, Molecular Cloning, A Laboratory Manual, 2d
Ed., Cold Spring Harbor Laboratory Press, Cold Spring harbor,
N.Y.): Filters containing DNA are pretreated for 6 h at 40.degree.
C. in a solution containing 35% formamide, 5.times.SSC, 50 mM
Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and
500 mg/ml denatured salmon sperm DNA. Hybridizations are carried
out in the same solution with the following modifications: 0.02%
PVP, 0.02% Ficoll, 0.2% BSA, 100 mg/ml salmon sperm DNA, 10%
(wt/vol) dextran sulfate, and 5-20.times.10.sup.6 cpm
.sup.32P-labeled probe is used. Filters are incubated in
hybridization mixture for 18-20 h at 40.degree. C., and then washed
for 1.5 h at 55.degree. C. in a solution containing 2.times.SSC, 25
mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is
replaced with fresh solution and incubated an additional 1.5 h at
60.degree. C. Filters are blotted dry and exposed for
autoradiography. If necessary, filters are washed for a third time
at 65-68.degree. C. and reexposed to film. Other conditions of low
stringency which may be used are well known in the art (e.g., as
employed for cross species hybridizations).
[0193] In another specific embodiment, a nucleic acid which is
hybridizable to a nucleic acid under conditions of moderate
stringency is provided. For example, but not by way of limitation,
procedures using such conditions of moderate stringency are as
follows: filters containing DNA are pretreated for 6 h at
55.degree. C. in a solution containing 6.times.SSC, 5.times.
Denhart's solution, 0.5% SDS and 100 mg/ml denatured salmon sperm
DNA. Hybridizations are carried out in the same solution and
5-20.times.10.sup.6 CpM .sup.32P-labeled probe is used. Filters are
incubated in the hybridization mixture for 18-20 h at 55.degree.
C., and then washed twice for 30 minutes at 60.degree. C. in a
solution containing 1.times.SSC and 0.1% SDS. Filters are blotted
dry and exposed for autoradiography. Other conditions of moderate
stringency which may be used are well-known in the art. Washing of
filters is done at 37.degree. C. for 1 h in a solution containing
2.times.SSC, 0.1% SDS.
[0194] For expression cloning (a technique commonly used in the
art), an expression library is constructed. For example, mRNA is
isolated from the cell type of interest, cDNA is made and ligated
into an expression vector (e.g., a bacteriophage derivative) such
that it is capable of being expressed by a host cell (e.g., a
bacterium) into which it is then introduced. Various screening
assays can then be used to select for the expressed gene product of
interest based on the physical, chemical, or immunological
properties of its expressed product. Such properties can be deduced
from the properties of the corresponding orthologs from other
species.
[0195] In another embodiment, polymerase chain reaction (PCR) can
be used to amplify the desired sequence from a genomic or cDNA
library. To isolate orthologous or paralogous genes from other
species, one synthesizes several different degenerate primers, for
use in PCR reactions. In a preferred aspect, the oligonucleotide
primers represent at least part of the gene comprising known
ortholog or paralog sequences of different species. It is also
possible to vary the stringency of hybridization conditions used in
priming the PCR reactions, to allow for greater or lesser degrees
of nucleotide sequence similarity between the known nucleotide
sequences and the nucleic acid homolog being isolated.
[0196] Synthetic oligonucleotides may be utilized as primers to
amplify by PCR sequences from a source (RNA or DNA), preferably a
cDNA library, of potential interest. PCR can be carried out, e.g.,
by use of a Perkin-Elmer Cetus thermal cycler and a thermostable
polymerase, e.g., Amplitaq (Perkin-Elmer). The nucleic acids being
amplified can include mRNA or cDNA or genomic DNA from any
eukaryotic species. After successful amplification of a segment of
a the gene of interest, that segment may be molecularly cloned and
sequenced, and utilized as a probe to isolate a complete cDNA or
genomic clone.
[0197] Once identified and isolated the gene of interest can then
be inserted into an appropriate cloning vector for amplification
and/or expression in a host. A large number of vector-host systems
known in the art may be used. Possible vectors include, but are not
limited to, plasmids and modified viruses, but the vector system
must be compatible with the host cell used. Such vectors include,
but are not limited to, bacteriophages such as lambda derivatives,
or plasmids such as pBR322 or pUC plasmid derivatives or the
Bluescript vector (Stratagene). The insertion into a cloning vector
can, for example, be accomplished by ligating the DNA fragment into
a cloning vector which has complementary cohesive termini.
6. EXAMPLE
Use of Specialized Databases for Identification of Novel Genes
[0198] To test the method of using databases for gene discovery,
protein sequence and domain/motif databases specific to two
overlapping functional groupings of proteins: (i) proteins known to
be tumor suppressors, and (ii) proteins implicated in apoptosis in
animals were developed.
[0199] 6.1 Apoptosis Gene Discovery Method
[0200] Identification of a putative apoptosis-related human gene
began with an identification of all genes in C. elegans that
contained either a POZ or kelch domain. A subset of these genes is
shown in FIG. 13. Hidden Markov Models (HMM) for the POZ and Kelch
domains were built as follows. Starting with POZ and kelch
sequences from the Drosophilia kelch protein (gi|577275) homologs
were identified in other protein sequences using the BLASTP
program. The resulting sequences showing significant similarity
(e-value less than 0.001) were aligned using CLUSTALW program and
the alignments were used to build Hidden Markov Models with HMMER-2
package (Krogh et al., 1995, :http://hmmer.wustl.edu/). A computer
printout listing of HMM models of tumor suppressors appears as a
Microfiche H to the present specification. (See,
http://hmmer.wustl.edu; Chapter 2, which is incorporated by
reference herein in its entirety, for a detailed description of HMM
models)
[0201] The resulting models were used to search through a database
collection of C. elegans protein sequences. The domain structures
of proteins having either a POZ or kelch domain were identified
using existing collections of protein domains (e.g., see
http://blocks.fhcrc.org/blocks/blocks release.html,
http://coot.embl-heidelberg.de/SMART/,
http://www.motif.genome.adjp/). One of the unannotated
protein-coding genes of C. elegans (corresponding protein accession
number gi|1132541, see FIG. 11) appeared to include a POZ domain,
death domain, kinase domain, and heat repeat. A death domain is
characteristic for the apoptosis system and a kinase domain
indicates that the protein is likely to participate in
phosphorylation of other proteins. The presence of these particular
domains suggests that this protein is serving as a regulatory
protein.
[0202] Using the protein sequence of gi|1132541, the database of
human EST sequences was searched and a number of partial human cDNA
sequences representing potential human orthologs or paralogs of the
C. elegans gi|1132541 were identified. The two closest human
sequences, AA481214 and W51957, are depicted in FIG. 14A. To
determine whether the identified human sequences were orthologs or
paralogs to the gi|1132541 gene of C. elegans, a gene tree (Saito
and Nei, 1997, Molecular Biol. Evol. 4:406-425) was computed. The
gene tree was generated using homologous genes identified with a
BLASTP search against NCBI non-redundant database, using the human
EST AA481214 sequence as a query. The resulting tree indicates that
the identified human EST AA481214 represents a true ortholog of the
C. elegans gene gi|1132541 (FIG. 14B). The nucleotide sequence of
the death domain protein is shown in FIG. 14C, as well as the
deduced amino acid sequence presented in FIG. 14D.
[0203] 6.1.2 Apoptosis Gene Discovery Method
[0204] As a first step in identifying a novel gene involved in
apoptosis, a comprehensive set of articles describing the system of
apoptosis/programmed cell death in different species was compiled
using the keyword "apoptosis". By analyzing the articles,
information on regulatory pathways characterizing this system in
different species, i.e., C. elegans, mouse, fruit fly, chicken, and
human, was extracted. The regulatory information was stored as a
collection of schemes produced in PowerPoint (Microsoft). FIG. 4
shows a set of keywords defining proteins involved in apoptosis
pathways. The keywords were used to generate a specialized sequence
database, referred to as Apoptosis3, utilizing the PsiRetriever
program for extraction of proteins from the all-inclusive
non-redundant GenBank database (NCBI). Using program PsiRetriever,
sequences from the non-redundant (NCBI) database of protein
sequences, were retrieved and stored as a FASTA file. The FASTA
file was then converted into binary blast database using program
FORMATDB from the BLAST suit of programs.
[0205] Genomic and cDNA sequences located in the region of human
chromosome 13q were compared with the Apoptosis3 database using
BLASTALL program from BLAST program complex. This region of the
human genome is associated with Chronic Lymphocytic Leukemia (CLL).
The comparison revealed significant similarity between a CLL region
open reading frame and the mouse RPT1 protein (sp|P15533|RPT1)
(FIG. 13). Analysis of regulatory functions of RPT1 in the mouse
reveals that this gene functions as a repressor of the interleukin
2 receptor (IL-2R) gene. When the RPT1 gene is knocked out, the
regulatory effect is manifested as a block of the apoptotic pathway
in T lymphocytes resulting in an accumulation of T lymphocytes in
blood. This result is consistent with aberrations observed in CLL,
namely abnormal accumulation of B-cells in the blood (Trentin L. et
al., 1997, Leuk. Lymphoma 27:35-42) and mutations in the human RPT1
gene play a role in development of CLL.
6.1.3 EXAMPLE
A Discovery of a Human Ortholog of the Murine Max-Interacting
Transcriptional Repressor
[0206] The family of Myc proto-oncogenes encodes a set of
transcription factors implicated in regulation of cell
proliferation, differentiation, transformation and apoptosis. C-Myc
null mutations result in retarded growth and development of mouse
embryos and are lethal by 9-10 day of gestation. In contrast,
overexpression of Myc genes inhibits cell differentiation and leads
to neoplastic transformation. Moreover, deregulation of Myc
expression by retroviral transduction, chromosomal translocation or
gene amplification is linked to a broad range of naturally
occurring tumors in humans and other species.
[0207] Another protein, called Max, is an obligatory heterodimeric
partner for Myc proteins in mediating their function as activators
of transcription during cell cycle progression, neoplastic
transformation and programmed cell death (apoptosis). In order to
make an active transcription factor the Myc proteins must form
heterodimers with Max protein. This interaction with Max protein is
necessary for specific binding of Myc with CACGTG box (or related
E-boxes) on DNA and for activation of promoters located proximal to
the binding sites.
[0208] Besides the Myc family of transcription factors, the Max
protein forms complexes with another family of so-called MAD
proteins: Mxi1, MAD1, MAD3 and MAD4. Whereas Myc:Max complexes
activate transcription, MAD:Max complexes work in an opposite way
repressing the transcription through the same E-box binding sites
and apparently antagonize Myc-mediated activation of the same set
of target genes.
[0209] During tissue development a shift from Myc:Max to MAD:Max
complexes occurs coincidentally with the switch from cell
proliferation to differentiation. The switch in heterocomplexes is
thought to reflect a switch from activation to repression of common
genes leading to cessation of proliferation, exiting the cell cycle
and the beginning of cell differentiation. In differentiating
neurons, primary keratinocytes, myeloid cell lines and probably
other tissues the expression of different MAD:Max complexes appear
in sequential order during the transition from cell proliferation
to differentiation. The MAD3 expression appears first and it is
restricted to proliferating cells prior to differentiation where it
is co-expressed with two different member of Myc family, c-Myc or
N-Myc. Mxi1 transcripts are detected in proliferating and
differentiating cells whereas MAD1 and MAD4 were confined to
post-mitotic cells. Because Myc expression is not always
downregulated in post-mitotic cells, co-expression of Myc and MAD
genes may result in competition for Max heterodimers thus providing
promoting or inhibitory effect on cell proliferation.
[0210] The gene expression patterns, along with ability of Mad
proteins to suppress Myc-dependent transformation, are consistent
with a potential function of Mad genes as tumor suppressors. This
view is supported by the fact that allelic loss and mutations were
detected at the Mxi1 locus in prostate cancers (Eagle et al., 1995
Nat Genet 9:249-55). Cloning of the murine proteins Mad3 and Mad4
as well as their relation to Max signaling network was described by
Hurlin (Hurlin P J, et al., 1995, EMBO J. 14:5646-59) and Queva
(Queva et al. 1998 Oncogene 16:967-977). Human orthologs of Mad4,
Mad1 and Mxi1 are known.
[0211] In this example, the discovery of an unknown human ortholog
of Mad3 protein found "in silico," by means of phylogenetic
analysis of known mouse and human members of the Mad gene family
and database searches is described. Since the function of murine
Mad3 as a Max-interacting transcriptional repressor of Myc-induced
neoplastic transformation is well described, we can assign the same
function to its human ortholog. The gene tree shown in the FIG. 20
was constructed in the following way. The protein sequences of
known members of Mad gene family were extracted from GenBank
database using NCBI Entrez keyword searches. The extracted
sequences were aligned using multiple alignment program Clustalw
running on Sun SPARC station. The quality of the multiple alignment
was checked using program HitViewer Iterate (A. Rzhetsky, available
upon request) and the redundant, non-homologous sequences as well
as distant homologs from S. cerevisiae, C. elegans, D. melanogaster
etc. were removed from the alignment. The refined set of sequences
was realigned with Clustalw and a gene tree as presented in FIG.
15A was computed from the alignment using program NJBOOT
(http://genome6.cpmc.columbia.edu//andrey) running on Sun SPARC
station and viewed with program TreeView
(http://genome6.cpmc.columbia.edu //andrey).
[0212] The tree presented in FIG. 19A clearly shows the
relationships between three known mouse genes and their two human
homologs. Attempts to find a missing human ortholog of the mouse
Mad3 gene in protein non-redundant database at NCBI using BLAST
search did not identify any human homologs other than sequences
that were already present on the tree, confirming the absence of a
known human ortholog for Mad3 protein in the database.
[0213] In order to identify a human ortholog of the Mad3 protein, a
human dbEST at NCBI was searched with program TBLASTN using Mad3
protein sequence as a query. Two EST were identified and are shown
in FIG. 17A.
[0214] Due to the nature of dbEST database this search produced
only partial sequences of potential candidate genes. To obtain
complete coding sequences (complete cds) of the genes, a search was
conducted to obtain overlapping sequences in dbEST. The search for
overlapping sequences was performed using the program Iterate with
EST zs77e55.r1 (gb|AA278224) serving as a query. The search
returned a single overlapping sequence, namely HUMGS0012279
(dbj|CO2407), thus indicating that the two EST sequences found
during the initial TBLASTN search belong to the same gene.
[0215] The complete sequence of the gene was assembled from the two
ESTs using commercially available sequence assembly program
SeqManII (DNASTAR Inc., WI). The nucleotide sequence of the human
Mad3 gene is presented in FIG. 17B. The deduced amino acid sequence
of the gene is presented in FIG. 17C. The translated sequence
consists of 206 amino acid residues 81% of which are identical to
mouse Mad3 protein. The alignment of human and mouse Mad3 proteins
shown below was made using BLAST server at NCBI and is presented in
FIG. 17C.
[0216] Multiple alignment of the new sequence with sequences of
known Mad proteins was made using Clustalw and viewed with the
HitViewer. A gene tree was computed from this alignment using
NJBOOT. Multiple alignment of the new sequence with sequences of
known Mad proteins (FIG. 17C) along with its position on gene tree
(FIG. 18B) shows that this new human gene found by the approach
described above belongs to the family of Mad proteins and is the
ortholog of mouse Mad3.
[0217] The present invention is not to be limited in scope by the
specific embodiments described herein, which are intended as single
illustrations of individual aspects of the invention, and
functionally equivalent methods and components are within the scope
of the invention. Indeed, various modifications of the invention,
in addition to those shown and described herein will become
apparent to those skilled in the art from the foregoing description
and accompanying drawings. Such modifications are intended to fall
within the scope of the appended claims.
[0218] Various publications are cited herein, the contents of which
are hereby incorporated by reference in their entireties.
Sequence CWU 1
1
21 1 39 DNA Artificial Sequence Synthetic nucleotide 1 agcaactaaa
cacccatcca agcaaacaca cacacaaac 39 2 40 DNA Artificial Sequence
Synthetic nucleotide 2 aagcaactaa acacccatcc aagcaaacac acacacaaac
40 3 292 DNA Artificial Sequence Synthetic nucleotide 3 aagtacagat
ccacggaagg aacgatccaa acaaagacgc aacgacagaa ataacgatcc 60
acataactat ccaaatacat acgcacggaa gtacacacgt aattaaacac ggaagtacat
120 acagatccat ccacggatcc aaataacgaa ttaattacgc atccaaacaa
atacggaagt 180 actcaaacac ggaacgaacc atccacggaa ggacctacat
acgtaagcaa ggatccacgg 240 aaggaacgaa gtacctatcc aaacacagac
ggaagtaagc aacgacagat cc 292 4 10 DNA Artificial Sequence Synthetic
nucleotide 4 atctgtcacg 10 5 405 DNA Homo sapiens 5 catggcttcc
tggacaccaa ccctgccatc cgggagcaga cggtcaagtc catgctgctc 60
ctggccccaa agctgaacga ggccaacctc aatgtggagc tgatgaagca ctttgcacgg
120 ctacaggcca aggatgaaca gggccccatc cgctgcaaca ccacagtctg
cctgggcaaa 180 atcggctcct acctcagtgc tagcaccaga cacagggtcc
ttacctctgc cttcagccga 240 gccactaggg acccgtttgc accgtcccgg
gttgcgggtg tcctgggctt tgctgccacc 300 cacaacctct actcaatgaa
cgactgtgcc cagaagatcc tgcctgtgct ctgcggtctc 360 actgtagatc
ctgagaaatc cgtgcgagac caggccttca aggca 405 6 453 DNA Homo sapiens
variation (146)...(146) n = A, C, G, or T 6 ccttcgagtt cggcaatgct
ggggccgttg tcctcacgcc cctcttcaag gtgggcaagt 60 tcctgagcgc
tgaggagtat cagcagaaga tcatccctgt ggtggtcaag atgttctcat 120
ccactgaccg ggccatgcgc atccgnctcc tgcagcagat ggagcagttc atccagtacc
180 ttgacgagcc aacagtcaac acccagatct tcccccacgt cgtacatggc
ttcctggaca 240 ccaaccctgc catccgggag cagacggtca agtccatgct
gctcctggcc ccaaagctga 300 acgaggccaa cctcaatgtg gagctgatga
agcactttgc acggctacag gccaaggatg 360 aacagggccc catccgctgc
aacaccacag tctgcctggg caaaatcggc tcctacctca 420 gtgctagcac
cagacacagg gtccttacct ctg 453 7 1727 DNA Homo sapiens 7 cagccgaagc
amgcaaaaat tcttccagga gctgagcaag agcctggacg cattccctga 60
ggayttctgt cggcacaagg tgctgcccca gctgctgacc gccttcgagt tcggcaatgc
120 tggggccgtt gtcctcacgc ccctcttcaa ggtgggcaag ttcctgagcg
ctgaggagta 180 tcagcagaag atcatccctg tggtggtcaa gatgttctca
tccactgacc gggccatgcg 240 catccgcctc ctgcagcaga tggagcagtt
catccagtac cttgacgagc caacagtcaa 300 cacccagatc ttcccccacg
tcgtacatgg cttcctggac accaaccctg ccatccggga 360 gcagacggtc
aagtccatgc tgctcctggc cccaaagctg aacgaggcca acctcaatgt 420
ggagctgatg aagcactttg cacggctaca ggccaaggat gaacagggcc ccatccgctg
480 caacaccaca gtctgcctgg gcaaaatcgg ctcctacctc agtgctagca
ccagacacag 540 ggtccttacc tctgccttca gccgagccac tagggacccg
tttgcaccgt cccgggttgc 600 gggtgtcctg ggctttgctg ccacccacaa
cctctactca atgaacgact gtgcccagaa 660 gatcctgcct gtgctctgcg
gtctcactgt agatcctgag aaatccgtgc gagaccaggc 720 cttcaaggcm
wttcggagct tcctgtccaa attggagtct gtgtcggagg acccgaccca 780
gctggaggaa gtggagaagg atgtccatgc agcctccagc cctggcatgg gaggagccgc
840 agctagctgg gcaggctggg cgtgaccggg gtctcctcac tcacctccaa
gctgatccgt 900 tcgcacccaa ccactgcccc aacagaaacc aacattcccc
aaagacccac gcctgaagga 960 gttcctgccc cagcccccac ccctgttcct
gccaccccta caacctcagg ccactgggag 1020 acgcaggagg aggacaagga
cacagcagag gacagcagca ctgctgacag atgggacgac 1080 gaagactggg
gcagcctgga gcaggaggcc gagtctgtgc tggcccagca ggacgactgg 1140
agcaccgggg gccaagtgag ccgtgctagt caggtcagca actccgacca caaatcctcc
1200 aaatccccag agtccgactg gagcagctgg gaarctgagg gctcctggga
acagggctgg 1260 caggagccaa gctcccagga gccacctyct gacggtacac
ggctggccag cgagtataac 1320 tggggtggcc cagagtccag cgacaagggc
gaccccttcg ctaccctgtc tgcacgtccc 1380 agcacccagc cgaggccaga
ctcttggggt gaggacaact gggagggcct cgagactgac 1440 agtcgacagg
tcaaggctga gctggcccgg aagaagcgcg aggagcggcg gcgggagatg 1500
gaggccaaac gcgccgagag gaaggtgcca agggccccat gaagctggga gcccggaagc
1560 tggactgaac cgtggcggtg gcccttcccg gctgcggaga gcccgcccca
cagatgtatt 1620 tattgtacaa accatgtgag cccggccgcc cagccaggcc
atctcacgtg tacataatca 1680 gagccacaat aaattctatt tcacaaaaaa
aaaaaaaaaa aaaaaaa 1727 8 287 PRT Homo sapiens VARIANT (4)...(4)
Xaa = Any amino acid 8 Ser Arg Ser Xaa Gln Lys Phe Phe Gln Glu Leu
Ser Lys Ser Leu Asp 1 5 10 15 Ala Phe Pro Glu Asp Phe Cys Arg His
Lys Val Leu Pro Gln Leu Leu 20 25 30 Thr Ala Phe Glu Phe Gly Asn
Ala Gly Ala Val Val Leu Thr Pro Leu 35 40 45 Phe Lys Val Gly Lys
Phe Leu Ser Ala Glu Glu Tyr Gln Gln Lys Ile 50 55 60 Ile Pro Val
Val Val Lys Met Phe Ser Ser Thr Asp Arg Ala Met Arg 65 70 75 80 Ile
Arg Leu Leu Gln Gln Met Glu Gln Phe Ile Gln Tyr Leu Asp Glu 85 90
95 Pro Thr Val Asn Thr Gln Ile Phe Pro His Val Val His Gly Phe Leu
100 105 110 Asp Thr Asn Pro Ala Ile Arg Glu Gln Thr Val Lys Ser Met
Leu Leu 115 120 125 Leu Ala Pro Lys Leu Asn Glu Ala Asn Leu Asn Val
Glu Leu Met Lys 130 135 140 His Phe Ala Arg Leu Gln Ala Lys Asp Glu
Gln Gly Pro Ile Arg Cys 145 150 155 160 Asn Thr Thr Val Cys Leu Gly
Lys Ile Gly Ser Tyr Leu Ser Ala Ser 165 170 175 Thr Arg His Arg Val
Leu Thr Ser Ala Phe Ser Arg Ala Thr Arg Asp 180 185 190 Pro Phe Ala
Pro Ser Arg Val Ala Gly Val Leu Gly Phe Ala Ala Thr 195 200 205 His
Asn Leu Tyr Ser Met Asn Asp Cys Ala Gln Lys Ile Leu Pro Val 210 215
220 Leu Cys Gly Leu Thr Val Asp Pro Glu Lys Ser Val Arg Asp Gln Ala
225 230 235 240 Phe Lys Ala Xaa Arg Ser Phe Leu Ser Lys Leu Glu Ser
Val Ser Glu 245 250 255 Asp Pro Thr Gln Leu Glu Glu Val Glu Lys Asp
Val His Ala Ala Ser 260 265 270 Ser Pro Gly Met Gly Gly Ala Ala Ala
Ser Trp Ala Gly Trp Ala 275 280 285 9 223 PRT Homo sapiens 9 Val
Met Glu Leu Leu Glu Glu Asp Leu Thr Cys Pro Ile Cys Cys Ser 1 5 10
15 Leu Phe Asp Asp Pro Arg Val Leu Pro Cys Ser His Asn Phe Cys Lys
20 25 30 Lys Cys Leu Glu Gly Ile Leu Glu Gly Ser Val Arg Asn Ser
Met Trp 35 40 45 Arg Pro Ala Pro Phe Lys Cys Pro Thr Cys Arg Lys
Glu Thr Ser Ala 50 55 60 Thr Gly Ile Asn Ser Leu Gln Val Asn Tyr
Ser Leu Lys Gly Ile Val 65 70 75 80 Glu Lys Tyr Asn Lys Ile Lys Ile
Ser Pro Lys Met Pro Val Cys Lys 85 90 95 Gly His Met Gly Gln Pro
Leu Asn Ile Phe Cys Leu Thr Asp Met Gln 100 105 110 Leu Ile Cys Gly
Ile Cys Ala Thr Arg Gly Glu His Thr Lys His Val 115 120 125 Phe Cys
Ser Ile Glu Asp Ala Tyr Ala Gln Glu Arg Asp Ala Phe Glu 130 135 140
Ser Leu Phe Gln Ser Phe Glu Thr Trp Arg Arg Gly Asp Ala Leu Ser 145
150 155 160 Arg Leu Asp Thr Met Glu Thr Ser Lys Arg Lys Ser Leu Gln
Leu Met 165 170 175 Thr Lys Asp Ser Asp Lys Val Lys Glu Phe Phe Glu
Lys Leu Gln His 180 185 190 Thr Leu Asp Gln Lys Lys Asn Glu Ile Leu
Ser Asp Phe Glu Thr Met 195 200 205 Lys Leu Ala Val Met Gln Ala Tyr
Asp Pro Glu Ile Asn Lys Leu 210 215 220 10 218 PRT Mus musculus 10
Val Leu Glu Met Ile Lys Glu Glu Val Thr Cys Pro Ile Cys Leu Glu 1 5
10 15 Leu Leu Lys Glu Pro Val Ser Ala Asp Cys Asn His Ser Phe Cys
Arg 20 25 30 Ala Cys Ile Thr Leu Asn Tyr Glu Ser Asn Arg Asn Thr
Asp Gly Lys 35 40 45 Gly Asn Cys Pro Val Cys Arg Val Pro Tyr Pro
Phe Gly Asn Leu Arg 50 55 60 Pro Asn Leu His Val Ala Asn Ile Val
Glu Arg Leu Lys Gly Phe Lys 65 70 75 80 Ser Ile Pro Glu Glu Glu Gln
Lys Val Asn Ile Cys Ala Gln His Gly 85 90 95 Glu Lys Leu Arg Leu
Phe Cys Arg Lys Asp Met Met Val Ile Cys Trp 100 105 110 Leu Cys Glu
Arg Ser Gln Glu His Arg Gly His Gln Thr Ala Leu Ile 115 120 125 Glu
Glu Val Asp Gln Glu Tyr Lys Glu Lys Leu Gln Gly Ala Leu Trp 130 135
140 Lys Leu Met Lys Lys Ala Lys Ile Cys Asp Glu Trp Gln Asp Asp Leu
145 150 155 160 Gln Leu Gln Arg Val Asp Trp Glu Asn Gln Ile Gln Ile
Asn Val Glu 165 170 175 Asn Val Gln Arg Gln Phe Lys Gly Leu Arg Asp
Leu Leu Asp Ser Lys 180 185 190 Glu Asn Glu Glu Leu Gln Lys Leu Lys
Lys Glu Lys Lys Glu Val Met 195 200 205 Glu Lys Leu Glu Glu Ser Glu
Asn Glu Leu 210 215 11 124 PRT Mus musculus 11 Met Glu Pro Val Ala
Ser Asn Ile Gln Val Leu Leu Gln Ala Ala Glu 1 5 10 15 Phe Leu Glu
Arg Arg Glu Arg Glu Ala Glu His Gly Tyr Ala Ser Leu 20 25 30 Cys
Pro His His Ser Pro Gly Thr Val Cys Arg Arg Arg Lys Pro Pro 35 40
45 Leu Gln Ala Pro Gly Ala Leu Asn Ser Gly Arg Ser Val His Asn Glu
50 55 60 Leu Glu Lys Arg Arg Arg Ala Gln Leu Lys Arg Cys Leu Glu
Gln Leu 65 70 75 80 Arg Gln Gln Met Pro Leu Gly Val Asp Cys Thr Arg
Tyr Thr Thr Leu 85 90 95 Ser Leu Leu Arg Ala Arg Val His Ile Gln
Lys Leu Glu Glu Gln Glu 100 105 110 Gln Gln Ala Arg Arg Leu Lys Glu
Lys Leu Arg Ser 115 120 12 125 PRT Homo sapiens 12 Met Glu Pro Leu
Ala Ser Asn Ile Gln Val Leu Leu Gln Ala Ala Glu 1 5 10 15 Phe Leu
Glu Arg Arg Glu Arg Glu Ala Glu His Gly Tyr Ala Ser Leu 20 25 30
Cys Pro His Arg Ser Pro Gly Pro Ile His Arg Arg Lys Lys Arg Pro 35
40 45 Pro Gln Ala Pro Gly Ala Gln Asp Ser Gly Arg Ser Val His Asn
Glu 50 55 60 Leu Glu Lys Arg Arg Arg Ala Gln Leu Lys Arg Cys Leu
Glu Arg Leu 65 70 75 80 Lys Gln Gln Met Pro Leu Gly Gly Asp Cys Ala
Arg Tyr Thr Thr Leu 85 90 95 Ser Leu Leu Arg Arg Ala Arg Met His
Ile Gln Lys Leu Glu Asp Gln 100 105 110 Glu Gln Arg Ala Arg Gln Leu
Lys Glu Arg Leu Arg Thr 115 120 125 13 63 PRT Mus musculus 13 Lys
Gln Gln Ser Leu Gln Gln Gln Leu Glu Gln Leu Gln Gly Leu Pro 1 5 10
15 Gly Ala Arg Glu Arg Glu Arg Leu Arg Ala Asp Ser Leu Asp Ser Ser
20 25 30 Gly Leu Ser Ser Glu Arg Ser Asp Ser Asp Gln Glu Asp Leu
Glu Val 35 40 45 Asp Val Glu Asn Leu Val Phe Gly Thr Glu Thr Glu
Leu Leu Gln 50 55 60 14 63 PRT Homo sapiens VARIANT (8)...(8) Xaa =
Any amino acid 14 Lys Gln Gln Ser Leu Gln Arg Xaa Trp Met Gln Leu
Arg Gly Leu Ala 1 5 10 15 Gly Ala Ala Glu Arg Glu Arg Leu Arg Ala
Asp Ser Leu Asp Ser Ser 20 25 30 Gly Leu Ser Ser Glu Arg Ser Asp
Ser Asp Gln Glu Glu Leu Glu Val 35 40 45 Asp Val Glu Ser Leu Val
Phe Gly Gly Glu Ala Glu Leu Leu Arg 50 55 60 15 733 DNA Homo
sapiens variation (454)...(454) n = A, C, G, or T 15 cagccgcttg
ctccggccgg caccctaggc cgcagtccgc caggctgtcg ccgacatgga 60
acccttggcc agcaacatcc aggtcctgct gcaggcggcc gagttcctgg agcgccgtga
120 gagagaggcc gagcatggtt atgcgtccct gtgcccgcat cgcagtccag
gccccatcca 180 caggaggaag aagcgacccc cccaggctcc tggcgcgcag
gacagcgggc ggtcagtgca 240 caatgaactg gagaagcgca ggagggccca
gttgaagcgg tgcctggagc ggctgaagca 300 gcagatgccc ctgggcggcg
actgtgcccg gtacaccacg ctgagcctgc tgcgccgtgc 360 caggatgcac
atccagaagc tggaggatca ggagcagcgg gcccgacagc tcaaggagag 420
gctgcgcaca aagcagcaga gcctgcagcg gcantggatg cagctccggg ggctggcagg
480 ngcggccgag cgggagcgnc tgcgggcgga cagtctggac tcctcaggcc
tctcctctga 540 gcgctcagac tcagaccaag aggagctgga ggtggatgtg
gagagcctgg tgtttggggg 600 tgaggccgag ctgctgcggg gcttcgtcgc
cggccaggag cacagctact cgcacgtcgg 660 cggcgcctgg ctatgatgtt
cctcacccan ggcgggcctc tgccctctta ctcgttgccc 720 aagcccactt tnc 733
16 206 PRT Homo sapiens VARIANT (133)...(133) Xaa = Any amino acid
16 Met Glu Pro Leu Ala Ser Asn Ile Gln Val Leu Leu Gln Ala Ala Glu
1 5 10 15 Phe Leu Glu Arg Arg Glu Arg Glu Ala Glu His Gly Tyr Ala
Ser Leu 20 25 30 Cys Pro His Arg Ser Pro Gly Pro Ile His Arg Arg
Lys Lys Arg Pro 35 40 45 Pro Gln Ala Pro Gly Ala Gln Asp Ser Gly
Arg Ser Val His Asn Glu 50 55 60 Leu Glu Lys Arg Arg Arg Ala Gln
Leu Lys Arg Cys Leu Glu Arg Leu 65 70 75 80 Lys Gln Gln Met Pro Leu
Gly Gly Asp Cys Ala Arg Tyr Thr Thr Leu 85 90 95 Ser Leu Leu Arg
Arg Ala Arg Met His Ile Gln Lys Leu Glu Asp Gln 100 105 110 Glu Gln
Arg Ala Arg Gln Leu Lys Glu Arg Leu Arg Thr Lys Gln Gln 115 120 125
Ser Leu Gln Arg Xaa Trp Met Gln Leu Arg Gly Leu Ala Gly Ala Ala 130
135 140 Glu Arg Glu Arg Leu Arg Ala Asp Ser Leu Asp Ser Ser Gly Leu
Ser 145 150 155 160 Ser Glu Arg Ser Asp Ser Asp Gln Glu Glu Leu Glu
Val Asp Val Glu 165 170 175 Ser Leu Val Phe Gly Gly Glu Ala Glu Leu
Leu Arg Gly Phe Val Ala 180 185 190 Gly Gln Glu His Ser Tyr Ser His
Val Gly Gly Ala Trp Leu 195 200 205 17 227 PRT Mus musculus 17 Met
Ala Thr Ala Val Gly Met Asn Ile Gln Leu Leu Leu Glu Ala Ala 1 5 10
15 Asp Tyr Leu Glu Arg Arg Glu Arg Glu Ala Glu His Gly Tyr Ala Ser
20 25 30 Met Leu Pro Tyr Ser Lys Asp Arg Asp Ala Phe Lys Arg Arg
Asn Lys 35 40 45 Pro Lys Lys Asn Ser Thr Ser Ser Arg Ser Thr His
Asn Glu Met Glu 50 55 60 Lys Asn Arg Arg Ala His Leu Arg Leu Cys
Leu Glu Lys Leu Lys Gly 65 70 75 80 Leu Val Pro Leu Gly Pro Glu Ser
Ser Arg His Thr Thr Leu Ser Leu 85 90 95 Leu Thr Lys Ala Lys Leu
His Ile Lys Lys Leu Glu Asp Cys Asp Arg 100 105 110 Lys Ala Val His
Gln Ile Asp Gln Leu Gln Arg Glu Gln Arg His Leu 115 120 125 Lys Arg
Arg Leu Glu Lys Leu Gly Ala Glu Arg Thr Arg Met Asp Ser 130 135 140
Val Gly Ser Val Val Ser Ser Glu Arg Ser Asp Ser Asp Arg Glu Glu 145
150 155 160 Leu Asp Val Asp Val Asp Val Asp Val Asp Val Asp Val Glu
Gly Thr 165 170 175 Asp Tyr Leu Asn Gly Asp Leu Gly Trp Ser Ser Ser
Val Ser Asp Ser 180 185 190 Asp Glu Arg Gly Ser Met Gln Ser Leu Gly
Ser Asp Glu Gly Tyr Ser 195 200 205 Ser Ala Thr Val Lys Arg Ala Lys
Leu Gln Asp Gly His Lys Ala Gly 210 215 220 Leu Gly Leu 225 18 221
PRT Homo sapiens 18 Met Ala Ala Ala Val Arg Met Asn Ile Gln Met Leu
Leu Glu Ala Ala 1 5 10 15 Asp Tyr Leu Glu Arg Arg Glu Arg Glu Ala
Glu His Gly Tyr Ala Ser 20 25 30 Met Leu Pro Tyr Asn Asn Lys Asp
Arg Asp Ala Leu Lys Arg Arg Asn 35 40 45 Lys Ser Lys Lys Asn Asn
Ser Ser Ser Arg Ser Thr His Asn Glu Met 50 55 60 Glu Lys Asn Arg
Arg Ala His Leu Arg Leu Cys Leu Glu Lys Leu Lys 65 70 75 80 Gly Leu
Val Pro Leu Gly Pro Glu Ser Ser Arg His Thr Thr Leu Ser 85 90 95
Leu Leu Thr Lys Ala Lys Leu His Ile Lys Lys Leu Glu Asp Cys Asp 100
105 110 Arg Lys Ala Val His Gln Ile Asp Gln Leu Gln Arg Glu Gln Arg
His 115 120 125 Leu Lys Arg Gln Leu Glu Lys Leu Gly Ile Glu Arg Ile
Arg Met Asp 130 135 140 Ser Ile Gly Ser Thr Val Ser Ser Glu Arg Ser
Asp Ser Asp Arg Glu 145 150 155 160 Glu Ile Asp Val Asp Val Glu Ser
Thr Asp Tyr Leu Thr Gly Asp Leu
165 170 175 Asp Trp Ser Ser Ser Ser Val Ser Asp Ser Asp Glu Arg Gly
Ser Met 180 185 190 Gln Ser Leu Gly Ser Asp Glu Gly Tyr Ser Ser Thr
Ser Ile Lys Arg 195 200 205 Ile Lys Leu Gln Asp Ser His Lys Ala Cys
Leu Gly Leu 210 215 220 19 221 PRT Homo sapiens 19 Met Ala Ala Ala
Val Arg Met Asn Ile Gln Met Leu Leu Glu Ala Ala 1 5 10 15 Asp Tyr
Leu Glu Arg Arg Glu Arg Glu Ala Glu His Gly Tyr Ala Ser 20 25 30
Met Leu Pro Tyr Asn Asn Lys Asp Arg Asp Ala Leu Lys Arg Arg Asn 35
40 45 Lys Ser Lys Lys Asn Asn Ser Ser Ser Arg Ser Thr His Asn Glu
Met 50 55 60 Glu Lys Asn Arg Arg Ala His Leu Arg Leu Cys Leu Glu
Lys Leu Lys 65 70 75 80 Gly Leu Val Pro Leu Gly Pro Glu Ser Ser Arg
His Thr Thr Leu Ser 85 90 95 Leu Leu Thr Lys Ala Lys Leu His Ile
Lys Lys Leu Glu Asp Cys Asp 100 105 110 Arg Lys Ala Val His Gln Ile
Asp Gln Leu Gln Arg Glu Gln Arg His 115 120 125 Leu Lys Arg Gln Leu
Glu Lys Leu Gly Ile Glu Arg Ile Arg Met Asp 130 135 140 Ser Ile Gly
Ser Thr Val Ser Ser Glu Arg Ser Asp Ser Asp Arg Glu 145 150 155 160
Glu Ile Asp Val Asp Val Glu Ser Thr Asp Tyr Leu Thr Gly Asp Leu 165
170 175 Asp Trp Ser Ser Ser Ser Val Ser Asp Ser Asp Glu Arg Gly Ser
Met 180 185 190 Gln Ser Leu Gly Ser Asp Glu Gly Tyr Ser Ser Thr Ser
Ile Lys Arg 195 200 205 Ile Lys Leu Gln Asp Ser His Lys Ala Cys Leu
Gly Leu 210 215 220 20 207 PRT Mus musculus 20 Met Glu Leu Asn Ser
Leu Leu Leu Leu Leu Glu Ala Ala Glu Tyr Leu 1 5 10 15 Glu Arg Arg
Asp Arg Glu Ala Glu His Gly Tyr Ala Ser Met Leu Pro 20 25 30 Phe
Asp Gly Asp Phe Ala Arg Lys Lys Thr Lys Thr Ala Gly Leu Val 35 40
45 Arg Lys Gly Pro Asn Asn Arg Ser Ser His Asn Glu Leu Glu Lys His
50 55 60 Arg Arg Ala Lys Leu Arg Leu Tyr Leu Glu Gln Leu Lys Gln
Leu Gly 65 70 75 80 Pro Leu Gly Pro Asp Ser Thr Arg His Thr Thr Leu
Ser Leu Leu Lys 85 90 95 Ala Lys Met His Ile Lys Lys Leu Glu Glu
Gln Asp Arg Arg Ala Leu 100 105 110 Ser Ile Lys Glu Gln Leu Gln Arg
Glu His Arg Phe Leu Lys Arg Arg 115 120 125 Leu Glu Gln Leu Ser Val
Gln Ser Val Arg Val Arg Thr Asp Ser Thr 130 135 140 Gly Ser Ala Val
Ser Thr Asp Asp Ser Glu Gln Glu Val Asp Ile Glu 145 150 155 160 Gly
Met Glu Phe Gly Pro Gly Glu Leu Asp Ser Ala Gly Ser Ser Ser 165 170
175 Asp Ala Asp Asp His Tyr Ser Leu Gln Ser Ser Gly Cys Ser Asp Ser
180 185 190 Ser Tyr Gly His Pro Cys Arg Arg Pro Gly Cys Pro Gly Leu
Ser 195 200 205 21 205 PRT Mus musculus 21 Met Glu Pro Val Ala Ser
Asn Ile Gln Val Leu Leu Gln Ala Ala Glu 1 5 10 15 Phe Leu Glu Arg
Arg Glu Arg Glu Ala Glu His Gly Tyr Ala Ser Leu 20 25 30 Cys Pro
His His Ser Pro Gly Thr Val Cys Arg Arg Arg Lys Pro Pro 35 40 45
Leu Gln Ala Pro Gly Ala Leu Asn Ser Gly Arg Ser Val His Asn Glu 50
55 60 Leu Glu Lys Arg Arg Arg Ala Gln Leu Lys Arg Cys Leu Glu Gln
Leu 65 70 75 80 Arg Gln Gln Met Pro Leu Gly Val Asp Cys Thr Arg Tyr
Thr Thr Leu 85 90 95 Ser Leu Leu Arg Ala Arg Val His Ile Gln Lys
Leu Glu Glu Gln Glu 100 105 110 Gln Gln Ala Arg Arg Leu Lys Glu Lys
Leu Arg Ser Lys Gln Gln Ser 115 120 125 Leu Gln Gln Gln Leu Glu Gln
Leu Gln Gly Leu Pro Gly Ala Arg Glu 130 135 140 Arg Glu Arg Leu Arg
Ala Asp Ser Leu Asp Ser Ser Gly Leu Ser Ser 145 150 155 160 Glu Arg
Ser Asp Ser Asp Gln Glu Asp Leu Glu Val Asp Val Glu Asn 165 170 175
Leu Val Phe Gly Thr Glu Thr Glu Leu Leu Gln Ser Phe Ser Ala Gly 180
185 190 Arg Glu His Ser Tyr Ser His Ser Thr Cys Ala Trp Leu 195 200
205
* * * * *
References