U.S. patent application number 11/187719 was filed with the patent office on 2006-03-30 for ache antisense oligonucleotide as an anti-inflammatory agent.
Invention is credited to Amir Dori, Gal Ifergane, Hermona Soreq, Itzhak Wirguin, Raz Yirmiya.
Application Number | 20060069051 11/187719 |
Document ID | / |
Family ID | 34044237 |
Filed Date | 2006-03-30 |
United States Patent
Application |
20060069051 |
Kind Code |
A1 |
Soreq; Hermona ; et
al. |
March 30, 2006 |
AChE antisense oligonucleotide as an anti-inflammatory agent
Abstract
Disclosed is a novel use for AChE antisense oligonucleotides as
anti-inflammatory agents, wherein said oligonucleotides are
preferably as denoted by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7.
Methods of treatment of inflammatory conditions, as well as fever,
and particularly inflammation-associated neuropathies such as
Guillain-Barre Syndrome, are described.
Inventors: |
Soreq; Hermona; (Jerusalem,
IL) ; Dori; Amir; (Lehavim, IL) ; Wirguin;
Itzhak; (Omer, IL) ; Ifergane; Gal; (Omer,
IL) ; Yirmiya; Raz; (Jerusalem, IL) |
Correspondence
Address: |
COOPER & DUNHAM, LLP
1185 AVENUE OF THE AMERICAS
NEW YORK
NY
10036
US
|
Family ID: |
34044237 |
Appl. No.: |
11/187719 |
Filed: |
July 21, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/IL04/00978 |
Oct 26, 2004 |
|
|
|
11187719 |
Jul 21, 2005 |
|
|
|
Current U.S.
Class: |
514/44A |
Current CPC
Class: |
A61P 25/18 20180101;
A61P 29/02 20180101; A61P 25/00 20180101; A61K 31/7088 20130101;
A61P 29/00 20180101; A61P 9/10 20180101; A61P 37/00 20180101; A61K
31/712 20130101; A61P 31/04 20180101; A61P 37/02 20180101; A61P
43/00 20180101; A61K 48/00 20130101 |
Class at
Publication: |
514/044 |
International
Class: |
A61K 48/00 20060101
A61K048/00 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0001] This work was supported by the US Army Medical Research and
Material Command DAMD 17-99-1-9647 (July 1999-August 2004) and the
Defense Advance Research Project Agency DARPA N66001-01-C-8015 (May
2001-May 2004). The US Government has certain rights in this
invention.
Foreign Application Data
Date |
Code |
Application Number |
Oct 26, 2003 |
IL |
158600 |
Claims
1. A method of treatment of a condition triggering an inflammatory
response in a mammalian subject, comprising administering to the
subject a therapeutically effective amount of an inhibitor of AChE
expression or a pharmaceutical composition comprising the same.
2. A method for the treatment and/or prevention of inflammation in
the joints, central nervous system, gastrointestinal tract,
endocardium, pericardium, lung, eyes, skin and urogenital system of
a mammalian subject, comprising administering to the subject a
therapeutically effective amount of an inhibitor of AChE expression
or a pharmaceutical composition comprising the same.
3. A method for suppressing the release of a pro-inflammatory
cytokine, comprising administering a therapeutically effective
amount of an inhibitor of AChE expression or a pharmaceutical
composition comprising the same, to a subject.
4. A method for treating fever, comprising administering a
therapeutically effective amount of an inhibitor of AChE expression
or a pharmaceutical composition comprising the same, to a
subject.
5. A method for the treatment of an inflammation-associated
neuropathy, comprising administering a therapeutically effective
amount of an inhibitor of AChE expressions or a pharmaceutical
composition comprising the same, to a subject.
6. The method of claim 5, wherein said inflammation-associated
neuropathy is Guillain-Barre Syndrome.
7. The method of claim 1, wherein said inhibitor of AChE expression
is any one of an AChE-specific ribozyme, an RNA sequence used for
RNA interference of the AChE gene, or an antisense oligonucleotide
directed against AChE.
8. The method of claim 1, wherein said inhibitor of AChE expression
is a nuclease resistant antisense nucleotide directed against AChE
or a functional analog, derivative, or fragment thereof.
9. The method of claim 7, wherein said inhibitor of AChE expression
is an antisense oligonucleotide directed against AChE, having the
sequence as denoted by any one of SEQ ID No:1, SEQ ID No:2 or SEQ
ID No:7 or a functional analog, derivative, or fragment
thereof.
10. The method of claim 7, wherein said inhibitor of AChE
expression is an antisense oligonucleotide directed against AChE,
having the sequence as denoted by SEQ. ID. NO:1, or a functional
analog, derivative, or fragment thereof.
11. The method of claim 3, wherein said pro-inflammatory cytokine
is selected from the group consisting of IL-1.beta., TNF.alpha.,
IL-6, IL-8, IL-12, and IL-18.
12. The method of claim 3, wherein said pro-inflammatory cytokine
release is triggered by one of stress, bacterial infection, drugs,
irradiation, exposure to AChE inhibitors, stroke, auto-immune
diseases, multiple chemical sensitivity, and any cumulative
age-dependent damages.
13. The method of claim 1, wherein said mammalian subject is a
human, and said inhibitor of AChE expression is an antisense
oligonucleotide directed against AChE, as denoted by the sequence
selected from SEQ. ID. NO:1 and SEQ. ID. NO:7, or a functional
analog, derivative, or fragment thereof.
14. The method of claim 10, wherein said antisense oligonucleotide
or composition comprising the same is for daily use by the subject,
and said therapeutically effective amount is a dosage of active
ingredient between about 0.001 .mu.g/g and about 50 .mu.g/g.
15. The method of claim 14, wherein said dosage of active
ingredient is between about 0.01 and about 5.0 .mu.g/g.
16. The method of claim 15, wherein said dosage of active
ingredient is between about 0.15 and about 0.50 .mu.g/g.
17. The method of claim 1, wherein said conditions are selected
from any one of stress, bacterial infection, drugs, irradiation,
exposure to AChE inhibitors, stroke, auto-immune diseases, multiple
chemical sensitivity and any cumulative age-dependent damages.
Description
FIELD OF THE INVENTION
[0002] The present invention relates to the field of
anti-inflammatory agents. More specifically, the present invention
provides a novel use for an antisense oligonucleotide targeted to
the coding domain of the acetylcholinesterase (AChE) nucleotide
sequence, as an anti-inflammatory agent.
BACKGROUND OF THE INVENTION
[0003] All publications mentioned throughout this application are
fully incorporated herein by reference, including all references
cited therein.
[0004] Inflammation plays a crucial role in defense against
pathogen invaders as well as in healing and recovery processes
following various types of injury. However, the magnitude and
duration of inflammatory responses have to be tightly regulated,
because excessive inflammatory reactions can be detrimental,
leading to autoimmune diseases, neurodegeneration, sepsis, trauma
and other pathological conditions. It has long been recognized that
regulation of inflammatory reactions is mediated both by immune
responses (particularly the secretion of anti-inflammatory
cytokines) and by neuroendocrine factors, particularly the
activation of the pituitary-adrenal axis and the secretion of
glucocorticoids. Recently it became evident that neural mechanisms
are also involved in limiting inflammatory responses. In
particular, it was found that cholinergic neurons inhibit acute
inflammation, providing a rapid, localized, and adaptive
anti-inflammatory reflex system (Tracy, 2002). In the periphery,
acetylcholine (ACh) is mainly released by the efferent vagus nerve.
It significantly attenuates the production of the pro-inflammatory
cytokines TNF.alpha., interleukin-1.beta. (IL-1.beta.), IL-6 and
IL-18, but not the anti-inflammatory cytokine IL-10 [Tracey, K. J.
(2002) Nature 420, 853-859]. Reciprocally, IL-1 causes AChE
over-production both in PC12 cells and in the rat cortex [Li, Y. et
al., (2000) J. Neurosci. 20, 149-155], suggesting a closed loop
whereby ACh suppresses IL-1, ablating the induction of AChE
production.
[0005] Within the mammalian spinal cord, several subsets of
interneurons function in concert to translate converging cortical
inputs into synchronized motoneuron activities [Noga, B. R. et al.
(1995) J. Neurosci. 15, 2203-2217; Phelps, P. E. et al., (1990) J.
Comp. Neurol. 291, 9-26; Sherriff, F. E. & Henderson, Z. (1994)
Brain Res. 634, 150-154; Perlmutter, S. I. et al. (1998) J.
Neurophysiol. 80, 2475-2494; Prut, Y. & Fetz, E. E. (1999)
Nature 401, 590-594]. Allostatic breakdown of this intricately
controlled pathway may occur under various stressors, including
glycinergic (strychnine) or cholinergic agents (succinylcholine),
or under myasthenic crisis or post-anesthesia effects [Becker, C.
M. et al., (1992) Neuron 8, 283-289; Millard, C. B. &
Broomfield, C. A. (1995) J. Neurochem. 64, 1909-1918; Subramony, S.
H. et al. (1986) Muscle Nerve 9, 64-68; Krasowski, M. D. et al.
(1997) Can. J. Anaesth. 44, 525-534]. These and other acute
stressors may induce massive tremor and spastic paralysis,
reflecting failure of the quality control processes which
presumably act to sustain cholinergic homeostasis in spinal cord
motoneurons. In addition to these modulations in cholinergic
neurotransmission, both injury and chemical stressors as well as
organophosphate inhibitors of acetylcholinesterase (AChE) induce
up-regulation of pro-inflammatory cytokines in the spinal cord
(e.g. IL-1.beta. following experimental spinal injury) [Wang, C. X.
et al. (1997) Brain Res 759, 190-196; Svensson, I. et al., (2001)
Neurotoxicology 22, 355-362; Dyer, S. M. et al., (2001) Toxicology
169, 177-185]. The cholinergic control over peripheral release of
pro-inflammatory cytokines [Bernik, T. R. et al. (2002) J. Exp.
Med. 195, 781-788; Borovikova, L. V. et al., (2000) Nature 405,
458-462; Tracey, K. J. et al. (2001) Faseb J. 15, 1575-1576] thus
provoked the question whether cholinergic allostasis serves to
control pro-inflammatory responses also in central nervous system
(CNS) neurons.
[0006] Because spinal cord motoneurons respond to ACh, the presumed
quality control process should exert regulatory effects upon
cholinergic neurotransmission. As it needs to function rapidly, it
likely involves short-lived molecules. Furthermore, in order to be
broad-ranged, the proposed mechanism is likely to be induced under
widely diverse stressors. The normally rare, stress-induced
acetylcholinesterase variant AChE-R meets all of the requirements
from an inducer of such response(s). AChE-R is overproduced under
psychological, chemical and physical stresses [reviewed by Soreq,
H. & Seidman, S. (2001) Nat. Rev. Neurosci. 2, 294-302]. A
parallel stress response involves down-regulation of choline
acetyltransferase (ChAT) [Kaufer, D. et al., (1998) Nature 393,
373-377] and the genomically linked vesicular acetylcholine
transporter (VAChT) [Weihe, E. et al. (1996) Proc. Natl. Acad. Sci.
USA. 93, 3547-3552], together limiting the production and vesicle
packaging of acetylcholine while expediting its degradation. This
yields down-regulation of the cholinergic hyperexcitation that is
associated with many stresses. At a longer range, this stress
response is associated with hypersensitivity to both agonists and
antagonists of cholinergic neurotransmission [Meshorer, E. et al.
(2002) Science 295, 508-512] and abnormal locomotor activities that
can be ablated under antisense destruction of AChE-R mRNA [Cohen,
O. et al. (2002) Mol. Psychiatry 7, 874-885]. Finely-tuned control
over AChE-R levels thus emerged as a key component of stress
management by spinal cord motoneurons. AChE-R over-expression,
which suppresses ACh levels, further lead to increased IL-1
production. Should this be the case, antisense suppression of
AChE-R production [Brenner, T. et al. (2003) Faseb J. 17(2),
214-22] would increase ACh levels and reduce the levels of
pro-inflammatory cytokines in CNS neurons.
[0007] In counterpart, parallel inflammatory responses and
production of cytokines, particularly within the brain, has raised
the suggestion that illness-associated alterations in memory
functioning caused by medical conditions like Alzheimer's disease
[Arendt, T. (2001) Neuroscience 102:723-65], multiple sclerosis
[Thornton, A. E. et al. (2002) J. Int. Neuropsychol. Soc.
8:395-409], acquired immunodeficiency syndrome [Navia, B. A. et al.
(1986) Ann. Neurol. 19:517-24] and infectious diseases [Capuron, L.
et al. (1999) Psychol. Med. 29:291-7], are at least partly mediated
by immune activation [Rachal Pugh C., et al. (2001) Neurosci.
Biobehav. Rev. 25:29-41; Maier S. F. and Watkins L. R. (1998)
Psychol. Rev. 105:83-107; Yirmiya R. (1997) Current Opinion in
Psychiatry, 10: 470-476; Yirmiya, R. et al. (2002) Neurobiology of
Learning and Memory, 78: 379-389]. Cytokine-induced memory
impairments in humans, including cancer and hepatitis-C patients,
as well as in experimental animals, support this notion [Capuron L.
et al., (2001) Psychosom. Med. 63:376-86; Meyers C. A. (1999) Adv.
Exp. Med. Biol. 461:75-81; Gibertini M. (1996) Adv. Exp. Med. Biol.
402:207-17; Oitzl M. S. et al., (1993) Brain Res. 613:160-3]. Thus,
like many other stressful stimuli, which are known to affect
learning and memory processes [Kim J. J. and Diamond D. M. (2002)
Nat. Rev. Neurosci. 3:453-62], inflammation can cause marked
alterations in memory functioning. Administration of endotoxin
(lipopolysaccharide), a complex glycolipid found in the outer
membrane of all gram-negative bacteria, serves to assess the
cognitive consequences of the acute host response to infection in
humans. Endotoxin administration induces fever, malaise and
increased production and secretion of cytokines, particularly
TNF-.alpha., IL-6, IL-1 and IL-1ra and cortisol [for review see
Burrell R. (1994) Circ. Shock 43:137-53], as well as proteases
[Fahmi H. and Chaby R. (1994) Immunol. Invest. 23:243-58]. In
healthy humans, endotoxin-induced cytokine secretion is correlated
with impairments in verbal and non-verbal declarative memory
functions [Reichenberg A. et al., (2001) Arch. Gen. Psychiatry
58:445-52].
[0008] Memory deficits and profound neurobehavioral and
neuroendocrine symptoms were also reported to be correlated with
endotoxin-induced secretion of cytokines in experimental animals
[Hauss-Wegrzyniak B. et al. (2000) Neuroreport 11:1759-63; Pugh C.
R. et al., (1998) Brain Behav. Immun. 12:212-29; Shaw K. N. et al.,
(2001) Behav. Brain Res. 124:47-54]. While these findings suggest
that cytokines are involved in mediating the effects of endotoxin
on memory, little is known about the neurotransmission pathways
associated with these cytokine activities. The inventors initiated
a search into the possibility that cholinergic processes are
relevant to endotoxin responses because in the central nervous
system (CNS), cholinergic responses are notably involved in several
important aspects of cognitive functioning, including attention,
learning and memory [for reviews see Levin E. D. and Simon B. B.
(1998) Psychopharmacology (Berl) 138:217-30; Segal M. and Auerbach
J. M. (1997) Life Sci. 60:1085-91]. Moreover, endotoxin decreases
brain choline acetyltransferase activity [Willard L. B. et al.
(1999) Neuroscience 88:193-200], similar to the effects of
psychological stress [Kaufer (1998) id ibid.]. In the periphery,
endogenous or exogenous acetylcholine (ACh) attenuates the release
of pro-inflammatory cytokines from endotoxin-stimulated human
macrophages [Borovikova (2000) id ibid.; Bernik (2002) id ibid.;
Tracey (2001) id ibid.]. The ACh hydrolyzing enzyme
acetylcholinesterase (AChE) was considered as potentially being of
particular relevance to these processes because AChE controls ACh
levels and since AChE inhibitors improve cognitive functions in
both clinical and experimental paradigms [Palmer A. M. (2002)
Trends Pharmacol. Sci. 23:426-33; Weinstock M. (1995)
Neurodegeneration 4:349-56]. Moreover, AChE over-expression is
triggered by acute and chronic stressful insults [Meshorer (2002)
id ibid.] and induces progressive memory impairments, as was
demonstrated in transgenic mice [Beeri R. et al. (1995) Curr. Biol.
5:1063-71].
[0009] Moreover, mice that overexpress both AChE-S and AChE-R
present progressive dendritic and spine loss [Beeri R. et al.
(1997) J. Neurochem. 69:2441-51], as well as altered anxiety
responses [Erb C. et al. (2001) J. Neurochem. 77:638-46].
Furthermore, these mice display early-onset deficits in social
recognition and exaggerated responsiveness to stressful insults.
These can be briefly ameliorated by conventional anticholinesterase
treatment or for longer periods by an antisense oligonucleotide
capable of specifically inducing the destruction of AChE-R mRNA
[Cohen (2002) id ibid.], suggesting that AChE-R is the primary
cause. Thus, AChE-R production may lead to both positive and
negative effects on cognition.
[0010] Stressful insults induce AChE-R production in the periphery
as well (e.g., in the small intestines), and failure to induce this
production, in response to aversive stimuli, results in
hypersensitivity to relatively mild stressors [Shapira M. et al.
(2000) Hum. Mol. Genet. 9:1273-1281]. This observation raised the
possibility that peripheral AChE modulations may serve as a
surrogate marker of endotoxin-induced changes in cognition as well.
However, in plasma, proteolytic cleavage of AChE-R leads to the
appearance in the serum of a short immunopositive C-terminal
peptide which facilitates the hematopoietic stress responses
[Grisaru, D. et al. (2001) Mol. Med. 7, 93-105]. Hence, the
inventors investigated the effects of endotoxin administration on
both AChE activity and AChE-R cleavage in healthy human volunteers
and explored potential correlations between these parameters, the
secretion of cytokines or cortisol, and changes with time in memory
functions. In addition to declarative memory, which involves
consciously accessible records of facts and events through
concerted functioning of hippocampal and prefrontal structures [Kim
and Diamond (2002) id ibid.], the inventors assessed the effects of
endotoxin and its interactions with AChE cleavage on working
memory, which involves temporary storage and manipulation of
information necessary for cognitive functioning [Baddeley A. (1992)
Science 255:556-9], and has been shown to involve prefrontal
cholinergic mechanisms [Furey M. L. et al., (2000) Science
290:2315-9].
[0011] Peripheral neurophaties are caused by altered function and
structure of peripheral motor, sensory or autonomic neurons. The
main causes of neuropathy are entrapment (compression), diabetes
and other systemic diseases, inherited disorders, inflammatory
demyelinating, ischemic, metabolic, and paraneoplastic conditions,
nutritional deficiency states, and toxin-induced derangement. One
example of a peripheral neuropathy is the Guillain-Barre syndrome
(GBS).
[0012] GBS is an acute inflammatory polyneuropathy. It is the most
common cause of acute flaccid paralysis worldwide, with an annual
incidence of 0.75 to 2 in 100,000 in the general population. GBS is
suspected when a patient presents with progressive motor weakness
and loss of deep tendon reflexes (areflexia). Other clinical
features include sensory symptoms, cranial nerve involvement,
autonomic dysfunction causing pulse and blood pressure changes, and
respiratory failure, which is a major cause of morbidity and
mortality [Asbury and Cornblath, (1990) Ann. Neurol. 27: Suppl.
S21-24]. The onset of symptoms can either be acute or sub-acute,
but improvement is gradual, initiating after a plateau phase of
several weeks, reaching clinical recovery by 6-7 months [Group,
T.I.G. (1996) Brain 119: (Pt. 6) 2053-2061]. Ventillatory support
due to respiratory muscle weakness is needed in about a quarter of
the patients and mortality ranges up to 13% [Seneviratne, U. (2000)
Postgrad. Med. 76: 774-782].
[0013] In about two thirds of patients, symptoms are preceded by an
antecedent infection, commonly an upper respiratory tract infection
(40%) or gastroenteritis (20%) occurring 4 weeks prior to onset of
disease [Group (1996) id ibid.; Rees, J. et al. (1995) N. Eng. J.
Med. 333: 1374-1379]. According to this, GBS is thought to result
from abnormal immune responses triggered by certain infectious
agents and directed towards the peripheral nerves [Seneviratne
(2000) id ibid.]. Interestingly, one recent report suggests that
the clinical symptoms of drug poisoning by the AChE-inhibitor
rivastigmine resemble those of GBS [Lai, M. W. et al. (2005) N.
Engl. J. Med. 353:3].
[0014] The diagnosis of Guillain-Barre syndrome is based on
clinical presentation, which is then supported by cerebrospinal
fluid (CSF) analysis demonstrating elevated protein content and
normal leukocyte cell count, indicating an inflammatory reaction.
Electrophysiological studies then specify the clinico-pathological
type according to evidence for damage of myelin, motor or sensory
axons [Asbury and Cornblath (1990) id ibid.].
[0015] Segmental demyelination, termed acute inflammatory
demyelinating polyradiculoneuropathy (AIDP) is the most common type
of Guillain-Barre syndrome, apparently mediated by lymphocytic and
macrophage infiltration of the peripheral nerves [Griffin J. et
al., (1995) Brain 118: (Pt. 3), 577-595; Honavar M. et al., (1991)
Brain 114: (Pt. 3), 1245-1269; Rees (1995) id ibid.] Demyelination
is demonstrated by electrophysiological reduction of nerve
conduction velocity, and subsequent remyelination is associated
with recovery. In contrast to this, only minimal demyelination but
prominent Wallerian-like degeneration with peri-axonal macrophage
infiltration are detected in axonal degeneration types of GBS,
where motor axons exclusively or motor together with sensory axons,
are damaged in acute motor axonal neuropathy (AMAN) [McKhann G. et
al. (1993) Ann. Neurol. 33: 333-342] and acute motor sensory axonal
neuropathy (AMSAN) [Griffin (1995) id ibid.], respectively.
Accordingly, the electrophysiological features in these cases are
reduced compound muscle action potential (CMAP) amplitude, and
additionally, reduced sensory nerve action potentials in AMSAN, but
preserved conduction velocity, indicating axonal dysfunction
without demyelination. Both axonal neuropathies are characterized
by rapidly progressive weakness, often with respiratory failure,
but although AMAN patients usually exhibit good recovery [McKhann
(1993) id ibid.], the recovery of AMSAN patients is generally slow
and incomplete, considered to be the most severe form of GBS (Brown
and Feasby (1984) Brain 107: (Pt. 1) 219-239].
[0016] Axonal degeneration types of GBS are often preceded by
infection with Campylobacter jejuni (Cj), which is associated with
a slow recovery, and severe residual disability [Rees (1995) id
ibid.]. There are several serotypes of Cj, and the one most often
isolated from GBS patients belongs to Penner serotype 19 (O:19)
(Saida, T. et al. (1997) J. Infect. Dis. 176: Suppl. 2, S129-134].
The lipopolysaccharides (LPS) of Cj share ganglioside-like epitopes
with ganglioside-surface molecules of peripheral nerves, and
patients with GBS have anti-ganglioside antibodies, suggesting that
"molecular mimicry" is the immunopathogenic mechanism of injury to
the peripheral nerve fibers [Sheikh, K. et al. (1998) Ann. N.Y.
Acad. Sci. 845: 307-321; Yuki N. et al. (1993) J. Exp. Med. 178:
1771-1775]. Nevertheless, although Cj-O:19 serotype is
significantly associated with elevated anti-ganglioside antibody
titers in the sera of the patients, no significant correlation was
found between the presence of these antibodies and the clinical
pattern of GBS [Nishimura M. et al. (1997) J. Neurol. Sci. 153:
91-99]. This therefore indicates that additional factors may
determine the axonal damage or disfunction following the apparently
antibody-mediated nerve-surface injury. In agreement with this, the
currently accepted treatments of GBS is intravenous immunoglobulin
administration or plasma exchange (plasmapheresis), which act
through suppression or removal of auto-antibodies, both which have
been found to be equally beneficial [Seneviratne (2000) id ibid.].
Nevertheless, several authors reported a rapid resolution of nerve
conduction blocks following plasmapheresis, which could not be
explained by remyelination or axonal regeneration [Kuwabara S. et
al. (1999) Muscle Nerve 22: 840-845; Suzuki and Choi, (1991) Acta.
Neuropathol. (Berl) 82: 93-101]. This suggests a possible role for
a humoral factor in the pathogenesis of the disease, causing
physiological conduction abnormalities that may facilitate the
destructive process.
[0017] Administration of LPS to humans is known to increase
production and secretion of cytokines and cortisol [Burrell R.
(1994) Circ. Shock 43: 137-153]. In addition to this, LPS decreases
the activity of brain choline acetyltransferase [Willard L. et al.,
(1999) Neuroscience 88: 193-200], similar to the effects of
psychological stress [Kaufer (1998) id ibid.], reducing production
of acetylcholine (ACh). In the periphery, ACh attenuates the
release of pro-inflammatory cytokines from LPS-stimulated human
macrophages [Bernik, T. et al., (2002) J. Exp. Med. 195: 781-788;
Borovikova L. et al., (2000) Nature 405: 458-462; Tracey K. et al.,
(2001) Faseb. J. 15: 1575-1576]. AChE is therefore considered as
potentially being of particular relevance to these processes
because AChE controls ACh levels. Acute and chronic stressful
insults trigger transcriptional activation of AChE gene expression,
which leads to accumulation of the normally rare, AChE-R splice
variant [Soreq (2001) id ibid.]. The AChE-R excess reduces the
stress-induced cholinergic hyperexcitation in the CNS [Kaufer
(1998) id ibid.]. In the periphery (e.g., in the small intestines),
failure to induce this production in response to aversive stimuli
results in hypersensitivity to relatively mild stressors [Shapira
(2000) id ibid.]. In plasma, proteolytic cleavage of AChE-R leads
to the appearance of its distinct short C-terminal peptide (AChE-R
Peptide; ARP) which accumulates following Salmonella-LPS endotoxin
administration to humans [Cohen O. et al., (2003) J. Mol. Neurosci.
21: 199-212], and facilitates the hematopoietic stress responses
[Grisaru (2001) id ibid.]. The inventors hence sought to examine
the involvement of AChE-R and ARP in induction of functional
conduction abnormalities in the sciatic nerve.
[0018] The role of cholinergic mechanisms in learning and memory,
the involvement of AChE-R in stress responses, the suppression by
ACh of pro-inflammatory cytokines production, the effects of
endotoxin on memory functions, and the potential involvement of
AChE-R in nerve conduction block, suggested involvement of AChE-R
in inflammatory associated processes which could thus potentially
be suppressed by an inhibitor of AChE-R expression.
[0019] The prospect of therapeutic agents of exquisite specificity
and action at very low concentration has stimulated the development
of antisense oligonucleotides (AS-ON) targeted against a variety of
mRNAs. Major problems remain access to the RNA processing machinery
of the cell, potential differences between specific cell types and
the mode of chemical protection employed. When the cell of interest
is within the CNS, the problem of access is compounded by the
presence of the blood-brain barrier [Tavitian, B. et al. (1998)
Nat. Med. 4, 467-471]. Nevertheless, some attempts have been
successful even in primates [Kasuya, E. et al., (1998) Regul. Pept.
75-76, 319-325; Mizuno, M. et al. (2000) Endocrinology 141,
1772-1779]. The inventors have previously demonstrated antisense
suppression of the stress-induced AChE-R mRNA, enabling retrieval
of normal cellular and physiological functions following
stress-induced changes in cultured rat and human cells [Galyam, N.
et al. (2001) Antisense Nucleic Acid Drug Dev. 11, 51-57; Grisaru,
D. et al. (2001) id ibid.] and in live mice [Cohen et al., (2002)
id ibid.; Shohami, E. et al., (2000) J. Mol. Med. 78, 228-236] and
rats [Brenner, T. et al. (2003) id ibid.]. While the tested
consequences in all of these studies were limited to direct
measurement of the target protein and mRNA, the working hypothesis
predicted additional, anti-inflammatory effects for antisense
retrieval of cholinergic balance. Here, the inventors report the
outcome of experiments aimed at addressing the stress-induced
overproduction and selective AS-ON retrieval of normal AChE-R
levels under injection stress in cynomolgus monkeys. The findings
demonstrate differential susceptibility of specific neuron types to
AS-ON responses, as well as concomitant suppression of IL-1.beta.
and IL-6 following the retrieval of cholinergic balance in spinal
cord neurons. The present inventors have previously found that
antisense oligonucleotides against the common coding region of AChE
are useful for suppressing AChE-R production [see WO 98/26062]. In
particular, the inventors have shown the use of an antisense
oligonucleotide against the AChE sequence for the treatment of
myasthenia gravis [WO 03/002739 and U.S. 2003-0216344].
[0020] Based on the inventors' herein described results, the
present invention provides a novel use for an antisense
oligonucleotide directed against the AChE mRNA sequence, as a new
anti-inflammatory agent, and particularly for the treatment of
subjects afflicted with inflammation associated neuropathies such
as the Guillain-Barre Syndrome.
[0021] Other purposes and advantages of the invention will become
apparent as the description proceeds.
SUMMARY OF THE INVENTION
[0022] In a first aspect, the present invention refers to a method
of treatment of conditions triggering an inflammatory response in a
mammalian subject in need, comprising administering a therapeutic
effective amount of an inhibitor of AChE expression, or a
pharmaceutical composition comprising the same.
[0023] In particular, said conditions are selected from any one of
stress, bacterial infection, drugs, irradiation, exposure to AChE
inhibitors, stroke, auto-immune diseases, multiple chemical
sensitivity and any cumulative age-dependent damages.
[0024] In another aspect, the present invention provides a method
for the treatment and/or prevention of inflammation in the joints,
central nervous system, gastrointestinal tract, endocardium,
pericardium, lung, eyes, skin and urogenital system in a mammalian
subject in need, comprising administering a therapeutic effective
amount of an inhibitor of AChE expression, or a pharmaceutical
composition comprising the same.
[0025] In a further aspect, the present invention provides a method
for suppressing the release of pro-inflammatory cytokines,
comprising administering a therapeutic effective amount of an
inhibitor of AChE expression, or a pharmaceutical composition
comprising the same, to a subject in need.
[0026] Preferably, said pro-inflammatory cytokine is selected from
the group consisting of IL-1.beta., TNF.alpha., IL-6, IL-8, IL-12
and IL-18, and the release of said cytokine is triggered by one of
stress, bacterial infection, drugs, irradiation, exposure to AChE
inhibitors, stroke, auto-immune diseases, multiple chemical
sensitivity, and any cumulative age-dependent damages.
[0027] In an even further aspect, the present invention provides a
method for treating fever, comprising administering a therapeutic
effective amount of an inhibitor of AChE expression, or a
pharmaceutical composition comprising the same, to a subject in
need.
[0028] Further, the present invention also provides a method for
the treatment of inflammation-associated neuropathies, comprising
administering a therapeutic effective amount of an inhibitor of
AChE expression, or a pharmaceutical composition comprising the
same, to a subject in need. One particular example of an
inflammation-associated neuropathy is the Guillain-Barre
Syndrome.
[0029] In one embodiment of the methods of the invention, said
inhibitor of AChE expression is one of an AChE-specific ribozyme,
an RNA sequence used for RNA interference of the AChE gene, and an
antisense oligonucleotide directed against AChE.
[0030] In one preferred embodiment of the methods of the invention,
said inhibitor of AChE expression is a nuclease resistant antisense
nucleotide directed against AChE, or functional analogs,
derivatives or fragments thereof.
[0031] In another preferred embodiment of the methods of the
invention, said inhibitor of AChE expression is an antisense
oligonucleotide directed against AChE, having the sequence as
denoted by any one of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7, as
follows: TABLE-US-00001 5'-CTGCCACGTTCTCCTGCACC-3'; (SEQ ID NO:1)
5'-CTGCAATATTTTCTTGCACC-3'; (SEQ ID NO:2) and
5'-CTGCCACGTTCTCCTGCA*C*C*-3', (SEQ ID NO:7)
wherein the three 3' terminal residues are modified with 2-O-methyl
groups (*), or functional analogs, derivatives or fragments
thereof.
[0032] In a further preferred embodiment of the methods of the
invention, said mammalian subject is a human, and said inhibitor of
AChE expression is an antisense oligonucleotide directed against
AChE, as denoted by the sequence selected from SEQ ID NO:1 and SEQ
ID NO:7, or functional analogs, derivatives or fragments
thereof.
[0033] In another embodiment of the method of the invention, said
antisense oligonucleotide or composition comprising the same is for
daily use by a subject in need, and said therapeutic effective
amount is a dosage of active ingredient between about 0.001 .mu.g/g
and about 50 .mu.g/g. Preferably, said dosage of active ingredient
is between about 0.01 and about 5.0 .mu.g/g. More preferably, said
dosage of active ingredient is between about 0.15 and about 0.50
.mu.g/g.
BRIEF DESCRIPTION OF THE FIGURES
[0034] FIG. 1A-1F: Reduced VAChT accumulation in cholinergic
terminals and partition cells of treated monkeys.
[0035] FIG. 1A: Confocal microscopy projections of spinal cord
motoneurons (cell diameter=40 .mu.m), immunolabeled (white) with
anti-VAChT antibody. The total volume and average number per cell
of labeled terminals were measured using Image-Pro Plus software,
and the result of each treatment (1, 2, 3 and 4) plotted in the
graphs shown in FIGS. 1B and 1C.
[0036] FIG. 1B: Average value of volume and average number per cell
of labeled terminals, including all motoneurons detected in a
section.
[0037] FIG. 1C: Population distribution of volume and average
number per cell of labeled terminals, including all motoneurons
detected in a section.
[0038] FIG. 1D: Average values of FIGS. 1B, 1C analyses
(.+-.Standard Evaluation of the Mean, SEM). Significant reductions
are marked by asterisks (p<0.01, Student's t test).
[0039] FIG. 1E: Immunolabeling with anti-ChAT antibody in partition
cells from naive spinal cord, localized in close proximity to the
central canal (arrows). Hematoxylin was used for background
staining.
[0040] FIG. 1F: Higher magnification of ChAT positive partition
cells in naive monkeys (1) or following oral (p.o.) administration
of 150 .mu.g/kg/day (2) or 500 .mu.g/kg/day (3) and i.v.
administration of 500 .mu.g/kg/day hEN101 (4). Note
dose-independent handling--induced reductions in both terminals
volume and density.
[0041] Abbreviations: n., naive; Term., terminal; vol., volume;
Part. Ce., Partition cell; Cent. Can., Central canal.
[0042] FIG. 2A-2J: Selective ACHE-R mRNA suppression by hEN101 in
monkey spinal cord neurons.
[0043] FIG. 2A: Scheme of the human ACHE gene coding exons and two
of its alternative transcripts, the synaptic AChE-S(S) and the
stress-associated AChE-R(R) mRNA. The S transcript includes exons
2, 3, 4 and 6, whereas the R transcript contains exons 2, 3, 4, 5
and pseudointron 4'. These distinctions served to prepare
transcript-specific probes, indicated by an asterisk.
[0044] FIG. 2B: Sampling site on the dissected monkey lumbar spinal
cord is indicated by an arrow.
[0045] FIG. 2C-2J: Tissue sections from lumbar spinal cords were
prepared following 7-day treatment with the noted doses of hEN101
by p.o. or i.v. administration. Shown is in situ hybridization used
to compare neuronal labeling pattern with the noted probes. Nuclei
were visualized by DAPI staining (white). There was no difference
between tested sections in total cell numbers and/or general
histology. Note that AChE-S mRNA labeling displayed significant
changes following treatment only in neuronal process sections (2F,
2H and 2J as compared to 2D), whereas neuronal AChE-R mRNA labeling
was notably reduced in cell bodies.
[0046] FIG. 2C: No treatment, staining specific for AChE-R
mRNA.
[0047] FIG. 2D: No treatment, staining specific for AChE-S
mRNA.
[0048] FIG. 2E: Treatment with 150 .mu.g/kg/day of EN101, p.o.,
staining specific for AChE-R mRNA.
[0049] FIG. 2F: Treatment with 150 .mu.g/kg/day of EN101, p.o.,
staining specific for AChE-S mRNA.
[0050] FIG. 2G: Treatment with 500 .mu.g/kg/day of EN101, p.o.,
staining specific for AChE-R mRNA.
[0051] FIG. 2H: Treatment with 500 .mu.g/kg/day of EN101, p.o.,
staining specific for AChE-S mRNA.
[0052] FIG. 2I: Treatment with 500 .mu.g/kg/day of EN101, i.v.,
staining specific for AChE-R mRNA.
[0053] FIG. 2J: Treatment with 500 .mu.g/kg/day of EN101, i.v.,
staining specific for AChE-S mRNA.
[0054] FIG. 3A-3C: Cell size-dependent efficacy of neuronal AChE-R
mRNA suppression.
[0055] FIG. 3A: Scheme of the lumbar spinal cord and its three
compartments: the ventral and dorsal horns separated by the
intermediate zone and the central canal.
[0056] FIG. 3B: Histological staining (Hematoxylin and eosin) of a
representative field in the intermediate zone of the lumbar spinal
cord. Three cells are marked according to their perikaryon
diameters: 10-20 .mu.m (arrowhead, the majority of those cells is
located in the dorsal horn), 20-40 .mu.m (asterisk) and =40 .mu.m
(arrow).
[0057] FIG. 3C: Shown are fractions of AChE-R positive neurons from
the three size groups under the different treatment regimens.
Insets: representative neurons from the different size groups,
taken from the p.o. 150 .mu.g/kg/day regimen. Columns show average
AChE-R positive cells in each size group .+-.SEM representing
repeated analyses of the entire lumbar spinal cord gray matter in
multiple sections. Stars note significant differences (p<0.05,
Wilcoxon test).
[0058] Abbreviations: Cent. Can., central canal; D. h., dorsal
horn; I. z., Intermediate zone; V. h., ventral horn; pos. ce.,
positive cells; si. gr., size group; Ce. Bo. Diam., cell body
diameter.
[0059] FIG. 4A-4C: Suppression of stress-induced neuronal
pro-inflammatory cytokines under antisense intervention with AChE-R
expression.
[0060] FIG. 4A: Shown are fractions of IL-1.beta. positive spinal
cord neurons of medium and large sizes under the different
treatment regimens (columns .+-.SEM representing repeated analyses
of the ventral horn and intermediate zone of lumbar spinal cord
gray matter in multiple sections). Insets: representative medium
and large size positive neurons, taken from the p.o. 500
.mu.g/kg/day regimen. *: p.ltoreq.0.05, **: p=0.067.
[0061] FIG. 4B: Graph showing the correlation between the average
fractions of AChE-R and IL-1.beta. positive medium-sized cells
(20-40 .mu.m) in the different hEN101 treatments. Large cells
(>40 .mu.m) did not display such correlation
(R.sup.2=0.1778).
[0062] FIG. 4C: Fractions of IL-6 positive spinal cord neurons were
evaluated essentially as under 4A. Note decreases in both
IL-1.beta. and IL-6 in spinal cord neurons of monkeys treated with
500 .mu.g/kg/day EN101.
[0063] Abbreviations: pos. ce., positive cells.
[0064] FIG. 5A-5D: Changes over time in the human plasma levels of
AChE activity and in AChE-R cleavage.
[0065] FIG. 5A: Hydrolytic activities. Shown are plasma AChE
activities (mean.+-.SEM) for ten volunteers injected twice, with
endotoxin or saline (placebo) at the noted intervals after
injection. Pre-injection (baseline) AChE level was considered as
100% for each individual. Asterisks denote statistical difference
(p<0.05).
[0066] FIG. 5B: Immunoblot. Shown are consecutive results for one
individual. Plasma samples underwent electrophoresis by SDS-PAGE,
and the blot immunoreacted with anti-AChE-R antibodies. Note the
6.5 kDa AChE-R cleavage product. Left lanes indicate the response
to a placebo injection; right lanes demonstrate elevated AChE-R
cleavage in response to endotoxin.
[0067] FIG. 5C: Densitometric intensities. Shown are average values
(mean.+-.SEM) of the rapidly migrating AChE-R cleavage product in
plasma of the endotoxin and placebo treated individuals as % of
baseline (described in A).
[0068] Note: Elevated AChE-R cleavage in endotoxin-treated subjects
co-appeared with decreased AChE activity.
[0069] FIG. 5D: Association analysis. Highly significant negative
association (correlation coefficient, r=-0.65) emerged between the
increases in AChE-R cleavage and the decrease in AChE activity
under endotoxin during the last testing period (t=9 hr). Each dot
represents a single individual.
[0070] Abbreviations: Act., activity; bas., baseline; H. p. inj.,
Hours post-injection; T. p. inj., Time post-injection; Plac.,
placebo; Endot., endotoxin; Cleav. Prod., cleavage product.
[0071] FIG. 6: Mass spectroscopy of gel-eluted band.
[0072] Shown is the outcome of electron spray mass spectrometry
analysis of the gel-eluted rapidly migrating band that
immunoreacted with anti-AChE-R antibodies. Note that the main
peptide displayed a molecular mass of 3613-3615. Calculation of
predicted masses positioned the presumed proteolytic cleavage site
36 residues from the C-terminus of AChE-R, between asparagine and
arginine residues in the sequence presented, with the presumed
cleavage site arrowed and the diversion site starred.
[0073] Abbreviations: Rel. abund., relative abundance.
[0074] FIG. 7A-7C: AChE-R is expressed in human vascular
endothelial cells from various tissues.
[0075] FIG. 7A: AChE-R mRNA. Shown are the results of in situ
hybridization using a 5'-biotinylated cRNA probe selective for the
AChE-R mRNA variant on sections of human vascular endothelial cells
affected by an inflammatory process (skin hypersensitivity
vasculitis; labeling is seen as pink color, red arrow).
[0076] FIG. 7B: AChE-R protein. Shown is an immunomicrograph of
human kidney vascular endothelial cells from a patient with
vasculitis, labeled with antibodies targeted at the AChE-R
C-terminal peptide (red arrow).
[0077] FIG. 7C: Image analysis. Shown are average AChE-R mRNA and
AChE-R protein labeling intensities (black and white columns,
respectively), in kidney, skin and muscle vascular endothelial
cells (mean values.+-.SEM) as the percentage of red pixels, falling
within a defined intensity range.
[0078] Abbreviations: prot., protein; int., intensity; k. rej.,
kidney rejection; k. vas., kidney vasculitis; nonspec.,
non-specific; n. end., normal endothelium; m., muscle; hyp. vasc.,
hypersensitivity vasculitis.
[0079] FIG. 8A-8C: Bidirectional associations between AChE-R
cleavage and the changes in cortisol and cytokines.
[0080] Shown are average .+-.SEM changes with time (left) in the
plasma levels of cortisol, TNF-.alpha. and IL-6 of the 10 patients
treated with endotoxin or placebo, and the associations (right) at
the noted time points between these changes and the changes in
AChE-R cleavage (measured by densitometric quantification of the
C-terminus AChE-R cleavage product).
[0081] FIG. 8A: cortisol.
[0082] FIG. 8B: TNF-.alpha..
[0083] FIG. 8C: IL-6.
[0084] Abbreviations: r, correlation coefficient; t, time after
injection; Plac., placebo; end., endotoxin; H. p. inj., hours
post-injection; cleav. prod., cleavage product.
[0085] FIG. 9: Endotoxin impairs declarative memory. Shown are
average .+-.SEM values for the performance in the immediate story
recall test of the endotoxin and placebo treated individuals at the
noted time following treatment as well as the associations of the
changes in these values at 9 hr post-injection with the changes in
AChE-R cleavage (b) and AChE activity (c).
[0086] Abbreviations: I.s.r., immediate story recall; plac.,
placebo; endot., endotoxin; H.p.inj., hours post-injection; cleav.
prod., cleavage product; act., activity.
[0087] FIG. 10: Endotoxin-induced improvement in working
memory.
[0088] Shown are the performance values (average +SEM) in the span
background test for the endotoxin and placebo treated individuals
(a) and the association of the changes in this performance at 3 hr
post-injection with the changes in AChE-R cleavage (b).
[0089] Abbreviations: r, correlation coefficient; t, time after
injection; S.b., Span backward; plac., placebo; endot., endotoxin;
H.p.inj., hours post-injection; cleav. prod., cleavage product;
act., activity.
[0090] FIG. 11A-11C: Scheme-Endotoxin induces interrelated
cytokine-cholinergic effects on memory.
[0091] Shown are the cellular and biochemical events that were
explored in this study and which explain the changes in memory
processes and the dynamic modifications in these changes during the
post-treatment observation period. The thickness of arrows reflects
the relative intensity of the relevant processes.
[0092] FIG. 11A: At 1 hr post-treatment: Endotoxin induces the
release of cytokines, cortisol and proteases. Cytokines elevation
associates with impaired declarative memory, which is a medial
temporal lobe-associated phenomenon. Cortisol induces AChE-R
production, which elevates the immunopositive AChE-R amounts in
plasma. Vesicular ACh is released into the synaptic cleft, where it
affects neuronal electrophysiology and may improve working memory,
which is a neocortex-associated property. In the periphery, ACh
begins to suppress cytokines production in macrophages (circular
arrow).
[0093] FIG. 11B: At 3 hr post-treatment: Proteases release a
C-terminal fragment of 36 amino acids in length from AChE-R and
initiate further destruction, followed by decreases in AChE
activity. Endotoxin is already gone, and ACh effectively suppresses
cytokines production; Increased ACh levels (reflecting enhanced
secretion and the decrease in AChE's hydrolytic activity) are
probably associated with activated working memory, whereas the
elevation in AChE-R cleavage product is associated with a lower
working memory improvement.
[0094] FIG. 11C: At 9 hr Post-treatment: Cortisol is gone as well.
However, the persistent, although slow decrease in AChE activity is
associated both with the impaired declarative memory and, probably
through ACh increases, with the activated working memory. The
steady increase in AChE-R cleavage product is now associated both
with a greater impairment in declarative memory and with lower
improvement in working memory.
[0095] Abbreviations: inc. lev., increased level; dec. lev.,
decreased level; cleav. Prod., cleavage product.
[0096] FIG. 12A-12B: Transgenic mice display higher body
temperature than wild-type mice.
[0097] FIG. 12A: Graph showing the temperature of each mouse over
time, squares represent transgenic mice, circles, control.
[0098] FIG. 12B: Graph showing the average temperature of each
group (transgenic or control) over time, diamonds represent
transgenic mice, squares, control.
[0099] Abbreviations: An. T., Anal temperature; Aver. An. T.,
Average Anal temperature; T. p. anest., time post-anesthesia.
[0100] FIG. 13A-13C: Effects of Tacrine on LPS-induced IL-1
secretion in the hippocampus and IL-1 and TNF-.alpha. secretion in
the serum.
[0101] FIG. 13A: Graph showing the levels of IL-1.beta. in the
hippocampus.
[0102] FIG. 13B: Graph showing the levels of IL-1.beta. in the
serum.
[0103] FIG. 13C: Graph showing the levels of TNF-.alpha. in the
serum.
[0104] Abbreviations: prot., protein; ser., serum; sal.,
saline.
[0105] FIG. 14A-14C: Effects of Rivastigmine on LPS-induced IL-1
secretion in the hippocampus and IL-1 and TNF-.alpha. secretion in
the serum.
[0106] FIG. 14A: Graph showing the levels of IL-1.beta. in the
hippocampus.
[0107] FIG. 14B: Graph showing the levels of IL-1.beta. in the
serum.
[0108] FIG. 14C: Graph showing the levels of TNF-.alpha. in the
serum.
[0109] Abbreviations: prot., protein; ser., serum; sal.,
saline.
[0110] FIG. 15A-15H: Effects of surgery stress on emotional and
cognitive parameters.
[0111] FIG. 15A: Graph showing the effect of surgery stress on
anxiety.
[0112] FIG. 15B: Graph showing the effect of surgery stress on
depression.
[0113] FIG. 15C: Graph showing the effect of surgery stress on
fatigue.
[0114] FIG. 15D: Graph showing the effect of surgery stress on
pain.
[0115] FIG. 15E: Graph showing the effect of surgery stress on word
list recall.
[0116] FIG. 15F: Graph showing the effect of surgery stress on word
list recognition.
[0117] FIG. 15G: Graph showing the effect of surgery stress on
story recall.
[0118] FIG. 15H: Graph showing the effect of surgery stress on
figure recall.
[0119] Abbreviations: Cont., control; str., stress; T., time; Anx.,
anxiety; Dep., depression; Fat., fatigue; P., pain; W.L.R., word
list recall; W. L. Recog., word list recognition; S. R., story
recall; Fig. R., figure recall.
[0120] FIG. 16A-16C: Effect of surgery stress on cytokine
levels.
[0121] FIG. 16A: Graph showing the effect of surgery stress on IL-1
and IL-6 levels.
[0122] FIG. 16B: Correlation between IL-1 and depression.
[0123] FIG. 16C: Correlation between cytokines and cognitive
parameters.
[0124] FIG. 17A-17C: Reduction of AChE gene expression upon EN301
treatment.
[0125] FIG. 17A: Analysis of RT-PCR reaction (AChE exon 2 product
after 31 PCR cycles). From left to right: lane 1, marker; lanes
2-8, samples from EN301-treated mice; lanes 9-14, samples from
PBS-treated mice.
[0126] FIG. 17B: Histogram representing quantitative analysis of
the results obtained in the PCR reaction using primers targeting
the common sequence in exon 2 of murine AChE cDNA.
[0127] FIG. 17C: Histogram representing quantitative analysis of
the results obtained in the PCR reaction using primers targeting
the sequence in exon 6 unique to the AChE-S variant.
[0128] Abbreviations: c.d., common domain; Arb. U., arbitrary
units; sal., saline.
[0129] FIG. 18A-18C: Schematic representation of injections and
conduction tracings in the GBS model
[0130] FIG. 18A: Systemic exposure was provided by intra-peritoneal
(i.p.) injection (systemic injection). Intra-neural (i.n.)
injections were to the sciatic nerve at the mid thigh level.
[0131] FIG. 18B: Compound muscle action potential is recorded from
the intrinsic foot muscles following proximal stimulation of the
sciatic nerve at the sciatic notch and distal stimulation of the
peroneal and posterior tibial nerves at the ankle.
[0132] FIG. 18C: Proximal to distal amplitudes ratio (PDR) of less
than 0.5 indicates conduction block.
[0133] Abbreviations: inj., injection; red., reduced; norm.,
normal; prox. stim., proximal stimulation; dist. stim., distal
stimulation; rec. si., recording site.
[0134] FIG. 19A-19D: Histograms representing average proximal to
distal amplitude ratio (PDR) in selected experiments.
[0135] Measurements were obtained one day following intra-neural
injection or on the second post-injection day, where
designated.
[0136] Abbreviations: i.n., intra-neural; i.p., intra-peritoneal;
LPS, lipopolysaccharide; EN101 or AS, antisense oligonucleotide;
SM, splenocyte medium; BMM, bone marrow macrophage; ARP,
AChE-readthrough peptide; ASP, AChE-synaptic peptide; n., none;
sal., saline; inj., injection; PID2, second post-injection day;
I.N.Inj., intra-neural injection; LPS-R,
lipopolysaccharide-reactive.
[0137] FIG. 20: Immunoblot signal for PKC.beta.II.
[0138] Expression of PKC.beta.II is increased following
intra-neural injection (i.n.) of LPS-reactive splenocyte medium in
two nerves (RM, lanes 3, 4) compared to two nerves injected with
non-reacted splenocyte medium (NM, lanes 1, 2). This increase is
attenuated in two nerves by concomitant i.n. injection of antisense
EN101 (RM+EN101, lanes 5, 6).
DETAILED DESCRIPTION OF THE INVENTION
[0139] For the purposes of clarity, the following abbreviations and
terms are defined herein: [0140] AChE: acetylcholinesterase [0141]
AChE-R: acetylcholinesterase, "readthrough" variant or isoform, its
mRNA includes pseudo-intron 14 [0142] AChE-S: acetylcholinesterase,
synaptic variant or isoform [0143] AS-ON: antisense oligonucleotide
[0144] CMAP: compound muscle action potential [0145] CNS: central
nervous system [0146] EN101: may also be referred as AS3, antisense
oligonucleotide targeted against human, rat or mouse (hEN101,
rEN101 or mEN101, respectively) AChE mRNA [0147] EN301: may also be
referred as mEN101, antisense oligonucleotide targeted against
mouse AChE mRNA [0148] GBS: Guillain-Barre Syndrome [0149] i.n.:
intraneural [0150] i.p.: intraperitoneal [0151] i.v.: intravenous
[0152] o.g.: oral gavage [0153] p.o.: per os [0154] PDR: proximal
to distal amplitude ratio
[0155] Antisense oligonucleotide: A nucleotide comprising
essentially a reverse complementary sequence to a sequence of AChE
mRNA. The nucleotide is preferably an oligodeoxynucleotide, but
also ribonucleotides or nucleotide analogues, or mixtures thereof,
are contemplated by the invention. The antisense oligonucleotide
may be modified in order to enhance the nuclease resistance
thereof, to improve its membrane crossing capability, or both. The
antisense oligonucleotide may be linear, or may comprise a
secondary structure. It may also comprise enzymatic activity, such
as ribozyme activity.
[0156] To reveal if cholinergic allostasis and CNS inflammatory
processes are inter-related, the inventors studied spinal cord
neurons from Cynomolgus monkeys following one week daily treatment
with hEN101 (SEQ ID NO:1), a 2'-oxymethylated antisense
oligonucleotide inducing AChE-R mRNA destruction. hEN101 prevented
the stress-induced increases in plasma AChE activities and
selectively suppressed neuronal AChE-R mRNA and
interleukins-1.beta. and -6 levels in a dose- and cell
size-dependent manner. In contrast, VAChT and ChAT levels were
reduced dose-independently in all of the handling-stressed monkeys,
demonstrating distinct regulation for the corresponding genes.
These findings allude to a causal association between cholinergic
allostasis and inflammatory responses in the primate CNS and
suggest antisense intervention with AChE-R accumulation for the
management of both these impairments. Furthermore, EN101
intervention in a GBS model prevented the appearance of nerve
conduction block following both in vivo and in vitro exposure to
Cj-LPS, and had a similar affect by exposure to E. Coli LPS.
[0157] Thus, the present invention refers to the use of an
inhibitor of AChE expression, as an anti-inflammatory agent.
Mainly, the present invention provides methods of treatment and/or
prevention of conditions selected from the group consisting of:
conditions triggering an inflammatory response, inflammation,
release of pro-inflammatory cytokines, fever, and
inflammation-associated neuropathies, particularly GBS, said method
comprising administering a therapeutic effective amount of an
inhibitor of AChE expression, or a pharmaceutical composition
comprising the same, to a subject in need.
[0158] As herein defined, an inhibitor of AChE expression is any
agent which is capable of blocking or hindering the expression of
the AChE gene, particularly by interacting with its mRNA. Thus,
said inhibitor may be an AChE-specific ribozyme, a double-stranded
nucleotide sequence used for RNA interference of the AChE gene, or
an antisense oligonucleotide directed against AChE. Antisense
nucleotides are preferably nuclease resistant.
[0159] Preferably, said inhibitor of AChE expression selectively
inhibits the AChE-R mRNA, consequently selectively inhibiting the
expression of the AChE-R isoform. In this regard, any agent capable
of inhibiting the soluble AChE-R isoform may also be an
anti-inflammatory agent. Therefore, a putative molecule that could
block AChE-R expression and/or function would be an
anti-inflammatory agent.
[0160] As shown in Example 1, BuChE levels in the plasma of treated
monkeys were not significantly altered, supporting the notion of a
selective antisense effect over AChE alone. Both plasma AChE
activity and neuronal AChE mRNA labeling increased in monkeys
treated with 150 .mu.g/kg hEN101, potentially reflecting increased
production at the tested daily time (Table 1 and data not shown).
Alternatively, or in addition, the mild stress associated with the
insertion of cannula for p.o. administration of hEN101 could be the
cause. Plasma AChE increases in the absence of hEN101 would likely
be even higher, as is indicated from the suppression of plasma AChE
activity in monkeys treated similarly with the higher dose of 500
.mu.g/kg hEN101. An apparent 3 hr delay was observed in the
drug-induced decreases of plasma AChE under this low hEN101 dose,
possibly reflecting prevention by antisense agents of the synthesis
of their target protein(s). This further indicates a short half
life for primate AChE-R mRNA in vivo, compatible with previous
findings by the inventors and others [Brenner et al. (2003) id
ibid.; Chan, R. Y. et al. (1998) J. Biol. Chem. 273,
9727-9733].
[0161] The fraction of AChE-R mRNA positive neurons, the intensity
of AChE-R mRNA labeling and the fraction of cells with AChE-R mRNA
labeled processes were all reduced under antisense treatment (FIGS.
2A-2J and 3A-3C). Neuronal susceptibility of AChE-R overproduction
to antisense suppression appeared inversely proportional to cell
body size, possibly reflecting distinct membrane and/or metabolic
properties, different cell volumes or a combined contribution of
these properties. In addition, antisense-independent reductions in
VAChT and ChAT likely indicated a slowdown of vesicle recycling
[Soreq, H. et al. (1990) Proc Natl Acad Sci U.S.A. 87: 9688-9692],
potentially modulating the pace of cholinergic neurotransmission.
Under naive conditions, AChE-S mRNA appeared in processes of many
more spinal cord neurons than AChE-R mRNA, creating a pattern
reminiscent of VAChT labeling in the rat spinal cord ventral horn
[Weihe et al. (1996) id ibid.]. Expectedly, hEN101 treatment was
highly efficient with neuronal AChE-R mRNA and much less effective
with AChE-S mRNA. However, the reduced intensity of neuronal AChE-S
mRNA labeling likely reflected limited reduction in neuronal AChE-S
mRNA levels as well. Under hEN101 treatment, AChE-S mRNA in
processes was reduced, suggesting common tendency for reduced
dendrite translocation of the rodent and primate AChE-S mRNA
transcript under stress [Meshorer et al. (2002) id ibid.]. This
difference further strengthened the notion that the naive monkey
was indeed under no stress, an important fact in a study with
strictly limited number of animals. The reduced AChE-S mRNA in
neuronal processes of the treated monkeys may be treatment- and/or
drug-induced. Following 7 days treatment, a shift from the primary
AChE-S mRNA transcript to the stress-induced antisense-suppressible
AChE-R mRNA may be visualized in the neuronal processes (FIG.
2A-2J).
[0162] Preferably, said inhibitor of AChE expression is an
antisense oligonucleotide directed against AChE, having any one of
the following sequences: TABLE-US-00002 5' CTGCCACGTTCTCCTGCACC 3';
(SEQ ID NO:1) and 5' CTGCCACGTTCTCCTGCA*C*C* 3', (SEQ ID NO:7)
wherein the three 3' terminal residues are modified with 2-O-methyl
groups (*).
[0163] The antisense oligonucleotides denoted by SEQ ID NO:1 or SEQ
ID NO:7 are also referred to herein as EN101, or hEN101. hEN101 is
also commercially known as Monarsen.TM..
[0164] The antisense oligonucleotides directed against AChE have
been described in the past by the present inventors [WO 03/002739],
and were shown to have a potent effect in the treatment of the
neuromuscular pathology myasthenia gravis [applicant's co-pending
U.S. 2003-0216344]. In the inventors' herein described results, as
shown in Example 5 and FIG. 4, the antisense oligonucleotide
directed against AChE was able to reduce the release of IL-1.beta.,
which is a pro-inflammatory cytokine.
[0165] As shown in Example 1, AChE-R mRNA levels in motoneurons
were minimally affected, However, elimination of AChE-R production
in spinal cord smaller neurons potentially increased ACh signaling
within the treated tissue, in spite of the stress-induced reduction
in VAChT and ChAT [Kaufer et al. (1998) id ibid.]. This attributes
to AChE-R the primary role of regulating ACh levels in the CNS.
Findings of others show large variability in the
electrophysiological activity patterns of spinal cord interneurons
[Perlmutter (1996) id ibid.] as well as pre-movement instructed
delay activity in them [Prut and Fetz (1999) id ibid.]. The
inventors observed the largest variability in AChE-R levels within
small cells, probably interneurons, suggesting that these
modulations may contribute towards the wide electrophysiological
variability between these neurons. Under normal conditions, AChE-R
expression in small cholinergic neurons, localized to the dorsal
horn of the spinal cord, may thus contribute to the control of
motoneuron activities (e.g. motor reflexes). C-terminal structures,
which affect the cholinergic input to motoneurons, were considered
to originate in proximity to the motoneurons themselves [Hellstrom
(1999) id ibid.]. This study attributes this origin to AChE mRNA
positive interneurons and small cholinergic neurons located in the
ventral horn and intermediate zone of the lumbar spinal cord. The
numbers of VAChT-labeled C-terminals surrounding motoneuron cell
bodies decreased in all of the handled animals. This observation
attributes this decrease to the handling stress, compatible with
the stress-induced decreases in ChAT and VAChT mRNA in hippocampal
neurons [Kaufer et al. (1998) id ibid.].
[0166] Additional antisense oligonucleotides directed against AChE
have also been described, and potentially have the same
anti-inflammatory effect as hEN101, as demonstrated in Example 16
for mEN101. These are antisense oligonucleotides derived from the
mouse and the rat AChE homologous sequences, which have the
following sequences: TABLE-US-00003 mEN101
5'-CTGCAATATTTTCTTGCACC-3' (SEQ ID NO:2) [Grifman and Soreq (1997)
Antisense Nucleic Acid Drug Dev. 7(4):351-9] Also referred herein
as EN301. rEN101 5'-CTGCCATATTTTCTTGTACC-3' (SEQ ID NO:3) [Brenner
(2003) id ibid.] hEN103 5'-GGGAGAGGAGGAGGAAGAGG-3' (SEQ ID NO:4)
[Grisaru, D. et al. (1999) Mol. Cell Biol. 19(1):788-95]
[0167] Example 16 demonstrates how administration of mEN101 (EN301)
was able to reduce the levels of ACHE-R in the brain. This could be
done directly, upon crossing the blood-brain-barrier, or
indirectly, by reducing the levels of peripheral AChE, increasing
the levels of ACh, which would then suppress the production of
pro-inflammatory cytokines by macrophages.
[0168] Thus, the present invention provides the use of an inhibitor
of AChE as defined herein, as a suppressor of pro-inflammatory
cytokines release. Known pro-inflammatory cytokines are IL-1.beta.,
TNF.alpha., IL-6, IL-8, IL-12 and IL-18, amongst others.
[0169] Preferably, IL-1.beta. is the pro-inflammatory cytokine to
be suppressed by the method of the invention upon administration of
an antisense oligonucleotide denoted by any one of SEQ ID NO:1, SEQ
ID NO:2 and SEQ ID NO:7, or a composition comprising thereof, to a
subject in need.
[0170] Pro-inflammatory cytokine release may be triggered by
factors of acquired, chemical or genetic origin. Amongst others,
these may be stress, bacterial infection, drugs, irradiation,
exposure to AChE inhibitors, stroke, auto-immune diseases, multiple
chemical sensitivity, or any cumulative age-dependent damages.
[0171] Known conditions which trigger pro-inflammatory cytokine
release are: bacterial infection, drugs, irradiation, exposure to
AChE inhibitors, stroke, auto-immune diseases, multiple chemical
sensitivity, or any cumulative age-dependent damages.
[0172] Stress-induced spinal IL-1.beta. over-production and spinal
IL-1.beta. suppression following AS-ON inhibition of AChE-R,
support the notion of cholinergic regulation of anti-inflammatory
response in the CNS. According to this scheme, "stressed" neurons
produce high levels of AChE-R, reducing ACh and allowing
uninterrupted production of IL-1.beta. in CNS neurons that do not
express IL-1.beta. under normal conditions. Antisense suppression
of the stress-induced AChE-R would increase ACh levels, which can
then suppress IL-1.beta. production in CNS neurons. Such
cholinergic regulation of inflammatory response within the CNS may
explain both the increase of pro-inflammatory cytokines under
cholinergic imbalance (e.g. exposure to organophosphate compounds)
[Svensson (2001) id ibid.; Dyer (2001) id ibid.] and the decrease
of those same cytokines under retrieval of cholinergic balance
(e.g. under antisense treatment, see FIG. 6). This provides a new
understanding of the improvement of survival and clinical status in
EAMG rats receiving daily oral doses of EN101 as compared to the
conservative AChE inhibitor (pyridostigmine) [Brenner (2003) id
ibid.].
[0173] It is known in the literature that IL-1.beta. induces
arthritis in chondrocytes by suppressing Col2 gene expression
[Hollander et al. (1994) J. Clin. Invest. 93: 1722; Hollander et
al. (1995) J. Clin. Invest. 96: 2859; Bi et al. (1999) Nat. Genet.
22: 85; Lefebvre et al. (1997) Mol. Cell Biol. 17: 2336; Murakami
et al. (2000) J. Biol. Chem. 275: 3687; Tanaka et al. (2000) Mol.
Cell Biol. 20: 4428]. Therefore, the inhibition of IL-1.beta.
release by the antisense oligonucleotide herein described might
result in cartilage regeneration. Thus, the invention also provides
the use of an inhibitor of AChE expression, as defined herein, as
an inducer of cartilage regeneration.
[0174] The antisense oligodeoxynucleotides used as
anti-inflammatory agents in the present invention are preferably
nuclease resistant. There are a number of modifications that impart
nuclease resistance to a given oligonucleotide. Reference is made
to WO 98/26062, which publication discloses that oligonucleotides
may be made nuclease resistant e.g., by replacing phosphodiester
internucleotide bonds with phosphorothioate bonds, replacing the
2'-hydroxy group of one or more nucleotides by 2'-O-methyl groups,
or adding a nucleotide sequence capable of forming a loop structure
under physiological conditions to the 3' end of the antisense
oligonucleotide sequence. An example for a loop forming structure
is the sequence 5'-CGCGAAGCG-3', which may be added to the 3' end
of a given antisense oligonucleotide to impart nuclease resistance
thereon.
[0175] Phosphorothioate-modified oligonucleotides are generally
regarded as safe and free of side effects. The antisense
oligonucleotides of the present invention have been found to be
effective as partially phosphorothioates and yet more effective as
partially 2'-O-methyl protected oligonucleotides. WO 98/26062
teaches that AChE antisense oligonucleotides containing three
phosphorothioate bonds out of about twenty internucleotide bonds
are generally safe to use in concentrations of between about 1 and
10 .mu.M. However, for long-term applications, oligonucleotides
that do not release toxic groups when degraded may be preferred.
These include 2'-O-methyl protected oligonucleotides, but not
phosphorothioate oligonucleotides. A further advantage of
2'-O-methyl protection over phosphorothioate protection is the
reduced amount of oligonucleotide that is required for AChE
suppression. This difference is thought to be related to the
improved stability of the duplexes obtained when the 2'-O-methyl
protected oligonucleotides are used [Lesnik, E. A. & Freier, S.
M. (1998) Biochemistry 37, 6991-7]. An alternative explanation for
the greater potency of the 2'-O-methyl oligonucleotides is that
this modification may facilitate penetration of the oligonucleotide
chain through the cell membrane. A further advantage of 2'-O-methyl
protection is the better protection against nuclease-mediated
degradation that it confers, thus extending the useful life time of
antisense oligonucleotides protected in this way.
[0176] Further, the inhibitor of AChE as defined above may also be
used as an anti-pyretic. Thus, the antisense oligonucleotides
denoted by any one of SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7, or
compositions comprising thereof, may be used in the method of the
invention for treating fever, or lowering body temperature, in a
subject in need.
[0177] In response to anesthesia, neural regulation induces rapid
decrease in body temperature. As shown in Example 12, transgenic
mice with host AChE-R elevation show inherently higher body
temperature as compared to strain, gender and age-matched controls.
Furthermore, their body temperature remains higher also under
anesthesia, demonstrating impaired regulation and tentative
association of AChE-R with pyrogenic responses. Thus, inhibitors of
AChE-R expression would also have an effect in lowering the
elevated body temperature that is characteristic of inflammatory
reactions.
[0178] Normal body temperature varies by person, age, activity, and
time of day. The average normal body temperature is 37.degree. C.
(98.6.degree. F.). An at least half-degree elevation of the average
temperature may already be considered as fever.
[0179] Fever, or elevated body temperature, may be triggered by
various causes, including: viral and bacterial infections, colds or
flu-like illnesses, sore throats and strep throat, ear infections,
viral gastroenteritis or bacterial gastroenteritis, acute
bronchitis, infectious mononucleosis, urinary tract infections,
upper respiratory infections (such as tonsillitis, pharyngitis or
laryngitis), medications (such as antibiotics, antihistamines,
barbiturates, and drugs for high blood pressure), occasionally,
more serious problems like pneumonia, appendicitis, tuberculosis,
and meningitis, collagen vascular disease, rheumatoid diseases, and
autoimmune disorders, juvenile rheumatoid arthritis, lupus
erythematosus, periarteritis nodosa, AIDS and HIV infection,
inflammatory bowel disease, regional enteritis, ulcerative colitis,
cancer, leukemia, neuroblastoma, Hodgkin's disease and
non-Hodgkin's lymphoma.
[0180] In accordance with the invention, the dosage of the
antisense oligodeoxynucleotide is about 0.001 to 50 .mu.g
oligonucleotide per gram of body weight of the treated mammalian
subject, and it is for daily use. Preferably, the dosage is about
0.01 to about 5.0 .mu.g/g. More preferably, the dosage is between
about 0.05 to about 0.7 .mu.g/g. Thus, the optimal dose range is
between 50-500 .mu.g/kg of body weight of the treated subject, for
rats, monkeys and most importantly humans. This dosage refers to
the antisense oligonucleotide administered per se, or in solution,
in a pharmaceutical composition.
[0181] Further, the present invention also provides a
pharmaceutical composition for the treatment of conditions
triggering an inflammatory response in a mammalian subject in need,
preferably a human, comprising as active agent the above-defined
inhibitor of AChE expression. Optionally, the composition further
comprises pharmaceutically acceptable additives, carriers and/or
diluents. Preferably, said inhibitor of AChE expression is an
antisense oligonucleotide directed against AChE, and has the
sequence as denoted by any one of SEQ ID NO:1 and SEQ ID NO:7.
[0182] Alternatively, wherein said mammalian subject is a non-human
mammalian, said antisense nucleotide has the sequence as denoted by
any one of SEQ ID NO:2 and SEQ ID NO:3.
[0183] In a yet further aspect, the present invention provides a
pharmaceutical composition for the treatment and/or prevention of
inflammation in the joints, central nervous system,
gastrointestinal tract, endocardium, pericardium, lung, eyes, skin
and urogenital system in a mammalian subject in need, comprising as
active agent the inhibitor of AChE expression as defined above,
optionally further comprising pharmaceutically acceptable
additives, carriers and/or diluents. Preferably, said inhibitor of
AChE expression is an antisense oligonucleotide.
[0184] More preferably, wherein said mammalian subject is a human,
said antisense nucleotide has the sequence as denoted by any one of
SEQ ID NO:1 and SEQ ID NO:7.
[0185] Alternatively, wherein said mammalian subject is a non-human
mammalian, said antisense nucleotide has the sequence as denoted by
any one of SEQ ID NO:2 and SEQ ID NO:3.
[0186] The inhibitor of AChE expression, as defined above, is to be
used in the preparation of the pharmaceutical composition
comprising the same.
[0187] The antisense oligonucleotides described herein are
generally provided in the form of pharmaceutical compositions. Said
compositions are for use by injection, topical administration, or
oral uptake.
[0188] Thus, the present invention also provides the use of the
antisense oligonucleotides described herein, and preferably the use
of the antisense oligonucleotides denoted by SEQ ID NO:1 and SEQ ID
NO:7, in the preparation of a pharmaceutical composition for the
treatment or prevention of conditions triggering an inflammatory
response in a subject in need. In particular, said conditions are
selected from the group comprised of inflammation in the joints,
central nervous system, gastrointestinal tract, endocardium,
pericardium, lung, eyes, skin, urogenital system, fever, the
release of pro-inflammatory cytokines, stroke, brain and peripheral
nerve trauma, neurodegenerative diseases (e.g. vascular dementia),
closed head injury, memory impairment, and inflammation-associated
neuropathies (e.g. Guillain-Barre syndrome).
[0189] Furthermore, the pharmaceutical composition of the invention
may comprise as active agent a combination of at least two
antisense oligonucleotides as defined in the invention, or
functional analogs, derivatives or fragments thereof.
[0190] By "analogs and derivatives" is meant the "fragments",
"variants", "analogs" or "derivatives" of said nucleic acid
molecule. A "fragment" of a molecule, such as any of the
oligonucleotide sequences of the present invention, is meant to
refer to any nucleotide subset of the molecule. A "variant" of such
molecule is meant to refer a naturally occurring molecule
substantially similar to either the entire molecule or a fragment
thereof. An "analog" of a molecule can be without limitation a
paralogous or orthologous molecule, e.g. a homologous molecule from
the same species or from different species, respectively.
[0191] Preferred modes of administration of the inhibitor of AChE
expression or pharmaceutical compositions comprising the same are
by subcutaneous, intraperitoneal, intravenous, intramuscular or
systemic injection.
[0192] The pharmaceutical composition described herein generally
comprises a buffering agent, an agent which adjusts the osmolarity
thereof, and optionally, one or more carriers, excipients and/or
additives as known in the art, e.g., for the purposes of adding
flavors, colors, lubrication, or the like to the pharmaceutical
composition.
[0193] A preferred buffering agent is Tris, consisting of 10 mM
Tris, pH 7.5-8.0, which solution is also adjusted for
osmolarity.
[0194] For in vivo use, the antisense oligonucleotides are
suspended is sterile distilled water or in sterile saline.
[0195] Other carriers may include starch and derivatives thereof,
cellulose and derivatives thereof, e.g., microcrystalline
cellulose, xantham gum, and the like. Lubricants may include
hydrogenated castor oil and the like.
[0196] Topical administration of pharmaceutical compositions may
include transdermal patches, ointments, lotions, creams, gels,
drops, suppositories, sprays, liquids and powders. Conventional
pharmaceutical carriers, aqueous, powder or oily bases, thickeners
and the like may be necessary or desirable.
[0197] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets or tablets. Thickeners, flavoring agents,
diluents, emulsifiers, dispersing aids or binders may be
desirable.
[0198] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0199] The pharmaceutical compositions described herein include,
but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0200] The pharmaceutical compositions of the present invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product. Such compositions may be formulated into any of many
possible dosage forms such as, but not limited to, tablets,
capsules, liquid syrups, soft gels, suppositories, and enemas. The
compositions of the present invention may also be formulated as
suspensions in aqueous, non-aqueous or mixed media. Aqueous
suspensions may further contain substances which increase the
viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0201] The pharmaceutical compositions may be formulated and used
as foams. Pharmaceutical foams include formulations such as, but
not limited to, emulsions, microemulsions, creams, jellies and
liposomes. While basically similar in nature these formulations
vary in the components and the consistency of the final
product.
[0202] In one embodiment, the pharmaceutical composition of the
invention is for daily use by a subject in need of such treatment,
at a dosage of active ingredient between about 0.001 .mu.g/g and
about 50 .mu.g/g. Preferably, the treatment and/or prevention
comprises administering a dosage of active ingredient of about 0.01
to about 5.0 .mu.g/g. Most preferably, said dosage of active
ingredient is of between about 0.05 to about 0.70 .mu.g/g, and even
most preferably, the dosage is from 0.15 to 0.50 .mu.g/g of body
weight of the subject in need.
[0203] Persons of ordinary skill in the art can easily estimate
repetition rates for dosing based on measured residence times and
concentrations of the antisense oligonucleotide in bodily fluids or
tissues. Following successful treatment, it may be desirable to
have the patient undergo maintenance therapy to prevent the
recurrence of the disease state, wherein the oligonucleotide is
administered in maintenance doses, ranging from 0.01 .mu.g to 100 g
per kg of body weight, once or more daily, to once every 20
years.
[0204] The preparation of pharmaceutical compositions is well known
in the art and has been described in many articles and textbooks,
see e.g., Gennaro A. R. ed. (1990) Remington's Pharmaceutical
Sciences, Mack Publishing Company, Easton, Pa., and especially
pages 1521-1712 therein.
[0205] The results presented herein are the first demonstration of
an organismal antisense response that affects primate CNS
neurotransmission (Example 1). Positron Emission Tomography (PET)
imaging studies in Rhesus monkeys demonstrated for 2'-O-methylated
oligonucleotides limited, yet relatively long-term persistence in
the brain as compared with phosphothioate agents [Tavitian (1998)
id ibid.]. In addition, the blood-brain barrier of primates may be
more easily penetrated than that of rodents, which is compatible
with the inventors' recent findings [Tomkins, O. et al. (2001) Cell
Mol Neurobiol 21: 675-691].
[0206] The antisense agent targeted toward the human ACHE sequence
(see Examples) appeared effective in Cynomolgus monkeys at the same
nanomolar dose as that of the corresponding agents in mice [Cohen
et al. (2002) id ibid.] and rats Brenner et al. (2003) id ibid.].
Long-term AChE-R overproduction, as is the case in head-injured
mice, is associated with impaired locomotion control that is
susceptible to improvement under antisense suppression of AChE-R
production [Shohami (2000) id ibid.]. In spite of the limited
number of experimented animals used in the current study, delivery
was appeared to be effective in both the intravenous and the oral
administration mode, with dose dependence reflected by the more
pronounced effects under 500 as compared to 150 .mu.g/kg/day of
orally administrated hEN101.
[0207] In conclusion, the present invention teaches methods of
treatment of conditions wherein lowering the amounts of circulating
AChE-R may be therapeutic and even preventive. Mainly, said
conditions may be summarized as conditions triggering an
inflammatory response, inflammation of any kind, and in particular
inflammation-associated neuropathies, such as Guillain-Barre
syndrome. The method comprises administering a therapeutically
effective amount of an inhibitor of AChE expression or a
composition comprising the same to a mammalian subject in need,
preferably a human.
[0208] Preferably, said inhibitor of AChE expression to be used in
the methods of the invention is an antisense oligonucleotide,
which, more preferably has the sequence as denoted by any one of
SEQ ID NO:1 and SEQ ID NO:7.
[0209] Said therapeutic effective amount, or dosing, is dependent
on severity and responsiveness of the disease state to be treated,
with the course of treatment lasting from several days to several
months, or until a cure is effected or a diminution of the disease
state is achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligonucleotides,
and can generally be estimated based on EC.sub.50, found to be
effective in in vitro as well as in in vivo.
[0210] The variant specificity, low dose and long duration efficacy
of the antisense agents may be clear advantages over conservative
drugs, both for interfering with acute stress-induced symptoms and
inflammatory response, and hence for prevention of
neurodeterioration. These considerations may be relevant to various
disease conditions, including amyotrophic lateral sclerosis [Shaw,
P. J. & Eggett, C. J. (2000) J. Neurol. 247 Suppl 1: I17-27],
myasthenic syndromes [Becker et al. (1992) id ibid.], muscular
dystrophy [Cifuentes-Diaz, C. et al. (2001) J. Cell Biol. 152:
1107-1114], spinal muscular atrophy [Sendtner, M. (2001) Curr.
Opin. Neurol. 14: 629-634], and sepsis-mediated critical illness
polyneuropathy [Hund, E. (2001) J. Neurol. 248: 929-934]. Antisense
facilitation of the cholinergic attenuation of inflammatory
responses in primate CNS neurons may thus offer interesting
therapeutic advantages.
[0211] The methods described herein also include combination
therapy, where the inhibitor of AChE expression or the composition
comprising thereof are administered in combination with other
drugs, in accordance with the condition of the subject to be
treated.
[0212] As shown in Examples 6-11, administration of a low dose of
endotoxin to healthy volunteers induces secretion of
pro-inflammatory cytokines and cortisol, compromises cholinergic
homeostasis and alters memory. Both psychological [Maes M. et al.
(1998) Cytokine 10:313-8], and physical [Goodman J. C. et al.
(1990) J. Neuroimmunol. 30:213-7] stressors are likewise associated
with the production of pro-inflammatory cytokines (including
TNF-.alpha. and IL-6) in humans. Exposure to stressful stimuli
exerts profound effects on cholinergic homeostasis in general and
on the production and cellular distribution of AChE-R in
particular. Therefore, experimental endotoxemia emerges as a valid
model for studying the interactions between cytokines and the
changes in cholinergic homeostasis (as those are reflected by
AChE-R modulations) as well as the impact of these interactions on
memory functions. No subjective feelings of illness were involved,
so that the endotoxin-induced memory alterations could not be
attributed to a perceived physical-illness-associated distress. The
selectivity of the observed memory changes was compatible with
reports by others that cortisol does not affect attention, verbal
executive function or vigilance [Lupien et al., (1999) Rev.
Neurosci. 10: 117-39].
[0213] FIG. 11 presents a scheme summarizing the kinetic follow-up
for the different parameters that were measured and the postulated
associations between them, predicting potentially causal
relationships between the induction of cytokines, hormone
secretion, AChE modulations and the resultant memory changes.
Interestingly, during the first testing period the
endotoxin-induced impairment in declarative memory was highest and
correlated positively with cytokine secretion, whereas the
improvement in working memory became prominent at 3 hr
post-treatment and showed no correlation with cytokine secretion.
In contrast, both types of memory changes were significantly
correlated with AChE-R cleavage, although cholinergic control over
working memory seemed to begin earlier than for declarative memory
(3 hr vs. 9 hr post-injection, FIG. 11B and FIG. 11C,
respectively).
[0214] Previous reports have documented decrements in declarative
memory following endotoxin administration to healthy volunteers
[Reichenberg (2001) id ibid.], as well as following cytokine
(especially interferon and interleukin-2) therapy [Meyers C. A.
(1999) Adv. Exp. Med. Biol. 461:75-81; Capuron L. et al. (2001)
Psychosom. Med. 63:376-86], viral (e.g., influenza) infection
[Capuron (1999) id ibid.] or cortisol administration [de Quervain,
D. J. et al. (2000) Nat. Neurosci. 3:313-4]. In this study, the
endotoxin-induced decrease in declarative memory performance was
associated with cytokines secretion only in the first testing
period. In contrast, it was associated with AChE activity and
AChE-R cleavage levels during the last period, when cytokine
concentrations have returned to baseline yet the differences
between AChE activity and AChE-R cleavage were maximal between the
endotoxin and the placebo conditions. These findings may suggest
that immune-mediated processes are prominent in the early
endotoxin-induced memory impairments, whereas the later effects are
probably mediated by the cholinergic system.
[0215] This study demonstrates that changes in memory functioning
following endotoxin exposure are co-associated with the induction
of pro-inflammatory cytokines and AChE-R cleavage. The tentative
pathway through which these changes may occur involves alterations
in cholinergic neurotransmission and elevation in cytokine
secretion (FIG. 11). These are associated with many medical
conditions that involve inflammatory processes, particularly within
the brain (e.g., stroke, brain trauma and neurodegenerative
disease, such as vascular dementia) [McGeer P. L. and McGeer E. G.
(1995) Brain Res. Rev. 21:195-218; Saito H. et al. (1995) Clin.
Exp. Pharmacol. Physiol. Suppl. 22:S257-9; Levin and Simon (1998)
id ibid]. For example, closed head injury results in the production
of TNF-.alpha. and other pro-inflammatory cytokines [Goodman et al.
(1990) id ibid.; Trembovler V. et al. (1999) J. Interferon Cytokine
Res. 19:791-5] as well as in excessive accumulation of AChE-R
within the brain [Shohami et al. (2000) id ibid.]. The findings
presented herein suggest that cytokine-cholinergic interactions
play an important role in the memory alterations that accompany
these conditions, and may provide insights into the development of
novel preventive and therapeutic procedures that will counteract
the corresponding memory impairments without harming the improved
capacities.
[0216] Disclosed and described, it is to be understood that this
invention is not limited to the particular examples, process steps,
and materials disclosed herein as such process steps and materials
may vary somewhat. It is also to be understood that the terminology
used herein is used for the purpose of describing particular
embodiments only and not intended to be limiting since the scope of
the present invention will be limited only by the appended claims
and equivalents thereof.
[0217] It must be noted that, as used in this specification and the
appended claims, the singular forms "a", "an" and "the" include
plural referents unless the content clearly dictates otherwise.
[0218] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", and
variations such as "comprises" and "comprising", will be understood
to imply the inclusion of a stated integer or step or group of
integers or steps but not the exclusion of any other integer or
step or group of integers or steps.
[0219] The following Examples are representative of techniques
employed by the inventors in carrying out aspects of the present
invention. It should be appreciated that while these techniques are
exemplary of preferred embodiments for the practice of the
invention, those of skill in the art, in light of the present
disclosure, will recognize that numerous modifications can be made
without departing from the spirit and intended scope of the
invention.
EXAMPLES
[0220] The basic working hypothesis guiding this study was that
stimulus-induced modulations in the levels and composition of
neuronal AChE variants, ChAT and VAChT together contribute toward
the maintenance of cholinergic homeostasis in primate motoneurons.
This predicted neuronal AChE-R overproduction as well as ChAT and
VAChT suppression also under mild stress (e.g. handling or
injection). To test this hypothesis, the inventors measured plasma
AChE activities and labeled AChE-R mRNA, ChAT and VAChT in lumbar
spinal cord sections of cynomolgus monkeys with and without
treatment with hEN101. There was no indication of change in the
motor functioning of hEN101-treated monkeys following daily
administration of nanomolar doses of hEN101 for one week, as
assessed by general follow-up of motor behavior, clinical signs or
electrocardiography. No treatment-related toxicity or inflammatory
effect was observed in white blood cell (WBC) counts or
post-mortem, suggesting that the modulations induced by this
oligonucleotide reflected solely the consequences of its antisense
effect and indicating general maintenance of cholinergic balance
under such effects. Because of its specificity towards AChE-R mRNA,
the inventors predicted that hEN101 would alter the level and/or
composition of peripheral AChE. The inventors further whether AChE,
CHAT and VAChT levels in motoneurons are changed under handling
stresses and, if so, whether antisense suppression of AChE-R would
attenuate neuronal IL-1.beta. accumulation.
Experimental Procedures
Experimental Procedures Employed in Studying the Anti-Inflammatory
Effects of hEN101 in the Primate Spinal Cord
[0221] Animals: 15 month-old purpose-bred cynomolgus monkeys were
supplied by Charles River (UK) Ltd. Antisense administration was
performed at Huntingdon Life Sciences Ltd. (Huntingdon, UK), in
compliance with all of the relevant regulations for animal
experimentation in the UK.
[0222] Test substance: Human (h) HPLC-purified, GLP grade EN101
(purity 95% as verified by capillary electrophoresis) was purchased
from Avecia Biotechnology (Milford, Mass.). The primary hEN101
sequence, 5'CTGCCACGTTCTCCTGCA*C*C*3' (SEQ ID NO:1), is
complementary to the coding sequence of human AChE mRNA (GeneBank
Accession No. NM 000665, nucleotide positions 733-752) within exon
2, common to all three AChE variants [Soreq, H. & Zakut, H.
(1993) Human cholinesterases and anticholinesterases, Academic
Press, INC. San Diego; Ben Aziz-Aloya, R. et al. (1993) Proc. Natl.
Acad. Sci. U.S.A. 90, 2471-2475]. The three 3'-terminal residues
(*) were protected against nuclease attack with oxymethyl groups at
the 2' position. The sequence representing hEN101 with the three
3'-terminal bases modified is denoted by SEQ ID NO:7. Lyophilized
oligonucleotides were resuspended in sterile double distilled water
(24 mg/ml), and stored at -20.degree. C.
[0223] Several modes of chemical protection for antisense agents
are currently being clinically tried in human studies [for recent
review see Opalinska, J. B. & Gewirtz, A. M. (2002) Nat. Rev.
Drug Discov. 1: 503-514]. The chemical protection protocol used in
the current study (namely, three 3'-terminal 2'-Oxymethyl groups)
combines maintenance of the oligonucleotide's capacity to recruit
RNase H to its unprotected part while tightening the hybridization
bonds through the 2'-O-methyl groups [Soreq and Seidman (2001) id
ibid.], and offering improved intestinal permeability [Geary, R. S.
et al. (2001) J. Pharmacol. Exp. Ther. 296: 890-7]. An additional
benefit of this protection scheme is that removal of the protected
3' end will leave behind a naked and hence vulnerable
oligonucleotide that will be rapidly degraded. Unlike other AS-ONs
[Bennett, C. F. (2002) Antisense Nucleic Acid Drug Dev. 12:
215-224; Braasch, D. A. & Corey, D. R. (2002) Biochemistry 41:
4503-4510; Sazani, P. et al., (2002) Nat. Biotechnol. 20:
1228-1233] gradual nucleolytic breakdown would not lead in this
case, to non-specific interactions, of shortened ON agents.
[0224] hEN101 stability: Stability of freeze-dried hEN101 was
tested by HPLC during storage at -20.+-.5.degree. C., 4.degree. C.
and 25.+-.2.degree. C. (60.+-.5% relative humidity) in the dark.
Three samples from each storage condition were collected after 3, 6
and 9 months and their stability analyzed by HPLC. hEN101 was found
to be stable for at least 6 months at -20.degree. C. under these
storage conditions.
[0225] hEN101 administration: Three pairs of 1.5 to 2.5 Kg
cynomolgus monkeys, 1 male and 1 female, were administered hEN101
for 7 days: 150 .mu.g/kg daily per os (p.o.) by oral gavage (15
.mu.g/ml in 0.9% saline) or 500 .mu.g/kg daily (p.o., 50 .mu.g/ml
in saline) or by intravenous (i.v.) injection (100 .mu.g/ml in
saline). Plasma samples were removed at the noted hours following
the second day of treatment and kept at -20.degree. C. until use.
Following 1 week of daily treatment, animals were euthanized and
lumbar spinal cord preparations were paraffin-embedded by standard
procedures. One male naive monkey served as control.
[0226] Toxicology: Potential toxicity of hEN101 was tested at
Huntingdon before, during and following treatment. Among the
parameters noted were body weight, food consumption, general
locomotor behavior, electrocardiography and blood pressure, blood
count, prothrombin time and standard blood chemistry (Hitachi 917
Clinical Chemistry Analyzer). Post-mortem observation included
organ weights and scanning of hematoxylin and eosin-stained
sections of brain, heart, kidneys, liver, lungs, spinal cord and
stomach.
[0227] In situ hybridization: Tissues were fixed in 4%
paraformaldehyde and cut into 7 .mu.m paraffin-embedded sections.
Lumbar spinal cord sections were deparaffinized, rehydrated using
serial ethanol dilutions and permeabilized with proteinase K (10
.mu.g/ml, 10 min at 37.degree. C.). Slides were exposed to 5'
biotinylated, fully 2'-oxymethylated AChE-R or AChE-S-specific
50-mer cRNA probes complementary to human ACHE pseudointron 4 or
exon 6, respectively (Microsynth, Belgach, Switzerland). The
following probes were employed:
[0228] human AChE-R probe (nucleotide positions 88-38 in GenBank
Accession No. S 71129; SEQ ID NO:5): TABLE-US-00004
5'-CUAGGGGGAGAAGAGAGGGGUUACACUGGCGGGCUCCCACUCCCCUCC UC-3';
[0229] human AChE-S probe (nucleotide positions 2071-2022 in
GenBank Accession No. NM 000665; SEQ ID NO:6): TABLE-US-00005
5'-CCGGGGGACGUCGGGGUGGGGUGGGGAUGGGCAGAGUCUGGGGCUC GUCU-3'.
[0230] Hybridization was performed overnight at 52.degree. C. in
hybridization mixture containing 10 .mu.g/ml probe, 50 .mu.g/ml
yeast tRNA, 50 .mu.g/ml heparin and 50% formamide in 375 mM Na
chloride, 37.5 mM Na citrate, pH 4.5. Slides were washed to remove
unhybridized probe, blocked with 1% skim milk containing 0.01%
Tween-20 and 2 mM levamisol, an alkaline phosphatase inhibitor used
to suppress non-specific staining and incubated with
streptavidin-alkaline phosphatase (Amersham Pharmacia, Little
Chalfont Bucks, UK). Fast Red.TM. substrate (Roche Diagnostics,
Mannheim, Germany) was used for detection.
[0231] Immunohistochemistry: Re-hydrated spinal cord sections were
subjected to heat-induced antigen retrieval by microwave treatment
in 0.01 M citrate buffer, pH 6.0. Non-specific binding was blocked
by 4% naive goat or donkey serum in PBS with 0.3% Triton X-100 and
0.05% Tween20.TM.. Slides were incubated with primary antibodies
diluted in the same buffer (1 h, room temp., overnight, 4.degree.
C.). Sections were rinsed and incubated with biotin-conjugated
secondary antibody, diluted (1:200) in the same blocking buffer (3
h, room temp.). The primary antibodies included rabbit polyclonal
anti-VAChT (1:100, Sigma, St. Louis, Mo.), goat polyclonal
anti-ChAT (1:50, Chemicon International, Temecula, Calif.) and goat
anti-IL-1.beta. (1:20, R&D systems, Minneapolis, Minn.).
Biotinylated secondary antibodies were donkey anti-rabbit
(Chemicon) and donkey anti-goat (Jackson ImmunoResearch
Laboratories, West Grove, Pa.), both used at 1:200 dilutions.
Detection was with Fast Red.TM. substrate for anti-VAChT and ChAT
antibodies and with Vectastain ABC peroxidase kit (Vector
Laboratories, Burlingame, Calif.) for the anti-IL-1.beta.
antibody.
[0232] Confocal microscopy: was carried out using a Bio-Rad MRC
1024 confocal scanhead (Hemel Hempsted, Hertfordshire, U.K.)
coupled to an inverted Zeiss Axiovert 135 microscope (Oberkochen,
Germany) equipped with a Plan Apochromat 40.times.1.3 immersion
objective. Fast Red was excited at 488 nm and emission was measured
through a 580df32 interference filter (580.+-.16 nm). Immunolabeled
sections were scanned every 0.5 .mu.m and projections analyzed
using the Image Pro Plus 4.0 (Media Cybernetics, Silver Spring,
Md.) software.
[0233] Cholinesterase activity measurements: Plasma samples were
subjected to cholinesterase catalytic activity measurements
[Ellman, G. L. et al. (1961) Biochem. Pharmacol. 7, 88-99] adapted
to a multi-well plate reader. Acetylthiocholine (ATCh) hydrolysis
rates were measured following prior incubation for 30 min with
5.times.10.sup.-5M of the specific butyrylcholinesterase (BuChE)
inhibitor tetraisopropylpyrophosphoramide, iso-OMPA. Total plasma
cholinesterase activities were measured in the absence of
inhibitors.
Experimental Procedures Employed in Studying the Relationship
Between AChE-R, Cytokines and Memory
[0234] Subjects of the memory study: Ten male subjects participated
in the study, which was approved by an independent ethics
committee. Subjects recruitment as well as physical and psychiatric
screening, were described in detail elsewhere [Reichenberg A. et
al. (2001) id ibid.]. The current study involved a subset of the
subjects included in the previous project, with serum AChE and
working memory tests added. Interviews by experienced psychiatrists
excluded the presence and the history of any axis I psychiatric
disorder according to the DSM-IV [American Psychiatric Association
(1994) Diagnostic and statistical manual for mental disorders, 4th
ed. Washington D.C.]. Only subjects who successfully passed the
screening procedure, and signed an informed consent form, were
considered eligible to participate. Comprehensive assessment was
performed, and involved each subject going through a number of
physical and neuropsychological tests in a clinical research unit
using a balanced, randomized, double-blind, cross-over design.
[0235] Procedure for the memory tests: All technical equipment,
including the blood sampling device, was housed in a room adjacent
to the sound-shielded experimental room. Every subject passed two
10 days apart testing sessions and spent the night before each
experimental session in the research unit. A battery of
neuropsychological tests, assessing memory, learning, and attention
was given for adaptation upon their first arrival in the evening,
minimizing subsequent practice effects [McCaffrey, R. J. and Lynch,
J. K. (1992) Neuropsychol. Rev. 3:235-48]. Alternate versions of
these tests were used in the experimental testing sessions. In the
next morning, an intravenous cannula was inserted into an
antecubital forearm vein for intermittent blood sampling and
intravenous (i.v.) injection of endotoxin (0.8 ng Salmonella
abortus equi endotoxin per Kg body weight) in one session or the
same volume of 0.9% NaCl (saline) solution on the other occasion
(placebo). The order of injections was balanced, so that half of
the subjects received the saline injection and half received the
endotoxin injection first. No significant differences were found
between the groups defined by the treatment order in either age,
years of education, or body weight. The experimenter and the
subject were blind with respect to the group assignment. During
each session, subjects were tested three times, at 1-2, 3-4 and
9-10 hr post-injection. Blood was collected at baseline before i.v.
injection, and at the beginning of each testing period. Rectal
temperature was measured continuously using a thermistor probe.
Self-reported physical sickness symptoms (headaches, muscle pain,
shivering, nausea, breathing difficulties, and fatigue) were
assessed at the end of each testing period, by a questionnaire
using a 5-point Leikart scale (0--no symptoms, 4--very severe
symptoms).
[0236] Salmonella abortus equi endotoxin: Prepared for use in
humans, this endotoxin was available as a sterile solution free of
proteins and nucleic acids. The endotoxin preparation employed has
proven to be safe in various studies of other groups [Burrell R.
(1994) id ibid.] and in studies at the Max Planck Institute of
Psychiatry, including more than 100 subjects since 1991 [Pollmacher
T. et al., (1996) J. Infect. Dis. 174:1040-5].
[0237] Plasma levels of AChE and its degradation product, cytokines
and cortisol: Blood was collected in tubes containing Na-EDTA and
aprotinin and was immediately centrifuged. Plasma was aliquoted and
frozen to -80.degree. C. AChE catalytic activity was measured as
the capacity for acetylthiocholine (ATCh) hydrolysis in the
presence of 1.times.10.sup.-5 M tetraisopropylpyrophosphoramidate
(iso-OMPA), a selective inhibitor of serum butyrylcholinesterase,
BChE [Soreq H. and Glick D. (2000): Novel roles for cholinesterases
in stress and inhibitor responses. In: Giacobini E. (ed.)
Cholinesterases and Cholinesterase Inhibitors: Basic, Preclinical
and Clinical Aspects. London, Martin Dunitz, pp 47-61].
Endotoxin-induced differences were calculated by subtracting
activities in the absence of endotoxin, with each individual
serving as its own control and daily hour carefully matched. To
evaluate AChE-R concentrations and integrity, plasma proteins (40
.mu.g) were subjected to 4-20% polyacrylamide gel electrophoresis
under fully denaturing conditions (BioRad Laboratories, Hercules,
Calif.), blotted to nitrocellulose filters, incubated with rabbit
anti-AChE-R antibodies [Sternfeld M. et al. (2000) Proc. Natl.
Acad. Sci. USA 97:8647-8652] and peroxidase-conjugated anti-rabbit
immunoglobulins, and subjected to ECL.TM. detection (Amersham
Pharmacia Biotech, UK), densitometric analysis and quantification
as described [Shohami (2000) id ibid.]. The plasma levels of
cortisol were determined by a radioimmunoassay, and the plasma
levels of cytokines and soluble cytokine receptors were assessed by
commercial enzyme-linked immunoabsorbent assays [Mullington J. et
al. (2000) Am. J. Physiol. Regul. Integr. Comp. Physiol.
278:R947-55]. Labeling AChE-R mRNA and its protein product in
vascular endothelial cells: Fluorescent in situ hybridization and
immunohistochemistry of AChE-R mRNA and AChE-R protein were
performed and quantified as reported [Cohen (2002) id ibid.; Perry,
C. et al. (2002) Oncogene 21:8428-8441] using paraffin-embedded
tissue sections from surgically-removed biopsies of patients with
or without clinical inflammation due to non-specific kidney
vasculitis or following kidney rejection.
[0238] MALDI-TOF-MS analysis of immunolabeled proteins:
Matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (MALDI-TOF-MS) was employed in an attempt to identify
the protein and peptide bands labeled by anti-AChE-R antibodies in
blotted membranes. Proteolytic degradation of the gel-eluted
peptide was performed using the endoprotease LysC from
Achromobacterlyticus (Wako Chemicals, Inc., USA) at a substrate to
enzyme ratio of 200:1. Digestion was carried out overnight in 0.05M
Tris HCl, pH 9.0, in the presence of 4M urea, at 30.degree. C.
[0239] Neuropsychological assessment: Declarative memory was
assessed using the Story Recall test [Green P. and Allen L. M.
(1995): Manual for the CogniSyst Story Recall test CogniSyst Inc.,
Durham, N.C.]. Subjects were requested to repeat a 25-item story
from memory immediately, and 30 min after presentation. The total
number of correct verbatim recall was counted. Memory span and
working memory were assessed using the Digit Span forward &
backward [Wechsler D. (1987): Wechsler Memory Scale, Revised Manual
The Psychological Corp, San Antonio, Tex.]. Subjects were requested
to repeat lists of digits with increased number of digits every two
lists either in the correct order of presentation (forward
condition--assessment of span), or in a reversed order (backward
condition--assessment of working memory). The number of lists
correctly repeated was counted. Attention was assessed using the
Ruff 2&7 cancellation test [Ruff R. M. and Allen C. C. (1996):
Ruff 2&7 Selective Attention Test: Professional Manual.
Psychological Assessment Resources Inc., Lutz, Fla.]: Subjects were
instructed to mark either the digit 2 or the digit 7, which are
randomly placed either between letters or between digits. The
numbers of correct responses in a 5 minute trial were counted.
[0240] Statistical analyses: The main hypotheses concerning
treatment effects on AChE activity, AChE-R levels, and
neuropsychological performance were tested using repeated measure
analysis of variance models (ANOVAs). Repeated measure ANOVAs were
also used to examine the treatment effect on physical sickness
symptoms, on plasma levels of cytokines and cortisol and on body
temperature. The level of significance was set at the critical
value of p=0.05 (two tailed). Whenever significant
treatment-by-time interactions were found, the simple effects were
analyzed as suggested [Winer B. et al. (1991): Statistical
Principles in Experimental Design, 3rd ed. McGraw-Hill, New York],
and Tukey's adjustments were applied.
[0241] To assess the associations between changes from the placebo
to the endotoxin condition in AChE activity, AChE-R levels, and
physiological (cytokines and cortisol secretion), and
neuropsychological parameters, Pearson's correlation coefficients
were calculated.
[0242] No deviation from normal distributions was evident for any
of the dependent variables. No univariate outliers were found using
Z-scores and no multivariate outliers were found using the
Mahalanobis distance [Tabachnick B. G. and Fidell L. S. (2001)
Using Multivariate Statistics, 4th ed. Allyn and Bacon, Boston,
Mass.]. To adjust for any non-homogeneity of covariance for the
within-subject effects, we used p values that were adjusted using
the Huynh-Feldt method [Norusis M. J. (1994) SPSS advanced
statistics 6.1. SPSS Inc., Chicago, Ill.]. Analyses were carried
out using SPSS 10.
[0243] Linear rank Wilcoxon test for two related samples was used
for the analysis of AChE-R- and IL-1.beta.-positive fractions of
analyzed neurons, measured on at least 4 sections from each group.
Differences were considered significant when a p value of
.about.0.05 or less was obtained using the SAS 8.0 software.
Student's t test was used for analyzing the numbers and volume of
VAChT-containing terminals in spinal cord sections.
Experimental Procedures Employed with the GBS Model
[0244] Pre-treatment, sensitization and LPS exposure: Systemic
Campylobacter or E. Coli LPS exposure was done as previously
described [Ifergane G. et al., (2003) J. Neurol. Sci. 213: 11-14]:
Female 8-week-old Lewis rats were sensitized with 100 g KLH by
subcutaneous (s.c.) injections administered to the base of tail on
days 1 and 21 followed by intraperitoneal injection of 15 microgram
Cj 0:19 or E. Coli 055:B5 LPS on day 28. In vitro LPS exposure:
Lewis rats were similarly sensitized with KLH. On day 28, the rats
were sacrificed, their spleens removed and disintegrated into cell
suspension. The cells were suspended in RPMI-1640 medium containing
antibiotics and glutamine. Following centrifugation, the pellet was
resuspended in RPMI, layered on Histopaque and centrifuged again.
The lymphocyte fraction was collected, washed and supplemented with
fetal calf serum and diluted to a concentration of
1.4.times.10.sup.7 cells/ml. Splenocytes reacted with LPS
additionally contained 0.5 .mu.g/ml Cj-LPS. Following incubation
for 48 hour at 37.degree. C. with 5% CO2, the cell suspension was
centrifuged and supernatant medium collected and stored at
-20.degree. C. until use.
[0245] Bone-marrow derived macrophages (BMM): Rat femur marrow
content was obtained as described elsewhere [Apte, R. N., and
Keisari, Y. (1987) Immunobiology 175: 470-481], dispersed into RPMI
1640 medium, washed, supplemented with serum and L-cell conditioned
medium as a source of a colony stimulating factor and cultured at
37.degree. C. 5% CO.sup.2. After 7 days a macrophage monolayer was
harvested.
[0246] Intraneural injection: Female 8-week-old Lewis rats were
anesthetized by intraperitoneal injection of 10% solution of
chloralhydrate (0.3-1 ml). The sciatic nerves exposed at the
mid-thigh through a skin incision from the sciatic notch to the
popliteal fossa. Tested mediums or solutions, 10 .mu.l each, were
intraneurally injected to separate sciatic nerves, via hand held
Hamilton microsyringe with a 301/2 gauge needle under a dissection
microscope.
[0247] Electrophysiological assessment was done as we previously
described [Ifergane (2003) id ibid.]: Nerve conduction was
performed prior to, 10 minutes, 1, 2, 3, 4 and 7 days following
intraneural injection under general anesthesia by chloralhydrate
solution of (0.3-1 ml) at room temperature. The sciatic nerve was
supramaximally stimulated at the sciatic notch, and the peroneal
and posterior tibial nerves at the ankle via needle electrodes.
Compound muscle action potentials (CMAP) was recorded from the
intrinsic foot muscles (both extensor digitorum brevis and flexor
digitorum brevis). CMAPs, their baseline to peak amplitude, latency
and duration were measured and the proximal and distal amplitudes
ratio (PDR) calculated for each nerve. A PDR of less than 0.5 was
considered a conduction block.
[0248] Tissue preparations: For western blot analysis, 7 .mu.m of
the sciatic nerve including the injection site were removed under
general anesthesia as described, quickly frozen in liquid nitrogen,
and stored at -70.degree. C. For morphological analysis, the nerve
segments were immersed in 4% paraformaldehyde in PBS (48 hrs,
4.degree. C.), embedded in paraffin and sectioned at 8 .mu.m in the
axial or longitudinal planes.
[0249] In situ hybridization and immunohistochemistry. As
previously reported [Dori A. et al., (2005) Cereb Cortex 15(4):
419-30], sections were deparaffinized, rehydrated and boiled in a
microwave (750 W, 15 min) in 0.01M citric buffer (pH 6.0).
Cy5-conjugated streptavidin and Cy3-conjugated anti-digoxygenin
will be employed for detection of AChE-R mRNA specific biotin- and
AChE-S mRNA specific digoxygenin-labeled probes, respectively. Cy3-
or biotin-conjugated secondary IgG reacted with avidin-bound
peroxidase-complex (ABC Elite, Vector Laboratories) will be applied
for detection of primary antibodies by confocal or light microscopy
following peroxidase reaction, respectively. Selected sections will
be counterstained with Gill-2 hematoxyllin.
[0250] Image analysis: Confocal microscopy and Scion Image software
(Scion Corporation, Frederick, Md.) will be applied as described
[Dori (2005) id ibid.].
[0251] Immunoblots: Nerve homogenates were produced by grounding
with a pestle and mortar and processed as we previously described
[Dori (2005) id ibid.].
[0252] Catalytic activity Acetylthiocholine hydrolysis will be
measured spectrophotometrically as described [Kaufer (1998) id
ibid.], using Iso-OMPA (tetraisopropylpyrophosphoramide) to block
butyrylcholinesterase activity (5-10-5 M).
[0253] Statistical analysis: ANOVA (Statistica software, StatSoft,
Tulsa, Okla.) will be used to compare multiple groups and
one-tailed t-test (Microsoft Excel) to compare two groups.
Example 1
Treatment-Reduced VAChT and ChAT Labeling in Spinal Cord
Motoneurons
[0254] VAChT was predictably concentrated in cholinergic (C)
terminals surrounding motoneurons [Weihe (1996) id ibid.], where it
loads neural vesicles with ACh. Confocal microscopy projections of
spinal cord motoneurons (cell diameter=40 .mu.m) from
hEN101-treated monkeys as compared with the naive state showed
small but significant dose-independent decreases (p<0.01,
Student's t test) in the average number of VAChT-positive
C-terminals per cell (FIG. 1A, 1B), suggesting a handling stress
effect on loading C-terminals with ACh. VACh-T-labeled C-terminals
were significantly smaller (<60 .mu.m.sup.3) under p.o.
administration of 150 .mu.g/kg/day as compared to control sections
(FIGS. 1B and 1C, p<0.01, Student's t test), perhaps reflecting
changes in VAChT translocation into vesicles and/or VAChT
stability.
[0255] VAChT production is largely co-regulated with that of ChAT
[Usdin, T. B. et al. (1995) Trends Neurosci. 18, 218-224], since
both are produced from one gene complex (the so called "cholinergic
locus") [Erickson, J. D. et al. (1996) Prog. Brain Res. 109,
69-82]. ChAT staining of C-terminals on motoneurons indeed
presented similar changes to those observed for VAChT staining
(data not shown). In addition, anti-ChAT antibodies labeled in
control sections several partition cells (FIG. 1D), from which
cholinergic terminals emerge to motoneurons [Barber, R. P. et al.
(1984) J. Comp. Neurol. 229, 329-346]. Lumbar spinal cord sections
from hEN101-treated monkeys, regardless of the dose or mode of
administration, revealed conspicuously decreased staining intensity
of ChAT-positive partition cells (FIG. 1E), again indicating
handling stress-related suppression of ACh production and slowdown
of vesicle recycling.
Example 2
[0256] EN101 Prevention of Stress-Induced Increases in Plasma AChE
Activity
[0257] Cholinesterase activities were measured in plasma samples
taken during the second day of hEN101 administration. ATCh
hydrolysis in plasma is largely due to serum BuChE, the primary
serum cholinesterase encoded by a non-homologous mRNA which
remained generally unchanged. However, plasma also includes a
minor, but significant AChE activity [Zakut, H. et al. (1998)
Cancer 61, 727-737], measurable following pre-incubation in the
presence of 5.times.10.sup.-5M of the BuChE-specific inhibitor,
iso-OMPA. AChE activity increased, as compared with the values
before treatment (pre-dose), within the 5 hr following the
stressful oral gavage administration of 150 .mu.g/kg EN101 (Table
1), potentially reflecting increased production under handling.
This further indicates a short half life for primate AChE-R mRNA in
vivo, compatible with previous findings [Chan (1991) id ibid;
Brenner et al. (2003) id ibid.]. Increases were effectively
suppressed by the higher oral dose of 500 .mu.g/kg EN101, and yet
more so following i.v. of administration of 500 .mu.g/kg EN101
(Table 1), possibly reflecting dose-dependent hEN101 prevention of
AChE-R synthesis. TABLE-US-00006 TABLE 1 hEN101-induced prevention
of treatment-associated increases in plasma AChE activity.sup.1
hEN101 dose (.mu.g/kg) Mode of hr post- 150 500 500 administration
treatment p.o. p.o. i.v. Total ChE activity 0 100 .+-. 1 100 .+-. 2
100 .+-. 1 (% of pre-treatment.sup.2) 3 92 .+-. 9 105 .+-. 1 89
.+-. 2 6 102 .+-. 3 96 .+-. 2 94 .+-. 1 12 98 .+-. 2 96 .+-. 1 93
.+-. 1 AChE activity 0 100 .+-. 4 100 .+-. 6 100 .+-. 4 (% of
pre-treatment.sup.3) 3 117 .+-. 2 114 .+-. 6 105 .+-. 4 6 135 .+-.
1 100 .+-. 5 89 .+-. 5 12 123 .+-. 3 112 .+-. 4 94 .+-. 3
.sup.1Percent changes in the ATCh hydrolysis rates in plasma
samples from monkeys treated twice on 2 consecutive days with the
noted amounts and administration routes of hEN101. .sup.2In the
absence of inhibitors, hydrolysis rates reflect activity of the
abundant cholinesterase in plasma, BChE. .sup.3AChE specific
activity, measured in the presence of 5 .times. 10.sup.-5 M of the
specific BChE inhibitor, iso-OMPA. Values represent average .+-.
SEM from six measurements in plasma samples derived from 2 monkeys.
Mean AChE and BChE absolute activity.
Example 3
EN101 Effects on AChE-R and ACHE-S mRNAs in Monkey Spinal Cord
Neurons
[0258] Paraffin-embedded sections of lumbar spinal cord from
Cynomolgus monkeys treated for 7 days once daily with hEN101 were
subjected to high resolution fluorescent in situ hybridization
(FISH). Variant-specific FISH probes (FIG. 2A) revealed AChE-S more
than AChE-R mRNA labeling in numerous punctuate areas and
longitudinal threads, possibly cross-sections and longitudinal
sections through neuronal processes (FIG. 2B-2C). This difference,
albeit statistically non-significant was compatible with previous
observations demonstrating AChE-S, but not AChE-R mRNA in murine
neuronal processes under normal conditions [Meshorer (2002) id
ibid.]. The higher oral and i.v. dose yielded reduced AChE-R mRNA
labeling (FIGS. 2G and 2I as compared with the lower dose, FIG.
2E). AChE-S mRNA-labeled neurons displayed limited EN101-induced
suppression (FIG. 2H, 2J as compared to 2D), with reduced process
labeling (FIGS. 2F, 2H and 2J). Positron Emission Tomography (PET)
imaging studies in Rhesus monkeys demonstrated for 2'-O-methylated
oligonucleotides limited, yet relatively efficient penetrance to
the brain as compared with phosphorothioate agents [Tavitian et al.
(1998) id ibid.]. In addition, the blood-brain-barrier of primates
may be more easily penetrated than that of rodents [Tomkins et al.
(2001) Cell Mol. Neurobiol. 21: 675-91]. Nevertheless, this is the
first demonstration of an organismal antisense response that
affects primate CNS neurons.
[0259] At the same nanomolar dose as that of the corresponding
agents in mice [Cohen (2002) id ibid.], and rats [Brenner (2003) id
ibid.], delivery of human EN101 appeared in Cynomolgus monkeys to
be effective in both the intravenous and the oral administration
mode, as it did in rats [Brenner (2003) id ibid.]. Albeit in a
limited number of animals, dose dependence was reflected by the
more pronounced effects under 500 as compared to 150 .mu.g/kg/day
of orally administrated hEN101.
Example 4
Antisense Destruction of AChE-R mRNA is Inversely Related to
Perikaryon Size
[0260] Similarly sized neurons in hematoxylin-eosin stained spinal
cord sections (FIG. 3A) were sorted into three size groups
according to their cell body diameter (FIG. 3B): motoneurons (=40
.mu.m, 20-35% of total counted neurons, localized to motor nuclei
in the ventral horn and intermediate zone), medium-sized neurons
(20-40 .mu.m, about 60%, dispersed throughout the spinal cord,
mainly in the ventral horn and intermediate zone), and small
neurons (10-20 .mu.m, 5-20%, located primarily in the dorsal horn).
AChE-S and AChE-R mRNA labeled cell fractions from each group were
evaluated in adjacent sections of small and medium sized AChE-R
positive cells (<40 .mu.m diameter) by over 4-fold as compared
to the naive state (p=0.057 for small cells, Wilcoxon test).
AChE-R-positive smaller neuron fractions dropped significantly
under the higher hEN101 oral dose (p=0.033, Wilcoxon test),
compared to the 150 .mu.g/kg/day treatment, and even further under
its i.v. administration (p=0.015). Medium sized fractions dropped
significantly following i.v. 150 .mu.g/kg/day as compared to p.o.
administration of 150 .mu.g/kg/day (p=0.030). Reduced staining
intensity suggested a certain antisense effect in motoneurons, as
well, albeit with relatively limited efficacy. However, there was
no discernable reduction in the total fractions of labeled large
cell bodies by any treatment (p>0.100). This possibly reflects
distinct membrane and/or metabolic properties, different cell
volumes or a combined contribution of these properties. For AChE-S
mRNA, the number of large positive cell bodies remained unchanged,
whereas positive small and medium sized neurons, were reduced by
50% and 20%, respectively under either low or high dose of hEN101
as compared to naive. The apparent dose-independence of changes in
AChE-S mRNA is compatible with the hypothesis that these changes
were not antisense driven, but could possibly reflect the effect of
handling stress of shifting splicing from AChE-S to AChE-R [Kaufer
(1998) id ibid.].
Example 5
hEN101 Suppression of Neuronal Pro-Inflammatory Cytokines
[0261] Lumbar sections from hEN101-treated monkeys contained a
higher fraction of both large and medium-sized IL-1.beta. positive
cell bodies than naive sections, suggesting stress-induced
inflammatory response (FIG. 4A, p=0.051 and 0.034 respectively,
Wilcoxon test). Lower fractions of IL-1.beta. labeled cell bodies
were shown in sections from 500 .mu.g/kg/day hEN101-i.v. as
compared to 150 .mu.g/kg/day p.o. treated monkeys (FIG. 4A, p=0.067
for both size groups, Wilcoxon test). Association analysis
demonstrated a putative correlation between neuronal AChE-R and
IL-1.beta. levels in medium-sized, but nor large cells (FIG. 4B and
data not shown). IL-6 labeling as well was suppressed significantly
following i.v. administration of 500 .mu.g/kg hEN101 (FIG. 4C,
p=0.03 and 0.015 for medium and large neurons, respectively) as
compared to 500 .mu.g/kg-p.o.-treated monkeys.
Example 6
Endotoxin Induces Impairments in AChE-R Activity and Integrity
[0262] Endotoxin administration produced a time-dependent decrease
in plasma AChE activity, measured by quantifying the rate of ATCh
hydrolysis in the presence of the butyrylcholinesterase (BChE)
inhibitor iso-OMPA. This reduction displayed a significant
treatment-by-time interaction (FIG. 5A) [F(2,16)=3.94, p=0.04].
Saline administration (placebo) caused no change in AChE activity,
excluding the possibilities that it was induced by the injection
stress or by circadian influences. The decline in hydrolytic
activity could potentially reflect losses in the AChE protein. To
test this possibility, electrophoretically separated plasma
proteins were immune-reacted with antibodies selective for the
C-terminal peptide unique to AChE-R [Sternfeld et al., (2000) id
ibid.]. These antibodies labeled a 66 kd protein, likely to be
full-length AChE-R, as well as a shorter peptide with an apparent
size of 6.5 kD. A parallel labeling pattern in the serum of
stressed mice [Grisaru et al. (2001) id ibid.] raised the
suggestion that this was an immunopositive C-terminus cleavage
product of AChE-R. Endotoxin administration induced a slight, yet
persistent, increase in the AChE-R cleavage product (FIG. 5B, 5C).
This increase did not reach statistical significance [F(1,8)=2.32,
p=0.16, for treatment effect] (FIG. 5C). However, at 9 hr
post-treatment, the endotoxin-induced decrease in AChE activity was
significantly correlated with endotoxin-induced increase in AChE-R
cleavage (r=-0.65) (FIG. 5D).
Example 7
MALDI-TOF-MS Analysis of AChE-R Cleavage Product
[0263] To further characterize the AChE-R cleavage product, larger
plasma samples (180 .mu.g/lane) were resolved by electrophoresis.
Protein bands that co-migrated with the bands labeled with anti
AChE-R antibodies were cut out of the gel and subjected to
MALDI-TOF-MS analyses. The elution product of the larger band was
identified as being mainly composed of serum albumin (molecular
weight, 69367), compatible with the assumption that AChE-R is only
a minor component in this size fraction of human serum proteins.
The shorter peptide eluted from the excised band, however, revealed
a single peak with a molecular mass of 3613-3615. FIG. 6
demonstrates the MALDI-TOF-MS profile of this eluted peptide.
Peptide property calculations positioned the presumed proteolytic
cleavage site 36 residues from the C-terminus of AChE-R, with a
calculated mass of 3614. Under these assumptions, cleavage could
occur between asparagine and arginine residues upstream to the
AChE-R diversion site (FIG. 6).
[0264] Parallel size peptides were observed in gel-eluted products
from several individuals, demonstrating consistent cleavage
processes. LysC proteolysis failed to further shorten this peptide.
Edman degradation was unsuccessful, perhaps due to N-terminal
blockade, and further experiments were prevented because of lack of
material. The mass spectrometry approach thus pointed, although
inconclusively, at an AChE-R cleavage site in human plasma under
endotoxic stress near the C-terminal splice site that marks the
deviation between human AChE splice isoforms.
Example 8
Vascular Endothelial Cells Produce AChE-R
[0265] In search for the potential cell type origin of plasma
AChE-R, the inventors performed fluorescent in situ hybridization
(FISH) and immunohistochemistry on human tissues from patients with
or without inflammatory diseases (e.g. kidney vasculitis). Vascular
endothelial cells displayed labeling with both AChE-R cRNA and anti
AChE-R antibodies (FIG. 7A, 7B). Quantification of signal
intensities revealed considerable similarities between AChE-R mRNA
and AChE-R protein levels in patients with or without inflammatory
vasculitis, so that tissues with less pronounced mRNA labeling also
displayed fainter protein labeling (FIG. 7C). This pointed at
vascular endothelial cells, which also harbor non-neuronal
nicotinic acetylcholine receptors [Heeschen et al., (2002) J. Clin.
Invest. 110:527-36] as a probable site of continuous plasma AChE-R
production.
Example 9
AChE-R Cleavage is Associated with Cytokines Secretion
[0266] Endotoxin induced a transient, significant increase in the
plasma levels of cortisol, TNF-.alpha. and IL-6 (FIG. 8A-8C),
although at the employed dose it does not produce any significant
effects on the subjective rating of physical or behavioral sickness
symptoms [Reichenberg (2001) id ibid.]. The selective increase in
peripheral cytokine levels in the absence of subjective CNS effects
on cognitive or intellectual function, suggested that changes in
memory functions under these conditions would reflect objective
endotoxin-induced alterations. Cortisol levels increased during the
first and second testing periods, TNF-.alpha. and IL-6 peaked
during the first testing period and decreased thereafter and rectal
temperature (not shown) peaked during the second period. These
time-dependent effects were reflected by significant
treatment-by-time interactions [F(2,16)=41.2, 10.6, 10.5, 3.2,
respectively, all p<0.05, by H-F].
[0267] At each testing period, correlation analysis enabled the
comparison between the biochemical and functional responses of
tested individuals. Thus, endotoxin-induced AChE-R cleavage
(computed as the change in a certain individual from the endotoxin
to the placebo condition) was significantly (p<0.05) and
positively correlated with the secretion of cortisol, during the
last testing period (r=0.70) (FIG. 8A). AChE-R cleavage was
significantly (p<0.01) and negatively correlated with the
secretion of TNF-.alpha. and IL-6 during the first (r=-0.72 and
-0.66, respectively) (FIG. 8B, 8C), but not later testing
periods.
Example 10
AChE-R Cleavage is Associated with Endotoxin-Induced Impairments in
Declarative Memory
[0268] Endotoxin administration decreased the performance in tests
of declarative memory during all testing periods. This was
reflected by decreased immediate recall of story items [F(1,8)=6.5,
p=0.03] (FIG. 9A) and reduced delayed story recall [F(1,8)=3.5,
p=0.09] (data not shown). Endotoxin-induced decrease in immediate
and delayed recall of story items was significantly (p<0.05) and
negatively associated with TNF-.alpha. and IL-6 secretion (r=-0.59
to -0.67) during the first, but not during other testing periods
(data not shown), suggesting the potential involvement of
additional mechanism(s) in endotoxin-induced impairments in
declarative memory. At the last testing period, the
endotoxin-induced decrease in immediate recall of story items was
significantly (p<0.05) and negatively (r=-0.63) associated with
AChE-R cleavage (FIG. 9B), indicating that the consequent increase
in ACh levels, perhaps in conjunction with continuously suppressed
cytokine production, interferes with declarative memory. This
notion was supported by the positive (r=0.68) association of
declarative memory impairments with the decrease in AChE activity
during the last testing period (FIG. 9C), when cytokine levels
already receded, but not during earlier testing periods.
Example 11
AChE-R Cleavage Association with Improved Working Memory
[0269] Endotoxin administration induced a significant improvement
in working memory performance, reflected by an increased score in
the digit span backward test during all testing periods
[F(1,8)=12.3, p=0.008] (FIG. 10A). No significant changes in the
digit span forward test (assessing memory span) or on the attention
test (Ruff 2&7 cancellation test) were evident (data not
shown), emphasizing the selectivity of the observed
differences.
[0270] The endotoxin-induced improvement in working memory
performance showed no significant association with the secretion of
TNF-.alpha., IL-6 or cortisol, yet was negatively associated with
AChE-R cleavage. Association was significant (p<0.05) during the
second and third testing periods (r=-0.84 and -0.64, respectively)
(FIG. 10B and data not shown). Thus, subjects with a greater
endotoxin-induced elevation in AChE-R cleavage (and, presumably,
larger increases in ACh levels) showed both lower endotoxin-induced
improvement in working memory functioning, and greater
endotoxin-induced impairment in declarative memory.
Example 12
AChE-S Transgenic Mice Display Elevated Body Temperature
[0271] Fever is one of the consequences of higher levels of
circulating pro-inflammatory cytokines. In order to verify whether
the constitutive expression of human synaptic AChE (hAChE-S) [Beeri
et al. (1995) id ibid.] and the consequent over-expression of
murine AChE-R [Cohen et al., (2002) id ibid.] influenced the
release of pro-inflammatory cytokines in the animal, the inventors
measured body temperature. Five transgenic FVB/N hAChE-S and
mAChE-R overexpressing females, 3-5 months old, had their
temperature measured between 5 and 55 minutes after anesthesia,
which was administered in order to induce a change in body
temperature. As shown in the graph (FIG. 12A-B), body temperature
decreased with post-treatment time. Interestingly, the average body
temperature of the transgenic mice was always 2.degree. C. higher
than in the control mice. This suggests that their inherited
cholinergic imbalance impaired their control over body temperature.
These finding are compatible with the inventors' previous report of
impaired hypothermic response of these transgenic mice to the
administration of paraoxon [Beeri et al., (1995) id ibid.].
Example 13
Effects of Tacrine on LPS-Induced IL-1 Secretion in the Hippocampus
and IL-1 and TNF-.alpha. Secretion in the Serum
[0272] Male C57 mice were injected (i.p.) with either saline or
tacrine (1.5 mg/kg), immediately followed by an injection of either
saline or LPS (1.0 mg/kg) (n=5 animals per group). Two hours later,
mice were deeply anesthetized with 24 .mu.g Nembutal per mouse,
blood was taken by heart puncture and the hippocampus was excised
and placed in tubes containing 500 .mu.l of RPMI+100 KIU aprotinin.
The levels of IL-1.beta. in the hippocampus (FIG. 13A) and
IL-1.beta. (FIG. 13B) and TNF-.alpha. (FIG. 13C) in the serum were
assessed with commercial ELISA kits (R&D Systems). LPS induced
a significant increase in the hippocampal and serum IL-1.beta.,
which was significantly attenuated in tacrine-treated mice. In
contrast, tacrine produced a small and non-significant attenuation
of LPS-induced TNF-.alpha. secretion in the serum.
Example 14
Effects of Rivastigmine on LPS-Induced IL-1 Secretion in the
Hippocampus and IL-1 and TNF-.alpha. Secretion in the Serum
[0273] Male C57 mice were injected (i.p.) with either saline or one
of three doses of rivastigmine (0.5, 1.5 and 3.0 mg/kg),
immediately followed by an injection of either saline or LPS (1.0
mg/kg) (n=5 animals per group). Two hours later, mice were deeply
anesthetized with 24 .mu.g Nembutal per mouse, blood was taken by
heart puncture and the hippocampus was excised and placed in tubes
containing 500 .mu.l of RPMI+100 KIU aprotinin. The levels of
IL-1.beta., and TNF-.alpha. were assessed with commercial ELISA
kits (R&D Systems). LPS induced a significant increase in the
hippocampal IL-1.beta., which was significantly attenuated only by
the high dose of rivastigmine (FIG. 14A). LPS-induced IL-1.beta.
secretion within the blood was dose-dependently suppressed by the
1.5 and 3.0 mg/kg doses of rivastigmine (FIG. 14B). LPS-induced
TNF-.alpha. secretion in the blood was not affected by rivastigmine
treatment, even at a high dose (FIG. 14C).
Example 15
Cytokines as Mediators of Emotional and Cognitive Effects of Stress
Caused by Surgery
[0274] Several lines of evidence indicate that stress influences a
variety of cognitive functions, including memory. In particular,
exposure to stress was found to impair declarative memory, while
leaving procedural memory intact. It is also well known that stress
influences many immune functions, including the production and
secretion of cytokines. Following exposure to various stressors,
there is an increase in peripheral IL-6, as well as IL-1.beta. and
TNF.alpha., accompanied by decrease in IL-2, in both humans and
experimental animals.
[0275] The study was designed to examine the role of cytokines in
mediating the affective and cognitive effects of stress. Two types
of stressful situations were investigated in the same subjects:
Psychological stress--while waiting for a surgery (i.e., in the
morning of the surgery day), and surgical stress--in the day after
surgery.
[0276] Twenty generally healthy volunteers were administered with a
comprehensive neuropsychological test battery, assessing emotional
and cognitive parameters, before and after a minor surgery
(Laparoscopic Cholecystectomy or Hernia). Each subject was tested
in three occasions: (a) Several days before surgery (baseline)=t0,
(b) In the morning of the surgery day=t1, (c) A day after
surgery=t2. Blood samples were collected in each session, and serum
levels of cytokines (IL-1.beta., IL-6) were measured. Fifteen
control subjects went through the same procedure.
[0277] In the morning of the surgery day, there was a significant
increase in the levels of both anxiety (STAI) (FIG. 15A) and
depression (DACL) (FIG. 15B) (F(2,82)=3.871, p<0.025 and
F(2,82)=11.189, p<0.0001, respectively). No change was found in
the levels of fatigue and pain (FIGS. 15C and 15D, respectively).
In the morning following surgery there was further increase in
depression, but not in anxiety, alongside a significant increase in
pain and fatigue (F(2,80)=24.588, p<0.0001 and F(2,80)=10.148,
p<0.0001, respectively).
[0278] With regards to the cognitive parameters (FIG. 15E-15H), in
the morning of the surgery day tests showed a significant decline
in performance of the word list recall task (HVLT) (F(2,70)=4.120,
p<0.021). In the morning following surgery, an additional
decline was found in the word list recall as well as in the
performance of a visual memory task involving a complex figure
reconstruction (MCG) (F(2,70)=3.973, p<0.023).
[0279] For each parameter (psychological performance, cytokine
level, etc) differences were computed between each stressful
situation (t1, t2) and baseline (t0). Pearson correlations were
computed between cytokines levels and psychological variables (FIG.
16A-C).
[0280] In the morning of the surgery day (t1), there was a
significant correlation between increased levels of IL-1.beta. and
the elevation in depressed mood (r=0.525) (FIG. 16b).
[0281] In the morning following the surgery (t2), there were
significant correlations between increased IL-1 levels and impaired
immediate and delayed Logical memory (story recall test) (r=-0.627
and -0.532, respectively). Significant correlations were obtained
between increased IL-6 levels and improved delayed recall in the
Word List Recall (HVLT) test (r=0.386), as well as improved
immediate and delayed Complex Figure recall test (MCG) (r=0.502 and
0.590, respectively). There was a significant increase in IL-6
(F(2,38)=29.114, p<0.0001) (FIG. 16C).
Example 16
Selective Elimination of AChE-R mRNA in the Brain of EN301-Treated
Mice
Experimental Procedure:
[0282] 3 month old FVB/N female mice were injected
intra-peritoneally daily with 500 .mu.g/kg of EN301 (n=7) or with
vehicle (PBS, n=6). EN301 corresponds to mEN101, defined herein as
SEQ ID NO:2. This antisense oligonucleotide is targeted to a
sequence within exon 2 of mouse AChE exon 2 sequence. EN301 was
produced by Microsynth, Switzerland, at relatively large quantities
for animal tests. The treatment persisted for 3 consecutive days,
and the mice were sacrificed on day 4. Brain was collected, flash
frozen in liquid nitrogen and stored at -70.degree. C.
[0283] Total RNA was extracted from the brain and RT-PCR reaction
was conducted using primers targeting the common sequence in Exon 2
of murine AChE cDNA or the unique sequence in Exon 6, specific to
the AChE-S variant. 5 .mu.l samples were removed from the 50 .mu.l
PCR reaction mixture at cycles 25, 31 and 35. Samples were run on a
1.5% Agarose gel. The results of the PCR specific for the exon 2
sequence, after 31 cycles, are shown in FIG. 17A. Photographs were
saved and fluorescence quantified using the PhotoShop software, and
the results expressed in histograms (FIGS. 17B-17C).
Results:
[0284] The goal of the present experiment was to test for reduction
in AChE gene expression under EN301 treatment, while ensuring that
AChE-S mRNA levels are maintained reflecting sustained cholinergic
neurotransmission.
[0285] Normalized to RNA quantities, EN301-treated brains showed a
significant 25% reduction (p=0.01, Student's T-Test) in the common
transcript levels (FIG. 17B), whereas the S variant showed a
non-significant 17% increase (FIG. 17C), reflecting a relatively
larger fraction of AChE-S mRNA out of the total content of mRNA as
compared with the untreated brain.
[0286] The ratio between AChE-S:common (S/Com) transcripts showed
that in the EN301-treated brain, the S/Com ratio is significantly
increased (from 0.65 to 0.98). RT-PCR data cannot be used as such
for comparing the absolute quantities of the analyzed transcripts,
because different primer pairs may function with different
efficacies. However, that these two tests point at the same
direction (namely, that AChE-R but not AChE-S mRNA was reduced in
the EN301-treated brains and that the relative concentration of
AChE-S mRNA increased, albeit insignificantly, under treatment)
supports the notion that this agent affects brain gene expression
as well.
[0287] The present results lead to the conclusion that EN301
treatment causes selective destruction of AChE-R mRNA in the EN301
treated brains while maintaining essentially unmodified AChE-S
levels. Note that to exert such an effect, EN301 does not
necessarily have to cross the blood-brain barrier. Rather, by
reducing the levels of peripheral AChE it would increase
acetylcholine levels, suppressing the production by macrophages of
pro-inflammatory cytokines e.g. IL-1 [Wang, H. et al. (2003) Nature
421, 384-8]. Because IL-1 promotes AChE gene expression [Li et al.
(2000) J. Neurosci. 20, 149-155], and since the peripheral
pro-inflammatory cytokines are known to affect the brain [Pick et
al. (2004) Annals NY Acad. Sci. 1018, 85-98], such an effect will
eventually reduce AChE-R levels in the brain as well.
Example 17
Animal Model for Guillain-Barre Syndrome and
Inflammation-Associated Neuropathy
[0288] Intra-neural injection into a rat peripheral nerve is often
used to study Guillain-Barre Syndrome GBS, testing the pathogenesis
of the disease following nerve sheath impairment, i.e., examining
the effect of intra-neural invasion of reactive soluble factors,
and not the nerve sheath disruption per se. Indeed, serum obtained
from GBS patients was reported to cause demyelination and
conduction blocks [Harrison B. et al., (1984) Ann. Neurol. 15:
163-170; Saida T. et al. (1982) Ann. Neurol. 11: 69-75], which are
not elicited by intra-neural injection of anti-GM1 IgG or IgM
[Harvey G. et al. (1995) Muscle Nerve 18: 388-394].
[0289] The inventors previously employed an animal model for GBS to
test the effect of systemic exposure to Cj-LPS on the sciatic nerve
[Ifergane (2003) id ibid.] Following pre-sensitization with the
immune responses activator--keyhole limpet hemocyanin (KLH), rats
were systemically exposed to Cj-O:19 LPS via intraperitoneal (i.p.)
injection. Parallel to LPS exposure, minor focal sciatic nerve
trauma was applied by intraneural (i.n.) injection of saline (FIG.
18A).
[0290] Compound muscle action potential (CMAP) stimulated proximal
to the neural injection site appeared lower than distally
stimulated CMAP (referred as reduced proximal to distal ratio; PDR,
see FIG. 18B,18C). This indicates nerve conduction blocks (when
PDR<0.5) which developed in rats that received an i.n. injection
of saline concomitantly with the systemic Cj-LPS exposure.
Conduction blocks appeared 1-3 days after the LPS exposure and
spontaneously resolved after 8 days. Conduction blocks did not
develop in rats which were systemically exposed to Cj-LPS without
an intraneural injection, and neither in rats which were injected
intraneurally directly with the Cj-LPS itself Conduction blocks
developed in 3 out of 10 intraneurally injected rats which were not
exposed to Cj-LPS and in none of the animals which were
intraneurally injected 8 days after Cj-LPS exposure. The
differences between the test and control groups were statistically
significant (P<0.01). Morphological analysis of the injected
nerves revealed no morphological abnormalities (i.e. demyelination,
axonal degeneration or inflammatory changes) on days 3 and 9
following i.n. injection, in either group. The fact that direct
Cj-LPS i.n. injection did not result in conduction abnormality,
suggests a non-direct mechanism, in which the Cj-LPS stimulates
systemic production of a factor that causes conduction block in the
peripheral nerves that it penetrates. Furthermore, similar results
were observed in rats treated with E. Coli LPS. All the animals
which were concomitantly treated by i.p. E. Coli LPS and i.n.
saline, developed conduction blocks on one day following injection
(average PDR=0.417, S.D. 0.06), which resolved in the following 2
days. This indicates that a systemic reaction common to both gram
negative bacilli LPS induces a neural reaction if soluble factors
penetrate through the nerve sheath.
[0291] To test this hypothesis, splenocytes from KLH pre-sensitized
rats were exposed to Cj-LPS in a cell suspension for 48 hours. The
medium of splenocytes which reacted with LPS in vitro (reactive
splenocyte medium) was then injected intraneurally to the sciatic
nerve of rats. This reactive medium was cell-free and devoid of IgG
or IgM, and did not elicit any electrophysiological effect within
10 minutes following injection, indicating that it did not contain
neuroinhibitory or toxic substances reminiscent of curare or
tetrodotoxine which typically block ion channels within minutes.
Nevertheless, one to 4 days following i.n. injection, CMAP
stimulated proximal to the injection site was reduced in more than
70% of nerves, indicating a conduction block. Normal splenocyte
medium (not reacted with LPS) induced a conduction block in only
6.2% of nerves which was significantly different (p<0.01).
Conduction block duration was 1.44.+-.1.02 days with resolution in
70% of the nerves. In this case as well, morphological analysis
demonstrated no demyelination, axonal degeneration or inflammatory
abnormalities, indicating that the electrophysiological pathology
was not due to gross neural deformity, or myelin sheath and axonal
degeneration. These results strengthen the hypothesis that an
immune reaction to Cj-LPS similar to E. Coli LPS, produces a
soluble factor which induces functional conduction abnormalities
within penetrated nerves while the neural structures are yet
preserved.
Example 18
Treatment with EN101 Inhibits Conduction Blocks
[0292] The inventors tested the participation of AChE-R in the
sequence of events that follow exposure to LPS and lead to
conduction abnormalities in the GBS model described above. Indeed,
systemic (i.p.) treatment with EN101 (0.5 mg/kg) prevented
formation of conduction blocks when applied with Cj-LPS parallel to
i.n. saline injection. Treatment with EN101 significantly improved
PDR (proximal to distal amplitude ratio, p<0.01), which became
similar to non-i.n. injected controls (p=0.45; FIG. 19A).
Furthermore, addition of EN101 (20 pmole) to i.n. injections of
Cj-LPS reactive splenocyte medium prevented the appearance of nerve
conduction block and reduction in PDR compared to control group
injected with LPS-reacted splenocyte medium alone (P<0.05; FIG.
19B). Additionally, to simulate macrophage intra-neural invasion as
detected in GBS, bone marrow-derived cultured macrophages were
intra-neurally injected. These cells induced conduction blocks
which initiated 1 day following injection, with resolution after
7.+-.1 days. Concomitant i.n. EN101 injection abolished the
appearance of conduction blocks or reduction in PDR (p<0.01;
FIG. 19C). Furthermore, addition of EN101 by i.p. injection at the
time of conduction block in non-EN101 treated injected nerves on
day 1, increased PDR on the following day compared to animals that
did not receive i.p. EN101 (t-test p<0.05). The direct causal
effect of AChE-R on nerve conduction was examined by i.n. injection
of synthetic ARP (1.4 nmole) to the sciatic nerve of adult naive
rats. This treatment produced a transient nerve conduction block,
which initiated 24 hrs following injection and lasted 48 hrs (FIG.
19D). Injection of AChE-Synaptic peptide (ASP; 1.4 nmole) as a
negative control did not produce a conduction block, indicating the
specificity of ARP for conduction blockade (p<0.05).
[0293] In a recent study, mild stress was shown to induce AChE-R in
the hippocampus, and to interact intraneuronally with a scaffold
protein RACK1 and through it, with its target, protein kinase
C.beta.II (PKC.beta.II), in a manner suppressible by antisense
prevention of AChE-R accumulation [Birikh (2003) id ibid.; Nijholt,
I. et al., (2004) Molecular Psychiatry 9: 174-183]. In agreement
with this, the inventors identified that LPS-reacted splenocyte
medium i.n. injection increased PKC.beta.II levels in sciatic nerve
by immunoblot analysis, which was suppressed by EN101 treatment
(FIG. 20). These results further support the hypothesis that AChE-R
plays a key role in induction of functional nerve conduction blocks
following immune activation by LPS exposure or i.n. invasion of
macrophages, as evidenced in GBS, and strongly suggest that ARP is
the active modulator in these processes. Nevertheless, AChE-R
induction is not restricted to reaction to the Campylobacter type
of LPS. Furthermore, the formation of nerve conduction block by
direct i.n. injection of ARP indicates that AChE-R and ARP may
affect nerve conduction in response to various inflammatory
responses, where nerve sheath/blood nerve barrier is injured or
disrupted, as exemplified in GBS. Hence, EN101 treatment to treat
nerve conduction pathology is applicable for conditions that
similarly induce AChE-R when concurrent nerve sheath disruption is
present.
Sequence CWU 1
1
7 1 20 DNA Artificial sequence Antisense oligonucleotide hEN101
targets human AChE 1 ctgccacgtt ctcctgcacc 20 2 20 DNA Artificial
sequence Antisense oligonucleotide mEN101 (EN301), targets mouse
AChE 2 ctgcaatatt ttcttgcacc 20 3 20 DNA Artificial sequence
Antisense oligonucleotide rEN101, targets rat AChE 3 ctgccatatt
ttcttgtacc 20 4 20 DNA Homo sapiens 4 gggagaggag gaggaagagg 20 5 50
RNA Homo sapiens 5 cuagggggag aagagagggg uuacacuggc gggcucccac
uccccuccuc 50 6 50 RNA Homo sapiens 6 ccgggggacg ucgggguggg
guggggaugg gcagagucug gggcucgucu 50 7 20 DNA Artificial sequence
Antisense oligonucleotide hEN101, with the 3 terminal residues
modified 7 ctgccacgtt ctcctgcacc 20
* * * * *