U.S. patent application number 10/798025 was filed with the patent office on 2006-03-30 for method of producing a dna library using positional amplification.
Invention is credited to John P. Langmore, Vladimir L. Makarov.
Application Number | 20060068394 10/798025 |
Document ID | / |
Family ID | 22764963 |
Filed Date | 2006-03-30 |
United States Patent
Application |
20060068394 |
Kind Code |
A1 |
Langmore; John P. ; et
al. |
March 30, 2006 |
Method of producing a DNA library using positional
amplification
Abstract
The disclosed invention relates to general and specific methods
to use the Primer Extension/Nick Translation (PENT) reaction to
create an amplifiable DNA strand, called a PENTAmer. A PENTAmers
can be made for the purpose of amplifying a controlled length of
DNA located at a controlled position within a DNA molecule, a
process referred to as Positional Amplification by Nick Translation
(PANT). In contrast to PCR, which amplifies DNA between two
specific sequences, PANT can amplify DNA between two specific
positions. PENTAmers can be created to amplify-very large regions
of DNA (up to 500,000 bp) as random mixtures (unordered positional
libraries), or as molecules sorted according to position (ordered
positional libraries). PANT is fast and economical, because
PENTAmer preparation can be multiplexed. A single PENTAmer
preparation can include very complex mixtures of DNA such as
hundreds of large-insert clones, complete genomes, or cDNA
libraries. Subsequent PCR amplification of the preparation using a
single specific primer can positionally amplify contiguous regions
along a specific clone, along a specific genomic region, or along a
specific expressed sequence.
Inventors: |
Langmore; John P.; (Ann
Arbor, MI) ; Makarov; Vladimir L.; (Ann Arbor,
MI) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI, LLP
1301 MCKINNEY
SUITE 5100
HOUSTON
TX
77010-3095
US
|
Family ID: |
22764963 |
Appl. No.: |
10/798025 |
Filed: |
March 11, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09860738 |
May 18, 2001 |
6828098 |
|
|
10798025 |
Mar 11, 2004 |
|
|
|
60206095 |
May 20, 2000 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6844 20130101;
C12N 15/1096 20130101; C12Q 1/6855 20130101; C12Q 2525/155
20130101; C12Q 2521/101 20130101; C12Q 2533/101 20130101; C12Q
2521/319 20130101; C12Q 2525/191 20130101; C12Q 2521/319 20130101;
C12Q 2531/113 20130101; C12Q 2521/319 20130101; C12Q 1/6855
20130101; C12N 15/1093 20130101; C12Q 1/6844 20130101; C12Q 1/6844
20130101; C40B 40/00 20130101; C12N 15/10 20130101; C12P 19/34
20130101; C12Q 2533/101 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C40B 40/08 20060101
C40B040/08; C12Q 1/68 20060101 C12Q001/68; C12P 19/34 20060101
C12P019/34 |
Goverment Interests
[0002] The government owns rights in the present invention pursuant
to grant number MCB 9514196 from the National Science Foundation.
Claims
1-189. (canceled)
190. A kit comprising amplifiable DNA, wherein said DNA is prepared
by the method comprising: a) obtaining a DNA sample comprising DNA
molecules having regions to be amplified; b) attaching upstream
adaptor molecules to ends of DNA molecules of the sample to provide
a nick translation initiation site; c) subjecting the DNA molecules
to nick translation comprising DNA polymerization and 5'-3'
exonuclease activity to produce nick translate molecules; and d)
attaching downstream adaptor molecules to the nick translate
molecules to produce adaptor attached nick translate molecules.
191. The kit of claim 190, wherein said DNA is genomic DNA.
192. The kit of claim 191, wherein said genomic DNA is isolated
from a prokaryote.
193. The kit of claim 191, wherein said genomic DNA is isolated
from a eukaryltic eukaryote.
194. The kit of claim 191, wherein said genomic DNA is isolated
from an animal.
195. The kit of claim 194, wherein said animal is selected from the
group consisting of human, feline, canine, bovine, equine, porcine,
caprine, murine, lupine, ranine, piscine and simian
196. The kit of claim 191, wherein said genomic DNA is isolated
from a plant.
197. The kit of claim 196, wherein said plant is a dicotyledonous
plant.
198. The kit of claim 197, wherein said dicotyledonous plant is
selected from the group consisting of tobacco, tomato, potato,
sugar beet, pea, carrot, cauliflower, broccoli, soybean, canola,
sunflower, alfalfa, cotton and Arabidopsis.
199. The kit of claim 195, wherein said DNA is isolated from a
monocotyledonous plant.
200. The kit of claim 199, wherein said monocotyledonous plant is
selected from the group consisting of wheat, maize, rye, rice,
turfgrass, oat, barley, sorghum, millet, and sugarcane.
201-272. (canceled)
Description
[0001] This application claims priority to the U.S. Provisional
Application Serial No. 60/206,095 filed May 20, 2000.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates generally to the fields of
molecular biology and biochemistry. Specifically, it concerns means
for the construction of DNA libraries facilitating amplifying and
analyzing DNA. More specifically, the present invention concerns
positional amplification of DNA by nick translation methods.
[0005] 2. Description of Related Art
A. DNA Preparation Using in vivo and in vitro Amplification and
Multiplexed Versions Thereof
[0006] Because the amount of any specific DNA molecule that can be
isolated from even a large number of cells is usually very small,
the only practical methods to prepare enough DNA molecules for most
applications involve amplification of specific DNA molecules in
vivo or in vitro. There are basically six general methods important
for manipulating DNA for analysis: 1) in vivo cloning of unique
fragments of DNA; 2) in vitro amplification of unique fragments of
DNA; 3) in vivo cloning of random libraries (mixtures) of DNA
fragments; 4) in vitro preparation of random libraries of DNA
fragments; 5) in vivo cloning of ordered libraries of DNA; and 6)
in vitro preparation of ordered libraries of DNA. The beneficial
effect of amplifying mixtures of DNA is that it facilitates
analysis of large pieces of DNA (e.g., chromosomes) by creating
libraries of molecule that are small enough to be analyzed by
existing techniques. For example the largest molecule that can be
subjected to DNA sequencing methods is less than 2000 bases long,
which is many orders of magnitude shorter than single chromosomes
of organisms. Although short molecules can be analyzed,
considerable effort is required to assemble the information from
the analysis of the short molecules into a description of the
larger piece of DNA.
[0007] 1. In vivo Cloning of Unique DNA
[0008] Unique-sequence source DNA molecules can be amplified by
separating them from other molecules (e.g., by electrophoresis),
ligating them into an autonomously replicating genetic element
(e.g., a bacterial plasmid), transfecting a host cell with the
recombinant genetic element, and growing a clone of a single
transfected host cell to produce many copies of the genetic element
having the insert with the same unique sequence as the source DNA
(Sambrook, et al., 1989).
[0009] 2. In vitro Amplification of Unique DNA
[0010] There are many methods designed to amplify DNA in vitro.
Usually these methods are used to prepare unique DNA molecules from
a complex mixture, e.g., genomic DNA or an artificial chromosome.
Alternatively, a restricted set of molecules can be prepared as a
library that represents a subset of sequences in the complex
mixture. These amplification methods include PCR, rolling circle
amplification, and strand displacement (Walker, et al. 1996a;
Walker, et al. 1996b; U.S. Pat. Nos. 5,648,213; 6,124,120).
[0011] The polymerase chain reaction (PCR) can be used to amplify
specific regions of DNA between two known sequences (U.S. Pat. Nos.
4,683,195, 4,683,202; Frohman et al., 1995). PCR involves the
repetition of a cycle consisting of denaturation of the source
(template) DNA, hybridization of two oligonucleotide primers to
known sequences flanking the region to the amplified, primer
extension using a DNA polymerase to synthesize strands
complementary to the DNA region located between the two primer
sites. Because the products of one cycle of amplification serve as
source DNA for succeeding cycles, the amplification is exponential.
PCR can synthesize large numbers of specific molecules quickly and
inexpensively.
[0012] The major disadvantages of the PCR method to amplify DNA are
that 1) information about two flanking sequences must be known in
order to specify the sequences of the primers; 2) synthesis of
primers is expensive; 3) the level of amplification achieved
depends strongly on the primer sequences, source DNA sequence, and
the molecular weight of the amplified DNA; and 4) the length of
amplified DNA is usually limited to less than 5 kb, although
"long-distance" PCR (Cheng, 1994) allows molecules as long as 20 kb
to be amplified.
[0013] "One-sided PCR" techniques are able to amplify unknown DNA
adjacent to one known sequence. These techniques can be divided
into 4 categories: a) ligation-mediated PCR, facilitated by
addition of a universal adaptor sequence to a terminus usually
created by digestion with a restriction endonuclease; b) universal
primer-mediated PCR, facilitated by a primer extension reaction
initiated at arbitrary sites c) terminal transferase-mediated PCR,
facilitated by addition of a homonucleotide "tail" to the 3' end of
DNA fragments; and d) inverse PCR, facilitated by circularization
of the template molecules. These techniques can be used to amplify
successive regions along a large DNA template in a process
sometimes called "chromosome walking."
[0014] Ligation-mediated PCR is practiced in many forms. Rosenthal
et al. (1990) outlined the basic process of amplifying an unknown
region of DNA immediately adjacent to a known sequence located near
the end of a restriction fragment. Reiley et al. (1990) used
primers that were not exactly complementary with the adaptors in
order to suppress amplification of molecules that did not have a
specific priming site. Jones (1993) and Siebert (1995; U.S. Pat.
No. 5,565,340.) used long universal primers that formed intrastrand
"panhandle" structures that suppressed PCR of molecules having two
universal adaptors. Arnold (1994) used "vectorette" primers having
unpaired central regions to increase the specificity of one-sided
PCR. Macrae and Brenner (1994) amplified short inserts from a Fugu
genomic clone library using nested primers from a specific sequence
and from vector sequences. Lin et al. (1995) ligated an adaptor to
restriction fragment ends that had an overhanging 5' end and
employed hot-start PCR with a single universal anchor primer and
nested specific-site primers to specifically amplify human
sequences. Liao et al. (1997) used two specific site primers and 2
universal adaptors, one of which had a blocked 3' end to reduce
non-specific background, to amplify zebrafish promotors. Devon et
al. (1995) used "splinkerette-vectorette" adaptors with special
secondary structure in order to decrease non-specific amplification
of molecules with two universal sequences during ligation-mediated
PCR. Padegimas and Reichert (1998) used phosphorothioate-blocked
oligonucleotides and exoIII digestion to remove the unligated and
partially ligated molecules from the reactions before performing
PCR, in order to increase the specificity of amplification of maize
sequences. Zhang and Gurr (2000) used ligation-mediated hot-start
PCR of restriction fragments using nested primers in order to
amplify up to 6 kb of a fungal genome. The large amplicons were
subsequently directly sequenced using primer extension.
[0015] To increase the specificity of ligation-mediated PCR
products, many methods have been used to "index" the amplification
process by selection for specific sequences adjacent to one or both
termini (e.g., Smith, 1992; Unrau, 1994; Guilfoyle, 1997; U.S. Pat.
No. 5,508,169).
[0016] One-sided PCR can also be achieved by direct amplification
using a combination of unique and non-unique primers. Harrison et
al. (1997) performed one-sided PCR using a degenerate
oligonucleotide primer that was complementary to an unknown
sequence and three nested primers complementary to a known sequence
in order to sequence transgenes in mouse cells. U.S. Pat. No.
5,994,058 specifies using a unique PCR primer and a second,
partially degenerate PCR primer to achieve one-sided PCR. Weber et
al. (1998) used direct PCR of genomic DNA with nested primers from
a known sequence and 1-4 primers complementary to frequent
restriction sites. This technique does not require restriction
digestion and ligation of adaptors to the ends of restriction
fragments.
[0017] Terminal transferase can also be used in one-sided PCR.
Cormack and Somssich (1997) were able to amplify the termini of
genomic DNA fragments using a method called RAGE (rapid
amplification of genome ends) by a) restricting the genome with one
or more restriction enzymes; b) denaturing the restricted DNA; c)
providing a 3' polythymidine tail using terminal transferase; and
d) performing two rounds of PCR using nested primers complementary
to a known sequence as well as the adaptor. Rudi et al. (1999) used
terminal transferase to achieve chromosome walking in bacteria
using a method of one-sided PCR that is independent of restriction
digestion by a) denaturation of the template DNA; b) linear
amplification using a primer complementary to a known sequence; c)
addition of a poly C "tail" to the 3' end of the single-stranded
products of linear amplification using a reaction catalyzed by
terminal transferase; and d) PCR amplification of the products
using a second primer within the known sequence and a poly-G primer
complementary to the poly-C tail in the unknown region. The
products amplified by Rudi (1999) have a very broad size
distribution, probably caused by a broad distribution of lengths of
the linearly-amplified DNA molecules.
[0018] RNA polymerase can also be used to achieve one-sided
amplification of DNA. U.S. Pat. No. 6,027,913 shows how one-sided
PCR can be combined with transcription with RNA polymerase to
amplify and sequence regions of DNA with only one known sequence.
Inverse PCR (Ochman et al., 1988) is another method to amplify DNA
based on knowledge of a single DNA sequence. The template for
inverse PCR is a circular molecule of DNA created by a complete
restriction digestion, which contains a small region of known
sequence as well as adjacent regions of unknown sequence. The
oligonucleotide primers are oriented such that during PCR they give
rise to primer extention products that extend way from the known
sequence. This "inside-out" PCR results in linear DNA products with
known sequences at the termini.
[0019] The disadvantages of all "one-sided PCR" methods is that a)
the length of the products are restricted by the limitation of PCR
(normally about 2 kb, but with special reagents up to 50 kb); b)
whenever the products are single DNA molecules longer than 1 kb
they are too long to directly sequence; c) in ligation-mediated PCR
the amplicon lengths are very unpredictable due to random distances
between the universal priming site and the specific priming
site(s), resulting in some products that are sometimes too short to
walk significant distance, some which are preferentially amplified
due to small size, and some that are too long to amplify and
analyze; and d) in methods that use terminal transferase to add a
polynucleotide tail to the end of a primer extention product, there
is great heterogeneity in the length of the amplicons due to
sequence-dependent differences in the rate of primer extension.
[0020] Strand displacement amplification (Walker, et al. 1996a;
Walker, et al. 1996b; U.S. Pat. Nos. 5,648,213; 6,124,120) is a
method to amplify one of more termini of DNA fragments using an
isothermal strand displacement reaction. The method is initiated at
a nick near the terminus of a double-stranded DNA molecule, usually
generated by a restriction enzyme, followed by a polymerization
reaction by a DNA polymerase that is able to displace the strand
complementary to the template strand. Linear amplification of the
complementary strand is achieved by reusing the template multiple
times by nicking each product strand as it is synthesized. The
products are strands with 5' ends at a unique site and 3' ends that
are various distances from the 5' ends. The extent of the strand
displacement reaction is not controlled and therefore the lengths
of the product strands are not uniform. The polymerase used for
strand displacement amplification does not have a 5' exonuclease
activity.
[0021] Rolling circle amplification (U.S. Pat. No. 5,648,245) is a
method to increase the effectiveness of the strand displacement
reaction by using a circular template. The polymerase, which does
not have a 5' exonuclease activity, makes multiple copies of the
information on the circular template as it makes multiple
continuous cycles around the template. The length of the product is
very large--typically too large to be directly sequenced.
Additional amplification is achieved if a second strand
displacement primer is added to the reaction to used the first
strand displacement product as a template.
[0022] 3. In vivo Cloning of DNA of Random Libraries
[0023] Libraries are collections of small DNA molecules that
represent all parts of a larger DNA molecule or collection of DNA
molecules (Primrose, 1998; Cantor and Smith, 1999). Libraries can
be used for analytical and preparative purposes. Genomic clone
libraries are the collection of bacterial clones containing
fragments of genomic DNA. cDNA clone libraries are collections of
clones derived from the mRNA molecules in a tissue.
[0024] Cloning of non-specific DNA is commonly used to separate
and, amplify DNA for analysis. DNA from an entire genome, one
chromosome, a virus, or a bacterial plasmid is fragmented by a
suitable method (e.g., hydrodynamic shearing or digestion with
restriction enzymes), ligated into a special region of a bacterial
plasmid or other cloning vector, transfected into competent cells,
amplified as a part of a plasmid or chromosome during proliferation
of the cells, and harvested from the cell culture. Critical to the
specificity of this technique is the fact that the mixture of cells
carrying different DNA inserts can be diluted and aliquoted such
that some of the aliquots, whether on a surface or in a volume of
solution, contain a single transfected cell containing a unique
fragment of DNA. Proliferation of this single cell (in vivo
cloning) amplifies this unique fragment of DNA so that it can be
analyzed. This "shotgun" cloning method is used very frequently,
because: 1) it is inexpensive; 2) it produces very pure sequences
that are usually faithful copies of the source DNA; 3) it can be
used in conjunction with clone screening techniques to create an
unlimited amount of specific-sequence DNA; 4) it allows
simultaneous amplification of many different sequences; 5) it can
be used to amplify DNA as large as 1,000,000 bp long; and 6) the
cloned DNA can be directly used for sequencing and other
purposes.
[0025] a. Multiplex Cloning
[0026] Cloning is inexpensive, because many pieces of DNA can be
simultaneously transfected into host cells. The general term for
this process of mixing a number of different entities (e.g.,
electronic signals or molecules) is "multiplexing," and is a common
strategy for increasing the number of signals or molecules that can
be processed simultaneously and subsequently separated to recover
the information about the individual signals or molecules. In the
case of conventional cloning the recovery process involves diluting
the bacterial culture such that an aliquot contains a single
bacterium carrying a single plasmid, allowing the bacterium to
multiply to create many copies of the original plasmid, and
isolating the cloned DNA for further analysis.
[0027] The principle of multiplexing different molecules in the
same transfection experiment is critical to the economy of the
cloning method. However, after the transfection each clone must be
grown separately and the DNA isolated separately for analysis.
These steps, especially the DNA isolation step, are costly and time
consuming. Several attempts have been made to multiplex steps after
cloning, whereby hundreds of clones can be combined during the
steps of DNA isolation and analysis and the characteristics of the
individual DNA molecules recovered later. In one version of
multiplex cloning the DNA fragments are separated into a number of
pools (e.g., one hundred pools). Each pool is ligated into a
different vector, possessing a nucleic acid tag with a unique
sequence, and transfected into the bacteria. One clone from each
transfection pool is combined with one clone from each of the other
transfection pools in order to create a mixture of bacteria having
a mixture of inserted sequences, where each specific inserted
sequence is tagged with a unique vector sequence, and therefore can
be identified by hybridization to the nucleic acid tag. This
mixture of cloned DNA molecules can be subsequently separated and
subjected to any enzymatic, chemical, or physical processes for
analysis such as treatment with polymerase or size separation by
electrophoresis. The information about individual molecules can be
recovered by detection of the nucleic acid tag sequences by
hybridization, PCR amplification, or DNA sequencing. Church has
shown methods and compositions to use multiplex cloning to sequence
DNA molecules by pooling clones tagged with different labels during
the steps of DNA isolation, sequencing reactions, and
electrophoretic separation of denatured DNA strands (U.S. Pat. Nos.
4,942,124 and 5,149,625). The tags are added to the DNA as parts of
the vector DNA sequences. The tags used can be detected using
oligonucleotides labeled with radioactivity, fluorescent groups, or
volatile mass labels (Cantor and Smith, 1999; U.S. Pat. Nos.
4,942,124; 5,149,625; and 5,112,736; Richterich and Church,
(1993)). A later patent was directed to a technique whereby the tag
sequences are ligated to the DNA fragments before cloning using a
universal vector (U.S. Pat. No. 5,714,318). Another patent
specifies method whereby the tag sequences added before
transfection are amplified using PCR after electrophoretic
separation of the denatured DNA (PCT WO 98/15644).
[0028] b. Disadvantages
[0029] The disadvantage of preparing DNA by amplifying random
fragments of DNA is that considerable effort is necessary to
assemble the information within the short fragments into a
description of the original, source DNA molecule. Nevertheless,
amplified short DNA fragments are commonly used for many
applications, including sequencing by the technique called "shotgun
sequencing." Shotgun sequencing involves sequencing one or both
ends of small DNA fragments that have been cloned from
randomly-fragmented large pieces of DNA. During the sequencing of
many such random fragments of DNA, overlapping sequences are
identified from those clones that by chance contain redundant
sequence information. As more and more fragments are sequenced more
overlaps can be found from contiguous regions (contigs), and the
regions that are not represented become smaller and less frequent.
However, even after sequencing enough fragments that the average
region has been sequenced 5-10 times, there will still be gaps
between contigs due to statistical sampling effects and to
systematic under-representation of some sequences during cloning or
PCR amplification (ref). Thus the disadvantage of sequencing random
fragments of DNA is that 1) a 5-10 fold excess of DNA must be
isolated, subjected to sequencing reactions, and analyzed before
having large contiguous sequenced regions; and 2) there are still
numerous gaps in the sequence that must be filled by expensive and
time-consuming steps.
[0030] 4. In vitro Preparation of DNA as Random Libraries
[0031] DNA libraries can be formed in vitro and subjected to
various selection steps to recover information about specific
sequences. In vitro libraries are rarely used in genomics, because
the methods that exist for creating such libraries do not offer
advantages over cloned libraries. In particular, the methods used
to amplify the in vitro libraries are not able to amplify all the
DNA in an unbiased manner, because of the size and sequence
dependence of amplification efficiency. PCT WO 00/18960 describes
how different methods of DNA amplification can be used to create a
library of DNA molecules representing a specific subset of the
sequences within the genome for purposes of detecting genetic
polymorphisms. "Random-prime PCR" (U.S. Pat. Nos. 5,043,272;
5,487,985) "random-prime strand displacement" (U.S. Pat. No.
6,124,120) and "AFLP" (U.S. Pat. No. 6,045,994) are three examples
of methods to create libraries that represent subsets of complex
mixtures of DNA molecules.
[0032] Single-molecule PCR can be used to amplify individual
randomly-fragmented DNA molecules (Lukyanov et al., 1996). In one
method, the source DNA is first fragmented into molecules usually
less than 10,000 bp in size, ligated to adaptor oligonucleotides,
and extensively diluted and aliquoted into separate fractions such
that the fractions often contain only a single molecule. PCR
amplification of a fraction containing a single molecule creates a
very large number of molecules identical to one of the original
fragments. If the molecules are randomly fragmented, the amplified
fractions represent DNA from random positions within the source
DNA.
[0033] WO0015779A2 describes how a specific sequence can be
amplified from a library of circular molecules with random genomic
inserts using rolling circle amplification.
[0034] 5. Direct in vivo Cloning of Ordered Libraries of DNA
[0035] Directed cloning is a procedure to clone DNA from different
parts of a larger piece of DNA, usually for the purpose of
sequencing DNA from a different positions along the source DNA.
Methods to clone DNA with "nested deletions" have been used to make
"ordered libraries" of clones that have DNA starting at different
regions along a long piece of source DNA. In one version, one end
of the source DNA is digested with one or more exonuclease
activities to delete part of the sequence (McCombie et al., 1991;
U.S. Pat. No. 4,843,003). By controlling the extent of exonuclease
digestion, the average amount of the deletion can be controlled.
The DNA molecules are subsequently separated based on size and
cloned. By cloning molecules with different molecular weights, many
copies of identical DNA plasmids are produced that have inserts
ending at controlled positions within the source DNA. Transposon
insertion (Berg et al. 1994) is also used to clone different
regions of source DNA by facilitating priming or cleavage at random
positions in the plasmids. The size separation and recloning steps
make both of these methods labor intensive and slow. They are
generally limited to covering regions less than 10 kb in size and
cannot be used directly on genomic DNA but rather cloned DNA
molecules. No in vivo methods are known are known to directly
create ordered libraries of genomic DNA.
[0036] 6. Direct in vitro Preparation of Ordered Libraries of
DNA
[0037] Ordered libraries have not been frequently created in vitro.
Hagiwara (1996) used one-sided PCR to create an ordered library of
PCR products that was used to sequence about 14 kb of a cosmid. The
cosmids were first digested with multiple restriction enzymes,
followed by ligation of vectorette adaptors to the products, PCR
amplification of the products using primers complementary to a
unique sequence in the cosmid and to the adaptor, size separation
of the amplified DNA to establish the order of the restriction
sites, and sequencing of the ordered PCR products. Because the
non-uniform spacing of the restriction sites, 2 kb of the 16 kb
region were not sequenced. This method required substantial effort
to produce and order the PCR products for the job of sequencing
cloned DNA. No in vitro methods are known to directly create
ordered genomic libraries of DNA.
B. DNA Physical Mapping to Assemble Ordered Clones
[0038] Because of the great difficulty in direct production of
ordered DNA libraries, there is a need to reorganize libraries of
randomly cloned DNA molecules into ordered libraries where the
clones are arranged according to position in the genome (Primrose,
1998; Cantor and Smith, 1999). Some of the purposes for creating an
ordered library are 1) to compare overlapping clones to detect
defects (e.g., deletions) in some of the clones; 2) to decide which
clones should be used to determine the underlying DNA sequence with
the least redundancy in sequencing effort; 3) to localize genetic
features within the genome; 4) to access different regions of the
genome on the basis of their relationship to the genetic map or
proximity to another region; and 5) to compare the structure of the
genomes of different individuals and different species. There are
four basic methods for creating ordered libraries of clones: 1)
hybridization to determine sequence homology among different
clones; 2) fluorescent in situ hybridization (FISH); 3) restriction
analysis; and 4) STS mapping.
[0039] 1. Mapping by Hybridization
[0040] The first method usually involves hybridization of one clone
or other identifiable sequence to all other clones in a library.
Those clones that hybridize contain overlapping sequences. This
method is useful for locating clones that overlap a common site
(e.g., a specific gene) in the genome, but is too laborious to
create an ordered library of an entire genome. In addition many
organisms have large amounts of repetitive DNA that can give false
indications of overlap between two regions. The resolution of the
hybridization techniques is only as good as the distance between
known sequences of DNA.
[0041] 2. Mapping by FISH
[0042] The FISH method allows a particular sequence or limited set
of sequences to be localized along a chromosome by hybridization of
a fluorescently-labeled probe with a spread of intact chromosomes,
followed by light-microscopic localization of the fluorescence.
This technique is also only of use to locate a specific sequence or
small number of sequences, rather than to create a physical map of
the entire genome or an ordered library representing the entire
genome. The resolution of the light microscope limits the
resolution of FISH to about 1,000,000 bp. To map a single-copy
sequence, the FISH probe usually needs to be about 10,000 long.
[0043] 3. Mapping by Restriction Digestion
[0044] Mapping by restriction digestion is frequently used to
determine overlaps between clones, thereby allowing ordered
libraries of clones to be constructed. It involves assembly of a
number of large clones into a contiguous region (contig) by
analyzing the overlaps in the restriction patterns of related
clones. This method is insensitive to the presence of repetitive
DNA. The products of a complete or partial restriction digestion of
every clone are size separated by electrophoresis and the molecular
weights of the fragments analyzed by computer to find correlated
sequences in different clones. The information from the restriction
patterns produced by five or more restriction enzymes is usually
adequate to determine not only which clones overlap, but also the
extent of overlap and whether some of the clones have deletions,
additions, rearrangements, etc. Physical mapping of restriction
sites is a very tedious process, because of the very large numbers
of clones that have to be evaluated. For example, >300,000 BAC
clones of 100,000 bp length need to be analyzed to map the human
genome. Using conventional techniques mapping two restriction sites
would require at least 300,000 bacterial cultures and DNA
isolations, as well as 600,000 restriction digestions and size
separations.
[0045] 4. Mapping by STS Amplification
[0046] Sequence tagged sites are sequences, often from the 3'
untranslated portions of mRNA, that can be uniquely amplified in
the genome. High-throughput methods employing sophisticated
equipment have been devised to screen for the presence of tens of
thousands of STSs in tens of thousands of clones. Two clones
overlap to the extent that they share common STSs.
C. DNA Sequencing Reactions
[0047] DNA sequencing is the most important analytical tool for
understanding the genetic basis of living systems. The process
involves determining the positions of each of the four major
nucleotide bases, adenine (A), cytosine (C), guanine (G), and
thymine (T) along the DNA molecule(s) of an organism. Short
sequences of DNA are usually determined by creating a nested set of
DNA fragments that begin at a unique site and terminate at a
plurality of positions comprised of a specific base. The fragments
terminated at each of the four natural nucleic acid bases (A, T, G
and C) are then separated according to molecular size in order to
determine the positions of each of the four bases relative to the
unique site. The pattern of fragment lengths caused by strands that
terminate at a specific base is called a "sequencing ladder." The
interpretation of base positions as the result of one experiment on
a DNA molecule is called a "read." There are different methods of
creating and separating the nested sets of terminated DNA molecules
(Adams et al., 1994; Primrose, 1998; Cantor and Smith, 1999).
[0048] 1. Maxim-Gilbert Method
[0049] The Maxim-Gilbert method involves degrading DNA at a
specific base using chemical reagents. The DNA strands terminating
at a particular base are denatured and electrophoresed to determine
the positions of the particular base. The Maxim-Gilbert method
involves dangerous chemicals, and is time- and labor- intensive. It
is no longer used for most applications.
[0050] 2. Sanger Method
[0051] The Sanger sequencing method is currently the most popular
format for sequencing. It employs single-stranded DNA (ssDNA)
created using special viruses like M13 or by denaturing
double-stranded DNA (dsDNA). An oligonucleotide sequencing primer
is hybridized to a unique site of the ssDNA and a DNA polymerase is
used to synthesize a new strand complementary to the original
strand using all four deoxyribonucleotide triphosphates (dATP,
dCTP, dGTP, and dTTP) and small amounts of one or more
dideoxyribonucleotide triphosphates (ddATP, ddCTP, ddGTP, and/or
ddTTP), which cause termination of synthesis. The DNA is denatured
and electrophoresed into a "ladder" of bands representing the
distance of the termination site from the 5' end of the primer. If
only one ddNTP (e.g., ddGTP) is used only those molecules that end
with guanine will be detected in the ladder. By using ddNTPs with
four different labels all four ddNTPs can be incorporated in the
same polymerization reaction and the molecules ending with each of
the four bases can be separately detected after electrophoresis in
order to read the base sequence.
[0052] Sequencing DNA that is flanked by vector or PCR primer DNA
of known sequence, can undergo Sanger termination reactions
initiated from one end using a primer complementary to those known
sequences. These sequencing primers are inexpensive, because the
same primers can be used for DNA cloned into the same vector or PCR
amplified using primers with common terminal sequences.
Commonly-used electrophoretic techniques for separating the
dideoxyribonucleotide-terminated DNA molecules are limited to
resolving sequencing ladders shorter than 500-1000 bases. Therefore
only the first 500-1000 nucleic acid bases can be "read" by this or
any other method of sequencing the DNA. Sequencing DNA beyond the
first 500-1000 bases requires special techniques.
[0053] 3. Other Base-Specific Termination Methods
[0054] Other termination reactions have been proposed. One group of
proposals involves substituting thiolated or boronated base analogs
that resist exonuclease activity. After incorporation reactions
very similar to Sanger reactions a 3' to 5' exonuclease is used to
resect the synthesized strand to the point of the last base analog.
These methods have no substantial advantage over the Sanger
method.
[0055] Methods have been proposed to reduce the number of
electrophoretic separations required to sequence large amounts of
DNA. These include multiplex sequencing of large numbers of
different molecules on the same electrophoretic device, by
attaching unique tags to different molecules so that they can be
separately detected. Commonly, different fluorescent dyes are used
to multiplex up to 4 different types of DNA molecules in a single
electrophoretic lane or capillary (U.S. Pat. No. 4,942,124). Less
commonly, the DNA is tagged with large number of different nucleic
acid sequences during cloning or PCR amplification, and detected by
hybridization (U.S. Pat. No. 4,942,124) or by mass spectrometry
(U.S. Pat. No. 4,942,124).
[0056] In principle, the sequence of a short fragment can be read
by hybridizing different oligonucleotides with the unknown sequence
and deciphering the information to reconstruct the sequence. This
"sequencing by hybridization" is limited to fragments of DNA <50
bp in length. It is difficult to amplify such short pieces of DNA
for sequencing. However, even if sequencing many random 50 bp
pieces were possible, assembling the short, sometimes overlapping
sequences into the complete sequence of a large piece of DNA would
be impossible. The use of sequencing by hybridization is currently
limited to resequencing, that is testing the sequence of regions
that have already been sequenced.
D. Preparing DNA for Determining Long Sequences
[0057] Because it is currently very difficult to separate DNA
molecules longer than. 1000 bases with single-base resolution,
special methods have been devised to sequence DNA regions within
larger DNA molecules. The "primer walking" method initiates the
Sanger reaction at sequence-specific sites within long DNA.
However, most emphasis is on methods to amplify DNA in such a way
that one of the ends originates from a specific position within the
long DNA molecule.
[0058] 1. Primer Walking
[0059] Once part of a sequence has been determined (e.g., the
terminal 500 bases), a custom sequencing primer can be made that is
complementary to the known part of the sequence, and used to prime
a Sanger dideoxyribonucleotide termination reaction that extends
further into the unknown region of the DNA. This procedure is
called "primer walking." The requirement to synthesize a new
oligonucleotide every 400-1000 bp makes this method expensive. The
method is slow, because each step is done in series rather than in
parallel. In addition, each new primer has a significant failure
rate until optimum conditions are determined. Primer walking is
primarily used to fill gaps in the sequence that have not been read
after shotgun sequencing or to complete the sequencing of small DNA
fragments <5,000 bp in length. However, WO 00/60121 addresses
this problem using a single synthetic primer for PCR to genome walk
to unknown sequences from a known sequence. The 5'-blocked primer
anneals to the denatured template and is extended, followed by
coupling to the extended product of a 3'-blocked oligonucleotide of
known sequence, thereby creating a single stranded molecule having
had only a single region of known target DNA sequence. By
sequencing an amplified product from the extended product having
the coupled 3'-blocked oligonucleotide, the process can be applied
reiteratively to elucidate consecutive adjacent unknown
sequences.
[0060] 2. PCR Amplification
[0061] PCR can be used to amplify a specific region within a large
DNA molecule. Because the PCR primers must be complementary to the
DNA flanking the specific region, this method is usually used only
to prepare DNA to "resequence" a region of DNA.
[0062] 3. Nested Deletion and Transposon Insertion
[0063] As described above, cloning or PCR amplification of long DNA
with nested deletions brought about by nuclease cleavage or
transposon insertion enables ordered libraries of DNA to be
created. When exonuclease is used to progressively digest one end
of the DNA there is some control over the position of one end of
the molecule. However the exonuclease activity cannot be controlled
to give a narrow distribution in molecular weights, so typically
the exonuclease-treated DNA is separated by electrophoresis to
better select the position of the end of the DNA samples before
cloning. Because transposon insertion is nearly random, clones
containing inserted elements have to be screened before choosing
which clones have the insertion at a specific internal site. The
labor-intense steps of clone screening make these methods
impractical except for DNA less than about 10 kb long.
[0064] 4. Junction-Fragment DNA Probes for Preparing Ordered DNA
Clones
[0065] Collins and Weissman have proposed to use "junction-fragment
DNA probes and probe clusters" (U.S. Pat. No. 4,710,465) to
fractionate large regions of chromosomes into ordered libraries of
clones. That patent proposes to size fractionate genomic DNA
fragments after partial restriction digestion, circularize the
fragments in each size-fraction to form junctions between sequences
separated by different physical distances in the genome, and then
clone the junctions in each size fraction. By screening all the
clones derived from each size-fraction using a hybridization probe
from a known sequence, ordered libraries of clones could be created
having sequences located different distances from the known
sequence. Although this method-was designed to walk along megabase
distances along chromosomes, it was never put into practical use
because of the necessity to maintain and screen hundreds of
thousands of clones from each size fraction. In addition, cross
hybridization would be expected to yield a large fraction of false
positive clones.
[0066] 5. Shotgun Cloning
[0067] The only practical method for preparing DNA longer than 5-20
kb for sequencing is subcloning the source DNA as random fragments
small enough to be sequenced. The large source DNA molecule is
fragmented by sonication or hydrodynamic shearing, fractionated to
select the optimum fragment size, and then subcloned into a
bacterial plasmid or virus genome (Adams et al., 1994; Primrose,
1998; Cantor and Smith, 1999). The individual subclones can be
subjected to Sanger or other sequencing reactions in order to
determine sequences within the source DNA. If many overlapping
subclones are sequenced, the entire sequence for the large source
DNA can be determined. The advantages of shotgun cloning over the
other techniques are: 1) the fragments are small and uniform in
size so that they can be cloned with high efficiency independent of
sequence; 2) the fragments can be short enough that both strands
can be sequenced using the Sanger reaction; 3) transformation and
growth of many clones is rapid and inexpensive; and 4) clones are
very stable
E. Genomic Sequencing
[0068] Current techniques to sequence genomes (as well as any DNA
larger than about 5 kb) depend upon shotgun cloning of small random
fragments from the entire DNA. Bacteria and other very small
genomes can be directly shotgun cloned and sequenced. This is
called "pure shotgun sequencing." Larger genomes are usually first
cloned as large pieces and each clone is shotgun sequenced. This is
called "directed shotgun sequencing."
[0069] 1. Pure Shotgun Sequencing
[0070] Genomes up to several millions or billions of base pairs in
length can be randomly fragmented and subcloned as small fragments
(Adams et al., 1994; Primrose, 1998; Cantor and Smith, 1999).
However, in the process of fragmentation all information about the
relative positions of the fragment sequences in the native genome
is lost. This information can be recovered by sequencing with
5-10-fold redundancy (i.e., the number of bases sequenced in
different reactions add up to 5 to 10 times as many bases in the
genome) so as to generate sufficiently numerous overlaps between
the sequences of different fragments that a computer program can
assemble the sequences from the subclones into large contiguous
sequences (contigs). However, due to some regions being more
difficult to clone than others and due to incomplete statistical
sampling, there will still be some regions within the genome that
are not sequenced even after highly redundant sequencing. These
unknown regions are called "gaps." After assembly of the shotgun
sequences into contigs, the sequencing is "finished" by filling in
the gaps. Finishing must be done by additional sequencing of the
subclones, by primer walking beginning at the edge of a contig, or
by sequencing PCR products made using primers from the edges of
adjacent contigs.
[0071] There are several disadvantages to the pure shotgun
strategy: 1) as the size of the region to be sequenced increases,
the effort of assembling a contiguous sequence from shotgun reads
increases faster than N 1 nN, where N is the number of reads; 2)
repetitive DNA and sequencing errors can cause ambiguities in
sequence assembly; and 3) because subclones from the entire genome
are sequenced at the same time and significant redundancy of
sequencing is necessary to get contigs of moderate size, about 50%
of the sequencing has to be finished before the sequence accuracy
and the contig sizes are sufficient to get substantial information
about the genome. Focusing the sequencing effort on one region is
impossible.
[0072] 2. Directed Shotgun Sequencing
[0073] The directed shotgun strategy, adopted by the Human Genome
Project, reduces the difficulty of sequence assembly by limiting
the analysis to one large clone at a time. This "clone-by-clone"
approach requires four steps 1) large-insert cloning, comprised of
a) random fragmentation of the genome into segments 100,000-300,000
bp in size, b) cloning of the large segments, and c) isolation,
selection and mapping of the clones; 2) random fragmentation and
subcloning of each clone as thousands of short subclones; 3)
sequencing random subclones and assembly of the overlapping
sequences into contiguous regions; and 4) "finishing" the sequence
by filling the gaps between contiguous regions and resolving
inaccuracies. The positions of the sequences of the large clones
within the genome are determined by the mapping steps, and the
positions of the sequences of the subclones are determined by
redundant sequencing of the subclones and computer assembly of the
sequences of individual large clones. Substantial initial
investment of resources and time are required for the first two
steps before sequencing begins. This inhibits sequencing DNA from
different species or individuals. Sequencing random subclones is
highly inefficient, because significant gaps exist until the
subclones have been sequenced to about 7.times. redundancy.
Finishing requires "smart" workers and effort equivalent to an
additional .about.3.times. sequencing redundancy.
[0074] The directed shotgun sequencing method is more likely to
finish a large genome than is pure shotgun sequencing. For the
human genome, for example, the computer effort for directed shotgun
sequencing is more than 20 times less than that required for pure
shotgun sequencing.
[0075] There is an even greater need to simplify the sequencing and
finishing steps of genomic sequencing. In principle, this can be
done by creating ordered libraries of DNA, giving uniform (rather
than random) coverage, which would allow accurate sequencing with
only about 3 fold redundancy and eliminate the finishing phase of
projects. Current methods to produce ordered libraries are
impractical, because they can cover only short regions
(.about.5,000 bp) and are labor-intensive.
F. Resequencing of DNA
[0076] The presence of a known DNA sequence or variation of a known
sequence can be detected using a variety of techniques that are
more rapid and less expensive than de novo sequencing. These
"resequencing" techniques are important for health applications,
where determination of which allele or alleles are present has
prognostic and diagnostic value.
[0077] 1. Microarray Detection of Specific DNA Sequences
[0078] The DNA from an individual human or animal is amplified,
usually by PCR, labeled with a detectable tag, and hybridized to
spots of DNA with known sequences bound to a surface (Primrose,
1998; Cantor and Smith, 1999). If the individual's DNA contains
sequences that are complementary to those on one or more spots on
the DNA array, the tagged molecules are physically detected. If the
individual's amplified DNA is not complementary to the probe DNA in
a spot, the tagged molecules are not detected. Microarrays of
different design have different sensitivities to the amount of
tested DNA and the extact amount of sequence complementarity that
is required for a positive result. The advantage of the microarray
resequencing technique is that many regions of an individual's DNA
can be simultaneously amplified using multiplex PCR, and the
mixture of amplified genetic elements hybridized simultaneously to
a microarray having thousands of different probe spots, such that
variations at many different sites can be simultaneously
detected.
[0079] One disadvantage to using PCR to amplify the DNA is that
only one genetic element can be amplified in each reaction, unless
multiplex PCR is employed, in which case only as many as 10-50 loci
can be simultaneously amplified. For certain applications, such as
SNP (single nucleotide polymorphism) screening, it would be
advantageous to simultaneously amplify 1,000-100,000 elements and
detect the amplified sequences simultaneously. A second
disadvantage to PCR is that only a limited number of DNA bases can
be amplified from each element (usually <2000 bp). Many
applications require resequencing entire genes, which can be up to
200,000 bp in length.
[0080] 2. Other Methods of Resequencing
[0081] Other methods such as mass spectrometry, secondary structure
conformation polymorphism, ligation amplification, primer
extension, and target-dependent cleavage can be used to detect
sequence polymorphisms. All these methods either require initial
amplification of one or more specific genetic elements by PCR or
incorporate other forms of amplification that have the same
deficiencies of PCR, because they can amplify only a very limited
region of the genome at one time.
[0082] WO 00/28084 is directed to isothermal amplification of a
target nucleic acid sequence utilizing serial generation of
double-stranded DNA engineered to contain terminal nicking sites,
nicking at least one of those sites, and extending it by strand
displacement with a polymerase that lacks 5' to 3' exonuclease
activity. The nick is generated by restriction endonuclease
digestion of a site formed by hybridization of amplification
primers to a target nucleic acid, wherein the site is hemi-modified
through polymerization in the presence of modified nucleotides.
[0083] WO 99/18241 concerns methods for amplification of nucleic
acid sequences of interest utilizing multiple strand displacement
amplifications with two sets of multiple primers situated to
amplify the sequence of interest. Following hybridization of the
primers distally to the sequence of interest, amplification
proceeds by replication initiated at each primer and continuing
through the nucleic acid sequence of interest. In the course of
polymerization from the primers in a continuous isothermal
reaction, the intervening primers are displaced. Once the nucleic
acid strands elongated from the right set of primers reaches the
region of the nucleic acid molecule to which the left set of
primers hybridizes, and vice versa, another round of priming and
replication occurs, allowing multiple copies of a nested set of the
target nucleic acid sequence to be synthesized quickly. In specific
embodiments the methods concern amplification of whole genomes or
concatenated DNA.
[0084] WO 00/60121 regards amplification methods of unknown
sequences of interest using PCR genome walking with synthetic
primers. Specifically, a sequence which is 3' to a known sequence
is amplified. A 5' oligonucleotide blocked at its 5' end is
annealed to the known sequence in a denatured sample of DNA and
extended by polymerization. The strands of the resulting dsDNA
molecule are melted, and a 3' oligonucleotide blocked at its 3' end
is coupled to the polymerized strand. A primer complementary in
sequence to the 3'-blocked oligonucleotide is used to generate a
double-stranded template for subsequence cycles of PCR.
[0085] WO 00/24929 is directed to linear amplification mediated
PCR, whereby an unknown DNA or RNA sequence which is adjacent to a
known DNA or RNA region is identified and/or sequenced. The region
is first subjected to one or more linear PCR steps using one or
more primers, and a ds DNA molecule is generated from the resultant
ss DNA of the first step. The ds DNA is digested with restriction
enzymes to generate blunt and/or cohesive ends, and an
oligonucleotide of known sequence is added to the digested ends,
and the ds DNA is then subjected to propagation and detection.
[0086] U.S. Pat. No. 6,063,604 is directed to amplification of a
target nucleic acid sequence within a single- or double-stranded
polynucleotide, wherein the method comprises providing a reaction
mixture containing a 5' primer and a 3' primer each having a
recognition sequence for a restriction endonuclease capable of
nicking one strand of a double-stranded hemi-modified recognition
site. The 5' primer is first annealed to a single stranded target
sequence and extended in the presence of deoxyribonucleoside
triphosphates wherein at least one is modified. The resultant ds
DNA product having one original target strand and a modified
polynucleotide extension product is enzymatically separated, and a
second amplification primer anneals to the modified polynucleotide
extension product and is extended in the presence of
deoxyribonucleoside triphosphates wherein at least one is modified
to generate a double-stranded polynucleotide comprising the two
resultant modified polynucleotide extension products. The resultant
hemi-modified recognition sites are subjected to nicking of one
strand, and the 3! end produced by the nick is extended, preferably
with a polymerase which displaces the strand.
[0087] U.S. Pat. No. 6,117,634, incorporated by reference herein in
its entirety, regards sequencing whereby the nucleic acid molecule
to be sequenced is double stranded and undenatured, which is an
improvement for sequencing regions having intramolecular and/or
intermolecular secondary structure. In one embodiment, the double
strand is nicked and is followed by strand replacement. The nick is
generated by, for example, restriction digestion wherein only one
strand is hydrolyzed, random nicking by an enzyme such as DNAase I,
nicking by f1 gene product II or homologous enzymes from other
filamentous bacteriophage, or chemical nicking of the template
directed by triple-helix formation. Alternatively, the nick is
generated by adapters having a gap or nick generated by, for
example, restriction enzyme digestion. The polymerase preferably
has 5' to 3' exonuclease activity. However, the resultant
polymerized strand is the sequencing substrate, and no further
modifications or manipulations to the polymerized strand occur.
[0088] Similarly, U.S. Pat. No. 6,197,557 and Makarov et al. (1997)
regard methods to prepare a DNA molecule by ligating or hybridizing
an adaptor to the end of a template double-stranded DNA molecule,
thereby introducing a nick, following with nick translation using a
DNA polymerase having 5' to 3' exonuclease activity. The reaction
proceeds for a specific time and is then terminated. The resultant
product may be amplified through linear amplification, such as by
primer extension, or alternatively by PCR. However, this reference
fails to teach specific modifications or manipulations prior to the
amplification of the nick translation-extended strand to facilitate
the amplification.
SUMMARY OF THE INVENTION
[0089] The instant invention seeks to overcome the noted
deficiencies in the art by providing methods and compositions for
use in positionally amplifying a specific sequence within a
polynucleotide molecule. Positional Amplification by Nick
Translation (PANT) is designed to amplify internal regions of DNA
molecules, including restriction fragments, cloned DNA, and intact
chromosomes, as molecules of controllable length. Positional
Amplification of sequences near the terminus of a DNA molecule
involves three essential steps: 1) a Primer Extension/Nick
Translation (PENT) reaction; 2) appending a second primer sequence
to the 3' end of the PENT product, forming a PENT amplifiable
strand (PENTAmer); and 3) an amplification reaction using one or
both priming sequences. In contrast to PCR, which amplifies DNA
between two specific sequences, PANT can amplify DNA between two
specific positions, or a specified position relative to a specific
sequence. PENTAmers can be created to amplify very large regions of
DNA (up to 500,000 bp) as random mixtures (unordered positional
libraries) or as molecules sorted according to position (ordered
positional libraries). PANT is fast and economical, because
PENTAmer preparation can be multiplexed. A single PENTAmer
preparation can include very complex mixtures of DNA such as
hundreds of large-insert clones, complete genomes, or cDNA
libraries. Subsequent PCR amplification of the preparation using a
single specific primer can positionally amplify contiguous regions
along a specific clone, along a specific genomic region, or along a
specific expressed sequence. A schematic diagram of how locus
specific amplification of DNA can be achieved using PCR, cloning,
and three examples of positional amplification of nick-translate
libraries are shown in FIG. 1.
[0090] Positional Amplification at large distances from the
terminus of a DNA molecule also requires size separation and
recombination of the template DNA. This disclosure describes the
core technology for preparing PENTAmers, as well as specific
implementations that produce PENTAmers suitable for amplifying
short templates up to 10 kb long, and "recombinant" PENTAmers
(formed by recombination between internal and terminal sites on
templates) suitable for amplifying large-insert clones such as BACs
and up to 500 kb regions of genomic DNA. In both cases the
PENTAmers may be prepared in microwell plates, such that successive
wells contain PENTAmers from a large number (e.g. 96) successive
positions within the template. Novel reagents and methods are
disclosed for: 1) efficient initiation of PENT reactions at
specific sites using novel oligonucleotides; 2) termination of PENT
reactions at controllable distances from initiation; 3) novel
nick-processing reactions to append priming sequences to the 3'
ends of PENTAmers; 4) novel recombination reactions; 5) novel ways
to separate PENTAmers that are located different distances from a
DNA terminus; 6) novel ways to prepare hundreds or thousands of
PENTAmers simultaneously by multiplexing; 7) novel ways to make and
use libraries of PENTAmers; and 8) novel ways to analyze the
sequence information in genomes.
[0091] PANT allows the amplification of a specific position within
a large clone or genome as a PENTAmer of constant length, between
10 and 5,000 bp. The most important applications of PANT involve:
1) creation of mixtures of PENTAmers covering a large region of DNA
between 500 and 500,000 bp (an unordered positional library); 2)
creation of ordered mixtures of PENTAmers that cover successive
slightly overlapping regions along a large region of DNA between
500 and 500,000 bp (an ordered positional library); and 3) creation
of mixtures of PENTAmers that cover multiple small regions of DNA
dispersed throughout the genome (a sampled positional library).
Unordered libraries can be used for purposes such as creating FISH
probes and identifying cDNA clones complementary to specific
regions of the genome, as well as shotgun sequencing of cDNA,
large-insert clones and genomes. Ordered libraries can be used for
directed sequencing of cDNA, large-insert clone and genomes, as
well as for comparative genomics. Sampled libraries can be used to
sequence or resequence informative sequences spread throughout the
genome to identify point variations and rearrangements within one
genome, or to identify the presence of specific genomes or genetic
elements within a population of genomes. PANT can be commercialized
as services (e.g., sequence ready ordered PENTAmers for directed
sequencing of BACs in high-throughput sequencing centers), as kits
(e.g., kits to allow large and small laboratories to create ordered
positional libraries for sequence analysis of specific regions of
the human genome), or as diagnostic products (e.g., PENTAmer arrays
for hybridization analysis of patients' blood to determine
chromosomal mutations).
[0092] The following definitions are provided to assist in
understanding the nature of the invention:
[0093] Up-stream (terminus-attaching) adaptor molecules: short
artificial DNA molecules that are ligated to the ends of DNA
fragments. Their design has a minimum of two domains: 1) a domain
that facilitates ligation to the ends of template DNA molecules;
and 2) a domain that facilitates initiation of a nick-translation
reaction. In addition, up-stream adaptors may comprise additional
domains that facilitate manipulation of the DNA strand, including,
for example, recombination, amplification, detection, affinity
capture, and inhibition of self-ligation.
[0094] Down-stream (nick-attaching) adaptor molecules: partially
double-stranded or completely single-stranded DNA molecules that
can be linked to 3' or 5' DNA termini at a nick within
double-stranded DNA molecule. Their design has a minimum of two
domains: 1) a domain that facilitates ligation to the 3' or 5' DNA
termini within the nick or a domain that facilitates priming of the
polymerization reaction which results in the extension of the 3'
terminus near the nick; 2) a domain that facilitates amplification.
In addition, down-stream adaptors may comprise additional domains
that facilitate manipulation of the DNA strand, including, for
example, recombination, amplification, detection, affinity capture,
and inhibition of self-ligation. Internal adaptor molecules: Short
artificial DNA molecules that are ligated to the ends of
[0095] DNA fragments that have been exposed by a second cleavage
event, usually restriction endonuclease cleavage of an internal
site within the source DNA molecules. Their design has a minimum of
two domains: 1) a domain that facilitates ligation to the ends of
template DNA molecules, and 2) a domain that facilitates initiation
of a nick-translation reaction. In addition, internal adaptors may
comprise additional domains that facilitate manipulation of the DNA
strand, including, for example, recombination, amplification,
detection, affinity capture, and inhibition of self-ligation.
[0096] Nick translate molecules: DNA molecules produced by
coordinated 5' ->3' DNA polymerase activity and 5'->3'
exonuclease activity. The two activities can be present within one
enzyme molecule (as in the case of Taq DNA polymerase or DNA
polymerase I) or two enzymes. The synthesis of nick translate
molecules is usually initiated at a nick site within an up-stream
adaptor at the ends of a DNA fragment or within a down-stream
adaptor within a DNA fragment, or within an internal adaptor.
[0097] Adaptor attached nick translate molecules: nick translate
molecules with up-stream and down-stream adaptor sequences at the
5' and 3' termini. Adaptor attached nick translate molecules are
usually created by covalent attachment of the down-stream adaptor
to the 3' end of the nick translate molecule.
[0098] Nick translation initiation site: a free 3'OH-containing
terminus at a nick or a small gap within an adaptor molecule. Where
the nick site is contained within an adaptor, the nick translation
initiation site can be: 1) a part of the adaptor before attachment
to DNA, 2) created by annealing a priming oligonucleotide to the
distal primer binding region of the adaptor before or after the
first nick translation reaction, or, 3) created by recombination of
two different adaptors.
[0099] DNA library: a collection of DNA molecules that represent
all or a specified fraction of the sequences within a template DNA.
DNA libraries can be formed from whole genome, cDNA, cloned, or PCR
amplified templates, whereby the template DNA has been reduced in
size, recombined, or otherwise processed to become more useful than
the original template DNA. Individual members of the library,
complementary to sequences within the template DNA, can be selected
and/or amplified by in vivo cloning or in vitro amplification.
[0100] Unordered DNA library: a DNA library with a pooled
collection of molecules comprised of sequences complementary to
unknown positions within a region of the template DNA.
[0101] Ordered DNA library: a DNA library separated into
sublibraries comprised of molecules complementary to specified
positions within a region of the template DNA.
[0102] Sampled DNA library: a DNA library with a pooled collection
of molecules comprised of sequences complementary to multiple
non-contiguous specific regions of the template DNA.
[0103] Nick-translate DNA library: a DNA library comprised of
adaptor attached DNA molecules that have been created by one or
more nick translation reactions.
[0104] Unordered nick-translate DNA library: a pooled collection of
all adaptor attached nick-translate molecules that are
complementary to random positions within a region of the template
DNA.
[0105] Sampled nick-translate DNA library: a DNA library with a
pooled collection of Adaptor-attached nick-translate molecules that
are complementary to multiple non-contiguous specific regions of
the template DNA.
[0106] Ordered nick-translate DNA library: an adaptor attached
nick-translate library separated into sublibraries of molecules
that are complementary to specified positions within a region of
the template DNA.
[0107] Adaptor mediated recombination: a biochemical process that
involves transient or stable non-covalent association of two
adaptor attached DNA regions followed by covalent stabilization
using DNA ligase or DNA polymerase enzymes.
[0108] Nick site: a discontinuity in one of the strands within
double stranded DNA. A nick site created enzymatically by the nick
translation reaction is characterized by a free, phosphorylated 5'
end a 3' hydroxyl group.
[0109] Nick translation: a coupled polymerization/degradation
process that is characterized by a coordinated 5' to 3' DNA
polymerase activity and 5' to 3' exonuclease activity. The two
activities are usually present within one enzyme molecule (as in
the case of Taq DNA polymerase or DNA polymerase 1), however nick
translation may also be achieved by simultaneous activity multiple
enzymes exhibiting polymerase and exonuclease activity.
[0110] Partial cleavage: the cleavage by an endonuclease of a
controlled fraction of the available sites within a DNA template.
The extent of partial cleavage can be controlled by, for example,
limiting the reaction time, the amount of enzyme, and/or reaction
conditions.
[0111] Kernel: a known sequence of DNA that is used to select the
amplified region within the template DNA.
[0112]
[0113] The invention is a means of preparing a DNA molecule having
an amplifiable region. In a preferred embodiment, DNA is prepared
by a method comprising obtaining a DNA sample including DNA
molecules and attaching upstream adaptor molecules to 5' termini of
DNA molecules of the sample to provide a nick translation
initiation site. The DNA is subjected to nick translation using a
DNA polymerase having 5'-3' exonuclease activity. This reaction
produces nick translate molecules. Downstream adaptor molecules are
attached to the 3' termini of the nick translate molecules to
produce adaptor attached DNA molecules.
[0114] It is contemplated that a variety of starting materials may
be employed in the context of the instant invention. Therefore, it
is contemplated that the DNA will often need to be prepared prior
to adaptor attachment. The 5' termini of the DNA sample may be
produced prior to the attachment of the upstream adaptor molecule.
It is contemplated that the termini may be produced by restriction
digestion by one or more restriction enzymes, by digestion with a
nuclease, by mechanical shearing, or by any other means known by
those of skill in the art to modify DNA such that an appropriate
adaptor may be attached. Where a DNA molecule is restriction
digested, a person of ordinary skill would be aware of a wide
variety of restriction enzymes that could be employed in the
context of the instant invention. Particularly, a person of
ordinary skill would be aware that particular application would
necessitate the use of a frequently cutting restriction enzyme
while other applications would necessitate the use of an infrequent
cutter. It would further be clear to a person of ordinary skill, in
the context of the contemplated application what would distinguish
a frequent from an infrequent cutter. It is further contemplated
that the enzymes used to digest may be manipulated to perform
either a partial or full digest. A person of ordinary skill would
be aware of specific modifications to reaction conditions that
would facilitate a partial digest. By means of example: salt
conditions could be modified or time of digest could be shortened.
A person of ordinary skill would also be aware of methods of
modifying chemical or mechanical cleaving processes to achieve a
full or partial digest of a DNA sample.
[0115] Following attachment of the adaptors to the nick translate
product, it is envisioned that the DNA may be denatured. For the
purpose of the instant invention, denatured DNA is DNA in which the
hydrogen bonds between base pairs in the double-stranded nucleic
acid molecules are disrupted to produce single-stranded
polynucleotides. Following denaturation, the DNA may be separated.
Separation of the denatured DNA may facilitate the separation of a
single stranded nick translation product from the DNA sample
template strand.
[0116] In a preferred embodiment of the invention, DNA is subjected
to nick translation for a specified period of time. As the number
of bases polymerized by a given DNA polymerase in a specific time T
may be definitively calculated, product length may be extrapolated
from reaction time. Consequently, the products of a timed reaction
will be of a predictable length.
[0117] In a further embodiment, upstream and down stream adaptors
include functional sites. It is envisioned that the adaptors are
specifically engineered to comprise sites that facilitate the
further manipulation of the DNA molecule. In preferred embodiments,
the upstream adaptors may be engineered to include at least one of
the following: a nick translation initiation site, a primer binding
region and/or further sites a person of ordinary skill would
envision as useful in the modification of the DNA sample.
Downstream adaptor may be similarly constructed to include a primer
binding region, a nick translation initiation site and/or further
sites a person of ordinary skill would envision as useful in the
modification of the DNA sample in the context of the invention.
[0118] The invention facilitates the manipulation of a both a
homogeneous and heterogeneous DNA sample. It is contemplated that
to facilitate the differentiation of alternate DNA species, more
than one adaptor construct may be attached to DNA molecules within
a DNA sample. In an embodiment of the invention, the upstream
adaptor attached to the DNA sample consists of a mixture of more
than one upstream adaptor molecule constructs. It is envisioned
that the alternate constructs may have different primer binding
regions. It is further envisioned that the downstream adaptor may
comprise more than one downstream adaptor molecule constructs.
These constructs may be also be distinguishable by the inclusion of
different primer binding regions.
[0119] It is envisioned that following adaptor attachment and nick
translation that the modified DNA molecules may be amplified.
Following amplification, the amplified DNA may be cloned, sequenced
or separated.
[0120] In a preferred embodiment of the claimed invention, it is
envisioned that the adaptor attached DNA, either prior to or
subsequent to amplification may be used in the creation of a DNA
library. It is envisioned that the DNA library may be either an
unordered or an ordered DNA library.
[0121] The ordered DNA library may be created with steps involving
DNA recombination or by performing nick translation for a specific
period of time. The ordered library may further constitute an
ordered genomic library. In a preferred embodiment, an ordered
library is subjected to sequence scanning.
[0122] In a further embodiment of the invention, Applicant's
envision that amplification of the adaptor attached DNA may be
carried out with primers complementary to the upstream adaptor
molecule and the downstream adaptor molecule. In an alternate
embodiment, the adaptor attached DNA may be amplified with a first
primer specific to the upstream adaptor and a second primer
specific to an internal sequence of the DNA molecule. In a further
embodiment, the adaptor attached DNA may be amplified with a first
primer specific to the downstream adaptor molecule and a second
primer specific to an internal sequence of the DNA molecule.
[0123] It is envisioned that the primers used for amplification of
the adaptor attached DNA may be labeled. In an additional
embodiment of the invention, use of these, labeled probes
facilitates the creation of hybridization probes.
[0124] In a further embodiment of the claimed invention, the
adaptor attached DNA molecules may be subjected to recombination.
It is envisioned that the recombination may be carried out by: 1)
joining an upstream adaptor molecule attached to a first adaptor
attached DNA molecule and a downstream adaptor molecule attached to
the same adaptor attached DNA molecule; 2) joining an upstream
adaptor molecule attached to a first adaptor attached DNA molecule
and an internal adaptor molecule attached at an internal site
within the same adaptor attached DNA molecule; 3) joining a
downstream adaptor molecule attached to a first adaptor attached
DNA molecule and an internal adaptor molecule attached at an
internal site within the same adaptor attached DNA molecule; 4)
joining an upstream adaptor molecule attached to a first adaptor
attached DNA molecule and an internal adaptor molecule attached at
an internal site within the same adaptor attached DNA molecule and
further joining a downstream adaptor molecule attached to a first
adaptor attached DNA molecule and an internal adaptor molecule
attached at an internal site within the same adaptor attached DNA
molecule; or 5) joining an upstream adaptor molecule attached to a
first adaptor attached DNA molecule and a downstream adaptor
molecule attached to a second adaptor attached DNA molecule.
[0125] In another embodiment, it is envisioned that the sample DNA
molecules may be between 0.5 and 500 kb in length. In a preferred
embodiment, the DNA sample comprises short template molecules of
1-20 kB. It is further envisioned that the sample DNA is cDNA,
genomic DNA, or cloned DNA. The cloned DNA may further be
classified as originating from a BAC, a YAC, a cosmid, or a large
insert clone.
[0126] Once the sample DNA is converted to adaptor attached DNA
molecules, it is envisioned that the DNA may be separated. In a
preferred embodiment, separation of the adaptor attached DNA is
based upon size. Nevertheless, a person of ordinary skill would be
aware of a variety of means of separating the DNA constructs of the
instant invention.
[0127] In a further embodiment of the claimed invention, diagnostic
mutation analysis is performed. In a preferred embodiment,
diagnostic mutation analysis involves the steps of: preparing a DNA
library in accordance with the disclosed methods and then screening
the DNA library for single or multiple nucleotide polymorphisms.
The disclosed DNA library facilitates the shotgun sequencing of the
DNA by sequencing the library using primers specific for known loci
to derive the sequence of adjacent unknown regions.
[0128] In an additional embodiment of the claimed invention, the
adaptor attached DNA is recombined after adaptor attachment, size
separated and then amplified. It is further envisioned that the
size separated DNA is distributed into the wells of a multi-well
plate. In a preferred embodiment, the amplified DNA is subsequently
mapped, sequenced, resequenced, and/or cloned into a vector.
[0129] In a further embodiment of the claimed invention, the
adaptor attached DNA is recombined after adaptor attachment, PCR
amplified using locus specific primers and subsequently PCR
amplified using one locus specific primer and one adaptor specific
primer. This amplified DNA may be subsequently sequenced or cloned
into a vector.
[0130] In a particular embodiment of the claimed invention, the
adaptor attached DNA is recombined after adaptor attachment. In a
preferred embodiment, the DNA is amplified after adaptor
attachment, hybridized to a microarray and the hybridization
patterns subsequently analyzed.
[0131] It is further envisioned that the DNA sample to be nick
translated is modified. This modification is, for example,
methylation. In another embodiment, modification of DNA occurs
during the nick translation reaction. In this context, the
nucleotides integrated by the reaction are modified. In a preferred
embodiment, the modified nucleotides are exonuclease resistant. In
this context, it is contemplated that the presence of exonuclease
resistant nucleotides facilitates the differentiation or isolation
of the nick translate product from the template strand.
[0132] It is specifically envisioned that the adaptor attached DNA
molecules of the instant invention may be further modified or
manipulated after the initial reaction. In a preferred embodiment
of the claimed invention, the adaptor attached DNA molecules are
modified by initiating a second nick translation reaction at the
upstream adaptor with a DNA polymerase having 5'-3' exonuclease
activity. A second downstream adaptor molecules is then attached to
the 5' end of the molecules to produce adaptor attached nick
translate molecules.
[0133] In a further embodiment, the adaptor attached DNA molecules
are denatured to produce single stranded DNA. The denatured DNA is
then replicated to form a double stranded product. This product is
subjected to nick translation using a DNA polymerase having 5'-3'
exonuclease activity, to produce nick translate molecules.
Downstream adaptor molecules are then attached to the nick
translation initiation site of the nick translate molecules to
produce adaptor attached nick translate molecules.
[0134] Modification of the DNA molecules of the instant invention
may be to facilitate more efficient manipulation of the nick
translate product. It is specifically envisioned that the DNA is
modified to facilitate efficient isolation or separation of
different DNA molecules. In a preferred embodiment, isolation or
purification is facilitated by the attachment to the DNA of an
affinity adaptor.
[0135] In preferred embodiments of the invention, DNA molecules are
subjected to recombination. A person of ordinary skill would
recognize that a variety of methods exist to carry out
recombination of DNA molecules. In a preferred embodiment,
recombination is carried out by attaching the upstream adaptor
molecule to both the proximal and distal ends of a DNA molecules to
create a circular product. Several alternate means of recombination
are specifically contemplated within the scope of the instant
invention. In a first embodiment, the adaptor attached, nick
translate product is recombined by incubating the product with a
linker oligonucleotide to form a nick site. The ends of the product
are then ligated with a DNA ligase. While a person of ordinary
skill would recognize that a broad range of oligonucleotide sizes
and properties would function in the context of this embodiment, it
is contemplated in the context of this embodiment that the linker
oligonucleotide is between 20-200 bp long and further that the
linker oligonucleotide includes a region complementary to the
upstream adaptor and a region complementary to the downstream
adaptor.
[0136] In a second embodiment, recombination is carried out by
restricting the DNA molecules of the DNA sample with one or more
restriction enzymes. Restriction generally is carried out with a
frequent cutter, and in specific embodiments, it is contemplated
that the digestion is only a partial digest. Further, each end of
the DNA molecule may be created with a different restriction
enzyme. Upstream adaptor molecules are then attached at both ends
of the restricted DNA molecules and nick translation carried out
from both upstream adaptors. Once this is done, the ends of the DNA
molecules are recombined. Once recombination has been carried out,
the recombined molecules may be separated according to size.
[0137] In a third embodiment, recombination is carried out by
restricting the DNA molecules of the DNA sample with one or more
infrequent cutting restriction enzymes. Upstream adaptor molecules
are then attached at ends of the restricted DNA molecules and nick
translation is carried out from the upstream adaptors. Following
nick translation, the nick translate molecules are partially
restricted with a frequent cutter and internal adaptor molecules
attached at ends of the restricted DNA molecules. Another nick
translation reaction is then carried out from the internal
adaptors, with the ends of the DNA molecules subsequently being
recombined.
[0138] Additional methods for recombination are included within
various aspects of the claimed invention. In a preferred
embodiment, recombination is carried out in a dilute solution and
is characterized as: cleaving the DNA molecules with a first
sequence-specific endonuclease, ligating an adaptor to the
sequence-specific termini of the DNA molecule, cleaving the DNA
molecules with a second sequence-specific endonuclease, incubating
the DNA molecules at low concentration with an excess of T4 DNA
ligase for 16-36 h and then concentrating the DNA molecules. In an
alternate embodiment, recombination is carried out in a dilute
solution by methylating the DNA molecules, attaching a first and
second adaptor with an activatable region to the ends of the DNA
molecules, activating the adaptors by incubation with a restriction
endonuclease thereby removing distal portion of the adaptors and
creating sticky ends, incubating the DNA molecules at low
concentration with an excess of T4 DNA ligase for 16-36 h; and then
concentrating the DNA molecules.
[0139] In a further embodiment, recombination is carried out in a
dilute solution by hybridizing the ends of adaptor attached
template molecules in dilute solution, concentrating the molecules
and ligating the ends of the molecules. In a still further
embodiment, recombination is carried out in a dilute solution by
hybridizing the ends of adaptor attached template molecules and
subjecting the DNA molecule to a nick-translation reaction to form
the covalent intramolecular junction.
[0140] Various alternate embodiments and modifications of the basic
methods of producing adaptor attached nick translate molecules are
specifically contemplated. In one embodiment, a DNA molecule having
an amplifiable region is produced by obtaining a DNA sample
comprising DNA molecules having regions to be amplified and
attaching upstream adaptor molecules to the proximal end of DNA
molecules to provide a nick translation initiation site. The DNA
molecules are then subjected to a nick translation reaction
comprising DNA polymerization and 5'-3' exonuclease activity, for a
specific time T. Downstream adaptor molecules are then attached to
the 5' end of the degraded template strand to produce adaptor
attached nick translate molecules. The product of this method may
then be amplified, sequenced, cloned or otherwise manipulated. In
embodiments in which the DNA sample contains a plurality of
alternate DNA molecules, the different DNA molecules may be reacted
for different times T.
[0141] Once a circular product is achieved through recombination,
the existence of a nick translation site facilitates the initiation
of a nick translation reaction. The positioning of the nick site on
the intramolecular junction facilitates nick translation through
the region. Proper placement of the nick site allows nick
translation to proceed either through the proximal or *distal end
of the recombined molecule. Coverage of the molecule can be
increased by exposing different internal regions of the nick
translate molecules as distal ends. It is further contemplated that
the adaptors used in recombination comprise single stranded
tails.
[0142] Where an adaptor is ligated to a DNA molecule in the context
of the instant invention, it is specifically contemplated that the
adaptor added to a DNA sample consists of a single adaptor
construct or multiple adaptor constructs. Thus, embodiments of the
invention comprise a DNA sample with a plurality of upstream
adaptors in a single tube and a DNA sample with a plurality of
downstream adaptors in a single tube.
[0143] The instant invention is of particular use in producing DNA
to be sequenced or amplified with specific regions for which the
sequence is not known. It is specifically contemplated that the
instant invention will facilitate the determination of unknown
sequences. In a preferred embodiment of the instant invention, the
unknown sequence to be determined will abut a known sequence. In
this and other contexts, it is specifically contemplated that the
nick translation reaction proceed through a known sequence on the
DNA molecule. Further, because the sequence of the region is known,
sequencing and PCR primers may be constructed to hybridize to such
regions within the context of the invention. In particular
embodiments of the instant invention, PCR is carried out using a
primer or primers specific for the known sequence and a primer or
primers specific for the attached adaptors.
[0144] In an alternate embodiment of the basic method, an
amplifiable region is prepared by obtaining a DNA sample comprising
DNA molecules having regions to be amplified followed by attaching
upstream adaptor molecules to the proximal end of the DNA molecules
of the sample to provide a nick translation initiation site. The
adaptor attached molecules are subjected to a first nick
translation comprising DNA polymerization and 5'-3' exonuclease
activity, for a-specific time T. A first downstream adaptor is then
attached to the 3' end of the nick translate product to produce
adaptor attached nick translate molecules. The adaptor attached
molecules are then subjected to a second nick translation initiated
from the upstream adaptor for a specific time T and then a second
downstream adaptor molecule is attached to the 5' end of the
degraded nick translate product. The product of this method may
then be amplified, sequenced, cloned, separated or otherwise
manipulated. In embodiments in which the DNA sample contains a
plurality of alternate DNA molecules, the different DNA molecules
may be reacted for a different time T for either of the nick
translation reactions performed.
[0145] In a further embodiment of the basic method, an amplifiable
region is prepared by obtaining a DNA sample comprising DNA
molecules having regions to be amplified followed by attaching
upstream adaptor molecules to the proximal end of the DNA molecules
of the sample to provide a nick translation initiation site. The
adaptor attached molecules are then subjected to a first nick
translation comprising DNA polymerization and 5'-3' exonuclease
activity, for a specific time T. A first downstream adaptor
molecules is then attached to the 3' end of the nick translate
product and the nick translate product separated from the template
molecule. The nick translate product is then replicated by primer
extension with the product of this step then subjected to a second
nick translation comprising DNA polymerization and 5'-3'
exonuclease activity,- for a specific time T. Following this step,
a second downstream adaptor molecule is attached to the 3' end of
the product. The product of this method may then be amplified,
separated, sequenced, cloned or otherwise manipulated. In
embodiments in which the DNA sample contains a plurality of
alternate DNA molecules, the different DNA molecules may be reacted
for different times T for either of the nick translation reactions
performed.
[0146] In a still further embodiment of the basic method, an
amplifiable region is prepared by obtaining a DNA sample comprising
DNA molecules having regions to be amplified followed by attaching
an affinity adaptor to the proximal ends of the DNA molecules. The
affinity adaptor attached molecules are subjected to partial
cleavage and then separated. Upstream adaptor molecules are
attached to the ends of the affinity adaptor attached molecules to
provide a nick translation initiation site and the molecules are
then subjected to nick translation comprising DNA polymerization
and 5'-3' exonuclease. Following this step, downstream adaptor
molecules are then attached to the nick translate molecules to
produce adaptor attached nick translate molecules. The product of
this method may then be amplified, sequenced, separated, cloned or
otherwise manipulated. In embodiments in which the DNA sample
contains a plurality of alternate DNA molecules, the different DNA
molecules may be reacted for different times T for either of the
nick translation reactions performed. In an additional embodiment,
polymerization may involve the incorporation of modified
nucleotides, with specific embodiments making the nick translate
molecule exonuclease resistant.
[0147] In a further modification of the basic nick translation
method, an amplifiable region is prepared by obtaining a DNA sample
comprising DNA molecules having regions to be amplified followed by
attaching the first end of a recombination adaptor to one end of
the DNA molecules and attaching the second end of the recombination
adaptor to the opposite end-of the DNA molecules. The circularized
molecule is then subjected to nick translation involving DNA
polymerization and 5'-3' exonuclease activity. A downstream adaptor
molecule is attached to the nick translate molecules to produce
adaptor attached nick translate molecules. The product of this
method may then be amplified, sequenced, separated, cloned or
otherwise manipulated. In embodiments in which the DNA sample
contains a plurality of alternate DNA molecules, the different DNA
molecules may be reacted for different times T for either of the
nick translation reactions performed.
[0148] In an additional modification of the basic nick translation
method, an amplifiable region is prepared by obtaining a DNA sample
comprising DNA molecules having regions to be amplified followed by
attaching the first end of a recombination adaptor to the proximal
end of said DNA molecules. Following adaptor attachment, the DNA is
partially cleaved to produce cleavage products having a plurality
of lengths. The second end of the recombination adaptor is then
attached to the distal ends produced by the partial cleavage. These
molecules are subjected to nick translation comprising DNA
polymerization and 5'-3' exonuclease activity, followed by
attaching downstream adaptor molecules to the nick translate
molecules to produce adaptor attached nick translate molecules.
These molecules may then be separated, for example, by size.
[0149] In a still further embodiment based upon the basic nick
translation method, a first DNA template is obtained and a first
upstream adaptor molecule attached to the template to provide a
nick translation initiation site. A second DNA template is obtained
and a second upstream adaptor molecule attached to the template to
provide a nick translation initiation site. The templates are then
mixed and subjected to nick translation initiated from the upstream
adaptor for a specific time T. Subsequently, a downstream adaptor
molecule is attached to the nick translate molecules to produce
adaptor attached nick translate molecules. These molecules may be
subsequently amplified and differentiated based upon the use of
alternate primers specific for the alternate upstream adaptors.
[0150] The methods of the instant application are specifically
applicable to the construction of a genomic library. In a preferred
embodiment, a genomic library is constructed by obtaining genomic
DNA and fragmenting it to a desired size. Upstream adaptor
molecules are attached to ends of the fragmented genomic DNA
molecules of the sample to provide a nick translation initiation
site and the molecules subjected to nick translation comprising DNA
polymerization and 5'-3' exonuclease activity. Following this
reaction, downstream adaptor molecules are attached to the nick
translate molecules to produce adaptor attached nick translate
molecules. These products may be recombined, amplified, sequenced,
separated, cloned, inserted into a vector or otherwise manipulated.
Separation of the library into sublibraries of molecules of
different size is contemplated to create an ordered DNA library. It
is further contemplated that samples may be chosen based upon the
presence of a known kernel sequence within the molecule. Where such
a sequence is present, it is contemplated to be useful for the
construction of primers for the amplification of the, molecule.
Amplification in this context will generally comprise sequences
adjacent to the kernel sequence. It is contemplated that
recombination may be facilitated through the presence of a 5'
phosphate group on the upstream adaptor or the use of a DNA ligase
employing a linking oligonucleotide. This method may be further
modified by incubating the linking oligonucleotide with the adaptor
attached nick translate molecule to form a nick and then ligating
the adaptor attached nick translate molecule with a DNA ligase. In
a preferred embodiment, a thermostable ligase will be used. In a
further embodiment, the sample will be diluted and performed at a
low concentration prior to recombination.
[0151] In addition to the basic method set forth above, alternate
methods of constructing genomic libraries are specifically
contemplated in the context of the instant invention. In a
preferred embodiment, the library is constructed by obtaining a
genomic DNA and fragmenting it. Upstream adaptor molecules are then
attached to the ends of the fragmented genomic DNA molecules of the
sample to provide a nick translation initiation site. The sample is
then subdivided into a plurality of reaction vessels and subjected
to nick translation comprising DNA polymerization and 5'-3'
exonuclease activity, for a specific time T. Following nick
translation, downstream adaptor molecules are attached to the nick
translate molecules to produce adaptor attached nick translate
molecules. These products may be recombined, amplified, sequenced,
separated, cloned, inserted into a vector or otherwise manipulated.
It is further contemplated that samples may be chosen based upon
the presence of a known kernel sequence within the molecule. Where
such a sequence is present, it is contemplated to be useful for the
construction of primers for the amplification of the molecule.
Amplification in this context will generally comprise sequences
adjacent to the kernel sequence. Where the molecule is recombined,
it is contemplate that it may be carried out by ligating the
upstream adaptor to the downstream adaptor. In a further
embodiment, these molecules may be recombined employing a DNA
ligase and a linking oligonucleotide. This method may be further
modified by incubating the linking oligonucleotide with the adaptor
attached nick; and translate molecule to form a nick and then
ligating the adaptor attached nick translate molecule with a DNA
ligase. In a preferred embodiment, a thermostable ligase will be
used. In a further embodiment, the sample will be diluted and
performed at a low concentration prior to recombination. Because
this method may be run in alternate reaction vessels, it is
contemplated that various times T of reaction may be applied to the
different reaction vessels.
[0152] DNA libraries produced in the context of the instant
invention may be ordered or unordered. In a preferred embodiment,
an unordered DNA library is produced by obtaining a DNA sample
comprising DNA molecules, cleaving the DNA molecules and attaching
adaptors to termini of the cleaved DNA molecules. The molecules are
then subjected to nick translation comprising DNA polymerization
and 5'-3' exonuclease activity, to produce nick translate molecules
wherein the nick translation is initiated from both ends of the
cleaved DNA molecules. The ends of this product are then
recombined. These products may be amplified, sequenced, separated,
cloned, inserted into a vector or otherwise manipulated. It is
further contemplated that samples may be chosen based upon the
presence of a known kernel sequence within the molecule. Where such
a sequence is present, it is contemplated to be useful for the
construction of primers for the amplification of the molecule.
Amplification in this context will generally comprise sequences
adjacent to the kernel sequence.
[0153] In a further embodiment, an ordered DNA library is produced
by obtaining a DNA sample comprising DNA molecules, cleaving the
DNA molecules and attaching adaptors to termini of the cleaved DNA
molecules. The cleaved molecules are then partially cleaved and
adaptors attached to the termini of the DNA molecules. These DNA
molecules are subjected to nick translation comprising DNA
polymerization and 5'-3' exonuclease activity, to produce nick
translate molecules wherein said nick translation is initiated from
both ends of the DNA molecules. These products may be recombined,
amplified, sequenced, separated, cloned, inserted into a vector or
otherwise manipulated. It is further contemplated that samples may
be chosen based upon the presence of a known kernel sequence within
the molecule. Where such a sequence is present, it is contemplated
to be useful for the construction of primers for the amplification
of the molecule. Amplification in this context will generally
comprise sequences adjacent to the kernel sequence. In a further
embodiment, nucleotide analogs are integrated during amplification.
In an additional embodiment, the-time of primer extension is
limited. In the context of recombining the molecules, it is
specifically contemplated that the sample will be diluted prior to
recombination and that recombination results in a covalent bond. In
a preferred embodiment, the sample may be diluted to a point where
the sample comprises substantially a single DNA molecule. Where the
product is sequenced, sequencing may be carried out by cycle
sequencing. Where cycle sequencing is performed it is specifically
contemplated that the cycle sequencing employs a primer
complementary to an adaptor and at least one or two base pairs
adjacent to the adaptor.
[0154] In an alternate aspect of the instant invention, the basic
methods set forth herein are applied to the construction of a DNA
library. In a preferred embodiment, the DNA library is constructed
by obtaining a DNA sample comprising DNA molecules and cleaving the
DNA molecules with an infrequently-cutting restriction enzyme.
Upstream adaptor molecules are then attached to the ends of the
cleaved DNA molecules of the sample to provide a nick translation
initiation site. The DNA molecules are then subjected to nick
translation comprising DNA polymerization and 5'-3' exonuclease
activity and downstream adaptor molecules subsequently attached to
the nick translate molecules to produce adaptor attached nick
translate molecules. These molecules are then partially cleaved
with a frequently cutting restriction enzyme; and upstream adaptor
molecules attached to the ends of the adaptor attached nick
translate molecules produced by said partial digestion. The DNA
molecules are then again subjected to nick translation comprising
DNA polymerization and 5'-3' exonuclease activity and downstream
adaptor molecules attached to the nick translate molecules to
produce adaptor attached nick translate molecules. These products
may be subsequently recombined, amplified or separated. Where the
recombined molecule is amplified it is contemplated that a primer
specific for an adaptor and or a primer specific for a kernel
sequence within the molecule may be used.
[0155] In an additional embodiment based upon the basic method, a
DNA sample comprising DNA molecules having regions to be amplified
is obtained. At least a first upstream adaptor and at least a
second upstream adaptor are then attached to the DNA molecules
which are then subjected to recombination at low DNA
concentrations. The recombined molecules are subjected to nick
translation comprising DNA polymerization and 5'-3' exonuclease
activity and downstream adaptor molecules attached to the nick
translate molecules to produce adaptor attached nick translate
molecules. The products of this reaction may be subsequently
amplified, sequenced, separated, cloned or otherwise
manipulated.
[0156] In an alternate embodiment, the instant invention provides
methods for sequencing large DNA molecules. In a preferred
embodiment, a BAC clone is sequenced by cleaving the BAC clone at a
cos site with lambda terminase and ligating an upstream adaptor to
the 5' overhangs. The DNA is partially cleaved with a frequently
cutting enzyme and the ends of the fragments recombined. A
nick-translation reaction is performed from both ends of the
fragments. A poly-G tail is added to the 3' end of the recombined
nick-translate product with terminal transferase. An adaptor having
a poly-C 3' single-strand overhang and a unique double strand
sequence is ligated at the end to the poly-G tail. The strands are
then size separated and distributed into the wells of a microplate.
The DNA is amplified with primers complementary to adaptor
sequences such that products are formed which proceed in either a
clockwise or counterclockwise direction around the recombined
molecule. The molecules are then ligated into a cloning vector and
subsequently sequenced.
[0157] It is further contemplated that the reagents necessary to
carry out the invention may be combined in a kit. In a preferred
embodiment, kits may include DNA for use in the context of the
instant invention. Where DNA is included in a kit, it is
specifically contemplated that the DNA may be genomic DNA. It is
further contemplated that the DNA may be prokaryotic or eukaryotic;
from a plant or an animal. Where the DNA is from a plant or animal,
a person of ordinary skill would recognize a wide variety of
species to which this method would be particularly applicable.
Animal DNA of particular relevance may include human, feline,
canine, bovine, equine, porcine, caprine, murine, lupine, ranine,
piscine and simian. Plant species of interest include both monocots
and dicots. Species of particular relevance include species of
agricultural relevance, for example, tobacco, tomato, potato, sugar
beet, pea, carrot, cauliflower, broccoli, soybean, canola,
sunflower, alfalfa, cotton, Arabidopsis, wheat, maize, rye, rice,
turfgrass, oat, barley, sorghum, millet, and sugarcane.
[0158] A variety of different adaptor constructs are important to
the methods of the instant inventions. Upstream adaptors,
downstream adaptors and recombination adaptors all have specific
functions in various embodiments of the invention. In a preferred
embodiment of the invention, an upstream adaptor construct may be
characterized as a first domain comprising nucleotides that
facilitate ligation of the construct to a nucleic acid and a second
domain proximal to the first domain, comprising a site which
facilitates the initiation of a nick translation reaction and a
site that facilitates recombination. When this adaptor is ligated
to a polynucleotide molecule it results in the only free 3' OH
group capable of initiating a nick translation reaction within the
second domain of the adaptor.
[0159] An alternate upstream adaptor construct useful in the
context of the invention is characterized as comprising: a first
oligonucleotide comprising a phosphate group at the 5' end and a
blocking nucleotide at the 3' end; a second oligonucleotide
comprising a blocked 3' end, a non-phosphorylated 5' end, and a
nucleotide sequence complementary to the 5' element of the first
oligonucleotide ; and a third oligonucleotide comprising a 3'
hydroxyl group, a non-phosphorylated 5' end, and a nucleotide
sequence complementary to the 3' element of said first
oligonucleotide. The oligonucleotides of this adaptor may be a
variety of lengths, nevertheless, in preferred embodiments the
first oligonucleotide is from 10 to 200 bases and the second and
third oligonucleotide are from 5 to 195 bases. The first
oligonucleotide may be further characterized as comprising an
additional 3' tail, a 3' end protected from exonuclease activity,
and/or one or more nuclease resistant nucleotide analogs. The third
oligonucleotide may be further characterized as comprising a 3' end
capable of initiating a nick translation reaction.
[0160] An additional upstream adaptor construct useful in the
context of the invention is characterized as comprising: a first
oligonucleotide including a 5' phosphate and a 3' nucleotide
blocked to prevent ligation or extension by a polymerase; a second
oligonucleotide comprising a domain which facilitates ligation to
the template strand and a nucleotide sequence complementary to the
5' element of the first oligonucleotide; a third oligonucleotide
comprising an initiation site for nick-translation and a nucleotide
sequence complementary to a region of the first oligonucleotide;
and a fourth, fifth and sixth oligonucleotide which comprise a
nucleotide sequence complementary to a region of said first
oligonucleotide and may be readily removed to expose the 3'
terminus of the adaptor. In a particular embodiment of this
construct, the removal of the fourth, fifth and sixth
oligonucleotides creates a site that facilitates recombination.
[0161] Another adaptor construct envisioned to be useful in- the
context of the instant invention comprises a first domain
comprising nucleotides that facilitate ligation of the construct to
a nucleic acid, a second domain proximal to the first domain
comprising a site which facilitates the initiation of a nick
translation reaction, and a third domain proximal to the first
domain, comprising a second site which facilitates the initiation
of a nick translation reaction. This adaptor may be further
characterized as a site that facilitates recombination. When this
adaptor is ligated to a polynucleotide molecule, it results in the
only free 3' OH groups capable of initiating a nick translation
reaction within said second and said third domains.
[0162] The adaptor construct may further comprise a variety of
features that would facilitate the manipulation of the attached DNA
molecule. The adaptors may be further characterized as including a
primer binding site, a nucleotide overhang, a domain that inhibits
self ligation, a single ligatable terminus, a single free 3' OH
group capable of initiating a nick translation reaction, one or
more nuclease resistant analogs and/or at least one degradable
base. Where the adaptor includes a degradable base, it may be used
for the creation of a free 3' OH and may be deoxyribouracil. The
site for initiation of a nick translation reaction may be further
characterized as a single stranded region in an otherwise
essentially double stranded molecule.
[0163] An additional adaptor construct is characterized as a first
oligonucleotide comprising a phosphate group at the 5' end and, a
blocking nucleotide at the 3' end. A second oligonucleotide
comprises a blocked 3' end, a non-phosphorylated 5' end, and a
nucleotide sequence complementary to the 5' element of the first
oligonucleotide. A third oligonucleotide comprises a 3' hydroxyl
group, a non-phosphorylated 5' end, and a nucleotide sequence
complementary to the 3' element of the first oligonucleotide. And,
a fourth oligonucleotide comprises a 3' hydroxyl group, a
non-phosphorylated 5' end, and a nucleotide sequence complementary
to the 3' element of said first oligonucleotide. In additional
embodiments, the length of the first oligonucleotide is from 10 to
200 bases while the second, third and fourth oligonucleotides may
be from 5 to 195 bases. In alternate embodiments, the first
oligonucleotide may be further characterized as comprising an
additional 3' tail, a 3' end protected from exonuclease activity
and/ or one or more nuclease resistant nucleotide analogs. The
third oligonucleotide may be further characterized as comprising a
3' end capable of initiating a nick translation reaction.
[0164] A further adaptor construct is characterized as comprising a
first oligonucleotide comprising a 5' region comprising a 5'
phosphate group and homopolymeric tract of 8-20 bases and a 3'
region comprising a 12-100 base primer binding domain and a second
oligonucleotide complementary to the 3' region of the first
oligonucleotide. In an additional embodiment, the adaptor construct
may be further characterized as comprising a recombination
site.
[0165] A further adaptor construct is characterized as comprising a
first oligonucleotide of 12-100 bases, wherein the 5' end of said
oligonucleotide comprises a free phosphate group and a second
oligonucleotide comprising a homopolymeric tract of 8-20, a 3'
blocking nucleotide and wherein the 5' region of said second
oligonucleotide is complementary to the first oligonucleotide. In
an additional embodiment, the adaptor construct may be further
characterized as comprising a recombination site.
[0166] A further adaptor construct is characterized as comprising a
first oligonucleotide comprising a 5' region comprising a 12-100
base primer binding domain and a 3' region comprising a
homopolymeric tract of 8-20 bases and a second oligonucleotide
comprising a blocked 3' end and a.3' region complementary to the 5'
region of the first oligonucleotide. In an additional embodiment,
the adaptor construct may be further characterized as comprising a
recombination site.
[0167] A further adaptor construct is characterized as comprising a
first oligonucleotide comprising a 5' region comprising a 12-100
base primer binding domain and a second oligonucleotide comprising
a homopolymeric tract of 4-12 bases at the 5' end, a blocking
nucleotide at the 3' end, and a 3' region complementary to said
first oligonucleotide. In an additional embodiment, the adaptor
construct may be further characterized as comprising a
recombination site.
[0168] In a further embodiment of the instant invention, an
amplifiable region may be prepared by obtaining a DNA sample
comprising DNA molecules having regions to be amplified and
attaching upstream adaptor molecules to the ends of the DNA
molecules of the sample to provide a nick translation initiation
site. The molecules are then subjected to nick translation
comprising DNA polymerization, to produce nick translate molecules.
Downstream adaptor molecules are then attached to the nick
translate molecules to produce adaptor attached nick translate
molecules. These products may be recombined, amplified, sequenced,
separated, cloned, inserted into a vector or otherwise manipulated.
In a preferred embodiment, the product may be organized as a DNA
library.
[0169] A preferred embodiment of the instant invention consists of
a kit with alternate adaptor constructs combined with components
necessary to carry out a nick translation reaction, including, for
example, a DNA polymerase and nucleotide triphosphates.
[0170] In a preferred embodiment of the instant invention, the
adaptor attached nick translate molecules are assembled as a
microarray or an ordered microarray and which is capable of being
probed for complementary sequences. In a preferred embodiment, the
microarray is assembled on a DNA chip. In an embodiment involving
the use of a DNA chip, the DNA chip may be used in a variety of
applications, for example the analysis of patients' blood to
determine chromosomal mutations or to facilitate diagnostic
mutation analysis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0171] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0172] FIG. 1: Comparison of positional amplification and
conventional cloning/PCR techniques with respect to DNA preparation
for sequence analysis
[0173] FIGS. 2A and 2B: Synthesis of primary and complement
PENTAmers
[0174] FIGS. 3A and 3B: Synthesis of secondary PENTAmers
[0175] FIG. 4: Time-controlled PENTAmer -mediated walking
[0176] FIG. 5: Creation of ordered libraries of PENTAmers from a
single template molecule
[0177] FIG. 6: Creation of the recombinant PENTAmer on a single DNA
molecule
[0178] FIG. 7: Positional amplification using ordered positional
libraries of recombinant PENTAmers from a single template
molecule
[0179] FIG. 8: Multiplexed primary PENTAmers
[0180] FIGS. 9A and 9B: Genomic primary PENTAmer libraries (after
partial digestion with frequently-cutting restriction enzyme)
[0181] FIG. 10: Positional amplification using primary linear
PENTAmer library
[0182] FIGS. 11A and 11B: Positional amplification using primary
circular PENTAmer library
[0183] FIGS. 12A and 12B: Positional amplification using primary
"walking" PENTAmer library (after complete restriction
digestion)
[0184] FIG. 13: General principle for creation and amplification of
a recombinant PENTAmer molecule
[0185] FIGS. 14A and 14B: Recombinant genomic PENTAmer library I
preparation using partial digestion with frequently-cutting
restriction enzyme (SmartGenome DNA I)
[0186] FIGS. 15A and 15B: Recombinant genomic PENTAmer library II
preparation using complete digestion with rare-cutting enzyme and
partial digestion (SmartGenome DNA II)
[0187] FIG. 16: Positional amplification of large DNA regions using
recombinant genomic PENTAmer libraries of type I
[0188] FIGS. 17A, 17B, 17C and 17D: Positional amplification of the
large restriction DNA fragments using linear and circular genomic
recombinant PENTAmer libraries of type II (two-step positional
amplification)
[0189] FIGS. 18A, 18B, and 18C: Different strategies for positional
amplification and sequencing of large genomes
[0190] FIG. 19: Up-stream terminus attaching nick-translation
adaptors
[0191] FIG. 20: Down stream nick attaching adaptor B-3' (I)
targeted to a gap by a ligation reaction
[0192] FIG. 21: Down stream nick attaching adaptor B-3' (II)
targeted to a homopolymeric DNA tail by a ligation reaction
[0193] FIG. 22: Down stream nick attaching adaptor B-3' (III)
targeted to a displaced 3' DNA tail by a ligation reaction
[0194] FIG. 23: Down stream nick attaching adaptor B-3' (IV)
targeted to a homopolymeric DNA tail as a template for a
polymerization-extension reaction
[0195] FIG. 24: Down stream nick attaching adaptor B-3' (V)
targeted to a displaced 3' DNA tail as a template for a
polymerization-extension reaction
[0196] FIG. 25: Upstream nick-attaching adaptor B-5 (I) targeted to
a gap by a ligation reaction
[0197] FIG. 26: Upstream nick-attaching adaptor B-5 (II) targeted
to a displaced 5' tail of the trimmed DNA strand by a ligation
reaction
[0198] FIG. 27 General structure of the recombination adaptor
[0199] FIGS. 28A and 28B: Examples of recombination down-stream
nick-attaching adaptors
[0200] FIG. 29: Classes of recombination adaptors
[0201] FIGS. 30A, 30B, 30C, 30D and 30E: Recombination by direct
ligation
[0202] FIGS. 31A, 31B, 31C, 31D and 31E: Recombination by
hybridization followed by ligation
[0203] FIG. 32: Recombination by hybridization followed by
nick-translation reaction
[0204] FIG. 33: Forms of recombinant DNA and nascent recombinant
PENTAmer formed when recombination occurs before the synthesis of
PENTAmers
[0205] FIGS. 34A and 34B: Different forms of nascent recombinant
PENTAmers formed after the synthesis of PENTAmers at both ends of
the DNA fragment.
[0206] FIG. 35: Different forms of nascent recombinant PENTAmers
formed-after the synthesis of PENTAmer at one end of the DNA
fragment
[0207] FIG. 36: Different forms of single-stranded recombinant
PENTAmers
[0208] FIG. 37: Terminal PENTAmer micro-arrays for chromosome
mutation analysis
[0209] FIG. 38: Whole-genome chromosome deletion analysis using
terminal PENTAmer micro-array technology
[0210] FIGS. 39A and 39B: High-resolution whole-genome chromosome
deletion analysis using terminal PENTAmer micro-array technology
and DNA size separation
[0211] FIG. 40: Adaptor constructs
[0212] FIG. 41: Efficient ligation of the 3'-end blocked up-stream
nick-translation adaptor A
[0213] FIG. 42: T4 DNA polymerase -mediated repair of blocked
3'-ends of the nick-translation adaptor A
[0214] FIG. 43: Primer-displacement activation of PENT reaction
[0215] FIG. 44: Effect of MgCl.sub.2 concentration on the rate of
PENT reaction
[0216] FIG. 45: Time-controlled synthesis of PENT products
[0217] FIG. 46: Poly-G TdT-mediated tailing at nick: model
oligonucleotide construct
[0218] FIG. 47: TdT tailing of PENT products: inhibitory effect of
Taq DNA polymerase
[0219] FIG. 48: TdT-mediated tailing of PENT products: effect of
carrier
[0220] FIG. 49: Model PENTAmer construct
[0221] FIG. 50: TdT-mediated synthesis and PCR amplification of
model PENTAmer molecules
[0222] FIG. 51: PCR amplification of PENTAmers
[0223] FIG. 52: PENTAmer synthesis doess not affect the mobility of
ds DNA fragments
[0224] FIG. 53: 2D-electrophoretic analysis of multiple PENT
products shows similar rate of Taq polymerase-mediated
nick-translation reaction at different ends of lambda DNA/Bam HI
restriction fragments
[0225] FIG. 54: .lamda.-DNA Methylation protection/RA-(L-cos)
adaptor cleavage
[0226] FIG. 55: RA-(L-cos) adaptor ligation to lambda DNA L-cos
site
[0227] FIG. 56: Sau 3A I partial digestion of lambda and human
DNA
[0228] FIG. 57: Frequency of Sau 3A I sites in human genome
[0229] FIG. 58: Efficiency of the recombination-circularization
reaction
[0230] FIG. 59: Rate of PENT reaction initiated at different Sau 3A
I/lambda DNA sites is sequence independent: 2D method
[0231] FIG. 60: Preparation of the ordered recombinant PENTAmer
library from lambda DNA
[0232] FIG. 61: Compositions of the recombinant lambda DNA PENTAmer
junctions
[0233] FIG. 62: Preparative agarose gel fractionation of the lambda
DNA nascent PENTAmers
[0234] FIG. 63: PCR amplification of the ordered lambda DNA
PENTAmer library ("positional amplification").
[0235] FIG. 64: Mbo I restriction fingerprint analysis of the
ordered lambda DNA PENTAmer library.
[0236] FIG. 65: Msp I restriction fingerprint analysis of the
ordered lambda DNA PENTAmer library.
[0237] FIG. 66: Detailed Mbo I restriction fingerprint analysis of
the lambda DNA PENTAmer fractions ## 25-32.
[0238] FIG. 67: Detailed Mbo I restriction fingerprint analysis of
the lambda DNA PENTAmer fractions ## 33-40.
[0239] FIG. 68: Detection of secondary PENTAmer products using
PCR.
[0240] FIG. 69: Sra oligos and extended regions of complementarity
of Sra' paired with original Sra2.
[0241] FIG. 70: Sra oligonucleotides, lambda recombinant screening
oligonucleotides, and E. coli recombinant screening
oligonucleotides.
[0242] FIG. 71: Recombination efficiency from RA.sub.1/RA.sub.2
adaptors.
[0243] FIG. 72: Effects Of MgCl.sub.2 concentration on
recombination efficiency.
[0244] FIG. 73: Recombination efficiency with multiple kernel
primer sets.
[0245] FIG. 74: Conversion of nicks to breaks through intermediate
forms.
[0246] FIG. 75: Comparison of S1 digestion to T7 exonuclease/S1
digestion.
[0247] FIG. 76: Complete conversion to fragments following T7
digestion.
[0248] FIG. 77: Release of PENTAmers following S1 treatment.
[0249] FIG. 78: Enzymatic release of recombinant PENTAmers.
[0250] FIG. 79: Amplification of secondary nick translation
released recombinant PENTAmers.
[0251] FIGS. 80A and 80B: Trapping of DNA molecules across agarose
gels.
[0252] FIG. 81: Graph depicting trapping of DNA molecules across
agarose 2D gels.
[0253] FIG. 82: Recovery of DNA fragments after Microcon YM-100
filtration.
[0254] FIG. 83: Removal of free primers and G-tailed adaptor from
amplified PENTAmer Not I genomic E. coli library.
[0255] FIG. 84: Removal of inhibitory activity on terminal
transferase from PENTAmer products generated from model pUCI19 DNA
template by Microcon YM-100 ultrafiltration.
[0256] FIG. 85: PCR amplification of genomic Not I PENTAmer E. coli
library and selected kernel sequences.
[0257] FIGS. 86A and 86B: Restriction enzyme fingerprint display of
end-labeled E. coli genomic Not I PENTAmer library.
[0258] FIGS. 87A and 87B: Restriction enzyme fingerprint display of
end-labeled E. coli genomic Not I PENTAmer library.
[0259] FIG. 88: PCR amplification of PENTAmer libraries prepared
from human genomic DNA after partial Sau3A I or complete BamH I
restriction digestion.
[0260] FIG. 89: PCR amplification of 40 kernel sequences from
PENTAmer library prepared from E. coli genomic partial Sau3A I
restriction digest.
[0261] FIG. 90: PCR amplification of genomic BamH I PENTAmer E.
coli library and selected kernel sequences.
[0262] FIGS. 91A and 91B: PCR amplification of serially diluted
double-stranded (91A) and double-stranded and single stranded (91B)
secondary libraries.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0263] As used herein the specification, "a" or "an" may mean one
or more. As used herein in the claim(s), when used in conjunction
with the word "comprising", the words "a" or "an" may mean one or
more than one. As used herein "another" may mean at least a second
or more.
[0264] This application incorporates by reference herein in its
entirety U.S. Patent Application Ser. No. 60/288,205, filed May 2,
2001 and entitled "Genome Walking by Selective Amplification of
Nick-Translate DNA Library and Amplification from Complex Mixtures
of Templates."
[0265] The method for creating an adaptor attached nick translate
molecule (designated a PENTAmer) provides a powerful tool useful in
overcoming many of the difficulties currently faced in large scale
DNA manipulation, particularly genomic sequncing. This core
technology can be implemented alone or in combination with other
steps in order to achieve position-specific polymerization of the
internal regions of small or large DNA molecules. The basic
reactions for forming a primary PENTAmer are the core technology
for all the applications are shown herein. Moreover, the uniqueness
and advantage of the PENTAmer technology over other technologies,
e.g., direct PCR amplification or ligation-mediated PCR are evident
from these basic reactions.
[0266] In the simplest implementation, as set forth in FIG. 2, a
PENTAmer is created and amplified by: [0267] 1) Ligating a
nick-translation adaptor A to the proximal end of the source DNA
(the template); [0268] 2) Initiating a nick translation reaction at
the nick site of said adaptor using a DNA polymerase having 5'-3'
exonuclease activity; [0269] 3) Elongating the PENT product a
specific time; and [0270] 4) Appending nick-ligation adaptor B to
the distal, 3' end of the PENT product to form a PENTAmer-template
hybrid ("nascent PENTAmer").
[0271] While this basic technique sets forth the primary
methodology envisioned by the inventors to create a PENTAmer
product, it would be clear to one of ordinary skill that changes
could be made in the basic application in order to achieve an
analogous outcome. While the basic method is envisioned by the
inventors to be a simple and efficient means of constructing a
PENTAmer molecule, it is contemplated that alternate methods may
facilitate carrying out the instant invention.
[0272] The PENT reaction is initiated, continued, and terminated on
a largely double-stranded template, which gives the PENTAmer
amplification important advantages for creating DNA for sequence
analysis. An advantage of using PENTAmers to amplify different
regions of the template is the fact that in most applications
PENTAmers having different internal sequences have the same
terminal sequences. These advantages are important for creating
PENTAmers that are most useful as intermediates for in vitro or in
vivo amplification. Amplification of these intermediates is more
useful than direct amplification of DNA by cloning or PCR.
[0273] Initiation of the PENT reaction at the end of dsDNA
molecules makes the reaction specific to terminal sites,
independent of sequence. Internal sites cannot be mistakenly
synthesized, e.g., by sequence-dependent mispriming during a PCR
reaction. Conversely, any terminus can be made to initiate a PENT
reaction, independent of sequence.
[0274] The specificity of the PENT reaction can be preserved during
later steps in vitro or in vivo by incorporating distinguishable
nucleotides during the reaction. For example, incorporation of
exonuclease resistant nucleotides (e.g., phosphorothioates or
phosphoroboronates) allows the PENT products to be stabilized
during a nuclease digestion of the entire template molecule.
Alternatively, an affinity label (e.g., biotinylated bases) can be
added during PENT synthesis. After destruction of the template DNA
or affinity isolation of the PENT products, the PENTAmers can be
amplified in vitro or in vivo, without any background from
non-specific amplification of the template.
[0275] Continuation of the PENT reaction on a dsDNA template allows
the rate of synthesis of the strand to be independent of sequence.
This allows the length of the PENTAmer to be controlled by time of
the PENT reaction, independent of sequence. Such uniformity of
synthesis is not possible on a single-strand template, for example,
due to formation of secondary structure that can interfere with
polymerization. The uniform molecular weight of the PENTAmers make
them easier to amplify by cloning or PCR, which vary in efficiency
for different molecular weights. The uniform molecular weight also
make it possible for each PENTAmer to carry a similar amount of
sequence information.
[0276] Another advantage of the uniform size of PENTAmers of
different sequence, created by a single PENT reaction, is that they
can be easily separated from the template DNA on the basis of
molecular weight. This separation decreases the background
(increases the specificity) during subsequent PCR or cloning
steps.
[0277] In every replication reaction there is chance for
misincorporation of the wrong nucleotide. The frequency of
misincorporation is expected to be increased on a single-strand
template, because the template strand can "slip" especially in
repetitive DNA tracts and the polymerase can "stall" and "jump"
when encountering secondary structure in the template. Replication
of DNA in cells achieves high fidelity, in part because a largely
double-strand template is used. Thus, the PENT reaction could have
increased fidelity of base incorporation over primer extension on
single-strand DNA.
[0278] Termination of the PENT reaction on a largely double-strand
DNA molecule allows the PENTAmer to be separated according to the
molecular weight of the parent template after the PENT.
This-property allows all steps creating PENTAmers to be performed
on a mixture of templates of different molecular weights, which can
be later fractionated by molecular weight. In many applications
this allows for extensive multiplexing of the reactions to save
time and effort.
[0279] The initiation site for a PENT reaction (as distinct from an
oligonucleotide primer) can be introduced by any method that
results in a free 3' OH group on one side of a nick or gap in
otherwise double-stranded DNA, including, but not limited to such
groups introduced by: a) digestion by a restriction enzyme-under
conditions that only one strand of the double-stranded DNA template
is hydrolyzed; b) random nicking by a chemical agent or an
endonuclease such as DNAase I; c) nicking by f1 gene product II or
homologous enzymes from other filamentous bacteriophage (Meyer and
Geider, 1979); and/or d) chemical nicking of the template directed
by triple-helix formation (Grant and Dervan, 1996).
[0280] However, for PENTAmer synthesis, the primary means of
initiation is through the ligation of an oligonucleotide primer
onto the target nucleic acid. This very powerful and general method
to introduce an initiation site for strand replacement synthesis
employs a panel of special double-stranded oligonucleotide adapters
designed specifically to be ligated to the termini produced by
restriction enzymes. Each of these adapters is designed such that
the 3' end of the restriction fragment to be sequenced can be
covalently joined (ligated) to the adaptor, but the 5' end cannot.
Thus the 3' end of the adaptor remains as a free 3' OH at a I
nucleotide gap in the DNA, which can serve as an initiation site
for the strand-replacement sequencing of the restriction fragment.
Because the number of different 3' and 5' overhanging sequences
that can be produced by all restriction enzymes is finite, and the
design of each adaptor will follow the same simple strategy, above,
the design of every one of the possible adapters can be foreseen,
even for restriction enzymes that have not yet been identified. To
facilitate sequencing, a set of such adapters for strand
replacement initiation can be synthesized with labels (radioactive,
fluorescent, or chemical) and incorporated into the
dideoxyribonucleotide-terminated strands to facilitate the
detection of the bands on sequencing gels.
[0281] More specifically, adapters with 5' and 3' extensions can be
used in combination with restriction enzymes generating 2-base,
3-base and 4-base (or more) overhangs. The sense strand (the upper
strand shown in Table 1 below) of the adaptor has a 5' phosphate
group that can be efficiently ligated to the restriction fragment
to be sequenced. The anti-sense strand (bottom, underlined) is not
phosphorylated at the 5' end and is missing one base at the 3' end,
effectively preventing ligation between adapters. This gap does not
interfere with the covalent joining of the sense strand to the
restriction fragment, and leaves a free 3' OH site in the
anti-sense strand for initiation of strand replacement
synthesis.
[0282] Polymerization may be terminated specific distances from the
priming site by inhibiting the polymerase a specific time after
initiation. For example, under specific conditions Taq DNA
polymerase is capable of strand replacement at the rate of 250
bases/min, so that arrest of the polymerase after 10 min occurs
about 2500 bases from the initiation site. This strategy allows for
pieces of DNA to be isolated from different locations in the
genome.
[0283] PENT reactions may also be terminated by incorporation of a
dideoxyribonucleotide instead of the homologous naturally-occurring
nucleotide. This terminates growth of the new DNA strand at one of
the positions that was formerly occupied by dA, dT, dG, or dC by
incorporating ddA, ddT, ddG, or ddC. In principle, the reaction can
be terminated using any suitable nucleotide analogs that prevent
continuation of DNA synthesis at that site. For specific mapping
applications, such as the determination of the length of telomeres,
the polymerization reaction can be terminated when the polymerase
cannot insert a particular nucleotide, because it is missing from
the reaction mixture.
[0284] The next sections provide a brief overview of materials and
techniques that a person of ordinary skill would deem important to
the practice of the invention. These sections are followed by a
more detailed description of the various embodiments of the
invention.
A. Nucleic Acids
[0285] Genes are sequences of DNA in an organism's genome encoding
information that is converted into various products making up a
whole cell. They are expressed by the process of transcription,
which involves copying the sequence of DNA into RNA. Most genes
encode information to make proteins, but some encode RNAs involved
in other processes. If a gene encodes a protein, its transcription
product is called mRNA ("messenger" RNA). After transcription in
the nucleus (where DNA is located), the mRNA must be transported
into the cytoplasm for the process of translation, which converts
the code of the mRNA into a sequence of amino acids to form
protein. In order to direct transport into the cytoplasm, the 3'
ends of mRNA molecules are post-transcriptionally modified by
addition of several adenylate residues to form the "polyA" tail.
This characteristic modification distinguishes gene expression
products destined to make protein from other molecules in the cell,
and thereby provides one means for detecting and monitoring the
gene expression activities of a cell.
[0286] The term "nucleic acid" will generally refer to at least one
molecule or strand of DNA, RNA or a derivative or mimic thereof,
comprising at least one nucleobase, such as, for example, a
naturally occurring purine or pyrimidine base found in DNA (e.g.
adenine "A," guanine "G," thymine "T" and cytosine "C") or RNA
(e.g. A, G, uracil "U" and C). The term "nucleic acid" encompass
the terms "oligonucleotide" and "polynucleotide." The term
"oligonucleotide" refers to at least one molecule of between about
3 and about 100 nucleobases in length. The term "polynucleotide"
refers to at least one molecule of greater than about 100
nucleobases in length. These definitions generally refer to at
least one single-stranded molecule, but in specific embodiments
will also encompass at least one additional strand that is
partially, substantially or fully complementary to the at least one
single-stranded molecule. Thus, a nucleic acid may encompass at
least one double-stranded molecule or at least one triple-stranded
molecule that comprises one or more complementary strand(s) or
"complement(s)" of a particular sequence comprising a strand of the
molecule. As used herein, a single stranded nucleic acid may be
denoted by the prefix "ss", a double stranded nucleic acid by the
prefix "ds", and a triple stranded nucleic acid by the prefix
"ts."
[0287] Nucleic acid(s) that are "complementary" or "complement(s)"
are those that are capable of base-pairing according to the
standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding
complementarity rules. As used herein, the term "complementary" or
"complement(s)" also refers to nucleic acid(s) that are
substantially complementary, as may be assessed by the same
nucleotide comparison set forth above. The term "substantially
complementary" refers to a nucleic acid comprising at least one
sequence of consecutive nucleobases, or semiconsecutive nucleobases
if one or more nucleobase moieties are not present in the molecule,
are capable of hybridizing to at least one nucleic acid strand or
duplex even if less than all nucleobases do not base pair with a
counterpart nucleobase. In certain embodiments, a "substantially
complementary" nucleic acid contains at least one sequence in which
about 70%, about 71%, about 72%, about 73%, about 74%, about 75%,
about 76%, about 77%, about 77%, about 78%, about 79%, about 80%,
about 81%, about 82%, about 83%, about 84%, about 85%, about 86%,
about 87%, about 88%, about 89%, about 90%, about 91%, about 92%,
about 93%, about 94%, about 95%, about 96%, about 97%, about 98%,
about 99%, to about 100%, and any range therein, of the nucleobase
sequence is capable of base-pairing with at least one single or
double stranded nucleic acid molecule during hybridization. In
certain embodiments, the term "substantially complementary" refers
to at least one nucleic acid that may hybridize to at least one
nucleic acid strand or duplex in stringent conditions. In certain
embodiments, a "partly complementary" nucleic acid comprises at
least one sequence that may hybridize in low stringency conditions
to at least one single or double stranded nucleic acid, or contains
at least one sequence in which less than about 70% of the
nucleobase sequence is capable of base-pairing with at least one
single or double stranded nucleic acid molecule during
hybridization.
[0288] As used herein, "hybridization", "hybridizes" or "capable of
hybridizing" is understood to mean the forming of a double or
triple stranded molecule or a molecule with partial double or
triple stranded nature. The term "hybridization", "hybridize(s)" or
"capable of hybridizing" encompasses the terms "stringent
condition(s)" or "high stringency" and the terms "low stringency"
or "low stringency condition(s)."
[0289] As used herein "stringent condition(s)" or "high stringency"
are those that allow hybridization between or within one or more
nucleic acid strand(s) containing complementary sequence(s), but
precludes hybridization of random sequences. Stringent conditions
tolerate little, if any, mismatch between a nucleic acid and a
target strand. Such conditions are well known to those of ordinary
skill in the art, and are preferred for applications requiring high
selectivity. Non-limiting applications include isolating at least
one nucleic acid, such as a gene or nucleic acid segment thereof,
or detecting at least one specific mRNA transcript or nucleic acid
segment thereof, and the like.
[0290] Stringent conditions may comprise low salt and/or high
temperature conditions, such as provided by about 0.02 M to about
0.15 M NaCl at temperatures of about 50.degree. C. to about
70.degree. C. It is understood that the temperature and ionic
strength of a desired stringency are determined in part by the
length of the particular nucleic acid(s), the length and nucleobase
content of the target sequence(s), the charge composition of the
nucleic acid(s), and to the presence of formamide,
tetraethylammonium chloride or other solvent(s) in the
hybridization mixture. It is generally appreciated that conditions
may be rendered more stringent, such as, for example, the addition
of increasing amounts of formamide.
[0291] It is also understood that these ranges, compositions and
conditions for hybridization are mentioned by way of non-limiting
example only, and that the desired stringency for a particular
hybridization reaction is often determined empirically by
comparison to one or more positive or negative controls. Depending
on the application envisioned it is preferred to employ varying
conditions of hybridization to achieve varying degrees of
selectivity of the nucleic acid(s) towards target sequence(s). In a
non-limiting example, identification or isolation of related target
nucleic acid(s) that do not hybridize to a nucleic acid under
stringent conditions may be achieved by hybridization at low
temperature and/or high ionic strength. Such conditions are termed
"low stringency" or "low stringency conditions", and non-limiting
examples of low stringency include hybridization performed at about
0.15 M to about 0.9 M NaCl at a temperature range of about
20.degree. C. to about 50.degree. C. Of course, it is within the
skill of one in the art to further modify the low or high
stringency conditions to suite a particular application.
[0292] As used herein a "nucleobase" refers to a naturally
occurring heterocyclic base, such as A, T, G, C or U ("naturally
occurring nucleobase(s)"), found in at least one naturally
occurring nucleic acid (i.e. DNA and RNA), and their naturally or
non-naturally occurring derivatives and mimics. Non-limiting
examples of nucleobases include purines and pyrimidines, as well as
derivatives and mimics thereof, which generally can form one or
more hydrogen bonds ("anneal" or "hybridize") with at least one
naturally occurring nucleobase in manner that may substitute for
naturally occurring nucleobase pairing (e.g. the hydrogen bonding
between A and T, G and C, and A and U).
[0293] As used herein, a "nucleotide" refers to a nucleoside
further comprising a "backbone moiety" generally used for the
covalent attachment of one or more nucleotides to another molecule
or to each other to form one or more nucleic acids. The "backbone
moiety" in naturally occurring nucleotides typically comprises a
phosphorus moiety, which is covalently attached to a 5-carbon
sugar. The attachment of the backbone moiety typically occurs at
either the 3'- or 5'-position of the 5-carbon sugar. However, other
types of attachments are known in the art, particularly when the
nucleotide comprises derivatives or mimics of a naturally occurring
5-carbon sugar or phosphorus moiety, and non-limiting examples are
described herein.
B. Restriction Enzymes
[0294] Restriction-enzymes recognize specific short DNA sequences
four to eight nucleotides long (see Table 1), and cleave the DNA at
a site within this sequence. In the context of the present
invention, restriction enzymes are used to cleave DNA molecules at
sites corresponding to various restriction-enzyme recognition
sites. The site may be specifically modified to allow for the
initiation of the PENT reaction. In another embodiment, if the
sequence of the recognition site is known primers can be designed
comprising nucleotides corresponding to the recognition sequences.
These primers, further comprising PENT initiation sites may be
ligated to the digested DNA.
[0295] Restriction-enzymes recognize specific short DNA sequences
four to eight nucleotides long (see Table 1), and cleave the DNA at
a site within this sequence. In the context of the present
invention, restriction enzymes are used to cleave cDNA molecules at
sites corresponding to various restriction-enzyme recognition
sites. Frequently cutting enzymes, such as the four-base cutter
enzymes, are preferred as this yields DNA fragments that are in the
right size range for subsequent amplification reactions. Some of
the preferred four-base cutters are NlaIII, DpnII, Sau3AI, Hsp92II,
MboI, NdeII, Bspl431, Tsp509 I, HhaI, HinPII, HpaII, MspI, Taq
alphaI, MaeII or K2091.
[0296] As the sequence of the recognition site is known (see list
below), primers can be designed comprising nucleotides
corresponding to the recognition sequences. If the primer sets have
in addition to the restriction recognition sequence, degenerate
sequences corresponding to different combinations of nucleotide
sequences, one can use the primer set to amplify DNA fragments that
have been cleaved by the particular restriction enzyme. The list
below exemplifies the currently known restriction enzymes that may
be used in the invention. TABLE-US-00001 TABLE 1 RESTRICTION
ENZYMES Enzyme Name Recognition Sequence AatII GACGTC Acc65 I
GGTACC Acc I GTMKAC Aci I CCGC Acl I AACGTT Afe I AGCGCT Afl II
CTTAAG Afl III ACRYGT Age I ACCGGT Ahd I GACNNNNNGTC Alu I AGCT Alw
I GGATG AlwN I CAGNNNCTG Apa I GGGCCC ApaL I GTGCAC Apo I RAATTY
Asc I GGCGCGCC Ase I ATTAAT Ava I CYCGRG Ava II GGWCC Avr II CCTAGG
Bae I NACNNNNGTAPyCN BamH I GGATCC Ban I GGYRCC Ban II GRGCYC Bbs I
GAAGAC Bbv I GCAGC BbvC I CCTCAGC Bcg I CGANNNNNNTGC BciV I GTATCC
Bcl I TGATCA Bfa I CTAG Bgl I GCCNNNNNGGC Bgl II AGATCT Blp I
GCTNAGC Bmr I ACTGGG Bpm I CTGGAG BsaA I YACGTR BsaB I GATNNNNATC
BsaH I GRCGYC Bsa I GGTCTC BsaJ I CCNNGG BsaW I WCCGGW BseR I
GAGGAG Bsg I GTGCAG BsiE I CGRYCG BsiHKA I GWGCWC BsiW I CGTACG Bsl
I CCNNNNNNNGG BsmA I GTGTC BsmB I CGTCTC BsmF I GGGAC Bsm I GAATGC
BsoB I CYCGRG Bsp1286 I GDGCHC BspD I ATCGAT BspE I TCCGGA BspH I
TCATGA BspM I ACCTGC BsrB I CCGCTC BsrD I GCAATG BsrF I RCCGGY BsrG
I TGTACA Bsr I ACTGG BssH II GCGCGC BssK I CCNGG Bst4C I ACNGT BssS
I CACGAG BstAP I GCANNNNNTGC BstB I TTCGAA BstE II GGTNACC BstF5 I
GGATGNN BstN I CCWGG BstU I CGCG BstX I CCANNNNNNTGG BstY I RGATCY
BstZ17 I GTATAC Bsu36 I CCTNAGG Btg I CCPuPyGG Btr I CACGTG Cac8 I
GCNNGC Cla I ATCGAT Dde I CTNAG Dpn I GATC Dpn II GATC Dra I TTTAAA
Dra III CACNNNGTG Drd I GACNNNNNNGTC Eae I YGGCCR Eag I CGGCCG Ear
I CTCTTC Eci I GGCGGA EcoN I CCTNNNNNAGG EcoO109 I RGGNCCY EcoR I
GAATTC EcoR V GATATC Fau I CCCGCNNNN Fnu4H I GCNGC Fok I GGATG Fse
I GGCCGGCC Fsp I TGCGCA Hae II RGCGCY Hae III GGCC Hga I GACGC Hha
I GCGC Hinc II GTYRAC Hind III AAGCTT Hinf I GANTC HinP1 I GCGC Hpa
I GTTAAC Hpa II CCGG Hph I GGTGA Kas I GCCGCC Kpn I GGTACC Mbo I
GATC Mbo II GAAGA Mfe I CAATTG Mlu I ACGCGT
Mly I GAGTCNNNNN Mnl I CCTC Msc I TGGCCA Mse I TTAA Msl I
CAYNNNNRTG MspAl I CMGCKG Msp I CCGG Mwo I GCNNNNNNNGC Nae I GCCGGC
Nar I GGCGCC Nci I CCSGG Nco I CCATGG Nde I CATATG NgoMI V GCCGGC
Nhe I GCTAGC Nla III CATG Nla IV GGNNCC Not I GCGGCCGC Nru I TCGCGA
Nsi I ATGCAT Nsp I RCATGY Pac I TTAATTAA PaeR7 I CTCGAG Pci I
ACATGT PflF I GACNNNGTC PflM I CCANNNNNTGG PleI GAGTC Pme I
GTTTAAAC Pml I CACGTG PpuM I RGGWCCY PshA I GACNNNNGTC Psi I TTATAA
PspG I CCWGG PspOM I GGGCCC Pst I CTGCAG Pvu I CGATCG Pvu II CAGCTG
Rsa I GTAC Rsr II CGGWCCG Sac I GAGCTC Sac II CCGCGG Sal I GTCGAC
Sap I GCTCTTC Sau3A I GATC Sau96 I GGNCC Sbf I CCTGCAGG Sca I
AGTACT ScrF I CCNGG SexA I ACCWGGT SfaN I GCATC Sfc I CTRYAG Sfi I
GGCCNNNNNGGCC Sfo I GGCGCC SgrA I CRCCGGYG Sma I CCCGGG Sml I
CTYRAG SnaB I TACGTA Spe I ACTAGT Sph I GCATGC Ssp I AATATT Stu I
AGGCCT Sty I CCWWGG Swa I ATTTAAAT Taq I TCGA Tfi I GAWTC Tli I
CTCGAG Tse I GCWGC Tsp45 I GTSAC Tsp509 I AATT TspR I CAGTG Tth111
I GACNNNGTC Xba I TCTAGA Xcm I CCANNNNNNNNNTGG Xho I CTCGAG Xma I
CCCGGG Xmn I GAANNNNTTC
Other Enzymes
[0297] Other enzymes that may be used in conjunction with the
invention include nucleic acid modifying enzymes listed in the
following tables. TABLE-US-00002 TABLE 2 POLYMERASES AND REVERSE
TRANSCRIPTASES Thermostable DNA Polymerases: OmniBase .TM.
Sequencing Enzyme Pfu DNA Polymerase Taq DNA Polymerase Taq DNA
Polymerase, Sequencing Grade TaqBead .TM. Hot Start Polymerase
AmpliTaq Gold Tfl DNA Polymerase Tli DNA Polymerase Tth DNA
Polymerase DNA Polymerases: DNA Polymerase I, Klenow Fragment,
Exonuclease Minus DNA Polymerase I DNA Polymerase I Large (Klenow)
Fragment Terminal Deoxynucleotidyl Transferase T4 DNA Polymerase
Reverse Transcriptases: AMV Reverse Transcriptase M-MLV Reverse
Transcriptase
[0298] TABLE-US-00003 TABLE 3 DNA/RNA MODIFYING ENZYMES Ligases: T4
DNA Ligase Kinases T4 Polynucleotide Kinase
C. DNA Polymerases
[0299] In the context of the present invention it is generally
contemplated that the DNA polymerase will retain 5'-3' exonuclease
activity. Nevertheless, it is envisioned that the methods of the
invention could be carried out with one or more enzymes where
multiple enzymes combine to carry out the function of a single DNA
polymerase molecule retaining 5'-3' exonuclease activity. Effective
polymerases which retain 5'-3' exonuclease activity include, for
example, E. coli DNA polymerase I, Taq DNA polymerase, S.
pneumoniae DNA polymerase I, Tfl DNA polymerase, D. radiodurans DNA
polymerase I, Tth DNA polymerase, Tth XL DNA polymerase, M.
tuberculosis DNA polymerase I, M. thermoautotrophicum DNA
polymerase I, Herpes simplex-1 DNA polymerase, E. coli DNA
polymerase I Klenow fragment, vent DNA polymerase, thermosequenase
and wild-type or modified T7 DNA polymerases. In preferred
embodiments, the effective polymerase will be E. coli DNA
polymerase I, M. tuberculosis DNA polymerase I or Taq DNA
polymerase.
[0300] Where the break in the substantially double stranded nucleic
acid template is a gap of at least a base or nucleotide in length
that comprises, or is reacted to comprise, a 3' hydroxyl group, the
range of effective polymerases that may be used is even broader. In
such aspects, the effective polymerase may be, for example, E. coli
DNA polymerase I, Taq DNA polymerase, S. pneumoniae DNA polymerase
I, Tfl DNA polymerase, D. radiodurans DNA polymerase I, Tth DNA
polymerase, Tth XL DNA polymerase, M. tuberculosis DNA polymerase
I, M. thermoautotrophicum DNA polymerase I, Herpes simplex-1 DNA
polymerase, E. coli DNA polymerase I Klenow fragment, T4 DNA
polymerase, vent DNA polymerase, thermosequenase or a wild-type or
modified T7 DNA polymerase. In preferred aspects, the effective
polymerase will be E. coli DNA polymerase I, M. tuberculosis DNA
polymerase 1, Taq DNA polymerase or T4 DNA polymerase.
D. Hybridization
[0301] PENTAmer synthesis requires the use of primers which
hybridize to specific sequences. Further, PENT and PANT reaction
products may be useful as probes in hybridization analysis. The use
of a probe or primer of between 13 and 100 nucleotides, preferably
between 17 and 100 nucleotides in length, or in some aspects of the
invention up to 1-2 kb or more in length, allows the formation of a
duplex molecule that is both stable and selective. Molecules having
complementary sequences over contiguous stretches greater than 20
bases in length are generally preferred, to increase stability
and/or selectivity of the hybrid molecules obtained. One will
generally prefer to design nucleic acid molecules for hybridization
having one or more complementary sequences of 20 to 30 nucleotides,
or even longer where desired. Such fragments may be readily
prepared, for example, by directly synthesizing the fragment by
chemical means or by introducing selected sequences into
recombinant vectors for recombinant production.
[0302] Depending on the application envisioned, one would desire to
employ varying conditions of hybridization to achieve varying
degrees of selectivity of the probe or primers for the target
sequence. For applications requiring high selectivity, one will
typically desire to employ relatively high stringency conditions to
form the hybrids. For example, relatively low salt and/or high
temperature conditions, such as provided by about 0.02 M to about
0.10 M NaCl at temperatures of about 50.degree. C. to about
70.degree. C. Such high stringency conditions tolerate little, if
any, mismatch between the probe or primers and the template or
target strand and would be particularly suitable for isolating
specific genes or for detecting specific mRNA transcripts. It is
generally appreciated that conditions can be rendered more
stringent by the addition of increasing amounts of formamide.
[0303] Conditions may be rendered less stringent by increasing salt
concentration and/or decreasing temperature. For example, a medium
stringency condition could be provided by about 0.1 to 0.25 M NaCl
at temperatures of about 37.degree. C. to about 55.degree. C.,
while a low stringency condition could be provided by about 0.15 M
to about 0.9 M salt, at temperatures ranging from about 20.degree.
C. to about 55.degree. C. Hybridization conditions can be readily
manipulated depending on the desired results.
[0304] In other embodiments, hybridization may be achieved under
conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3
mM MgCl.sub.2, 1.0 mM dithiothreitol, at temperatures between
approximately 20.degree. C. to about 37.degree. C. Other
hybridization conditions utilized could include approximately 10 mM
Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl.sub.2, at temperatures
ranging from approximately 40.degree. C. to about 72.degree. C.
E. Amplification of Nucleic Acids
[0305] Nucleic acids useful as templates for amplification may be
isolated from cells, tissues or other samples according to standard
methodologies (Sambrook et al., 1989). In certain embodiments,
analysis is performed on whole cell or tissue homogenates or
biological fluid samples without substantial purification of the
template nucleic acid. The nucleic acid may be genomic DNA or
fractionated or whole cell RNA. Where RNA is used, it may be
desired to first convert the RNA to a complementary DNA.
[0306] The term "primer," as used herein, is meant to encompass any
nucleic acid that is capable of priming the synthesis of a nascent
nucleic acid in a template-dependent process. Typically, primers
are oligonucleotides from ten to twenty and/or thirty base pairs in
length, but longer sequences can be employed. Primers may be
provided in double-stranded and/or single-stranded form, although
the single-stranded form is preferred.
[0307] Pairs of primers designed to selectively hybridize to
nucleic acids are contacted with the template nucleic acid under
conditions that permit selective hybridization. Depending upon the
desired application, high stringency hybridization conditions may
be selected that will only allow hybridization to sequences that
are completely complementary to the primers. In other embodiments,
hybridization may occur under reduced stringency to allow for
amplification of nucleic acids contain one or more mismatches with
the primer sequences. Once hybridized, the template-primer complex
is contacted with one or more enzymes that facilitate
template-dependent nucleic acid synthesis. Multiple rounds of
amplification, also referred to as "cycles," are conducted until a
sufficient amount of amplification product is produced.
[0308] The amplification product may be detected or quantified. In
certain applications, the detection may be performed by visual
means. Alternatively, the detection may involve indirect
identification of the product via chemiluminescence, radioactive
scintigraphy of incorporated radiolabel or fluorescent label or
even via a system using electrical and/or thermal impulse signals
(Affymax technology).
[0309] A number of template dependent processes are available to
amplify the oligonucleotide sequences present in a given template
sample. One of the best known amplification methods is the
polymerase chain reaction (referred to as PCR.TM.) which is
described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and
4,800,159, and in Innis et al., 1990, each of which is incorporated
herein by reference in their entirety. Briefly, two synthetic
oligonucleotide primers, which are complementary to two regions of
the template DNA (one for each strand) to be amplified, are added
to the template DNA (that need not be pure), in the presence of
excess deoxynucleotides (dNTP's) and a thermostable polymerase,
such as, for example, Taq (Thermus aquaticus) DNA polymerase. In a
series (typically 30-35) of temperature cycles, the target DNA is
repeatedly denatured (around 90.degree. C.), annealed to the
primers (typically at 50-60.degree. C.) and a daughter strand
extended from the primers (72.degree. C.). As the daughter strands
are created they act as templates in subsequent cycles. Thus the
template region between the two primers is amplified exponentially,
rather than linearly.
[0310] A reverse transcriptase PCR.TM. amplification procedure may
be performed to quantify the amount of mRNA amplified. Methods of
reverse transcribing RNA into cDNA are well known and described in
Sambrook et al., 1989. Alternative methods for reverse
transcription utilize thermostable DNA polymerases. These methods
are described in WO 90/07641. Polymerase chain reaction
methodologies are well known in the art. Representative methods of
RT-PCR are described in U.S. Pat. No. 5,882,864.
[0311] 1. LCR
[0312] Another method for amplification is the ligase chain
reaction ("LCR"), disclosed in European Patent Application No.
320,308, incorporated herein by reference. In LCR, two
complementary probe pairs are prepared, and in the presence of the
target sequence, each pair will bind to opposite complementary
strands of the target such that they abut. In the presence of a
ligase, the two probe pairs will link to form a single unit. By
temperature cycling, as in PCR.TM., bound ligated units dissociate
from the target and then serve as "target sequences" for ligation
of excess probe pairs. U.S. Pat. No. 4,883,750, incorporated herein
by reference, describes a method similar to LCR for binding probe
pairs to a target sequence.
[0313] 2. Qbeta Replicase
[0314] Qbeta Replicase, described in PCT Patent Application No.
PCT/US87/00880, also may be used as still another amplification
method in the present invention. In this method, a replicative
sequence of RNA which has a region complementary to that of a
target is added to a sample in the presence of an RNA polymerase.
The polymerase will copy the replicative sequence which can then be
detected.
[0315] 3. Isothermal Amplification
[0316] An isothermal amplification method, in which restriction
endonucleases and ligases are used to achieve the amplification of
target molecules that contain nucleotide
5'-[.alpha.-thio]-triphosphates in one strand of a restriction site
also may be useful in the amplification of nucleic acids in the
present invention. Such an amplification method is described by
Walker et al. 1992, incorporated herein by reference.
[0317] 4. Strand Displacement Amplification
[0318] Strand Displacement Amplification (SDA) is another method of
carrying out isothermal amplification of nucleic acids which
involves multiple rounds of strand displacement and synthesis,
i.e., nick translation. A similar method, called Repair Chain
Reaction (RCR), involves annealing several probes throughout a
region targeted for amplification, followed by a repair reaction in
which only two of the four bases are present. The other two bases
can be added as biotinylated derivatives for easy detection. A
similar approach is used in SDA.
[0319] 5. Cyclic Probe Reaction
[0320] Target specific sequences can also be detected using a
cyclic probe reaction (CPR). In CPR, a probe having 3' and 5'
sequences of non-specific DNA and a middle sequence of specific RNA
is hybridized to DNA which is present in a sample. Upon
hybridization, the reaction is treated with RNase H, and the
products of the probe identified as distinctive products which are
released after digestion. The original template is annealed to
another cycling probe and the reaction is repeated.
[0321] 6. Transcription-Based Amplification
[0322] Other nucleic acid amplification procedures include
transcription-based amplification systems (TAS), including nucleic
acid sequence based amplification (NASBA) and 3SR, Kwoh et al.,
1989; PCT Patent Application WO 88/10315 et al., 1989, each
incorporated herein by reference).
[0323] In NASBA, the nucleic acids can be prepared for
amplification by standard phenol/chloroform extraction, heat
denaturation of a clinical sample, treatment with lysis buffer and
minispin columns for isolation of DNA and RNA or guanidinium
chloride extraction of RNA. These amplification techniques involve
annealing a primer which has target specific sequences. Following
polymerization, DNA/RNA hybrids are digested with RNase H while
double stranded DNA molecules are heat denatured again. In either
case the single stranded DNA is made fully double stranded by
addition of second target specific primer, followed by
polymerization. The double-stranded DNA molecules are then multiply
transcribed by a polymerase such as T7 or SP6. In an isothermal
cyclic reaction, the RNA's are reverse transcribed into double
stranded DNA, and transcribed once against with a polymerase such
as T7 or SP6. The resulting products, whether truncated or
complete, indicate target specific sequences.
[0324] 7. Other Amplification Methods
[0325] Other amplification methods, as described in British Patent
Application No. GB 2,202,328, and in PCT Patent Application No.
PCT/US89/01025, each incorporated herein by reference, may be used
in accordance with the present invention. In the former
application, "modified" primers are used in a PCR.TM. like,
template and enzyme dependent synthesis. The primers may be
modified by labeling with a capture moiety (e.g., biotin) and/or a
detector moiety (e.g., enzyme). In the latter application, an
excess of labeled probes are added to a sample. In the presence of
the target sequence, the probe binds and is cleaved catalytically.
After cleavage, the target sequence is released intact to be bound
by excess probe. Cleavage of the labeled probe signals the presence
of the target sequence.
[0326] Miller et al., PCT Patent Application WO 89/06700
(incorporated herein by reference) disclose a nucleic acid sequence
amplification scheme based on the hybridization of a
promoter/primer sequence to a target single-stranded DNA ("ssDNA")
followed by transcription of many RNA copies of the sequence. This
scheme is not cyclic, i.e., new templates are not produced from the
resultant RNA transcripts.
[0327] Other suitable amplification methods include "race" and
"one-sided PCR.TM." (Frohman, 1990; Ohara et al., 1989, each herein
incorporated by reference). Methods based on ligation of two (or
more) oligonucleotides in the presence of nucleic acid having the
sequence of the resulting "di-oligonucleotide", thereby amplifying
the di-oligonucleotide, also may be used in the amplification step
of the present invention, Wu et al., 1989, incorporated herein by
reference).
F. Detection of Nucleic Acids
[0328] Following any amplification, it may be desirable to separate
the amplification product from the template and/or the excess
primer. In one embodiment, amplification products are separated by
agarose, agarose-acrylamide or polyacrylamide gel electrophoresis
using standard methods (Sambrook et al., 1989). Separated
amplification products may be cut out and eluted from the gel for
further manipulation. Using low melting point agarose gels, the
separated band may be removed by heating the gel, followed by
extraction of the nucleic acid.
[0329] Separation of nucleic acids may also be effected by
chromatographic techniques known in art. There are many kinds of
chromatography which may be used in the practice of the present
invention, including adsorption, partition, ion-exchange,
hydroxylapatite, molecular sieve, reverse-phase, column, paper,
thin-layer, and gas chromatography as well as HPLC.
[0330] In certain embodiments, the amplification products are
visualized. A typical visualization method involves staining of a
gel with ethidium bromide and visualization of bands under UV
light. Alternatively, if the amplification products are integrally
labeled with radio- or fluorometrically-labeled nucleotides, the
separated amplification products can be exposed to x-ray film or
visualized under the appropriate excitatory spectra.
[0331] In one embodiment, following separation of amplification
products, a labeled nucleic acid probe is brought into contact with
the amplified marker sequence. The probe preferably is conjugated
to a chromophore but may be radiolabeled. In another embodiment,
the probe is conjugated to a binding partner, such as an antibody
or biotin, or another binding partner carrying a detectable
moiety.
[0332] In particular embodiments, detection is by Southern blotting
and hybridization with a labeled probe. The techniques involved in
Southern blotting are well known to those of skill in the art. See
Sambrook et al., 1989. One example of the foregoing is described in
U.S. Pat. No. 5,279,721, incorporated by reference herein, which
discloses an apparatus and method for the automated electrophoresis
and transfer of nucleic acids. The apparatus permits
electrophoresis and blotting without external manipulation of the
gel and is ideally suited to carrying out methods according to the
present invention.
[0333] Other methods of nucleic acid detection that may be used in
the practice of the instant invention are disclosed in U.S. Pat.
Nos. 5,840,873, 5,843,640, 5,843,651, 5,846,708, 5,846,717,
5,846,726, 5,846,729, 5,849,487, 5,853,990, 5,853,992, 5,853,993,
5,856,092, 5,861,244, 5,863,732, 5,863,753, 5,866,331, 5,905,024,
5,910,407, 5,912,124, 5,912,145, 5,919,630, 5,925,517, 5,928,862,
5,928,869, 5,929,227, 5,932,413 and 5,935,791, each of which is
incorporated herein by reference.
G. Separation and Quantitation Methods
[0334] Following amplification, it may be desirable to separate the
amplification products of several different lengths from each other
and from the template and the excess primer for the purpose
analysis or more specifically for determining whether specific
amplification has occurred.
[0335] 1. Gel Electrophoresis
[0336] In one embodiment, amplification products are separated by
agarose, agarose-acrylamide or polyacrylamide gel electrophoresis
using standard methods (Sambrook et al., 1989).
[0337] Separation by electrophoresis is based upon the differential
migration through a gel according to the size and ionic charge of
the molecules in an electrical field. High resolution techniques
normally use a gel support for the fluid phase. Examples of gels
used are starch, acrylamide, agarose or mixtures of acrylamide and
agarose. Frictional resistance produced by the support causes size,
rather than charge alone, to become the major determinant of
separation. Smaller molecules with a more negative charge will
travel faster and further through the gel toward the anode of an
electrophoretic cell when high voltage is applied. Similar
molecules will group on the gel. They may be visualized by staining
and quantitated, in relative terms, using densitometers which
continuously monitor the photometric density of the resulting
stain. The electrolyte may be continuous (a single buffer) or
discontinuous, where a sample is stacked by means of a buffer
discontinuity, before it enters the running gel/ running buffer.
The gel may be a single concentration or gradient in which pore
size decreases with migration distance. In SDS gel electrophoresis
of proteins or electrophoresis of polynucleotides, mobility depends
primarily on size and is used to determined molecular weight. In
pulse field electrophoresis, two fields are applied alternately at
right angles to each other to minimize diffusion mediated spread of
large linear polymers.
[0338] Agarose gel electrophoresis facilitates the separation of
DNA or RNA based upon size in a matrix composed of a highly
purified form of agar. Nucleic acids tend to become oriented in an
end on position in the presence of an electric field. Migration
through the gel matrices occurs at a rate inversely proportional to
the logio of the number of base pairs (Sambrook et al., 1989).
[0339] Polyacrylamide gel electrophoresis (PAGE) is an analytical
and separative technique in which molecules, particularly proteins,
are separated by their different electrophoretic mobilities in a
hydrated gel. The gel suppresses convective mixing of the fluid
phase through which the electrophoresis takes place and contributes
molecular sieving. Commonly carried out in the presence of the
anionic detergent sodium dodecylsulphate (SDS). SDS denatures
proteins so that noncovalently associating sub unit polypeptides
migrate independently and by binding to the proteins confers a net
negative charge roughly proportional to the chain weight.
[0340] 2. Chromatographic Techniques
[0341] Alternatively, chromatographic techniques may be employed to
effect separation. There are many kinds of chromatography which may
be used in the present invention: adsorption, partition,
ion-exchange and molecular sieve, and many specialized techniques
for using them including column, paper, thin-layer and gas
chromatography (Freifelder, 1982). In yet another alternative,
labeled cDNA products, such as biotin or antigen can be captured
with beads bearing avidin or antibody, respectively.
[0342] 3. Microfluidic Techniques
[0343] Microfluidic techniques include separation on a platform
such as microcapillaries, designed by ACLARA BioSciences Inc., or
the LabChip.TM. "liquid integrated circuits" made by Caliper
Technologies Inc. These microfluidic platforms require only
nanoliter volumes of sample, in contrast to the microliter volumes
required by other separation technologies. Miniaturizing some of
the processes involved in genetic analysis has been achieved using
microfluidic devices. For example, published PCT Application No. WO
94/05414, to Northrup and White, incorporated herein by reference,
reports an integrated micro-PCR.TM. apparatus for collection and
amplification of nucleic acids from a specimen. U.S. Pat. Nos.
5,304,487 and 5,296,375, discuss devices for collection and
analysis of cell containing samples and are incorporated herein by
reference. U.S. Pat. No. 5,856,174 describes an apparatus which
combines the various processing and analytical operations involved
in nucleic acid analysis and is incorporated herein by
reference.
[0344] 4. Capillary Electrophoresis
[0345] In some embodiments, it may be desirable to provide an
additional, or alternative means for analyzing the amplified genes.
In these embodiment, micro capillary arrays are contemplated to be
used for the analysis.
[0346] Microcapillary array electrophoresis generally involves the
use of a thin capillary or channel which may or may not be filled
with a particular separation medium. Electrophoresis of a sample
through the capillary provides a size based separation profile for
the sample. The use of microcapillary electrophoresis in size
separation of nucleic acids has been reported in, for example,
Woolley and Mathies, 1994. Microcapillary array electrophoresis
generally provides a rapid method for size-based sequencing,
PCR.TM. product analysis and restriction fragment sizing. The high
surface to volume ratio of these capillaries allows for the
application of higher electric fields across the capillary without
substantial thermal variation across the capillary, consequently
allowing for more rapid separations. Furthermore, when combined
with confocal imaging methods, these methods provide sensitivity in
the range of attomoles, which is comparable to the sensitivity of
radioactive sequencing methods. Microfabrication of microfluidic
devices including microcapillary electrophoretic devices has been
discussed in detail in, for example, Jacobsen et al., 1994;
Effenhauser et al., 1994; Harrison et al., 1993; Effenhauser et
al., 1993; Manz et al., 1992; and U.S. Pat. No. 5,904,824, here
incorporated by reference. Typically, these methods comprise
photolithographic etching of micron scale channels on a silica,
silicon or other crystalline substrate or chip, and can be readily
adapted for use in the present invention. In some embodiments, the
capillary arrays may be fabricated from the same polymeric
materials described for the fabrication of the body of the device,
using the injection molding techniques described herein.
[0347] Tsuda et al., 1990, describes rectangular capillaries, an
alternative to the cylindrical capillary glass tubes. Some
advantages of these systems are their efficient heat dissipation
due to the large height-to-width ratio and, hence, their high
surface-to-volume ratio and their high detection sensitivity for
optical on-column detection modes. These flat separation channels
have the ability to perform two-dimensional separations, with one
force being applied across the separation channel, and with the
sample zones detected by the use of a multi-channel array
detector.
[0348] In many capillary electrophoresis methods, the capillaries,
e.g., fused silica capillaries or channels etched, machined or
molded into planar substrates, are filled with an appropriate
separation/sieving matrix. Typically, a variety of sieving matrices
are known in the art may be used in the microcapillary arrays.
Examples of such matrices include, e.g., hydroxyethyl cellulose,
polyacrylamide, agarose and the like. Generally, the specific gel
matrix, running buffers and running conditions are selected to
maximize the separation characteristics of the particular
application, e.g., the size of the nucleic acid fragments, the
required resolution, and the presence of native or undenatured
nucleic acid molecules. For example, running buffers may include
denaturants, chaotropic agents such as urea or the like, to
denature nucleic acids in the sample.
[0349] 5. Mass Spectroscopy
[0350] Mass spectrometry provides a means of "weighing" individual
molecules by ionizing the molecules in vacuo and making them "fly"
by volatilization. Under the influence of combinations of electric
and magnetic fields, the ions follow trajectories depending on
their individual mass (m) and charge (z). For low molecular weight
molecules, mass spectrometry has been part of the routine
physical-organic repertoire for analysis and characterization of
organic molecules by the determination of the mass of the parent
molecular ion. In addition, by arranging collisions of this parent
molecular ion with other particles (e.g., argon atoms), the
molecular ion is fragmented forming secondary ions by the so-called
collision induced dissociation (CID). The fragmentation
pattern/pathway very often allows the derivation of detailed
structural information. Other applications of mass spectrometric
methods in the known in the art can be found summarized in Methods
in Enzymology, Vol. 193: "Mass Spectrometry" (McCloskey, editor),
1990, Academic Press, New York.
[0351] Due to the apparent analytical advantages of mass
spectrometry in providing high detection sensitivity, accuracy of
mass measurements, detailed structural information by CID in
conjunction with an MS/MS configuration and speed, as well as
on-line data transfer to a computer, there has been considerable
interest in the use of mass spectrometry for the structural
analysis of nucleic acids. Reviews summarizing this field include
Schram, 1990 and Crain, 1990 here incorporated by reference. The
biggest hurdle to applying mass spectrometry to nucleic acids is
the difficulty of volatilizing these very polar biopolymers.
Therefore, "sequencing" had been limited to low molecular weight
synthetic oligonucleotides by determining the mass of the parent
molecular ion and through this, confirming the already known
sequence, or alternatively, confirming the known sequence through
the generation of secondary ions (fragment ions) via CID in an
MS/MS configuration utilizing, in particular, for the ionization
and volatilization, the method of fast atomic bombardment (FAB mass
spectrometry) or plasma desorption (PD mass spectrometry). As an
example, the application of FAB to the analysis of protected
dimeric blocks for chemical synthesis of oligodeoxynucleotides has
been described (Koster et al. 1987).
[0352] Two ionization/desorption techniques are
electrospray/ionspray (ES) and matrix-assisted laser
desorption/ionization (MALDI). ES mass spectrometry was introduced
by Fenn, 1984; PCT Application No. WO 90/14148 and its applications
are summarized in review articles, for example, Smith 1990 and
Ardrey, 1992. As a mass analyzer, a quadrupole is most frequently
used. The determination of molecular weights in femtomole amounts
of sample is very accurate due to the presence of multiple ion
peaks which all could be used for the mass calculation.
[0353] MALDI mass spectrometry, in contrast, can be particularly
attractive when a time-of-flight (TOF) configuration is used as a
mass analyzer. The MALDI-TOF mass spectrometry has been introduced
by Hillenkamp 1990. Since, in most cases, no multiple molecular ion
peaks are produced with this technique, the mass spectra, in
principle, look simpler compared to ES mass spectrometry. DNA
molecules up to a molecular weight of 410,000 daltons could be
desorbed and volatilized (Williams, 1989). More recently, this the
use of infra red lasers (IR) in this technique (as opposed to
UV-lasers) has been shown to provide mass spectra of larger nucleic
acids such as, synthetic DNA, restriction enzyme fragments of
plasmid DNA, and RNA transcripts upto a size of 2180 nucleotides
(Berkenkamp, 1998). Berkenkamp also describe how DNA and RNA
samples can be analyzed by limited sample purification using
MALDI-TOF IR.
[0354] In Japanese Pat. No. 59-131909, an instrument is described
which detects nucleic acid fragments separated either by
electrophoresis, liquid chromatography or high speed gel
filtration. Mass spectrometric detection is achieved by
incorporating into the nucleic acids atoms which normally do not
occur in DNA such as S, Br, I or Ag, Au, Pt, Os, Hg.
[0355] 6. Energy Transfer
[0356] Labeling hybridization oligonucleotide probes with
fluorescent labels is a well known technique in the art and is a
sensitive, nonradioactive method for facilitating detection of
probe hybridization. More recently developed detection methods
employ the process of fluorescence energy transfer (FET) rather
than direct detection of fluorescence intensity for detection of
probe hybridization. FET occurs between a donor fluorophore and an
acceptor dye (which may or may not be a fluorophore) when the
absorption spectrum of one (the acceptor) overlaps the emission
spectrum of the other (the donor) and the two dyes are in close
proximity. Dyes with these properties are referred to as
donor/acceptor dye pairs or energy transfer dye pairs. The
excited-state energy of the donor fluorophore is transferred by a
resonance dipole-induced dipole interaction to the neighboring
acceptor. This results in quenching of donor fluorescence. In some
cases, if the acceptor is also a fluorophore, the intensity of its
fluorescence may be enhanced. The efficiency of energy transfer is
highly dependent on the distance between the donor and acceptor,
and equations predicting these relationships have been developed by
Forster, 1948. The distance between donor and acceptor dyes at
which energy transfer efficiency is 50% is referred to as the
Forster distance (R.sub.O). Other mechanisms of fluorescence
quenching are also known including, for example, charge transfer
and collisional quenching.
[0357] Energy transfer and other mechanisms which rely on the
interaction of two dyes in close proximity to produce quenching are
an attractive means for detecting or identifying nucleotide
sequences, as such assays may be conducted in homogeneous formats.
Homogeneous assay formats are simpler than conventional probe
hybridization assays which rely on detection of the fluorescence of
a single fluorophore label, as heterogeneous assays generally
require additional steps to separate hybridized label from free
label. Several formats for FET hybridization assays are reviewed in
Nonisotopic DNA Probe Techniques (1992. Academic Press, Inc., pgs.
311-352).
[0358] Homogeneous methods employing energy transfer or other
mechanisms of fluorescence quenching for detection of nucleic acid
amplification have also been described. Higuchi (1992), discloses
methods for detecting DNA amplification in real-time by monitoring
increased fluorescence of ethidium bromide as it binds to
double-stranded DNA. The sensitivity of this method is limited
because binding of the ethidium bromide is not target specific and
background amplification products are also detected. Lee, 1993,
discloses a real-time detection method in which a doubly-labeled
detector probe is cleaved in a target amplification-specific manner
during PCR.TM.. The detector probe is hybridized downstream of the
amplification primer so that the 5'-3' exonuclease activity of Taq
polymerase digests the detector probe, separating two fluorescent
dyes which form an energy transfer pair. Fluorescence intensity
increases as the probe is cleaved. Published PCT application WO
96/21144 discloses continuous fluorometric assays in which
enzyme-mediated cleavage of nucleic acids results in increased
fluorescence. Fluorescence energy transfer is suggested for use in
the methods, but only in the context of a method employing a single
fluorescent label which is quenched by hybridization to the
target.
[0359] Signal primers or detector probes which hybridize to the
target sequence downstream of the hybridization site of the
amplification primers have been described for use in detection of
nucleic acid amplification (U.S. Pat. No. 5,547,861). The signal
primer is extended by the polymerase in a manner similar to
extension of the amplification primers. Extension of the
amplification primer displaces the extension product of the signal
primer in a target amplification-dependent manner, producing a
double-stranded secondary amplification product which may be
detected as an indication of target amplification. The secondary
amplification products generated from signal primers may be
detected by means of a variety of labels and reporter groups,
restriction sites in the signal primer which are cleaved to produce
fragments of a characteristic size, capture groups, and structural
features such as triple helices and recognition sites for
double-stranded DNA binding proteins.
[0360] Many donor/acceptor dye pairs known in the art and may be
used in the present invention. These include, for example,
fluorescein isothiocyanate (FITC)/tetramethylrhodamine
isothiocyanate (TRITC), FITC/Texas Red..TM.. (Molecular Probes),
FITC/N-hydroxysuccinimidyl 1-pyrenebutyrate (PYB), FITC/eosin
isothiocyanate (EITC), N-hydroxysuccinimidyl 1-pyrenesulfonate
(PYS)/FITC, FITC/Rhodamine X, FITC/tetramethylrhodamine (TAMRA),
and others. The selection of a particular donor/acceptor
fluorophore pair is not critical. For energy transfer quenching
mechanisms it is only necessary that the emission wavelengths of
the donor fluorophore overlap the excitation wavelengths of the
acceptor, i.e., there must be sufficient spectral overlap between
the two dyes to allow efficient energy transfer, charge transfer or
fluorescence quenching. P-(dimethyl aminophenylazo) benzoic acid
(DABCYL) is a non-fluorescent acceptor dye which effectively
quenches fluorescence from an adjacent fluorophore, e.g.,
fluorescein or 5-(2'-aminoethyl) aminonaphthalene (EDANS). Any dye
pair which produces fluorescence quenching in the detector nucleic
acids of the invention are suitable for use in the methods of the
invention, regardless of the mechanism by which quenching occurs.
Terminal and internal labeling methods are both known in the art
and maybe routinely used to link the donor and acceptor dyes at
their respective sites in the detector nucleic acid.
[0361] 7. Chip Technologies
[0362] DNA arrays and gene chip technology provides a means of
rapidly screening a large number of DNA samples for their ability
to hybridize to a variety of single stranded DNA probes immobilized
on a solid substrate. Specifically contemplated are chip-based DNA
technologies such as those described by Hacia et al., (1996) and
Shoemaker et al. (1996). These techniques involve quantitative
methods for analyzing large numbers of genes rapidly and accurately
The technology capitalizes on the complementary binding properties
of single stranded DNA to screen DNA samples by hybridization.
Pease et al., 1994; Fodor et al., 1991. Basically, a DNA array or
gene chip consists of a solid substrate upon which an array of
single stranded DNA molecules have been attached. For screening,
the chip or array is contacted with a single stranded DNA sample
which is allowed to hybridize under stringent conditions. The chip
or array is then scanned to determine which probes have hybridized.
In the context of this embodiment, such probes could include
synthesized oligonucleotides, cDNA, genomic DNA, yeast artificial
chromosomes (YACs), bacterial artificial chromosomes (BACs),
chromosomal markers or other constructs a person of ordinary skill
would recognize as adequate to demonstrate a genetic change.
[0363] A variety of gene chip or DNA array formats are described in
the art, for example U.S. Pat. Nos. 5,861,242 and 5,578,832 which
are expressly incorporated herein by reference. A means for
applying the disclosed methods to the construction of such a chip
or array would be clear to one of ordinary skill in the art. In
brief, the basic structure of a gene chip or array comprises: (1)
an excitation source; (2) an array of probes; (3) a sampling
element; (4) a detector; and (5) a signal amplification/treatment
system. A chip may also include a support for immobilizing the
probe.
[0364] In particular embodiments, a target nucleic acid may be
tagged or labeled with a substance that emits a detectable signal;
for example, luminescence. The target nucleic acid may be
immobilized onto the integrated microchip that also supports a
phototransducer and related detection circuitry. Alternatively, a
gene probe may be immobilized onto a membrane or filter which is
then attached to the microchip or to the detector surface itself.
In a further embodiment, the immobilized probe may be tagged or
labeled with a substance that emits a detectable or altered signal
when combined with the target nucleic acid. The tagged or labeled
species may be fluorescent, phosphorescent, or otherwise
luminescent, or it may emit Raman energy or it may absorb energy.
When the probes selectively bind to a targeted species, a signal is
generated that is detected by the chip. The signal may then be
processed in several ways, depending on the nature of the
signal.
[0365] The DNA probes may be directly or indirectly immobilized
onto a transducer detection surface to ensure optimal contact and
maximum detection. The ability to directly synthesize on or attach
polynucleotide probes to solid substrates is well known in the art.
See U.S. Pat. Nos. 5,837,832 and 5,837,860 both of which are
expressly incorporated by reference. A variety of methods have been
utilized to either permanently or removably attach the probes to
the substrate. Exemplary methods include: the immobilization of
biotinylated nucleic acid molecules to avidin/streptavidin coated
supports (Holmstrom, 1993), the direct covalent attachment of
short, 5'-phosphorylated primers to chemically modified polystyrene
plates (Rasmussen, et al., 1991), or the precoating of the
polystyrene or glass solid phases with poly-L-Lys or poly L-Lys,
Phe, followed by the covalent attachment of either amino- or
sulfhydryl-modified oligonucleotides using bi-functional
crosslinking reagents. (Running, et al., 1990); Newton, et al.
(1993)). When immobilized onto a substrate, the probes are
stabilized and therefore may be used repeatedly. In general terms,
hybridization is performed on an immobilized nucleic acid target or
a probe molecule is attached to a solid surface such as
nitrocellulose, nylon membrane or glass. Numerous other matrix
materials may be used, including reinforced nitrocellulose
membrane, activated quartz, activated glass, polyvinylidene
difluoride (PVDF) membrane, polystyrene substrates,
polyacrylamide-based substrate, other polymers such as poly(vinyl
chloride), poly(methyl methacrylate), poly(dimethyl siloxane),
photopolymers (which contain photoreactive species such as
nitrenes, carbenes and ketyl radicals capable of forming covalent
links with target molecules.
[0366] Binding of the probe to a selected support may be
accomplished by any of several means. For example, DNA is commonly
bound to glass by first silanizing the glass surface, then
activating with carbodimide or glutaraldehyde. Alternative
procedures may use reagents such as
3-glycidoxypropyltrimethoxysilane (GOP) or
aminopropyltrimethoxysilane (APTS) with DNA linked via amino
linkers incorporated either at the 3' or 5' end of the molecule
during DNA synthesis. DNA may be bound directly to membranes using
ultraviolet radiation. With nitrocellous membranes, the DNA probes
are spotted onto the membranes. A UV light source (Stratalinker,
from Stratagene, La Jolla, Calif.) is used to irradiate DNA spots
and induce cross-linking. An alternative method for cross-linking
involves baking the spotted membranes at 80.degree. C. for two
hours in vacuum.
[0367] Specific DNA probes may first be immobilized onto a membrane
and then attached to a membrane in contact with a transducer
detection surface. This method avoids binding the probe onto the
transducer and may be desirable for large-scale production.
Membranes particularly suitable for this application include
nitrocellulose membrane (e.g., from BioRad, Hercules, Calif.) or
polyvinylidene difluoride (PVDF) (BioRad, Hercules, Calif.) or
nylon membrane (Zeta-Probe, BioRad) or polystyrene base substrates
(DNA.BIND.TM. Costar, Cambridge, Mass.).
G. Identification Methods
[0368] Amplification products must be visualized in order to
confirm amplification of the target-gene(s) sequences. One typical
visualization method involves staining of a gel with for example, a
flourescent dye, such as ethidium bromide or Vista Green and
visualization under UV light. Alternatively, if the amplification
products are integrally labeled with radio- or
fluorometrically-labeled nucleotides, the amplification products
can then be exposed to x-ray film or visualized under the
appropriate stimulating spectra, following separation.
[0369] In one embodiment, visualization is achieved indirectly,
using a nucleic acid probe. Following separation of amplification
products, a labeled, nucleic acid probe is brought into contact
with the amplified gene(s) sequence. The probe preferably is
conjugated to a chromophore but may be radiolabeled. In another
embodiment, the probe is conjugated to a binding partner, such as
an antibody or biotin, where the other member of the binding pair
carries a detectable moiety. In other embodiments, the probe
incorporates a fluorescent dye or label. In yet other embodiments,
the probe has a mass label that can be used to detect the molecule
amplified. Other embodiments also contemplate the use of Taqman.TM.
and Molecular Beacon.TM. probes. In still other embodiments,
solid-phase capture methods combined with a standard probe may be
used as well.
[0370] The type of label incorporated in PCR.TM. products is
dictated by the method used for analysis. When using capillary
electrophoresis, microfluidic electrophoresis, HPLC, or LC
separations, either incorporated or intercalated fluorescent dyes
are used to label and detect the PCR.TM. products. Samples are
detected dynamically, in that fluorescence is quantitated as a
labeled species moves past the detector. If any electrophoretic
method, HPLC, or LC is used for separation, products can be
detected by absorption of UV light, a property inherent to DNA and
therefore not requiring addition of a label. If polyacrylamide gel
or slab gel electrophoresis is used, primers for the PCR.TM. can be
labeled with a fluorophore, a chromophore or a radioisotope, or by
associated enzymatic reaction. Enzymatic detection involves binding
an enzyme to primer, e.g., via a biotin:avidin interaction,
following separation of PCR.TM. products on a gel, then detection
by chemical reaction, such as chemiluminescence generated with
luminol. A fluorescent signal can be monitored dynamically.
Detection with a radioisotope or enzymatic reaction requires an
initial separation by gel electrophoresis, followed by transfer of
DNA molecules to a solid support (blot) prior to analysis. If blots
are made, they can be analyzed more than once by probing, stripping
the blot, and then reprobing. If PCR.TM. products are separated
using a mass spectrometer no label is required because nucleic
acids are detected directly.
[0371] A number of the above separation platforms can be coupled to
achieve separations based on two different properties. For example,
some of the PCR.TM. primers can be coupled with a moiety that
allows affinity capture, and some primers remain unmodified.
Modifications can include a sugar (for binding to a lectin column),
a hydrophobic group (for binding to a reverse-phase column), biotin
(for binding to a streptavidin column), or an antigen (for binding
to an antibody column). Samples are run through an affinity
chromatography column. The flow-through fraction is collected, and
the bound fraction eluted (by chemical cleavage, salt elution,
etc.). Each sample is then further fractionated based on a
property, such as mass, to identify individual components.
H. Sequencing
[0372] It is envisioned that amplified product will commonly be
sequenced for further identification. Sanger dideoxy-termination
sequencing is the means commonly employed to determine nucleotide
sequence. The Sanger method employs a short oligonucleotide or
primer that is annealed to a single-stranded template containing
the DNA to be sequenced. The primer provides a 3' hydroxyl group
which allows the polymerization of a chain of DNA when a polymerase
enzyme and dNTPs are provided. The Sanger method is an enzymatic
reaction that utilizes chain-terminating dideoxynucleotides
(ddNTPs). ddNTPs are chain-terminating because they lack a
3'-hydroxyl residue which prevents formation of a phosphodiester
bond with a succeeding deoxyribonucleotide (dNTP). A small amount
of one ddNTP is included with- the four conventional dNTPs in a
polymerization reaction. Polymerization or DNA synthesis is
catalyzed by a DNA polymerase. There is competition between
extension of the chain by incorporation of the conventional dNTPs
and termination of the chain by incorporation of a ddNTP.
[0373] Although a variety of polymerases may be used, the use of a
modified T7 DNA polymerase (Sequenase.TM.) was a significant
improvement over the original Sanger method (Sambrook et al., 1988;
Hunkapiller, 1991). T7 DNA polymerase does not have any inherent
5'-3' exonuclease activity and has a reduced selectivity against
incorporation of ddNTP. However, the 3'-5' exonuclease activity
leads to degradation of some of the oligonucleotide primers.
Sequenase.TM. is a chemically-modified T7 DNA polymerase that has
reduced 3' to 5' exonuclease activity (Tabor et al., 1987).
Sequenase.TM. version 2.0 is a genetically engineered form of the
T7 polymerase which completely lacks 3' to 5' exonuclease activity.
Sequenase.TM. has a very high processivity and high rate of
polymerization. It can efficiently incorporate nucleotide analogs
such as dITP and 7-deaza-dGTP which are used to resolve regions of
compression in sequencing gels. In regions of DNA containing a high
G+C content, Hoogsteen bond formation can occur which leads to
compressions in the DNA. These compressions result in aberrant
migration patterns of oligonucleotide strands on sequencing gels.
Because these base analogs pair weakly with conventional
nucleotides, intrastrand secondary structures during
electrophoresis are alleviated. In contrast, Klenow does not
incorporate these analogs as efficiently.
[0374] The use of Taq DNA polymerase and mutants thereof is a more
recent addition to the improvements of the Sanger method (U.S. Pat.
No. 5,075, 216). Taq polymerase is a thermostable enzyme which
works efficiently at 70-75.degree. C. The ability to catalyze DNA
synthesis at elevated temperature makes Taq polymerase useful for
sequencing templates which have extensive secondary structures at
37.degree. C. (the standard temperature used for Klenow and
Sequenase.TM. reactions). Taq polymerase, like Sequenase.TM., has a
high degree of processivity and like Sequenase 2.0, it lacks 3' to
5' nuclease activity. The thermal stability of Taq and related
enzymes (such as Tth and Thermosequenase.TM.) provides an advantage
over T7 polymerase (and all mutants thereof) in that these
thermally stable enzymes can be used for cycle sequencing which
amplifies the DNA during the sequencing reaction, thus allowing
sequencing to be performed on smaller amounts of DNA. Optimization
of the use of Taq in the standard Sanger Method has focused on
modifying Taq to eliminate the intrinsic 5'-3' exonuclease activity
and to increase its ability to incorporate ddNTPs to reduce
incorrect termination due to secondary structure in the
single-stranded template DNA (EP 0 655 506 B 1). The introduction
of fluorescently labeled nucleotides has further allowed the
introduction of automated sequencing which further increases
processivity.
I. DNA Immobilization
[0375] Immobilization of the DNA may be achieved by a variety of
methods involving either non-covalent or covalent interactions
between the immobilized DNA comprising an anchorable moiety and an
anchor. In a preferred embodiment of the invention, immobilization
consists of the non-covalent coating of a solid phase with
streptavidin or avidin and the subsequent immobilization of a
biotinylated polynucleotide (Holmstrom, 1993). It is further
envisioned that immobilization may occur by precoating a
polystyrene or glass solid phase with poly-L-Lys or poly L-Lys,
Phe, followed by the covalent attachment of either amino- or
sulfhydryl-modified polynucleotides using bifunctional crosslinking
reagents (Running, 1990 and Newton, 1993).
[0376] Immobilization may also take place by the direct covalent
attachment of short, 5'-phosphorylated primers to chemically
modified polystyrene plates ("Covalink" plates, Nunc) Rasmussen,
(1991). The covalent bond between the modified oligonucleotide and
the solid phase surface is introduced by condensation with a
water-soluble carbodiimide. This method facilitates a predominantly
5'-attachment of the oligonucleotides via their 5'-phosphates.
[0377] Nikiforov et al. (U.S. Pat. No. 5610287 incorporated herein
by reference) describes a method of non-covalently immobilizing
nucleic acid molecules in the presence of a salt or cationic
detergent on a hydrophilic polystyrene solid support containing a
hydrophilic moiety or on a glass solid support. The support is
contacted with a solution having a pH of about 6 to about 8
containing the synthetic nucleic acid and a cationic detergent or
salt. The support containing the immobilized nucleic acid may be
washed with an aqueous solution containing a non-ionic detergent
without removing the attached molecules.
[0378] Another commercially available method envisioned by the
inventors to facilitate immobilization is the "Reacti-Bind..TM..
DNA Coating Solutions" (see "Instructions--Reacti-Bind..TM.. DNA
Coating Solution" 1/1997). This product comprises a solution that
is mixed with DNA and applied to surfaces such as polystyrene or
polypropylene. After overnight incubation, the solution is removed,
the surface washed with buffer and dried, after which it is ready
for hybridization. It is envisioned that similar products, i.e.
Costar "DNA-BIND.TM." or. Immobilon-AV Affinity Membrane (IAV,
Millipore, Bedford, Mass.) are equally applicable to immobilize the
respective fragment.
J. Analysis of Data
[0379] Gathering data from the various analysis operations will
typically be carried out using methods known in the art. For
example, microcapillary arrays may be scanned using lasers to
excite fluorescently labeled targets that have hybridized to
regions of probe arrays, which can then be imaged using charged
coupled devices ("CCDs") for a wide field scanning of the array.
Alternatively, another particularly useful method for gathering
data from the arrays is through the use of laser confocal
microscopy which combines the ease and speed of a readily automated
process with high resolution detection. Scanning devices of this
kind are described in U.S. Pat. Nos. 5,143,854 and 5,424,186.
[0380] Following the data gathering operation, the data will
typically be reported to a data analysis operation. To facilitate
the sample analysis operation, the data obtained by a reader from
the device will typically be analyzed using a digital computer.
Typically, the computer will be appropriately programmed for
receipt and storage of the data from the device, as well as for
analysis and reporting of the data gathered, i.e., interpreting
fluorescence data to determine the sequence of hybridizing probes,
normalization of background and single base mismatch
hybridizations, ordering of sequence data in SBH applications, and
the like, as described in, e.g., U.S. Pat. Nos. 4,683,194,
5,599,668 and 5,843,651 incorporated herein by reference.
K. Kits
[0381] The materials and reagents required for performing the PENT
reactions and producing PENTAmeres from a biological sample may be
assembled together in a kit. The kits of the invention also will
generally comprise one or more preselected primer sets and/or
probes that may be specifically designed for the amplification to
be performed. Preferably, the kits will comprise, in suitable
container means, one or more nucleic acid primer sets, the
necessary reagents for amplification and isolation and potentially
a means for detecting nucleic acid products. In certain
embodiments, such as in kits for use in amplification reactions,
the means for detecting the nucleic acids may be a label, such as a
fluorophore, a radiolabel, an enzyme tag, etc., that is linked to
the nucleic acid primer or the nucleotides themselves. It is
envisioned that kits may contain DNA samples for
standardization.
[0382] Preferred kits are those suitable for use in PCR.TM.. In
PCR.TM. kits, two primers will preferably be provided that have
sequences from, and that hybridize to, specific adaptor sequences.
Also included in PCR.TM. kits may be enzymes suitable for
amplifying nucleic acids, including various polymerases (RT, Taq,
etc.), deoxynucleotides and buffers to provide the necessary
reaction mixture for amplification.
[0383] In each case, the kits will preferably comprise distinct
containers for each individual reagent and enzyme, as well as for
each probe or primer pair. Each biological agent will generally be
suitable aliquoted in their respective containers. The container
means of the kits will generally include at least one vial or test
tube. Flasks, bottles and other container means into which the
reagents are placed and aliquoted are also possible. The individual
containers of the kit will preferably be maintained in close
confinement for commercial sale. Suitable larger containers may
include injection or blow-molded plastic containers into which the
desired vials are retained. Instructions may be provided with the
kit.
L. Plants
[0384] The term "plant," as used herein, refers to any type of
plant. The inventors have provided below an exemplary description
of some plants that may be used with the invention. However, the
list is not in any way limiting, as other types of plants will be
known to those of skill in the art and could be used with the
invention.
[0385] A common class of plants exploited in agriculture are
vegetable crops, including artichokes, kohlrabi, arugula, leeks,
asparagus, lettuce (e.g., head, leaf, romaine), bok choy, malanga,
broccoli, melons (e.g., muskmelon, watermelon, crenshaw, honeydew,
cantaloupe), brussels sprouts, cabbage, cardoni, carrots, napa,
cauliflower, okra, onions, celery, parsley, chick peas, parsnips,
chicory, chinese cabbage, peppers, collards, potatoes, cucumber
plants (marrows, cucumbers), pumpkins, cucurbits, radishes, dry
bulb onions, rutabaga, eggplant, salsify, escarole, shallots,
endive, garlic, spinach, green onions, squash, greens, beet (sugar
beet and fodder beet), sweet potatoes, Swiss chard, horseradish,
tomatoes, kale, turnips, and spices.
[0386] Other types of plants frequently finding commercial use
include fruit and vine crops such as apples, apricots, cherries,
nectarines, peaches, pears, plums, prunes, quince-almonds,
chestnuts, filberts, pecans, pistachios, walnuts, citrus,
blueberries, boysenberries, cranberries, currants, loganberries,
raspberries, strawberries, blackberries, grapes, avocados, bananas,
kiwi, persimmons, pomegranate, pineapple, tropical fruits, pomes,
melon, mango, papaya, and lychee.
[0387] Many of the most widely grown plants are field crop plants
such as evening primrose, meadow foam, corn (field, sweet,
popcorn), hops, jojoba, peanuts, rice, safflower, small grains
(barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok,
leguminous plants (beans, lentils, peas, soybeans), oil-plants
(rape, mustard, poppy, olives, sunflowers, coconut, castor oil
plants, cocoa beans, groundnuts), fibre plants (cotton, flax, hemp,
jute), lauraceae (cinnamon, camphor), or plants such as coffee,
sugarcane, tea, and natural rubber plants.
[0388] Still other examples of plants include bedding plants such
as flowers, cactus, succulents and ornamental plants, as well as
trees such as forest (broad-leaved trees and evergreens, such as
conifers), fruit, ornamental, and nut-bearing trees, as well as
shrubs and other nursery stock.
M. Animals
[0389] The term "animal," as used herein, refers to any type of
animal. The inventors have provided below an exemplary description
of some animals that may be used with the invention. However, the
list is not in any way limiting, as other types of animals will be
known to those of skill in the art and could be used with the
invention.
[0390] For the purpose of the instant invention, the term animal is
expressly construed to include humans.
[0391] In addition to humans, other animals of importance in the
context of the instant invention are those animals deemed of
commercial relevance. Animals of commercial relevance specifically
include domesticated species including companion and agricultural
species.
[0392] The following sections provide a detailed description of
specific embodiments and applications of the instant invention.
N. Principles of Creating Pentamers to Amplify the Terminal and
Internal Regions of a Single DNA Template
[0393] Using specific methods and compositions, a terminal or
internal region of a DNA template can be synthesized as an
amplifiable DNA strand (a PENTAmer). The methods comprise
nick-translation reactions that are initiated and terminated at
controlled positions within the template and methods to separate
and recombine the products of the nick translation reactions. The
compositions comprise oligonucleotide adaptor molecules that become
attached to the 3' and 5' ends of the nick translated strands that
are specifically designed to initiate the nick-translation reaction
and serve as priming sites during PENTAmer amplification.
Additional compositions comprise oligonucleotides designed to
direct intramolecular recombination reactions involving the
PENTAmers.
[0394] 1. Primary PENTAmers
[0395] The basic reactions forming a primary PENTAmer is the core
technology for most of the applications shown in this disclosure.
Moreover, the uniqueness and advantage of the PENTAmer technology
over other technologies, e.g., direct PCR amplification or
ligation-mediated PCR are evident from these basic reactions.
[0396] a. Creation of a Primary PENTAmer
[0397] In the simplest implementation, shown in FIG. 2 A, the
primary PENTAmer is created by:
[0398] Ligating an up-stream, terminus-attaching, nick-translation
adaptor A to the proximal end of the template DNA;
[0399] Initiating a PENT reaction at the proximal end of the
template using adaptor A, a DNA polymerase with 5'-3' exonuclease
activity, and nucleotide triphosphates;
[0400] Continuing the nick-translation reaction a specified time to
create a nick-translation product of a specified length;
[0401] Appending a down-stream, nick-attaching adaptor B-3' to the
distal, 3' end of the PENT product to form a PENTAmer, comprising a
covalently intact strand containing adaptor A, the nick-translation
product strand, and adaptor B-3'.
[0402] Nick-translation has created the PENTAmer as a single
strand, hydrogen bonded to the template. This double-stranded
PENTAmer-template hybrid is called a "nascent primary PENTAmer."
The PENTAmer can undergo subsequent preparative and analytical
steps as the double-stranded nascent PENTAmer or as a
single-stranded molecule, after separation from the template by
denaturation (e.g., heating or alkaline treatment), or destruction
of the template.
[0403] Specific designs for the adaptors and methods for attaching
the adaptors to the terminus and nick used in steps 1 and 4 are
described below.
[0404] 2. Creation of a Primary PENTAmer with Modified
Nucleotides
[0405] For purposes of distinguishing the synthetic PENTAmer strand
from template strands, modified nucleotides can be incorporated
during the nick-translation reaction and/or in the adaptors.
Subsequent steps can separate the PENTAmer strand from the template
strands. For example, affinity chromatography can be used to
isolate the molecules containing the modified nucleotides from
those that do not. Alternatively, chemical or enzymatic treatment
can be used to destroy the template strands. For example,
incorporation of exonuclease-resistant nucleotides (e.g.,
phosphorothioates or phosphoroboronates) allows the PENT products
to be stabilized during a nuclease digestion of the entire template
molecule. After destruction of the template DNA or affinity
isolation of the PENT products, the PENTAmers can be amplified in
vitro or in vivo, without any background from non-specific
amplification of the template.
[0406] 3. Unique Features of the PENT Reaction and Primary
PENTAmers
[0407] a. Specificity and Efficiency of Initiation of
Nick-Translation Reaction on a Double Strand Template
[0408] The nick-translation reaction is specific to the end of the
double-strand template to which the upstream terminus-attaching
adaptor has been ligated. In this simplest example of the
nick-translation reaction at a single end of the template, the
adaptor can be specifically targeted to the desired end by
employing an asymmetric template, i.e., with one terminus cleaved
with a first restriction enzyme and second terminus cleaved using a
different agent such as a second endonuclease, a chemical, or
hydrodynamic force, which creates a non-complementary structure at
the distal end. Initiation of the PENT reaction at the end of
double-stranded DNA molecules makes the reaction specific to
terminal sites, independent of sequence. Internal sites cannot be
mistakenly synthesized, e.g., by sequence-dependent mispriming on
an internal sequence.
[0409] b. Control of the Length of the Nick-Translation Product
[0410] Continuation of the. PENT reaction on a dsDNA template
allows the rate of synthesis of the strand to be nearly independent
of sequence. This allows the length of the primary PENTAmer to be
controlled to within narrow limits by adjusting time of the PENT
reaction, independent of sequence. Such uniformity of synthesis is
not possible on a single-strand template, for example, due to
formation of secondary structure that can interfere with
polymerization. The uniform molecular weight of the primary
PENTAmers make them easier to amplify by cloning or PCR, which vary
in efficiency for different molecular weights. The uniform
molecular weight also makes it possible for each PENTAmer to carry
a similar amount of sequence information. For these purposes it is
important that the template DNA not have an excessive number of
nicks or gaps, because a nick or gap on the template strand will
lead to termination of nick translation of the opposite strand.
This is fundamentally different than conditions used for
uncontrolled nick-translation reactions, e.g., those used to
radioactively label DNA. These labeling reactions create molecules
of random length that start at random sites within the native
template and are often terminated at random nicks within the
template strand.
[0411] Another advantage of the uniform size of primary PENTAmers
of different sequence, created by a single PENT reaction, is that
they can be easily separated from the template DNA on the basis of
molecular weight. This separation decreases the background
(increases the specificity) during subsequent PCR or cloning
steps.
[0412] C. Unique Position of the 5' End of the PENTAmer and
Variable Position of the 3' End of the PENTAmer
[0413] The 5' terminus and sequences adjacent to the 5' terminus of
the primary PENTAmer are unique by virtue of the unique initiation
site for nick translation. In contrast, the 3' terminus of the
PENTAmer has a unique adaptor sequence but a variable sequence
adjacent to the adaptor, because the nick translation reaction does
not proceed an exact number of bases from the initiation site.
There is a continuous distribution of lengths of the
nick-translation products, and thus of the PENTAmer. Experimental
results (e.g., Makarov et al., 1997) show that the uncertainty in
PENTAmer length is about 10% of the average length.
[0414] d. High Fidelity of Replication of a Double-Strand
Template
[0415] In every replication reaction there is chance for
misincorporation of the wrong nucleotide. The frequency of
misincorporation is expected to be higher on a single-strand
template because the template strand can "slip," especially in
repetitive DNA tracts, and the polymerase can "stall" and "jump"
when encountering secondary structure in the template. Replication
of DNA in cells achieves high fidelity, in part because a largely
double-strand template is used. The PENT reaction is expected to
have increased fidelity of base incorporation than primer extension
on single-strand DNA.
[0416] e. Nascent Primary PENTAmer Remains a Part of Double-Strand
Template
[0417] Time-controlled termination of the PENT reaction on a
largely double-strand DNA template allows the primary PENTAmer to
be separated according to the molecular weight of the parent
template after synthesis of the PENTAmer.
[0418] 4. Amplification of a PENTAmer or Nascent PENTAmer
[0419] A PENTAmer can be amplified in vitro or in vivo using
specific sequences on one or both adaptors. For example, a PENTAmer
can be linearly amplified using primers complementary to adaptor
B-3' or adaptor A, or exponentially amplified by PCR using primer
sequence A and primer sequence B-3'. A nascent PENTAmer can be
amplified by any means possible for double-stranded templates, such
as transcription by an RNA polymerase, strand displacement
amplification, etc. The specificity and efficiency of amplification
can be increased, if necessary, using any of the common techniques
available for those purposes including, but not limited to 1) using
nested PCR primers; 2) using different temperatures, times, and
conditions; and/or 3) using different combinations of polymerases.
After conversion into a double-stranded molecule by primer
extension or by PCR amplification, a PENTAmer can be cloned into
any of a number of bacterial or viral vectors.
[0420] 5. Sequencing of PENTAmers
[0421] PENTAmers can be subjected to any sequencing reactions,
including the Sanger dideoxyribonucleotide termination reactions
and cycle sequencing reactions using, for example, primers
complementary to sequences on the upstream terminus-attaching
adaptor A.
[0422] PENTAmers from a single template terminate at sequences that
are complementary to different positions within the template,
because the nick-translation reaction has terminated at different
positions on different copies of the template molecule. Therefore
the 3' ends of the PENTAmers have heterogeneous sequence and the 3'
end of the sequencing primer cannot be complementary to adaptor
B-3'.
[0423] PENTAmers with unique 3' ends can be prepared for sequencing
by two methods:
[0424] First, the PENTAmers with heterogeneous 3' ends can be
cloned into a bacterial or viral vector. Each PENTAmer clone will
have unique sequence and can be sequenced from either terminus.
[0425] Second, uncloned PENTAmers with heterogeneous sequences
adjacent to the downstream adaptor can be amplified or sequenced as
unique molecules using a "selection" primer with 5' terminus
complementary to the downstream nick-attaching adaptor B-3' and 3'
terminus complementary to a specific sequence present at the 3' end
of the nick-translation product. In one embodiment, downstream
primers with different 3' termini are tested by trial and error and
the primer that is specific that is complementary to a PENTAmer
with unique sequence used for the amplification or sequencing
reaction.
[0426] PENTAmer amplification of the termini of a template is
distinct from direct amplification of DNA fragments using
random-prime PCR, which amplifies random internal regions. PENTAmer
amplification is distinct from direct amplification of DNA termini
using conventional techniques of one-sided PCR and
strand-displacement amplification, which result in amplimers of
heterogeneous size. PENTAmers are amplified as molecules of uniform
size.
[0427] 6. Construction of Ordered Primary PENTAmers
[0428] Different times of PENT reaction produce primary PENTAmers
of different lengths having 3' ends different distances from the
end of the template (FIG. 4A). The 3' end of the primary PENTAmer
can be 10 kb or more from the end of the template. PENTAmer
molecules created by different reaction times can be organized into
a library of ordered PENTAmers that can be amplified in vitro as an
ordered library of amplified DNA molecules or in vivo as ordered
clones. PENTAmers from different internal regions of the template
can also be pooled into a mixture of amplimers or clones from a
large region.
[0429] Primary PENTAmers created by different times of the PENT
reaction can be used as template for polymerization reactions
localized to the 3' ends of the primary PENTAmers using
conventional techniques, such as a) ligation-mediated PCR; b)
strand displacement amplification; or c) RNA transcription.
Alternatively, a second PENT reaction can be initiated from the 3'
end of the primary PENTAmer, as described in subsection 8,
below.
[0430] 7. Complement PENTAmers
[0431] Synthesis of the PENT product is coordinated with
unidirectional degradation of one of the template DNA strands by
the 5' exonuclease activity of the polymerase used for
nick-translation. Appending a nick-attaching adaptor to the 5'
terminus of the degraded DNA strand results in a creation of a new
type of amplimer, which is termed herein a complement PENTAmer.
[0432] a. Creation of a Complement PENTAmer
[0433] In the simplest implementation, shown in FIG. 2 B, the
complement PENTAmer is created and amplified by:
[0434] Ligating an up-stream, terminus-attaching, nick-translation
adaptor A to the proximal end of the template DNA;
[0435] Initiating a PENT reaction at the proximal end of the
template using adaptor A;
[0436] Elongating the PENT product a specific time, T;
[0437] Appending an up-stream nick-attaching adaptor B-5' to the 5'
end of the degraded template DNA strand to form a complement
PENTAmer-template hybrid ("nascent complement PENTAmere); and
[0438] (Optionally) separating the single-stranded complement
PENTAmer from the template (e.g., by denaturation).
[0439] b. Amplification of a Complement-PENTAmer
[0440] A complement PENTAmer can be amplified in vitro or in vivo
by the same means used to amplify primary PENTAmers, except
initiating syntheses at adaptor sequence A and or adaptor sequence
B-5'.
[0441] c. Construction of an Ardered Complement PENTAmers
[0442] Different times of PENT reaction produce complement
PENTAmers of different lengths having 5' ends different distances
from the end of the template (FIG. 4 B). The 5' end of the
complement PENTAmer can be 10 kb or more from the end of the
template. Complement PENTAmers created by different
nick-translation reaction times can be organized into a ordered
complement PENTAmers that can be amplified in vitro as an ordered
set of amplified DNA molecules or in vivo as an ordered set of
clones. Complement PENTAmers from different internal regions of the
template can also be pooled into a mixture of amplimers from a
large region or unordered clones.
[0443] d. Unique Features of the Complement PENTAmer
[0444] The sum of the lengths of the primary PENTAmer and the
complement PENTAmers is constant and equal to the length of the
original template DNA strand. The complement PENTAmer has all
unique features of the primary PENTAmer, however increasing times
of the PENT reaction result in shorter complement PENTAmers.
[0445] 8. Secondary PENTAmers
[0446] a. Creation of Secondary PENTAmers
[0447] Secondary. PENTAmers are created by two nick-translation
reactions. The length of the first PENT reaction determines the
distance of one end of the secondary PENTAmer from the initiation
position, whereas the second (shorter) PENT reaction determines the
length of the secondary PENTAmer. The advantage of secondary
PENTAmers is that the position of the PENTAmer within the template
DNA and the length of the PENTAmer are independently
controlled.
[0448] There are two methods to synthesize a secondary
PENTAmer.
[0449] In the first method (FIG. 3 A) a secondary PENTAmer is
created and amplified by:
[0450] Ligating an up-stream, terminus-attaching, nick translation
adaptor A to the proximal end of the template DNA molecule;
[0451] Initiating a first PENT reaction at the proximal end of the
source DNA molecule using up-stream adaptor A;
[0452] Elongating the first PENT product a specific time T;
[0453] Appending a first, down-stream nick-attaching adaptor B-3'
to the distal, 3' end of the first PENT product;
[0454] Initiating a second PENT reaction at the same proximal end
of the source DNA molecule using the up-stream adaptor A;
[0455] Elongating the second PENT product a specific time t;
[0456] Appending a second, up-stream nick-attaching adaptor B-5' to
the 5' end of the degraded first PENT product;
[0457] (Optionally) separating the single-stranded secondary
PENTAmer of length from the template (e.g., by denaturation);
[0458] A secondary PENTAmer of the first type can be amplified in
vitro or in vivo using the same methods used to amplify a primary
PENTAmer, except polymerization reactions begin at adaptor sequence
B-3' and/or adaptor sequence B-5'.
[0459] In the second method (FIG. 3B) a secondary PENTAmer is
created by:
[0460] Ligating an up-stream, terminus-attaching, nick translation
adaptor A to the proximal end of the template DNA molecule;
[0461] Initiating a first PENT reaction at the proximal end of the
source DNA molecule using adaptor A;
[0462] Elongating the PENT product a specific time T;
[0463] Appending a first down-stream, nick-attaching adaptor B-3'
(I) to the distal, 3' end of the PENT product;
[0464] Separating the single-stranded primary PENTAmer from the
template Replicating the second strand of the primary PENTAmer
using primer extension from primer sequence B1 (as indicated in
FIG. 3B);
[0465] Initiating a second PENT reaction at the upstream end of the
secondary PENTAmer using primer sequence B2 (as indicated in FIG.
3B);
[0466] Elongating the secondary PENT product a specific time t;
[0467] Appending a second, down-stream, nick-attaching adaptor B-3'
(II) to the 3' end of the secondary PENT product; and
[0468] (Optionally) separating the single-stranded secondary
PENTAmer from the template.
[0469] A secondary PENTAmer of the second type can be amplified in
vitro or in vivo using the same methods used to amplify a primary
PENTAmer, except polymerization reactions begin at adaptor sequence
B-3' (I) and/or adaptor sequence B-3' (II).
[0470] b. Construction of Ordered Secondary PENTAmers
[0471] Different times (T) of the primary PENT reaction produce
secondary PENTAmers with one end a controllable distance from the
start of the primary PENT reaction (FIG. 4C). Different times (t)
of the secondary PENT reaction produce secondary PENTAmers of
different length. To positionally amplify regions of DNA increasing
distances from the initiation site on the template, the same
template should be reacted for increasing nick translation times,
e.g., T1<T2<T3,< . . . <Tn. By using longer times
t1<t2<t3, . . . <tn for the secondary PENT reactions in
the first method, or constant time t for the secondary PENT
reactions in the second method the PENTAmers from different
positions within the template can all be designed to have about the
same length. Secondary PENTAmers located different distances from
the terminus of the template DNA can be collected into an ordered
set of PENTAmers of similar length. Because all the amplimers are
of similar length and have the same adaptor sequences on both ends,
the efficiencies of amplification of different members of the set
are independent of distance of the member from the terminus of the
template. The ordered PENTAmers can be amplified in vitro or in
vivo, or pooled into unordered sets as described earlier.
[0472] 9. Synthesis of Primary PENTAmers Large Distances from the
Terminus of a Template
[0473] The methods disclosed above are limited to creating and
amplifying regions up to 10-20 kb from the terminus of the
template. PENTAmers synthesized with longer times of the
nick-translation reaction would form products with increasing
positional uncertainty. This section describes methods to
synthesize PENTAmers large, specified distances from a terminus of
a template.
[0474] a. Synthesis of a Primary PENTAmer a Large Distance from the
Terminus of a Template
[0475] The simplest method to make a PENTAmer a large distance from
a specified end of a template is to make a primary PENTAmer on the
opposite end. For example, if the template is 100 kb long, a 1
kb-long primary PENTAmer created using an adaptor ligated to the
right end of the template will be complementary to a region that is
not only 0-1 kb from the right end of the template, but is also
99-100 kb from the left end of the template. If the length of the
template is initially unknown, then the distance of the PENTAmer
from the left end will become known by determining the length of
the template by any means available, e.g., gel electrophoresis,
column chromatography, or centrifugation. The determination of the
length of the template can be done before or after synthesizing the
nascent primary PENTAmer, because the nascent primary PENTAmer has
nearly the same molecular weight and structure as the unreacted
template and therefore should be separated by electrophoresis or
other methods nearly the same as the unreacted template.
[0476] b. Synthesis of Ordered PENTAmers Complementary to Different
Distances within a Large Template Molecule
[0477] Primary PENTAmers can be synthesized on a nested set of
double-stranded DNA molecules (e.g., created by a partial
restriction digestion), creating a nested set of nascent PENTAmers
having one common terminus and a set of termini different distances
from the common terminus. Separation of the nascent PENTAmers by
electrophoresis or other means creates an ordered set of PENTAmers
complementary to different regions within the template. Creation of
nested sets of nascent primary PENTAmers is a critical step in the
most important applications of PENTAmers to genomics.
[0478] FIG. 5 schematically shows how primary PENTAmers can be used
to organize distal regions of a template DNA molecule into ordered
sets of overlapping nascent PENTAmers and PENTAmers. The basic
steps of creating a non-recombinant ordered set of primary
PENTAmers on a large template are: [0479] 1) Ligation of an
affinity adaptor (e.g., a double-stranded oligonucleotide with
biotinylated bases) to the proximal ends of the template molecules;
[0480] 2) Exposure of different internal regions of the template
DNA as distal ends (e.g., partial cleavage with a restriction
endonuclease, non-specific endonuclease, or chemical cleavage,);
[0481] 3) Separation of all fragments having the proximal ends
(e.g., by immobilization on and subsequent release from a
streptavidin-coated surface), creating a nested set of template
molecules with distal ends different distances from the proximal
ends; [0482] 4) Creation of a primary PENTAmer at all distal ends
(ligation of up-stream, terminus-attaching, nick-translation
adaptor A, controlled PENT reaction, and appending of down-stream,
nick-attaching adaptor B to the end of the PENT products); and
[0483] 5) Size fractionation.
[0484] These steps can be done in any order that follows the logic
of 3 after 1 and 2; 4 after 2; 5 after 1 and 2.
[0485] Amplification of the primary PENTAmers in individual size
fractions creates an ordered set of PENTAmers that can be amplified
by the methods discussed previously.
[0486] The template is made with one end compatible for ligation to
the immobilization template. This can be achieved by using a
template with incompatible restriction sites at the two ends, or by
creating the template ends using a sequence-specific endonuclease,
such as lambda terminase, that cleaves at non-palindromic
sequences.
[0487] The PENT reaction at the distal ends is necessary to create
primary PENTAmers that contain sequences from different internal
positions. The sequence independence of the PENT reaction rate
makes this practical to do for a mixture of molecules with
different distal sequences.
[0488] Size separation of the nested set of DNA is critical to the
construction of the ordered PENTAmers. In the schematic procedure
shown in FIG. 5, the nascent primary PENTAmers are separated
according to size. The number of different fragments in each size
fraction depends upon the density of partial cleavage sites and the
range of fragment sizes included in the set of PENTAmers. In the
example shown in FIG. 5, each size fraction contains a plurality of
PENTAmers that are complementary to partially overlapping regions
of the template, because many cleavage sites exist within the range
of molecular weights in each size fraction. It is expected that
PENTAmers will behave very similarly to the intact template
molecules during the procedures now used for molecular weight
separation of DNA. The only difference between a template and the
nascent primary PENTAmer made from that template is 1) a nick or a
small gap located near the end of the molecule; and 2) a short
extension to the end of the PENT product. Neither of these
differences should alter the charge, hydrodynamic properties,
molecular weight, or spectroscopic properties of the molecule.
While in principle the templates could be separated by size before
creating the primary PENTAmer, it is more efficient to complete as
many steps as possible before size fractionation. Separation of the
nascent primary PENTAmers yields maximal efficiency.
[0489] Cleavage-resistant nucleotide analogs can be incorporated
into the terminus-attaching and nick-attaching adaptors, as
described earlier, in order to allow destruction of all template
strands before amplification so that there is an increase in the
specificity of amplification.
[0490] c. Creation of Ordered PCR Products from Nested Sets of DNA
Molecules Using Ligation-Mediated PCR
[0491] In principle, ligation-mediated PCR could be used to create
and amplify ordered amplimers. Ligation-mediated PCR is able to
amplify the termini of DNA fragments using the following steps:
[0492] 1) Ligation of an affinity adaptor (e.g., a double-stranded
oligonucleotide with biotinylated bases) to the proximal ends of
the template molecules; [0493] 2) Exposure of different internal
regions of the template DNA as distal ends (e.g., partial cleavage
with a restriction endonuclease, non-specific endonuclease, or
chemical cleavage,); [0494] 3) Ligation of a PCR adaptor to all
restricted ends; [0495] 4) Separation of all fragments having the
proximal ends (e.g., by immobilization on and subsequent release
from a streptavidin-coated surface), creating a nested set of
template molecules with distal ends different distances from the
proximal ends; [0496] 5) Size fractionation of the proximal
fragments; [0497] 6) Complete restriction with a frequently-cutting
restriction endonuclease, and ligation of a second PCR adaptor to
the completely-restricted termini; [0498] 7) PCR amplification of
each size fraction using primers complementary to the two
conventional adaptors to create an ordered set of PCR products.
[0499] Ordered PCR products would have less-attractive
characteristics than the ordered PENTAmers. Because
ligation-mediated PCR depends upon a second restriction site to
determine the internal priming site, the PCR products would have
very heterogeneous size. Some ends might have internal priming
sites so close to the end that insufficient DNA would be amplified
to represent the region. Other ends might have internal priming
sites so far from the ends that PCR would be inefficient. In
addition, special methods would be required to reduce the
amplification of non-terminal DNA sequences due to pairs of
non-terminal restriction sites. One of these special methods is
called "suppression PCR," used to suppress PCR of fragments with
the same priming sequences on both ends. 4
[0500] d. Creation of Ordered Sets of RNA Molecules from Nested
Sets of DNA Molecules Using RNA Polymerase
[0501] In principle, ligation-mediated RNA synthesis could be used
to create ordered sets of single-stranded RNA molecules.
Ligation-mediated RNA synthesis is able to amplify the termini of
DNA fragments using the following steps: [0502] 1) Ligation of an
affinity adaptor (e.g., a double-stranded oligonucleotide with
biotinylated bases) to the proximal ends of the template molecules;
[0503] 2) Exposure of different internal regions of the template
DNA as distal ends (e.g., partial cleavage with a restriction
endonuclease, non-specific endonuclease, or chemical cleavage,);
[0504] 3) Ligation of a conventional adaptor containing an RNA
polymerase promotor to the ends left by partial cleavage; [0505] 4)
Separation of all fragments having the proximal ends (e.g., by
immobilization on and subsequent release from a streptavidin-coated
surface), creating a nested set of template molecules with distal
ends different distances from the proximal ends; [0506] 5) Size
fractionation of the nested DNA molecules; [0507] 6) Amplification
of each size fraction using RNA polymerase to make an ordered set
of RNA molecules.
[0508] Ordered RNA molecules would have less-attractive
characteristics than ordered PENTAmers, because 1) The RNA
molecules will be of variable length; 2) RNA is less stable than
DNA; and 3) RNA polymerase linearly amplifies the sequence rather
than exponentially, as in PCR.
[0509] 10. Recombinant PENTAmers and Ordered Recombinant PENTAmers
from Single Template Molecules
[0510] The difficulty of using very long PENTAmers to amplify or
analyze sequences long distances from termini may be overcome by
bringing together sequences from both the proximal and distal ends
of long templates to create a short recombinant PENTAmer having two
sequences far apart.
[0511] a. Synthesis of a Recombinant PENTAmer from a Single
Template
[0512] FIG. 6 shows how a recombinant PENTAmer can be made on a
single template molecule, having different structures at the left
(proximal, P) and right (distal, D) ends. [0513] 1) The first end
of recombination adaptor RA is attached to the left, proximal end
of the template; [0514] 2) The second end of recombination adaptor
RA is attached to the right, distal end, to form a circular
molecule; and [0515] 3) The initiation domain of adaptor RA is used
to synthesize a PENTAmer containing the distal template
sequences.
[0516] PENTAmers will only be created on those fragments that have
been ligated to both ends of the recombination adaptor RA. Thus the
recombination step replaces the affinity immobilization step
previously described. Specific designs and use of recombination
adaptors are described elsewhere in this application. One
embodiment uses an adaptor RA comprising a first ligation domain
complementary to the proximal terminus of the template, an
activatable second ligation domain complementary to the distal
terminus, and a nick-translation initiation domain capable
of-translating the nick from the distal end toward the center of
the template. In the case of a recombination adaptor of that
specific design, the template would be made resistant to cleavage
by the activation restriction enzyme by methylation at the
restriction recognition sites, and the second step would be
executed in the following way: 1) removal of unligated adaptor RA
from solution, 2) activation of adaptor RA by restriction digestion
of the unmethylated site within the adaptor, 3) dilution of the
template, 4) ligation of the second ligation domain to the distal
end of the template, and 5) concentration of the circularized
molecules. Step 3 is executed by the same methods used to create a
primary PENTAmer, however the nick-translation initiates at the
initiation domain of an RA adaptor.
[0517] The PENTAmer formed can be amplified by any of the methods
described earlier, e.g., by PCR using primers complementary to
sequences in adaptors RA and B-3'.
[0518] b. Synthesis of an Ordered Set of Recombinant PENTAmers
Complementary to Different Regions Within a Single Template
[0519] Recombinant PENTAmers can be synthesized on a nested set of
double-stranded DNA molecules (e.g., created by a partial
restriction digestion), to create a nested set of nascent PENTAmers
having common proximal termini and a set of distal termini
different distances from the common termini. Separation of the
nascent PENTAmers by electrophoresis or other means creates an
ordered set of recombinant PENTAmers complementary to different
regions within the template.
[0520] FIG. 7 schematically shows how recombinant PENTAmers can be
used to amplify distal regions of DNA as an ordered set of
overlapping PENTAmers. The number of different fragments in each
set depends upon the density of partial cleavage sites and the
range of fragment sizes included in the set. In the example shown
in FIG. 7, each size fraction contains a plurality of PENTAmers
that are complementary to partially overlapping regions of the
template, because many cleavage sites exist within the range of
molecular weights in each size fraction.
[0521] The basic steps of creating recombinant ordered PENTAmers on
a large template are: [0522] 1) The first end of recombination
adaptor RA is attached to the left, proximal end of the template;
[0523] 2) Different internal regions of the template DNA are
exposed as distal ends; [0524] 3) The second end of recombination
adaptor RA is attached to the right, distal ends of the fragments,
to form a nested set of circular molecules; [0525] 4) Synthesis of
a nascent PENTAmer or PENTAmers containing the distal template
sequences of each member of the nested set of fragments; and [0526]
5) Size fractionation of the nested set of nascent recombinant
PENTAmers.
[0527] Steps 1 and 3 are achieved using the oligonucleotide
adaptors and methods described herein. Step 2 is achieved by
partial cleavage with a restriction endonuclease, non-specific
endonuclease, or chemical cleavage. To facilitate recombination,
the distal ends can be attached to a second type of recombination
adaptor before the recombination step. PENTAmer synthesis (step 4)
uses the methods detailed elsewhere beginning at the initiation
domain(s) of adaptor RA (i.e., initiating of the nick-translation
reaction, terminating the nick-translation reaction at a specified
time, and appending a down-stream, nick-attaching adaptor B-3' to
the nick). Size-separation can be performed on the nested set of
circular molecules, or on linear molecules produced after
linearization of the template by cleavage of a restriction site
within adaptor RA. Alternative order of the five steps is possible,
including steps 2 and 3 before step 1, and step 5 any time after
step 2. The order shown is usually optimal, because all samples are
processed simultaneously in the same tube and size-selected at the
last step.
[0528] Amplification of the ordered nascent recombinant PENTAmers
creates ordered PENTAmers that can be amplified by the methods
discussed previously.
[0529] The PENT reaction at the distal ends is necessary to create
primary PENTAmers that contain sequences from different internal
positions. The sequence independence of the PENT reaction rate-
makes this practical do for a mixture of distal sequences. If a
single PENTAmer is synthesized on each template molecule, the
nick-translation reaction must proceed from the distal template end
toward the center of the molecule. If the RA adaptor is designed to
create two PENTAmers they will be in opposite directions and will
result in two down-stream nick-attaching adaptors, capable of
numerous recombination reactions.
[0530] Size separation of the nested set of DNA is critical to the
construction of the ordered PENTAmers. It is expected that
PENTAmers will behave very similarly to the intact template
fragments during the procedures now used for molecular weight
separation of DNA. The only difference between a template fragment
and the nascent primary PENTAmer made from that fragment is 1) a
nick or a small gap located near the end of the molecule; and 2) a
short extension to the 3' and 5' ends of the PENT product. Neither
of these differences are expected to alter the molecular weight,
charge, or hydrodynamic properties of the molecule. While in
principle the templates could be separated by size before creating
the primary PENTAmer, it is more efficient to complete as many
steps as possible before size fractionation. Separation of the pool
of nascent primary PENTAmers yields maximal efficiency.
[0531] Separation of the PENTAmers from the template molecules
before amplification on the basis of molecular weight and/or
incorporation of affinity-tagged or nuclease-resistant nucleotides
during the PENT reaction will increase the specificity of the
amplification reaction. This can be done by incorporating
cleavage-resistant nucleotide analogs during the nick-translation
reaction and/or into the adaptors, as described earlier. In the
case of high molecular weight templates, this can be done by
denaturation of the molecules and size separation of the smaller
PENTAmers from the larger, template fragments.
O. Multiplexing of PENTAmers Synthesis and Amplification
[0532] Reaction-specific adaptors can be incorporated during
PENTAmer synthesis and subsequently used for amplification of
specific PENTAmers. This process allows PENTAmers from multiple
templates or from multiple regions within templates to be pooled
during one or more preparative steps. The processing of the pools
of molecules saves time, effort and cost of those steps. At the end
of the processing, the PENTAmers from a specific template or region
within a template can be recovered from the pool and be
specifically amplified with a primer or primers specific for the
reaction-specific adaptors.
[0533] 1. Multiplexing PENTAmer Synthesis from Different
Templates
[0534] The synthesis of PENTAmers from a single template molecule
is described above. In this section it is demonstrated that a
plurality of different templates can be synthesized as PENTAmers by
using adaptors with template-specific sequences. PENTAmers from
individual templates can be subsequently recovered using
template-specific amplification primers (e.g., thermal cycling
primer extension, strand displacement amplification; PCR, or RNA
transcription), and/or subsequent to amplification using methods to
distinguish among the reaction-specific adaptor sequences, such as
Sanger cycle sequencing, or hybridization to DNA microarrays.
[0535] Multiplex cloning methods described in U.S. Pat. No.
4,942,124 are directed to multiplexed clones combined during a
Sanger sequencing reaction followed by analytical electrophoresis
and recovery of the sequences of individual molecules during
analysis of the sequencing ladders. However, the multiplexing
disclosed herein is distinct from that of U.S. Pat. No. 4,942,124,
because the multiplexing occurs during molecule preparation rather
than sequencing analysis. The sequences that facilitate
multiplexing are incorporated into template-specific adaptors that
are used to initiate or terminate a nick-translation synthesis of a
new molecular species, the PENTAmer. Recovery of information about
individual templates is done during the preparative step of
PENTAmer amplification or during sequencing or hybridization array
analysis.
[0536] The method to multiplex preparation of a primary PENTAmer on
two templates is as follows:
[0537] 1) Upstream terminus-attaching adaptor Al is ligated to
template 1;
[0538] 2) -Upstream terminus-attaching adaptor A2 is ligated to
template 2;
[0539] 3) Adapted templates 1 and 2 are mixed into a single tube;
and
[0540] 4) PENTAmer synthesis is completed on templates I and 2 in
said tube.
[0541] PENTAmers on both templates are elongated under identical
conditions (e.g., time, temperature, enzyme concentration, etc.)
and attaching the same downstream adaptor B-3' to each
template.
[0542] To recover PENTAmers complementary to template 1,
amplification is done including a primer that is specific for
sequences within adaptor A1. For example, the PENTAmers from
template 1 can be PCR amplified using a primer specific for
sequences within template-specific adaptor A1 and universal adaptor
B-3'. Likewise, to recover PENTAmers complementary to template 2,
amplification is done including a primer that is specific for
sequences within adaptor A2, e.g., a primer complementary to
adaptor A2 and a primer complementary to adaptor B-3'.
[0543] In cases where templates 1 and 2 have identical termini that
are to be attached to the adaptors, steps 1 and 2 above will be
performed in separate tubes. If templates 1 and 2 have termini of
different structure, adaptors A1 and A2 will have different
terminal structure and can be attached to templates 1 and 2 within
the same tube.
[0544] In addition, if the template-specific adaptors have an outer
region with universal sequence and an inner region with unique
sequence, then amplification can be performed with primers
complementary to the universal sequences and analysis performed
with primers complementary to the inner unique sequences, e.g., by
Sanger sequencing reaction, pyrosequencing, or DNA microarray
hybridization.
[0545] Multiplexing can be achieved with two or more template
molecules. In principle, thousands of templates can be prepared
with thousands of template-specific upstream terminus-attaching
adaptors, mixed into a single tube, and prepared as a pool of
PENTAmers. PENTAmers containing sequences from a specified template
can subsequently be amplified and/or analyzed using at least one
primer complementary to the template-specific upstream
terminus-attaching adaptor.
[0546] In principle templates can also be multiplexed using
template-specific downstream nick-attaching adaptors. However in
this case PENTAmers can only be mixed after completion of PENTAmer
synthesis.
[0547] FIG. 8 is a schematic diagram of multiplexed PENTAmer
creation and amplification.
[0548] Complement PENTAmers from different templates can be
multiplexed by attaching different adaptor A' sequences A'1, A'2,
A'3, . . . A'n) to n different templates.
[0549] Secondary PENTAmers prepared by the first method can be
multiplexed by attaching template-specific adaptors B-3' and/or
B-5'. Secondary PENTAmers prepared by the second method can be
multiplexed by attaching template-specific adaptors B-3' (I) or
B-3'(II). The purpose of this multiplexing is to combine secondary
PENTAmers complementary to different templates. Recovery of
information from specified templates or regions within templates is
subsequently done using template-specific amplification
primers.
[0550] 2. Multiplexing PENTAmer Synthesis from Different Regions
Within One or More Templates
[0551] Recombinant PENTAmers from multiple templates or from
multiple regions within templates can be prepared using
template-specific or template-fragment-length-specific adaptors.
Secondary PENTAmers prepared by the first method can be multiplexed
by attaching template-specific, time T-specific or time t-specific
adaptors B-3' or B-5'. Secondary PENTAmers prepared by the second
method can be multiplexed by attaching template-specific, time
T-specific or time t-specific adaptors B-3' (I) or B-3'(II)
adaptors. The purpose of this multiplexing is to combine secondary
PENTAmers complementary to different templates and/or different
regions within the same template. The templates to be amplified or
analyzed by multiplexing must exist in separate reaction volumes in
order to attach different adaptors: The separated volumes can
comprise DNA from different individual organisms, different species
of bacteria, animals or plants, different size fractions, different
restriction digestions of the same starting DNA, etc. Recovery of
information from specified templates or regions within templates is
subsequently done using template- or region-specific amplification
primers.
P. Pentamer Library Synthesis of Complex Mixtures of Templates such
as Genomes and cDNA Preparations
[0552] Current strategies for preparing genomic libraries include
random DNA fragmentation, size fractionation, and DNA-end repair,
followed by in vivo cloning. The clones can be randomly selected
for analysis or screened by hybridization or PCR in order to select
locus-specific clones for analysis.
[0553] PENTAmers can be used to form in vitro genomic libraries.
The controllable, narrow size distribution of PENTAmers make them
an ideal resource to prepare useful genomic libraries.
Amplification of PENTAmer libraries using template-specific primers
is used to select locus-specific PENTAmers for analysis.
[0554] PENTAmer libraries may be made from complex mixtures of
templates such as genomes and subsequently amplified using
locus-specific priming sites within the template. Consistent with
usage of the term library in genomics a PENTAmer library is herein
defined as PENTAmers representing the sequences present in the
mixture of template molecules. PENTAmer libraries can be unordered
or ordered. PENTAmer libraries can represent all sequences within
the template or subsets of sequences. PENTAmer libraries can be
amplified or unamplified.
[0555] Complex templates can be prepared by different methods
before PENTAmer synthesis, however the methods to synthesize and
separate PENTAmers are the same as those used for single templates.
The locus-specific primers are used to selectively amplify
specified positions within the genome or specified expressed
sequences within the cDNA preparation. These applications are
different from those previously described, because the
amplification primer(s) used to create libraries include one or
more primers complementary to sequences within the template, rather
than sequences in the adaptors.
[0556] 1. Primary PENTAmer Library Synthesis and Amplification from
Complex Mixtures of Templates
[0557] When primary PENTAmers are made from complex template
mixtures all sequences within the mixtures are represented in the
PENTAmer library. Amplification of the library with a
locus-specific primer or primers is used to isolate the PENTAmers
that contain the locus.
[0558] The amplification of primary PENTAmer libraries is analogous
to amplifying a locus of an intact genome or large-insert clone
using PCR primers complementary to sequences adjacent to the locus.
However, PCR employs priming sites flanking both ends of the locus,
whereas PENTAmer amplification requires a single priming site to
one side of the locus.
[0559] The amplification of primary PENTAmer libraries is also
analogous to amplification of "GeneWalker" Libraries (Clontech),
which are fragments prepared by complete restriction digestion of a
genome and ligation of universal adaptors to both ends. These
libraries are commercial versions of molecular intermediates used
in one-sided PCR. Locus-specific amplification is performed using
one locus-specific primer and one universal primer complementary to
the terminal adaptor. In this case, the lengths of the PCR products
are determined by the distance between a restriction site and the
locus-specific site. Because the restriction sites are sometimes
too close to the locus-specific priming site or sometimes too far
from the locus-specific priming site, many combinations of
restriction enzyme and genomic priming site are unsuccessful in
amplifying an appreciable length of the genome. To compensate for
this problem, multiple GeneWalker Libraries are made using
different restriction enzymes, and the amplification of a specific
region is performed on each library in order to find a library
capable of forming a PCR product of the desired size.
[0560] In contrast to the GeneWalker Libraries, PENTAmer libraries
are synthetic strands of uniform length made from templates
consisting of partially-digested genomic DNA. In contrast to
GeneWalker amplification, primary PENTAmer amplification results in
amplimers that are a range of sizes, up to a maximum size, set by
the size of the PENTAmer. In addition, before amplification
PENTAmers can be separated from the template strands, which reduces
background during amplification.
[0561] a. Synthesis and Amplification of Genomic Primary PENTAmer
Libraries Made from Template Molecules Comprised of a Partial
Restriction Digest of Genomic DNA.
[0562] Primary PENTAmer libraries from a genome (or other complex
template) is synthesized as follows:
[0563] 1) The genome is fragmented into molecules of desired size;
and
[0564] 2) Primary PENTAmers are synthesized at fragment
termini.
[0565] After synthesis of the library, a locus-specific molecule
can be amplified using PCR or other amplification method. If the
locus is to be sequenced, molecules having regions of identical
sequence are selected by cloning, PCR, or other or other in vitro
or in vivo amplification method and subjected to a
dideoxyribonucleotide termination or other suitable reaction.
[0566] FIG. 9 A shows an example of generation of linear primary
PENTAmer libraries. The genome or other complex template is
fragmented to a specified size (e.g., 1-10 kb) by partial cleavage
using a frequently-cutting restriction enzyme (e.g., Sau 3A I or
CvJ, which on average cleave random sequences every 256 or 64 bp,
respectively). Alternatively, DNase 1, or very gentle sonication,
nebulization, or gradient shearing can be used for cleavage. These
template fragments are ligated to the up-stream terminus-attaching
nick-translation adaptor A. (Sheared or DNase I cleaved DNA should
be end-repaired by T4 DNA polymerase/exonuclease III mixture before
blunt-end ligation.) Terminal PENTAmers of a specified size are
synthesized at all DNA ends by time-controlled nick-translation
synthesis and by appending a down-stream nick-attaching adaptor
B-3'. Upper (W) and lower (C) strands of the template DNA result in
W- and C-PENTAmers. The PENTAmers can be separated from the
template DNA by affinity capture or by size fractionation under
denaturing conditions. Both sets of PENTAmers constitute a primary
linear PENTAmer library, which redundantly represents the whole
genome.
[0567] Locus-specific members of the linear PENTAmer library can be
amplified by: 1) PCR; 2) cloning; or 3) circularization followed by
PCR. Single members of the library are selected by gel
electrophoresis.
[0568] i. Positional Amplification and Selection of Locus-Specific
Sequences from Primary Linear PENTAmer Libraries
[0569] A subset of PENTAmers in the library will overlap a
specified sequence (the kernel, K) in the genome. If the specified
sequence is unique to the genome, a nested set of PENTAmers
overlapping the unique locus can be amplified. If the specified
sequence appears multiple times in the genome, multiple nested sets
representing all of loci with the kernel sequences can be
amplified.
[0570] FIG. 10 illustrates how the C-strands in the linear primary
PENTAmer library (comprised of molecules C--P.sub.1, C--P.sub.2,
C--P.sub.3, etc., where C--P.sub.n denotes the nth C-strand
PENTAmer) that overlap the kernel are amplified using PCR. A one
step (or nested, two step) PCR reaction in the presence of primary
PENTAmer molecules, primer complementary to adaptor B and primer
k.sub.2L (or k.sub.1L and k.sub.2L) oriented toward adaptor B-3'
results in a nested set of DNA fragments C--P.sub.1<,
C--P.sub.2<, C--P.sub.3<, etc. (FIG. 10A). These fragments
have one common terminal sequence, within the kernel, and one
variable terminal sequence (left end in FIG. 10A), determined by
the length of the PENTAmer and the initiation site nick-translation
adjacent to the cleavage sites. The amplified DNA fragments are
size-separated on an agarose gel. The length of each amplified
fragment is determined by where the cleavage site occurred relative
to the kernel sequence. The electrophoretic band from PENTAmers
terminated at each cleavage site is slightly diffuse, because of
intrinsic uncertainty in the distance of nick-translation.
[0571] A PCR reaction using a primer complementary to adaptor A and
primer k.sub.2R (or k.sub.1R and k.sub.2R) oriented towards the
primer A would result in another nested set of DNA fragments,
C--P1>, C--P2>, C--P3>(FIG. 10B). Contrary to the previous
case, the electrophoretic bands are sharp, because adaptor A is
always adjacent to the restriction sites.
[0572] Using different combinations of primers, e.g., kL and A, or
kR and B would result in amplification of PENTAmers from the
opposite strand (W-PENTA mers).
[0573] The amplification of W- or C-strand PENTAmers is positional
amplification, because the positions of the sequences at the
termini of the amplimers (relative to the kernel) is known from the
size of the amplimers.
[0574] Kernel-specific PENTAmer amplimers that terminate at
restriction sites contain unique sequences discrete distances from
the kernel. Whenever amplimers of different length can be
distinguished, they can be directly subjected to cycle sequencing,
PCR amplified and sequenced, or cloned and sequenced. Because
amplimers can be selected from specific distances in each direction
from the kernel, the sequence of a large region surrounding the
kernel can be assembled from minimally redundant sequencing.
[0575] Kernel-specific PENTAmer amplimers that terminate at
heterogeneous ends (i.e., including the downstream nick-attaching
adaptor sequences) contain sequences different distances from the
kernel. These amplimers of heterogeneous length can be amplified by
selection PCR, dilution PCR, or cloned to create large numbers of
unique sequence templates for sequencing. Because amplimers can be
selected from specific distances in each direction from the kernel,
the sequence of a large region surrounding the kernel can be
assembled from sequences of minimally redundant in vivo or in vitro
amplified PENTAmers.
[0576] ii. Positional Amplification and Selection of Locus-Specific
Sequences from Circularized Primary PENTAmer Libraries
[0577] Linear primary PENTAmers have common adaptor sequences at
their 5' and 3' ends. Therefore, they can be circularized by
ligation. To be circularized, the upstream, terminus attaching
adaptor A needs to be synthesized with a 5' phosphate group.
Although circularization is possible using ligase specific for
single-stranded DNA ends (e.g., RNA ligase), it is more rapid and
efficient using a DNA ligase employing a "linking" oligonucleotide
(shown in FIG. 9B).
[0578] Circularization is performed using the following steps:
[0579] 1) A linking oligonucleotide is incubated under optimized
conditions to the ends of the PENTAmer together to form a nick;
and
[0580] 2) The PENTAmer ends are ligated using a DNA enzyme, such as
a ligase.
[0581] The linking oligonucleotide (shown as L in FIG. 9B) is
20-200 bp long and has a 5' arm complementary to the 3' PENTAmer
end and 3' arm complementary to the 5' PENTAmer end. The lengths
and sequences of the arms form a more stable duplex with one
PENTAmer end compared to the other. In the example shown in FIG. 9
B, this is achieved by having a greater number of nucleotides at
the 5' arm (LA) that are complementary to the PENTAmer than the
number of complementary nucleotides on the 3' arm (LB).
Alternatively, arms of the same length, but different GC content
can be used.
[0582] The reaction is performed at low PENTAmer concentration to
facilitate intra- versus inter-ligation processes. The criteria for
selection of DNA concentration is simple: The concentration of
PENTAmer termini should be much lower then their "local" molecular
concentration. The last concentration is much higher for single
stranded then for double stranded DNA because of big difference in
a persistence length between the two types of molecules.
[0583] The ligation reaction is performed with thermostable ligase
at 50-70 C.degree. to reduce effect of secondary structure and
intermolecular interactions. The reaction temperature should be
lower than the melting temperature of a duplex formed between
oligonucleotide L and one of PENTAmer ends (duplex between adaptor
sequence A and LA portion of the oligo L in FIG. 9B) but slightly
higher then the melting temperature of a duplex formed by oligo L
with the other PENTAmer end. At this temperature oligonucleotide L
will be stably bound to only one end of the single-stranded
PENTAmer and form transient secondary structure with another end,
providing a template for the ligase. This approach overcomes the
need to precisely adjust the stoichiometric ratio of PENTAmers to
linking oligonucleotides. The reaction can take place at much
higher linking oligonucleotide concentration, increasing the rate
and efficiency of ligation.
[0584] The library of circularized PENTAmers is a mixture of
circular C-PENTAmers and W-PENTAmers.
[0585] FIG. II shows an example of how a circular primary PENTAmer
library is used to amplify sequences adjacent to the kernel, K.
[0586] The first step is an inverse PCR reaction of all members of
the library. FIG. 11A shows amplification of circular C-strand
PENTAmers C--P.sub.1, C--P.sub.2, C--P.sub.3, and C--P.sub.4 and
FIG. 11B shows amplification of circular W-strand PENTAmers
W-P.sub.1, W-P.sub.2, W-P.sub.3, and W-P.sub.4. Primers k.sub.L and
k.sub.R oriented towards the boundaries of the kernel results in
amplification of the mixture of DNA fragments C--P.sub.1*,
C--P.sub.2*, C--P.sub.3*, C--P.sub.4*, and W--P.sub.1*,
W--P.sub.2*, W--P.sub.3*, W--P.sub.4*. These molecules have the
same size and common junction element AB with different orientation
and at different distances from the end for different DNA fragments
(FIGS. 11A, B). The amplimers contain sequences on both sides of
the kernel.
[0587] The second step is PCR amplification of the products of the
first amplification (diluted 100-1000 times) using a primer
complementary to adaptor A and a kernel primer. Amplification with
k.sub.R results in a nested set of amplimers C--P.sub.1**,
C--P.sub.2**, C--P.sub.3**, and C--P.sub.4** complementary to the
region to the right of the kernel (FIG. 11A). Amplification with
k.sub.L results in a nested set of amplimers W--P.sub.1**,
W--P.sub.2**, W--P.sub.3**, and W--P.sub.4**, complementary to the
region to the left of the kernel. Amplimers C--P.sub.1**,
C--P.sub.2**, C--P.sub.3**, and C--P.sub.4** and/or W--P.sub.1**,
W--P.sub.2**, W--P.sub.3**, and W--P.sub.4** are size separated by
electrophoresis. Their lengths reflect the distances between the
kernel and the restriction sites. The electrophoretic bands are
sharp, because of the distinct positions of the adaptor A sequences
with respect to the restriction sites.
[0588] The amplification of circularized W- or C-strand PENTAmers
is positional amplification, because the positions of the sequences
at the termini of the amplimers (relative to the kernel) is known
from the size of the amplimers.
[0589] Amplicons from the second amplifications are separated (by
human or robot selection), further amplified (if necessary) and
cycle sequenced using a primer complementary to adaptor A. The
sequence assembly can be performed with minimal redundancy at both
sides of the kernel.
[0590] Circular primary PENTAmer libraries are amplified and
selected more efficiently than linear PENTAmer libraries,
because:
[0591] 1) The reaction is more specific because it involves inverse
PCR using only kernel-specific primers at the first, most critical
amplification step;
[0592] 2) Both sequences to the right and left of the kernel are
amplified in one step;
[0593] 3) All amplimers are of equal size during the first
amplification step;
[0594] 4) Cloning is not obligatory because the electrophoretic
bands are sharp and individual fragments can be isolated and
sequenced.
[0595] b. Synthesis and Amplification of Genomic "Walking" PENTAmer
Libraries Made from Template Molecules Comprised of a Complete
Restriction Digest of Genomic DNA.
[0596] A walking PENTAmer library is produced by the following
steps:
[0597] 1) Complete digestion of genomic DNA with a restriction
enzyme; and
[0598] 2) Synthesis of primary PENTAmers of different specified
lengths.
[0599] The optimal size of restriction fragments is 8-10 kb. The
primary PENTAmers are created to be different lengths in different
tubes, up to .about.10 kb long.
[0600] FIG. 12 shows an example of creating a walking library for
four different lengths of PENTAmers prepared in different tubes by
controlling nick-translation times. Each reaction results in a
library of W- and C-strand PENTAmers, originating from the two ends
of each restriction fragment. If necessary, PENTAmers can be
separated from template DNA by affinity capture or by denaturation
and size fractionation.
[0601] FIG. 12A is an example of "parallel" positional
amplification to the left of a kernel using walking PENTAmer
libraries of 1, 2, 3, and 4 kb. One step (or nested, two step) PCR
amplification of each library using a primer complementary to
adaptor B and primer k.sub.2L (or k.sub.1L and k.sub.2L) oriented
towards primer B produces amplimers C--P.sub.1*, C--P.sub.2*,
C--P.sub.3*, C--P.sub.4*. These amplimers have one common end
within the kernel and a variable end specified by the length of
PENTAmer. The amplimers from each tube can be cloned and directly
sequenced. Walking libraries give access to sequences located
within .about.10 kb of restriction sites. To apply positional
amplification to the entire genome several walking libraries should
be prepared by digestion with different restriction endonucleases,
e.g., Eco RI, Hind III, and Bam HI, Pvu II. PCR screening of the 1
and 2 kb restriction-enzyme-specific walking libraries using
primers specific to adaptor A and the kernel is used to identify
which restriction-enzyme-specific walking library should be used to
amplify the locus adjacent to the specified kernel.
[0602] A parallel positional amplification to the right of the
kernel shown in FIG. 12A requires amplification of the walking
library using primers complementary to the opposite strands of
adaptor B and the kernel.
[0603] FIG. 12B is an example of "serial" positional amplification
to the left of a kernel using walking PENTAmer libraries. In this
case DNA sequence information generated at one
amplification/sequencing step is used for the design of a primer to
amplify. and sequence the next, more distal DNA region.
[0604] 2. Secondary PENTAmer Library Synthesis and Amplification
from Complex Mixtures of Templates
[0605] Secondary PENTAmer walking libraries can be made from
complex templates such as genomes. Synthesis of secondary PENTAmers
different distances from the ends of restriction fragments will
give rise to linear or circular PENTAmer libraries that can be used
for serial positional amplification to either side of a kernel
using obvious extension of the methods used to amplify primary
PENTAmer libraries.
[0606] 3. Recombinant PENTAmer Library Synthesis and Amplification
from Complex Template Mixtures
[0607] Recombinant PENTAmer libraries can be made by the same
techniques used to synthesize recombinant PENTAmers on single
template molecules. After synthesis the PENTAmers representative of
one locus are amplified using one or more primers complementary to
a kernel region within the genome or other complex template
mixture, and (optionally) one or more primers complementary to a
recombination adaptor. Genomic PENTAmer libraries are made from
either DNA fragments produced from a partial restriction digestion
of a genome with a frequently-cutting restriction enzyme (type I
library), or fragments from a partial restriction with a
frequently-cutting restriction enzyme and complete digestion with
an infrequently-cutting enzyme (type II library). The genomic
libraries either represent a mixture of nascent PENTAmers of all
lengths (unordered libraries) or nascent PENTAmers of different
lengths (ordered PENTAmers). Amplification of unordered libraries
using at least one primer complementary to a kernel sequence
produces a random mixture of amplified PENTAmers complementary to a
large region to one side of the kernel. Amplification of ordered
libraries using at least one primer complementary to a kernel
sequence produces an ordered set of amplified PENTAmers
complementary to ordered regions different distances from the
kernel on one side of the kernel.
[0608] The fundamental steps of preparing an unordered library
are:
[0609] 1) Restriction with one or more restriction enzymes;
[0610] 2) Attachment of one or more types of recombination adaptors
to fragment termini;
[0611] 3) Synthesis of primary PENTAmers at both ends of the
fragments; and
[0612] 4) Intramolecular recombination between the ends of the
fragments.
[0613] The fundamental steps of preparing an ordered library
are:
[0614] 1) Restriction with one or more restriction enzymes;
[0615] 2) Attachment of one or more types of recombination adaptors
to fragment termini;
[0616] 3) Synthesis of primary PENTAmers at both ends of the
fragments;
[0617] 4) Intramolecular recombination between the ends of the
fragments; and
[0618] 5) Separation of the nascent PENTAmers according to
size.
[0619] Depending upon the type of library to be formed, the design
of the adaptors, and methods of recombination, size separation, and
amplification, the details and order of these steps can be
different.
[0620] PENTAmer libraries are amplified using the same methods used
for PENTAmers made from single template molecules, however
inclusion of one or more kernel-specific primers selects and
amplifies only those PENTAmers that contain the kernel sequence (in
the specified orientation).
[0621] Convenient genomic kernels are ESTs, STSs, and anonymous
sequences known to be within the genome. Kernels can also be
discovered by random or systematic sequencing of small fragments of
a genome. For special applications, kernels can be genetic elements
that have been inserted into the genome by natural (e.g., viral) or
artificial (e.g., bioballistics) means. Kernels can be known by
exact sequence, or by sequence analogy with known sequences in
related organisms. Specifically, primers complementary to a kernel
in one species can be tested and optimized for efficiency of
amplification of the analogous locus in a related species, by the
same process that PCR primers for one species can be optimized or
modified to amplify an analogous locus in a different species. Most
applications are best developed using kernels that are unique to
the genome, however some applications can also be developed that
use kernels that could occur multiple times in the genome, such as
transposable elements, microsatellites, etc., in order to create
libraries of DNA sequences that are adjacent to those multi-copy
sequences. Convenient cDNA kernels are 3' ESTs.
[0622] The topological construction and the applications of the
recombinant PENTAmers are similar to the "junction-fragment DNA
probes and probe clusters" (U.S. Pat. No. 4,710,465). That patent
proposes to size fractionate genomic DNA fragments after partial
restriction digestion, circularize the fragments in each
size-fraction to form junctions between sequences separated by
different physical distances in the genome, and then clone the
junctions in each size fraction. By screening all the clones
derived from each size-fraction for using a hybridization probe
from a known sequence, ordered libraries of clones could be created
having sequences located different distances from the known
sequence.
[0623] In contrast to the methods described by Collins and
Weissman, the methods described herein use specially-designed
multi-functional adaptors and nick translation reactions to
synthesize an in vitro amplifiable strand of controlled length. The
locus specificity of in vitro amplification is determined by a
primer complementary to a natural sequence in the genome (see FIG.
13).
[0624] 4. Type I Recombinant PENTAmer Library
[0625] A type I recombinant PENTAmer ordered library is created
from a complex template such as a genome that has been partially
fragmented using a frequently-cutting restriction enzyme or
randomly cleaved. In this example, it is assumed that a genome has
been partially restricted.
[0626] a. Synthesis of a Type I Genomic Recombinant PENTAmer
Ordered Library
[0627] FIG. 14 shows an example of creating a type I genomic
PENTAmer ordered library.
[0628] First the genome is restricted using a frequently-cutting
restriction enzyme. The nested set of fragments terminating at a
specific, proximal restriction site n1 is shown in FIG. 14A. The
members of this set have distal ends at different restriction
sites, m1, m2, m3, . . . The set of fragments of uniform size
terminating at distal restriction sites m1, m2, m3, . . . is shown
in FIG. 14B.
[0629] Second, nascent primary PENTAmers are synthesized at the
ends of the restriction fragments (i.e., ligation of an upstream
terminus-attaching recombination adaptor to each end, initiation
and termination of a controlled nick-translation reaction, and
attachment of a down-stream nick-attaching adaptor B).
[0630] Third, the nascent PENTAmers are fractionated by size using
gel electrophoresis, pulse-field gel electrophoresis,
centrifugation, or another appropriate method. Individual size
fractions are placed into different tubes. The nascent PENTAmers
from increasing size fractions contain distal PENTAmers increasing
distances from the proximal PENTAmers. These nascent PENTAmers form
a component of the genomic ordered PENTAmer library.
[0631] Fourth, the nascent PENTAmers are circularized by one of the
recombination methods described in a later section. The FIG. shows
the RA1-RA2 adaptor junctions formed by recombination of the distal
PENTAmer strand with the proximal template strand. In this example,
both adaptors can have the same sequence and structure. The
structure of these recombinant PENTAmers is shown to be linear in
this example, however the recombinant PENTAmers made using other
recombination procedures could have different structure, including
circular. The essential feature of these recombinant PENTAmers is
that they join the proximal and distal ends of template fragments
of different length.
[0632] Using appropriately designed adaptors, recombination can be
performed before PENTAmer synthesis or before size separation.
Whenever recombination is done before size fractionation, the
nascent PENTAmers are separated as circular molecules.
[0633] b. Positional Amplification of a Type I Genomic Recombinant
PENTAmer Ordered Library
[0634] Recombinant PENTAmers can be amplified in a
locus-independent or locus-specific manner.
[0635] Locus-independent amplification of all or most all of the
members of a recombinant PENTAmer library is useful to increase the
number and fraction of molecules that can later be subjected to
locus-specific amplification. The molecules produced can
incorporate nucleotide analogs during nick-translation or as a part
of the primer, and subsequently isolated by affinity of a matrix or
surface for the nucleotide analog, e.g., a biotinylated nucleotide.
Alternatively, the complexity of the library can be decreased by
incorporating nucleotide analogs into the PENTAmer strands that are
resistant to chemical or enzymatic degradation. Subsequent
degradation of the natural genomic DNA will enrich the library for
PENTAmers. Locus-independent amplification can be done using
multiple cycles of a primer-extension reaction using a primer
complementary to the nick attaching adaptor B, or a single cycle of
primer extension followed by transcription of the double-stranded
product using RNA polymerase and a promotor domain within adaptor
B.
[0636] To amplify a specific locus in a genome as an ordered
amplified library, those members of the recombinant PENTAmer
library containing a specified, kernel sequence are amplified. The
specificity of this amplification is highest when conventional or
nested PCR is used. However, any other method that employs
kernels-specific primers can also be used. FIG. 16 shows an example
of how the recombinant PENTAmers containing kernel sequences are
amplified using a nested PCR reaction with primers complementary to
the kernel sequences k1 and k2. Sequences complementary to regions
increasingly distant from the genomic kernel are amplified in
successive size fractions as amplimers of uniform size. Of course,
depending upon the length difference between successive nascent
PENTAmer size fractions and upon the length of the nick-translation
products, the PENTAmer sequences in adjacent tubes will overlap by
different amounts or not overlap at all.
[0637] Fragments with identical proximal ends (as shown in FIG.
14A) will have kernel regions unique distances from the junctions.
Fragments with all possible proximal ends (as shown in FIG. 14B)
will have kernel regions different distances from the junctions.
The distance between the kernel and the junction can be limited to
a narrow distribution by doing one of the following:
[0638] 1) Limiting the time of primer extension during linear or
exponential amplification;
[0639] 2) Separating the amplified strands by size; or
[0640] 3) Designing the adaptors and recombination reactions to
covalently join the proximal and distal PENTAmer strands, as shown
in FIG. 34A, B, and D, in which cases the time of the
nick-translation reactions limit the distance of the kernel from
the junction.
[0641] After locus-specific amplification of each tube from the
ordered library using kernel-specific primers, the distal PENTAmers
can be amplified using a primer complementary to a site within one
of the recombination adaptors and the downstream adaptor B. This
will produce amplimers that are smaller and more uniform in size,
which are more appropriate for in vivo or in vitro cloning as
molecules with unique sequence.
[0642] c. Selection of Unique Members of a Type I Genomic
Recombinant PENTAmer Ordered Library
[0643] The molecules amplified in a single tube of a type I genomic
recombinant PENTAmer ordered library will have a distribution of
sequences, because the upstream adaptor RA2 has been attached to a
number of different restriction sites, and the nick-translation
reaction will have terminated at a large number of sites within the
genome. Although a distribution of sequences can be "read" by
certain sequencing methods, including sequencing by hybridization
and mass spectrometry, a distribution of sequences cannot be read
using a conventional sequencing apparatus, which requires that most
strands have a unique 5' end, and a 3' end that terminates at a
specific nucleotide base.
[0644] To prepare samples from a PENTAmer library for sequencing,
the amplified molecules should have unique sequences at one or both
ends of the template-complementary region. This can be achieved by
one of the following techniques:
[0645] 1) PCR amplification of samples that have been diluted to
the extent that usually only one DNA molecule is contained by the
reaction mixture;
[0646] 2) PCR amplification of samples using one primer
complementary to the nick-attaching adaptor and a second primer
with 5' end complementary to the terminus-attaching primer and a 3'
end with one or more bases complementary to one or two specific
template bases adjacent to the terminus-attaching primer. Only
molecules with template sequences complementary to the selection
primers will be amplified;
[0647] 3) Cycle sequencing reactions that employ a selection primer
with 3' end complementary to one or two bases of the template
adjacent to the upstream terminus attaching adaptor; or 4) Cloning
of the amplified fragments in a bacterial or viral vector and
selecting individual clones for sequencing.
[0648] The advantage of the last method is that the cloned DNA has
unique sequences at both ends of the template region and can be
sequenced using sequencing reactions in both directions. The in
vivo cloning approach is illustrated in FIG. 18 A.
[0649] d. Type I Recombinant PENTAmer Unordered Libraries
[0650] Omission of the size fractionation produces a single tube
with nascent PENTAmers of all sizes. When this mixture is amplified
using primers complementary to the kernel and the adaptors, all
template sequences covering a large region to the right or left of
the kernel are amplified as a mixture. The sequence of this mixture
can be used for many preparative and analytic purposes. Because the
size of the region amplified is limited only by the physical
stability of the fragments produced by enzymatic, physical, or
chemical cleavage, a region of the genome as large as
.about.500,000 bp can be amplified in a single tube using one set
of PCR primers or transcription initiation site. This mixture of
fragments can resequenced using DNA microarrays, or cloned and
shotgun sequenced. This mixture can be used to map the positions of
genetic markers using PCR or hybridization, or to map loci on
chromosomes using FISH.
[0651] e. Multiplexed Type I Recombinant PENTAmer Libraries
[0652] Using adaptors with different sequences during creation of
different PENTAmer ordered or unordered libraries allows different
libraries to be combined during subsequent processing steps, and
the members of individual libraries later recovered by
amplification using library-specific primers. For example,
different bacterial genomes can be separately attached to upstream
(and/or downstream) adaptors having distinguishable sequences, and
subsequently combined to form a mixed library. Additionally,
genomic DNA from different individual animals and plants can be
separately attached to upstream (and/or downstream) adaptors having
distinguishable sequences, and subsequently combined to form a
mixed library. The ordered library produced could be amplified
using locus-specific primers and adaptor-specific primers to
amplify DNA strands from a specified position in a specified
genome. Multiplexed adaptors can be distinguished during
amplification, as above, as the result of reading the sequence, by
hybridization, by direct labeling of the adaptors using
fluorescence or mass tags, or other means. Multiplexing is an
efficient method to combine the steps of processing, amplification,
and detection of DNA molecules to decrease the time and cost of
analysis.
[0653] 5. Type II Recombinant PENTAmer Libraries
[0654] Ordered and unordered libraries can also be made from
complex templates that have been cleaved twice--a complete
restriction digestion with an infrequently cutting restriction
enzyme and a partial digestion with a frequently-cutting agent such
as a frequently-cutting restriction enzyme. The kernel sequences
are chosen to be adjacent to the infrequently-cut sites. These
"asymmetric" fragments have many advantages over the "symmetric"
fragments restricted with a single enzyme. First, all kernel
sequences are close enough to the terminus that they can be used
for amplification. Second, the fraction of fragments that contain a
specified kernel close to the terminus is greatly increased. Third,
because the fragments containing kernels have ends created by
different restriction digestions, the PENTAmers created at the two
ends can have different lengths as well as different upstream and
downstream adaptor sequences. Fourth, this approach makes it easy
to systematically choose kernel sequences to sequence entire
chromosomes. Fifth, the kernel sequences developed for
amplification can also be used to detect genome instabilities.
[0655] a. Synthesis of Type II Recombinant PENTAmer Ordered
Libraries
[0656] FIG. 15 shows an example of synthesis of a type II
recombinant PENTAmer ordered library.
[0657] The steps are as follows:
[0658] 1) Complete restriction with an infrequently-cutting
restriction endonuclease to produce R1 ends;
[0659] 2) Synthesis of primary PENTAmers at R1 ends (terminal
PENTAmers);
[0660] 3) Partial cleavage using a frequently-cutting restriction
endonuclease to produce R2 ends;
[0661] 4) Synthesis of primary PENTAmers at R2 ends (internal
PENTAmers);
[0662] 5) Recombination between the R1 and R2 ends; and
[0663] 6) Size fractionation of the nascent PENTAmers.
[0664] Synthesis of the primary PENTAmers is achieved by the means
described earlier. Each PENTAmer is made by attaching an upstream
adaptor A, performing a controlled nick-translation reaction, and
attaching a downstream adaptor B. The upstream and downstream
adaptors are appropriate for specifically recombining the terminal
and internal PENTAmers on the same DNA fragments. It is this
joining of a proximal PENTAmer to a distal PENTAmer that creates a
recombinant PENTAmer that is able to be amplified using
locus-specific kernel primers.
[0665] The terminal PENTAmer is shown in FIG. 15A as being
synthesized prior to partial restriction, followed by synthesis of
the internal PENTAmers. This stepwise process allows the upstream
and downstream adaptors and the length of the PENTAmers to be
different on the proximal (terminal) and distal (internal) ends of
the fragments. Fragments with two R.sub.2 ends will not recombine.
The order of the partial and complete restriction digestions is
arbitrary. For many applications, it is more advantageous to digest
with the frequently-cutting restriction enzyme first. Because the
R1 and R2 sites can be made to have non-complementary structure, it
is also possible to synthesized the PENTAmers after both
restriction digestions.
[0666] The recombination reaction is carried out with highly
diluted template fragments to reduce dramatically the frequency of
intermolecular recombination.
[0667] FIG. 15B shows one linear recombinant PENTAmer, made by
joining a recombinant upstream adaptor RA.sub.2 (shown in diagram
as A.sub.2) and a downstream recombinant adaptor RB.sub.1 (shown in
diagram as B.sub.1), to produce a recombinant PENTAmer with two
strands synthesized by nick-translation.
[0668] Other examples of recombinant adaptors, recombination
reactions, and recombinant structures are described in later
sections. Of particular interest are the circular recombinant
PENTAmers.
[0669] As the result of size fractionation of the nascent
recombinant PENTAmers, different tubes of the ordered library
contain nascent PENTAmers of different lengths, having terminal and
internal PENTAmers complementary to regions different distances
apart in the genome.
[0670] b. Synthesis of Type II Recombinant PENTAmer Unordered
Libraries
[0671] A type II recombinant PENTAmer unordered library is
synthesized by performing all steps as in synthesizing a type II
recombinant PENTAmer ordered libraries, without size separation of
the nascent PENTAmers.
[0672] c. Amplification of Type II Recombinant PENTAmer
Libraries
[0673] Type II recombinant PENTAmer libraries can be PCR amplified
in a non-locus-specific fashion using primers complementary to the
adaptors (e.g., A.sub.1 and B.sub.2, as shown in FIG. 15B). Such
amplification amplifies the entire library.
[0674] Linear type II recombinant PENTAmer libraries can be PCR
amplified in a locus-specific fashion using one or more primers
complementary to a kernel region within a terminal PENTAmer and one
or more primers complementary to the upstream adaptor at the distal
(internal) R1 ends of the fragments.
[0675] d. Two-Step Locus-Specific Amplification of Type II
Recombinant PENTAmer Unordered and Ordered Libraries
[0676] In many applications, a known kernel sequence is not
adjacent to an infrequently-cut restriction site and therefore
cannot be used for locus-specific amplification. In this very
important case, an initial amplification (step A) of a type II
recombinant PENTAmer unordered library can be used to sequence a
terminal kernel site and that terminal kernel used in a second step
(step B) to amplify a large region adjacent to the RI terminus as
an unordered or ordered library.
[0677] FIGS. 17A through 17D show an example of using linear type
II recombinant PENTAmer libraries in a two-step process. An
unordered library is used in the first step and an ordered or
unordered library used in the second step. Both libraries have been
made with the same infrequently-cutting restriction enzyme. The
frequently-cutting restriction enzymes may be identical or
different. In step A, the unordered library is amplified using one
or more primers complementary to a known, internal kernel sequence
and one or more primers complementary to the upstream adaptor RA1
(shown as A1). The recombinant PENTAmers containing the kernel
sequence will be amplified, including a region within the internal
PENTAmers and the entire terminal PENTAmer. The sequence of the
terminal PENTAmer can be determined using a Sanger sequencing
reaction primed by an oligonucleotide complementary to the upstream
adaptor A1. The sequence of the terminal PENTAmer is examined to
determine one or more sites that can be used as terminal kernels,
e.g., T1 and T2. Primers complementary to the terminal kernel(s)
and complementary to an adaptor of the internal PENTAmer (shown in
FIG. 17A as downstream adaptor B2) will amplify different internal
PENTAmer sequences, IPx. If an ordered library is used in the
second step, ordered fragments will be produced in different tubes.
If an unordered library is used in the second step, random
fragments from throughout a large region between two
infrequently-cut restriction sites will be amplified.
[0678] The choice of priming sites for amplification depends upon
the sequences of the adaptors used and the method used to achieve
recombination. For example, FIG. 17B shows the two step process of
positional amplification beginning with an internal kernel mediated
by circular recombinant PENTAmers. This example shows a first
lamplification of an unordered circular library using inverse PCR
with two internal kernel-specific primers and a second step of
inverse PCR using two terminal kernel primers.
[0679] e. Use of Type II PENTAmer Libraries for Genome
Sequencing
[0680] FIG. 18B and C illustrate the strategies for using type II
libraries for genomic sequencing. FIG. 18B shows how a known
internal kernel can be used to first determine the terminal
sequences of one region flanked by two rare restriction sites, and
then the terminal sequences used to amplify all the internal
PENTAmers, followed by selection of unique fragments by in vivo or
in vitro cloning and sequencing.
[0681] FIG. 18C shows a strategy to sequence an entire genome
without prior identification of kernels. In step 1 primary
PENTAmers are synthesized at all termini created by the rare
restriction enzyme. These terminal PENTAmers are sequenced and the
sequences assembled into a database of terminal sequences. In step
2 the internal PENTAmers are amplified and sequenced, using kernels
in the database of terminal sequences. In step 3 a type I ordered
or unordered library is used to link the terminal sequences from
one large restriction fragment with the sequences of the adjacent
large restriction fragment.
Q. Specialized Adaptors for Pentamer Synthesis
[0682] To promote synthesis of the primary PENTAmers and facilitate
creation of the complement PENTAmers and secondary PENTAmers,
several new adaptors and methods for their creation described
herein. Depending on the location of the attachment site along
double-stranded DNA molecule the adaptors can be divided into two
classes: terminus-attaching and nick-attaching adaptors. A
terminus-attaching adaptor is designed to be ligated to a DNA end
created by enzymatic, chemical or physical DNA cleavage. A
nick-attaching adaptor is designed to be covalently linked to a
free 3'-OH or 5'-P group located at an internal nick or gap within
a primarily double-stranded DNA molecule. Depending on the position
within the DNA strand the adaptors can be also divided into two
groups: up-stream and down-stream adaptors. Up-stream adaptors are
adaptors located at the 5' end of the DNA strand, down-stream
adaptors are adaptors located at the 3' end. Adaptors can have
multiple domains with different functions, for instance, specific
domains for hybridization or ligation to a ends of template DNA
molecules, efficient initiation of a PENT reaction, detection,
amplification, and recombination. Adaptors can be single or double
stranded DNA molecules. A functional domain can be a fraction of
the nucleotides of a DNA molecule, the entirety of a DNA molecule,
or multiple DNA molecules connected via non-covalent linkages.
[0683] 1. Up-Stream Terminus-Attaching Nick-Translation Adaptors:
Composition and Attachment to DNA.
[0684] Up-stream terminus-attaching nick-translation adaptors are
short artificial DNA molecules that are directly ligated to the
ends of DNA fragments generated, for example, by digestion with
restriction enzyme(s). Their design has a minimum of two domains:
1) a domain optimized for efficient ligation to the ends of
template DNA molecules, and 2) a domain optimized for efficient
initiation of the nick-translation reaction towards the middle of
the template DNA fragments. In addition, other functional domains
can be present, such as domains for optimal amplification or
detection and/or domains that inhibit self-ligation of the
adaptors.
[0685] A preferred design of an up-stream nick-translation adaptor
is formed by annealing 3 oligonucleotides (or more):
oligonucleotide 1, oligonucleotide 2 and oligonucleotide 3 (FIG.
19A). The left ends of these adaptors are designed to be ligated to
double-stranded ends of template DNA molecules and used to initiate
nick-translation reactions. Oligonucleotide I has a phosphate group
(P) at the 5' end and a blocking nucleotide (X) at the 3' end, a
non-specified nucleotide composition and length from 10 to 200
bases. Oligonucleotide 2 has a blocked 3' end (X), a
non-phosphorylated 5' end, a nucleotide sequence complementary to
the 5' part of oligonucleotide I and length from 5 to 195 bases.
When hybridized together, oligonucleotides I and 2 form a
double-stranded end designed to be ligated to the 3' strand at the
end of a template molecule. To be compatible with a ligation
reaction to the end of a DNA restriction fragment, an up-stream
nick-translation adaptor can have blunt, 5'-protruding (as shown by
example in FIG. 19A) or 3'-protruding end. Oligonucleotide 3 has a
3' hydroxyl group, a non-phosphorylated 5' end, a nucleotide
sequence complementary to the 3' part of oligonucleotide 1, and
length from 5 to 195 bases. When hybridized to oligonucleotide 1,
oligonucleotides 2 and 3 form a nick or a few base gap within the
lower strand of the adaptor. Oligonucleotide 3 can serve as a
primer for initiation of the nick-translation reaction.
[0686] Blocking nucleotides at the 3' ends can be any
dideoxynucleotide, amino-modified nucleotide or any other
nucleotide analog that prevents ligation of the 3' ends to another
strand or extension of the oligonucleotide by a polymerase such as
Taq polymerase or terminal deoxynucleotidyl transferase (TdT). The
5' ends of all oligonucleotides in FIG. 19 are not phosphorylated,
and therefore blocked from ligation reactions, unless where
indicated wherein phosphorylation competent 5' ends are shown as
dark circles.
[0687] The functions of oligonucleotide 1 are to be ligated to the
end of a template DNA molecule, and to hybridize to additional,
complementary oligonucleotides that have additional functions.
Oligonucleotide 2 hydrogen bonds to complementary sequences
adjacent to the 5' end of oligonucleotide 1 to make a
double-stranded terminus that is compatible (i.e., can be ligated
to) the end of a template DNA molecule. Oligonucleotide 3 hydrogen
bonds to complementary sequences adjacent to the 3' end of
oligonucleotide 1, has a 3' end that can prime (i.e., initiate) a
nick-translation reaction, and a 5' end incapable of being ligated
to another strand.
[0688] Less preferred embodiments of the upstream
terminus-attaching nick-translation adaptors can be made to achieve
the same purposes. For example, a gap between the 5' end of
oligonucleotide 2 and 3' end of oligonucleotide 3 would achieve the
same goal of preventing ligation of oligonucleotide 2 to
oligonucleotide 3.
[0689] When it is necessary to perform a second nick-translation
reaction to create a secondary PENTAmer molecule, oligonucleotide I
is designed to have an exterided 3' tail for binding the second
oligonucleotide primer 4 (FIG. 19B).
[0690] An up-stream nick-translation adaptor has only one
ligation-competent terminus--the phosphorylated 5' end of
oligonucleotide 1. This novel feature prevents ligase from
dimerizing the adaptors. As a result, the adaptor concentration
remains high during the ligation reaction with T4 DNA ligase, and
the adaptor can be efficiently ligated to the 3' ends of DNA
molecules even when present at a low adaptor/DNA terminus
ratio.
[0691] After an upstream terminus-attaching nick-translation
adaptor is ligated to template DNA there is only one free 3' OH
group available for a DNA polymerase reaction. This novel feature
is critical for the production of a PENTAmer, because it allows 1)
efficient initiation of a nick-translation reaction from the ends
of the template DNA fragments by extending oligonucleotide 3 in the
presence of DNA polymerase with 5' exonuclease activity, and 2)
appends a known sequence to the 3' end of the nick-translation
product that can later be used in amplification reactions.
[0692] In addition to the critical functions of the upstream
terminus-attaching nick-translation adaptor listed above, there are
two optional features that can be designed into the adaptor. First,
for those applications where an 3' exonuclease is used to convert
the nick-translation nick to a gap, the adaptor should be designed
so as to protect the 3' end of oligonucleotide 1 from
exonucleolytic activity. This can be done by incorporation of a
nuclease-resistant nucleotide analog (e.g., .alpha.-thioated
(Nakayame et al., 1988) or .alpha.-boronated nucleotides (WO
98.1112)) into the adaptor. Second, for those applications
involving recombination of the upstream end of the adaptor, the
sequence and structure of the adaptor can be optimized to promote
recombination. These more sophisticated nick-translation
recombination adaptors are referred to as RA adaptors and are
discussed later.
[0693] According to the nomenclature utilized herein, up-stream
terminus-attaching nick-translation adaptors are labeled with the
capital letter A. Subscript symbols are used to differentiate
adaptors attached to two different ends of a template DNA fragment,
if they are produced by two different biochemical, chemical or
physical procedures and have different structure.
[0694] An additional design (FIG. 19C) has oligonucleotide 1 of the
same design as above, and complementary oligonucleotide 2 that
hydrogen bonds to all or part of oligonucleotide 1. Although not
always necessary, oligonucleotide 2 can have a blocking nucleotides
at the 3' and 5' ends to prevent ligation to other adaptors. To
facilitate creation of an initiation site for the nick-translation
reaction, several nucleotide positions have deoxyribouracil or
other degradable bases. After ligation to the adaptor end of a
template molecule, the degradable bases can be degraded (e.g.,
using dU glycosylase and endonuclease IV or V, fragmenting a region
of oligonucleotide into short molecules that dissociate from
oligonucleotide 1, so as to expose a single-stranded region of
oligonucleotide 1. Oligonucleotide 3 can subsequently be hybridized
to the 3' single strand region on oligonucleotide 1.
Oligonucleotide 3 should have a 3' end capable of being extended to
initiate the nick-translation reaction. The 5' end of
oligonucleotide 3 can be blocked or unblocked.
[0695] An additional design (FIG. 19D) has oligonucleotide 1 with
5' phosphate group and blocked 3' end. Oligonucleotide 2 has a
single degradable base, such as a deoxyribouracil, and a 3' end
that is blocked or has a 3' hydroxyl that can be covalently joined
to the template. After ligation of this adaptor to the template DNA
the degradable base is degraded to expose a 3' hydroxyl group that
can be extended in a nick-translation reaction using a
polymerase.
[0696] An additional design (FIG. 19E) has an oligonucleotide 1
with a 5' phosphate, and an oligonucleotide 2 that is complementary
to oligonucleotide 1 and a 3' end with a 3' hydroxyl group, capable
of being extended by a polymerase. This forms a double-stranded DNA
molecules that can ligate to the 3' strand of the template DNA, but
forms a gap between the 5' end of the template and the 3' end of
the adaptor that prevents ligation of the 5' end of even a
phosphorylated template to the adaptor. This gap has the function
of protecting this 3' end of the adaptor from ligation to the
template, while still serving as an efficient initiation site for
the nick-translation reaction. This initiation oligonucleotide
could be designed to be ligated to a template with either a 3' or
5' overhang, but not a blunt end. This adaptor would be protected
against dimerization.
[0697] FIG. 19F shows an example of an adaptor that has the left
end that is compatible with the restricted end of the template and
is ligated to the template without a gap. This simple adaptor
design can be used on template molecules that have been
dephosphorylated before ligation of the adaptor. This adaptor
design has the disadvantage that it will form adaptor dimers in
addition to being ligated to the template.
[0698] 2. Nick-Attaching Adaptors
[0699] Nick-attaching adaptors are partially double-stranded or
completely single-stranded short DNA molecules that can be
covalently linked to 3' or 5' DNA termini within the nick produced
by a nick-translation reaction. Addition of these adaptors to the
products of the nick-translation reaction is necessary to add the
specific sequences used in the amplification of PENTAmers.
[0700] a. Nick Modifications.
[0701] Because DNA termini within the nick have very low ligation
efficiency, additional enzymatic procedures that specifically
modify the nick are necessary for efficient attachment of the
down-stream adaptor. These procedures either convert the nick into
a small gap, add a limited number of nucleotides to the 3'
terminus, or displace a small length of the 5' end.
[0702] A nick can be converted into a small gap by a limited
treatment of DNA with: (i) 5'-exonuclease (e.g., gene 6 exonuclease
from bacteriophage T7, .alpha.-exonuclease), or (ii) 3' exonuclease
(e.g., exonuclease III, Klenow fragment of the DNA polymerase I, T4
DNA polymerase). In the last case, the control of the DNA trimming
in the 3'.fwdarw.5' direction can be facilitated by incorporation
of a nuclease-resistant .alpha.-thioated or .alpha.-boronated
nucleotide derivatives at the end of the nick-translation
reaction.
[0703] A 3' hydroxyl group within the nick can be extended with a
homopolymeric tail by DNA incubation with terminal deoxynucleotidyl
transferase (TdT) and one of the triphosphates (dATP, dTTP, dCTP or
dGTP). The dGTP is a preferred nucleotide, because G-tails of a
limited length (15-20 guanines) can be efficiently added to the
ends of DNA, and to DNA templates with a nick (See Examples 8, 9,
11, 12, 13, and 21).
[0704] DNA templates with nick can be subjected to a limited
strand-displacement DNA synthesis in the presence of such
polymerases as Klenow fragment, DNA polymerase I (exo.sup.-), Bst
DNA polymerase, Vent (exo.sup.-) and Deep Vent (exo.sup.-). These
polymerases have strand-displacement activity but lack 3'.fwdarw.5'
and 5'.fwdarw.3' exonucleolytic activities. As a result of such
treatment, a small (10-20 base) 5' portion of the DNA strand beyond
the nick (trimmed strand) will be displaced by additionally
synthesized DNA. At elevated temperature the displaced
phosphorylated 5' tail would transiently re-associate with DNA and
displace the 3' portion of the newly synthesized strand.
[0705] b. Down-Stream Nick-Attaching Adaptors: Composition and
Attachment to DNA.
[0706] Down-stream nick-attaching adaptors are partially
double-stranded or completely single-stranded short DNA molecules
that can be covalently linked to the 3' hydroxyl group of the
nick-translation DNA product. Nick-translation DNA product can be a
single-stranded molecule isolated from its DNA template or the
nick-translation product still hybridized to the template DNA.
Down-stream nick-attaching adaptors are designed to complete the
synthesis of the 3' end of PENTAmers. The label B-3' denotes all
types of down-stream nick-attaching adaptors.
[0707] Below, it is proposed five types of down-stream
nick-attaching adaptors that can be linked to the gapped or tailed
nicks within double-stranded DNA to create a covalent link between
the adaptor and the 3' end of the nick-translation product.
[0708] i. Down-Stream Nick-Attaching Adaptor B-3' (I) Targeted to a
Gap by a Ligation Reaction.
[0709] Down-stream adaptor B-3' (I) is a completely or partially
single-stranded oligonucleotide construct. It consists of
oligonucleotide I and optional complementary oligonucleotide 2
(FIG. 20). Oligonucleotide I has a short 5' region (n)N with a
random base composition and a length from 4 to 10 bases, and a long
3' region with a unique but non-specified nucleotide composition
and length from 12 to 100 bases. At the 5' and 3' ends it has a
phosphate group P and a blocking nucleotide X, respectively.
Oligonucleotide 2 has a blocking nucleotide X at the 3' end. It
hybridizes to the unique 3' region of the oligonucleotide 1 to
reduce the non-specific interaction of the adaptor with DNA.
[0710] Down-stream nick-attaching adaptor B-3' (I) can be ligated
by its 5' phosphate group P to the 3' end of the nick-translation
product when it transiently hybridizes to the single-stranded DNA
within a gap (FIG. 20). Different ligases can be used to ligate the
down-stream nick-attaching adaptor, including T4 DNA ligase.
[0711] ii. Down-Stream Nick-Attaching Adaptor B-3' (II) Targeted to
the Terminal Deoxynucleotidyl Transferase-Synthesized Homopolymeric
Tail by a Ligation Reaction.
[0712] Down-stream adaptor B-3'(II) is a partially single-stranded
molecule. It is formed by annealing two mostly complementary
oligonucleotides 1 and 2 (FIG. 21). Oligonucleotide 1 has a unique
sequence with a non-specified nucleotide composition and a length
from 12 to 100 bases and a phosphate group P at the 5' end.
Oligonucleotide 2 has a homopolymeric tract of 8-20 bases (poly A,
poly T, poly C or poly G), a blocking nucleotide X at the 3' end,
and a 5' region complementary to the oligonucleotide 1 of the same
length (12-100 bases).
[0713] Down-stream adaptor B-3' (H) is ligated by its 5' phosphate
group P to the 3' end of the homopolymeric tail at the end of the
nick-translation product when it transiently or stably hybridizes
to it (FIG. 21). Different ligases can be used to ligate the
down-stream nick-attaching adaptor including T4 DNA ligase, E. coli
DNA ligase, Taq DNA ligase (New England BioLabs), or Ampligase
(Epicentre).
[0714] iii. Down-Stream Nick-Attaching Adaptor B-3' (III) Targeted
to a Partially Displaced 3' Terminus of the Nick-Translation
Product by a Ligation Reaction.
[0715] Down-stream adaptor B-3' (III) is a partially
single-stranded oligonucleotide construct. It is formed by
annealing two mostly complementary oligonucleotides 1 and 2 (FIG.
22). Oligonucleotide 1 has a unique sequence with a non-specified
nucleotide composition and a length from 12 to 100 bases and a
phosphate group P at the 5' end. Oligonucleotide 2 has a short
random tract of N bases (preferably 4-12 bases), a blocking
nucleotide X at the 3' end, and a 5' region complementary to the
oligonucleotide I of the same length (12-100 bases).
[0716] Down-stream nick-attaching adaptor B-3' (III) is ligated by
its 5' phosphate group P to the 3' end of the displaced DNA tail at
the end of the nick-translation product by transiently or stably
hybridizing it to the displaced 3' tail (FIG. 22). Different
ligases can be used to ligate the down-stream nick-attaching
adaptor including T4 DNA ligase, E. coli DNA ligase, Taq DNA ligase
(New England BioLabs), Ampligase (Epicentre).
[0717] iv. Down-Stream Nick-Attaching Adaptor B-3' (IV) Targeted to
the TdT-Synthesized Homopolymeric Tail by a Primer-Extension
Reaction
[0718] Down-stream nick-attaching adaptor B-3' (IV) is a
single-stranded oligonucleotide (FIG. 23). The oligonucleotide has
a homopolymeric tract of 8-20 bases (poly A, poly T, poly C or poly
G) and a blocking nucleotide X at the 3' end, a unique sequence
with a non-specified nucleotide composition at the 5' end and
length from 12 to 100 bases. In the example shown in FIG. 23, the
homopolymer tail of the extended product is poly G. This adaptor is
hybridized transiently or stably to the 3' end of the
nick-translation product and subjected to a primer extension
reaction that uses the sequences of the adaptor as the template to
complete synthesis of the PENTAmer. Different DNA polymerases can
be used for the polymerization reaction.
[0719] V. Down-Stream Nick-Attaching Adaptor B-3'(V) Targeted to a
Partially Displaced 3' Termini of the Nick-Translation Products by
a Primer-Extension Reaction
[0720] Down-stream adaptor B-3' (V) is a single-stranded
oligonucleotide (FIG. 24). The oligonucleotide has a short random
tract of 4-12 bases, a blocking nucleotide X at the 3' end, and a
unique sequence with a non-specified nucleotide composition at the
5' end and length from 12 to 100 bases.
[0721] Down-stream nick-attaching adaptor B-3' (V) is used as a
template for the primer-extension reaction by transiently or stably
hybridizing it to the displaced 3' tail at the end of the
nick-translation product. Different DNA polymerases can be used for
the polymerization reaction.
[0722] c. Up-Stream Nick-Attaching Adaptors: Composition and
Attachment to DNA.
[0723] Up-stream nick-attaching adaptors are partially
double-stranded or completely single-stranded short DNA molecules
that can be covalently linked to the 5' phosphate group of the
trimmed DNA strand located down-stream of a nick-translation DNA
product. Up-stream nick-attaching adaptors B-5' are designed to
create amplifiable DNA units compromising the trimmed DNA strand
(PENTAmer complement) or fraction of the primary PENTAmer if a
second nick-translation synthesis was initiated and performed from
the same DNA end for a shorter period of time (secondary
PENTAmer).
[0724] It is propose herein two types of the up-stream
nick-attaching adaptors that can be attached to the gapped or
tailed nicks within a double-stranded DNA to create a covalent bond
between the adaptor and the 5' end of degraded original or nascent
DNA strand.
[0725] i. Up-Stream Nick-Attaching Adaptor B-5' (I) Targeted to a
Gap by a Ligation Reaction.
[0726] Up-stream adaptor B-5' (I) is a completely or partially
single-stranded oligonucleotide construct. It consists of
oligonucleotide 1 and optional oligonucleotide 2 (FIG. 25).
Oligonucleotide 1 has a unique 5' region with a non-specified
nucleotide composition and length from 12 to 100 bases, and short
random 3'-region (n)N where N=4-10 bases. Oligonucleotide 2 has a
blocking nucleotide X at the 3' end, and, when present, is
hybridized to oligonucleotide 1 to reduce its non-specific
interaction with DNA.
[0727] Up-stream nick-attaching adaptor B-S' (I) is ligated by its
non-blocked 3' end to the 5' phosphate group of the trimmed DNA
strand by transiently or stably hybridizing it to a single-stranded
DNA within a gap and performing a ligation reaction (FIG. 25).
Different ligases can be used to ligate the adaptor B-5' (I)
including T4 DNA ligase, E. coli DNA ligase, Taq DNA ligase (New
England BioLabs), and Ampligase (Epicentre).
[0728] ii. Up-Stream Nick-Attaching Adaptor B-5' (II) Targeted to a
Partially-Displaced 5' Tail Near the Nick by a Ligation
Reaction.
[0729] Up-stream nick-attaching adaptor B-5' (II) is a partially
single-stranded oligonucleotide construct. It is formed by two
mostly complementary oligonucleotides I and 2 (FIG. 26).
Oligonucleotide I has a unique sequence with a non-specified
nucleotide composition and a length from 12 to 100 bases.
Oligonucleotide 2 has a short random tract of 4-12 bases at the 5'
end, a blocking nucleotide X at the 3' end, and a 3' region
complementary to the oligonucleotide 1.
[0730] Oligonucleotide I is ligated by its 3' hydroxyl to the
phosphate group of the displaced 5' tail near the nick by
transiently or stably hybridizing it to the displaced DNA (FIG.
26). Different ligases can be used to ligate the up-stream
nick-attaching adaptor including T4 DNA ligase, E. coli DNA ligase,
Taq DNA ligase (New England BioLabs), and Ampligase
(Epicentre).
R. Recombination Adaptors
[0731] Recombination adaptors (RA or RB adaptors) are
oligonucleotide constructs attached to the ends or to the internal
regions of a double-stranded DNA to promote intra-molecular
interactions and facilitate creation of recombinant DNA molecules,
specifically recombinant PENTAmers. In many applications,
recombination adaptors are designed to have at least one additional
function. For example, they can also function as up-stream
terminus-attaching nick-translation adaptors or down-stream
nick-attaching adaptors.
[0732] 1. General Structure of the Recombination Adaptor.
[0733] Recombination adaptors have two major domains F and R, FIG.
27A. The proximal, F domain comprises all of the functional domains
that are not directly involved in the recombination reactions, and
the distal, R domain is specific for the specificity and efficiency
of recombination. The part of the F domain at the terminus of the
recombination adaptor is responsible for adaptor attachment to
termini or nicks in DNA and has similar composition and function as
the terminus-attaching or nick-attaching adaptors (see FIG. 19-FIG.
26). Internal regions within the F domain are responsible for
optional functions, such as initiation of the nick-translation
reactions, amplification (e.g., PCR priming sites, RNA polymerase
promotor sites), affinity capture (e.g., on magnetic beads), and/or
detection (e.g., on filters, microarrays, or in solution. FIG. 27B
schematically shows an adaptor with ligation domain (L),
nick-translation initiation domain (D), and recombination domain
(R). The distal domain R is essential for the recombination
processes that are used to make recombinant PENTAmers, which are
the focus of this section.
[0734] a. Examples of Recombination Adaptors with Multiple
Functions.
[0735] As example, FIG. 28A shows the structure of the up-stream
terminus-attaching nick-translation recombination adaptor RA, which
has a dual-function F domain (described previously in FIG. 19A)
attached to a specific recombination domain. This adaptor has
oligonucleotide 1 with 5' phosphate and 3' end blocked with
dideoxyribonucleotide or other nucleotide unable to be ligated by
ligase or extended by polymerase. Oligonucleotide 2 assists in
directing the adaptor to the ligation site on the template
molecule. Oligonucleotide 3 is the specific priming site for a
nick-translation reaction. Oligonucleotides 4, 5, and 6 are short
strands that can be easily removed by mild heating or other
reaction to expose a recombinogenic 3' terminus of the adaptor.
[0736] FIGS. 28B and C showss examples of different down-stream
nick-attaching recombination adaptors RB-3' (for recombination
adaptors, the nomenclature described previously in 4.1 and 4.2 is
used, but R is added to indicate the recombination nature of the
adaptor). The upper strand of the adaptors shown on FIG. 28A is
formed by the long oligonucleotide (20 to 100 b), and the lower
strand is composed of multiple oligonucleotides complementary to
different regions of the long oligonucleotide. In all cases, the
left proximal part of the adaptor represents a non-recombinogenic
functional domain F, and the right distal part of the adaptor
represents a recombination domain R.
[0737] b. Forms and Classes of Recombination Adaptors
[0738] The molecular basis for recombination of the RA and RB
adaptors is the complementarity of the sequences of distal
single-stranded regions of adaptors on two DNA ends. The simplest
designs of RA adaptors are single-stranded (examples of
single-stranded down-stream nick attaching RB-3' adaptors are shown
in FIG. 28B, E, F). The functional domains that target RA and RB
adaptors to the ends or internal nicks of the template DNA
molecules are the same as for the A and B adaptors described for
making primary and secondary PENTAmers.
[0739] In many situations it is preferable to use double-stranded
recombination adaptors with two possible states, "inactive" and
"active". In the "inactive" form, recombination adaptors are unable
to interact by their distal recombination domains. For many reasons
it is preferable to maintain this condition during DNA processing
and "activate" adaptors just before the initiation of
recombination. In the "active" form the adaptors become
recombinogenic. The transition into the active form can be carried
out by chemical, biochemical, and/or physical process, which
affects the structure of the distal terminus of the recombination
domain. This process is illustrated by FIG. 29 using up-stream
terminus-attaching nick-translation recombination adaptor RA (FIG.
28A) as an example.
[0740] In a simple case (recombination adaptors of class I, shown
in FIG. 29A) the inactive recombination adaptors have termini
blocked from ligation using a blocking nucleotide X such as a
dideoxynucleotide. Activation is done by cleaving the recombination
domain with a restriction endonuclease. Such cleavage removes the
blocking 3' group X and exposes a 3' or 5' single-stranded overhang
with the phosphate group at the distal 5' terminus.
[0741] To prevent cleavage of the genomic DNA, either the
endonuclease chosen should be an extremely rare-cutting enzyme
(such as homing endonucleases Ceu I, Sce I, PI-Psp I, etc.), or the
genomic DNA should be methylated (as shown in FIG. 29A) with a
methylase before attaching the recombination adaptor, such that the
methylated genomic DNA cannot be cleaved by the restriction enzyme
used.
[0742] In a more sophisticated but preferable case (recombination
adaptors of class II FIG. 29B) the R domain has a structure similar
to that shown in FIG. 28B, C, which have one or more small
oligonucleotides hydrogen bonded to the region protecting the end
of the adaptor from unwanted reactions. Activation of the R domain
involves two steps: (1) removal of the blocking 3' group X at the
distal end of oligonucleotide 1 using some chemical, photochemical,
biochemical or physical reaction; and (2) exposure of a long
(10-100 b) single-stranded tail.
[0743] Removal of the 3' blocking group X from oligonucleotide 1 is
achieved by cleavage of the terminal base(s) using a restriction
endonuclease, or chemical removal of a labile base, for example
removal of a ribonucleotide using high pH.
[0744] Exposure of the long 3' single strand tail is achieved by
removal of the bases complementary to that tail. For the adaptor
shown in FIG. 28A, activation is achieved by dissociation of the
distal short (10-15 bp long) oligonucleotides 4-6 bound to
oligonucleotide 1. This can be done by mild heating to dissociate
the short oligonucleotides, but leave oligonucleotides 2 and 3
bound to oligonucleotide 1. Alternatively, the short
oligonucleotide(s) can be designed with labile nucleotides such as
deoxyuridine or ribonucleotides, that can be degraded using
dU-glycosylase or RNase, respectively. Alternatively, the 5' end of
the oligonucleotide(s) bound to oligonucleotide I can be degraded
by a 5' exonuclease (e.g., exonuclease T7, gene 6). This
exonuclease degradation can be terminated at a specific location by
incorporating resistant bases (e.g. .alpha.S-nucleotides) at
desired distances from the 5' end of the adaptor.
S. Methods of Recombination
[0745] Three different molecular processes are proposed for
creation of recombinant PENTAmers. In the first process,
intramolecular recombination is effected by ligating complementary
ends of the adapted template molecule in dilute solution. In the
second process, intramolecular recombination is effected by stably
hybridizing the ends of the adapted template molecules in dilute
solution, followed by concentration of the molecules and ligation
in the concentrated state. In the third process, recombination is
effected by hybridizing the ends of the adapted template molecules,
followed by a nick-translation reaction to form the covalent
intramolecular junction.
[0746] 1. Direct Intra-Molecular Ligation and Nick-Translation
[0747] Recombination by direct ligation and nick-translation can be
applied to molecules with short or long complementary termini
(adaptors of class I and II, respectively). To minimize
intermolecular interactions and maximize the yield of the
intramolecular products the ligation reaction should be performed
at a very low concentration of termini and high concentration of
ligase.
[0748] a. One Adaptor Approach
[0749] In simple cases (shown in FIG. 30A, B) recombination by
direct ligation uses adaptor RA ligated to only one end of the
template DNA molecule ("one-adaptor" approach). This is appropriate
when DNA ends are produced by cleavage of the template DNA with two
different restriction enzymes. The designs of the ligation and
initiation domains of the adaptor are similar to the design of
up-stream end-attaching, nick-translation A adaptors shown in FIG.
19 with the ligation domain compatible with the DNA end produced by
a first endonuclease, a nick-translation initiation domain, and a
recombination domain compatible with the end produced by a second
endonuclease. Unlike the designs shown in FIG. 19, oligonucleotide
1, which initiates the nick-translation reaction must be
phosphorylated at the 5' end in order to be covalently joined to
the template. Unlike many of the other applications, the adaptor is
not activated by removal of the 3' blocking group. In the example
shown in FIG. 30A, the nick-translation primer (shown in bold) is
located on the lower-strand and oriented towards the attached
template terminus. In the example shown in FIG. 30B, the
nick-translation initiation oligonucleotides is located on the
upper strand and oriented in the opposite orientation, away from
the unique template end and toward the recombination site. Because
of the inverse orientation of the nick-translation primer it is
obligatory to perform the nick-translation reaction in the second
case only after the intra-molecular ligation. The one adaptor
approach achieves recombination using the following steps:
[0750] 1) A first sequence-specific endonuclease is used to digest
the template DNA into smaller molecules;
[0751] 2) Both strands of the RA adaptor are ligated to the
sequence-specific termini of the template molecules;
[0752] 3) The template molecules are digested (partially, in most
cases) with the second sequence-specific endonuclease;
[0753] 4) The adapted template molecules are incubated at low
concentration with a large amount of T4 DNA ligase for 16-36 h to
achieve the intramolecular recombination reaction (FIG. 30A, B),
and then concentrated using a microfiltration device or by ethanol
precipitation;
[0754] 5) A nick-translation reaction is initiated and allowed to
proceed a controlled time to create a PENT product of specified
length (FIG. 30A, B);
[0755] 6) A down-stream nick-attaching adaptor B-3' is added to the
3' end of the PENT product to create a recombinant PENTAmer.
[0756] Because of low yield of circularized DNA molecules with
blunt or one- or two-base single strand termini, it is expected
that the "one-adaptor" direct ligation approach will have a
reasonable efficiency only if the second sequence-specific
endonuclease produces DNA ends with three- or four-base 5' or 3'
overhangs.
[0757] b. Two Adaptor Approach
[0758] In order to increase the circularization efficiency using
restriction enzymes that produce short 3' or 5' overhangs or blunt
ends, a "two-adaptor" direct ligation approach is described herein,
which employs an adaptor activation step. For example, FIG. 30C
shows the recombination by direct ligation between two adaptors
RA.sub.1 and RA.sub.2 (class I) that have been ligated to the two,
ends of a template DNA molecule. Their design is similar to the
design of up-stream adaptors A.sub.1 and A.sub.2 (FIG. 19) with the
only difference that both adaptors have a recombination domain and
a site specifically for restriction endonuclease at their distal
part. FIG. 30C shows the steps to making a recombinant PENTAmer at
Eco RI sites.
[0759] 1) Template DNA molecules are methylated using Eco RI
methylase;
[0760] 2) Adaptors RA1 and RA2 (each having a proximal terminus
with: a) an Eco RI-compatible end that has a sequence that cannot
form an Eco RI recognition sequence; b) a single nick-translation
initiation site; and c) a single Eco RI restriction recognition
sequence within the recombination domain) are ligated to both
strands at the termini of the template molecules;
[0761] 3) The adaptors are activated by incubation with restriction
endonuclease Eco RI which removes the 3'-blocked distal portion of
the adaptors and creates sticky ends with four-base 5' overhangs
without affecting the integrity of the nascent PENTAmers;
[0762] 4) The adapted template fragments are incubated at low
concentration with large amount of T4 DNA ligase for 16-36 h to
circularize the template molecules, and then concentrated using a
microfiltration device or by ethanol precipitation;
[0763] 5) The circularized template molecules are subjected to a
nick-translation reaction to which is followed by addition of
down-stream nick-attaching adaptors B-3'.
[0764] PCR using primers complementary to B-3' and a known sequence
either on the left or right end of the template junction will
amplify the DNA in the unknown region, thus achieving amplification
of a distal, unknown sequence, using a primer that is specific for
a known, proximal sequence.
[0765] In many applications, the nick-translation reaction will be
done before the ends of the RA adaptors are activated and
recombined (e.g., FIG. 30D). In other applications, the PENTAmers
are created after recombination (FIG. 30A, B, C, E). Depending on
the design of the adaptors RA.sub.1 and RA.sub.2, the reactions
would result in one (unidirectional nick-translation reaction, FIG.
30D, E) or two (bidirectional nick-translation reaction (FIG. 30C)
recombinant PENTAmer molecules.
[0766] The method of recombination shown in FIG. 30B was used to
circularize template DNA molecules with >70% efficiency in
Example 19 and to create PENTAmers from circularized template DNA
in Example 21.
[0767] 2. Intra-Molecular Hybridization Followed by a Ligation
Reaction.
[0768] Recombination by direct ligation described above requires
large amounts of DNA ligase because of the large reaction volume
necessary to reduce the fraction of non-desirable intermolecular
products.
[0769] To address this problem, new methods of recombination
between DNA ends by a "hybridization-ligation" process using
recombination adaptors with long 3' tails (class II) are described
herein. FIG. 31A-D illustrates several examples of recombination by
hybridization-ligation between two adaptors RA.sub.1 and
RA.sub.2.
[0770] FIG. 31A shows the case of upstream adaptors designed as
shown in FIG. 28A and used as shown in FIG. 29B. FIG. 31A
illustrates the most sophisticated protocol for creation of
recombinant PENTAmer molecules by the hybridization-ligation
method. In this protocol, ligation of adaptor RA.sub.1 and
synthesis of PENTAmers at the DNA ends created by the first
restriction endonuclease (e.g., rare cutting) is followed by second
digestion with a second endonuclease (for example, partial
digestion with frequently cutting restriction enzyme), ligation of
adaptor RA.sub.2 and synthesis of PENTAmers at newly created DNA
ends. Because the two PENTAmer synthesis reactions are separated in
time, this method allows control of the individual size of both
PENT products and to append different down-stream sequences B-3'(1)
and B-3'(2) to the 3' ends of PENTAmers.
[0771] FIG. 31B illustrates the case when ligation of adaptors
RA.sub.1 and RA.sub.2 occurs simultaneously and is followed by a
bidirectional nick-translation reaction and appending of the same
nick-attaching adaptor B-3' to both PENT products.
[0772] FIG. 31C illustrates the case which is similar to the
previous one except that the nick-translation reaction is performed
in only one direction, owing to only one adaptor having a
nick-translation initiation domain.
[0773] FIG. 31D illustrates the case when activation of the
adaptors, hybridization and ligation steps are performed first.
After the ligation reaction, the DNA molecules are subjected to a
PENT reaction and PENTAmers are created by the usual protocols.
[0774] After completion of the PENTAmer synthesis in protocols
presented in FIG. 31A-C the adaptors are activated by the
incubation with Eco RI to remove blocking groups at the 3' end of
the two adaptors. Subsequent cleavage with dU-glycosylase at
37.degree. C. and incubation at 50-60.degree. C. releases the short
oligonucleotides adjacent to the termini to form the long
single-strand tails necessary for recombination.
[0775] Hybridization of the two ends is then done in a large volume
for sufficient time to approach completion. If necessary, the
unreacted termini can be subsequently blocked by adding excess
amounts of the blocked short oligonucleotides complementary to the
tails. Finally, all DNA molecules are concentrated by a
microfiltration device or ethanol precipitation and then ligated in
a small volume with a DNA ligase. The ligase will covalently close
circular molecules with hybridized tails but will not be able to
ligate ends that have not hybridized at low concentration. Because
very large hybridization volumes can be used for the hybridization
reactions, very high ratios of intra- versus inter-molecular
recombination can be achieved with this method, even for very long
DNA molecules. However, because the intramolecular ligation
reaction can be carried out in a small volume, only small amounts
of ligase and reaction time are necessary to achieve a high
efficiency of ligation.
[0776] 3. Intra-Molecular Hybridization Followed by a
Polymerization (Nick-Translation) Reaction.
[0777] Class II recombination adaptors can also be used to create
PENTAmers without using ligase to covalently attach the two ends of
the template molecules. Hybridization of the two ends of DNA
molecules with class II recombination adaptors creates templates
for two nick-translation reactions, which stabilizes the circular
form that can be further processed to form the recombinant
PENTAmer. In this case, a polymerase rather then a ligase is used
to create the recombinant PENTAmer molecule.
[0778] As an example, FIG. 32 shows the recombination between two
adaptors RA.sub.1 and RA.sub.2 using hybridization-polymerization
to effect recombination. These adaptors are similar to those
described in the previous cases, except the adaptors-are designed
to propagate the nick through the intermolecular junction, rather
than away from the intramolecular junction. The adaptor termini are
activated by restriction enzyme cleavage, the protecting
oligonucleotides removed, the resulting complementary single-strand
tails hybridized, and a bidirectional PENT reaction performed to
create the recombinant PENTAmer.
[0779] Hybridization of the two ends is done in a large volume for
sufficient time to approach completion. If necessary, the unreacted
termini are blocked after the hybridization reaction by adding
excess amounts of the short blocking oligonucleotides. Finally, all
DNA molecules are concentrated by the microfiltration device or by
ethanol precipitation. As a result of the nick-translation
reaction, the 3' termini of the adaptors are extended, creating the
recombinant PENTAmer and stabilizing its association with the
template. The polymerization reaction stabilizes the circularized
molecules, but not the linear molecules, with ends that have not
hybridized at low concentration. Because very large hybridization
volumes can be used for the hybridization reactions, very high
ratios of intra- versus inter-molecular recombination can be
achieved with this method, even for very long DNA molecules.
However, because the polymerization reaction can be carried out in
a small volume, only small amounts of polymerase and time are
necessary to achieve a high efficiency of nick-translation.
T. Composition of Recombinant Pentamers
[0780] Limitations of the time-controlled PENTAmer-mediated walking
technique are overcome by creating recombinant PENTAmers, which
bring together sequences from both the proximal and distal ends of
templates. Different forms of recombinant PENTAmers can be created,
depending on when the recombination process occurs, before or after
the PENTAmer synthesis. The term "nascent recombinant PENTAmer" is
used herein to describe a double stranded DNA molecule with
PENTAmers produced by the intra-molecular adaptor-mediated
recombination. The term "recombinant PENTAmer" is used herein to
describe a recombinant single-stranded DNA molecule that is formed
by fusion of two primary PENTAmers or a single primary PENTAmer and
a distal DNA strand. The name of the resultant recombinant form is
determined by the names of recombination adaptors involved in the
process of recombination. For example, the recombinant PENTAmer
form is termed B.sub.2A.sub.1 if it is formed by interaction
between recombination adaptors RB2 and RA.sub.1.
[0781] 1. Recombinant PENTAmer Formed when Recombination Occurs
Before PENTAmer Synthesis.
[0782] This is a very simple case, because only two up-stream
recombination adaptors RA.sub.1 and RA.sub.2 can be involved in the
recombination process. Consequently, only one form of the nascent
recombinant PENTAmer can be formed (A.sub.1A.sub.2 ). The process
involves three major steps, shown in FIG. 33:
[0783] 1) Ligation of up-stream recombination adaptors A1 and
A2;
[0784] 2) Intramolecular recombination at low DNA
concentration;
[0785] 3) PENTAmer synthesis.
[0786] a. PENTAmer Recombinant Form T.sub.1A.sub.1A.sub.2P.sub.2B
(T.sub.1A.sub.1A.sub.2P.sub.2B)
[0787] The resultant recombinant nascent PENTAmer structure is a
circular double-stranded DNA molecule with two internally attached
adaptors B (FIG. 33B). The recombinant PENTAmers are long
single-stranded DNA molecules formed by covalent junctions between
the 5' end of synthesized PENTAmers and the 3' end of non-modified
DNA strand at the opposite end of the DNA fragment, with the
A.sub.1A.sub.2 junction in the middle (FIG. 36, AI, AII). These
recombinant PENTAmers are denoted T.sub.1A.sub.1A.sub.2P.sub.2B,
explicitly showing the order of recombined elements within the
recombinant PENTAmer molecule: T.sub.1 (the template DNA strand
ligated to the adaptor A.sub.1); A.sub.1A.sub.2 (the fused
adaptors); P.sub.2 (the PENT product initiated at the adaptor
A.sub.2); and B (the nick-attaching adaptor).
[0788] It is preferable that adaptors RA.sub.1 and RA.sub.2 have
different sequences. Recombination between two identical adaptors
would result in a palindrome sequence, which might cause some
problems during PENTAmer amplification.
[0789] Ligation of two different adaptors RA.sub.1 and RA.sub.2 is
straightforward when templates are produced by two enzymes: a
complete digestion with a first, rarely-cutting restriction enzyme,
and a partial digestion with a second, frequently-cutting
restriction enzyme. In this case, stepwise ligation of the adaptors
RA.sub.1 and RA.sub.2 can be achieved in two separate
cleavage-ligation reactions: complete cleavage.fwdarw.RA.sub.1
adaptor ligation.fwdarw.partial cleavage.fwdarw.RA.sub.2 adaptor
ligation, or partial cleavage.fwdarw.RA.sub.2 adaptor
ligation.fwdarw.complete cleavage.fwdarw.RA.sub.1 adaptor
ligation.
[0790] When templates are produced by partial digestion with only a
frequently-cutting restriction enzyme, -the ligation of different
adaptors RA1 and RA2 to the ends of the same DNA molecule can be
achieved by having both adaptors in the ligation reaction at an
equimolar ratio. In this case, 50% of DNA molecules are expected to
have different adaptors at their ends, while 50% have identical
adaptors. By choosing class II recombination adaptors, it is
possible to promote recombination only between ends with adaptors
RA.sub.1 and RA.sub.2 using the recombination-ligation or
recombination-polymerization methods. Alternatively, if class I
adaptors are used, both the homotypic junctions (A.sub.1A.sub.1 and
A.sub.2A.sub.2) and heterotypic junctions (A1A2 and A2A1) junctions
will be produced. The molecules with heterotypic junctions can be
purified by affinity capture. After addition of adaptors to both
ends, the template molecules will form non-covalently closed
circles due to intramolecular hybridization of the complementary
sequences at the 3' ends of the adaptors.
[0791] When the hybridization-ligation method is used, the covalent
recombinant junctions are formed by incubation with ligase, and
converted to recombinant PENTAmers by unidirectional or
bidirectional nick-translation reactions initiated at nick(s)
within adaptor(s) RA.sub.1 and/or RA.sub.2. When the
hybridization-polymerization method is used, the recombinant
PENTAmers are formed by direct unidirectional or bidirectional
nick-translation reaction using 3' end(s) of RA.sub.1 or/and
RA.sub.2 adaptors as primers.
[0792] Synthesis of the recombinant PENTAmer(s) is completed after
appending the adaptor sequence B at the internal nick(s).
[0793] The described preparation of the recombinant molecules when
recombination precedes the PENTAmer synthesis might be especially
useful for very large DNA molecules (100-1000 kb). In this case,
DNA is prepared in agarose plugs or micro-beads, digested in-gel
with one or two restriction enzymes, ligated to adaptors and size
fractionated by pulse-field agarose gel electrophoresis. Gently
melted agarose slices containing very large DNA fragments are
incubated with agarase, diluted, and DNA fragments are circularized
by hybridization. After concentration, the PENTAmer synthesis is
performed as described before.
[0794] 2. Recombinant PENTAmers Produced by Recombination After the
PENTAmer Synthesis.
[0795] This is the most interesting case because four elements,
namely, adaptors RA.sub.1, RA.sub.2, RB.sub.1 and RB.sub.2 can be
involved in recombination. Consequently, forms of recombinant
PENTAmers with different adaptor junctions can be created:
[0796] 1) linear forms T.sub.1A.sub.1A.sub.2P.sub.2B.sub.2 or
T.sub.2A.sub.2A.sub.1P.sub.1B.sub.1, with A.sub.1A.sub.2 or
A.sub.2A.sub.1 junctions;
[0797] 2) linear forms A.sub.1P.sub.1B.sub.1A.sub.2P.sub.2B.sub.2
or A.sub.2P.sub.2B.sub.2A.sub.1P.sub.1B.sub.1, with B.sub.1A.sub.2
or B.sub.2A.sub.1 junctions;
[0798] 3) cyclic form cA.sub.1P.sub.1B.sub.1A.sub.2P.sub.2B.sub.2
with the both B.sub.1A.sub.2 and B.sub.2A.sub.1 junctions;
[0799] 4) cyclic forms cA.sub.1P.sub.1B.sub.1 or
cA.sub.2P.sub.2B.sub.2; with the B.sub.1A.sub.1 or B.sub.2A.sub.2
junctions;
[0800] All seven recombinant PENTAmer forms are shown on the FIG.
34 and FIG. 36 (AI,AII, B-F) and described below.
[0801] a. Recombinant PENTAmers T.sub.1A.sub.1A.sub.2P.sub.2B.sub.2
and T.sub.2A.sub.2A.sub.1P.sub.1B.sub.1
[0802] This form of recombinant PENTAmer is similar to the
previously analyzed form. The recombination reaction can be
achieved by a direct ligation or by hybridization-ligation method
bringing together distal and proximal ends of the adapted DNA
fragments (FIG. 34A).
[0803] The nascent recombinant PENTAmer structure is a circular
double-stranded DNA molecule with two attached down-stream adaptors
B.sub.1, and B.sub.2. The recombinant PENTAmers are long
single-stranded DNA molecules formed by a covalent junction between
the 5' end of the synthesized PENTAmers and the 3' end of the
displaced and trimmed DNA strand at the opposite end of the DNA
fragment, with the A.sub.1A.sub.2 or A.sub.2A.sub.1 junction in the
middle (FIG. 36, AI, AII).
[0804] It is preferable that adaptors RA.sub.1 and RA.sub.2 have
different sequence composition. It is important that they are
mutually recombinogenic. Adaptors B.sub.1 and B.sub.2 can have
similar or different sequence, which differentiates this case from
the previously analyzed.
[0805] In this case, two different restriction enzymes should be
used to produce proximal and distal ends of the template and the
two PENTAmers should be synthesized in separate reactions.
[0806] b. Recombinant PENTAmer
A.sub.1P.sub.1B.sub.1A.sub.2P.sub.2B.sub.2
[0807] This recombinant PENTAmer structure can only be formed after
synthesis of both PENTAmers. The recombination reaction can be
achieved by a direct ligation or by a hybridization-ligation method
bringing together up-stream and down-stream adaptors RA.sub.2 and
RB.sub.1 of distal and proximal PENTAmers (FIG. 34B).
[0808] The recombinant nascent PENTAmer structure is a
double-stranded DNA molecule with one large loop region, and two
linear branches: one formed by double-stranded DNA containing
PENTAmer A.sub.1P.sub.1B.sub.1 (1-2 kb in size), another by the
down-stream adaptor B.sub.2.
[0809] The recombinant PENTAmer is a single-stranded DNA molecule
formed by a covalent junction between the 3' end of the PENTAmer
A.sub.1P.sub.1B.sub.1 and the 5' end of the PENTAmer
A.sub.2P.sub.2B.sub.2 with the B.sub.1A.sub.2 junction in the
middle (FIG. 34B and FIG. 36B).
[0810] It is critical that the up-stream adaptor RA.sub.2 is
mutually recombinogenic with the down-stream adaptor RB.sub.1 but
not with the adaptor B.sub.2. Consequently, the sequences RB.sub.1
and RB2 should be different to avoid simultaneous production of
non-desirable cyclic form cA.sub.2P.sub.2B.sub.2. This is possible
if: (i) two different restriction enzymes are used to produce the
proximal and distal ends of the template, (ii) the PENTAmers
A.sub.1P.sub.1B.sub.1 and A.sub.2P.sub.2B.sub.2 are synthesized in
different reactions.
[0811] c. Recombinant PENTAmer
A.sub.2P.sub.2B.sub.2A.sub.1P.sub.1B.sub.1.
[0812] The form is produced by recombination of the second pair of
up-stream and down-stream adaptors RA.sub.1 and RB.sub.2, (FIG. 34C
and FIG. 36C).
[0813] d. Cyclic Recombinant PENTAmer
cA.sub.1P.sub.1B.sub.1A.sub.2P.sub.2B.sub.2 with Both
B.sub.1A.sub.2 and B.sub.2A.sub.1 Junctions.
[0814] This recombinant PENTAmer can be only formed after synthesis
of PENTAmers at both ends of the template. Recombination can be
achieved by direct ligation or by hybridization-ligation, bringing
together up-stream adaptor RA.sub.1 with down-stream adaptor
RB.sub.2, and up-stream adaptor RA.sub.2 with down-stream adaptor
RB.sub.1 (FIG. 34D).
[0815] The nascent recombinant PENTAmer structure is a theta-shaped
double-stranded DNA molecule with a small loop (2-4 kb) formed by
PENTAmers A.sub.1P.sub.1B.sub.1 and A.sub.2P.sub.2B.sub.2, and a
large loop formed by the rest of the template (FIG. 34D). The
recombinant PENTAmer is a single-stranded circular DNA molecule,
formed by a covalent junction between the 5' end of PENTAmer
A.sub.1P.sub.1B.sub.1 and the 3' end of PENTAmer
A.sub.2P.sub.2B.sub.2, and the 5' end of the PENTAmer
A.sub.2P.sub.2B.sub.2 and the 3' end of the PENTAmer
A.sub.1P.sub.1B.sub.1, with the both A.sub.2B, and B.sub.2A.sub.1
junctions in the middle, (FIG. 36D).
[0816] Adaptor RA.sub.1 is mutually recombinogenic with adaptor
RB.sub.2 but not with adaptor RB.sub.1. Adaptor RA.sub.2 is
mutually recombinogenic with adaptor RB.sub.1 but not with adaptor
RB.sub.2. Consequently, the adaptor sequences B.sub.1 and B.sub.2
are different to avoid simultaneous synthesis of non-desirable
cyclic forms cA.sub.1P.sub.1B.sub.1 and cA.sub.2P.sub.2B.sub.2. The
desired conditions are possible if: (i) two different restriction
enzymes are used to produce the proximal and distal ends of DNA
template, and (ii) PENTAmers A.sub.1P.sub.1B.sub.1 and
A.sub.2P.sub.2B.sub.2 are synthesized in two different
reactions.
[0817] e. Cyclic Recombinant PENTAmer cA.sub.1P.sub.1B.sub.1 with
B.sub.1A.sub.1 Junction
[0818] This is a special recombinant structure that can be formed
after PENTAmer synthesis. It is expected as a side product during
synthesis of the linear recombinant form
A.sub.2P.sub.2B.sub.2A.sub.1P.sub.1B.sub.1 when down-stream
adaptors B.sub.1 and B.sub.2 have the same sequence composition
(FIG. 34E).
[0819] The recombinant nascent PENTAmer structure is a
predominantly linear double-stranded DNA molecule with a small loop
(1-2 kb in size) at one end (FIG. 34E). The recombinant PENTAmer is
a single-stranded circular DNA molecule formed by covalent junction
between 3' and 5' ends of the PENTAmer A.sub.1P.sub.1B.sub.1 (FIG.
36E). Note that sequences from the proximal and distal ends of the
template have not been recombined.
[0820] f. Cyclic Recombinant PENTAmer cA.sub.2P.sub.2B.sub.2 with
B.sub.2A.sub.2 Junction
[0821] This form of recombinant structure is similar to the form
cA.sub.1P.sub.1B.sub.1 and is produced by recombination between
another pair of up-stream and down-stream adaptors RA.sub.2 and
RB.sub.2 (FIG. 34F and FIG. 36F). Note that sequences from the
proximal and distal ends of the template have not been
recombined.
[0822] 3. Recombinant PENTAmers Produced when Recombination Occurs
After the Synthesis of Only One PENTAmer
[0823] This is only possible if two different restriction enzymes
are involved in the generation of the template DNA. There are four
different possible nascent recombinant forms:
T.sub.2A.sub.2A.sub.1B.sub.1 (FIG. 35A) and
T.sub.1A.sub.1A.sub.2B.sub.2 (not shown), and
A.sub.1P.sub.1B.sub.1A.sub.2T.sub.2 (FIG. 35B) and A2P2B2A1T1 (not
shown). The nascent recombinant PENTAmer structures. (FIG. 35A, B)
and corresponding recombinant single-stranded PENTAmer molecules
(FIG. 36, AI-AIV) are similar to structures previously
described.
U. Applications of Positional Amplification Using Pentamers
[0824] Like PCR, Positional, Amplification using PENTAmers is a
general method to select and amplify DNA in vitro. To demonstrate
the utility of Positional Amplification obvious applications of the
method to create DNA molecules for sequencing and hybridization
analysis of genomic DNA and cDNA are herein described.
[0825] 1. Sequencing Internal Regions of Short Templates Using
Primary PENTAmers
[0826] Primary PENTAmers can be used to sequence internal regions
of DNA molecules approximately 1-20 kb in size.
[0827] Primary PENTAmers that terminate at specific positions
within the DNA strand are created by different times of controlled
PENT reaction from one or both ends of the DNA molecule. PENTAmers
that terminate at a designated position are cloned into a suitable
vector (or PCR amplified) and the downstream end of the PENTAmer
insert sequenced using a conventional technique.
[0828] The entire length of the DNA molecule can be sequenced by
producing an ordered set of PENTAmers created by synthesizing
primary PENTAmers of different lengths (determined by the time of
PENT reaction), cloning or otherwise amplifying the molecules in
each size class, and sequencing the downstream ends of the
PENTAmers by conventional techniques. If, for example, successive
PENTAmer preparations differ by 500 bp, sequencing of the
downstream ends of all the PENTAmers with read lengths of 600 bp
should produce overlapping sequence information covering the entire
source DNA fragment. Sequence information from one strand is
produced using PENTAmers created from one end of the template, and
sequence information from the opposite strand is produced from
PENTAmers created from the opposite end of the template.
[0829] 2. Sequencing Internal Regions of Short Templates Using
Secondary PENTAmers
[0830] Secondary PENTAmers can be used to sequence internal regions
of DNA molecules approximately 1-20 kb in size.
[0831] Secondary PENTAmers that terminate at specific positions
within the DNA strand are created by different times of controlled
PENT reaction from one or both ends of the DNA molecule. PENTAmers
that terminate at a designated position are cloned into a suitable
vector (or PCR amplified) and the downstream end of the PENTAmer
insert sequenced using a conventional technique. Because the
PENTAmers have two ends internal to the template DNA, both strands
can be sequenced using PENTAmers initiated from one end of the
template.
[0832] The entire length of the DNA molecule can be sequenced by
producing an ordered set of PENTAmers created by synthesizing
secondary PENTAmers of the same length (determined by the protocol
used) located different distances from the initiation site for the
PENT reaction (determined by the time of the initial PENT
reaction), cloning or otherwise amplifying the molecules in each
size class, and sequencing the upstream and/or downstream ends of
the PENTAmers by conventional techniques. If, for example, the
position of the internal ends of the PENT products designed to be
separated by 800 bp, and the size of the secondary PENTAmers is
designed to be 1000, sequencing the downstream and upstream ends of
the secondary PENTAmers with a read length of .about.660 bases
should produce overlapping sequence information covering the entire
source DNA fragment.
[0833] 3. Sequencing Internal Regions of Short Templates Using
Complement PENTAmers
[0834] Complement PENTAmers can be used to sequence internal
regions of DNA molecules approximately 1-20 kb in size.
[0835] Complement PENTAmers that terminate at specific positions
within the DNA strand are created by different times of controlled
PENT reaction from one or both ends of the DNA molecule. PENTAmers
that terminate at a designated position are cloned into a suitable
vector (or PCR amplified) and the internal end of the PENTAmer
insert sequenced using a conventional technique.
[0836] The entire length of the DNA molecule can be sequenced by
producing an ordered set of PENTAmers created by synthesizing
complement PENTAmers of different lengths (determined by the time
of PENT reaction), cloning or otherwise amplifying the molecules in
each size class, and sequencing the internal ends of the PENTAmers
by conventional techniques. If successive-complement PENTAmer
preparations differ by 500 bp, sequencing of the ends of all the
PENTAmers with read lengths of 600 bp should produce overlapping
sequence information covering the entire source DNA fragment.
Sequence information from one strand is produced using PENTAmers
created from one end of the template, and sequence information from
the opposite strand is produced from PENTAmers created from the
opposite end of the template.
[0837] 4. Sequencing Large-Insert Clones Using Ordered Positional
Libraries of PENTAmers
[0838] Sequencing of a single 100 kb BAC using PENTAmers would be
done using ordered positional libraries as described above. The
procedure would be very similar to the 50 kb lambda positional
amplification experiment provided in the Examples, and could
involve:
[0839] 1) Cleavage of the BAC at the cos site with lambda
terminase
[0840] 2) Ligation of a different nick-translation adaptor to each
of the 5' overhangs. The design of these adaptors is critical to
the preparation, because they must be very specific for ligation to
individual cos overhangs but not self-ligating, specific for
initiating PENT reactions and specific for subsequent ligation to
restriction sites such as Sau 3A ends.
[0841] 3) Removal of the unligated adaptors
[0842] 4) Partial restriction of the mixture with a frequently
cutting enzyme such as Sau 3A to create a nested set of template
molecules having proximal ends at the cos sites and distal ends at
the restriction sites, as well as other molecules having two cos
ends or two restricted ends
[0843] 5) Dilution of the-DNA and intermolecular circularization of
the DNA molecules
[0844] 6) Concentration of the DNA
[0845] 7) Initiation of an approximately 3 minute PENT reaction by
addition of Taq and dNTPs to create approximately 700-1000 bp PENT
products (note that molecules having two cos ends or two restricted
ends will not undergo PENT reactions
[0846] 8) Removal of Taq
[0847] 9) Addition of a polyG tail to the 3' end of the PENT
product using terminal transferase.
[0848] 10) Ligation of a nick-ligation adaptor having a poly-C 3'
single-strand overhang and a unique double strand sequence at the
other end to form a nascent PENTAmer
[0849] 11) Concentration of the nascent PENTAmers
[0850] 12) Size-separation of the nascent PENTAmers by pulse-field
electrophoresis into fractions each covering about a 1 kb interval
(this can be done with the circular nascent PENTAmers or after
linearization of the nascent PENTAmers by specific cleavage of the
adaptor). The size fractions can be automatically eluted from the
gel, such as by using a Bio-Rad (Hercules, Calif.) electrophoretic
elution device.
[0851] 13) Each of 48 size fractions are placed in duplicate wells
of one 96-well microplate.
[0852] 14) The first 48 wells of one plate are PCR amplified using
a primer complementary to the nick-ligation adaptor and a primer
complementary to the nick-translation adaptor that was ligated to
the left side of the cos site. The other half of the plate is PCR
amplified with the same common primer and the specific primer
complementary to the nick-translation adaptor ligated to the right
side of the cos site. This creates two ordered libraries of
PENTAmers, one extending clockwise into the BAC and one
counterclockwise into the BAC. Amplification is preferably done
using a polymerase with high fidelity.
[0853] 15) Cloning vector is added to each microwell, ligated to
the amplified PENTAmers and used to transform bacteria using a
96-well electroporation device
[0854] 16) Colonies from each clone library are selected, isolated,
and sequenced using conventional technology.
[0855] Because each library contains clones with DNA from only one
region within the BAC, all regions will be equally represented
rather than statistically represented as in shotgun cloning. This
directed sequencing strategy is expected to yield high quality
sequences with minimal redundancy (3-4.times.). Assembly of the
sequences of individual clones into contigs will be extremely easy
even in regions containing repetitive sequences, because the
position of each sequence is known within the BAC. If gaps or
sequence ambiguities exist after the initial sequencing run, the
positions of those deficiencies will be known and specific
libraries targeted for additional sequencing. Even if specific
regions have not been cloned due to failure to amplify or failure
to clone the PENTAmers from that region, the gap formed will be
between contigs of known sequence and orientation so that primer
walking or PCR can be used to directly sequence DNA from that
position in the BAC.
[0856] To make this process more efficient for sequencing many
large-insert clones, PENTAmer preparation can be completely
multiplexed between steps 2 and 13, above. For steps 1 and 2 a
large number of BACs (e.g., 100) can be processed separately,
ligating a different set of hick-translation adaptors to each BAC.
All of these "tagged" BACs can be mixed together and processed as
one pool for steps 3-12. At step 13 all 48 samples can be first
linearly amplified using a primer complementary to the common
nick-ligation adaptor, aliquoted into 100 microwell plates and
separately handled during steps 14-16. PENTAmers from specific BACs
will be amplified in specific wells using primers complementary to
the template-specific "tags" on the nick-translation adaptors. This
multiplex preparation greatly reduces the labor involved in
preparing OPL-DNA for BAC sequencing.
[0857] 5. Genomic Sequencing Using Type I and Type II Recombinant
PENTAmer Ordered Libraries
[0858] Recombinant PENTAmer ordered libraries contain all the
recombinant DNA necessary to amplify any locus in a specific
genome. The recombinant PENTAmers will have been purified from
template DNA to reduce non-specific background and linearly
amplified using locus-independent adaptor sequences so that one
electrophoretic fraction can be diluted to fill a specified well in
hundreds or thousands of multiwell plates. These amplified ordered
libraries will be aliquoted into 48 or 96-microwell plates and
diluted. Successive wells will be capable of amplifying sequences
complementary to regions different distances from the kernel
sequences used for locus-specific amplification.
[0859] To amplify locus-specific PENTAmers for sequencing, kernel
primers are synthesized and tested to determine the specificity of
amplification using PENTAmers from a single size-fraction. If the
kernel primers initially chosen are not specific, the amplification
conditions or primer sequences will be altered to achieve high
specificity.
[0860] In order to efficiently use the Ordered Positional Library
("OPL")-DNA for sequencing, molecules with unique sequences need to
be generated. Usually Positional Amplification produces a number of
different molecules in each well. Only a limited number of
possibilities exist for the sequences at the upstream end of the
PENTAmers, corresponding to the position of restriction sites. The
downstream ends of the PENTAmers will have a large number of
different sequences due to different exact positions of termination
of the PENT reaction. Separation of unique-sequence fragments for
sequencing can be done in three ways: 1) cloning the locus-specific
PENTAmers in each microwell and choosing individual clones for
sequencing; 2) diluting each sample of locus-specific PENTAmers in
each microwell into many subwelts such that at least one well
contains a single DNA molecule that can be amplified by PCR; or 3)
selectively amplifying specific PENTAmers using primers that are
complementary to the adaptors but having 3' ends that include 1, 2,
or 3 additional bases that will selectively amplify PENTAmers that
have template DNA terminating with a specific sequence.
[0861] 6. Using Ordered PENTAmers to Determine Gene Position
[0862] PENTAmers amplified different distances from the end of the
clone or from the kernel sequence are spotted as an ordered array
onto a membrane. To determine which positions code for proteins the
membrane is hybridized to a DNA probe that is complementary to
coding sequences (e.g., a cDNA clone or pool of cDNA molecules).
Those spots that hybridize to the probe contain coding sequences.
To determine non-coding regions, the membrane is hybridized with a
probe containing non-coding sequences, isolated using subtractive
hybridization or complementary to repetitive DNA. Information
gained by these simple hybridization experiments can be used to
determine which members of the ordered libraries should be
sequenced to focus effort on the coding sequences. This approach is
expected to be especially useful to study corn and other plant
genes, because the genes are small with large regions consisting of
repetitive retrotransposon sequences located in the "spacer"
regions. In a specific embodiment, spacer regions identified by
hybridization do not necessarily need to be sequenced.
[0863] 7. Using Unordered Positional Libraries for Sequencing and
Resequencing
[0864] Because Positional Amplification can amplify a very large
region adjacent to the kernel sequence, it can be used as a general
tool to create unordered DNA molecules for analysis. Unordered
PENTAmers are created when the nascent PENTAmers are not separated
according to size before amplification. This results in a large
region of the genome being amplified as molecules of uniform size
in a single tube. If recombinant PENTAmer libraries are created in
this way, their locus-specific amplification produces a pool of
molecules covering a region as large as 500 kb. These molecules can
be shotgun sequenced or used for non-sequencing applications. The
inherent advantages over PCR in these applications are 1) only a
single priming site rather than two priming sites is necessary; 2)
the amplimers are of short, uniform length, which is ideal for
labeling and hybridization; and 3) the amplimers cover larger
regions. Example applications are: [0865] 1) Diagnostic mutation
analysis--PCR is currently used to amplify patient DNA for mutation
detection using microarray hybridization, heteroduplex analysis,
and other methods. Positional Amplification can amplify DNA to
diagnose mutations over much larger distances than is possible with
PCR alone. Now that the human genome has been sequenced, these
point mutation chips are powerful tools in the discovery and
analysis of the alleles responsible for inherited and acquired
diseases, propensity for disease, and/or pharmacogenomic response
to treatment. [0866] 2) Automated instruments for diagnostic
mutation analysis--In order to perform rapid, inexpensive
diagnostics, dedicated instrumentation for PENTAmer preparation,
hybridization, and detection are envisioned. Conventional
bioprocessing principles and/or microdevices are adequate to
develop such instrumentation. [0867] 3) Shotgun sequencing of a
region of the genome without cloning--A region as large as about
100-500 kb can be amplified by locus-specific PENTAmer
amplification, cloned as a library of random fragments representing
a large region of a genome, and subsequently sequenced using a
conventional "shotgun" strategy. This is useful for sequencing
regions of a genome that cannot be cloned (such as the 11 gaps
remaining in the sequence of human chromosome 22) and to sequence
the same locus in related species or individuals without cloning.
[0868] 4) Single-tube kits for shotgun sequencing of a region
without cloning--Unamplified PENTAmers are made for different
genomes and sold as kits. Addition of locus-specific primers and
amplification by PCR or other techniques amplify the regions
adjacent to the kernels. [0869] 5) Hybridization probes for
FISH--Conventional PCR probes are too short to detect single-copy
genes. Rubicon SmartDNA amplimers can cover about 100-500 kb, which
is easily detected by FISH. In this application, the primers used
for Positional Amplification can be labeled with fluorescent dyes
and incorporated into the DNA during linear or exponential
amplification of the PENTAmers. Alternatively,
fluorescently-labeled nucleotides or nucleotides that can be
fluorescently or otherwise labeled in vitro can be incorporated
along the entire length of the PENTAmers during Positional
Amplification. [0870] 6) FISH Positional Amplification
kits--Unamplified PENTAmers in individual tubes can be sold for
purposes of making visible FISH probes. All components except the
locus specific primers could be provided.
[0871] 8. cDNA Sequencing Using Type I Recombinant PENTAmers made
from cDNA Preparations
[0872] Unamplified cDNA preparations can be prepared as recombinant
PENTAmers. Briefly, the cDNA molecules are partially restricted and
prepared as ordered PENTAmer libraries using methods similar to
those used for genomic DNA.
[0873] The cDNA is less complex than genomic DNA and can be
prepared as size fractions up to only about 20 kb and organized
into 24 or 48 wells of a microwell plate. The poly A 3' tails can
be used to create the proximal ends of the recombinant PENTAmers.
Ideal kernel sequences would be in the 3' UTRs, which are often
found in EST databases. After amplifying the PENTAmers from a
specific gene, the microwell plates that have been amplified (e.g.,
5 or 10 for a 5 kb transcript) can be cloned as ordered libraries
and sequenced by the same method used for directed sequencing of
large-insert clones or genomic DNA discussed above.
[0874] During the process of PCR amplification of the PENTAmers,
underrepresented sequences from rare transcripts and 5' ends
regions will be amplified. For example, even if only 1% of the cDNA
molecules in the cDNA preparation extends all the way to a 5' end
that is 18 kb away from the 3' end of the expressed sequence, the
recombinant PENTAmers from that sequence will be present in the "18
kb" microwell and be amplifiable without competition from the much
more abundant cDNA sequences from near the 3' end, which will be in
different wells.
[0875] By using OPL-cDNA kits from the entire mixture of cDNA
molecules, there is no need to first isolate clones having a
specific cDNA sequences, and then sequence the longest clones. The
investigator can go directly to the full length cDNA sequence.
[0876] 9. Use of Terminal PENTAmers for Diagnosis of Chromosomal
Rearrangements
[0877] Nascent PENTAmers from a complete restriction digest of a
genome can be size separated, amplified in a sequence-independent
manner, and hybridized to a DNA microarray in order to diagnose
rearrangements of genomic DNA between different individuals or
between different tissues samples in the same individual. The types
of rearrangements diagnosable include: 1) deletions; 2)
amplifications; 3) translocations; 4) inversions; and 5) complex
combinations of the individual rearrangements. DNA microarray
hybridization with PENTAmers could replace karyotyping as the major
method to diagnose chromosomal aberrations, because it could be 1)
more sensitive; 2) less labor-intensive; 3) faster; and/or 4) less
expensive. The examples given below relate to human diagnostics,
however, it is understood that similar methods can be used for
animal and plant genome diagnostics.
[0878] a. Representation of a Genome by Terminal Sequences of
Restriction Fragments
[0879] A genome can be described, in part, as an ordered set of
restriction recognition sites and restriction fragments, FIG.
37A,B. For example, chromosome 1 can be partially described as an
ordered set of restriction recognition fragments; starting from one
end of the chromosome (e.g., the tip of the "p" arm) these
fragments can be given successive numerical labels, e.g., F(1,1),
F(1,2), F(1,3) . . . . Chromosome M would be described by the set
of fragments, F(M,1), F(M,2), F(M,3) . . . . The fragments can also
be described by the DNA sequences at the ends of each fragment,
e.g., the sequences at the "p" and "q" ends of fragment 1 of
chromosome 1 would be Sp(1,1) and Sq(1,1), respectively. The two
sequences for the Nth fragment of the Mth chromosome would be
Sp(M,N) and Sq(M,N). If the average length of the restriction
fragments is 50,000, there should be approximately 60,000 fragments
in the human genome, and therefore 120,000 terminal sequences. Each
of those 120,000 sequences is prepared as a cloned terminal
PENTAmer or represented by a unique complementary oligonucleotide.
The terminal PENTAmers (TP) for the Nth restriction fragment of the
Mth chromosome (or their oligonucleotide representatives) are
denoted TP(M,pN) and TP(M,qN) (with sequences Sp(M,N) and Sq(M,N),
respectively (FIG. 37B, C).
[0880] To prepare a diagnostic DNA microarray, each of the TP
terminal PENTAmers or oligonucleotides are placed or synthesized as
different spots in a DNA microarray (FIG. 37 C, D). Each spot in
the microarray is used to detect the presence of one of the
terminal sequences in a test sample of DNA by hybridizing labeled
test DNA to the microarray. A microarray containing 500 bp TP
clones represents .about.2% of the human genome. A microarray
containing unique 20-mer TP oligonucleotides represents 0.1% of the
human genome
[0881] b. Determination of Deletions Using Unfractionated
PENTAmers
[0882] A TP microarray is produced to represent a single
"reference" individual. This array will have each of the terminal
sequences characteristic of that reference individual. If DNA from
the same reference individual is restricted with the same
restriction enzyme, used to synthesize terminal PENTAmers,
amplified and labeled using PCR, and hybridized to the microarray
of reference terminal fragments, every terminal PENTAmer will be
present in the hybridization mixture and every spot on the
microarray will hybridize to the PENTAmer DNA and have a
fluorescent signal, FIG. 38 (left panels). However, if the DNA from
a "test" individual is restricted, terminally amplified, labeled as
PENTAmer DNA, and hybridized to the microarray, deletions of
terminal sequences in one allele (FIG. 38, right panel)) will cause
a 2.times. decrease of the hybridization intensity of specific
spots in the microarray. For example a 100 kb deletion would be
expected to delete on average 2 restriction sites (assuming an
average restriction fragment length of 50 kb) and therefore
deletion of 4 terminal sequences. By recording which spots have
2.times. reduced hybridization intensity, the chromosomal position
of the deletion is determined. To reduce the effect of variations
in the amount of reference terminal sequences present in every
microarray spot and differences in rate of hybridization of
different PENTAmers to different spots, the hybridization reactions
is best carried out simultaneously with a means to differentiate
between PENTAmers from the reference genome, and the PENTAmers from
the test genome, such as by labeling with nonidentical fluorescent
dyes. To quantify the abundance of a particular PENTAmer in the
experimental genome, a ratio of intensities from the dyes used to
label the test and reference genomes is detected.
[0883] The sensitivity of this technique is limited by the size of
the restriction fragments and complexity of the terminal PENTAmers.
The advantage of using PENTAmers to detect deletions is that the
PENTAmers can be amplified en masse to increase the concentration
of the labeled sequences. Conventional strategies of hybridizing
unamplified DNA or randomly-amplified DNA would produce a lower
molar concentration and a higher complexity of the hybridizing
sequences, increasing the time required for efficient hybridization
and increasing the background from hybridization of non-specific
sequences. The disadvantage of using this method to detect
deletions is that sequence polymorphisms (estimated to be 1 bp out
of every 1,000 bp) will prevent some of the expected sequences from
being produced as PENTAmers. Assuming an 8-base restriction
recognition sequence, about 1% of the expected terminal sequences
will not be found due to polymorphism. This problem can be reduced
by referring to the database of known polymorphisms to anticipate
which sequences might be polymorphic in the population, and
therefore unreliable for deletion detection. In addition, loss of
several consecutive terminal sequences will rarely occur due to
polymorphisms.
[0884] It is also envisioned that arrays are made to represent
populations of individuals. Population microarrays will contain
terminal sequences of all common TP polymorphisms in the
population. Population microarrays would genotype individuals in
terms of known and novel restriction site polymorphisms and
rearrangements.
[0885] c. Determination of Chromosomal Amplification Using
Unfractionated PENTAmers
[0886] Using the same protocol utilized to detect deletions of DNA,
amplification of loci can also be detected. If a specific locus in
the experimental individual's DNA has been amplified, e.g., in the
course of tumorigenesis, the copy number of specific sequences will
be increased. This will lead to an increase in the strength of the
hybridization signal on specific spots of the DNA microarray.
Identification of adjacent sequences that more strongly hybridize
than expected reveals the position and size of the amplified
region. This leads immediately to information about which gene or
genes might have been amplified. In case of differences in the
amount of DNA in different spots of the microarray, PENTAmers from
the reference genome can be labeled differentially from PENTAmers
from the experimental genome, such as by labeling with different
fluorescent dyes. In this case, the intensity of both fluorophores
will be measured at every spot after hybridization, and the ratio
of signals used to determine the copy number of specific terminal
sequences.
[0887] d. Determination of Chromosome Rearrangements Using
Size-Fractionated Restriction Fragments
[0888] In this section, it is shown that measurement of the sizes
of the restriction fragments make it possible to determine small
deletions and rearrangements of a test genome relative to a
reference genome. Each reference restriction fragment is
characterized by a length, L(M,N). The lengths of every reference
fragment can be predicted from the complete sequence of the genome,
or experimentally determined by size separation. To determine the
sizes experimentally, the reference genome is digested to
completion with the restriction enzyme, nascent primary PENTAmers
created at both ends of each restriction fragment, and the nascent
PENTAmer restriction fragments separated by size, e.g., by
electrophoresis. When the nascent PENTAmers from a specific size
fraction (e.g., 80 kb) are amplified in a sequence-independent way
using PCR primers complementary to the two universal adaptors, all
the sequences at the termini of 80 kb restriction fragments will be
amplified. If these "80 kb" reference PENTAmers are labeled and
hybridized to a reference DNA microarray, only those spots
containing sequences from 80 kb restriction fragments will be
labeled. Because every restriction fragment has two ends, the
microarray spots will be labeled in pairs, e.g., if spot Sq(2,350)
is labeled, so will spot Sp(2,350), and the labeling of both of
these spots indicates that restriction fragment F(2,350) has a
length of about 80 kb. When all of the size fractions from the
reference genome have been hybridized to the reference microarray,
the sizes of all restriction fragments will be known.
[0889] To analyze a test genome, the genome is restricted, terminal
PENTAmers synthesized, the nascent PENTAmers separated according to
size, and each size fraction hybridized to the reference DNA
microarray (FIGS. 39A and 39B). If each test size fraction has the
same sequences present as the reference size fractions, then all
the restriction fragment lengths are the same in the reference and
test genomes. If two test sequences, Sp(M,N) (shown as f in FIG.
39), and Sq(M,N) (shown as g in FIG. 39) are found in a different
size fraction in the reference and test samples, then the length of
that particular restriction fragment is different in the two
genomes. For example, if both sequences are found in the 80 kb
fraction of the reference sample (i.e., the length of F(M,N) (shown
as fg in FIG. 39) is 80 kb, but in the 60 kb fraction of the test
sample (i.e., the length of the test fragment, F*(M,N) (shown as
fg* in FIG. 39) is 60 kb in one of alleles, a deletion of 20 kb
would have been detected within fragment F(M,N) of one of alleles
(allele x in FIG. 39).
[0890] If the test genome has a chromosomal translocation (genetic
exchange between two chromosomes) then a new situation arises. The
outcome of a specific translocation is predictable. For example, if
the test genome has a reciprocal translocation between the DNA in
fragment F(5,360) and fragment F(20,502), then two new restriction
fragments are present in the test DNA, one fragment F*(5,360)
containing Sq(5,360) and Sp(20,502), and a second fragment
F*'(20,502) containing Sq(20,502) and Sp(5,360). The sum of the
lengths of the two new fragments will be the same as the sum of the
fragment lengths from the two reference fragments. However, because
the break point for the translocation can be anywhere within the
two reference fragments, the sizes of the test fragments will not
be the same as the reference fragments. The result is that when the
size fractions from the test PENTAmers are hybridized to the
reference DNA microarray, sequences Sq(5,360) and Sp(20,502) will
be found in a new size fraction corresponding to the new
restriction fragment F*(5,360), and sequences Sq(20,502) and
Sp(5,360) will be found in a new size fraction corresponding to the
new restriction fragment F*(20,502). A different outcome is
predicted for an inversion of genetic information within a
chromosome. Therefore, to analyze a test genome for these
rearrangements, the nascent PENTAmer size fractions from the test
individual are hybridized to the reference DNA microarray and the
sizes of the restriction fragments containing each of the terminal
sequences are determined. Analysis of those sequences that appear
in unexpected size fractions can determine the nature and position
of chromosomal rearrangements.
[0891] It is also envisioned that the arrays made to represent
populations of individuals will be used to determine
translocations, inversions, deletions, and amplifications of
individuals using size-fractionated nascent PENTAmers. Population
microarrays will contain terminal sequences of all common TP
polymorphisms in the population. Population microarrays would
genotype individuals in terms of known and novel restriction site
polymorphisms and rearrangements.
[0892] 10. Use of Sampled PENTAmer Libraries Comprising Terminal
PENTAmers for Detection and Identification of Organisms and
Variants of Organisms
[0893] Complete or partial digestion of a single genome or genomes
from a mixture of organisms with a first restriction enzyme,
followed by synthesis of primary PENTamers at the ends of the
restriction fragments, creates a sampled PENTAmer library of
amplifiable DNA molecules that represent a specific, restricted
fraction of the entire genome. This sampled genome is amplified and
analyzed in vitro. Amplification is achieved by PCR or other
amplification method using the two primers complementary to adaptor
A and B sequences. Analysis is done by restriction fragment
fingerprinting or hybridization, in specific embodiments. Fragment
fingerprinting can be achieved by cutting to completion the sampled
PENTAmer library with one or more other restriction enzymes in
order to produce a spectrum of fragments of different length which
contain the adaptor A sequence. Those fragments are separated by
size using electrophoresis or other method and visualized directly
in the electrophoretic gel or transferred to a membrane for
detection. The size-separated fragments are visualized by means of
a fluorescent, radioactive, chemiluminescent, or other label
incorporated within adaptor A, or by detecting the adaptor A
sequence indirectly by hybridizing labeled DNA probes to the
size-separated DNA. Example 31 shows the fingerprint patterns from
a Not I digest of E. coli DNA. The fingerprint patterns from a
series of digestions with second restriction enzymes in a specific
embodiment are compared to a reference fingerprint of different
bacteria in order to determine the specie(s) of bacteria present in
a sample, or to determine the type or subtype of a bacterium
present in the sample. The presence or absence of specific fragment
lengths after digestion with a specific second restriction enzyme
is diagnostic for the presence or absence of an expected specific
sequence in the sample, as well as the presence of unexpected
sequences from unexpected restriction sites in known or unknown
genomes.
[0894] Hybridization analysis of the sampled PENTAmer library
identifies, in specific embodiments, the presence or absence of
known sequences in the sample. For example, after a Not I digestion
of a culture of bacteria or mixture of bacteria, primary PENTAmers
are created from the terminus of every restriction fragment, the
PENTAmers amplified using primers complementary to adaptors A and
B, and the amplified sampled PENTAmer library hybridized to a DNA
microarray containing all or a fraction of all the Not I terminal
sequences from one or more reference cultures of bacteria. During
amplification, labeled primers or labeled bases are used to label
the amplified PENTAmers. If a particular species, type, or subtype
of bacterium is present in the sampled PENTAmer library, those
microarray spots that contain DNA from the reference bacteria are
labeled. In principle, oligonucleotides complementary to
restriction termini from hundreds of different bacteria are placed
on a single microarray and used to detect the presence of hundreds
of different bacteria simultaneously from a mixture of many
bacteria.
[0895] For large quantities of source DNA, analysis by
fingerprinting or hybridization is done by direct labeling of the
unamplified PENTAmers using labeled adaptors or by incorporation of
a label during the nick-translation reaction.
[0896] Applications for a sampled PENTAmer library of bacteria
include: a) identification of different bacterial species, types,
or subtypes present in a mixture; b) identification of deletion of
specific sequences from or insertion of known sequences into a
bacterium that, in a specific embodiment, is relevant for
surveillance or diagnostic purposes.
[0897] 11. Use of Sampled PENTAmer Libraries Comprised of Terminal
PENTAmers to Amplify Specific Subsets of Genomes
[0898] Complete restriction digestion of a single genome or genomes
from a mixture of organisms with a restriction enzyme, followed by
synthesis of primary PENTAmers at the ends of the fragments, is a
method to produce an amplifiable library of fragments that
represent a specific subset of the genome.
[0899] For example, if a human genome is digested with a
restriction enzyme that cleaves on average every 100,000 bp, the
PENTAmer library made from all 35,000 restriction fragments would
comprise about 70,000 specific sequences in the human genome. The
molecules in the library could be made to have an average length of
1 kb by controlling the time of the nick-translation reaction. The
PENTAmers in a specific embodiment are separated from the remainder
of the genome (e.g., by size separation, or by using a biotinylated
adaptor). The sampled library in another specific embodiment is
labeled during amplification using primers complementary to
adaptors A and B (e.g., using a fluorescent primer(s)). The
advantage of the sampled PENTAmer library over other proposals to
amplify a subset of the genome (e.g., WO 099/18241, WO 00/18960A2)
is that the amplimers are of uniform, controllable length and are
specific to the termini of restriction fragments. Therefore, the
PENTAmer library is used for single-tube amplification of a
specific subpopulation of the sequences of a complex genome with
minimal non-specific amplification of non-terminal sequences and
substantially equal representation of all restriction termini.
[0900] 12. Use of Oversampled PENTAmer Libraries Comprised of
Terminal PENTAmers to Amplify Complete Genomes
[0901] Partial restriction digestion of a single genome or genomes
from a mixture of organisms with a frequently-cutting restriction
enzyme, followed by synthesis of primary PENTAmers at the ends of
the fragments is a method to produce an amplifiable library of
fragments that represent an entire genome.
[0902] For example, if a human genome is partially digested with a
restriction enzyme that cleaves on average every 64 bp to produce
DNA fragments with an average size of 5 kb, templates will be
formed to make an overlapping PENTAmer library of the genome.
Primary PENTAmers of specified length are synthesized from all
restriction fragments. In a specific embodiment, the PENTAmers are
separated from the remainder of the genome (e.g., by size
separation, or by using a biotinylated adaptor). The sampled
library are labeled during amplification using primers
complementary to adaptors A and B (e.g., using a fluorescent
primer(s)). The resulting mixture of PENTAmers represents the
entire human genome. Amplification of the PENTAmer library achieves
amplification of the entire genome. The advantage of the
oversampled PENTAmer library over the proposal to amplify an entire
genome using strand displacement amplification with random primers
(WO 99/18241) is that the amplimers are of uniform, controllable
length and are specific to the termini of restriction fragments.
Therefore the oversampled PENTAmer library can be used for
single-tube amplification of all sequences of a complex genome with
substantially equal representation of all sequences.
EXAMPLES
[0903] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1
Preparation of PENT Adaptors.
[0904] This example describes the preparation of several types of
adaptors used in different examples for terminal and internal
tagging of the double-stranded DNA molecules. Oligonucleotide
sequences are shown in Table 4.
[0905] Up-stream, terminus-attaching nick-translation adaptor A
(FIG. 40) is prepared by annealing 100 pmol of oligonucleotide 5608
I and 100 pmol of the oligonucleotide 5602 I by cooling from
70.degree. C. to room temperature at least 2 h in 20 .mu.l of
TE-0.1 (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA). The annealed
oligonucleotides are incubated with 5 U of Klenow enzyme
(exo.sup.-) in 40 .mu.l of 50 mM Tris-HCl, pH 7.5, 10 mM
MgCl.sub.2, 1 mM DTT, 50 .mu.g/ml BSA, and in the presence of 100
mM dATP and 1 mM ddCTP at 37.degree. C. for 1 h.
[0906] Acceptor-adaptor (AC) (FIG. 40) is prepared by
dephosphorylation of 10 pmol of oligonucleotide 5608 I in 10 .mu.l
of 50 mM Tris-HCl, pH 8.5, 5 mM MgCl.sub.2 using 2 U of
shrimp-alkaline phosphatase, SAP (Boehringer Mannheim;
Indianapolis, Ind.) for 1 h at 37.degree. C., followed by heat
inactivation of SAP at 68.degree. C. for 15 min, mixing with 1
.mu.l of 10 mM oligonucleotide 5603 I and annealing at room
temperature for at least 2 h.
[0907] Recombination, nick translation adaptor RA-(L-cos) (FIG. 40)
is prepared by annealing 100 pmol of 5'-phosphorylated
oligonucleotide 5686 I and 100 pmol of 3'-blocked oligonucleotide
5689 I (cooled from 70.degree. C. to room temperature over at least
2 h) in 30 .mu.l volume of TE-0.1.
[0908] Down-stream, nick attaching Adaptor B-3'(a) (FIG. 40) is
prepared by annealing (as above) 100 pmol of oligonucleotide 5607 I
and 100 pmol of oligonucleotide 5604 I in 40 .mu.l of TE-0.1,
followed by incubation for 1 h at 37.degree. C. in 60 .mu.l of 100
mM potassium cacodylate, pH 7.2, 2 mM CoCl.sub.2, 0.2 mM DTT in the
presence of 333 .mu.M ddCTP and 20 U of terminal deoxynucleotidyl
transferase (Gibco BRL). TABLE-US-00004 TABLE 4
Oligonucleotides.sup.(a) Code Sequence (5'-3') Length.sup.(b)
Applications 5608 I P-GATCGCCTATACCTAGGACCATGT 24.sup.(b) A adaptor
(SEQ ID NO. 1) 5602 I GTTACAUGGUCCUAGGTAUAGG 22 A adaptor (SEQ ID
NO. 2) 5603 I GTTACATGGTCCTAGGTATAGGC 23 PENT, PCR primer (SEQ ID
NO. 3) 5686 I P-GATCGCCTATACCTAGGACCATGT 37.sup.(b) RA-(L-cos)
adaptor AACGAATTCATCA (SEQ ID NO. 4) 5689 I
AGGTCGCCGCCCTGATGAATTCGUTACAUG 45.sup.(c) RA-(L-cos) adaptor
GTCCUAGGTAUAGGCNH.sub.2 (SEQ ID NO. 5) 5687 I GGGCGGCGACCT (SEQ ID
NO. 6) 12 R-cos blocker 5604 I GGGAGATCTGAATTCCCCCCCCCCC 25 B-3'
adaptor (a) (SEQ ID NO. 7) 5605 I GGGAGATCTGAATTCAAAAAAAA 23 B-3'
adaptor (c) (SEQ ID NO. 8) 5607 I P-GAATTCAGATCTCCCGGGTCACCG
24.sup.(b) B-3' adaptor (a, c) (SEQ ID NO. 9) 7422 I
GCGGTGACCCGGGAGATCTGCCCCCCCCCC 30 B-3' adaptor (b) (SEQ ID NO. 10)
7421 I GCGGTGACCCGGGAGATCTGAAAAAAA 30 B-3' adaptor (d) AAA (SEQ ID
NO. 11) 7424 I P-CAGATCTCCCGGGTCACCGCGCCTAT 42.sup.(b) B-3' adaptor
(b, d) ACCTAGGACCATGTAA (SEQ ID NO. 12) 5776 I
GCGGTGACCCGGGAGATCTGAATTC 25 PCR primer (SEQ ID NO. 13) 2498 D
Biotin-GCGGTGACCCGGGAGATCTGAATTC 25.sup.(d) Oligo-construct with
nick (SEQ ID NO. 14) 464108 P-AGGTCGCCGCCCTGAATTCAGATCT 38.sup.(b)
Oligo-construct with nick CCCGGGTCACCGC (SEQ ID NO. 15) .sup.(a)all
oligonucleotides except 464108 are synthesized at the U of M DNA
Synthesis Core; oligonucleotide 464108 is synthesized by Gibco BRL
Customer Service. .sup.(b)oligonucleotides 5608 I, 5686 I, 5607 I,
and 464108 are synthesized with 5' phosphate group P
.sup.(c)oligonucleotide 5689 I is synthesized with 3' blocking
amino group NH .sup.(d)oligonucleotide 2498 D is synthesized with
5' biotin molecule
[0909] Down-stream, nick-attaching adaptor B-3'(b) (FIG. 40) is
prepared by phosphorylation of 800 pmol of oligonucleotide 7424 I
in 20 .mu.l of 50 mM Tris-HCl, pH 8.2, 10 mM MgCl.sub.2, 0.1 mM
EDTA, 5 mM DTT, 0.1 mM spermidine in the presence of 1 mM dATP and
10 U of polynucleotide kinase, PNK (Boehringer Mannheim,
Indianapolis, Ind.) at 37.degree. C. for 1 h, followed by heat
inactivation of PNK, adding 800 pmol of the oligonucleotide 5603 I
and 800 pmol of oligonucleotide 7422 I, and annealing from
80.degree. C. to room temperature for at least 2 h in 20 .mu.l 25
mM Tris-HCl, 0.05 mM EDTA, pH 8.0.
[0910] Down-stream, nick-attaching adaptor B-3'(c) (FIG. 40) is
prepared by annealing (as above) 100 pmol of oligonucleotide 5607 I
and 100 pmol of oligonucleotide 5605 I, in 40 .mu.l TE-0.1,
followed by incubation for 1 h at 37.degree. C. in 60 pi of 100 mM
potassium cacodylate, pH 7.2, 2 MM CoCl.sub.2, 0.2 mM DTT in the
presence of 333 .mu.M ddATP and 20.U of terminal deoxynucleotidyl
transferase (Gibco BRL).
[0911] Down-stream, nick-attaching adaptor B-3'(d) (FIG. 40) is
prepared by phosphorylation of 800 pmol of oligonucleotide 7424 I
in 20 .mu.l of 50 mM Tris-HCl, pH 8.2, 10 mM MgCl.sub.2, 0.1 mM
EDTA, 5 mM DTT, 0.1 mM spermidine in the presence of 1 mM dATP and
10 U of polynucleotide kinase (Boehringer Mannheim, Indianapolis,
Ind.) at 37.degree. C. for 1 h, followed by heat inactivation of
PNK, addition of 800 pmol of oligonucleotide 5603 I and 800 pmol of
oligonucleotide 7421 I, and annealing from 80.degree. C. to room
temperature for at least 2 h in 20 .mu.l 25 mM Tris-HCl, 0.05 mM
EDTA, pH 8.0.
[0912] Adaptors B-3'(a), B-3'(b), B-3'(c) and B-3'(d) are
equivalent to a down-stream, nick-attaching adaptor B-3'(II) shown
in FIG. 28 and discussed above.
Example 2
Efficient Ligation of Blocked PENT-Adaptors
[0913] Ligation of specialized nick-translation adaptors to the
ends of DNA molecules is an important step towards the creation of
a PENTAmer. This example describes the efficiency of ligation of a
specialized 3'-end-blocked recombination nick-translation adaptor
RA-(L-cos)(donor-adaptor Dn) with 5'phosphorylated 4-base GATC
terminus to the recipient molecule (acceptor-adaptor AC) with
complementary 5' termini (Example 1).
[0914] Five reaction mixtures which contain 0, 200, 400, 800 and
800 nM adaptor RA-(L-cos) (donor Dn), 200 nM acceptor-adaptor (AC)
in the first four tubes (no acceptor-adaptor in tube 5), 66 mM
Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 1 mM DTT, 1 mM ATP and 1 U of T4
DNA ligase (Boehringer Mannheim, Indianapolis, Ind.) in 10 .mu.l
are incubated for 2 h at 20.degree. C. Tubes 6 and 7 contain
ligase-deficient controls with 200 nM adaptor-acceptor and 800 nM
adaptor-acceptor, respectively. The products of the ligation
reactions are analyzed on a 15% polyacrylamide, 1.times.TBE gel,
stained with ethidium bromide (FIG. 41).
[0915] FIG. 41 shows the results of ligation. The bands at the top
of the gel represent ligation products. The bands of lower
molecular weight are from the monomeric species. Lane 6 shows
adaptor-acceptor in the absence of ligase. Lane 7 shows
adaptor-donor in the absence of ligase. The ratio of monomers to
dimers is determined from the relative intensities of fluorescence
from the monomer and dimer bands. In the reaction with
adaptor-acceptors alone, about 30% of the molecules form dimers as
a result of self-ligation of not completely dephosphorylated
adaptor A (lane 1). Addition to the ligation mixture of the
adaptor-donor (Dn) leads to formation of the donor-acceptor dimers
(Ac-Dn) and disappearance of the monomer acceptor band Ac, even
with only a 1:1 ratio of the two adaptors (lanes 2-4). The 3'-end
blocked adaptor RA-(L-cos)(donor-adaptor Dn) shows minor formation
of self-ligation products at 800 nM concentration (lane 5) when
compared with control 800 nM donor-adaptor sample without ligation
(lane 7). This gel shows that self-ligation can be inhibited.
Example 3
Preparation of the "PENT-Ready" Lambda DNA Bam HI templates.
[0916] This example describes the preparation of lambda DNA/Bam HI
restriction fragments with upstream nick-translation adaptors A,
which are used in Examples 4-7, and 9-14.
[0917] Following the incubation of 5 .mu.g of lambda DNA with 20 U
Bam HI (Boehringer Mannheim, Indianapolis, Ind.) in 25 .mu.l of 10
mM Tris-HCl, pH 8.0, 5 mM MgCl.sub.2, 100 mM NaCl, 1 mM
2-mercaptoethanol for 2 h at 37.degree. C., the mixture is
supplemented with 3 .mu.l of shrimp alkaline phosphatase (SAP)
buffer (Boehringer Mannheimn) and 2 U of SAP (Boehringer Mannheim),
and incubated for 30 min at 37.degree. C. After heat inactivation
of SAP at 68.degree. C. for 15 min the DNA is precipitated with
ethanol, washed with 70% ethanol, dried and dissolved in 31 .mu.l
TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) with a final molar
concentration of Bam HI ends equal to 50 nM. Then, 5 .mu.l of SAP
treated Barn HI lambda DNA restriction fragments (250 fmol ends)
are ligated with 1 pmol of nick-translation adaptor A (type C) or
recombination nick-translation adaptor RA-(L-cos) in 10 .mu.l of 66
mM Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 1 mM DTT, 1 mM ATP and 1 U T4
DNA ligase (Boehringer Mannheim, Indianapolis, Ind.) at room
temperature for 4 h. The reaction is terminated by adding 1.5 .mu.l
50 mM EDTA and heating at 68.degree. C. for 15 min, followed by
adding 1 U dU-glycosylase (Boehringer Mannheim, Indianapolis, Ind.)
and incubation for 1 h at 37.degree. C. to destabilize the binding
of the 3'-blocked oligonucleotide 5602 I (adaptor A) or 5689 I
(RA-(L-cos) adaptor).
Example 4
T4 DNA Polymerase-Mediated Repair of the Blocked 3'-Ends of
PENT-Adaptors
[0918] The PENT adaptors that are used in this example contain
blocked 3' ends. To initiate PENT reaction it is necessary to have
a primer with 3'-OH group. This example describes a first method to
activate the nick-translation primer within PENT-adaptors.
[0919] 1 pmol of the 3'-end blocked oligonucleotide 5689 I labeled
with [.gamma.-.sup.32P]ATP (using T4 kinase) is hybridized with 2
pmol of oligonucleotide 5686 I (FIG. 40) in 20 .mu.l of 100 mM KCl,
50 mM Tris-HCl, pH 7.5 to form a RA-(L-cos)adaptor at a
concentration of 50 nM. Four repair reaction mixtures are prepared.
Each tube has a final volume of 25 .mu.l containing 50 fmol
.sup.32P-labeled adaptor RA-(L-cos) and 100 .mu.M dNTP (i.e., 100
.mu.M dATP, 100 .mu.M dCTP, 100 .mu.M dGTP, and 100 .mu.M dTTP).
Tube 1 contains no polymerase. Tube 2 contains 1 U T4 DNA
polymerase (Boehringer Mannheim). Tube 3 contains 2 U Klenow
fragment (Gibco BRL). Tube 4 contains 1 U of T4 DNA polymerase and
2 U Klenow fragment. Tubes 1, 2 and 4 are brought to final volume
with 50 mM Tris-HCl, pH 8.8, 15 .mu.M (NH.sub.4).sub.2SO.sub.4, 7
mM MgCl.sub.2, 0.1 mM EDTA, 10 mM 2-mercaptoethanol, 20 .mu.g/ml
BSA. Tube 3 is brought to final volume with 50 mM Tris-HCl, pH 7.5,
10 mM MgCl.sub.2, 1 mM DTT, 50 .mu.g/ml BSA. After adjusting the
volumes with buffer, the tubes are incubated for 1 h at 16.degree.
C. Products of the repair reactions are separated on 12%
polyacrylamide/7 M urea denaturing gel at 60.degree. C. After
electrophoresis, the gel is dried and analyzed using a Molecular
Dynamics, (Sunnyvale, Calif.) 400A PhosphorImager and ImageQuant
software (Makarov et al., 1997) (FIG. 42).
[0920] Repair of the blocked oligonucleotide 5689 I should be
evidenced by increase of the molecular weight of the labeled
oligonucleotide from 45 b to 49 b. The repair is efficient with T4
DNA polymerase (compare lanes 1 and 2) but not with Klenow fragment
(compare lanes 1 and 3). Mixture of T4 DNA polymerase and Klenow
fragment (lane 4) results in only partial repair probably due to
competitive binding of Klenow fragment.
Example 5
Primer-Displacement Activation of the PENT Reaction
[0921] This example describes a method to initiate the PENT
reaction, which utilizes the reduced binding of the 3' blocked
primer after dU-glycosylase treatment of the adapted DNA
fragments.
[0922] 0.8 .mu.g "PENT-ready" lambda DNA Bam HI templates prepared
as described in Example 3 (250 fmol adapted ends) are mixed with
500 fmol of .sup.32P-labeled PENT primer 5603 I in 13.5 .mu.l
volume, heated to 70.degree. C. and allowed to cool slowly to room
temperature for more than 2 h. The concentration of the ends is
adjusted to 1 fmol/.mu.l with TE buffer.
[0923] Primer-extension nick-translation reaction (PENT) is
performed with wild type Taq DNA polymerase as described before
(Makarov et al., 1997). In all examples described, wild type Taq
stock at 60 U/.mu.l was provided by Dr. David Engelke of the
University of Michigan. It was always diluted 30.times. with Taq
buffer (20 mM Tris-HCl pH 8.3, 50 mM KCl, 2 mM Mg Cl.sub.2) before
use. To conduct PENT reactions at different Taq DNA polymerase
concentrations, six mixtures containing 5 .mu.l of lambda DNA/Bam
HI restriction fragments with ligated and activated
nick-translation adaptor A (as described above), 5 .mu.l of
10.times. PCR.TM. buffer (100 mM Tris-HCl, pH 8.3, 50 mM KCl), 4
.mu.l 25 mM MgCl.sub.2, and 1, 1.5, 2, 3, 5 or 10 .mu.l of Taq DNA
polymerase (30 times diluted with 1.times. Taq buffer from stock at
60 U/.mu.l) and H.sub.2O to make a final volume of 49 .mu.l are
prepared in six 0.5 ml PCR.TM. tubes. Samples are preheated at
50.degree. C. for 5 min, and the PENT reactions are initiated by
adding 1 .mu.l of 2.5 mM dNTP (i.e., 2.5 mM dATP, 2.5 mM dTTP, 2.5
mM dGTP, and 2.5 mM dCTP) solution to each tube. After 7 min of
incubation at 50.degree. C., the reactions are terminated by adding
1 .mu.l 0.5 M EDTA and precipitated with ethanol. PENT reaction
products are separated on an alkaline (40 mM NaOH, 1 mM EDTA) 1%
agarose gel. After electrophoresis, the gel is neutralized,
electro-blotted onto ZetaProbe membrane (BioRad) and analyzed with
a Molecular Dynamics (Sunnyvale, Calif.) 400A PhosphorImager and
ImageQuant software (Makarov et al., 1997) (FIG. 43).
[0924] PENT products are detected as a 1.4 kb band from 3 U to 20 U
of Taq DNA polymerase (lanes 2-6), which suggest the PENT reaction
initiates synchronously and proceeds at about 200 bp/min at
50.degree. C.
Example 6
Effect of MgCl.sub.2 Concentration on the Rate of PENT Reaction
[0925] This example shows that the PENT reaction can be performed
by wild type Taq DNA polymerase over a broad range of Mg ion
concentration.
[0926] To carry out the PENT reactions at different MgCl.sub.2
concentrations, five mixtures containing 5 .mu.l of lambda DNA/Bam
HI restriction fragments with ligated and activated
nick-translation adaptor A (as described in Example 5), 5 .mu.l of
10.times. PCR.TM. buffer (100 mM Tris-HCl, pH 8.3, 50 mM KCl), 2,
4, 8, 10 or 14 .mu.l 25 mM MgCl.sub.2, 2 .mu.l of Taq DNA
polymerase (30 times diluted with 1.times. Taq buffer from stock at
60 U/.mu.l) and an amount of H.sub.2O to attain a final volume of
49 .mu.l are prepared in five 0.5 ml PCR.TM. tubes. Samples are
preheated at 50.degree. C. for 5 min, and the PENT reactions are
initiated by adding 1 .mu.l of 2.5 mM dNTP solution to each tube.
After 7 min of incubation at 50.degree. C., reactions are
terminated by adding 1 .mu.l 0.5 M EDTA and EtOH precipitated.
[0927] PENT reaction products are separated on an alkaline 40 mM
NaOH, 1 mM EDTA) 1% agarose gel. After electrophoresis, the gel is
neutralized, electro-blotted onto ZetaProbe membrane (BioRad;
Hercules, Calif.) and analyzed with a Molecular Dynamics
(Sunnyvale, Calif.) 400A PhosphorImager and ImageQuant software
(Makarov et al., 1997) (FIG. 44).
[0928] PENT products are detected as 1.2-1.4 kb bands with PENT
reaction rate changing from 170 to 200 bp/min when MgCl.sub.2
concentration rises from 1 to 4 mM. No further increase of the PENT
reaction rate is found in the range of 4 to 7 mM MgCl.sub.2. The
efficiency of initiation is fairly independent of Mg
concentration.
Example 7
Control of the Length of PENT Products by Control of the Duration
of the PENT Reaction.
[0929] It was shown before for human telomeres and model plasmid
construct that the size of newly synthesized strand during PENT is
strictly proportional to the time of reaction, suggesting a simple
and reproducible method of time-controlled DNA synthesis (Makarov
et al., 1997). This example describes time-controlled DNA synthesis
on a mixture of 10 different DNA templates.
[0930] Three mixtures are prepared in three 0.5 ml PCR.TM. tubes
which contain 10 ml of lambda DNA/Bam HI restriction fragments with
ligated and activated nick-translation adaptor A (as described in
Example 5), 5 .mu.l of 10.times. PCR.TM. buffer (100 mM Tris-HCl,
pH 8.3, 50 mM KCl), 4 .mu.l 25 mM MgCl.sub.2, 2 .mu.l of Taq DNA
polymerase (30 times diluted with 1.times. Taq buffer from stock at
60 U/.mu.l) and H.sub.2O in final volume 49 .mu.l. Samples are
preheated at 50.degree. C. for 5 min, and the PENT reactions are
initiated by adding 1 .mu.l of 2.5 mM dNTP solution to each tube.
The reactions are continued at 50.degree. C. and terminated by
adding 1 .mu.l 0.5 M EDTA after 2 min (tube 1), after 4 min (tube
2), and after 6 min (tube 3). The contents of all tubes were EtOH
precipitated.
[0931] PENT reaction products are separated on an alkaline (40 mM
NaOH, 1 mM EDTA) 1% agarose gel. Molecular weight markers were also
loaded onto the gel. After electrophoresis, the gel is neutralized,
electro-blotted onto ZetaProbe membrane (BioRad; Hercules, Calif.)
and analyzed with a Molecular Dynamics (Sunnyvale, Calif.) 400A
PhosphorImager and ImageQuant software (Makarov et al., 1997) (FIG.
45).
[0932] PENT products from tubes 1, 2, and 3 are detected as 0.4,
0.8 and 1.2 kb bands, respectively. The average rate of PENT
reaction is estimated to be 200 bases/min at 50.degree. C. Because
the bands are narrow, it is concluded that the PENT products from
the 10 template ends had similar lengths.
Example 8
Terminal Deoxynucleotidyl Transferase (TdT) Tailing at the Nick in
a Model Oligonucleotide Construct
[0933] This example describes the addition of long homopolymeric
tails to the 3'-OH within a nick of a model double-stranded
oligonucleotide using TdT.
[0934] Model oligonucleotide construct with a nick (FIG. 40) is
prepared by: a) mixing 1 nmol oligonucleotide 2498 D with 1 nmol
oligonucleotide 464108 in 20 .mu.l TE buffer; b) heating and
annealing as described in Example 1; c) .sup.32P-labeling of the
3'-end of oligonucleotide 2498 D by incubating 5 pmol of the oligo
2498 D/oligo 464108 hybrid in 10 .mu.l reaction mixture containing
50 mM Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT, 50 .mu.g/ml
BSA, 0.33mM [.alpha.-.sup.32P] dATP and 5 U Klenow fragment
(exo.sup.-) (Ambion) for 30 min at 20.degree. C.; d) inhibiting
with 0.5 .mu.l 0.5 M EDTA and hybridizing 5 pmol of the
oligonucleotide lambda R-cos to 5' end of the oligo 2498 D/oligo
464108 hybrid at 37.degree. C. in 20 .mu.l TE to form a structure
with nick; e) diluting to 50 nM.
[0935] Four 20 .mu.l TdT reaction mixtures containing 50 fmol
[.alpha.-.sup.32P] -labeled oligo-construct (see above), 100 mM
potassium cacodylate, pH 7.2, 2 mM CoCl.sub.2, 0.2 mM DTT, 15 U TdT
(Gibco BRL), and 1 .mu.M, 3 .mu.M, 10 .mu.M and 30 .mu.M dGTP are
incubated at 37.degree. C. for 40 min. Reactions are terminated by
adding 1 .mu.l 200 mM EDTA and 20 .mu.l 2.times. formamide loading
buffer (10.times. TBE, 90% deionized formamide, 0.5% Bromphenol
Blue).
[0936] Products of the reactions are separated on 12%
polyacrylamide/7M urea denaturing gel at 60.degree. C. After
electrophoresis, gel is dried and analyzed with a Molecular
Dynamics (Sunnyvale, Calif.) 400A PhosphorImager and ImageQuant
software (Makarov et al., 1997) (FIG. 46). Products of TdT-mediated
tailing are detected as broad smeared bands with a size larger than
26 bp. Tubes with increasing concentrations of dGTP contained
labeled molecules with longer homopolymeric tails. Even at low
concentrations of nucleotide, the majority of nicks were
extended.
Example 9
Terminal Deoxynucleotidyl Transferase (TdT) Tailing of PENT
Products: Inhibitor Effect of Taq DNA Polymerase
[0937] This example describes prerequisites for efficient
homopolymeric tailing by TdT at the internal 3'-ends (nicks) of
PENT products. The addition of homopolymer tails using TdT and
non-purified templates directly after PENT reaction are not
preferred. In fact, phenol/chloroform purification of DNA after
incubation with Taq polymerase followed by ethanol precipitation is
preferred for TdT-mediated reaction.
[0938] PENT reaction is performed as described in Examples 5-7.
Specifically, four mixtures are prepared in four 0.5 ml PCR.TM.
tubes which contain 5 .mu.l of lambda DNA/Bam HI restriction
fragments with ligated and activated nick-translation adaptor A (as
described in the Example 5), 5 .mu.l of 10.times.PCR.TM. buffer
(100 mM Tris-HCl, pH 8.3, 50 mM KCl), 4 .mu.l 25 mM MgCl.sub.2, 2
.mu.l of Taq DNA polymerase (30 times diluted with 1.times. Taq
buffer from stock at 60 U/.mu.l) and H.sub.2O in final volume 49
.mu.l. Samples are preheated at 50.degree. C. for 5 min, and the
PENT reactions are initiated by adding 1 .mu.l of 2.5 mM dNTP
solution to each tube. After 5 minutes of incubation at 50.degree.
C., the reactions are terminated by adding 1 .mu.l 200 mM EDTA. The
PENT DNA samples from tubes 1 and 2 are precipitated with ethanol
in the presence of 1 .mu.l glycogen (Boehringer Mannheim;
Indianapolis, Ind.). The PENT DNA from tube 3 is extracted with
phenouchloroform and precipitated as described above. The PENT DNA
from tube 4 is washed 3.times. with 0.5 ml of TE-0.1 in a Microcon
100 centrifugal filter device (Amicon) by spinning at 300 g for 20
min at room temperature and recovered in 26 .mu.l volume. The PENT
DNA samples from tubes 1, 2 and 3 are pelleted, washed 3.times.
with 70 % EtOH, dried, and dissolved in 20 .mu.l TE.
[0939] Four TdT tailing reactions and four control reactions are
performed. Tubes 1A (experimental) and 1B (control) contain 10
.eta.l DNA from tube 1 (above), 100 mM potassium cacodylate, pH
7.2, 2 mM CoCl.sub.2, and 0.2 mM DTT. 1 .mu.l 1 mM dTTP and 15 U
TdT (Gibco BRL) are added to tube 1A. Tubes 2A (experimental) and
2B (control) contain 10 .mu.l DNA from tube 2, 100 mM potassium
cacodylate, pH 7.2, 2 mM CoCl.sub.2, and 0.2 mM DTT. 0.5 .mu.l 1 mM
dGTP and 15 U TdT (Gibco BRL) are added to tube 2B. Tubes 3A
(experimental) and 3B (control) contain 10 .mu.l DNA from tube 3,
100 mM potassium cacodylate, pH 7.2, 2 mM CoCl.sub.2, and 0.2 mM
DTT. 1 .mu.l 1 mM dTTP and 15 U TdT (Gibco BRL) are added to tube
3A. Tubes 4A (experimental) and 4B (control) contain 10 .mu.l DNA
from tube 4, 100 mM potassium cacodylate, pH 7.2, 2 MM CoCl.sub.2,
and 0.2 mM DTT. 1 .mu.l 1 mM dTTP and 15 U TdT (Gibco BRL) are
added to tube 4A. Tubes are adjusted to 20 .mu.l with H.sub.2O.
[0940] All 8 tubes are incubated at 37.degree. C. for 40 min,
ethanol precipitated, dissolved, loaded and separated on an
alkaline (40 mM NaOH, 1 mM EDTA) 1% agarose gel. After
electrophoresis, gel is neutralized, electro-blotted onto ZetaProbe
membrane (BioRad; Hercules, Calif.) and analyzed with a Molecular
Dynamics (Sunnyvale, Colo.) 400A PhosphorImager and ImageQuant
software (Makarov et al., 1997) (FIG. 47).
[0941] TdT-tailed PENT products are detected as broadened DNA bands
with increased molecular weight relative to the controls. Only
those DNA samples that are extracted with phenouchloroform or
washed with Amicon filters have noticable lengths of homopolymeric
DNA. These results indicate that removal of Taq polymerase after
the PENT reaction is necessary to allow the TdT to use the PENT
product as a substrate.
Example 10
Terminal deoxynucleotidyl transferase (TdT) tailing of PENT
products: effect of carrier.
[0942] Frequently, in manipulations of small amounts of DNA it is
necessary to use a carrier molecule for efficient DNA recovery.
This example describes the observation that tRNA as a carrier has
no inhibitory effect on the PENT tailing capacity of the terminal
deoxynucleotidyl transferase, while glycogen inhibits the
reaction.
[0943] PENT reaction is performed as described in Examples 5-7.
Specifically, four mixtures are prepared in four 0.5 ml PCRT tubes
which contain 5 .mu.l of lambda DNA/Bam HI restriction fragments
with ligated and activated nick-translation adaptor A (as described
in the Example 5), 5 .mu.l of 10.times. PCR.TM. buffer (100 mM
Tris-HCl, pH 8.3, 50 mM KCl), 4 .mu.l 25 mM MgCl.sub.2, 2 .mu.l of
Taq DNA polymerase (30 times diluted with 1.times. Taq buffer from
stock at 60 U/.mu.l) and H.sub.2O in final volume 49 .mu.l. Samples
are preheated at 50.degree. C. for 5 min, and the PENT reactions
are initiated by adding 1 .mu.l of 2.5 mM dNTP solution to each
tube. After 5 min incubation at 50.degree. C. the reactions are
terminated by adding 1 .mu.l 500 mM EDTA. DNA samples in all 4
tubes are extracted with phenouchloroform and precipitated with
ethanol in the presence of 1 .mu.l glycogen (tubes 1 and 3), 3
.mu.l tRNA in tube 2, and 1 .mu.l tRNA (tube 4). After overnight
precipitation, the DNA samples in tubes 1-4 are washed 3 times with
75% ethanol, dried and dissolved in 20 .mu.l H.sub.2O.
[0944] Four TdT tailing reactions are performed as described below.
Tube A, B, C and D contain 10 .mu.l DNA from tube 1, 2, 3, and 4,
respectively, and all four tubes contain 100 mM potassium
cacodylate, pH 7.2, 2 mM CoCl.sub.2, 0.2 mM DTT, 1 .mu.l 1 mM dTTP,
and 15 U TdT (Gibco BRL) in 20 .mu.l volume. All 4 reaction
mixtures are incubated at 37.degree. C. for 70 min, terminated by
adding 1 .mu.l 200 mM EDTA, ethanol precipitated, dissolved, loaded
and separated on the alkaline (40 mM NaOH, 1 mM EDTA) % agarose
gel. After electrophoresis, gel is neutralized, electro-blotted
onto ZetaProbe membrane (BioRad; Hercules, Calif.), and analyzed
with a Molecular Dynamics (Sunnyvale, Calif.) 400A PhosphorImager
and ImageQuant software (Makarov et al., 1997) (FIG. 48).
[0945] TdT-tailed PENT products are detected as broadened DNA bands
with increased molecular weight relative to the controls. DNA
samples precipitated with tRNA show more prominent increase of the
molecular weight then DNA precipitated with glycogen, indicating
that glycogen inhibits TdT. In contrast, tRNA can be used to
increase precipitation efficiency without inhibiting TdT
activity.
Example 11
TdT-Mediated Synthesis and PCR.TM. Amplification of Model
PENTAmers
[0946] This example describes the preparation of model PENTAmers
and their amplification using PCR.TM..
[0947] First, six different DNA molecules are synthesized using
PENT primer (oligo 5603 I, Table 4) as a template and terminal
deoxynucleotidyl transferase homopolymeric tailing activity in the
presence of 3, 10 and 30 .mu.M dTTP, and 3, 10 and 30 .mu.M dGTP.
Second, 3'-ends of these tailed-DNA molecules are ligated to
down-stream adaptors B-3'(a) and B-3'(b) to form model PENTAmers.
Third, the model PENTAmers are diluted, amplified by PCR.TM. and
analyzed on agarose gel.
[0948] TdT tailing reactions (schematically shown in FIG. 49A): Six
10 .mu.l mixtures are prepared in six 0.5 ml tubes which contain
100 nM PENT primer (oligo 5603 I), 100 mM potassium cacodylate, pH
7.2, 2 mM CoCl.sub.2, 0.2 mM DTT, 7.5 U TdT (Gibco BRL) and 3, 10,
30 .mu.M dTTP in tailing reaction tubes 1, 2, 3, respectively, and
3, 10, 30 .mu.M dGTP in tailing reaction tubes 4, 5, 6,
respectively. Mixtures are incubated at 37.degree. C. for 30 min,
then heated at 70.degree. C. for 15 min.
[0949] Down-stream adaptor B-3' ligation reactions (schematically
shown in FIG. 49B): Eight mixtures are prepared in eight 0.5 ml
tubes which contain 66 mM Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 1 mM
DTT, 1 mM ATP, 0.5 U T4 DNA ligase (Boehringer Mannheim;
Indianapolis, Ind.). Ligation reaction tubes 1, 2, and 3 are
supplemented with 3 .mu.l of the TdT reaction products from tailing
reaction tubes 1, 2, 3, and 3 .mu.l 1 .mu.M adaptor B-3'(c).
Ligation reaction tubes 4, 5, and 6 are supplemented with 3 .mu.l
of the TdT reaction products from tailing reaction-tubes 4, 5, 6,
and 3 .mu.l 1 .mu.M down-stream adaptor B-3'(a). Ligation reaction
tubes 7 and 8 (controls) are supplemented with 300 fmol PENT primer
(oligo 5603 I without TdT tail) and 3 .mu.l down-stream adaptors
B-3'(c) and B-3'(a), respectively. All volumes are adjusted to 20
.mu.l with H.sub.2O. Ligation reactions in tubes 1, 2, 3, and 7 are
performed at room temperature for 1 h; ligation reactions in tubes
4, 5, 6, and 8 are performed at 37.degree. C. for 1 h. Reactions
are terminated by adding 0.5 .mu.l 500 mM EDTA and 280 gl H.sub.2O.
Aliquots of the samples are also diluted 10.times. and 100.times.
with TE and placed into separate sets of tubes.
[0950] PCR amplification (schematically shown in FIG. 49C): 25
mixtures are prepared in 25 thin-wall 0.5 ml PCR.TM. tubes which
contain 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl.sub.2, 100
.mu.M dNTP, 200 nM PENTAmer PCR.TM. primer 1 (oligo 5602 I), 200 nM
PENTAmer PCR.TM. primer 2 (oligo 5776 I), 2 ml Taq polymerase
(30-times diluted with 1.times. Taq buffer from stock at 60
U/.mu.l). Tubes 1-8 are supplemented with 1 .mu.l DNA from
non-diluted ligation reaction tubes 1-8. Tubes 9-16 are
supplemented with 1 .mu.l DNA from 10' diluted ligation reaction
tubes 1-8. Tubes 17-24 are supplemented with 1 .mu.l DNA from
100.times. diluted ligation reaction tubes 1-8. No DNA is added to
tube 25 (primer-dimer control). Volumes of all tubes are adjusted
to 50 .mu.l with H.sub.2O. 21 cycles of PCR.TM. amplification were
performed in a DNA Thermal Cycler 480 (Perkin-Elmer) using the
following PCR.TM. cycling conditions: 94.degree. C. for 30 sec,
58.degree. C. for 30 sec, 72.degree. C. for 30 sec. PCR.TM.
products are analyzed on 10% polyacrylamide/1.times. TBE gel (FIG.
50).
[0951] PCR.TM. amplified PENTAmers (created by tailing with poly T
and ligation of the adaptor) are detected as broadened DNA bands
with increased molecular weight relative to 48 b size of the
putative primer-dimer formed by PENTAmer primers 1 and 2
(oligonucleotides 5603 I and 5776 I). No amplification is detected
for control DNA samples C1 and C2 where TdT tailing reaction is
omitted (tubes 8 and 7, respectively, and for control C3 in the
absence of any DNA (primer-dimer control). TdT-mediated tailing
with dGTP results in a limited addition of only 15-20 guanine bases
while the reaction with dTTP produces more than 100 b homopolymeric
tails. Both nucleotides are efficiently incorporated by terminal
deoxynucleotidyl transferase at 3-10 .mu.M concentration.
Example 12
Synthesis and PCR.TM. Amplification of PENTAmers at the Ends of
Lambda DNA/Bam HI Restriction Fragments
[0952] This example describes the complete process of PENTAmer
synthesis and amplification. The process includes: a) upstream
nick-translation adaptor A ligation; b) adaptor A activation; c)
PENT reaction; d) internal TdT tailing of PENT products; e)
internal down-stream nick-attaching adaptor B-3' ligation; and f)
PENTAmer amplification.
[0953] Steps (a) and (b) are performed exactly as described in
Examples 3 and 5, respectively. Step (c) is performed as described
in Example 10.
[0954] Step (d): Four tailing mixtures are prepared in four 0.5 ml
tailing reaction tubes 1, 2, 3, 4 which contain 2 .mu.l PENT DNA
from tube 2 from Example 10, 100 mM potassium cacodylate, pH 7.2, 2
mM CoCl.sub.2, 0.2 mM DTT, 7.5 U TdT (Gibco BRL), 10 and 30 .mu.M
dTTP in tubes 1 and 2, respectively, and 10 and 30 .mu.M dGTP in
tubes 3 and 4, respectively. After incubation at 37.degree. C. for
30 min, the tailing reaction tubes are supplemented with 0.5 .mu.l
50 mM EDTA and heated at 70.degree. C. for 15 min.
[0955] Step (e): Four ligation mixtures are prepared in four 0.5 ml
ligation reaction tubes 1, 2, 3, and 4 which contain 66 mM
Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 1 mM DTT, 1 mM ATP, 0.5 U T4 DNA
ligase (Boehringer Mannheim; Indianapolis, Ind.), 3 .mu.l DNA from
tailing reaction tubes 1, 2, 3, 4, respectively. 3 .mu.l of 1 mM
adaptor B-3'(c) and H.sub.2O are added to ligation reaction tubes 1
and 2 to final volume 20 .mu.l and the mixtures are incubated at
20.degree. C. for 1 h, then at 37.degree. C. for 15 min. 3 .mu.l of
1 mM adaptor B-3'(c) and H.sub.2O are added to ligation reaction
tubes 3 and 4 to final volume 20 .mu.l and the mixtures are
incubated at 37.degree. C. for 1 h, then at 42.degree. C. for 15
min. Reactions are terminated by adding 2.5 .mu.l 50 mM EDTA and
heating at 70.degree. C. for 10 min and diluted 10 times with
H.sub.2O. The incubation temperatures were different for the two
PENTAmer adaptors due to their different melting temperatures on
the tailed PENT-products.
[0956] Step (f): Four mixtures are prepared in four thin-wall 0.5
ml PCR.TM. tubes which contain 1 .mu.l 10.times. diluted DNA from
ligation reaction tubes 1, 2, 3, and 4, 2.5 .mu.l 10.times.
Advantage cDNA PCRT Reaction Buffer (Clontech), 200 nM PENTAmer
PCRT primer 1 (oligo 5603 I), 200 nM PENTAmer PCRT primer 2 (oligo
5776 1), 200 nM dNTP and 0.5 .mu.l Advantage cDNA Polymerase Mix in
25 .mu.l volume. 31 cycles of PCR.TM. were performed in a DNA
Engine Thermal Cycler PTC-200 (MJ Research, Inc.) using the cycling
conditions: 10 sec at 94.degree. C., 15 sec at 58.degree. C., 1 min
at 68.degree. C. 5 .mu.l DNA from each PCR.TM. tube was mixed with
0.5 .mu.l 10.times. electrophoretic loading buffer (20% Ficoll 400,
0.1 M EDTA, pH 8.0, 1% SDS, 0.025 % Bromphenol Blue, 0.025% Xylene
Cyanol), loaded and analyzed on the 1% agarose gel (FIG. 51).
[0957] PCR.TM. amplified PENTAmers are detected as bands of about 1
kb. Examples 8-12 demonstrate methods by which reaction conditions
(e.g., nucleotide, enzyme, and salt concentrations, temperature,
and time) can be optimized to most efficiently create and amplify
PENTAmers.
Example 13
PENTAmer Synthesis does not Affect the Mobility of Double-Stranded
DNA Fragments
[0958] This example describes the electrophoretic analysis of
double-stranded lambda DNA/Bam HI restriction fragments at
different stages of PENTAmer synthesis: a) DNA after
primer-displacement activation as described in Example 3 (FIG. 52,
lane 1); b) DNA after PENT reaction as described in Example 10
(FIG. 52, lane 2); c) DNA after TdT-mediated internal tailing DNA
from (b) in the presence of 3 and 30 .mu.M dTTP (FIG. 52, lanes 3
and 4) and 3 and 30 .mu.M dGTP (FIG. 52, lanes 5 and 6); d) DNA
samples after ligation of down-stream nick-attaching adaptors
B-3'(c) (FIG. 52, lanes 7 and 8) and B-3'(a) pC I (FIG. 52, lanes 9
and 10). Samples are loaded and run on 0.6% SeaKem Gold
agarose/1.times. TAE gel, electroblotted onto ZetaProbe filter
(BioRad; Hercules, Calif.) and analyzed with a Molecular Dynamics
400A PhosphorImager and ImageQuant software (Makarov et al.,
1997).
[0959] Data presented on FIG. 52 show that enzymatic steps involved
in the process of PENTAmer synthesis such as PENT reaction (lane
2), TdT-mediated internal tailing (lanes 3-6), and internal
ligation of PENTAmer adaptors (lanes 7-10) do not affect the
mobility of three resolved bands generated by cleavage of lambda
DNA with Bam HI (lane 1). Bands of higher molecular weight are not
shown. This example demonstrates that the nascent PENTAmers can be
size-fractionated by electrophoresis, with mobilities very similar
to those of double-stranded DNA restriction fragments.
Example 14
Two-Dimensional Electrophoretic Analysis of Multiple PENT Products
Shows Similar Rate of Taq Polymerase-Mediated
Primer-Extension/Nick-Translation Reaction at Different Ends of
Lambda DNA/Bam HI Restriction Fragments
[0960] This example describes the results of a single PENT reaction
performed on a mixture of the 5 lambda DNA/Bam HI restriction
fragments. The PENT products were analyzed on a two-dimensional
neutral/alkaline gel electrophoretic system (Makarov et al.,
1997).
[0961] The PENT DNA sample is prepared as in Example 10 using
lambda DNA/Bam HI restriction fragments with ligated and activated
nick-translation adaptor A as described in the Example 5. First,
the sample is loaded and run on 0.6% SeaKem Gold/1.times. TAE gel
to separate restriction fragments of different size. Then the gel
is soaked twice in 40 mM NaOH, 1 mM EDTA solution and run under
alkaline conditions in the second direction which is orthogonal to
the first one. After electrophoresis, the gel is neutralized,
electro-blotted onto ZetaProbe membrane (BioRad; Hercules, Calif.)
and analyzed with a Molecular Dynamics (Sunnyvale, Calif.) 400A
PhosphorImager and ImageQuant software (Makarov et al., 1997) (FIG.
53).
[0962] This 2-D gel experiment shows that size distributions of
radioactively labeled PENT products synthesized at the ends the
lambda DNA/Bam HI restriction fragments are very similar and
suggests that the rate of PENT reaction is not sensitive to the DNA
base composition or size of the double stranded DNA template.
Example 15
Lambda DNA Methylation Protection/Recombination Nick-Translation
Adaptor RA-(L-cos)
[0963] This example describes a complete cleavage and a complete
resistance to Eco RI restriction endonuclease cleavage by the
nick-translation adaptor RA-(L-cos) (FIG. 40) and methylated lambda
DNA, respectively. Both reactions are important for linearization
of circular recombinant intermediates in the process of preparing
DNA for positional amplification (Example 21, step 7).
[0964] Methylation protection reaction: A mixture containing 1
.mu.g lambda DNA, 50 mM NaCl, 50 mM Tris-HCl, pH 8.0, 10 mM EDTA,
80 .mu.M S-adenosylmethionine and 10 U of Eco RI methylase (New
England BioLabs) in 20 .mu.l volume is incubated for 3 h at
37.degree. C., following by heat inactivation at 68.degree. C. for
20 min.
[0965] Eco RI cleavage: Tubes 1-4 contain 20 .mu.l of 50 mM
Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2, 1 mM DTE
(dithioerythrotol), 10 U Eco RI (Boehringer Mannheim). Tube 1 also
contains 2.5 pmol adaptor RA-(L-cos). Tube 2 also contains 2.5 pmol
adaptor RA-(L-cos) hybridized to an equimolar amount of the R-cos
oligonucleotide 56871. Tube 3 also contains 250 ng methylated
lambda DNA. Tube 4 also contains 250 ng lambda DNA. Tubes 1-4 are
incubated at 37.degree. C. for 3 h and the restriction digestions
terminated by addition of 2.5 .mu.l 10.times. electrophoretic DNA
loading buffer. Samples from tubes 1 and 2 as well as non-digested
adaptors are analyzed on 15% polyacrylamide/1.times. TBE gel. (FIG.
54, left panel). Samples from tubes 3 and 4 are analyzed on 0.8 %
agarose/1.times. TAE gel (FIG. 54, right panel).
[0966] The results presented on FIG. 54 show that lambda DNA can be
completely protected from Eco RI cleavage by Eco RI methylase
(right panel), and that the recombination nick-translation adaptor
RA-(L-cos) can be completely cleaved by Eco RI restriction
endonuclease whether it is hybridized or not with the R-cos
oligonucleotide 5687 I which has the same sequence as single
stranded 12 base L-cos end of lambda DNA (left panel).
Example 16
Efficiency of Ligation of the Recombination Nick-Translation
Adaptor RA-(L-cos) to Lambda DNA L-cos Site
[0967] This example describes the efficiency of a two-step ligation
process presented in detail in Example 21, step 2. To perform this,
lambda DNA with and without RA-(L-cos) adaptor are digested with
Bgl II restriction endonuclease, radioactively labeled, and
analyzed electrophoretically. Bgl II has a restriction site located
at 415 bp from the lambda L-cos end (adaptor site), so the ligation
of the 45 bp adaptor should result in a new band located at 460
bp.
[0968] Specifically, two tubes containing 50 mM Tris-HCl pH 7.9,
100 mM NaCl, 10 mM MgCl.sub.2, 1 mM DTT and 3 U Bgl II (New England
BioLabs), and either 1 .mu.l (100 ng) lambda DNA after ligation
(Example 21, step 2) (tube 1) or 100 ng non-ligated lambda DNA
(tube 2) are incubated at 37.degree. C. for 4 h. The reactions in
tubes 1 and 2 are terminated by adding 1 .mu.l 200 mM EDTA and both
DNA samples were ethanol precipitated and recovered. Tube 3
contains DNA marker (1 .mu.g 1 kb DNA ladder, Gibco BRL). The three
tubes are labeled with [.alpha.-.sup.32P]dATP by adding 50 mM
Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT, 50 .mu.g/ml BSA, 12.5
.mu.M dTTP, 12.5 .mu.M dCTP, 12.5 .mu.M dGTP, 40 nM
[.alpha.-.sup.32P] DATP and 5 U Klenow fragment (exo.sup.-)
(Ambion) and incubating in final 50 .mu.l volumes at 20.degree. C.
for 1 h. The DNA samples in the three tubes are precipitated and
washed with 70% ethanol, dried, and dissolved in 1.times.
electrophoretic DNA loading buffer. The DNA samples are separated
on 5% polyacrylamide/1.times. TBE gel, dried, and analyzed with a
Molecular Dynamics (Sunnyvale, Calif.) 400A PhosphorImager and
ImageQuant software (Makarov et al., 1997) (FIG. 55).
[0969] The data presented on FIG. 55 show that after ligation with
RA-(L-cos) adaptor the 415 bp band corresponding to the terminal
restriction fragment with L-cos end is shifted to the 460 bp
position as expected if the ligation efficiency is close to 100%.
No shift is observed for internal restriction fragments produced by
cleavage of lambda DNA with Bgl II
Example 17
Sau 3A I Partial Digestion of Lambda and Human DNA
[0970] This example describes a serial dilution method to
accurately and reproducibly control the partial digestion of
genomic DNA with a restriction enzyme.
[0971] Two mixtures containing 5.5 .mu.g lambda and human leukocyte
DNA, respectively, 33 mM Tris-Acetate, pH 7.9, 66 mM K Acetate, 10
mM Mg Acetate and 0.5 mM DTT in a total volume of 110 .mu.l are
prepared at 4.degree. C. and divided into two sets of 5.times.1.5
ml Eppendorf tubes such that tube 1 contains 30 .mu.l, tubes 2 to 4
contain 20 .mu.l, and tube 5 contains 10 .mu.l of the lambda or
human DNA mixture. Tubes are kept on ice. 2 .mu.l of 20 times
diluted Sau 3A I (Boehringer Mannheim; stock concentration
4U/.mu.l) are then added to tube 1 and mixed. 10 .mu.l from tube 1
is transferred into tube 2 and mixed. The serial dilution process
is continued by successively pipetting 10 .mu.l from tube 2 to 3, 3
to 4, and 4 to 5. When finished, all five tubes contain 20 .mu.l.
All five tubes are incubated for 15 min at 37.degree. C. and the
reactions are stopped by adding 1.1 .mu.l 200 mM EDTA followed by
thermal inactivation at 68.degree. C. for 20 min.
[0972] To end-label the restriction fragments produced by partial
digestion of lambda and human DNA with Sau 3A I, 5 .mu.l of each
restricted DNA sample is incubated in 10 .mu.l volume with 2.5 U of
Klenow (exo.sup.-) enzyme in the presence of 50 mM Tris-HCl, pH
7.5, 10 mM MgCl.sub.2, 1 mM DTT, 50 .mu.g/ml BSA, 25 .mu.M dTTP, 25
.mu.M dCTP, 25 .mu.M dGTP, and 80 nM [.alpha.-.sup.32P] dATP at
20.degree. C. for 1 h. Labeled DNA samples are precipitated with
ethanol, washed, dried, dissolved in 1.times. electrophoretic DNA
loading buffer, separated on 0.4% SeaKem Gold agarose gel (FMC
Bioproducts) together with an end-labeled I kb DNA ladder (see
Example 16) and analyzed with a Molecular Dynamics (Sunnyvale,
Calif.) 400A PhosphorImager and ImageQuant software (FIG. 56).
Because DNA molecules are end-labeled, the images on FIG. 56
represent molar size distributions of the restriction fragments
generated by partial digestion with Sau 3A I restriction
endonuclease.
[0973] Comparison of the molecular weight distributions of the
fragments after different extents of restriction digestion is
required to optimize the fragment lengths for short-range or
long-range positional amplification. By adjusting the extent of
digestion the molecular weight distribution of the fragments can be
controlled. Data presented on FIG. 56 shows that, once optimized
with lambda DNA, the serial dilution protocol can be efficiently
and reproducibly used to produce the desired extent of partial
restriction digestion of DNA from other species.
Example 18
Frequency of Sau 3A I Sites in the Human Genome
[0974] This example shows a molar size distribution of DNA
restriction fragments generated after complete digestion of human
leukocyte DNA with Sau 3A I restriction endonuclease. This test is
used to determine the probability of PENTAmer synthesis within a
region of DNA of a'specified length.
[0975] 1 .mu.g human leukocyte DNA is digested in 23 .mu.l volume
with 5 U Sau 3A I in the presence of 33 mM Tris-Acetate, pH 7.9, 66
mM K Acetate, 10 mM Mg Acetate and 0.5 mM DTT at 37.degree. C. for
5 h. The reaction is terminated by adding 1.5 .mu.l 200 mM EDTA and
heating at 68.degree. C. for 20 min. To end-label DNA restriction
fragments 5 .mu.l of Sau 3A I-digested DNA is incubated in 10 .mu.l
volume with 2.5 U of Klenow (exo.sup.-) enzyme in the presence of
50 mM Tris-HCl, pH 7.5, 10 mM MgCl.sub.2, 1 mM DTT, 50 .mu.g/ml
BSA, 25 .mu.M dTTP, 25 .mu.M dCTP, 25 .mu.M dGTP, and 80 nM
[.alpha.-.sup.32P] DATP at 20.degree. C. for 1 h. Labeled DNA is
precipitated with ethanol, washed, dried and dissolved in 1.times.
electrophoretic DNA loading buffer. End-labeled human DNA, digested
completely by Sau 3A I, and 1 kb DNA ladder are separated on 0.8%
SeaKem Gold agarose gel (FMC Bioproducts) and analyzed with a
Molecular Dynamics (Sunnyvale, Calif.) 400A PhosphorImager and
ImageQuant software (FIG. 57). Because DNA molecules are
end-labeled, the pattern on FIG. 57 represents molar size
distribution of the restriction fragments generated by complete
digestion with Sau 3A I restriction endonuclease.
[0976] Quantitation of the molecular weight distribution using
ImageQuant software reveals the probabilities of having no Sau 3A I
restriction site within 3 kb, 2 kb and 1 kb intervals as less than
1%, 3% and 18%, respectively. These probabilities are considerably
larger than predicted for random-sequence DNA, showing the
necessity to test each restriction enzyrne before using it to
prepare PENTAmers from a specific genome.
Example 19
Efficiency of Circularization Reaction with Recombination
Nick-Translation Adaptor RA-(L-cos)
[0977] This example describes the efficiency of ligation-mediated
circularization of lambda DNA molecules with recombination
nick-translation adaptor RA-(L-cos) at one end and a Bam HI
generated opposite end (Sau 3A I compatible end).
[0978] 3 .mu.l of lambda DNA ligated to the adaptor RA-(L-cos)
(after step 2.2, Example 21) is incubated with 5 U Bam HI in the
presence of 10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 5 mM MgCl.sub.2, 1
mM 2-mercaptoethanol in 20 .mu.l volume at 37.degree. C. for 1 h.
The reaction is terminated with 1 .mu.l 0.5 M EDTA. DNA is
extracted with phenol/chloroform, precipitated with ethanol,
washed, dried and dissolved in 30 .mu.l TE-0.1 to a concentration
of 10 ng/.mu.l. 50 ng of this Bam HI restricted DNA is incubated
with 10 U T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.)
in 200 .mu.l volume in the presence of 66 mM Tris-HCl, pH 7.5, 5 mM
MgCl.sub.2, 1 mM DTT and 1 mM ATP at 15.degree. C. for 18 h. In a
control experiment, 50 ng Bam HI restricted DNA is incubated at the
same conditions (buffer, temperature, time) without ligase. After
incubation both samples are precipitated with ethanol, washed with
70% ethanol, dissolved in 1.times. electrophoretic DNA loading
buffer and separated on 1% agarose/0.5 TBE gel at a high voltage (7
V/cm). After electrophoresis, the gel is electroblotted onto a
ZetaProbe membrane (BioRad; Hercules, Calif.) and hybridized
overnight with .sup.32P-labeled PENT-primer (prepared as described
in Example 5). The washed and dried membrane is analyzed with a
Molecular Dynamics (Sunnyvale, Calif.) 400A PhosphorImager and
ImageQuant software (FIG. 58).
[0979] Quantitation of intensities of circular (IC) and linear (IL)
DNA forms using ImageQuant software allows estimation of the
efficiency of the circularization reaction E=IC/(IC+IL)=77%. This
type of test is preferred to determine the success of the
circularization reaction.
Example 20
Rate of PENT Reaction is Independent of the DNA Sequence and the
Number of Different DNA Molecules Participating in the Reaction: 2D
Electrophoretic Approach
[0980] This example determines the size distribution of PENT
reaction products from a complex mixture of nested lambda DNA
fragments created by partial digestion with Sau 3A I.
[0981] Methylated lambda DNA is ligated to adaptor RA-(L-cos),
partially digested with Sau 3A I, incubated with Taq DNA
polymerase, TdT (in the presence of 10 .mu.M dGTP) and Eco RI as
described in detail (Example 21, steps 1-7) and analyzed on the
two-dimensional neutralalkaline gel electrophoretic system (Makarov
et al., 1997). Specifically, 100 ng of the processed lambda DNA is
separated on 0.4% SeaKer Gold/1.times. TAE agarose gel (FMC
Bioproducts) at 0.4 V/cm for 30 h. The gel lane with separated DNA
molecules is excised and embedded in a 1% agarose gel. After
soaking twice in 40 mM NaOH, 1 mM EDTA, the DNA samples are
separated in the orthogonal direction in the same alkaline buffer
at 1.5 V/cm for 15 h. The gel is neutralized with 1.times. TBE and
electroblotted onto ZetaProbe membrane (BioRad; Hercules, Calif.).
The membrane is hybridized overnight with .sup.32P-labeled
oligonucleotide 5608 I, complementary to the PENT-primer. Washed
and dried membranes are analyzed with a Molecular Dynamics
(Sunnyvale, Calif.) 400A PhosphorImager and ImageQuant software
(FIG. 59).
[0982] As can be seen from FIG. 59, PENT products (vertical spots,
shown by arrow) originating from different internal lambda DNA
sites produced by partial digestion with Sau 3A I endonuclease
(diagonal spots) have similar mobility on the NaOH agarose gel
(second direction). As in Example 14, it is concluded that the rate
of PENT reaction does not depend on the DNA sequence.
Example 21
Detailed Protocol for the PENTAmer-Mediated Positional
Amplification of Lambda DNA
[0983] FIG. 60 shows all steps involved in the preparation,
amplification and analysis of the lambda recombinant PENTAmer
library.
Step 1--Lambda DNA Protection by Methylation with Eco
RI--Methylase
[0984] The mixture containing 12 .mu.g lambda DNA, 50 mM NaCl, 50
mM Tris-HCl, pH 8.0, 10 mM EDTA, 80 .mu.M S-adenosylmethionine and
120 U of Eco RI methylase (New England BioLabs) in 150 .mu.l volume
is incubated for 6.5 h at 37.degree. C., following by heat
inactivation at 68.degree. C. for 20 min. The methylated DNA is
concentrated and then washed 3.times. with 0.5 ml TE-0.1 in a
Microcon 100 centrifugal filter device (Amicon) by spinning at 300
g for 20 min at room temperature and recovered in 47 .mu.l
volume.
Step 2--Ligation of the Recombination Nick-Translation Adaptor
RA-(L-cos) to the Lambda DNA L-cos Site
[0985] The adaptor ligation is achieved in two consecutive sub
steps.
2.1 Blocking Lambda DNA at the R-cos Site by Ligation of the
12-Base Blocking Oligonucleotide Complementary to the R-cos
Site.
[0986] The mixture containing 23.5 .mu.l of the washed, methylated
DNA from Step 1, 20 pmol of the phosphorylated oligo 5687 I (Table
4), 20 mM Tris-HCl, pH 8.3, 25 mM KCl, 10 mM MgCl.sub.2, 0.5 mM
NAD, 0.1% Triton X-100 and 10 U of thermostable DNA ligase
Ampligase (Epicentre Technologies) in 50 .mu.l volume is incubated
at 45.degree. C. for 100 min after preheating at 65.degree. C. for
5 min in the absence of Ampligase, followed by reducing temperature
to 45.degree. C. and adding ligase and inactivating by adding 2
.mu.l 0.5 M EDTA. The ligation reaction is followed by washing the
DNA 4.times. with 0.4 ml TE-0.1 in a Microcon 100 centrifugal
filter device as described in Step 1. The DNA is recovered in 46
.mu.l volume.
2.2 Ligation of the Recombination Nick-Translation Adaptor
RA-(L-cos) to the 12-Base 5'-Overhang at the Lambda DNA L-cos Site
(FIG. 61A).
[0987] The mixture containing 46 .mu.l (200. fmol) of lambda DNA
from the Step 2.1, 400 fmol of the adaptor RA-(L-cos) (FIG. 40), 20
mM Tris-HCl, pH 8.3, 25 mM KCl, 10 mM MgCl.sub.2, 0.5 mM NAD, 0.1%
Triton X-100 and 11 U of thermostable DNA ligase Ampligase
(Epicentre Technologies) in 58 .mu.l volume is incubated at
50.degree. C. for 20 min, followed by incubation at 45.degree. C.
for 40 min and inactivation by adding 2 .mu.l 0.5 M EDTA. The
ligated DNA is washed twice in a Microcon 100, as described above,
and recovered in a 64 .mu.l volume.
[0988] Such ligation results in the formation of a) a covalent bond
between the recessed non-protected 3'-OH group of the adaptor
RA-(L-cos) and 5'-phosphate group of the L-cos 5'-overhang of
lambda DNA; and b) a nick in the opposite strand (FIG. 61A).
Step 3--Partial Digestion of Lambda DNA with Sau 3A I Restriction
Enzyme.
[0989] Partial digestion is performed by serial dilution method as
described in Example 17. Specifically, the mixture containing 55
.mu.l DNA from the previous step, 33 mM Tris-Acetate, pH 7.9, 66 mM
K Acetate, 10 mM Mg Acetate, and 0.5 mM DTT in a total volume of
110 .mu.l is prepared at 4.degree. C. and divided into 5.times.1.5
ml Eppendorf tubes such that tube 1 contains 30 .mu.l, tubes 2 to 4
contain 20 .mu.l, and tube 5 contains 10 .mu.l. Tubes are kept on
ice. 2 .mu.l of 20 times diluted Sau 3A I (Boehringer Mannheim
(Indianapolis, Ind.); stock concentration 4 U/.mu.l) are then added
to tube 1 and mixed. 10 .mu.l from tube 1 is transferred into tube
2 and mixed. The serial dilution process is continued by
successively pipetting 10 .mu.l from tube 2 to 3, 3 to 4, and 4 to
5. When finished, all five tubes contain 20 .mu.l. All five tubes
are incubated for 15 min at 37.degree. C., and the reactions are
stopped by adding 1.1 .mu.l 200 mM EDTA followed by thermal
inactivation at 68.degree. C. for 20 min.
[0990] 1 .mu.l DNA from each tube are analyzed on 0.8% SeaKem
Gold/1.times. TAE agarose gel (FMC BioProducts) to determine which
sample has been optimally digested and will be used for further
processing. On the basis of this electrophoretic analysis, tubes 4
and 5 with average size about 20 kb are chosen for processing in
the next step.
Step 4--DNA Circularization by Ligation at Low Molar Concentration
(FIG. 61B).
[0991] DNA circularization is performed at low concentration to
favor intramolecular circularization and reduce undesirable
intermolecular ligation.
[0992] The mixture containing 6 .mu.l DNA from tube 4 and 6 .mu.l
DNA from tube 5 (above), 66 mM Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 1
mM DTT, 1 mM ATP and 50 U T4 DNA ligase (Boehringer Mannheim) in
the volume 1 ml is incubated at 15.degree. C. for 18 h, followed by
phenol/chloroform extraction and ethanol precipitation. Recovered
DNA is washed with 70% ethanol and dissolved in 20 .mu.l
TE-0.1.
[0993] Step 4 results in a formation of junctions between the
termini of the recombination nick-translation adaptors RA-(L-cos)
and the internal Sau 3A I restriction sites (FIG. 61B). As a
result, a nick at the adaptor/L-cos end junction (Step 2.2) becomes
located near the restriction sites (nick jumping) and can be used
to initiate PENTAmer synthesis along the lambda sequences adjacent
Sau 3A I restriction sites. During this process, the blocked nick
at the 3'-end of the adaptor RA-(L-cos) is removed as the PENTAmer
is synthesized (FIG. 61C).
Step 5--Time-Controlled PENT Reaction Initiated at the Internal Sau
3A I Sites.
[0994] The mixture containing 20 .mu.l of circularized DNA from
Step 4, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl.sub.2 and 2
.mu.l Taq DNA polymerase (30 times diluted with 1.times. Taq buffer
from stock at 60 U/.mu.l) in 49 .mu.l volume is preheated at
50.degree. C., for 5 min and then supplemented with 1 .mu.l 2.5 mM
dNTP to initiate the PENT reaction. After 5 min of incubation at
50.degree. C. the reaction is terminated by adding 1 .mu.l 0.5 M
EDTA followed by phenouchloroform extraction, ethanol precipitation
in the presence of 20 .mu.g of carrier yeast tRNA, washing with 70%
ethanol and resuspension in TE-0.1. Additional 3 washes in Microcon
100 filter device are performed (as described in Step 1, except
that the last wash was with H.sub.2O) to completely eliminate the
traces of nucleotides that might interfere with the next reaction.
The DNA is recovered in 36 .mu.l of H.sub.2O.
Step 6--Terminal Deoxynucleotidyl Transferase (TdT)-Mediated polyG
Tailing at the Internal 3'-Ends (Nicks) of the PENT Products.
[0995] The mixture containing 36 .mu.l of DNA from Step 5, 100 mM
potassium cacodylate, pH 7.2, 2 mM CoCl.sub.2, 0.2 mM DTT, 20 .mu.M
dGTP and 30 U TdT (Gibco BRL) in 50 .mu.l volume is incubated at
37.degree. C. for 50 min and terminated by adding 1.5 .mu.l of 200
mM EDTA and subsequent heating at 65.degree. C. for 20 min. After
two washes in Microcon 100 filter device with TE-0.1, the DNA is
recovered in 39 .mu.l volume.
Step 7--Linearization of the Circular Recombinant DNA Molecules by
Cleavage of the Recombination Nick-Translation Adaptor RA-(L-cos)
Using Eco RI Restriction Endonuclease.
[0996] The mixture containing 39 .mu.l DNA from Step 6, 50 mM
Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2, 1 mM DTE and 15 U
Eco RI (Boehringer Mannheim; Indianapolis, Ind.) in 45 .mu.l volume
is incubated at 37.degree. C. for 12 h, terminated with 1 .mu.l 0.5
M EDTA and heated at 68.degree. C. for 15 min. After 2 washes in
Microcon 100 filter device with TE-0.1, the DNA is recovered in a
30 .mu.l volume.
Step 8--Completion of Synthesis of the Recombinant PENTAmers by
Ligation-Mediated Tagging at the polyG Tails of the TdT-Treated
PENT Products.
[0997] 10 .mu.l DNA from Step 7, 66 mM Tris-HCl, pH 7.5, 5 mM
MgCl.sub.2, 1 mM DTT, 1 mM ATP, 1 U T4 DNA ligase (Boehringer
Mannheim) and nick-attaching adaptor B-3'(a) (FIG. 40) in 20 .mu.l
volume is incubated at 37.degree. C. for 55 min, then at 40.degree.
C. for 10 min and finally at 44.degree. C. for 15 min to assure an
efficient hybridization and ligation of the adaptor to the
single-stranded polyG tails. The ligation is terminated by adding
2.2 .mu.l of 10.times. loading electrophoretic buffer (20% Ficoll
400, 0.1 M EDTA, pH 8.0, 1% SDS, 0.025% Bromphenol Blue, 0.025%
Xylene Cyanol).
[0998] The procedure (above) was repeated using nick-attaching
adaptor B-3'(b).
Step 8'--Synthesis of the Recombinant PENTAmers by Primer
Extension-Mediated Tagging at the polyG Tails of the TdT-Treated
PENT Products.
[0999] Poly G tails at the ends of PENT products can be also
extended with DNA polymerase when hybridized to single stranded
oligo template with poly C terminated 3' ends.
[1000] A mixture containing 10 .mu.l DNA from Step 7, 10 mM
Tris-HCl, pH 8.3, 50 mM KCl, 83 .mu.M dNTP, 170 nM of primer
oligonucleotide 5604 I, 1 .mu.l Taq DNA polymerase (30 times
diluted with 1.times. Taq buffer from stock at 60 U/.mu.l) in 30
.mu.l volume is incubated at 50.degree. C. for 3 min, then at
45.degree. C. for 3 min, and finally at 40.degree. C. for 3 min.
The ligation is terminated by adding 3.3 .mu.l of the 10.times.
loading electrophoretic buffer (20% Ficoll 400, 0.1 M EDTA, pH 8.0,
1% SDS, 0.025% Bromphenol Blue, 0.025% Xylene Cyanol).
[1001] Step 8 (8') results in a formation of PENTAmer (FIG.
61C).
Step 9--Electrophoretic DNA Size Fractionation
[1002] Nascent PENTAmers prepared at Steps 8 and 8' as well as DNA
size markers are loaded on separate wells of a preparative 0.3%
SeaKem Gold/1.times. TAE gel formed within a 1% supporting agarose
frame and separated by electrophoresis at 0.6 V/cm for 30 h. Lanes
with processed lambda DNA samples are excised from the gel and cut
into narrow gel slices by a razor blade (FIG. 62). To establish the
correlation between a fraction position on the gel and the
molecular weight of DNA agarose lanes with DNA size markers (1 kb
ladder, Gibco BRL and marker XV, Boehringer Mannheim; Indianapolis,
Ind.) are excised from the gel, stained with EtBr and analyzed.
Example 22
PCR.TM. Amplification of the PENTAmers
[1003] Forty seven agarose slices of fractionated lambda DNA
preparation after ligation of down-stream nick-attaching adaptor
B-3'(b) (Step 8) are subjected to further analysis. Agarose slices
are washed with TE-0.1 for 16 h, melted at 95.degree. C., and 5
.mu.l from each fraction is mixed with 45 .mu.l TE-0.1 in a
separate tube ( 1/10 dilution). 48 PCR.TM. reactions are assembled
in 0.5 ml thin wall PCRT tubes (MJ Research). 47 mixtures contain 6
.mu.l 1/10 diluted DNA from fractions 1-47, 3 .mu.l 10.times.
Advantage cDNA PCR.TM. Reaction Buffer (Clontech), 400 nM PCR.TM.
primer (oligo 5603 I), 200 nM dNTP and 0.6 .mu.l Advantage cDNA
Polymerase Mix in 30 .mu.l volume. The 48th mixture contains 6
.mu.l non-processed lambda DNA (0.6 .mu.g), 3 .mu.l 10.times.
Advantage cDNA PCR.TM. Reaction Buffer (Clontech), 400 nM PCR.TM.
primer (oligo 5603 I), 200 nM dNTP and 0.6 .mu.l Advantage cDNA
Polymerase Mix in 30 .mu.l volume (control). Cycling conditions in
a DNA Engine Thermal Cycler PTC-200 (MJ Research): 10 sec at
94.degree. C., 15 sec at 58.degree. C., 1 min at 68.degree. C., 34
cycles.
[1004] After PCR.TM., 5 .mu.l DNA from each PCR.TM. tube is mixed
with 0.5 .mu.l 10.times. electrophoretic loading buffer (20% Ficoll
400, 0.1 M EDTA, pH 8.0, 1% SDS, 0.025% Bromphenol Blue, 0.025%
Xylene Cyanol), loaded and analyzed on the 1% agarose gel (FIG.
63).
[1005] The amplified Lambda DNA PENTAmers are detected as 1 kb
bands for most of the analyzed DNA fractions. The narrow size
distribution shows that the PENTAmers had approximately the same
lengths. Some lanes contain little amplified material, due to lack
of a Sau 3A I site in certain regions of lambda DNA. Other lanes
had strong signals due to the presence of several restriction sites
in certain regions of lambda.
Example 23
Restriction Fingerprint Analysis of the Positionally Amplified
Lambda DNA PENTAmers
[1006] To show that 1 kb PCR products detected for most of the
agarose DNA fractions represent positionally amplified PENTAmers
within lambda DNA, the PCR.TM. products are subjected to
restriction fingerprint analysis.
[1007] One set of 47 mixtures contains 12.5 .mu.l PCR.TM. amplified
DNA from Example 23, 50 mM Tris-HCl, pH 8.0, 10 mM MgCl.sub.2, 50
mM NaCl and 3 U Mbo I (Gibco BRL) in 15 .mu.l volume. A second set
of 47 mixtures contains 12.5 .mu.l PCR.TM. amplified DNA from
Example 23, 50 mM Tris-HCl, pH 8.0, 10 mM MgCl.sub.2, and 5 U Msp I
(Gibco BRL) in 15 .mu.l volume. Digestions are performed at
37.degree. C. for 14 h and the tubes are mixed with 1.8 .mu.l
10.times. electrophoretic loading buffer (20% Ficoll 400, 0.1 M
EDTA, pH 8.0, 1% SDS, 0.025% Bromphenol Blue, 0.025% Xylene
Cyanol), loaded and analyzed on a 2% NuSieve agarose gel (FMC).
[1008] FIG. 64 and FIG. 65 show the results of the fingerprint
analysis. Taking into account the total number of different
restriction fragments produced by Mbo I and Msp I digestion of
lambda DNA (117 and 329, respectively), one can expect that most
fractions should have unique restriction patterns characterized in
average by 2.5 and 7 bands for Mbo I and Msp I, respectively, which
is in a good agreement with the experimental data.
[1009] FIG. 66 and FIG. 67 show more detailed analysis of the Mbo I
fingerprints of PCR.TM. products generated from fractions 25-32 and
33-40, respectively. Using known positions of DNA marker bands (100
bp ladder, Gibco BRL) an empirical relationship is determined
between log.sub.10 (DNA molecular weight). The migration distances
of the restriction fragments in each lane were measured, and the
molecular weights of all restriction fragments determined, using
the empirical relationship between migration and molecular weight.
The empirical molecular weights of the fragments were compared with
the expected molecular weight of restriction fragments at different
positions along the lambda genome. This analysis demonstrates very
good correlation between the theoretically predicted and
experimentally determined molecular weights within each fraction
analyzed.
Example 24
Generation of Secondary PENTAmers
[1010] Secondary PENTAmers are formed by nick-translation initiated
from a DNA oligomer placed at the 3' terminus of a primary
PENTamer. The secondary PENTAmer permits controlled synthesis of a
DNA strand complementary to the primary PENTAmer. This example uses
terminal transferase to synthesize a homopolymeric stretch of
guanosines at the 3' terminus of a primary PENTAmer. The guanosine
homopolymer sequence then serves as an annealing site for the B1
adaptor containing a homopolymeric cytosine sequence (Table 5).
Ligation of the adaptor is followed by primer extension of a DNA
oligomer annealed to the Bt adaptor sequence, thereby generating a
double-stranded DNA molecule the full length of the primary
PENTAmer. At this point, the primary PENTAmer is competent for
nick-translation in the reverse direction (i.e., from the 3'
terminus to the 5' terminus of the primary PENTAmer). FIG. 3B
outlines this process. TABLE-US-00005 TABLE 5 Adaptor Structures
Adaptor A1 (Bam H I, Sau 3AI) (5')
P-gatctgaggttgtagaagactcggacgatacacatgcaccgtcggtgcagtcgtaatccagtcccga-
tctN-C7 (3' (3') N-C7actccaacatcttc tgagcctgctatgtgtacgtggc-Biotin
(5') Adaptor A2 (Not I) (5')
P-ggcctgaggttgtagaagactcggacgatacacatgcaccg-N-C7 (3') (3')
N-C7actccaacatcttc tgagcctgctatgtgtacgtggc-Biotin (5') Adaptor A3
(Bam HI, Sau 3AI) (5')
P-gatctgaggttgttgaagcgttuacccaautcgatuaggcaa-N-C7 (3') (3')
N-C7actccaacaacttc gcaaaugggtuaagcuaatccgtt-Biotin (5') Adaptor B1
(Poly N universal) (5')
P-aagtctgcaagatcatcgcggaaggtgacaaagactcgtatcgtaaNNNNc-N-C7 (3')
(3') N-C7 ttcagacgttctagtagcgccttccactgtttctgagcatagcatt-P (5')
Adaptor B2 (Poly N universal) (5')
P-aaatcaccataccaactcgcgtcctcctgtgcatgtcgatacgtaaNNNNc-N-C7 (3')
(3') N-C7 tttagtggtgtggttgagcgcaggaggacacgtacagctatgcatt-P (5')
Adaptor B1 (Poly C universal) (5')
P-aagtctgcaagatcatcgcggaaggtgacaaagactcgtatcgtaaccccccccccc-N-C7
(3') (3') N-C7 ttcagacgttctagtagcgccttccactgtttctgagcatagcatt-P
(5')
where [1011] N-C7=Amino C7 Blocking group [1012] P=5' phosphate
[1013] Adaptor 1 (BamH I, Sau3A I) in a specific embodiment is
comprised of the following oligonucleotides:
[1014] (5 ')P-gatctgaggttgtagaagactcggacgatacacatgcaccgtc
ggtgcagtcgtaatccagtcccgatct-N--C7 (3') (SEQ ID NO:33);
(3')N--C7-actccaacatcttc-(5') (SEQ ID NO:34); and
(3')-tgagcctgctatgtgtacgtggc-Biotin (5') (SEQ ID NO:35). Adaptor 2
(NotI) in a specific embodiment is comprised of the following
oligonucleotides:
(5')P-ggcctgaggttgtagaagactcggacgatacacatgcaccg-N-C7 (3') (SEQ ID
NO:36); (3')N--C7-actccaacatcttc-(5') (SEQ ID NO:37); and
(3')-tgagcctgctatgtgtacgtggc-Biotin (5') (SEQ ID NO:38). Adaptor 3
(BamH I, Sau3A I) in a specific embodiment is comprised of the
following oligonucleotides: (5')P-
gatctgaggttgttgaagcgttuacccaautcgatuaggcaa --N--C7 (3') (SEQ ID
NO:39); (3') N--C7-actccaacaacttc-(5') (SEQ ID NO:40); and
(3')-gcaaaugggtuaagcuaatccgtt-Biotin (5') (SEQ ID NO:41). Adaptor
B1 (Poly N universal) in a specific embodiment is comprised of the
following oligonucleotides:
(5')P-AAGTCTGCAAGATCATCGCGGAAGGTGACAAAGACTCGTATCGTAANNNNc-N--C7
(3') (SEQ ID NO:42); and
(3')N--C7-ttcagacgttctagtagcgccttccactgtttctgagcatagcatt-P(5') (SEQ
ID NO:43). Adaptor B.sub.2 (Poly-N universal) in a specific
embodiment is comprised of the following oligonucleotides:
(5')P-AAATCACCATACCAACTCGCGTCCTCCTGTGCATGTCGATACGTAANNNNC--N--C7
(3') (SEQ ID NO:44); and
(3')N--C7-TTTAGTGGTGTGGTTGAGCGCAGGAGGACACGTACAGCTATGCATT-P(5') (SEQ
ID NO:45). Adaptor B1 (Poly C universal) in a specific embodiment
is comprised of the following oligonucleotides:
(5')P-AAGTCTGCAAGATCATCGCGGAAGGTGACAAAGACTCGTATCGTAACCCCCCCCCCC--N--C7
(3') (SEQ ID NO:46); and (3')N--C7
TTCAGACGTTCTAGTAGCGCCTTCCACTGTTTCTGAGCATAGCATT-P(5') (SEQ ID
NO:47).
[1015] For this example, the plasmid pUC19 was cut to completion
with BamHI and EcoRI. The A.sub.3 adaptor (Table 5) was ligated to
the BamHI site at a 2:1 ratio using T4 DNA ligase. Excess A.sub.3
adaptor was removed by washing on a microcon YM-100 (see Example
29). A primary PENTamer was generated by nick-translation from the
A.sub.3 adaptor using a biotinylated DNA oligomer. The
nick-translation reaction was performed for 10 minutes, resulting
in approximately a 2000 nucleotide product as indicated by gel
electrophoresis on a denaturing acrylamide gel. A microcon YM-100
was used to remove dNTPs and concentrate the primary PENTAmer
products. Poly-guanosine was synthesized from the 3' terminus of
the primary PENTAmers using terminal transferase (NEB) and 1 .mu.M
dGTP. The reaction was allowed to proceed for 15 minutes at
37.degree. C. Products were washed using a microcon YM-100 to
remove dGTP and buffer salts. The poly C universal B1 adaptor was
then ligated to the guanosine homopolymer at a 5:1 ratio using Tsc
DNA ligase (Roche). Ligation was performed for 2 hours at
45.degree. C. The reaction was extracted with
phenol:chloroform:isoamyl alcohol (25:24:1), and excess adaptor was
removed using a microcon YM-100. The primary PENTamer products were
then captured on Dynal streptavidin-conjugated magnetic beads (see
bead immobilization described in Example 31). Beads were washed
with 100 mM NaOH to denature double-stranded DNA and remove the
complementary strand of the bead-bound primary PENTAmer. The primer
extension DNA oligomer (oligomer 19, Table 6) was annealed to B1
adaptor, located at the 3' terminus of the primary PENTAmer, and
extended using Taq DNA polymerase and standard PCR reaction buffer
conditions for 15 minutes. Beads were washed, and the second DNA
oligomer (oligomer 16, Table 6) was annealed and nick translated
for 2.5, 5, and 7.5 minutes to generate secondary PENTAmers.
TABLE-US-00006 TABLE 6 Oligonucleotides Length (bases) and Number
Sequence (5'-3') Modifications Application 1. cgg tgc atg tgt atc
gtc cga gt 23 a Adaptors A1, A2 (SEQ ID NO:48) Sequencing,
end-labeling 2. ctc ctg tgc atg tcg ata cgt aac 33 Amplification of
poly ccc ccc ccc G-tailed sequences (SEQ ID NO:49) 3. cgg tgc atg
tgt atc gtc cga gt 23 Adaptors A1, A2 PCR (SEQ ID NO:50) primer 4.
gat ctg agg ttg tag aag act cgg 71 b, c Adaptor A1 (BamH I) acg ata
cac atg cac cgt cgg tgc backbone agt cgt aat cca gtc ccg atc tc
(SEQ ID NO:51) 5. ctt cta caa cct ca 14 c Adaptors A1, A2 (SEQ ID
NO:52) blocking primer 6. cgg tgc atg tgt atc gtc cga gt 23 d
Adaptors A1, A2 (SEQ ID NO:53) nick-translation primer 7. ggc ctg
agg ttg tag aag act cgg 41 b, c Adaptor A2 (Not I) acg ata cac atg
cac cg backbone (SEQ ID NO:54) 8. cgg tgc atg tgt atc gtc cga gt 23
e Adaptors A1, A2 (SEQ ID NO:55) end-labeling 9. gat ctg agg ttg
ttg aag cgt 42 b, c Adaptor A3 (BamH I) tua ccc aau tcg atu agg caa
backbone (SEQ ID NO:56) 10. ttg cct aau cga aut ggg uaa acg 24 d
Adaptors A3 nick- (SEQ ID NO:57) translation primer 11. ctt caa caa
cct ca 14 c Adaptor A3 blocking (SEQ ID NO:58) primer 12. ttg cct
aat cga att ggg taa acg 24 Adaptors A3 PCR (SEQ ID NO:59) primer
13. ttc cct aat cga att ggg taa acg 42 c Adaptor A3 backbone ctt
caa caa cct cag atc complement block (SEQ ID NO:60) 14. tta cga tac
gag tct ttg tca cct tcc 46 b, c Adaptor B1 phospho- gcg atg atc ttg
cag act t rylated strand (SEQ ID NO:61) 15. aag tct gca aga tca tcg
cgg aag 51 c Adaptor B1 poly N gtg aca aag act cgt atc gta aNNNNc
strand (SEQ ID NO:62) 16. aag tct gca aga tca tcg cgg aa 23 Adaptor
B1 PCR (SEQ ID NO:63) primer, also used for nick-translation 17.
acg ggc tag caa aat agc gct gtc 46 c blocking primer to c(N)g atc
tga ggt tgt tga agc g prevent adaptor A3- (SEQ ID NO:64) B1 dimers
formation 18. gga cag cgc tat ttt gct agc ccg t 25 c blocking
primer to (SEQ ID NO:65) prevent adaptor A3- B1 dimers formation
19. ggt gac aaa gac tcg tat cgt aa 23 primer extension from (SEQ ID
NO:66) B1 (poly C) 20. ctc ctg tgc atg tcg ata cgt aa 23 B2
proximal primer (SEQ ID NO:67) 21. aaa tca cca tac caa ctc gcg tc
23 B2 distal primer (SEQ ID NO:68) a 5' Cy 5.0 labeled b 5'
phosphorylated c 3' C7 amino blocked d 5' biotinylated e 5'
fluorescein labeled N random base
[1016] The secondary PENTAmer products were liberated from their
complementary bead-bound primary PENTAmers by washing with 100 mM
NaOH. The beads were immobilized using a magnet and the solution
was transferred to a fresh tube. An equal volume of 3M NaOAc, pH
5.2 was added to neutralize the base and bring the pH to
approximately 5.2. Eight volumes of water and 25 volumes of ethanol
were added to precipitate the secondary PENTAmers. The
single-stranded DNA was pelleted at 16,000.times.g for 30 minutes,
washed with 80% ethanol, dried, and then resuspended in water. The
B.sub.2 (poly N universal) adaptor (Table 5) was ligated to the 3'
end of the secondary PENTAmers at >10:1 ratio.
[1017] Secondary PENTAmer products were detected by using PCR with
DNA oligomers complementary to the B1 (5' terminus) and B.sub.2 (3'
terminus) adaptors. FIG. 68 shows agarose gel electrophoresis of
two independent sets of PCR products from the 2.5, 5, and
7.5-minute nick translation reactions used in generation of the
secondary PENTAmers. Lanes A and B contain DNA molecular weight
markers. Lanes C, D, and E contain PCR products of secondary
PENTAmers generated from 2.5, 5, and 7.5-minute nick-translation
reactions, respectively. Lanes F, G, and H contain another set of
2.5, 5, and 7.5-minute products. The 2.5-minute nick translation
reaction resulted in a product of approximately 400 bp. The
5-minute reaction product was slightly larger than 800 bp. The
.sup.7..sup.5-minute reaction did not produce discrete products in
either sample set.
Example 25
Activation of Recombinant Adaptors by Methylation-Sensitive
Endonucleases
[1018] Specific methylation within recombinant adapters can serve
as a mechanism for activation of ends for recombination.
Recombination adapters RA.sub.1 and RA.sub.2 (FIG. 69) were
assembled and methylated using dam methylase. Selective digestion
of the A-methylation site within the engineered GATC recognition
site for endonucleases Dpn-I (cleaves methylated sites) and Mbo I
(cleaves non-methylated sites) shows efficient methylation of
adapters.
[1019] Lambda DNA grown under dam.sup.- conditions (NEB) was
digested to completion with BamHI, dephosphorylated by shrimp
alkaline phosphatase (SAP), and adapters ligated (T4 DNA ligase,
15.degree. C. 16 hrs) with a four-fold molar excess of a 1:1
mixture of RA.sub.1/RA.sub.2. Ligation reactions were heat
inactivated (65.degree. C. for 20 min.), and unligated adapters
were removed by microcon filtration (Example 29). Purified Lambda
fragments with adapters were either a) nick translated and
subsequently Dpn-I activated for ligation-mediated recombination;
or b) activated for recombination by Dpn-I digestion for
recombination primed nick translation.
[1020] Adapter modified lambda fragments were nick translated (50
ng/.mu.L DNA, 1.times. Perkin Elmer Taq buffer, 2 mM MgCl.sub.2,
200 .mu.M dNTPs, and 0.2 U/.mu.L wt Taq DNA polymerase) for 4
minutes, initiating the reaction by the addition of dNTPs and
stopping the reaction by addition of EDTA to 10 mM. Reactions were
purified by phenol extraction and ethanol precipitation. Nick
translated DNA was resuspended, and dispersed to low concentrations
(1 ng/.mu.L or 0.1 ng/.mu.L) to maximize intramolecular
recombination events in 1.times. thermostable ligase buffer
(Roche). It was then heated to 75.degree. C. to dissociate the
protecting oligos (FIG. 70) from activated ends, exposing the
complementary sequence for recombination. Thermostable ligase (Tsc
ligase, Roche) was added and reactions run for 10 cycles
(94.degree. C. 1 min, 45.degree. C. 30 min). Products were
recovered by phenol extraction and ethanol precipitation for
analysis of recombination.
[1021] Recombination was assessed by junction fragment analysis of
predicted lambda fragments. Oligonucleotide primers facing the
BamHI fragment junctions were used to evaluate the efficiency of
recombination. Amplification of a dilution series of the
recombinant pool with primers from within the same fragment give
the relative efficiency of intra-molecular recombination, which can
be quantified and compared to selected amplification between
different fragments, or inter-molecular recombination. Products of
amplification were size fractionated by agarose gel electrophoresis
and quantified (BioRad (Hercules, Calif.) Fluor-S Imager) with
values weighted for their relative occurrence in the genome. Total
junction fragments are represented by PCR amplification within the
recombinant junction using the designated DNA oligomers (FIG. 70,
lambda recombination screening oligos). Undigested lambda DNA
served as the control for primer specificity and identification of
residual undigested products in the case where intermolecular
recombination was tested across junctions that occur naturally in
the genome. FIG. 71 demonstrates recombination efficiency from
RA.sub.1/RA.sub.2 where nick translation preceded recombination as
in the Example above. Normalized data shows that intra-molecular
recombination approaches the theoretical maximum with DNA
concentrations in the 0.1 ng/.mu.L and 1.0 ng/.mu.L range during
recombination for this model template.
[1022] Adapter modified lambda BamHI fragments were digested with
Dpn-I (Neb Dpn-I, 10 U/.mu.g, 4 hr at 37.degree. C.), digests were
heat inactivated (80.degree. C., 20 min) and Microcon-filtered
(Example 29) to remove blocking oligos. The high molecular weight
DNA recovered was diluted to low concentrations (1 ng/.mu.L or 0.1
ng/.mu.L) in 1.times. Perkin Elmer Taq buffer supplemented to 2 mM
MgCl.sub.2, heated (75.degree. C.) to dissociate unligated oligos
and mixed by pipetting to disperse molecules, then slowly cooled to
50.degree. C. for optimal annealing and incubated overnight.
Annealed samples were reduced to room temperature and supplemented
with wt Taq DNA polymerase to 0.2 U/.mu.L, mixed thoroughly, and
returned to 50.degree. C. for a 10 minute pre-incubation. Nick
translation was initiated by addition of dNTPs to 200 .mu.M for 4
minutes then stopped by the addition of EDTA to 10 mM. Reactions
were purified by phenol extraction and ethanol precipitation for
analysis of recombination.
[1023] Recombination primed nick translation was applied to Lambda
model templates with Dpn-I activation of RA.sub.1/RA.sub.2 prior to
the annealing step giving similar results to post nick translation
recombination. As this approach does not require protected adapter
termini, a set of simplified recombinant adapters (Sra1/Sra2) were
designed which can be directly recombined. The Sra adapters were
initially tested as above with Lambda templates, and subsequently
tested on total bacterial genomic preparations. A series of primer
sets (B1, B3, B5, B8, B12, FIG. 71, E. coli recombination screening
oligos) were designed to test recombination of a complete BamHI
digest of E. coli (strain K-12, MG1655). Each set was comprised of
an anchor primer (PCR) which when paired with a nest primer (NEST)
amplifies the total amount of the available template in the
preparation. The resulting product was compared to the product
obtained using the anchor primer paired with a recombinant primer
(RP). The anchor primer and recombinant primer combination
amplifies the fraction of the total number of molecules that have
undergone intra-molecular recombination. FIG. 72 shows an example
in which the B1 primer set is used to examine the effects of
MgCl.sub.2 concentration on recombination efficiency expressed as a
percent of the total. Primer set (A) represents the total target
amplified, (B) represents the fraction which has recombined, and
(C) shows the absence of product with a non-recombinant reverse
primer. FIG. 73 shows all five kernel primer sets and their
relative recombination efficiencies.
Example 26
Enzymatic Release of Recombinant PENTAmers, a Nicked Template
Model
[1024] Once a recombinant PENTAmer exists within the context of
genomic DNA it must be released prior to the addition of terminal
adapters. One method involves the conversion of the remaining nick,
which has been translated outward during the timed reaction, into a
double stranded break. This example describes the optimization of
converting a nicked model template into their corresponding
fragments.
[1025] Nicked template was prepared utilizing the mutant
restriction enzyme N. BstNBI (NEB, 10U/ug, 1 hr. 55.degree. C.) to
generate nicks within plasmid pUC19. S1 nuclease (Roche) was tested
over a range of conditions to optimize the conversion of nicks to
breaks and minimize the degree of non-specific cleavage. FIG. 74
shows the progressive conversion of nicks through the intermediate
forms. Degradation is evident as a background of highly variable
sized DNA products, most notably in samples low in salt
concentration and high in enzyme concentration. SI alone does not
efficiently convert simple nicks to breaks, however a larger single
stranded region can serve as an excellent template. An ideal
candidate enzyme for opening the remaining nick into a gap is the
T7 (gene 6) exonuclease. Nicked plasmid was subjected to a time
course of T7 exonuclease treatment prior to S1 digestion. FIG. 75
demonstrates the effectiveness of this treatment in comparison to
the same sample digested with S1 alone. Nicked plasmid without
subsequent digest (open circle) as well as restriction digest with
Ple-I, which cleaves the recognition sequence nicked by N.BstNBI,
serve as controls for this assay. Since all T7 exonuclease
treatments gave complete cleavage upon S1 digestion, it was of
interest to titrate the T7 exonuclease enzyme required for
formation of S1 accessible gaps. N.BstNBI nicked plasmid was
treated with 0, 0.4, 4.0, or 40 U/.mu.g of T7 exonuclease (NEB) for
5 minutes at room temperature. Reactions were phenol extracted and
ethanol precipitated prior to treatment with 2.5, 5.0, 10, or 20 U
of S1 nuclease. FIG. 76 shows the complete conversion to fragments
at the 4 U/.mu.g T7 concentration. These conditions establish a
baseline for enzymatic release of PENTAmers with minimal (10
U/.mu.g) S1 nuclease concentrations limiting the non-specific
degradation associated with S1.
Example 27
Enzymatic Release of Recombinant PENTAmers Generated from Bacterial
Genomic DNA
[1026] This example describes the release of nick translation
products by enzymatic methods. The conditions established in
plasmid model templates were applied to primary nick translation
products synthesized from adapter modified Lambda templates.
Products were subjected to conditions for S1 nuclease digestion
optimized on the model template (250 mM NaCl, 200 U S1, 50 mM
NaOAc, 1 mM ZnOAc, pH 4.6). The primary nick translation products
showed specificity through resistance to nuclease attack by prior
ligation. A portion of the preparation was not nick translated and
served as a negative control in which S1 treatment did not yield
the release product. FIG. 77 shows a native gel of S1 released
products. Ligation completely protects the sample from digestion
(lanes 5 and 7) and the controls that were not nick-translated
(lanes 2 and 3) confirm the origin of these products.
[1027] As the 5'.fwdarw.3' exonuclease activity of T7 gene 6 would
degrade primary PENTAmers from their 5' ends, further testing of
the enzymatic release mechanism requires the use of recombinant
PENTAmers (RPs). Recombinant PENTAmers were generated by
recombination primed nick translation of BamHI cut E. coli genomic
DNA with Sra1/Sra2 and recombined as described above in Example 26.
Total recombined material was maximized without regard for
specificity of ends by elevating DNA concentrations to 10 ng/.mu.L
during recombination. Recombined sample was nick translated for 4
or 6 minutes as described in Example 26, then subjected to S1
cleavage or T7 exonuclease digestion followed by S1 cleavage. FIG.
78 shows the size-fractionated products on a native agarose gel. In
digestion with only S1 nuclease, the monomer fraction is visualized
as 400 and 800 bp products. Recombinant molecules, which migrate at
approximately twice the molecular weight of monomer, are not
distinguishable in the background of genomic DNA. When T7
exonuclease is applied prior to S1 cleavage, much of the genomic
DNA has been degraded and only the recombinant PENTAmer is
observed.
Example 28
Secondary Nick Translation Release of Recombinant PENTAmer
[1028] This example demonstrates an alternative to nuclease release
of recombinant PENTAmers based on the example for secondary
PENTAmer synthesis (Example 24). The method incorportates the
following steps: terminal transferase tailing of nascent PENTAmer
ends, ligation of terminal adapters, primer extension, and finally
a secondary nick translation reaction to generate free recombinant
PENTAmers of defined length. Recombination primed PENTAmers were
generated as previously described in Example 26 at 1 ng/.mu.L DNA
concentrations and 6 mM MgCl.sub.2 for recombination. After nick
translation residual dNTPs were removed from the preparation by
phenol extraction followed by microcon YM-100 (Millipore) filter
purification (Example 30). The nascent PENTAmers were then tailed
with dGTP under conditions that favor generation of short 10-15
nucleotide guanosine tails (1.times. NEB buffer 4, 0.25 mM
CoCl.sub.2, 1 .mu.M dGTP, 0.2 U/.mu.L terminal transferase (NEB),
for 15 min. at 37.degree. C.). Tailed products were phenol
extracted and ethanol precipitated prior to terminal adapter
ligation. Terminal adapters were ligated using the B1 (Poly C
universal) adaptor (Table 5) with an eleven base poly-C overhang
under thermostable ligase conditions (Roche) for 10 cycles
(94.degree. C. 1 min, 45.degree. C. 30 min.). Unincorporated
adapter was removed by phenol extraction and microcon filtration
(Example 30). Primer extension of these templates was performed by
addition of a priming oligo complementary to the proximal end of
the terminal adapter. Heat denaturation (98.degree. C. for 5
minutes) was followed by cooling to 65.degree. C. to anneal the
primer extension oligo. Bst DNA polymerase (NEB) was used to extend
the primer (1.times. NEB thermoPol buffer, 4 U/.mu.g BstPol, 300
.mu.M dNTPs, 6 mM MgCl.sub.2, 100 .mu.M primer) for 30 minutes at
65.degree. C. Bst Pol was heat inactivated (80.degree. C., 10
minutes) and the distal adapter primer for nick translation added.
This primer includes a 5' terminal biotin allowing product primed
by this oligo to be captured in single stranded form on
streptavidin coated magnetic beads. Reaction temperature was
reduced to 50.degree. C. for 10 minutes and nick translation was
initiated by addition of wild-type Taq. The reaction was incubated
for 8 minutes at 50.degree. C. The products are denatured and bound
to beads (bead immobilization described in Example 32). Adaptor was
then attached to the 3' terminus by ligation (T4 DNA ligase
15.degree. C. 16 hr) using a poly (N) guide oligo to represent the
possible combinations found in the library (Table 5).
Oligonucleotide primers to the 5' and 3' terminal adapters could
then be used to amplify the recombinant library for further
analysis. FIG. 79 shows the secondary amplification of the library.
These products were T/A cloned (pCR2.1Topo, Invitrogen; Carlsbad,
Calif.) and sequenced to confirm the presence of each modification
and the resulting PENTAmer partners.
Example 29
Evaluation of Trapping of DNA Molecules Across Agarose Gels in
One-Dimensional and Two-Dimensional Electrophoresis
[1029] This example shows comparison between one-dimensional (1D)
and two-dimensional (2D) Field Inversion Gel Electrophoresis (FIGE)
for trapping of 2.3 kB size DNA fragment across pulsed-field grade
agarose gels.
[1030] To purify full-size lambda DNA having minimal number of
double stranded breaks, 6 .mu.g of non-methylated lambda DNA (New
England Biolabs; Beverly, Mass.) are heated at 75.degree. C. in 200
.mu.t TE buffer for 5 min and loaded in preparative well on 0.8%
pulsed-field grade agarose (Bio Rad) gel. Electrophoresis is
carried out in 0.5.times. TBE buffer on FIGE Mapper Apparatus (Bio
Rad) at forward voltage of 180 V, reverse voltage of 120 V, linear
switch ramps of 0.1-0.8 sec, for 16 hours at room temperature.
Following staining with Sybr Gold (Molecular Probes), lambda DNA
band is excised and electroeluted in 60 kD cut-off dialysis bag
(Spectra/Por) in 0.5.times. TBE buffer at 87 V interrupted field
(60 sec on, 5 sec off) for 3 hours at room temperature. Recovered
DNA is concentrated in Microcon YM-100 ultrafiltration units
(Millipore) at 200.times.g.
[1031] One-half microgram of purified lambda DNA is digested with
10 units of Hind III restriction endonuclease (NEB) in 50 .mu.L
volume for 3 hours at 37.degree. C. Aliquots of digested lambda DNA
(50 ng) are mixed with standard gel loading buffer and separated by
1D FIGE in 0.8% pulsed field grade agarose gel along with 2.5 Kb
ladder (Bio Rad). FIG. 80A shows the result of this separation.
Electrophoresis is performed in 0.5.times. TBE buffer on FIGE
Mapper at-forward voltage of 180 V, reverse voltage of 120 V,
linear switch ramps of 0.1-0.8 sec, for 16 hours at room
temperature. Sections of the gel are excised and directly analyzed
by quantitative PCR as described bellow or a second run is carried
out under the same conditions after inverting the gel at 90.degree.
resulting in diagonal separation (FIG. 80B).
[1032] After staining with Sybr Gold, sections of the gels
corresponding to different size are cut out (FIGS. 80A and 80B),
quantitated by mass, melted at 95.degree. C., and serially diluted
in 10 mM Tris-HCl buffer of pH 7.5. One-microliter aliquots of the
prepared serial dilutions are subjected to PCR in 25 .mu.L volume
using standard PCR conditions for AdvanTaq+ (Clontech) and
oligonucleotides specific for the 2.3 Kb lambda Hind III fragment.
The amplified products are separated by electrophoresis in
0.5.times. TBE buffer on 1% garose under standard conditions,
stained with Sybr Gold or EtBr and quantitated on Bio Rad Fluor S
MultiImager by integrating the image pixels in specified volumes
(Quantity One quantitation software, Bio Rad (Hercules, Calif.)).
After normalization, dilution data are expressed as percentage of
the total PCR signal.
[1033] FIG. 81 shows average percentage distribution of trapped 2.3
Kb DNA across FIGE gel in 1D and 2D separation mode. This
experiment demonstrates that 2D diagonal separation offers close to
one order of magnitude better separation over 1D electrophoresis as
determined by quantitating the level of cross-contamination with
smaller molecules over a broad range of DNA size distribution.
Example 30
Removal of Short DNA Sequences and Taq DNA Polymerase from PENT
Products by Microcon YM-100 Ultrafiltration
[1034] This example shows that in the presence of moderate to high
concentration of NaCl (0.2-0.625 M) and centrifugal force of
200.times.g double-stranded fragments of bellow 300 bp could be
effectively separated from higher molecular weight DNA on Microcon
YM-100 ultrafiltration units (Millipore). It also demonstrates that
this procedure adequately removes Taq DNA polymerase as verified by
the ability of terminal transferase to catalyze addition of polyG
to model template following Microcon YM-100 purification or
phenol:chloroforn extraction, but not after ethanol
precipitation.
[1035] Aliquots of 15 .mu.g 50 bp DNA ladder (Life Technologies) in
400 .mu.L of TE buffer or in 400 .mu.L TE buffer supplemented with
0.5.times.QF buffer (Qiagen) containing 625 mM NaCl, 7.5%
isopropanol, 25 mM Tris-HCl, pH 8.0, are placed in Microcon YM-100
units and centrifuged at 200.times.g to a volume of 100 .mu.L.
Samples are washed 2 times with 500 .mu.L of TE buffer at
200.times.g, concentrated to a final volume of approximately 50
.mu.L, and analyzed by electrophoresis on 1% agarose gel. After
staining with Sybr Gold bands are quantitated on Bio Rad Fluor S
MultiImager by integrating the image pixels in specified volumes.
FIG. 82 shows comparison between samples filtered in just TE buffer
(lane 1) or in TE buffer containing 0.5.times.QF buffer (lane 2).
The amount of DNA in bands filtered in TE buffer is taken as 100%
and the recovery of DNA across a range of DNA sizes form the sample
filtered in high salt buffer is expressed in %. As shown in FIG.
82, lane 2 the cut-off limit of separation is gradual such that on
average 3%, 8%, 20%, 35%, 52%, and 64% are recovered from 50 bp,
100 bp, 150 bp, 200 bp, 250 bp, and 300 bp DNA fragments,
respectively. Recovery of kilobase DNA is in the range of 95%.
[1036] Approximately 50 atomoles of primary PENTAmer library
prepared from Not I digested E. coli genomic DNA are amplified by
standard PCR with 5'-fluorescein labeled universal primer specific
for adaptor A.sub.2 (primer 1) and a poly C (10) primer (primer 2,
see Example 4 for details in preparing the library). Thirty two PCR
samples (25 .mu.L each) are combined, mixed with 1/4 vol of QF
buffer (240 mM NaCl, 3% isopropanol, and 10 mM Tris-HCl, pH 8.5
final concentrations), placed in 2 Microcon YM-100 units, and
centrifuged at 200.times.g for approximately 15 min to a volume of
100 .mu.L each. Samples are flushed 2 times with 400 .mu.L of TE
buffer at 200.times.g and concentrated to a final volume of 180
.mu.l total volume. FIG. 83 shows the products of the original PCR
reaction (12 .mu.L, lane 1) and 3 .mu.L of the sample obtained
after Microcon YM-100 filtration (lane 2) analyzed by
electrophoresis on 1% agarose gel after staining with Sybr Gold on
Bio Rad Fluor S MultiImager. This experiment demonstrates the
complete removal of unreacted primers and small molecules
corresponding to free adaptor A tailed with poly G by terminal
transferase which are co-amplified as artifact during PCR (see
Example 32).
[1037] Three picomoles of BamH I digested pUC19 plasmid DNA are
dephosphorylated with shrimp alkaline phosphatase (SAP, Roche) and
ligated to an equimolar amount of BamH I compatible
nick-translation adaptor (Adaptor A1, consisting of primers 3, 4,
5) with 4 units of T4 DNA ligase (Roche) in 100 .mu.L volume at
16.degree. C. overnight. After purification by standard
phenol-chloroform extraction and ethanol precipitation, DNA is
subjected to time-controlled nick-translation with 32 units of
wild-type Taq DNA polymerase in a final volume of 200 .mu.L of
1.times. Perkin-Elmer PCR buffer II containing 2 mM MgCl.sub.2 and
200 .mu.M of each DNTP for 4 min at 50.degree. C. Reaction is
stopped by adding 8 .mu.l of 0.5 M EDTA and the sample is ethanol
precipitated in the presence of 20 .mu.g tRNA as carrier. One third
of the sample is kept as control, one third filtered through
Microcon-YM 100 after mixing with 400 .mu.l of 0.5.times.QF buffer
(final concentration of 625 mM NaCl, 7.5% isopropanol, 25 mM
Tris-HCl, pH 8.5) and centrifuged at 200.times.g to a volume of 100
.mu.L. Sample is washed 3 times with 400 .mu.l of TE buffer at
200.times.g, and concentrated to a final volume of 30 .mu.L. The
remaining one third is extracted twice with phenol-chloroform and
then subjected to Microcon-YM 100 filtration as described above.
One half of each sample is left as control and the other half
extended by limited poly-G tailing with 15 units of terminal
transferase (Roche) in the buffer recommended by the manufacturer,
containing in addition 0.75 mM CoCl.sub.2 and 5 .mu.M dGTP, for 20
min at 37.degree. C. Aliquots of each sample are normalized for
amount of DNA, diluted in water and tested for tailing by terminal
transferase in standard PCR using poly C (10) primer (primer 2) and
primer to adaptor A1 (primer 3). Products of the PCR are analyzed
on 1% agarose gel along with 1 Kb+ DNA size markers (Life
Technologies) after staining with Sybr Gold on Fluor S
MultiImager.
[1038] FIG. 84 shows that unlike the sample purified only by
ethanol precipitation, both Microcon YM-100 treatment and Microcon
YM-100 preceded by phenol-chloroform extraction make possible
tailing of PENT products by terminal transferase, presumably by
removal of Taq polymerase interference. Thus, the combination of
phenol-chloroform extraction followed by Microcon YM-100
purification provides the best recovery of PENT products and the
most complete removal of proteins, adaptors and free
oligonucleotides from kilobase DNA.
Example 31
Purification of Uniform Size DNA Molecules by Reverse Field
Isodimensional Focusing (RF-IDF)
[1039] This example describes a new electrophoretic procedure used
to preparatively focus and purify DNA fragments of desired size or
range of sizes in agarose gels with minimum contamination of
trapped small molecules.
[1040] Aliquots of 10 .mu.g E. coli genomic DNA prepared by
standard purification are digested in 3 tubes with 4, 2, and 1
units of Sau3AI (NEB) respectively for 20 min at 37.degree. C. in
final volume of 100 .mu.l. Samples are combined and loaded on
preparative 0.55% pulse-field grade agarose gel (Bio Rad) along
with 1 Kb+ ladder (Life Technologies). Electrophoresis in forward
direction is performed at 6 V /cm in interrupted mode (60 sec on, 5
sec off) for 1.5 hours. Section of the gel containing a lane of
standards and a lane of the DNA sample is excised, stained with
Sybr Gold and bands are visualized on Dark Reader Blue Light
Transilluminator (Clare Chemical Research). The undesired DNA size
impurities smaller than the cut-off threshold of 2 Kb are cut out
and removed. The remaining portion of the stained slice is aligned
back with the unstained gel and used as a landmark for cutting and
removing of the fraction containing undesired small molecules (i.e.
below 2 Kb in size). The unstained gel is then run in reverse
direction in interrupted field of 6 V/cm (60 sec on, 5 sec off) for
85% of the forward timre. After electrophoresis is complete, the
gel is stained with Sybr Gold. The bands of interest now focused in
a very sharp narrow regions are cut out and recovered from the
agarose by Gel Extraction kit (Qiagen, see Example 33).
[1041] This method has efficiency of separation similar to that of
two-dimensional gels, while preserving the simplicity of the
traditional 1D gel electrophoresis. RF-IDF has been successfully
applied for preparing size-fractionated genomic libraries of
partial restriction digests as described in this example,
purification of PENT products obtained by nick-translation from
such libraries, and removal of adaptor sequences and adaptor dimers
following PCR amplification.
Example 32
Preparation of Prototype Single Stranded Not I PENTAmer Library of
E. coli MG-1655 Immobilized on Magnetic Beads and Analysis of
Specific Kernel Sequences by Restriction Fingerprinting Display and
Sequencing
[1042] This example describes an optimized multi-step procedure to
generate PENTAmer NotI library of E. coli immobilized on magnetic
beads. Fluorescent end-labeled derivatives of the library prepared
by PCR are used to display and analyze restriction fingerprint
patterns on acrylamide or agarose gels or by end-labeled fragment
analysis on sequencing instrument.
[1043] Genomic DNA embedded in agarose plugs is prepared by
standard procedure from E. coli MG-1655 strain. After equilibrating
the plugs with 1.times. NotI buffer (Roche) and melting the agarose
at 65.degree. C. approximately 10 .mu.g of DNA are digested
overnight at 37.degree. C. with 20 units of Not I restriction
enzyme (Roche). DNA is dephosphorylated with 5 units of shrimp
alkaline phosphatase (SAP, Roche) for 15 min at 37.degree. C. and
heated for 15 min at 65.degree. C. to inactivate SAP. Agarose is
solidified at 4.degree. C., plugs washed 5 times with 1 ml of
1.times. Gelase buffer (Perkin Elmer) over a period of 1 hour,
melted at 65.degree. C. for 15 min and agarose is digested with 5
units of Gelase (Perkin Elmer) at 45.degree. C. for 2 hours.
[1044] Sample is brought to a volume of 800 .mu.l with TE buffer
containing 0.1 mM EDTA (TE-L buffer), supplemented with NaCl to a
final concentration of 280 mM and split into 2 Microcon YM-100
units. Samples are centrifuged at 200.times.g for approximately 15
min to a volume of 100 .mu.l, then washed twice with 400 .mu.l of
TE-L buffer at 200.times.g and finally concentrated to a final
volume of 50 .mu.l each.
[1045] Five micrograms of the DNA digest is mixed with 160 fmoles
of pre-assembled NotI nick-translation adaptor (adaptor
A.sub.2--primers 5, 6 and 7). Ligation is carried out overnight at
16.degree. C. with 1300 units of T4 ligase (NEB) in 100 .mu.L
volume. Sample is extracted with equal volume of phenol-chloroform
and subjected to Microcon YM-100 filtration as described above to
remove excess free adaptor.
[1046] The purified sample is subjected to nick-translation with 16
units of wild type Taq DNA polymerase (from David Engelke,
University of Michigan Medical School, Department of Biological
Chemistry) in 1.times. PCR buffer (Perkin Elmer buffer II)
containing 2 mM MgCl.sub.2 and 200 .mu.M of each dNTP for 5 min at
50.degree. C. Reaction is stopped by addition of 5 .mu.l of 0.5 M
EDTA pH 8.0 and products are analyzed on 6% TBE-urea gel (Novex)
after staining with Sybr Gold.
[1047] Due to steric constraints restricting binding of molecules
originating from longer NotI fragments and favoring binding of PENT
products derived from short Notl fragments, a heat denaturing step
is introduced prior to binding of nick-translated DNA to magnetic
beads. The sample is denatured by boiling at 100 .degree. C. for 5
min and cooled on ice for 3 min. Five hundred .mu.g of streptavidin
coated Dynabeads M-280 (Dynal) are prewashed with TE-L buffer and
resuspended in 2.times. BW buffer (20 mM Tris-HCl, 2 mM EDTA, 2 M
NaCl, pH 7.5). Denatured DNA is mixed with equal volume of beads in
2x BW buffer and placed on rotary shaker for 1 hr at room
temperature. The beads are bound to magnet and washed with
3.times.100 .mu.l each of 1.times.BW buffer and TE-L buffer.
Non-biotinylated DNA is removed by incubating the beads in 100
.mu.l of 0.1 N NaOH for 5 min at room temperature. Beads are
neutralized by washing five times with 100 .mu.l of TE-L buffer and
then ressuspended in 50 .mu.l of the same buffer.
[1048] Approximately 40 fmoles of library DNA corresponding to 30
.mu.l beads are extended by limited poly-G tailing with 12 units of
terminal transferase (Roche) in the buffer recommended by the
manufacturer, containing in addition 0.75 mM CoCl.sub.2 and 5 .mu.M
dGTP, for 20 min at 37.degree. C. Reaction is quenched by adding 2
.mu.l of 0.5 M EDTA and DNA cleaned by sequential washing with
2.times.100 .mu.l each of TE-L buffer, 1.times. BW buffer, and TE-L
buffer.
[1049] One .mu.l aliquots of 10.times., 50.times., and 100.times.
dilutions of poly-G extended library beads or control beads
containing DNA that is not tailed with terminal transferase are
used as template in standard PCR reaction with universal poly C
(10) primer (primer 3) and NotI adaptor primer (primer 3) and
analyzed on 1% agarose gel after Sybr Gold staining (FIG. 86A).
Only two types of molecules are amplified--approximately 1 Kb band
with relatively broad size distribution corresponding to library
PENTAmers originating at Not I sites and having heterogeneous 3'
ends and approximately 100 bp molecules, corresponding to residual
free adaptor NotI which is poly G tailed and coamplified as a
byproduct. As shown later, this artifact can be effectively removed
by Microcon YM-100 treatment.
[1050] To test the quality and representativity of the prepared Not
I PENTAmer library, specific sequences within 1 Kb from NotI sites
(i.e. predicted to be within the nick-translated PENT products) are
analyzed by PCR.- The product of the PCR amplification from the
previous step, obtained after 30 cycles of amplification of
10.times. diluted primary library, is purified using Qiaquick PCR
purification kit (Qiagen). After appropriate dilution the sample is
used as PCR template with universal Not I adaptor primer (primer 3)
and a set of 5 internal primers specific for predicted PENT
products originating from Not I fragments ranging from 4 kB to 1 Mb
in size (FIG. 85B). This experiment demonstrates that the library
is representative and all five sequences tested are present in
proportional amounts in the library. The products of the PCR
reactions are purified using Qiaquick PCR purification kit and
subjected to dye-terminator cycle sequencing with the universal Not
I adaptor primer (primer 3) using OpenGene sequencing instrument
(Visible Genetics) under the manufacturer's protocol. All five
sequences were confirmed to match the published database of the E.
coli Genome Center at the University of Wisconsin-Madison.
[1051] Large-scale PCR is carried out to prepare sufficient amounts
of end-labeled library DNA suitable for restriction enzyme
fingerprint display analysis. Approximately 50 atomoles of Not I E.
coli PENTAmer library DNA per reaction is used as PCR template with
poly C (10) primer (primer 2) and 5'-fluorescein labeled universal
Not I adaptor primer (primer 8) in 32 individual tubes (25 .mu.l
each). The combined PCR products are purified away from artifact
adaptor dimers by mixing with 1/4 vol of QF buffer (240 mM NaCl, 3%
isopropanol, and 10 mM Tris-HCl, pH 8.5 final concentrations) and
filtration in 2 Microcon YM-100 units. Samples are centrifuged at
200.times.g to a volume of 100 .mu.l, then washed 3 times with 400
.mu.l of TE-L buffer at 200.times.g and concentrated to a final
volume of 180 .mu.l (see Example 30, FIG. 83). Aliquots of 500 ng
of the prepared end-labeled library are digested overnight at
37.degree. C. with 10 units of four restriction enzymes Bgl II, Pst
I, Pvu II, and BamH I (NEB) in final volume of 30 .mu.l and 250 ng
of each digest are analyzed on acrylamide 4-20% gradient gel
(Novex) or 3% NuSieve agarose gel (BioWitteker) along with DNA size
markers. Gels are first analyzed on Fluor S MultiImager (Bio Rad)
for fluorescein signal (FIG. 86A; FIG. 87A) then stained with Sybr
Gold and imaged on Fluor S MultiImager (FIG. 86B; FIG. 87B). This
experiment validates the presence of all predicted 46 different
end-led labeled sequences originating from 23 separate Not I sites
in the E. coli genome.
[1052] Similar analysis of end-labeled fragments but at much higher
sensitivity and at single base resolution is performed by
fingerprint display of Cy-5.0 end-labeled library derivative using
the fragment analysis feature of the OpenGene sequencing instrument
of Visible Genetics. Labeling is carried out by PCR. Approximately
50 amoles of Not I E. coli PENTAmer library DNA per reaction is
used as PCR template with universal poly C (10) primer and
5'-Cy-5.0 labeled Not I adaptor primer (primers 1 and 2) in 16
individual tubes (25 .mu.l each). The combined PCR products are
purified out of adaptor dimers by supplementing with 1/4 vol of QF
buffer (240 mM NaCl, 3% isopropanol, and 10 mM Tris-HCl, pH 8.5
final concentrations) and filtratered in Microcon YM-100 unit.
Sample is centrifuged at 200.times.g to a volume of 100 .mu.l, then
washed 3 times with 400 .mu.l of TE-L buffer at 200.times.g and
concentrated to a final volume of 74 .mu.l. Aliquots of 200 ng of
the prepared end-labeled library are digested overnight at
37.degree. C. with 20 units of Hha I, Msp I, and Pst I restriction
enzymes (NEB) in final volume of 50 .mu.l and samples are
concentrated by standard ethanol precipitation to a volume of 5
.mu.l. Between 20 and 40 ng of the respective digests are loaded
per lane on OpenGene sequencing gel (Visible Genetics) in 1.times.
formamide loading buffer along with DNA size markers
(Amersham-Pharmacia) Table 7 shows analyses of displayed 38
end-labeled fragments obtained after digestion with Hha I.
TABLE-US-00007 TABLE 7 Predicted and Experimentally Determined
Sizes of Hha I Restriction Fragments from Primary Genomic Not I E.
coli PENTAmer Library Predicted Fragment Size (bp) Calculated
Fragment Size (bp) 60 61.7 64 63.4 73 70.2 78 77.5 79 78.6 82 83.5
83 85.6 103 102.9 105 104.5 112 112.9 120 124.4 128 128.2 152 150.6
164 159.0 165 161.2 167 167.9 173 176.6 184 192.3 198 194.6 201
199.6 202 201.9 222 220.1 232 230.2 233 231.1 244 240.5 245 243.1
268 262.5 281 276.0 282 278.2 299 300.1 338 337.2 348 350.2 366
369.0 372 377.8 405 409.4 454 461.8 469 481 558 574.3
[1053] The elution times obtained after running DNA size standards
are plotted as a function of size and fit to a first order linear
regression equation using Dplot 95 software (USAE Waterways,
correlation coefficient=0.9997). Sizes of the analyzed restriction
fragments are extrapolated from the constructed plot and compared
to predicted restriction pattern for the Hha I restriction enzyme
for 1 Kb PENT molecules originating at Not I sites in the E. coli
genome database. Discrepancy between predicted and experimental
results is within 3%. This example demonstrates that the prepared
primary Not I genomic PLEX-imer library is representative for all
predicted sequences in the E. coli genome.
Example 33
Preparation and Analysis of PENTAmer Library from E. coli BamH I
Complete Genomic Digest
[1054] This example describes a protocol for preparation of primary
PENTAmer library of higher complexity from E. coli genomic DNA with
upstream nick-translation BamH I compatible adaptor A and
downstream nick-attaching adaptor B having randomized bases at the
strand used to direct ligation at the 3' end of nick-translated
PENT molecules.
[1055] Genomic DNA is prepared by standard procedure from E. coli
MG-1655. 10 .mu.g of DNA aliquot is digested at 37.degree. C. for 4
hours with 120 units of BamH I restriction enzyme (NEB) in total
volume of 150 .mu.l. The sample is split into two tubes, diluted
twice with water, supplemented with 1.times. SAP buffer (Roche) and
DNA is dephosphorylated with 10 units of SAP (Roche) for 20 min at
37.degree. C. SAP is heat-inactivated for 15 min at 65.degree. C.
and DNA is purified by extraction with equal volume of
phenol-chloroform followed by precipitation with ethanol. Digested
DNA is dissolved in 50 .mu.l of 10 mM Tris-CL pH 7.5.
[1056] The sample is mixed with 3 pmoles of pre-assembled BamH I
nick-translation adaptor (Adaptor A.sub.3--primers 9, 10, and 11)
and ligation is carried out overnight at 16.degree. C. with 1200
units of T4 ligase (NEB) in 60 .mu.l volume. To remove ligase and
excess free adaptor the sample is extracted with equal volume of
phenol-chloroform, supplemented with 1/4 volume of QF buffer (240
mM NaCl, 3% isopropanol, and 10 mM Tris-HCl, pH 8.5 final
concentrations) in a volume of 400 .mu.l and centrifuged at
200.times.g to 100 .mu.l. The sample is then washed 3 times with
400 .mu.l of TE-L buffer at 200.times.g and concentrated to a
volume of 80 .mu.l.
[1057] The purified sample is subjected to nick-translation with 20
units of wild type Taq polymerase in 1.times. Perkin Elmer PCR
buffer buffer II containing 2 mM MgCl.sub.2 and 200 .mu.M of each
dNTP for 5 min at 50.degree. C. Reaction is stopped by addition of
5 .mu.l of 0.5 M EDTA pH 8.0 and products are analyzed on 6%
TBE-urea gel (Novex) after staining with Sybr Gold.
[1058] To increase representativity of single-stranded PENT
molecules bound to streptavidin beads and to prevent their
reassociation with the strand used as template for nick-translation
in the region of the adaptor an oligonucleotide complementary to
the template strand spanning the entire adaptor sequence (primer
13) is added at a final concentration of 0.8 .mu.M and the sample
is denatured by boiling at 100.degree. C. for 3 min and cooling on
ice for 5 min. 800 .mu.g of streptavidin coated Dynabeads M-280
(Dynal) are prewashed with TE-L buffer and resuspended in 2.times.
BW buffer (20 mM Tris-HCl, 2 mM EDTA, 2 M NaCl, pH 7.5). Denatured
DNA is mixed with equal volume of beads in 2.times. BW buffer and
placed on rotary shaker for 1 hr at room temperature. The beads are
bound to magnet and washed with 3.times.100 .mu.l each of 1.times.
BW buffer and TE-L buffer. Non-biotinylated DNA is removed by
incubating the beads in 100 .mu.l of 0.1 N NaOH for 5 min at room
temperature. Beads are neutralized by washing with 5.times.100
.mu.l of TE-L buffer and then resuspended in 20 .mu.l of water.
[1059] Adaptor B.sub.1 is ligated to the single-stranded primary
BamH I PENT library bound to magnetic beads. Adaptor B.sub.1
consists of two oligonucleotides, one of which is 5'-phosphorylated
and 3'-blocked (primer 14), and its complement that has a
3'-extension with four random bases and is also 3'-blocked (primer
15). The latter oligonucleotide will anneal and direct the
phosphorylated strand to single-stranded genomic PENT library
molecules. The library DNA from the previous step is mixed with 40
pmoles of each adaptor B1 oligonucleotide in 1.times. T4 ligase
buffer and 1200 units of T4 ligase (NEB) in final volume of 30
.mu.l. Ligation is performed at room temperature for 1 hour on
end-to-end rotary shaker to keep the beads in suspension. Beads are
bound to magnet, washed with 2.times.100 .mu.l each of 1.times. BW
buffer and TE-L buffer and nonbiotinylated DNA molecules are
removed by incubating the beads in 100 .mu.l of 0.1 N NaOH for 5
min at room temperature. Beads are neutralized by washing with
5.times.100 .mu.l of TE-L buffer, ressuspended in 100 .mu.l of
storage buffer (SB containing 0.5 M NaCl, 10 mM Tris-HCl, 10 mM
EDTA, pH 7.5) and stored at 4.degree. C.
[1060] FIG. 88 shows analysis of selected random E. coli sequences
in the E. coli genome adjacent to Bam HI sites to assess the
quality and representativity of the library. One microliter of
library beads diluted 10.times. in water are used as template in
PCR reactions with universal adaptor B primer (primer 16) and 5
specific E. coli primers adjacent to BamH I sites. A negative
control with adaptor B primer alone and a positive control with
adaptor B and adaptor A primers (primers 12, 16) are also included.
Aliquots of the PCR reactions are separated on 1% agarose gel and
visualized on Fluor S MultiImager (Bio Rad) after staining with
Sybr Gold. All five analyzed E. coli sequences are present in the
library and are amplified as 1 Kb fragments. The sequences are
confirmed by dye-terminator cycle sequencing using standard
OpenGene protocol (Visible Genetics) and specific primers.
Example 34
Preparation and Analysis of PENTAmer Library from E. coli Sau 3AI
Partial Genomic Digest
[1061] This example demonstrates that a library of even higher
complexity can be prepared from E. coli genomic DNA using partial
digest with frequently cutting enzyme. This library can be
potentially used for feeling gaps and de novo sequencing of genomes
having the complexity of an average bacterial genome.
[1062] Aliquots of 10 .mu.g E. coli genomic DNA prepared by
standard purification are digested in 3 tubes with 4, 2, and 1
units of Sau3A I (NEB) respectively for 20 min at 37.degree. C. in
final volume of 100 .mu.l. DNA fragments are size-fractionated by
RF-IDF (see Example 3). Samples are combined and loaded on
preparative 0.55% pulse-field grade agarose gel (Bio Rad) along
with 1 Kb+ ladder (Life Technologies). Electrophoresis in forward
direction is performed at 6 V/cm in interrupted mode (60 sec on, 5
sec off) for 1.5 hours. Section of the gel containing a lane of
standards and a lane of the DNA sample is excised, stained with
Sybr Gold and bands are visualized on Dark Reader Blue Light
Transilluminator (Clare Chemical Research). The undesired DNA size
impurities smaller than the cut-off threshold of 2 Kb are cut out
and removed. The remaining portion of the stained slice is aligned
back with the unstained gel and used as a landmark for cutting and
removing of the fraction containing undesired small molecules (i.e.
below 2 Kb in size). The unstained gel is then run in reverse
direction in interrupted field of 6 V/cm (60 sec on, 5 sec off) for
85% of the forward time. After electrophoresis is complete the gel
is stained with Sybr Gold. The bands of interest now focused in a
very sharp narrow regions are cut out and recovered from the
agarose by Gel Extraction kit (Qiagen) in 10 mM Tris-HCl pH
8.5.
[1063] The sample is split into two tubes, supplemented with
1.times. SAP buffer (Roche) and DNA is dephosphorylated with 15
units of SAP (Roche) for 20 min at 37.degree. C. SAP is
heat-inactivated for 15 min at 65.degree. C. and DNA is purified by
extraction with equal volume of phenol-chloroform and precipitation
with ethanol. Digested DNA is dissolved in 100 .mu.l of TE-L
buffer.
[1064] The sample is mixed with 40 pmoles of pre-assembled BamH I
nick-translation adaptor (adptor A.sub.3--primers 9, 10, 11) and
ligation is carried out overnight at 16.degree. C. with 2,800 units
of T4 ligase (NEB). To remove ligase and excess free adaptor the
sample is extracted with equal volume of phenol-chloroform then
mixed with 1/4 vol of QF buffer (240 mM NaCl, 3% isopropanol, and
10 mM Tris-HCl, pH 8.5 final concentrations) in a volume of 400
.mu.l and centrifuged at 200.times.g for app. 15 min to a volume of
100 .mu.l on Microcon YM-100. The sample is then washed 3 times
with 400 .mu.l of TE-L buffer at 200.times.g and concentrated to a
volume of 135 .mu.l.
[1065] The purified sample is subjected to nick-translation with 38
units of wild type Taq DNA polymerase in 1.times. Perkin Elmer PCR
buffer buffer II containing 4 mM MgCl.sub.2 and 200 .mu.M of each
dNTP in final volume of 240 .mu.l for 5 min at 50.degree. C.
Reaction is stopped by addition of 6 .mu.l of 0.5 M EDTA pH 8.0 and
products are analyzed on 6% TBE-urea gel (Novex) after staining
with Sybr Gold.
[1066] The sample is supplemented with blocking oligonucleotide
complementary to the nick-translation template strand adaptor
sequence (primer 13) at a final concentration of 1 .mu.M denatured
by boiling at 100.degree. C. for 3 min and cooled on ice for 5 min.
1.2 mg of streptavidin coated Dynabeads M-280 (Dynal) are prewashed
with TE-L buffer and ressuspended in 2.times. BW buffer (20 mM
Tris-HCl, 2 mM EDTA, 2 M NaCl, pH 7.5). Denatured DNA is mixed with
equal volume of beads in 2.times. BW buffer and placed on rotary
shaker for 2 hr at room temperature. The beads are bound to magnet
and washed with 2.times.100 .mu.l each of 1.times. BW buffer and
TE-L buffer. Non-biotinylated DNA is removed by incubating the
beads in 100 .mu.l of 0.1 N NaOH for 5 min at room temperature.
Beads are washed with 100 .mu.l of 0.1 N NaOH, neutralized by
washing with 5.times.100 .mu.l of TE-L buffer, and resuspended in
150 .mu.l of TE-L buffer.
[1067] One half of the prepared library DNA is then processed for
ligation with adaptor B1. To minimize formation of adaptor A-B
dimers on magnetic beads the suspension (75 .mu.l) is supplemented
with 1.times. T4 ligase buffer (NEB) incubated with 50 pmoles of
3'-blocked oligonucleotides one of which is complementary to the
biotinylated adaptor A strand and has 3'-extension of 24 bases
(primer 17) to which the second oligonucleotide (primer 18) is
complementary. The suspension is heated for 1 min at 60.degree. C.,
cooled to room temperature and incubated for 10 min at room
temperature to anneal the blocking oligonucleotides to residual
adaptor A molecules bound to magnetic beads. Beads are then washed
with 50 .mu.l of 1.times. T4 ligase buffer and resuspended in 50
.mu.l of the same buffer. Adaptor B1 having 3' extension of 4
randomized bases which will anneal and direct the phosphorylated
strand to PENT library molecules (see Example 4) is then ligated to
the library DNA. The sample from the previous step is supplemented
with 40 pmoles of each adaptor B oligonucleotide (primers 14, 15)
in 1.times. T4 ligase buffer and 4000 units of T4 ligase (NEB) in
final volume of 55 .mu.l. Ligation is performed at room temperature
for 3 hours on end-to-end rotary shaker to keep the beads in
suspension. Beads are bound to magnet, washed with 2.times.100
.mu.l each of 1.times. BW buffer and TE-L buffer and
nonbiotinylated DNA removed by incubating the beads in 100 .mu.l of
0.1 N NaOH for 5 min at room temperature. Beads are washed with 100
.mu.l of 0.1 N NaOH, neutralized by washing with 5.times.100 .mu.l
of TE-L buffer, resuspended in 90 .mu.l of SB buffer and stored at
4.degree. C.
[1068] FIG. 89 shows analysis of representivity of the PENTAmer
library from E. coli Sau 3AI partial genomic digest. Forty random
oligonucleotides specific for regions of the E. coli genome located
approximately 100-200 bp downstream of Sau3A I restriction sites
were designed to have high internal stability and low frequency of
their six 3'-terminal bases matched against E. coli genomic
frequency database (Oligo Primer Analysis software, Molecular
Biology Insights). Magnetic beads containing library DNA are
pre-washed with water and 1 .mu.l used as template for PCR
amplification with 100 nM of universal adaptor B primer (primer 16)
and 100 nM of each E. coli kernel primer in a final volume of 25
.mu.l. After initial denaturing 32 cycles are carried out at
94.degree. C..sub.4for 10 sec and 68.degree. C. for 75 sec.
Five-microliter aliquots are separated on 1% agarose gel and
visualized on Fluor S MultiImager (BioRad; Hercules, Calif.) after
staining with Sybr Gold. As shown in FIG. 89, specific patterns of
fragments are generated for each sequence. The bands correspond to
amplified PENTAmers having the kernel sequence at different
positions relative to the ligated adaptor B1. This pattern of
amplification reflects the frequency of Sau3A I sites relative to a
given kernel sequence and confirms the prediction for PLEX-imer
libraries prepared from partially digested genomic DNA with
frequently cutting restriction endonucleases.
[1069] The example demonstrates that normalized representative
primary PENTAmer libraries can be prepared from E. coli genomic DNA
following partial digest with frequent cutter and are potentially
useful for gap feeling and de novo walking sequencing.
Example 35
Preparation and Analysis of PENTAmer Libraries from Human Genomic
DNA after Complete Bam H I or Partial Sau3A I Digestion
[1070] This example describes the preparation of primary human
genomic PENTAmer libraries bound to magnetic beads and their
amplification with universal adaptor primers.
[1071] Aliquots of 10 .mu.g genomic DNA prepared by standard
purification from fresh human lymphocytes are digested with 140
units of BamH I (NEB) for 6 hours at 37.degree. C. or with 20 units
of Sau3A I (New England Biolabs; Beverly, Mass.) for 35 min at
37.degree. C. 20 .mu.g of Bam H I or 50 .mu.g of Sau3A I digested
DNA are treated with 3 units/.mu.g of SAP (Roche; Nutley, N.J.) for
20 min at 37.degree. C. SAP is heat-inactivated for 15 min at
65.degree. C. and DNA is purified by extraction with equal volume
of phenol-chloroform and precipitation with ethanol. DNA fragments
are size-fractionated by preparative RF-IDF in 0.75% pulse-field
grade agarose gel (Bio Rad; Hercules, Calif.) as described in
Example 3. Electrophoresis in forward direction is performed at 6
V/cm in interrupted mode (60 sec on, 5 sec off) for 2 hours. After
cutting the section of the gel containing DNA molecules bellow 2
Kb, reverse field is applied at 6 V/cm (60 sec on, 5 sec off) for
1.7 hours. Bands are excised and recovered from the agarose by Gel
Extraction kit Gel Extraction kit (Qiagen) in 10 mM Tris-HCl pH
8.5.
[1072] Samples are mixed with 1.2 pmoles (BamH I) or 6 pmoles
(Sau3A I) of pre-assembled BamH I nick-translation adaptor (adaptor
A3--primers 9, 10, 11) and after heating at 65.degree. C. for 1 min
ligation is carried out at 20.degree. C. for 2.5 hours with 4,800
units of NEB T4 ligase (Bam H I) or 11,200 units of NEB T4 ligase
(Sau3A I). To remove ligase and excess free adaptor the sample is
extracted with equal volume of phenol-chloroform then mixed with
1/4 vol of QF buffer (240 mM NaCl, 3% isopropanol, and 10 mM
Tris-HCl, pH 8.5 final concentrations) in a volume of 400 .mu.l and
centrifuged at 200.times.g for approximately 15 min to a volume of
100 .mu.l in Microcon YM-100 filtration units. The samples are
washed 3 times with 400 .mu.l of TE-L buffer at 200.times.g and
concentrated to a volume of 65 .mu.l (BamH I) and 120 .mu.l (Sau3A
I).
[1073] The purified samples are subjected to nick-translation with
19 units (BamH I) or 38 units (Sau3A I) of wild type Taq DNA
polymerase in 1.times. Perkin Elmer PCR buffer buffer II containing
4 mM MgCl.sub.2 and 200 .mu.M of each dNTP in final volume of 120
.mu.l (Bam H I) or 240 .mu.l (Sau3A I) for 5 min at 50.degree. C.
Reactions are stopped by addition of 6 .mu.l of 0.5 M EDTA pH 8.0
and products are analyzed on 6% TBE-urea gel (Novex) after staining
with Sybr Gold.
[1074] Samples are supplemented with blocking oligonucleotide
complementary to the nick-translation template strand at the region
of the adaptor (primer 13) at a final concentration of 1 .mu.M
denatured by boiling at 100.degree. C. for 3 min and cooled on ice
for 5 min. 1.8 mg of streptavidin coated Dynabeads M-280 (Dynal)
are prewashed with TE-L buffer and resuspended in 2.times. BW
buffer (20 mM Tris-HCl, 2 mM EDTA, 2 M NaCl, pH 7.5). Denatured DNA
samples are mixed with equal volume of beads (1/3 of the total
beads with Bam H I and 2/3 with Sau 3A I samples) in 2.times. BW
buffer and placed on rotary shaker for 1.5 hr at room temperature.
The beads are bound to magnet and washed 2.times. with 100 .mu.l
each of 1.times. BW buffer and TE-L buffer. Non-biotinylated DNA is
removed by incubating the beads in 100 .mu.l of 0.1 N NaOH for 5
min at room temperature. Beads are washed with 100 .mu.l of 0.1 N
NaOH, neutralized by washing with 5.times.100 .mu.l of TE-L buffer,
and resuspended in TE-L buffer.
[1075] Prepared library DNA samples are then processed for ligation
with adaptor B. To minimize formation of adaptor A-B dimers on
magnetic beads the beads suspensions are supplemented with 1.times.
T4 ligase buffer (NEB) and incubated with 50 pmoles of 3'-blocked
oligonucleotides (primers 17 and 18) as described in Example 6. The
suspensions are heated for 1 min at 60.degree. C., cooled to room
temperature and incubated for 10 min at room temperature to anneal
the blocking oligonucleotides to residual adaptor A molecules bound
to magnetic beads. Beads are then washed with 50 .mu.l of 1.times.
T4 ligase buffer and resuspended in 50 .mu.l of the same buffer.
Adaptor B1 having 3' extension of 4 randomized bases which will
anneal and direct the phosphorylated strand to PENT library
molecules is then ligated to the library DNA. The samples are
supplemented with 40 pmoles (BamH I) or 80 pmoles (Sau3A I) of each
adaptor B1 oligonucleotide (primers 14 and 15) in 1.times. T4
ligase buffer and 4000 units (BamH I) or 8000 units (Sau3A I) of T4
ligase (NEB) in final volume of 100 .mu.l (BamH I) or 200 .mu.l
(Sau3A I). Ligation is performed at room temperature for 3.5 hours
on end-to-end rotary shaker to keep the beads in suspension. Beads
are bound to magnet, washed with 2.times.100 .mu.l each of 1.times.
BW buffer and TE-L buffer and non-biotinylated DNA is removed by
incubating the beads in 100 .mu.l of 0.1 N NaOH for 5 min at room
temperature. Beads are washed with 100 .mu.l of 0.1 N NaOH,
neutralized by washing with 5.times.100 .mu.l of TE-L buffer,
resuspended in 160 .mu.l (BamH I) or 280 .mu.l (Sau 3A I) of SB
buffer and stored at 4.degree. C.
[1076] FIG. 90 shows amplification of the primary PENTAmer
libraries from human genomic DNA prepared by complete BamH I, or
partial Sau3A I digestion. Magnetic beads containing library DNA
are prewashed in water and 0.5 .mu.l of each library used as
template for PCR amplification with 100 nM of universal adaptor
A.sub.3 and adaptor B.sub.1 primers (primers 12 and 16) in final
volume of 25 .mu.l. After initial denaturing the indicated number
of cycles are carried out at 94.degree. C. for 10 sec and
68.degree. C. for 75 sec. Ten microliter aliquots are separated on
1% agarose gel and visualized on Fluor S MultiImager (Bio Rad;
Hercules, Calif.) after staining with Sybr Gold.
[1077] This example demonstrates that primary PENTAmer libraries
can be prepared from genomic DNA having the complexity of the human
genome.
Example 36
Retention of Single-Stranded and Double Stranded Libraries on
Streptavidin-Conjugated Magnetic Beads
[1078] In order to test the retention of DNA on Streptavidin beads
a double-stranded and single-stranded secondary BamH I library of
E. coli strain K-12 were created.
[1079] Double and single-stranded secondary libraries were
constructed as follows. One microliter of 12-fold diluted primary
BamH I library (prepared as described in Example 33) of E. coli
K-12 are used a template for each 25 .mu.l PCR reaction. Standard
PCR conditions for Advantaq+ (Clontech; Palo Alto, Calif.) are used
with 0.2 .mu.M final concentration of biotinylated Adaptor B
specific primer and Adaptor A specific primer. 0.2 mM dNTP and 0.25
mM dUTP final concentration are used in each PCR reaction. A total
of 16 different 25 .mu.l PCR reactions are used. 2-step PCR cycling
parameters are used: 95.degree. C. for 1 minute, 94.degree. C. for
10 seconds, 68.degree. C. for 1 minute and 15 seconds, cycled for
25 rounds. This is followed by 72.degree. C. for 1 minute and held
at 4.degree. C. The reactions are combined into one 1.5 ml tube
(400 ul total) and placed in a magnet for 2 minutes. The
supernatant is placed in a clean 1.5 ml tube.
[1080] In order to remove any unincorporated biotinylated primers
prior to binding to Streptavidin beads, the PCR reactions are
purified with Microcon YM-100 filters (Millipore). To each filter
is added 100 ul of PCR reaction, 200 ul TE-L buffer (10 mM Tris pH
8.0, 0.1 mM EDTA), and 100 ul QF Buffer (Qiagen) (240 mM NaCl, 3%
isopropanol, and 10 mM Tris-HCl, pH 8.5 final concentrations). The
filters are spun at 200.times.g for 18 minutes; this is followed by
2 washes with 400 ul TE-L (200.times.g, 15 minutes). After elution,
the volume of the combined reactions is brought up to 400 ul with
TE-L. 200 ul is used for creation of the single-stranded secondary
library and 200 ul is used for creation of the double-stranded
secondary library.
[1081] The single-stranded secondary library bound to beads as
follows. Sixty microliters of Dynal Streptavidin beads are washed
twice with 100 ul 2.times. WB (WB: 1M NaCl, 10 mM Tris-HCl pH 7.5,
1 mM EDTA), washed once with 200 ul 1.times. WB, washed twice with
200 ul TE-L, and resuspended in 200 ul 2.times. WB. 200 ul of the
purified PCR reactions are placed at 100.degree. C. for 5 minutes,
placed on ice for 5 minutes and then mixed with 200 ul of the
prepared Streptavidin beads. Binding of the biotinylated PCR
products to the Streptavidin beads is done by rotating the mixture
at room temperature for 2.5 hours. After binding the mixture is
washed once with 200 ul 2.times. WB, twice with 200 ul TE-L, and
resuspended in 100 ul TE-L.
[1082] Removal of the non-biotinylated strand is done by
resuspending the mixture in 100 .mu.l 0.1N NaOH followed by
incubation at room temperature for 2 minutes. The mixture is placed
on a magnet and the supernatant is removed. The beads are
resuspended once more with 100 .mu.l 0.1N NaOH. The supernatant is
again removed by placing the mixture on a magnet. Neutralization is
accomplished by washing the beads 4 times with 200 ul TE-L. The
single-stranded secondary library is resuspended in 40 .mu.l
ddH.sub.2O.
[1083] The ends of the single-stranded library are blocked by the
addition of ddATP through terminal transferase. To the 40 .mu.l of
the single-stranded library, 20 .mu.l 5.times. terminal transferase
buffer (Roche), 10 .mu.l 2.5M CoCl.sub.2, 10 .mu.L 1 mM ddATP, and
20 .mu.l Terminal Transferase (New England Biolabs) are added. The
reaction is incubated at 37.degree. C. for 30 minutes. The reaction
is then washed twice with 100 .mu.l TE-L and twice with 2.times. WB
buffer. The single-stranded secondary library is finally
resuspended in 130 ul 1.times. storage buffer and stored at
4.degree. C.
[1084] The double-stranded library was bound to beads as follows.
Two-hundred microliters of the purified PCR reactions is mixed with
200 .mu.l of Dynal Streptavidin beads, prepared as above. Binding
is carried out by rotating the mixture for 2.5 hours at room
temperature. After binding the beads are washed twice with 200
.mu.l 2.times. WB and twice with 200 .mu.l TE-L. After washing the
double-stranded secondary library is resuspended in 100 .mu.l TE-L
and stored at 4.degree. C.
[1085] Removal of bead-bound DNA via denaturation with formamide
was tested as follows. The double-stranded secondary library is
washed once with 200 ul TE-L, and resuspended in 200 .mu.l TE-L. 20
.mu.l of the washed library is resuspended in 50 .mu.l formamide
buffer (95% formamide, 10 mM EDTA) and incubated at 95.degree. C.
for 5 minutes. The beads are placed in a magnet heated to
70.degree. C. The supernatant is removed and 150 .mu.l TE-L, 20
.mu.l 3M NaAcetate, and 2 .mu.l (20 mg/ml) Glycogen are added. The
DNA is precipitated by adding 666 ul of 100% ethanol and placed at
-80.degree. C. for 1 hour. The sample is spun at 16,000.times.g for
30 minutes and washed 3 times with 1 ml 75% ethanol. After the
sample is dried for 5 minutes in a vacu-fuge the pellet is
resuspended in 100 ul TE-L (the sample is 5 fold diluted).
[1086] Serial dilutions are performed on the released DNA and
untreated double-stranded secondary library from 500 to 200,000
fold. 25 .mu.l PCR reactions are performed with 1 ul of the
dilutions as template using standard Advaniaq+ (Clontech; Palo
Alto, Calif.) conditions. An E. coli K-12 specific primer and an
adaptor B specific primer are used (0.2 um final concentration),
this produces an approximately 1 kb PCR product. The 2-step PCR
cycling parameters are used as above, but with 30 cycles. 2.5 .mu.l
of 10.times. loading buffer (Life Technologies; Rockville, Md.) are
added to each sample and 15 .mu.l are loaded onto a 1% TBE agarose
gel under standard conditions. The gel was stained with ethidium
bromide and bands were quantitated on the Bio Rad Fluor S
MultiImager by integrating the image pixels in specified volumes
(Quantity One software, Bio Rad; Hercules, Calif.).
[1087] FIG. 91A shows the PCR of the serial dilutions of the
formamide released and untreated double-stranded secondary
libraries. Quantitation of the band intensities (Adjusted Volumes,
Quantity One software, Bio Rad), for the 500 and 10.sup.4
dilutions, showed that there was 25% less product in the library
bound to beads compared to the formamide released library. This
demonstrates that most if not all DNA is released from the
streptavidin beads upon exposure to formamide. The released DNA
produced more PCR product than DNA bound to streptavidin under the
same conditions.
[1088] Removal of bead-bound DNA via denaturation with NaOH was
tested as follows. Three samples were used: single-stranded
secondary library (treated twice with NaOH), single-stranded
secondary library released via formamide (treated twice with NaOH),
and double stranded secondary library released via formamide (not
treated with NaOH). The double-stranded library released via
formamide represents the entire input of DNA prior to NaoH
treatment used to make the single-stranded secondary library.
[1089] The single-stranded secondary library is washed once with
200 .mu.l TE-L and resuspended in 200 .mu.l TE-L. 20 .mu.l of the
library is released from the streptavidin beads via formamide as
above. The released DNA is resuspended in 100 .mu.l TE-L (the
sample is 5 fold diluted). Serial dilutions from 50 to 5,000 are
made for the released and unreleased single-stranded library.
Serial dilutions from 1,000 to 100,000 are made for the
double-stranded library. 1 .mu.l of the serial dilutions are used
as templates in 25 .mu.l PCR reactions. The primers, PCR
conditions, gel running conditions, and quantitation assays are the
same as used for removal via formamide of DNA bound to Streptavidin
beads test above.
[1090] FIG. 91B shows the gel of the PCR from the serial dilutions
of the various samples. The single-stranded secondary library
released via formamide is similar in band intensity compared to the
unreleased sample (lanes 7-12 and lanes 13-18). From the gel it is
clear that there is some loss of DNA following NaOH treatment
(lanes 3, 12, and 18: all 5,000 fold dilutions). Quantitation of
the band intensities (Adjusted Volumes, Quantity One software, Bio
Rad) was performed on each of the lanes. There are too few data
points to make a very accurate estimate of loss during NaOH
treatment, but by looking at the 5,000 fold dilutions among the
three samples an estimate can be made. The single-stranded
secondary library released from the beads is 3.5 fold less (72%
loss) than the double-stranded library and the single-stranded
library on the beads is 3 fold less (66% loss). If a correction is
made for the double-stranded character of the library (divide by 2)
then the single-stranded library is 1.8 fold less (43% loss) and
the unreleased library is 1.5 fold less (32% loss). Therefore,
after the 2 NaOH washes the single-stranded library has been
subject to approximately a 37% loss in DNA.
[1091] Loss of DNA from sequential washing of DNA-bound beads was
determined as follows. The double-stranded secondary library is
subject to sequential treatments with NaOH and the supernatant is
be tested by PCR to quantitate DNA loss during the washes. All
non-biotinylated DNA (the second strand in the double-stranded
library) should be removed with the first wash, so any product that
is amplified in subsequent washes will be due to loss of DNA from
the streptavidin beads as a result of the NaOH treatment.
[1092] Twenty microliters of washed double-stranded secondary
library (same amount as the previous assays) are resuspended in 50
.mu.l 0.1N NaOH and incubated at 37.degree. C. for 3 minutes. To
neutralize the supernatant, 32 .mu.l 0.2N HCL and 5 .mu.l 1M Tris
pH 8.0 are added. 2 .mu.l glycogen (20 mg/ml) and 267 .mu.l 100%
ethanol are added to the supernatant to precipitate the DNA. The
mixture is placed at -80.degree. C. for 1 hour. The sample is spun
at 16,000-.times. g for 30 minutes and washed 3 times with 1 ml 75%
ethanol. After the sample is dried for 5 minutes in a vacu-fuge the
pellet is resuspended in 100 .mu.l TE-L (the sample is 5 fold
diluted). The double-stranded library bound to streptavidin beads
is treated 5 times sequentially in this manner, and each
supernatant is used in serial dilutions prior to PCR. Serial
dilutions from 500 to 10,000 are performed on the first NaOH wash,
the second wash is serially diluted from 50 to 1,000, and the third
and fourth NaOH washes are diluted from 5 to 100. 1 .mu.l of each
dilution is used as template in a 25 .mu.l PCR reaction The
primers, PCR conditions, gel running conditions, and quantitation
assays are the same as described above.
[1093] Using the data from the Adjusted Volumes of band intensities
(Quantity One software, Bio Rad; Hercules, Calif.) of the various
dilutions, the percentage loss of DNA from the streptavidin beads
following the sequential washes with NaOH is calculated. The first
wash will contain the DNA strand that is not bound to the beads and
any loss. The streptavidin beads used in the subsequent washes will
have bound to them the single biotinylated strand. For
quantitation, the first wash is considered the total amount of DNA
that will still be bound to the beads. By comparing the band
intensities for the 500 fold dilutions for the first wash and the
second wash, the second wash is 80% less than the first wash, which
corresponds to a 20% loss in DNA. Comparing the 500-fold dilution
of the first wash and the average of the 50 and 100 fold dilutions
of the third and fourth washes, these washes are 87% and 88% less
than the first wash respectively. This corresponds to a 12% loss in
the third wash and an 11% loss in the fourth wash. If the loss of
DNA from previous washes is considered in the calculations (for the
third wash the total is 80% of the first wash and for the fourth
wash the total is 67% of the total), the loss is 16% and 17% for
the third and fourth washes respectively. Therefore, regardless of
the total amount of DNA bound to the streptavidin beads there is
approximately an 18% loss in DNA bound to the beads, with each
subsequent exposure to NaOH.
[1094] All of the METHODS disclosed and claimed herein can be made
and executed without undue experimentation in light of the present
disclosure. While the compositions and methods of this invention
have been described in terms of preferred embodiments, it will be
apparent to those of skill in the art that variations may be
applied to the METHODS and in the steps or in the sequence of steps
of the method described herein without departing from the concept,
spirit and scope of the invention. More specifically, it will be
apparent that certain agents that are both chemically and
physiologically related may be substituted for the agents described
herein while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
REFERENCES
[1095] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by
reference.
PUBLICATIONS
[1096] Ardrey, Electrospray Mass Spectrometry, Spectroscopy Europe,
4, 10-18, 1992. [1097] Arnold, C. and I. J. Hodgson. 1991.
Vec-torette PCR: a novel approach to genomic walking. PCR Methods
Appl. 1:39-42. [1098] Berg et al. in Automated DNA sequencing and
analysis by Adams, Fields, and Venter. Academic Press (1994) [1099]
Berkenkamp et al., Science, 281:260-2, 1998 [1100] Cantor and Smith
Genomics, John Wiley & Sons, Inc., N.Y., 1999. [1101] Cheng, S.
et al. (1994) Nature, 369, 684-685. long range PCR [1102] Cormack
and Somssich Gene 194 (1997) 273-276 [1103] Crain, Mass
Spectrometry Reviews, 9: 505-554, 1990. [1104] Dieffenbach and
Dveksler. PCR Primer CSHL Press 1995. [1105] Devon, R. S.,
Porteous, D. J., and Brookes, A. J. (1995) Nucleic Acids Res. 23,
1664-1645. [1106] Fenn et al., J. Phys. Chem. 88, 4451-59, 1984.
[1107] Fodor, et al., Nature; 364(6437):555-6, 1995. [1108]
Forster, Ann. Phys., 2:55-75, 1948. [1109] Freifelder, et al. Anal
Biochem, 123(1):83-5, 1982 [1110] Frohrnan, In: PCR Protocols: A
Guide To Methods And Applications, Academic Press, N.Y., 1990.
[1111] Grant, et al. Biochemistry, 35(38):12313-9, 1996. [1112]
Guilfoyle, et al. Nucleic Acids Research 25:1854-1858 (1997) [1113]
Hacia, et al., Nature Genet., 14:441-449,-1996. [1114] Hagiwara, K.
and Harris Nucleic Acids Research 24:2460-2461 (1996) [1115]
Harrison, et al., BioTechniques 22:650-653 (1997) [1116] Higuchi et
al., Biotechnology 10:413-417 1992 [1117] Hillenkamp, et al., Anal
Chem.,63(24): 1193A-1203A, 1991. [1118] Holmstrom et al., Anal.
Biochem. 209:278-283, 1993. [1119] Hunkapiller, et al., Science,
254(5028):59-67. 1991 [1120] Innis, et al., PCR Protocols, Academic
Press, Inc., San Diego, 1990 [1121] Jones, D. H. and S. C.
Winistorfer, BioTechniques 15:894-904, 1993. [1122] Jones, D. H.
and S. C. Winistorfer, Nucleic Acids Res. 20:595-600, 1992. [1123]
Koster et al. Biomedical Environmental Mass Spectrometry, 14:
111-116, 1987. [1124] Kwoh, et al., Proc Natl Acad Sci USA.
1986(4):1173-7, 1989. [1125] Lee, et al., Nuc. Acids Res. 21,
3761-3766, 1993. [1126] Liao et al, Analytical Biochemistry,
253:137-139, (1997). [1127] Lin, et al., Analytical Biochemistry
231:449-452, 1995. [1128] Lukyanov et al. Nucleic Acids Research
24:2194-2195 (1996). [1129] Makarov, et al., 1997 [1130] Macrae and
Brenner (1994) Genomics 24:176-178 [1131] Maniatis T, Fritsch E F
and Sambrook J. (1989). Molecular cloning: A laboratory manual.
[1132] Cold Spring Harbour Laboratory: Cold Spring Harbour, N.Y.
[1133] McCombie et al. Methods: Companion Methods Enzymology
3:33-40 (1991). [1134] Methods in Enzymology, Vol. 193: "Mass
Spectrometry" (McCloskey, ed.), Academic Press, New York, 1990.
[1135] Meyer, et al. Nature, 278(5702):365-7, 1979. [1136] Nakamaye
et al. Nucleic Acids Research 16:9947 (1988) [1137] Newton, et al.
Nucl. Acids Res. 21:1155-1162, 1993. [1138] Nonisotopic DNA Probe
Techniques, Academic Press, Inc., pgs. 311-352, 1992. [1139] Ochman
et al. Genetics 120:621-623 (1988). [1140] Ohara et al., Proc. Natl
Acad. Sci. USA, 86:5673-5677, 1989. [1141] Padegimas et al.
Analytical Biochemistry, 260, 149-153, 1998. [1142] Pease et al.,
Proc. Natl. Acad. Sci. USA, 91:5022-5026, 1994. [1143] Primrose
Principles of Genome Analysis, Second Edition, Blackwell Science,
1998. [1144] Rasmussen et al., Anal. Biochem, 198:138-142, 1991.
[1145] Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner,
D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990)
Nucleic Acids Res. 18, 2887-2890 [1146] Richterich and Church,
Method Enzymol., vol 218, 187-222 (1993) [1147] Rosenthal, A., and
Jones, D. S. (1990) Nucleic Acids Res. 18, 3095-3096. [1148] Rudi
et al. (1999) BioTechniques 27:1170-1177 [1149] Running et al.,
BioTechniques 8:276-277, 1990. [1150] Sambrook et al., "Molecular
Cloning," A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory Press, New York, 13.7-13.9:1989. [1151] Schram, Methods
Biochem Anal., 34: 203-287 1990. [1152] Shoemaker et al., Nature
Genetics 14:450-456, 1996. [1153] Smith et al., Anal. Chem. 62,
882-89, 1990. [1154] Siebert et al. Nucleic Acids Res. 23,
1087-1088, 1995. [1155] Smith, D. R. (1992) PCR Methods Appl., 2,
21-27. [1156] Sterky et al. Journal of Biotechnology 60 (1998)
119-129 [1157] Tabor, et al., Proc Natl Acad Sci USA.,
84(14):4767-71, 1987. [1158] Unrau,P. and Deugau,K. (1994) Gene,
145, 163-169. [1159] Vos et al., Nucleic Acids Research
23:4407-4414 (1995). [1160] Walker et al. (1992a) PNAS 89:392-396
[1161] Walker et al. (1992b) Nuc. Acids Res. 20: 1691-1696. [1162]
Williams et al., Science, 246: 1585-87, 1989 [1163] Xu et al. Anal.
Chem. Vol 69, 3595-3602, 1997 [1164] Zhang, et al. Gurr Gene 253
(2000) 145-150.
PATENTS
[1164] [1165] U.S. Pat. No. 4,942,124 [1166] U.S. Pat. No.
4,683,194 [1167] U.S. Pat. No. 4,710,465 [1168] U.S. Pat. No.
5,075,216 [1169] U.S. Pat. No. 5,143,854 [1170] U.S. Pat. No.
5,149,625 [1171] U.S. Pat. No. 5,424,186 [1172] U.S. Pat. No.
5,366,877 [1173] U.S. Pat. No. 5,547,861 [1174] U.S. Pat. No.
5,578,832 [1175] U.S. Pat. No. 5,599,668 [1176] U.S. Pat. No.
5,610,287 [1177] U.S. Pat. No. 5,837,832 [1178] U.S. Pat. No.
5,837,860 [1179] U.S. Pat. No. 5,843,651 [1180] U.S. Pat. No.
5,861,242 [1181] U.S. Pat. No. 6,027,913 [1182] U.S. Pat. No.
6,045,994 [1183] U.S. Pat. No. 6,124,120 [1184] EP0655 506B1 [1185]
Japanese Pat. No. 59-131909 [1186] WO 88/10315 [1187] WO 89/06700
[1188] WO 90/14148 [1189] WO 96/21144 [1190] WO 98/1112 [1191] WO
98/15644 [1192] WO 99/18241 [1193] WO 00/15779 [1194] WO 00/18960
[1195] WO 00/28084 [1196] WO 00/60121
Sequence CWU 1
1
121 1 24 DNA Unknown Primer 1 gatcgcctat acctaggacc atgt 24 2 22
DNA Artificial Sequence DNA/RNA Primer 2 gttacauggu ccuaggtaua gg
22 3 23 DNA Unknown Primer 3 gttacatggt cctaggtata ggc 23 4 37 DNA
Unknown Primer 4 gatcgcctat acctaggacc atgtaacgaa ttcatca 37 5 45
DNA Unknown DNA/RNA Primer 5 aggtcgccgc cctgatgaat tcgutacaug
gtccuaggta uaggc 45 6 12 DNA Unknown Primer 6 gggcggcgac ct 12 7 25
DNA Unknown Primer 7 gggagatctg aattcccccc ccccc 25 8 23 DNA
Unknown Primer 8 gggagatctg aattcaaaaa aaa 23 9 24 DNA Unknown
Primer 9 gaattcagat ctcccgggtc accg 24 10 30 DNA Unknown Primer 10
gcggtgaccc gggagatctg cccccccccc 30 11 30 DNA Unknown Primer 11
gcggtgaccc gggagatctg aaaaaaaaaa 30 12 42 DNA Unknown Primer 12
cagatctccc gggtcaccgc gcctatacct aggaccatgt aa 42 13 25 DNA Unknown
Primer 13 gcggtgaccc gggagatctg aattc 25 14 25 DNA Unknown Primer
14 gcggtgaccc gggagatctg aattc 25 15 38 DNA Unknown Primer 15
aggtcgccgc cctgaattca gatctcccgg gtcaccgc 38 16 27 DNA Unknown
Primer 16 gatcgcctat acctaggacc atgtaan 27 17 23 DNA Artificial
Sequence DNA/RNA Primer 17 gttacauggu ccuaggtaua ggn 23 18 26 DNA
Unknown Primer 18 gatcgcctat acctaggacc atgtaa 26 19 23 DNA
Artificial Sequence DNA/RNA Primer 19 gttacauggu ccuaggtaua ggc 23
20 37 DNA Unknown Primer 20 gatcgcctat acctaggacc atgtaacgaa
ttcatca 37 21 45 DNA Artificial Sequence DNA/RNA Primer 21
aggtcgccgc cctgatgaat tcgutacaug gtccuaggta uaggc 45 22 26 DNA
Unknown Primer 22 gggagatctg aattcccccc cccccn 26 23 25 DNA Unknown
Primer 23 gaattcagat ctcccgggtc accgn 25 24 53 DNA Unknown Primer
24 gttacatggt cctaggtata ggcgcggtga cccgggagat ctgccccccc ccc 53 25
42 DNA Unknown Primer 25 cagatctccc gggtcaccgc gcctatacct
aggaccatgt aa 42 26 25 DNA Unknown Primer 26 gggagattct gaattcaaaa
aaaan 25 27 25 DNA Unknown Primer 27 gaattcagat ctcccgggtc accgn 25
28 53 DNA Unknown Primer 28 gttacatggt cctaggtata ggcgcggtga
cccgggagat ctgaaaaaaa aaa 53 29 42 DNA Unknown Primer 29 cagatctccc
gggtcaccgc gcctatacct aggaccatgt aa 42 30 26 DNA Unknown Primer 30
gcggtgaccc gggagatctg aattca 26 31 12 DNA Unknown Primer 31
gggcggcgac ct 12 32 38 DNA Unknown Primer 32 aggtcgccgc cctgaattca
gatctcccgg gtcaccgc 38 33 70 DNA Unknown Primer 33 gatctgaggt
tgtagaagac tcggacgata cacatgcacc gtcggtgcag tcgtaatcca 60
gtcccgatct 70 34 14 DNA Unknown Primer 34 cttctacaac ctca 14 35 23
DNA Unknown Primer 35 cggtgcatgt gtatcgtccg agt 23 36 41 DNA
Unknown Primer 36 ggcctgaggt tgtagaagac tcggacgata cacatgcacc g 41
37 14 DNA Unknown Primer 37 cttctacaac ctca 14 38 23 DNA Unknown
Primer 38 cggtgcatgt gtatcgtccg agt 23 39 42 DNA Artificial
Sequence DNA/RNA Primer 39 gatctgaggt tgttgaagcg ttuacccaau
tcgatuaggc aa 42 40 14 DNA Unknown Primer 40 cttcaacaac ctca 14 41
24 DNA Unknown DNA/RNA Primer 41 ttgcctaauc gaautgggua aacg 24 42
51 DNA Unknown Primer 42 aagtctgcaa gatcatcgcg gaaggtgaca
aagactcgta tcgtaannnn c 51 43 46 DNA Unknown Primer 43 ttacgatacg
agtctttgtc accttccgcg atgatcttgc agactt 46 44 51 DNA Unknown Primer
44 aaatcaccat accaactcgc gtcctcctgt gcatgtcgat acgtaannnn c 51 45
46 DNA Unknown Primer 45 ttacgtatcg acatgcacag gaggacgcga
gttggtgtgg tgattt 46 46 57 DNA Unknown Primer 46 aagtctgcaa
gatcatcgcg gaaggtgaca aagactcgta tcgtaacccc ccccccc 57 47 46 DNA
Unknown Primer 47 ttacgatacg agtctttgtc accttccgcg atgatcttgc
agactt 46 48 23 DNA Unknown Primer 48 cggtgcatgt gtatcgtccg agt 23
49 33 DNA Unknown Primer 49 ctcctgtgca tgtcgatacg taaccccccc ccc 33
50 23 DNA Unknown Primer 50 cggtgcatgt gtatcgtccg agt 23 51 71 DNA
Unknown Primer 51 gatctgaggt tgtagaagac tcggacgata cacatgcacc
gtcggtgcag tcgtaatcca 60 gtcccgatct c 71 52 14 DNA Unknown Primer
52 cttctacaac ctca 14 53 23 DNA Unknown Primer 53 cggtgcatgt
gtatcgtccg agt 23 54 41 DNA Unknown Primer 54 ggcctgaggt tgtagaagac
tcggacgata cacatgcacc g 41 55 23 DNA Unknown Primer 55 cggtgcatgt
gtatcgtccg agt 23 56 42 DNA Artificial Sequence DNA/RNA Primer 56
gatctgaggt tgttgaagcg ttuacccaau tcgatuaggc aa 42 57 24 DNA
Artificial Sequence DNA/RNA Primer 57 ttgcctaauc gaautgggua aacg 24
58 14 DNA Unknown Primer 58 cttcaacaac ctca 14 59 24 DNA Unknown
Primer 59 ttgcctaatc gaattgggta aacg 24 60 42 DNA Unknown Primer 60
ttccctaatc gaattgggta aacgcttcaa caacctcaga tc 42 61 46 DNA Unknown
Primer 61 ttacgatacg agtctttgtc accttccgcg atgatcttgc agactt 46 62
51 DNA Unknown Primer 62 aagtctgcaa gatcatcgcg gaaggtgaca
aagactcgta tcgtaannnn c 51 63 23 DNA Unknown Primer 63 aagtctgcaa
gatcatcgcg gaa 23 64 46 DNA Unknown Primer 64 acgggctagc aaaatagcgc
tgtccngatc tgaggttgtt gaagcg 46 65 25 DNA Unknown Primer 65
ggacagcgct attttgctag cccgt 25 66 23 DNA Unknown Primer 66
ggtgacaaag actcgtatcg taa 23 67 23 DNA Unknown Primer 67 ctcctgtgca
tgtcgatacg taa 23 68 23 DNA Unknown Primer 68 aaatcaccat accaactcgc
gtc 23 69 67 DNA Unknown Primer 69 gatctgaggt tgtagaagac tcggacgata
cacatgcacc gtcggtgcag tcgtaatcca 60 gtcccga 67 70 69 DNA Unknown
Primer 70 gatcgctagt tattgctcac gggctagcaa aatagcgctg tcctcgggac
tggattacga 60 ctgcaccga 69 71 156 DNA Unknown Primer 71 gatctgaggt
tgtagaagac tcggacgata cacatgcacc gtcggtgcag tcgtaatcca 60
gtcccgatct cagagcgttt tcgctctgag atcggtgcag tcgtaatcca gtcccgagga
120 cagcgctatt ttgctagccc gtgagcaata actagc 156 72 71 DNA Unknown
Primer 72 gatctgaggt tgtagaagac tcggacgata cacatgcacc gtcggtgcag
tcgtaatcca 60 gtcccgatct c 71 73 14 DNA Unknown Primer 73
cttctacaac ctca 14 74 23 DNA Unknown Primer 74 cggtgcatgt
gtatcgtccg agt 23 75 46 DNA Unknown Primer 75 agagcgtttt cgctctgaga
tcgggactgg attacgactg caccga 46 76 158 DNA Unknown Primer 76
gatcgctagt tattgctcac gggctagcaa aatagcgctg tcctcgggac tggattacga
60 ctgcaccgat ctcagagcgt tttcgctctg agatcggtgc agtcgtaatc
cagtcccgag 120 gacagcgcta ttttgctagc ccgtgagcaa taactagc 158 77 73
DNA Unknown Primer 77 gatcgctagt tattgctcac gggctagcaa aatagcgctg
tcctcgggac tggattacga 60 ctgcaccgat ctc 73 78 13 DNA Unknown Primer
78 gagcaatact agc 13 79 25 DNA Unknown Primer 79 ggacagcgct
attttgctag cccgt 25 80 46 DNA Unknown Primer 80 agagcgtttt
cgctctgaga tcggtgcagt cgtaatccag tcccga 46 81 59 DNA Unknown Primer
81 gatctgaggt tgttgaagac tcggacgata cacacgctgg gttgaggaag tcgtaaata
59 82 14 DNA Unknown Primer 82 cttcaacaac ctca 14 83 24 DNA Unknown
Primer 83 tcgtccgagt cttcaacaac ctca 24 84 28 DNA Unknown Primer 84
tatttacgac ttcctcaacc cagcgtgt 28 85 60 DNA Unknown Primer 85
gatcgctagt tattgctgtt gggatggtta tttatttacg acttcctcaa cccagcgtgt
60 86 14 DNA Unknown Primer 86 cagcaataac tagc 14 87 25 DNA Unknown
Primer 87 aaccatccca acagcaataa ctagc 25 88 28 DNA Unknown Primer
88 acacgctggg ttgaggaagt cgtaaata 28 89 60 DNA Unknown Primer 89
gatctgaggt tgttgaagac acgctgggtt gaggaagtcg taaataaata accatcccaa
60 90 14 DNA Unknown Primer 90 ttgggatggt tatt 14 91 59 DNA Unknown
Primer 91 gatctgaggt tgttgaagac tcggacgata cacacgctgg gttgaggaag
tcgtaaata 59 92 14 DNA Unknown Primer 92 cttcaacaac ctca 14 93 24
DNA Unknown Primer 93 tcgtccgagt cttcaacaac ctca 24 94 28 DNA
Unknown Primer 94 tatttacgac ttcctcaacc cagcgtgt 28 95 60 DNA
Unknown Primer 95 gatcgctagt tattgctgtt gggatggtta tttatttacg
acttcctcaa cccagcgtgt 60 96 14 DNA Unknown Primer 96 cagcaataac
tagc 14 97 25 DNA Unknown Primer 97 aaccatccca acagcaataa ctagc 25
98 28 DNA Unknown Primer 98 acacgctggg ttgaggaagt cgtaaata 28 99 60
DNA Unknown Primer 99 gatctgaggt tgttgaagac acgctgggtt gaggaagtcg
taaataaata accatcccaa 60 100 14 DNA Unknown Primer 100 ttgggatggt
tatt 14 101 18 DNA Unknown Primer 101 aggttgtaga agactcgg 18 102 18
DNA Unknown Primer 102 gctagttatt gctcacgg 18 103 18 DNA Unknown
Primer 103 gcatcgcttg aattgtcc 18 104 18 DNA Unknown Primer 104
tgctctcgga atatcaat 18 105 18 DNA Unknown Primer 105 gcatcgcttg
aattgtcc 18 106 18 DNA Unknown Primer 106 atattcaggc cagttatc 18
107 21 DNA Unknown Primer 107 cttacaccgg cgaagtgaaa g 21 108 25 DNA
Unknown Primer 108 cgctgccgga gctgttagac aattc 25 109 25 DNA
Unknown Primer 109 gcctgcaagc cggtgtagac atcac 25 110 21 DNA
Unknown Primer 110 ctgcaggcca gcgagacaga t 21 111 23 DNA Unknown
Primer 111 gttgtggcct tccagtaagg tcc 23 112 27 DNA Unknown Primer
112 gcaaaatagc tggctggcag gtgtagg 27 113 21 DNA Unknown Primer 113
tagggcggca tcaggtaata c 21 114 23 DNA Unknown Primer 114 tgccgccgtt
cgcatccata cca 23 115 26 DNA Unknown Primer 115 ttccctgcct
ggtcgccgta tctgtg 26 116 21 DNA Unknown Primer 116 tgaaggatac
ggaagcagaa a 21 117 25 DNA Unknown Primer 117 gccattgctg attgcccacc
gacaa 25 118 26 DNA Unknown Primer 118 ctctatcgct cggcctaagt ctttac
26 119 21 DNA Unknown Primer 119 gcggtcggcg tggataaagt a 21 120 23
DNA Unknown Primer 120 gtgagcggga tgaacgaacc tta 23 121 26 DNA
Unknown Primer 121 ctgcgccagg gcttccagac attgtg 26
* * * * *