U.S. patent application number 10/037415 was filed with the patent office on 2006-03-23 for nuclear factors associated with transcriptional regulation.
Invention is credited to Patrick A. Baeuerle, Albert S. JR. Baldwin, David Baltimore, Roger G. Clerc, Lynn M. Corcoran, Chen-Ming Fan, Jonathan LeBowitz, Michael J. Lenardo, Thomas P. Maniatis, Ranjan Sen, Phillip A. Sharp, Harinder Singh, Louis Staudt.
Application Number | 20060063709 10/037415 |
Document ID | / |
Family ID | 46254274 |
Filed Date | 2006-03-23 |
United States Patent
Application |
20060063709 |
Kind Code |
A1 |
Baltimore; David ; et
al. |
March 23, 2006 |
Nuclear factors associated with transcriptional regulation
Abstract
Constitutive and tissue-specific protein factors which bind to
transcriptional regulatory elements of Ig genes (promoter and
enhancer) are described. The factors were identified and isolated
by an improved assay for protein-DNA binding. Genes encoding
factors which positively regulate transcription can be isolated and
employed to enhance transcription of Ig genes. In particular,
NF-kB, the gene encoding NF-kB, IkB and the gene encoding IkB and
uses therefor.
Inventors: |
Baltimore; David; (New York,
NY) ; Sen; Ranjan; (Cambridge, MA) ; Sharp;
Phillip A.; (Newton, MA) ; Singh; Harinder;
(Chicago, IL) ; Staudt; Louis; (Silver Springs,
MD) ; LeBowitz; Jonathan; (Zionsville, IN) ;
Baldwin; Albert S. JR.; (Chapel Hill, NC) ; Clerc;
Roger G.; (Binningen, CH) ; Corcoran; Lynn M.;
(Port Melbourne, AU) ; Baeuerle; Patrick A.;
(Eichenau, DE) ; Lenardo; Michael J.; (Potomac,
MD) ; Fan; Chen-Ming; (San Francisco, CA) ;
Maniatis; Thomas P.; (Belmont, CA) |
Correspondence
Address: |
FISH & NEAVE IP GROUP;ROPES & GRAY LLP
ONE INTERNATIONAL PLACE
BOSTON
MA
02110-2624
US
|
Family ID: |
46254274 |
Appl. No.: |
10/037415 |
Filed: |
January 4, 2002 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
08464364 |
Jun 5, 1995 |
6410516 |
|
|
10037415 |
Jan 4, 2002 |
|
|
|
08418266 |
Apr 6, 1995 |
5804374 |
|
|
08464364 |
Jun 5, 1995 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
08418266 |
Apr 6, 1995 |
|
|
|
06946365 |
Dec 24, 1986 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
07318901 |
Mar 3, 1989 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
07162680 |
Mar 1, 1988 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
07341436 |
Apr 21, 1989 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
06817441 |
Jan 9, 1986 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
07155207 |
Feb 12, 1988 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
07280173 |
Dec 5, 1988 |
|
|
|
07791898 |
Nov 13, 1991 |
|
|
|
Current U.S.
Class: |
435/6.13 ;
435/6.16; 514/3.8; 530/358; 536/23.5 |
Current CPC
Class: |
C12Q 1/6897 20130101;
C12Q 1/68 20130101; C12N 2830/15 20130101; C12Q 1/6813 20130101;
C12N 2830/30 20130101; C12N 2830/00 20130101; C07K 14/4702
20130101; C07K 2319/00 20130101; C12N 15/85 20130101; C12N
2740/16022 20130101; C07K 14/005 20130101; G01N 2500/02 20130101;
C12N 2830/85 20130101; C12N 2800/108 20130101; G01N 33/6872
20130101; C12N 2830/008 20130101 |
Class at
Publication: |
514/012 ;
530/358; 536/023.5 |
International
Class: |
A61K 38/17 20060101
A61K038/17; C07K 14/47 20060101 C07K014/47; C07H 21/04 20060101
C07H021/04 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The work leading to this invention was supported in part by
a grant from the National Cancer Institute. The Government has
certain rights in this invention.
Claims
1. Isolated nuclear protein which binds, in a sequence specific
manner, to a transcriptional regulatory DNA element of an
immunoglobulin light chain genes, a transcriptional regulatory DNA
element of an immunoglobulin heavy chain genes or both.
2. Isolated nuclear protein, which binds, in a sequence specific
manner, to enhancer DNA sequences of the kappa light chain
gene.
3. A nuclear protein of claim 2, wherein the sequences are
TGGGGATTCCCA.
4. Isolated NF-.kappa.B.
5. Isolated nuclear protein, which: a) binds to DNA sequences in
the upstream region of both mouse heavy and Kappa light chain gene
promoters; and b) binds to DNA sequences of mouse heavy chain gene
enhancer.
6. A nuclear protein of claim 5, wherein the sequences are
ATTTGCAT.
7. Isolated nucleic acid encoding a nuclear protein of claim 1.
8. Isolated nucleic acid encoding a nuclear protein which binds, in
a sequence specific manner, to enhancer DNA sequences of the Kappa
light chain gene.
9. Isolated nucleic acid of claim 8 wherein the nuclear protein
binds, in a sequence specific manner, to enhancer DNA sequences of
the Kappa light chain gene.
10. Isolated DNA encoding a structural gene for a nuclear protein,
which protein binds in a sequence specific manner to the kappa
enhancer.
11. Isolated DNA which encodes a nuclear protein which: a) binds to
DNA sequences in the upstream region of both mouse heavy and Kappa
light chain gene promoters; and b) binds to DNA sequences of mouse
heavy chain gene enhancer.
12. DNA encoding the transcriptional regulatory factor IgNF-B
(NF-A2).
13. A cloned DNA sequence which encodes a protein which binds to
the K-element TGGGGATTCCCCA and which hybridizes to a single,
approximate 10 kb RNA transcript from both B and non-B human
cells.
14. An assay for detection of binding of cellular nuclear protein
to DNA, comprising the steps of: a) providing an extract of
cellular nuclear protein; b) preparing an incubation mixture
consisting of: i. the extract of nuclear protein; ii. a
radiolabeled DNA fragment to be tested for binding with the nuclear
protein; and iii. an alternating copolymer duplex
poly(dI-dc)-poly(dI-dc); c) incubating the mixture under conditions
which allow the formation of protein-DNA complexes; and d)
resolving complexed DNA from free DNA by electrophoresis through a
low ionic strength, nondenaturing polyacrylamide gel.
15. An assay of claim 14, wherein the radiolabeled DNA fragment to
be tested is less than about 100 base pairs.
16. A method of claim 14, wherein the DNA fragment is end-labeled
with .sup.32P.
17. A method of enhancing the transcription of a gene of interest
whose transcription is regulated by a regulatory factor which binds
DNA in the vicinity of the gene, comprising the steps of: a)
preparing an expressible gene construct comprising a strong
promoter linked to a gene encoding the regulatory factor; and b)
incorporating into a cell containing the gene of interest, single
or multiple copies of the gene construct sufficient to enhance
transcription of the gene of interest.
18. A method of claim 17, wherein the cell is a lymphoid cell and
the gene of interest is a gene encoding an Ig chain.
19. A method of claim 17, wherein the regulatory factor is selected
from the group consisting of the following factors: IgNF-A, E,
IgNFB and NF-.kappa.B.
20. A method of claim 17, wherein the regulatory factor is
IgNF-B.
21. A method of claim 17, wherein the lymphoid cell is a hybridoma
cell.
22. A method of enhancing transcription of a gene encoding an Ig
chain, comprising: a) preparing an expressible gene construct
comprising a strong promoter linked to DNA encoding a structural
gene for B-cell nuclear protein, which protein binds in a sequence
specific manner to a transcriptional regulatory DNA element of an
immunoglobulin light chain genes, a transcriptional regulatory DNA
element of an immunoglobulin heavy chain gene or both; and b)
transfecting an Ig chain-producing lymphoid cell with the construct
in multiple copies to enhance the transcription of the Ig
chain-encoding gene.
23. A method of claim 22, wherein the DNA encoding the structural
gene for a B-cell nuclear protein encodes IgNFB.
24. A lymphoid cell transformed with an expressible nucleic acid
construct comprising nucleic acid encoding a transcriptional
regulatory factor which regulates Ig gene transcription.
25. A lymphoid cell of claim 24, which is a hybridoma.
26. A lymphoid cell of claim 24, wherein the regulatory factor is
B.about.cell nuclear protein, which protein binds in a sequence
specific manner to a transcriptional regulatory DNA element of an
immunoglobulin light chain gene, a transcriptional regulatory
element of an immunoglobulin heavy chain gene, or both.
27. A lymphoid cell of claim 26, Wherein the regulatory factor is
IgNF-B or NF-.kappa.B.
28. A method of screening for the expression of a sequence-specific
binding protein by a recombinant expression vector, comprising
contacting protein produced by a host cell transformed by the
recombinant vector with a nucleic acid recognition site probe,
under conditions which permit the specific formation of a complex
of the sequence-specific binding protein and the recognition site
probe and determining whether such formation of a complex occurs,
wherein formation of a complex is an indication of the expression
of the sequence-specific binding protein by the recombinant
vector.
29. A method of identifying recombinant expression vectors which
express a sequence-specific DNA binding protein, comprising the
steps of: a) cloning the vector in host cells to form clonal
colonies; b) generating a replica plate of the cellular protein of
the clonal colonies; c) contacting the cellular protein with a DNA
probe comprising a DNA sequence embodying the binding site for the
sequence-specific binding protein under conditions which permit the
sequence specific binding protein to bind the probe to form a
complex; d) washing the cellular protein to remove unbound probe;
and
30. A method of claim 29, wherein the sequence-specific binding
protein is a transcriptional regulatory factor.
31. A method of claim 29, wherein the expression vector is the
bacteriophage .lamda.gt11.
32. A method of claim 29, wherein a nonspecific competitor DNA is
contacted with cellular protein along with the DNA probe.
33. A method of claim 32, wherein the nonspecific competitor DNA is
poly(dI-dC)-poly(dI-dC) or denatured calf thymus DNA.
34. A method of claim 29, wherein the probe is up to 150 bp in
length.
35. A method of claim 29, wherein the probe comprises a oligomer of
binding sites for the sequence-specific binding protein.
36. A labeled DNA probe complementary to at least a portion the
sequence of nucleic acid encoding a transcriptional regulatory
factor.
37. A DNA probe of claim 30, wherein the factor is
lymphoid-specific.
38. A DNA probe of claim 37, selected from the group consisting of
NF-.kappa.B and IgNF-B.
39. A method of detecting DNA or RNA encoding a transcriptional
regulatory factor, comprising contacting a sample to be tested with
a labeled DNA probe complementary to at least a portion the
sequence of nucleic acid encoding a transcriptional regulatory
factor; incubating the probe and the sample under hybridization
conditions which permit the labeled probe to hybridize with
complementary DNA or RNA sequences; removing unhybridized probe and
analyzing the sample for hybridized probe.
40. A method of claim 39, for determination of expression of the
factor, wherein the conditions of hybridization are sufficiently
stringent such that the probe hybridizes only to nucleic acid
sequences to which it is substantially complementary.
41. A method of claim 39, for the identification of a gene encoding
a transcriptional regulatory factor, wherein the hybridization
conditions are of a sufficiently relaxed stringency such that the
probe will hybridize to DNA sequences which are not completely
complementary.
42. Polyclonal or monoclonal antibody specifically reactive with a
nuclear protein which binds, in a sequence specific manner, to a
transcriptional regulatory DNA element of an immunoglobulin light
chain gene, a transcriptional regulatory DNA element of an
immunoglobulin heavy chain gene or both.
43. An immunoassay for detection of a transcriptional regulatory
factor in a biological fluid, in which the antibody of claim 42 is
used to detect the transcriptional regulatory factor.
44. An immunoassay of claim 43, for detection of IgNF-B or
NF-.kappa.B, wherein the antibody is specifically reactive with
IgNF-B or NF-.kappa.B.
45. The recombinant phage .lamda.h3, ATCC 67629.
46. The recombinant phage OCT-2, ATCC 67630.
47. A method of identifying an agonist or an antagonist of gene
transcription, comprising employing a gene encoding a
transcriptional regulatory factor in an in vivo or in vitro assay
to identify an agonist or antagonist of the factor or the gene
encoding the factor.
48. An agonist or antagonist of the activity of a transcriptional
regulatory factor of claim 1 or a gene encoding the factor.
49. DNA encoding the DNA binding domain of a transcriptional
regulatory protein of claim 1.
50. A method of specifically stimulating gene transcription in a
cell, comprising: a) providing an expressible gene construct
comprising DNA encoding the binding domain of a transcriptional
regulatory factor linked to DNA encoding an activator of the RNA
polymerase for the gene; and b) introducing the construct into the
cell.
51. A method of claim 50, wherein the DNA encodes the binding
domain of IgNF-B or NF-.kappa.B.
52. A DNA construct comprising DNA encoding the binding domain of a
transcriptional regulatory factor linked to DNA encoding an
activator of the RNA polymerase for the gene.
53. A DNA construct of claim 52, wherein the DNA encodes the
binding domain of IgNF-B or NF-.kappa.B.
54. A method of inducing expression of a gene, comprising the steps
of: a) preparing a DNA construct comprising: i) a Kappa enhancer
sequence or a portion of the Kappa enhancer sequence containing at
least the sequence to which the factor NF-.kappa.B binds; ii) a
promoter; and iii) a structural gene of interest. b) transfecting a
eukaryotic host cell with the DNAconstruct; and c) stimulating the
transfected cell with a substance which stimulates NF-B activation
and binding to the enhancer sequence.
55. A method of claim 54, wherein the structural gene encodes a
cytotoxic protein.
56. A method of claim 54, wherein the substance which stimulates
NF-B is an activator of protein kinase C.
57. A method of altering expression in a cell of a gene whose
transcriptional activity is altered by binding of NF-.kappa.B to
the enhancer of said gene, comprising controlling dissociation of
the NF-.kappa.B--I.kappa.B complex present in the cytoplasm of said
cell.
58. The method of reducing expression in a cell of a gene whose
transcriptional activity is activated by binding of NF-.kappa.B to
the enhancer of said gene, comprising preventing dissociation of
NF-.kappa.B--I.kappa.B complex present in the cytoplasm of said
cell.
59. A method of activating in a host cell an NF-.kappa.B precursor
present in the cytoplasm of said host cell, the precursor
comprising an NF-.kappa.B--I.kappa.B complex, comprising contacting
the host cell with a substance which causes dissociation of the
complex into I.kappa.B and NF-.kappa.B and translocation of said
NF-.kappa.B into the nucleus of said cell.
60. A method of preventing activation in a host cell of an
NF-.kappa.B precursor present in the cytoplasm of said host cell,
the precursor comprising an NF-.kappa.B--I.kappa.B complex,
comprising contacting the host cell with a substance which prevents
dissociation of the complex into l.kappa.B and NF-.kappa.B.
61. A method of causing activation of an NF-.kappa.B precursor,
present in the cytosol of a host cell, the NF-.kappa.B precursor
being an NF-.kappa.B--I.kappa.B complex, comprising treating the
cell with a substance which causes dissociation of the
NF-.kappa.B--I.kappa.B complex, resulting in induction of
DNA-binding activity and nuclear translocation of the NF-.kappa.B
present in the complex.
62. A method of controlling expression of human immunodeficiency
virus DNA in a host cell latently infected with human
immunodeficiency virus DNA, comprising preventing binding of
NF-.kappa.B to human immunodeficiency virus transcriptional control
elements.
63. A method of claim 62 wherein binding of NF-.kappa.B to
immunodeficiency virus transcriptional control elements is
prevented by inhibiting dissociation of an NF-.kappa.B--I.kappa.B
complex present in the cytoplasm of said host cell into I.kappa.B
and NF-.kappa.B.
64. Isolated NF-.kappa.B--I.kappa.B complex.
65. Isolated DNA encoding NF-<B--I.kappa.B complex.
66. A method of regulating NF-.kappa.B-mediated gene expression in
a cell, comprising altering NF-.kappa.B activity in the cell.
67. A method of regulating transduction in a cell of an
extracellular signal by NF-.kappa.B, comprising altering
NF-.kappa.B activity in the cell.
68. A method of claim 67 wherein NF-.kappa.B activity is
reduced.
69. A method of claim 67 wherein NF-.kappa.B is enhanced.
70. A method of regulating NF-.kappa.B-mediated expression of a
selected gene in a cell, comprising introducing into the cell a
substance which regulates NF-.kappa.B activity in the cell.
71. A method of positively regulating NF-.kappa.B-mediated gene
expression in a cell, comprising: a) introducing into the cell a
gene construct comprising a gene of interest, a DNA sequence which
is the binding site of NF-.kappa.B and a promoter for the gene; and
b) maintaining the cell under conditions appropriate for expression
of the gene.
72. A method of claim 71 wherein the binding site is represented by
the following consensus sequence: TABLE-US-00005 C C GGGRATYYAC, T
T
or equivalents thereof.
73. A method of claim 72 wherein the consensus sequence is present
in the group consisting of: the Ig .kappa. enhancer regulatory
element, the SV40 enhancer regulatory element, the HIV long
terminal repeat, a regulatory element of the MHC class I H2-K gene,
a regulatory element of the IL-2 lymphokine gene, a regulatory
element of the IL-2R gene, and a regulatory element of the
interferon .beta. PRDII gene.
74. A method of positively regulating the expression of a gene in a
cell, the gene having a DNA sequence which is a binding site of
NF-.kappa.B, said method comprising introducing an effective amount
of NF-.kappa.B into the cell, under conditions appropriate for
binding of NF-.kappa.B to the binding site.
75. A method of positively regulating in a cell the expression of a
gene comprising a DNA sequence which is a binding site of
NF-.kappa.B, comprising introducing into the cell a gene construct
encoding NF-.kappa.B and maintaining the cell, under conditions
appropriate for expression of the gene.
76. A method of positively regulating the expression of a gene in a
cell, the gene having a DNA sequence encoding a binding site of
NF-.kappa.B, said method comprising inducing NF-.kappa.B activity
by introducing into the cell an NF-.kappa.B inducing substance.
77. A method of claim 76 wherein the NF-.kappa.B inducing substance
is selected from the group consisting of lipopolysaccharide,
cyclohexamide, phorbol esters, virus, and tumor necrosis factor
.alpha. phorbol myristate.
78. A method of negatively regulating the expression of a gene in a
cell, the gene having a binding site of NF-.kappa.B, said method
comprising introducing an inhibitor of NF-.kappa.B into the cell,
under conditions appropriate for binding of the inhibitor to
NF-.kappa.B.
79. A method of claim 78 wherein the inhibitor of NF-.kappa.B is
I-.kappa.B.
80. A method of negatively regulating the expression of a gene in a
cell, the gene having a binding site of NF-.kappa.B, said method
comprising introducing a gene construct encoding I-.kappa.B cell,
under conditions appropriate for I-.kappa.B production and binding
of I-.kappa.B to NF-.kappa.B.
81. A method of negatively regulating the expression of a gene in a
cell, the gene having a binding site of NF-.kappa.B, said method
comprising introducing into the cell a DNA sequence which is the
binding site of NF-.kappa.B, under conditions appropriate for
binding of the DNA sequence and NF-.kappa.B.
82. A method of claim 81 wherein the binding site is represented by
the foilowing consensus sequence of: TABLE-US-00006 C C GGRATYYAC,
T T
or equivalents thereof.
83. A method of claim 81 wherein the consensus sequence is present
in the group consisting of: the Ig .kappa. enhancer regulatory
element, the SV40 enhancer regulatory element, the HIV long
terminal repeat, a regulatory element of the MHC class I H2-K gene,
a regulatory element of the IL-2 lymphokine gene, a regulatory
element of the IL-2R gene, and a regulatory element of the
interferon .beta. PRDII gene.
84. A method of modifying the expression of at least one gene in a
cell, the gene having an NF-.kappa.B binding site, said method
comprising introducing into the cell a gene construct comprising
DNA encoding a modified NF-.kappa.B molecule which binds
selectively to the NF-.kappa.B binding site of said selected gene
or genes, under conditions appropriate for expression of the
encoded modified NF-.kappa.B and binding of the modified
NF-.kappa.B to the NF-.kappa.B binding site of said gene or
genes.
85. A method of negatively regulating the expression of a gene in a
cell, the gene having a DNA sequence encoding a binding site of
NF-.kappa.B, said method comprising introducing into the cell a
gene construct, the construct comprising DNA encoding a modified
NF-.kappa.B molecule which comprises a DNA binding domain and lacks
a RNA polymerase activating domain.
86. Isolated or recombinant I.kappa.B.
87. A composition comprising an NF-.kappa.B inhibitor.
88. A composition of claim 85 wherein the inhibitor is a peptide
capable of binding NF-.kappa.B.
Description
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of application of
Ser. No. 06/946,365(WHI86-10), filed Dec. 24, 1986; Ser. No.
07/318,901 (WHI87-11A), filed Mar. 3, 1989; Ser. No. 07/162,680
(WHI87-11), filed Mar. 1, 1988; and Ser. No. 07/341,436 (WHI89-02)
filed Apr. 21, 1989; Ser. No. 06/817,441 (MIT-4167), filed Jan. 9,
1986; Ser. No. 07/155,207 (MIT-4167A), filed Feb. 12, 1988 and Ser.
No. 07/280,173 (MIT-4167AA), filed Dec. 5, 1988. The contents of
the seven referenced applications are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0003] Trans-acting factors that mediate B cell specific
transcription of immunoglobulin (Ig) genes have been postulated
based on an analysis of the expression of exogenously introduced Ig
gene recombinants in lymphoid and non-lymphoid cells. Two B
cell-specific, cis-acting transcriptional regulatory elements have
been identified. One element is located in the intron between the
variable and constant regions of both heavy and kappa light chain
genes and acts as a transcriptional enhancer. The second element is
found upstream of both heavy chain and kappa light chain gene
promoters. This element directs lymphoid-specific transcription
even in the presence of viral enhancers.
[0004] Mouse and human light chain promoters contain the octamer
sequence ATTTGCAT approximately 70 base pairs upstream from the
site of initiation. Heavy chain gene promoters contain the
identical sequence in inverted orientation, ATGCAAAT, at the same
position. This element appears to be required for the efficient
utilization of Ig promoters in B cells. The high degree of sequence
and positional conservation of this element as well as its apparent
functional requirement suggests its interaction with a
sequence-specific transcription factor but no such factor has been
identified.
DISCLOSURE OF THE INVENTION
[0005] This invention pertains to human lymphoid-cell nuclear
factors which bind to gene elements associated with regulation of
the transcription of Ig genes and to methods for identification and
for isolation of such factors. The factors are involved in the
regulation of transcription of Ig genes. The invention also
pertains to the nucleic acid encoding the regulatory factors, to
methods of cloning factor-encoding genes and to methods of altering
transcription of Ig genes in lymphoid cells or lymphoid derived
cells, such as hybridoma cells, by transfecting or infecting cells
with nucleic acid encoding the factors.
[0006] Four different factors which bind to transciptional
regulatory DNA elements of Ig genes were identified and isolated in
nuclear extracts of lymphoid cells. Two of the factors, IgNF-A and
E, are constitutive; two IgNF-B and .kappa.-3 (hereinafter
NF-.kappa.B) are lymphoid cell specific. Each factor is described
below.
IgNF-A (NF-A1)
[0007] IgNF-A binds to DNA sequences in the upstream regions of
both the murine heavy and kappa light chain gene promoters and also
to the murine heavy chain gene enhancer. The binding is sequence
specific and is probably mediated by a highly conserved sequence
motif, ATTTGCAT, present in all three transcriptional elements. A
factor with binding specificity similar to IgNF-A is also present
in human HeLa cells indicating that IgNF-A may not be tissue
specific.
E factors
[0008] The E factors are expressed in all cell types and bind to
the light and heavy chain enhancers.
IgNF-B (NF-A2)
[0009] IgNF-B exhibits the same sequence-specificity as IgNF-A; it
binds to upstream regions of murine heavy and kappa light chain
gene promoters and to murine heavy chain gene enhancer. This
factor, however, is lymphoid specific; it is restricted to B and T
cells.
NF-.kappa.B (Previously Kappa-3)
[0010] NF-.kappa.B binds exclusively to the kappa light chain gene
enhancer (the sequence TGGGGATTCCCA). Initial work provided
evidence that NF-kB is specific to B-lymphocytes (B-cells) and also
to be B-cell stage specific. NF-kB was originally defected because
it stimulates transcription of genes encoding kappa immunoglobulins
in B lymphocytes. As described herein, it has subsequently been
shown that transcription factor NF-kB, previously thought to be
limited in its cellular distribution, is, in fact, present and
inducible in many, if not all, cell types and that it acts as an
intracellular messenger capable of playing a broad role in gene
regulation as a mediator of inducible signal transduction. It has
now been demonstrated that NF-kB has a central role in regulation
of intercellular signals in many cell types. For example, NF-kB has
not been shown to positively regulate the human .beta.-interferon
(.beta.-IFN) gene in many, if not all, cell types. As described
below, it is now clear not only that NF-kB is not tissue specific
in nature, but also that in the wide number of types of cells in
which it is present, it serves the important function of acting as
an intracellular transducer of external influences. NF-kB has been
shown to interact with a virus inducible element, called PRDII, in
the .beta.-IFN gene and to be highly induced by virus infection or
treatment of cells with double-stranded RNA. In addition, NF-kB
controls expression of the human immunodeficiency virus (HIV).
[0011] As further described, it has been shown that a precursor of
NF-.kappa.B is present in a variety of cells, that the NF-.kappa.B
precursor in cytosolic fractions is inhibited in its DNA binding
activity and that inhibition can be removed by appropriate
stimulation, which also results in translocation of NF-.kappa.B to
the nucleus. A protein inhibitor of NF-.kappa.B, designated IkB,
has been shown to be present in the cytosol and to convert
NF-.kappa.B into an inactive form in a reversible, saturable and
specific reaction. Release of active NF-kB from the IkB-NF-kB
complex has been shown to result from stimulation of cells by a
variety of agents, such as bacterial lipopolysaccharide,
extracellular polypeptides and chemical agents, such as phorbel
esters, which stimulate intracellular phosphokinases. IkB and
NF-.kappa.B appear to be present in a stoichiometric complex and
dissociation of the two complex components results in two events:
activation (appearance of NF-KB binding activity) and translocation
of NF-KB to the nucleus.
Identification and Isolation of the Transcriptional Regulatory
Factors
[0012] The transcription regulatory factors of the present
invention were identified and isolated by means of a modified DNA
binding assay. The assay has general applicability for analysis of
protein DNA interactions in eukaryotic cells. In performing the
assay, DNA probes embodying the relevant DNA elements or segments
thereof are incubated with cellular nuclear extracts. The
incubation is performed under conditions which allows the formation
of protein-DNA complexes. Protein-DNA complexes are resolved from
uncomplexed DNA by electrophoresis through polyacrylamide gels in
low ionic strength buffers. In order to minimize binding of protein
in a sequence nonspecific fashion, a competitor DNA species can be
added to the incubation mixture of the extract and DNA probe. In
the present work with eukaryotic cells the addition of alternating
copolymer duplex poly(dI-dC)-poly(dI-dC) as a competitor DNA
species provided for an enhancement of sensitivity in the detection
of specific protein-DNA complexes and facilitated detection of the
regulatory factors described herein.
[0013] This invention pertains to the transcriptional regulatory
factors, the genes encoding the four factors associated with
transcriptional regulation, reagents (e.g., oligonucleotide probes,
antibodies) which include or are reactive with the genes or the
encoded factors and uses for the genes, factors and reagents. It
further relates to NF-KB inhibitors, including isolated IkB, the
gene encoding IkB and agents or drugs which enhance or block the
activity of NF-KB or of the NF-KB inhibitor (e.g., IkB).
[0014] The invention also pertains to a method of cloning DNA
encoding the transcriptional regulatory factors or other related
transcriptional regulatory factors. The method involves screening
for expression of the part of the binding protein with binding-site
DNA probes. Identification and cloning of the genes can also be
accomplished by conventional techniques. For example, the desired
factor can be purified from crude cellular nuclear extracts. A
portion of the protein can then be sequenced and with the sequence
information, oligonucleotide probes can be constructed and used to
identify the gene coding the factor in a cDNA library.
Alternatively, the polymerase chain reaction (PCR) can be used to
identify genes encoding transcriptional regulatory factors.
[0015] The present invention further relates to a method of
inducing expression of a gene in a cell. In the method, a gene of
interest (i.e., one to be expressed) is linked to the enhancer
sequence containing the NF-KB binding site in such a manner that
expression of the gene of interest is under the influence of the
enhancer sequence. The resulting construct includes the kappa
enhancer or a kappa enhancer portion containing at least the NF-KB
binding site, the gene of interest, and a promoter appropriate for
the gene of interest. Cells are transfected with the construct and,
at an appropriate time, exposed to an appropriate inducer of NF-KB,
resulting in induction of NF-KB and expression of the gene of
interest.
[0016] The subject invention further relates to methods of
regulating (inducing or preventing) activation of NF-KB,
controlling expression of the immunoglobulin kappa light chain gene
and of other genes whose expression is controlled by NF-KB (e.g.,
HIV).
[0017] As a result of this finding, it is now possible to alter or
modify the activity of NF-.kappa.B as an intracellular messenger
and, as a result, to alter or modify the effect of a variety of
external influences, referred to as inducing substances, whose
messages are transduced within cells through NF-.kappa.B activity.
Alteration or modification, whether to enhance or reduce
NF-.kappa.B activity or to change its binding activity (e.g.,
affinity, specificity), is referred to herein as regulation of
NF-.kappa.B activity. The present invention relates to a method of
regulating or influencing transduction, by NF-.kappa.B, of
extracellular signals into specific patterns of gene expression
and, thus, of regulating NF-.kappa.B-mediated gene expression in
the cells and systems in which it occurs.
[0018] In particular, the present invention relates to a method of
regulating (enhancing or diminishing) the activity of NF-.kappa.B
in cells in which it is present and capable of acting as an
intracellular messenger, as well as to substances or composition
useful in such a method. Such methods and compositions are designed
to make use of the role of NF-.kappa.B as a mediator in the
expression of genes in a variety of cell types. The expression of a
gene having a NF-.kappa.B binding recognition sequence can be
regulated, either positively or negatively, to provide for
increased or decreased production of the protein whose expression
is mediated by NF-.kappa.B. NF-.kappa.B-mediated gene expression
can also be selectively regulated by altering the binding domain of
NF-.kappa.B in such a manner that binding specificity and/or
affinity are modified. In addition, genes which do not normally
possess NF-.kappa.B binding recognition sequences can be placed
under the control of NF-.kappa.B by inserting an NF-.kappa.B
binding site in an appropriate position, to produce a construct
which is then regulated by NF-.kappa.B. As a result of the present
invention, cellular interactions between NF-.kappa.B and a gene or
genes whose expression is mediated by NF-.kappa.B activity and
which have, for example, medical implications (e.g.,
NF-.kappa.B/cytokine interactions; NF-.kappa.B/HTLV-I tax gene
product interactions) can be altered or modified.
[0019] Genes encoding the regulatory factors can be used to alter
cellular transcription. For example, positive acting lymphoid
specific factors involved in Ig gene transcription can be inserted
into Ig-producing cells in multiple copies to enhance Ig
production. Genes encoding tissue specific factors can be used in
conjunction with genes encoding constitutive factors, where such
combinations are determined necessary or desirable. Modified genes,
created by, for example, mutagenesis techniques, may also be used.
Further, the sequence-specific DNA binding domain of the factors
can be used to direct a hybrid or altered protein to the specific
binding site.
[0020] DNA sequences complementary to regions of the
factor-encoding genes can be used as DNA probes to determine the
presence of DNA encoding the factors for diagnostic purposes and to
help identify other genes encoding transcriptional regulatory
factors. Antibodies can be raised against the factors and used as
probes for factor expression. In addition, the cloned genes permit
development of assays to screen for agonists or antagonists of gene
expression and/or of the factors themselves. Further, because the
binding site for NF-kB in the kappa gene is clearly defined, an
assay for blockers or inhibitors of binding is available, as is an
assay to determinte whether active NF-kB is present.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1A is a schematic depiction of the 5' region of the
MOPC 41 V.sub..kappa. gene segment; FIG. 1B is an auto-radiograph
of gel electrophoresis DNA binding assays with the SfaNI-SfaNI
.kappa. promoter fragment of the MOPC 41 V.sub..kappa. gene; and
FIG. 1C is an autoradiograph of gel electrophoresis DNA binding
assay with overlapping promoter fragments.
[0022] FIG. 2 show autoradiographs of binding competition analysis
in nuclear extracts of human (a) EW and (b) HeLa nuclear
extracts.
[0023] FIG. 3 shows the results of DNase I foot printing analysis
of factor-DNA complexes.
[0024] FIG. 4A shows the nucleotide sequences of actual and
putative binding sites of IgNF-A; FIG. 4B is an autoradiograph of
binding assays with various DNA probes of three Ig transcriptional
control elements.
[0025] FIG. 5A shows the DNA sequence of the promoter region of
MODC41; FIG. 5B shows an autoradiograph of RNA transcript
generalized in whole cell extracts made from human B lymphoma cell
lines RAMOS and EW and from HeLa cells from the indicated
templates.
[0026] FIG. 6 shows an autoradiograph of RNA transcripts from
templates containing an upstream deletion.
[0027] FIG. 7 is a radioautograph of the binding of B cell nuclear
extract to the MOPC-41 .kappa. promoter region showing the IgNF-A
and IgNF-B complexes.
[0028] FIG. 8 shows the binding of T cell and nonlymphoid cell
nuclear extracts to the MOPC-41 .kappa. promoter region.
[0029] FIG. 9A shows a restriction map of the .mu.-enhancer; FIG.
9B shows an autoradiograph binding assay carried out with
.mu.-enhancer fragments.
[0030] FIG. 10A shows a restriction map of the .mu.300 fragment;
FIG. 10B shows complexes formed by various subfragments of .mu.300;
FIG. 10C is a restriction map of the relevant region; FIGS. 10E and
10D show competition binding assays with the subfragment
.mu.70.
[0031] FIGS. 11A and 11B show location of binding sites in .mu.50
and .mu.70 by the methylation interference technique; FIG. 11C
provides a summary of these results.
[0032] FIGS. 12A and 12B show an autoradiograph of binding
complexes formed with .mu.50 and .mu.70 in B-cell and non B-cell
extracts.
[0033] FIG. 13A is a restriction map of .kappa. enhancer; FIG. 13B
shows an autoradiograph of binding assays with .kappa.-enhancer
fragments; FIGS. 13C and 13D show an autoradiograph of competition
assays with .kappa.-enhancer fragments.
[0034] FIG. 14 shows location of NK-.kappa.B binding by methylation
interference experiments.
[0035] FIG. 15A shows binding analysis of NK-.kappa.B in various
lymphoid and non-lymphoid cells; FIG. 15B shows the binding
analysis of NK-.kappa.B in cells at various stages of B-cell
differentiation.
[0036] FIG. 16 shows the .lamda.gt11-EBNA-1 (.lamda.EB) recombinant
and the oriP probe.
[0037] FIG. 17 shows the sequence of the DNA probe used to screen
for an H2TF1 and NF-.kappa.B expression.
[0038] FIG. 18A shows the nucleotide sequence of the oct-2 gene
derived from cDNA and the predicted amino acid sequence of encoded
proteins.
[0039] FIG. 18B shows the nucleotide sequence of the 3' terminus
and predicted the amino acid sequence of the C-terminus derived
from clone pass-3.
[0040] FIG. 18C is a schematic representation of the amino acid
sequence deduced from oct-2 gene derived cDNA.
[0041] FIG. 19 is a schematic representation of expression plasmid
pBS-ATG-oct-2.
[0042] FIG. 20 shows amino acid sequence alignment of the DNA
binding domain of oct-2 factor with homeo-boxes of several other
genes.
[0043] FIG. 21 shows the electrophoretic mobility shift analysis of
(A) extracts derived from 10Z/3 cells before and after simulation
with bacterial lipopolysaccharide (LPS) and (B) extracts derived
from PD, an Abelson murine leukemia virus transformed pre-B cell
line before and after stimulation with LPS.
[0044] FIG. 22 shows the effect (A) of cycloheximide on LPS
stimulation of 70Z/3 cells and (B) of anisomycin on LPS stimulation
of 70Z/3 cells.
[0045] FIG. 23 shows the effect of phorbol 12-myristate-13-acetate
(PMA) on NF-B in 70Z/3 cells.
[0046] FIG. 24 shows the induction of NFKB in a human lymphoma and
in HeLa cells.
[0047] FIG. 25 is a representation of binding sites for the NF-kB
transcription factor in the immunoqlobulin kappa light chain
enhancer and the HIV enhancer. Boxes indicate the binding sites for
NF-kB (B); other regulatory sites are referred to as E1, E2 and E3
and Spl. Dots indicate guanosine residues in the kappa enhancer
whose methylation interfered with binding of NF-kB.
[0048] FIG. 26 is a characterization of the NF-kB protein. FIG. 26A
represents determination of the molecular weight of NF-.kappa.B.
Nuclear extract (300 ug of protein) from TPA-stimulated 70Z/3 pre-B
cells was denatured and subjected to reducing SDS-polyacrylamide
gel electrophoresis (SDS-PAGE). Protein in the molecular weight
fractions indicated by dashed lines was eluted and renatured prior
to mobility shift assays as described. A fluorogram of a native gel
is shown. The filled arrowhead indicates the position of a specific
protein DNA-complex only detected in the 62-55 kDa fraction with a
wild type (wt) but not with a mutant (mu) kappa enhancer fragment.
The open arrowhead indicates the position of unbound DNA-fragments.
FIG. 26B is a representation of glycerol gradient centrifugation of
NF-kB. Nuclear extract (400 ug of protein) from TPA-stimulated
70Z/3 cells was subjected to ultracentrifugation on a continuous
10-30% glycerol gradient for 20 hours at 150,000.times.g in buffer
D(+). Co-sedimented molecular weight standards (ovalbumin, 45 kDa;
bovine serum albumin, 67 kDa; immunoglobulin G, 158 kDa;
thyroglobulin monomer, 330 kDa and dimer 660 kDa) were detected in
the fractions by SDS-PAGE, followed by Coomassie Blue staining. The
distribution of NF-kB activity was determined by electrophoretic
mobility shift assays using an end-labelled kappa enhancer
fragment. Fluorograms of native gels are shown. The specificity of
binding was tested using a kappa enhancer fragment with a mutation
in the NF-kB binding site.
[0049] FIG. 27 represents detection of a cytosolic precursor of
NF-kB. FIG. 27A represents analysis of subcellular fractions for
NF-kB DNA-binding activity. Nuclear extracts (N), cytosolic (C) and
postnuclear membrane fractions (P) from control and TPA-stimulated
70Z/3 pre-B cells were analyzed by gel-shift assays. The filled
arrowhead indicates the position of the specific protein-DNA
complex seen only with a wild type but not with a mutant kappa
enhancer fragment. FIG. 27B represents activation of a cytosolic
NF-kB precursor after treatment with dissociating agents.
Subcellular fractions were treated with 25% formamide followed by
dilution and addition of 0.2% sodium desoxycholate as described.
FIG. 27C represents detection of a cytosolic NF-kB precursor after
denaturation, SDS-PAGE and renaturation of protein. Nuclear extract
(N) and cytosolic fraction (C) from unstimulated (control) 70Z/3
cells was subjected to the treatment outlined in FIG. 26A. For
details of illustration, see FIG. 27A.
[0050] FIG. 28 represents analysis of subcellular fractions for
DNA-binding activity of the TPA-inducible transcription factor
AP-1. Equal cell-equivalents of nuclear extracts (N) and cytosolic
fractions (C) from 70Z/3 and HeLa cells were used in mobility shift
assays. AP-1 specific DNA-binding activity was detected using an
end-labeled EcoRI-HindIII fragment from the yeast HIS 4 promoter
containing three binding sites for GCN4 recognized by mammalian
AP-1. The three protein-DNA complexes seen on shorter exposures of
the fluorogram are indicated by filled arrowheads and the position
of unbound DNA-fragment by an open arrowhead.
[0051] FIG. 29 represents results of electrophoretic mobility shift
analysis of subcellular fraction of 70Z/3 cells.
[0052] FIG. 30 shows the effect of denaturation and renaturation of
kB-specific DNA-binding activity in nuclear extracts and cytosolic
fractions of 70Z/3 cells.
[0053] FIG. 31 shows the effects of dissociating agents on the
activity of NF-kB in subcellular fractions of 70Z/3 cells. FIG.
31A: cell-free activation of a NF-kB precursor in the cytosolic
fraction by desoxycholate. FIG. 31B: cell-free activation of a
NF-kB precursor in the cytosolic fraction by formamide and by a
combined treatment with formamide and desoxycholate.
[0054] FIG. 32 shows the effect of TPA stimulation on the
subcellular distribution of NF-kB in 70Z/3 cells.
[0055] FIG. 33 shows the effect of TPA stimulation on the
subcellular distribution of NF-kB in HeLa cells.
[0056] FIG. 34 shows results of DNA-cellulose chromatography of
DOC-treated cytosol. Cytosol was prepared from unstimulated 70Z/3
pre-B cells and protein concentrations determined. In the
fluorograms of native gels shown, the filled arrowheads indicate
the position of the NF-kB-k enhancer fragment complex and the open
arrowheads the position of unbound DNA probe. FIG. 34A: Release of
DOC-independent NF-kB activity. Equal proportions of load,
flow-through (FT), washings, and eluates were analyzed by EMSA,
with (+) or without (-) excess DOC. The .sup.=P-radioactivity in
the NF-kB-DNA complexes was counted by liquid scintillation and the
percentage of NF-kB activity recovered in the various fractions was
calculated. FIG. 34B: Release of an inhibitory activity. NF-kB
contained in the 0.2M NaCl fraction (31 ng of protein) or NF-kB in
a nuclear extract from TPA-treated 70Z/3 cells (1.1 .mu.g of
protein) was incubated under non dissociating conditions with the
indicated amounts (in microliters) of either cytosol which was
DOC-treated but not passed over DNA-cellulose (lanes 4 to 6 and 13
to 15) or the flow-through fraction (referred to as NF-kB-depleted
cytosol; lanes 7 to 9 and 16 to 18).
[0057] FIG. 35 shows characterization of IkB and its complex with
NF-kB. In the fluorograms shown, the filled arrowheads indicate the
position of the NF-kB-DNA complex and the open arrowheads the
position of free DNA probe. FIG. 35A: For size determination of
IkB, the flow-through from the DNA-cellulose column was passed over
a G-200 Sephadex column. Portions of fractions were incubated with
NF-kB contained in nuclear extracts from TPA-stimulated 70Z/3 cells
(N TPA), and analyzed by EMSA. v, void volume; P, fraction where
remaining NF-kB precursor (FIG. 34A, lane 4) peaked after gel
filtration as assayed with excess DOC in the absence of added
NF-kB; I, fraction where the inhibiting activity peaked. FIG. 35B:
The effect of trypsin treatment on the inhibiting activity of IkB.
NF-kB in a nuclear extract (lane 1) was incubated with a fraction
containing inhibitor (lane 2) without any addition (-; lane 3) or
with bovine pancreas trypsin inhibitor (TI; lane 4), trypsin that
had been incubated with BPTI (T+TI; lane 5), or with trypsin alone
(T; lane 6). Samples were then used in the inhibitor assay. FIG.
35C: Glycerol gradient sedimentation of NF-kB and its complex with
IkB. Nuclear extract from TPA-stimulated 70Z/3 cells (N TPA) and
cytosol from unstimulated cells (C Co) were subjected to
sedimentation through a glycerol gradient. Cosedimented size
markers were ovalbumin (45 kD), BSA (67 kD), immunoglobulin G (158
kD) and thyroglobulin (330 and 660 kD). NF-.kappa.B activity was
detected in the fractions by EMSA with a wild type k enhancer
fragment (kB wt, left panels). The specificity was tested with a
mutant fragment (kB mu, right panels). The inactive cytosolic
NF-.kappa.B precursor (lower panel) was activated by formamide
treatment (Fa; middle panel).
[0058] FIG. 36 shows the reversibility and kinetics of the
inactivation of NF-kB. FIG. 36A: The effect of DOC treatment on in
vitro inactivated NF-kB. NF-kB contained in nuclear extracts from
TPA-stimulated 70Z/3 cells (N TPA; 1.1 .mu.g of protein) was
inactivated by addition of a gel filtration fraction containing IkB
(2.5 .mu.g of protein). A duplicate sample was treated after the
inhibition reaction with 0.8% DOC followed by addition of DNA
binding reaction mixture containing 0.7% NP-40. Samples were
analyzed by EMSA. In the fluorograms shown, the filled arrowhead
indicates the position of the NF-kB-DNA complex and the open
arrowhead the position of unbound DNA probe. FIG. 36B: A titration
and kinetic analysis of the in vitro inactivation of NF-kB. NF-kB
contained in nuclear extracts from TPA-treated 70Z/3 cells (2.2
.mu.g of protein) was incubated with increasing amounts (0.25 to
2.25 .mu.g of protein) of a gel filtration fraction containing IkB.
After the DNA binding reaction, samples were analyzed by EMSA. The
.sup.32 P-radioactivity in the NF-kB-DNA complexes visualized by
fluorography was determined by liquid scintillation counting. All
reactions were performed in triplicates. The bars represent
standard deviations.
[0059] FIG. 37 shows the specificity of IkB. Nuclear extracts from
unstimulated (Co) or TPA-treated cells were incubated with 5 .mu.l
of buffer G (-) or with 5 .mu.l of a gel filtration fraction
containing IkB (+) (A, in the presence of 150 mM NaCl). After DNA
binding reactions, samples were analyzed by EMSA. FIG. 37A:
Influence of IkB on the DNA binding activity of various nuclear
factors. The probes were: NF-kB; H2TF1, an oligonucleotide
subcloned into pUC containing the H2TF1 binding site from the H-2
promoter; OCTA, an oligonucleotide subcloned into pUC containing
the common binding site for the ubiquitous (upper filled arrowhead)
and lymphoid-specific (lower filled arrowhead) octamer-binding
proteins; NF-.mu.E1; NF-kE2; and AP-1, EcoRI-HindIII fragment of
the yeast HIS4 promoter containing three binding sites recognized
by mammalian AP-1/jun. In the fluorograms shown, filled arrowheads
indicate the positions of specific protein-DNA complexes. Open
arrowheads indicate the positions of uncomplexed DNA fragments.
FIG. 37B: Interaction of IkB with NF-kB from different cell lines.
The filled arrowheads indicate the positions of the NF-kB-DNA
complexes from the various cell lines and the open arrowhead
indicates the position of uncomplexed DNA probe.
[0060] FIG. 38 shows the presence of NF-kB in enucleated cells.
FIG. 38A: Phase contrast and fluoresence microscopy of enucleated
HeLa cells. From 612 cells counted on photographic prints, 63
showed nuclear staining. A representative micrograph is shown. The
arrow indicates a cell that retained its nucleus. FIG. 38B:
Analysis of complete and enucleated cells for NF-kB activity. Total
cell extracts (1.2 .mu.g of protein) from control (Co) and
TPA-treated complete and enucleated cells were analyzed by EMSA
with a labeled k enhancer fragment (kB) or HIS4 promoter fragment
(AP-1), 3 .mu.g of poly(dI-dC), 1 .mu.g of BSA, 1.2% NP-40 and the
binding buffer in a final volume of 20 .mu.l. In lanes 5 to 8,
extracts were treated with DOC followed by the addition of the DNA
binding mixture to give final concentrations of 0.8% DOC and 1.2%
NP-40. Samples were analyzed by EMSA. In the fluorograms shown, the
filled arrowheads indicate the positions of specific protein-DNA
complexes and the open arrowheads the positions of uncomplexed DNA
probe.
[0061] FIG. 39 is a diagram showing the location of positive
regulatory domain II (PRDII) within the interferon gene regulatory
element (IRE) and a comparison of the nucleotide sequences of the
PRDII site, .kappa.B site, and the H2TF1 site.
[0062] FIG. 40 shows the results of assays demonstrating that
NF-.kappa.B binds to PRDII in vitro.
[0063] FIG. 40A shows the results of mobility shift electrophoresis
assays using as radiaolabelled probe an IRE DNA fragment (IRE,
lanes 1-3, 10-14, 20-24, 30 and 31), an oligonucleotide containing
two copies of the PRDII sequence (PRDII.sub.2, lanes 4-6) or a
.kappa.B site oligonucleotide (.kappa.B, lanes 7-9, 15-19, 25-29,
32 and 33). Assays contained either no protein (0, lanes 1, 4 and
7); 5 .mu.g of unstimulated Jurkat nuclear extract (-, lanes 2, 5
and 8) or 5 .mu.g of nuclear extract from Jurkat cells stimulated
with PHA and PMA (+, lanes 3, 6, 9 and 10-29). Competitions used
either the .kappa.B oligonucleotide (.kappa.B; lanes 10-19) or the
PRDII oligonucleotide (PRD II.sub.2, lanes 20-29) in the ng amounts
shown above each lane. Cytosol (8 .mu.g) from unstimulated Jurkat
cells was tested either before (-, lanes 30 and 32) or following
treatment with 0.8% deoxycholate (DC, lanes 31 and 33).
[0064] FIG. 40B shows that mutations within PRDII that reduce
.beta.-IFN induction in vivo decrease the affinity of NF-.kappa.B
for PRDII in vitro. IRE sequences bearing the mutations indicated
(for positions refer to FIG. 39) were tested. The mutations were
previously shown to have either high (+) or low (-) inducibility.
Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, 85:1447-1451
(1988). Binding and competition were carried out, as described for
FIG. 2A, using 5 .mu.g of nuclear extract from virus infected 70Z/3
cells. Competitor was 10 ng of either the wild-type (WT) or mutant
(MUT) .kappa.B oligonucleotide (lanes 7,8).
[0065] FIG. 41 demonstrates the functional interchangeability of
PRDII and NF-.kappa.B in vivo.
[0066] FIG. 41A is an autoradiogram showing the results of CAT
assays of extracts prepared from L929 and S194 myeloma cells
transfected with the reporter genes illustrated in FIG. 41B.
[0067] FIG. 41B is a diagram of the reporter genes containing
multiple copies of PRDII or .kappa.B. Two or four PRDII sites
[(P).sub.2 and (P).sub.4, respectively] were inserted upstream of
the truncated -41 human .beta.-globin promoter/CAT fusion gene
(-41.beta.) using an oligonucleotide containing two copies of PRDII
(PRDII.times.2, as described in the Exemplification). Two copies of
a synthetic wild-type .kappa.B site, or mutant .kappa.B site (B and
B.sup.-, respectively) were inserted upstream of the mouse c-fos
promoter/CAT fusion gene in which the promoter was truncated to
nucleotide -56 (.DELTA.56).
[0068] FIG. 42 demonstrates that virus infection activates binding
of NF-.kappa.B and gene expression in B lymphocytes and
fibroblasts.
[0069] FIG. 42A represents the results of a binding assay which
shows complexes formed with the Ig .kappa.B site using 5 .mu.g of
nuclear extract from unstimulated cells (lanes 1, 9 and 17) and 5
.mu.g (lanes 2-6, 10-14 and 18-22) or 1 .mu.g (lanes 7, 8, 15, 16,
23 and 24) of nuclear extract from cells after virus infection.
Extracts were prepared from Namalwa cells (lanes 1-8), 70Z/3 cells
(lanes 7-16), and L929 cells (lanes 17-28). Competitions used
either 5 or 20 ng of the wild-type (WT) or mutant (MUT) .kappa.B
oligonucleotide. GTP stimulation was tested by addition directly to
the binding assay to a final concentration of 3 mM. Cytosol was
obtained from L929 cells either prior to (lanes 25, 26) or after
(lanes 27, 28) viral treatment and tested before (-) and after (DC)
treatment with deoxycholate.
[0070] FIG. 42B presents a comparison of methylation interference
footprints of virus-induced complexes from Namalwa and L929 cell
extracts with NF-.kappa.B complexes derived from PHA/PMA-stimulated
Jurkat cells. The cleavage pattern resulting from methylation of
guanine or adenine residues is shown for DNA extracted from the
free probe (F) or the DNA-protein complex (B) observed following
mobility shift electrophoresis. The sequence of the KB site
presented at the sides and methylated residues that interfere with
binding are indicated by a solid circle.
[0071] FIG. 42C presents results of Northern blot analyses of 70Z/3
cells treated with various inducers. The upper panel shows the
induction (from 0 to 20 hr as indicated) of .kappa. (.kappa.) mRNA
by treatment with 50 ng/ml PMA (PMA, lanes 1-4), 15 .mu.g/ml LPS
(LPS, lanes 5-8) or Sendai virus (V, lanes 9-12). The lower panel
shows the same blot hybridized to a .beta.-IFN DNA fragment.
[0072] FIG. 43 is the nucleotide sequence and the amino acid
sequence of IkB-.varies..
Clone Deposits
[0073] Clones .lamda.h3 and .lamda.3-1 were deposited (Feb. 12,
1988) at the AMerican Type Culture Collection (12301 Parklawn
Drive; Rockville, Md. 20852), under the terms of the Budapest
Treaty. They were assigned ATCC Designationals 67629 and 67630,
respectively. Upon issue of a U.S. patent from the subject
application, all restrictions upon the availability of these clones
will be irrevocably removed.
DETAILED DESCRIPTION OF THE INVENTION
[0074] The present invention relates to the identification,
isolation and characterization of human transcriptional regulatory
factors, to genes encoding the factors, methods of isolating DNA
encoding transcriptional regulatory factors and the encoded
factors, uses of the DNA, encoded factors, and antibodies against
the encoded factors, inhibitors of the transcriptional regulatory
factors. In particular, it relates to the transcriptional
regulatory factor NF-kB (previously designated Kappa-3); its
inhibitor; IkB, DNA encoding each, methods of altering interactions
of NF-kB and IkB and methods of regulating the activity of NF-kB.
As described herein, NF-kB, was initially thought to be a B-cell
specific factor involved in immunoglobulin gene regulation and has
since been shown to be inducible in many, if not all, cell types
and to act as an intracellular transducer or mediator of a variety
of external influences. The following is a description of the
discovery and characterization of four transcriptional regulatory
factors, assessment of the function of NF-kB and its role, in many
cell types, as an intracellular mediator or transducer of a variety
of external influences, discovery of the NF-kB inhibitor IkB and
demonstration that NF-kB and IkB exist in the cytoplasm as a
NF-kB-IkB complex whose dissociation results in activation of NF-kB
and its translocation into the nucleus. The following is also a
description of the uses of the genes, regulatory factors and
related products and reagents.
[0075] The transcriptional regulatory factors described herein can
be broadly classified as constitutive (non-lymphoid) or tissue
(lymphoid) specific. All factors are believed to play a role in
transcription of immunoglobulin (Ig) genes. Constitutive factors,
which are present in non-lymphoid cells, may have a role in
regulating transcription of genes other than Ig genes;
lymphoid-specific factors might also play a role in regulating
transcription of genes in addition to Ig genes.
[0076] Four transcriptional regulatory factors were identified, as
described below and in the Examples. The presence of constitutive
factors rendered the detection of tissue specific factors more
difficult. A sensitive DNA binding assay, described below, was
employed in all studies to facilitate detection of tissue specific
factors.
[0077] The characteristics of the transcriptional regulatory
factors IgNF-A, E, IgNFB and Kappa-3 (or NF-.kappa.B) are
summarized in Table 1 below. TABLE-US-00001 TABLE 1 CHARACTERISTICS
OF FOUR TRANSCRIPTIONAL REGULATORY FACTORS Ig Regulatory Sequence
Factor Promoter Enhancer Designation V.sub.H V.sub..kappa. U.sub.E
K.sub.E Lymphoid Nonlymphoid IgNF-A + + + - + + (NF-A1) E factors -
- + + + + IgNF-B + + + - + - (NF-A2) Kappa-3 - - - + + -
(NF-.kappa.B)
Factor Ig NF-A
[0078] As indicated in Table 1, IgNF-A binds to Ig regulatory DNA
elements in the region of mouse heavy and kappa light chain gene
promoters and also to mouse heavy chain gene enhancer. DNAase I
footprint analysis indicates that the binding is mediated by the
octamer sequence (ATTTGCAT) which occurs in mouse and human light
chain gene promoters approximately 70 base pairs upstream from the
site of initation and in heavy chain gene promoters at about the
same position (in inverted sequence).
[0079] Deletion or disruption of the IgNF-A binding site in Ig
promoters significantly reduces the level of accurately initiated
transcripts in vivo. See, e.g., Bergman, Y. et al. PNAS USA 81
7041-7045 (1984); Mason, J. O. et al. Cell 41 479-487 (1985). As
demonstrated in Example 2, this also occurs in an in vitro
transcription system IgNF-A appears to be a positive transacting
factor.
[0080] The IgNF-A binding site appears to be a functional component
of the B-cell-specific Ig promoter. For example, sequences from
this promoter containing the IgNF-A binding site specify accurate
transcription in B-cells but not in Hela cells. IgNF-A however, may
not be restricted to B-cells because a factor was detected in Hela
cell extracts which generated complexes with similar mobilities and
sequence specificity (as tested by competition analysis).
Interestingly, the Ig octamer motif in the IgNF-A binding site has
recently been shown to be present in the upstream region (about 225
bp) of vertebrate U1 and U2 snRNA genes. More importantly, this
element dramatically stimulates (20 to 50 fold) transcription of U2
snRNA genes in Xenopus oocytes. Therefore, IgNF-A may be a
constitutive activator protein that also functions in the high
level expression of U1 and U2 snRNA genes in vertebrate cells.
[0081] The presence of an IgNF-A binding site in the mouse heavy
chain enhancer suggests the additional involvement of IgNF-A in
enhancer function. It is known that deletion of an 80 bp region of
the enhancer containing the putative binding site reduces activity
approximately tenfold. The occupation of the binding site, in vivo,
has been inferred from the fact that the G residue in the enhancer
octamer is protected from dimethyl sulfate modification only in
cell of the B lineage. Furthermore, IgNF-A also binds in a
sequence-specific manner to the SV40 enhancer (J. Weinberger,
personal communication), which contains the Ig octamer motif,
thereby strengthening the notion that the factor participates in
enhancer function.
E Factors
[0082] The E factors are constitutive factors which bind to the Ig
light and heavy chain enhancer.
Factor Ig NF-B
[0083] Factor IgNF-B binds to the same regulatory elements as
IgNF-A. Indeed, the binding site for IgNF-B appears to be the
octamer motif. I-n contrast to IgNF-A, IgNF-B is lymphoid cell
specific. It was found in nuclear extracts from pre-B, mature B and
myeloma cell lines and in nuclear extracts from some T cell
lymphomas. IgNF-B was undetectable in nuclear extracts of several
non-lymphoid cells. The gene encoding Ig NF-B has been cloned
(oct-2 clone below) and its nucleotide sequence has been determined
(See FIG. 18a).
Factor NF-.kappa.B
[0084] NF-.kappa.B (previously referred to as Kappa-3) binds only
to the Ig light chain enhancer. The binding is mediated by the
sequence TGGGATTCCCA. The factor initially was characterized as
lymphoid cell specific and also as lymphoid stage specific; that
is, work showed that it is expressed only by mature B-cells. Thus,
it is a marker of B cell maturation (e.g. the factor can be used to
type B cell lymphomas). Additional work, described in Examples 8-15
in particular, has shown that NF-kB is an inducible factor in
cells, both pre-B and non pre-B, in which it is not constitutively
present (Example 8), that it is present in the cytoplasm as an
inactive precursor (Examples 10 and 11), and that the inactive
precursor is a complex of NF-kB and an inhibitor, referred to as
IkB, which converts NF-kB to an inactive form in a reversible
saturable and specific reaction. Dissociation of the complex
results in activation of NF-kB (appearance of NF-kB binding
activity) and translocation of the NF-kB into the nucleus.
[0085] As discussed below, it is now evident that this DNA binding
protein, initially thought to be a B-cell specific factor and
subsequently implicated in gene regulation in T lymphocytes, is
present in many, if not all, cell types and that it acts as an
important intra-cellular transducer or mediator of a variety of
external influences. That is, NF-.kappa.B is now known to be
involved in a variety of induction processes in essentially all
types of cells and is thought to participate in a system through
which multiple induction pathways work, in much the same manner as
"second messengers" (e.g., cAMP, IP.sub.3) act, resulting in
transduction of a variety of extra-cellular signals into specific
patterns of gene expression. Different cell types and different
genes respond to this one signal, which serves as a central
"control", whose activity can be altered by means of the present
invention. As used, the terms altering and modifying mean changing
the activity or function of NF-.kappa.B in such a manner that it
differs from the naturally-occurring activity of NF-.kappa.B under
the same conditions (e.g., is greater than or less than, including
no activity, the naturally-occurring NF-.kappa.B activity: is of
different specificity in terms of binding, etc.).
[0086] It has been shown that NF-.kappa.B participates in gene
expression (e.g., cytokine gene expression) which is activated by a
specific influence or extracellular signal (e.g., infection by a
virus) in many, if not all types of cells. In particular, it has
now been demonstrated that NF-.kappa.B has a central role in virus
induction of human .beta.-interferon (.beta.-IFN) gene expression.
Virus infection has been shown to potently activate the binding and
nuclear localization of NF-.kappa.B and, in pre-B lymphocytes, to
result in expression of both the .beta.-IFN gene and the Ig kappa
gene. The wide variety of cell types in which .beta.-interferon can
be induced and the divergent set of gene induction processes which
involve NF-.kappa.B provide evidence that NF-.kappa.B plays a broad
role in gene regulation as a mediator of inducible signal
transduction.
[0087] The following is a description and exemplification of work
(Example 15) which clearly demonstrates the role of NF-.kappa.B in
virus-induced human .beta.-IFN gene expression; of the evidence
that there is a single NF-.kappa.B which serves many roles in many
different cell types and how it acts as an intracellular messenger
in a variety of different gene induction processes, particularly
several which have important effects on cell physiology in health
and disease; and of the use of methods and compositions of the
present invention.
Role of NF-.kappa.B in Cytokine Gene Regulation
[0088] The role of NF.kappa.B as a mediator or messenger in
cytokine gene regulation has been demonstrated, as explained in
greater detail in the Exemplification, through assessment of the
viral induction of human .beta.-IFN gene expression. The human
.beta.-IFN gene has been shown to be positively regulated by
NF-.kappa.B, which was, in turn, shown to interact with a virus
inducible element, called PRDII, in the .beta.-IFN gene. As
described below, NF-.kappa.B has been shown to be highly induced in
lymphoid and non-lymphoid cells by either virus infection or
treatment of cells with double-stranded RNA [poly (rI:rC)]. It has
also been shown to bind specifically to PRDII, which is one of two
positive regulatory domains of the interferon gene regulatory
element (IRE) which, together with the release of a negative
influence over a site called NRDI, are necessary and sufficient for
virus induction of the .beta.-IFN gene.
[0089] It is known that the human .beta.-interferon (.beta.-IFN)
gene is highly inducible by virus or synthetic double-stranded RNA
poly(rI:rC) in many, if not all, cell types. DeMaeyer, E. and J.
DeMaeyer-Guignard, "Interferons and Other Regulatory Cytokines",
John Wiley and Sons, New York (1988). Extensive characterization of
the .beta.-IFN gene promoter has revealed a complex arrangement of
positive and negative regulatory elements. Taniguchi, T., Ann. Rev.
Immunol., 6:439-464 (1988). A 40 base pair DNA sequence designated
the IRE (Interferon gene Regulatory Element) is both necessary and
sufficient for virus induction. Goodbourn et al., Cell, 41: 509-520
(1985). The IRE contains two distinct positive regulatory domains
(PRDI and PRDII) and one negative regulatory domain (NRDI).
Goodbourn et al., Cell, 45:601-610 (1986); Goodbourn, S. and T.
Maniatis, Proc. Natl. Acad. Sci. USA, 85:1447-1451 (1988). Virus
induction apparently requires cooperative interactions between PRDI
and PRDII. Goodbourn, S. and T. Maniatis, Proc. Natl. Acad. Sci.
USA, 85:1447-1451 (1988). Single copies of PRDI or PRDII alone are
not sufficient for virus or poly(rI:rC) induction, but two or more
copies of PRDI (Fujita et al., Cell, 49:357-367 (1987)) or PRDII
(Fan, C. M. and T. Maniatis, EMBO J., 8:101-110 (1989)) confer
inducibility on heterologous promoters.
[0090] The PRDII sequence binds a nuclear factor, designated
PRDII-BF, that is present in extracts from both uninduced and
induced MG63 cells. Keller, A. and T. Maniatis, Proc. Natl. Acad.
Sci. USA, 85:3309-3313 (1988). A cDNA clone encoding a PRDII
binding factor (designated PRDII-BF1) was isolated. DNA sequence
analysis revealed that PRDII-BF1 is similar, if not identical, to a
cDNA clone encoding a protein that binds to related sites in both
the MHC class I H-2K.sup.b gene and the Ig .kappa. enhancer. Singh
et al., Cell 52:415-423 (1988). This observation suggested that
PDRII might be functionally related to the H2-K.sup.b and .kappa.
enhancer sites.
[0091] The site in the H-2 K.sup.b promoter is required for its
constitutive and interferon-induced expression and binds a factor
designated H2TF1 and possibly similar factors KBF1 and EBP-1 which
are constitutively expressed in most cell types. (Baldwin, A. S.
and P. A. Sharp, Proc. Natl. Acad. Sci. USA, 85:723-727 (1988);
Yano et al., EMBO J., 6:3317-3324 (1988); Clark et al., Genes &
Dev., 2:991-1002 (1988)). The Ig .kappa. enhancer site, termed
.kappa.B, binds NF-.kappa.B, which is required for K enhancer
function. Sen, R. and D. Baltimore, Cell, 46:705-716 (1986);
Atchison, M. and R. P. Perry, Cell, 48:121-128 (1987); Lenardo, M.
et al., Science, 236:1573-1577 (1987). The transcriptional
activities and in vitro binding of the .kappa.B site and PRDII were
compared and results showed that the two regulatory sequences are
interchangeable in vivo, and that PRDII specifically binds
NF-.kappa.B in vitro. A binding activity indistinguishable from
NF-.kappa.B in nuclear extracts from virus-infected cells was also
identified. Viral treatment of 70Z/3 pre-B lymphocytes induced
.kappa. gene expression as well as .beta.-IFN gene expression.
These results show that NF-.kappa.B plays an important role in the
virus induction of the .beta.-IFN gene and indicate that
NF-.kappa.B acts similarly to second messenger systems in that it
transduces a variety of extracellular signals into specific
patterns of gene expression.
[0092] It has been shown, by all available criteria, that the
.kappa.B and the PRDII DNA elements--one from the Ig .kappa. light
chain gene and one from the .beta.-IFN gene--are interchangeable.
They drive transcription of reporter genes in response to the same
set of inducers, cross-compete for binding in vitro and have
closely-related DNA sequences. Another indication of the identity
of the two elements is that release of NF-.kappa.B from a complex
with its inhibitor, I-.kappa.B, correlates with the induction of
.beta.-IFN in L929 cells and that, conversely, a .beta.-IFN inducer
(Sendai virus) induces .beta. gene transcription in 70Z/3 cells.
This relationship is strengthened by the correlation between the
ability of mutations in PRDII to decrease .beta.-IFN gene
inducibility in vivo and reduce binding to NF-.kappa.B in vitro.
Evidence that double-stranded RNA induces a factor resembling
NF-.kappa.B has also been recently obtained by Visvanathan, K. V.
and S. Goodbourn, EMBO J., 8:1129-1138 (1989).
[0093] Results described in the Exemplification strongly imply that
.beta.-IFN gene expression is activated, at least in part, by
induction of NF-.kappa.B. The ability of NF-.kappa.B to be
activated by a protein synthesis-independent pathway is consistent
with the fact that induction of .beta.-IFN is not blocked by
cycloheximide. In fact, the .beta.-IFN gene, like the .kappa. gene,
can be induced by cycloheximide. Ringold et al., Proc. Natl. Acad.
Sci. USA, 81:3964-3968 (1984); Enoch et al., Mol. Cell Biol.,
6:801-810 (1987); and Wall et al., Proc. Natl. Acad. Sci. USA,
83:295-298 (1986). In addition to the interaction between
NF-.kappa.B and PRDII, virus induction of .beta.-IFN involves
activation through PRDI and the release of repression at NRDI. The
present data revealing a role for NF-.kappa.B in .beta.-IFN
regulation is a striking example of how it is used in many, if not
all, cell types.
Evidence for the Existence of a Single NF-.kappa.B
[0094] As shown in Table 1, sites present in a variety of genes
form a mobility shift electrophoretic complex which resembles
NF-.kappa.B, as reported by Sen, and Baltimore, upon incubation of
the Ig .kappa. enhancer with B-cell extracts, Sen, R. and D.
Baltimore, (Cell 46:705-716 (1986)). The biochemical evidence
suggests the involvement of a single NF-.kappa.B in all cell types
and not a family of factors in which individual members are
specifically inducible in particular cell types.
[0095] This evidence includes the fact that purification of
NF-.kappa.B to homogeneity from both human and bovine sources
yields a single polypeptide chain of approximately 44 to 50 kD
(although this could be a fragment of a larger protein). Kawakami
et al., Proc. Natl. Acad. Sci. USA 85:4700-4704 (1988); and Lenardo
et al., Proc. Natl. Acad. Sci. USA, 85:8825-8829 (1988).
NF-.kappa.B adopts an oligomeric structure in solution; based on
the size of the complex, it exists either as a homodimer or
associates with a heterologous subunit of approximately equal
molecular weight. Baeuerle, P. et al., Cold Spring Harbor
Symposium, 53:789-798 (1988); Lenardo et al., Proc. Natl. Acad.
Sci. USA, 85:8825-8829 (1988). NF-.kappa.B has the unique property
that nucleoside triphosphates dramatically stimulate its ability to
bind DNA in vitro. Lenardo et al., Proc. Natl. Acad. Sci. USA,
85:8825-8829 (1988). NF-.kappa.B is further distinguished by the
fact that it can be released as an active binding species from an
inactive cytosolic form that is completed with I.kappa.B. Baeuerle,
P. and D. Baltimore, Cell, 53:211-217 (1988); Baeuerle, P. and D.
Baltimore, Science, 242:540-545 (1988). All of these features are
shared by the NF-.kappa.B complex irrespective of the cell-type
from which it is derived.
[0096] More importantly, no differences in binding specificity have
been detected between the NF-.kappa.B complexes from different cell
types. That is, the NF-.kappa.B complex induced in T cells has no
preference for sites from genes activated in T cells rather than
those from genes activated in B cells and vice-versa, Lenardo et
al., Proc. Natl. Acad. Sci. USA, 85:8825-8829 (1988). An identical
pattern of base contacts is characteristic of complexes between DNA
and NF-.kappa.B from different cell types, further decreasing the
possibility that the NF-.kappa.B complex in different cell types is
due to heterogeneous proteins.
[0097] It is clear that NF-.kappa.B binding sites are recognized by
other obviously distinct transcription factors. The best examples
are the H2-TF1 and KBF-1 proteins, which bind to an
NF-.kappa.B-like site in the H2-K.sup.b MHC class I gene (Baldwin,
A. S. and P. A. Sharp, Mol. Cell. Biol., 7:305-313 (1987); and Yano
et al., EMBO J., 6:3317-3324 (1987)). However, these factors are
constitutively active nuclear binding proteins in many different
cell types and no evidence implicates them in inducible gene
expression. Other examples include the factor EBP-1 which binds to
the SV40 .kappa.B site but has a different molecular size than
NF-.kappa.B and is also not inducible (Clark et al., Genes &
Development, 2:991-1002 (1988); HIVEN86A, an 86 kD factor
identified in activated T cell extracts by DNA affinity
chromatography (Franza et al., Nature, 330:391-395 (1987)); and
finally, a protein encoded by a cDNA (.lamda.h3 or PRDI1-BF1)
selected from .lamda.gt11, expression libraries (Singh et al.,
Cell, 52:415-523 (1988)). Recent evidence has made it unlikely that
the .lamda.h3 clone encodes NF-.kappa.B because several cell types
that have abundant expression of NF-.kappa.B lack the transcript
for .lamda.h3. Taken together these findings indicate that there is
only one NF-.kappa.B that serves multiple roles in many different
cell types.
NF-.kappa.B Acts as an Intracellular Messenger
[0098] A salient feature of the induction of NF-.kappa.B is that it
takes place in the absence of new protein synthesis. Sen, R. and D.
Baltimore, Cell, 47:921-928 (1986). In fact, the protein synthesis
inhibitor cycloheximide can alone activate NF-.kappa.B. Sen, R. and
D. Baltimore, Cell, 47:921-928 (1986). It appears, therefore, that
NF-.kappa.B induction involves the conversion of a pre-existing
precursor into an active form.
[0099] Inactive NF-.kappa.B is complexed with a labile inhibitor
protein, I-KB. Cytosolic extracts from uninduced cells can be
treated in vitro with dissociating agents such as formamide and
deoxycholate to unmask very high levels of NF-.kappa.B activity.
Baeuerle, P. and D. Baltimore, Cell, 53:211-217 (1988). These
treatments by and large do not work on nuclear extracts from
uninduced cells. Conversely, NF-.kappa.B activated normally in the
cell is detected in nuclear but not cytosolic extracts implying a
nuclear translocation step following activation in vivo. The
inhibitory activity has been shown to be due to a protein of 68 kD
that can be separated chromatographically from NF-.kappa.B.
Baeuerle, P. and D. Baltimore, Science, 242:540-545 (1988). This
protein is able to inhibit the binding of NF-.kappa.B but not other
DNA-binding proteins and has therefore been named "I-.kappa.B"
(Inhibitor-.kappa.B).
[0100] Notably, crude preparations of I-.kappa.B efficiently
inhibit binding of NF-.kappa.B derived from mature B cells or other
cell-types that have been induced. Baeuerle, P. and D. Baltimore,
Science, 242:540-545 (1988). The implicaton is that activation of
NF-.kappa.B involves a modification of 1-KB and not NF-.kappa.B.
This distinguishes NF-.kappa.B activation from a similar phenomenon
involving the glucocorticoid receptor. In the latter, a direct
interaction of glucocorticoid with the receptor is required to
release it from a cytoplasmic complex with the heat shock protein,
hsp90. Picard, D. and K. R. Yamamoto, EMBO J., 6:3333-3340
(1987).
[0101] The model which ties together these observations is that
NF-.kappa.B is initially located in the cytoplasm in a form unable
to bind DNA because it is complexed with I-.kappa.B. Various
inducers then cause an alteration in I-.kappa.B allowing
NF-.kappa.B to be released from the complex. Free NF-.kappa.B then
travels to the nucleus and interacts with its DNA recognition sites
to facilitate gene transcription. The complex formation of
NF-.kappa.B with I-.kappa.B appears to be rapidly and efficiently
reversible in vitro which lends itself well to the shut-off as well
as turn-on of NF-.kappa.B binding. Moreover, this model resolves a
major question in signal transduction: NF-.kappa.B, like the
glucocorticoid receptor, acts as a messenger to transmit the gene
induction signal from the plasma membrane to the nucleus.
[0102] The model presented above is not unlike the well known role
of cAMP as a second messenger in the action of many hormones; in
the case of cAMP, the first messenger is the hormone itself. (see,
e.g., Pastan, Sci. Amer., 227:97-105 (1972)). The essential
features of the cAMP model are that cells contain receptors for
hormones in the plasma membrane. The combination of a hormone with
its specific membrane receptor stimulates the enzyme adenylate
cyclase which is also bound to the plasma membrane. The concomitant
increase in adenylate cyclase activity increases the amount of cAMP
inside the cell which serves to alter the rate of one or more
cellular processes. An important feature of this second messenger
or mediator model is that the hormone (the first messenger) need
not enter the cell.
[0103] The participation of NF-.kappa.B in gene expression that is
activated in specific cells by specific influences calls for a
level of regulation in addition to the inducibility of NF-.kappa.B
binding. How is "cross-talk" between the various paths employing
NF-.kappa.B avoided? Factors acting upon other sequences within a
transcriptional control element appear to govern the response to
the NF-.kappa.B signal, as described herein for .beta.-IFN. Studies
of .beta.-IFN expression have shown that virus induction works
through three events: two virus-inducible positive signals, one of
which is NF-.kappa.B, and the release of a single negative
regulator. The two positive signals work through distinct DNA sites
(PRDI and PRDII), but must act together to facilitate
transcription. Either site alone is not inducible.
[0104] The theme of multiple signals that generate specificity is
further supported by studies of the Ig .kappa. gene and the IL-2
receptor gene. The NF-.kappa.B site from the .kappa. light chain
enhancer alone on a short oligonucleotide will stimulate
transcription in B and T lymphocytes as well as in non-lymphoid
cells. Pierce, J. W. et al., Proc. Natl. Acad. Sci. USA,
85:1482-1486 (1988). Its function depends solely on the presence of
NF-.kappa.B. By contrast, the entire .kappa. enhancer is inducible
only in B lymphocytes and is unresponsive to NF-.kappa.B in other
cell types. The restricted response to NF-.kappa.B by the .kappa.
enhancer has now been Attributed to a repressor sequence. The
repressor sequence resides in the enhancer some distance away from
the NF-.kappa.B binding site and acts to suppress transcriptional
effects of NF-.kappa.B in non-B cell types. The activation of the
IL-2 receptor gene specifically in T lymphocytes is attained by a
slightly different means. Full induction of this gene depends on
NF-.kappa.B as well as a positively-acting sequence immediately
down-stream. The downstream element has now been found to bind a T
cell specific protein called NF-ILT. Though NF-ILT is not itself
inducible, its presence only in T cells seems to contribute to T
cell specific induction of the IL-2 receptor gene.
Role of NF-.kappa.B in Other Inducible Systems
[0105] Recently, NF-.kappa.B has been implicated in several other
inducible systems. For example, NF-.kappa.B is induced in T-cells
by a trans-activator (tax) of HTLV-1 or by PMA/PHA treatment and
thereby activates the IL-2 receptor .alpha. gene and possibly the
IL-2 gene. Bohnlein et al., Cell, 53:827-836 (1988); Leung, K. and
G. Nabel, Nature, 333:776-778 (1988); Ruben et al., Science,
241:89-92 (1988); Cross et al., Science, (1989); and Lenardo et
al., Proc. Natl. Acad. Sci. USA, 85:8825-8829 (1988). NF-.kappa.B
also appears to take part in gene activation during the acute phase
response of the liver. Edbrooke et al., (1989). Results described
here suggest that inducibility of NF-.kappa.B plays a prominent
role in interactions between cytokines. IL-1 and TNF-.alpha.
activate NF-.kappa.B binding and both have been shown known to
induce .beta.-IFN. Osborn et al., Proc. Natl. Acad. Sci. USA,
86:2336-2340 (1989); and DeMaeyer, E. and J. DeMaeyer-Guignard,
"Interferons and Other Regulatory Cytokines", John Wiley and Sons,
New York (1988). Finally, NF-.kappa.B has been shown to play a role
in the transcription of human immunodeficiency virus (HIV). Nabel,
G. and D. Baltimore, Nature, 326:711-713 (1987). Significantly,
herpes simplex virus has recently been shown to increase HIV LTR
transcription through NF-.kappa.B/core sequences. Gimble et al., J.
Virol., 62:4104-4112 (1988). Thus, NF-.kappa.B induction may lead
to the propagation of HIV in cells infected with other viruses.
[0106] NF-.kappa.B is unique among transcription regulatory
proteins in its role as a major intracellular transducer of a
variety of external influences in many cell types. In the cases
studied thus far, it appears that the actual target of induction is
I-.kappa.B, which becomes modified to a form that no longer binds
to NF-.kappa.B. Baeuerle, P. and D. Baltimore, Science, 242:540-545
(1988). The released NF-.kappa.B then displays DNA binding activity
and translocates to the nucleus.
Role of NF-kB in HIV Expression
[0107] Treatment of latently HIV-infected T-cells with phorbol
ester (12-O-tetradecanoylphorbol 13-acetate; TPA) and with
phytohaemaglutinin (PHA) results in the onset of virus production.
Harada, S. et al., Virology, 154:249-258 (1986); Zagury, D. J. et
al., Science, 232:755-759 (1986). The same treatments induce NF-kB
activity in the human T-lymphoma cell line Jurkat. Sen, R. and D.
Baltimore, Cell, 47:921-928 (1896). This correlation and the
finding that two NF-kB binding sites are present upstream of the
transcriptional start site in the HIV enhancer, (FIG. 25) suggested
a direct role for NF-kB in the activation of the viral enhancer, an
event ultimately leading to the production of virus. Nabel, G. and
D. Baltimore, Nature, 326:711-713 (1987). This possibility was
tested by transient transfection of a plasmid containing an HIV
LTR-controlled CAT gene into a human T-lymphoma cell line. Nabel,
G. and D. Baltimore, Nature, 326:711-713 (1987). The viral
cis-acting elements rendered the transcriptional activity of the
CAT gene responsive to TPA/PHA treatment of cells. This inducible
transcriptional stimulation of the CAT gene was completely
dependent on intact binding sites for NF-kB in the HIV enhancer
because mutation of the two binding sites abolished inducibility. A
protein-DNA complex with a fragment of the HIV enhancer containing
the two NF-kB binding sites was observed in mobility shift assays
only with nuclear extracts from TPA/PHA-stimulated T-cells and not
with control extracts. These observations provided strong evidence
that HIV expression in latently infected T-cells is induced by the
same transcription factor that regulates kappa gene expression,
NF-kB. A precursor of NF-kB is constitutively present in T-cells.
Its activity can be induced by a treatment that mimicks antigenic
T-cell activation and, after induction, NF-kB is able to bind to
and subsequently enhance the activity of HIV transcriptional
control elements. Thus, it is reasonable to conclude that NF-kB is
the physiological trans-activator responsible for initial
expression of dormant HIV-DNA following stimulation of
T-lymphocytes.
[0108] Other factors have also been implicated in the control of
HIV expression including the HIV-encoded tat-III protein, the
cellular transcription factor Spl, and viral proteins encoded by
the ElA gene of adenovirus and the ICPO gene of the Herpes Simplex
Virus. Muesing, M. A. et al., Cell, 48:691-701 (1987); Jones, K. A.
et al., Science, 232:755-759 (1986); Gendelman, H. E. et al., Proc.
of the Natl. Acad. of Sc., USA, 83:9759-9763 (1986); Nabel, G. J.
et al., Science (1988); Rando, R. F. et al., Oncogene, 1:13-19
(1987); Mosca, J. D. et al., Nature, 325:67-70 (1987). It is
doubtful whether the tat-III and Spl proteins are responsible for
an initial induction of HIV expression. Although the tat-III
protein functions as a strong positive feedback regulator of HIV
expression, full expression of the tat-III protein appears to
depend on NF-kB. Muesing, M. A. et al., Cell, 48:691-701 (1987);
Nabel, G. and D. Baltimore, Nature, 326:711-713 (1987). It is
unlikely that Spl initiates HIV expression because it is
constitutively active. Dynan, W. S. and R. Tjian, Cell, 32:669-680
(1983). The viral ElA and ICPO gene products might lead to
induction of HIV expression. This, however, is independent of
T-cell activation by antigenic stimulation and of NF-kB, as shown
by cotransfection experiments into human T-lymphoma cells of
plasmids with an HIV enhancer-controlled CAT gene and plasmids
encoding the viral genes. The increase in CAT activity induced by
the viral gene products was unchanged when the NF-kB binding sites
in the HIV enhancer were inactivated by mutation.
Improved DNA Binding Assay with Enhanced Sensitivity for
Identification of Regulatory Factors
[0109] The transcriptional regulatory factors described above were
identified in extracts of cellular nuclear protein by means of an
improved gel electrophoresis DNA binding assay with enhanced
sensitivity. This improved assay is a modification of an original
assay based on the altered mobility of protein-DNA complexes during
gel electrophoresis. In the improved assay of this invention, the
simple alternating copolymer, duplex poly(dI-dC)-poly(dI-dC) was
used as the competitor DNA species. The use of this copolymer as
competitor resulted in an enhancement of sensitivity for detection
of specific protein-DNA complexes. The original assay has been
extensively employed in equilibrium and kinetic analyses of
purified prokaryotic gene regulatory proteins. See, e.g., Fried, M.
and Crothers, D. M., Nucleic Acid Res. 9 6505-6525 (1981); Garner,
M. M. and Revzin A., Nucleic Acids Res. 9 3047-3060 (1981). More
recently it has been used to identify and isolate a protein that
binds to satellite DNA from a nuclear extract of eukaryotic cells
(monkey cells). See Strauss, R. and Varshavsky, A., Cell 37 889-901
(1984). In the latter study an excess of heterologous competitor
DNA (E. coli) was included with the specific probe fragment to bind
the more abundant, sequence non-specific DNA binding proteins in
the extract.
[0110] The assay is performed essentially as described by Strauss
and Varshavky, supra, except for the addition of the
poly(dI-dC)-poly(dI-dC). An extract of nuclear protein is prepared,
for example, by the method of Dingnam, J. D. et al., Nucleic Acids
Research 11:1475-1489 (1983). The extract is incubated with a
radiolabelled DNA probe (such as an end-labeled DNA probe) that is
to be tested for binding to nuclear protein present in the extract.
Incubation is carried out in the presence of the
poly(dI-dC)-poly(dI-dC) competitor in a pysiological buffer. DNA
protein complexes are resolved from (separated from) free DNA
probes by electrophoresis through a polyacrylamide gel in a low
ionic strength buffer and visualized by autoradiography.
[0111] In a preferred embodiment of the method, protein samples
(about 10 .mu.g protein) are incubated with approximately 10,000
cpm (about 0.5 .mu.g) of an end-labeled P double-stranded DNA probe
fragment in the presence of about 0.8-4 .eta.g
poly(dI-dC)-poly(dI-dC) (Pharmacia) in a final volume of about 25
.mu.l. Incubations are carried out at 30.degree. for 30-60 minutes
in 10 mM Tris HCl (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA.
Protein-DNA complexes are resolved on low-ionic strength
polyacrylamide gels. Samples are layered onto low ionic-strength 4%
polyacrylamide gels (0.15.times.16 cm; acrylamide:bisacrylamide
weight ratio of 30:1). Gels are pre-electrophoresed for about 30
min at 11 V/cm in buffer consisting of 6.7 mM Tris HCl, (pH 7.5),
3.3 mM NaOAc, and 1 mM EDTA. Buffer is recirculated between
compartments. Gels are electrophoresed at the same voltage at room
temperature, transferred to Whatman 3 MM, dried and
autoradiographed.
[0112] The enhanced sensitivity of the assay of the present
invention is evident in the initial work which led to
identification of the factor IgNF-A. A radiolabelled SfaNI-SfaNI
DNA fragment derived from the upstream region of the MOPC 41
.kappa. light chain gene (FIG. 1a) was incubated with a nuclear
extract of a human B cell line, in the absence or in the presence
of E. coli chromosomal DNA or poly(dI-dC)-poly(dI-dC). The
resulting complexes were resolved from the free fragment by
electrophoresis through a low ionic strength, non-denaturing
polyacrylamide gel and visualized by autoradiography (FIG. 1b). In
the absence of competitor DNA, all of the labeled fragment was
retained at the top of the gel (lane 1), probably due to the
binding of an excess of non sequence-specific proteins. With
addition of increasing amounts of either poly(dI-dC)-poly(dI-dC)
(lanes 2-6) or E. coli chromosomal DNA (lanes 7-11) as competitors,
putative protein-DNA complexes which migrated slower than the free
fragment were detected. The relative abundance of the major species
of complex (B) as well as that of minor species was significantly
greater in the presence of the alternating copolymer competitor
DNA.
[0113] The use of a sensitive gel electrophoresis DNA binding assay
in conjunction with the copolymer competitor
poly(dI-dC)-poly(dI-dC) facilitated the identification of the
regulatory factors described herein. The simple alternating
copolymer probably competes less effectively than heterologous DNA
sequences for binding of a sequence-specific factor, thereby
significantly increasing the sensitivity of the assay. The assay
has general applicability for elucidation of mammalian gene
regulatory proteins.
[0114] A further increase in sensitivity in this assay is obtained
by the use of small DNA probes (about 100 bp or less) which
minimize non-specific binding interactions in a crude extract. (See
Example 1).
[0115] Employing this assay, binding competition tests can be
performed to analyze the sequence specificity of protein-DNA
interactions. For this purpose, an unlabeled DNA fragment to be
examined for competitive binding to the protein factor can be added
to the incubation mixture of protein extract and labeled DNA probe
(along with the poly(dI-dC)-poly(dI-dC)). The disappearance of
protein-DNA probe complex, or its diminishment, indicates that the
unlabeled fragments compete for binding of the protein factor. In
addition, relative binding affinity of the protein to a probe
sequence can be assessed by examining the ability of a competitor
to displace the protein at varying concentrations.
[0116] In conjunction with the competition assays, DNase I
footprint analysis (See Galas, D. and Schmitz A., Nucl. Acids Res.
5 3157-3170 (1978) and Example 1) and methylation interference
experiments (See, e.g., Ephrussi, A. et al., Science 227:134-140
(1985) can be used to refine analysis of the binding domain of the
protein factors.
Assessment of the Functional Role of Factors Described Herein in
Regulation of Transcription
[0117] The functional role of the factors in the regulation of the
transcription can be assessed in several ways. A preferred
technique for lymphoid cell factors entails the use of the in vitro
transcription system developed from cells of lymphoid cell lineage.
This system is described in detail in the Example 2. The function
of a factor can be indirectly assessed in this system by employing
as templates for transcription, nucleotide sequences from which the
binding domain of the factor has been deleted. As has been noted
above, deletion of the upstream sequence located between -44 and
-79 bp from the cap site of the MOPC41 K gene disrupts
transcriptions in this system (This has also been noted in in vivo
systems). The deleted region includes the IgNF-A binding site. This
indicates that transcription of the template is dependent upon the
factor--binding site and, inferentially, upon the factor
itself.
[0118] A direct way to assess the function of the factors is to
show that transcription can be modulated by removal and replacement
of the factor in the in vitro transcription system with an
appropriate template. For example, the intact MOPC41 .kappa.
promoter gene can be used as a template in the in vitro system
described and transcription of this template can be assessed in the
presence and absence of a factor (for instance, NF-.kappa.B, a
lymphoid specific factor). The factor can be removed from the
lymphoid cell extract by chromatographic fractionation and then
replaced. If the level of transcription is diminished in the
absence and restored by replacement of the factor, a direct
indication of the factors involvement in transcription is
provided.
[0119] In an alternative approach, antisera or monoclonal antibody
can be raised against a purified or enriched preparation of the
factor. The antibody can be used to probe for expression of the
factor in a library of cDNA of cells known to express the
factor.
Cloning of Genes Encoding Sequence-Specific DNA Binding Proteins,
Particularly Genes Encoding Transcriptional Regulatory Factors
[0120] Genes encoding transcriptional regulatory factors can be
isolated by a novel method for cloning genes that encode
sequence-specific DNA binding proteins. The method involves
screening a library of recombinant expression vectors for
expression of the factor with a DNA probe comprising the
recognition (binding) site for the factor. Expression of the factor
is identified by the presence of complex between the DNA probe and
the expressed binding protein. The approach has general
applicability to the cloning of sequence-specific DNA binding
proteins.
[0121] According to the method, an expression library is created by
inserting DNA (e.g., cDNA from a cell which expresses the sequence
specific binding protein) into an appropriate expression vector to
establish an expression library. A preferred expression vector is
the bacteriophage .lamda.gt11 which is capable of expressing
foreign DNA inserts within E. coli. See e.g., Young, R. A. and
Davis, R. W. in Genetic Engineering: Principles and Techniques, vol
7 (eds Setlow, J. & Hollaender, A.) 29-41 (Plenum, New York
1985). Alternatively, plasmid vectors may be used.
[0122] The expression library is screened with a binding-site DNA
probe. The probe comprises the DNA sequence recognized by the
binding protein, such as an appropriate transcriptional regulatory
element (e.g., the octamer or .kappa.-element). In preferred
embodiments, the probe is less than 150 bp in length, to reduce
nonspecific binding. The probe can be an oligomer of the binding
site. Multiple copies of the site provide for multiple protein
binding to the probe. The DNA probe is generally detectably labeled
DNA. A particularly useful label is .sup.32 P.
[0123] In the present method, the binding site probe is incubated
with host cell protein under conditions which allow the probe to
complex with the any cognate binding protein expressed in the cell.
The formation of such complexes is determined by detecting label
associated with the protein. In a preferred mode, the screening is
performed by generating a replica of host cell lysates and by
screening the replicated protein with the probe. For example, when
the bacteriophage .lamda.gt11, is used, recombinant viruses are
plated in arrays onto a lawn of E. coli and a replica of the
resulting viral plaques is made by transferring plaque protein onto
an appropriate adsorbtive surface (e.g. protein replica filters).
The adsorbed plaque protein is contacted with the probe under
conditions which permit the formation of complexes between adsorbed
protein and the probe. The replica is then washed to remove unbound
probe and then examined for associated label. The protein can be
examined autoradio-graghically for the presence of label.
[0124] In other embodiments, a nonspecific competitor DNA can be
used along with the recognition site probe, to reduce nonspecific
binding to the probe. Examples of such nonspecific competitor DNA
include poly (dI-dC)-poly(dI-dC) and denatured calf thymus DNA. In
addition, the protein-probe complexes can be stabilized covalently
for detection, for example, by uv irradiation.
[0125] This method of screening for sequence specific binding
proteins is dependent, inter. alia, upon: [0126] i) the functional
expression of the binding domain of the desired binding protein in
the host cell; [0127] ii) a strong and selective interaction
between the binding domain and the DNA probe; and [0128] iii) a
sufficiently high level of expression of the binding protein. These
parameters can be optimimized for different proteins by routine
experimentation. Some factors relevant to such optimization are
discussed in detail in the exemplification of the cloning of
transcriptional regulatory factor NF-.kappa.B given below.
[0129] Other modes of cloning genes encoding sequence-specific DNA
binding proteins, such as genes encoding transcriptional regulatory
factors, may be used. For example, the factor can be purified
chromatographically by, for example, ion exchange, gel filtration
and affinity chromatography or combinations thereof. Once the
factor is sufficiently purified, it can be partially sequenced and
from the sequence information, oligodeoxynucleotide probes can be
made and used to identify the gene encoding the factor in a cDNA
library.
Occurrence and Activation of NF-kB and Demonstration of the Role of
an NF-kB Inhibitor (IkB)
[0130] The following is a description of the occurrence and
activation of NF-kB in cells which do not express k immunoglobulin
light chain genes (and, in which NF-kB is not evident in either
cytoplasmic or nuclear fractions). In particular, the following is
a description of localization of NF-kB in the cytosolic fraction;
of activation of NF-kB in cytosolic fractions by dissociating
agents; of redistribution of NF-kB into the nuclear fraction upon
TPA stimulation; of demonstration of the appearance of NF-kB
binding ability; and of the occurrence and characterization of an
NF-kB inhibitor.
NF-kB Occurrence and Activation in 70Z/3 Cells
NF-kB is Virtually Undetectable in Unstimulated 70Z/3 Cells
[0131] To determine where in the cell NF-kB or its inactive
precursor are located, subcellular fractions from control and
TPA-stimulated 70Z/3 cells were analyzed for kB-specific
DNA-binding activity. Nuclear extracts, cytosolic and postnuclear
membrane fractions were analyzed at equal amounts of protein in an
electrophoretic mobility shift assay, described in Example 1,
followed by fluorography. (Sen, R. and D. Baltimore, Cell,
46:705-716 (1986). The specificity of protein-binding to a fragment
of the kappa light chain enhancer was controlled by using a
fragment with a mutation in the binding motif for NF-kB. This
mutation has been shown to prevent binding of NF-kB. Lenardo, M. et
al., Science, 236:1573-1577 (1987). Thus, any complexes formed on
the wild type, but not on the mutant fragment, are considered
specific for the NF-kB site.
[0132] Nuclear extracts from control cells contained very little
kB-specific binding activity (FIG. 29, compare lanes 1 and 7). This
is in agreement with results reported previously by Sen and
Baltimore. Sen, R. and D. Baltimore, Cell, 46:705-716 (1986); Sen,
R. and D. Baltimore, Cell, 47:921-928 (1986). Similarly, the
ctyosolic fraction produced only a faint, but specific and
reproducible, signal co-migrating with the signal from the nuclear
extract (FIG. 29, compare lanes 2 and 8). The fraction containing
postnuclear membranes did not exhibit any detectable DNA-binding
activity (FIG. 29, lane 3).
[0133] Upon treatment of cells with TPA for 30 minutes, the nuclear
NF-kB activity was dramatically increased (FIG. 8, compare lanes 4
and 10). Almost no increase of the specific signal in the cytosolic
fraction was observed (FIG. 29, compare lanes 5 and 11). The
post-nuclear membrane fraction gave raise to an apparently
kB-specific complex with a mobility higher than that formed by
nuclear NF-kB (FIG. 29, compare lanes 6 and 12). None of the
fractions had inhibitors of binding because added authentic NF-kB
was fully recovered in all fractions, indicating that the results
reflect a true activation of binding specificity.
NF-kB is Detectable in the Cytosolic Fraction after Denaturation
and Renaturation
[0134] To examine whether active NF-kB might be present but masked
in fractions from unstimulated 70Z/3 cells, proteins from nuclear
extracts and cytosolic fractions of control and TPA-stimulated
cells were precipitated, denatured by boiling in SDS plus
2-mercaptoethanol and fractionated by electrophoresis through
SDS-polyacrylamide gels. 300 ug of protein of nuclear extracts (N)
and cytosolic fractions (C) from control (Co) and TPA-stimulated
cells (TPA) were subjected to reducing SDS-polyacrylamide gel
electrophoresis. Proteins eluted from different molecular weight
fractions of the gel (i.e., corresponding to approximately 70-62
kDa (gel slice No. 6), 62-55 kDa (gel slice No. 7) and 55-48 kDa
(gel slice No. 8)) were subjected to a renaturation protocol after
removal of SDS. Hager, D. A. and R. R. Burgess, Anal. Biochem.,
109:76-86 (1980) and Example 10. Renatured fractions were tested
for kB-specific DNA-binding activity in mobility shift assays using
wild type and mutant kappa light chain enhancer fragments.
DNA-binding reactions were performed with 11 ul of the renatured
fractions in the presence of 80 ng poly(d[1-c]) in a final volume
of 15 ul. Assays with wild type (WT) and mutant (mu) k enhancer
fragments were loaded in adjacent lanes.
[0135] In nuclear extracts from TPA-stimulated cells, NF-kB
activity was exclusively found in a molecular weight region of
62-55 kDa. The efficiency of renaturation of the nuclear NF-kB
activity was about one percent. In FIG. 30, the active and two
adjacent fractions are shown for the nuclear extract from
TPA-stimulated cells (lanes 13 to 18). In nuclear extracts from
control cells, much less NF-kB activity was found in the same
molecular weight fraction after renaturation (FIG. 30, lanes 3 and
4). Both the cytosolic fractions from control and TPA-stimulated
cells, however, gave rise to a strong NF-kB-specific signal (FIG.
30, lanes 9, 10 and 21, 22). The specificity of the signal was
shown by several criteria. First, it was only present when the wild
type, but not the mutant, DNA fragment was used in mobility shift
assays (FIG. 3D, lanes 9, 10 and 21, 22). Second, it was generated
with protein eluted from the same molecular weight fraction that
contained authentic nuclear NF-kB. Third, upon mixing, the complex
formed by the putative cytoplasmic NF-kB co-migrated exactly in
native polyacrylamide gels with the complex formed by interaction
of the nuclear form of NF-kB with its cognate DNA.
[0136] Assuming that NF-kB from the various fractions had a similar
recovery and efficiency of renaturation, the data suggest that
significant amounts of NF-kB can be activated in unstimulated 70Z/3
cells by denaturation, followed by fractionation and renaturation.
Furthermore, in unstimulated cells, the in vitro activated NF-kB
activity was almost exclusively recovered in the cytosolic
fraction.
[0137] The subcellular distribution of two noninducible DNA-binding
proteins, NF-uE3 and the octamer-binding protein were also examined
in mobility shift assays, in order to determine whether other
DNA-binding factors also partition into cytoplasmic fractions. Sen,
R. and D. Baltimore, Cell, 46:705-716 (1986); Singh, H. et al.,
Nature, 319:154-158 (1986); and Staudt, L. M. et al., Nature,
323:640-643 (1986). The vast majority of both DNA-binding
activities was found in nuclear extracts; cytosolic and postnuclear
membrane fractions contained only very little activities (FIG. 29,
lanes 13 to 24). No significant change in the complex formation by
the two factors was observed when fractions from control and
TPA-stimulated cells were compared. Thus, although subcellular
fractionation can produce artificial redistribution of proteins,
the fractions used in this study do well reflect nuclear
localization of a number of DNA-binding proteins.
NF-kB in the Cytosolic Fraction Can be Activated by Dissociating
Agents
[0138] The ability to reveal cytosolic NF-kB by simply denaturation
and renaturation suggested that NF-kB might be bound to an
inhibitor and therefore several compounds that might dissociate
protein complexes were tested for their ability to directly
activate kB-specific DNA-binding activity in fractions of 70Z/3
cells. The cytosolic fraction from unstimulated cells and, as a
control, the nuclear extract from TPA-treated cells were incubated
with the compounds prior to electrophoretic separation of the
protein-DNA complexes. Incubation of the cytosolic fraction with
0.2% sodium desoxycholate (DOC) (in the presence of 0.2% NP-40)
resulted in the activation of DNA-binding activity (FIG. 31, lane
2). The induced complex had the same mobility in native gels as the
one formed by nuclear NF-kB. It appeared to be specific for the kB
site of the kappa light chain enhancer because it was not formed
when the mutant fragment was used in the mobility shift assay (FIG.
31, lane 21). Higher concentrations of DOC led to the inactivation
of the newly activated kB-binding activity (FIG. 31, lanes 3 to 5)
as well as of the authentic nuclear factor (FIG. 31, lanes 13 to
15).
[0139] DOC can be sequestered out of a solution by the addition of
excess nonionic detergent, presumably by inclusion of the DOC into
micelles formed by the nonionic detergent. When treatment of the
cytosolic fraction with up to 0.8% DOC was followed by the addition
of 1% of the nonionic detergent NP-40, a quite efficient activation
of the cytosolic kB-binding activity was achieved (FIG. 31, lanes 7
to 9). The DNA-binding activity of in vivo activated NF-kB from
nuclear extracts was not significantly increased at low
concentrations of DOC (FIG. 31, lanes 11, 12 and 16, 17). Elevated
concentrations of DOC showed inhibitory effects on the DNA-binding
activity of TPA-activated NF-kB that paralleled those observed for
the in vitro activated kB-binding activity (FIG. 31, compare lanes
3, 4, 5 with lanes 13, 14, 15 and lanes 9, 10 with lanes 19,
20).
[0140] A partial activation of the cytosolic kB-binding activity
was observed after treatment of the cytosolic fraction with 27%
formamide followed by dilution (FIG. 31, lane 7). With the further
addition of 0.2% DOC--a condition that alone also leads only to
partial activation (FIG. 31, lane 3)--a very potent activation was
observed (FIG. 31, lane 11). A titration showed that formamide and
DOC activated in a synergistic manner (FIG. 31, lanes 2 to 11). The
DNA-binding activity of in vivo activated NF-.kappa.B from nuclear
extracts was not enhanced by any of the treatments (FIG. 31, lanes
13 to 22). On the contrary, partial inhibition of DNA-binding of
NF-kB was observed under some conditions.
[0141] No in vitro activation of NF-kB was achieved by treatment
with guanidinium hydrochloride (between 0.3 and 3M), urea (between
0.5 and 5M), and SDS (between 0.1 and 1%), in the presence of 0.2%
NP-40). Exhaustive dialysis of the cytosolic fraction using
dialysis membranes with a cut-off of 25 kDa did not lead to an
activation of DNA-binding activity. In the dialyzed fraction,
NF-kB-activity could still be efficiently induced by formamide/DOC
treatment, suggesting that no freely diffusible cofactors smaller
than 25 kDa were required for the in vitro activation.
TPA Stimulation Causes Redistribution of NF-kB into the Nuclear
Fraction
[0142] To examine whether the form of NF-kB detected after in vitro
activation in the cytosolic fraction could quantitatively account
for the NF-kB found in nuclear extracts after TPA stimulation of
cells, subcellular fractions of 70Z/3 cells were reinvestigated in
mobility shift assays after treatment with formamide and DOC using
equal cell-equivalents of subcellular fractions. Equal
cell-equivalents of nuclear extracts (N) and cytosolic (C) and
post-nuclear membrane fractions (P) from control (Co) and
TPA-stimulated cells (TPA) were left untreated (lanes 1-6 and
13-18) or subjected to a formamide/desoxycholate treatment (Fa+DOC;
lanes 7-12 and 19-24; for conditions see FIG. 31, lane 11). This
treatment was preferred over the DOC/NP-40 chase treatment because
it gave a higher resolution of bands in mobility shift assays.
DNA-binding reactions were performed in the presence of 3.2 ug
poly(d[I-C]) using 4.4 ug of protein from nuclear extracts, 8.8 ug
of protein from cytosolic fractions or 2.2 ug of protein from
postnuclear membrane fractions (all in 4 ul buffer D(+)).
Fluorograms of native gels are shown. The specificity of
protein-DNA complexes was controlled using wild type (kB wt) and
mutant kappa enhancer fragments (kB mutant; see legend to FIG. 29).
The filled arrowhead indicates the position of kB-specific
protein-DNA complexes and the open arrowhead the positions of
unbound DNA-fragments.
[0143] Densitometric scanning of fluorograms showed that in control
cells, more than 92% of the total cellular kB-specific DNA-binding
activity was recovered in the cytosolic fraction following
treatment with formamide and COD (FIG. 32, lanes 7 to 9). In
TPA-stimulated cells, 80% of the kB-specific DNA-binding activity
was found in nuclear extracts (FIG. 32, lanes 10 to 12). The
remaining activity was largely recovered in the cytosolic fraction
(FIG. 32, lane 11). All DNA-binding activities described were
specific for the kB site, as shown by their absence when the mutant
kappa enhancer fragment was used in the mobility shift assays (FIG.
32, lanes 13 to 24).
[0144] When the total cellular NF-.kappa.B activity that was
activated in vitro in control cells was compared to the total
cellular activity found in TPA-stimulated cells after the same
treatment, virtually identical amounts of activity were observed.
The equal amounts of NF-kB activity found in control and
TPA-treated cells suggest that the treatment with formamide and DOC
resulted in the complete conversion of an inactive precursor of
NF-kB into a form of NF-kB with high DNA-binding affinity.
Furthermore, these results provide evidence for a TPA-inducible
translocation of NF-kB from the cytosol into the nucleus.
NF-kB Occurrence and Activation in HeLa Cells
[0145] NF-kB activity can also be induced in HeLa cells after TPA
treatment, as shown by the appearance of a kB-specific DNA-binding
activity in nuclear extracts. Sen, R. and D. Baltimore, Cell,
47:921-928 (1986). Therefore, induction of NF-kB in the cytosolic
fraction of HeLa cells was tested by treatment with formamide and
DOC. To equal cell-equivalents of fractions, 17% formamide was
added and diluted to 10% by the addition of the DNA-binding
reaction mixture containing 4 ug poly(d[I-C]). DOC was then added
to a final concentration of 0.6% to give a reaction volume of 20
ul. Assays contained either 1.35 ug of protein from nuclear
extracts, 9 ug of protein from the cytosolic fractions of 0.9 ug of
protein from the postnuclear membrane fractions (all in 10 ul
buffer D(+)).
[0146] Redistribution of NF-kB activity in the subcellular
fractions upon TPA stimulation of cells, was also assessed, using
the procedure described for 70Z/3 cells. Mobility shift assays were
performed with equal cell-equivalents of the subcellular fractions.
Because HeLa cells had about ten times as much cytosolic protein as
nuclear protein--as opposed to the 2:1 ratio in 70Z/3 cells--the
use of equal cell-equivalents of fractions gave very different
quantitative results from those obtained with equal amounts of
protein. Without any treatment, only traces of a kB-specific
DNA-binding activity were detected in the nuclear and cytosolic
fractions of HeLa cells and no activity was observed in the
postnuclear membrane fraction (FIG. 33, lanes 1 to 3). Upon TPA
stimulation of cells under the same conditions as for 70Z/3 cells,
NF-kB activity was strongly increased in the nuclear extract (FIG.
33, lane 4). Also, in the cytosolic fraction, a significant
increase of NF-kB activity was found (FIG. 33, lane 5). This was
not an artifact of fractionation because the activity of AP-1,
another nuclear factor (Lee, W. et al., Cell, 49:741-752 (1987),
was highly enriched in nuclear extracts and almost not detectable
in the cytosolic fraction of HeLa cells before and after TPA
stimulation.
[0147] The treatment of control fractions of HeLa cells with
formamide and DOC revealed large amounts of kB-specific DNA-binding
activity in the cytosolic fraction (FIG. 33, compare lanes 3 and
20). The concentrations of formamide and DOC required for an
optimal in vitro activation of NF-kB in HeLa cells were different
from those required for 70Z/3 cells; less formamide and more DOC
was needed. All DNA-binding activities described were specific for
the kB-binding site in the kappa enhancer fragment (FIG. 33, lanes
13 to 24).
[0148] Almost no activity was detected in the HeLa nuclear extract
and the postnuclear membrane fraction after in vitro activation
(FIG. 33, lanes 7 and 9). Large amounts of NF-kB activity could
still be activated in the cytosolic fraction of TPA-stimulated HeLa
cells (FIG. 33, lane 11). This suggests that in vivo in HeLa
cells--as contrasted to 70Z/3 cells--only a minor portion of the
total cellular NF-kB is activated upon a TPA stimulus. The NF-kB
activity in formamide/DOC-treated nuclear extracts of
TPA-stimulated cells was less, compared to untreated nuclear
extracts (FIG. 33, compare lanes 4 and 10) reflecting a partial
inhibition of the DNA-binding activity of in vivo activated NF-kB.
As in 70Z/3 cells, the total cellular NF-kB activity in HeLa cells,
as revealed after in vitro activation, remained constant before and
after TPA treatment of cells. These data imply that NF-kB is
activated by the same mechanism in HeLa cells as it is in the pre-B
cell line 70Z/3. However, in HeLa cells, TPA is much less complete
in its activation than it is in 70Z/3 cells.
NF-kB Occurrence and Activation in Other Cell Types
[0149] NF-kB occurrence and activation in several additional cell
types, including two T cell lines (H9, Jurkat) and fibroblasts, and
in tissues, including human placenta and mice kidney, liver,
spleen, lung, muscle and brain, were also assessed, as described
above. In each case, NF-kB in a DOC-activatable form was shown to
be present in the cytosolic fraction.
Appearance of Binding Activity
[0150] Results described above suggested that the appearance of
binding activity may be due to separation of NF-kB from an
inhibitor. Size fractionation and denaturing agents were both shown
to be capable of separating NF-kB from such an inhibitor, which was
apparently of low molecular weight. This provides a reasonable
explanation for how NF-kB is induced in pre-B cells, HeLa cells and
other inducible cells, such as T cells.
[0151] Whether the DOC-dependence of cytosolic NF-kB results from
its association with an inhibitor, was investigated by probing for
activity in cytosolic fractions that would specifically prevent DNA
binding to NF-kB in electrophoretic mobility shift assays (EMSA).
This work demonstrated the existence of a protein inhibitor, called
IkB, in cytosolic fractions of unstimulated pre-B cells, that can
convert NF-kB into an inactive DOC-dependent form by a reversible,
saturable, and specific reaction. The inhibitory activity becomes
evident after selective removal of the endogenous cytosolic NF-kB
under dissociating conditions, suggesting that NF-kB and IkB were
present in a stoichiometric complex. Enucleation experiments showed
that the complex of NF-kB and IkB is truly cytoplasmic. The data
are consistent with a molecular mechanism of inducible gene
expression by which a cytoplasmic transcription factor-inhibitor
complex is dissociated by the action of TPA, presumably through
activation of protein kinase C. The dissociation event results in
activation and apparent nuclear translocation of the transcription
factor. It would appear that IkB is the target for the TPA-induced
dissociation reaction. The following is a description of this
investigation, which is described in greater detail in Example
12.
Separation of an Inhibitor from NF-kB
[0152] Cytosolic fractions from unstimulated 70Z/3 pre-B cells were
examined for an activity that would impair the DNA binding activity
of added NF-kB in an EMSA. Baeuerle, P. A., and D. Baltimore, Cell
53: 211 (1988). Increasing amounts of cytosol from unstimulated
cells did not significantly influence the formation of a
protein-DNA complex between NF-kB and a k enhancer fragment (FIG.
34, lanes 13 to 15). This indicated the absence of free inhibitor,
presumably because all of it is complexed with endogenous NF-kB.
DNA-cellulose was used to selectively remove the endogenous NF-kB
from DOC-treated cytosol, in an attempt to liberate the inhibitor.
Almost all NF-kB was present in a DOC-dependent form prior to DOC
activation and chromatography (FIG. 34A, lanes 1 and 2). In the
presence of excess DOC, about 80% of the NF-kB activity was
retained by DNA-cellulose (FIG. 34A, compare lanes 2 and 4), most
of which eluted from the DNA-cellulose between 0.15 and 0.35M NaCl
(FIG. 34A, lanes 8 to 10 and 16 to 18). The NF-kB activity eluting
at high salt was detectable in mobility shift assays in the absence
of excess DOC (FIG. 34A, lanes 8 to 11), indicating that NF-kB had
been separated from an activity that caused its DOC-dependent DNA
binding activity. In contrast, the small percentage of NF-kB
activity contained in the washings was still dependent on DOC (FIG.
34A, compare lanes 5 to 7 and 13 to 15). These results show that
affinity chromatography is sufficient to convert DOC-dependent
NF-kB precursor into DOC-independent active NF-kB, similar to that
found in nuclear extracts from TPA-stimulated cells.
[0153] The flow-through fraction from the DNA-cellulose was assayed
for an activity that, after neutralization of DOC by non-ionic
detergent, would inactivate added NF-kB from the 0.2M NaCl-fraction
from nuclear extracts of TPA-stimulated cells. Increasing amounts
of cytosol from which the endogenous NF-kB was removed inhibited
the formation of an NF-kB---DNA complex as monitored by EMSA (FIG.
34B, lanes 7 to 9 and 16 to 18). DOC-treated cytosol that was not
passed over DNA-cellulose had no effect (FIG. 34B, lanes 4 to 6 and
13 to 15), even if cells had been treated with TPA. The fact that,
after DNA-cellulose chromatography of DOC-treated cytosol, both
DOC-independent NF-kB and an inhibitory activity were observed made
it reasonable to believe that NF-kB had been separated from an
inhibitor. This inhibitor is referred to as IkB.
IkB Characterization
[0154] IkB fractionates as a 60 to 70 kD protein. The flow-through
fraction from the DNA-cellulose column was subjected to gel
filtration through G-200 Sephadex and the fractions were assayed
for an activity that would interfere with the DNA binding activity
of added NF-kB contained in a nuclear extract from TPA-stimulated
70Z/3 cells (FIG. 35A). The 67 kD fraction had the highest
activity: it virtually completely prevented interaction of NF-kB
and DNA (FIG. 35A, lanes 6). In fractions from a G-75 Sephadex
column, no additional inhibitor of low molecular size was
detectable indicating that NF-.kappa.B was inactivated by a
macromolecule of defined size. No significant inhibitory activity
could be demonstrated after gel filtration of a DNA-cellulose
flow-through of DOC-treated cytosol from TPA-stimulated 70Z/3
cells, implying that TPA treatment of cells inactivated IkB.
[0155] The inhibitor fraction was treated with trypsin to test
whether IkB is a protein (FIG. 35B). Tryptic digestion was stopped
by the addition of bovine pancreas trypsin inhibitor (BPTI) and
samples were analyzed for NF-kB inhibition. Trypsin treatment
interfered with the activity of IkB, as shown by the complete
inability of the treated sample to inhibit NF-.kappa.B activity
(FIG. 35B, compare lanes 1 and 6). Trypsin that had been treated
with BPTI had no effect (FIG. 35B, lane 5), demonstrating that the
inactivation of IkB was specifically caused by the proteolytic
activity of trypsin. It appears that IkB requires an intact
polypeptide structure for its activity. The nucleotide sequence of
the IkB-.varies. gene and the amino acid sequence of IkB-.varies.
are shown in FIG. 43.
[0156] The cytosolic complex of IkB and NF-kB showed an apparent
size of about 120 to 130 kD, both after gel filtration (FIG. 35A,
lane 3) and after sedimentation through a glycerol gradient (FIG.
35C, lanes 6 and 7). For both methods, cytosol from unstimulated
cells was analyzed under non-dissociating conditions. NF-.kappa.B
was activated in fractions by either DOC (FIG. 35A) or formamide
(FIG. 35C, middle panel) prior to analysis by EMSA. Baeuerle, P. A.
and D. Baltimore, Cell, 53:211 (1988). The specificity of complexes
was tested with a mutant DNA probe (FIG. 35C, right panels).
Lenardo, M. et al., Science, 236:1573 (1987). The apparent release
of a 60 to 70 kD inhibitory protein from the cytosolic NF-kB
precursor, its sedimentation velocity in glycerol gradients, and
its size seen by gel filtration suggest that the inactive
NF-.kappa.B precursor is a heterodimer composed of a 55 to 62 kD
NF-.kappa.B molecule and a 60 to 70 kD IkB molecule. Nuclear
NF-.kappa.B was found to cosediment with the cytosolic complex of
IkB and NF-kB (FIG. 35C, upper panel). Native gel electrophoresis,
a method that allows resolution of size differences of protein-DNA
complexes, provided evidence that the 120 kD form of nuclear NF-kB
seen in glycerol gradients comes from the formation of a homodimer.
Hope, I. A. and K. Struhl, EMBO J., 6:2781 (1987). By these
interpretations, activation of NF-kB would include an additional
step (i.e., formation of a NF-kB homodimer). This is consistent
with the observation that the protein-DNA complexes formed with in
vitro-activated NF-kB have the same mobility in native gels as
those formed with nuclear NF-kB. Baeuerle, P. A. and D. Baltimore,
Cell, 53:211 (1988).
[0157] The inactivation of NF-kB by IkB is reversible, saturable
and specific. Incubation with the inhibitor fraction can inhibit
the DNA binding activity of NF-kB by more than 90% (FIG. 36A, lanes
1 and 3). Treatment of a duplicate sample with DOC after the
inhibition reaction reactivated 66% of the added NF-kB activity
(FIG. 36A; compare lanes 3, 4 and 6). This showed that a
DOC-dependent form of NF-kB can be reconstituted in vitro by the
addition of a fraction containing IkB to nuclear NF-kB. The
incomplete activation of NF-kB by DOC might be due to the
DOC-neutralizing effect of non-ionic detergent which was still
present in the sample from the preceding inhibition reaction.
[0158] A titration and kinetic analysis showed that IkB
stoichiometrically interacts with NF-kB (FIG. 36B). Increasing
amounts of inhibitor fraction were added to an excess amount of
NF-kB and incubated for 20 or 60 minutes. After the DNA binding
reaction, NF-kB-DNA complexes were separated on native gels and
quantified by liquid scintillation counting. The relationship
between amount of IkB fraction added and extent of inhibition was
linear. The amount of NF-kB inactivated after 20 minutes of
incubation was not increased after 60 minutes (FIG. 36B). These
kinetics were probably not the result of a rapid decay of a
catalytically active inhibitor because the fractions were incubated
prior to the reaction. The data are consistent with rapid formation
of an inactive complex by addition of IkB to NF-kB. The fraction
containing IkB does not appear to catalytically or covalently
inactivate NF-kB: neither the reversibility nor the kinetics
support such a model.
[0159] IkB was tested for its influence on the DNA binding activity
of other defined nuclear factors (FIG. 13A). These factors were
contained in nuclear extracts that had essentially no active NF-kB,
which otherwise could have inactivated IkB by complex formation.
The DNA binding activity of H2TF1, a transcription factor thought
to be related to NF-.kappa.B, was not affected by the inhibitor
fraction. Baeuerle, P. A. et al., unpublished observation).
Ubiquituous and lymphoid-specific octamer-binding proteins (OCTA)
(Sive, H. L. and R. G. Roeder, Proc. Natl. Acad. Sci. USA, 83:6382
(1986) and Staudt, L. M. et al., Nature, 323:640 (1986)) were
unaffected in their DNA binding activities, as were two E-box
binding factor, NF-.mu.E1 (Weinberger, J. et al., Nature, 322:846
(1986)) and NF-kE2 (Lenardo, M. et al., Science, 236:1573 (1987)),
interacting with .mu. heavy chain and k light chain enhancers,
respectively. AP-1, another TPA-inducible transcription factor
(Lee, W. et al., Cell, 49:741 (1987); Angel, P. et al., Cell,
49:729 (1987)), also showed equal complex formation after
incubation in the presence and absence of the inhibitor fraction.
Furthermore, none of the undefined DNA binding activities seen in
the EMSA showed any inactivation by IkB. These results show that
IkB is a specific inhibitor of the DNA binding activity of
NF-kB.
[0160] In vivo activated NF-.kappa.B is responsive to IkB. IkB
prepared from the mouse pre-B cell line 70Z/3 was tested for
inactivation of NF-kB contained in nuclear extracts from other cell
lines. Human NF-kB contained in nuclear extracts from
TPA-stimulated HeLa cells and H-9 T-lymphoma cells was efficiently
inactivated (FIG. 37B). When excess amounts of the various NF-kB
activities were used in the inhibitor assay, the extent of
reduction of NF-kB activities by a fixed amount of IkB was very
similar, as quantified by liquid scintillation counting. NF-kB from
nuclear extracts of TPA-stimulated Madin-Darby bovine kidney (MDBK)
cells was also inactivated suggesting that the control of NF-kB
activity by IkB is conserved among different mammalian species.
[0161] NF-kB is constitutively active in cell lines derived from
mature B cells. Sen, R. and D. Baltimore, Cell, 46:705 (1986).
Nuclear extracts from the mouse B cell line WEHI 231 were tested in
the inhibitor assay to examine whether NF-kB has undergone a
modification in those cell lines that prevented its inactivation by
IkB. NF-kB from B cells was as efficiently inactivated as NF-kB
from pre-B cells (FIG. 37B), suggesting that NF-kB is not stably
modified in B cells (or in other cells after TPA stimulation) in
such a way that it cannot respond to inactivation by IkB.
[0162] The NF-kB---IkB complex is present in enucleated cells. The
NF-kB---IkB complex shows a cytosolic localization on subcellular
fractionation (FIG. 38A). This procedure may, however, cause
artifacts. Hypotonic lysis of cells may result in partitioning of
nuclear proteins into the cytosol, especially, when they are not
tightly associated with nuclear components. Li, J. J. and T. J.
Kelly, Proc. Natl. Acad. Sci, USA, 81:6973 (1984). Detection of the
complex of IkB and NF-kB in enucleated cells was attempted.
Enucleation is performed with living cells at 37.degree. C. and
should therefore not interfere with active nuclear import of
proteins, which is ATP-dependent and blocked at low temperature.
Prescott, D. M. and J. B. Kirkpatrick, In: Methods Cell Biol., D.
M. Prescott, ed. (Academic Press, New York, 1973), p. 189;
Newmeyer, D. D. and D. J. Forbes, Cell, 52:641 (1987); Richardson,
W. D. et al., Cell, 52:655 (1988).
[0163] Using cytochalasin B-treated HeLa cells, an enucleation
efficiency of about 90% was obtained (FIG. 38A). Enucleated and
cytochalasin B-treated complete cells were incubated in the absence
and presence of TPA, solubilized by detergent and proteins were
extracted with high salt. Because of the small number of cells
analyzed, this procedure is different from the standard one. Total
cell extracts were analyzed for NF-kB specific DNA binding activity
by EMSA (FIG. 38B). In both enucleated and complete cells, similar
amounts of NF-kB activity were found after TPA stimulation (FIG.
38B, lanes 1 to 4). The activity was specific for NF-kB because it
was not observed with a mutant k enhancer fragment. Lenardo, M. et
al., Science, 236:1573 (1987); These results suggest that
TPA-inducible NF-kB in HeLa cells is predominantly cytoplasmic
because it was still present in enucleated cells. The NF-kB
activity seen under control conditions (FIG. 38B, lanes 1 and 3)
was most likely activated by the lysis conditions used because it
was also observed in extracts from HeLa cells that were not treated
with cytochalasin B, but not in fractions obtained after hypotonic
lysis. Baeuerle, P. A. and D. Baltimore, Cell, 53:211 (1988). It
was still evident, however, that TPA could activate NF-kB in
enucleated cells (FIG. 38B, lanes 3 and 4).
[0164] After treatment with DOC, total extracts from complete and
enucleated control cells showed about a 2-fold increase in the
amount of NF-kB activity (FIG. 38B, compare lanes 1 and 3 with 5
and 7). The demonstration of DOC-activatable NF-kB in enucleated
cells, as well as the presence of similar amounts of total NF-kB in
enucleated and complete cells (FIG. 38B, compare lanes 5 to 8),
shows that a substantial amount of the total cellular NF-kB---IkB
complex was cytoplasmic. In contrast to NF-kB, most of the DNA
binding activity of AP-1, a bona fide nuclear protein, was
apparently lost by enucleation of cells (FIG. 38B, lanes 9 to 12).
Lee, W. et al., Cell, 49:741 (1987); Angel, P. et al., Cell, 49:729
(1987).
Mechanism of NF-kB Activation
[0165] Thus, it has been shown that the NF-kB nuclear transcription
factor exists in unstimulated pre-B cells in a cytoplasmic complex
with a specific inhibitory protein, I.kappa.B. In this complex,
NF-kB does not exhibit DNA binding activity in EMSA and partitions
upon sub-cellular fractionation into the cytosol. The complex is
apparently a heterodimer consisting of about a 60 kD NF-kB molecule
and a 60 to 70 kD IkB molecule. Upon TPA stimulation of cells, or
after treatment with dissociating agents in vitro, the NF-kB---IkB
complex dissociates. This releases NF-kB, which appears now to form
a homodimer and can translocate into the nucleus. Whether
dimerization is required for activation of NF-kB is not known.
[0166] The inhibitory effect of IkB on the DNA binding activity and
nuclear localization properties of NF-kB appears to arise from a
simple physical affinity of the two proteins. The complex freely
dissociates and the components readily associate under in vitro
conditions. Even in vivo, dissociation by short-term TPA treatment
and reassociation after long-term TPA treatment is evident. The
latter presumably results from the degradation of protein kinase C
after TPA activation and implies that NF-.kappa.B can move back to
the cytoplasm after being active in the nucleus.
[0167] The effect of TPA appears to involve an alteration of IkB,
but not of NF-kB. After TPA stimulation, no active IkB was
found--implying its alteration--while the nuclear NF-.kappa.B
remained sensitive to unmodified IkB when tested in vitro. Whether
inactive IkB can be regenerated is unclear; in experiments using
cycloheximide (Baeuerle, P. A. et al., Cold Spring Harbor Symp.
Quant. Biol., 53, In Press), irreversible loss of IkB activity was
the only demonstrable effect after 8 hours of TPA treatment. Given
the ability of TPA to activate protein kinase C, it is a reasonable
hypothesis that direct or indirect phosphorylation of IkB results
in its dissociation from NF-kB.
[0168] It had previously been found that the NF-kB---IkB complex is
recovered in the cytosol. It is now shown directly that the complex
is not removed from the cell by enucleation and, therefore, is
truly cytoplasmic. Welshons, W. V. et al., Nature, 307:747 (1984).
Because active protein kinase C is bound to the plasma membrane
(Kraft, A. S. et al., J. Biol. Chem., 257:13193 (1983); Wolf, M. et
al., Nature, 317:546 (1985); Kikkawa, U. and Y. Nishizuka, Ann.
Rev. Cell. Biol., 2:149 (1986)), it becomes increasingly attractive
to suggest that the cytoplasmic complex interacts in the cytoplasm
(maybe near the plasma membrane) with protein kinase C and the
liberated NF-kB carries the signal from cytoplasm to nucleus. Under
a number of conditions, active NF-kB is found in the cytoplasm.
This fact and the reversibility of NF-kB activation in vivo
suggests that the protein may freely move in and out of the
nucleus, bringing to the nucleus information reflecting the
cytoplasmic activation state of protein kinase C and possibly of
other signalling systems.
[0169] The response of NF-kB to activated protein kinase C occurs
apparently indirectly through modification and subsequent release
of associated IkB. The inducibility of NF-kB by TPA is thus
dependent on the presence and state of activity of IkB. Changes in
amount or activity of IkB should therefore influence the TPA
inducibility of NF-kB. NF-kB can indeed exist not only in
TPA-inducible but also in constitutively active form (e.g., in
mature B cells; Sen, R. and D. Baltimore, Cell, 46:705 (1986).
Because constitutive NF-kB from B cells is still responsive to IkB
in vitro, it is thought that IkB, and not NF-kB, is altered during
differentiation of pre-B into B cells.
[0170] IkB is apparently unstable when not complexed with NF-kB.
This is suggested by the absence of excess active inhibitor in the
cytosol from unstimulated cells. In a situation where the
production of new inhibitor is impaired, the decay of occasionally
released inhibitor could activate NF-kB. This would explain the
partial activation of NF-kB seen after treatment with the protein
synthesis inhibitors cycloheximide and anisomycin. Sen R. and D.
Baltimore, Cell, 47:921 (1987). The demonstration of a specific
inhibitory protein of NF-kB and the interpretation that
cycloheximide treatment can activate NF-kB, presumably because
cells become depleted of inhibitor, suggest that IkB is the
putative labile repressor of k gene expression (Wall, R. et al.,
Proc. Natl. Acad. Sci. USA, 83:295 (1986)) and of NF-kB activity.
Sen, R. and D. Baltimore, Cell, 47:921 (1987).
[0171] As a result of the work described herein, the I.kappa.B gene
is now available, as is I.kappa.B itself, antibodies specific for
the I.kappa.B gene-encoded product, and probes which include all or
a portion of the I.kappa.B gene sequence. Also available are
methods of using the I.kappa.B gene, the encoded protein and
I.kappa.B-specific antibodies for such purposes as identifying and
isolating other I.kappa.B genes, I.kappa.B "like" genes, and
I.kappa.B-encoded products. Altering NF-.kappa.B activity and
altering NF-.kappa.B-mediated gene expression. In particular, it is
now possible, through the method of the present invention, to block
or inhibit NF-.kappa.B passage into the nucleus of cells in which
it occurs and, thus, block (partially or totally) binding of
NF-.kappa.B to NF-.kappa.B binding sites on genes which include
such recognition sites. Such a method is useful for altering
expression of genes which is mediated by NF-.kappa.B; such genes
include cellular genes (e.g., cytokine genes) and genes introduced
into host cells (e.g., viral genes, such as cytomegalovirus gene,
HIV-1 genes (e.g., the tax gene), and the SV40 gene). This method
of altering NF-.kappa.B-mediated gene expression is useful, for
example, for inhibiting viral gene expression in infected cells,
such as in an individual infected with the HIV-1 or
cytomegalovirus.
[0172] The I.kappa.B gene and the encoded I.kappa.B protein can be
used to negatively regulate NF-.kappa.B activity in cells. For
example, the I.kappa.B gene can be incorporated into an appropriate
vector (e.g., a retroviral vector or capable of expressing the
I.kappa.B gene and introduced into cells in which NF-.kappa.B
activity is to be inhibited (partially or totally). For example, a
vector capable of expressing I.kappa.B can be introduced into HIV-1
infected cells (e.g, T cells) in order to inhibit HIV-1 gene
expression and activity in the cells. I.kappa.B expressed in the
cells binds NF-.kappa.B (e.g., free NF-.kappa.B such as that
released from its inactive complex with I.kappa.-.beta.) and limits
its ability to act as a messenger by inhibiting its translocation
into the nucleus. For this purpose, all or a portion of the
I.kappa.B-encoding DNA or DNA encoding an I.kappa.B-like protein is
used. If a portion is used, it must encode at least that region of
the I.kappa.B (or other rel-associated protein) molecule sufficient
to bind NF-.kappa.B and prevent it from passing into the cell
nucleus. The I.kappa.B-encoding DNA or DNA encoding an
I.kappa.B-like protein used can be obtained from a source in which
it naturally occurs, can be produced by genetic engineering or
recombinant techniques or can be synthesized using known chemical
methods. For convenience, DNA from all three types of sources is
referred to herein as "essentially pure". The DNA used can have all
or a portion of the DNA sequence of clone MAD-3, all or a portion
of pp40 or all or a portion of another sequence which encodes a
rel-associated or I.kappa.B-like protein capable of inhibiting
NF-.kappa.B. In a similar manner, DNA encoding a rel-associated or
I.kappa.B-like protein can be introduced into cells to inhibit a
rel-related protein other than NF-.kappa.B.
[0173] Cells in which I.kappa.B (or other rel-associated protein)
is to be expressed in this manner to inhibit NF-.kappa.B (or other
rel-related protein) can be removed from the body, the
I.kappa.B-expressing vector can be introduced, using known methods,
and the resulting cells, which contain the I.kappa.B-expressing
vector, then reintroduced into the body. For example, T-cells or
bone marrow cells can be removed from an HIV-1 infected individual,
I.kappa.B-expressing vectors can be introduced into them, and they
can then be replaced in the individual. Alternatively, the
expression vector containing I.kappa.B-encoding DNA can be
introduced into an individual, using known techniques, by any of a
variety of routes, such as intramuscular, intravenous,
intraperitoneal administration. I.kappa.B itself (or other
rel-associated protein) can also be introduced into cells to
inhibit NF-.kappa.B (or other rel-related Protein). The entire
I.kappa.B molecule or a portion sufficient to bind NF-.kappa.B and
prevent its passage into the nucleus can be used for this purpose.
I.kappa.B or an appropriate I.kappa.B portion can be obtained from
naturally-occurring sources, can be produced using known genetic
engineering methods or, particularly in the case of an I.kappa.B
portion, can be synthesized chemically. For convenience, proteins
(or portions thereof) of all three types are referred to herein as
"essentially pure".
Uses of Genes Encoding Transcriptional Regulatory Factors, the
Encoded Factors and Related Products
[0174] The genes encoding positive transcriptional regulatory
factors provide a means for enhancing gene expression.
Lymphoid-specific factors involved in positive regulation of Ig
gene transcription provide a method for enhancing immunoglobulin
production in lymphoid cells. Lymphoid cells, such as monoclonal
antibody-producing hybridomas or myelomas, can be transfected with
multiple copies of a gene encoding a regulatory factory to induce
greater production of Ig. For this purpose, the gene encoding a
regulatory factor can be linked to a strong promoter. In addition,
the construct can include DNA encoding a selectable marker.
Multiple copies of the contruct can be inserted into the cell,
using known transfection procedures, such as electroporation. The
cell can be transfected with multiple regulatory factors, including
constitutive factors; this is particularly useful in the case of
factors determined to act in conjunction, possibly synergistically.
Amplification of genes encoding transcriptional regulatory factors
in this manner results in enhanced or increased production of the
regulatory factors and, consequently, production of immunoglobulin
is enhanced in these cells.
[0175] The present invention also relates to a method for
transiently expressing a gene product in a eukaryotic cell, in
which the inducibility of the NF-kB factor is used to advantage.
This phenomenon can be exploited to provide for the transient
overexpression of a gene product produced by a transfected gene in
a eukaryotic cell at a chosen time.
[0176] According to the method of this invention, a gene of
interest is placed under influence of the .kappa. enhancer sequence
containing the binding site for NF-kB (i.e., the entire enhancer
sequence or a portion containing at least the NF-kB site). The
.kappa.-enhancer sequence is linked to a structural gene of
interest to provide an gene inducible by NF-kB. A gene construct is
thus provided comprising 1) a .kappa.-enhancer sequence or a
portion of the .kappa. enhancer sequence containing at least the
sequence to which the factor NF-kB binds; 2) a promoter; and in 3)
structural gene of interest.
[0177] Conventional recombinant DNA techniques can be used to
prepare the construct. The .kappa. enhancer sequence can be
obtained from lymphoid cells which express the .kappa.-light chain.
The .kappa. enhancer can also be obtained from clones containing
the sequence. The construct can be prepared in or inserted into a
transfection vehicle such as a plasmid.
[0178] The structural gene can be any gene or gene segment which
encodes, a useful protein for Which transient overexpression is
desired. Such proteins are, for example, those that are damaging to
cells when produced constitutively. The structural gene can be used
with its endogenous promoter or other eukaryotic promoter.
[0179] Cells for transfection can be any eukaryotic cells used for
the expression of eukaryotic proteins. Transfection procedures,
such as the calcium precipitation technique are well known in the
art.
[0180] As the desired time, the transfected cells can be stimulated
with the appropriate inducer in an amount sufficient to induce
production of NF-kB. The preferred inducer is a phorbol ester which
acts rapidly and directly to activate protein kinase C and induces
production of NF-kB. If the transfected cell is a lymphoid cell
(e.g., B cell) responsive to a mitogen such as LPS or PHA the
mitogen may be used alone or in combination with phorbol ester.
[0181] Genes encoding transcriptional regulatory factors can be
modified for a variety of purposes, such as to encode factors with
activity equivalent to the naturally-occuring factor, factors with
enhanced ability to regulate transcription (e.g., to cause enhanced
transcription of genes, relative to transcription resulting from
regulation by or the effects of the normal/unmodified factor), or
factors with decreased ability to regulate transcription. This can
be carried out, for example, by mutagenesis of factor-encoding DNA
or by producing DNA (e.g., by recombinant DNA methods or synthetic
techniques) which encodes a modified or mutant transcriptional
regulatory factor (i.e., a transcriptional regulatory factor with
an amino acid sequence different from the normal or
naturally-occurring transcription factor amino acid sequence).
These modified DNA sequences and encoded modified factors are
intended to be encompassed by the present invention.
[0182] The gene encoding IgNF-b, for example, has been cloned and
sequenced and the nucleotide sequence is shown in FIG. 18A. For the
various utilities discussed below, the modified nucleotide sequence
can be obtained either naturally (e.g., polymorphic variants) or by
mutagenesis to yield substantially complementary sequences having
comparable or improved biological activity. Fragments of the
sequence may also be used. This invention encompasses nucleic acid
sequences to which the sequence of FIG. 18A hybridizes in a
specific fashion.
[0183] In addition, the DNA binding domain of the factors, which is
responsible for the binding sequence-specificity, can be combined
with different "activators" (responsible for the effect on
transcription) to provide modified or hybrid proteins for
transcriptional regulation. For example, with recombinant DNA
techniques, DNA sequences encoding the binding domain can be linked
to DNA sequences encoding the activator to form a gene encoding a
hybrid protein. The activator portion can be derived from one of
the factors or from other molecules. The DNA binding region of the
hybrid protein serves to direct the protein to the cognate DNA
sequence. For example, in this way, stronger activators of RNA
polymerases can be designed and linked to the appropriate DNA
binding domain to provide for stronger enhancement of
transcription.
[0184] DNA probes for the genes encoding the regulatory factors can
be used to determine the presence, absence or copy number of
regulatory factor-encoding genes or to identify related genes, by
hybridization techniques or a polymerase chain amplification method
(e.g., PCR). The ability to detect and quantify genes encoding
transcriptional regulatory factors can be used in diagnostic
applications, such as to assess conditions relating to aberrant
expression of a regulatory factor. Cells can be typed as positive
or negative for the occurrence of a particular gene and, in
addition, can be analyzed for the copy number of the gene. The DNA
probes are labeled DNA sequences complementary to at least a
portion of a nucleic acid encoding a transcriptional regulatory
factor. The labeled probe is contacted with a sample to be tested
(e.g., a cell lysate) and incubated under stringent hybridization
conditions which permit the labeled probe to hybridize with only
DNA or RNA containing the sequence to which the probe is
substantially complementary. The unhybridized probe is then removed
and the sample is analyzed for hybridized probe.
[0185] The DNA probes can also be used to identify genes encoding
related transcriptional regulatory factors. For this purpose,
hybridization conditions may be relaxed in order to make it
possible to detect related DNA sequences which are not completely
homologous to the probe.
[0186] Antibodies can be raised against the transcriptional
regulatory factors of this invention. The antibodies can be
polyclonal or monoclonal and they can be used as diagnostic
reagents in assays to determine whether a factor is expressed by
particular cells or to quantitate expression levels of a
factor.
[0187] A gene encoding a transcriptional regulatory factors can
also be used to develop in vivo or in vitro assays to screen for
agonists or antagonists of a factor-encoding gene or of the factor
encoded by the gene. For example, genetic constructs can be created
in which a reporter gene (e.g., the CAT gene) is made dependent
upon the activity of a factor-encoding gene. These constructs
introduced into host cells provide a means to screen for agonists
or antagonists of the factor-encoding gene. The antagonists may be
used to decrease the activity of the factors and thus may be useful
in the therapy of diseases associated with overactivity of a
transcriptional regulatory factor. Such agonists or antagonists
identified by assays employing the factor-encoding genes of this
invention are within the scope of this invention.
[0188] The present invention is useful as a means of controlling
activation in a host cell of an NF-kB precursor, which results in
formation of activated NF-kB, which, in turn, plays a key role in
transcriptional activation of other sequences, such as the k light
chain enhancer, the HIV enhancer and the interleukin-2 receptor
.alpha.-chain gene. NF-kB has been shown to be a ubiquitous
inducible transcription factor; it has been shown, as described
herein, to be present in many types of cells (i.e., all cell types
assessed to date). It serves to make immediate early responses
which it is capable of effecting because it is post-translationally
activated. As a result, the method and composition of the present
invention can be used to control transcriptional activation of
genes encoding a selected cellular protein. Changes in expression
of genes transcribed by RNA polymerase II in response to agents,
such as steroid hormones, growth factors, interferon, tumor
promoters, heavy metal ions and heat shock are mediated through
cis-acting DNA sequence elements such as enhancers. Binding of
NF-kB transcription factor has been shown to confer transcriptional
activity on several genes. Expression of these genes and others
similarly affected can be controlled by the present method. For
example, it has been shown that expression of one of the two
elements of the cell surface receptor specific for IL-2 is
controlled by NF-kB. Thus, in T cells, which produce IL-2,
production can be controlled (enhanced, reduced) by controlling
activation of NF-kB. In a similar manner, the method of the present
invention can be used to control expression of human
immunodeficiency virus in infected host cells.
[0189] Methods and compositions of the present invention are based
on use of the role of NF-.kappa.B as a second messenger, or
mediator, in the expression of genes in a wide variety of cell
types. The expression of a gene having an NF-.kappa.B binding
recognition sequence can be positively or negatively regulated to
provide, respectively, for increased or decreased production of the
protein whose expression is mediated by NF-.kappa.B. Furthermore,
genes which do not, in their wild type form, have NF-.kappa.B
recognition sequences can be placed under the control of
NF-.kappa.B by inserting NF-.kappa.B binding site in an appropriate
position, using techniques known to those skilled in the art.
[0190] DNA sequences known to contain NF-.kappa.B binding domains
are shown in Table 2. According to the methods described herein,
the expression of genes under the control of one of these elements
is subject to modulation by alteration of the concentration or
availability of NF-.kappa.B. This can also be carried out,
according to the present method, for any gene which contains an
NF-.kappa.B binding site. Furthermore, genes which do not naturally
contain NF-.kappa.B binding sites can be modified, using known
techniques, to subject these genes to NF-.kappa.B modulation.
First, an appropriate expression vector is selected for use in a
biological system of interest, the vector having a gene of interest
and restriction enzyme recognition sequences to facilitate the
insertion of a DNA fragment carrying the NF-.kappa.B binding
sites.
[0191] For example, the sequences of the .kappa. immunoglobulin
enhancer, the SV40 70 base pair repeat, the HIV long terminal
repeat, the MHC class I H2-kb gene and the interferon .kappa. PRDII
gene, all possess NF-.kappa.B binding sites (Table 2). By comparing
sequences to which NF-.kappa.B binds specifically, a consensus
sequence has been determined: TABLE-US-00002 C C GGGRATYYAC. T
T
DNA sequences which flank the binding site are scanned for
convenient restriction enzyme recognition sequences to facilitate
removal of the fragment from the longer sequence in which occurs
and its subsequent insertion into the expression vector. If such
sequences are present, the transfer of the fragment carrying the
binding site, to the expression vector, is straight forward. If
convenient sites do not exist, fragment transfer is facilitated
through the introduction of such restriction enzyme recognition
sequences using well known, site-directed mutagenic techniques. The
construct, prepared as described, can then be introduced into a
biological system of interest.
[0192] The expression of such constructs in a biological system is
subject to modulation by NF-.kappa.B. For example, purified
NF-.kappa.B could be introduced into the system in an effective
amount such that any inhibitory molecule present in the system
would be titrated out and uninhibited NF-.kappa.B could interact
with its binding recognition sequence, thereby increasing the rate
of transcription. This is an example of positive regulation.
[0193] Similarly, a copy of the NF-.kappa.B gene, cloned in an
appropriate expression vector, could be introduced into the
biological system, thereby providing for internal expression of the
NF-.kappa.B molecule, preferably at relatively high levels. Again,
high levels of NF-.kappa.B would function to titrate out any
inhibitor molecule present, and also to increase the rate of
transcription from a gene possessing a NF-.kappa.B binding
site.
[0194] A level of discrimination among members of a related family
of NF-.kappa.B binding sites, by a modified NF-.kappa.B molecule,
can also be introduced. Referring to Table 1, for example, there
are apparent differences among the various NF-.kappa.B binding
sites from various genes. A copy of a cloned NF-.kappa.B gene can
be mutagenized to alter the binding domain by well known
techniques, such as site or region directed mutagenesis.
Alternatively, DNA fragments encoding a modified NF-.kappa.B
binding domain can be made synthetically, having appropriate
cohesive or blunt termini to facilitate insertion into the
NF-.kappa.B gene to replace the existing sequences encoding the
corresponding portion of the binding domain. Such restriction
fragments can be synthesized having any desired nucleotide changes.
Mutated proteins encoded by such genes can be expressed and assayed
for preferential binding to, for example, one of the 10 different
DNA binding sites shown in Table 1 or related members of the family
of NF-.kappa.B binding sites. An example of an assay which can be
used to screen large numbers of recombinant clones in order to
identify binding domain mutants is that described by Singh et al.,
(Cell, 52:415-423 (1988)). Once such a mutant is identified, a DNA
expression vector encoding this mutant protein can be introduced
into a cell. The mutant protein will preferentially bind to the
selected member or members of the family of DNA binding sites, such
as those shown in Table 2, thereby preferentially enhancing
transcription from only those genes which contain that particular
binding site. TABLE-US-00003 TABLE 2 Sequences recognized by
NF-.kappa.B. Gene Sequence Ig .kappa. enhancer-mouse GGGGACTTTCC
SV40 enhancer HIV-1 (-91) CMV (4).sup.1,2 HIV-1 (-105) AGGGACTTTCC
HIV-2 CMV (1).sup.1 .beta.2-microglobulin serum amyloid A-g.sup.9
Ig .kappa. enhancer-human GGGGATTTCC CMV (3).sup.1
Interferon-.beta.- PRDII GGGAAATTCC CMV(2).sup.1 GGGACTTTCC MHC
class II-E.sub..alpha..sup.d GGGACTTCCC IL-2 lymphokine GGGATTTCAC
mouse IL-2R.alpha. GGGGATTCCT human IL-2R.alpha. GGGAATCTCC MHC
class I - H2-K.sup.b GGGATTCCCC HLA - A2, A11, B7 B27, B51 C C
CONSENSUS.sup.3: GGGRATYYA C T T .sup.1In this particular element,
the sequence has not been tested in a binding assay. All others
have been proven by direct binding and usually by inhibition of
binding to the Ig .kappa. sequence. .sup.2Since there are four
putative NF-KB recognition sites in the cytomegalovirus enhancer,
these have been numbered 1-4 as they are found from 5' to 3' on the
coding strand. .sup.3Consensus is based on all sequences though the
assignments of the sixth and tenth positions ignore one
deviant.
[0195] Negative regulation can be effected in an analogous manner.
For example, a specific inhibitor molecule which is able to block
(reduce or eliminate) NF-.kappa.B binding can be added to the
biological system in an effective amount. Preferably, this
inhibitor is specific for NF-.kappa.B and does not interact with
other cell constituents. An example of such a molecule is
I-.kappa.B.
[0196] Alternatively, negative regulation can be effected using
"decoy" molecules, which are designed to mimic a region of the gene
whose expression would normally be induced by NF-.kappa.B. In this
case, NF-.kappa.B would bind the decoy and, thus, not be available
to bind its natural target.
[0197] Furthermore, in the case of an inhibitor molecule which is
also a protein, the gene encoding the inhibitor molecule can be
identified, isolated, and cloned into an appropriate expression
vector using common methodology. When introduced into an
appropriate biological system, the inhibitor molecule is
synthesized and functions to interact with NF-.kappa.B with its
binding site and as a consequence reducing the level of
transcription of the gene containing the NF-.kappa.B binding
site.
[0198] Yet another method for negatively regulating the expression
of a gene containing an NF-.kappa.B binding domain involves the
introduction of an effective amount of a decoy sequence encoding
the NF-.kappa.B binding domain. The decoy sequence serves as an
unproductive binding domain with which the NF-.kappa.B molecule
binds. As the finite number of NF-.kappa.B molecules bind to the
decoy sequences, the number which bind productively (result in
increased transcription) with an intact gene, decreases.
[0199] Negative regulation can also be effected by the introduction
of "dominantly interfering" molecules (see e.g., Friedman et al.,
Nature, 335:452-454 (1988). For example, if the DNA binding domain
and the DNA polymerase activating domain of NF-.kappa.B are
spatially distinct in the molecule, a truncated form of the
NF-.kappa.B molecule can be synthesized, using well known
techniques. A preferred embodiment would be a truncated molecule
retaining the DNA binding domain, but lacking the RNA polymerase
activating domain. Such a "dominantly interfering" molecule would
recognize and bind to the NF-.kappa.B binding site, however, the
binding would be non-productive. Because the activation portion of
NF-.kappa.B would be required for enhanced transcription, the
truncated molecule would exert no positive effect. Furthermore, its
occupation of the NF-.kappa.B binding site effectively blocks
access to any intact NF-.kappa.B molecule which may be present in
the cell.
[0200] The invention is further illustrated by the following
examples, which are not intended to be limiting in any way.
EXAMPLES
Example 1
Identification of Nuclear Factor IgNF-A
Methods
1. Gel Electrophoresis DNA Binding Assays with the SfaNI-SfaNI
.kappa. Promoter Fragment.
[0201] The SfaNI fragment was subcloned into the SmaI site of pS64
(pSPIgV.sub..kappa., provided by N. Speck). For binding analysis
this fragment was excised from pSPIgV.sub..kappa. by digesting with
Hind III and Eco RI. These Latter sites flank the Sma I site in the
polylinker of pSP64. After end-labeling with [.alpha.-2P]dATP and
the large fragment of E. coli DNA polymerase I, the radiolabeled
fragment was isolated by polyacrylamide gel electrophoresis.
Binding reactions were performed and the reaction mixtures resolved
by electrophoresis (FIG. 1b). The .sup.32Plabeled fragment (about
0.5 ng, 10,000 cpm) was incubated with a nuclear extract of a human
B lymphoma cell line (EW)(prepared by the method of Dignam, J. D.
et al. Nucl. Acids Res. 11 1475-1489 (1983)) in the absence (lane
1) or presence of two different non-specific competitor DNAs (lanes
2-11). Binding reactions (25 .mu.l) contained 10 mM Tris.HCl (pH
7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol and 8 .mu.g EW
nuclear extract protein. Reactions 2-6 additionally contained 800,
1600, 2400, 3200 and 4000 .eta.g, respectively, of
poly(dI-dC)-poly(dI-dC). Reactions 7-11 contained 300, 600, 900,
1200 and 1500 .eta.g, respectively, of Hinf I digested E. coli
chromosomal DNA. After a 30 min incubation at room temperature, the
resulting complexes were resolved in a low ionic strength 4%
polyacrylamide gel (acrylamide:bisacrylamide weight ratio of 30:1)
containing 6.7 mM Tris.HCl (pH 7.5), 3.3 mM Na-acetate and 1 mM
Na-EDTA. See Strauss, F. and Varshavsky, A. Cell 37 889-901 (1984).
The gel was preelectrophoresed for 30 min at 11 V/cm.
Electrophoresis was carried out at the same voltage gradient for 90
min at room temperature with buffer recirculation. The gel was then
dried and auto-radiographed at -70.degree. C. with a screen. In
FIG. 1b, F and B indicate positions of free and bound fragments
respectively.
[0202] Binding assays were performed as detailed above using 2400
ng poly (dI-dC)-poly(dI-dC)) and the following DNA fragments:
.kappa. SfaNI-SfaNI (.about.0.5 rig, 10,000 cpm, lane 1), .kappa.
PvuII-KpnI (.about.0.5 .eta.g, 10,000 cpm, lane 2), .kappa.
PvuII-SfaNI (.about.0.1 rig, 5000 cpm, lane 3) and pSP64
PvuII-EcoRI (.about.0.2 ng, 5000 cpm, lane 4). The .kappa.
PvuII-SfaNI fragment was derived from the plasmid
pSPIgV.sub..kappa. by digesting with PvuII and EcoRI. The EcoRI
site is in the polylinker and therefore this fragment contains 16
bp of polylinker sequence.
2. Binding Competition Analysis in Nuclear Extracts of Human EW and
HeLa Cells.
[0203] EW nuclear extract, FIG. 2a. Binding assays were performed
as detailed above using radiolabeled K PvuII-SfaNI fragment
(.about.0.1 .eta.g, 5000 cpm) and 2400 .eta.g
poly(dI-dC)-poly(dI-dC). Reactions 2-4 additionally contained 50,
100 and 200 .eta.g, respectively, of the bacterial plasmid pSP64
whereas 5-7 contained 50, 100 and 200 .eta.g, respectively, of the
recombinant plasmid pSPIgV.sub..kappa.. Assuming that a molecule of
pSPIgV.sub..kappa. contains a single high affinity site whereas a
molecule of pSP64 (3000 bp) contains 6000 non-specific sites, the
apparent affinity ratio of the factor for these two types of sites
is greater than 6000.times.200/50=12.4.times.10.sup.4 Hela nuclear
extract, FIG. 2b. Binding assays were performed as detailed above
using radiolabeled .kappa. PvuII-SfaNI fragment (about 0.1 ng, 5000
cpm), 2400 ng poly(dI-dC)-poly(dI-dC) and 6 .mu.g Hela nuclear
extract protein (provided by P. Grabowski). Reactions 1 and 2
additionally contained 100 .eta.g of pSP64 and pSPIgV.sub.78,
respectively.
3. DNase Footprinting of Factor-DNA Complexes. (FIG. 3)
[0204] The B cell nuclear extract was applied to a
heparin-sepharose column equilibrated with 10 mM Hepes pH 7.9, 20%
glycerol, 1 mM DTT, 1 mM EDTA, 5 mM MgCl.sub.2 and 0.1 M KCl. The
.kappa.-promoter binding factor was eluted with a 0.25 M KCl step.
Binding reactions with this fraction (30 .mu.l) contained 2.5 mM
MgCl.sub.2, .kappa. PvuII-SfaNI (.about.1 ng, 100,000 cpm) and 4800
.kappa.g poly(dI-dC)-poly(dI-dC) in addition to components detailed
above. The coding strand of the .kappa. promoter probe was 3'
end-labeled (Eco RI site) with [.alpha.-.sup.32 P] dATP using the
large fragment of E. coli DNA polymerase. Reaction 1 was digested
with DNase I (5 .mu.g/ml) for 2.5 min at room temperature in the
absence of B cell nuclear protein. Reaction 2 was initially
incubated with the heparin Sepharose fraction of the EW nuclear
factor (14 .mu.g protein) for 15 min at room temperature and then
digested with DNase I as above. Each reaction was stopped with EDTA
(5 mM) and the products separated by native polyacrylamide gel
electrophoresis as detailed above. After autoradiography to
visualize the various species, DNA was eluted from the free
(reaction 1) and bound (B1 and B2, reaction 2) fragment bands by
incubating gel slices in 0.5 M ammonium acetate (ph 7.5), 0.1% SDS
and 1 mM EDTA with shaking at 37.degree. C. overnight. The
supernatants were extracted sequentially with
phenol-chloroformisoamylalcohol (25:24:1 v/v) and
chloroform-isoamylalcohol (24:1 v/v) and precipitated with 2
volumes of ethanol in the presence of carrier tRNA. After a
reprecipitation step the products were analyzed by separation in a
10% poly-acrylamide gel (20:1) in the presence of 8M urea followed
by autoradiography at -70.degree. C. with a screen. Lane 1 contains
products of free fragment digestion from reaction 1. Lanes 2 and 3
contain digestion products eluted from bound bands B1 and B2,
respectively, from reaction 1. Lanes 1', 2' and 3' corresponds to
1, 2 and 3, respectively, with the exception that the former set
was digested with DNase 1 for 5 min. A-G chemical cleavage ladders
of the K promoter probe were coelectrophoresed to map the binding
domain. See Maxam, A. and Gilbert, W. Meth. Enzymol. 65, 499-525
(1980).
4. Binding of a Common Nuclear Factor to Three Ig Transcriptional
Control Elements.
[0205] Nucleotide sequences of actual and putative binding sites,
FIG. 4a. The V.sub.L binding site is defined by the DNase I
protection assay (* indicates boundaries of the protected region).
The V.sub.H and J.sub.H-C.sub.U sequences are putative binding
sites in the V.sub.17.2.25 promoter and the mouse heavy chain
enhancer, respectively. Numbers in brackets indicate start
coordinated of octamer motif. Binding competitions. Binding assays
(10 .mu.l) were performed as detailed above using 1600 ng
poly(dI-dC)-poly(dI-dC) and the heparin Sepharose fraction of the
EW nuclear factor (1.5 .mu.g protein). V.sub.L probe (about 0.1 ng,
5000 cpm) lanes 1-3, 10, 11. V.sub.H probe (.about.0.2 ng, 5000
cpm) lanes 4-6, 12-12. J.sub.H-C.sub..mu. probe (-0.2 .eta.g, 5000
cpm), lanes 7-9, 14, 15. Lanes 2, 5, 8 additionally contained 5 ng
of a V.sub.L promoter oligomer (36 bp, spanning positions -81 to
-44 of the MOPC-41 V.sub..kappa. gene segment) whereas lanes 3, 6,
9 contained 50 ng of the same oligomer. Lanes 11, 13, 15
additionally contained 50 .eta.g of a J.sub.H-C.sub.H oligomer (41
bp, spanning positions -1 to 40 of the heavy chain enhancer).
Complementary single-stranded synthetic oligonucleotides were
kindly made by Dr. Ronald Mertz, Genzentrum der Universitat Munchen
and Dr. E. L. Winnacker, Institut fur Biochemie der Universitat
Munchen. They were annealed prior to use as competition substrates
in the binding assay.
Results
[0206] A radiolabeled SfaNI-SfaNI DNA fragment derived from the
upstream region of the MOPC 41 .kappa. light chain gene (FIG. 1a)
was incubated with a nuclear extract of a human B cell line in the
absence or presence of two different competitor DNAs. The resulting
complexes were resolved from the free fragment by electrophoresis
through a low ionic strength, non-denaturing polyacrylamide gel and
visualized by autoradiography (FIG. 1b). In the absence of
competitor DNA all of the labeled fragment was retained at the top
of the gel (lane 1) probably due to the binding of an excess of non
sequence-specific proteins. With addition of increasing amounts of
either poly(dI-dC)-poly(dI-dC) (lanes 2-6) or E. coli chromosomal
DNA (lanes 7-11) as competitors, putative protein-DNA complexes
which migrated more slowly than the free fragment were detected.
The relative abundance of the major species of complex (B) as well
as that of minor species was significantly greater in the presence
of the alternating copolymer competitor DNA. Because substitution
of the simple copolymer considerably increased the sensitivity of
the assay it assay used in all subsequent binding analyses.
[0207] To test the sequence-specificity of the major species
detected in the binding assay, a set of mutually overlapping Kappa
promoter fragments (See FIG. 1a, SfaNI-SfaNI, PvuII-KpnI and
PvuII-SfaNI) and a similar length fragment derived from the
bacterial plasmid SP64 (EcoRI-PvuII) were individually assayed
(FIG. 1c). Whereas the bacterial DNA fragment showed no appreciable
binding (lane 4) all of the .kappa. promoter fragments yielded
major discrete complexes of similar mobilities (lanes 1-3). The
mobilities of a series of complexes formed with different length
fragment probes (75-300 bp) are approximately the same (data not
shown). These data therefore suggested the binding of a specific
nuclear factor within the region of overlap of the Kappa promoter
fragments. This region includes the conserved octameric sequence
but not the TATA element. Note that with the smallest 75 bp Kappa
promoter fragment (lane 3) no appreciable label was retained at the
top of the gel. Thus, as has been noted recently, the use of small
probe fragments further enhances the sensitivity of detection of
specific protein-DNA complexes.
[0208] The sensitivity gained by use of both the copolymer and a
small fragment probe permitted the detection of two complexes, B1
and B2 (FIG. 2a, lane 1). The major species B1 corresponds to
complex B in the earlier figure. The relative affinity of the
factor(s) for .kappa. promoter DNA was estimated by a competition
assay (FIG. 2a). Whereas a control plasmid (pSP64), when added in
the above incubation, failed to compete for binding in the
concentration range tested (lanes 2-4), the recombinant plasmid
(pSPIgV.sub..kappa.) effectively reduced the formation of both
species B1 and B2 in the same range (lanes 5-7). The latter plasmid
was constructed by insertion of the upstream region of the Kappa
promoter into pSP64. Assuming that the pSPIgV.sub..kappa. plasmid
contains a single high affinity binding site these results suggest
that the nuclear factor(s) responsible for B1 and B2 has at least a
10.sup.4-fold higher affinity for its cognate sequence than for
heterologous plasmid DNA (see Methods section 2 above).
[0209] To determine if the factor(s) responsible for formation of
B1 and B2 was specific to B lymphocytes, a nuclear extract derived
from human HeLa cells was assayed for binding to the .kappa.
promoter probe (FIG. 2b). Both species B1 and B2 were generated at
similar levels as that observed with B cell extracts, by the HeLa
extract (lane 1). Furthermore, both were specifically competed by
the pSPIgV.sub..kappa. plasmid (lane 2). Thus HeLa cells also
contain a factor(s) which binds specifically to the .kappa.
promoter upstream region.
[0210] DNase I footprint analysis was used to delineate at a higher
resolution the binding domain(s) of factor(s) present in complexes
B1 and B2. To facilitate these studies, the binding factor(s) from
B cells was partially purified by chromatography of nuclear extract
protein on a heparin sepharose column. Most of the binding activity
eluted in a 0.25 M KCl step fraction, giving a purification of
approximately 5-fold (data not shown; see legend to FIG. 3). For
footprint analysis, DNase I was added for a partial digestion after
incubation of the partially purified factor(s) with the .kappa.
promoter probe B1 and B2 species were then resolved from free
fragment by polyacrylamide gel electrophoresis. Bound DNA was
eluted from both B1 and B2 bands and examined by denaturing
polyacrylamide gel electro-phoresis (FIG. 3, lanes 2, 3 and 2',
3'). DNase I digests of the .kappa. promoter probe in the absence
of B cell protein (lanes 1 and 1') and A+C chemical cleavage
ladders were coelectro-phoresed to map the binding domain.
Factor(s) in the B1 complexes (lanes 2 and 2') appeared to protect
a 19 nucleotide region on the coding strand. The 5' and 3'
boundaries of the protected region map to positions -72 and -52,
respectively, from the site of transcriptional initiation. The
region of DNase I protection was centered about the conserved
octanucleotide sequence ATTTGCAT suggesting its importance in the
recognition of the Ig promoter by the nuclear factor. B2 complexes
showed a virtually identical DNase I protection pattern as B1
complexes and therefore do not appear to involve additional DNA
contacts (lanes 3 and 3'). The simplest interpretation of this
observation is that the B2 complex is generated by dimerization
through protein-protein interactions of the factor responsible for
the B1 complex. Alternatively, the B2 complex could be formed
either by the binding of another protein to the factor responsible
for the B1 complex or by recognition of the same set of sequences
by a distinct DNA binding protein.
[0211] Because the octamer sequence motif is present in both light
and heavy chain gene promoters as well as in the enhancer elements
of both mouse and human heavy chain genes, assays were performed
for factor binding to fragments from a mouse heavy chain promoter
(V.sub.H) and the mouse heavy chain enhancer. The V.sub.H promoter
fragment was derived from the 5' region of the V.sub.17.2.25 gene
and included nucleotides between positions -154 and +57 relative to
the transcriptional start site. Grosscheal, R. and Baltimore, D.
Cell 41 885-897 (1985). In this promoter the conserved
octanucleotide spans positions -57 to -50 (FIG. 4a). The heavy
chain enhancer fragment was derived from the germline J.sub.H
C.sub..mu. region and spanned positions 81 to 251 within a 313 bp
region implicated in enhancer function. Banerji, T. et al. Cell 33
729-740 (1983). The conserved octanucleotide is positioned between
coordinates 166 to 173 in the above fragment (FIG. 4a). The B-cell
heparin sepharose fraction (purified on the basis of binding to the
Kappa promoter sequence, FIG. 4b, lane 1) evidenced binding to both
the V.sub.H promoter fragment (lane 4) and to the enhancer fragment
(lane 7). The mobilities of the complexes formed with the three
fragments were very similar consistent with the binding of a common
factor. Furthermore, binding to these fragments was specifically
competed by a synthetic duplex 40-mer that spanned the
octanucleotide motif of the MOPC 41 .kappa. light chain gene
promoter (lanes 1-9). An oligomer of equivalent size containing a
sequence from a region of the mouse heavy chain enhancer lacking
the octanucleotide motif (FIG. 4b) failed to compete for binding in
the same concentration range (lanes 10-15). This competition
analysis further strengthens the suggestion that a common nuclear
factor (IgNF-A) binds to all three Ig transcriptional elements. As
has been mentioned previously, these three transcriptional elements
share an identical sequence motif ATTTGCAT (FIG. 4a). Thus, the
binding of a common nuclear factor is almost certainly mediated by
this motif.
Example 2
Dependency of In Vitro Transcription of Ig Genes on an Upstream
Sequence
Methods
[0212] FIG. 5a: Templates. The deletions 5'.DELTA.5 and 5'.DELTA.7
have been described before. See Bergman Y. et al PNAS USA 81:7041
(1981). The highly conserved octanucleotide sequence which is found
upstream of all sequenced heavy and light chain variable region
genes is boxed (labelled "OCTA"). It is located approximately 30
base pairs upstream from the "TATA" box. The plasmids p.kappa. and
p.DELTA..kappa. were constructed by converting the 5'-ends of
5'.DELTA.5 and 5'.DELTA.7 into a Hind III site by means of
synthetic linkers followed by cloning the fragment up to the Bgl II
site in the J.sub..kappa.-C.sub..kappa.major intron into Hind III,
Bam HI digested pUC-13. pKE.sub..kappa. and pKE.sub..kappa.
represent plasmids containing either the kappa enhancer of the
heavy chain enhaner cloned into the unique Hind III site of pK. The
segments used as the enhancers are an 800 bp Hind III-Mbo II
fragment from the J.sub..kappa.-C.sub..kappa. intron (Max, E. E. et
al. (1981) J. Biol. Chem. 2565116) and a 700 bp Xba I-Eco RI
fragment from the J.sub.H-C.sub..mu. intron. Gillies, S. D. et al.
Cell 33:717 (1983); Banjerji, J. et al. Cell 33:729 (1983). FIG.
5b; transcription in whole cell extracts made from the human B
lymphoma cell lines RAMOS (lanes 1,2) and EW (lanes 3,4):
transcription in a HeLa whole cell extract (from A Fire (lanes
5,6)). The expected 2.3 kb run off transcript is indicated.
[0213] The cell lines RAMOS and EW were grown in RPMI medium
containing 10% inactivated fetal calf serum to a density of
5-8.times.10.sup.5 cells per ml. Whole cell extracts were generated
according to the procedure of Manley et al., PNAS USA 77:3855
(1980), and had a final protein concentration of approximately 18
mg/ml. Run off transcription reactions were carried out at 300 for
60' in a reaction volume of 20 .mu.l. A typical reaction mix
contained 9 ul (160 .mu.g) of whole cell extract, 50 uM each of
ATP, CTP and GTP, 0.5 uM UTP, 10 .mu.Ci of .alpha.-.sup.32P UTP
(NEG 007.times., 7600 Ci/mM) 5 mM creatine phosphate, 0.3 mg/ml
creatine phosphokinase (Sigma), 12 mM Hepes 7.9, 12% glycerol, 60
mM KCl, 5 mM MG.sup.++, 1 mM EDTA, 0.6 mM DTT, linearized template
(about 50 .eta.g) and poly (dI-dC)-poly(dI-dc) as a non-specific
carrier (about 400 .eta.g). The reactions were terminated by adding
200 .mu.l of stop buffer (7M urea, 100 mM LiCl, 0.5% SDS, 10 mM
EDTA, 250 .mu.g/ml tRNA, 10 mM Tris (pH 7.9), followed by two
extractions with phenol: chloroform: isoamyl alcohol (1:1:0.05),
one with chloroform and precipitation with ethanol. The RNA's were
treated with glyoxal and analyzed by electrophoresis through a 1.4%
agarose gel in 10 mM sodium phosphate (pH 6.8), 1 mM EDTA. See
Manley et al. supra. The gel was then dried for autoradiography
with an intensifying screen at -70.degree. C.
[0214] FIG. 6: Effect of the upstream deletion 5'.DELTA.7 on in
vitro transcription in B cell extracts utilizing a pre-incubation
pulse chase protocol. Run off transcripts obtained utilizing
templates containing either the wild type promoter (lane 1) or the
truncated Kappa promoter (lanes 2,3). Lanes 4-6: In vitro
transcription using closed circular templates containing the wild
type promoter (lane 4) or the truncated .kappa. promoter (lanes
5-6). In these reactions 50 ng of a closed circular template
containing the adenovirus major late promoter (MLP) was included as
an internal control. The transcripts specific to the .kappa.
template or the adenovirus template are indicated as .kappa. and
MLP, respectively. For a template containing the major late
promoter the plasmid pFLBH was used. The plasmid contains sequences
from 14.7 to 17.0 map units of adenovirus inserted between the Bam
HI and Hind III sites of pBR322 and was the kind gift of A. Fire
and M. Samuels.
[0215] Either the linearized or the supercoiled template (50
.eta.g) was incubated in a volume of 20 .mu.l with 9 .mu.l (about
150 .mu.g) of EW extract, 6% (wt/vol) polyethylene glycerol 20,000
and all other components described for FIG. 5b except the
nucleotides for a period of 60 minutes at 30.degree. C.
Transcription was initiated by the addition of nucleotides and
radioactive UTP to the following final concentrations: 60 uM each
of ATP, CTP and GTP and 1 .mu.M UTP and 10 .mu.Ci .alpha.-.sup.32P
UTP (NEG 007.times., 600 Ci/mM). The initiating pulse was
maintained for 10' at 30.degree. followed by a 10' chase with a
vast excess of non-radioactive nucleotides. Final concentrations
during the chase were as follows: 330 .mu.M ATP, CTP, GTP and 1 mM
UTP. The reactions were quenched, worked up and the run off
transcripts analyzed as described above. Mapping of the initiation
site of the transcript was conducted as follows: Transcripts
generated from closed circular templates were taken up in 20 .mu.l
of HE (50 mM Hepes, pH 0.7, 1 mM EDTA) and 10 .mu.l was used for
hybridization selection. A hybridization template complementary to
the K RNA was constructed by cloning the Pva II-Sau 3A fragment
which contains the cap site of the MOPC41 gene (Queen and
Baltimore, Cell 33:741 (1983)) into the M13 phage MP9. Single
stranded phage DNA was prepared and purified by density gradient
centrifugation through cesium chloride. MLP specific transcripts
were detected using the M13 clone XH11 provided by A. Fire and M.
Samuels. Hybridizations were done in a final volume of 15 .mu.l in
the presence of 750 mM NaCl and 100-200 ug of single stranded
complementary DNA at 50.degree. C. for 2 hrs. The reactions were
then diluted with 200 .mu.l of cold quench solution (0.2 M NaCl, 10
mM Hopes pH 7.5, 1 mM EDTA) and 2 U of ribonuclease T1 added.
Digestion of single stranded RNA was allowed to proceed for 30' at
30.degree. C. after which the reactions were extracted once with
phenol chloroform isoamyl alcohol (1:1:0.05) and precipitated with
carrier tRNA. The pellet was washed once with cold 70% ETOH, dried
and resuspended in 80% v/v formamide, 50 mM Tris borate, pH 8.3 and
1 mM EDTA. The RNA was denatured at 95.degree. C. for 3 min and
then electrophoresed through a 6% polyacrylamide 8.3 M urea
sequencing gel. The upper of 2 bands (.kappa.) derived form the
immunoglobulin promoter represent the correct start for .kappa.
transcription. The lower band is seen at variable intensities and
probably does not represent a different cap site, as explained
below
Results
[0216] Whole cell extracts were made from two human Burkitt
lymphoma lines, EW and RAMOS, by the procedure of Manley et al.
supra. The templates used for in vitro transcription reactions are
diagrammed in FIG. 5a. The template representing the wild type gene
(pK) was derived from the MOPC41 .kappa. gene and contained
sequences from approximately 100 bp upstream from the transcription
initiation site (end point 5'.DELTA.5, FIG. 5a) to the Bgl II site
in the major J.sub..kappa.-C.sub..kappa. intron Max, E. E. J. Biol.
Chem. 256:5116. This fragment retains the complete variable region
which is rearranged to J.sub..kappa.l, but not the .kappa. enhancer
which is further downstream of the Bgl II site. See, e.g., Queen
and Stafford, Mol. Cell. Biol. 4:1042 (1984). This short 5' flank
has been shown to be sufficient for accurate initiation and high
level of transcription in a transient transfection assay. Bergman,
Y. et al. PNAS USA 81:7041 (1984). Deletion analysis of the .kappa.
promoter showed previously that important regulatory sequences are
present between nucleotides -79 and -44 because deletion 5'.DELTA.7
completely abolished transcriptional competence of the gene while
deletion 5'.DELTA.5 had no effect. See Bergman et al. supra. The
template representing an inactive promoter mutant (paK) was
constructed by engineering a Hind III site into the 5'-end of
5'.DELTA.7 and cloning the segment of the gene up to the Bgl II
site into pUC13 cut with Hind III and Bam HI.
[0217] To examine transcriptional activity in B cell extracts, a
linear template truncated at the Sac I site in the polylinker was
used and transcripts ending at this site (run off transcripts) were
examined by electrophoretic separation. A run off transcript of 2.3
kb was evident when RAMOS, EW or HeLa cell extracts were used (FIG.
5b, lanes 2, 4 and 6). When a K chain enhancer sequence was added
to the construct, no effect was evident implying that transcription
in these extracts is enhancer independent (FIG. 5b, lanes 1, 3 and
5). (In EW and HeLa, the enhancer appears to cause a slight
increase in the background radioactivity but not in the 2.3 kb
band.) The band at 2.3 kb could be abolished by not adding the
template or by transcribing in the presence of 0.5 .mu.g/ml
amanitin. Thus it represents a template-specific, RNA polymerase II
transcript. The band just below 2.3 kb is not decreased by
.alpha.-amanitin and presumably reflects end-labeling of endogenous
18S rRNA.
[0218] To assess whether initiation of transcription occurred at
the natural cap site, a second assay was used. See Hansen, U. and
P.A. Sharp (1983) EMBO J. 2:2293. For this assay, the uniformly
labeled RNA was hybridized to a single stranded DNA probe spanning
the transcription initiation site (generated by cloning the Pvu
II-Sau 3A fragment of the .kappa. gene into phage M13). The
resulting complex was digested with ribonuclease T1 and the
ribonuclease-resistant RNA fragments were analyzed by
electrophoresis through a 6% polyacrylamide gel with 8.3 M urea.
Analysis of in vitro synthesized RNA by this method is shown in
FIG. 6 (lane4). The upper band (labeled .kappa.) represents the
correct cap site. The band just below it was seen at variable
intensities and probably does not represent a different cap site
but rather arises from cleavage with ribonuclease T1 at the next G
residue from the 3'-end of the protected region. (Examination of
the sequence near the Sau 3A1 site shows that the second set of G
residues on the RNA lies 19 bp upstream from the end of the region
of homology with the single stranded DNA probe). Thus the extracts
generated from B cells were capable of correctly initiating and
transcribing the immunoglobulin promoter in vitro with
approximately the same efficiency as a HeLa cell extract.
[0219] To analyze the effect of 5' flanking sequences in vitro, we
examined the transcription of the deleted gene, p.DELTA.K. Because
many regulatory effects act upon the rate of initiation of
transcription, we chose to use a preincubation, pulse-chase
protocol which measures the initiation rates. See Fire, A. et al.
J. Biol. Chem. 259:2509 (1984). The template DNA was first
preincubated with the extract to form a pre-initiation complex.
Transcription was then initiated by the addition of nucleotides and
radiolabeled UTP. The initiated transcripts were completed during a
chase period with unlabelled nucleotides and analyzed by
electrophoretic separation. Incorporated radioactivity in this
assay is proportional to the number of correct initiations
occurring during the pulse.
[0220] In FIG. 6, comparison of lanes 2 and 3 with lane 1 shows
that the template p.kappa., which contains about 100 bp upstream of
the initiation site, initiated approximately 10-fold more
efficiently than did the deletion mutant, p.kappa.. Again, the
presence of the heavy chain enhancer placed at -44 bp to the
truncated promoter did not alter the level of transcription. When
closed circular templates were used, a similar effect of the
promoter truncation was observed (FIG. 6, lanes 4-6). In these
reactions a template containing the major late promoter of
adenovirus was included as an internal control; the expected
protected RNA fragment of 180 bp is labeled MLP. Comparison of
lanes 5 and 6 with lane 4 shows that there was a 10-fold decrease
in the efficiency of transcription from the mutant promoter,
whereas the transcript of the major late promoter remained
constant. The reason for the apparent decrease in the amount of
transcription from the supercoiled template containing the heavy
chain enhancer has not been further addressed. It is evident,
however, that the dependence of transcription on an upstream
sequence between -44 and -79 is observed whether the effect
described above was specific to B cell extracts, the same templates
were transcribed in the heterologous HeLa whole cell extract. A 4-
to 5-fold decrease in transcription was seen with the deleted
template when compared with the wild type template (data not
shown). Thus, the effect of the deletion is at best, only modestly
tissue-specific.
[0221] We have reported here the development of transcriptionally
competent whole cell and nuclear extracts from two independent
human B cell lymphomas. In such extracts, transcription from the
promoter of the MOPC41 .kappa. gene was correctly initiated and a
promoter deletion significantly reduced the level of initiated RNA.
In vitro, the effect of the deletion used here is several
hundredfold when analyzed by a transient transfection assay.
However, the effect observed in vitro is only about 10- to 15-fold.
Although, there are now several examples of upstream sequence
requirements for in vitro transcriptions, See, e.g., Groschedl R.
and Birsteil M. L. (1982) PNAS USA 79:297; Hen, R. et al. (1982)
PNAS USA 79:7132, the effects have been smaller than the
corresponding one in vivo. This is possibly due to the dominance of
the TATA box and associated factors in determining the level of
transcription in vitro Miyamoto, N. G. et al., Nucl. Acids Res.
12:8779 (1984).
Example 3
Discovery and Characterization of IgNF-B
[0222] The mobility shift gel electrophoresis assay was used to
screen nuclear extracts from a variety of cell lines for octamer
binding proteins. The band corresponding to IgNF-A was found in all
extracts but a second band with distinct mobility from IgNF-A was
found only in nuclear extracts from lymphoid cells. This
lymphoidspecific octamer binding protein, termed IgNF-B, was found
in nuclear extracts from all pre-B, mature B and myeloma cell lines
tested and in nuclear extracts from some T cell lymphomas (see
FIGS. 7 and 8). IgNFB was not detected in nuclear extracts from the
non-lymphoid cell lines, Hela, .PSI.2, Cos and MeI (see FIG. 8).
IgNF-B was shown to be specific for the same octamer sequence as
IgNF-A by competition experiments n which the IGNFB band was
selectively competed by unlabelled DNA fragments sharing only the
octamer sequence and not by DNA fragments lacking the octamer
sequence.
[0223] The octamer sequence is found at approximately position -70
upstream of the transcription start site of all immunoglobulin (Ig)
variable genes which is in the region that has been shown to
control the lymphoid specificity of the Ig promoter. Thus, IgNF-B
binds to the upstream octamer sequence in lymphoid cells and
activate transcription.
Example 4
Factors Binding to .beta.-Enhancer: E Factor
[0224] The fully functional .mu. enhancer has been localized to a
700 bp XbaI EcoRI fragment from the major intron between J.sub.H
and C.sub..mu.. This fragment can be further subdivided by cleaving
at the PstI site to generate a 400 bp Xbal-PstI fragment (.mu.400)
and a 300 bp PstI-EcoRI fragment (.mu.300). It has been shown by
transient transfections that 30-50% of the tissue specific enhancer
activity is retained in .mu.300, whereas there is no detectable
activity of .mu.400. The gel binding assay was employed to
investigate what protein factors may interact with the u-enhancer.
Briefly, end-labelled DNA fragments were incubated with nuclear
extracts made from tissue culture cells. After 20 min at room
temperature the mixture was loaded on a low ionic strength
polyacrylamide gel and electrophoresis carried out at 120V for 2
hrs. The gels were then dried for autoradiography. When the
functional 300 bp (.mu.300) enhancer fragment was used in such an
assay a DNA-protein complex was observed in extracts derived from
the human B lymphoma cell line EW (FIG. 9b, lane 2). To show that
this new band represented a specific complex binding reactions were
carried out in the presence of varying amounts of non-radioactive
competitor fragments (FIG. 9b, lanes 3-11). It is easily seen that
when .mu.300 is added as the competitor fragment, the complex band
is completely lost. In contrast, the adjacent .mu.400 fragment
(lanes 6,7,8) or a 450 bp fragment containing the .kappa. light
chain enhancer (lanes 9,10,11), cause only a minor effect even at
the highest concentrations used. It is interesting to note that
there appears to be a slight increase in the amount of specific
complex in the presence of the .kappa. enhancer fragment (compare
lanes 9 and 2). As demonstrated below, both the .mu. and the
.kappa. enhancers interact with at least one common protein and
this is not the factor being detected by binding the u300 fragment.
The increase in the specific complex in the presence of the .kappa.
enhancer is probably due to the removal of factors common to both
the enhancers from the reaction mix, thus leaving more of the
labelled fragment available to bind to the .mu. specific factor
being detected by it.
[0225] In order to be able to detect binding sites for less
abundant proteins and also to more precisely define the complex
detected with .mu.300, this fragment was further dissected. Each of
the smaller fragments generated were analyzed for their ability to
serve as binding sites for nuclear proteins. FIG. 10A shows a
partial restriction map of the relevant region of the .mu.
enhancer. .mu.300 was digested with AluI, HinfI and DdeI to
generate a number of 50-70 bp fragments labelled .mu.50,
.mu.(60).sub.2 (a mixture of AluI-DdeI and HinfI to AluI) and
.mu.70 (AluI-AluI). Binding reactions were carried out with each of
these fragments with nuclear extracts of EW lymphoma cells in the
presence of increasing amounts of the non-specific competitor poly
(dI-dC)-poly(dI-dC). The results are shown in FIG. 10B.
[0226] Fragment .mu.50 forms a major complex band (lanes 2,3,4)
that is barely decreased even in the presence of 4 ug of
poly(dI-dC)-poly(dI-dC) (lane 4). The mixture of the two 60 bp
fragments does not give rise to a discrete complex band (lanes
6,7,8). Finally the .mu.70 fragment gave 2 faint, but discrete,
nucleoprotein complex bands (lanes 10,11,12) of which the lower one
is again barely affected by 3 ugm of non-specific carrier
poly(dI-C)-(dI-C) (lane 12).
[0227] Specificity of the complexes observed were shown by
competition experiments using a variety of DNA fragments, FIG. 10C.
Thus, the complex generated with .mu.50 is specifically competed
away in the presence of .mu.300 (of which .mu.50 is a part), or a
.kappa. promoter fragment, but not by corresponding amounts of
.mu.400 or a .kappa. enhancer fragment, consistent with the complex
being generated by the interaction of the previously described
factor IgNF-A with its cognate sequence. (This factor recognizes a
conserved octanucleotide, ATTTGCAT, found in the promoters of all
sequenced immunoglobulin genes and within this subfragment of the
heavy chain enhancer.)
[0228] The complex observed with .mu.70 was specifically competed
away by itself (lane 9) and to some extent with the .kappa.
enhancer (lanes 5,6 FIG. 10C) but not at all by either the Moloney
murine leukemia virus enhancer (lanes 3,4) or by p400 (lanes 7,8,
FIG. 10D). Further competition analysis showed that this complex
could not be competed away by either (.mu.60).sub.2 (FIG. 2D, lanes
7,8), .mu.50 (FIG. 2D, lanes 5,6) or .mu.170 (central AluI-AluI
fragment) (FIG. 10D, lanes 11,12). The binding we have observed is
therefore specific to this small fragment and was detected only
upon further dissecting .mu.300 which separated the major
observable interaction of IgNF-A with the enhancer sequence to
another fragment (.mu.50).
[0229] Ephrussi et al. and Church et al. have used methylation
protection experiments to define a set of G residues within the
heavy chain enhancer that are specifically resistant to methylation
by DMS in B cells. This result lead to the proposal that
tissue-specific DNA binding proteins were respon-sible for this
decreased accessibility of the reagent to DNA. The protection was
observed in 4 clusters, the DNA sequences of which were
sufficiently homologous to derive a consensus sequence for the
binding site of a putative factor. All four postulated binding
sites (E1-E4) are found within the 700 bp fragment; however .mu.300
retains only 2 complete binding domains (E3 and E4) for this factor
and the octamer (O) sequence. The Alu-Alu fragment that shows that
specific nucleoprotein complex described above contains the
complete E3 domain and the factor we detect in vitro presumably is
the same as that detected in vivo. Thus, it was unexpected that the
HinfI-Dde fragment (.mu.50) containing E4 and 0 should not compete
for binding to .mu.70 (FIG. 10D, lanes 5,6).
[0230] In case this was due to the fragment predominantly binding
IgNF-A at the octamer site and thus making it unavailable as a
competitor for .mu.70, binding reactions and competition assay were
done for a fraction generated by chromatography of the crude
extract over a heparin-sepharose column, that contained .mu.70
binding activity and was significantly depleted of IgNF-A. When
.mu.50 or .mu.170 was endlabeled and incubated with the column
fraction, no specific nucleoprotein complexes were seen upon
electrophoretic analysis. Even in this fraction, .mu.50 and .mu.170
failed to compete successfully for the interaction between .mu.70
and its binding protein (data not shown), thus implying strongly
that the binding site defined as E4 perhaps does not bind the same
factor that binds at E3. Similarly, the E1 domain (isolated as a
Hinf-PstI fragment) does not compete as effectively as .mu.70
itself for the binding of the factor to .mu.70.
[0231] To determine the location of the binding sites within
individual fragments (.mu.70 and .mu.50), the technique of
methylation interference was employed. End-labelled DNA fragments
were partially methylated on guanines and adenines using dimethyl
sulfate (DMS). Methylated DNA was then used for binding reactions
with crude extracts and the complex was resolved from the free
fragment by electrophoresis. Both complex and free fragment bands
were then excised from the gel, and the DNA was recovered by
electroelution. Piperidine cleavage of the recovered fragments was
followed by electrophoresis through 12% polyacylamide urea
sequencing gels. In principle, if any of methyl groups introduced
by reaction with DMS interfere with the binding of a specific
protein then that molecule of DNA will be selectively missing in
the complex formed and subsequently the corresponding ladder. The
method therefore allows identification of G residues making
intimate contacts with the protein. [we have found that the use of
DNaseI footprinting via the gel binding assay to be complicated in
the case of some of these less abundant factors because of the
short half lives of the complexes themselves. Thus, if a binding
incubation is followed by partial DNaseI digestion, it is possible
that in the course of time required to load the sample and have the
complex enter the gel, DNA fragments that were in complex form may
exchange with the larger amounts of free fragment in the binding
reaction. Thus not leading to any distinction in the DNase patterns
seen with wither the complex or the free DNA (e.g. the half life of
the nucleoprotein complex in .mu.70 is less than 1 minute)].
[0232] The result of carrying out such an interference experiment
using nuclear extracts and on the u50 DNA fragment shows that the
complex observed arises via interaction of the IgNF-A protein at
the conserved octameric sequence (FIG. 3A). The free fragment
generates a characteristic G ladder (FIG. 11A), lane 2,3) and the
complex form (lane 1) is specifically depleted in DNA molecules
carrying a methyl group at the G residue indicated by the asterisk
which lies in the middle of the conserved octamer. Presumably,
modification at this residue seriously impedes the formation of a
stable complex between the protein and its cognate sequence. This
residue was also shown to be protected against methylation of DMS
in vivo. Interestingly, however, none of the other G residues
observed to be protected in vivo in this region of the .mu.
enhancers appear to be affected in our in vitro interference
experiment. Therefore, if these protections in vivo are due to the
binding of a protein, this factor is different from IgNF-A or B and
is not binding to fragment in vitro.
[0233] On the .mu.70 fragment several G residues were identified as
being important in forming intimate contacts with the binding
protein (E) (FIG. 11B). On the coding strand bands the 3 G's are
significantly reduced in intensity in the complex as compared to
the free DNA fragment (FIG. 11B, compare lanes 1,2), and on the
non-coding strand 2, G's are significantly affected (FIG. 11B,
compare lanes 3 and 4).
[0234] The results of both the in vivo DMS protection experiment
and the in vitro methylation interference experiments are
summarized in FIG. 3C. The open and closed circles above the
sequence were the residues identified by Ephrussi et al. to be
protected against methylation in vivo whereas the encircled G's are
the ones identified by us in vitro. The pattern of protection and
interference on the .mu.70 fragment over the consensus sequence is
strikingly similar in vivo and in vitro, which indicated strongly
that the protein identified here by means of the gel bind assay is
the one that interacts with this sequence in vivo. Analogous to
.mu.50, however, the second set of protections seen in this region
in vivo was not observed in vitro. Tissue specificity of the
factors detected: In order to determined whether the proteins
identified are limited to expression only in B cells, a large
number of extracts made from B cells and non-B cells were screened
(FIG. 12). Complexes that co-migrate with the ones generated and
characterized (by competition and methylation interference
experiments) in the B cell line EW, were observed on both the
fragments .mu.50 and .mu.70 (FIG. 12; .mu.70) in all the cell lines
examined. Although the complex generated in each extract has not
been further characterized, we interpret this data as indicating
that both these factors are non-tissue specific. A second complex
(NF-.kappa.B) was observed with the .mu.50 fragment that was
restricted to B and T cells only.
[0235] A point to note is that although the amount of protein in
each lane has been held constant at between 9 and 11 .mu.g, the
extent of complex generated was found to vary considerably from
extract to extract. Thus, showing that quantitive estimations of
the abundance of proteins in different cell lines using this assay
is not very meaningful at this stage. (This is presumably due to
subtle variations in the state of the cells and the extraction
conditions for the different cell lines).
[0236] In summary, analysis of the functional 300 bp PstI-EcoRI
fragment of the .mu. enhancer reveals that: [0237] (i) at least 2
different proteins bind within this DNA sequence. One protein
(IgNF-A) interacts with an octamer sequence (ATTTGCAT) that is
highly conserved upstream of all heavy and light chain variable
region genes and is also found in the u enhancer. The second
protein interacts with a sequence shown by Ephrussi and Church to
be protected in a tissue specific manner against methylation by DMS
in whole cells; [0238] (ii) both factors can be detected in nuclear
extracts from a variety of cell lines and are therefore not B-cell
specific; [0239] (iii) both E1 and E4 sequences hardly compete for
the binding of the factor to .mu.70 (which corresponds to E3), thus
implying that these sequences do not interact with the same factor,
although the sequence homology amongst the sites would have lead
one to expect that they should.
Example 5
Identification of Factors Binding to Kappa-Light Chain Enhancer
[0240] An enhancer element has also been identified in the major
intron of the .kappa. light chain gene. Picard and Schaffner showed
that the enhancement activity can be localized to a .about.500 bp
AluI-AluI fragment and Queen and Stafford have further refined the
5' and 3' boundaries so that the enhancer may be considered
restricted to 275 base pairs within the larger fragment. We have
dissected this region into a number of smaller fragments and
assayed each of these by means of the gel binding assay for the
location of protein binding sites.
[0241] A restriction map of the relevant region of the enhancer is
shown in FIG. 13a. The black boxes represent sequences identified
by Church et al. to be homologous to the putative protein binding
domains detected in the .mu. enhancer in vivo.
[0242] Fragments generated by cutting with Dde and HaeIII
(.lamda.1, .lamda.2, .lamda.3, .lamda.4 and .lamda.5; FIG. 13a)
were assayed for binding in the presence of increasing amounts of
poly(dI-dC)-(dI-dc) as a non-specific carrier, .lamda.4 and
.lamda.5 appeared to be obviously negative (FIG. 13b, lanes 1-8)
while .kappa.3 and .kappa.2 appeared to be positive (FIG. 13b,
lanes 10-12 and 14-16). Preliminary results show that the internal
fragment does not contain any specific binding sites either. The
nucleoprotein complex bands generated with 0.5-1 .eta.g of
radiolabelled probe could be detected even in the presence of 3
.mu.g of the carrier (lanes 12, 16, FIG. 13b).
[0243] To show that the bands detected represented a specific
interaction between a protein and DNA, we carried out competition
experiments (FIGS. 13c and 13d). The competition pattern for
.kappa.2 was strikingly similar to what had been earlier observed
with the .mu.70 fragment; relatively large amounts of u400, the
Moloney leukemia virus enhancer, the SV40 enhancer or the .kappa.
promoter (containing the conserved octa) to .kappa.2 did not
compete for binding, although .mu.300 and the K enhancer did. Since
.kappa.2 contains a putative E box identified by sequence
comparison (as does .mu.70) we competed its binding with smaller
fragments from .mu.300 (FIG. 5C). The complex is specifically
competed away by the addition of unlabelled .mu.70 during the
incubation (compare lanes 3 and 4 with lane 2), but not by .mu.60
(lanes 5,6), .mu.70 (lanes 7,8) or the SV40 enhancer (lanes 9,10).
Further, the protein that binds to this sequence co-fractionates
with the .mu.70 binding activity through two sequential
chromatographic steps (Heparin agarose and DEAE Sepharose). Thus,
we conclude that the same sequence specific protein binds to both
the fragments .mu.70 and .mu.2 and that there is at least one
common protein interacting with both the .mu. and the .kappa.
enhancers.
[0244] The .kappa.3 complex (indicated by the arrowhead, FIG. 13d)
failed to be competed away by .kappa.300 (compare lanes 3 and 4
with lane 2), .mu.400 (compare lanes 5 and 6 with lane 2) as a
.kappa. promoter containing fragment (compare lanes 7 and 8 with
lane 2). However, the complex was specifically competed away with
both the complete .kappa. enhancer (lanes 9,10) and the SV40
enhancer (lanes 11,12). The band below the major .kappa.3 complex
was seen at variable intensities in different experiments and
failed to compete even with the complete .kappa. enhancer in this
experiment and has not been further investigated at this stage. The
observation that the SV40 enhancer specifically competes for
binding of this factor is not altogether surprising, since this
fragment and the SV40 enhancer share an identical stretch of 11
nucleotides.
[0245] The binding site of this factor on the .kappa.3 fragment was
localized by methylation interference experiments. In two different
extracts, methylation at three of a stretch of 4 residues within
this sequence completely abolished binding (FIG. 14, compare lane 1
[complex] and 2 [free]; and lanes 3 [complex] and 4 [free]). This
stretch of G's forms a part of the conserved region (GGGGACTTTCC)
between the SV40 enhancer and .kappa.3. Thus, the binding site was
localized towards one end of the .kappa.3 fragment. The results
also served to explain the specific competition observed earlier
with the SV40 Enhancer. Interestingly, deletion mapping of the
.kappa. enhancer shows that sequences within the .kappa.3 fragment
are extremely important for enhancer function.
[0246] The tissue range of this factor was examined by carrying out
binding analysis with .kappa.3 in extracts from a variety of cell
lines. Nucleoprotein complex formation .kappa.3 was detected in a
mouse B cell line (FIG. 15a, lane 2), but not in 5 other non-B cell
lines (FIG. 15a, odd numbered lanes from 5-11). Even numbered lanes
show that the ubiquitous factor detected by .mu.50 is present in
all these cell lines and served as a positive control for the
experiment. The factor .kappa.3 therefore appears to be restricted
to expression to B lymphoid cells.
[0247] We then examined extracts made from cells at various stages
of B cell differentiation (FIG. 15B). Interestingly .kappa.3
binding protein can be detected in the Abelson murine leukemia
virus transformed pre-B cell line PD, in two mouse B cell lines
(WEH1231 and AJ9, FIG. 15B, lanes 12,14), one human B cell line
(EW, FIG. 15B, lane 16) mouse myeloma line (MPC22, FIG. 15B, lane
18) and 2 human myelomas (KR12 and 8226, FIG. 15B, lanes 20,22).
However, it does not appear to be present in a pre-preB cell line
(C5, FIG. 15B, lane 4) and in mouse pre-B cell lines (HATFL, 38B9,
70Z, FIG. 15B, lanes 6,8,10). Thus, this factor appears to be not
only tissue-specific, i.e., limited to cells of the B lymphoid
lineage, but also stage-specific within that lineage. In the series
of extracts examined, the presence of this factor bears a striking
correlation with F. expression.
[0248] The results with the Kappa enhancer can be summarized
follows: Dissection of the .kappa. enhancer enabled detection of
two distinct binding proteins with this DNA. One of these proteins
appears to be ubiquitous and interacts with the u heavy chain
enhancer as well. The second protein appears to be highly expressed
in a stage-specific manner within the B cell lineage and can be
detected only in those cell lines where the endogenous .kappa. gene
is active. There does not appear to be a binding site for this
factor in the heavy chain enhancer, although there is one in the
SV40 enhancer.
Examples 6 and 7 describe cloning of two transcriptional factors:
NF-KB and IgNFB.
Example 6
Cloning of Putative NF-.kappa.B
EXPERIMENTAL PROCEDURES
.lamda.gt11-EBNA-1 Recombinant
[0249] A HinfiI-AhaII DNA fragment of the EBV genome (coordinates
107,946-109,843), that contains the EBNA-1 open reading frame, was
subcloned using BamHI linkers into the BamHI site of pUC13
(pUCEBNA-1). The .lamda.gt11-EBNA-1 recombinant was constructed by
inserting the 600 bp SamI-BamHI fragment of pUCEBNA-1 (EBV
coordinates 109,298-109,893) into the EcoRI site of .lamda.gt11,
using an EcoRI linker (GGAATTCC). A phage recombinant containing
the EBNA-1 insert in the sense orientation was isolated by
immunoscreening with EBNA-1 antibodies (see below). In this
recombinant, the carboxy-terminal region of EBNA-1 (191 amino
acids) is fused in frame to the carboxy-terminus of
.beta.-galactosidase.
.lamda.gt11, cDNA Expression Library
[0250] The human B cells (RPMI 4265) cDNA library constructed in
the expression vector .lamda.gt11, was purchased from Clontech
Laboratories, Inc. The library contains approximately
9.times.10.sup.5 independent clones and has an average insert size
of 1.2 kb.
E. Coli Strains
[0251] The standard pair of .lamda.gt11 host strains Y1090 and
Y1098, were employed. The former was used to screen .lamda.gt11,
recombinants and the latter to generate .lamda.lysogens for the
analysis of .beta.-gal fusion proteins.
Plasmids
[0252] The plasmid pUCoriP1 as constructed by subcloning the
EcoRI-Ncol fragment from the oriP region of the EBV genome into the
SmaI site of pUC13. This fragment contains 20 high affinity binding
sites for EBNA-1. pUCoriP2 was derived from pUCoriP1 by subcloning
of an oriP fragment (EcoRI-BstXI) of the latter into the SmaI site
of pUC13. pUCoriP2 contains 11 high affinity binding sites for
EBNA-1. pUCORI.lamda.2 was made by insertion of a synthetic binding
site for the bacteriophase .lamda.O protein
(AAATCCCCTAAAACGAGGCATAAA) into the SmaI site of pUC13. The
complementary oligonucleotides were a gift of R. MacMacken. pUCMHCl
and pUCmhcI were constructed by insertion of the following
oligonucleotides: TABLE-US-00004 GATCCGGCTGGCGATTCCCCATCT
GATCCGGCTGcGGATTCCCaATCT GCCGACCCCTAAGGGGTAGACTAG
GCCGACgCCTAAGGGtTAGACTAG
into the BamHI site of pUC13. The wild type sequence is a binding
site for H2TF1 and NF-.kappa.B. pUCOCTA is a similarly constructed
pUC18 derivative that contains a synthetic recognition site
(ATGCAAAT) for the mammalian octamer binding protein(s). The
plasmids p190H2KCAT (-190 to +5) and p138H2KCAT (-138 to +5)
contain 5'-deletions of the H-2K gene promoter fused to the coding
sequence for chloramphenicol acetyl transferase. All plasmid DNAs
were purified by an alkaline lysis protocol followed by two
bandings in CsCl-EtBr gradients. Binding Site Probes Competitor
DNAs
[0253] The MHC, mhc1, ori and OCTA probes were generated by
digesting the corresponding pUC plasmids with EcoRI and HindIII.
The resulting products were end-labeled with [.alpha.-.sup.32P]dATP
using the large fragment of E. coli DNA polymerase I. dCTP, dGTP
and dTTP were included in these reactions so as to fill in the ends
of the restriction fragments. The labeled fragments were separated
by native polyacrylamide gel electrophoresis. The binding site
fragments (60-75 bp) were eluted from the gel and purified by
ELUTIP.TM. (Schleicher and Schuell) chromatography. Using high
specific activity [.alpha.-.sup.=P]dATP (5000 Ci/mmol), typical
labelings yielded DNA probes with specific activities of
2-4.times.10.sup.7 cpm/pmol.
[0254] To generate the oriP probe, pUCoriP2 was digested with EcoRI
and HindIII, and the oriP fragment (-400 bp) isolated by low melt
agarose gel electrophoresis. This DNA fragment was then digested
with HpaII and the products labeled as detailed above. The smaller
of the two HpaII fragments (-90 bp) was isolated for use as the
oriP probe. The MHCg probe was prepared by digesting p190H2KCAT
with XhoI was labeling as before. The labeled DNA was then digested
with HincII and the 90 bp probe fragment purified as before. This
probe contains sequence from -190 to -100 of the upstream region of
the H-2K.sup.b gene.
[0255] The .DELTA.6 MHCg (-190 to +270) and .DELTA.11MHCg (-138 to
+270) competitor DNAs were prepared by digesting the plasmids,
p190H2KCAT and p138H2KCAT, with XhoI and EcoRI. The H2KCAT
fragments were isolated by low melt agarose gel
electrophoresis.
Results
Specific Detection of a .lamda. Recombinant Expressing EBNA-1
[0256] A model system was used to test the notion that a
recombinant clone encoding a sequence-specific DNA binding protein
could be specifically detected with a recognition site probe. The
Epstein-Barr virus nuclear antigen (EBNA-1) was selected as the
model protein. EBNA-1 is required for maintenance of the EBV genome
as an autonomously replicating plasmid in human cell lines. It is
also a transactivator of viral gene expression. The
carboxy-terminal region of EBNA-1 (191 amino acids) has been
expressed in E. coli as a fusion protein and shown to encode a
sequence-specific DNA binding domain. The fusion protein binds to
multiple high affinity sites at three different loci in the EBV
genome. Two of these loci consitute a cis-acting element required
for maintenance of the plasmid state (orip). In the
.lamda.gt11-EBNA-1 (.lamda.EB) recombinant the carboxy-terminal
region of ENBA-1 was fused in frame to the carboxy-terminus of
.beta.-galactosidase (FIG. 16). A lysogen harboring the AEB phage
conditionally expressed a .beta.-gal-EBNA-1 fusion protein of
expected size (approximately M. W. 145,000) that accumulated to a
level of about 1%. The DNA binding activity of the fusion protein
was assayed with a segment of oriP DNA that contained two high
affinity sites for EBNA-1 (FIG. 16). Extracts of .lamda.gt11 and
.lamda.EB-lysogens were incubated with labeled oriP DNA and the
products resolved by native polyacrylamide gel electrophoresis.
With the .lamda.EB extract, a distinct set of protein-DNA complexes
was observed. The formation of these complexes was specifically
competed by an excess of plasmid DNA containing EBNA-1 binding
sites. Thus, the .beta.-gal-ENBA-1 fusion protein has the expected
sequence-specific DNA binding activity.
[0257] To establish conditions for detection of EB plaques with
probes of oriP DNA, protein replica filters were generated from
platings of the phage. These filters were screened with a variety
of protocols using oriP or control DNAs. Under a defined set of
conditions (see Experimental Procedures), .lamda.EB plaques can be
specifically detected using radiolabeled oriP DNA. The control
probe (ori) contains a high affinity binding site for the
bacteriophage .lamda.O protein. The specific array of spots
generated by the oriP probe corresponded to plaques on the master
plate as well as to spots that reacted with antiserum to .beta.-gal
on the replica filter. Furthermore, in a similar experiment the
oriP probe did not detect control .lamda.gt11, plaques. From a
series of such experiments the following conclusions were drawn;
(i) the specific detection of .lamda.EB plaques requires a DNA
probe with at least one binding site for EBNA-1 (a duplex 30-mer
with a consensus binding site sequence gave a signal comparable to
a probe containing two or more binding sites), (ii) DNA probes
longer than 150 bp yield higher non-specific signals, (iii) the
addition of an excess of non-specific competitor DNA
[poly(dI-dC)-poly(dI-dC)] to the binding solution reduces the
non-specific signal, and (iv) both specific and non-specific
interactions of the DNA probe with proteins on the replica filter
are reversible. In view of this latter point and the fact that
non-specific interactions typically have much shorter half-lives
than the specific interactions, sequence-specific binding proteins
can be detected after a suitable wash time.
[0258] Given the ability to specifically detect .lamda.EB plaques
with oriP DNA, reconstruction experiments were carried out to test
the sensitivity of the screen. In these experiments the .lamda.EB
phage was mixed with an excess of control .lamda.gt11,
recombinants. Relica filters generated from such mixed platings
were screened initially with orip DNA and subsequently with
antibodies to EBNA-1. In an experiment where approximately 5,000
phage were plated, with AEB being present at a frequency of 10
.sup.-2, a identical number of positives (approximately 50) were
detected with both oriP DNA and antibody probes. In fact, the two
patterns are superimposable. Furthermore the signal to noise ratio
of the DNA binding site probe was better than that of the antibody
probe. Thus it is possible to screen for the .lamda.EB phage with
an oriP DNA probe.
Screening for Mammalian Clones Encoding Sequence-Specific DNA
Binding Proteins
[0259] A .lamda.gt11 library of cDNAs prepared with mRNA from human
B cells was screened using the conditions developed with XEB. The
DNA probe used in the screen contained a regulatory element from a
mouse MHC class I gene (H-2 K.sup.b FIG. 17). This sequence (MHC)
was synthesized and cloned into the pUC polylinker. The mammalian
transcriptional regulatory factors H2TF1 and NF-.kappa.B bind with
high affinity to this MHC element. In a screen of
2.5.times.10.sup.5 recombinants, two positive phage, designated
.lamda.h3 and .lamda.h4, were isolated. In an autoradiogram of a
filter from the primary screen, a positive spot resulted in the
isolation of .lamda.h3. Partially purified .lamda.h3 and .lamda.h4
phage were challenged with other DNA probes to determine if their
detection was specific for the MHC probe. .lamda.h3 and .lamda.h4
were not detected by the ori probe. These phage were also not
detected by labeled pUC polylinker DNA or by a related probe (OCTA)
containing a recognition site for the immunoglobulin octamer
binding protein(s). A mutant MHC binding site probe (mhcl FIG. 17)
was used to more stringently test the sequence-specificity of the
presumptive fusion proteins. The mhcl probe did not detect either
.lamda.h3 or .lamda.h4 plaques. These data strongly suggested that
the two phage express proteins that bind specifically to the MHC
element.
Characterization of the DNA Binding Proteins Encoded by .lamda.3
and .lamda.h4
[0260] Direct evidence that the; .beta.-gal fusion proteins encoded
by .lamda.h3 and .lamda.h4 are responsible for the
sequence-specific DNA binding activities was obtained by screening
Western blots with DNA and antibody probes. Lysogens of
.lamda.gt11, .lamda.h3 and .lamda.h4 were isolated and induced to
generate high levels of their respective .beta.-gal proteins.
Western blots of proteins from induced lysogens were prepared and
the immobilized proteins were briefly denatured with 6M guanidine
and then allowed to renature (see Experimental Procedures above).
This treatment increased the recovery of active molecules. Two
equivalent transfers were initially probed with either the MHC
element or the OCTA control DNA. A set of four bands specific to
the MHC probe and the .lamda.h3, .lamda.h4 tracks was observed. The
two largest species of this set are labeled P1 and P2. The same
transfers were then probed with antibodies to .beta.-gal. A pair of
novel fusion protein bands was observed with each of the two
recombinant lysogens. These bands corresponded to the species P1
and P2 detected with the MHC probe. This shows that .lamda.h3 and
.lamda.h4 encode .beta.-gal fusion proteins which bind specifically
to the MHC element DNA. The two phage may be identical since they
encode the same size fusion proteins. P1 (approximate m.w. 160,000)
probably represents the full length fusion protein whereas P2 is a
presumptive proteolytic cleavage product. Since the .beta.-gal
portion of this fusion polypeptide has a molecular weight of
approximately 120,000, the cDNA encoded portion must have a
molecular weight of 40,000.
[0261] A gel electrophoresis DNA binding assay was used to confirm
the sequence specificity of the .lamda.h3 and .lamda.h4 fusion
proteins as well as to better define their recognition properties.
Extracts derived from the .lamda.gt11, .lamda.h3 and .lamda.h4
lysogens were assayed, with the MHC probe. A novel DNA binding
activity was detected specifically in extracts of the .lamda.h3 and
.lamda.h4 lysogens. This activity was IPTG inducible indicating
that it was a product of the lacZ fusion gene. A competition assay
indicated that the activity represented a sequence-specific DNA
binding protein. Two 5' deletion mutants of the H-2K.sup.b genomic
sequence was used as competitor DNAs. The segment 6 MHCg extends to
190 nucleotides upstream of the transcription start site and
contains the MHC sequence element. The segment .DELTA.11MHCg, on
the other hand, only contains 138 nucleotides of sequences upstream
of the initiation site and therefore lacks the MHC element.
Increasing amounts of .DELTA.6 MHCg specifically competed for the
binding of the .lamda.h3 fusion protein to the MHC element
oligonucleotide probe while the control .DELTA.11MHCg did not
compete. It should be noted that the sequences flanking the MHC
element in the probe used for the initial screening, the cloned
oligonucleotide, are totally difference from the sequences flanking
the same element in the genomic probe, .DELTA.6 MHCg. Therefore,
the fusion protein appears to exclusively recognize the common MHC
element. This was confirmed by a direct DNA binding assay with a
genomic sequence probe (MHCg) containing the MHC element. Both the
oligonucleotide (MHC) and genomic (MHCg) probes gave rise to
similarly migrating complexes. Furthermore, a double base
substitution mutant (mhc1, FIG. 17) abolished recognition by the
fusion protein. The mutant sequence contains a transverion in each
half of the symmetric MHC element. These changes destroy the
symmetry of the element and abolish binding by either H2TF1 or
NF-.kappa.B.
[0262] The immunoglobulin .kappa. chain gene enhancer contains a
binding site (EN) for NF-.kappa.B. This site is related in sequence
to the MHC element but is recognized by H2TF1 with a 10 to 20 fold
lower affinity (FIG. 17). A mutant .kappa. enhancer (.kappa.EN) has
been characterized both in vivo and in vitro. This mutant sequence
has no B cell specific enhancer activity and is not bound by
NF-.kappa.B. The mutant contains clustered base substitutions and
an insertion of a base pair in one of the two symmetric half sites
(FIG. 17). The binding of the .lamda.h3 fusion protein to the wild
type .kappa.-element and the mutant version was tested. The
.kappa.EN probe generated a complex with a mobility similar to
those obtained with the MHC probes. No specific complex was formed
with the mutant .kappa.-enhancer DNA. Experiments in which the MHC
and .kappa.-enhancer binding sites were tested for competition with
binding of the MHC probe showed that the fusion protein bind with
2-5 fold higher affinity to the MHC site (data not shown). The
.kappa.EN site differs, in part, from the MHC site by the
substitution of two adenine residues for guanine residues. As
discussed below, these guanine residues are probably contacted by
the fusion.
[0263] The contacts of the fusion protein with the MHC element were
probed chemically by modification of the DNA with dimethylsulfate.
After partial methylation at purine residues, the modified probe
was used in the gel electrophoresis DNA binding assay. Free (F) and
bound (B) probe DNA was recovered, subjected to chemical cleavage
at methylated interference experiment. On both the coding and
non-coding strands strong interference was detected when any of
central guanine residues of each putative half site was modified at
the N-7 position in the major groove. Weaker interference was
observed when the external guanine residue in either putative half
site was similarly modified. Thus, the fusion protein appears to
symmetrically contact the MHC element in a manner similar to both
H2TF1 and NF-.kappa.B.
Hybridization Analysis with the cDNA Segment of the Recombinant
Phage
[0264] The recombinant phage .lamda.h3 and .lamda.h4 contain
cross-hybridizing and equivalent size (approximately 1 b) cDNA
segments. The inserts also have indistinguishable restriction maps
and therefore appear to be identical. Southern blot hybridization
confirmed that these cDNA segments are homologous to sequences in
the human genome. The patterns of hybridization to restriction
digests of genomic DNAs of various human cell lines are identical.
Furthermore, the fact that restriction digests with Bam HI (no site
in cDNA) and Pst I (on site in cDNA) both generate two prominent
bands suggests that the cDNAs are derived from a single copy gene.
A similarly simple hybridization pattern is observed on probing the
mouse and rat genomes.
[0265] The expression of the human gene was analyzed by Northern
blot hybridization. A single, large transcript (approximately 10
kb) was observed with polyA(+) RNA from both B (X50-7) and non-B
human cells (HeLa). This transcript is moderately abundant in both
cell types. Since the cDNA library was constructed by oligo dT
priming, we were probably fortunate to obtain the coding region for
the DNA binding domain within the 1 kb segments of the recombinant
phage. However, this only illustrates the power of the screening
strategy for the isolation of clones encoding sequence-specific DNA
binding domains.
Discussion
[0266] A novel strategy is disclosed for the molecular cloning of
genes encoding sequence-specific DNA binding proteins. This
strategy can be used to isolate genes specifying mammalian
transcription regulatory proteins. An important step in this
approach is the detection of bacterial clones synthesizing
significant levels of a sequence-specific DNA binding protein by
screening with a labeled DNA binding site probe. This approach is
similar to that previously developed for the isolation of genes by
screening recombinant libraries with antibodies specific for a
given protein. In fact, the phage expression vector, .lamda.gt11,
developed previously for immunological screening can be in this
approach.
[0267] The feasibility of the strategy was established by the
specific detection of a phage recombinant, .lamda.EB, encoding a
.beta.-gal-EBNA-1 fusion polypeptide with oriP DNA. Conditions have
also been developed for the selective detection of E. coli colonies
expressing high levels of EBNA-1 or the bacteriophage .lamda.O
protein with their respective binding site DNAs. In these cases, a
plasmid expression vector was employed. Using the conditions
developed with AEB, we have screened phage cDNA libraries with
three difference DNA probes. Screening with a probe containing the
H2TF1 site in the MHC class I gene H-2 K.sup.b led to the isolation
of two identical clones that specify a putative transcription
regulatory protein (properties discussed below). In similar screens
with two other DNA probes, positive recombinant phage were also
isolated at a frequency of approximately 1/100,000. However, the
DNA binding proteins encoded by these phage do not appear to
recognize specific sequence elements but rather to bind sequence
nonspecifically to either single strand or double strand DNA.
Although detection of these types of clones represented a
troublesome background in this study their isolation suggests that
recombinants encoding different types of DNA binding proteins can
be detected by such functional screens of expression libraries. In
future screens for recombinants encoding site-specific DNA binding
proteins, the detection of these other types of clones might be
selectively suppressed by inclusion of a non-specific competitor
DNA that is structurally more similar to the probe than
poly(dI-dC)-poly(dI-dC).
[0268] The prospects for the isolation of other cDNAs encoding
sequence-specific binding protein by this strategy can be assessed
by examining the three assumptions on which it is based: (i)
functional expression of the DNA binding domain of the desired
protein in E. coli, (ii) a strong and selective interaction of the
binding domain and its recognition site, and (iii) high level
expression of the DNA binding domain. A number of eukaryotic
sequence-specific DNA binding proteins have been functionally
expressed in E. coli. These include the proteins GAL4, GCN4 and MAT
2 of yeast, ftz of Drosophila, TFIIIA of Xenopus, E2 of the bovine
papilloma virus and EBNA-1 of the Epstein Barr Virus. In most
cases, the functional DNA binding domain is contained within a
short tract of amino acids. Thus, it is reasonable to expect the
functional expression in E. coli of the sequence-specific DNA
binding domain of most eukaryotic regulatory proteins. The
equilibrium association constants of site-specific DNA binding
proteins range over many orders of magnitude (10.sup.7-0.sup.12 M).
The following analysis suggests that successful screening may be
restricted to proteins with relatively high binding constants. If a
regulatory protein has an association constant of 10.sup.10 M, then
under the screening conditions (the DNA probe is in excess and at a
concentration of (.about.10.sup.10 M) approximately half of the
active molecules on the filter will have DNA bound. Since the
filters are subsequently washed for 30 minutes, the fraction of
protein-DNA complexes that remain will be determined by their
dissociation rate constant. Assuming a diffusion limited
association rate constant of 10.sup.7 M.sup.-1S.sup.-1 the
dissociation rate constant will be 10.sup.-3 S.sup.-1. Such a
protein-DNA complex will have a half life of approximately 15
minutes. Thus only a quarter of the protein-DNA complexes will
survive the 30 minute wash. For a binding constant of 10.sup.9 M,
only about a tenth of the active protein molecules will have DNA
bound and much of this signal will be lost, since the half-life of
these complexes is approximately 1.5 minutes. Isolation of
recombinants encoding proteins with binding constants of 10.sup.9
or lower may be possible given that the binding of probe to less
than 1% of the total fusion protein within a plaque can be
detected. The sensitivity of the current methodology for low
affinity proteins could be significantly enhanced by covalent
stabilization of protein-DNA complexes. This might be accomplished
by procedures such as UV-irradiation of pre-formed complexes. Since
the binding constants of regulatory proteins are dependent on ionic
strength, temperature and pH, these factors might also be
manipulated to enhance detection.
[0269] The successful detection of .lamda.EB and .lamda.h3
recombinants with DNA binding site probes required high level
expression of their fusion proteins. In both cases, the fusion
proteins accumulate, after induction, to a level of about 1% of
total cellular protein. This level of recombinant protein
expression is typical of .lamda.gt11, as well as other E. coli
vectors. The strategy of cloning a gene on the basis of specific
detection of its functional recombinant product in E. coli has
considered potential. Indeed, while our work was in progress, this
approach was used by other to isolate clones encoding a peptide
acetyltransferase and a calmodulin-binding protein. Direct
screening of clones encoding recombinant protein products has also
been used to isolate ras GTP-binding mutants.
[0270] The .lamda.h3 recombinant expresses a .beta.-gal fusion
protein that recognizes related transcription control elements in
the enhancers of the MHC class I and immunoglobulin .lamda.-chain
genes (see FIG. 17 for sequences). This protein also binds a
similar element in the SV40 enhancer 72 bp repeat. Furthermore,
there are two putative binding sites in the long terminal repeat
(LRT) of the HIV genome (FIG. 17). One of these is identical to the
site in the SV40 enhancer and therefore should be recognized by the
fusion protein. The existence of a clone such as Ah3 was
anticipated since it had previously been shown that a common
factor, NF-.kappa.B, binds to the three related elements in the
enhancer, the SV40 72 bp repeat an the HIV-LTR. Interestingly,
these three binding sites are more closely related to one another
than they are to the MHC site (FIG. 17). The former set can be
viewed as variants of the MHC site which exhibits perfect two-fold
symmetry. It should be noted that the pUC polylinker contains the
sequence, CGGGGA, which is a variant of one of the symmetric halves
(TGGGGA) of the MHC element. The fusion protein does not bind with
detectably affinity to the pUC polylinker. Thus, a high affinity
interacter appears to require both symmetric halves.
[0271] Even though the above control elements represent quite
similar sequences, they function in very different regulatory
capacities. The MHC element is a component of an enhancer that
functions in a variety of cell types that express MHC class I
genes. The .lamda.-element, on the other hand, is a component of a
cell-type specific enhancer that functions only in B cells. The
activity of this enhancer is induced in pre-B cells upon their
differentiation into mature B lymphocytes. Such differentiation, in
vitro, is accompanied by transcriptional activation of the chain
gene. The .kappa.-element appears to dictate the B cell specificity
of the .kappa.-enhancer. The different modes of functioning of the
MHC and .alpha.-elements are correlated with the properties of
their corresponding recognition factors, H2TF1 and NF-.kappa.B.
H2TF1 activity is detected in a variety of differentiated cell
types and this protein appears to stimulate MHC class I gene
transcription approximately 10-fold. On the other hand, NF-.kappa.B
activity is detected only a mature B cells. In addition, this
activity is induced during differentiation of pre-B cells to mature
lymphocytes. Finally, NF-.kappa.B activity is also induced by
phorbol ester treatment of non-B cell lines (HeLa, Jurkat). In the
case of Jurkat cells, a T4.sup.+ human T cell line, NF-.kappa.B
appears to stimulate the transcriptional activity of the HIV-LTR.
It should be noted that induction of NF-.kappa.B in non-B cells
does not require new protein synthesis. Thus the protein for
NF-.kappa.B must exist in cells before induction and the activated
by a post-translational modification.
[0272] The DNA binding properties of the fusion protein encoded by
the recombinant .lamda.h3 overlap those of H2TF1 or NF-.kappa.B.
Mutants of the MHC and K-elements that are not recognized by H2TF1
or NF-.kappa.B are also not bound by the fusion protein. The
recombinant protein binds the MHC element DNA with 2-5 fold higher
affinity than the .kappa.-element. In this regard, the fusion
protein has relative affinities intermediate between those of H2TF1
and NF-.kappa.B. H2TF1 binds the MHC element with 10- to 20-fold
higher affinity than the .kappa.-element while NF-.kappa.B
recognizes both elements with roughly equivalent affinity. This
intermediate relationship is also observed in the comparison of the
methylation interference patterns of the three DNA binding
activities. Methylation of any of the central six guanine residues
in the MHC site strongly interfers with the binding of all three
activities. Methylation at either of the two external guanines
partially interferes with recognition by the fusion protein. In
contrast, H2TF1 binding is strongly suppressed upon methylation of
either of these residues while NF-.kappa.B binding shows little
perturbation upon this modification. This analysis of the three DNA
binding activities is limited by the use of cell extracts and not
purified proteins. Furthermore, the properties of a recombinant
protein may be different from those of its native counterpart.
Thus, it is not possible to be definitively relate the protein
encoded by .lamda.h3 to either H2TF1 or NF-.kappa.B.
[0273] Antibodies raised against the .lamda.h3 fusion protein will
be useful in clarifying its structural relationship with H2TF1 and
NF-.kappa.B. A definitive relationship will emerge from a
comparison of the deduced amino acid sequence of the cDNA and the
protein sequences of H2TF1 and NF-.kappa.B. It should be noted that
in terms of protein expression, both H2TF1 and NF-.kappa.B are
present in a wide variety of mammalian cells. Furthermore, the DNA
binding specificities of these two factors are remarkably similar.
These facts as well as the observations that the cDNA in .lamda.h3
hybridizes to a single copy gene and to a single mRNA in both B and
non-B cells suggest that all three binding activities may be
products of the same gene. This hypothesis would imply that H2TF1
and NF-.kappa.B represent alternative modifications of a common
protein.
Example 7
Cloning of the IgNFB Gene
Methods
DNA Sequencing
[0274] DNA sequencing was performed on double stranded plasmid DNA
templates according to the Sanger dideoxynucleotide protocol as
modified by United States Biochemical for use with bacteriophage T7
DNA polymerase (Sequenase). The entire sequence was confirmed by
sequencing the opposite strand and in the GC-rich regions by
sequencing according to Maxam and Gilbert (Methods Enzymol., 65:
449-560, (1980)
Plasmid Constructions
[0275] cDNA's were subcloned from .lamda.gt11, to pGEM4 (Promega),
and these plasmids were used for DNA sequence analysis and in vitro
transcription. Plasmid pBS-ATG was kindly provided by H. Singh and
K. LeClair and was constructed by ligating a 27 bp long
oligonucleotide containing an ATG codon surrounded by the
appropriate boxes for efficient initiation,
TGCACACCATCGCCATCGATATCGATC, into the Pstl site of pBS-/+Bluescropt
plasmid (Stratagene). The expression vector pBS-ATG-oct-2 depicted
in FIG. 19A was designed for transcription and translation in vitro
and was constructed by cleaving pBS-ATG with Smal and ligating the
blunt-ended EcoRI 1.2 kb cDNA fragment from plasmid 3-1 (position
655 to 1710 in FIG. 18A).
In Vitro Transcription/Translation
[0276] In vitro transcription and translation reactoins were
performed as recommended by the manufacturer (Promega).
DNA Binding Assay
[0277] The EcoRI/HindIII 50 bp fragment containing the wild type
octanucleotide sequence ATGCAAAT in the BamHI site of pUC18
polylinker was .sup.32P-labeled (50,000 cpm/ng) and 1 ng DNA probe
was incubated with 1 .mu.l of the reacted/unreacted reticulocyte
lysate. The bindign reactions were incubated at room temperature
for 30 min. and contained 10 mM Tris HCl pH7.5, 50 mM NaCl, 1 mM
DTT, 1 .mu.m EDTA pH8, 5% glycerol, 25 .mu.l/ml sonicated denatured
calf thymus DNA in 2.5 .mu.l/ml sonicated native calf thymus DNA as
nonspecific competitors. The complexes were resolved by
electrophoresis in 4% polyacrylamide gel (acrylamide: bisacrylamide
weight ratio of 20:1), containing as buffer 25 mM Tris HCl pH8.5,
190 mM glycine, 1 mM EDTA buffer as previouly described (Singh et
al., Nature 319: 154-158 (1986)).
Purification of NF-A2
[0278] NF-A2 was purified to >90% homogeneity from nuclear
extracts derived from the human Burkett's lymphoma cell line, BJAB.
Purification was accomplished by sequential fractionation on
Zetachrom QAE discs (Cuno Inc.), heparin sepharose (Pharmacia),
ssDNA cellulose (Pharmacia), and on a DNA affinity column which
contained an immobilized double straded (ds) segment containing the
octanucleotide seuqnce. In vitro translated,
.sup.35S-methionine-labeled, oct-2 protein was purified by
chromatography on dsDNA cellulose followed by affinity
chromatography on the octanucleotide DNA affinity column.
Tryptic Digestions of NF-A1 and oct-2 Protein
[0279] Tryptic digests were performed at room temperature in a
buffer consisting of 20 mM Hepes, KOH, pH 7.9, 20% glycerol, 0.5 M
KCl, 0.2 mM EDTA, 0.5 MM DTT. Aliquots of purified NF-A2
(.about.250 ng) or of affinity purified oct-2 protein (90,000 cpm)
were incubated with varying amounts of trypsin (affinity incubated
with varying amounts of trypsin (affinity purified trypsin was a
gift of Dan Doering). After 60 minutes, reactions were terminated
by the addition of 2.5 volumes of SDS-PAGE sample buffer and were
boiled for 5 minutes. The tryptic digestes were resolved on 10%
polyacrylamide gels. Tryptic fragments of NF-A2 were visualized by
silver-staining. Tryptic fragments of .sup.35S-methionine labeled
oct-2 protein were visualized by autoradiography after treatment of
the gel with En hance (Dupont).
[0280] To clone the gene encoding the lymphoid-specific octamer
binding protein, IgNF-B (NF-A2), a randomly primed, non-size
selected cDNA library in .lamda.gt11, was constructed using
cytoplasmic poly (A)-containing mRNA from a human B cell lymphoma
cell line, BJAB. We had previously observed that this cell line
contained a particularly large amount of NF-A2 when 28 lymphoid
cell lines were surveyed. By randomly priming the cDNA synthesis we
expected to obtain recombinant phage encoding the octamer motif
binding domain even if that domain was encoded by the 5' end of a
long mRNA. The randomly primed cDNA library in .lamda.gt11, was
generated by standard methods (Gubler, U. and Hoffman, B.J., Genes
25:263-269 (1983)). Random hexamers (Pharmacia) were used to prime
the first strand cDNA synthesis. The un-amplified library contained
500,000 recombinants. This library was screened by the method
described above using a radiolabelled DNA probe consisting of four
copies, in direct orientation, of a 26 bp oligonucleotide derived
from the Vk41 promoter. The probe was constructed by cloning four
copies of the oligonucleotide in direct orientation into the BamH1
site of the pUC polylinker and radiolabelling the 112 bp Smal-Xba1
fragment. The library was screened with the tetramer prpbe (at
1.times.10.sup.6 cpm/ml) as described above for the cloning of
NF-.kappa.B with the following modification. Previous screens using
poly(dI-dC)-poly(dI-dC) as the nonspecific competitor DNA yielded
recombinant phage encoding single stranded DNA binding proteins.
The signal from these phage but not phage encoding
sequence-specific DNA binding proteins could be efficiently
competed with denatured calf thymas DNA (5 .mu.g/ml) and therefore
this nonspecific competitor was substituted for
poly(dI-dC)-poly(dI-dC) in all subsequent screens.
[0281] From a primary screen of 450,000 phage plaques, three
plaques were isolated which bound this tetramer probe. Two of these
phage, phage 3 and phage 5, were found to give plaques that bound
specifically to the tetramer probe in that they did not bind DNA
probes which lacked the octamer motif. These two phage bound probes
containing one copy of the .kappa. promoter octamer motif with a
much lower affinity than they bound the tetramer probe. Even when
four-fold more monomer probe was used then tetramer probe, the
tetramer probe still gave a greater signal suggesting that the
better binding of the tetramer probe was not merely a result of
increasing the molar concentration of binding sites in the screen.
Certainly in the case of phage 5, which showed dramatically better
binding to the tetramer probe, it seems most likely that the
tetramer probe was able to bind simultaneously to multiple phage
fusion proteins on the filter. This multipoint attachment would be
expected to dramatically decrease the dissociation rate and thus,
increase the avidity of the interaction. Genes encoding DNA binding
proteins with relatively low binding affinities could be cloned by
screening .lamda.gt11, expression libraries with such multimer
probes.
[0282] The specificity of the DNA binding proteins encoded by the
recombinant phage was investigated by preparing extracts of induced
phage lysogens. Lysogen extracts from both phages bound to the
tetramer probe in a mobility shift assay whereas lysogen extracts
from non-recombinant .lamda.gt11, showed no binding to this probe.
Only the phage 3 extract bound strongly to the .kappa. promoter
probe. Because the inserts of phage 3 and phage 5 (1.2 kb and 0.45
kb in size, respectively) were found to cross-hybridize by Southern
blotting analysis, phage 3 was chosen for further analysis.
[0283] Phage 3 encoded an octamer binding protein as demonstrated
by a competition mobility shift assay in which the lysogen extract
was bound to the .kappa. promoter probe in the presence of
competing unlabelled DNA fragments containing either the wild type
or mutant octamer motifs. Phage lysogen extracts were prepared as
described above for NK-.kappa.B cloning. The extracts were assayed
in a mobility shift assay as described above using the
octamer-containing PvuII-EcoR1 fragment from pSPIgVk as the
radiolabelled probe. Binding reactions were carried out in the
absence or presence of 24.eta.g of cold competitor DNA containing
no octamer motif, the wild type octamer motif or mutant octamer
motifs as described.
[0284] The wild type octamer motif competed efficiently for binding
but the octamer motifs containing point mutations either did not
compete or competed less well than the wild type motif. In fact,
the two mutants which showed slight competition for the binding of
the lysogen protein, TCATTTCCAT and ATATTGCAT, were the only
mutants which somewhat competed the binding of NF-A1 and NF-A2 in a
WEHI 231 nuclear extract.
[0285] The phage-encoded octamer binding protein was further
compared to NF-A1 and NF-A2 using a methylation interference
footprinting assay. Methylation interference was performed as
described using the non-coding strand of the octamer-containing
PvuII-EcoR1 fragment of pSPlgVk as radiolabelled probes. The probes
were partially methylated and used in preparative mobility shift
DNA binding assays. DNA present in the bound bands (NF-A1 and NF-A2
bands from a nuclear extract from the BJAB cell line (or phage 3
lysogen extract bound band or free bands) was isolated, cleaved at
the modified purine residues and subjected to denaturing
polyacrylamide gel electrophoresis. The footprint obtained using
the lysogen extract was centered over the octamer motif and was
very similar to the footprints of NF-A1 and NF-A2 from a BJAB
nuclear extract and from a WEHI 231 nuclear extract (see above).
Minor differences were seen between the footprints of the lysogen
and nuclear extract proteins which could reflect changes in
affinity and/or specificty of DNA binding as a result of fusion of
the insert-encoded octamer binding protein with
.beta.-galactosidase. Alternatively, the phage insert could encode
an octamer binding protein distinct from NF-A1 and NF-A2.
[0286] The phage-encoded .beta.-galactosidase fusion protein was
directly shown to be the octamer binding protein in the phage
lysogen extracts. Phage lysogen extracts were subjected to SDS
polyacrylamide gel electrophoresis and transferred to
nitrocellulose filters. After a denaturation/renaturation procedure
(Celenza, J. L. and Carlson, M. Science 233:1175-1180 (1986)), the
filters were probed with either the radiolabelled
octamer-containing tetramer probe (OCTA) or a non-specific DNA
probe (pUC). The OCTA probe specifically bound to the
.beta.-galactosidase fusion proteins of phage 3 and phage 5 to a
much greater extent than the pUC probe, thus formally showing that
the octamer binding activity was encoded by the phage inserts. The
apparent molecular weights of the largest fusion proteins of phage
3 and phage 5 lysogens are consistent with the entire phage inserts
contributing coding sequences to the fusion proteins. Prototeolysis
was presumed to account for the heterogeneity in apparent molecular
weight of the fusion proteins.
[0287] The insert of phage 3, which defines what we term the OCT-2
gene, was used in a Southern blot analysis to probe human and mouse
genomic DNA digested with several restriction enzymes. Restriction
enzyme digested genomic DNA was electrophoresed through a 1%
agarose gel and transferred to Zetabind (CUNO Laboratory, Inc.) by
standard techniques (Maniatis, T., Frisch, E. F. and Sambrook, J.
Molecular Cloning. A Laboratory Manual. Cold Spring Harbor
Laboratory Press, NY. (1982)). The phage 3 insert was radiolabelled
by randomly primed synthesis using hexanucleotides (Pharmacia).
Following standard prehybridization high-stringency hybridization
(Maniatis, supra.) with the OCT-2 probe the filters were washed
with 0.2.times.SSC, 0.1% SDS or 2.times.SSC, 0.1% SDS.
[0288] One or two bands were observed in each restriction enzyme
digest which is consistent with OCT-2 being a single genetic locus.
No rearrangements or amplifications of the gene were observed in a
survey of 8 lymphoid and non-lymphoid cells lines including BJAB.
The strength of the signal on the mouse Southern blot at high
stringency suggested that the gene is highly conserved between
human and mouse.
[0289] The oct-2 cDNA segment (1.2 kb) of phage 3 was used to
identify additional overlapping recombiants in the same library.
One of these phage (pass-3) contained a 1.8 kb DNA insert. Sequence
analysis of the cDNA segment in the original .lamda.gt11, phage
(3-1) revealed a long open reading frame (ORF) which was ended with
multiple nonsense codons at its 3' terminus. Sequence analysis of
the pass-3 segment yielded an identical sequence through the open
reading frame but an abrupt transition to a novel sequence occurred
at the C-terminue (FIG. 18B; see below). The N terminus of the open
reading frame in both of these cDNA segments was not represented in
the cDNA inserts. Additional recombinats from the .lamda.gt11
library were identified by screening with a probe from the
NOterminal portionof the pass-3 segment. This resulted in the
isolationof a 0.75 kb cDNA segment (pass-5.5) whose sequence
extended the N-terminal portion o the previously identified open
readign frame. In this cDNA segment, a nonsense codon is foudn 36
pb upstream of the first AUG in the open frame. The sequence
context of this AUG confoms well to that expected for an initiation
codon (Kozak, Cell 44: 283-292 (1986)). Two other AUG codons occur
at positions 6 and 13 in the reading frame. Each of these also has
an excellent context for initiation. The N terminus of the protein
has been arbitrarily assigned to the 5'-most AUG codon. The cDNA
sequence extends 66 bases 5' from this positon but the total length
of the 5' untranslated region has not been determined.
[0290] The sequences of pass-5.5, pass-3 and 3-1 were combined to
form an open reading frame encoding a protein of 466 amino acids in
length as shown in FIG. 46 amino acids in length as shown in FIG.
18. FIG. 18 shows the amino-acid sequence of oct-2 protein depicted
in plain capital letters. cDNA-clone pass-5.5 spans from position 1
(5' end) to position 750 (3' end). cDNA clone pass-3 5' end and 3'
end are respectively at position 92 in FIGS. 18a and 1847 in FIG.
18b. cDNA clone 3-1 starts at position 650 and ends at position
1710. The nucleotide sequence shown in panel A was reconstructed by
merging the DNA seuqences from clone pass-5.5 from position 1 to
100, from clone pass-3 from 100 to 660 and from clone 3-1 from
position 660-1710. Extensive nucleotide sequence overlaps were
available to allow unequivocal merges. Sequence of protein encoded
by the long overlappingopen reading frame (LORF, 277aa) is shown in
italic letters. Wavy arrows delimit the glutamine (Q)-rich,
glutamic and aspartic (E/D)-rich and glycine (G)-rich regions,
respectively. Solid arrows delimt the helix-turn-helix motif. Boxed
leucine (L) residues are spaced exactly by seven residues. Vertical
arrow indicates the position where the nucleotide seuqnece diverges
iwth that shown in panel B. Stars indicate stop codons.
[0291] FIG. 18b shows the nucleotide sequence of the 3' terminus
and redicted amino acid sequence of the C-terminus derived from
clone pass-3. The code is the same as in A and the vertical arrow
denote sthe divergence point.
[0292] FIG. 18c is a schematic representation of the amino acid
sequence deduced from oct-2 gene derived cDNA. The code is as in
panel A. The DNA binding domain is depicted as DNA and the region
containing the four regularly spaced L residues is boxed-in. LORF
stands for long open reading frame, N stands for N-terminus and C
for COOH-terminus.
[0293] Data presented below suggests that this ORF encodes one form
of NF-A2 (oct-2). The amino acid sequence of oct-2 has several
interesting features (FIG. 18C). It contains three glutamine (Q)
rich blocks (ranging from 50% of Q content) in teh N-terminal part
of the polypeptide, beginnign at nucleotide postions 376, 448 and
502, and a comparably acidic region [aspartic (E) or glutamic (D)
amino acids] between postions 648 and 678. Clusters of Q resideus
as well as E or D amino acids have been described previously in
many transcription factors. Such acidic regions in other factors
have been shown to be important in activation of transcroption
(Gill and Ptashne, Cell 51: 121-126 1987; Hope et al., Nature 333:
635-640 (1988)).
[0294] The region of oct-2 responsible for sequence-specific DNA
bidnign, depicted "DNA", is discussed below. Downstream of this
position is a series of four leucine residues separated by exactly
seven amino acids (position 1227 to 1293 in FIG. 18A). A similar
configuration of leucine residues in the transcription factor C/EBP
has been suggested to form an amphipathic .varies.-helical
structure where the leucine residues are arranged along one side of
the helix. Two such helices are throught to interact by a "leucine
zipper" mechanism generating a dimeric protein (Handschultz et al.,
Science 240: 1759-1764 (1988); Landschultz et al., Genes &
Development 2: 786-800 (1988)).
[0295] Consistent with this sugestion, no helix disrupting proline
residue is present in oct-2 in the 22 amino acid tract defined by
the four leucines. However, unlike the first example of a leucine
zipper", protein C/EBP, the potential .alpha.-helical region in
oct-2 does not possess a high density of paried charged residues
which could stabilize the structure. Also, unlike the C/EBP
protein, which binds DNA specifically as a homodimer probably by
pairing through the "leucine zipper", the oct-2 protein appears to
specifically bind DNA as a monomer. It is interesting to speculate
that the "leucine zipper" region of oct-2 might be important for
interaction with other proteins as there is no obvious reason to
restrict the binding of such a structure to self-recognition.
[0296] Searches for sequence similariites in the GenBank library
revealed that a region of the oct-2 protein from position 952 to
1135 was distantly related to a family of proteins containing
homeoboxes. The 60-residue homeobox domain is highly conserved
among 16 examples in different Drosophila genes (Gehering, Science
236: 1245-1252 (1987)). This level of conservation extends to
homeobox sequences found in vertebrates and worms. Among this total
family, nine of the 60 residues are invariant. The oct-2 protein
only contains six of these nine residues and four of these six
sites are clustered in the sub-region of the homeobox thought to be
related to the helix-turn-helix structure (see FIG. 20). As shown
in FIG. 20A, a 60 amino acid region of oct-2 contains 30% identity
with the prototype homeobox sequence in the Antennapedia (Antp)
protein.
[0297] FIG. 20 shows the amino acid sequence alignment of the DNA
binding domain of oct-2 factor with homeoboxes from Antp.
(Schneuwly et al., EMBO J. 5: 733-739 (1986), cut (Blochlinger,
Nature 333:629-635 (1988), en (Poole et al., Cell 40: 37-43 (1985),
proteins (boxed-in amino acid sequences from the S. cerevisae
proteins Matal (Miller, EMBO J. #: 1061-1065 (1984), Mat.varies.2
(Astell et al., Cell 53: 339-340 (1988) and C. elegans protein
mec-3 (Way and Chalfie, Cell 54: 5-16 (1988). THe nine invariant
residues in canonical homeobox sequences Atnp, cut, and en are
listed below the boxed-in amino acid sequences and shown in bold
print if present in the amino acid sequences. The stars indicate
the hydrophobic amino acids that are critical for the protein to
maintain the helix-turn-helix structure (Pabo and Sauer, 1984).
Solid arrows delimit the helix-turn-helix domain.
[0298] That the homeobox specifies a sequence-specific DNA binding
domain is most strongly argued by its homology with the DNA binding
domain of the yeast mating regulatory protein, MATA (Astell et al.,
Cell 27: 15-23 (1981); Scott and Weiner, Proc. Natl. Acad. Sci. USA
81: 4115-4119 (1984)), which also has homology through this
subregion of the homeobox but does not conserve the other invariant
of the homeobox. The homologous regions in these proteins can be
folded into a helix-turn-helix-structure similar to that first
identified in the structural analysis of phage .lamda. repressor
(for a review see Pabo and Sauer, Ann. Rev. Biochem. 53: 293-321
(1984)). A prediction of the most probable secondary structure of
oct-2 also revealed a helix-turn-helix structure between the
residues of isoleucine (position 1041) and cysteine (position
1090). Thus, by analogy, we propose that this region of oct-2
specifies the sequence-specified binding of the protein.
[0299] As mentioned above, sequences at the 3' end of the pass-3
recombinant abruptly diverged from that of recombinant 3-1 at the
position (1463) of its termination codon (see vertical arrow in
FIG. 18B). The substituted sequences in the second recombinant,
pass-3, extended the reading frame of the oct-2 realted protein by
an additional 16 amino acids. To rule out a possible artifactual
sequence generated by the insertion of fragment during construction
of the cDNA library, total polyA(+) RNA from the BJAB cell line was
analyzed by Northern blot iwth a DNA fragment from the novel 3'
terminal portionof the pass-3 cDNA. This specific probe hydribized
only to the two fastest migrating mRNAs of the total family of six
mRNAs which were detected by hybridization with the total 3-1 cDNA.
A similar specific probe was excised from the 3' terminus of the
3-1 cDNA. In contracts, this probe only hybridized to the two
slowest migrating mRNAs in the total family of six. This suggests
that the two cDNA segments correspond to different populations of
oct-2 mRNAs.
[0300] The proteins encoded by the two cDNAs should only differ at
their C terminus by 16 amino acids or approximatley 1.5 kD. In
vitro transcription/translation of subfragments of the 3-1 and
pass-3 recombinants was used to confirm this prediction. Fragments
representing the 3' portions of 3-1 and pass-3 were subcloned into
the expression plasmid pBS-ATG. The resulting plasmid DNAs were
transcribed with bacteriophage T7 RNApolymerase and were
subsequently translated in a reticulocyte system. The resulting
polypeptides migrated with the mobilities of the anticpated
molecular weights 34 kD and 32.4 kD. the polypeptide from the
pass-3 cDNA was 1.6 kD larger than that fromt he 3-1 cDNA. Both
polypeptides specifically bound a probe containing the
octanucleotide sequence, producing a readily detectable DNA-protein
complex in the gel mobility assay. This suggests that the oct-2
gene is expressed as a family of polypeptides in B-cells.
[0301] The potential significance of these additional 16 amino
acids is unclear. These two cDNAs almost certainly differ by
alternative splicing patterns of RNA transcribed from the oct-2
gene. Furthermore, it is likely that the oct-2 gene encodes a more
diverse set of mRNAs than those partially defined by these two
cDNAs. Six differenet length mRNAs are produced at significant
levels in mature B cells. The relative amounts of these mRNAs vary
between pre-B, B and plasma cell lines (Staudt et al., Science 241:
577-580 (1988)). This population could reflect variations in sites
of initiation of transcription and of polyadenylation as well as
further differences in splicing patterns.
[0302] The expression of the OCT-2 gene was assessed by Northern
blot analysis of mRNA from 13 lymphoid and non-lymphoid cell lines
and was found to be predominantly restricted to lymphoid cells.
Poly(A)-containing mRNA (3 .mu.g, or 20 .mu.g) or total mRNA (30
.mu.g) was analyzed from the following cell lines. 1. NIH 3T3:
mouse fibroblast; 2. 38B9: mouse pre-B cell line; 3. WEHI 231:
mouse mature B cell line; 4. A431: human epidermal cell line; 5.
U1242: human glioma cell line; 6. RB27: human retinoblastoma cell
line; 7. Jurkat: human T cell line; 8. Namalwa: human mature B cell
line; 9. BJAB: human mature B cell line (poly(A)-containing mRNA);
10. BJAB (total mRNA); 11. Hut78: human T cell line; 12. HeLa:
human cervical carcinoma cell line; 13. EL4: mouse T cell line.
mRNA was electrophoresed through a formaldehyde-containing 1.3%
agarose gel and transfered to a nitrocellulose filter by standard
techniques (Maniatis, supra.). Following prehybridization, the
filter was hybridized at high stringency with radio-labelled OCT-2
probe (above). The filter was washed in 0.2.times.SSC, 0.1% SDS at
68.degree. C. and autoradiographed with an intensifying screen at
-70.degree. C. for 24 hrs. The filter was stripped by washing in
50% formamide, 10 mM Tris (pH 7.4), 1 mM EDTA at 68.degree. C. for
1 hr. and rehybridized with a radiolabelled rat alpha tubulin cDNA
probe (Lemischka, I. R., Farmer, S., Racaniello, V. R. and Sharp,
P. A., J. Mol. Biol. 151:101-120(1981)) to control for the amount
of mRNA loaded.
[0303] All five B lymphoma cell lines, including pre-B and mature B
cell lines, and one of three T lymphoma cell lines expressed a
family of 6 transcripts. Of the five non-lymphoid cell lines
tested, only a glioma cell line, U1242( ), showed detectable
expression of this gene. Even at low stringency we were unable to
detect a transcript present in all cell lines which might
correspond to NF-A1. The various transcripts, estimated to be 7.2
kb, 5.8 kb, 5.4 kb, 3.7 kb, 3.1 kb and 1.2 kb long, were expressed
in somewhat varying amounts relative to each other in the positive
cell lines. Whether these transcripts represent alternative mRNA
splicing or highly specific mRNA degradation remains to be
determined. In this regard, it is interesting that highly purified
preparations of NF-A2 consist of three or more major polypeptides
with distinct molecular weights which could be the products of the
family of transcripts that we have observed.
[0304] Previously, we and others (See above and Gerster, T. et al.
EMBO J. 6:1323-1330 (1987); Landolfi et al., Nature 323:548-51
(1986)) showed that the octamer binding protein NF-A2 varied
considerably in expression among lymphoid cell lines. We therefore
investigated the relationship between levels of expression of the
OCT-2 gene and levels of NF-A2 as judged by mobility shift
analysis. BJAB, the cell line which expressed the largest amount of
transcript showed the largest amount of NF-A2. Nuclear extracts
from the pre-B cell lines, 38B9 and 70Z, showed very little NF-A2
and, correspondingly, expressed very little transcript (more
poly(A)-containing mRNA from these two cell lines was loaded to see
a readily detectable signal). Of the three T lymphoma cell lines
tested, Jurkat, HUT78 and EL4, EL4 was the only line that showed
large amounts of NF-A2. Although NF-A2 was previously believed to
be expressed only in lymphoid cells we found that nuclear extracts
from the glioma cell line that expressed the OCT-2 gene contained
an octamer binding protein which comigrated with NF-A2 in the
mobility shift assay. Nuclear extracts from two glioma cell lines
which were negative for OCT-2 expression did not contain NF-A2. We
have at present no explanation for this apparent non-lymphoid
expression of NF-A2 and the cloned octamer binding protein gene.
Previously, we had shown that NF-A2 but not NF-A1 was inducible in
pre-B cells by treatment of the cells with bacterial
lipopolysaccharide (LPS) and that this induction required new
protein synthesis. Therefore, we prepared poly(A)-containing mRNA
from the pre-B cell line 70Z/3 before and after LPS treatment and
observed that LPS increased the expression of the OCT-2 gene. Thus,
in every instance, the expression of the OCT-2 gene correlated with
the presence of NF-A2 and is thus a good candidate for the gene
which encodes NF-A2.
[0305] Further evidence that the oct-2 gene encodes NF-A2 was
discovered when the NF-A2 factor was purified from nuclear extracts
of BJAB cells by conventional chromatography followed by multiple
passages over an affinity column containing immobilized oligomers
of the octa-nucleotide sequence. The purified NF-A2 consisted of
three bands, as resolved by gel electrophoresis: a major band and
two minor bands with deduced molecular weights of 61 kD and 58 kD,
and 63 kD, respectively. A cDNA (pass-3) for the oct-2 gene was
inserted into the poly-linker of the pGEM (Promega) expression
vector. Translation of RNA transcribed from the SP6 promoter-pass-3
cDNA construct yielded a major polypeptide from the purified sample
of NF-A2.
[0306] The mobility of a DNA-protein complex in the gel assay is
primarily determined by the molecular weight of the protein.
Complexes were generated with the affinity purified NF-A2 and the
products of translations in vitro of RNA from the oct-2 cDNA. These
complexes co-migrated during electrophoresis in a native gel, again
suggesting that the oct-2 cDNA encodes the major form of the NF-A2
factor.
[0307] The affinity purified NF-A2 protein and the polypeptide
translated in vitro from the oct-2 cDNA were also compared by
partial tryptic digestion. Samples from different digestion times
of NF-A2were resolved by denaturing gel electrophoresis and
detected by staining with silver. The mobility of these partial
fragments was compared with those observed after a parallel
analysis of .sup.35S-methionine labelled polypeitide from
transcription/translation of the pass-3 cDNA in vitro. The two
samples generated a similar set of digestion fragments, again
suggesting that NF-A2 is encoded by the oct-2 cDNA.
[0308] Protein sequence comparisons suggested that the DNA binding
domain of oct-2 was specified by a domain (positions 952-1135) that
was distantly related to both the helix-turn-helix structure of
bacterial repressors and the homeobox-proteins. To directly test
this analogy a fragment of the cDNA encompassing this region (655
to 1710) was inserted into the expression vector pBS-ATG so that
RNA could be transcribed from the truncated templates by
bacteriophage T7 RNA polymerase as indicated in FIG. 19A. The
polypeptides translated in vitro from these RNAs were tested for
specific DNA binding by addition of the total translation mix to
the DNA-protein gel assay. Polypeptides produced from RNAs
terminating at postions 1710 (Kpnl), 1443 (Stul), and 1134 (Pstl)
specifically bound the octanucleotide containing probe, while the
polypeptide translated from RNA terminating at the 945 (Eagl) site
did not specifically bind. The region containing the
helix-turn-helix portion of oct-2 is deleted in the latter protein.
Since the truncated polypeptide encoded by RNA from the latter
template was efficiently translated in the reticulocyte reaction,
this suggests that the specific binding of the oct-2-protein
requires the helix-turn-helix structure.
[0309] Two distinct but similarly migrating protein-DNA complexes
were detected in the sample generated by translation of RNA from
the Stul cleaved template. Faint slower migrating complex
comigrated with the complex generated with templates cleaved by
Kpnl. The presence of the two complexes in the Stul-sample is due
to a partial digestion of the plasmid DNA. The slower migrating
complex is probably produced by protein terminated at the stop
codon TAA located at position 1465. The faster migrating complex
probalby reults from molecules terminated at the Stul site. This
interpretaton was supported by the resolution of two
.sup.35S-labeled polypeptides during gel electrophoresis of the
Stul sample and confirms the positon of the temrination codon of
oct-2.
[0310] Many sequence-specific binding proteins have an oligomeric
structure. For example, bacterial repressor proteins typically bind
sites with two-fold rotational symmetry by forming a similarly
symmetric dimer (Ptashne, Cell Press and Blackwell Scientitic
Publications, (1986)). It should be noted that the binding site
sequence of the oct-2 protein is not symmetric but oligomeric
proteins could bind to non-symmetric sites. Other examples of
oligomerization of sequence-specific bindingprotiens are the GCN4
protein of yeast (Hope and Struhl, EMBO J. 6: 2781-2784, (1987))
and the C/EBP protein of mammals. In the latter case, an
.varies.-helical region with an amphipathic character reflected in
the spacing of four leucine residues by exactly seven residues is
thought to be responsible for dimer formation (Landschultz et al.,
Science 240: 1759-1764 (1988); Landschultz et al., Genes &
Development 2: 786-800 (1988)). A convenient assay for detection of
dimerization of sequence-specific bindignproteins is to
co-translate RNAs encoding two different size forms of the protein
and test whether protein-DNA complexes with novel mobilities are
generated (Hope and Struhl, EMBO J. 6: 2781-2784 (1987). If only
monomers bind to the probe, the sample containing the co-translated
polypeptides will generated only the complexes detected when either
RNA is assayed singularly. This was the case with combinations of
different length RNAs transcribed from the oct-2 cDNA segment.
Specifically, cotranslation of RNAs from templates cleaved at Stul
(1443) and Pstl (1134) did not generate novel bands in the gel
mobility assay. Thus, on the basis of this negative evidence, we
suggest that a single molecule of the oct-2 protein is present in
the resolved DNA-protein complexes and that it does not require
dimerization for binding to DNA.
[0311] Anti-sera raised in rabbits against a bacterial fusion
protein containing oct-2 encoded sequence (prepared employing the
vestor pRIT2T (Pharmacia)) recognized the native oct-2 protein in
metabolically labeled (.sup.35S-methionine) human B cells.
[0312] The molecular cloning of a lymphoid-restricted octamer
binding protein gene demonstrates that higher eukaryotes have
adopted a strategy of genetic diversification of transcriptional
regulatory proteins which bind a common regulatory motif. The
ubiquitous and lymphoid-specific octamer binding proteins have
indistinguishable DNA binding sites, yet appear to have distinct
functional properties (Staudt, L. M. et al, Nature 323:640-643
(1986)). Structure-function analysis of cloned yeast transcription
factors (Petkovich, M. et al., Cell 330:444-450 (1987); Giguere, V.
et al., Nature 330:625-629 (1987)) and steroid receptor related
transcription regulatory activity of a transcription factor often
reside in discrete protein domains that can be experimentally
interchanged. The present findings suggest that similar
diversification of function among proteins which bind the octamer
motif has occurred during evolution. The octamer motif has been
shown to be necessary and sufficient for lymphoid specific promoter
activity (Fletcher, C. et al., Cell 51:773-781 (1987)) and NF-A2
has been shown to function as a transcription factor using octamer
containing templates in vitro (Scheidereit, C. et al., Cell
51:783-793 (1987)). A further understanding of the
lymphoid-specific activity of immunoglobulin promoters may now come
from an understanding of the mechanisms underlying the
lymphoid-specific expression of the OCT-2 gene.
Example 8
Induction of NF-KB in Cells in Which it is Not Constitutively
Present
[0313] The following work demonstrates that NF-.kappa.B is
inducible in cells otehr than B (lymphoid) cells. As described
below, it has now been shown that NF-.kappa.B is inducible in pre-B
cells and in non-lymphoid cells. In particular, the following work
demonstrates that: 1) NF-kB factor can be induced by the mitogen
lipopolysaccharide (LPS) in two cell lines representing a pre-B
stage of B cell differentiation; 2) induction of this factor
involves a post-translational modification of a pre-existing
protein because the induction takes place even in the presence of
translational inhibitors like cycloheximide and anisomycin; 3)
these translational inhibitors by themselves can at least partially
induce NF-kB and synergize with LPS to produce a superinduction; 4)
an active phorbol ester like PMA can induce NF-kB by itself, and
the time-course of this activation is more rapid than that with LPS
alone; and 5) it is also possible to induce this factor in cell
lines other than those having a pre B phenotype by means of an
appropriate stimulus (e.g., in the human T cell line, Jurkat, by
PHA and/or PMA or in HeLa cells with PMA). Thus, B cells and plasma
cells appear to support constitutive presence of this factor
whereas in other cell types it can be induced transiently by an
appropriate stimulus.
Experimental Procedures
[0314] Cell lines and Extracts: 70Z/3 and PD cells were grown in
RPMI 1640 medium supplemented with 10% inactivated fetal calf
serum, 50 .mu.M .beta.-mercaptoethanol and penicillin and
streptomycin sulfate (pen-strep) antibiotics. LPS (GIBCO)
stimulation was carried out with 10-15 .mu.g/ml. For experiments
using protein synthesis inhibitors and LPS, cell cultures were
treated with inhibitors approximately 20 min prior to addition of
LPS. Cycloheximide (Sigma) was used to 10 .mu.g/ml which causes
greater than 95% inhibition of protein synthesis in 70Z/3 cells
(Wall, R., et al., Proc. Natl. Acad. Sci. USA 83:295-298, (1986).
Anisomycin (Sigma) was used at 10 which causes approximately 99%
inhibition of protein synthesis in HeLa cells (Grollman, A. P., J.
Biol. Chem. 242:3226-3233, 1967). Phorbol ester activation of 70Z/3
cells was carried out using the active ester phorbol
12-myristate-13-acetate (PMA) or the inactive ester phorbol
12,13-didecanoate at a concentration of 25 ng/ml for the times
indicated in the text. All treatments were carried out at cell
densities varying between 5.times.10.sup.5-10.sup.6 cells/ml.
Jurkat cells were grown in RPMI 1640 medium with 10% inactivated
fetal calf serum and pen-strep antibiotics. Phytohemmagglutinin
(PHA) treatment was done at 5 .mu.g/ml and PMA treatment at 50
.mu.g/ml. HeLa cells were grown in MEM medium with 5% horse serum
and pen-strep antibiotics. Phorbol ester (PMA treatment was at 50
.mu.g/ml with cell density varying between
7.times.10.sup.5-10.sup.6 cells/ml.
[0315] Nuclear extracts were generated essentially according to the
protocol of Dignam, J. D. et al., Nucl. Acids Res. 11:1475-1489
(1983) and protein concentration were determined using a Bradford
assay with serum albumin standards.
[0316] Gel Binding Analysis: Gel binding analyses were carried out
as described earlier using a radioactive DdeI to HaeIII fragment
(k3) derived from the enhancer (Sen and Baltimore, 1986). Levels of
NF-KB induced by various stimuli were normalized to total protein
present in the extracts. Further, analysis with a different
fragment that contains a binding site for the ubiquitous factor
NF-A, shows that this nuclear protein remains at approximately
constant levels in all of the extracts reported here. Thus, the
modulation of NF-KB activity is not a reflection of variability of
nuclear factors in general under these conditions. For competition
experiments, the specific and non-specific competitors DNA's were
included in the mixture (in amounts shown in FIG. 24C) prior to
addition of the protein. The competitor fragments .mu.300, .mu.400,
KE and SV40E which have been described earlier (Sen and Balitmore,
1986) were isolated from low melting point agarose gels and
quantitated by spotting onto ethidium bromide-containing agarose
plates.
NF-.kappa.B Can be Induced in Pre-B Cell Lines with Bacterial
Lipopolysaccharide
[0317] To examine whether NF-.kappa.B might be inducible in 70Z/3
cells, cells were stimulated with LPS for 20 hr and nuclear
extracts derived from these cells were assayed for the presence of
NF-KB using the electrophoretic mobility shift assay described
previously. Singh, H. et al., Nature, 319:154-158 (1986). U.S.
patent application Ser. No. 817,441, To assay for NF-.kappa.B, a
DNA fragment containing its binding site (K3 fragment; Sen and
Baltimore, supra,) was end-labelled and incubated with extracts
derived from either unstimulated 70Z/3 (11 s (FIG. 21A, lanes 2,3)
or LPS-stimulated 70Z/3 cells (FIG. 21A, lanes 4,5) in the presence
of increasing amounts of the carrier poly d(IC). Binding reactions
were carried out for 15-30 minutes at room temperature in a final
volume of 15 .mu.l containing 9 .mu.g of total protein 3.5 .mu.g
(lanes 2,4) or 4.5 .mu.g (lanes 3,5) of nonspecific carrier DNA
poly d(IC) and 0.2-0.5 .mu.g of probe. Reaction products were
fractionated by electrophoresis through low ionic strength
polyacrylamide gels and viualized by autoradiography. Lane 1: free
DNA fragments; lane 6: nucleoprotein complex generated by
interaction of NF KB with the fragment 3 in a nuclear extract
derived from the B cell line WEHI 231.
[0318] Unstimulated 70Z/3 cell extracts lacked a major band evident
with B cell extracts (FIG. 21A, lane 6; arrow). This nucleoprotein
complex band was induced in the 70Z/3 cells after LPS treatment for
20 hr. The band was not competed away even with 4.5 ugm of poly
d(IC) (lane 5). This induction phenomenon was not restricted to the
70Z/3 cell line; another pre-B cell line, PD (Lewis S., et al.,
Cell 30:807-816 (1982)), was weakly positive for the factor prior
to induction (FIG. 21B, lane 3; Sen and Baltimore, 1986) but was
strongly induced by LPS (FIG. 21B lanes 5,6). A number of other
minor bands could be seen in the binding assay, some of which were
inducible and others not. The major inducible band comigrated with
the major band produced by B cell and plasma cell extracts
(typified by WEHI 231 extracts in FIG. 21A, lane 6 and FIG. 21B,
lane 2). We have earlier characterized this band by competition
experiments and localized the binding site of the factor by
methylation interference experiments defining the band as one
produced by interaction of the NF-.kappa.B factor with the B site
within the enhancer (a site containing the sequence GGGGACTTTCC).
Thus two pre-B cell lines, one with a rearranged K gene (70Z/3) and
the other in the process of undergoing rearrangement (PD), are
clearly inducible by LPS for NF-KB activity.
Induction of NF-KB by LPS Does not Require Protein Synthesis
[0319] Recently it has been reported that induction of
transcription in 70Z/3 does not require new protein synthesis.
Nelson, K. J. et al., Proc. Nat. Acad. Sci. USA 82:5305-5309
(1985). Thus, induction of gene expression was evident in cells
pretreated (10 min) with the translation inhibitors cycloheximide
or anisomysin followed by stimulation with LPS. Further, Wall et
al. reported that expression could be induced in the presence of
cycloheximide alone which led them to argue in favor of a labile
repressor blocking the activation of genes in this cell line. See
Wall, R. et al. Proc. Nat. Acad. Sci. USA 83:295-298 (1986). To
determine if these characteristics of transcriptional activation
were paralleled by changes in the levels of NF-.kappa.B, we
analyzed extracts derived from 70Z/3 cells which had been treated
either with LPS alone, or with a translation inhibitor alone or
with both together. To be able to make direct correlations with the
published reports concerning the effects of translational
inhibitors on expression in pre-B cells, we examined a 4 hr time
point in these experiments, although maximal stimulation of
expression by LPS takes 14-20 hr. Binding reactions were carried
out as detailed in FIG. 21A legend and contained 2.5, 3.5 or 4.5
.mu.g poly dIG) with each set of extracts. End-labelled K3 fragment
was the proble lane 1) and was incubated with 9-11 .mu.g or protein
from extracts derived from: untreated 70Z/3 cells (lanes 2,3,4),
70Z/3 cells treated for 4 hr with 10 .mu.g/ml of LPS (lanes 5,6,7),
70Z/3 cells treated for 4 hr with 10 .mu.g/ml of LPS and 10
.mu.g/ml cycloheximide (lanes 8,9,10); 70Z/3 cells treated with 10
.mu.g/ml of cyclheximide alone (lanes 11,12,13) and WEHI 231 cells
(lane 14). The characteristic nucleoprotein complex is indicated by
the arrow. In accord with the transcriptional analyses, uninduced
70Z/3 cells were negative for NF-.kappa.B (FIG. 22A, lanes 2-4),
and treatment with either LPS alone (FIG. 22A, lanes 5-7) or with
cycloheximide alone (FIG. 22A, lanes 11-13) for 4 hrs induced the
factor. Unexpectedly, stimulation of 70Z/3 with LPS in the presence
of cycloheximide for 4 hr gave a superinduction of NF-KB (FIG. 22A,
lanes 8-10), increasing it to a level above that seen after a 20 hr
induction.
[0320] Qualitatively, the same result was observed when anisomycin
was used as a translation inhibitor (FIG. 22B). Binding reactions
were as detailed in FIG. 21A legend using 2.5 and 3.5 .mu.g of poly
d(IC) and protein from untreated 70Z/3 cells (lanes 2,3); 70Z/3
cells after induction with LPS alone (lanes 4,5); 70Z/3 cells with
LPS induction in the presence of anisomycin (lanes 6,7); 70Z/3
cells treated with anisomycin by itself (lanes 8,9) and the B cell
WEHI 231 as a positive control (lane 10). The characteristic
nucleoprotein complex is indicated by the arrow. Thus, the presence
of anisomycin (10 uM) during a 4 hr stimulation with LPS gave a
superinduction of NF-.kappa.B (FIG. 22B, lanes 6,7) relative to
either LPS alone (FIG. 22B, lanes 4,5) or anisomycin alone (FIG.
22B lanes 8-9). Once again, prior to LPS treatment there was no
detectable NF-KB activity in 70Z/3 (FIG. 22B lanes 2,3). Although
treatment of 70Z/3 with cycloheximide alone or with LPS alone gave
approximately equivalent amounts of NF-KB (FIG. 22A compare lanes
5-7 with lanes 11-13), the level of NF-KB induced with anisomycin
alone appeared to be much less (FIG. 22B, compare lanes 8,9 with
lanes 4,5). This is probably due to drug toxicity because, even
after a short exposure to anisomycin, the cells looked quite
unhealthy. Presumably this also accounts for lesser degree of
superinduction seen with LPS and anisomycin. Thus the enhancer
binding factor NF-KB appears to be inducible in 70Z/3 cells in the
absence of protein synthesis. Further, it appears to be inducible
by either of 2 different translation inhibitors alone and is
superinduced when the cells are stimulated with LPS and the
inhibitor.
Phorbol Ester can Induce NF-KB in 70Z/3
[0321] The tumor promoting phorbol ester, phorbol
12-myristate-13-acetate (PMA), has been shown to induce surface
immunoglobulin in 70Z/3, presumably via activation of K
transcription and transport of complete immunoglobulin to the cell
surface (Rosoff P. M. et al., J. Biol. Chem. 259:7056-7060 1984;
Rosoff, P. M. and Cantley, L.C., J. Biol. Chem. 260 9209-9215,
(1985). To determine if this activation is reflected in an increase
of NF-KB, we analyzed extracts derived from 70Z/3 cells after a 4
hr stimulation with PMA at 50 ng/ml. Binding reactions using K3 as
a problem (lane 1) were carried out as detailed in FIG. 21A legend
with protein from untreated 70Z/3 cells (lane 2) or 70Z/3 cells
that had been treated with PMA at 50 ng/ml for 4 hr (lanes 3,4).
Lane 5 is the positive control for NF-.kappa.B in extracts from
WEHI 231. There was a striking induction of NF-KB activity in these
extracts (FIG. 23A, compare lanes 3,4 with lane 2). Thus an active
phorbol ester by itself is capable of inducing NF-B activity in
70Z/3 cells, implicating protein kinase C as a possible
intermediate in the post-translational modification reaction that
produces NF-B in these cells [(Bell, R. M. Cell 45:631-632 (1986);
Nishizuka, Y. Nature 308:693-697, (1984)]. An inactive phorbol
ester (phorbol 12, 13 didecanoate) did not cause induction of NF-KB
under similar conditions (data not shown).
Time Course of Activation of NF-B by LPS and PMA are Different
[0322] LPS-mediated stimulation of surface Ig expression of mRNA
accumulation reaches a maximum after at least one cell cycle, i.e.,
in 14-18 hr. Recent work has shown that LPS stimulation of RNA
synthesis, as measured by nuclear run on assays [Nelson, K. J., et
al., Proc. Natl. Acad. Sci USA 82:5305-5309 (1985); Wall et al.
supra, (1986)] can be seen as early as 4 hr after stimulation and
that the DNAse I hypersensitive site associated with the enhancer
can be detected as early as 1 hr post-stimulation. To examine the
time-course of NF-KB induction, we generated 70Z/3 cell extracts
after stimulation either by LPS or PMA for varying lengths of time.
Analysis for NF-KB activity using the binding assay showed that the
time course of activation of NF-KB by these two agents was quite
different (FIG. 23B). Binding reactions were carried out with
extracts derived from 70Z/3 cells that had been treated with LPS at
10 .mu.g/ml (lanes 3-7) or PMA at 25 ng/ml (lanes 8-12) for various
lengths of time as shown above each lane in the figure. Lane 2 is a
positive control for NF-.kappa.B in WEHI 231 extracts. With LPS
alone, a nucleoprotein complex band reflecting the presence of
NF-KB increased until 2 hr post-stimulation after which a slight
decrease occurred and then the level remained constant. By
contrast, in PMA-stimulated cells, NF-KB was detected at maximal
levels within 0.5 hr after stimulation, remained at this level for
2-3 hours and then began to drop off rapidly, such that by 8 hr it
was barely detectable. Because prolonged exposure of cells to
phorbol esters is known to result in desensitization of endogenous
protein kinase C (Rodriquez-Pena, A. and Rozengurt, E., Biochem
Biophys. Res. Comm. 120:1053-1009, 1984; EMBO J, 5:77-83 1986), a
possible explanation for the rapid decline of NF-KB may be that its
maintenance as a binding factor requires continuous activity of
protein kinase C. A similar phenomenon has been described recently
by Blemis and Erikson where S6 kinase activity assayed by
phosphorylation of S6 protein) first rises and then falls during
prolonged exposure to PMA. See Blemis, J. and Erikson, R. L. Proc.
Natl. Acad. Sci. USA 83:1733-1737 (1986). Although it has been
reported that LPS may directly activate protein kinase C (Wightman,
P. D. and Raetz, C. R. H., J. Biol. Chem. 259:10048-10052, 1984)
the different kinetics of induction of NF-KB by LPS and PMA implies
that these activators feed into a common pathway through
distinguishable sites of activation.
Non pre-B Cell Lines can Also be Activated to Produce
NF-.kappa.B
[0323] In our previous analysis we have shown that NF-.kappa.B is
present only in cell lines representing the B cell or plasma cell
stages of B lymphoid differentiation, but was undetectable in a
variety of non B cells, pre-B cells and T cells (Sen and Baltimore,
1986). However, as shown above, this factor may be induced to high
levels in pre-B cells upon stimulation with LPS. To check if this
inducibility was restricted to cells having a pre-B pheno-type only
or was a general characteristic of the other constitutively
negative cell lines we have taken representative examples of cell
types (T cells and non lymphoid cells) and examined then for
induction of NF-KB after appropriate stimulation.
[0324] The human T leukemia cell line, Jurkat, can be stimulated to
produce interleukin-2 (IL-2) by the combined influence of
phytohemagglutinin (PHA) and phorbol ester (PMA) (Gillis, S. and
Watson, J., J. Exp. Med., 152:1709-1719, 1980; Weiss et al., J.
Immunol. 133:123-128, 1984). Nuclear extracts were prepared from
Jurkat cells that had been stimulated with either PHA alone or PMA
alone or both together and analyzed for the presence of NF-.kappa.B
(FIG. 24A). The human T lymphoma Jurkat was stimulated with
phytohemagglutinin (PHA) and phorbol 12-myristate-13-acetate (PMA)
individually or together for 20 hr. Nuclear extracts made after
treatment were analyzed by the mobility shift assay using K-3
fragment as the labelled probe. Binding reactions typically
contained 6 g of protein, 2.5-3.5 g of poly d(IC) and 0.3-0.5 ng of
end-labelled DNA probe. Lane 1: no protein added; lane 2: WEHI 231
extract (positive control); lane 3: extract from uninduced Jurkat
cells: lane 4: Jurkat cells stimulated with PHA alone; lane 5:
Jurkat cells stimulated with pHA and PMA; Lane 6: Jurkat cells
stimulated with PMA alone. The arrow shows the position of the
expected nucleoprotein complex generated by interaction of
NF-.kappa.B with K-3 fragment. As originally observed, extracts
derived from uninduced Jurkat cells were negative for NF-.kappa.B
activity (FIG. 24A, lane 3). However, extracts made from Jurkat
cells which had been stimulated either with PHA or PMA contained
detectable levels of NF-KB (FIG. 24A, lanes 4,6) and the extracts
from the co-stimulated cells showed higher levels of the factor
(FIG. 24A, lane 5). Thus a factor with the properties of NF-KB can
be induced in a T cell lines after appropriate activation.
[0325] As an example of a non-lymphoid line we used the human HeLa
cell lines which is constitutively negative for NF-KB (Sen and
Baltimore, 1986). These cells were induced with PMA for 2 hr and
extracts derived from treated and untreated cells were analyzed for
NF-KB activity (FIG. 24B). HeLa cells were treated with PMA (50
ng/ml) for 2 hrs. and the extracts derived thereafter were analyzed
for induction of NF-.kappa.B. Binding reactions contained 15-18
.mu.g of protein, 3.5 .mu.g of poly d(IC) and 0.3-0.5 .mu.g of
end-labelled DNA probe. Lane 1: 3 fragment/no protein added; lane
2: 3 fragment incubated with extracts derived from the human B
lymphoma EW; lane 3: K3 fragment incubated with uninduced HeLa cell
nuclear extract; lane 4: .mu.50 fragment (derived from the
.mu.-heavy chain enhancer and containing a copy of the conserved
octamer sequence ATTTGCAT) incubated with uninduced HeLa cell
extracts; lane 5: K3 fragment incubated with induced HeLa cell
extracts. The untreated HeLa extract (FIG. 24B, lane 3) did not
show a nucleoprotein complex which comigrated with the complex
generated in B cell extracts. However treatment with PMA induced a
factor that generated the characteristic DNA-protein complex
produced by NF-KB (FIG. 24B, lane 5). As a control, both the
uninduced and induced extracts showed equivalent levels of the
ubiquitous NF-A1 DNA binding protein when analyzed using a probe
containing the sequence ATTTGCAT (FIG. 24B, lanes 4,6; Singh, H. et
al., Nature 319:154-158, 1986). Therefore treatment of HeLa cells
with PMA induces a factor that can form a nucleoprotein complex
with the K3 fragment.
[0326] To further characterize the DNA-protein complex formed in
the PMA-treated HeLa cell extracts, we carried out competition
experiments. Binding reactions were carried out using end-labelled
K3 fragment, 3.5 .mu.g of poly d(IC) and 15-18 .mu.g of nuclear
extract in the present of 50 ng of unlabelled competitor DNA
derived from various immunoglobulin and viral regulatory sequences
(lanes 5-9). The complex generated in PMA-induced HeLa cell
extracts (FIG. 24C, lane 4) was specifically competed away by the
inclusion of 50 ng of unlabelled DNA in the binding reaction
containing either the enhanced (FIG. 24C, lane 7) or the SV40
enhanced (FIG. 24c, lane 8) but was unaffected by two DNA fragments
that together span the K enhancer (FIG. 24c, lane 5,6), or by a 250
bp fragment containing the K promoter (FIG. 24C, lane 9). This
pattern of competition exactly parallels the pattern observed
earlier using the K3 fragment in binding experiments with B cell
derived extracts (Sen and Baltimore, 1986). These results further
strengthen the conclusion that the NF-KB factor can be induced in
non-lymphoid cells as well as lymphoid cells following appropriate
stimulation.
Example 9
Characterization of the NF-kB Protein and Electrophoretic Mobility
Shift Analysis of Subcellular Fractions of 70Z/3 Cells
Characterization of the NF-kB Protein
[0327] Mouse NF-kB is a polypeptide with a molecular weight around
60 kDa. This has been determined by a DNA-binding renaturation
experiment using eluates from different molecular weight fractions
of a reducing SDS-gel (FIG. 26A). The size of the native NF-kB
protein was determined in the following manner: Nuclear extract
from TPA-stimulated cells was subjected to ultracentrifugation on a
continuous glycerol gradient. The fractions were assayed for
DNA-binding activity of NF-kB by electrophoretic mobility shift
assays (FIG. 26B). NF-kB activity was found highest between the
co-sedimented bovine serum albumin (67 kDa) and IgG (158 kDa)
standards (FIG. 26B, lanes 6 to 8). The specificity of binding was
shown by the absence of a complex when a DNA probe with a mutation
in the NF-kB binding sequence was used to assay the fractions (FIG.
26B, right lanes 4 to 10). Lenardo, M. et al., Science,
236:1573-1577 (1987). Little NF-kB activity was contained in the
fractions where a 60 kDa protein would be expected to sediment
(FIG. 26B, lanes 4 and 5). It the sedimentation of NF-kB is not
highly abnormal, the results from the glycerol gradient
centrifugation suggest that NF-kB is associated with another
protein of approximately the same size. Presumably NF-kB forms a
homodimer because the protein-DNA complex formed in native gels
using whole nuclear extract is of the same mobility as the complex
formed with renatured NF-kB protein from a single spot of a
two-dimensional gel.
[0328] 70Z/3 cell cultures were incubated in the absence (Co) and
presence of phorbol ester (TPA), followed by subcellular
fractionation of cells. In the DNA-binding reactions, 8.8 ug of
protein of nuclear extracts (N), cytosolic fractions (C), and
post-nuclear membrane fractions (P) in 4 ul buffer D(+) were used.
The endlabeled DNA-fragments were incubated in the presence of 3.2
ug poly(d[I-C]) with the subcellular fractions in a final volume of
20 ul for 15 to 30 minutes followed by separation of protein-DNA
complexes and unbound DNA on native 4% polyacrylamide gels.
Fluorograms of native gels are shown. To detect kB-specific
DNA-binding activity a DdeI-HaeIII wild type fragment of the kappa
light chain enhancer (kB wt; lanes 1-6) was used. Sen, R. and D.
Baltimore, Cell, 46:705-716 (1986). kB-unspecific activities
binding to the kappa enhancer fragment were detected using a
fragment mutated in NF-kB binding site that was otherwise identical
to the wild type fragment (lanes 7-12). Ienardo, M. et al.,
Science, 236:1573-1577 (1987). NF-uE3-binding activity and octamer
binding protein activity were assayed with a HaeIII-DdeI kappa
enhancer fragment (uE3; lanes 13-18) and a PvuII-EcoRI kappa heavy
chain promoter fragment (OCTA; lanes 19-24), respectively. Sen, R.
and D. Baltimore, Cell, 46:705-716 (1986); Singh, H. et al.,
Nature, 319:154-158 (1986). Specific protein-DNA complexes are
indicated by filled arrowheads and the positions of unbound
DNA-fragments by open arrowheads.
Example 10
Renaturation of NF-kB
[0329] 70Z/3 cells were grown in spinner cultures with RPMI 1640
medium supplemented with 10% newborn calf serum and 50 uM
2-mercaptoethanol. HeLa cells were also grown in spinner cultures
with MEM medium supplemented with 10% horse serum. Cell cultures
were treated with 25 ng/ml 12-O-tetradecanoylphorbol 13-acetate
(TPA; Sigma) for 30 minutes at cell densities between
7.times.10.sup.5 and 2.times.10.sup.6/ml.
Subcellular Fractionation
[0330] Cells were collected by centrifugation for 1o minutes at
150.times.g. Cell pellets were resuspended in ice-cold
phosphate-buffered saline and collected again by centrifugation.
All following steps were carried out at 4.degree. C. Washed cells
were resuspended in four packed cell volumes of a hypotonic lysis
buffer (buffer A; Dignam, J. P. et al., Nucleic Acid Research,
11:1475-1489 (1983)). After 20 minutes, cells were homogenized by
15 (HeLa) or 20 strokes (70Z/3 cells) with a loose fitting Dounce
homogenizer. Nuclei were collected by centrifugation for 6 minutes
at 4300.times.g, resuspended in five volumes of buffer A and washed
once by centrifugation. Proteins were extracted from washed nuclei
by high salt, followed by centrifugation of the nuclear extracts
and dialysis against buffer D as described. Dignam, J. P. et al.,
Nucleic Acids Research, 11:1475-1489 (1983). One percent NP-40
(v/v) was added to the dialyzed nuclear extracts. The postnuclear
supernatant was centrifuged for 6 minutes at 4300.times.g and the
resulting supernatant ultracentrifuged for 1 hour at
150,000.times.g. The pellet after ultracentrifugation containing
postnuclear membranes was dissolved in buffer D containing 1% (v/v)
NP-40 (referred to as buffer D (+)). Insoluble material was removed
by centrifugation for 10 minutes in a Microfuge. The supernatant
after ultracentrifugation (referred to as cytosolic fraction) was
adjusted to buffer D(+) conditions by the addition of stock
solutions. Fractions were stored at -70.degree. C.
[0331] Protein concentrations were determined by an assay using
bicinchoninic acid. Smith, P. K. et al., Anals of Biochemistry,
150:76-85 (1985). The ratio of the total protein recovered during a
fractionation experiment in nuclear extracts, cytosolic fractions
and postnuclear membrane fractions was 2:4:1 for 70Z/3 cells and
1:10:1.5 for HeLa cells. These ratios were used to adjust the
fractions to protein concentrations reflecting equal
cell-equivalents of subcellular fractions.
Electrophoretic Mobility Shift Assays and Treatments with
Dissociating Agents
[0332] DNA-binding reactions were carried out as described above.
The DNA-binding reaction mixture contained poly(d[I-C])
(Pharmacia), 3000-6000 cpm of [.sup.32P]end-labeled DNA-fragments
and a buffer composed of 10 mM Tris-HCl.sub.1, pH 7.5, 50 mM NaCl,
1 mM dithiothreitol (DTT), 1 mM EDTA and 5% glycerol. Binding
reactions and sub-sequent analysis on native 4% polyacrylamide gels
were performed at room temperature as described. Sen, R. and D.
Baltimore, Cell, 46:705-716 (1986). Subcellular fractions were
treated with formamide (DNA grade; American Bioanalytical) prior to
the addition of the DNA-binding reaction mixture. Sodium
desoxycholate (Fisher Scientific Company) was added after the
DNA-binding reaction.
Renaturation of NF-kB
[0333] Protein in the subcellular fractions was precipitated at
-20.degree. C. by the addition of four volumes of acetone. Pellets
were dissolved in SDS-sample buffer containing 3.3%
2-mercaptoethanol and boiled for 5 minutes. Laemmli, U.K., Nature,
227:680-685 (1970). After SDS-polyacrylamide gel electrophoresis,
gel pieces from different molecular weight regions were cut out,
ground, and proteins eluted overnight at 4.degree. C. in 500 ul of
a buffer containing 50 mM Tris-HCl, pH 7.9, 0.1% SDS, 0.1 mg/ml
bovine serum albumin, 1 mM DTT, 0.2 mM EDTA, 0.1 mM
phenylmethylsulfonyl fluoride (PMSF) and 2.5% glycerol. After
centrifugation for 2 minutes in a Microfuge, the supernatant was
removed and recentrifuged for 10 minutes to remove gel debris.
[0334] To 200 ul of the supernatant four volumes of acetone were
added and proteins were allowed to precipitate for 2 hours at
-20.degree. C. The precipitate was collected by centrifugation for
10 minutes in a Microfuge, washed once with 1 ml methanol at
-20.degree. C. and dried for 30 minutes in the inverted tube. The
dried pellet was dissolved in 2.5 ul of a saturated solution of
urea (ultrapure; American Bioanalytical) and dilued with 125 ul of
a buffer containing 20 mM Tris-HCl, pH 7.6, 10 mM KCl, 2 mM DTT and
10 uM PMSF. Renaturation was allowed for a minimum of 18 hours at
4.degree. C. kB-specific DNA-binding activity was detectable in
mobility shift assays for at least 48 hours after storage of
renatured fractions at 4.degree. C. without appreciable loss of
activity.
Example 11
Subcellular Localization of the NF-kB Precursor
[0335] Because NF-kB is a DNA-binding protein, it is expected to
reside in the nucleus. This is certainly true for NF-kB of phorbol
ester-treated cells and mature B-cells where the activity is
detectable in nuclear extracts. It is however not mandatory for a
precursor of NF-kB especially, in view of the fact that the
precursor is activated by protein kinase C, a cytosolic protein
that is associated in its active state with the plasma
membrane.
[0336] The precursor of NF-kB was analyzed by an investigation of
subcellular fractions of unstimulated pre-B cells for the presence
of NF-Kb activity, using electrophoretic mobility shift assays
(FIG. 27A). Little DNA-binding activity was detected in the
subcellular fractions, indicating that the precursor must exist in
a form of low affinity for its cognate DNA (FIG. 27A, lanes 1 to
3). In fractions from TPA-stimulated cells, the newly activated
NF-kB was almost exclusively contained in the nuclear extract (FIG.
27A, lanes 4 to 6).
[0337] In an attempt to activate the DNA-binding activity of the
NF-.kappa.B precursor, the various subcellular fractions were
treated with agents known to gently dissociate protein-protein
interactions. Low concentrations of desoxycholate, formamide or a
combination of both included in the mobility shift assay mixture
led to the activation of an NF-kB-specific DNA-binding activity
(FIG. 27B). The fraction containing the bulk of the in vitro
activatable NF-kB precursor was the cytosol (FIG. 27B, lanes 1 to
3). When fractions from TPA-stimulated cells were subjected to the
same treatment, the amount of precursor in the cytosolic fraction
was found strongly reduced, apparently because of redistribution of
activated NF-kB into the nuclear extract fraction (FIG. 27B, lanes
4 and 5). In both control and TPA-stimulated cells, the amount of
total cellular NF-kB activity revealed after treatment with
dissociating agents was equal, suggesting a complete conversion of
the NF-kB precursor into active NF-kB. Cytosolic fractions from
HeLa cells and from calf spleen also contained NF-kB precursor
which could be demonstrated after activation with dissociating
agents. These observations strongly suggest that NF-kB is localized
as an inactive precursor in the cytosol. Activation of protein
kinase C by phorbol ester then would result in two events:
induction of DNA-binding activity and nuclear translocation of
NF-kB.
[0338] Using subcellular fractions from HeLa cells, another
TPA-inducible transcription factor, AP-1, was tested to determine
whether it also exhibits activation and subcellular redistribution
upon TPA-stimulation. As detected by mobility shift assays, AP-1
from nuclear extracts did not show an increase in DNA-binding
activity after TPA-stimulation nor were there significant amounts
of AP-1 activity present in the cytosolic fractions from control
and stimulated cells (FIG. 28). This showed that the mechanism by
which the transcription factor activity of NF-kB is induced is
fundamentally different from that of AP-1 although the initial
signal--activation of protein kinase C by phorbol ester--is the
same.
Example 12
Investigation of the DOC-dependence of Cytosolic NF-kB
[0339] Cytosol from unstimulated 70Z/3 pre-B cells in buffer A
(Dignam, J. P. et al., Nucl. Acids. Res., 11:1475 (1983); Baeuerle,
P. A. and D. Baltimore, Cell, 53:211 (1988)) was adjusted to a
final concentration of 50 mM NaCl, 20 mM (HEPES) (pH 7.9), 1.5 mM
EDTA, 5% glycerol and 0.2% NP-40. Cytosolic protein (45 mg) was
mixed to a final volume of 4 ml with 0.6% DOC, 0.75 g calf thymus
(wet weight) DNA-cellulose [Sigma; equilibrated in buffer G: 10 mM
Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol
(DTT), 5% glycerol, 0.2% DOC, 0.2% NP-40, and 0.5 mM phenylmethyl
sulfonylfluoride (PMSF)] and 1.2% NP-40. The suspension was
incubated in a mini column for 1 hour at room temperature on a
rotary shaker. The flow-through fraction was used for gel
filtration. DNA-cellulose was washed with buffer G and eluted with
a NaCl step gradient in buffer G. Equal proportions of fractions
were assayed by EMSA (Sen, R. and D. Baltimore, Cell, 46:705
(1986); Baeuerle, P. A. and D. Baltimore, Cell, 53:211 (1988)) at a
final concentration of 1.2% NP-40 in the presence of either 0.03%
DOC (non dissociating condition) or 0.6% DOC (dissociating
condition) and with 10 .mu.g of bovine serum albumin (BSA) as
carrier. Results of this investigation are represented in FIG. 34
and described above.
Example 13
Characterization of IkB and its Complex with NF-.kappa.B
[0340] The flow-through fraction from the DNA-cellulose column
(1.55 mg of protein in 250 .mu.l described in Example 4) was
subjected to a G-200 Sephadex column (280 by 7 mm) with a flow rate
of 0.15 ml/min in buffer G at room temperature. A mix of size
markers (dextran blue; immunoglobulin G, 158 kDa, BSA, 67 kDa,
ovalbumin, 45 kDa, myoglobin, 17 kDa; Biorad) was run separately on
the column prior to sample runs. Markers were detected in fractions
by their color and using SDS-polyacrylamide gel electrophoresis
(SDS-PAGE) followed by Coomassie Blue staining.
[0341] To detect inhibiting activity, portions of fractions (5
.mu.l; in buffer G) were mixed with 1 .mu.l of nuclear extracts [in
buffer D(+)] and 0.5 .mu.l 10% NP-40. Dignam, J. P. et al., Nucl.
Acids Res., 11:1475 (1983). After 30 minutes at room temperature,
the reaction volume was brought to 20 .mu.l by the addition of a
DNA binding reaction mixture containing 3.2 .mu.g of poly(dI-dC)
(Pharmacia), 5 to 20 fmoles of .sup.32P-end labeled k enhancer
fragment, 75 mM NaCl, 15 mM Tris-HCl (pH 7.5), 1.5 mM EDTA, 1.5 mM
DTT, 7.5% glycerol, 0.3% NP-40 and 20 .mu.g BSA. After a 20-minute
DNA binding reaction, samples were analyzed by EMSA.
[0342] Gel filtration fractions containing IkB (25 .mu.g of
protein) were incubated for 1 hour at room temperature in buffer G
without any addition or with 2 .mu.g of TPCK-treated trypsin
(Sigma), 8 .mu.g of BPTI (Sigma), or with 2 .mu.g of trypsin that
had been incubated with 8 .mu.g of BPTI. Tryptic digestion was
stopped by a 10-minute incubation with 8 .mu.g of BPTI and samples
analyzed as described above.
[0343] Nuclear extract from TPA-stimulated .about.70Z/3 cells and
cytosol from untreated cells (both 220 .mu.g of protein) were
sedimented through 5 ml of a continuous 10 to 30% glycerol gradient
in buffer D(+) and 150,000 g (SW 50.1 rotor; Beckman) for 20 hours
at 4.degree. C. Cosedimented size markers were detected in
fractions by SDS-PAGE and Coomassie Blue staining. Portions of
glycerol gradient fractions (4 .mu.l) were analyzed by EMSA with 10
.mu.g of BSA as carrier and 0.5 .mu.g of poly(dI-dC). NF-kB
precursor was activated by treating 4 .mu.l of fractions with 1.5
.mu.l of formamide before the DNA binding reaction mixture was
added.
Example 14
Demonstration of the Presence of the NF-kB---IkB Complex in
Enucleated Cells
[0344] HeLa cells were grown in Eagle's Minimum Essential Medium
supplemented with 10% horse serum, penicillin (50 I.U./ml) and
streptomycin (50 .mu.g/ml) (referred to as MEM-medium) on discs
(1.8 cm in diameter) cut from cell culture plastic ware. For
enucleation, discs were placed upside down into centrifuge tubes
filled with 10 ml of MEM-medium of 37.degree. C. containing
cytochalasin B (10 .mu.g/ml) and held for the same time in the
incubator. To estimate the enucleation efficiency, enucleated cells
on one disc were fixed with formaldehyde (3.7%) in
phosphate-buffered saline (PBS) for 20 minutes, stained for 4
minutes with 4',6-diamidino-2-phenylindole (DAPI, 1 .mu.g/ml;
Sigma) in PBS, and washed in PBS. Fluorescence microscopy under UV
light and phase contrast microscopy were performed with a Zeiss
Photomicroscopes III. Control and enucleated cells were allowed to
recover in cytochalasin B-free MEM-medium for 30 minutes before a
2-hour incubation in the absence or presence of TPA (50 ng/ml).
Cells were then washed in ice-cold PBS, scraped off the discs in
100 .mu.l of a buffer containing 20 mM HEPES (pH 7.9), 0.35M NaCl,
20% glycerol, 1% NP-40, 1 mM MgCl.sub.2, 1mM DTT, 0.5 mM EDTA, 0.1
mM EGTA, 1% aprotinin (Sigma) and 1 mM PMSF. After lysis and
extraction for 10 minutes on ice, particulate material was removed
by centrifugation (Microfuge) for 15 minutes at 4.degree. C. and
the resulting supernatants were analyzed by EMSA.
Example 15
Demonstration of the Role of NF-.kappa.B as Mediator in Regulation
of a Gene in Non-Lymphoid Cells
[0345] The following demonstrates that NF-.kappa.B has the role of
mediator in cytokine gene regulation (in this case, positive
regulation of .beta.-IFN gene expression). NF-.kappa.B has been
shown to interact with a virus-inducible element (PRDII) in the
.beta.-IFN gene and to be highly induced by either virus infection
or treatment of cells with double-standard RNA.
A. Experimental Procedure
Cell Culture and Transfection
[0346] Mouse L929 fibroblasts were maintained in MEM medium (Gibco)
with 5% serum (Gibco). Jurkat (human T lymphocytes), Namalwa (human
Burkitt lymphoma), S194 (mouse myeloma), and 70Z/3 (mouse pre-B
lymphocyte) cells were grown in RPMI 1640 medium supplemented with
10% fetal calf serum (Life Science) and 50 .mu.M
.beta.-mercapto-ethanol. Sendai virus (SPAFAS) or poly(rI:rC)
(Pharmacia) inductions were either 6 hours in length for protein
extracts (Zinn et al., Cell, 34:865-879 (1983)) or 12 hours for
transfections. Phorbol myristate acetate (Sigma) and
phytohemagglutinin (PHA) induction was carried out as described by
Sen, R. and D. Baltimore (Cell, 47:921-928 (1986)).
[0347] Transient transfections of L929 cells were performed
according to Kuhl et al., Cell, 50:1057-1069 (1987); and for S194
cells, according to Pierce et al., Proc. Natl. Acad. Sci. USA,
85:1482-1486 (1988). A .beta.-galactosidse (.beta.-gal) expression
plasmid (Edlund et al., Science, 230:912-916 (1985)) was
co-transfected to monitor the transfection efficiency. CAT assays
were described by Gorman et al., Mol. Cell. Biol., 2:1044-1051
(1982), and the amount of protein assayed was normalized to a
constant amount of .beta.-gal activity. An et al., Mol. Cell.
Biol., 2:1628-1632 (1982).
Plasmid constructions
[0348] The plasmids p-41.beta.CAT (-41.beta.), p-41PII4r (-41
.beta.(P).sub.4), and p-41PII2r (-41 .beta.(P).sub.2) were
constructed as follows: in Fan, C. M. and T. Maniatis, EMBO J., in
press (1989). The nucleotide sequence of the PRDIIx2 (PRDII.sub.2)
is 5'-GATCTGTGGGAAATTCCGTGGGAAATTCCGGATC-3'. The construction of
.beta.56 (c-fosCAT), .DELTA.56(B).sub.2 (J16), and
.DELTA.56(B.sup.-) (J32) were described by Pierce et al., Proc.
Natl. Acad. Sci. USA, 85:1482-1486 (1988). The .kappa.B
oligonucleotides were: Wild-type:
5'-TCGACAGAGGGGACTTTCCGAGAGGCTCGA-3' and mutant:
5'-TCGACAGAATTCACTTTCCAGGAGGCTCGA-3'. The IRE was isolated as a
BglII-BamHI fragment (Goodbourn et al., Cell, 45:601-610 (1986))
and cloned into pSP73. Mutant PRDII sites were described in
Goodbourn, S. and T. Maniatis, Proc. Natl. Acad. Sci. USA,
85:1447-1451 (1988).
Preparation of Subcellular Protein Fractions and Mobility Shift
Electrophoresis
[0349] Buffers A, C and D are those described by Dignam et al.,
Nucl. Acids Res., 11:1475-1489 (1983). Frozen pellets containing
from 1.times.10.sup.6 to 1.times.10.sup.7 cells were thawed in the
presence of an equal volume of buffer A. The suspension was mixed
using 10 strokes of a Dounce homogenizer and the nuclei were
pelleted for 20 minutes at 40 in a microcentrifuge. The
supernatant, termed cytosol, was ultracentrifuged for 1 hour at
100,000.times.g and adjusted to 20% glycerol, 10 mM HEPES, pH 7.9,
1 mM EDTA, and 0.1 M KCl. The nuclei were extracted with 2 volumes
of the buffer C for 20 minutes and the nuclear extract was cleared
by centrifugation and dialyzed against buffer D. To minimize
proteolysis, all buffers included 0.5 mM PMSF, 0.3 .mu.g/ml
leupeptin, and 0.3 .mu.g/ml antipain and buffers A and C included
0.3 TIU/ml aprotinin, 0.5 mg/ml benzamidine, 0.1 .mu.g/ml
chymostatin, and 0.7 .mu.g/ml pepstatin.
[0350] Binding assays were carried out as described in Lenardo et
al., Science, 236:1573-1577 (1987) and Lenardo et al., Proc. Natl.
Acad. Sci. USA, 85:8825-8829 (1988). Assay samples of 20 .mu.l
contained nuclear extract incubated with 0.25 ng .sup.32P labeled
DNA fragment (5,000 CPM), 10 mM Tris:Cl, pH 7.5, 1 mM
dithiothreitol, 1 mM EDTA, 0.5 mM MgCl.sub.2, 3 mM GTP (omitted in
experiments varying amounts of added GTP), 2 .mu.g poly(dI-dC), and
5% glycerol for 20 minutes at room temperature. Cytosol was
activated in vitro using 0.8% sodium deoxycholate followed by
addition of the binding mixture including 0.75% NP-40. Methylation
interference assays were performed using the procedure of Gilman et
al., Mol. Cell. Biol., 6:4305-4316 (1986).
RNA Analysis
[0351] RNA preparation and Northern blot analysis were carried out
as previously described by Zinn et al., Cell, 34, 865-879
(1983).
B. Results
NF-.kappa.B Binds Specifically to PRDII
[0352] The protein encoded by the PRDI1-BF1 cDNA binds to the PRDII
site and to the H2-K.sup.b and B binding sites (FIG. 39, Singh et
al., Cell, 52:415-423 (1988); Fan and Maniatis, unpublished). Thus,
the ability of NF-.kappa.B to bind to PRDII and to the KB site was
compared, using an electrophoretic mobility shift assay. Fried, M.
and Crothers, D. M., Nucleic Acid Res., 9:6505-6525 (1981).
NF-.kappa.B is present in the human T lymphocytic line Jurkat in an
inactive form, but its binding is inducible by phorbol myristate
acetate (PMA) and phytohemagglutinin (PHA). Sen, R. and D.
Baltimore, Cell, 47:921-928 (1986); and Nabel, G. and D. Baltimore,
Nature, 326:711-713 (1987). The entire interferon gene regulatory
element (IRE) or an oligonucleotide comprised of two copies of the
PRDII sequences (PRDII.sub.2 or (P).sub.2) was used. A complex with
PMA/PHA-induced Jurkat nuclear extracts that migrated identically
to that formed with the .kappa.B site was detected. It was assumed
that the additional slower migrating complex observed with the
PRDII.sub.2 oligonucleotide corresponds to DNA molecules in which
both of the PRDII sites are bound to protein. Specific .kappa.B
complexes were undetectable in extracts from unstimulated Jurkat
cells.
[0353] To determine whether the same protein binds to PRDII and
.kappa.B, competition experiments were carried out. Increasing
amounts of unlabeled .kappa.B oligonucleotide inhibited complex
formation with either the IRE or the .kappa.B site. The ability of
PRDII and KB to compete for NF-.kappa.B binding was also
reciprocal; an unlabeled fragment prevented complex formation with
either labeled fragment. Quantitatively, both sites competed
equally for NF-.kappa.B. Furthermore, the IRE and the .kappa.B
sites both formed an identical complex using cytosol from
unstimulated Jurkat cells after treatment with the detergent
deoxycholate. This observation is in agreement with the finding
that NF-.kappa.B binding activity can be unmasked in cytosolic
extracts by deoxycholate. Baeuerle, P. and D. Baltimore, Cell,
53:211-217 (1988).
[0354] A number of single base mutations in PRDII decrease the
level of virus induction of the .kappa.-IFN gene. Goodbourn, S. and
T. Maniatis, Proc. Natl. Acad. Sci. USA, 85:1447-1451 (1988).
Therefore, these mutations were examined to assess whether they
also affect in vitro binding to NF-.kappa.B. Four point mutations
that impair inducibility of the .beta.-IFN gene were shown to
reduce binding of NF-.kappa.B. (64G.fwdarw.A, 62G.fwdarw.A,
60A.fwdarw.G and 56C.fwdarw.T). A single point mutation that has no
effect on inducibility allows specific NF-.kappa.B binding
(65T.fwdarw.C). Taken together, these results strongly suggest the
NF-.kappa.B plays a direct role in .beta.-IFN gene regulation.
The In Vivo Activities of PRDIII and the .kappa.B Site are
Indistinguishable
[0355] To determine whether the PRDII and .kappa.B sites function
similarly in vivo, we compared their transcriptional activities
were compared, using chloramphenicol acetyl-transferase gene (CAT)
reporter plasmids in virus-induced mouse L929 fibroblasts and in
S194 mouse myeloma cells. The structures of the reporter genes are
illustrated in FIG. 41B. The -41 .beta.-globin/CAT gene was not
expressed in L929 cells before or after induction by inactivated
Sendai virus or poly(rI:rC) (FIG. 41A, lanes 1-3). However, the
reporter gene linked to four copies of PRDII (-41P(P).sub.4) was
highly inducible (FIG. 41A, lanes 4-6). Remarkably, two
tandemly-repeated KB sites also conferred virus and poly(rI:rC)
inducibility on a c-fos promoter/CAT fusion gene in L929 cells
(FIG. 41A, compare lanes 7-9 to 10-12). Mutations in the KB site
that eliminated binding of NF-.kappa.B also abolished virus
inducibility. Thus, in L929 cells, the same inducible factor may
interact with PRDII and the .kappa.B site to stimulate
transcription.
[0356] The B-cell specific activities of PRDII and the .kappa.B
site were compared by transfecting the reporter enes into S194
mouse myeloma cells. As previously demonstrated, wild-type, but not
mutant, .kappa.B sites were highly active in mature B-cells which
constitutively express NF-.kappa.B (FIG. 40A, lanes 13-15; Pierce
et al., Proc. Natl. Acad. Sci. USA, 85:1482-1486 (1988)).
Significantly, multiple PRDII elements were also highly active in
S194 cells (lanes 16-18). These results further suggest that the
same factor, NF-.kappa.B, interacts productively with PRDII and the
.kappa.B site.
Virus Induction Stimulates NF-.kappa.B Binding in Lymphoid and
Non-Lymphoid Cells
[0357] The ability of PRDII to bind NF-kB suggested that virus
infection might activate NF-.kappa.B. Therefore, nuclear extracts
prepared from cells before and after virus induction were analyzed.
NF-.kappa.B binding activity was virus-inducible in Namalwa human
mature B lymphocytes, 70Z/3 murine pre-B lymphocytes, and murine
L929 fibroblasts. Virus induction of NF-.kappa.B in Namalwa cells
was unexpected because these cells display significant constitutive
NF-.kappa.B binding activity in the nucleus. Thus, only a fraction
of the NF-.kappa.B in Namalwa cells is in the active state, and the
remaining molecules can be activated by virus. Virus-induced
complexes in all three cell types appeared to contain NF-.kappa.B
because they could be eliminated by competition with wild-type (WT)
but not mutant (MUT) KB sites. Moreover, complex formation could be
stimulated by GTP, a biochemical property of NF-.kappa.B. Lenardo
et al., Proc. Natl. Acad. Sci. USA, 85:8825-8829 (1988). The
NF-.kappa.B complex was also induced by poly(rI:rC) in 70Z/3 cells,
but the effect was less dramatic.
[0358] Additional evidence that the virus-induced complexes contain
NF-.kappa.B was provided by comparisons of the methylation
interference patterns of the virus-induced complexes from Namalwa
and L929 cells with the PMA/PHA-induced complex in Jurkat cells.
All of the interference patterns were identical and exhibited the
close base contacts that are distinctive of the interaction between
NF-.kappa.B and its cognate binding site in the .kappa. enhancer.
Sen, R. and D. Baltimore, Cell, 46:705-716 (1986); and Baldwin, A.
S. and P. A. Sharp, Mol. Cell. Biol., 7:305-313 (1988). Finally,
the level of NF-.kappa.B revealed by deoxy-cholate in the cytosol
of L929 cells was diminished after virus induction. Therefore, like
phorbol ester treatment, virus infection apparently releases
NF-.kappa.B from an active cytosolic form and allows translocation
to the nucleus. Baeuerle, P. and D. Baltimore, Cell, 53:211-217
(1988).
Endogenous .beta.-IFN and Ig Kappa Gene Expression are Activated by
Virus in Pre-B Lymphocytes
[0359] As shown above, virus infection dramatically increased the
levels of nuclear NF-.kappa.B and induced reporter genes containing
PRDII or .kappa.B sites. Therefore, the ability of virus to induce
the transcription of an endogenous .kappa. gene was also assessed.
The pre-B cell line 70Z/3, which produces cytoplasmic Ig .mu. heavy
chains, but not light chains, was used for this purpose. Paige et
al., J. Immunol., 1-21:641--647 (1978). The .kappa. gene in 70Z/3
cells is functionally rearranged and can be transcriptionally
induced by lipopolysaccharide (LPS) and phorbol myristate acetate
(PMA), conditions which powerfully induce NF-.kappa.B. Nelson et
al., Nucl. Acids Res., 12: 1911-1923 (1984); Rosoff and Cantley, J.
Biol. Chem., 259:7056-7060 (1985); and Sen, R. and D. Baltimore,
Cell, 47:921-928 (1986). As expected, treatment of 70Z/3 cells with
phorbol esters or, more strikingly, with LPS resulted in the
activation of the endogenous .kappa. gene. Surprisingly, virus
infection also induced .kappa. gene expression to a level
comparable to that observed with PMA induction. Under the same
conditions, endogenous .beta.-IFN mRNA Was induced by virus, but
not by PMA or LPS. Thus, NF-.kappa.B is necessary and sufficient
for expression of the endogenous .kappa. gene in 70Z/3 cells, but
not for the .beta.-IFN gene. These results indicate the
virus-induced complex has all the in vitro binding properties and
in vivo transcriptional properties of NF-.kappa.B.
Equivalents
[0360] Those skilled in the art will recognize or be able to
ascertain, using no more than routine experimentation, many
equivalents of the specific embodiments of the invention described
therein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
59 1 12 DNA Homo sapiens 1 tggggattcc ca 12 2 11 DNA Mus musculus 2
ggggactttc c 11 3 11 DNA HIV 3 agggactttc c 11 4 10 DNA Homo
sapiens 4 ggggatttcc 10 5 10 DNA Homo sapiens 5 ggggatttcc 10 6 10
DNA CMV 6 gggactttcc 10 7 10 DNA Homo sapiens 7 gggacttccc 10 8 10
DNA Homo sapiens 8 gggatttcac 10 9 9 DNA Mus musculus 9 gggattcct 9
10 10 DNA Homo sapiens 10 gggaatctcc 10 11 10 DNA Homo sapiens 11
gggattcccc 10 12 10 DNA Artificial Sequence Consensus sequence 12
gggrntyync 10 13 24 DNA Artificial Sequence Synthetic binding site
13 aaatccccta aaacgaggga taaa 24 14 24 DNA Artificial Sequence
Oligonucleotide for pUCMHCI construction 14 gatccggctg gggattcccc
atct 24 15 24 DNA Artificial Sequence Oligonucleotide for pUCMHCI
construction 15 gatccggctg cggattccca atct 24 16 24 DNA Artificial
Sequence Oligonucleotide for pUCmhci construction 16 gccgacccct
aaggggtaga ctag 24 17 24 DNA Artificial Sequence Oligonucleotide
for pUCmhcI construction 17 gccgacgcct aagggttaga ctag 24 18 27 DNA
Artificial Sequence Oligonucleotide for Plasmid pBS-ATG
construction 18 tgcacaccat ggccatcgat atcgatc 27 19 10 DNA
Artificial Sequence Mutant showing slight competition for binding
of lysogen protein 19 tcatttccat 10 20 34 DNA Artificial Sequence
Nucleotide sequence of the PRDIIx2 20 gatctgtggg aaattccgtg
ggaaattccg gatc 34 21 30 DNA Artificial Sequence KB wild type
oligonucleotide 21 tcgacagagg ggactttccg agaggctcga 30 22 30 DNA
Artificial Sequence KB mutant oligonucleotide 22 tcgacagaat
tcactttcca ggaggctcga 30 23 31 DNA Homo sapiens 23 gcttcttaat
aatttgcata ccctcactgc a 31 24 24 DNA Homo sapiens 24 tcttaataat
ttgcataccc tcac 24 25 24 DNA Homo sapiens 25 cgcacatgat ttgcatactc
atga 24 26 24 DNA Homo sapiens 26 cctgggtaat ttgcatttct aaaa 24 27
75 DNA Homo sapiens 27 ctaactgctt cttaataatt tgcataccct cactgcatcg
ccttggggac ttctttatat 60 aacagtcaaa catat 75 28 22 DNA Homo sapiens
28 aattacccag gtggtgtttt gc 22 29 22 DNA Homo sapiens 29 agcagctcat
gtggcaaggc ta 22 30 30 DNA Artificial Sequence EBNA-1 Consensus
binding site 30 agattaggat agcatatgct acccagatat 30 31 13 DNA
Artificial Sequence DNA probe 31 tggggattcc cca 13 32 13 DNA
Artificial Sequence DNA probe 32 tgcggattcc caa 13 33 14 DNA
Artificial Sequence DNA probe 33 aggggacttt ccgg 14 34 12 DNA
Artificial Sequence DNA probe 34 aaatactttc cg 12 35 13 DNA
Artificial Sequence DNA probe 35 tggggacttt cca 13 36 13 DNA
Artificial Sequence DNA probe 36 tggggacttt cca 13 37 13 DNA
Artificial Sequence DNA probe 37 aagggacttt ccg 13 38 1717 DNA Homo
sapiens CDS (67)..(1464) 38 ctggggcccc cagagagggt ggggagatga
cacagttgtt cccccagccc tggcggggcg 60 ggcagc atg gtt cac tcc agc atg
ggg gct cca gaa ata aga atg tct 108 Met Val His Ser Ser Met Gly Ala
Pro Glu Ile Arg Met Ser 1 5 10 aag ccc ctg gag gcc gag aag caa ggt
ctg gac tcc cca tca gag cac 156 Lys Pro Leu Glu Ala Glu Lys Gln Gly
Leu Asp Ser Pro Ser Glu His 15 20 25 30 aca gac acc gaa aga aat gga
cca gac act aat cat cag aac ccc caa 204 Thr Asp Thr Glu Arg Asn Gly
Pro Asp Thr Asn His Gln Asn Pro Gln 35 40 45 aat aag acc tcc cca
ttc tcc gtg tcc cca act ggc ccc agt aca aag 252 Asn Lys Thr Ser Pro
Phe Ser Val Ser Pro Thr Gly Pro Ser Thr Lys 50 55 60 atc aag gct
gaa gac ccc agt ggc gat tca gcc cca gca gca ccc ctg 300 Ile Lys Ala
Glu Asp Pro Ser Gly Asp Ser Ala Pro Ala Ala Pro Leu 65 70 75 ccc
cct cag ccg gcc cag cct cat ctg ccc cag gcc caa ctc atg ttg 348 Pro
Pro Gln Pro Ala Gln Pro His Leu Pro Gln Ala Gln Leu Met Leu 80 85
90 acg ggc agc cag cta gct ggg gac ata cag cag ctc ctc cag ctc cag
396 Thr Gly Ser Gln Leu Ala Gly Asp Ile Gln Gln Leu Leu Gln Leu Gln
95 100 105 110 cag ctg gtg ctt gtg cca ggc cac cac ctc cag cca cct
gct cag ttc 444 Gln Leu Val Leu Val Pro Gly His His Leu Gln Pro Pro
Ala Gln Phe 115 120 125 ctg cta ccg cag gcc cag cag agc cag cca ggc
ctg cta ccg aca cca 492 Leu Leu Pro Gln Ala Gln Gln Ser Gln Pro Gly
Leu Leu Pro Thr Pro 130 135 140 aat cta ttc cag cta cct cag caa acc
cag gga gct ctt ctg acc tcc 540 Asn Leu Phe Gln Leu Pro Gln Gln Thr
Gln Gly Ala Leu Leu Thr Ser 145 150 155 cag ccc cgg gcc ggg ctt ccc
aca cag gcc gtg acc cgc cct acg ctg 588 Gln Pro Arg Ala Gly Leu Pro
Thr Gln Ala Val Thr Arg Pro Thr Leu 160 165 170 ccc gac ccg cac ctc
tcg cac ccg cag ccc ccc aaa tgc ttg gag cca 636 Pro Asp Pro His Leu
Ser His Pro Gln Pro Pro Lys Cys Leu Glu Pro 175 180 185 190 cca tcc
cac ccc gag gag ccc agt gat ctg gag gag ctg gag caa ttc 684 Pro Ser
His Pro Glu Glu Pro Ser Asp Leu Glu Glu Leu Glu Gln Phe 195 200 205
gcc cgc acc ttc aag caa cgc cgc atc aag ctg ggc ttc acg cag ggt 732
Ala Arg Thr Phe Lys Gln Arg Arg Ile Lys Leu Gly Phe Thr Gln Gly 210
215 220 gat gtg ggc ctg gcc atg ggc aag ctc tac ggc aac gac ttc agc
cag 780 Asp Val Gly Leu Ala Met Gly Lys Leu Tyr Gly Asn Asp Phe Ser
Gln 225 230 235 acg acc att tcc cgc ttc gag gcc ctc aac ctg agc ttc
aag aac atg 828 Thr Thr Ile Ser Arg Phe Glu Ala Leu Asn Leu Ser Phe
Lys Asn Met 240 245 250 tgc aaa ctc aag ccc ctc ctg gag aag tgg ctc
aac gat gca gag act 876 Cys Lys Leu Lys Pro Leu Leu Glu Lys Trp Leu
Asn Asp Ala Glu Thr 255 260 265 270 atg tct gtg gac tca agc ctg ccc
agc ccc aac cag ctg agc agc ccc 924 Met Ser Val Asp Ser Ser Leu Pro
Ser Pro Asn Gln Leu Ser Ser Pro 275 280 285 agc ctg ggt ttc gac ggc
ctg ccc ggc cgg aga cgc aag aag agg acc 972 Ser Leu Gly Phe Asp Gly
Leu Pro Gly Arg Arg Arg Lys Lys Arg Thr 290 295 300 agc atc gag aca
aac gtc cgc ttc gcc tta gag aag agt ttt cta gcg 1020 Ser Ile Glu
Thr Asn Val Arg Phe Ala Leu Glu Lys Ser Phe Leu Ala 305 310 315 aac
cag aag cct acc tca gag gag atc ctg ctg atc gcc gag cag ctg 1068
Asn Gln Lys Pro Thr Ser Glu Glu Ile Leu Leu Ile Ala Glu Gln Leu 320
325 330 cac atg gag aag gaa gtg atc cgc gtc tgg ttc tgc aac cgg cgc
cag 1116 His Met Glu Lys Glu Val Ile Arg Val Trp Phe Cys Asn Arg
Arg Gln 335 340 345 350 aag gag aaa cgc atc aac ccc tgc agt gcg gcc
ccc atg ctg ccc agc 1164 Lys Glu Lys Arg Ile Asn Pro Cys Ser Ala
Ala Pro Met Leu Pro Ser 355 360 365 cca ggg aag ccg gcc agc tac agc
ccc cat atg gtc aca ccc caa ggg 1212 Pro Gly Lys Pro Ala Ser Tyr
Ser Pro His Met Val Thr Pro Gln Gly 370 375 380 ggc gcg ggg acc tta
ccg ttg tcc caa gct tcc agc agt ctg agc aca 1260 Gly Ala Gly Thr
Leu Pro Leu Ser Gln Ala Ser Ser Ser Leu Ser Thr 385 390 395 aca gtt
act acc tta tcc tca gct gtg ggg acg ctc cac ccc agc cgg 1308 Thr
Val Thr Thr Leu Ser Ser Ala Val Gly Thr Leu His Pro Ser Arg 400 405
410 aca gct gga ggg ggt ggg ggc ggg ggc ggg gct gcg ccc ccc ctc aat
1356 Thr Ala Gly Gly Gly Gly Gly Gly Gly Gly Ala Ala Pro Pro Leu
Asn 415 420 425 430 tcc atc ccc tct gtc act ccc cca ccc ccg gcc acc
acc aac agc aca 1404 Ser Ile Pro Ser Val Thr Pro Pro Pro Pro Ala
Thr Thr Asn Ser Thr 435 440 445 aac ccc agc cct caa ggc agc cac tcg
gct atc ggc ttg tca ggc ctg 1452 Asn Pro Ser Pro Gln Gly Ser His
Ser Ala Ile Gly Leu Ser Gly Leu 450 455 460 aac ccc agc acg
gggtaagtgg gtgcacgtgg gaagctgtgg ggagaagcag 1504 Asn Pro Ser Thr
465 ggtcgctgct gcttctaggg tggggagcgg caccccagtt atgttggcag
gtccctgccc 1564 ctgctaatgc ctctgctttg cctcttgcag aagcacaatg
gtggggttga gctccggctg 1624 agtccagccc tcatgagcaa caaccctttg
gccactatcc aaggtgcgtg ctgcctcatg 1684 tcacacccat cgtcaccagc
cccggaattc gag 1717 39 466 PRT Homo sapiens 39 Met Val His Ser Ser
Met Gly Ala Pro Glu Ile Arg Met Ser Lys Pro 1 5 10 15 Leu Glu Ala
Glu Lys Gln Gly Leu Asp Ser Pro Ser Glu His Thr Asp 20 25 30 Thr
Glu Arg Asn Gly Pro Asp Thr Asn His Gln Asn Pro Gln Asn Lys 35 40
45 Thr Ser Pro Phe Ser Val Ser Pro Thr Gly Pro Ser Thr Lys Ile Lys
50 55 60 Ala Glu Asp Pro Ser Gly Asp Ser Ala Pro Ala Ala Pro Leu
Pro Pro 65 70 75 80 Gln Pro Ala Gln Pro His Leu Pro Gln Ala Gln Leu
Met Leu Thr Gly 85 90 95 Ser Gln Leu Ala Gly Asp Ile Gln Gln Leu
Leu Gln Leu Gln Gln Leu 100 105 110 Val Leu Val Pro Gly His His Leu
Gln Pro Pro Ala Gln Phe Leu Leu 115 120 125 Pro Gln Ala Gln Gln Ser
Gln Pro Gly Leu Leu Pro Thr Pro Asn Leu 130 135 140 Phe Gln Leu Pro
Gln Gln Thr Gln Gly Ala Leu Leu Thr Ser Gln Pro 145 150 155 160 Arg
Ala Gly Leu Pro Thr Gln Ala Val Thr Arg Pro Thr Leu Pro Asp 165 170
175 Pro His Leu Ser His Pro Gln Pro Pro Lys Cys Leu Glu Pro Pro Ser
180 185 190 His Pro Glu Glu Pro Ser Asp Leu Glu Glu Leu Glu Gln Phe
Ala Arg 195 200 205 Thr Phe Lys Gln Arg Arg Ile Lys Leu Gly Phe Thr
Gln Gly Asp Val 210 215 220 Gly Leu Ala Met Gly Lys Leu Tyr Gly Asn
Asp Phe Ser Gln Thr Thr 225 230 235 240 Ile Ser Arg Phe Glu Ala Leu
Asn Leu Ser Phe Lys Asn Met Cys Lys 245 250 255 Leu Lys Pro Leu Leu
Glu Lys Trp Leu Asn Asp Ala Glu Thr Met Ser 260 265 270 Val Asp Ser
Ser Leu Pro Ser Pro Asn Gln Leu Ser Ser Pro Ser Leu 275 280 285 Gly
Phe Asp Gly Leu Pro Gly Arg Arg Arg Lys Lys Arg Thr Ser Ile 290 295
300 Glu Thr Asn Val Arg Phe Ala Leu Glu Lys Ser Phe Leu Ala Asn Gln
305 310 315 320 Lys Pro Thr Ser Glu Glu Ile Leu Leu Ile Ala Glu Gln
Leu His Met 325 330 335 Glu Lys Glu Val Ile Arg Val Trp Phe Cys Asn
Arg Arg Gln Lys Glu 340 345 350 Lys Arg Ile Asn Pro Cys Ser Ala Ala
Pro Met Leu Pro Ser Pro Gly 355 360 365 Lys Pro Ala Ser Tyr Ser Pro
His Met Val Thr Pro Gln Gly Gly Ala 370 375 380 Gly Thr Leu Pro Leu
Ser Gln Ala Ser Ser Ser Leu Ser Thr Thr Val 385 390 395 400 Thr Thr
Leu Ser Ser Ala Val Gly Thr Leu His Pro Ser Arg Thr Ala 405 410 415
Gly Gly Gly Gly Gly Gly Gly Gly Ala Ala Pro Pro Leu Asn Ser Ile 420
425 430 Pro Ser Val Thr Pro Pro Pro Pro Ala Thr Thr Asn Ser Thr Asn
Pro 435 440 445 Ser Pro Gln Gly Ser His Ser Ala Ile Gly Leu Ser Gly
Leu Asn Pro 450 455 460 Ser Thr 465 40 277 PRT Homo sapiens 40 Cys
Gly Pro Gly His Gly Gln Ala Leu Arg Gln Arg Leu Gln Pro Asp 1 5 10
15 Asp His Phe Pro Leu Arg Gly Pro Gln Pro Glu Leu Gln Glu His Val
20 25 30 Gln Thr Gln Ala Pro Pro Gly Glu Val Ala Gln Arg Cys Arg
Asp Tyr 35 40 45 Val Cys Gly Leu Lys Pro Ala Gln Pro Gln Pro Ala
Glu Gln Pro Gln 50 55 60 Pro Gly Phe Arg Ala Cys Met Pro Glu Thr
Gln Glu Glu Asp Gln Met 65 70 75 80 Arg Asp Lys Lys Pro Leu Arg Leu
Arg Glu Glu Phe Ser Ser Glu Pro 85 90 95 Glu Ala Tyr Leu Arg Gly
Asp Pro Ala Asp Arg Arg Ala Ala Ala His 100 105 110 Gly Glu Gly Ser
Asp Pro Arg Leu Val Leu Gln Pro Ala Pro Glu Gly 115 120 125 Glu Thr
His Gln Pro Leu Gln Cys Gly Pro His Ala Ala Gln Pro Arg 130 135 140
Glu Ala Gly Gln Leu Gln Pro Pro Tyr Gly His Thr Pro Ala Gly Arg 145
150 155 160 Gly Asp Leu Thr Val Val Pro Ser Phe Gln Gln Ser Glu His
Asn Ser 165 170 175 Tyr Tyr Leu Ile Leu Ser Cys Gly Asp Ala Pro Pro
Gln Pro Asp Ser 180 185 190 Asn Met Gly Trp Gly Met Gly Arg Gly Cys
Ala Pro Pro Gln Phe His 195 200 205 Pro Leu Cys His Ser Pro Thr Pro
Gly His Asn Gln Gln His Lys Pro 210 215 220 Gln Pro Ser Arg Gln Pro
Leu Gly Tyr Met Leu Val Ala Pro Glu Pro 225 230 235 240 Gln Asn Gly
Val Ser Gly Cys Thr Trp Glu Ala Val Gly Arg Ser Arg 245 250 255 Val
Ala Ala Ala Ser Arg Val Gly Ser Gly Thr Pro Val Met Leu Ala 260 265
270 Gly Pro Cys Pro Cys 275 41 437 DNA Homo sapiens CDS (1)..(90)
41 cct caa ggc agc cac tcg gct atc ggc ttg tca ggc ctg aac ccc agc
48 Pro Gln Gly Ser His Ser Ala Ile Gly Leu Ser Gly Leu Asn Pro Ser
1 5 10 15 acg ggc cct ggc ctc tgg tgg aac cct gcc cct tac cag cct
90 Thr Gly Pro Gly Leu Trp Trp Asn Pro Ala Pro Tyr Gln Pro 20 25 30
tgatggcagc gggaatctgg tgctgggggc agccggtgca gccccgggga gccctggcct
150 ggtgacctcg ccgctcttct tgaatcatgc tgggctgccc ctgctcagca
ccccgcctgg 210 tgtgggcctg gtctcagcag cggctgcggg tgtggcagcc
tccatctcca gcaagtctcc 270 tggcctctcc tcctcatcct cttcatcctc
atcctcctcc tcctccactt gcagcgagac 330 ggcagcacag accctggagg
tccagggggg cccgaggcag ggtccaaacc tgagtgaggg 390 ccagccatgc
ctcccctccc attcctctgg tccctgcccc ggaattc 437 42 30 PRT Homo sapiens
42 Pro Gln Gly Ser His Ser Ala Ile Gly Leu Ser Gly Leu Asn Pro Ser
1 5 10 15 Thr Gly Pro Gly Leu Trp Trp Asn Pro Ala Pro Tyr Gln Pro
20 25 30 43 50 PRT Homo sapiens 43 Ser Ala Gln Pro Leu Gly Tyr Arg
Leu Val Met Pro Glu Pro Gln Met 1 5 10 15 Gly Pro Asn Pro Leu Val
Glu Pro Cys Pro Leu Pro Ala Leu Met Ala 20 25 30 Ala Gly Ile Trp
Cys Trp Gly Gln Pro Val Gln Pro Arg Gly Ala Leu 35 40 45 Ala Trp 50
44 62 PRT Homo sapiens 44 Arg Arg Lys Lys Arg Thr Ser Ile Glu Thr
Asn Val Arg Phe Ala Leu 1 5 10 15 Glu Lys Ser Phe Leu Ala Asn Gln
Lys Pro Thr Ser Glu Glu Ile Leu 20 25 30 Leu Ile Ala Glu Gln Leu
His Met Glu Lys Glu Val Ile Arg Val Trp 35 40 45 Phe Cys Asn Arg
Arg Gln Lys Glu Lys Arg Ile Asn Pro Cys 50 55 60 45 57 PRT Homo
sapiens 45 Ser Pro Lys Gly Lys Ser Ser Ile Ser Pro Gln Ala Arg Ala
Phe Leu 1 5 10 15 Glu Gln Val Phe Arg Arg Lys
Gln Ser Leu Asn Ser Lys Glu Lys Glu 20 25 30 Glu Val Ala Lys Lys
Cys Gly Ile Thr Pro Leu Gln Val Arg Val Trp 35 40 45 Phe Ile Asn
Lys Arg Met Arg Ser Lys 50 55 46 59 PRT Homo sapiens 46 Lys Pro Tyr
Arg Gly His Arg Phe Thr Lys Glu Asn Val Arg Ile Leu 1 5 10 15 Glu
Ser Trp Phe Ala Lys Asn Pro Tyr Leu Asp Thr Lys Gly Leu Glu 20 25
30 Asn Leu Met Asn Thr Ser Leu Ser Arg Ile Gln Ile Lys Asn Trp Val
35 40 45 Ser Asn Arg Arg Arg Lys Glu Lys Thr Ile Thr 50 55 47 60
PRT Homo sapiens 47 Gln Arg Pro Lys Arg Thr Arg Ala Lys Gly Glu Ala
Leu Asp Val Leu 1 5 10 15 Lys Arg Lys Phe Glu Ile Asn Pro Thr Pro
Ser Leu Val Glu Arg Lys 20 25 30 Lys Ile Ser Asp Leu Ile Gly Met
Pro Glu Lys Asn Val Arg Ile Trp 35 40 45 Phe Gln Asn Arg Arg Ser
Lys Glu Arg Arg Leu Lys 50 55 60 48 60 PRT Homo sapiens 48 Arg Arg
Gly Pro Arg Thr Thr Ile Lys Gln Asn Gln Leu Asp Val Leu 1 5 10 15
Asn Glu Met Phe Ser Asn Thr Pro Lys Pro Ser Lys His Ala Arg Ala 20
25 30 Lys Leu Ala Leu Glu Thr Gly Leu Ser Met Arg Val Ile Gln Val
Trp 35 40 45 Phe Gln Asn Arg Arg Ser Lys Glu Arg Arg Leu Lys 50 55
60 49 60 PRT Homo sapiens 49 Ser Lys Lys Gln Arg Val Leu Phe Ser
Glu Glu Gln Lys Glu Ala Leu 1 5 10 15 Arg Leu Ala Phe Ala Leu Asp
Pro Tyr Pro Asn Val Gly Thr Ile Glu 20 25 30 Phe Leu Ala Asn Glu
Leu Gly Leu Ala Thr Arg Thr Ile Thr Asn Trp 35 40 45 Phe His Asn
His Arg Met Arg Leu Lys Gln Gln Val 50 55 60 50 60 PRT Homo sapiens
50 Glu Lys Arg Pro Arg Thr Ala Phe Ser Ser Glu Gln Leu Ala Arg Leu
1 5 10 15 Lys Arg Glu Phe Asn Glu Asn Arg Tyr Leu Thr Glu Arg Arg
Arg Gln 20 25 30 Gln Leu Ser Ser Glu Leu Gly Leu Asn Glu Ala Gln
Ile Lys Ile Trp 35 40 45 Phe Gln Asn Lys Arg Ala Lys Ile Lys Lys
Ser Thr 50 55 60 51 60 PRT Homo sapiens 51 Arg Lys Arg Gly Arg Gln
Thr Tyr Thr Arg Tyr Gln Thr Leu Glu Leu 1 5 10 15 Glu Lys Glu Phe
His Phe Asn Arg Tyr Leu Thr Arg Arg Arg Arg Ile 20 25 30 Glu Ile
Ala His Ala Leu Cys Leu Thr Glu Arg Gln Ile Lys Ile Trp 35 40 45
Phe Gln Asn Arg Arg Met Lys Trp Lys Lys Glu Asn 50 55 60 52 21 DNA
Homo sapiens 52 cagaggggac tttccgagag g 21 53 34 DNA HIV 53
tacaagggac tttccgctgg ggactttcca ggga 34 54 41 DNA Homo sapiens 54
gagaagtgaa agtgggaaat tcctctgaat agagagagga c 41 55 11 DNA Homo
sapiens 55 ggggactttc c 11 56 11 DNA Homo sapiens 56 ggggattccc c
11 57 91 DNA Plasmid pBS-ATG 57 agggaacaaa agcttgcatg cctgcaccat
ggccatcgat atcgatcccc aattccggcc 60 cgccccggaa ttgggtaccg
agctcgaatt c 91 58 3067 DNA Homo sapiens CDS (1175)..(2239) 58
aacattgcaa ccttataaaa aattaactat ttcgacaatg ccgcagaagg aaattctgtg
60 tttaggtgct ggtgggaaaa cactatctcc agcttgtagg tttgagcatc
accagaacca 120 cttgatgaaa tcacacacag aacaagtaga ggaggcaact
gtgaatcgtg gggctataaa 180 gccatcaagg gatctgatga aagaacccgc
gagacgaacc cccccacccc ccacaacagg 240 atcggcaccc cagagttcaa
caagtggctg actttgttaa aacactacgt gggaacccat 300 agtcccggat
cagtagttgc acagccccct ccccgacaga ctacaccgct gtttgctgat 360
ccttgcccac cccatgctct cctcccaggc ccccgttctg ctcctctgtc ctgcggcgct
420 ggattgaacc gcacacaagt ctgcatctgg cacgaattct catgggagcc
acgtcatgag 480 gtacgtggtt gcacacctat cacaagaagt cttgcagttc
tgactctcct gagctcggtg 540 ggaaagtctg gatagtacct cccctctcct
gccacaaaag cagccctcac attcacaagt 600 ttccaaagca ggtctattga
gtttctcttc agagcgagcc tttgtcaaac acacctggag 660 gggggagtct
cacctctccc cagcaactca gatcagtgcc ttatttttaa tgctccggcc 720
caatcctgag gtgctgctgg gtttgtgggc tgcgttttgt tgaacctccc ccctcccctc
780 ccaacgccct ggcatttgca attaaaactg ggattcaagg gccaaattca
agcccagagt 840 gagcagtagg atgtggagct caaagcagag ttgcacctgc
tgacccccag cctgaatttg 900 gttcacccag agactacaag tcagaaaggc
atgtttagaa agaggcatgc taaggactga 960 tggtggaacg gccaatttgt
ccccaccagc acagtgggga aggctggaca gagaaggaag 1020 agaaggatcc
atagagatgt gaaccagaat cagtcgtgtt gagctctggg tatatcacta 1080
catgtttaac tcttgcaaga ccgtttgccc agggctttgg taccacaggg ttagagttac
1140 attaaccaca accaccagag aggaactgag gttt atg acc ccc ccc ccc cca
aag 1195 Met Thr Pro Pro Pro Pro Lys 1 5 gtt aga ttt ctg ccg agt
ata aag ggg ggg gaa ggg ggg ggt cct tgg 1243 Val Arg Phe Leu Pro
Ser Ile Lys Gly Gly Glu Gly Gly Gly Pro Trp 10 15 20 ttc att tcc
ctt cac tgt gtg acc gaa gtt ttg ctt tta ttt gta aac 1291 Phe Ile
Ser Leu His Cys Val Thr Glu Val Leu Leu Leu Phe Val Asn 25 30 35
atc ttg aat tac ccg tcg ttt tcc agt ctt cat cgt gct gtt gtc agg
1339 Ile Leu Asn Tyr Pro Ser Phe Ser Ser Leu His Arg Ala Val Val
Arg 40 45 50 55 cca ctg gag gga att ccc cgt ctc gga acg ccg ccg cca
gca cca gca 1387 Pro Leu Glu Gly Ile Pro Arg Leu Gly Thr Pro Pro
Pro Ala Pro Ala 60 65 70 gcc gcg ccg cgc cgc ccc gcc agc tcc gcc
gcc atg ctc agc gcc cac 1435 Ala Ala Pro Arg Arg Pro Ala Ser Ser
Ala Ala Met Leu Ser Ala His 75 80 85 cgc ccc gcc gag ccg ccc gcc
gtg gag ggc tgc gag ccg ccg cgc aag 1483 Arg Pro Ala Glu Pro Pro
Ala Val Glu Gly Cys Glu Pro Pro Arg Lys 90 95 100 gaa cgg caa ggc
ggg ctg ctg ccg ccc gac gac cgc cac gac agc ggg 1531 Glu Arg Gln
Gly Gly Leu Leu Pro Pro Asp Asp Arg His Asp Ser Gly 105 110 115 ctg
gac tcc atg aag gag gag gag tac agg cag ctg gtg cgg gag ctg 1579
Leu Asp Ser Met Lys Glu Glu Glu Tyr Arg Gln Leu Val Arg Glu Leu 120
125 130 135 gag gac atc cgc ctg cag ccc cgc gag ccg ccc gcc cgg ccg
cac gcc 1627 Glu Asp Ile Arg Leu Gln Pro Arg Glu Pro Pro Ala Arg
Pro His Ala 140 145 150 tgg gcc cag cag ctc acc gag gac ggc gac act
ttt ctc cac ttg gcg 1675 Trp Ala Gln Gln Leu Thr Glu Asp Gly Asp
Thr Phe Leu His Leu Ala 155 160 165 atc att cac gag gaa aag gcc ctg
agc ctg gag gtg atc cgg cag gcc 1723 Ile Ile His Glu Glu Lys Ala
Leu Ser Leu Glu Val Ile Arg Gln Ala 170 175 180 gct ggg gac gcc gcc
ttc ctg aac ttc cag aac aac ctc agc cag act 1771 Ala Gly Asp Ala
Ala Phe Leu Asn Phe Gln Asn Asn Leu Ser Gln Thr 185 190 195 ccg ctc
cac ctg gcg gtg atc acg gac cag gcc gaa atc gcc gag cac 1819 Pro
Leu His Leu Ala Val Ile Thr Asp Gln Ala Glu Ile Ala Glu His 200 205
210 215 ctg ctg aag gct ggc tgc gac ctg gat gtc agg gac ttc cgt ggg
aac 1867 Leu Leu Lys Ala Gly Cys Asp Leu Asp Val Arg Asp Phe Arg
Gly Asn 220 225 230 acc ccg ctc cac atc gcc tgc cag cag ggc tcg ctc
cgc agc gtc agt 1915 Thr Pro Leu His Ile Ala Cys Gln Gln Gly Ser
Leu Arg Ser Val Ser 235 240 245 gtc ctc acg cag cac tgc cag ccc cac
cac ctc ctc gcc gtc ctg cag 1963 Val Leu Thr Gln His Cys Gln Pro
His His Leu Leu Ala Val Leu Gln 250 255 260 gcc acc aac tac aac ggc
cat aca tgt ctc cat ttg gca tct att caa 2011 Ala Thr Asn Tyr Asn
Gly His Thr Cys Leu His Leu Ala Ser Ile Gln 265 270 275 gga tac ctg
gct gtt gtc gaa tac ctg ctg tcc tta gga gca gat gta 2059 Gly Tyr
Leu Ala Val Val Glu Tyr Leu Leu Ser Leu Gly Ala Asp Val 280 285 290
295 aat gct cag gag cca tgc aat ggg aga aca gca cta cac ttg gcc gta
2107 Asn Ala Gln Glu Pro Cys Asn Gly Arg Thr Ala Leu His Leu Ala
Val 300 305 310 gac ctt cag aac tca gac ctg gtg tca ctt ctg gtg aaa
cac ggg cca 2155 Asp Leu Gln Asn Ser Asp Leu Val Ser Leu Leu Val
Lys His Gly Pro 315 320 325 gat gtg aac aaa gtg acc tac cag ggc tac
tcc cca tac cag ctt aca 2203 Asp Val Asn Lys Val Thr Tyr Gln Gly
Tyr Ser Pro Tyr Gln Leu Thr 330 335 340 tgg gca gag aca acg cca gca
tac agg agc agc tga agctgctgac 2249 Trp Ala Glu Thr Thr Pro Ala Tyr
Arg Ser Ser 345 350 cacagctgac ctgcagatac tgcccgaaag tgaggatgag
gagagcagtg aatcagagcc 2309 agagttcaca gaggatgaac ttatgtatga
tgactgctgt attggaggaa gacagctgac 2369 attttaaagc agaggtttct
gtgagaagtg actgtgtaca tatgtatagg aaaaaaagcc 2429 tgactttctt
catttaaaaa gaaagtctat actcgaagga gaaaaaagta ctgagatact 2489
acactgccca gccaggagca catcatccta acaggttcca tgctctgacc tgtacttaag
2549 taacgggatg ggatgtgtaa catcgttaag agatcagtga acatgcacac
catctgataa 2609 agagccacgt tatctaattt ctctgccaca tgaggataac
ggactgcacg tccaatgtgc 2669 tgttgtcaga aatgcgtttg agagctgcct
tgtgacacta agtgctgtga ggagtgctca 2729 tccccctcgg tggcaagaca
ggcttgcaca aacgtcccat ctgcttgaag actgtgaggt 2789 tggcattagg
ttgaggcact gctgtgccct gctccctgac cctggctgct cagggttgag 2849
gagtccgacc atgggagagg tgacctggct gctgggagga aggtagcaat gatgttaact
2909 gtgggcattt ggaaactgtg tgtttcacac catgtgtgtc ataattgcta
cactttttag 2969 caactgtata gaatgtaaat actgtacatc tttgtttata
attattttgg tacctgtgag 3029 atatgtattt attaaaaaag gcagatttct
gtaaaaaa 3067 59 354 PRT Homo sapiens 59 Met Thr Pro Pro Pro Pro
Lys Val Arg Phe Leu Pro Ser Ile Lys Gly 1 5 10 15 Gly Glu Gly Gly
Gly Pro Trp Phe Ile Ser Leu His Cys Val Thr Glu 20 25 30 Val Leu
Leu Leu Phe Val Asn Ile Leu Asn Tyr Pro Ser Phe Ser Ser 35 40 45
Leu His Arg Ala Val Val Arg Pro Leu Glu Gly Ile Pro Arg Leu Gly 50
55 60 Thr Pro Pro Pro Ala Pro Ala Ala Ala Pro Arg Arg Pro Ala Ser
Ser 65 70 75 80 Ala Ala Met Leu Ser Ala His Arg Pro Ala Glu Pro Pro
Ala Val Glu 85 90 95 Gly Cys Glu Pro Pro Arg Lys Glu Arg Gln Gly
Gly Leu Leu Pro Pro 100 105 110 Asp Asp Arg His Asp Ser Gly Leu Asp
Ser Met Lys Glu Glu Glu Tyr 115 120 125 Arg Gln Leu Val Arg Glu Leu
Glu Asp Ile Arg Leu Gln Pro Arg Glu 130 135 140 Pro Pro Ala Arg Pro
His Ala Trp Ala Gln Gln Leu Thr Glu Asp Gly 145 150 155 160 Asp Thr
Phe Leu His Leu Ala Ile Ile His Glu Glu Lys Ala Leu Ser 165 170 175
Leu Glu Val Ile Arg Gln Ala Ala Gly Asp Ala Ala Phe Leu Asn Phe 180
185 190 Gln Asn Asn Leu Ser Gln Thr Pro Leu His Leu Ala Val Ile Thr
Asp 195 200 205 Gln Ala Glu Ile Ala Glu His Leu Leu Lys Ala Gly Cys
Asp Leu Asp 210 215 220 Val Arg Asp Phe Arg Gly Asn Thr Pro Leu His
Ile Ala Cys Gln Gln 225 230 235 240 Gly Ser Leu Arg Ser Val Ser Val
Leu Thr Gln His Cys Gln Pro His 245 250 255 His Leu Leu Ala Val Leu
Gln Ala Thr Asn Tyr Asn Gly His Thr Cys 260 265 270 Leu His Leu Ala
Ser Ile Gln Gly Tyr Leu Ala Val Val Glu Tyr Leu 275 280 285 Leu Ser
Leu Gly Ala Asp Val Asn Ala Gln Glu Pro Cys Asn Gly Arg 290 295 300
Thr Ala Leu His Leu Ala Val Asp Leu Gln Asn Ser Asp Leu Val Ser 305
310 315 320 Leu Leu Val Lys His Gly Pro Asp Val Asn Lys Val Thr Tyr
Gln Gly 325 330 335 Tyr Ser Pro Tyr Gln Leu Thr Trp Ala Glu Thr Thr
Pro Ala Tyr Arg 340 345 350 Ser Ser
* * * * *