U.S. patent application number 11/226795 was filed with the patent office on 2006-03-23 for host-vector system for antibiotic-free coie1 plasmid propagation.
This patent application is currently assigned to Boehringer Ingelheim Austria GmbH. Invention is credited to Reingard Grabherr, Irene Pfaffenzeller.
Application Number | 20060063232 11/226795 |
Document ID | / |
Family ID | 34926585 |
Filed Date | 2006-03-23 |
United States Patent
Application |
20060063232 |
Kind Code |
A1 |
Grabherr; Reingard ; et
al. |
March 23, 2006 |
Host-vector system for antibiotic-free CoIE1 plasmid
propagation
Abstract
A host-vector system that uses the RNA-based copy number control
mechanism of ColE1-type plasmids for regulating the expression of a
marker gene allows for antibiotic-free selection of plasmids and is
useful for production of plasmid DNA and recombinant proteins.
Inventors: |
Grabherr; Reingard;
(Pressbaum, AT) ; Pfaffenzeller; Irene; (Vienna,
AT) |
Correspondence
Address: |
MICHAEL P. MORRIS;BOEHRINGER INGELHEIM CORPORATION
900 RIDGEBURY RD
P. O. BOX 368
RIDGEFIELD
CT
06877-0368
US
|
Assignee: |
Boehringer Ingelheim Austria
GmbH
Wien
AT
A-1121
|
Family ID: |
34926585 |
Appl. No.: |
11/226795 |
Filed: |
September 14, 2005 |
Current U.S.
Class: |
435/69.1 ;
435/252.33; 435/488 |
Current CPC
Class: |
C12N 15/70 20130101 |
Class at
Publication: |
435/069.1 ;
435/252.33; 435/488 |
International
Class: |
C12P 21/06 20060101
C12P021/06; C12N 15/74 20060101 C12N015/74; C12N 1/21 20060101
C12N001/21 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 17, 2004 |
EP |
04 022 201 |
Claims
1. A non-naturally occurring bacterial cell containing i) a DNA
sequence encoding a protein the expression of which is to be
regulated, and, operably associated thereto, ii) a DNA sequence
encoding an RNA sequence that mimics an RNA II sequence, or parts
thereof, and that is complementary to an RNA I sequence that is
transcribable from a plasmid with a ColE1 origin of
replication.
2. The bacterial cell of claim 1 containing said DNA sequences i)
and ii) integrated in its genome.
3. The bacterial cell of claim 1 or 2, wherein said DNA sequence i)
is a DNA sequence that is foreign to said cell.
4. The bacterial cell of claim 3, wherein said foreign DNA sequence
i) encodes a protein that is lethal or toxic to said cell.
5. The bacterial cell of claim 4, wherein said foreign DNA sequence
i) is under the control of an inducible promoter.
6. The bacterial cell of claim 4, wherein said foreign DNA sequence
i) encodes a protein that is lethal or toxic to said cell per se or
by generating a toxic substance.
7. The bacterial cell of claim 4, wherein said foreign DNA sequence
i) encodes a repressor protein that is lethal or toxic to said
bacterial cell by repressing the transcription of a gene that is
essential for growth of said cell.
8. The bacterial cell of claim 7, wherein said essential gene is
operably linked to a promoter which contains a DNA sequence that
specifically bound by said repressor protein.
9. The bacterial cell of claim 8, wherein said promoter linked to
said essential gene is inducible.
10. The bacterial cell of claim 9, wherein said inducible promoter
is inducible independent of the inducible promoter of claim 5.
11. The bacterial cell of claim 1, wherein said DNA sequence ii) is
inserted between the ribosomal binding site and the start codon of
said DNA sequence i).
12. The bacterial cell of claim 1, wherein said DNA sequence i) and
said DNA sequence ii) are linked such that they encode a fusion
protein.
13. The bacterial cell of claim 1, wherein said DNA sequence i) and
said DNA sequence ii) are translationally coupled.
14. The bacterial cell of claim 1 that has the ability to replicate
a plasmid with a ColE1 origin of replication.
15. The bacterial cell of claim 14, wherein said cell is an
Escherichia coli cell.
16. A host-vector system comprising a) a plasmid with a ColE1
origin of replication; b) a bacterial host cell in which said
plasmid a) can be replicated, containing i) a DNA sequence encoding
a protein the expression of which is to be regulated, and, operably
associated thereto, ii) a DNA sequence encoding an RNA sequence
that mimics an RNA II sequence, or parts thereof, and that is
complementary to an RNA I sequence transcribable from the plasmid
a), wherein said RNA sequence defined in ii), in the absence of the
plasmid a), allows for expression of said protein and wherein, when
said plasmid a) is present inside said host cell, the RNA I
molecule transcribed from the plasmid hybridizes with said RNA
sequence defined in ii), whereby expression of said protein is
suppressed.
17. The host-vector system of claim 16, wherein said bacterial host
cell contains DNA sequences i) and ii) integrated into its
genome.
18. The host-vector system of claim 16, wherein said DNA sequence
i) encodes a protein that is lethal or toxic to said bacterial cell
and wherein said RNA sequence defined in ii), in the absence of the
plasmid a), allows for expression of said lethal or toxic protein
such that growth of said host cell is completely or partially
inhibited and wherein, when said plasmid a) is present inside said
host cell, the RNA I molecule transcribed from the plasmid
hybridizes with said RNA sequence defined in ii), whereby
expression of said lethal or toxic protein is suppressed such that
said complete or partial growth inhibition is abrogated in
plasmid-bearing cells.
19. The host-vector system of claim 16, wherein said plasmid a)
additionally contains a gene of interest.
20. A method for producing plasmid DNA, comprising the steps of i)
transforming a population of bacterial host cells of claim 4 with a
plasmid that has a ColE1 origin of replication and contains a gene
of interest that is not to be expressed from said plasmid in said
bacterial host cell, ii) growing said bacterial host cell
population under conditions in which said lethal or toxic protein
is expressible in the cells, whereby expression of said protein
completely or partially inhibits growth of plasmid-free cells such
that the plasmid-bearing cells outgrow the plasmid-free cells, iii)
harvesting plasmid-bearing cells, and iv) isolating and purifying
the plasmid DNA.
21. A method for producing a protein of interest, comprising the
steps of i) transforming a population of bacterial host cells of
claim 4 with a plasmid that has a ColE1 origin of replication and
contains a DNA sequence encoding a protein of interest under the
control of a prokaryotic promoter that enables expression of said
protein in said bacterial host cells, ii) growing said bacterial
host cell population under conditions in which said lethal or toxic
protein is expressible in the cells, whereby expression of said
protein completely or partially inhibits growth of plasmid-free
cells such that the plasmid-bearing cells outgrow the plasmid-free
cells, iii) harvesting the protein of interest, and iv) isolating
and purifying it.
Description
RELATED APPLICATIONS
[0001] This application claims priority from EP 04 022201 filed
Sep. 17, 2004.
[0002] The present invention relates to the field of plasmid
propagation, in particular for production of plasmid DNA and
recombinant proteins. In addition, the sequence listing submitted
herewith is incorporated herein by reference in its entirety.
BACKGROUND AND DESCRIPTION OF THE INVENTION
[0003] The use of plasmid DNA as gene transfer vehicle has become
widespread in gene therapy. In gene therapy applications, a plasmid
carrying a therapeutic gene of interest is introduced into
patients; transient expression of the gene in the target cells
leads to the desired therapeutic effect.
[0004] Recombinant plasmids carrying the therapeutic gene of
interest are obtained by cultivation of bacteria. For selecting
bacterial transformants and in order to assure maintenance of the
plasmids in the bacterial host cell, traditionally, an antibiotic
resistance gene is included in the plasmid backbone. Selection for
plasmids is achieved by growing the cells in a medium containing
the respective antibiotic, in which only plasmid bearing cells are
able to grow.
[0005] The use of antibiotic resistance genes for selection of
plasmids for application in gene therapy is accompanied by severe
drawbacks:
[0006] Since in gene therapy entire plasmids are being delivered,
antibiotic resistance genes are introduced into the treated
subject. Although these genes are driven by prokaryotic promoters
and are should therefore not be active in mammalian cells and
tissues, there is the chance that the delivered genes may be
incorporated into the cellular genome and may, if in proximity of a
mammalian promoter, become transcribed and expressed.
[0007] A second drawback of plasmids that bear antibiotic
resistance genes is a potential contamination of the final product
with residual antibiotic. In view of possible immune sensitization,
this is an issue, especially in the case of beta-lactam
antibiotics.
[0008] In order to avoid these risks, efforts have been made to ban
antibiotic resistance genes from the manufacture of therapeutic
plasmids and to develop alternative selection methods.
[0009] In an attempt to achieve antibiotic-free selection, plasmids
have been used that can compensate a host auxotrophy. However, the
main disadvantage of this and all related approaches is that
additional genes on the plasmid are required (e.g. Hagg et al.,
2004).
[0010] Another approach is a concept termed "repressor titration"
(Wiliams et al., 1998). According to this concept, a modified E.
coli host strain contains the kan gene (kanamycin resistance gene)
under the control of the lac operator/promoter. In the absence of
an inducer (IPTG or allolactose), the strain cannot grow on
kanamycin-containing medium. Transformation with a high copy number
plasmid containing the lac operator leads to kan expression by
titrating lacI from the operator. Only cells that contain a high
plasmid copy number are able to survive after addition of
kanamycin. The major drawback of this concept is the fact that,
again, the use of antibiotics is indispensable.
[0011] It has been an object of the invention to provide a novel
system for selection of plasmids that goes without antibiotics.
[0012] To solve the problem underlying the invention, the mechanism
of replication that is used by plasmids with a ColE1 origin of
replication has been exploited. (In the following, plasmids with a
ColE1 origin of replication are referred to as "ColE1-type
plasmids".)
[0013] A large number of naturally occurring plasmids as well as
many of the most commonly used cloning vehicles are ColE1-type
plasmids. These plasmids replicate their DNA by using a common
mechanism that involves synthesis of two RNA molecules, interaction
of these molecules with each other on the one hand and with the
template plasmid DNA on the other hand (Helinski, 1996; Kues and
Stahl, 1989).
[0014] Representatives of ColE1-type plasmids are the naturally
occurring ColE1 plasmids pMB1, p15A, pJHCMW1, as well as the
commonly used and commercially available cloning vehicles such as
pBR322 and related vectors, the pUC plasmids, the pET plasmids and
the pBluescript vectors (e.g. Bhagwat and Person, 1981; Balbas et
al., 1988; Bolivar, 1979; Vieira and Messing, 1982).
[0015] For all these plasmids, ColE1 initiation of replication and
regulation of replication have been extensively described (e.g.:
Tomizawa, 1981, 1984, 1986, 1989, 1990; Chan et al., 1985; Eguchi
et al., 1991a; Cesareni et al., 1991). The ColE1 region contains
two promoters for two RNAs that are involved in regulation of
replication. Replication from a ColE1-type plasmid starts with the
transcription of the preprimer RNA II, 555 bp upstream of the
replication origin, by the host's RNA polymerase. During
elongation, RNA II folds into specific hairpin structures and,
after polymerization of about 550 nucleotides, begins to form a
hybrid with the template DNA. Subsequently, the RNA II preprimer is
cleaved by RNaseH to form the active primer with a free 3' OH
terminus, which is accessible for DNA polymerase I (Lin-Chao and
Cohen, 1991; Merlin and Polisky, 1995).
[0016] At the opposite side of the ColE1-type origin strand, RNA I,
an antisense RNA of 108 nucleotides, complementary to the 5' end of
RNA II, is transcribed. Transcription of RNA I starts 445 bp
upstream from the replication origin, to approximately where the
transcription of RNA II starts. RNA I inhibits primer formation and
thus replication by binding to the elongating RNA II molecule
before the RNA/DNA hybrid is formed.
[0017] The interaction of the two RNAs is a stepwise process, in
which RNA I and RNA II form several stem loops. They initially
interact by base-pairing between their complementary loops to form
a so-called "kissing complex". Subsequently, RNA I hybridizes along
RNA II, and a stable duplex is formed. Formation of the kissing
complex is crucial for inhibition of replication. As it is the rate
limiting step, is has been closely investigated (Gregorian and
Crothers, 1995).
[0018] Apart from RNA I/RNA II interaction, the rom/rop transcript
of ColE1 contributes to plasmid copy number control by increasing
the rate of complex formation between RNA II and RNA I. To increase
copy number, the gene encoding rom/rop has been deleted on some
derivatives of pBR322, for example on pUC19.
[0019] The present invention relates, in a first aspect to a
non-naturally occurring bacterial cell containing, [0020] i) a DNA
sequence encoding a protein, the expression of which is to be
regulated, and, operably associated thereto, [0021] ii) a DNA
sequence encoding a RNA sequence that mimics a RNA II sequence, or
parts thereof, and is complementary to a RNA I sequence that is
transcribable from a plasmid with a ColE1 origin of
replication.
[0022] In a further aspect, the present invention relates to a
host-vector system comprising a plasmid with a ColE1 origin of
replication and a bacterial host cell in which said plasmid can be
replicated, wherein said host-vector system comprises
[0023] a) a plasmid with a ColE1 origin of replication
[0024] b) a bacterial host cell in which said plasmid can be
replicated, containing, [0025] i) a DNA sequence encoding a
protein, the expression of which is to be regulated, and, operably
associated thereto, [0026] ii) a DNA sequence encoding an RNA
sequence that mimics an RNA H sequence, or parts thereof, and is
complementary to an RNA I sequence that is transcribable from the
plasmid a),
[0027] wherein said RNA sequence defined in ii), in the absence of
the plasmid a), allows for expression of said protein and
[0028] wherein, when said plasmid a) is present inside said host
cell b), the RNA I molecule transcribed from the plasmid hybridizes
with said RNA sequence defined in ii), whereby expression of said
protein is suppressed.
[0029] In a preferred embodiment, the DNA sequence i) is a foreign
DNA sequence.
[0030] In preferred embodiments, the protein encoded by said
foreign DNA i) is toxic or lethal to the host cell.
[0031] In a further aspect, the present invention relates to a
host-vector system comprising a plasmid with a ColE1 origin of
replication and a bacterial host cell in which said plasmid can be
replicated, wherein said host-vector system comprises
[0032] a) a plasmid with a ColE1 origin of replication,
[0033] b) a non-naturally occurring bacterial host cell containing,
integrated in its genome, [0034] i) a foreign DNA sequence encoding
a protein that is lethal or toxic to said host cell, and operably
associated thereto [0035] ii) a DNA sequence encoding an RNA
sequence that mimics an RNA II sequence, or parts thereof, and is
complementary to an RNA I sequence transcribable from the plasmid
a),
[0036] wherein said RNA sequence defined in ii), in the absence of
the plasmid a), allows for expression of said lethal or toxic
protein such that growth of said host cell is completely or
partially inhibited and
[0037] wherein, when said plasmid a) is present inside said host
cell, the RNA I molecule transcribed from the plasmid hybridizes
with said RNA sequence defined in ii), whereby expression of said
lethal or toxic protein is suppressed such that said complete or
partial growth inhibition is abrogated in plasmid-bearing
cells.
[0038] The invention makes use of the RNA-based copy number control
mechanism of ColE1-type plasmids for regulating the expression of
one or more genes that are present in the bacterial host cell,
preferably inserted in the bacterial genome, and serve as selection
markers.
[0039] In the following, the DNA sequence of i) (or the RNA
transcribed from such DNA, respectively) is referred to as "marker
gene" (or "marker RNA", respectively).
[0040] As mentioned above, in an embodiment of the invention, the
marker gene encodes a protein that is lethal or toxic per se. In
this embodiment, in the meaning of the present invention, the term
"marker gene" also encompasses genes the expression of which
results in a toxic effect that is not directly due to the
expression product, but is based on other mechanisms, e.g.
generation of a toxic substance upon expression of the marker gene.
For simplicity, in the following, the protein encoded by the marker
gene is termed the "marker protein"; in the case that the marker
protein is a lethal or toxic protein, it is referred to as "toxic
protein".
[0041] In a preferred embodiment, the marker protein is not lethal
or toxic per se or due to a toxic effect generated upon its
expression, but by repressing the transcription of a gene that is
essential for growth of said bacterial cell. Such marker protein,
or the DNA encoding it, respectively, is referred to as "repressor"
or "repressor gene", respectively, and the gene that is essential
for growth of the bacterial cells is referred to as "essential
gene".
[0042] In the following, an RNA sequence that mimics an RNA II
sequence, or parts thereof, is referred to as "RNA II-like
sequence".
[0043] In the meaning of the present invention "operably
associated" means that the DNA sequence i) and the DNA sequence ii)
are positioned relative to each other in such a way that expression
of the marker protein encoded by said DNA sequence i) is modulated
by said RNA sequence ii) (the RNA II-like sequence).
[0044] The principle of the invention, i.e. RNA I-mediated marker
gene down-regulation or silencing, is shown in FIG. 1:
[0045] The RNA II-like sequence is present on the host's transcript
in combination with a Shine Dalgarno sequence. The RNA I sequence
transcribed from the plasmid functions as an antisense RNA to said
RNA II-like sequence and thus inhibits translation of the marker
mRNA.
[0046] After induction of marker gene expression, in the case that
the marker gene encodes a toxic protein, the host can only survive
in the presence of the plasmid, because the plasmid provides the
RNA I sequence that is complementary to the RNA II-like sequence
and therefore hybridizes to the marker gene transcript, thus
preventing the translation of the toxic protein. As described,
regulation of the system is based on RNA-RNA interaction between
the RNA I of the plasmid and, complementary thereto, an RNA II-like
sequence of defined length that is positioned upstream or
downstream the ribosomal binding site of the marker gene sequence,
usually within the host's mRNA.
[0047] The length of the RNA II-like sequence and its distance and
position relative to the ribosomal binding site and to the start
codon of the marker gene must be such that the plasmid-free host is
able to translate the mRNA; which means that care must be taken
that the RNA II-like sequence does not interfere with ribosomal
binding and translation.
[0048] Also, the inserted RNA II-like sequence must be designed and
positioned such that it guarantees sufficient RNA-RNA interaction
of the complementary sequences, so that when the plasmid is
present, the RNA I transcribed therefrom binds to the mRNA of the
host in an extent sufficient to inhibit translation of the marker
gene. Inhibition of the marker gene must be to an extent such that
an advantage in growth is provided, as compared to cells where no
plasmid, hence no RNA I, is present.
[0049] Thus, the bacterial host is engineered such that in the
absence of the ColE1-type plasmid the marker mRNA is translated
into a marker protein, and in presence of a ColE1-type plasmid,
translation of the protein is completely or partially suppressed.
In the case that said mRNA encodes a toxic protein that partially
or completely inhibits cell growth, hosts that contain the plasmid
will survive the toxicity or outgrow plasmid-free hosts.
[0050] For the purpose of the present invention, a toxic protein is
toxic in the sense that it partially or completely inhibits growth
of the cells, at least to an extent to which cells without the
marker gene have an advantage with regard to growth rate. If there
are two populations of cells, on the one hand a population with the
marker gene and, on the other hand, a population without or with an
inhibited marker gene, in an equimolar distribution, the cell
population without or with an inhibited marker gene will increase
to 99% of the population in less than 10 generations.
[0051] In an embodiment of the invention, expression of the marker
gene is regulated by an additional mechanism, e.g. by induction.
Since in the case that the marker gene encodes a toxic protein, the
marker gene needs to be turned off during cell propagation, an
inducible promoter is advantageously used for transcriptional
control, which promotes mRNA transcription only upon addition of an
inducer. Examples are the T7 promoter in a T7-polymerase producing
host, given that T7-polymerase is under control of the IPTG, or the
lactose-inducible Lac-promoter, or an arabinose-inducible
promoter.
[0052] Alternatively, said marker gene codes for a protein that is
not per se toxic, but acts via an indirect mechanism, e.g. an
enzyme, which, after addition of a substrate, modifies that
substrate to a toxic substance. An example is SacB from Bacillus
subtilis. sacB encodes a protein called levan sucrase. This protein
turns sucrose into levan, a substance that is toxic to
bacteria.
[0053] The RNA I sequence of the ColE1-type plasmid represents an
essential feature that contributes to the advantages of the system.
It provides selection criteria for plasmid-bearing hosts without
the use of additional selection markers on the plasmid, e.g.
antibiotic resistance genes. Thus, the invention provides an
innovative system for antibiotic-free selection of ColE1-type
plasmids.
[0054] In embodiments of the invention, the following components
are useful:
1. Host Cells
[0055] Since their replication depends on the host machinery,
ColE1-type plasmids are plasmids with a narrow host range.
Replication is limited to E. coli and related bacteria such as
Salmonella and Klebsiella (Kues and Stahl, 1989). Thus, the only
mandatory property of the host is that it has the ability to
replicate ColE1 plasmids. Suitable hosts are the widely used
Escherichia Coli strains K12 or the B strain or related
commercially available strains, e.g. JM108, TG1, DH5alpha, Nova
Blue, XL1 Blue, HMS174 or L121(for review see Casali, 2003).
[0056] Preferred genetic features of the host cell are mutations
that improve plasmid stability and quality or recovery of intact
recombinant protein. Examples of desirable genetic traits are recA
(absence of homologous recombination), endA (absence of
endonuclease I activity, which improves the quality of plasmid
minipreps) or ompT (absence of an outer membrane protease), hsdr
(abolished restriction but not methylation of certain sequences),
hsdS (abolished restriction and methylation of certain
sequences).
[0057] In the experiments of the invention, the host strain
HMS174(DE3) (Novagen) was used, which contains the DE3 phage with
the IPTG inducible T7 polymerase in its genome (Studier and
Moffatt, 1986). Another example for a suitable host is
HMS174(DE)pLysS, which additionally contains the pACYC184 plasmid
(Cm.sup.R) that carries the gene for the T7-lysozyme to decrease
the transcriptional activity of the T7-Promoter in the un-induced
state.
[0058] Particularly in the case of a lethal marker protein, it is
desirable to avoid its expression without induction.
2. Constructs for Engineering the Host Cells
[0059] The principle of a construct suitable for engineering the
host cells is shown in FIG. 2: All the components--two homologous
arms [H], promoter+operator [P+O], RNA I marker sequence (RNA
II-like sequence), marker gene [gene] (in the Examples, GFP was
used in initial experiments) with a transcriptional terminator and
the Kan cassette (kanamycin resistance cassette containing FRT, the
.+-.FLP recombinase recognition marker sequences; alternatively,
other conventional selection markers may be used) are cloned into
the multiple cloning site of a suitable vector, e.g. pBluescript
KS+. Linear fragments for genomic insertion are cut out with
restriction enzymes or amplified by PCR.
[0060] The kanamycin resistance cassette can be obtained, by way of
example, from the pUC4K vector (Invitrogen). It can be cloned into
the fragment at two different sites, namely before or after the
marker gene. To avoid unintended premature transcription of the
marker gene before it is turned on deliberately, the gene is
preferably inserted in the opposite direction of the chromosomal
genes.
[0061] Preferably, the marker construct is integrated in the
bacterial genome. This can be achieved by conventional methods,
e.g. by using linear fragments that contain flanking sequences
homologous to a neutral site on the chromosome, for example to the
attTN7-site (Rogers et al., 1986; Waddel and Craig, 1988; Craig,
1989) or to the recA site. Fragments are transformed into the host,
e.g. E. coli strains MG1655 or HMS174 that contain the plasmid
pKD46 (Datsenko and Wanner; 2000). This plasmid carries the .lamda.
Red function (.gamma., .beta. exo) that promotes recombination in
vivo. Alternatively, DY378 (Yu et al., 2000), an E. coli K12 strain
which carries the defective .lamda. prophage, can be used. In case
of MG1655 or DY378 the chromosomal locus including the expression
fragment can be brought into the HMS174(DE3) genome via
transduction by P1 phage. Positive clones are selected for
antibiotic resistance, e.g. in the case of using the Kan cassette
for kanamycin, or chloramphenicol. The resistance genes can be
eliminated afterwards using the FLP recombinase function based on
the site-specific recombination system of the yeast 2 micron
plasmid, the FLP recombinase and its recombination target sites
FRTs (Datsenko and Wanner, 2000).
[0062] Alternatively to having the construct integrated in the
host's genome, it may be present on a phage or a plasmid that is
different from a ColE1-type plasmid and that is compatible with the
system of the invention in the sense that it does not influence
expression of the marker gene (and the gene of interest). Examples
for suitable plasmids or phages are pACYC184 (which is a derivative
of miniplasmid p15A; see Chang and Cohen, 1978), R1-miniplasmids
(Diaz and Staudenbauer, 1982),F1-based plasmids or filamentous
phages (Lin, 1984) or the plasmid pMMB67EH (Furste et al., 1986)
that was used in the experiments of the invention.
[0063] More specifically, the elements of suitable constructs can
be defined as follows:
2.1. Homologous Arms
[0064] It was found in initial experiments of the invention that
homologies of 30 bp on either side of the construct are sufficient
for recombination by .lamda. Red system (Yu, 2000). However, since
better results are obtained with longer homologies, the arms are
preferably in the range of 50-400 bp. In the Example homologous
arms of 250 and 350 bp are used.
2.2. Promoter
[0065] If the foreign marker gene product is per se toxic or lethal
to the cell or if it is a repressor, its expression has to be
regulated. The promoter region has to contain suitable operator
sequences (e.g. the Lac operator) that allow control of gene
expression.
[0066] According to certain embodiments of the invention, the T7
promoter, the tac or the trc promoter, the lac or the lacUV5
promoter, the P.sub.BAD promoter (Guzman et al., 1995), the trp
promoter (inhibited by tryptophan), the P.sub.1 promoter (with c;
repressor) or the gal promoter are used.
[0067] When using the lac operator, addition of IPTG (isopropyl
thiogalactoside, an artificial inducer of the Lac operon) or
lactose are used to activate the marker gene. When an inducible
system is used, bacteria are able to survive without induction, but
die upon addition of the inducer.
[0068] To achieve tight regulation of toxic gene expression, a
tightly regulable promoter like the arabinose-inducible PBAD
promoter (Guzman et al., 1995) is preferably used, in particular in
the case that the marker protein is per se toxic to the cells.
[0069] Another way to control expression of the marker gene is by
using constitutive promoters in combination with a gene that is
non-toxic (e.g. a reporter gene) or only toxic under defined
conditions, e.g. the Bacillus subtilis sacB gene. SacB is only
toxic to E. coli when sucrose is present.
[0070] The promoter is chosen in coordination with the effect of
the marker gene product and the required efficiency of
down-regulation or silencing effect of RNA I. For example, for a
construct containing a non-toxic or less toxic marker gene, a
stronger promoter is desirable.
2.3. RNA II-Like Sequence
[0071] As RNA I has to act as a partial or complete inhibitor, RNA
II-like sequences that are complementary to RNA 1 (10-555 nt) have
to be presented upstream of the marker gene, together with a
ribosome binding site (Shine-Dalgarno sequence) that is upstream,
downstream or embedded within said RNA II-like sequence.
Shine-Dalgarno sequence (SD) refers to a short stretch of
nucleotides on a prokaryotic mRNA molecule upstream of the
translational start site, that serves to bind to ribosomal RNA and
thereby brings the ribosome to the initiation codon on the mRNA.
When located upstream of the RNA II-like sequence, the SD sequence,
preferably consisting of 7 nucleotides (GAAGGAG) should be located
approximately 4 to 15 bp, e.g. 7 bp, upstream of the ATG start
codon of the marker gene. In the case that a ribosome binding site
is embedded within the RNA I sequence complementary to the marker
gene, this sequence should be inserted such that only the stem
region is altered, loop structures and preferably the whole
secondary structure should stay intact in order to allow antisense
RNA interaction with RNA I and formation of a kissing complex.
[0072] In an embodiment that provides a start codon in front of the
RNAII-like sequence, the construct results in a fusion product
comprising the marker sequence and the RNA II-like sequence.
[0073] In another embodiment, the RNA II-like sequence is inserted
between the ribosomal binding site and the start codon; this
approach is limited to the maximal gap possible to allow
translation, e.g. 15 to 20 bp. (If the distance between the
ribosomal binding site and the start codon increases, translational
efficiency decreases.)
[0074] Alternatively to directly fusing the RNA II-like sequence
and the marker gene, the RNA II-like sequence can be
translationally coupled with the marker gene. To achieve this, by
way of example, a construct may be used that starts with a start
ATG, followed by the RNA II-like sequence, a further ribosome
binding site, a sequence which represents an overlap between a stop
and a start codon, e.g. TGATG, and the marker sequence. In this
case the marker gene is only translated when the RNA II-like
sequence has been translated before and separately from the marker
gene. The advantage of this set up is that protein fusion to the
marker gene is not required. This approach provides the option of
separate translation, which may be beneficial for some marker
proteins, e.g. in the case of some repressors like the Tet
repressor.
[0075] Since even single RNA I/RNA II stem loops form kissing
complexes (Eguchi 1991b; Gregorian, 1995), it has to be ensured
that at least a single loop is formed. In any case, both
requirements, i.e. on the one hand translation of the marker mRNA
in spite of inserted loop structures and, on the other hand,
efficient RNA-RNA antisense reaction between the inserted loop
structure of the RNA II-like sequence and the complementary RNA I
on the plasmid are fulfilled.
[0076] The interaction between RNA I and the marker mRNA that
contains the RNA II-like sequence has the purpose to inhibit
binding of the ribosome, thereby abolishing translation. Said mRNA
is under control of an inducible promoter (e.g. the lac, arabinose
or T7 promoter) and after induction (e.g. by IPTG, lactose,
arabinose), expression of said marker gene is down-regulated,
whenever sufficient RNA I is produced from the plasmid's origin of
replication. Preferably, the marker gene encodes a lethal protein
or a toxic protein that inhibits cell growth at least to a certain
extent (as defined above); in this case, expression results in cell
death or decreased cell growth (in plasmid-free cells), whereas
down-regulation provides cell-growth (in plasmid-bearing
cells).
[0077] Alternatively to marker genes that encode lethal or toxic
proteins, the marker gene may encode any protein the expression of
which is to be regulated during growth of bacterial cells, for
whatever purpose. In particular, the marker gene may be a reporter
gene, as described below (2.4.).
[0078] In the system of the present invention, RNA I, which is
normally responsible for down-regulation of plasmid replication,
acts as "gene-silencer", while inhibition of replication is
decreased. Thus, the use of the system of the present invention
results in an increase of plasmid replication, which is beneficial
for survival of the bacterial host cells.
2.4. Marker Gene
[0079] RNA I-mediated down-regulation of the marker gene, which is
a key feature of the invention, can be applied to any gene the
expression of which, for any given purpose, is to be regulated.
[0080] According to a first aspect, RNA I-mediated down-regulation
is useful for marker genes that are conditionally lethal to the
host (e.g. see Davison, 2002, for review).
[0081] Examples for marker genes that are toxic per se and suitable
in the present invention are genes encoding restriction nucleases
(e.g. CviAII, a restriction endonuclease originating from Chlorella
virus PBCV-1; Zhang et al., 1992), EcoRI (Torres et al., 2000),
genes encoding toxins that interact with proteins, e.g.
streptavidin or Stv13 (a truncated, easy soluble streptavidin
variant), as described by Szafransky et al., 1997; Kaplan et al.,
1999; Sano et al., 1995, which act by deprivation of biotin, an
essential protein in cell growth);genes encoding proteins that
damage membranes (the E gene protein of .PHI.174 (Ronchel et al.,
1998; Haidinger et al., 2002), gef (Jensen et al., 1993; Klemm et
al., 1995), relF (Knudsen et al., 1995); genes that encode other
bacterial toxins, e.g. the ccdb gene (Bernard and Couturier, 1992)
that encodes a potent cell killing protein from the F-plasmid
trapping the DNA gyrase or sacB from Bacillus Subtilis (Gay et al.,
1983); or genes that encode eukaryotic toxins that are toxic to the
bacterial host (e.g. FUS; Crozat et al., 1993). When using toxic
genes, it is essential that their expression can be modulated by an
inducible promoter. This promoter must not be active without
inductor, but provide expression upon induction, sufficient to
inhibit cell growth.
[0082] Further examples of genes toxic in bacteria and useful in
the present invention are given by Rawlings, 1999.
[0083] In certain embodiments, the marker gene is selected from
genes encoding restriction nucleases, streptavidin or genes that
have an indirect toxic effect, e.g. SacB, as described above.
[0084] In a preferred embodiment, the toxic marker protein is not
lethal or toxic per se or due to a toxic effect upon its
expression, but a repressor protein which acts by repressing the
transcription of a gene that is essential for growth of said
bacterial cell.
[0085] In this embodiment of the invention, RNA I-mediated
down-regulation in the presence of the plasmid affects the
repressor. This means that the presence of RNA I and its
interaction with the repressor mRNA (the RNA II-like sequence)
leads to inhibition of the repressor and thus to activation or
up-regulation of an essential gene, with the effect that growth of
the cells only occurs in the presence of the replicating plasmid.
In this embodiment, the promoter of an essential gene is modified
by providing a binding DNA sequence (an "operator"), preferably the
natural promoter is replaced by a complete, inducible promoter
(containing an operator sequence) in such way that the expressed
repressor protein, e.g. the Tet repressor, can bind to that
operator, thereby inhibiting transcription and regulating
expression of the essential gene, e.g. murA (by expression of the
Tet repressor.).
[0086] The operator is a DNA sequence to which its specific
repressor or enhancer is bound, whereby the transcription of the
adjacent gene is regulated, e.g. the lac operator located in the
lac promoter with the sequence TGGAATTGTGAGCGGATAACAATT (SEQ ID NO:
53; Gilbert and Maxam, 1973) or derivatives thereof (Bahl et al.,
1977). The repressor gene, which should not be present in the
wild-type host, is engineered into the genome under the control of
an inducible promoter, e.g. the T7, the lac or the tac promoter.
Under normal growth conditions, the repressor is not expressed.
After induction, by e.g. IPTG, the repressor is expressed, binds to
the artificially introduced operator within the promoter region of
the essential gene or the artificially inserted promoter and thus
inhibits expression of the respective essential gene. Whenever
there is replicating ColE1 plasmid present in the host, RNA I is
produced which can bind to the repressor mRNA, which had been
modified accordingly. By this RNA-RNA interaction, the translation
of the repressor is inhibited (analogously to any other toxic
marker protein). Consequently, the essential gene product can be
produced and the cells maintain viable and grow.
[0087] In essence, in this embodiment the bacterial host comprises,
besides the RNA II-like sequence, one of its essentials genes (as
naturally embedded in the bacterial genome) under the control of an
inducible promoter (which has been engineered into the genome to
modify or, preferably completely replace the naturally occurring
promoter of the essential gene). The promoter region controlling
the essential gene also contains a DNA sequence (operator) that is
recognized and specifically bound by said repressor protein. The
repressor gene, which is engineered into the bacterial chromosome,
is also under the control of an inducible promoter that is
different from the promoter controlling the essential gene in thus
independently inducible.
[0088] Essential bacterial genes are known from the literature,
e.g. from Gerdes et al., 2002 and 2003, and from the PEC (Profiling
the E. coli Chromosome) database
(http://www.shigen.nig.ac.jp/ecoli/pec/genes.jsp), e.g.
Isoleucyl-tRNA synthetase (ileS), cell division proteins like ftsQ,
ftsA, ftsZ, DNA polymerase III alpha subunit (dnaE), murA, map, rps
A (30s ribosomal protein S1), rps B (30s ribosomal protein S2), lyt
B (global regulator), etc.
[0089] A repressor is a protein that binds to an operator located
within the promoter of an operon, thereby down-regulation
transcription of the gene(s) located within said operon. Examples
for repressors suitable in the present invention are the
tetracyclin repressor (tet) protein TetR, which regulates
transcription of a family of tetracycline resistance determinants
in Gram-negative bacteria and binds to tetracyclin (Beck, et al.,
1982; Postle et al., 1984), the tryptophan repressor (trp), which
binds to the operator of the trp operon, which contains the
tryptophan biosynthesis gene (Yanofski et al., 1987).
[0090] Examples for inducible promoters are promoters, where
transcription starts upon addition of a substance, thus being
regulable by the environment, e.g. the lac promoter, which is
inducible by IPTG (Jacob and Monod, 1961), the arabinose-promoter
(pBAD), inducible by arabinose (Guzman et al., 1995), and
copper-inducible promoters (Rouch and Brown, 1997).
[0091] In the experiments of the invention, the tet-repressor
(tetR) was chosen to be the repressor gene, which served as "toxic"
marker gene by turning off an essential bacterial gene upon
addition of the inducer IPTG.
[0092] For implementation of the repressor gene approach, two types
of cassettes are designed and inserted in the bacterial chromosome
in the experiments of the invention (Example 4). The first set of
constructs comprises cassettes that serve to replace (or modify)
promoters of specific essential genes on the genome. The second
type of cassettes serve as test constructs employing GFP as a
surrogate for an essential gene to provide proof of concept. The
aim of the experiments using the GFP test constructs is to evaluate
regulatory cascades, promoter strengths and thus adjustment of all
interacting components of the system.
[0093] Thus, in another embodiment, the marker gene is a reporter
gene, e.g. encoding GFP (Green Fluorescent Protein), hSOD (human
superoxide dismutase), CAT (chloramphenicol acetyltransferase) or
luciferase.
[0094] A reporter gene is useful in cultivation processes whenever
information on the presence or absence of a ColE1-type plasmid in a
host cell or on plasmid copy number is needed. Such information is
particularly useful when fermentation processes are to be optimized
with regard to control of plasmid copy number.
[0095] A reporter gene may also serve as a surrogate of a toxic
marker gene, and may thus be used in experimental settings that aim
at proving the functionality of constructs to be employed for the
gene-regulating or silencing and to determine their effect on a
toxic marker gene.
[0096] In order to evaluate the functionality of constructs
designed for engineering a bacterial host such that expression of a
toxic marker gene can by regulated by a ColE1-type plasmid, the
reporter gene, green fluorescent protein"(GFP) served as a model in
the initial experiments of the invention. Due to its
auto-fluorescence (Tsien, 1998) GFP was considered suitable to
substitute the marker gene, or the essential gene, respectively, in
the initial experiments.
[0097] In certain embodiments of the invention, the marker gene may
be an endogenous host gene, which may be any gene of interest that
is intended to be regulated. In this case, the host cell is
engineered such that the sequence encoding the RNA II-like sequence
is operably associated with the relevant host gene, as described in
2.3.
3. ColE1-Type Plasmid
[0098] In the present invention, all ColE1-type plasmids with their
natural RNA I/RNA II pairs, as well as with modified RNA I and/or
RNA II sequences, e.g. as described in WO 02/29067, may be
used.
[0099] As mentioned above, representatives of useful ColE1-type
plasmids are the naturally occurring ColE1 plasmids pMB1, p15A,
pJHCMW1, as well as the commonly used and commercially available
cloning vehicles such as pBR322 and related vectors, the pUC
plasmids, the pET plasmids and the pBluescript vectors.
[0100] No antibiotic resistance genes need to be included in the
plasmid sequence. As essential elements, the plasmid basically only
contains the ColE1 origin of replication and the gene expression
cassette carrying the gene of interest.
[0101] The gene of interest on the plasmid and its promoter depend
on the type of application; the invention is not limited in any way
with respect to the gene of interest, e.g. a therapeutic gene. For
gene therapy applications, the gene may be operably associated to
an eukaryotic promoter, e.g. the CMV promoter.
APPLICATION OF THE INVENTION
[0102] The present invention can be widely used in state-of-the-art
fermentations, both for plasmid DNA production and for producing
recombinant proteins.
[0103] Several approaches for fermentation of pDNA have been
described that are useful for applying the present invention. The
methods for plasmid DNA production differ with regard to the level
of control imposed upon the cells and the numerous factors that
influence fermentation:
[0104] For pDNA production on a laboratory scale, cultivation of
plasmid-bearing cells in shake flasks is the simplest method
(O'Kennedy et al., 2003; Reinikainen et al., 1988; O'Kennedy et
al., 2000; U.S. Pat. No. 6,255,099).
[0105] To obtain higher quantities of plasmids, the cells can be
cultivated in controlled fermenters in so-called "batch
fermentations", in which all nutrients are provided at the
beginning and in which no nutrients are added during cultivation.
Cultivations of this type may be carried out with culture media
containing so called "complex components" as carbon and nitrogen
sources, as described e.g. by O'Kennedy et al., 2003, and Lahijani
et al., 1996, and in WO 96/40905, U.S. Pat. No. 5,487,986 and WO
02/064752. Alternatively, synthetic media may be used for pDNA
production, e.g. defined culture media that are specifically
designed for pDNA production (Wang et al., 2001; WO 02/064752).
[0106] The present invention may also be used in fed batch
fermentations of E. coli, in which one or more nutrients are
supplied to the culture by feeding, typically by using a feed-back
control algorithm by feeding nutrients in order to control a
process parameter at a defined set point. Feed-back control is
hence directly related to cell activities throughout fermentation.
Control parameters which may be used for feed-back control of
fermentations include pH value, on line measured cell density or
dissolved oxygen tension (DOT). A feed-back algorithm for
controlling the dissolved oxygen tension at a defined set point by
the feeding rate was described in WO 99/61633.
[0107] Another, more complex algorithm uses both the DOT and the pH
value as control parameters for a feed-back cultivation method
(U.S. Pat. No. 5,955,323; Chen et al., 1997).
[0108] Another feeding mode is based on the supply of feeding
medium following an exponential function. The feeding rate is
controlled based on a desired specific growth rate .mu.. WO
96/40905 and O'Kennedy et al., 2003 describe methods that use an
exponential fed-batch process for plasmid DNA production. Lahijani
et al., 1996, describe combining exponential feeding with
temperature-controllable enhancement of plasmid replication.
[0109] Alternatively, the invention may be applied in a process for
producing plasmid DNA, in which E. coli cells are first grown in a
pre culture and subsequently fermented in a main culture, the main
culture being a fed-batch process comprising a batch phase and a
feeding phase. The culture media of the batch phase and the culture
medium added during the feeding phase are chemically defined, and
the culture medium of the feeding phase contains a growth-limiting
substrate and is added at a feeding rate that follows a pre-defined
exponential function, thereby controlling the specific growth rate
at a pre-defined value.
[0110] When the marker gene is under the control of an inducible
promoter, the inducer may be added to the batch at the beginning
and/or pulse-wise (both in a batch and in fed-batch cultivations).
During the feed phase, the inducer may be added pulse-wise or
continuously.
[0111] At the end of the fermentation process, the cells are
harvested and the plasmid DNA is isolated and purified according to
processes known in the art, e.g. by methods based on anion exchange
and gel permeation chromatography, as described in U.S. Pat. No.
5,981,735 or by using two chromatographic steps, i.e. an anion
exchange chromatography as the first step and reversed phase
chromatography as the second step, as described in U.S. Pat. No.
6,197,553. Another suitable method for manufacturing plasmid DNA is
described in WO 03/051483, which uses two different chromatographic
steps, combined with a monolithic support.
[0112] In addition to applying the invention for plasmid
production, e.g. for production of plasmids for gene therapy
applications, it is also useful for recombinant protein
production.
[0113] With regard to recombinant protein production, in principle,
any method may be used that has proven useful for expressing a gene
of interest in E. coli, in particular from a ColE1 type plasmid
(see, for review, e.g. Jonasson et al., 2002; Balbas, 2001). The
protein may be obtained intracellularly (completely or partially
soluble or as inclusion bodies) or by secretion (into the cell
culture medium or the periplasmic space) from batch fermentations
or, preferably, fed-batch cultivations, using complex, synthetic or
semisynthetic media.
[0114] In plasmid DNA production, usually plasmid DNA for gene
therapy applications, the gene of interest is not expressed in the
bacterial host cell. In view of its application in mammals,
preferably in humans, where it is to be ultimately expressed, the
gene of interest is usually operably associated with a eukaryotic
promoter. In contrast, for recombinant production of proteins in E.
coli, the gene of interest is to be expressed in the host cell
therefore under the control of a prokaryotic promoter,
[0115] For recombinant protein production, the two promoters, i.e.
the promoter controlling the marker gene and the promoter
controlling the gene of interest, may be different or the same, as
long as no interference occurs that disturbs expression of either
one.
[0116] Advantageously, since their activity is independent of each
other concerning time-point and level of transcription, the
promoters are differently regulated. Preferably, the promoter
controlling the marker gene is active at the start of the
fermentation process and produces moderate amounts of mRNA, while
the promoter of the gene of interest is rather strong and activated
at a chosen time-point during fermentation. If inducible promoters
are used for both the gene of interest and the marker gene, they
are usually chosen such that they are turned on by different
inducers. Alternatively, the marker gene may be under an inducible
and the gene of interest under a constitutive promoter, or vice
versa. This applies both for methods in which the marker gene
construct is integrated in the bacterial host genome and in which
the marker gene construct is contained in a plasmid or phage, as
described above.
[0117] With regard to induction of the promoter in the various
phases of fermentation, the principle described above for plasmid
DNA production applies.
[0118] The invention has the great advantage that all replicated
plasmids are devoid of antibiotic resistance genes and are
therefore, in addition to gene therapy applications, suitable for
all applications for which the absence of antibiotic resistance
genes is required or desirable, e.g. for the generation of
recombinant yeast strains that are intended for human and animal
food production or for the generation of recombinant plants.
BRIEF DESCRIPTION OF THE FIGURES
[0119] FIG. 1: Principle of RNA I-mediated marker gene
down-regulation or silencing
[0120] FIG. 2: Construct for engineering host cells
[0121] FIG. 3: Results from hybridization experiments with in vivo
transcribed constructs
[0122] FIG. 4: Constructs containing marker gene and RNA II-like
sequences
[0123] FIG. 5: Gene down-regulation effect in the presence of
pBR322
[0124] FIG. 6: Gene down-regulation effect of various plasmids
[0125] FIG. 7: Expression/suppression of marker gene during
fermentation
[0126] FIG. 8: Principle of a construct based on an essential gene
including replacement of essential gene promoter
[0127] FIG. 9: Test constructs for repressing GFP as a surrogate
for an essential gene
[0128] FIG. 10: Results from shake flask experiments with test
constructs inserted into the HMS174(DE3) genome
[0129] In Examples 1 and 2, the oligonucleotides as shown in Table
1 are used: TABLE-US-00001 TABLE 1 SEQ ID Org. NO: Primer Length
Sequence (T7, E. 1 T7 rbs@st- 159 mer 5'GAAATTAATACGACTCACTATAGG 0
coli, A. loop2 +1 GAACAAAAAAACCACCGCTACCAGC victoria)
GGTGGTTTGTTTGCCTCTAGTTCAGC TACCAACTGAAGGAGAGAATACATA
TGGCTAAAGGAGAAGAACTTTTCAC TGGAGTTGTCCCAATTCTTGTTGAAT TAGATGGT 3'
(T7, E. 2 T7-atg-loop2- 161 mer 5'GAAATTAATACGACTCACTATAGG coli, A.
sbulge GCCTCTAGAAATAATTTTGTTTAACT Victoria)
TTAAGAAGGAGATATACATATGCGG ATCAAGAGCTACCAACTCTTGTTCCG
ATGGCTAAAGGAGAAGAACTTTTCA CTGGAGTTGTCCCAATTCTTGTTGAA TTAGATGGT 3'
T7, E. 3 T7Prom-sRNA 45 mer 5'GAAATTAATACGACTCACTATAGGG coli
I_ColE1-back ACAGTATTTGGTATCTGCGC 3' E. coli 4 asRNA 20 mer
5'AACAAAAAAACCACCGCTAC 3' I_ColE1-for T7, E. 5 T7Prom-RNA 45 mer
5'GAAATTAATACGACTCACTATAGGG coli IIe_ColEI-back
GCAAACAAAAAAACCACCGC 3' E. coli 6 RNA 20 mer 5'ACAGTATTTGGTATCTGCGC
3' IIe_ColEI-for T7, E. 7 oligo-T7prom- 23 mer
5'GAAATTAATACGACTCACTATAG coli p11a-back 3' A. 8 oligo-GFP-for 23
mer 5'ACCATCTAATTCAACAAGAATTG 3' victoria
[0130] Gel 1: [0131] 1 neg. control RNA [0132] 2. RNAI+neg. control
RNA [0133] 3 RNAII.sub.108nt [0134] 4 RNAI+RNAII.sub.108nt (heating
prior to incubation (3 min at 90.degree. C.) [0135] 5
RNAI+RNAII.sub.108nt [0136] 6 RNAI (heating prior to incubation (3
min at 90.degree. C.)) [0137] 7 RNAI
[0138] On gel 2 of FIG. 3, lanes 8, 9 and 10, only the RNAI band is
shown. When incubated with a transcript carrying one RNAII loop, a
very weak reaction is seen, whereas a transcript with two loops
gave a strong reaction.
Gel 2:
[0139] 8 RNAI [0140] 9 RNAI (+RNAII loop2) [0141] 10 RNAI (+RNAII
loop1 and 2)
[0142] Loop2GFP (lane 9) shows a slightly weakened RNA I band
compared to the negative control, whereas Loop1+2GFP (lane 10)
shows a dramatic decrease in the RNA I band, indicating formation
of a kissing complex. This data shows that RNA-RNA interaction with
the presence of only one loop is efficient.
[0143] Loop constructs that indicate formation of a kissing complex
on the gel--even a weak one--are cloned into pMMB67EH and
pBluescriptII KS+ and tested for GFP expression. Since interaction
of RNA I with a marker containing two hairpin loops is stronger,
this construct is considered the favorite candidate for the in vivo
experiments.
EXAMPLE 2
[0144] In vivo Assay to Test Gene Expression and Gene Silencing
[0145] In the constructs to be tested, either one or two RNA II
stem loops are cloned into an expression vector. Secondary
structures and proper folding of the transcript are confirmed by
the computer program RNAfold (Gene Quest, Vienna RNA folding
procedure; see Zuker, 1999). For this experiment, an expression
vector with a non-ColE1 origin, for example pMMB67EH (Furste et
al., 1986) is considered useful to circumvent RNA I-target
interactions within the plasmid and to determine whether GFP
expression is hampered by the presence of additional sequences in
proximity of the ribosomal binding site. This is considered to be
an important point, because additional sequences and secondary
structures on or near the ribosomal track usually decrease or even
completely inhibit gene expression (Malmgren, 1996; Ringquist,
1993).
[0146] Based on the results obtained with the native RNA gels (see
Example 1), two fusions of GFP with RNA II-like sequences are
constructed (FIG. 4). Two different RNA II-like sequences are
inserted upstream of the GFP coding sequences, under control of the
T7 promoter and lac operator.
[0147] The gfp gene is amplified from pGFPmut3. 1 by primers
NheI-GFP-back and BamHI-GFP-for (for primer sequences see Table 2).
The T7/lacO promoter--with and without RNAII loops/RBS
combinations--is fully synthesized on primers (HindIII-T7GFP-back)
and together with BamHI-GFP-for used to amplify gfp or synthesized
on oligos (T7a13-oligo and T7L12ras-oligo) and fused to the
amplified gfp by NheI restriction site. The whole fragment is
cloned into pMMB67EH by BamHI and HindIII restriction (for primers
and oligos see Table 2). TABLE-US-00002 TABLE 2 Selected constructs
SEQ ID Primer/ Org. NO: Oligo Sequence A. 9 NheI- 5' GAT GAT GCT
AGC AAA GGA victoria GFP-back GAA GAA C 3' A. 10 BamHI- 5' GAT GAT
GGA TCC TTA TTT victoria GFP-for GTA TAG TTC 3' (T7, 11 T7a13- 5'
TAA TAC GAC TCA CTA TAG E. coli) oligo GGG AAT TGT GAG CGG ATA ACA
ATT CCC CTC TAG AAA TAA TTT TGT TTA ACT TTA AGA AGG AGA TAC ATA TGG
GTA ACT GGC TTC AGC AGA GCG CAG ATA CCA TG 3' E. coli 12 Nhe-ATG-
5' ATC ATC GCT AGC CAT GGT loop3-for ATG TGC GCT CTG CTG 3' (T7, 13
T7L12ras- 5' TAA TAC GAG TCA CTA TAG E. coli) oligo GGG AAT TGT GAG
CGG ATA ACA ATT CCC CAA CAA AAA AAC CAC CGC TAC CAG CGG TGG TTT GTT
TGC CTC TAG TTC AGC TAC CAA CTG AAG GAG AGA ATA CAT ATG 3' arti- 14
Nhe-ras12 5' ATC ATC GCT AGC CAT ATG ficial for TAT TCT CTC CTT C
3' T7, 15 HindIII- 5' GAT GAT AAG CTT TAA TAC E. coli, T7GFP- GAC
TCA CTA TAG GGG AAT TGT A. back GAG CGG ATA ACA ATT CCC CTC
victoria TAG AAA TAA TTT TGT TTA ACT TTA AGA AGG AGA TAT ACA TAT
GGC TAG CAA AGG AGA AG 3' T7 16 HindIII- 5' GAT GAT AAG CTT TAA TAC
T7-back GAC TCA CTA TAG GG 3' T7 17 XhoI- 5' GAT GAT CTC GAG CAA
AAA T7term- ACC CCT CAA GAC C 3' for T7 18 EcoRI- 5' AGT AGT GAA
TTC CAA AAA T7term- ACC CCT CAA GAC C 3' for
[0148] The constructs are cloned into the pMMB67EH vector to
confirm GFP expression in spite of additional sequences in
proximity to the ribosomal binding site. Both constructs produce
GFP, but expression is significantly lower as compared to a
construct without hairpin loops. The two constructs are cloned into
vector pBluescript containing the Tn7 homologies and the kanamycin
resistance gene, which serves for selection of hosts that have the
capacity to integrate the entire cassette into the chromosome. The
GFP cassettes are inserted on the bacterial chromosome as described
before.
[0149] FIG. 4: shows constructs that are cloned into pMMB67EH and
also inserted on the genome of HMS174(DE3). Cassettes for I)
HMS174(DE3)T7GFP=IS5, II) HMS174(DE3)T7a13GFP=IS11 and III)
HMS174(DE3)T7112rasGFP=IS13
[0150] As T7aL3GFP and T7112rasGFP show GFP expression when cloned
into pMMB67EH, these expression cassettes--and T7GFP as a negative
control--are inserted on the bacterial chromosome for testing their
ability to serve as a target for antisense RNAI. The constructs are
cloned into vector pBluescript KSII+ by BamHI and HindIII
restriction sites. The Tn7 homologies are amplified from E. coli
HMS174(DE3) colonies with primers NotI-Tn7/1-back and EcoRI-Tn7-for
for homology 1 and primers XhoI-Tn7/2-back and KpnI-Tn7-for for
homology 2 (for primer sequences see Table 3). For the kanamycin
resistance cassette, which serves for selection of hosts that have
the entire cassette integrated into the chromosome, the EcoRI
fragment from pUC4K is taken. The T7 Terminator is amplified from
expression vector pET11a by primers XhoI-T7term-for and EcoRI-T7
term-for (Table 2). The entire plasmids are digested by NotI and
KpnI for the cassette and by Alw44I for the digestion of the
plasmid backbone. The gel purified linear cassette is inserted on
the bacterial chromosome of MG1655 carrying the Red Helper plasmid
pKD46. The chromosomal section carrying the inserted fragment is
transferred to HMS174(DE3) by P1 transduction. Correct insertion of
the expression cassettes is confirmed by PCR (external primers
(Table 3) and internal primers). TABLE-US-00003 TABLE 3 Primers for
Tn7 site for strains IS 5, IS 11 and IS 13 SEQ ID Org. NO: Primer
Sequence E. coli 19 NotI-Tn7/1-back 5' GAT GAT GCG GCC GC G TTG CGA
CGG TGG TAC G 3' E. coli 20 EcoRI-Tn7/1-for 5' GAT GAT GAA TTC TAT
GTT TTT AAT CAA ACA TCC TG 3' E. coli 21 XhoI-Tn7/2-back 5' GAT GAT
CTC GAG GCA TCC ATT TAT TAC TCA ACC 3' E. coli 22 KpnI-Tn7/2-for 5'
GAT GAT GGT ACC TGA AGA AGT TCG CGC GCG 3' E. coli 23 TN7/1 extern
5' ACC GGC GCA GGG AAG G 3' E. coli 24 TN7/2 extern 5' TGG CGC TAA
TTG ATG CCG 3'
[0151] As chromosomal insertion site attTn7 is chosen (deBoy and
Craig, 2000), which is situated in the non-coding region between
genes glmS and phoS within the transcriptional terminator of glmS.
By the specified Tn7 primers only this transcriptional terminator
is replaced by the cassette. (Yu and coworkers demonstrated that
homologies of 40 bp are sufficient for integration of linear
fragments into the chromosome (Yu et al., 2000)). As better results
are obtained with longer homologies, they are extended to 300 bp on
one side and 240 bp on the other side. As HMS 174(DE3) does not
seem to be suitable for direct integration of linear DNA by Red
Helper plasmid, MG1655 is used for initial integration and by P1
transduction the recombinant chromosomal section is transferred
into HMS174(DE3). Resulting strains HMS174(DE3)T7a13GFP=IS5, HMS
174(DE3)T7GFP=IS 11 and HMS174(DE3)T7112rasGFP=IS13 contain GFP
under control of the T7 promoter with or without an RNA II loop
structure, respectively. Correct insertion of the expression
cassettes is confirmed by PCR. The obtained strains are designated
I) IS5, II) IS 11 and III) IS 13 and tested for GFP expression and
RNAI-mediated gene silencing effect in shake flask experiments.
[0152] For shake flasks experiments, overnight cultures are diluted
1:100 and grown until OD.sub.600.about.0.5. Then IPTG is added for
induction. Fluorescence is measured by the microplate reader
SPECTRAmax GeminiXS and software, SOFTmax Pro (Molecular devices)
at excitation wavelength 488 nm and emission 530 nm with a 515 nm
cutoff filter.
[0153] Detection of GFP with and without induction with IPTG shows
a clear gene silencing effect when pBR322 is present (FIG. 5). IS13
shows lower GFP expression the IS11 and inhibition of GFP
expression is little, whereas IS11 shows higher GFP expression and
a significant gene silencing effect providing evidence that our
concept is working.
[0154] When no RNA II-like sequence is present (IS5) upstream of
the GFP-gene, no gene silencing is detected (FIG. 6).
[0155] IS5 is transformed with different plasmids, including
pET11a, pET3d, pMMB67EH and pBR322, to check for undesired
interaction between plasmid and genomic gene expression (FIG. 6).
It is found that only when the GFP mRNA contains the RNA II-like
sequence and a ColE1 plasmid is used that does not contain
homologous sequences to the cassette on the genome, e.g. the T7
promoter or the lac operator, a defined gene silencing effect can
be observed. No interference between host and plasmid disturbs the
antisense reaction when using pBR322 related plasmids that are
typically used in gene therapy.
[0156] FIG. 5 shows the comparison of strains IS11 and IS13 with
and without pBR322. Rfu/OD are fluorescence units related to
optical density. The increase of GFP fluorescence is observed after
induction in intervals of 1.5 hrs.
[0157] FIG. 6 shows the results of the shake flask experiments with
IS5 containing various plasmids. pBR322 and related plasmids (as
used in gene therapy applications) show no interference between
host and plasmid.
EXAMPLE 3
[0158] Expression/Suppression of Marker Gene During
Fermentation
[0159] The E. coli strains IS11 and IS5 are analyzed during a
fed-batch fermentation process, with and without the presence of
plasmid pBR322. Table 4 summarizes the experimental set-up of four
fed-batch fermentations. Each strain is grown either in the
presence or absence of pBR322. TABLE-US-00004 TABLE 4 Fed batch
fermentations Experiment Host strain pBR322 AS1 IS 11 - AS2 IS 11 +
AS3 IS 5 - AS4 IS 5 +
[0160] All four cultivations show very similar trends for online
signals such as CO.sub.2, O.sub.2, base consumption or capacity and
the course of total BDM varies also in a very small range of less
than .+-.10% from the calculated mean as shown in FIGS. 7a and 7b.
FIG. 7a shows bacterial dry mass (BDM) and GFP expression of IS II
with or without maintenance of pBR322. While the total BDM is
identical for both fermentations, the GFP concentration is
drastically decreased when pBR322 is present (50%). The curve
progression of GFP measurements strongly indicates inhibition of
GFP translation by the plasmid's presence, hence, its replication,
and confirms the expectation that RNA I and the modified mRNA of
GFP interact, thereby hampering translation (FIG. 7a). In order to
rule out that pBR322 has an effect on recombinant protein
expression per se, further fed-batch experiments are carried out
using IS5, again with or without plasmid propagation. As is shown
in FIG. 7b, there is no difference in GFP expression or cellular
growth: whether pBR322 is present in the host or not, no influence
on transcription nor translation of GFP can be detected. In these
experiments the overall GFP expression is much higher than when
strain IS11 is used, due to efficient translation of the native
mRNA. Although, protein expression is decreased by the presence of
a stable RNA loop structure near the ribosomal binding site in
IS11, expression is inhibited, when pBR322 is present. Thus, it can
be demonstrated by using GFP as a surrogate for a toxic marker that
the replication regulatory system of ColE1 can be used to suppress
marker gene expression.
EXAMPLE 4
[0161] Use of a Repressor for Regulating the Expression of an
Essential Gene
a) Generation of Constructs for Essential Genes
[0162] The first essential gene to be tested is map (Li et al.,
2004), the gene for the methionine aminopeptidase, which is located
at min 4 of the E. coli chromosome, 357 base pairs from the
rpsB-tsf operon and 201 bp from the T44-RNA gene. The two genes are
transcribed divergently and promoters do not overlap. This is an
essential point, because the promoter of the essential gene is to
be removed entirely and replaced by an inducible promoter that is
specific for a chosen repressor. Chang et al, 1989 described a
conditionally lethal mutant strain which has the map gene
controlled by the lac promoter. By the map cassette, a 67 bp
chromosomal section is replaced containing the map promoters (Chang
et al, 1989). To circumvent possible transcripts from the genome,
two strong transcriptional terminators T1 and T2 from the rrnB
operon (Brosius et al, 1981) are added to the integration
cassette.
[0163] The second gene that is tested is murA (Brown et al, 1995),
which has been described as an essential E. coli gene. The gene
murA encoding the enzyme UDP-N-acetylglucosamine enolpyruvyl
transferase for the first committed step of bacterial cell wall
biosynthesis, is situated on the E. coli chromosome at 69.3 min
Herring and Blattner compared death curves of several conditional
lethal amber mutants in their publication (Herring and Blattner,
2004), amongst others also those of map and murA mutants. But of
all the mutations murA is far the most bactericidal showing the
best and fastest killing rate in non-permissive medium.
[0164] FIG. 8 shows the principle of a construct based on an
essential gene, including replacement of essential gene
promoter.
[0165] The constructs for genomic integration are cloned into
vector pBluescript KSII+ again. The essential gene homologies, each
.about.300 bp are amplified from MG1655 colonies with primer pairs
SacI-map1-for/NotI-map1-back and XhoI-map2-back/KpnI-map2-for for
the map homologies and primer pairs SacI-murA1-for/NotI-murA1-back
and XhoI-murA2-back/KpnI-murA2-for for the murA homologies (for
primer sequences see Table 5). The fragment containing the lactose
promoter and operator (plac) is amplified from pBluescriptKSII+ by
primers BamHI-placO-back and NotI-placO-for. The gene for the
chloramphenicol acetyl transferase (cat) is amplified from pLys
(pACYC184) with primers HindII-SalI-Cat-back and XhoI-Cat-for. The
rrnBT12 Terminators are amplified from pBAD by primers
BamHI-T12-for and HindIII-T12-back. The assembled vectors
pBSKmap<plac-T12-Cat> and pBSKmurA<plac-T12-Cat> are
digested by SacI and KpnI and the linearized cassettes are inserted
on the genome of MG 1655 as described previously. Correct
integration of the cassettes is verified by PCR combining external
primers (map I extern, map2 extern, murA1 extern, murA2 extern;
Table 5) and internal primers.
[0166] The primers for essential and test gene constructs are shown
in Table 5. TABLE-US-00005 TABLE 5 SEQ ID Org. NO: Primer Sequence
E. coli 25 Not-map1-back 5' ATG ATG ATG GCG GCC GCA CCG ACG CTG ATG
GAC AGA ATT AAT GG 3' E. coli 26 SacI-map1-for 5' GCT GCT GAG CTC
CCA TCT TTG ATT ACG GTG AC 3' E. coli 27 XhoI-map2-back 5' ATG ATG
CTC GAG CGC CAA ACG TGC CAC TG 3' E. coli 28 KpnI-map2-for 5' GCT
GCT GGT ACC GAA GTG AAC ACC AGC CTT G 3' E. coli 29 map2 extern 5'
TTC GGG TTC CAG TAA CGG G 3' E. coli 30 map1 extern 5' TTT CGA GGT
ATC GCC GTG G 3' E. coli 31 SacI-murA1-for 5' GCT GCT GAG GTC CAA
AGC GCG CTA CCA GCG 340 E. coli 32 NotI-murA1-back 5' ATG ATG ATG
GCG GCC GCT TAA CTG AGA ACA AAC TAA ATG G 3' E. coli 33
XhoI-murA2-back 5' ATG ATG CTC GAG GCT CAA AAG CCG TTC AGT TTG 3'
E. coli 34 KpnI-murA2-for 5' GCT GCT GGT ACC TGC CAG CGC AAC TTT
GCT C 3' E. coli 35 murA1 extern 5' GTA CAA CCG CCA GGT AGT G 3' E.
coli 36 murA2 extern 5' GTC TGA TTT ATC AGC GAG GC 3' E. coli 37
HindIII-SalI- 5' GCT GCT AAG CTT GTC Cat-back GAC AGC CAC TGG AGC
ACC TC 3' E. coli 38 XhoI-Cat-for 5' ATG ATG CTC GAG ACG GGG AGA
GCC TGA GC 3' E. coli 39 BamHI-T12-for 5' ATG ATG GGA TCC AAA AGG
CCA TCC GTC AGG 3' E. coli 40 HindIII-T12-back 5' GTC GTC AAG CTT
ATA AAA CGA AAG GCT CAG TC 3' E. coli 41 BamHI-placO-back 5' GCT
GCT GGA TCC GCG CCC AAT ACG CAA ACC 3' E. coli 42 NotI-placO-for 5'
ATG ATG ATG GCG GCC GCT GTG AAA TTG TTA TCC GCT C 3'
[0167] If the homology primers are chosen correctly, colonies are
expected after genomic integration only in the presence of IPTG. No
ribosomal binding site (RBS) is provided on the primers
NotI-map/murA-for, as it is intended not to replace the native RBS
by the cassette to keep gene expression pattern as normal as
possible. So the aim is to replace any promoter in front of the
essential gene but to keep the native RBS intact.
[0168] Neither the map nor the murA mutants grew on LB-CM plates
after transformation, but they grew properly on LB-CM plates and
liquid medium containing 0,1 mmol IPTG/L, indicating that the
choice of the primers was correct and plac and the terminators are
functioning properly. However, in further cultivation map mutants
show slight growth on plates and liquid medium without IPTG. As
murA mutants did not show any growth on non-permissive media the
murA construct is chosen as a basis for the selection system.
[0169] b) Generation of Test Constructs for Repressing GFP as a
Surrogate for an Essential Gene
[0170] The principal of the constructs, exemplified by
pBluescriptKSII+, is shown in FIG. 9. The plasmid
pBSKTn7<pLtetOgfp-T7aL3tetR-Cat> is constructed in several
successive cloning steps from pBSKTn7<T7a13GFP> as starting
vector and intermediate plasmids containing the individual
fragments (for primer sequences see Table 5 and 6). The Tn7
homology 1 is amplified from a bacterial template using primers
SacI-Tn7/1-back and EcoRI-Tn7/1-for, Tn7 homology 2 is amplified
using primers XhoI-Tn7/2-back and KpnI-Tn7/2-for, rrnBT12
terminators are amplified using primers EcoRI-T12-back and
HindIII-SalI-T12 for and the cat gene is amplified by primers
HindIII-SalI-Cat-back and XhoI-Cat-for. (Table 5). The tetracyclin
repressor gene (tetR) is amplified from the tetracycline resistant
strain IS1 (HMS174(DE3) ilv500::Tn10) containing Tn10 by primers
NheI-tetR-back and BamHI-tetR-for. The tet-inducible pLtetO
promoter is fully synthesized on a primer
(HindIII-PLtetO-NotI-RBS-GFP back) and together with primer
EcoRI-GFP-for used to amplify gfp. For genomic integration, the
assembled vector pBSKTn7<pLtetOgfp-T7a13tetR-Cat> is again
digested with SacI and NotI to release the desired expression
cassette. TABLE-US-00006 TABLE 6 Additional Primers for test
construct: SEQ ID Org. NO: Primer Sequence E. coli 43 EcoRI-T12- 5'
GCT GCT GAA TTC back ATA AAA CGA AAG GCT CAG TC 3' E. coli 44
HindIII-SalI- 5' GCT GCT AAG CTT T12 for GTC GAC AAA AGG CCA TCC
GTC AGG 3' E. coli 45 EcoRI-Tn7/1- 5' GAT GAT GAA TTC for TAT GTT
TTT AAT CAA ACA TCC TG 3' E. coli 46 SacI-Tn7/1- 5' GAT GAT GAG CTC
back: GTT GCG ACG GTG GTA CG 3' E. coli 47 XhoI-Tn7/2- 5' GAT GAT
CTC GAG back GCA TCC ATT TAT TAC TCA ACC 3' E. coli 48 KpnI-Tn7/2-
5' GAT GAT GGT ACC for TGA AGA AGT TCG CGC GCG 3' E. coli 49
NheI-tetR- 5' GCT GCT GCT AGC back ATG ATG TCT AGA TTA GAT AAA AG
3' E. coli 50 BamHI-tetR- 5' GCT GCT GGA TCC for TTA AGA CCC ACT
TTC ACA TTT AAG 3' A. victoria 51 EcoRI GFP 5' GTC GTC GAA TTC for
TTA TTT GTA TAG TTC ATC CAT GC 3' (A. victoria, 52 HindIII- 5' GCT
GCT AAG CTT E. coii, PLtetO-NotI- TCC CTA TCA GTG ATA Lambda)
RBS-GFP GAG ATT GAC ATC CCT back ATC AGT GAT AGA GAT ACT GAG CAC
ATC GCG GCC GCT TTA AGA AGG AGA TAT ACA TAT GCG TAA AGG AGA AGA AC
3'
[0171] When HMS-GTC containing the plasmid is induced at the start
of cultivation, a slight increase (factor 1.44) in GFP expression
is measured compared to the flask without plasmid. However, this
slight increase (factor 1.43) is also measured in MG 1655-GTC
indicating that this GFP cumulation is probably caused by the
plasmid but not by RNAI-antisense reaction.
[0172] Completely different results are obtained when IPTG is added
when an OD.sub.600nm of 0.5 is reached. Although basal GFP level is
higher, there is a definite raise in GFP expression, when pBR322 is
present in the cell. Here RNAI and its antisense reaction with the
loop3 of RNAII is the antagonist of the inducer IPTG. However, IPTG
is a strong inducer and RNAI-loop3 antisense reaction is
comparatively weak.
[0173] Also a more than double increase (factor 2.29) of GFP is
observed in HMS-GTC pBR322 without induction (Table 7). This can be
explained by the leakiness of T7 system (Studier and Mofatt, 1986)
and is also an indirect proof of the antisense reaction. Due to the
basal level of 17-polymerase, small amounts of TetR are present in
the cell. And since TetR is a strong and efficient repressor
molecule, this small amount is sufficient to suppress GFP
expression to a factor of 2.29. When RNAI from pBR322 is present,
it is able to "handle" the few tetR mRNA molecules and GFP level
raises.
REFERENCES
[0174] Balbas, P., Soberon, X., Bolivar, F. and Rodriguez, R. L.:
The plasmid, pBR322. Biotechnol 10, 5-41 (1988) [0175] Balbas, P.,
(2001). Understanding the Art of Producing Protein and Nonprotein
Molecules in Escherichia coli. Mol. Biotechnol. November;
19(3):251-67. [0176] Bahl., C. P., Wu, R., Stawinsky, J., Narang,
S. A. (1977) Minimal length of the lactose operator sequence for
the specific recognition by the lactose repressor. Proc. Natl.
Acad. Sci. USA 74, 966-970. [0177] Beck, C. F., Mutzel, R. Barbe,
J., Muller, W. A. (1982) A multifunctional gene (tetR) controls
Tn10-encoded tetracycline resistance. J. Bacteriol. 150, 633-642.
[0178] Bernard, P., Couturier, M. (1992). Cell killing by the F
plasmid CcdB protein involves poisoning of DNA topoisomerase II
complexes. J Mol Biol., August 5, 226:3 735-45 [0179] Bhagwat, A.
S. and Person, S.: Structure and properties of the region of
homology between plasmids pMB1 and ColE1. Mol Gen Genet 182,
505-507 (1981) [0180] Bolivar, F.: Molecular cloning vectors
derived from the CoLE1 type plasmid pMB1. Life Sci 25, 807-817
(1979) [0181] Brosius J, Ullrich A, Raker M A, Gray A, Dull T J,
Gutell R R, Noller H F (1981).: Construction and fine mapping of
recombinant plasmids containing the rrnB ribosomal RNA operon of E.
coli. Plasmid. July;6(1):112-8. [0182] Brown, E. D., Vivas, E. I.,
Walsh C. T., Kolter, R. (1995): MurA (MurZ), the enzyme that
catalyzes the first committed step in peptidoglycan biosynthesis,
is essential in Escherichia coli. Journal of Bacteriology, Vol.
177, No. 14, 4194-4197. [0183] Casali, N., (2003), Escherichia coli
host strains. Methods Mol. Biol. 253, 27-48. [0184] Cesare ni, G.,
Helmer-Citterich, M., Castagnoli, L. (1991). Control of ColE1
plasmid replication by antisense RNA. Trends Genet. July 7:7, 230-5
[0185] Chan, P. T., Ohmori, H., Tomizawa, J., Lebowitz, J. (1985).
Nucleotide sequence and gene organization of ColE1 DNA. J Biol
Chem, Jul. 25, 1985, 260:15, 8925-35 [0186] Chang, A. C. Y.,and
Cohen, S. N. Construction and characterization of amplifiable
multicopy DNA cloning vehicles derived from the P15A cryptic
miniplasmid. Journal J. Bacteriol. Vol. 134, 1141 1156, (1978)
[0187] Chang S Y, McGary E C, Chang S. (1989). Methionine
aminopeptidase gene of Escherichia coli is essential for cell
growth. J Bacteriol. July;171(7):4071-2 [0188] Chen, W., Graham,
C., and Ciccare lli, R. B. (1997). Automated fed-batch fermentation
with feed-back controls based on dissolved oxygen (DO) and pH for
production of DNA vaccines. J. Ind. Microbiol. Biotechnol., 18,
43-48. [0189] Craig, N. L: Transposon TN7. In Berg, D. E and Howe,
M. H. (Eds.), Mobile DNA. American Society of Microbiology,
Washington D.C., (1989), 211-225. [0190] Crozat, A., Aman, P.,
Mandahl, N., Ron, D. (1993). Fusion of CHOP to a novel RNA binding
protein in human myoxid liposarcoma. Nature 363, 640-644 [0191]
Datsenko, K., and Wanner, B. (2000). One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR products.
PNAS. June 6, Vol. 97, No. 12, 6640-6645. [0192] Davison, J.
(2002). Towards safer vectors for the field release of recombinant
bacteria. Environ. Biosafety Res. 1:9-18. [0193] DeBoy R T and
Craig N L. (2000), Target site selection by Tn7: attTn7
transcription and target activity. J Bacteriol. 2000
June;182(11):3310-3. [0194] Diaz, R. and Staudenbauer, W. L.:
Origin and direction of mini-R1 plasmid DNA replication in cell
extracts of Escherichia coli. J Bacteriol. (1982) June; 150(3):
1077-1084 [0195] Eguchi, Y., Itoh, T., Tomizawa, J. (1991a).
Antisense RNA. Annu Rev Biochem 60:631-52. [0196] Eguchi, Y., and
Tomizawa, J. (1991b). Complexes formed by complementary RNA stem
loops: Their formations, structures and interaction with ColE1 Rom
protein. J Mol Biol 220:831-842. [0197] F{umlaut over (r)}ste, J.,
Pansegrau, W., Frank, R., Blocker, H., Scholz, P., Bagdasarian, M.,
Lanka, E. (1986). Molecular cloning of the plasmid RP4 primase
region in a multi-host-range tacP expression vector. Gene,
48:119-131. [0198] Gay, P., Le Coq, D., Steinmetz, M., Ferrari, E.,
Hoch, J. A. (1983). Cloning structural gene sacB, which codes for
exoenzyme levansucrase of Bacillus subtilis: expression of the gene
in Escherichia coli. J Bacteriol., March;153(3):1424-31. [0199]
Gerdes S. Y., Scholle M. D., D'Souza M., Bernal A., Baev M. V.,
Farrell M., Kurnasov O. V., Daugherty M. D., Mseeh F., Polanuyer B.
M., Campbell J. W., Anantha S., Shatalin K. Y., Chowdhury S. A. K.,
Fonstein M. Y., Osterman A. L. (2002). From genetic footprinting to
antimicrobial drug targets: Examples in cofactor biosynthetic
pathways. Journal of Bacteriology, August 2002, Vol.184, No. 16, pp
4555-4572. [0200] Gerdes S Y, Scholle M D, Campbell J W, Balazsi G,
Ravasz E, Daugherty M D, Somera A L, Kyrpides N C, Anderson I,
Gelfand M S, Bhattacharya A, Kapatral V, D'Souza M, Baev M V,
Grechkin Y, Mseeh F, Fonstein M Y, Overbeek R, Barabasi A L, Oltvai
Z N, Osterman A L. (2003) Experimental determination and system
level analysis of essential genes in Escherichia coli MG1655. J
Bacteriol. 185, 5673-84. [0201] Gilbert, W. and Maxam, A. (1973)
Proc. Natl. Acad. Sci. USA 70, 3581-3584. [0202] Gregorian, R., and
Crothers, D. (1995). Determinants of RNA Hairpin Loop-Loop Complex
Stability. J Mol Biol 248:968-984. [0203] Guzman, L. M., Belin, D.,
Carson, M., Beckwith, J. (1995). Tight regulation, modulation, and
high-level expression by vectors containing the arabinose pBAD
Promoter. Journal of Bacteriology. Vol. 177, 14: 4121-4130. [0204]
Hagg, P., Wa de Pohl, J., Abdulkarim, F., Isaksson, L. (2004) A
host/plasmid system that is not dependent on antibiotic resistance
genes for stable plasmid maintenance in Escherichia coli. J.
Biotechnology 111, 17-30. [0205] Haidinger, W., Szostak, M. P.,
Jechlinger, W., Lubitz, W. Online monitoring of Escherichia coli
ghost production. Appl. Environ. Microbiol. January 2002, 468-474.
[0206] Helinski, Toukdarian, A. and Novick, R.: Replication control
and other stable maintenance mechanisms of plasmids. In:
Escherichia coli and Salmonella. Cellular and Molecular Biology.
Ed: Neidhardt F., American Society for Microbiology Press,
Washington, D.C., 2295-2324 (1996) [0207] Herring, C. D., Blattner,
F. R. (2004). Conditional lethal amber mutations in essential
Escherichia coli genes. Journal of Bacteriology, Vol. 186, No. 9,
2673-2681. [0208] Jacob, F., Monod, J. (1961) Genetic regulatory
mechanism in the synthesis of proteins. Journal of Molecular
Biology 3, 318-356. [0209] Jensen, L. B., Ramos, J. L., Kaneva, Z.,
Molin, S. (1993). A substrate-dependent biological containment
system for Pseudomonas putida based on the Escherichia coli gef
gene. Appl Environ Microbiol., November 59:11, 3713-7 [0210]
Jonasson, P., et al., (2002). Genetic design for facilitated
production and recovery of recombinant proteins in Escherichia
coli. Biotechnol. Appl. Biochem. 35, 91-105 [0211] Kaplan, D. L.,
Mello, C., Sano, T., Cantor, C., Smith, C. (1999).
Streptavidin-based containment systems for genetically engineered
microorganisms. Biomol Eng Dec. 31 1999, 16:1-4 135-40. [0212]
Klemm, P., Jensen, L. B., Molin, S. (1995). A stochastic killing
system for biological containment of Escherichia coli. Appl Environ
Microbiol. February 61:2, 481-6. [0213] Knudsen, S., Saadbye, P.,
Hansen, L. H., Collier, A., Jacobsen, B. L., Schlundt, J.,
Karlstrom, O. H. (1995). Development and testing of improved
suicide functions for biological containment of bacteria. Appl
Environ Microbiol., March 61:3 985-91. [0214] Kues, U. and Stahl,
U. (1989): Replication of plasmids in gram negative bacteria.
Microbiol Rev 53, 491-516 [0215] Lahijani, R., Hulley, G., Soriano,
G., Horn, N. A., and Marquet, M. (1996). High-yield production of
pBR322-derived plasmids intended for human gene therapy by
employing a temperature-controllable point mutation. Hum. Gene
Ther. 7, 1971-1980. [0216] Li J Y, Chen L L, Cui Y M, Luo Q L, Gu
M, Nan F J, Ye Q Z. Characterization of full length and truncated
type I human methionine aminopeptidases expressed from Escherichia
coli. (2004) Biochemistry 43, 7892-8. [0217] Lin, E. C. C.,
Bacteria, Plasmids, and Phages: An Introduction to Molecular
Biology. (1984). Cambridge, Mass.: Harvard University Press, 11-18.
[0218] Lin-Chao, S., and Cohen, S. N. (1991). The rate of
processing and degradation of antisense RNA I regulates the
replication of ColE1-type plasmids in vivo. Cell. June 28, 65:7
1233-42. [0219] Malmgren, C., Engdahl, H., Romby, B., Wagner, G.
(1996). An antisense/target RNA duplex or a strong intramolecular
RNA structure 5' of a translation initiation signal blocks ribosome
binding: The case of plasmid R1. RNA 1: 1022-1032. [0220] Merlin,
S., and Polisky, B. (1995). Assessment of quantitative models for
plasmid ColE1 copy number control. J Mol Biol., April 28, 248:2,
211-9 [0221] O'Kennedy, R. D., Baldwin, C., and Keshavarz-Moore,
E., (2000). Effects of growth medium selection on plasmid DNA
production and initial processing steps. J. Biotechnol. 76,
175-183. [0222] O'Kennedy et al., (2003). Effects of fermentation
strategy on the characteristics of plasmid DNA production.
Biotechnol Appl. Biochem. 34, 83-90. [0223] Postle, K., Nguyen, T.
T., Bertrand, K. P. (1984) Nucleotide sequence of the repressor
gene of the TN10 tetracycline resistance determinant. Nucleic Acids
Res. 12, 4849-4863. [0224] Rawlings, D. E. (1999) Proteic
toxin-antitoxin, bacterial plasmid addiction systems and their
evolution with special reference to the pas system of pTF-FC2. FEMS
Microbiology Letters, 176, 269 277. [0225] Reinikainen, P.,
Korpela, K., Nissinen, V., Olkku, J., Soderlund, H., and Markkanen,
P. (1988). Escherichia coli plasmid production in Fermenter.
Biotech. Bioeng. 33, 386-393. [0226] Ringquist, S., MacDonald, M.,
Gibson, T., Gold, L. (1993). Nature of the ribosomal mRNA track:
Analysis of ribosome-binding sites containing different sequences
and secondary structures. Biochemistry. 32:10254-10262. [0227]
Rogers, M., Ekaterinaki, N., Nimmo, E., Sherratt, D., Analysis of
Tn7 transposition. Mol Gen Genet (1986), December 205:3 550-6
[0228] Ronchel, M. C., Molina, L., Witte, A., Lubitz, W., Molin,
S., Ramos, J.1., Ramos, C. (1998), Characterization of cell lysis
in Peudomonas putida induced upon expression of heterologous
killing genes. Appl. Environ. Microbiol. 64: 4904-4911. [0229]
Rouch, D. A., Brown N. L. (1997) Copper-inducible transcriptional
regulation at two promoters in the Escherichia coli copper
resistance determinant pco. Microbiology 143, 1191-1202. [0230]
Sano, T., Pandori, M., Chen, X., Smith, C., Cantor, C. (1995).
Recombinant core streptavidins. The Journal of Biological
Chemistry. Vol. 270, 47: 28204-28209. [0231] Studier, F. W.,
Moffatt, B. A. (1986). Use of bacteriophage T7 RNA polymerase to
direct selective high-level expression of cloned genes. J Mol
Biol., May 5, 189:1 113-30. [0232] Szafranski, P., Mello, C. M.,
Sano, T., Smith, C. L., Kaplan, D. L., Cantor, C. R. (1997). A new
approach for containment of microorganisms: dual control of
streptavidin expression by antisense RNA and the T7 transcription
system. Proc Natl Acad Sci USA. February 18, 94:4 1059-63. [0233]
Tomizawa, J. and Itoh, T. (1981). Plasmid ColE1 incompatibility
determined by interaction of RNA I with primer transcript. Proc
Natl Acad Sci USA 78, 6096-6100 [0234] Tomizawa, J. (1984). Control
of ColE1 plasmid replication: the process of binding of RNA I to
the primer transcript. Cell 38, 861-870 [0235] Tomizawa, J. (1986).
Control of Plasmid Replication: Binding of RNA I to RNA II and
Inhibition of Primer Formation. Cell. 47:89-97. [0236] Tomizawa, J.
(1989). Control of ColE1 Plasmid Replication: Intermediates in the
binding of RNA I and RNA II. J Mol Biol 212:683-694. [0237]
Tomizawa J. (1990). Control of ColE1 plasmid replication.
Interaction of Rom protein with an unstable complex formed by RNA I
and RNA II. J Mol Biol. April 20; 212(4):695-708 [0238] Torres, B.,
Jaenecke, S., Timmis, K. N., Garcia, J. L., Diaz, E. (2000). A gene
containment strategy based on a restriction-modification system.
Environ Microbiol., October 2:5, 555-63. [0239] Tsien, R. Y.
(1998). The green fluorescent protein. Annu Rev Biochem., 67:509-44
[0240] Vieira, J. and Messing, J.: The pUC plasmids, an
M13mp7-derived system for insertion mutagenesis and sequencing with
synthetic universal primers. Gene 19, 259-268 (1982) [0241]
Waddell, C. S., and Craig, N. L. (1988), Tn7 transposition: two
transposition pathways directed by five Tn7-encoded genes. Genes
Dev, February 2:2, 137-49 [0242] Wang, et al. (2001). Medium design
for Plasmid DNA based on stoichimetric model. Proc. Biochem. 36,
1085-1093. [0243] Wiliams, S., Cranenburgh, R., Weiss, A. Repressor
titration: a novel system for selection and stable maintenance of
recombinant plasmids. Nucleids Acids Research, (1998), Vol 26, No.
9; 2120-2124 [0244] Yanofski, C., Crawford, I. P. (1987) The
tryptophan operon. In Neidhardt, F. C., Ingraham, J. L., Low, K.
B., Magasanik, B., Schaechter, M., Umbarger, H. E., editors:
Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B.,
Schaechter, M., Umbarger, H. E. Escherichia coli and Salmonella
typhimurium: cellular and bolecular biology. Washington D.C.,
American Society for Microbiology, pp1453-1472. [0245] Yu, D.,
Ellis, H., Lee, C., Jenkins, N., Copeland, N., Court, D. (2000). An
efficient recombination system for chromosome engineering in
Escherichia coli. PNAS. May 23, Vol. 987, No. 11, 5978-5983. [0246]
Zhang, Y., Nelson, M., Nietfeldt, J., Burbank, D. E., Van Etten, J.
L. (1992). Characterization of Chlorella virus PBCV-1 CviAII
restriction and modification system. Nucleic Acids Research, Vol.
20, 20: 5351 5356. [0247] Zuker, M., Mathews, D., Turner, D.
(1999), Algorithms and Thermodynamics for RNA Secondary Structure
Prediction: A Practical Guide. In RNA Biochemistry and
Biotechnology, J. Barciszewski & B. F. C. Clark, eds., NATO ASI
Series, Kluwer Academic Publishers.
Sequence CWU 1
1
53 1 159 DNA Artificial sequence Primer 1 gaaattaata cgactcacta
tagggaacaa aaaaaccacc gctaccagcg gtggtttgtt 60 tgcctctagt
tcagctacca actgaaggag agaatacata tggctaaagg agaagaactt 120
ttcactggag ttgtcccaat tcttgttgaa ttagatggt 159 2 161 DNA Artificial
sequence Primer 2 gaaattaata cgactcacta tagggcctct agaaataatt
ttgtttaact ttaagaagga 60 gatatacata tgcggatcaa gagctaccaa
ctcttgttcc gatggctaaa ggagaagaac 120 ttttcactgg agttgtccca
attcttgttg aattagatgg t 161 3 45 DNA Artificial sequence Primer 3
gaaattaata cgactcacta tagggacagt atttggtatc tgcgc 45 4 20 DNA
Artificial sequence Primer 4 aacaaaaaaa ccaccgctac 20 5 45 DNA
Artificial sequence Primer 5 gaaattaata cgactcacta taggggcaaa
caaaaaaacc accgc 45 6 20 DNA Artificial sequence Primer 6
acagtatttg gtatctgcgc 20 7 23 DNA Artificial sequence Primer 7
gaaattaata cgactcacta tag 23 8 23 DNA Artificial sequence Primer 8
accatctaat tcaacaagaa ttg 23 9 25 DNA Artificial sequence Primer 9
gatgatgcta gcaaaggaga agaac 25 10 27 DNA Artificial sequence Primer
10 gatgatggat ccttatttgt atagttc 27 11 122 DNA Artificial sequence
Primer 11 taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta
gaaataattt 60 tgtttaactt taagaaggag atacatatgg gtaactggct
tcagcagagc gcagatacca 120 tg 122 12 33 DNA Artificial sequence
Primer 12 atcatcgcta gccatggtat ctgcgctctg ctg 33 13 123 DNA
Artificial sequence Primer 13 taatacgact cactataggg gaattgtgag
cggataacaa ttccccaaca aaaaaaccac 60 cgctaccagc ggtggtttgt
ttgcctctag ttcagctacc aactgaagga gagaatacat 120 atg 123 14 31 DNA
Artificial sequence Primer 14 atcatcgcta gccatatgta ttctctcctt c 31
15 119 DNA Artificial sequence Primer 15 gatgataagc tttaatacga
ctcactatag gggaattgtg agcggataac aattcccctc 60 tagaaataat
tttgtttaac tttaagaagg agatatacat atggctagca aaggagaag 119 16 32 DNA
Artificial sequence Primer 16 gatgataagc tttaatacga ctcactatag gg
32 17 31 DNA Artificial sequence Primer 17 gatgatctcg agcaaaaaac
ccctcaagac c 31 18 31 DNA Artificial sequence Primer 18 agtagtgaat
tccaaaaaac ccctcaagac c 31 19 31 DNA Artificial sequence Primer 19
gatgatgcgg ccgcgttgcg acggtggtac g 31 20 35 DNA Artificial sequence
Primer 20 gatgatgaat tctatgtttt taatcaaaca tcctg 35 21 33 DNA
Artificial sequence Primer 21 gatgatctcg aggcatccat ttattactca acc
33 22 30 DNA Artificial sequence Primer 22 gatgatggta cctgaagaag
ttcgcgcgcg 30 23 16 DNA Artificial sequence Primer 23 accggcgcag
ggaagg 16 24 18 DNA Artificial sequence Primer 24 tggcgctaat
tgatgccg 18 25 44 DNA Artificial sequence Primer 25 atgatgatgg
cggccgcacc gacgctgatg gacagaatta atgg 44 26 32 DNA Artificial
sequence Primer 26 gctgctgagc tcccatcttt gattacggtg ac 32 27 29 DNA
Artificial sequence Primer 27 atgatgctcg agcgccaaac gtgccactg 29 28
31 DNA Artificial sequence Primer 28 gctgctggta ccgaagtgaa
caccagcctt g 31 29 19 DNA Artificial sequence Primer 29 ttcgggttcc
agtaacggg 19 30 19 DNA Artificial sequence Primer 30 tttcgaggta
tcgccgtgg 19 31 30 DNA Artificial sequence Primer 31 gctgctgagc
tccaaagcgc gctaccagcg 30 32 40 DNA Artificial sequence Primer 32
atgatgatgg cggccgctta actgagaaca aactaaatgg 40 33 33 DNA Artificial
sequence Primer 33 atgatgctcg aggctcaaaa gccgttcagt ttg 33 34 31
DNA Artificial sequence Primer 34 gctgctggta cctgccagcg caactttgct
c 31 35 19 DNA Artificial sequence Primer 35 gtacaaccgc caggtagtg
19 36 20 DNA Artificial sequence Primer 36 gtctgattta tcagcgaggc 20
37 35 DNA Artificial sequence Primer 37 gctgctaagc ttgtcgacag
ccactggagc acctc 35 38 29 DNA Artificial sequence Primer 38
atgatgctcg agacggggag agcctgagc 29 39 30 DNA Artificial sequence
Primer 39 atgatgggat ccaaaaggcc atccgtcagg 30 40 32 DNA Artificial
sequence Primer 40 gtcgtcaagc ttataaaacg aaaggctcag tc 32 41 30 DNA
Artificial sequence Primer 41 gctgctggat ccgcgcccaa tacgcaaacc 30
42 37 DNA Artificial sequence Primer 42 atgatgatgg cggccgctgt
gaaattgtta tccgctc 37 43 32 DNA Artificial sequence Primer 43
gctgctgaat tcataaaacg aaaggctcag tc 32 44 36 DNA Artificial
sequence Primer 44 gctgctaagc ttgtcgacaa aaggccatcc gtcagg 36 45 35
DNA Artificial sequence Primer 45 gatgatgaat tctatgtttt taatcaaaca
tcctg 35 46 29 DNA Artificial sequence Primer 46 gatgatgagc
tcgttgcgac ggtggtacg 29 47 33 DNA Artificial sequence Primer 47
gatgatctcg aggcatccat ttattactca acc 33 48 30 DNA Artificial
sequence Primer 48 gatgatggta cctgaagaag ttcgcgcgcg 30 49 35 DNA
Artificial sequence Primer 49 gctgctgcta gcatgatgtc tagattagat
aaaag 35 50 36 DNA Artificial sequence Primer 50 gctgctggat
ccttaagacc cactttcaca tttaag 36 51 35 DNA Artificial sequence
Primer 51 gtcgtcgaat tcttatttgt atagttcatc catgc 35 52 116 DNA
Artificial sequence Primer 52 gctgctaagc tttccctatc agtgatagag
attgacatcc ctatcagtga tagagatact 60 gagcacatcg cggccgcttt
aagaaggaga tatacatatg cgtaaaggag aagaac 116 53 24 DNA Escherichia
coli Operator 53 tggaattgtg agcggataac aatt 24
* * * * *
References