U.S. patent application number 11/222626 was filed with the patent office on 2006-03-23 for compositions and methods for the detection of dna topoisomerase ii complexes with dna.
Invention is credited to Donald A. Baldwin, Carolyn A. Felix.
Application Number | 20060063184 11/222626 |
Document ID | / |
Family ID | 36074505 |
Filed Date | 2006-03-23 |
United States Patent
Application |
20060063184 |
Kind Code |
A1 |
Felix; Carolyn A. ; et
al. |
March 23, 2006 |
Compositions and methods for the detection of DNA topoisomerase II
complexes with DNA
Abstract
Compositions, methods, and kits for detecting DNA topoisomerase
II-DNA complexes are disclosed.
Inventors: |
Felix; Carolyn A.; (Ardmore,
PA) ; Baldwin; Donald A.; (Newtown Square,
PA) |
Correspondence
Address: |
DANN, DORFMAN, HERRELL & SKILLMAN
1601 MARKET STREET
SUITE 2400
PHILADELPHIA
PA
19103-2307
US
|
Family ID: |
36074505 |
Appl. No.: |
11/222626 |
Filed: |
September 9, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60608331 |
Sep 9, 2004 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/91.2 |
Current CPC
Class: |
C12Q 1/6876 20130101;
C12Q 2600/142 20130101; C12Q 2600/156 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Goverment Interests
[0002] Pursuant to 35 U.S.C. .sctn.202(c) it is acknowledged that
the U.S. Government has certain rights in the invention described
herein, which was made in part with funds from the National
Institutes of Health, Grant Numbers RO1 CA77683, CA85469, and
CA80175.
Claims
1. A method for identifying sequences present in DNA topoisomerase
H-DNA complexes in cells, comprising: a) providing cells suspected
of containing DNA topoisomerase H-DNA complexes; b) isolating DNA
topoisomerase H-DNA complexes from the cell; c) amplifying the DNA
present in said isolated DNA topoisomerase H-DNA complexes via
polymerase chain reaction; and d) identifying the sequences present
in said amplified DNA, thereby identifying the sequences present in
said DNA topoisomerase II-DNA complexes.
2. The method of claim 1, wherein the DNA in said DNA topoisomerase
11-DNA complexes is genomic DNA.
3. The method of claim 1, wherein the identification of the
sequences in step d) comprises further amplifying the amplified DNA
from step c) with gene specific primers.
4. The method of claim 1, wherein the identification of the
sequences in step d) comprises further amplifying the amplified DNA
from step c) by real-time PCR.
5. The method of claim 1, wherein the identification of the
sequences in step d) comprises hybridizing the amplified DNA from
step c) with a microarray.
6. The method of claim 1, wherein said cells are CD34+ cells.
7. The method of claim 1, wherein said amplified DNA of step c)
comprises sequences from the MLL gene.
8. The method of claim 1, wherein said cells are exposed to an
agent suspected of modulating formation of topoisomerase cleavage
complexes.
9. The method of claim 5, wherein said microarray comprises MLL bcr
oligonucleotide sequences.
10. The method of claim 9, wherein said MLL bcr oligonucleotide
sequences hybridize to non-repetitive MLL bcr sequences.
11. The method of claim 9, wherein said microarray further
comprises oligonucleotide sequences from the Alu region between
nucleotide positions 663-1779 in the MLL bcr.
12. The method of claim 9, wherein said microarray further
comprises control sequences which are not involved in MLL
translocations.
13. The method of claim 13, wherein said control sequences are
selected from the group consisting of MLL exon 25, MLL exon 3,
GAPDH, c-myc, and bacterial gene sequences.
14. The method of claim 9, wherein said microarray further
comprises oligonucleotide sequences from MLL partner genes.
15. The method of claim 14, wherein said MLL partner genes are
selected from the group consisting of LAF-4, AF4 (MLLT2, FEL),
AF5.alpha., AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17,
ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1),
AF15q14, AF1p (eps1S), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17,
ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM,
LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.
16. The method of claim 5, wherein said microarray comprises
oligonucleotide sequences from MLL partner genes.
17. The method of claim 16, wherein said MLL partner genes are
selected from the group consisting of LAF-4, AF4 (MLLT2, FEL),
AF5.alpha., AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17,
ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1),
AF15q14, AF1p (eps15), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17,
ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM,
LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.
18. The method of claim 9, wherein the microarray comprises
oligonucleotide sequences comprising SEQ ID NOs 1-162.
19. The method of claim 9, wherein the microarray comprises
oligonucleotide sequences comprising SEQ ID NOs 163-246.
20. The method of claim 1, wherein said isolating of DNA
topoisomerase II-DNA complexes of step b) comprises lysing said
cells and immunoprecipitating said DNA topoisomerase 11-DNA
complexes.
21. A microarray comprising MLL bcr oligonucleotide sequences.
22. The microarray of claim 21, wherein said MLL bcr
oligonucleotide sequences hybridize to non-repetitive MLL bcr
sequences.
23. The microarray of claim 21, wherein said microarray further
comprises oligonucleotide sequences from the Alu region between
nucleotide positions 663-1779 in the MLL bcr.
24. The microarray of claim 21, wherein said microarray further
comprises control sequences which are not involved in MLL
translocations.
25. The microarray of claim 24, wherein said control sequences are
selected from the group consisting of MLL exon 25, MLL exon 3,
GAPDH, c-myc, and bacterial gene sequences.
26. The microarray of claim 21, wherein said microarray further
comprises oligonucleotide sequences from MLL partner genes.
27. The microarray of claim 26, wherein said MLL partner genes are
selected from the group consisting of LAF-4, AF4 (MLLT2, FEL),
AF5.alpha., AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17,
ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1),
AF15q14, AF1p (eps1S), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17,
ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM,
LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.
28. A microarray comprising oligonucleotide sequences from MLL
partner genes.
29. The microarray of claim 28, wherein said MLL partner genes are
selected from the group consisting of LAF-4, AF4 (MLLT2, FEL),
AF5.alpha., AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17,
ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1),
AF15q14, AF1p (eps15), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17,
ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM,
LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.
30. The microarray of claim 21, wherein the microarray comprises
oligonucleotide sequences comprising SEQ ID NOs 1-162.
31. The microarray of claim 21, wherein the microarray comprises
oligonucleotide sequences comprising SEQ ID NOs 163-246.
32. A kit for performing the method of claim 1.
33. The kit of claim 32, comprising: a) an agent and a buffer for
lysing cells; b) a solid support and a buffer for isolating DNA-DNA
topoisomerase II complexes; c) at least one primer and a buffer for
PCR amplification of isolated DNA by whole genome amplification; d)
at least one first detectable label for incorporation into products
of whole genome amplification; e) calibrated reference standard DNA
comprising a second detectable label; f) a microarray comprising
oligonucleotide sequences from the MLL bcr; and g) instruction
material.
Description
[0001] This application claims priority under 35 U.S.C. .sctn.
119(e) to U.S. Provisional Patent Application No. 60/608,331, filed
on Sep. 9, 2004. The foregoing application is incorporated by
reference herein.
FIELD OF THE INVENTION
[0003] The present invention relates to the fields of molecular
biology and oncology. More specifically, the invention provides
compositions and methods for detection of DNA topoisomerase II
complexes with genomic DNA.
BACKGROUND OF THE INVENTION
[0004] Several publications and patent documents are cited
throughout the specification in order to describe the state of the
art to which this invention pertains. Each of these citations is
incorporated herein by reference as though set forth in full.
[0005] Epipodophyllotoxins and anthracyclines, which are commonly
used chemotherapeutic DNA topoisomerase II inhibitors, more
accurately are called DNA topoisomerase II poisons because they
increase the concentration of DNA topoisomerase II cleavage
complexes and have the overall effect of enhancing cleavage, which
is cytotoxic (1). These agents are associated with leukemia as a
treatment complication (2). Most DNA topoisomerase II
inhibitor-related leukemias have MLL (myeloid lymphoid leukemia)
translocations (3). The translocations disrupt an 8.3 kb bcr
between exons 5-11 of the .about.100 kb MLL gene at chromosome band
11q23. The association of DNA topoisomerase II inhibitors with
leukemia has suggested a translocation mechanism that involves
chromosomal breakage from drug-stabilized DNA topoisomerase II
cleavage and formation of the breakpoint junctions when the
breakage is repaired (2). The drug stabilized complexes have been
called ternary (drug-DNA-topoisomerase II) complexes in the
literature. In previous reports, MLL translocations have been
characterized and tracked in leukemias in two patients receiving
chemotherapy (Megonigal 2000; Blanco 2001), and the role of
chemotherapy-stabilized DNA topoisomerase II cleavage in the
translocation process has been investigated in in vitro assays of
DNA substrates outside of the cellular context (Lovett, 2001;
Lovett 2001; Whitmarsh 2003). However, cell death from chemotherapy
also forces bone marrow progenitor cell proliferation (4) and
native DNA topoisomerase II.alpha. expression is highest in
proliferating cells (5, 6).
[0006] Genomic breakpoint junctions on derivative chromosomes
arising from MLL translocations were cloned in two cases of
leukemia following intensive neuroblastoma regimens (7, 8). Such
chemotherapy regimens have been associated with a high incidence of
leukemia as a treatment complication (9).
SUMMARY OF THE INVENTION
[0007] It is an objective of the present invention to provide
compositions and methods for detecting ternary topoisomerase II/DNA
complexes with cytotoxic chemotherapy drugs (e.g., DNA
topoisomerase II poisons) or with natural compounds that have
similar activity, as well as topoisomerase II complexes with DNA
formed by the native enzyme as a means to assess strategies to
prevent the oncogenic events associated with chemotherapy and
exposure to natural topoisomerase II inhibitors.
[0008] In addition, it is known that cytotoxic chemotherapy may
cause cell death that is followed by bone marrow progenitor cell
proliferation with accompanying increased native DNA topoisomerase
II expression. A patient has recently bee identified with leukemia
with an MLL translocation which emerged after chemotherapy that did
not include a DNA topoisomerase II poison (Langer, 2003).
Accordingly, it is another objective of the present invention to
provide compositions and methods for detecting topoisomerase II/DNA
complexes that are formed by the native enzyme at elevated levels,
and as a means to prevent leukemogenic events associated with
chemotherapy.
[0009] Thus, in accordance with the present invention,
compositions, methods, and kits are provided for the detection of
topoisomerase II-genomic DNA complexes. The detection of such
complexes can be indicative of DNA damage, particularly in relation
to treatment-related leukemia. An exemplary method entails
providing cells which express topoisomerase II and exposing the
cells to an agent suspected of inducing formation of
agent-topoisomerase-DNA cleavage complexes for a time period
sufficient for such complexes to form. The cells are then lysed and
DNA-topoisomerase cleavage complexes are isolated. Alternatively,
the cells can be exposed to agents that result in increased
expression of topoisomerase II without formation of
agent-topoisomerase-DNA cleavage complexes, in which topoisomerase
II-DNA cleavage complexes can be measured. Following isolation, the
DNA present in the isolated complexes can be amplified by
degenerative oligonucleotide PCR and then assayed by real-time PCR
with primers specific for the region of interest, such as, for
example, the MLL breakpoint cluster region (bcr). Alternatively or
additionally, the DNA present in the isolated complexes that has
been amplified by degenerative oligonucleotide PCR can be labeled
with a detectable label. The optionally labeled DNA is then
characterized via hybridization to predetermined sequences present
in the region of genomic DNA where the complexes form in order to
characterize the sites of complex formation with DNA at the
sequence level. In one aspect of the invention, the predetermined
sequences are present on a microarray. According to another aspect,
the genomic DNA sequences are from the MLL bcr. According to
another aspect, the genomic DNA sequences, with or without DNA
sequences from the MLL bcr, comprise partner genes which are fused
with MLL in certain leukemias. In accordance with another aspect of
the invention, the genomic DNA sequences are sequences associated
with leukemia. In accordance with yet another aspect of the
invention, the genomic DNA sequences comprise the entire human
genome.
[0010] In accordance with another aspect of the instant invention,
a method for identifying sequences present in DNA topoisomerase
II-DNA complexes in cells is provided. The method comprises: a)
providing cells suspected of containing DNA topoisomerase II-DNA
complexes; b) isolating DNA topoisomerase II-DNA complexes from the
cell; c) amplifying the DNA present in isolated DNA topoisomerase
II-DNA complexes via polymerase chain reaction; and d) identifying
the sequences present in said amplified DNA, thereby identifying
the sequences present in said DNA topoisomerase II-DNA complexes.
In a preferred embodiment, the DNA in the DNA topoisomerase II-DNA
complexes is genomic DNA. In a particular embodiment, the
identification of the sequences in step d) comprises 1) further
amplifying the amplified DNA from step c) with gene specific
primers; 2) further amplifying the amplified DNA from step c) by
real-time PCR; and/or 3) hybridizing the amplified DNA from step c)
with a microarray, such as those described hereinbelow. In another
embodiment, the cells are CD34+ cells. Additionally, the amplified
DNA of step c) may comprise sequences from the MLL gene. According
to another aspect of the invention, the cells are exposed to an
agent suspected of modulating formation of topoisomerase cleavage
complexes.
[0011] In yet another aspect of the invention, microarrays are
provided. In a particular embodiment, the microarray comprises at
least one of the group consisting of MLL bcr oligonucleotide
sequences and oligonucleotide sequences of MLL partner genes. In
another embodiment, the MLL bcr oligonucleotide sequences hybridize
to non-repetitive MLL bcr sequences. The microarrays may also
further comprise oligonucleotide sequences from the Alu region
between nucleotide positions 663-1779 in the MLL bcr and/or control
sequences which are not involved in MLL translocations. Examples of
control sequences include, without limitation, MLL exon 25, MLL
exon 3, GAPDH, c-myc, and bacterial gene sequences. MLL partner
genes include, without limitation, LAF-4, AF4 (MLLT2, FEL),
AF5.alpha., AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17,
ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1),
AF15q14, AF1p (eps15), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17,
ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM,
LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL. In a
particular embodiment of the invention, the microarray comprises
oligonucleotide sequences of at least one of SEQ ID NOs 1-162. In
another particular embodiment of the invention, the microarray
comprises oligonucleotide sequences of at least one of SEQ ID NOs
163-246.
[0012] In accordance with yet another aspect of the instant
invention, kits are provided for performing the methods of the
instant invention, such as for the detection of DNA-DNA
topoisomerase II complexes and the sequences of the DNA of these
complexes. The kits may comprise any or all of the following: an
agent and a buffer for lysing cells; a solid support; a buffer for
isolating DNA-DNA topoisomerase II complexes; at least one primer
for use in whole genome amplification method; a buffer for PCR
amplification of isolated topoisomerase II bound DNA; primers and
buffer for real-time PCR analysis of specific genes in the
isolated, topoisomerase II-bound DNA that has been amplified by a
whole genome amplification method; at least one detectable label
for comparative labeling of topoisomerase II bound DNA from two
cell populations that has been amplified by a whole genome
amplification method or comparative labeling of topoisomerase II
bound DNA from one cell population that has been amplified by a
whole genome amplification method and a calibrated control DNA;
calibrated control DNA for labeling and hybridization to the
microarray at the same time as the test sample labeled with another
detectable label; a microarray comprising sequences from at least
one of the group consisting of the MLL bcr and MLL partner genes
and, optionally, control sequences; and instruction material. In a
particular aspect of the invention, the kit comprises: a) an agent
and a buffer for lysing cells; b) a solid support and a buffer for
isolating DNA-DNA topoisomerase II complexes; c) at least one
primer and a buffer for PCR amplification of isolated DNA by whole
genome amplification; d) at least one first detectable label for
incorporation into products of whole genome amplification; e)
calibrated reference standard DNA comprising a second detectable
label; f) a microarray comprising oligonucleotide sequences from
the MLL bcr; and g) instruction material.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] FIG. 1A is a summary of the clinical course and treatment of
patient t-120 and the Southern blot and PCR analysis of sequential
bone marrow specimens. The chemotherapy cycles administered
according to the Memorial Sloan-Kettering N7 regimen were CAV
(cyclophosphamide 4200 mg/m.sup.2, doxorubicin 75 mg/M.sup.2,
vincristine 1.5 mg/m.sup.2) or PVP (cisplatin 200 mg/m.sup.2,
etoposide 600 mg/m.sup.2). 3F8* indicates radiolabeled anti-GD2
monoclonal antibody treatment. (+) or (-) indicates detection of
MLL translocation by Southern blot analysis or by nested PCR with
gene-specific primers. FIG. 1B is a gel of a Southern blot analysis
of MLL breakpoint cluster region (bcr) rearrangements in sequential
marrow specimens. FIG. 1C is a gel of Clonotypic PCR analysis
(Round 1) and nested clonotypic PCR analysis of the der(4) genomic
breakpoint junction in sequential marrow specimens.
[0014] FIGS. 2A and 2B are images of autoradiographs showing the
cleavage products after 10 min incubation at 37.degree. C. of 25 ng
(30,000 cpm) singly 5' end-labeled DNA with 147 nM human DNA
topoisomerase II.alpha., 1 mM ATP and, where indicated, 20 .mu.M
etoposide (VP16), etoposide catechol (VP16-OH), etoposide quinone
(VP16-Q), or doxorubicin (ADR). FIG. 2A is an analysis of normal
homologues of MLL genomic breakpoint sequences in ALL (acute
lymphoblastic leukemia) of patient t-120. DNA topoisomerase II
cleavage of MLL intron 8 coordinates 6513 to 6778. FIG. 2B is an
analysis of normal homologues of AF-4 genomic breakpoint sequences
in ALL of patient t-120 in DNA topoisomerase II in vitro cleavage
assays. DNA topoisomerase II cleavage of AF-4 intron 3 coordinates
6956 to 7239. The indicated reactions were incubated for an
additional 10 min at 75.degree. C. before trapping of covalent
complexes. The 5' side (-1 position) of the cleavage sites are
shown. Corkscrew arrows at far right indicate translocation
breakpoints. FIGS. 2C and 2D demonstrate the effects of doxorubicin
over a range of concentrations on the cleavage of the MLL (FIG. 2C)
and AF-4 (FIG. 2D) substrates.
[0015] FIGS. 3A and 3B are schematic drawings of models for
processing of cleavage sites to form der(11) and der(4) genomic
breakpoint junctions in ALL of patient t-120. In FIG. 3A, DNA
topoisomerase II cleavage sites at MLL intron 8 position 6588 and
AF-4 intron 3 position 7126 with 4-base 5' overhangs are shown at
the top. The cleavage at MLL (fragment shown is SEQ ID NO: 258)
intron 8 position 6588 was detected in the presence of etoposide,
etoposide metabolites and doxorubicin. The cleavage at AF-4
(fragment shown is SEQ ID NO: 259) intron 3 position 7126 was
detected in the presence of etoposide and etoposide metabolites.
The processing includes exonucleolytic nibbling (italic) to form
single-base homologies and create both breakpoint junctions of the
t(4; 11) by error-prone non-homologous end joining (NHEJ) (boxes).
In formation of the der(11) (SEQ ID NO: 260 shown) positions 6590
to 6592 on the antisense strand of MLL and positions 7127 to 7129
on the sense strand of AF-4 are lost by exonucleolytic nibbling
(italic, middle) before NHEJ (box, middle) joins the indicated
bases. Positions 7110 to 7126 on the sense strand of AF-4,
positions 7111 to 7130 on the antisense strand of AF-4, positions
6589 to 6594 on the sense strand of MLL and positions 6593 to 6595
on the antisense strand of MLL are lost by exonucleolytic nibbling
(italic, bottom) and the der(4) (SEQ ID NO: 261 shown) also forms
by NHEJ (box, bottom). Similarly, FIG. 3B demonstrates the
formation of der(11) (SEQ ID NO: 260 shown) and der(4) (SEQ ID NO:
261 shown) genomic breakpoint junctions wherein the DNA
topoisomerase II cleavage sites at MLL (fragment shown is SEQ ID
NO: 258) intron 8 position 6588 and AF-4 (fragment shown is SEQ ID
NO: 259) intron 3 position 7114 are employed, the latter of which
was detected in the presence of doxorubicin.
[0016] FIGS. 4A and 4B are images of autoradiographs of normal
homologues of MLL (FIG. 4A) and GAS7 (FIG. 4B) genomic breakpoint
sequences in acute myeloid leukemia (AML) of patient t-39 in DNA
topoisomerase II in vitro cleavage assays. DNA topoisomerase II
cleavage of MLL intron 8 coordinates 4589 to 4768 and GAS7
coordinates 1129 to 1440 upstream of exon 1. FIGS. 4C and 4D
demonstrate the effects of doxorubicin over a range of
concentrations on the cleavage of the MLL at position 4673 and 4675
(FIG. 4C) and GAS7 at position 1238 (FIG. 4D).
[0017] FIG. 5 is a schematic drawing of a model for processing of
DNA topoisomerase II cleavage sites that were detected without drug
and enhanced greatly with low concentration doxorubicin, (the only
DNA topoiosomerase II targeted drug to which the patient was
exposed before molecular detection of the translocation) to form
der(11) (SEQ ID NO: 264 shown) and der(17) (SEQ ID NO: 265 shown)
genomic breakpoint junctions in AML of patient t-39. Both genomic
breakpoint junctions are formed by resolution of
doxorubicin-stimulated DNA topoisomerase II cleavage sites via
error-prone nonhomologous end-joining (NHEJ). DNA topoisomerase II
cleavage sites at MLL (fragment shown is SEQ ID NO: 262) intron 8
position 4675 and GAS7 (fragment shown is SEQ ID NO: 263) position
1238 with 4-base 5' overhangs are shown at the top. In formation of
the der(11) positions 4664 to 4675 on the sense strand of MLL,
positions 4665 to 4679 on the antisense strand of MLL and positions
1239 to 1240 on the sense strand of GAS7 are lost by exonucleolytic
nibbling (italic, middle) before NHEJ (box, middle) and gap fill-in
(black, middle) ensue. Positions 1204 to 1238 on the sense strand
of GAS7, positions 1207 to 1242 on the antisense strand of GAS7,
positions 4676 to 4679 on the sense strand of MLL and positions
4680 to 4682 on the antisense strand of MLL are lost by
exonucleolytic nibbling (italic, bottom) and the der(17) forms by
NHEJ (box, bottom) and mismatch repair (asterisks, bottom).
[0018] FIG. 6 is an image of a Western blot analysis of DNA
topoisomerase II.alpha. protein expression in ex vivo-expanded
CD34+ cells and cultured hematopoietic cell lines. 3 .mu.g of
protein per lane were loaded on the gel. The filter was
simultaneously hybridized to mouse anti-human DNA topoisomerase
II.alpha. (DAKO, Glostrup, Denmark) and mouse anti-human
.beta.-actin (Abcam, Cambridge, Mass.) antibodies.
[0019] FIGS. 7A through 7D are images of Western blots
demonstrating DNA topoisomerase II-DNA complex formations in the
presence of various drugs at various concentrations in a modified
ICE bioassay. The assays were performed on CEM cells (FIG. 7A),
K562 cells (FIGS. 7B and 7C), and KG-1 cells (FIG. 7D). Etoposide
(VP16), etoposide catechol (VP16-OH), etoposide quinone (VP16-Q),
and doxorubicin were tested.
[0020] FIG. 8 is an image of a gel showing a modified in vivo
complex of enzyme (ICE) assay of DNA topoisomerase II covalent
complexes in ex-vivo expanded CD34.sup.+ cells. The cells were
untreated or treated for 2 hours with etoposide at 100 .mu.M final
concentration. Total genomic DNA containing protein-bound DNA was
isolated on a CsCl cushion and 5.6 .mu.g per well was loaded on a
4-12% Bis-Tris gradient gel. An anti-human DNA topoisomerase
II.alpha. antibody (DAKO, Glostrup, Denmark) was used to detect DNA
topoisomerase II covalent complexes. Recombinant human DNA
topoisomerase II.alpha. is in lane at the far left. The molecular
weight of the topoisomerase II band is >170 kD, which is the
molecular weight of topoisomerase II. This is consistent with DNA
bound to the enzyme.
[0021] FIGS. 9A, 9B, 9C, and 9D are plots from the real-time PCR
analysis of DNA topoisomerase II covalent complexes with MLL and
other sequences. CD34.sup.+ cells were untreated or treated for 2
hours with etoposide at a 100 .mu.M final concentration. Total
genomic DNA containing protein-bound DNA was isolated on a CsCl
cushion, and DNA topoisomerase II.alpha.-bound DNA was purified on
an immunoaffinity column and then amplified by degenerative
oligonucleotide PCR (DOP). 50 ng of DOP products ranging from 500
bp to 1 kb in size served as a template for amplification in
real-time PCR with primers specific for MLL intron 8-exon 9 (FIG.
9A), GAPDH (FIG. 9B), MLL exon 25 (FIG. 9C), or MLL intron7-exon 8
(FIG. 9D). Products were not detectable in duplicate
reagent-control reactions for these amplicons. .DELTA.Rn (measure
of reporter signal) v. cycles are shown in the plots.
[0022] FIG. 10 is a schematic drawing of the methods of an in vivo
complex of enzyme bioassay allowing for the detection of DNA-DNA
topoisomerase II complexes.
[0023] FIG. 11 is a schematic drawing of the methods for the
isolation of DNA-DNA topoisomerase II complexes.
[0024] FIG. 12A is an image of XeoChips.TM. containing different
amounts of products from DOP amplification of MLL bcr plasmid that
were labeled with AlexaFluor 546 or AlexaFluor 647 in order to
establish conditions for calibrated standard. FIGS. 12B and 12C are
Quantile-Quantile plots standardized by intensity comparing
etoposide-treated and untreated cells and genistein-treated and
untreated cells, respectively, when the test sample (treated or
untreated) was labeled with AlexaFluor 546 and the MLL bcr
calibrated reference sample was labeled with AlexaFluor 647. The
points that deviate from the linear relationship suggests coldspots
or hotspots for formation DNA topoisomerase II cleavage complexes
in the treated compared to untreated cells.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The emergence of the MLL translocation relative to intensive
multimodality neuroblastoma therapy administered to two patients
with secondary acute leukemia was traced to assess the role of
specific agents in the genesis of the translocations. An in vitro
assay was employed and a CD34+ cell model developed in order to
pinpoint whether the translocations arose from drug stimulated DNA
topoisomerase II.alpha. cleavage and formation of
drug-DNA-topoisomerase II complexes at or in close proximity to the
translocation breakpoints. Variability in the molecular emergence
of traceable translocations was found. In one case, the t(4; 11)
was first detectable 6 months after neuroblastoma diagnosis,
following completion of all chemotherapy and exposure to etoposide
and doxorubicin. Processing of functional DNA topoisomerase II
cleavage sites enhanced by etoposide or its metabolites or
doxorubicin resulted in both breakpoint junctions. In another case,
doxorubicin was the only DNA topoisomerase II inhibitor exposure
before detection of the MLL-GAS7 translocation at six weeks after
starting treatment (7). There were strong DNA topoisomerase II
cleavage sites detected without drug and further enhanced by
doxorubicin in MLL and GAS7 that resulted in both breakpoint
junctions. This is the first functional demonstration of relevance
of doxorubicin-DNA-topoisomerase II covalent complexes with MLL and
with its partner gene in the genesis of MLL translocations in
treatment-related AML.
[0026] In the ALL of patient t-120 described above, the
translocation breakpoint in the leukemia and the site of in vitro
drug-DNA-topoisomerase II complex formation both were at the
translocation breakpoint hotspot region 3' in intron 8 in the MLL
bcr (reviewed in Whitmarsh 2003). In the recent treatment-related
AML described by Langer (2003) where the leukemia occurred after
cytotoxic chemotherapy without DNA topoisomerase II poisons, the
translocation breakpoint also was at the same translocation
breakpoint hotspot region. The in vitro assays described above as
well as in Whitmarsh (2003) showed that not only
drug-DNA-topoisomerase II complexes but also DNA-native
topoisomerase II complexes were formed in this translocation
breakpoint hotspot region.
[0027] It was important to devise a cellular model to further study
the role of DNA topoisomerase II cleavage in the genesis of MLL
translocations because cleavage sites in the cellular context
should be more restricted than in vitro (Capranico et al., 1990).
In the development of this cellular model it was important to focus
on the breakpoint hotspot region 3' in intron 8 of the MLL bcr. DNA
topoisomerase II was highly expressed in CD34+ cells and formed
cleavage complexes with the MLL bcr at the 3' breakpoint hotspot
region in untreated CD34+ cells and CD34+ cells treated with
etoposide. These findings establish that DNA topoisomerase II forms
cleavage complexes with the MLL bcr in bone marrow stem cells, and
implicate not only drug-stabilized DNA topoisomerase II cleavage
but also native DNA topoisomerase II cleavage as mechanisms to
damage MLL.
[0028] A modified in vivo complex of enzyme (ICE) bioassay, which
entails trapping and immunodetection of DNA covalently bound to DNA
topoisomerase II, has been developed to examine native and
chemotherapy-stabilized DNA topoisomerase II cleavage complexes in
ex vivo stimulated CD34+ progenitor cells from normal human marrow.
The details of the ICE assay as applied to cell lines were
described in (Whitmarsh 2003). However, the ICE bioassay detects
overall formation of DNA topoisomerase II covalent complexes
genome-wide but does not address the enzyme-DNA interaction at the
sequence level.
[0029] In accordance with the present invention, a new approach was
created to detect DNA topoisomerase II covalent complexes with MLL
bcr in CD34+ cells at the sequence level. Total genomic DNA samples
including protein-bound DNA from untreated or etoposide-treated ex
vivo-expanded human CD34+ cells were prepared on a CsCl cushions
according to the ICE assay protocol. However, the ICE assay then
utilizes immunoblotting to detect all DNA in total genomic DNA
bound to DNA topoisomerase II.alpha. by the covalent
phosphotyrosine linkage formed between this enzyme and DNA
(Whitmarsh et al., 2003) without attention to any specific
sequences. The instant assay diverges, for example, from the ICE
assay in the following manner: DNA topoisomerase II.alpha. covalent
complexes in the total genomic DNA isolated using the CsCl cushion
are purified on an immuno-affinity column consisting of Protein
A-Sepharose beads covalently coupled to a mouse anti-human DNA
topoisomerase II.alpha. antibody. Eluted material from the column
is then subjected to degenerative oligonucleotide PCR (DOP) in
order to generate template DNAs in sufficient quantity for
real-time PCR. MLL bcr primers for real-time PCR were designed to
amplify positions 6784 to 6851 at the junction of intron 8-exon 9
near the previously described translocation breakpoint hotspot
(Whitmarsh et al., 2003). Other primer pairs would amplify a
genomic region of GAPDH and a genomic region of MLL exon 25, which
are not involved in MLL translocations (Langer et al., 2003). Yet
other primers would amplify a region of the MLL bcr at the junction
of intron 7-exon 8 near a region where other MLL translocation
breakpoints have been identified in cases of leukemia in
infants.
[0030] The finding of native DNA topoisomerase II complexes and
etoposide-DNA-topoisomerase II complexes in total genomic DNA
(without regard to any specific sequences in the genome) of CD34+
cells by ICE had never been described. Moreover, the assay
disclosed herein that incorporates immuno affinity purification,
whole genome amplification and real-time PCR after isolation of
total cellular DNA including protein bound DNA, to rapidly detect
DNA topoisomerase II covalently bound specifically to the MLL bcr
in human CD34+ cells. Using this new assay, native as well as
etoposide-stabilized DNA topoisomerase II covalent complexes with
the MLL bcr were detectable in the immuno-affinity purified DNA
topoisomerase II covalent complexes, demonstrating for the first
time that DNA topoisomerase II forms covalent complexes with MLL at
sites of translocation breakpoints in human CD34+ cells. Since DNA
templates containing double-strand breaks from DNA topoisomerase II
cleavage would not be amplified by PCR, these data indicate the
presence of DNA-DNA topoisomerase II covalent complexes proximal to
the amplicon (MLL bcr positions 6784 to 6851) where products were
detected with resolution at the size of the DOP template. The use
of chemotherapy creates a risk for leukemia as a treatment
complication. Tracing of the temporal molecular emergence of the
leukemia-associated MLL translocations relative to chemotherapy
administration and analysis of the genomic breakpoint junction
sequences in the leukemias and functional DNA topoisomerase II
cleavage assays suggest that not only drug-stabilized but also
native DNA topoisomerase II cleavage can result in translocations.
In particular, a rare case of treatment-related leukemia recently
was described where the prior chemotherapy exposure did not include
a DNA topoisomerase II poison (Langer 2003) Native DNA
topoisomerase II cleavage can be the cause of the DNA damage in
such cases because cytotoxic chemotherapy in general typically is
followed by bone marrow progenitor cell proliferation (Knudson,
1992), which would be associated with high DNA topoisomerase
II.alpha. expression (Isaacs et al., 1998; Woessner et al.,
1991).
[0031] In accordance with the present invention, a custom
oligonucleotide array comprising sequences that span the breakpoint
cluster region of the MLL gene that is disrupted in infant
leukemias and treatment-related leukemias is provided. This custom
oligonucleotide array can be used as an alternative to the real
time PCR approach to detect the specific sequences that are
involved in the formation of DNA-topoisomerase complexes or
drug-DNA-topoisomerase complexes. This microarray facilitates
analysis of the formation of DNA topoisomerase II complexes with
MLL upon various different treatments of primary human
hematopoietic cells and hematopoietic cell lines or
non-hematopoietic cells. Briefly, such complexes can be detected by
1) treating the cells (in vitro, ex vivo, or in vivo), 2) isolating
total genomic DNA including protein bound DNA, 3) isolating DNA
topoisomerase II-bound DNA (e.g., on an immunoaffinity column), 4)
amplifying the DNA by degenerative oligonucleotide PCR or by
alternative whole-genome amplification methods, 5) labeling the
test sample and a calibrated reference sample with different
detectable labels (e.g., two different fluorescent dyes), and 6)
hybridizing the labeled test sample and the calibrated standard or,
alternatively, two different test samples labeled with different
dyes with an MLL bcr microarray with two different channels, one
channel for each one of the two dyes. The Examples describe
experiments utilizing real-time PCR and microarrays to further
characterize topoisomerase II-genomic DNA complexes and the
sequences bound by topoisomerase II. Partner genes identified by
various panhandle PCR techniques (see, e.g., U.S. Pat. No.
6,368,791; U.S. patent application Ser. No. 10/118,783; and U.S.
Provisional Application 60/599,385), or by other techniques that
lead to the identification of the sequences of translocation
breakpoints may also be used with the real-time PCR and microarrays
(see Table 6 for list of exemplary partner genes). The partner
genes can be employed, alone or in combination with the MLL bcr in
order to determine the relationship of translocation breakpoints to
sites of DNA topoisomerase complex formation in different types of
cells.
[0032] Notably, DNA damage mediated by aberrant topoisomerase
activity can occur following exposure to naturally occurring
topoisomerase poisons/inhibitors rather than chemotherapeutic
agents, and exposure of pregnant women to such agents has been
linked to infant leukemias. The methods and compositions of the
invention can be utilized to characterize this DNA damage and
provide the means to develop strategies to prevent topoisomerase II
mediated alteration of the fetal chromosomal DNA during
pregnancy.
Definitions
[0033] As used herein, the term "microarray" refers to an ordered
arrangement of hybridizable array elements. The array elements are
arranged so that there are preferably at least one or more
different array elements, more preferably at least 100 array
elements, and most preferably at least 1,000 array elements on a
solid support. Preferably, the hybridization signal from each of
the array elements is individually distinguishable, the solid
support is a chip, and the array elements comprise oligonucleotide
probes.
[0034] The term "MLL partner gene" refers to the gene or genomic
DNA sequence fused with MLL after a translocation, such as those
fusions present in certain leukemias.
[0035] "Nucleic acid" or a "nucleic acid molecule" as used herein
refers to any DNA or RNA molecule, either single or double stranded
and, if single stranded, the molecule of its complementary sequence
in either linear or circular form. In discussing nucleic acid
molecules, a sequence or structure of a particular nucleic acid
molecule may be described herein according to the normal convention
of providing the sequence in the 5' to 3' direction. With reference
to nucleic acids of the invention, the term "isolated nucleic acid"
is sometimes used. This term, when applied to DNA, refers to a DNA
molecule that is separated from sequences with which it is
immediately contiguous in the naturally occurring genome of the
organism in which it originated. For example, an "isolated nucleic
acid" may comprise a DNA molecule inserted into a vector, such as a
plasmid or virus vector, or integrated into the genomic DNA of a
prokaryotic or eukaryotic cell or host organism.
[0036] The term "oligonucleotide" as used herein refers to
sequences, primers and probes of the present invention, and is
defined as a nucleic acid molecule comprised of two or more ribo-
or deoxyribonucleotides, preferably more than three. The exact size
of the oligonucleotide will depend on various factors and on the
particular application and use of the oligonucleotide.
[0037] The phrase "specifically hybridize" refers to the
association between two single-stranded nucleic acid molecules of
sufficiently complementary sequence to permit such hybridization
under pre-determined conditions generally used in the art
(sometimes termed "substantially complementary"). In particular,
the term refers to hybridization of an oligonucleotide with a
substantially complementary sequence contained within a
single-stranded DNA or RNA molecule of the invention, to the
substantial exclusion of hybridization of the oligonucleotide with
single-stranded nucleic acids of non-complementary sequence.
[0038] For instance, one common formula for calculating the
stringency conditions required to achieve hybridization between
nucleic acid molecules of a specified sequence homology is set
forth below (Sambrook et al., 1989): T.sub.m=81.5.degree. C.+16.6
Log [Na+]+0.41(%G+C)-0.63(%formamide)-600/#bp in duplex
[0039] As an illustration of the above formula, using [Na+]=[0.368]
and 50% formamide, with GC content of 42% and an average probe size
of 200 bases, the T.sub.m is 57.degree. C. The T.sub.m of a DNA
duplex decreases by 1-1.5.degree. C. with every 1% decrease in
homology. Thus, targets with greater than about 75% sequence
identity would be observed using a hybridization temperature of
42.degree. C.
[0040] The stringency of the hybridization and wash depend
primarily on the salt concentration and temperature of the
solutions. In general, to maximize the rate of annealing of the
probe with its target, the hybridization is usually carried out at
salt and temperature conditions that are 20-25.degree. C. below the
calculated T.sub.m of the hybrid. Wash conditions should be as
stringent as possible for the degree of identity of the probe for
the target. In general, wash conditions are selected to be
approximately 12-20.degree. C. below the T.sub.m of the hybrid. In
regards to the nucleic acids of the current invention, a moderate
stringency hybridization is defined as hybridization in
6.times.SSC, 5.times. Denhardt's solution, 0.5% SDS and 100
.mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in
2.times.SSC and 0.5% SDS at 55.degree. C. for 15 minutes. A high
stringency hybridization is defined as hybridization in
6.times.SSC, 5.times. Denhardt's solution, 0.5% SDS and 100
.mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in
1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes. A very
high stringency hybridization is defined as hybridization in
6.times.SSC, 5.times. Denhardt's solution, 0.5% SDS and 100
.mu.g/ml denatured salmon sperm DNA at 42.degree. C., and washed in
0.1.times.SSC and 0.5% SDS at 65.degree. C. for 15 minutes.
[0041] The term "primer" as used herein refers to a DNA
oligonucleotide, either single-stranded or double-stranded, either
derived from a biological system, generated by restriction enzyme
digestion, or produced synthetically which, when placed in the
proper environment, is able to functionally act as an initiator of
template-dependent nucleic acid synthesis. When presented with an
appropriate nucleic acid template, suitable nucleoside triphosphate
precursors of nucleic acids, a polymerase enzyme, suitable
cofactors and conditions such as a suitable temperature and pH, the
primer may be extended at its 3' terminus by the addition of
nucleotides by the action of a polymerase or similar activity to
yield a primer extension product. The primer may vary in length
depending on the particular conditions and requirement of the
application. For example, in diagnostic applications, the
oligonucleotide primer is typically 15-25 or more nucleotides in
length. The primer must be of sufficient complementarity to the
desired template to prime the synthesis of the desired extension
product, that is, to be able anneal with the desired template
strand in a manner sufficient to provide the 3' hydroxyl moiety of
the primer in appropriate juxtaposition for use in the initiation
of synthesis by a polymerase or similar enzyme. It is not required
that the primer sequence represent an exact complement of the
desired template. For example, a non-complementary nucleotide
sequence may be attached to the 5' end of an otherwise
complementary primer. Alternatively, non-complementary bases may be
interspersed within the oligonucleotide primer sequence, provided
that the primer sequence has sufficient complementarity with the
sequence of the desired template strand to functionally provide a
template-primer complex for the synthesis of the extension
product.
[0042] Polymerase chain reaction (PCR) has been described in U.S.
Pat. Nos. 4,683,195, 4,800,195, and 4,965,188, the entire
disclosures of which are incorporated by reference herein.
[0043] The term "isolated" may refer to a compound or complex that
has been sufficiently separated from other compounds with which it
would naturally be associated. "Isolated" is not meant to exclude
artificial or synthetic mixtures with other compounds or materials,
or the presence of impurities that do not interfere with
fundamental activity or ensuing assays, and that may be present,
for example, due to incomplete purification, or the addition of
stabilizers.
[0044] As used herein, an "instructional material" includes a
publication, a recording, a diagram, or any other medium of
expression which can be used to communicate the usefulness of the
composition of the invention for performing a method of the
invention.
[0045] The phrase "solid support" refers to any solid surface
including, without limitation, any chip (for example, silica-based,
glass, or gold chip), glass slide, membrane, bead, solid particle
(for example, agarose, sepharose, polystyrene or magnetic bead),
column (or column material), test tube, or microtiter dish.
[0046] The following materials and methods are provided to
facilitate the practice of the present invention.
Cloning and Detection of MLL Genomic Breakpoint Junction Sequences
in Sequential Bone Marrows
[0047] Characterization of genomic breakpoint junction sequences of
the der(11) and other derivative chromosomes in the leukemias of
the patients designated patients t-120 and t-39 by panhandle PCR
approaches and PCR with gene-specific primers was previously
described (7, 8). Backtracking to examine molecular emergence of
the translocation in sequential bone marrow specimens from patient
t-39 and to date the translocation in relation to chemotherapy
administration has been reported (7). For patient t-120 diagnosed
with treatment-related ALL harboring t(4; 11), BamHI-digested DNAs
from sequential marrow samples were analyzed with the B859 fragment
of ALL-1 cDNA corresponding to the MLL bcr. The der(4) genomic
breakpoint junction sequence obtained by reverse panhandle PCR (8)
provided sequences for forward AF-4 primer
5'-ATTGTTCTGCCCCCAACATA-3' (SEQ ID NO: 247) and reverse MLL primer
5'-AGAGGCCCAGCTGTAGTTCT-3' (SEQ ID NO: 248), and nested forward
AF-4 primer 5'-TCCGTAAGCTCGACCCTAGT-3' (SEQ ID NO: 249) and nested
reverse MLL primer 5'-GCGCTCGTTCTCCTCTAAAC-3' (SEQ ID NO: 250),
which were used for clonotypic PCR to examine sequential bone
marrow samples for molecular emergence of the t(4;11) translocation
in relation to chemotherapy administered.
DNA Topoisomerase II In Vitro Cleavage Assays
[0048] DNA topoisomerase II in vitro cleavage assays were performed
using previously described methods (10, 11). DNA fragments
containing the normal homologues of each genomic breakpoint in MLL
or GAS7 were subcloned into the EcoRI and BamHI sites, and the DNA
fragment containing the normal homologue of the AF-4 genomic
breakpoint into the BamHI and NotI sites of pBluescript II SK
(Stratagene; La Jolla, Calif.). Twenty-five ng of singly 5'
end-labeled DNA substrates from these plasmids were incubated with
human DNA topoisomerase II.alpha., ATP and MgCl.sub.2 in absence of
drug or in the presence of etoposide, etoposide catechol, etoposide
quinone or doxorubicin at 20 .mu.M final concentration for 10 min
at 37.degree. C. DNA topoisomerase II cleavage complexes were
irreversibly trapped by adding SDS, without heating or after
subsequent incubation for 10 min at 75.degree. C. to evaluate heat
stability (12). Cleavage complexes were deproteinized and
electrophoresed in a DNA sequencing gel alongside a dideoxy
sequencing ladder to locate the cleavage sites (10, 11). In
addition, doxorubicin was studied over a range of lower
concentrations because of its known mixed effects of DNA
topoisomerase II cleavage enhancement at low concentrations and DNA
topoisomerase II catalytic inhibition due to intercalation at high
concentrations (Capranico, 1998).
Ex Vivo Expansion of CD34+ Cells
[0049] Ten.times.10.sup.6 primary human cadaveric bone marrow CD34+
cells obtained through NHLBI were established in culture at a
density of 2.times.10.sup.4 to 2.times.10.sup.5 cells per ml and
expanded in two T-75 flasks for 8 days in HPGM serum-free medium
(Cambrex, Walkersville, Md.) supplemented with 100 ng/ml each of
stem cell factor, Flk2/Flt3 ligand (FL) and IL-6, 10 ng/ml
thrombopoietin and 1 .mu.g/ml soluble IL-6 receptor (R&D
Systems, Minneapolis, Minn.), conditions that promote minimal
differentiation (13).
Western Blot Analysis
[0050] DNA topoisomerase II protein expression was examined with a
mouse anti-human DNA topoisomerase II.alpha. antibody (DAKO,
Glostrup, Denmark) in 3 .mu.g of total cellular protein from
untreated ex vivo-expanded CD34+ cells and compared to that in the
hematopoietic cell lines RS4:11, SEM-K2 and K562 (14-16). Protein
concentrations were measured using the RCDC protein assay kit
(Biorad, Hercules, Calif.) and Western blot analysis was performed
with the Western Breeze kit (Invitrogen, Carlsbad, Calif.). The
filter was simultaneously hybridized to a mouse anti-human
.beta.-actin antibody (Abcam, Cambridge, Mass.).
Real-Time PCR Analysis of DNA Topoisomerase II.alpha. mRNA
Expression
[0051] Quantitative real-time PCR analysis was performed on 10 ng
of cDNA prepared from total RNA from untreated ex vivo-expanded
CD34+ cells by `Assays on Demand` for DNA topoisomerase II.alpha.
and GAPDH (Applied Biosystems, Foster City, Calif.) and compared to
that in cultured hematopoietic cell lines using
2.sup.-.DELTA..DELTA.Ct analysis of relative gene expression data
(17).
ICE (In Vivo Complex of Enzyme) Bioassay
[0052] Modified ICE assays were performed exactly as described
(11). Five.times.10.sup.6 ex vivo expanded CD34+ cells were
incubated without drug or with 100 .mu.M final concentration of
etoposide at 37.degree. C. in 2 ml of HPGM medium for 2 hours.
Percentages of viable cells were assessed by Trypan Blue exclusion.
Treated and untreated cells were pelleted and lysed as described
(11). After flash-freezing and thawing at 37.degree. C., the DNA
was sheared by passage through a 25.sub.1/2G needle. Supernatants
were collected and layered onto a CsCl cushion, and total genomic
DNA including protein-bound DNA was isolated by ultracentrifugation
at 80,000.times.g in an NVT90 rotor (Beckman; Palo Alto, Calif.)
(11). The pellet was dissolved in 200 .mu.l of 10 mM Tris-HCl (pH
8.0) 1 mM EDTA buffer, the DNA was quantified and 5.6 .mu.g of DNA
was analyzed on a Western blot with a mouse anti-human DNA
topoisomerase II.alpha. antibody (DAKO, Glostrup, Denmark) to
detect DNA topoisomerase II.alpha.-bound DNA (11).
Affinity Column Purification of DNA-DNA Topoisomerase II.alpha.
Covalent Complexes and Detection of MLL-Bound DNA Topoisomerase
Ia
[0053] Each 1 ml affinity column consisted of Protein A-Sepharose
Beads (Pharmacia Biotech, Upsala, Sweden) covalently coupled to
mouse anti-human DNA topoisomerase II.alpha. antibody (DAKO,
Glostrup, Denmark) in PBS/0.02% sodium azide (18). The column was
pre-washed with 10 volumes of 1.times.PBS. Total genomic DNA
samples including protein-bound DNA from 32.5.times.10.sup.6
untreated or etoposide-treated ex vivo-expanded human CD34+ cells
was prepared according to the ICE assay protocol and diluted to a
volume of 10 ml with cold 1.times.PBS. Samples were pre-cleared by
incubation with Protein A Sepharose for 30 min while rotating at
4.degree. C. in a 15 ml conical tube (18) and then centrifuged at
1200 rpm for 5 min in a Beckman G6 low-speed centrifuge.
Supernatants were transferred to clean 15 ml conical tubes and
incubated with the 1 ml of anti-human DNA topoisomerase II.alpha.
antibody-conjugated beads for 2 hrs while rotating at 4.degree. C.
and then run by gravity flow over affinity columns, followed by
washing of the columns with 10 volumes of cold 1.times.PBS.
Antibody-bound DNA topoisomerase II.alpha.-DNA complexes from the
untreated and etoposide-treated CD34+ cells were eluted with 1 ml
of 100 mM glycine pH 2.7 and collected in 1.5 ml Eppendorf tubes
containing a few drops of 1.times.PBS pH 11 for neutralization
(18). The eluted material was PCI-extracted, ethanol-precipitated
with NaOAc, washed with 70% EtOH and resuspended in 25 .mu.l of
dH.sub.2O and 1 .mu.l was subjected to degenerative oligonucleotide
PCR (DOP) using the primer 5'-CCGACTCGAGNNNNNNATGTGG-3' (SEQ ID NO:
251) (19) to generate template DNAs in sufficient quantity for
real-time PCR. The products were quantified by OD.sub.260
measurements and their sizes determined on an agarose gel.
[0054] MLL bcr primers for real-time PCR were selected using Primer
Express v. 2.0 software, and their specificity confirmed using the
BLAST algorithm. Forward and reverse primers
5'-ATAGTTTGTGTATTGCCAAGTCTGTTG-3' (SEQ ID NO: 252) and
5'-GGCGCTCGTTCTCCTCTAAA-3' (SEQ ID NO: 253), respectively, spanned
MLL bcr positions 6784 to 6851 at the junction of intron 8-exon 9.
The primer pair 5'-ACCACCGGGACCGCTACT-3' (SEQ ID NO: 254) and
5'-GTGGCCCTAAGACATGATCAACT-3' (SEQ ID NO: 255), was designed to
amplify a genomic region of MLL exon 25, and a genomic region of
GAPDH was examined by an intra-exon `Assay on Demand` (Applied
Biosystems); these genomic regions are not involved in MLL
translocations. MGB oligonucleotide fluorogenic probes, which were
synthesized by Applied Biosystems, were non-overlapping with the
respective primer pairs and were designed according to Applied
Biosystems guidelines using Primer Express v. 2.0 (20-23).
Fluorogenic probe sequences for the amplicons at the MLL intron
8-exon 9 junction and MLL exon 25, respectively, were
5'-CCCTTCCACAAGTTTT-3' (SEQ ID NO: 256) and
5'-ATCTTGAATCAAGTGCCAAA-3' (SEQ ID NO: 257). Real-time PCR
reactions were performed in duplicate in a MicroAmp 96-well plate
using 50 ng of DOP-generated template, and the ABI Prism 7700
Sequence Detection System was used to examine product
accumulation.
[0055] The following examples are provided to illustrate various
embodiments of the present invention. They are not intended to
limit the invention in any way.
EXAMPLE I
Identification and Tracing of Translocation Breakpoint Sequences in
Leukemias in Patients, and Evidence from In Vitro Assays to Suggest
that Translocation Breakpoints are Topoisomerase II Cleavage
Sites
Therapy, Clinical Course and Detection of MLL-AF-4 Translocation in
Sequential Bone Marrow Specimens of Patient t-120
[0056] In patient t-120, rearrangements consistent with both
derivative chromosomes from the t(4;11) translocation were detected
by Southern blot analysis in the bone marrow from ALL diagnosis,
and both breakpoint junctions were characterized by panhandle PCR
approaches (Raffini et al., 2002). The clinical course, primary
neuroblastoma therapy and molecular analyses are summarized in FIG.
1A. All available sequential bone marrows were examined for the
presence of the translocation. The translocation also was
detectable by Southern blot at 9 months from the start of
treatment. The translocation was not detectable by Southern blot
analysis in the cells used for autologous marrow rescue or in any
other marrow samples (FIG. 1B, 1C). By first-round PCR analysis of
the der(4) breakpoint junction in 200 ng genomic DNA prepared from
cryopreserved sequential bone marrow samples (.about.20,000 cell
equivalent), only the marrows at 9 months after neuroblastoma
diagnosis and at ALL diagnosis contained the translocation. By
nested PCR (FIG. 1B, 1C) the translocation also was detectable in
the marrow from 6 months after neuroblastoma diagnosis, after all 7
chemotherapy cycles and bone marrow harvest. This was before local
radiation therapy, radiolabeled 3F8 monoclonal antibody and
autologous marrow rescue, 5 months before leukemia was diagnosed.
Spiking DNA from the ALL sample into peripheral blood lymphocyte
DNA from a normal subject and serial dilutions indicated that the
sensitivity of the nested PCR for detection of the translocation
was between 1 cell in 10.sup.5 and 1 cell in 10.sup.6 cells.
Chemotherapy Enhances DNA Topoisomerase II Cleavage at MLL and AF-4
Genomic Translocation Breakpoints in all of Patient t-120
[0057] From prior sequencing the der(11) MLL breakpoint was
position 6588 or 6589 in intron 8 and the der(11) AF-4 breakpoint
was position 7130 or 7131 in intron 3. The der(4) AF-4 breakpoint
was position 7108, 7109 or 7110 in intron 3 and the der(4) MLL
breakpoint was position 6594, 6595 or 6596 in intron 8 (Raffini et
al., 2002). Although `A` nucleotides at the breakpoints in both
genes at the der(11) breakpoint junction and 5'-CA-3' sequences at
the breakpoints in both genes at the der(4) breakpoint junction
precluded more precise breakpoint assignments, 4-7 bases and 19-22
bases, respectively, were deleted from MLL and AF-4 (Raffini et
al., 2002).
[0058] These near-precise recombinations with few bases lost
relative to the normal sequences indicated that the translocation
breakpoints were in close proximity to the sites of damage. The
first molecular detection of the translocation was after all 7
chemotherapy cycles, which included etoposide and doxorubicin as
DNA topoisomerase II poisons. Therefore, DNA topoisomerase II in
vitro cleavage assays were performed without drug or with
etoposide, its catechol or quinone metabolites or doxorubicin on
double stranded DNA substrates containing the normal homologues of
the respective MLL (FIG. 2A, 2C) and AF-4 (FIG. 2B, 2D)
translocation breakpoints to locate where the drugs to which the
patient was exposed stimulated cleavage complexes. DNA
topoisomerase II creates staggered nicks in duplex DNA with 4-base
5' overhangs (Fortune and Osheroff, 2000); cleavage site locations
were defined by the base at the 5' side of cleavage (-1 position)
on the sense strand of DNA. DNA topoisomerase II cleavage sites in
MLL (FIG. 2A, 2C) and AF-4 (FIG. 2B, 2D) were identified at or
proximal to the translocation breakpoints.
[0059] Because the der(11) and der(4) MLL breakpoints were at a
hotspot for translocation breakpoints in treatment-related
leukemia, cleavage assays of the relevant MLL substrate with all
drugs at 20 .mu.M final concentration had already been performed
(Whitmarsh et al., 2003). In the present study, however,
doxorubicin was studied over a range of concentrations (FIG. 2C)
because of its dual effects of cleavage stimulation at low
concentrations and DNA topoisomerase II catalytic inhibition due to
intercalation at high concentrations (Capranico and Binaschi,
1998). MLL bcr position 6588 ranked 5.sup.th of 8 cleavage sites
detected without drug in the MLL substrate (Whitmarsh et al.,
2003). Etoposide, etoposide catechol and etoposide quinone each at
20 .mu.M, enhanced cleavage at this site 7.9-, 4.4- and 9.8-fold,
respectively, over cleavage without drug (FIG. 2A). The especially
strong cleavage detected at this position ranked 3.sup.rd of
cleavage sites in the substrate in the presence of etoposide
quinone (FIG. 2A) (Whitmarsh et al., 2003). The enzyme-only
cleavage and cleavage with etoposide or its metabolites at position
6588 remained detectable after heating, indicating resistance to
religation and stability of the cleavage complexes. Although
position 6588 was one of only two cleavage sites detected with
doxorubicin at 20 .mu.M, the cleavage was weak compared to
enzyme-only cleavage (0.4-fold), indicating catalytic inhibition at
high concentration (FIG. 2A). At concentrations from 0.01 .mu.M to
0.5 .mu.M doxorubicin resulted in dose-dependent increases over
enzyme-only cleavage at MLL bcr position 6588 consistent with
poisoning effects, whereas the cleavage enhancement at this site
began to decrease at 2.5 .mu.M (FIG. 2C). Thus the intercalating
agent doxorubicin has site-specific, concentration-dependent, mixed
effects of a poison and a catalytic inhibitor of DNA topoisomerase
II at this position in the MLL translocation breakpoint hotspot
region. In contrast, at positions 6587 and 6589, only catalytic
inhibition was observed at all concentrations tested (FIG. 2C).
[0060] In the AF-4 intron 3 substrate spanning positions 6956 to
7239, there was no detectable cleavage at position 7126 without
drug or with doxorubicin at 20 .mu.M (FIG. 2B) or lower
concentrations (FIG. 2D), but cleavage at this position ranked
first in relative intensity among all cleavage sites with etoposide
and etoposide catechol and 5.sup.th among all cleavage sites with
etoposide quinone (FIG. 2B). There was 3.2-, 5.9- and 3.4-fold
cleavage at position 7126 in the presence of etoposide, etoposide
catechol and etoposide quinone, respectively, relative to the
strongest enzyme-only cleavage in the substrate, which occurred at
position 7114. Cleavage at position 7126 in the presence of
etoposide and both etoposide metabolites were not only especially
strong, but also especially heat-stable. Examination of
doxorubicin-associated cleavage over a range of concentrations with
particular attention to the region of the breakpoints showed
dose-dependent increases in cleavage stimulation over enzyme-only
cleavage at AF-4 intron 3 positions 7111, 7114 and 7119, consistent
with poisoning effects, while cleavage at these sites began to
decrease at 0.5 .mu.M, consistent with the mixed effect of
catalytic inhibition (FIG. 2D).
Processing of DNA Topoisomerase II Cleavage Sites Enhanced by
Etoposide or its Metabolites or Doxorubicin Forms Both Genomic
Breakpoint Junctions in all of Patient t-120
[0061] The model shown in FIG. 3A for formation of the observed
der(11) and der(4) genomic breakpoint junctions was derived from
the cleavage sites at MLL bcr position 6588, which was enhanced by
etoposide, both etoposide metabolites and doxorubicin, and AF-4
intron 3 position 7126, which was enhanced by etoposide and both
etoposide metabolites but not doxorubicin. Processing of the 4-base
5' overhangs from DNA topoisomerase II cleavage at these sites
would generate the der(11) and der(4) sequences observed in the
leukemia. In the model shown, exonucleolytic nibbling creates
single-base homologies and base-pairing promotes the formation of
both breakpoint junctions by error-prone nonhomologous end-joining
(NHEJ). Consistent with the genomic sequencing and relative to the
sense strands, 6 bases from MLL and 20 bases from AF-4 are lost
during the processing, MLL bcr position 6588 and AF-4 intron 3
position 7130 are joined to form the der(11), and AF-4 intron 3
position 7109 and MLL bcr position 6595 are joined to form the
der(4) (FIG. 3A).
[0062] The especially strong doxorubicin-stabilized cleavage sites
at MLL bcr position 6588 and AF-4 intron 3 position 7114 were used
to develop the alternative model in FIG. 3B for formation of the
observed der(11) and der(4) genomic breakpoint junctions by
error-prone NHEJ. In this model, 6 bases from MLL and 20 bases from
AF-4 relative to the sense strands again are lost during the
processing (FIG. 3B), and the same bases in MLL bcr and AF-4 intron
3 as described above are joined to form both breakpoint junctions.
These models demonstrate that interchromosomal recombination by
repair of chemotherapy-stabilized DNA topoisomerase II cleavage
could be the translocation mechanism in this ALL, although models
using other DNA topoisomerase II cleavage sites proximal to the
translocation breakpoints are possible as well (not shown).
However, it cannot be determined in this case whether etoposide or
its metabolites or doxorubicin led to the relevant damage resulting
in the translocation in the leukemia in this patient since each
compound stimulated strong DNA topoisomerase II cleavage complexes
proximal to the breakpoints.
Therapy, Clinical Course and Molecular Detection of MLL-GAS7
Translocation in Sequential Bone Marrow Specimens of Patient
t-39
[0063] Patient t-39 was a 13-year old boy with stage 4
neuroblastoma treated with 4 cycles of cyclophosphamide,
doxorubicin and vincristine (CAV), 1 cycle of cyclophosphamide and
doxorubicin in which vincristine was omitted for toxicity, 3 cycles
of cisplatin and etoposide (PVP), surgical resection, local
radiation, and 3F8 monoclonal antibody with GM-CSF (Megonigal et
al., 2000). The clinical diagnosis of secondary AML and molecular
analyses of sequential bone marrow samples relative to the
neuroblastoma treatment have been described (Megonigal et al.,
2000). The MLL translocation was not PCR-detectable at
neuroblastoma diagnosis, but was detectable by clonotypic PCR
analysis of the der(11) genomic breakpoint junction in all marrow
specimens obtained at and after 6 weeks from the start of
treatment, which was after two cycles of CAV (Megonigal et al.,
2000). AML was diagnosed 15.5 months after the translocation was
PCR-detectable (Megonigal et al., 2000).
MLL and GAS7 Genomic Translocation Breakpoints in AML of Patient
t-39 are Proximal to Doxorubicin-Stabilized DNA Topoisomerase II
Cleavage Sites
[0064] From previously described genomic sequencing, the der(11)
MLL breakpoint in the treatment-related AML was position 4662,
4663, or 4664 in intron 8 and the der(11) GAS7 breakpoint was
position 1240, 1241 or 1242 upstream of exon 1 (Megonigal et al.,
2000). MLL positions 4663-4664 and GAS7 positions 1240-1241 were
5'-AT-3', precluding more precise breakpoint assignments (Megonigal
et al., 2000). The der(17) GAS7 breakpoint was position 1203 and
the der(17) MLL breakpoint was position 4680 (Megonigal et al.,
2000). 15-17 bp from MLL and 36-38 bp from GAS7 were deleted during
this translocation (Megonigal et al., 2000). The involved region of
MLL was more 5' in the bcr and was not the translocation breakpoint
hotspot.
[0065] Although doxorubicin was the only DNA topoisomerase II
poison to which the patient was exposed before molecular emergence
of the translocation (Megonigal et al., 2000), DNA topoisomerase II
in vitro cleavage assays were performed without drug, with
doxorubicin or, as references for cleavage site intensities, with
etoposide or its metabolites. The translocation breakpoints were
near strong, enzyme-only cleavage sites at MLL bcr position 4675
(FIG. 4A) and GAS7 position 1238 (FIG. 4B) that were enhanced
substantially by doxorubicin at low concentrations (FIG. 4C, 4D).
In the MLL bcr substrate, the enzyme-only cleavage at position 4675
was 0.27-fold relative to cleavage with etoposide, and this
position ranked 3.sup.rd among all enzyme-only cleavage sites (FIG.
4A). GAS7 position 1238, where the enzyme-only cleavage was
0.44-fold relative to cleavage with etoposide, was the strongest
enzyme-only cleavage site in the GAS7 substrate (FIG. 4B). The
enzyme-only cleavage complexes at MLL bcr position 4675 and GAS7
position 1238 were highly heat-resistant (FIG. 4A, 4B), indicating
these cleavage complexes were particularly stable. Consistent with
behavior as a poison, doxorubicin at 0.01 .mu.M was associated with
quantifiably enhanced cleavage over the already very strong
enzyme-only cleavage, not only at MLL bcr position 4675, but also
at MLL bcr position 4673 (FIG. 4C) and GAS7 position 1238 (FIG.
4D). The site-specific enhancement of cleavage over enzyme-only
cleavage at these sites in the presence of doxorubicin began to
decrease at 0.1 .mu.M (FIG. 4C, D) and there was complete
diminution at 20 .mu.M (FIG. 4A, 4B), indicating mixed effects of a
poison and catalytic inhibitor of DNA topoisomerase II.
Processing of Doxorubicin-Stabilized DNA Topoisomerase II Cleavage
Sites in MLL and GAS7 Generates Genomic Breakpoint Junctions in AML
of Patient t-39
[0066] A model for processing of the doxorubicin-stimulated
cleavage sites at MLL intron 8 position 4675 and GAS7 position 1238
to form both genomic breakpoint junctions in the AML of patient
t-39 is shown in FIG. 5. Exonucleolytic nibbling of the indicated
bases (italic, middle) creates a single-base homology (box,
middle), and NHEJ and gap fill-in ensue, resulting in the der(11)
breakpoint junction. The processing to create the observed der(17)
genomic breakpoint junction also includes exonucleolytic nibbling
(italic, bottom) to form a single-base homology (box), followed by
NHEJ and mismatch repair (bottom). Relative to the sense sequences,
the exonucleolytic nibbling in the model results in loss of 16
bases from MLL and 37 bases from GAS7 during processing of the
overhangs from the cleavage (FIG. 5). MLL bcr position 4663 and
GAS7 position 1241 are joined to form the der(11), and GAS7
position 1203 and MLL bcr position 4680 are joined to form the
der(17), which is consistent with prior genomic sequencing of the
breakpoint junctions in the AML (Megonigal et al., 2000).
EXAMPLE II
Hematopoietic Progenitor Cells--a Model Cellular System for
Analysis of Chromosomal Translocations Mediated by Elevated
Expression of Topoisomerase II
Characterization of Native DNA Topoisomerase II.alpha. mRNA and
Protein Expression in Human CD34+ Cells
[0067] By quantitative real-time PCR analysis, DNA topoisomerase
II.alpha. mRNA expression in the cell lines RS4:11, SEM-K2 and K562
cells was 1.54(1.16+2.03)-fold, 1.55(1.14-2.10)-fold and
2.75(2.53-2.99)-fold relative to ex vivo-expanded human CD34+ cells
(Table 1), indicating that DNA topoisomerase II.alpha. mRNA in
proliferating bone marrow stem cells is in the range of that in
hematopoietic cell lines. Western blot analysis suggested that DNA
topoisomerase II.alpha. protein expression in the ex vivo-expanded
human CD34+ cells was also high and comparable to that in
hematopoietic cell lines (FIG. 6). TABLE-US-00001 TABLE 1 Relative
DNA topoisomerase II.alpha. mRNA expression in leukemia cell lines
compared to CD34+ cells .DELTA.C.sub.T Normalized DNA DNA (Avg. DNA
topoisomerase II.alpha. topoisomerase topoisomerase
.DELTA..DELTA.C.sub.T amount relative to II.alpha. C.sub.T GAPDH
C.sub.T II.alpha. C.sub.T - Avg. (Avg. .DELTA.C.sub.T - Avg. CD34+
cells Cells (Avg. .+-. S.D.) (Avg. .+-. S.D.) GAPDH C.sub.T)
.DELTA.C.sub.T.sub.CD34+ cells) 2.sup.-.DELTA..DELTA.CT CD34+ 25.69
.+-. 0.26 20.58 .+-. 0.06 5.11 .+-. 0.23 0 1 cells RS4: 11 25.28
.+-. 0.38 20.79 .+-. 0.15 4.49 .+-. 0.40 -0.62 .+-. 0.40
1.54(1.16-2.03) SEM- 24.50 .+-. 0.28 20.02 .+-. 0.18 4.48 .+-. 0.44
-0.63 .+-. 0.44 1.55(1.14-2.10) K2 K562 25.61 .+-. 0.23 21.96 .+-.
0.12 3.65 .+-. 0.12 -1.46 .+-. 0.12 2.75(2.53-2.99)
EXAMPLE III
Ice Bioassay Detects Topoisomerase--DNA and Topoisomerase-DNA-Drug
Covalent Complexes in Total Genomic DNA of Hematopoietic Cell Lines
and CD34 Cells
DNA Topoisomerase II Covalent Complexes are Detected in
Hematopoietic Cell Lines Treated with Chemotherapy
[0068] Although etoposide has been previously studied in ICE assays
of, eg., the hematopoietic cell line CEM, induction of DNA
topoisomerase II cleavage complexes by etoposide metabolites had
not been previously studied in a cellular context. A modified in
vivo complex of enzyme (ICE) bioassy was employed to determine
whether etoposide metabolites induce DNA topoisomerase II covalent
complexes in the chromatin context of hematopoietic cell lines
(11). The assay entails trapping the DNA covalently bound to DNA
topoisomerase II by phosphotyrosine linkage using protein
denaturants and detection on a Western blot. Isolation of the
protein-bound DNA using a CsCl cushion, as elaborated by Topogene,
streamlines the methodology compared to previous methods. In
addition, the approach was changed further from use of the slot
blot analysis to detect the cleavage complexes to detection of the
complexes by Western blot analysis, which enables size separation
of the DNA-protein complexes. ICE bioassys demonstrated significant
induction of DNA topoisomerase II cleavage complexes in CEM cells
after treatment for 2 hours with etoposide or its catechol or
quinone metabolites at 20 .mu.M (FIG. 7A). The cleavage complexes
induced by etoposide catechol were comparable in amount to the
parent drug. Induction of DNA cleavage complexes was also observed
in K562 cells treated with 20 .mu.M etoposide or etoposide quinone
(FIG. 7B). Consistent with the presence of DNA bound to the enzyme,
the DNA topoisomerase II.alpha. protein ran higher than its known
molecular weight of 170 kDa. Notably, no induction of DNA
topoisomerase II cleavage complexes was detected in either CEM or
K562 cells after treatment with doxorubicin at the same
concentration within the sensitivity of the assay. However,
doxorubicin is an intercalative DNA topoisomerase II poison that
induces DNA topoisomerase II cleavage with different sequence
site-selectivity (Capranico et al., 1990) and that also is
associated with leukemia as a treatment complication, albeit less
often (Sandoval et al., 1993). Its behavior as a site-specific
poison of DNA topoisomerase II in in vitro assays of translocation
breakpoints was established herein. Additional ICE assays in K562
cells showed a concentration dependent increase in the induction of
DNA topoisomerase II cleavage complexes treated with etoposide
quinone for 2 hours, consistent with its behavior as a DNA
topoisomerase II poison (FIG. 7C). Unlike in CEM cells and K562
cells, in KG1 cells not only etoposide and its metabolites, but
also doxorubicin at 100 .mu.M induced DNA II covalent complexes
(FIG. 7D).
Native and Etoposide-Stabilized DNA Topoisomerase II Covalent
Complexes are Detected In Ex Vivo Expanded Human CD34+ Cells
[0069] ICE assays were performed on ex vivo expanded CD34+ cells
from cadaveric human bone marrow that were either treated for 2
hours with etoposide or untreated. Cell viability assessed by
Trypan blue exclusion was .about.70% for both conditions. Results
for the untreated cells and cells treated with etoposide at 100
.mu.M final concentration are shown in FIG. 8. As predicted in
proliferating cells (6), native DNA topoisomerase II covalent
complexes were detected in the untreated cells. Etoposide treatment
resulted in increased formation of DNA topoisomerase II covalent
complexes. The DNA topoisomerase II.alpha. protein ran higher than
its known molecular weight of 170 kDa, which is consistent with the
presence of DNA bound to the enzyme. Etoposide catechol treatment
also showed increased formation of topoisomerase-DNA cleavage
complexes in CD34+ cells.
EXAMPLE IV
Real-Time PCR with MLL Specific Primers Detects Topoisomerase-DNA
and Topoisomerase-DNA-Drug Covalent Complexes with Specific
Sequences in MLL Gene in Total Genomic DNA of Hematopoietic Cell
Lines and CD34 Cells After Immunoaffinity Purification and DOP
Amplification
DNA Topoisomerase II Covalent Complexes with MLL bcr are Detected
in Untreated and Etoposide-Treated Ex Vivo-Expanded CD34+ Cells
[0070] A real-time PCR approach was developed to detect DNA
topoisomerase II covalent complexes at the sequence level with the
MLL breakpoint cluster region (bcr) in CD34+ cells. Total genomic
DNA samples, including protein bound DNA from untreated or
etoposide-treated, ex-vivo expanded human CD34+ cells, were
prepared on CsCl cushions according to the ICE assay protocol.
DNA-DNA topoisomerase II.alpha. covalent complexes in the total
genomic DNA were purified on an immuno-affinity column consisting
of Protein A-Sepharose beads covalently coupled to a mouse
anti-human DNA topoisomerase II.alpha. antibody. The eluted
material from the column was subjected to degenerative
oligonucleotide PCR in order to generate template DNAs in
sufficient quantity for real-time PCR. MLL bcr primers for
real-time PCR were designed to amplify MLL bcr positions 6784 to
6851 at the junction of intron 8-exon 9 near the translocation
breakpoint, which is in proximity to the hotspot region for
translocation breakpoints occurring in cases of leukemia in
patients exposed to DNA topoisomerase II poisons (Whitmarsh 2003)
and, in at least one patient after chemotherapy without such agents
(Langer 2003).
[0071] Real-time PCR products were detected with the primer pair
for the junction of MLL intron 8-exon 9 in the DOP-amplified
immunoaffinity-purified DNA topoisomerase II.alpha.-bound DNA from
untreated and etoposide-treated CD34+ cells (FIG. 9A). The DOP
template DNA used for real-time PCR was 500 bp to 1 kb. Since DNA
templates containing double-strand breaks from DNA topoisomerase II
cleavage would not be amplified by PCR, these data indicate the
presence of DNA-DNA topoisomerase II covalent complexes proximal to
the amplicon (MLL bcr positions 6784 to 6851) where products were
detected with resolution at the size of the DOP template. No
products were detected in reactions assaying the GAPDH gene (FIG.
9B), which is not involved in MLL translocations. Although no
product was detected in untreated CD34+ cells, etoposide induced
DNA-DNA topoisomerase II covalent complexes proximal to the MLL
exon 25 amplicon (FIG. 9C), indicating that the formation of DNA
topoisomerase II cleavage complexes in MLL is not limited to the
bcr.
DNA Topoisomerase II Covalent Complexes with MLL bcr are Detected
in Etoposide-Treated and Genistein-Treated Ex Vivo-Expanded CD34+
Cells
[0072] In cases of leukemia in infants, the MLL translocation
breakpoints are distributed heterogeneously in the bcr (Felix,
1998.) Genistein is one example of a naturally-occurring DNA
topoisomerase II poison that can stimulate formation of cleavage
complexes with DNA and to which the fetus can be exposed in utero
via the maternal diet. FIG. 9D shows real-time PCR products that
were detected with primers at the junction of MLL intron 7-exon 8
in the DOP-amplified immunoaffinity-purified DNA topoisomerase
II.alpha.-bound DNA after treatment of CD34+ cells with either
etoposide or genistein.
2. Discussion
[0073] The temporal emergence of MLL translocations has been
characterized herein with respect to the timing of administration
of specific anti-cancer drugs and mechanistic studies of DNA
topoisomerase II cleavage were performed in order to link specific
DNA damage to the genesis of MLL translocations in two cases of
treatment-related leukemia. There was variability in molecular
emergence of the translocations; after all 4 cycles of CAV and 3
cycles of PVP in one case, but after only 2 cycles of CAV in the
other (Megonigal et al., 2000). In both cases the translocation was
absent at neuroblastoma diagnosis, suggesting that the treatment
caused and did not select for a pre-existing translocation. These
results are consistent with other observations on a patient
diagnosed with primary ALL and MLL-rearranged treatment-related AML
where the MLL translocation was found to emerge during the course
of treatment (Blanco et al., 2001). Absence of the MLL
translocation at neuroblastoma diagnosis and the short latency in
the secondary cases under study here also relate to the time of
acquisition of the translocation in MLL-rearranged de novo cases.
In MLL-rearranged infant leukemias the translocation is a somatic,
in utero event and the latency is short: specifically from some
time in pregnancy to the time of leukemia diagnosis in the infant
host (Ford et al., 1993; Gale et al., 1997; Megonigal et al.,
1998). However, MLL-rearranged leukemias in older children
generally are not traceable to birth (Maia et al., 2004). Factors
that determine latency from acquisition of the translocation to
emergence of leukemia are unknown but the variable latencies in the
present study, 5 months and 15.5 months in the respective cases
where the partner genes were AF-4 and GAS7, may indicate
differences in sufficiency of the varied MLL gene fusions. Latency
also may be a function of the subsequent primary cancer treatment,
which would not only contribute to secondary alterations but also
affect selection and survival of the preleukemia clone.
[0074] Patient t-120 was managed with autologous marrow rescue
after monoclonal antibody 3F8-targeted
.sup.131I-radioimmunotherapy. The ALL was diagnosed 11 months after
neuroblastoma diagnosis, only 2 weeks after transplant. It has been
suggested that autologous stem-cell collection following etoposide
is associated with an increased risk of leukemia with
characteristic balanced translocations (Krishnan et al., 2000).
However, by a sensitive PCR-based assay the t(4;11) was not
detectable in the unpurged or the purged marrow autograft harvested
after the second cycle of etoposide-containing PVP, and did not
emerge until after all chemotherapy cycles were complete. The
t(4;11) occurred before the local radiation and radioimmunotherapy
during the intensive N7 neuroblastoma regimen. The MLL-GAS7
translocation also was present before any radiation (Megonigal et
al., 2000), indicating that the chemotherapy but not radiation
contributed to the damage that caused these translocations.
[0075] The DNA topoisomerase II inhibitor exposures before
molecular emergence of the t(4;11) in the case of patient t-120
were doxorubicin and etoposide, and there were etoposide-,
etoposide metabolite- and doxorubicin-stimulated DNA topoisomerase
II in vitro cleavage sites proximal to the translocation
breakpoints that could be repaired to form both breakpoint
junctions. The alternative models for formation of the der(11) and
der(4) genomic breakpoint junctions were based on cleavage sites at
MLL bcr position 6588, which was enhanced by all of the drug
exposures, and either the cleavage site at AF-4 intron 3 position
7126 enhanced only by etoposide and its metabolites (FIG. 3A) or
AF-4 intron 3 position 7114 enhanced only by doxorubicin (FIG. 3B).
Since this was a later-occurring translocation during the treatment
and emerged only after exposure to both DNA topoisomerase II
poisons in the regimen, it is possible that etoposide or its
metabolites or doxorubicin caused the relevant damage. Nonetheless,
in the ALL of patient t-120, the processing of functional
drug-stabilized DNA topoisomerase II cleavage sites in MLL and AF-4
generated the observed genomic breakpoint junctions.
[0076] These results differ from the findings in the second case
where the translocation first became detectable when doxorubicin
was the only DNA topoisomerase II poison to which the patient was
exposed. The translocation breakpoints in MLL and GAS7 were
proximal to strong doxorubicin-stimulated DNA topoisomerase II in
vitro cleavage sites at MLL bcr position 4675 and GAS7 position
1238 that could be resolved to form both breakpoint junctions. This
is the first functional demonstration of relevance of
doxorubicin-stimulated DNA topoisomerase II covalent complexes with
MLL and with its partner gene in the genesis of MLL translocations
in treatment-related AML.
[0077] Another consideration was that anthracyclines are known to
exhibit both cleavage stimulation characteristic of DNA
topoisomerase II poisons at low concentrations but, at high
concentrations, catalytic inhibition of DNA topoisomerase II
function due to intercalation (Capranico and Binaschi, 1998).
Analysis of DNA topoisomerase II cleavage with doxorubicin over a
range of concentrations unmasked doxorubicin-stimulated cleavage
sites proximal to the translocation breakpoints in MLL, AF-4 and
GAS7 that were not detected at higher concentrations. The balance
of dose-dependent dual effects of doxorubicin as a poison and a
catalytic inhibitor of DNA topoisomerase II function has
substantial implications for its role in the genesis of
translocations in a cellular context because the model for
formation of the translocations is based on poisoning effects. The
site selectivity of the doxorubicin-stimulated in vitro cleavage
sites proximal to the breakpoints also is of interest. Different
patterns of cleavage stimulation by various DNA topoisomerase II
poisons at preferred sites in any given substrate has suggested
that local base sequences enable formation of ternary
drug-DNA-enzyme complexes (Capranico and Binaschi, 1998). The
previously reported site selectivity of doxorubicin was A at
position -1 and T at position -2 relative to the cleavage
(Capranico and Binaschi, 1998). Here, however, only 2 of the 7
cleavage sites in MLL, AF-4 and GAS7 (shown in FIGS. 2C, 2D, 4C,
and 4D) where doxorubicin behaved as a poison (specifically, MLL
bcr position 4673 and AF-4 intron 3 position 7119), fulfilled these
sequence preferences on either the sense strand or the antisense
strand of the DNA. Thus the sequence preferences for poisoning
effects of doxorubicin may be less stringent than previously
thought.
[0078] Non-homologous end joining (NEJ) repair events, which have
been implicated in the resolution of DNA damage in the MLL
translocation process (Lovett et al., 2001), are often imprecise
and ensue after small deletions or insertions at the site of damage
(Liang et al., 1998). The models in FIGS. 3A, 3B, and 5 invoked
small deletions at the DNA topoisomerase II cleavage sites in MLL
and its partner genes to create homologous overhangs that formed
characteristic breakpoint junctions. Single-base homologies, as
would be present after exonucleolytic nibbling at these staggered
nicks, are sufficient for error-prone NHEJ (Liang et al.,
1998).
[0079] The formation of drug-stabilized and native DNA
topoisomerase II cleavage complexes in ex vivo-expanded human CD34+
cells was also investigated as a cellular model for analysis of MLL
translocations. It was important to devise a cellular model to
further study the role of DNA topoisomerase II cleavage in the
genesis of MLL translocations because cleavage sites in the
cellular context should be more restricted than in vitro (Capranico
et al., 1990). In a murine retroviral transplant model it recently
was shown that leukemias with MLL translocations can arise either
in self-renewing stem cells or in committed myeloid progenitor cell
populations (Cozzio et al., 2003), corroborating relevance of the
human CD34+cell model system. The analyses of DNA topoisomerase
II.alpha. mRNA (Table 1) and protein (FIG. 6) expression indicate
that in human CD34+ cells grown in short-term culture DNA
topoisomerase II.alpha. is highly expressed at levels comparable to
human hematopoietic cell lines. Human CD34+ cells had not been
previously studied in the ICE bioassay, which detects any DNA in
total genomic DNA bound to DNA topoisomerase II.alpha. by the
covalent phosphotyrosine linkage formed between this enzyme and DNA
(Whitmarsh et al., 2003). Both native and etoposide-stabilized DNA
topoisomerase II.alpha. cleavage complexes were demonstrable in the
CD34+ cells.
[0080] In addition, a new approach was devised for detecting DNA
topoisomerase II.alpha. covalently bound specifically to the MLL
bcr in untreated or etoposide-treated CD34+ cells. This assay,
which is similar to a ChIP assay (Boyd et al., 1998) without
cross-linking, was accomplished by immuno-affinity purification of
DNA topoisomerase II covalent complexes from the total genomic DNA
of the CD34+ cells followed by DOP and then real-time PCR using
primers proximal to the hotspot for MLL translocation breakpoints
(Whitmarsh et al., 2003) in intron 8 3' in the bcr. Native as well
as etoposide-stabilized DNA topoisomerase II covalent complexes
with the MLL bcr were detectable in the immuno-affinity purified
DNA topoisomerase II covalent complexes, demonstrating that DNA
topoisomerase II forms covalent complexes with MLL at sites of
translocation breakpoints in human CD34+ cells. That MLL exon 25 is
distal to the bcr and not involved in leukemia-associated
translocations, yet etoposide induced DNA topoisomerase II cleavage
complexes proximal to the MLL exon 25 amplicon, may suggest that
translocations resulting from repair of DNA topoisomerase
II-mediated damage in MLL exon 25 would not provide a selective or
proliferative advantage for leukemogenesis. Detection of DNA
topoisomerase II covalent complexes at the hotspot for MLL
translocation breakpoints in intron 8 3' in the bcr in the presence
of etoposide establishes that drug-stabilized DNA topoisomerase II
cleavage is a mechanism to damage MLL at a relevant site and in a
relevant cellular model system.
[0081] In addition, formation of DNA topoisomerase II.alpha.
covalent complexes at the hotspot for MLL translocation breakpoints
by the native enzyme is especially important. Translocations of the
MLL gene are the hallmark aberrations in leukemias that follow
chemotherapy with DNA topoisomerase II poisons (Rowley and Olney,
2002) and several treatment-related leukemias occurring after DNA
topoisomerase II poisons have translocation breakpoints at this
hotspot region (reviewed in (Whitmarsh et al., 2003)). However, not
all MLL-rearranged treatment-related leukemias occur after exposure
to these agents. For example, a case of secondary AML with t(9;11)
and der(11) and der(9) MLL breakpoints in this hotspot region has
been reported after chemotherapy for primary Hodgkin's disease
without DNA topoisomerase II poisons (Langer et al., 2003).
Formation of DNA topoisomerase II.alpha. covalent complexes in this
genomic region by the native enzyme may be the cause of the
breakage in such cases. Furthermore, native DNA topoisomerase II
cleavage also should be active during the bone marrow repopulation
and recovery after cytotoxic chemotherapy in general because DNA
topoisomerase II.alpha. expression is cell cycle-dependent and
highest in proliferating cells (Isaacs et al., 1998).
[0082] The results of the present study imply two mechanisms for
DNA topoisomerase II involvement in the DNA damage that results in
MLL translocations. The first mechanism implicates direct poisoning
effects of drug-stabilized DNA topoisomerase II cleavage complexes
at the translocation breakpoint sites as the damage mechanism. In
the second mechanism, native DNA topoisomerase II mediates cleavage
at the translocation breakpoints. This second mechanism is relevant
to the cases where prior cytotoxic chemotherapy without DNA
topoisomerase II poisons was administered. Ternary DNA
topoisomerase II cleavage complexes with MLL sequences involved in
translocations can be stimulated by poisons of the enzyme, but the
native enzyme alone forms cleavage complexes with the MLL
translocation breakpoint hotspot; either can be important in the
DNA damage that leads to translocations.
[0083] Another example was shown of real-time PCR detection of DNA
topoisomerase II complexes in proximity to the MLL intron 7-exon 8
junction in CD34+ cells that were treated either with etoposide or
genistein, indicating that the naturally-occurring compound that is
found in diet also is associated with formation of functional DNA
topoisomerase cleavage complexes proximal to this amplicon in the
MLL bcr.
EXAMPLE V
Microarrays
[0084] One goal of these assays is the global identification of DNA
topoisomerase II mediated damage from etoposide and its metabolites
in the MLL bcr and in the genome in general. Such damage can be
studied in ex vivo-expanded human bone marrow progenitor cells as
representative targets for translocations. A direct interaction of
DNA topoisomerase II with specific MLL bcr sequences has not been
investigated in a cellular context except in the real-time PCR
assays described herein. The generation of a custom MLL
bcr-specific oligonucleotide array would further streamline and
improve upon the present detection method.
[0085] Employing XeoChip.TM. technology (Xeotron, Houston, Tex.), a
first generation MLL bcr oligonucleotide array containing replicate
slots of each of 162 probes was created. The 162 probes included 73
probes for the non-repetitive MLL bcr sequences, 8 probes for the
Alu region between nucleotide positions 663-1779 in the MLL bcr, 57
probes for MLL exon 25 which is unaffected by the translocations,
and 24 probes for 9 bacterial control genes (see Tables 2 and 3;
Tables 4 and 5 provide another example of a series of
oligonucleotides that can be employed in a microarray). The 8.3 kb
MLL bcr is represented by replicates of each of the 73 50mers at
average intervals of 115 bases to span the bcr. Because it has been
well documented in the literature that the printing, general
hybridization conditions, and scanning of microarrays introduce
systemic effects that are related to the position on the chip,
replicates of each of the probes in the array have been spaced
throughout the chip.
[0086] MLL-specific probes without homology to each other or to Alu
sequences were designed to be 50mer sense-strand sequences in
accordance with Xeotron parameters. A BLAST search of the probes
against the human genome sequence confirmed that the probes were
MLL-specific. Special probe design was utilized for the Alu-rich
region from MLL bcr positions 663-1779 where no consideration for
cross-homology was possible. Bacterial control gene sequences were
BLAST searched against the human genome sequence database. Probes
were not designed to regions where BLAST hits were found and then
designed to be sense-strand 50mer sequences using the Xeotron
parameters. Except in the instance of the Alu-rich region probes,
this probe design, under stringent hybridization and washing
conditions, should enable distinguishing between distinct sequences
where the overall homology is <80% (i.e. 10 mismatches out of 50
bases) and where there are no stretches of >25 bases of
homology.
[0087] Primary CD34+ selected human bone marrow cells were obtained
through the NHLBI or purchased commercially. The cells were
expanded ex vivo using conditions optimized to promote minimal
differentiation in order to increase cell numbers as required to
generate a useful model system. Briefly, the general strategy is:
1) ex vivo-expand CD34+ cells or other relevant cells to be treated
with etoposide or different test compound, 2) treat the cells with
etoposide or reserve as untreated, 3) lyse the cells, 4) shear the
DNA, 5) isolate total genomic DNA including any protein-bound DNA
as for ICE bioassays (see FIG. 10), 6) isolate DNA-DNA
topoisomerase II covalent complexes with an immunoaffinity column
according to the scheme summarized in FIG. 11 and elute DNA-DNA
topoisomerase II covalent complexes from the column, 7) perform
whole genome amplification by degenerative oligonucleotide PCR or
another suitable technique, 8) quantify DOP products by measuring
the OD260, 9) measure fragment sizes of DOP products in an agarose
gel, and 10) analyze the DOP products from the experimental sample
(which can either be untreated cells or cells treated with specific
agent) and the calibrated standard sample (i.e. plasmid containing
genomic sequence of the MLL bcr) labeled with a detectable label
such as Alexa Fluor dyes (Molecular Probes, Eugene, Oreg.),
heat-denatured, and hybridized in different channels to a
pre-hybridized MLL bcr XeoChip.TM..
[0088] Components of the experimental design, including statistical
and computational tools to use MLL bcr DNA oligonucleotide arrays
to study human CD34+ cells treated with etoposide and compare
treated with untreated cells, also were developed. A degenerative
oligonucleotide PCR-(DOP-) amplified plasmid DNA template
containing an 8.3 kb genomic DNA insert of the entire MLL bcr in
PBSK II+ is employed for use as a labeled reference sample
calibrated against every probe in the array in order to enable
better accuracy in spot intensity information and control for any
unequal labeling of specific regions in the bcr in the
DOP-amplified experimental samples. By 1) serial dilutions of
AlexaFluor dye-labeled DOP products of the reference sample, 2)
acquisition of MLL bcr XeoChip.TM. images with the Cy-3 and Cy-5
channels of a GenePix.RTM. (Axon Instruments, Foster City, Calif.)
laser scanner, and 3) analysis using the GenePix.RTM. program, it
has been established that hybridization of 0.02 .mu.g of the
reference sample gives a non-saturating hybridization signal (FIG.
12).
[0089] In additional experiments, CD34+ cells were expanded in
culture, treated or untreated for 2 hours with etoposide at 100
.mu.M final concentration. The total cellular DNA was harvested
including any protein-bound DNA on CsCl cushions, and then
immunoaffinity column purification of DNA covalently bound to DNA
topoisomerase II.alpha. was performed in etoposide-treated or
untreated samples according to the schematics summarized in FIG. 10
and FIG. 11. DOP of the immunoaffinity-purified DNA topoisomerase
II cleavage complexes from the treated and untreated cells was
performed exactly as was done with the reference sample. In one
such experiment the samples from untreated cells or cells treated
with 100 .mu.M etoposide were labeled with AlexaFluor 546
(equivalent of Cy-3; green) and the MLL bcr reference sample was
labeled with AlexaFluor 647 (equivalent of Cy-5; red). Dye-swap
experiments were also performed. MLL bcr XeoChip.TM. hybridizations
were then performed with 0.02 .mu.g of AlexaFluor dye-labeled DOP
products of etoposide-treated or untreated samples in one channel
of the chip and the reference sample labeled with the reverse
AlexaFluor dye in the other channel.
[0090] GeneSpring (Silicon Genetics, Redwood City, Calif.) was
employed as a computational tool to visualize and analyze the data
from MLL bcr XeoChips.TM. with either treated or untreated samples
in one channel and the reference sample in the other.
Non-parametric statistical regression tools can also be applied in
order to identify hybridization hotspots that suggest effects of
treatment. The preliminary data analysis suggests that the MLL
Xeochips.TM. microarray is useful for detecting hotspots and
coldspots for DNA topoisomerase II complex formation with the MLL
bcr.
[0091] A Quantile-Quantile (Q-Q) plot (44, 45) standardized by
intensity was employed to compare etoposide-treated and untreated
cells (FIG. 12B). DOP-amplified DNA from the DNA topoisomerase II
cleavage complexes in treated or untreated cells on separate chips
was labeled with AlexaFluor 546. The MLL bcr reference sample was
labeled with AlexaFluor 647. The null hypothesis represented by the
straight line is that there is no effect at any probe, whereas
upward departure points are potential hotspots and downward
departure points are potential coldspots. As seen in FIG. 12B,
probes 1-41 and 1-51, for example, appear as hotspots and probes
2-28, 1-30, 1-18, and 1-15, for example, appears as a cold
spot.
[0092] A similar Q-Q plot was performed on untreated cells and
cells treated with 100 .mu.M genistein (FIG. 12C). Probes 1-68 (SEQ
ID NO: 157), 1-41 (SEQ ID NO: 49), 1-51 (SEQ ID NO: 141), and 1-33
(SEQ ID NO: 132) were identified as potential hotspots and probes
1-31 (SEQ ID NO: 27), 2-50 (SEQ ID NO: 162), 1-74 (SEQ ID NO: 62),
2-28 (SEQ ID NO: 34), 1-10 (SEQ ID NO: 83), and 1-22 (SEQ ID NO:
71) were identified as potential coldspots. Notably, probes 1-41
(SEQ ID NO: 49) and 1-51 (SEQ ID NO: 141) were identified as
hotspots in both etopside and genistein treated cells while probe
2-28 (SEQ ID NO: 34) was identified as a coldspot. It is also
noteworthy that probes 1-68 (SEQ ID NO: 157) and 1-33 (SEQ ID NO:
132) correspond to nearby oligonucleotides. Additionally, these
results mirror in vitro cleavage studies with etoposide and
genistein as there is some overlap in cleavage sites induced by the
different agents as well as differences in site selectivity.
TABLE-US-00002 TABLE 2 Probe Ranked Position Random Original order
of Sequence within Sorter Sorter Probe ID preference Sequence
Description Length sequence 1 93 0002-12 12 MLL Exon 25 4249 2662 2
66 0001-66 24 MLL Exon-intron 5 to 11 8342 3682 3 113 0002-32 32
MLL Exon 25 4249 2450 4 24 0001-24 24 MLL Exon-intron 5 to 11 8342
5309 5 32 0001-32 32 MLL Exon-intron 5 to 11 8342 5938 6 106
0002-25 25 MLL Exon 25 4249 436 7 54 0001-54 12 MLL Exon-intron 5
to 11 8342 4395 8 161 LysX-M 1 LysX-M 270 132 9 118 0002-37 37 MLL
Exon 25 4249 2748 10 112 0002-31 31 MLL Exon 25 4249 334 11 110
0002-29 29 MLL Exon 25 4249 2829 12 157 TrpnX-3 1 TrpnX-3 579 128
13 86 0002-5 5 MLL Exon 25 4249 3476 14 160 BioB-3 1 BioB-3 298 61
15 30 0001-30 30 MLL Exon-intron 5 to 11 8342 2460 16 61 0001-61 19
MLL Exon-intron 5 to 11 8342 3149 17 39 0001-39 39 MLL Exon-intron
5 to 11 8342 3214 18 81 0001-81 8 >MLL Exon-intron 5 to 11 8342
1578 19 12 0001-12 12 MLL Exon-intron 5 to 11 8342 4666 20 2 0001-2
2 MLL Exon-intron 5 to 11 8342 7974 21 73 0001-73 31 MLL
Exon-intron 5 to 11 8342 1875 22 130 0002-49 12 MLL Exon 25 4249
160 23 85 0002-4 4 MLL Exon 25 4249 4048 24 103 0002-22 22 MLL Exon
25 4249 1285 25 46 0001-46 4 MLL Exon-intron 5 to 11 8342 314 26 57
0001-57 15 MLL Exon-intron 5 to 11 8342 3349 27 31 0001-31 31 MLL
Exon-intron 5 to 11 8342 88 28 139 BioB-5 1 BioB-5 274 83 29 52
0001-52 10 MLL Exon-intron 5 to 11 8342 5089 30 72 0001-72 30 MLL
Exon-intron 5 to 11 8342 4585 31 20 0001-20 20 MLL Exon-intron 5 to
11 8342 7877 32 13 0001-13 13 MLL Exon-intron 5 to 11 8342 5549 33
155 ThrX-5 1 ThrX-5 645 391 34 109 0002-28 28 MLL Exon 25 4249 2314
35 21 0001-21 21 MLL Exon-intron 5 to 11 8342 7776 36 45 0001-45 3
MLL Exon-intron 5 to 11 8342 4501 37 65 0001-65 23 MLL Exon-intron
5 to 11 8342 5347 38 34 0001-34 34 MLL Exon-intron 5 to 11 8342
4361 39 15 0001-15 15 MLL Exon-intron 5 to 11 8342 1779 40 119
0002-38 1 MLL Exon 25 4249 3435 41 35 0001-35 35 MLL Exon-intron 5
to 11 8342 6403 42 18 0001-18 18 MLL Exon-intron 5 to 11 8342 6578
43 99 0002-18 18 MLL Exon 25 4249 3937 44 126 0002-45 8 MLL Exon 25
4249 857 45 94 0002-13 13 MLL Exon 25 4249 181 46 7 0001-7 7 MLL
Exon-intron 5 to 11 8342 7 47 105 0002-24 24 MLL Exon 25 4249 3395
48 100 0002-19 19 MLL Exon 25 4249 1182 49 41 0001-41 41 MLL
Exon-intron 5 to 11 8342 343 50 116 0002-35 35 MLL Exon 25 4249
1984 51 117 0002-36 36 MLL Exon 25 4249 523 52 149 DapX-M 1 DapX-M
561 367 53 150 LysX-3 1 LysX-3 283 171 54 5 0001-5 5 MLL
Exon-intron 5 to 11 8342 2361 55 162 LysX-5 1 LysX-5 273 12 56 67
0001-67 25 MLL Exon-intron 5 to 11 8342 3471 57 53 0001-53 11 MLL
Exon-intron 5 to 11 8342 7636 58 88 0002-7 7 MLL Exon 25 4249 3557
59 27 0001-27 27 MLL Exon-intron 5 to 11 8342 3584 60 153 PheX-M 1
PheX-M 392 238 61 152 PheX-5 1 PheX-5 348 86 62 74 0001-74 1
>MLL Exon-intron 5 to 11 8342 779 63 83 0002-2 2 MLL Exon 25
4249 3839 64 75 0001-75 2 >MLL Exon-intron 5 to 11 8342 870 65
158 TrpnX-5 1 TrpnX-5 531 218 66 101 0002-20 20 MLL Exon 25 4249
2956 67 44 0001-44 2 MLL Exon-intron 5 to 11 8342 516 68 76 0001-76
3 >MLL Exon-intron 5 to 11 8342 991 69 114 0002-33 33 MLL Exon
25 4249 3303 70 19 0001-19 19 MLL Exon-intron 5 to 11 8342 7541 71
22 0001-22 22 MLL Exon-intron 5 to 11 8342 3022 72 135 0002-54 17
MLL Exon 25 4249 2457 73 90 0002-9 9 MLL Exon 25 4249 70 74 47
0001-47 5 MLL Exon-intron 5 to 11 8342 6398 75 144 BioDn-5 1
BioDn-5 277 221 76 123 0002-42 5 MLL Exon 25 4249 1264 77 79
0001-79 6 >MLL Exon-intron 5 to 11 8342 1343 78 122 0002-41 4
MLL Exon 25 4249 1556 79 111 0002-30 30 MLL Exon 25 4249 909 80 120
0002-39 2 MLL Exon 25 4249 2280 81 50 0001-50 8 MLL Exon-intron 5
to 11 8342 680 82 56 0001-56 14 MLL Exon-intron 5 to 11 8342 5466
83 10 0001-10 10 MLL Exon-intron 5 to 11 8342 2611 84 91 0002-10 10
MLL Exon 25 4249 604 85 124 0002-43 6 MLL Exon 25 4249 2016 86 37
0001-37 37 MLL Exon-intron 5 to 11 8342 6683 87 8 0001-8 8 MLL
Exon-intron 5 to 11 8342 169 88 107 0002-26 26 MLL Exon 25 4249
1656 89 25 0001-25 25 MLL Exon-intron 5 to 11 8342 663 90 140
BioB-M 1 BioB-M 258 80 91 38 0001-38 38 MLL Exon-intron 5 to 11
8342 4480 92 26 0001-26 26 MLL Exon-intron 5 to 11 8342 3921 93 98
0002-17 17 MLL Exon 25 4249 2540 94 142 BioC-5 1 BioC-5 349 193 95
97 0002-16 16 MLL Exon 25 4249 1575 96 102 0002-21 21 MLL Exon 25
4249 3753 97 14 0001-14 14 MLL Exon-intron 5 to 11 8342 2699 98 16
0001-16 16 MLL Exon-intron 5 to 11 8342 6769 99 151 PheX-3 1 PheX-3
442 353 100 42 0001-42 42 MLL Exon-intron 5 to 11 8342 4574 101 55
0001-55 13 MLL Exon-intron 5 to 11 8342 2829 102 64 0001-64 22 MLL
Exon-intron 5 to 11 8342 2515 103 127 0002-46 9 MLL Exon 25 4249
2636 104 134 0002-53 16 MLL Exon 25 4249 1392 105 84 0002-3 3 MLL
Exon 25 4249 3101 106 108 0002-27 27 MLL Exon 25 4249 705 107 78
0001-78 5 >MLL Exon-intron 5 to 11 8342 1256 108 63 0001-63 21
MLL Exon-intron 5 to 11 8342 2940 109 138 0002-57 20 MLL Exon 25
4249 3351 110 141 BioC-3 1 BioC-3 253 5 111 4 0001-4 4 MLL
Exon-intron 5 to 11 8342 6963 112 49 0001-49 7 MLL Exon-intron 5 to
11 8342 5675 113 77 0001-77 4 >MLL Exon-intron 5 to 11 8342 1153
114 28 0001-28 28 MLL Exon-intron 5 to 11 8342 5669 115 136 0002-55
18 MLL Exon 25 4249 278 116 92 0002-11 11 MLL Exon 25 4249 1437 117
89 0002-8 8 MLL Exon 25 4249 4165 118 128 0002-47 10 MLL Exon 25
4249 3269 119 3 0001-3 3 MLL Exon-intron 5 to 11 8342 250 120 11
0001-11 11 MLL Exon-intron 5 to 11 8342 517 121 62 0001-62 20 MLL
Exon-intron 5 to 11 8342 3913 122 58 0001-58 16 MLL Exon-intron 5
to 11 8342 2299 123 125 0002-44 7 MLL Exon 25 4249 2118 124 148
DapX-5 1 DapX-5 499 2 125 146 CreX-5 1 CreX-5 535 229 126 95
0002-14 14 MLL Exon 25 4249 2206 127 147 DapX-3 1 DapX-3 447 85 128
132 0002-51 14 MLL Exon 25 4249 3757 129 137 0002-56 19 MLL Exon 25
4249 3037 130 71 0001-71 29 MLL Exon-intron 5 to 11 8342 5171 131
48 0001-48 6 MLL Exon-intron 5 to 11 8342 5258 132 33 0001-33 33
MLL Exon-intron 5 to 11 8342 2827 133 145 CreX-3 1 CreX-3 407 220
134 82 0002-1 1 MLL Exon 25 4249 1890 135 43 0001-43 1 MLL
Exon-intron 5 to 11 8342 6966 136 23 0001-23 23 MLL Exon-intron 5
to 11 8342 7450 137 17 0001-17 17 MLL Exon-intron 5 to 11 8342 6493
138 115 0002-34 34 MLL Exon 25 4249 1775 139 129 0002-48 11 MLL
Exon 25 4249 3568 140 6 0001-6 6 MLL Exon-intron 5 to 11 8342 3104
141 51 0001-51 9 MLL Exon-intron 5 to 11 8342 8087 142 121 0002-40
3 MLL Exon 25 4249 641 143 159 TrpnX-M 1 TrpnX-M 489 165 144 143
BioDn-3 1 BioDn-3 286 73 145 60 0001-60 18 MLL Exon-intron 5 to 11
8342 8175 146 133 0002-52 15 MLL Exon 25 4249 1748 147 80 0001-80 7
>MLL Exon-intron 5 to 11 8342 1493 148 70 0001-70 28 MLL
Exon-intron 5 to 11 8342 5791 149 1 0001-1 1 MLL Exon-intron 5 to
11 8342 6881 150 87 0002-6 6 MLL Exon 25 4249 1033 151 9 0001-9 9
MLL Exon-intron 5 to 11 8342 5126 152 40 0001-40 40 MLL Exon-intron
5 to 11 8342 2278 153 156 ThrX-M 1 ThrX-M 571 485 154 104 0002-23
23 MLL Exon 25 4249 3201 155 96 0002-15 15 MLL Exon 25 4249 2073
156 154 ThrX-3 1 ThrX-3 463 135 157 68 0001-68 26 MLL Exon-intron 5
to 11 8342 3257 158 69 0001-69 27 MLL Exon-intron 5 to 11 8342 435
159 59 0001-59 17 MLL Exon-intron 5 to 11 8342 3818 160 36 0001-36
36 MLL Exon-intron 5 to 11 8342 8055 161 29 0001-29 29 MLL
Exon-intron 5 to 11 8342 8293 162 131 0002-50 13 MLL Exon 25 4249
3121
[0093] TABLE-US-00003 TABLE 3 SEQ ID Probe ID NO Probe Sequence
0002-12 1 GTCCTGGCCCGTCTCAGATTTCCAATGCAGCTGTCCAGACCACTCCACCC
0001-66 2 AAAGAATCCTGAATAAATGGGGACTTTCTGTTGGTGGAAAGAAATATAGA
0002-32 3 TCCAACTCCTGAAGGCCACATGACTCCTGATCATTTTATCCAAGGACACA
0001-24 4 ATTCAGTCTACAAGTGCCAGGGGTCTACTGTATCCTCTTTTCCGTCTTAA
0001-32 5 AGGCCTTATTTAGGTTTGACCAATTGTCCCAATAATTCCTTTATGGCAAA
0002-25 6 TGAGTTCCAAGAGCTCAGAGGGATCTGCACATAATGTGCCTTACCCTGGA
0001-54 7 AGAGCAGGTTACAAGATAATATATAAAGCACAATCCCATCTTAGTTTGCA LysX-M
8 CGCATACGCATGACTACATTACAACGGGCCAGGAAGATTCAAAGTTTGGT 0002-37 9
AACCAGAACATGCAGCCACTTTATGTTCTCCAAACTCTTCCAAATGGAGT 0002-31 10
ACAGTCACTTGGATGGATCTTCATCTTCAGAAATGAAGCAGTCCAGTCCT 0002-29 11
AGTTCTACACCCAGTGTGATGGAGACAAATACTTCAGTATTGGGACCCAT TrpnX-3 12
AAATATTGCGGTATTCGGTCACTAAAGGATTTGCAGCTTGCGGCGGAATC 0002-5 13
CCACCTCACATCAGGGTCTGTGTCTGGCTTGGCATCCAGTTCCTCTGTCT BioB-3 14
GAACGAACAGACTCAGGCGATGTGCTTTATGGCAGGCGCAAACTCGATTT 0001-30 15
CCACAGGATCAGAGTGGACTTTAAGGTAAAGGTGTTCAGTGATCATAAAG 0001-61 16
AGGCATCCTGCTTCTTTGTACCCCAGGAAGTACATAAATGATTGATCTGG 0001-39 17
AGTCTGTTTTGTTGGTATTTAGCAGGTACTATTCCCTGTTTAAACCAGCT 0001-81 18
CCTGTACTCCCAGCTACTCAGGAGAGTGAGCCAGGAGAATCGCGTGAACC 0001-12 19
TCCTACATCCTTTACAGTTCTTAAATTCCTGGCAGATACCTCTTTGCCTT 0001-2 20
TGGAGTGTAATAAGTGCCGAAACAGCTATCACCCTGAGTGCCTGGGACCA 0001-73 21
AAATCACCCTTCCCTGTATTCACTATTTTTATTTATTATGGATAAAGAGA 0002-49 22
ACTCTAGGAATAATGTTTCCTCAGTCTCCACCACCGGGACCGCTACTGAT 0002-4 23
CTCCATCCTCTCCATCTTCTGGACAGCGGTCAGCAAGCCCTTCAGTGCCG 0002-22 24
AGGACAGAAACCTAATGCTTCCAGATGGCCCCAAACCTCAGGAGCATGGC 0001-46 25
AAGCACTGATGTCTCAAACAGCATTTGAAAGCAGGAAATGTATGATTTGA 0001-57 26
AATCCCATCTCTCTTAAATTCAGTCTTTATTAGAGTTCTGATCTTTCTGT 0001-31 27
TCGGCCTGAATCCAAACAGGCCACCACTCCAGCTTCCAGGAAGTCAAGCA BioB-5 28
TTCGATCCTCGTCAGGTGCAGGTCAGCACGTTGCTGTCGATTAAGACCGG 0001-52 29
AGAAAATCCAAGCTAGGTTGAAATCTGAATGTTGAGCAGTCAGTGAGACA 0001-72 30
TGTACCACCTTTACAATGAGGAAGGAAAAAGTAGCACAATTTTAAATAGG 0001-20 31
TGCCAGTAAATGTGAAATGGGGTACTAAGTAATAGGTGTTGGCTGAAGGT 0001-13 32
ACTGCACTCCTAAAGCATGACCAGTGCTTGATAAACTCTCCTCCATGCGA ThrX-5 33
AGAAATCACCGATTGCCCTTGTCAACTCAGTCAACCCTTACCGCATTGAA 0002-28 34
GGAGTCCCACTGTCCCCAGCCAGAATCCCAGTAGACTAGCTGTTATCTCA 0001-21 35
ACTGAGTGCCTTTGGCAGGAAATAAATCTATCTCAATGCGTTAATTGGGA 0001-45 36
ATTAAGAGTGTGGTTGGATTATGGGTGACCTTTATTTGTTTCTCTGGTTT 0001-65 37
TTTCCGTCTTAATACAGTGCTTTGCACCCATATATATGCCACCCACAGGA 0001-34 38
TGGAAAGATGTCCATGACATATCACTGAGTGAAAAGAGCAGGTTACAAGA 0001-15 39
CCCACATGTTCTAGCCTAGGAATCTGCTTATTCTAAAGGCCATTTGGCGT 0002-38 40
GCCACAGCGGCAGGCACATCAACAATAAGCCAGGATACTAGCCACCTCAC 0001-35 41
TGGAAAGGACAAACCAGACCTTACAACTGTTTCGTATATTACAGAAAACG 0001-18 42
TTTCCACTGGTATTACCACTTTAGTACTCTGAATCTCCCGCAATGTCCAA 0002-18 43
CCCAGGTATCCAACTTTACCCAGACCGTAGACGCTCCTAATAGCATGGGA 0002-45 44
CGTGACAACTGGTGAGGAAGGAAACTTCAAGCCAGAGTTTATGGATGAGG 0002-13 45
CAGTCTCCACCACCGCGACCGCTACTGATCTTGAATCAAGTGCCAAAGTA 0001-7 46
TGCCCCAAAGAAAAGCAGTAGTGAGCCTCCTCCACGAAAGCCCGTCGAGG 0002-24 47
ACCGGCACCCCTGTTACCACAGAGTGTGGGAGGAACTGCTGCCACAGCGG 0002-19 48
TCAGCCTCTGAAAATCCAGGAGATGGTCCAGTGGCCCAACCAAGCCCCAA 0001-41 49
AGCAGGAAATGTATGATTTGAAGTCTTCAGTTCAAGAAAATCAGCTCTCT 0002-35 50
AGCTCCTGAAATCAGATTCAGACAATAACAACAGTGATCACTGTGGGAAT 0002-36 51
CTAGAGAACTGAATGTTAGTAAAATCGGCTCCTTTGCTGAACCCTCTTCA DapX-M 52
TGTCTCGGCATTAATCCGTTTATGTGATCTGTATTCCATTCCGCTCGCCA LysX-3 53
GATCGAACCGGGCCGTTCTCTCGTGGGAGACGCAGGCACAACTCTTTATA 0001-5 54
ACCTCCGGTCAATAAGCAGGAGAATGCAGGCACTTTCAACATCCTCAGCA LysX-5 55
CAACATGGTCATTTAGAAATCGGAGGTGTGGATGCTCTCTATTTAGCGGA 0001-67 56
TGTATATCAAAGCCTCTTCATCTATAAGGAGCTCTTACCAATTAATAAGA 0001-53 57
TTTACTTAGTCTGTCTTTAGCATTTAATTGGGTGTAATCAGTTGCCTATT 0002-7 58
CCCTACAAGTAGTGCGTCAGTTCCAGGACACGTCACCTTAACCAACCCAA 0001-27 59
GAAATAAATACATGTTGGGTGGCAGGGGGAGGTGAAGGGAGGGTGTCTGT PheX-M 60
TTTAATACATGAACAGCCTTTCCCAATCGTCGGTGAAATGACGTTGCCGA PheX-5 61
GCAGATTCAGTAGCAGATGCCGTTCAAAAGGTCGATTTAAGTAGAAGTGC 0001-74 62
AACTTCAAGTTTAGGCTTTTAGCTGGGCACGGTCGCTCACGCTGGTAATC 0002-2 63
AGCAGACGAACACTATCAGCTTCAGCATGTGAACCAGCTCCTTGCCAGCA 0001-75 64
CAGCAGTTCAAGACCAGCCTGGGCAACATAGCAAGACCCTGTCTTTATTT TrpnX-5 65
AAACCCTTACTGCCGGTGAGGCTGAAACGCTGATGAATATGATGATGGCA 0002-20 66
AAGGATTGCTACCCATGTCTCATCACCAGCACTTACATTCCTTCCCTGCA 0001-44 67
GCCCTTTCTTCACAGGTCAGTCAGTACTAAAGTAGTCGTTGCCAGCATCT 0001-76 68
TCAGGAGGCTGAGATAGAAGGATTGTCTTGAGCCCACGAATTCAAGGCTG 0002-33 69
AGTCTGTTAGATTTGGGGTCACTTAATACTTCATCTCACCGAACTGTCCC 0001-19 70
GGAAACCAAGGATGACTGTGCTTAGAGTATTGCTTTCTTTCTTGATTTGT 0001-22 71
CTCTCCACAGGAGGATTGTGAAGCACAAAATGTGTGGGAGATGGGAGGCT 0002-54 72
CCTGAAGGCCACATGACTCCTGATCATTTTATCCAAGGACACATGGATGC 0002-9 73
GCATTGGCTCCAGGCGTCACAGTACCTCTTCCTTATCACCCCACCGCTCC 0001-47 74
ACAAATGGAAAGGACAAACCAGACCTTACAACTGTTTCGTATATTACAGA BioDn-5 75
CGCAAGAGGGCAGACCGATAGAATCATTGGTAATGAGCGCCGGATTACGC 0002-42 76
ACTATCAGAATCTTCCAGTACAGGACAGAAACCTAATGCTTCCAGATGGC 0001-79 77
GCAGTGAGCCGAGATTGCATCATTGCACTCTAGCCTGGACAACAGAGCTA 0002-41 78
CACTAGAACAGTGATTTCTTCAGGTGGAGAGCAACGACTGGCATCCCATA 0002-30 79
TTGACTCCTGAGTATATGGGCCAACGACCATGTAACAATGTTTCTTCTGA 0002-39 80
GAGCTACCATCTGATCTGTCTGTCTTGACCACCCGCAGTCCCACTGTCCC 0001-50 81
TGTTTCTCTGCCATTTCTCAGGGATGTATTCTATTTTGTAGGGAAAAGCC 0001-56 82
TTCTGATCTAAATTCTTTATAGTTGTACATAGCAATCTCACAGGGTTCCT 0001-10 83
AGCAGGTGGGTTTAGCGCTGGGACAGCTTTGGACAGTGTTGTTAGGTCAC 0002-10 84
TCCCACACCTCCATTTGAGAGGGCAAAGGAATGATCGAGACCAACACACA 0002-43 85
AGTGATGACTGTGGGAATATCCTGCCTTCAGACATTATGGACTTTGTACT 0001-37 86
TGCCAGTGGACTACTAAAACCCAAAGTATATAAGAAGGGTATGGTTGATT 0001-8 87
GCCTCAGCCACCTACTACAGGACCGCCAAGAAAAGAAGTTCCCAAAACCA 0002-26 88
GATGGTGTTGATGATGGGACAGAGAGTGATACTAGTGTCACAGCCACAAC 0001-25 89
AAAGGTGAGGAGAGATTTGTTTCTCTGCCATTTCTCAGGGATGTATTCTA BioB-M 90
GGGATCAAAGTCTGTTCTGGCGGCATTGTCGGCTTAGGCGAAACCGTAAA 0001-38 91
TGGAAGGATTCACACCAAAATATTAAGAGTGTGGTTGGATTATGGGTGAC 0001-26 92
ACCCGAAAGTCCATCTATAGGGAGCATGGGTTAAAATAAGCATAGGGCAT 0002-17 93
AGAGCAAGGTCATGGCAACAATCAGGATTTAACTAGGAACAGTAGCACCC BioC-5 94
CGCCAATGCTTGTTCAGGCACGCCAGAAGGATGCCGCAGACCATTATCTG 0002-16 95
TCAGGTGGAGAGGAACGACTGGCATCCCATAATTTATTTCGGGAGGAGGA 0002-21 96
ACTGCTGCAATAACAGCGGCATCTAGCATCTGTGTGCTCCCCTCCACTCA 0001-14 97
TTCCTATCCATCCTGAGGAGTATCAGAGGAAGTAATTCCTTCACATGGAA 0001-16 98
TCCCATGTTCTTACTATAGTTTGTCTATTGCCAAGTCTGTTGTGAGCCCT PheX-3 99
CGTTTGATGATGTATTGATTCCAGGGGCCATGCAGGAGCTTGAAGCACTC 0001-42 100
TTTTTGGAGTATGTACCACCTTTACAATGAGGAAGGAAAAAGTAGCACAA 0001-55 101
CTATGAATTGAACAACTAGGTGAGCCTTTTAATAGTCCGTGTCTGAGATT 0001-64 102
TGAGTGTCAAAGACTTTAAATAAAGAAAATGCTACTACCAAAGGTGTTGA 0002-46 103
GAAGTATGTGCCCAATTCTACTGATAGTCCTGGCCCGTCTCAGATTTCCA 0002-53 104
GGGCTTACCCCACTCTATGGAGTAAGATCCTATGGTGAAGAAGACATTCC 0002-3 105
AGAATCCAGCCAGAGGACAGACCTCAGTACCACAGTAGCCACTCCATCCT 0002-27 106
ACCTTGAAGCTATCTGGAATGAGCAACAGATCATCCATTATCAACGAACA 0001-78 107
CCGGTTGTGGTAGTGGGTGCTTGGTAATCCTAGCTACTTGGGAGCCTGAG 0001-63 108
ATGTCACACTAATTTTATGCTTTTCATCCTTATTTTCCATCCAAAGTTGT 0002-57 109
CCCAACATCATAAAAAGATCTAAATCTAGCATCATGTATTTTGAACCGGC BioC-3 110
CGAACGTCATCAGGCGTGGCAGGCGGTGCACGAGCGTCCGCATGCTAATC 0001-4 111
TGGGCCTCTGTATCAGTGGGTTCTGTATCCCTGGACTCAACCAACCTTGG 0001-49 112
CCCTCACCCAAATTCCCTAAGTGTTAATATGTTTCTCTGTGTGTATATAT 0001-77 113
CACTTTGGGAAGCCGAAGCAGGCAGATCACTTGAGGTCAGGAGTTGGAGA 0001-28 114
AAGTACCCCTCACCCAAATTCCCTAAGTGTTAATATGTTTCTCTGTGTGT 0002-55 115
AAACACTTCCACCTCTTCAAATTTGCAAAGGACAGTGGTTACTGTAGGCA 0002-11 116
ATTCCATTCTACAGCAGCTCAACTGGGAAGAAGCGAGGCAAGAGATCAGC 0002-8 117
AGCACAAAGTTTCCCATTTGCGGACCAGTTCTTCTGAAGCACACATTCCA 0002-47 118
TAACTTCACACCCTCCCAGCTTCCTAATCATCCAAGTCTGTTAGATTTGG 0001-3 119
ACCACCAGAATCAGGTGAGTGAGGAGGGCAAGAAGGAATTGCTGACCCAC 0001-11 120
CCCTTTCTTCACACGTCAGTCAGTACTAAAGTAGTCGTTGCCAGCATCTG 0001-62 121
TGGAAACAACCCGAAAGTCCATCTATAGGGAGCATGGGTTAAAATAAGCA 0001-58 122
TGTGAAGGCAAATAGGGTGTGATTTTGTTCTATATTCATCTTTTGTCTCC
0002-44 123 TCAGAACTCCTGAATCTTGGTGAAGGATTGGGTCTTCACAGTAATCGTGA
DapX-5 124 GGCAGAACGAACACCACATTTTGACCTTGTAGGGGCCATAGACCATACAT
CreX-5 125 AAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCC
0002-14 126 TGCCTACAACAGAACCTGTGGATAGTAGTGTCTCTTCCTCTATCTCAGCA
DapX-3 127 TGATCAGGCAATTCGGTCAATTGTCACTGTCATCAGAATCTGTCGGCCAA
0002-51 128 CTGCAATAACAGCGGCATCTAGCATCTGTGTGCTCCCCTCCACTCAGACT
0002-56 129 GCAATCCTCCTTCAGGCCTGCTTATTGGGGTTCAGCCTCCTCCGGATCCC
0001-71 130 TGCCATTTGAAGTTATTACTAGCAAAATTACAAATTATTGCCTACTATTC
0001-48 131 ACAACTTATTGTTCTAAGTGCAGAAGTTCAGATATCATTGAGACTGAGAA
0001-33 132 CACTATGAATTGAACAACTAGGTGAGCCTTTTAATAGTCCGTGTCTGAGA
CreX-3 133 CTAAGGATGACTCTGGTCAGAGATACCTGGCCTGGTCTGGACACAGTGCC
0002-1 134 TCCTTGGAAGCTCAGCTCAGCTCATTGGAGTCAAGCCGCAGAGTCCACAC
0001-43 135 GCCTCTGTATCAGTGGGTTCTGTATCCCTGGACTCAACCAACCTTGGATT
0001-23 136 TGTTATATGCAAATGCTGCACCATTTTGTCTAGGGACTTGGGCATCCATG
0001-17 137 TCCCATAGCTCTTTGTTTATACCACTCTTAGGTCACTTAGCATGTTCTGT
0002-34 138 ACCTGAAGATGCTGGGGAGAAAGAACATGTCACTAAGAGTTCTGTTGGCC
0002-48 139 GTGCGTCAGTTCCAGGACACGTCACCTTAACCAACCCAAGGTTGCTTGGT
0001-6 140 AGGGTGGTTTGCTTTCTCTGTGCCAGTAGTGGGCATGTAGAGGTAAGGCA
0001-51 141 TTATAGAGAACCACCATGTGACTATTGGACTTATGTAACTTGTATTACAA
0002-40 142 AGACCAACACACAGATTCTACCCAATCAGCAAACTCCTCTCCAGATGAAG
TrpnX-M 143 CTCACTGAAGGAAGGAACGGAGCTGGCGTTAGAGACGATTACAACCGGAG
BioDn-3 144 CCGGTGATACTGGTAGTTGGTGTGAAACTCGGCTGTATTAATCACGCGAT
0001-60 145 CCCTCATTACTAGGAAATCATCTCAGGAGAGAAATTAAATCTATAAATGG
0002-52 146 TGGAACAGAGAACTTAAAGATTGATAGACCTGAAGATGCTGGGGAGAAAG
0001-80 147 AGGAGATCGAGACCATCCTGGCTAACACGGTGAAACCCTGTCTCTACTAA
0001-70 148 TGAGAACAAGTTGGAGACATAAACCATTTTACCTCTAAATATTTTAGTGT
0001-1 149 TGTCGTCGCTGCAAATTCTGTCACGTTTGTGGAGGGCAACATCACGCTAC
0002-6 150 AGGAATTACAGGCACCACGGAAACGCACAGTCAAAGTGACACTGACACCT
0001-9 151 AGTCAGTGAGACACAAACTAGCTAAGAAAGTCAACCCTGCCCACTTGCCA
0001-40 152 TGCATTATTATCTGTTGCAAATGTGAAGGCAAATAGGGTGTGATTTTGTT
ThrX-M 153 TACAGATAACCTGATCTACCAAGTGGCTAAACGGACCGCAGATTTGTACG
0002-23 154 AAACTTGCTCCCTCTAGTACCCCTTCAAACATTGCCCCTTCTGATGTGGT
0002-15 155 ACTCCATCCATGCAGGCTTTGGGTGAGAGCCCAGAGTCATCTTCATCAGA
ThrX-3 156 AAGTGCTGACAAGAGACGCGAGAGACGTGCTTCCGAAGGAGTTTCCATAT
0001-68 157 ACCAGCTAAAGAAATGTTTTGAAGTATTTTAGAGATTTTAGGAAGGAATC
0001-69 158 AAACAGTTAAATTGGAGGTATTGTTTTAATTTCCTGTTCGAAGCCTAGAG
0001-59 159 GCACTTCAAACACTTATGGATATAATTAGATAAATTGGCAAATCTGTAGA
0001-36 160 AAGTCTGGGTGAGTTATACACATGATGCTCTTTTATAGAGAACCACCATG
0001-29 161 TTCTTTTCTAGATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCC
0002-50 162 ACCTCAGTACCACAGTAGCCACTCCATCCTCTGGACTCAAGAAAAGACCC
[0094] TABLE-US-00004 TABLE 4 SEQ ID NO Sequence 163
CACTTTGCACTGGAACTTACAACACCCGAGCAAGGACCCGACTCTCCCGA 164
GACACTTCCCCGCCGCTGCCAGGACCCGCTTCTCTGAAAGGCTCTCCTTG 165
CCAGCCAGCGGTCCGCAACCCTTGCCGCATCCACGAAACTTTGCCCATAG 166
CTTTGCACTGGAACTTACAACACCCGAGCAAGGAC 167
CAACCCTTGCCGCATCCACGAAACTTTGCCCATAG 168
CTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGT 169
TTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTC 170
CGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATG 171
GTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAG 172
CGTTTATAGCAGTTACACAGAATTTCAATCCTAGTATATAGTACCTAGTA 173
GAGACTGAAAGATTTAGCCATAATGTAAACTGCCTCAAATTGGACTTTGG 174
CCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATG 175
TTACACAATGTTTCTCTGTAAATATTGCCATTAAATGTAAATAACTTTAA 176
CATCTCCGTATTGAGTGCGAAGGGAGGTCCCCCTATTATTATTTGACACC 177
GCCACTCCAGCCGGCGAGAGAAAGAAGAAAAGCTGGCAAAAGGAGTGTTG 178
GTATTGAGTGCGAAGGGAGGTGCCCCTATTATTATTTG 179
CTTGTATTTATGGAGGGGTGTTAAAGCCCGCGGCTGAG 180
AAAACTTTGTGCCTTGGATTTTGGCAAATTGTTTTCCTCACCGCCACCTC 181
GAGATAGCAGGGGACTGTCCAAAGGGGGTGAAAGGGTGCTCCCTTTATTC 182
AAAACTTTGTGCCTTGGATTTTGGCAAATTGTTTTCCTC 183
GGAATGGTTTTTAAGACTACCCTTTCGAGATTTCTGCCTTATGAATATAT 184
TTTTATCACTTTAATGCTGAGATGAGTCGAATGCCTAAATAGGGTGTCTT 185
CTCCCATTCCTGCGCTATTGACACTTTTCTCAGACTAGTTATGGTAACTG 186
TTATCTTACAACTCAATCCACTTCTTCTTACCTCCCGTTAACATTTTAAT 187
GATCTTCTCAGCCTATTTTGAACACTGAAAAGCAAATCCTTCCCAAAGTT 188
TTTCATTGGCAGCTTATTTAACGGGCCACTCTTATTAGGAAGGAGAGATA 189
CATTAAGTCTTAGGTAAGAATTGGCATCAATGTCCTATCCTGGGAAGTTG 190
CATTTCCAGTAAAATAGGGAGTTGCTAAAGTCATACCAAGCAATTTGCAG 191
ATCATTTGCAACACCTGAAGTGTTCTTGGTAAAGTCCCTCAAAAATAGGA 192
AATCTGGTAATTGATTATTTTAATGTAACCTTGCTAAAGGAGTGATTTCT 193
GATAATTTTGTCCAGAGACCTTTCTAACGTATTCATGCCTTGTATTTGTA 194
GTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAG 195
TACACTCAGCACCAGGTGCTCTCCTCTGACTTCAACAGCGACACCCACTC 196
CTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGG 197
CACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTG 198
AAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCT 199
CATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTG 200
CTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAG 201
TGATGCTTTTCCTAGATTATTCTCTGGTAAATCAAAGAAGTGGGTTTATG 202
CTGTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAGTTTGATGATG 203
TATTCTCTGGTAAATCAAAGAAGTGGGTTTATGGAGGTCCTCTTCTGTCC 204
GATTTCTGGAAAAGAGCTAGGAAGGACAGGCAACTTGGCAAATCAAAGCC 205
CACCGCACCCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAGCT 206
CAGAAGCTGAGTCATGGGTAGTTGGAAAAGGACATTTCCACCGCAAAATG 207
ATTATTCTCTGGTAAATCAAAGAAGTGGGTTTATGGAGGTCC 208
CTGTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAG 209
CCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAG 210
GAAAAGAGCTAGGAAGGACAGGCAACTTGGCAAATCAAAG 211
GGGAGAAGCTGAGTCATGGGTAGTTGGAAAAGGACATTTC 212
GAAAGACAAGGAAGGAACACCTCCACTTACAAAAGAAGATAAGACAGTTG 213
CAAAGTATGCCAAAGAAGGTCTTATTCGCAAACCAATATTTGATAATTTC 214
AAATAACACATGGAAAGGACATTTCAGAGTTACCAAAGGGAAACAAAGAA 215
GCTGTCAAAACCAAAATACTTATAAAGAAAGGGAGAGGAAATCTGGAAAA 216
CTCACTCTAGAATATTTGAGTCTGTAACCTTGCCTAGTAATCGAACTTCT 217
GTTTATAGAGGATGAGGATTATGACCCTCCAATTAAAATTGCCCGATTAG 218
AAATGAGAGTAATGATAGGAGAAGCAGAAGGTATTCAGTGTCGGAGAGAA 219
GACACATTACATAAACTAGGAGAACTTAAGACTACGAACAGAATATTTGG 220
TGTGTATGAATTCCTTCTTTCAAGTGAACTGATACTAGATTTATTTAAGA 221
CTTAATTATAAAGTTGGATGTCATTTGAGAAACTCTGGGAATTGGAAGTA 222
TAAATAAATTCTTATTCAGCTCCTCGAACCAATAATTACTTTCCAGTAGG 223
TTAAACCGAAATCAGGAGTAGTTGTGTAAAGAACTTATTGGTAATGATGG 224
TGCTTGTGGATACATTGTAACAAATGCTTATAAATCATTTCCAAACTAAT 225
CCAAGGAAAACAGTAGGTGTGGTATCAATATAGGAAACAAATAAGTATTT 226
TAATCATTAAGAAATACTAATTTAAGTATGGCAAAGGAAAGCACAGGTGC 227
TTTCTAGCCTATTCAAATCAATCTGGTCATTTATGGTACTTTCCTATTAG 228
CAATAACAGCATACATTTCTTGACTGGTTGAATTTCATTAACTATTTGGC 229
GCATTTGTGTTTCTTAGGTGACAGTTGCTAGGTAGAATTGAATTAAATAT 230
TTAACATTTCTCAATATCAGGCAGAGATCATATTTAAACAGTTTCAATCT 231
CTGTGTATTTGACTGTGCTTGGGTATATTATACTTTTCTTACTGATTGAG 232
AAACTGACTTTATGGAGACATAACCCTGTTTACCTTTAGAAAGAAGGAAG 233
AAAATAAACCCTGTGATTGTGATGCTTAACTTAATTTTCTACAGTGAATC 234
GAATAATTTGGGACATTGCCAGGAATCACAATAGTTTACTATCTGAAGTA 235
ATGAAATTGAGGGATAGATACAGTAAGTGAGTTGTCTAAGATTACATAGT 236
GCTTTCCAAGTGATTTCACATAAATTATTTATTCCTTACAGTGCTCAAAT 237
ATTGTGATAAGATTTTATATTAATTGTGCTGTTAGGAGTTTTGGCTGTTT 238
TTTCATGAGAAGTCATTCAGTATCATTAAGTATGCTGATTTGTCTCCTTT 239
AGAAATTTATTTGGGGTTCAGATTCACATGTTGTAGGTTAGTTATATACT 240
GGATCTCAAATGTACAGAAATCACATCTAAATGTCAATTCCTGAGTTAAG 241
CTGTATGTTTCTGCCATTATACTTATTTGCTTACCTGATTTAAAGTTGTC 242
TATTAATCAGTTTCTTTAAATAGACCATCTTTCTTGACAACTTGTGCAAA 243
GTATCTATAGTTTGAAATTAGGACTATCCTCTGTGTACTATGCACCAAAG 244
TCTGTAATAAAGCTGTATGGCTGGGTCCATTTATTTCAATATTAGTTATT 245
CCAACTATAACTGAAAATAGGATGCTTCCCTAAGTTTTAGTAAAGGATTT 246
GTCTTTGAAGAGGAGAATTTCAGCCTTTTCTTAAATAGTCCAATACTTTA
[0095] TABLE-US-00005 TABLE 5 Probe Probe position SEQ Position
within ID Sequence within gene NO Name Length fragment sequence 163
CMYC_Exon1_NT008046.14[1_to_366]_1 366 195 195 164
CMYC_Exon1_NT008046.14[1_to_366]_2 366 273 273 165
CMYC_Exon1_NT008046.14[1_to_366]_3 366 134 134 166
CMYC_Exon1_NT008046.14[1_to_366]_short_1 366 197 197 167
CMYC_Exon1_NT008046.14[1_to_366]_short_2 366 149 149 168
CMYC_Exon2_NT008046.14[1991_to_2762]_1 772 22 2012 169
CMYC_Exon2_NT008046.14[1991_to_2762]_short_1 772 29 2019 170
CMYC_Exon2_NT008046.14[1991_to_2762]_short_2 772 378 2368 171
CMYC_Exon2_NT008046.14[1991_to_2762]_short_3 772 78 2068 172
CMYC_Exon3_NT008046.14[4141_to_5168]_1 1028 863 5003 173
CMYC_Exon3_NT008046.14[4141_to_5168]_2 1028 671 4811 174
CMYC_Exon3_NT008046.14[4141_to_5168]_3 1028 583 4723 175
CMYC_Exon3_NT008046.14[4141_to_5168]_4 1028 808 4948 176
CMYC_Intron1_NT008046.14[1110_to_1410]_1 301 158 1267 177
CMYC_Intron1_NT008046.14[1110_to_1410]_2 301 252 1361 178
CMYC_Intron1_NT008046.14[1110_to_1410]_short_1 301 165 1274 179
CMYC_Intron1_NT008046.14[1110_to_1410]_short_3 301 211 1320 180
CMYC_Intron1_NT008046.14[1551_to_1880]_1 330 54 1604 181
CMYC_Intron1_NT008046.14[1551_to_1880]_2 330 243 1793 182
CMYC_Intron1_NT008046.14[1551_to_1880]_short_1 330 54 1604 183
CMYC_Intron1_NT008046.14[367_to_1110]_1 744 222 588 184
CMYC_Intron1_NT008046.14[367_to_1110]_2 744 37 403 185
CMYC_Intron1_NT008046.14[367_to_1110]_4 744 89 455 186
CMYC_Intron2_NT008046.14[2763_to_3400]_1 637 262 3024 187
CMYC_Intron2_NT008046.14[2763_to_3400]_4 637 527 3289 188
CMYC_Intron2_NT008046.14[2763_to_3400]_5 637 55 2817 189
CMYC_Intron2_NT008046.14[3419_to_3709]_1 291 145 3563 190
CMYC_Intron2_NT008046.14[3419_to_3709]_2 291 1 3419 191
CMYC_Intron2_NT008046.14[3419_to_3709]_3 291 53 3471 192
CMYC_Intron2_NT008046.14[3996_to_4140]_1 145 78 4073 193
CMYC_Intron2_NT008046.14[3996_to_4140]_2 145 21 4016 194
GAPDH_Exon8_NT009759.15[3050_to_3462]_1 413 217 3266 195
GAPDH_Exon8_NT009759.15[3050_to_3462]_2 413 300 3349 196
GAPDH_Exon8_NT009759.15[3050_to_3462]_3 413 364 3413 197
GAPDH_Exon8_NT009759.15[3050_to_3462]_4 413 182 3231 198
GAPDH_Exon8_NT009759.15[3050_to_3462]_5 413 234 3283 199
GAPDH_Exon8_NT009759.15[3050_to_3462]_short_2 413 374 3423 200
GAPDH_Exon8_NT009759.15[3050_to_3462]_short_3 413 299 3348 201
GAPDH_Intron2_NT009759.15[328_to_1959]_1 1632 582 909 202
GAPDH_Intron2_NT009759.15[328_to_1959]_2 1632 1196 1523 203
GAPDH_Intron2_NT009759.15[328_to_1959]_3 1632 599 926 204
GAPDH_Intron2_NT009759.15[328_to_1959]_5 1632 1049 1376 205
GAPDH_Intron2_NT009759.15[328_to_1959]_6 1632 928 1255 206
GAPDH_Intron2_NT009759.15[328_to_1959]_7 1632 693 1020 207
GAPDH_Intron2_NT009759.15[328_to_1959]_short_1 1632 597 924 208
GAPDH_Intron2_NT009759.15[328_to_1959]_short_2 1632 1196 1523 209
GAPDH_Intron2_NT009759.15[328_to_1959]_short_3 1632 936 1263 210
GAPDH_Intron2_NT009759.15[328_to_1959]_short_4 1632 1057 1384 211
GAPDH_Intron2_NT009759.15[328_to_1959]_short_5 1632 691 1018 212
MLL_Exon3_AP001267.4[1_to_2654]_10 2654 491 491 213
MLL_Exon3_AP001267.4[1_to_2654]_2 2654 1402 1402 214
MLL_Exon3_AP001267.4[1_to_2654]_3 2654 199 199 215
MLL_Exon3_AP001267.4[1_to_2654]_4 2654 2361 2361 216
MLL_Exon3_AP001267.4[1_to_2654]_5 2654 1618 1618 217
MLL_Exon3_AP001267.4[1_to_2654]_6 2654 779 779 218
MLL_Exon3_AP001267.4[1_to_2654]_7 2654 1058 1058 219
MLL_Intron1_AP001267.4[10100_to_12332]_1 2233 339 10438 220
MLL_Intron1_AP001267.4[10100_to_12332]_10 2233 1609 11708 221
MLL_Intron1_AP001267.4[10100_to_12332]_2 2233 1809 11908 222
MLL_Intron1_AP001267.4[10100_to_12332]_3 2233 988 11087 223
MLL_Intron1_AP001267.4[10100_to_12332]_4 2233 803 10902 224
MLL_Intron1_AP001267.4[10100_to_12332]_6 2233 1270 11369 225
MLL_Intron1_AP001267.4[10100_to_12332]_7 2233 1147 11246 226
MLL_Intron1_AP001267.4[10100_to_12332]_8 2233 391 10490 227
MLL_Intron1_AP001267.4[12670_to_14434]_1 1765 401 13070 228
MLL_Intron1_AP001267.4[12670_to_14434]_2 1765 1204 13873 229
MLL_Intron1_AP001267.4[12670_to_14434]_3 1765 876 13545 230
MLL_Intron1_AP001267.4[12670_to_14434]_4 1765 1036 13705 231
MLL_Intron1_AP001267.4[12670_to_14434]_6 1765 1277 13946 232
MLL_Intron1_AP001267.4[12670_to_14434]_7 1765 89 12758 233
MLL_Intron1_AP001267.4[12670_to_14434]_8 1765 454 13123 234
MLL_Intron1_AP001267.4[12670_to_14434]_9 1765 625 13294 235
MLL_Intron1_AP001267.4[27613_to_29591]_1 1979 994 28606 236
MLL_Intron1_AP001267.4[27613_to_29591]_2 1979 939 28551 237
MLL_Intron1_AP001267.4[27613_to_29591]_3 1979 1304 28916 238
MLL_Intron1_AP001267.4[27613_to_29591]_7 1979 478 28090 239
MLL_Intron1_AP001267.4[27613_to_29591]_9 1979 1417 29029 240
MLL_Intron1_AP001267.4[30450_to_31832]_10 1383 844 31293 241
MLL_Intron1_AP001267.4[30450_to_31832]_2 1383 1027 31476 242
MLL_Intron1_AP001267.4[30450_to_31832]_3 1383 550 30999 243
MLL_Intron1_AP001267.4[30450_to_31832]_6 1383 1095 31544 244
MLL_Intron1_AP001267.4[30450_to_31832]_7 1383 1190 31639 245
MLL_Intron1_AP001267.4[30450_to_31832]_8 1383 680 31129 246
MLL_Intron1_AP001267.4[30450_to_31832]_9 1383 21 30470
[0096] TABLE-US-00006 TABLE 6 Chromosomal Location
Structure/Function Occurrence Reference Nuclear transcription
factors LAF-4 2q11 transcription factor ALL GenBank Accession No.
AF422798 (Huret, 2001) AF4 4q21 transcription factor ALL (Nakamura,
1993) (MLLT2, t-ALL (Raffini, 2002) FEL) AML AF5.alpha. 5q12 (Taki,
1996) AF5q31 5q31 AF6q21 6q21 forkhead transcription t-AML
(Hillion, 1997) (FKHRL1) factor AF9 9p22 transcriptional activator
AML (Nakamura, 1993) (MLLT3) ALL (Langer, 2003) t-AML (Whitmarsh,
2003) AF10 10p12 leucine zipper protein t-AML (Megonigal, 2000) 2
.alpha.-helical domains MLL 11q23 de novo AML t-AML AF17 17q21 ENL
19p13.3 transcriptional activator ALL (Tkachuk, 1992) (MLLT1, AML
(Yamamoto, 1993) LTG19) T-cell ALL (Iida, 1993) t-AML (Chervinsky,
1995) (Rubnitz, 1996) (Moorman, 1998) (LoNigro, 2002) AFX Xq13
forkhead transcription (Corral, 1993) factor Proteins involved in
transcripttional regulation CBP 16p13 transcriptional adaptor/ MDS
(Taki, 1997) co-activator; histone (RAEB-T) (Satake, 1997) acetyl
transferase t-MDS (Sobulo, 1997) (RAEB-T) (Rowley, 1997) t-CMML
(Hayashi, 2000) t-AML (Sugita, 2000) t-ALL (B- lineage) T-cell ALL
ELL (MEN) 19p13.1 RNA polymerase II AML (Thirman, 1994) elongation
t-AML (Mitani, 1995) factor (Rubnitz, 1996) (Shilatifard, 1996)
(Johnstone, 2001) (Maki, 1999) (Moorman, 1998) (LoNigro, 2002)
(Megonigal, 2000) p300 22q13 transcriptional co- activator Nuclear
proteins of unknown function AF3p21 3p21 SH3 domain, bipartite
t-AML (Sano, 2001) nuclear localization (Hayakawa, 2001) signal,
proline rich domain, homo- oligomerization domain LCX (TET1) 10q22
CXXC domain, nuclear de novo (Ono, 2002) localization signals, AML
(Lorsbach, 2003) coiled-coil motif AF15q14 (Hayette, 2000)
Cytoplasmic proteins AF1p 1p32 EGFR pathway tyrosine AUL (M0)
(Bernard, 1994) (eps15) kinase substrate CMML (Wong, 1994) ALL
(Rogaia, 1997) AF1q 1q21 mRNA destabilizing AML (Tse, 1995)
consensus (So, 2000) sequences (Busson-Le Coniat, cytokine-like
features 1999) GMPS 3q24 amidotransferease t-AML (Pegram, 2000) LPP
3q28 GRAF 5q31 AF6 6q27 Ras binding protein AML (Prasad, 1993)
t-AML (Taki, 1996) T-cell ALL (Martineau, 1998) B-lineage (Joh,
1997) ALL (Mitterbauer, 2000) (Akao, 2000) CDK6 7q21 kinase FBP17
9q34 ABI-1 10p11.2 CBL 11q23.3 proline-rich domain, de novo (Fu,
2003) ubiquitin- AML associated domain, leucine zipper domain, zinc
finger domain, tyrosine kinase binding domain, linker region, ring
finger domain MPFYVE 15q14 FYVE domain de novo (Chinwalla, 2003)
phosphotidyl-inositol-3 AML phosphate (PtdIns(3)P binding protein
GAS7 17p13 (Megonigal, 2000) LASP1 17q21 LIM and SH3 domains AML
(Strehl, 2003) MSF 17q25 septin (McIlhatton, 2001) GTP-binding
domain lacks coiled-coil domain in C- terminus EEN 19p13 Src
homology 3 (SH3) AML (So, 1997) protein hCDCrel 22q11 (Megonigal,
1998) SEPTIN6 Xq23 (Slater, 2002) Cell membrane proteins CALM
11q14-q21 clathrin assembly AML (Wechsler, 2003) protein LARG 11q23
GPHN 14q23.3 MYO1F 19p13.2-19p13.3 head domain with AML (LoNigro,
2002) conserved ATP- and actin-binding sites, neck domain with IQ
motif, tail domain Golgi/Endo plasmic reticulum ALKALINE 19p13
(LoNigro, 2002) CERAMIDASE Ribosomal protein RPS3 11q13.3-11q13.5
AML (LoNigro, 2003) MIFL U.S. Provisional Application No.
60/599,385 MAM L2 11q21 Mastermind-Like MLL exon 7 to position
transcriptional 1799 of MAML2 coactivator for mammalian Notch
receptors (GenBank No. AY040322)
[0097] While certain of the preferred embodiments of the present
invention have been described and specifically exemplified above,
it is not intended that the invention be limited to such
embodiments. Various modifications may be made thereto without
departing from the scope and spirit of the present invention, as
set forth in the following claims.
REFERENCES
[0098] 1. Fortune, J. M. & Osheroff, N. (2000) Prog Nucleic
Acid Res and Molecular Biology 64, 221-53. [0099] 2. Felix, C. A.
(2001) Med Pediatr Oncol 36, 525-535. [0100] 3. Rowley, J. D. &
Olney, H. J. (2002) Genes Chromosomes Cancer 33, 331-45. [0101] 4.
Knudson, A. G. (1992) Sem Cancer Biol 3, 99-106. [0102] 5.
Woessner, R. D., Mattern, M. R., Mirabelli, C. K., Johnson, R. K.
& F. H., D. (1991) Cell Growth Differ 2, 209-14. [0103] 6.
Isaacs, R. J., Davies, S. L., Sandri, M. I., Redwood, C., Wells, N.
J. & Hickson, I. D. (1998) Biochim Biophys Acta 1400, 121-37.
[0104] 7. Megonigal, M. D., Cheung, N. K., Rappaport, E. F.,
Nowell, P. C., Wilson, R. B., Jones, D. H., Addya, K., Leonard, D.
G., Kushner, B. H., Williams, T. M., Lange, B. J. & Felix, C.
A. (2000) Proc Natl Acad Sci USA 97, 2814-9. [0105] 8. Raffini, L.
J., Slater, D. J., Rappaport, E. F., Lo Nigro, L., Cheung, N.-K.
V., Biegel, J. A., Nowell, P. C., Lange, B. J. & Felix, C. A.
(2002) Proc Natl Acad Sci USA 99, 4568-4573. [0106] 9. Kushner, B.
H., Cheung, N. K., Kramer, K., Heller, G. & Jhanwar, S. C.
(1998) J Clin Oncol 16, 3880-3889. [0107] 10. Lovett, B. D., Lo
Nigro, L., Rappaport, E. F., Blair, I. A., Osheroff, N., Zheng, N.,
Megonigal, M. D., Williams, W. R., Nowell, P. C. & Felix, C. A.
(2001) Proc Natl Acad Sci USA 98, 9802-9807. [0108] 11. Whitmarsh,
R., Saginario, C., Zhuo, Y., Hilgenfeld, E., Rappaport, E. F.,
Megonigal, M. D., Carroll, M., Liu, M., Osheroff, N., Cheung, N.-K.
V., Slater, D. J., Ried, T., Knutsen, T., Blair, I. A. & Felix,
C. A. (2003) Oncogene 22, 8448-8459. [0109] 12. Bromberg, K. D.
& Osheroff, N. (2001) Biochem 40, 8410-8418. [0110] 13. Ueda,
T., Tsuji, K., Yoshino, H., Ebihara, Y., Yagasaki, H., Hisakawa,
H., Mitsui, T., Manabe, A., Tanaka, R., Kimio, K., Ito, M.,
Yasukawa, K. & Nakahata, T. (2000) J Clin Invest 105,
1013-1021. [0111] 14. Stong, R., Korsmeyer, S., Parkin, J., Arthur,
D. & Kersey, J. (1985) Blood 65, 21-31. [0112] 15. Pocock, C.
F., Malone, M., Booth, M., Evans, M., Morgan, G., Greil, J. &
Cotter, F. E. (1995) Br J Haematol 90, 855-67. [0113] 16. Lozzio,
B. B., Lozzio, C. B., Bamberger, E. G. & Feliu, A. S. (1981)
Proc Soc Exp Biol Med 166, 546-50. [0114] 17. Livak, K. J. &
Schmittgen, T. D. (2001) Methods 25, 402-408. [0115] 18. Harlow, E.
& Lane, D. (1999) Using Antibodies: A Laboratory Manual (Cold
Spring Harbor Laboratory. [0116] 19. Cheung, V. G. & Nelson, S.
F. (1996) Proc Natl Acad Sci USA 93, 14676-14679. [0117] 20.
Gelmini, S., Orlando, C., Sestini, R., Vona, G., Pinzani, P.,
Ruocco, L. & Pazzagli, M. (1997) Clin Chem 43, 752-8. [0118]
21. Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M.
(1996) Genome Res 6, 986-94. [0119] 22. Holland, P. M., Abramson,
R. D., Watson, R. & Gelfand, D. H. (1991) Proc Natl Acad Sci
USA 88, 7276-80. [0120] 23. Pongers-Willemse, M. J., Verhagen, O.
J., Tibbe, G. J., Wijkhuijs, A. J., de Haas, V., Roovers, E., van
der Schoot, C. E. & van Dongen, J. J. (1998) Leukemia 12,
2006-14. [0121] 24. Lovett, B. D., Strumberg, D., Blair, I. A.,
Pang, S., Burden, D. A., Megonigal, M. D., Rappaport, E. F.,
Rebbeck, T. R., Osheroff, N., Pommier, Y. G. & Felix, C. A.
(2001) Biochemistry 40, 1159-70. [0122] 25. Blanco, J. G.,
Dervieux, T., Edick, M. J., Mehta, P. K., Rubnitz, J. E.,
Shurtleff, S. A., Raimondi, S. C., Behm, F. G., Pui, C.-H. &
Relling, M. V. (2001) Proc Natl Acad Sci USA 98, 10338-43. [0123]
26. Ford, A. M., Ridge, S. A., Cabrera, M. E., Mahmoud, H., Steel,
C. M., Chan, L. C. & Greaves, M. (1993) Nature 363, 358-360.
[0124] 27. Gale, K., Ford, A., Repp, R., Borkhardt, A., Keller, C.,
Eden, O. & Greaves, M. (1997) Proc Natl Acad Sci USA 94,
13950-13954. [0125] 28. Megonigal, M. D., Rappaport, E. F., Jones,
D. H., Williams, T. M., Lovett, B. D., Kelly, K. M., Lerou, P. H.,
Moulton, T., Budarf, M. L. & Felix, C. A. (1998) Proc Natl Acad
Sci USA 95, 6413-6418. [0126] 29. Maia, A. T., Koechling, J.,
Corbett, R., Metzler, M., Wiemels, J. L. & Greaves, M. (2004)
Genes, Chromosomes & Cancer 39, 335-340. [0127] 30. Krishnan,
A., Bhatia, S., Slovak, M. L., Arber, D. A., Niland, J. C.,
Nademanee, A., Fung, H., Bhatia, R., Kashyap, A., Molina, A.,
O'Donnell, M. R., Parker, P. A., Sniecinski, I. & Snyder, D. S.
(2000) Blood 95, 1588-1593. [0128] 31. Liang, F., Han, M.,
Romanienko, P. J. & Jasin, M. (1998) Proc Natl Acad Sci USA 95,
5172-5177. [0129] 32. Capranico, G., Jaxel, C., Roberge, M., Kohn,
K. W. & Pommier, Y. (1990) Nucleic Acids Res 18, 4553-4559.
[0130] 33. Cozzio, A., Passegue, E., Ayton, P. M., Karsunky, H.,
Cleary, M. L. & Weissman, I. L. (2003) Genes Dev 17, 3029-35.
[0131] 34. Boyd, K. E., Wells, J., Gutman, J., Bartley, S. M. &
Farnham, P. J. (1998) Proc Natl Acad Sci USA 95, 13887-92. [0132]
35. Langer, T., Metzler, M., Reinhardt, D., Viehmann, S.,
Borkhardt, A., Reichel, M., Stanulla, M., Schrappe, M., Creutzig,
U., Ritter, J., Leis, T., Jacobs, U., Harbott, J., Beck, J. D.,
Rascher, W. & Repp, R. (2003) Genes Chromosomes Cancer 36,
393-401. [0133] 36. Felix, C. A., Hosler, M. R., Slater, D. J., et
al. (1998) J. Pediatr. Hematol/Oncol 20:299-308. [0134] 37. Felix,
C. A., Jones, D. H. (1998) Leukemia 12:976-981. [0135] 38. Slater,
D. J., Hilgenfeld, E., Rappaport, E. F. et al. (2002) Oncogene
21:4706-4714. [0136] 39. Megonigal, M. D. Rappaport E. F., Wilson,
R. B., et al. (2000) PNAS 97:9597-9602. [0137] 40. Pegram, L. D.,
Megonigal, M. D., Lange, B. J., et al. (2000) Blood 96:4360-4362.
[0138] 41. Felix, C. A., Kim, C. S., Megonigal, M. D., et al.
(1997) Blood 90:4679-4686. [0139] 42. Lo Nigro, L., Rappaport E.,
Slater, D., et al. (1999) Proc ASCO 18:565a. [0140] 43. Lo Nigro,
L., Slater, D. J., Rappaport, E. F., et al. (2002) Blood 100(Suppl
1):531a. [0141] 44. Dudoit, S. and Yang, Y. H. (2002) Bioconductor
R packages for exploratory analysis and normalization of cDNA
microarray data. In: The analysis of Gene Expression Data: Methods
and Software; Parmigiani, et al. (Ed) pp. 73-101; New
York:Springer. [0142] 45. Dudoit, S., Speed, T. P., Callow, M. J.
(2002) Statistica Sinica 12:111-139. [0143] 46. Huret J L, et al.
(2001) Leukemia, 15(6):987-9. [0144] 47. Nakamura T, et al. (1993)
Proc Natl Acad Sci USA. 15; 90(10):4631-5. [0145] 48. Taki T, et
al. (1996) Oncogene. 13(10):2121-30. [0146] 49. Hillion J, et al.
(1997) Blood. 90(9):3714-9. [0147] 50. Moorman A V, et al. (1998)
Leukemia. 12(5):805-10. [0148] 51. Rubnitz J E, et al. (1996)
Blood. 87(11):4804-8. [0149] 52. Chervinsky D S, et al. (1995)
Genes Chromosomes Cancer. 14(1):76-84. [0150] 53. Yamamoto K, et
al. (1993) Oncogene. 8(10):2617-25. [0151] 54. Iida S, et al.
(1993) Oncogene. 8(11):3085-92. [0152] 55. Tkachuk D C, et al.
(1992) Cell. 71(4):691-700. [0153] 56. Corral J, et al. (1993) Proc
Natl Acad Sci USA. 90(18):8538-42. [0154] 57. Taki T, et al. (1997)
Blood. 89(11):3945-50. [0155] 58. Satake N, et al. (1997) Genes
Chromosomes Cancer. 20(1):60-3. [0156] 59. Sobulo O M, et al.
(1997) Proc Natl Acad Sci USA. 94(16):8732-7. [0157] 60. Rowley J
D, et al. (1997) Blood. 90(2):535-41. [0158] 61. Hayashi Y, et al.
(2000) Cancer Res. 60(4):1139-45. [0159] 62. Sugita K, et al.
(2000) Genes Chromosomes Cancer. 27(3):264-9. [0160] 63. Thirman M
J, et al. (1994) Proc Natl Acad Sci USA. 91(25):12110-4. [0161] 64.
Shilatifard A, et al. (1996) Science. 271(5257):1873-6. [0162] 65.
Maki K, et al. (1999) Blood. 93(10):3216-24. [0163] 66. Mitani K,
et al. (1995) Blood. 85(8):2017-24. [0164] 67. Sano K. (2001) Leuk
Lymphoma. 42(4):595-602. [0165] 68. Hayakawa A, et al. (2001) Genes
Chromosomes Cancer. 30(4):364-74. [0166] 69. Ono R, et al. (2002)
Cancer Res. 62(14):4075-80. [0167] 70. Lorsbach R B, et al. (2003)
Leukemia. 17(3):637-41. [0168] 71. Hayette S, et al. (2000)
Oncogene. 19(38):4446-50. [0169] 72. Bernard O A, et al. (1994)
Oncogene. 9(4):1039-45. [0170] 73. Wong W T, et al. (1994)
Oncogene. 9(6):1591-7. [0171] 74. Rogaia D, et al. (1997) Cancer
Res. 57(5):799-802. [0172] 75. Tse W, et al. (1995) Blood.
85(3):650-6. [0173] 76. So C W, et al. (2000) Leukemia.
14(4):594-601. [0174] 77. Busson-Le Coniat M, et al. (1999)
Leukemia. 13(2):302-6. [0175] 78. Pegram L D, et al. (2000) Blood.
96(13):4360-2. [0176] 79. Prasad R, et al. (1993) Cancer Res.
53(23):5624-8. [0177] 80. Taki T, et al. (1996) Oncogene.
13(10):2121-30. [0178] 81. Martineau M, et al. (1998) Leukemia.
12(5):788-91. [0179] 82. Joh T, et al. (1997) Oncogene.
15(14):1681-7. [0180] 83. Mitterbauer G, et al. (2000) Br J
Haematol. 109(3):622-8. [0181] 84. Akao Y, et al. (2000) Genes
Chromosomes Cancer. 27(4):412-7. [0182] 85. Fu J F, et al. (2003)
Genes Chromosomes Cancer. 37(2):214-9. [0183] 86. Chinwalla V, et
al. (2003) Oncogene. 22(9):1400-10. [0184] 87. Strehl S, et al.
(2003) Oncogene. 22(1):157-60. [0185] 88. McIlhatton M A, et al.
(2001) Oncogene. 20(41):5930-9. [0186] 89. So C W, et al. (1997)
Proc Natl Acad Sci USA. 94(6):2563-8. [0187] 90. Wechsler D S, et
al. (2003) Genes Chromosomes Cancer. 36(1):26-36. [0188] 91. Lo
Nigro L, et al. (2003) Blood. 102:184-185b.
Sequence CWU 1
1
265 1 50 DNA Artificial Sequence Synthetic Sequence 1 gtcctggccc
gtctcagatt tccaatgcag ctgtccagac cactccaccc 50 2 50 DNA Artificial
Sequence Synthetic Sequence 2 aaagaatcct gaataaatgg ggactttctg
ttggtggaaa gaaatataga 50 3 50 DNA Artificial Sequence Synthetic
Sequence 3 tccaactcct gaaggccaca tgactcctga tcattttatc caaggacaca
50 4 50 DNA Artificial Sequence Synthetic Sequence 4 attcagtcta
caagtgccag gggtctactg tatcctcttt tccgtcttaa 50 5 50 DNA Artificial
Sequence Synthetic Sequence 5 aggccttatt taggtttgac caattgtccc
aataattcct ttatggcaaa 50 6 50 DNA Artificial Sequence Synthetic
Sequence 6 tgagttccaa gagctcagag ggatctgcac ataatgtggc ttaccctgga
50 7 50 DNA Artificial Sequence Synthetic Sequence 7 agagcaggtt
acaagataat atataaagca caatcccatc ttagtttgga 50 8 50 DNA Artificial
Sequence Synthetic Sequence 8 cgcatacgca tgactacatt acaacgggcc
aggaagattc aaagtttggt 50 9 50 DNA Artificial Sequence Synthetic
Sequence 9 aaccagaaca tgcagccact ttatgttctc caaactcttc caaatggagt
50 10 50 DNA Artificial Sequence Synthetic Sequence 10 acagtcactt
ggatggatct tcatcttcag aaatgaagca gtccagtgct 50 11 50 DNA Artificial
Sequence Synthetic Sequence 11 agttctacac ccagtgtgat ggagacaaat
acttcagtat tgggacccat 50 12 50 DNA Artificial Sequence Synthetic
Sequence 12 aaatattgcg gtattcggtc actaaaggat ttgcagcttg cggcggaatc
50 13 50 DNA Artificial Sequence Synthetic Sequence 13 ccacctcaca
tcagggtctg tgtctggctt ggcatccagt tcctctgtct 50 14 50 DNA Artificial
Sequence Synthetic Sequence 14 gaacgaacag actcaggcga tgtgctttat
ggcaggcgca aactcgattt 50 15 50 DNA Artificial Sequence Synthetic
Sequence 15 ccacaggatc agagtggact ttaaggtaaa ggtgttcagt gatcataaag
50 16 50 DNA Artificial Sequence Synthetic Sequence 16 aggcatcctg
cttctttgta ccccaggaag tacataaatg attgatctgg 50 17 50 DNA Artificial
Sequence Synthetic Sequence 17 agtctgtttt gttggtattt agcaggtact
attccctgtt taaaccagct 50 18 50 DNA Artificial Sequence Synthetic
Sequence 18 cctgtagtcc cagctactca ggagagtgag ccaggagaat ggcgtgaacc
50 19 50 DNA Artificial Sequence Synthetic Sequence 19 tcctacatcc
tttacagttc ttaaattcct ggcagatacc tctttggctt 50 20 50 DNA Artificial
Sequence Synthetic Sequence 20 tggagtgtaa taagtgccga aacagctatc
accctgagtg cctgggacca 50 21 50 DNA Artificial Sequence Synthetic
Sequence 21 aaatcaccct tccctgtatt cactattttt atttattatg gataaagaga
50 22 50 DNA Artificial Sequence Synthetic Sequence 22 actctaggaa
taatgtttcc tcagtctcca ccaccgggac cgctactgat 50 23 50 DNA Artificial
Sequence Synthetic Sequence 23 ctccatcctc tccatcttct ggacagcggt
cagcaagccc ttcagtgccg 50 24 50 DNA Artificial Sequence Synthetic
Sequence 24 aggacagaaa cctaatgctt ccagatggcc ccaaacctca ggaggatggc
50 25 50 DNA Artificial Sequence Synthetic Sequence 25 aagcactgat
gtctcaaaca gcatttgaaa gcaggaaatg tatgatttga 50 26 50 DNA Artificial
Sequence Synthetic Sequence 26 aatcccatct ctcttaaatt cagtctttat
tagagttctg atctttctgt 50 27 50 DNA Artificial Sequence Synthetic
Sequence 27 tgggcctgaa tccaaacagg ccaccactcc agcttccagg aagtcaagca
50 28 50 DNA Artificial Sequence Synthetic Sequence 28 ttcgatcctc
gtcaggtgca ggtcagcacg ttgctgtcga ttaagaccgg 50 29 50 DNA Artificial
Sequence Synthetic Sequence 29 agaaaatcca agctaggttg aaatctgaat
gttgagcagt cagtgagaca 50 30 50 DNA Artificial Sequence Synthetic
Sequence 30 tgtaccacct ttacaatgag gaaggaaaaa gtagcacaat tttaaatagg
50 31 50 DNA Artificial Sequence Synthetic Sequence 31 tgccagtaaa
tgtgaaatgg ggtactaagt aataggtgtt gggtgaaggt 50 32 50 DNA Artificial
Sequence Synthetic Sequence 32 actgcactcc taaagcatga ccagtgcttg
ataaactctc ctccatgcga 50 33 50 DNA Artificial Sequence Synthetic
Sequence 33 agaaatcacc gattgccctt gtcaactcag tcaaccctta ccgcattgaa
50 34 50 DNA Artificial Sequence Synthetic Sequence 34 ggagtcccac
tgtccccagc cagaatccca gtagactagc tgttatctca 50 35 50 DNA Artificial
Sequence Synthetic Sequence 35 actgagtgcc tttggcagga aataaatcta
tctcaatgcg ttaattggga 50 36 50 DNA Artificial Sequence Synthetic
Sequence 36 attaagagtg tggttggatt atgggtgacc tttatttgtt tctctggttt
50 37 50 DNA Artificial Sequence Synthetic Sequence 37 tttccgtctt
aatacagtgc tttgcaccca tatatatgcc acccacagga 50 38 50 DNA Artificial
Sequence Synthetic Sequence 38 tggaaagatg tccatgacat atcactgagt
gaaaagagca ggttacaaga 50 39 50 DNA Artificial Sequence Synthetic
Sequence 39 cccacatgtt ctagcctagg aatctgctta ttctaaaggc catttggcgt
50 40 50 DNA Artificial Sequence Synthetic Sequence 40 gccacagcgg
caggcacatc aacaataagc caggatacta gccacctcac 50 41 50 DNA Artificial
Sequence Synthetic Sequence 41 tggaaaggac aaaccagacc ttacaactgt
ttcgtatatt acagaaaacg 50 42 50 DNA Artificial Sequence Synthetic
Sequence 42 tttccactgg tattaccact ttagtactct gaatctcccg caatgtccaa
50 43 50 DNA Artificial Sequence Synthetic Sequence 43 cccaggtatc
caactttacc cagacggtag acgctcctaa tagcatggga 50 44 50 DNA Artificial
Sequence Synthetic Sequence 44 ggtgacaact ggtgaggaag gaaacttgaa
gccagagttt atggatgagg 50 45 50 DNA Artificial Sequence Synthetic
Sequence 45 cagtctccac caccgggacc gctactgatc ttgaatcaag tgccaaagta
50 46 50 DNA Artificial Sequence Synthetic Sequence 46 tgccccaaag
aaaagcagta gtgagcctcc tccacgaaag cccgtcgagg 50 47 50 DNA Artificial
Sequence Synthetic Sequence 47 accggcaccc ctgttaccac agagtgtggg
aggaactgct gccacagcgg 50 48 50 DNA Artificial Sequence Synthetic
Sequence 48 tcagcctctg aaaatccagg agatggtcca gtggcccaac caagccccaa
50 49 50 DNA Artificial Sequence Synthetic Sequence 49 agcaggaaat
gtatgatttg aagtcttcag ttcaagaaaa tcagctctct 50 50 50 DNA Artificial
Sequence Synthetic Sequence 50 agctcctgaa atcagattca gacaataaca
acagtgatga ctgtgggaat 50 51 50 DNA Artificial Sequence Synthetic
Sequence 51 ctagagaact gaatgttagt aaaatcggct cctttgctga accctcttca
50 52 50 DNA Artificial Sequence Synthetic Sequence 52 tgtctcggca
ttaatccgtt tatgtgatgt gtattccatt ccgctcgcca 50 53 50 DNA Artificial
Sequence Synthetic Sequence 53 gatcgaaccg ggccgttctc tcgtgggaga
cgcaggcaca actctttata 50 54 50 DNA Artificial Sequence Synthetic
Sequence 54 acctccggtc aataagcagg agaatgcagg cactttgaac atcctcagca
50 55 50 DNA Artificial Sequence Synthetic Sequence 55 caacatggtc
atttagaaat cggaggtgtg gatgctctct atttagcgga 50 56 50 DNA Artificial
Sequence Synthetic Sequence 56 tgtatatcaa agcctcttca tctataagga
gctcttacca attaataaga 50 57 50 DNA Artificial Sequence Synthetic
Sequence 57 tttacttagt ctgtctttag catttaattg ggtgtaatca gttgcctatt
50 58 50 DNA Artificial Sequence Synthetic Sequence 58 ccctacaagt
agtgcgtcag ttccaggaca cgtcacctta accaacccaa 50 59 50 DNA Artificial
Sequence Synthetic Sequence 59 gaaataaata catgttgggt ggcaggggga
ggtgaaggga gggtgtctgt 50 60 50 DNA Artificial Sequence Synthetic
Sequence 60 tttaatacat gaacagcctt tgccaatcgt gggtgaaatg acgttgccga
50 61 50 DNA Artificial Sequence Synthetic Sequence 61 gcagattcag
tagcagatgc cgttcaaaag gtcgatttaa gtagaagtgc 50 62 50 DNA Artificial
Sequence Synthetic Sequence 62 aacttcaagt ttaggctttt agctgggcac
ggtggctcac gctggtaatc 50 63 50 DNA Artificial Sequence Synthetic
Sequence 63 agcagacgaa cactatcagc ttcagcatgt gaaccagctc cttgccagca
50 64 50 DNA Artificial Sequence Synthetic Sequence 64 cagcagttca
agaccagcct gggcaacata gcaagaccct gtctttattt 50 65 50 DNA Artificial
Sequence Synthetic Sequence 65 aaacccttac tgccggtgag gctgaaacgc
tgatgaatat gatgatggca 50 66 50 DNA Artificial Sequence Synthetic
Sequence 66 aaggattgct acccatgtct catcaccagc acttacattc cttccctgca
50 67 50 DNA Artificial Sequence Synthetic Sequence 67 gccctttctt
cacaggtcag tcagtactaa agtagtcgtt gccagcatct 50 68 50 DNA Artificial
Sequence Synthetic Sequence 68 tcaggaggct gagatagaag gattgtcttg
agcccaggaa ttcaaggctg 50 69 50 DNA Artificial Sequence Synthetic
Sequence 69 agtctgttag atttggggtc acttaatact tcatctcacc gaactgtccc
50 70 50 DNA Artificial Sequence Synthetic Sequence 70 ggaaaccaag
gatgactgtg cttagagtat tgctttcttt cttgatttgt 50 71 50 DNA Artificial
Sequence Synthetic Sequence 71 ctctccacag gaggattgtg aagcagaaaa
tgtgtgggag atgggaggct 50 72 50 DNA Artificial Sequence Synthetic
Sequence 72 cctgaaggcc acatgactcc tgatcatttt atccaaggac acatggatgc
50 73 50 DNA Artificial Sequence Synthetic Sequence 73 gcattggctc
caggcgtcac agtacctctt ccttatcacc ccagcggtcc 50 74 50 DNA Artificial
Sequence Synthetic Sequence 74 acaaatggaa aggacaaacc agaccttaca
actgtttcgt atattacaga 50 75 50 DNA Artificial Sequence Synthetic
Sequence 75 cgcaagaggg cagaccgata gaatcattgg taatgagcgc cggattacgc
50 76 50 DNA Artificial Sequence Synthetic Sequence 76 actatcagaa
tcttccagta caggacagaa acctaatgct tccagatggc 50 77 50 DNA Artificial
Sequence Synthetic Sequence 77 gcagtgagcc gagattgcat cattgcactc
tagcctggac aacagagcta 50 78 50 DNA Artificial Sequence Synthetic
Sequence 78 cactagaaca gtgatttctt caggtggaga ggaacgactg gcatcccata
50 79 50 DNA Artificial Sequence Synthetic Sequence 79 ttgactcctg
agtatatggg ccaacgacca tgtaacaatg tttcttctga 50 80 50 DNA Artificial
Sequence Synthetic Sequence 80 gagctaccat ctgatctgtc tgtcttgacc
acccggagtc ccactgtccc 50 81 50 DNA Artificial Sequence Synthetic
Sequence 81 tgtttctctg ccatttctca gggatgtatt ctattttgta gggaaaagcc
50 82 50 DNA Artificial Sequence Synthetic Sequence 82 ttctgatcta
aattctttat agttgtacat agcaatctca cagggttcct 50 83 50 DNA Artificial
Sequence Synthetic Sequence 83 agcaggtggg tttagcgctg ggagagcttt
ggacagtgtt gttaggtcac 50 84 50 DNA Artificial Sequence Synthetic
Sequence 84 tcccacacct ccatttgaga gggcaaagga atgatcgaga ccaacacaca
50 85 50 DNA Artificial Sequence Synthetic Sequence 85 agtgatgact
gtgggaatat cctgccttca gacattatgg actttgtact 50 86 50 DNA Artificial
Sequence Synthetic Sequence 86 tgccagtgga ctactaaaac ccaaagtata
taagaagggt atggttgatt 50 87 50 DNA Artificial Sequence Synthetic
Sequence 87 gcctcagcca cctactacag gaccgccaag aaaagaagtt cccaaaacca
50 88 50 DNA Artificial Sequence Synthetic Sequence 88 gatggtgttg
atgatgggac agagagtgat actagtgtca cagccacaac 50 89 50 DNA Artificial
Sequence Synthetic Sequence 89 aaaggtgagg agagatttgt ttctctgcca
tttctcaggg atgtattcta 50 90 50 DNA Artificial Sequence Synthetic
Sequence 90 gggatcaaag tctgttctgg cggcattgtg ggcttaggcg aaacggtaaa
50 91 50 DNA Artificial Sequence Synthetic Sequence 91 tggaaggatt
cacaccaaaa tattaagagt gtggttggat tatgggtgac 50 92 50 DNA Artificial
Sequence Synthetic Sequence 92 acccgaaagt ccatctatag ggagcatggg
ttaaaataag catagggcat 50 93 50 DNA Artificial Sequence Synthetic
Sequence 93 agagcaaggt catggcaaca atcaggattt aactaggaac agtagcaccc
50 94 50 DNA Artificial Sequence Synthetic Sequence 94 cgccaatgct
tgttcaggca cgccagaagg atgccgcaga ccattatctg 50 95 50 DNA Artificial
Sequence Synthetic Sequence 95 tcaggtggag aggaacgact ggcatcccat
aatttatttc gggaggagga 50 96 50 DNA Artificial Sequence Synthetic
Sequence 96 actgctgcaa taacagcggc atctagcatc tgtgtgctcc cctccactca
50 97 50 DNA Artificial Sequence Synthetic Sequence 97 ttcctatcca
tcctgaggag tatcagagga agtaattcct tcacatggaa 50 98 50 DNA Artificial
Sequence Synthetic Sequence 98 tcccatgttc ttactatagt ttgtgtattg
ccaagtctgt tgtgagccct 50 99 50 DNA Artificial Sequence Synthetic
Sequence 99 cgtttgatga tgtattgatt ccaggggcca tgcaggagct tgaagcactc
50 100 50 DNA Artificial Sequence Synthetic Sequence 100 tttttggagt
atgtaccacc tttacaatga ggaaggaaaa agtagcacaa 50 101 50 DNA
Artificial Sequence Synthetic Sequence 101 ctatgaattg aacaactagg
tgagcctttt aatagtccgt gtctgagatt 50 102 50 DNA Artificial Sequence
Synthetic Sequence 102 tgagtgtcaa agactttaaa taaagaaaat gctactacca
aaggtgttga 50 103 50 DNA Artificial Sequence Synthetic Sequence 103
gaagtatgtg cccaattcta ctgatagtcc tggcccgtct cagatttcca 50 104 50
DNA Artificial Sequence Synthetic Sequence 104 gggcttaccc
cactctatgg agtaagatcc tatggtgaag aagacattcc 50 105 50 DNA
Artificial Sequence Synthetic Sequence 105 agaatccagc cagaggacag
acctcagtac cacagtagcc actccatcct 50 106 50 DNA Artificial Sequence
Synthetic Sequence 106 accttgaagc tatctggaat gagcaacaga tcatccatta
tcaacgaaca 50 107 50 DNA Artificial Sequence Synthetic Sequence 107
ccggttgtgg tagtgggtgc ttggtaatcc tagctacttg ggaggctgag 50 108 50
DNA Artificial Sequence Synthetic Sequence 108 atgtcacact
aattttatgc ttttcatcct tattttccat ccaaagttgt 50 109 50 DNA
Artificial Sequence Synthetic Sequence 109 cccaacatca taaaaagatc
taaatctagc atcatgtatt ttgaaccggc 50 110 50 DNA Artificial Sequence
Synthetic Sequence 110 cgaacgtcat caggcgtggc aggcggtgga cgagcgtccg
catgctaatc 50 111 50 DNA Artificial Sequence Synthetic Sequence 111
tgggcctctg tatcagtggg ttctgtatcc ctggactcaa ccaaccttgg 50 112 50
DNA Artificial Sequence Synthetic Sequence 112 ccctcaccca
aattccctaa gtgttaatat gtttctctgt gtgtatatat 50 113 50 DNA
Artificial Sequence Synthetic Sequence 113 cactttggga agccgaagca
ggcagatcac ttgaggtcag gagttggaga 50 114 50 DNA Artificial Sequence
Synthetic Sequence 114 aagtacccct cacccaaatt ccctaagtgt taatatgttt
ctctgtgtgt 50 115 50 DNA Artificial Sequence Synthetic Sequence 115
aaacacttcc acctcttcaa atttgcaaag gacagtggtt actgtaggca 50 116 50
DNA Artificial Sequence Synthetic Sequence 116 attccattct
acagcagctc aactgggaag aagcgaggca agagatcagc 50 117 50 DNA
Artificial Sequence Synthetic Sequence 117 agcacaaagt ttcccatttg
cggaccagtt cttctgaagc acacattcca 50 118 50 DNA Artificial Sequence
Synthetic Sequence 118 taacttcaca ccctcccagc ttcctaatca tccaagtctg
ttagatttgg 50 119 50 DNA Artificial Sequence Synthetic Sequence 119
accaccagaa tcaggtgagt gaggagggca agaaggaatt gctgacccac 50 120 50
DNA Artificial Sequence Synthetic Sequence 120 ccctttcttc
acaggtcagt cagtactaaa gtagtcgttg ccagcatctg 50 121 50 DNA
Artificial Sequence Synthetic Sequence 121 tggaaacaac ccgaaagtcc
atctataggg agcatgggtt aaaataagca 50 122 50 DNA Artificial Sequence
Synthetic Sequence 122 tgtgaaggca aatagggtgt gattttgttc tatattcatc
ttttgtctcc 50 123 50 DNA Artificial Sequence Synthetic Sequence 123
tcagaactcc tgaatcttgg tgaaggattg ggtcttgaca gtaatcgtga 50 124 50
DNA Artificial Sequence Synthetic Sequence 124 ggcagaacga
acaccacatt ttgaccttgt aggggccata gaccatacat 50 125 50 DNA
Artificial Sequence Synthetic Sequence 125 aaactatcca gcaacatttg
ggccagctaa acatgcttca tcgtcggtcc 50 126 50 DNA Artificial Sequence
Synthetic Sequence 126 tgcctacaac agaacctgtg gatagtagtg tctcttcctc
tatctcagca 50 127 50 DNA Artificial Sequence Synthetic Sequence 127
tgatcaggca attcggtcaa ttgtcactgt catcagaatc tgtcggccaa 50 128 50
DNA Artificial Sequence Synthetic Sequence 128 ctgcaataac
agcggcatct agcatctgtg tgctcccctc cactcagact 50 129 50 DNA
Artificial Sequence Synthetic Sequence 129 gcaatcctcc ttcaggcctg
cttattgggg ttcagcctcc tccggatccc 50 130 50 DNA Artificial Sequence
Synthetic Sequence 130 tgccatttga agttattact agcaaaatta caaattattg
cctactattc 50 131 50 DNA Artificial Sequence Synthetic Sequence 131
acaacttatt gttctaagtg cagaagttca gatatcattg agactgagaa 50 132 50
DNA Artificial Sequence Synthetic Sequence 132 cactatgaat
tgaacaacta ggtgagcctt ttaatagtcc gtgtctgaga 50 133 50 DNA
Artificial Sequence Synthetic Sequence 133 ctaaggatga ctctggtcag
agatacctgg cctggtctgg acacagtgcc 50 134 50 DNA Artificial Sequence
Synthetic Sequence 134 tccttggaag ctcagctcag ctcattggag tcaagccgca
gagtccacac 50 135 50 DNA Artificial Sequence Synthetic Sequence 135
gcctctgtat cagtgggttc tgtatccctg gactcaacca accttggatt 50 136 50
DNA Artificial Sequence Synthetic Sequence 136 tgttatatgc
aaatgctgca ccattttgtc tagggacttg ggcatccatg 50 137 50 DNA
Artificial Sequence Synthetic Sequence 137 tcccatagct ctttgtttat
accactctta ggtcacttag catgttctgt 50
138 50 DNA Artificial Sequence Synthetic Sequence 138 acctgaagat
gctggggaga aagaacatgt cactaagagt tctgttggcc 50 139 50 DNA
Artificial Sequence Synthetic Sequence 139 gtgcgtcagt tccaggacac
gtcaccttaa ccaacccaag gttgcttggt 50 140 50 DNA Artificial Sequence
Synthetic Sequence 140 agggtggttt gctttctctg tgccagtagt gggcatgtag
aggtaaggca 50 141 50 DNA Artificial Sequence Synthetic Sequence 141
ttatagagaa ccaccatgtg actattggac ttatgtaact tgtattacaa 50 142 50
DNA Artificial Sequence Synthetic Sequence 142 agaccaacac
acagattcta cccaatcagc aaactcctct ccagatgaag 50 143 50 DNA
Artificial Sequence Synthetic Sequence 143 ctcactgaag gaaggaacgg
agctggcgtt agagacgatt acaagcggag 50 144 50 DNA Artificial Sequence
Synthetic Sequence 144 ccggtgatac tggtagttgg tgtgaaactc ggctgtatta
atcacgcgat 50 145 50 DNA Artificial Sequence Synthetic Sequence 145
ccctcattac taggaaatca tctcaggaga gaaattaaat ctataaatgg 50 146 50
DNA Artificial Sequence Synthetic Sequence 146 tggaacagag
aacttaaaga ttgatagacc tgaagatgct ggggagaaag 50 147 50 DNA
Artificial Sequence Synthetic Sequence 147 aggagatcga gaccatcctg
gctaacacgg tgaaaccctg tctctactaa 50 148 50 DNA Artificial Sequence
Synthetic Sequence 148 tgagaacaag ttggagacat aaaccatttt acctctaaat
attttagtgt 50 149 50 DNA Artificial Sequence Synthetic Sequence 149
tgtcgtcgct gcaaattctg tcacgtttgt ggagggcaac atcaggctac 50 150 50
DNA Artificial Sequence Synthetic Sequence 150 aggaattaca
ggcaccacgg aaacgcacag tcaaagtgac actgacacct 50 151 50 DNA
Artificial Sequence Synthetic Sequence 151 agtcagtgag acacaaacta
gctaagaaag tcaaccctgc ccacttgcca 50 152 50 DNA Artificial Sequence
Synthetic Sequence 152 tgcattatta tctgttgcaa atgtgaaggc aaatagggtg
tgattttgtt 50 153 50 DNA Artificial Sequence Synthetic Sequence 153
tacagataac ctgatctacc aagtggctaa acggaccgca gatttgtacg 50 154 50
DNA Artificial Sequence Synthetic Sequence 154 aaacttgctc
cctctagtac cccttcaaac attgcccctt ctgatgtggt 50 155 50 DNA
Artificial Sequence Synthetic Sequence 155 actccatcca tgcaggcttt
gggtgagagc ccagagtcat cttcatcaga 50 156 50 DNA Artificial Sequence
Synthetic Sequence 156 aagtgctgac aagagacgcg agagacgtgc ttccgaagga
gtttccatat 50 157 50 DNA Artificial Sequence Synthetic Sequence 157
accagctaaa gaaatgtttt gaagtatttt agagatttta ggaaggaatc 50 158 50
DNA Artificial Sequence Synthetic Sequence 158 aaacagttaa
attggaggta ttgttttaat ttcctgttcg aagcctagag 50 159 50 DNA
Artificial Sequence Synthetic Sequence 159 gcacttcaaa cacttatgga
tataattaga taaattggca aatctgtaga 50 160 50 DNA Artificial Sequence
Synthetic Sequence 160 aagtctgggt gagttataca catgatgctc ttttatagag
aaccaccatg 50 161 50 DNA Artificial Sequence Synthetic Sequence 161
ttcttttcta gatctgtacc aagtgtgttc gctgtaagag ctgtggatcc 50 162 50
DNA Artificial Sequence Synthetic Sequence 162 acctcagtac
cacagtagcc actccatcct ctggactcaa gaaaagaccc 50 163 50 DNA
Artificial Sequence Synthetic Sequence 163 cactttgcac tggaacttac
aacacccgag caaggacgcg actctcccga 50 164 50 DNA Artificial Sequence
Synthetic Sequence 164 gacacttccc cgccgctgcc aggacccgct tctctgaaag
gctctccttg 50 165 50 DNA Artificial Sequence Synthetic Sequence 165
ccagccagcg gtccgcaacc cttgccgcat ccacgaaact ttgcccatag 50 166 35
DNA Artificial Sequence Synthetic Sequence 166 ctttgcactg
gaacttacaa cacccgagca aggac 35 167 35 DNA Artificial Sequence
Synthetic Sequence 167 caacccttgc cgcatccacg aaactttgcc catag 35
168 50 DNA Artificial Sequence Synthetic Sequence 168 ctcaacgtta
gcttcaccaa caggaactat gacctcgact acgactcggt 50 169 40 DNA
Artificial Sequence Synthetic Sequence 169 ttagcttcac caacaggaac
tatgacctcg actacgactc 40 170 40 DNA Artificial Sequence Synthetic
Sequence 170 cgagaccttc atcaaaaaca tcatcatcca ggactgtatg 40 171 40
DNA Artificial Sequence Synthetic Sequence 171 gtatttctac
tgcgacgagg aggagaactt ctaccagcag 40 172 50 DNA Artificial Sequence
Synthetic Sequence 172 cgtttatagc agttacacag aatttcaatc ctagtatata
gtacctagta 50 173 50 DNA Artificial Sequence Synthetic Sequence 173
gagactgaaa gatttagcca taatgtaaac tgcctcaaat tggactttgg 50 174 50
DNA Artificial Sequence Synthetic Sequence 174 ccttctaaca
gaaatgtcct gagcaatcac ctatgaactt gtttcaaatg 50 175 50 DNA
Artificial Sequence Synthetic Sequence 175 ttacacaatg tttctctgta
aatattgcca ttaaatgtaa ataactttaa 50 176 50 DNA Artificial Sequence
Synthetic Sequence 176 catctccgta ttgagtgcga agggaggtgc ccctattatt
atttgacacc 50 177 50 DNA Artificial Sequence Synthetic Sequence 177
gccactccag ccggcgagag aaagaagaaa agctggcaaa aggagtgttg 50 178 38
DNA Artificial Sequence Synthetic Sequence 178 gtattgagtg
cgaagggagg tgcccctatt attatttg 38 179 38 DNA Artificial Sequence
Synthetic Sequence 179 cttgtattta tggaggggtg ttaaagcccg cggctgag 38
180 50 DNA Artificial Sequence Synthetic Sequence 180 aaaactttgt
gccttggatt ttggcaaatt gttttcctca ccgccacctc 50 181 50 DNA
Artificial Sequence Synthetic Sequence 181 gagatagcag gggactgtcc
aaagggggtg aaagggtgct ccctttattc 50 182 39 DNA Artificial Sequence
Synthetic Sequence 182 aaaactttgt gccttggatt ttggcaaatt gttttcctc
39 183 50 DNA Artificial Sequence Synthetic Sequence 183 ggaatggttt
ttaagactac cctttcgaga tttctgcctt atgaatatat 50 184 50 DNA
Artificial Sequence Synthetic Sequence 184 ttttatcact ttaatgctga
gatgagtcga atgcctaaat agggtgtctt 50 185 50 DNA Artificial Sequence
Synthetic Sequence 185 ctcccattcc tgcgctattg acacttttct cagagtagtt
atggtaactg 50 186 50 DNA Artificial Sequence Synthetic Sequence 186
ttatcttaca actcaatcca cttcttctta cctcccgtta acattttaat 50 187 50
DNA Artificial Sequence Synthetic Sequence 187 gatcttctca
gcctattttg aacactgaaa agcaaatcct tgccaaagtt 50 188 50 DNA
Artificial Sequence Synthetic Sequence 188 tttcattggc agcttattta
acgggccact cttattagga aggagagata 50 189 50 DNA Artificial Sequence
Synthetic Sequence 189 cattaagtct taggtaagaa ttggcatcaa tgtcctatcc
tgggaagttg 50 190 50 DNA Artificial Sequence Synthetic Sequence 190
catttccagt aaaataggga gttgctaaag tcataccaag caatttgcag 50 191 50
DNA Artificial Sequence Synthetic Sequence 191 atcatttgca
acacctgaag tgttcttggt aaagtccctc aaaaatagga 50 192 50 DNA
Artificial Sequence Synthetic Sequence 192 aatctggtaa ttgattattt
taatgtaacc ttgctaaagg agtgatttct 50 193 50 DNA Artificial Sequence
Synthetic Sequence 193 gataattttg tccagagacc tttctaacgt attcatgcct
tgtatttgta 50 194 50 DNA Artificial Sequence Synthetic Sequence 194
gtctagaaaa acctgccaaa tatgatgaca tcaagaaggt ggtgaagcag 50 195 50
DNA Artificial Sequence Synthetic Sequence 195 tacactgagc
accaggtggt ctcctctgac ttcaacagcg acacccactc 50 196 50 DNA
Artificial Sequence Synthetic Sequence 196 ctggggctgg cattgccctc
aacgaccact ttgtcaagct catttcctgg 50 197 50 DNA Artificial Sequence
Synthetic Sequence 197 cactgccaac gtgtcagtgg tggacctgac ctgccgtcta
gaaaaacctg 50 198 50 DNA Artificial Sequence Synthetic Sequence 198
aaatatgatg acatcaagaa ggtggtgaag caggcgtcgg agggccccct 50 199 39
DNA Artificial Sequence Synthetic Sequence 199 cattgccctc
aacgaccact ttgtcaagct catttcctg 39 200 39 DNA Artificial Sequence
Synthetic Sequence 200 ctacactgag caccaggtgg tctcctctga cttcaacag
39 201 50 DNA Artificial Sequence Synthetic Sequence 201 tgatgctttt
cctagattat tctctggtaa atcaaagaag tgggtttatg 50 202 50 DNA
Artificial Sequence Synthetic Sequence 202 ctgtccagtt aatttctgac
ctttactcct gccctttgag tttgatgatg 50 203 50 DNA Artificial Sequence
Synthetic Sequence 203 tattctctgg taaatcaaag aagtgggttt atggaggtcc
tcttgtgtcc 50 204 50 DNA Artificial Sequence Synthetic Sequence 204
gatttctgga aaagagctag gaaggacagg caacttggca aatcaaagcc 50 205 50
DNA Artificial Sequence Synthetic Sequence 205 caccgcaccc
tggtctgagg ttaaatatag ctgctgacct ttctgtagct 50 206 50 DNA
Artificial Sequence Synthetic Sequence 206 gagaagctga gtcatgggta
gttggaaaag gacatttcca ccgcaaaatg 50 207 42 DNA Artificial Sequence
Synthetic Sequence 207 attattctct ggtaaatcaa agaagtgggt ttatggaggt
cc 42 208 40 DNA Artificial Sequence Synthetic Sequence 208
ctgtccagtt aatttctgac ctttactcct gccctttgag 40 209 40 DNA
Artificial Sequence Synthetic Sequence 209 cctggtctga ggttaaatat
agctgctgac ctttctgtag 40 210 40 DNA Artificial Sequence Synthetic
Sequence 210 gaaaagagct aggaaggaca ggcaacttgg caaatcaaag 40 211 40
DNA Artificial Sequence Synthetic Sequence 211 gggagaagct
gagtcatggg tagttggaaa aggacatttc 40 212 50 DNA Artificial Sequence
Synthetic Sequence 212 gaaagacaag gaaggaacac ctccacttac aaaagaagat
aagacagttg 50 213 50 DNA Artificial Sequence Synthetic Sequence 213
caaagtatgc caaagaaggt cttattcgca aaccaatatt tgataatttc 50 214 50
DNA Artificial Sequence Synthetic Sequence 214 aaataacaca
tggaaaggac atttcagagt taccaaaggg aaacaaagaa 50 215 50 DNA
Artificial Sequence Synthetic Sequence 215 gctgtcaaaa ccaaaatact
tataaagaaa gggagaggaa atctggaaaa 50 216 50 DNA Artificial Sequence
Synthetic Sequence 216 ctcactctag aatatttgag tctgtaacct tgcctagtaa
tcgaacttct 50 217 50 DNA Artificial Sequence Synthetic Sequence 217
gtttatagag gatgaggatt atgaccctcc aattaaaatt gcccgattag 50 218 50
DNA Artificial Sequence Synthetic Sequence 218 aaatgagagt
aatgatagga gaagcagaag gtattcagtg tcggagagaa 50 219 50 DNA
Artificial Sequence Synthetic Sequence 219 gacacattac ataaactagg
agaacttaag actacgaaca gaatatttgg 50 220 50 DNA Artificial Sequence
Synthetic Sequence 220 tgtgtatgaa ttccttcttt caagtgaact gatactagat
ttatttaaga 50 221 50 DNA Artificial Sequence Synthetic Sequence 221
cttaattata aagttggatg tcatttgaga aactctggga attggaagta 50 222 50
DNA Artificial Sequence Synthetic Sequence 222 taaataaatt
cttattcagc tcctcgaagc aataattact ttccagtagg 50 223 50 DNA
Artificial Sequence Synthetic Sequence 223 ttaaaccgaa atcaggagta
gttgtgtaaa gaacttattg gtaatgatgg 50 224 50 DNA Artificial Sequence
Synthetic Sequence 224 tgcttgtgga tacattgtaa caaatgctta taaatcattt
ccaaactaat 50 225 50 DNA Artificial Sequence Synthetic Sequence 225
ccaaggaaaa cagtaggtgt ggtatcaata taggaaacaa ataagtattt 50 226 50
DNA Artificial Sequence Synthetic Sequence 226 taatcattaa
gaaatactaa tttaagtatg gcaaaggaaa gcacaggtgc 50 227 50 DNA
Artificial Sequence Synthetic Sequence 227 tttctagcct attcaaatca
atctggtcat ttatggtact ttcctattag 50 228 50 DNA Artificial Sequence
Synthetic Sequence 228 caataacagc atacatttct tgactggttg aatttcatta
actatttggc 50 229 50 DNA Artificial Sequence Synthetic Sequence 229
gcatttgtgt ttcttaggtg acagttgcta ggtagaattg aattaaatat 50 230 50
DNA Artificial Sequence Synthetic Sequence 230 ttaacatttc
tcaatatcag gcagagatca tatttaaaca gtttcaatct 50 231 50 DNA
Artificial Sequence Synthetic Sequence 231 ctgtgtattt gactgtgctt
gggtatatta tacttttctt actgattgag 50 232 50 DNA Artificial Sequence
Synthetic Sequence 232 aaactgactt tatggagaga taaccctgtt tacctttaga
aagaaggaag 50 233 50 DNA Artificial Sequence Synthetic Sequence 233
aaaataaacc ctgtgattgt gatgcttaac ttaattttct acagtgaatc 50 234 50
DNA Artificial Sequence Synthetic Sequence 234 gaataatttg
ggacattgcc aggaatcaga atagtttact atctgaagta 50 235 50 DNA
Artificial Sequence Synthetic Sequence 235 atgaaattga gggatagata
cagtaagtga gttgtctaag attacatagt 50 236 50 DNA Artificial Sequence
Synthetic Sequence 236 gctttccaag tgatttcaca taaattattt attccttaca
gtgctcaaat 50 237 50 DNA Artificial Sequence Synthetic Sequence 237
attgtgataa gattttatat taattgtgct gttaggagtt ttggctgttt 50 238 50
DNA Artificial Sequence Synthetic Sequence 238 tttcatgaga
agtcattcag tatcattaag tatgctgatt tgtctccttt 50 239 50 DNA
Artificial Sequence Synthetic Sequence 239 agaaatttat ttggggttca
gattcacatg ttgtaggtta gttatatact 50 240 50 DNA Artificial Sequence
Synthetic Sequence 240 ggatctcaaa tgtacagaaa tcacatctaa atgtcaattc
ctgagttaag 50 241 50 DNA Artificial Sequence Synthetic Sequence 241
ctgtatgttt ctgccattat acttatttgc ttacctgatt taaagttgtc 50 242 50
DNA Artificial Sequence Synthetic Sequence 242 tattaatcag
tttgtttaaa tagaccatct ttcttgagaa cttgtgcaaa 50 243 50 DNA
Artificial Sequence Synthetic Sequence 243 gtatctatag tttgaaatta
ggactatcct ctgtgtacta tgcaccaaag 50 244 50 DNA Artificial Sequence
Synthetic Sequence 244 tctgtaataa agctgtatgg ctgggtccat ttatttcaat
attagttatt 50 245 50 DNA Artificial Sequence Synthetic Sequence 245
ccaactataa ctgaaaatag gatgcttccc taagttttag taaaggattt 50 246 50
DNA Artificial Sequence Synthetic Sequence 246 gtctttgaag
aggagaattt cagccttttc ttaaatagtc caatacttta 50 247 20 DNA
Artificial Sequence Synthetic Sequence 247 attgttctgc ccccaacata 20
248 20 DNA Artificial Sequence Synthetic Sequence 248 agaggcccag
ctgtagttct 20 249 20 DNA Artificial Sequence Synthetic Sequence 249
tccgtaagct cgaccctagt 20 250 20 DNA Artificial Sequence Synthetic
Sequence 250 gcgctcgttc tcctctaaac 20 251 22 DNA Artificial
Sequence Synthetic Sequence 251 ccgactcgag nnnnnnatgt gg 22 252 27
DNA Artificial Sequence Synthetic Sequence 252 atagtttgtg
tattgccaag tctgttg 27 253 20 DNA Artificial Sequence Synthetic
Sequence 253 ggcgctcgtt ctcctctaaa 20 254 18 DNA Artificial
Sequence Synthetic Sequence 254 accaccggga ccgctact 18 255 23 DNA
Artificial Sequence Synthetic Sequence 255 gtggccctaa gacatgatca
act 23 256 16 DNA Artificial Sequence Synthetic Sequence 256
cccttccaca agtttt 16 257 20 DNA Artificial Sequence Synthetic
Sequence 257 atcttgaatc aagtgccaaa 20 258 43 DNA Artificial
Sequence Synthetic Sequence 258 actttctatt tccactggta ttaccacttt
agtactctga atc 43 259 44 DNA Artificial Sequence Synthetic Sequence
259 gaaagcatga agaataagtc acctgcactt cagaggccaa attt 44 260 37 DNA
Artificial Sequence Synthetic Sequence 260 actttctatt tccactggta
cttcagaggc caaattt 37 261 24 DNA Artificial Sequence Synthetic
Sequence 261 gaaagcactt tagtactctg aatc 24 262 41 DNA Artificial
Sequence Synthetic Sequence 262 ataagggaca tatcctacat cctttacagt
tcttaaattc c 41 263 57 DNA Artificial Sequence Synthetic Sequence
263 aggggatgtc aaatgtgatg ggatatgtca aggagggttt tattggactt gtttaaa
57 264 25 DNA Artificial Sequence Synthetic Sequence 264 ataagggaca
ttggacttgt ttaaa 25 265 20 DNA Artificial Sequence Synthetic
Sequence 265 aggggcagtt cttaaattcc 20
* * * * *