Novel gene and protein encoded by the gene

Abstract

Novel DNAs containing the regions which encode proteins have been directly cloned from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, the nucleotide sequences thereof have been determined, and their functions have been identified. The present invention provides DNA which comprises the nucleotide sequence encoding the following polypeptide (a) or (b): (a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; (b) a polypeptide comprising an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a); a recombinant polypeptide, which is encoded by the above DNA; and a protein containing the polypeptide.

Description

TECHNICAL FIELD

[0001] The present invention relates to DNA and a gene containing the DNA, and a recombinant polypeptide encoded by the DNA and a novel recombinant protein containing the polypeptide.

BACKGROUND ART

[0002] An enormous amount of information on the nucleotide sequence of the human genome has been obtained by large-scale sequencing in the Human Genome Project and analysis of the information is continuing on a daily basis.

[0003] The ultimate goal of the Human Genome Project is not just simple determination of the entire nucleotide sequence of the genome, but also the elucidation of various human life phenomena based on the structural information, that is the nucleotide sequence information of DNA.

[0004] Only limited regions of the human genome sequence encode proteins. Currently, the coding regions are predicted by the neural network or an information science technique, called the Hidden Markov Model. However, these models' predictive abilities are not yet sufficiently reliable.

DISCLOSURE OF THE INVENTION

[0005] For the purpose of finding novel genes, we have completed the present invention by succeeding in directly cloning novel DNAs comprising regions that encode proteins from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, and determining the nucleotide sequences thereof.

[0006] In a first embodiment, the present invention relates to DNA comprising a nucleotide sequence encoding the following (a) or (b): [0007] (a) a polypeptide consisting of an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; [0008] (b) a polypeptide consisting of an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acid(s), and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a). Examples of such DNA include, but are not limited to, DNAs comprising the nucleotide sequences of SEQ ID NOS: 71 to 140.

[0009] In a second embodiment, the present invention further relates to a DNA hybridizing to the DNA of the first embodiment of the present invention under stringent conditions, and encoding a polypeptide having biological activity which is substantially the same characteristic with the function of the polypeptide of (a) above.

[0010] Hereinafter, the DNAs of the first and the second embodiments of the present invention are together referred to as "the DNA of the present invention." Further, the present invention also relates to antisense DNA comprising a nucleotide sequence which is substantially complementary to the DNA of the present invention.

[0011] In a third embodiment, the present invention relates to a gene construct containing the DNA of the present invention. The term "gene construct" in the present specification refers to every artificially-engineered gene. Examples of the gene construct include, but are not limited to, a vector containing the DNA of the present invention or the antisense DNA of the DNA of the present invention, and an expression vector of the DNA of the present invention.

[0012] In a fourth embodiment, the present invention relates to the following (a) or (b): [0013] (a) a polypeptide, consisting of an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; [0014] (b) a polypeptide, consisting of an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a).

[0015] In a fifth embodiment, the present invention relates to a recombinant polypeptide encoded by the gene construct of the third embodiment of the present invention.

[0016] Hereinafter, the above polypeptides are together also referred to as "the polypeptide of the present invention." The term "polypeptide" in the present specification refers to "polymers of amino acids having every molecular weight." The present invention also relates to a recombinant protein containing the polypeptide of the present invention. As defined above, in the present specification the term "polypeptide" is not to be limited by molecular weight, and therefore the term "the polypeptide of the present invention" also includes a recombinant protein containing the polypeptide of the present invention.

[0017] In a sixth embodiment, the present invention relates to an antibody against the polypeptide of the present invention.

[0018] In a seventh embodiment, the present invention relates to a DNA chip on which the DNAs of the present invention are arrayed.

[0019] In an eighth embodiment, the present invention relates to a polypeptide chip on which the polypeptides of the present invention are arrayed.

[0020] In a ninth embodiment, the present invention relates to an antibody chip on which the antibodies of the sixth embodiment of the present invention are arrayed.

[0021] Table 1 shows the names of clones having the DNA of the present invention, lengths of the polypeptide of the present invention, their putative functions and grounds for prediction.

[0022] The DNAs of the present invention are identified by determining the nucleotide sequences after isolating them as cDNA fragments from cDNA libraries that we have prepared using as a starter material the commercially available (Clontech) mRNA of human adult whole brain, the human adult hippocampus and the human embryonic whole brain.

[0023] Specifically, clones are randomly isolated from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain prepared according to the method of Ohara et al. (DNA Research 4:53-59 (1997)).

[0024] Next, redundant clones (clones containing the same sequences) are removed by hybridization, followed by in vitro transcription and translation. Both termini of its nucleotide sequence are determined for a clone that has been confirmed to have products of 50 kDa or more.

[0025] Homology searches are performed with databases of known genes using the thus obtained terminal nucleotide sequences as queries. As a result, the full-length nucleotide sequence of a clone that is shown to be new is determined.

[0026] As described above, unknown genes that cannot be obtained by standard cloning techniques, which rely on known genes, can now be cloned systematically.

[0027] Further, the entire region of a human-derived gene containing the DNA of the present invention can also be prepared by a PCR method, such as RACE, while exercising proper care so as not to cause short fragments or any artificial mistakes in obtained sequences.

[0028] Furthermore, the present invention provides a recombinant vector which comprises the DNA of the present invention or a gene construct containing the DNA of the present invention; a transformant retaining the recombinant vector; a method for producing the polypeptide of the present invention or a recombinant protein containing the polypeptide, or salts thereof, which comprises the steps of culturing the transformant, producing and accumulating the polypeptide of the present invention or the recombinant protein containing the polypeptide, and collecting these products; and the thus produced polypeptide of the present invention or the recombinant protein containing the polypeptide, or salts thereof.

[0029] The present invention also relates to a pharmaceutical preparation comprising the DNA of the present invention or the gene construct; a pharmaceutical preparation comprising a polynucleotide (DNA) comprising a nucleotide sequence which encodes the polypeptide of the present invention or a partial polypeptide thereof, or a recombinant protein containing the polypeptides, an antisense nucleotide comprising a nucleotide sequence substantially complementary to the nucleotide sequence which encodes the polypeptide of the present invention or a partial polypeptide thereof, or a recombinant protein containing the polypeptides; a pharmaceutical preparation comprising the polynucleotide of the present invention and the antisense nucleotide , and a pharmaceutical preparation comprising the polypeptide of the present invention or a partial polypeptide thereof, and a recombinant protein containing the polypeptides.

[0030] The present invention further relates to a DNA chip, a peptide chip and an antibody chip that are prepared by arraying the DNAs of the present invention, the polypeptides of the present invention and the antibodies against the polypeptide of the present invention, respectively.

[0031] The present invention further relates to an antibody against the polypeptide of the present invention or a partial polypeptide thereof or a recombinant protein containing the polypeptides, or against salts thereof, and a method for screening a substance which specifically interacts with the polypeptide of the present invention by using the polypeptide of the present invention, a partial polypeptide thereof or a recombinant protein containing the polypeptides, or salts thereof, or antibodies against these substances; a kit for screening; and the substance (compound) itself which is identified by the screening method.

[0032] Any DNA can be used as the DNA of the present invention, so far as it comprises a nucleotide sequence encoding the above-mentioned polypeptide of the present invention. Further, the DNA of the present invention may be cDNA identified and isolated from cDNA libraries or the like derived from the human brain, from cells or tissues other than the brain, such as the heart, lung, liver, spleen, kidney, and testicle, or synthetic DNA.

[0033] A vector used for constructing libraries may be a bacteriophage, a plasmid, a cosmid, or a phagemid. In addition, using total RNA fractions or mRNA fractions prepared from the above cells or tissues, amplification can be performed directly by a reverse transcriptase-polymerase chain reaction (hereinafter, abbreviated as "RT-PCR method.").

[0034] Any antisense DNA may be used as an antisense oligonucleotide (DNA) having a nucleotide sequence substantially complementary to the DNA that encodes the polypeptide of the present invention or a partial polypeptide thereof, so far as it comprises a nucleotide sequence substantially complementary to the nucleotide sequence of the DNA, and is capable of inhibiting the expression of the DNA. A substantially complementary sequence is, for example, a nucleotide sequence having preferably about 90% or more, more preferably about 95% or more, and most preferably 100% homology with the full-length or partial nucleotide sequence of the nucleotide sequence complementary to the DNA of the present invention. The antisense DNA of the present invention includes a nucleic acid sequence (RNA or DNA modified) having a similar function to that of the antisense DNA. These antisense DNAs can be produced using a known DNA synthesizer or the like.

[0035] The term "an amino acid sequence substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70" refers to an amino acid sequence having on the overall average about 70% or more, preferably about 80% or more, further preferably about 90% or more, and particularly preferably about 95% or more homology with each of all the amino acid sequences represented by any one of SEQ ID NOS: 1 to 70.

[0036] An example of a polypeptide consisting of an amino acid sequence substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 of the present invention is a polypeptide having the above homology with the amino acid sequence represented by each of the above SEQ ID NOS, and having biological activity (function) which is substantially the same characteristic with the function of the polypeptide comprising the amino acid sequence represented by each SEQ ID NO. The term "substantially the same characteristic" refers to the activity (function) having the same characteristics.

[0037] Further, the polypeptide of the present invention also includes, for example, a polypeptide consisting of an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids (preferably about 1 to 20, more preferably about 1 to 10, and further preferably several amino acids) or by a combination of these, and having biological activity (function) which is substantially the same characteristic with the function of a polypeptide comprising an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70.

[0038] The polypeptide consisting of an amino acid sequence which is substantially identical to the above amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, or the polypeptide comprising an amino acid sequence derived from the above amino acid sequence by deletion, substitution or addition of a section of the amino acids can be easily produced by, for example, an appropriate combination of methods known by a person skilled in the art, such as site-directed mutagenesis, homologous recombination of genes, primer elongation and PCR.

[0039] For the polypeptide to have biological activity which is substantially the same characteristics, a possible method is substitution between homologous amino acids (polar or nonpolar amino acids, hydrophobic or hydrophilic amino acids, positively or negatively charged amino acids, aromatic amino acids and the like) among amino acids composing the polypeptide. To maintain biological activity that is substantially the same characteristics, it is preferred to retain amino acids within functional domains contained in each polypeptide of the present invention.

[0040] Further, the DNA of the present invention includes DNA comprising a nucleotide sequence encoding an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, and a DNA hybridizing to the DNA under stringent conditions, and encoding a polypeptide having biological activity (function) which is the same characteristic with the function of a polypeptide consisting of an amino acid sequence represented by each of the sequences.

[0041] Under such conditions, examples of DNA capable of hybridizing to DNA comprising a nucleotide sequence encoding an amino acid sequence represented by each of the nucleotide sequences of SEQ ID NOS: 1 to 70 include DNA comprising a nucleotide sequence having on the overall average about 80% or more, preferably about 90% or more, more preferably about 95% or more homology with each of all the nucleotide sequences of the DNAs.

[0042] Hybridization can be performed by a method known in the art or a method according to any known methods, such as a method described in Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987). When a commercially available library is used, hybridization can also be performed by the method described in the attached instructions.

[0043] The term "stringent conditions" means, for example, conditions that allow hybridizing to the DNA probe of the present invention by southern blot hybridization under conditions that involve hybridization in an 7% SDS solution containing 1 mM sodium EDTA and 0.5 M dibasic sodium phosphate (pH 7.2) at 65.degree. C., and washing membranes in a 1% SDS solution containing 1 mM sodium EDTA and 40 mM dibasic sodium phosphate (pH 7.2) at 65.degree. C. The same stringency can also be achieved by conditions other than the above conditions.

[0044] To clone the DNA of the present invention, amplification is performed by a PCR method using a synthetic DNA primer having an appropriate nucleotide sequence of a part of the polypeptide of the present invention or the like, or the DNA can be selected by hybridization of DNA incorporated in an appropriate vector with DNA labeled using a DNA fragment or synthetic DNA which encodes a section or the full-length region of the polypeptide of the present invention.

[0045] Hybridization can be performed according to, for example, the above-described method in "Current Protocols in Molecular Biology" (edited by Frederick M. Ausubel et al., 1987). In addition, when commercially available libraries are used, hybridization can be performed according to the method described in the attached instructions.

[0046] Cloned DNA encoding a polypeptide can be used intact, or can be used after digestion with restriction enzymes if necessary, or after addition of linkers thereto, depending on the purposes. The DNA may contain ATG as a translation initiating codon at the 5' terminal side, or TAA, TGA or TAG as a translation termination codon at the 3' terminal side. These translation initiating and termination codons may be added using an appropriate synthetic DNA adaptor.

[0047] An expression vector for the polypeptide of the present invention can be produced according to any method known in the technical field. For example, the vector can be produced by (1) cleaving a DNA fragment containing the DNA of the present invention or a gene having the DNA of the present invention, and (2) ligating the DNA fragment downstream of a promoter in an appropriate expression vector.

[0048] Examples of vectors that can be used herein include plasmids derived from Escherichia coli, (for example, pBR322, pBR325, pUC18 and pUC118), plasmids derived from Bacillus subtilis (for example, pUB110, pTP5 and pC194), plasmids derived from yeast (for example, pSH19 and pSH15), bacteriophages, such as .lamda. phages, and animal viruses, such as retrovirus, vaccinia virus, baculovirus and the like.

[0049] Any promoter can be used in the present invention, so far as it is appropriate for a host to be used for gene expression. Preferred examples of promoters include, when the host is Escherichia coli, trp promoters, lac promoters, recA promoters, .lamda.PL promoters and lpp promoters; when the host is Bacillus subtilis, SPO1 promoters, SPO2 promoters and penP promoters; and when the host is yeast, PHO5 promoters, PGK promoters, GAP promoters and ADH promoters. When animal cells are used as hosts, examples of promoters include SR.alpha. promoters, SV40 promoters, LTR promoters, CMV promoters and HSV-TK promoters.

[0050] In addition to the above substances, an enhancer, splicing signal, polyA addition signal, a selection marker, SV40 replication origin and the like that are known in the technical field can be added to the expression vector, if desired. Further, if necessary, a protein encoded by the DNA of the present invention can be expressed as a fusion protein with another protein (for example, glutathione S transferase and protein A). Such a fusion protein can be cleaved with appropriate protease and then separated into each protein.

[0051] Examples of host cells that are used herein include bacteria of the genus Escherichia or the genus Bacillus, yeast, insect cells, insects, and animal cells.

[0052] Specific examples of bacteria of the genus Escherichia that are used herein include Escherichia coli K12/DH1 (Proc. Natl. Acad. Sci. USA, 60:160 (1968)), JM103 (Nucleic Acids Research, 9:309 (1981)), JA221 (Journal of Molecular Biology, 120:517 (1978)), and HB 101 (Journal of Molecular Biology, 41:459 (1969)).

[0053] Examples of bacteria of the genus Bacillus that are used herein include Bacillus subtilis MI114 (Gene, 24:255(1983)) and 207-21 [Journal of Biochemistry, 95:87 (1984)].

[0054] Examples of yeast that are used herein include Saccaromyces, such as Saccaromyces cerevisiae AH22, AH22R-, NA87-11A, DKD-5D and 20B-12; Schizosaccaromyces pombe NCYC1913 and NCYC2036; and Pichia pastoris.

[0055] Examples of animal cells that are used herein include monkey cells, such as COS-7 and Vero, Chinese hamster ovary cells, such as CHO (hereinafter, abbreviated as CHO cells), dhfr gene-deficient CHO cells; mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, and human FL cells.

[0056] These host cells can be transformed according to a method known in the technical field. For example, transformation can be performed by referring to Proc. Natl. Acad. Sci. USA, 69:2110 (1972); Gene, 17:107 (1982); Molecular & General Genetics, 168:111 (1979); "Methods in Enzymology," vol. 194, p 182-187 (1991); Proc. Natl. Acad. Sci. USA, 75:1929 (1978); A Separate Volume 8 of Cell Technology, New Experimental Protocols in Cell Technology, p 263-267 (1995) (issued by Shujunsha); and Virology, 52:456 (1973).

[0057] The thus obtained transformant, which has been transformed with an expression vector containing the DNA of the present invention or a gene containing the DNA of the present invention, can be cultured according to a method known in the technical field.

[0058] For example, when hosts are bacteria of the genus Escherichia, culturing is performed normally at about 15.degree. C. to 43.degree. C. for about 3 to 24 hours, and if necessary, aeration and agitation may be performed. When hosts are bacteria of the genus Bacillus, culturing is performed normally at about 30.degree. C. to 40.degree. C. for about 6 to 24 hours, and if necessary, aeration and agitation may be performed.

[0059] A transformant whose host is yeast is normally cultured using media adjusted to have pH of approximately 5 to 8, at about 20.degree. C. to 35.degree. C. for about 24 to 72 hours, and if necessary, aeration and agitation may be performed.

[0060] A transformant whose host is an animal cell is normally cultured using media adjusted to have pH of about 6 to 8, at about 30.degree. C. to 40.degree. C. for about 15 to 60 hours, and if necessary, aeration and agitation may be performed.

[0061] To isolate and purify the polypeptide or the protein of the present invention from the above culture product, for example, bacteria or cells are collected by a known method after culturing, suspended in an appropriate buffer, disrupted by ultrasonication, lysozyme and/or freezing and thawing, and then centrifuged or filtered, thereby obtaining a crude protein extract. The buffer may contain a protein denaturing agent, such as urea or guanidine hydrochloride, or a surfactant, such as Triton X-100 (trade-mark). When the protein is secreted in a culture solution, bacteria or cells are separated after culturing from the supernatant by a known method, thereby collecting the supernatant. The thus obtained culture supernatant or the protein contained in an extract can be purified by an appropriate combination of known isolation and purification methods.

[0062] The thus obtained polypeptide of the present invention can be converted to a salt by a known method or a method according to the known method. Conversely, when the polypeptide is obtained as a salt, it can be converted to an educt or another salt by a known method or a method according to the known method. Further before or after purification, the protein produced by a recombinant can be freely modified by allowing an appropriate protein modification enzyme, such as trypsin and chymotrypsin, to act on the protein, or polypeptides can be partially removed.

[0063] The presence of the polypeptide of the present invention or its salt can be measured by various binding assays and enzyme immunoassay using a specific antibody.

[0064] The C terminus of the polypeptide of the present invention is normally a carboxyl group (--COOH) or a carboxylate (--COO--), and the C terminus may be an amide (--CONH.sub.2) or ester (--COOR). Here, examples of R in ester that are used herein include a C1-6 alkyl group, such as methyl, ethyl, n-propyl, isopropyl or n-butyl; a C3-8 cycloalkyl group, such as cyclopentyl or cyclohexyl; a C6-12 aryl group, such as phenyl or .alpha.-naphthyl; a phenyl-C1-2 alkyl group, such as benzyl or phenethyl; and a C7-14 aralkyl group, such as an .alpha.-naphthyl-C1-2 alkyl group, e.g., .alpha.-naphthyl methyl. Further, pivaloyl-oxymethylester which is generally used as oral administration may also be used.

[0065] When the polypeptide of the present invention has a carboxyl group (or carboxylate) at the terminus other than the C terminus, the carboxyl group is amidated or esterified. The polypeptide of the present invention encompasses such a polypeptide. An example of ester that is used in this case is the above-mentioned ester at the C-terminus. Moreover, the polypeptide of the present invention also encompasses a polypeptide wherein an amino group of a methionine residue at the N-terminus is protected with a protecting group (for example, a C1-6 acyl group, such as a formyl group or an acetyl group); a polypeptide wherein a glutamic acid residue at the N-terminus which is generated by in vivo cleavage is pyroglutamated; a polypeptide wherein OH, COOH, NH.sub.2, SH and the like on the side chain of intramolecular amino acids are protected with appropriate protecting groups (for example, a C1-6 acyl group, such as a formyl group and an acetyl group); or a complex protein, such as a so-called glycoprotein formed by the binding of sugar chains.

[0066] A partial polypeptide of the polypeptide of the present invention may be any polypeptide which is a partial peptide of the above-mentioned polypeptide of the present invention and has activity which has substantially the same characteristics. For example, a peptide that is used herein comprises a sequence of at least 10 or more, preferably 50 or more, further preferably 70 or more, further more preferably 100 or more, and most preferably 200 or more amino acids of the amino acid sequence composing the polypeptide of the present invention, and, for example, has biological activity substantially the same characteristic with the function of the polypeptide of the present invention. An example of a preferable partial polypeptide of the present invention contains each functional domain. Further, the partial peptide of the present invention normally has a carboxyl group (--COOH) or a carboxylate (--COO--) at the C terminus, and it may also have an amide (--CONH.sub.2) or an ester (--COOR) at the C terminus like the above polypeptide of the present invention may have. Further, examples of the partial peptide of the present invention, similar to the polypeptide of the present invention described above, include a peptide wherein an amino group of a methionine residue at the N terminus is protected with a protecting group; a peptide wherein a glutamyl residue at the N-terminus which is generated by in vivo cleavage is pyroglutamated; a peptide wherein a substituent on the side chain of intramolecular amino acids is protected with an appropriate protecting group; a complex peptide, such as a so-called glycopeptide formed by the binding of sugar chains, or the like. The partial peptide of the present invention can be used as, for example, a reagent, reference materials for experiments, or an immunogen or a portion thereof.

[0067] Particularly preferred salts of the polypeptide of the present invention or the partial peptide are physiologically acceptable acid-added salts. Examples of such salts that are used herein include a salt formed with inorganic acid (for example, hydrochloric acid, phosphoric acid, hydrobromic acid and sulfuric acid), and a salt formed with organic acid (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methane sulfonic acid and benzenesulfonic acid).

[0068] The polypeptide of the present invention, the partial peptide thereof or salts thereof, or amides thereof can be prepared by a chemical synthesis method known in the technical field.

[0069] For example, amino acids whose .alpha.-amino groups and side chain functional groups are appropriately protected are condensed on resin (which is commercially available resin for protein synthesis) in accordance with the sequence of a target polypeptide, according to various condensation methods known in the art. Various protecting groups are then removed simultaneously with cleavage of the polypeptide from the resin at the end of reaction. Further, reaction for forming an intramolecular disulfide linkage is conducted in a highly diluted solution, thereby obtaining a target polypeptide, the partial peptide thereof or amides thereof. Examples of activation reagents that can be used to condense the above protected amino acids include those that can be used for polypeptide synthesis and are represented by carbodiimides, such as DCC, N,N'-diisopropylcarbodiimide and N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide. For activation by such reagents, both protected amino acids and a racemization-suppressing additive (for example, HOBt or HOOBt) are directly added to the resin; or protected amino acids can be previously activated with acid anhydride as a control, or HOBt ester or HOOBt ester, and then added to the resin.

[0070] Solvents used for activation of protected amino acids and condensation with resin can be appropriately selected from solvents known in the art as applicable to polypeptide condensation reaction, such as acid amides, halogenated hydrocarbons, alcohols, sulfoxides and ethers. A reaction temperature is appropriately selected from a known range that can be used for reaction of polypeptide linkage formation. Activated amino acid derivatives are normally used in 1.5 to 4-fold excess. When condensation is insufficient as a result of a test using ninhydrin reaction, sufficient condensation can be performed by repeating condensation reaction without eliminating protecting groups. When condensation is still insufficient even when reaction is repeated, unreacted amino acids are acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

[0071] Protecting groups which are normally employed in the technical field can be used for raw materials, such as those for each of amino groups, carboxyl groups and serine hydroxyl groups.

[0072] The protection of functional groups that should not involve the reaction of raw materials, protecting groups, and the elimination of the protecting groups, and the activation of functional groups that involve reaction and the like can be appropriately selected from known groups or performed by known measures.

[0073] The partial peptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known in the technical field, or by cleaving the polypeptide of the present invention with appropriate peptidase. For example, the peptide synthesis method may be either a solid-phase synthesis method or a liquid phase synthesis method. Examples of a known condensation method and a method of elimination of protecting groups are described in Nobuo IZUMIYA et al., Basics and Experiment for Peptide Synthesis, Maruzen (1975); Haruaki YAJIMA and Shunpei SAKAKIBARA, Experiment Course for Biochemistry 1, Protein Chemistry IV, 205 (1977); and Development of Pharmaceutical Preparation 2, vol. 14, Peptide Synthesis, under the editorship of Haruaki YAJIMA, Hirokawa Publishing Co.

[0074] After reaction, the partial peptide of the present invention can be purified and isolated using known methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like in combination. When the partial peptide obtained by the above methods is an educt, it can be converted to an appropriate salt by a known method. Conversely, when the peptide is obtained as a salt, it can be converted to an educt by a known method.

[0075] The antibody for the polypeptide of the present invention, the partial peptide thereof or salts thereof may be either a polyclonal or a monoclonal antibody, so far as it can recognize these substances. The antibody for the polypeptide of the present invention, the partial peptide thereof or salts thereof can be produced using as an antigen the polypeptide of the present invention or the partial peptide thereof according to a known method for producing antibodies or anti-serum.

[0076] The antibody of the present invention can be used to detect the polypeptide of the present invention and the like which are present in a specimen, such as body fluid, tissues or the like. In addition, the antibody can be used for preparing an antibody column to be used for purifying these substances; detecting the polypeptide of the present invention in each fraction upon purification; analyzing the behavior of the polypeptide of the present invention within the cells of a specimen; and the like.

[0077] The use of the DNA, the polypeptide and the antibody of the present invention will be further described below.

[0078] Using as a probe the DNA of the present invention, the antisense DNA of the DNA of the present invention, or a gene construct containing these DNAs, abnormalities (of the gene) in DNA or mRNA encoding the polypeptide of the present invention or the partial peptide thereof can be detected.

[0079] The DNA, the antisense DNA or the gene construct of the present invention are useful as a genetic diagnostic agent for, for example, damages, mutation or hypoexpression in the DNA or mRNA, and an increase or hyperexpression of the DNA or mRNA. The above gene diagnosis using the DNA of the present invention can be performed by, for example, a known northern hybridization or a PCR-SSCP method (Genomics, 5:874-879(1989), Proc. Natl. Acad. Sci. USA, 86:2766-2770 (1989)).

[0080] Moreover, for patients who cannot exert normal in vivo functions because of abnormalities or deletions in the DNA or the gene of the present invention, or because the expression amount of the DNA or the gene of the present invention is reduced, it is effective that the DNA or the gene construct of the present invention is introduced for expression into the bodies of the patients by gene therapy using as vehicles appropriate vectors, such as retrovirus vectors, adenovirus vectors and adenovirus-associated virus vectors according to known techniques. Further, when patients cannot exert normal functions because of an increased expression amount, introduction of antisense can be effective.

[0081] The DNA, the antisense DNA of the present invention, or the gene construct thereof can be administered alone, or in combination with an adjuvant to promote uptake using a gene gun or a catheter, such as a hydrogel catheter.

[0082] In another example, injection of the polypeptide of the present invention or the like into patients with the above diseases also enables the polypeptide of the present invention or the like to exert its function in the patients.

[0083] Furthermore, the antibody of the present invention can be used for quantitatively determining the polypeptide of the present invention in a test liquid by a known method. Specifically, the antibody of the present invention can be used for quantitative determination by a sandwich immuno-assay using monoclonal antibodies, detection by tissue staining, and the like, by which, for example, diseases that involve the polypeptide of the present invention or the like can be diagnosed.

[0084] For these purposes, an antibody molecule itself can be used, or the antibody molecules F(ab')2, Fab' or Fab fractions can be used. Quantitative determination methods for the polypeptide of the present invention using the antibody of the present invention are not specifically limited. Any measurement method can be used, so far as it involves detecting the amount of antibodies, antigens or antibody-antigen complexes corresponding to the amount of antigens (for example, protein amount) in a test liquid by chemical or physical means, and calculating with a calibration curve which has been prepared using a standardized solution containing a known amount of antigens. For example, nephrometry, competitive assay, immunometric assay and sandwich assay are preferably used, and a later described sandwich assay is preferred in terms of sensitivity and specificity. Examples of a labeling agent that can be used in a measurement method using a labeling substance include a substance known in the technical field, such as radioisotopes, enzymes, fluorescent materials and light-emitting materials.

[0085] Details about the general technical procedures concerning these measurement and detection methods can be referred to in a review, reference book or the like, such as Radioimmunoassay 2 edited by Hiroshi IRIE, (Kodansha, issued in 1979); Enzyme Immunoassay edited by Eiji ISHIKAWA et al., (3.sup.rd edition; Igaku-Shoin, issued in 1987); and Methods in Enzymology (issued by Academic Press), vol. 70, "Immunochemical Techniques (Part A)," vol. 73, "Immunochemical Techniques (Part B)," vol. 74, "Immunochemical Techniques (Part C)," vol. 84, "Immunochemical Techniques (Part D: Selected Immunoassays)," vol. 92, "Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods)," and vol. 121, "Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies)."

[0086] Moreover, DNA chips prepared by arraying the DNA of the present invention are useful in detecting mutations and polymorphism of the DNA of the present invention, and monitoring the DNA dynamics. Regarding DNA array, which is a type of DNA chip, see "DNA Microarray and Current PCR method" (a separate volume of Cell Technology, Genome Science Series 1, under the editorship of Masaaki MURAMATSU and Hiroyuki NABA, 1.sup.st impression of the first edition, issued on Mar. 16, 2000) and the like.

[0087] Further, polypeptide chip prepared by arraying the polypeptides of the present invention can be a strong tool for functional analysis on the expression, interaction and posttranslational modification of the polypeptides of the present invention, and for identification and purification of proteins.

[0088] Antibody chip prepared by arraying antibodies against the polypeptides of the present invention are very useful in analyzing the correlation between the polypeptides of the present invention and diseases, disorders, or other physiological phenomena.

[0089] Methods and materials for preparing the chip are known by persons skilled in the art.

[0090] Furthermore, the polypeptides of the present invention or the like are useful as reagents for screening compounds which interact specifically with these substances. Specifically, the present invention provides a method for screening compounds which specifically interact with the polypeptide of the present invention, a partial peptide thereof or salts thereof, or antibodies against them by using these substances; and provides the screening kit therefor.

[0091] Compounds or salts thereof that are identified using the screening method or the screening kit of the present invention are selected from the above test compounds. The compounds interact with the polypeptide of the present invention or the like. For example, the compounds regulate, inhibit, promote or antagonize the biological activity of the polypeptide of the present invention or the like. The compound or a salt thereof may directly act on the activity of the polypeptide of the present invention or the like, or indirectly act on the activity of the polypeptide of the present invention or the like by acting on the expression of the polypeptide of the present invention or the like. An example of the salt of the compound that is used herein is a pharmaceutically acceptable salt. Specific examples of such salts include a salt formed with inorganic base, a salt formed with organic base, a salt formed with inorganic acid, a salt formed with organic acid, and a salt formed with basic or acidic amino acid. Compounds which inhibit the biological activity of the polypeptide of the present invention or the like can also be used as pharmaceutical preparations, such as therapeutic agents and preventive agents for each of the above-mentioned diseases.

[0092] When nucleotides (bases) and amino acids are indicated with abbreviations in the present specification, the abbreviations follow the IUPAC-IUB Joint Commission on Biochemical Nomenclature, or those commonly used in the art. Amino acids for which optical isomerism is possible are, unless otherwise specified, in the L form.

BEST MODE FOR CARRYING OUT THE INVENTION

[0093] The present invention will now be further described by means of examples that are not intended to limit the present invention. The various gene manipulations employed in the examples are according to the methods described in the above Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987).

(1) Construction of cDNA Library Derived from Human Adult Whole Brain, Human Adult Hippocampus and Human Embryonic Whole Brain

[0094] Double-stranded cDNA was synthesized using an oligonucleotide having Not-I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC(T).sub.15) (Invitrogen) as a primer, mRNAs (Clontech) derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain as templates, and a SuperScriptII reverse transcriptase kit (Invitrogen). Next, an adaptor (Invitrogen) having SalI site was ligated to the cDNA, followed by digestion with NotI and 1% low-melt agarose electrophoresis. Thus, DNA fragments of 3 kb or more were purified.

[0095] The purified cDNA fragment was ligated to pBluescript IISK+ plasmid pre-treated with SalI-NotI restriction enzymes. The recombinant plasmid was introduced into Escherichia coli strain ElectroMax DH10B (Invitrogen) by electroporation.

(2) Screening

[0096] Subsequently, clones were randomly picked up from the constructed cDNA library, and then spotted onto membranes. The mixture of oligo DNAs (each comprising 21 nucleotides) was prepared based on each of the full-length nucleotide sequences of approximately 1300 clones that we had previously analyzed. Each 3' terminus of the oligo DNAs was labeled with DIG using terminal transferase. Using the DIG-labeled DNAs as probes, dot hybridization (Current Protocols in Molecular Biology, edited by Frederick M. Ausubel et al, 1987) was performed so as to remove redundant clones (clones containing the same sequences).

[0097] Next, in vitro transcription and translation (Promega, TNT T7 Quick Coupled Transcription/Translation System cat. No. L1107) were performed, thereby selecting clones for which products of 50 kDa or more had been confirmed.

[0098] The terminal nucleotide sequences of the selected clones were then determined. Using the obtained sequences as queries, a homology search program BLASTN 2.0.14 (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs," Nucleic Acids Res. 25:3389-3402) was run on nr database (GenBank+EMBL+DDBJ+PDB sequences which do not contain EST, STS, GSS or HTGS (phase 0, 1 or 2) sequences). As a result, the full-length nucleotide sequences of novel genes, for which no homologous gene was present, were determined.

[0099] For sequencing, a DNA sequencer (ABI PRISM377) and a reaction kit which are manufactured by PE Applied Biosystems were used. Most sequences were determined by a dye terminator method using shotgun clones. Part of the nucleotide sequences was determined by synthesizing oligonucleotides based on the determined nucleotide sequences, and then performing a primer walking method.

[0100] As described above, screening for novel DNAs or genes was performed. As a result, a novel DNA or a gene represented by any one of SEQ ID NOS: 71 to 140 in the sequence listing was detected.

[0101] The nucleotide sequences of these novel DNAs or genes were determined by the above sequencing method. Table 1 shows the names of clones having the DNA or the gene of the present invention, the length of a polypeptide encoded by the gene in the clone, its putative function and the grounds for prediction. TABLE-US-00001 TABLE 1 Clone Name and Putative Function Clone SEQ Name/Protein length/ ID Full length or partial Grounds for NO: sequence Putative function prediction 1 fg01864 323 Partial Involved in mitoses, cell motility Partially has a region sequence and phagocytosis through the having 50% homology to regulation of the cytoskeleton. coronin-, actin-binding Useful in therapy and diagnosis in protein 1C. the field of regulating the dynamic states of cells, such as suppression of cancer metastasis and the action of immunocytes. 2 fg02011 314 Partial Regulates gene expression by binding Partially has a region sequence of C2H2 type zinc finger motif to having 42% homology to DNA, and interaction between zinc finger protein 91 Kruppel-associated box (KRAB) and has zf-C2H2 motifs. domain and the other transcriptional apparatus. The deletion or the mutation of the protein may cause abnormalities in morphogenesis or cell proliferation. The detection of the mutation is useful in diagnosing cancer and the introduction of the normal gene is useful in treating cancer. 3 fg02301 187 Partial A molecule inferred to be involved in Partially has a region sequence cell adhesion because it has a having 39% homology to transmembrane domain and three the immunoglobulin Ig-like C2-type domains, and shares superfamily, and has ig high homology with NCAM1 and NCAM2. motifs and a sosui Since the molecule regulates transmembrane domain. intercellular adhesion, it is useful in diagnosing and treating canceration of cells and cancer metastasis, and screening for the therapeutic agent. 4 fg02936 1479 Partial A membrane protein expressed in the Partially has a region sequence nerve system. Inferred to function having 99% homology to as receptors for semaphorins, the NOV/plexin-A1 protein guidance factor to elongate neural and has the function axial filaments, thus regulating motifs of each of Sema, neuron formation. With its Plexin_repeat, integrin.sub.-- function to regulate the growth of B, and TIG. neural axial filaments, it is useful in diagnosing and treating a variety of neuropsychiatric diseases, or screening for the therapeutic agent. 5 fg04068 258 Partial Encodes a guanine nucleotide Partially has a region sequence exchange factor (GEF) whose target having 91% homology to a is Rho-type GTPase. Activates Rho neuronal guanine signal by converting Rho to GTP type. nucleotide exchange The expression of the protein is high factor, and has a PH in the brain, suggesting that it is domain motif. involved in brain functions. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also inferred to be useful in improving brain functions, since it is strongly expressed in the brain and is thought to be involved in recognition functions. 6 fg05423 675 Partial A DNA-binding protein having a zinc Partially has a region sequence finger motif, and is a having 51% homology to transcriptional regulatory factor. EVI1 protein, and has Inferred to be a protooncogene, zf-C2H2 motifs and a similar to EVI-1, or a causative zf-BED motif. protein of osteomyelodysplasia syndrome. Thus, it is thought to be useful in diagnosing and treating cancer or osteomyelodysplasia, and in screening for the therapeutic agent. 7 fg06344 248 Partial Inferred to synthesize acetyl Partially has a region sequence coenzyme A. The protein may be having 60% homology to useful in screening for anticancer acetyl CoA synthetase. agents and immunosuppressant agents. 8 fg06691 193 Partial Inferred to have high homology with Partially has a region sequence an enzyme, proline dehydrogenase, having 93% homology to and has functions similar to proline proline dehydrogenase. dehydrogenase. Oxidizes proline to 1-proline-5-carboxilic acid. The deletion of the enzyme causes hyperprolinemia. Proline regulates transmission by glutamate-operated synapses, and controls neurotransmission in the brain. Elevated blood proline levels lead to abnormal sensory motor. Thus, it is useful in diagnosing and treating mental disorders due to hyperprolinemia and proline metabolic disorders. 9 fh02216 373 Partial Has .alpha.1,2-mannosidase activity to Partially has a region sequence remove the terminal mannose of having 100% homology to Man9GlcNac2-, the precursor, formed .alpha.1,2-mannosidase, and in ER during the biosynthetic has a Glyco_hydro_47 pathways of N-glycoside-binding motif and a sosui sugar chain; and plays an important transmembrane domain. role in sugar chain synthesis of N-glycoside-binding glycoprotein. The N-glycoside-binding sugar chain functions everywhere in vivo. The deletion of the protein may cause diseases induced by deficient N-glycoside binding sugar chain. The protein is useful in treating and diagnosing these diseases. 10 fh02982 215 Partial Regulates exocytosis, triggered by Partially has a region sequence Ca2+, of neurotransmitters in having 68% homology to synapse. Inferred to be useful in NIM3, and has a C2 domain diagnosing and treating nervous motif. diseases. 11 fh03203 1134 Partial An extracellular matrix Partially has a region sequence glycoprotein which responds to having 37% homology to pheromone and is transcribed. hydroxyproline-rich Involved in biophylaxis. glycoprotein DZ-HRGP. 12 fh05673 438 Partial Expressed upon cephalization to be a Partially has a region sequence guidance for the growth of neural having 57% homology to axial filaments. Not a type which netrin-G1c and has a acts by diffusion, but acts locally laminin_Nterm motif and a on the surface of a cell membrane. laminin_EGF motif. Useful in diagnosing and treating various neuropsychiatric diseases, or screening for the therapeutic agents for these diseases, since the protein regulates the growth of neural axial filaments. 13 fh06634 505 Partial One of the proteins forming an Partially has a region sequence adaptor molecule complex which having 100% homology to transduces a signal from tyrosine guanine kinase to Ras. Functions as guanine nucleotide-releasing nucleotide-releasing factor 2 for factor 2, and has a Ras. Since the protein is involved RasGEFN motif and a in signal transduction from a RasGEF motif. receptor to Ras, it is useful in diagnosing and treating cancer through the regulation of cell proliferation, and screening for the therapeutic agent. 14 fh08795 572 Partial Promotes GTPase activity of Partially has a region sequence Ras-related nuclear protein Ran, having 100% homology to which is involved in cell cycle; thus Ran GTPase activating promotes conversion of active protein 1. GTP-Ran to inactive GDP-Ran, thereby regulating initiation of cell mitosis. Useful in diagnosing and treating cancer, and screening for the therapeutic agent, since abnormalities in the protein can cause canceration. 15 fh13310 1051 Partial Inferred to help the migration of Partially has a region sequence hnRNPA1 from cytoplasms to nuclei by having 98% homology to binding to hnRNPA1, which is a karyopherin.beta.2b, protein controlling mRNA processing transportin, and has and the transport of mRNA from nuclei Armadillo_seg motifs and to cytoplasms. Useful in HEAT motifs. diagnosing and treating cancer by regulating the gene. 16 fh18356 887 Partial Inferred to be a factor which is Partially has a region sequence induced in blastocysts by having 94% homology to parathyroid hormone, and involved in PTH-responsive the activation of blastocysts by osteosarcome B1 protein. parathyroid hormone and osteogenesis. Useful in diagnosing and treating bone diseases, such as osteoporosis and a variety of cancers, and screening for the therapeutic agent for these diseases. 17 fh18358 689 Partial Promotes the formation of Partially has a region sequence CDC25c/14-3-3 protein complex by having 64% homology to phosphorylating Ser216 of Cdc25C associated CDC25c; and regulates the initiation protein kinase C-TAK1, of cell mitosis through the complex. and has a pkinase motif Useful in diagnosing and treating and a UBA motif. cancer and screening for the therapeutic agent, since it is involved in the regulation of cell division. 18 fh20539 1004 Partial Has the ankyrin repeat and is Partially has a region sequence involved in protein interaction. having 35% homology to Useful in treating cystic fibrosis, FRANK2 protein, and has since it is involved in regulating ank repeat motifs. CFTR expression. 19 fh22167 761 Partial Serine/threonine kinase in the Partially has a region sequence intracellular signal transduction having 30% homology to system. Useful in screening a drug protein kinase WNK1. for diseases which involve the signal transduction system. 20 fh23421 480 Partial A nuclear protein involved in mRNA Has 97% homology to a sequence splicing. Concentrated in portions putative splicing referred to as nuclear TY body, and factor, YT521-B. inferred to provide a site for mRNA splicing. Useful in diagnosing and treating cancer, and screening for the therapeutic agent, since it is involved in regulating expression and cell proliferation. Also useful in the field of regeneration medicine. 21 fh24594 762 Partial Involved in binding synaptosome Partially has a region sequence binding protein (SNAP-25) to the having 94% homology to cytoskeleton, and regulating SNAP-25-interacting exocytosis. Useful in diagnosing, protein, and has a preventing and treating nervous Troponin motif. diseases, since it is involved in regulating the release of neurotransmitters. 22 fh26207 1094 Partial A GnRH-like decapeptide precursor Partially has a region sequence acting as gonadotropin releasing having 98% homology to hormone. Useful in diagnosing, putative preoptic preventing and treating regulatory factor-2 abnormalities in sex hormones, such precursor. as infertility and cancer. 23 fj00154 388 Partial An enzyme which substitutes Partially has a region sequence adenosine residue 37 of alanine tRNA having 99% homology to with an inosine residue. Useful in adenosine deaminase preventing, treating and diagnosing acting on tRNA 1, and has diseases involved in modifying, such A_deamin motifs. as tRNA.

24 fj00597s1 523 Full Inferred to transport iron or other Partially has a region length divalent cations or to function as a having 39% homology to membrane-binding receptor. For TTYH1, and has sosui example, iron metabolic disorders transmembrane motifs. cause blood diseases, such as anemia, the disease of nervous degeneration and the like. Thus it is useful in diagnosing and treating such diseases by detecting and regulating the expression and the function of the protein. 25 fj03879s1 1653 Partial Acts on protein interaction since it Partially has a region sequence has a PH domain. Inferred to act on having 44% homology to the morphological changes in P116 RHO-interacting neurons. Also inferred to inhibit protein (P116RIP) cell expansion and the elongation of (RIP3), and has a PH neurons by acting on Rho. Useful in domain motif. diagnosing and treating nervous diseases and cancer, and screening for the therapeutic agents for these diseases by regulating the gene. 26 fj04226 959 Partial A microtubule-associated protein Partially has a region sequence which regulates microtubule having 61% homology to kinetics and interaction between microtubule-associated microtubules and other protein 4, and has intracellular molecules. With the tubulin-binding motifs. strong involvement of a microtubule-associated protein in cancer and Alzheimer's disease, the protein, a putative member of the protein family, is useful in diagnosing and treating these diseases. 27 fj04751 878 Full A protein which binds to oxysterol, Partially has a region length and plays an important role in having 60% homology to regulating cholesterol metabolism. oxysterol-binding Useful in diagnosing and treating protein, and has a PH cardiovascular diseases caused by domain and an abnormalities in cholesterol Oxysterol_Bp motif. metabolism, and screening for the drug. 28 fj05456 281 Partial Inferred to act as a cytoskeleton Partially has a region sequence factor in neurons of the brain. having 32% homology to a This protein has 5 kelch motifs, ring canal protein, and while Gigaxonin (mutated Gigaxonin has Kelch motifs. is found in giant axonal neuropathy) has the BTB domain and 6 Kelch motifs. The protein is useful in diagnosing and treating giant axonal neuropathy and degenerative disorders in the nervous system (e.g., amyotrophic lateral sclerosis, amyotrophy, charcot-Marie-tooth disease). 29 fj06918 707 Partial Present in neurons, and co-exists Partially has a region sequence with ion channels. Involved in having 46% homology to a differentiation of the functional cell recognition domain of axial filaments. Useful molecule, Caspr2, and has in treating, preventing, and laminin_G motifs and an diagnosing nervous diseases, and EGF motif. screening for the therapeutic agent. 30 fj08985 341 Partial A protein having a motif which binds Partially has a region sequence to GTP-Rho, and which plays a role in having 80% homology to transducing Rho signal to other GTP-rho binding protein proteins. Involved in the regulation 1, and has a BRO1 motif. of the cytoskeleton which is based on actin, the contraction of the smooth muscle, transcription, cell proliferation, and the regulation of cell cycle. Useful in diagnosing and treating diseases caused by abnormalities in the cytoskeleton and morphogenesis, and cancer, and screening for the therapeutic agent. 31 fj10564 531 Partial An isozyme of phosphoenzyme which Partially has a region sequence converts inositol triphosphate to having 100% homology to inositol tetraphosphate. inositol1, 4,5- Regulates intracellular calcium triphosphate3-kinase levels and is involved in signal (IP3K). transduction. Expressed in the hippocampus. Useful in screening for an agent selectively acting on the inositol phosphate pathway. 32 fj11471 1199 Partial Has domains involved inhistogenesis Partially has a region sequence and development of extremities. having 37% homology to Possible involvement in cell FH1/FH2 localization, cell division and the domain-containing regulation of the cytoskeleton. protein FHOS, and has a High expression of this protein in FH2 motif. the spleen suggests its involvement in maturation and development of B cells and erythrocytes. Useful in diagnosing and treating diseases caused by cell or tissue development, morphogenesis and maturation, and in regeneration medicine. 33 fj12188 449 Partial Regulates the binding and fusion of Partially has a region sequence synaptic vesicles at the synaptic having 51% homology to termini in the brain. Useful in serine/threonine- treating and diagnosing diseases protein kinase DCAMKL1, with abnormalities in neural and has a pkinase motif. transmission. 34 fj14406 1354 Partial A motor molecule which converts ATP Partially has a region sequence (chemical energy) into physical having 37% homology to 1 force so as to move along .beta. dynein heavy chain, microtubules. While dyneins and has a Dynein_heavy involved in mitosis, vesicle motif. transport, and the movement of cilia and fragella exist as multisubunit complexes, the protein functions as 1.beta. dynein heavy chain which is a component of the complex. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also useful in diagnosing cranial nerve diseases, such as hydrencephaly, infertility and respiratory apparatus-related diseases. 35 fj15278 966 Partial Involved in regulation of binding Has 95% homology to Sequence and fusion of synaptic vesicles to rsec8. pre-synaptic membranes. A component of a complex involved in neural transmission. Useful in treating and diagnosing diseases with abnormalities in neural transmission. 36 fj16085s1 1766 Partial Regulates cell differentiation and Partially has a region sequence cell proliferation by interacting having 57% homology to with proteins having the SET domain. nuclear dual-specificity Useful in diagnosing and treating phosphatase, and has a cancer, and screening for the DENN, a GRAM and a PH therapeutic agent. domain motif. 37 fj17028 498 Partial Produces phospholipids, the second Partially has a region sequence messenger, and involved in having 95% homology to intracellular reactions including phosphatidic production of hyperoxides in acid-preferring neutrophils, actin polymerization phospholipase A1, and has and the like. Useful in diagnosing a DDHD motif. and treating infectious diseases, inflammation and immune diseases, and screening for the drug. 38 fj17066 389 Full Regulates the expression of homeotic Partially has a region length genes by modifying the structure of having 87% homology to chromosomes, and inhibits chromobox homolog 8, and (functions to perform silencing) has a chromo motif. gene expression. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also useful in gene diagnosis of malformation, teratogeny and the like, and in the field of regeneration medicine. 39 gh01817b 380 Partial Dissociates a transcribed complex Partially has a region sequence from a template. Can be used for having 92% homology to analyzing the transcriptional polymerase I and a mechanism. transcript release factor. 40 gh13812 360 Partial A regulatory subunit of phosphatase Partially has a region sequence which regulates the activity of a having 93% homology to pyruvate dehydrogenase complex. pyruvate dehydrogenase Useful in diagnosing and treating phosphatase regulatory cancer, and screening for the subunit precursor, and therapeutic agent. Also useful in has a GCV_T motif. screening for an antiobestic drug. 41 hh05136b 832 Partial A homologue of collagen V precursor. Partially has a region sequence Collagen V plays an important role in having 46% homology to forming extracellular matrix. collagen .alpha.1 (V) chain Useful in diagnosing cirrhosis, and precursor, and has as biological base materials in Collagen motifs and COLFI regeneration medicine. motifs. 42 hh05356 370 Partial Forms a spindle during cell Partially has a region sequence division, and delivers chromosomes having 97% homology to to daughter cells. Involved in tubulin .beta.-5 chain (.beta.- constructing and maintaining the tubulin class-V). three-dimensional structure of a cytoplasm together with actin fibers and intermediate filaments. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. 43 hh10052 412 Partial Inferred to be the gene product of a Partially has a region sequence novel human cartilage link protein having 49% homology to family, which is important in proteoglycan link differentiation and proliferation protein precursor of cartilage cells. Useful in (cartilage link regeneration of the cartilage. protein), and has an ig motif and Xlink motifs. 44 hh13045 803 Partial Inferred to be novel cadherin Partially has a region sequence molecules, since they have cadherin having 30% homology to repeats. Involved in cell FAT tumor suppressor, and adhesion. Possible involvement in has cadherin motifs. segregation of cancer cells from primary layers and infiltrationwith cancer cells. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also useful as a marker for renal diseases, because of its high expression in kidney. 45 hh14180 1036 Full (Threonin)-0-binding Has a region having 99% length N-acetylglucosamine transferase, homology to which controls activities of various N-acetylglucosaminyl proteins including a transcription transferase 110 KDA factor, a nuclear membrane protein, subunit, and has TPR a cytoskeletal protein and a motifs. cancer-related protein within the nucleus and cytoplasm. Useful in diagnosing and treating various diseases, such as cancer, and screening for the therapeutic agent. 46 hj02562 277 Partial A protein which may function as a Has a region having 88% sequence co-activator in RNA polymerase II homology to PC2 glutamine complexes. Possible involvement in rich binding protein. cranial nerve diseases, such as Alzheimer's disease and Parkinson's disease, because they have glutamate repeats. Useful in diagnosing cranial nerve diseases, such as Alzheimer's disease and Parkinson's disease, and as a target therapeutic agent to be developed. 47 hj03865 1115 Partial Has 98% homology to a Partially has a region sequence huntingtin-associated protein having 98% homology to interacting protein (HAPIP) which huntingtin-associated binds to a protein (Duo) binding to protein interacting huntingtin, the cause of protein, and has a RhoGEF Huntington's chorea. High and a PH domain motif.

expression in the brain. UNC-73, the C. elegans homologue of HAPIP, has been shown to involve axonal guidance. Suggested to be involved in signal transduction, because it has the RhoGEF motif. Inferred to be useful in diagnosing and treating Huntington's chorea. Useful as a target gene for developing an agent for nerve regeneration because of the involvement in axonal guidance. 48 hj05256 783 Partial Inferred to be a transcription Partially has a region sequence factor, since the protein has the having 48% homology to zinc finger motif. A deletion or a zinc finger protein 91, mutation in the protein may cause and has zf-C2H2 motifs. abnormalities in morphogenesis and cell proliferation. Detection of a mutation in the gene is useful in diagnosing cancer, and introduction of the normal gene is useful in treating cancer. 49 hk02174 797 Partial A protein, which is accumulated in Partially has a region sequence significant amount in the having 94% homology to post-synaptic density of excitable proline rich synapse synapses. Inferred to be a gene associated protein 2, and encoding a protein which anchors has a SAM motif. SAP90/PSD-95, the scaffold for a membrane receptor, to the cytoskeleton in synapses using glutamate in the central nerve system. The protein may have influence on the generation of the neural network, and establishment of memory and learning. Useful in diagnosing various neuropsychiatric disorders, and screening for the therapeutic agent. 50 pf00330s1 1043 Full A protein, the scaffold for ephr in B, Partially has a region length which plays an important role by having 87% homology to guiding axial filaments in the glutamate receptor embryogenesis, to form a complex interacting protein 2, that transduces signal. Inferred and has PDZ motifs. to involve neural circuit formation. Useful in gene diagnosis and the field of regeneration medicine. 51 pf00447 421 Partial It may bind to a protein having the Partially has a region sequence SH3 domain, because the protein is having 41% homology to homologous to SH3-domain binding SH3-domain binding protein. Since the protein having protein 5 the SH3-domain is often involved in (BTK-associated). intracellular signal transduction, it can be inferred that the protein has similar functions. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. 52 pg00239 1644 Partial Inferred to perform protein Partially has a region sequence interaction, since the protein has having 30% homology to the ankyrin repeat. Possible ankyrin 3, and has ank involvement in signal transduction repeat motifs. and transcriptional control. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. 53 pg00264 534 Partial Inferred to be sialyltransferase, Partially has a region sequence and involve post-translational having 54% homology to modification of protein. Useful in CMP-N-acetylneuraminate- treating, preventing and diagnosing .beta.-galactosamide-.alpha.-2, cancer, and screening for the drug. 6-siaryltransferase, and Also useful in modifying the sugar has a sosui transmembrane chain of a recombinant protein, motif and a similar to a human type. Glyco_transf_29 motif. 54 pg00933 1768 Partial A motor molecule which converts ATP Partially has a region sequence (chemical energy) into physical having 98% homology to force so as to move along ubiqutinating enzyme microtubules. While dyneins E2-230 kDa. involved in mitosis, vesicle transport, and the movement of cilia and fragella exist as multisubunit complexes, the protein functions as 1.beta. dynein heavy chain which is a component of the complex. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also useful in diagnosing cranial nerve diseases, such as hydrencephaly, infertility and respiratory apparatus-related diseases. 55 ph00331 1313 Partial Inferred to be ubiquitin-binding Partially has a region sequence enzyme. It is known that with an having 73% homology to abnormal ubiquitinating process, dynein heavy chain cells are unable to differentiate isotype 6. and proliferate, inducing various diseases including cancer and Parkinson's disease. Useful in screening for the therapeutic agent of these diseases. 56 pj01645 765 Partial Inferred to be a gene involved in Partially has a region sequence cilia formation. Useful in having 76% homology to diagnosing and treating respiratory KPL2. diseases and cilia dysfunction. 57 pj01649 439 Full Many microtubule-binding proteins Partially has a region length are present in neurons, and involve having 58% homology to neural axial filament formation. putative Therefore abnormal microtubule-associated microtubule-binding proteins affect protein. neurogenesis and cause malformation and teratogeny. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also useful in gene diagnosis of congenital diseases and the field of nerve regeneration medicine. 58 bf00083 879 Full A pyruvate dehydrogenase Has a region having 91% length phosphatase activity regulatory homology to pyruvate subunit. Inferred to involve dehydrogenase regulating sugar metabolism. phosphatase regulatory Useful in diagnosing and treating subunit precursor, and cancer, and screening for the has a DAO, a Phytoene_dh therapeutic agent. Also useful in and a GCV_T motifs. screening for an antiobestic agent. 59 bf00135 699 Partial Kinesin light chain, the motor Partially has a region sequence protein which moves along having 36% homology to microtubules. Inferred to involve kinesin light chain, and the intracellular transport of has TPR motifs. substances. Directly binds amyloid protein precursor (APP), the causative agent of Alzheimer with substances, so as to transport the substances along neural axial filaments in neurons. Useful in preventing diseases involved in the intracellular transport of substances; and diagnosing and treating Alzheimer, and screening for the therapeutic agent. 60 bg00184 1179 Partial A novel transcription factor. Many Partially has a region sequence of them are present as a nuclear having 99% homology to protein in the cerebellum. Useful TFNR. in diagnosing and treating cancer, and screening for the therapeutic agent. 61 bj00061 802 -- A protein analogous to endozepine, Partially has a region the ligand of the receptor of having 80% homology to benzodiazepine which is classified endodiazepine-related as an antianxiety agent or sedative protein precursor, and drug/hypnotics. Useful as an has an ACBP motif and a analgesic agent, antianxiety agent sosui transmembrane and anticonvulsant in diagnosing, motif. preventing and treating nervous diseases. 62 bj00195 1194 Partial Type 1 hexokinase, which is Partially has a region sequence transcribed upon spermatogenesis. having 94% homology to The protein is present in the cytoplasmic dynein heavy acrosome of a sperm, and functions as chain 2. a receptor for ZP3 protein, the pellucid zone of an egg, upon fertilization. Useful in discriminating the maturity of sperms and suppressing the function of sperm. Also useful in diagnosing and treating infertility, and contraception. 63 fg01285 1560 Partial A protein analogous to myosin, which Partially has a region sequence is involved in intracellular having 35% homology to transport and induces dysgenic myosin XV, and has a congenital asymptomatic auditory myosin_head motif and a disorder DFNB3. Useful in MyTH4 motif. preventing, diagnosing and treating nervous diseases involving intracellular transport. Also useful in the filed of medicine of nerve regeneration. 64 fh17057 958 Partial Inferred to be breakpoint cluster Present on chromosome 14, sequence region protein 2, the product of a partially has a region house keeping gene which encodes a having 99% homology to protein necessary for cell breakpoint cluster survival. Useful in diagnosing region protein 2, and has and treating cancer, and screening WD40 motifs. for the therapeutic agent. 65 ha06731 715 Partial An analogous protein of HrPOPK-1, Partially has a region sequence which is inferred to have having 51% homology to serine/threonine kinase activity, HrPOPK-1, and has a sosui and have regulatory functions in transmembrane motif. generation/differentiation, such as determination of the embryonic axis. Useful in gene diagnosis of congenital abnormalities and teratogeny, and in the field of regeneration medicine. Further, useful in diagnosing and treating cancer, and screening for the therapeutic agent. 66 hj05226 105 -- Homologous to a part of EGF-like Partially has a region domains in a protein (MEGF) having having 52% homology to many EGF-like domains. It is known MEGF6, and has EGF that mutations in the domains affect motifs. cell-to-cell interaction in the brain and ligand-receptor interaction, so as to cause auxesis of the nerve system or disorganization of the brain cortex, thus induces dementia or the like. Useful in diagnosing and treating diseases of the brain and the nervous system. 67 pf01012 1192 -- Homologous to a part of EGF-like Partially has a region domains in a protein (MEGF) having having 32% homology to many EGF-like domains. It is known MEGF6, and has EGF that mutations in the domains affect motifs. cell-to-cell interaction in the brain and ligand-receptor interaction, so as to cause auxesis of the nerve system or disorganization of the brain cortex, thus induces dementia or the like. Useful in diagnosing and treating diseases of the brain and the nervous system. 68 fg02852 350 Partial An analogous protein of p150-Spir Partially has a region sequence protein which regulates having 42% homology to reconstruction of actin by being p150-Spir protein. phosphorylated with stress-responsive phosphoenzyme JNK. Useful in diagnosing and treating cancer, and screening for the therapeutic agent. 69 fh21913a 244 Partial A protein analogous to fibrillin Partially has a region sequence which is a major component of a thin having 74% homology to fiber network formed by assembly of fibrillin 5, and has EGF

elastin proteins and is present motifs and a TB motif. extensively over the connective tissue. With its possible involvement in a hereditary disease, Marfans syndrome, associated with cardiovascular and visual disorders, it is useful in the diagnosis and the treatment. 70 fj22564 1299 -- A protein having C2H2 type zinc Partially has a region finger motifs. One of intranuclear having 96% homology to proteins expressed in embryonic stem zinc finger protein and cells. Inferred to involve has zf-C2H2 motifs. development, differentiation and proliferation. With possible involvement in development of early embryos, it is inferred to involve cell proliferation or differentiation. Thus it is useful in diagnosing and treating cancer, and screening for the therapeutic agent. Also it is useful in regeneration medicine or gene diagnosis of congenital abnormalities and teratogeny.

(3) Homology Search for the DNA of the Present Invention

[0102] Next, based on the thus obtained full-length nucleotide sequences, the amino acid sequences of the clones were searched on the library of known sequences, nr release 122, using an analysis program BLASTP 2.0.14 (the above-mentioned "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs"). Thus, it was shown that the clones were homologous to each homologous genes listed in Table 2. Table 2 shows the information on these homologous genes, specifically, the name, database ID, biological species, nomenclature, protein length and the literature containing the information. TABLE-US-00002 TABLE 2 Homologous Gene of Each Gene and Biological Species SEQ Homologous gene ID Database Biological Protein NO: Name ID species.sup..asterisk-pseud. length Literature 1 coronin, actin binding protein gi|6753496 Mouse 474 DNA Cell Biol. 17 (9), 1C 779-787 (1998) 2 zinc finger protein 91 gi|4508041 Human 1191 Proc. Natl. Acad. Sci. U.S.A. 88 (9), 3608-3612 (1991) 3 immunoglobulin superfamily gi|7657226 Human 442 Genomics 62 (2), 139-146 (1999) 4 NOV/plexin-A1 protein emb|CAB57274.1| Human 1754 Proc. Natl. Acad. Sci. U.S.A. 93 (2), 674-678 (1996) 5 neuronal guanine nucleotide gi|9845277 Mouse 554 Genomics 65 (1), 53-61 exchange factor (2000) 6 EVI1 protein pir||S41705 Human 1042 EMBO J. 13 (3), 504-510 (1994) 7 acetyl-coenzyme A synthetase gb|AAG08119.1|AE004887_3 Bacillus of green pus 645 Nature 406 (6799), 959-964 (2000) 8 proline dehydrogenase gb|AAD24775.1|AF120278_1 Human 516 Nat. Genet. 21 (4), 434-439 (1999) 9 alpha 1,2-mannosidase gi|7706437 Human 699 Glycobiology 9 (10), 1073-1078 (1999) 10 NIM3 gb|AAF81657.1|AF199335_1 Rat 285 J. Biol. Chem. 275 (26), 20033-20044 (2000) 11 hydroxyproline-rich emb|CAB62280.1| Volvox 409 J. Biol. Chem. 274 glycoprotein DZ-HRGP (49), 35023-35028 (1999) 12 Netrin-G1c dbj|BAB12008.1| Mouse 438 J. Neurosci. 20 (17), 6540-6550 (2000) 13 guanine nucleotide-releasing gi|4885357 Human 1077 Proc. Natl. Acad. Sci. factor 2 U.S.A. 91 (8), 3443-3447 (1994) 14 Ran GTPase activating protein 1 gi|4506411 Human 587 Proc. Natl. Acad. Sci. U.S.A. 91 (7), 2587-2591 (1994) 15 karyopherin beta 2b, gi|7305595 Human 887 J. Cell Biol. 138 transportin (6), 1181-1192 (1997) 16 PTH-responsive osteosarcoma gb|AAD25981.1|AF095771_1 Human 802 Bone 24 (4), 305-313 B1 protein (1999) 17 Cdc25C associated protein gb|AAC15093.1| Human 729 Cell Growth Differ. 9 kinase C-TAK1 (3), 197-208 (1998) 18 FRANK2 protein emb|CAB96906.1| Hawaii's 1596 Genome Res. 10 (8), sea urchin 1194-1203 (2000) 19 protein kinase WNK1 gb|AAF74258.1|AF227741_1 Rat 2126 J. Biol. Chem. 275 (22), 16795-16801 (2000) 20 putative splicing factor gb|AAD55973.1|AF144731_1 Rat 738 Mol. Biol. Cell 10 YT521-B (11), 3909-3926 (1999) 21 SNAP-25-interacting protein gi|9507127 Rat 1197 J. Biol. Chem. 275 (2), 1191-1200 (2000) 22 PUTATIVE PREOPTIC REGULATORY sp|P18890|PRF2.sub.-- Rat 75 Mol. Endocrinol. 4 FACTOR-2 PRECURSOR (8), 1205-1210 (1990) 23 adenosine deaminase acting on gi|6912230 Human 502 Proc. Natl. Acad. Sci. tRNA 1 U.S.A. 96 (16), 8895-8900 (1999) 24 TTYH1 gb|AAG02580.1|AF177909_1 Human 450 Genomics 68 (1), 89-92 (2000) 25 P116 RHO-INTERACTING PROTEIN sp|P97434|RIP3 Mouse 1024 J. Cell Biol. 137 (7), (P116RIP) (RIP3) 1603-1613 (1997) 26 microtubule-associated gi|4505099 Human 1152 Cell Motil. protein 4 Cytoskeleton 23 (4), 236-243 (1992) 27 OXYSTEROL-BINDING PROTEIN sp|P16258|OXYB Rabbit 809 J. Biol. Chem. 264 (28), 16798-16803 (1989) 28 ring canal protein gb|AAA53472.2| Fruit fly 1477 Cell 72 (5), 681-693 (1993) 29 cell recognition molecule gi|7662350 Human 1331 Neuron 24 (4), Caspr2 1037-1047 (1999) 30 GTP-rho binding protein 1 gi|6680085 Mouse 643 Science 271 (5249), 645-648 (1996) 31 INOSITOL 1,4,5-TRISPHOSPHATE sp|P27987|IP3L Human 505 Biochem. J. 278 (Pt 3-KINASE (IP3K) 3), 883-886 (1991) 32 FH1/FH2 domain-containing gi|7019375 Human 1164 Gene 232 (2), 173-182 protein FHOS (1999) 33 SERINE/THREONINE-PROTEIN sp|008875|DCK1 Rat 433 J. Mol. Neurosci. 10 KINASE DCAMKL1 (2), 75-98 (1998) 34 1 beta dynein heavy chain emb|CAB99316.1| Chlamydomonas 4513 Mol. Biol. Cell 11 (7), 2297-2313 (2000) 35 rsec8 pir||I59422 Rat 975 Proc. Natl. Acad. Sci. U.S.A. 92 (21), 9613-9617 (1995) 36 nuclear dual-specificity gb|AAC39675.1| Human 1697 Nature Genet. 18 (4), phosphatase 331-337 (1998) 37 phosphatidic acid-preferring gb|AAC03019.1| Bovine 875 J. Biol. Chem. 273 phospholipase A1 (1998) 5468-5477 38 chromobox homolog 8 gi|7304947 Mouse 362 Gene 242 (1-2), 31-40 (2000) 39 polymerase I and transcript gi|6679567 Mouse 392 EMBO J. 17 (10), release factor 2855-2864 (1998) 40 pyruvate dehydrogenase gb|AAC48785.1| Bovine 878 J. Biol. Chem. 272 phosphatase regulatory (50), 31625-31629 subunit precursor (1997) 41 collagen alpha 1(V) chain pir||CGHU1V Human 1838 J. Biol. Chem. 261 precursor (11), 5034-5040 (1986) 42 TUBULIN BETA-5 CHAIN sp|P09653|TBB5.sub.-- Gallus 446 Mol. Cell. Biol. 6 (BETA-TUBULIN CLASS-V) CHICK (12), 4409-4418 (1986) 43 PROTEOGLYCAN LINK PROTEIN sp|P07354|PLK_CHICK Gallus 355 Proc. Natl. Acad. Sci. PRECURSOR (CARTILAGE LINK U.S.A. 83 (11), PROTEIN) 3766-3770 (1986) 44 FAT tumor suppressor gi|4885229 Human 4590 Genomics 30 (2), 207-223 (1995) 45 N-ACETYLGLUCOSAMINYLTRANSFERASE sp|P56558|OGT1 Rat 1036 J. Biol. Chem. 272 110 KDA SUBUNIT (14), 9308-9315 (1997) 46 OPA-containing protein 1 gb|AAC83164.1| Mouse 2074 Mol. Psych. 3 (4), 303-309 (1998) 47 huntingtin-associated protein gi|4504335 Human 1663 Hum. Mol. Genet. 6 interacting protein (9), 1519-1525 (1997) 48 zinc finger protein 91 gi|4508041 Human 1191 Proc. Natl. Acad. Sci. U.S.A. 88 (9), 3608-3612 (1991) 49 Proline rich synapse emb|CAB45688.1| Rat 1806 Biochem. Biophys. associated protein 2 Res. Commun. 264, 2476-2528 (1999) 50 glutamate receptor gb|AAD25916.1|AF072509_1 Rat 1043 Neuron 22, 511-524 interacting protein 2 (1999) 51 SH3-domain binding protein 5 gi|4759058 Human 425 Biochem. Biophys. (BTK-associated) Res. Commun. 245 (2), 337-343 (1998) 52 ankyrin 3 gb|AAB01607.1| Mouse 1961 J. Cell Biol. 130 (2), 313-330 (1995) 53 CMP-N-ACETYLNEURAMINATE-BETA- sp|Q92182|CAG1.sub.-- Gallus 413 Eur. J. Biochem. 219 GALACTOSAMIDE-ALPHA-2, CHICK (1-2), 375-381 (1994) 6-SIALYLTRANSFERASE 54 dynein heavy chain isotype 6 pir||T30298 Globe fish 1125 Mol. Biol. Cell 5 (1), 57-70 (1994) 55 ubiquitinating enzyme E2-230 kDa pir||I49264 Mouse 299 Proc. Natl. Acad. Sci. U.S.A. 92 (11), 4982-4986 (1995) 56 KPL2 gb|AAD56310.1|AF102129_1 Rat 1744 Am. J. Respir. Cell Mol. Biol. 20 (4), 675-683 (1999) 57 putative microtubule gb|AAC79958.1| Gallus 369 J. Med. Dent. Sci. 45, associated protein 123-133 (1998) 58 pyruvate dehydrogenase gb|AAC48785.1| Bovine 878 J. Biol. Chem. 272 phosphatase regulatory (50), 31625-31629 subunit precursor (1997) 59 kinesin light chain gb|AAB87735.1| Plectonema 490 DNA Cell Biol. 16 (6), 787-795 (1997) 60 TFNR emb|CAC21448.1| Human 2187 Genomics 70, 315-326 (2000) 61 ENDOZEPINE-RELATED PROTEIN sp|P07106|ENDR Bovine 533 DNA 6 (1), 71-79 PRECURSOR (1987) 62 cytoplasmic dynein heavy chain 2 gi|12711694 Rat 4306 Mol. Biol. Cell 9, 276 (1998) 63 Myosin XV gi|6754780 Mouse 3511 Genomics 61 (3), 243-258 (1999) 64 breakpoint cluster region gb|AAC08965.1| Human 510 Genomics 52 (1), 17-26 protein 2 (1998) 65 HrPOPK-1 dbj|BAA28663.1| Ascidian 698 Mech. Dev. 76 (1-2), 161-163 (1998) 66 MEGF6 gi|12621134 Rat 1574 Genomics 51 (1), 27-34 (1998) 67 MEGF6 gi|12621134 Rat 1574 Genomics 51 (1), 27-34 (1998) 68 p150-Spir protein emb|CAB62901.1| Fruit fly 1020 Curr. Biol. 10 (6), 345-348 (2000) 69 fibrillin 5 emb|CAB56757.1| Human 754 Nature 352 (6333), 330-334 (1991) 70 zinc finger protein pir||B38203 Mouse 191 Genes Dev. 6 (6), 903-918 (1992) .sup..asterisk-pseud.Nomenclature of each biological species is as follows: mouse = Mus musculus; human = Homo sapiens; bacillus of green pus = Pseudomonas aeruginosa; rat = Rattus norvegicus; volvox = Volvox carteri f. nagariensis; Hawaii's sea urchin = Tripneustes gratilla; rabbit = Oryctolagus cuniculus; fruit fly = Drosophila melanogaster; chlamydomonas = Chlamydomonas reinhardtii; # bovine = Bos taurus; gallus = Gallus gallus; globe fish = Takifugu rubripes; plectonema = Plectonema boryanum; ascidian = Halocynthia roretzi.

[0103] Table 3 summarizes a variety of data concerning homology between the DNA or the gene of the present invention contained in each clone and each homologous gene listed in Table 2. The meaning of each item in Table 3 is as follows: [0104] Score: the higher the value, the higher the reliability [0105] E-value: the closer this value to 0, the higher the reliability [0106] Starting point: an amino acid position as a starting point of the homologous region [0107] End point: an amino acid position as an end point of the homologous region [0108] Homology: the proportion (degree) of amino acid residues that are identical in a homologous region.

[0109] Homologous region %: the proportion (%) of a homologous region in a homologous gene. TABLE-US-00003 TABLE 3 Homology between each gene and homologous gene Homologous region Homologous SEQ clone gene Homology value ID Starting End Starting End Homologous NO: point point point point Score E-value Homology region % 1 20 318 211 472 295 4e-79 50% (155/310) 55% 2 1 183 975 1166 156 3e-37 42% (81/192) 16% 3 20 187 259 442 122 3e-27 39% (74/187) 42% 4 1 1324 278 1601 2708 0 99% (1321/1324) 75% 5 71 217 322 468 266 2e-70 91% (135/147) 27% 6 4 653 294 923 599 e-170 51% (343/661) 60% 7 1 235 303 534 325 3e-88 60% (142/235) 36% 8 51 193 283 425 275 3e-73 93% (134/143) 28% 9 92 373 418 699 591 e-168 100% (282/282) 40% 10 6 215 76 285 303 9e-82 68% (143/210) 74% 11 875 1130 27 277 144 6e-33 37% (96/256) 61% 12 36 380 28 372 444 e-124 57% (199/346) 79% 13 47 505 619 1077 928 0 100% (459/459) 43% 14 37 530 1 494 963 0 100% (494/494) 84% 15 165 1051 1 887 1794 0 98% (874/887) 100% 16 62 856 1 755 1499 0 94% (753/795) 94% 17 2 669 1 655 816 0 64% (435/674) 90% 18 2 998 515 1592 593 e-168 35% (398/1127) 68% 19 187 748 739 1328 189 9e-47 30% (188/625) 28% 20 1 480 251 738 1001 0 97% (476/488) 66% 21 1 718 457 1173 1364 0 94% (683/719) 60% 22 1020 1094 1 75 152 1e-35 98% (74/75) 100% 23 26 388 97 459 738 0 99% (360/363) 72% 24 6 413 7 417 306 3e-82 39% (163/411) 91% 25 1063 1644 383 975 452 e-125 44% (273/611) 58% 26 140 913 332 1089 835 0 61% (491/793) 66% 27 54 878 20 809 965 0 60% (498/830) 98% 28 1 278 408 684 136 3e-31 32% (91/284) 19% 29 1 705 597 1329 663 0 46% (343/736) 55% 30 94 259 160 325 267 1e-70 80% (133/166) 26% 31 319 519 3 203 419 e-116 100% (201/201) 40% 32 2 361 216 569 182 2e-44 37% (142/379) 30% 33 308 445 75 212 152 7e-36 51% (71/138) 32% 34 1 1353 3205 4512 966 0 37% (515/1363) 29% 35 1 966 9 975 1816 0 95% (921/967) 99% 36 110 1762 5 1630 1828 0 57% (957/1674) 96% 37 4 498 381 875 979 0 95% (475/495) 57% 38 1 389 1 362 667 0 87% (341/389) 100% 39 1 380 11 392 682 0 92% (355/382) 97% 40 1 360 519 878 715 0 93% (336/360) 41% 41 2 592 634 1274 545 e-154 46% (304/647) 35% 42 14 369 90 445 720 0 97% (346/356) 80% 43 36 376 19 353 361 7e-99 49% (171/345) 94% 44 3 615 2979 3576 255 1e-66 30% (189/618) 13% 45 1 1036 1 1036 2117 0 99% (1030/1036) 100% 46 129 263 1911 2052 101 7e-21 50% (72/144) 7% 47 53 1115 588 1663 2132 0 98% (1063/1076) 65% 48 66 760 425 1157 744 0 48% (365/758) 62% 49 1 797 1010 1806 1504 0 94% (754/799) 44% 50 4 1043 11 1043 1814 0 87% (912/1040) 99% 51 80 365 7 269 213 2e-54 41% (120/287) 62% 52 658 1057 213 611 149 2e-34 30% (126/413) 20% 53 211 524 100 413 371 e-102 54% (172/315) 76% 54 717 1768 1 1047 1570 0 73% (774/1060) 93% 55 129 368 1 240 497 e-139 98% (236/240) 80% 56 6 735 965 1715 1195 0 76% (579/753) 43% 57 1 439 1 369 472 e-132 58% (258/440) 100% 58 1 879 1 878 1680 0 91% (804/878) 100% 59 264 557 179 446 153 5e-36 36% (108/294) 55% 60 1 742 1446 2187 1463 0 99% (741/742) 34% 61 6 437 93 533 722 0 80% (357/443) 83% 62 1 1194 3113 4306 2274 0 94% (1126/1194) 28% 63 146 965 1653 2499 494 e-138 35% (319/888) 24% 64 278 787 1 510 1048 0 99% (508/510) 100% 65 1 650 44 647 611 e-174 51% (346/678) 87% 66 4 94 330 419 117 5e-26 52% (48/91) 6% 67 74 892 32 1002 499 e-139 32% (315/982) 62% 68 62 318 213 456 189 6e-47 42% (109/259) 24% 69 1 242 163 405 435 e-121 74% (181/243) 32% 70 798 988 1 191 389 e-106 96% (185/191) 100%

(4) Search for Each Domain

[0110] Using as queries the amino acid sequence encoded by DNAs contained in the clones, functional domains were searched with a search tool contained in Pfam 6.0 (Pfam HMM ver. 2.1 Search (HMMPFAM), Sonnhammer, E. L. L., Eddy, S. R., Birney, E., Bateman, A., and Durbin, R. (1998) "Pfam: multiple sequence alignments and HMM-profiles of protein domains" Nucleic Acids Res. 26:320-322).

[0111] Further, transmembrane domains were searched with a prediction program for membrane proteins, the SOSUI system (ver. 1.0/10, March, 1996) (Takatsugu Hirokawa, Seah Chieng and Shigeki Mitaku, SOSUI: Classification and Secondary Structure Prediction System for Membrane Proteins), Bioinformatics (formerly CABIOS) 1998 May; 14(4):378-379).

[0112] Table 4 shows the detected functional domains and transmembrane domains for each clone.

[0113] The meaning of each item in Table 4 is as follows: [0114] Functional domain: a domain detected by Pfam or SOSUI [0115] Starting point: an amino acid position as a starting point of a functional domain [0116] End point: an amino acid position as an end point of a functional domain. [0117] Score (Pfam only): the higher the value, the higher the reliability [0118] Exp (Pfam only): the closer the value to 0, the higher the reliability

[0119] Table 5 shows the complete notation of each functional domain. TABLE-US-00004 TABLE 4 Functional domain SEQ Clone Homologous gene ID Functional Starting End Functional Starting End NO: domain point point Score Exp domain point point Score Exp 1 WD40 72 109 33.1 6.2e-06 WD40 122 159 28.6 0.00015 WD40 166 202 21.4 0.022 2 zf-C2H2 45 67 31.2 2.4e-05 KRAB 13 75 159.5 5.6e-44 zf-C2H2 73 95 37.1 3.9e-07 zf-C2H2 182 200 -1.9 1.3e+02 zf-C2H2 123 145 23.2 0.0063 zf-C2H2 210 232 21.8 0.017 zf-C2H2 151 173 31.3 2.2e-05 zf-C2H2 238 260 33.1 6.3e-06 zf-C2H2 179 201 27.7 0.00026 zf-C2H2 266 288 34 3.4e-06 zf-C2H2 261 283 31.3 2.3e-05 zf-C2H2 294 316 37.9 2.3e-07 zf-C2H2 289 311 38.4 1.6e-07 zf-C2H2 322 344 37.9 2.2e-07 zf-C2H2 350 372 36.1 7.8e-07 zf-C2H2 378 400 34.9 1.8e-06 zf-C2H2 406 428 35.3 1.4e-06 zf-C2H2 434 456 35.3 1.4e-06 zf-C2H2 462 484 33.8 3.9e-06 zf-C2H2 490 512 37.1 4e-07 zf-C2H2 518 540 15.7 1.1 zf-C2H2 546 568 32.4 1.1e-05 zf-C2H2 574 596 34 3.4e-06 zf-C2H2 602 624 34.2 3.1e-06 zf-C2H2 630 652 37.9 2.2e-07 zf-C2H2 658 680 36.1 7.8e-07 zf-C2H2 686 708 34.9 1.8e-06 zf-C2H2 714 736 35.3 1.4e-06 zf-C2H2 742 764 36.8 5e-07 zf-C2H2 770 792 35 1.7e-06 zf-C2H2 798 820 37.3 3.4e-07 zf-C2H2 826 848 34.8 2e-06 zf-C2H2 854 876 37 4.2e-07 zf-C2H2 885 904 11.3 6.3 zf-C2H2 910 932 38.2 1.9e-07 zf-C2H2 938 960 36.5 5.9e-07 zf-C2H2 966 988 34.3 2.8e-06 zf-C2H2 994 1016 39 1.1e-07 zf-C2H2 1022 1044 35.1 1.6e-06 zf-C2H2 1050 1072 33.8 3.8e-06 zf-C2H2 1078 1100 39 1.1e-07 zf-C2H2 1106 1128 32.9 7.5e-06 zf-C2H2 1134 1156 19.5 0.081 3 ig 21 87 16.9 0.0012 sosui 16 38 -- -- sosui 120 142 -- -- ig 57 126 23.3 1.1e-05 ig 159 222 9.6 0.21 ig 260 315 36.6 8.6e-10 sosui 374 396 -- -- 4 Sema 14 196 78.3 2.9e-20 Sema 29 473 198.8 8.3e-56 Plexin_repeat 215 265 58.1 1.9e-13 Plexin_repeat 492 542 58.1 1.9e-13 integrin_B 221 237 5.1 0.18 integrin_B 498 514 5.1 0.18 Plexin_repeat 361 408 59.8 5.7e-14 Plexin_repeat 638 685 59.8 5.7e-14 Plexin_repeat 509 563 50.7 3.3e-11 Plexin_repeat 786 840 50.7 3.3e-11 integrin_B 516 535 9.4 0.006 integrin_B 793 812 9.4 0.006 TIG 565 660 75.5 1.1e-18 TIG 842 937 75.5 1.1e-18 TIG 662 746 86.3 6.3e-22 TIG 939 1023 86.3 6.3e-22 TIG 749 848 71.3 2e-17 TIG 1026 1125 71.3 2e-17 TIG 851 937 42.9 7.2e-09 TIG 1128 1214 42.9 7.2e-09 sosui 943 965 -- -- 5 PH 83 194 43.6 7.7e-11 RhoGEF 121 297 71.2 2.2e-17 PH 334 445 42.8 1.3e-10 SH3 459 515 47.3 3.3e-10 6 zf-C2H2 449 471 37.3 3.4e-07 zf-C2H2 21 44 26.3 0.00074 zf-BED 462 501 11.3 0.073 zf-C2H2 75 97 26.5 0.00061 zf-C2H2 477 500 33.5 4.8e-06 zf-C2H2 103 125 35.1 1.6e-06 zf-C2H2 506 528 26.5 0.00061 zf-BED 116 155 -0.3 1.5 zf-C2H2 131 154 37.2 3.8e-07 zf-C2H2 160 182 32 1.4e-05 zf-C2H2 188 210 26.5 0.00064 zf-C2H2 217 239 29.5 7.8e-05 zf-C2H2 724 746 37.3 3.4e-07 zf-BED 737 776 11.3 0.073 zf-C2H2 752 775 33.5 4.8e-06 zf-C2H2 781 803 27.5 0.0003 7 AMP-binding 108 544 446.8 1.8e-130 8 Pro_dh 143 498 582.7 2.4e-171 9 Glyco_hydro_47 2 369 205 1.2e-57 sosui 83 105 -- -- sosui 17 39 -- -- Glyco_hydro_47 256 695 696 1.9e-205 10 C2 76 163 45.6 1.1e-09 C2 146 233 61.9 1.4e-14 12 BNR 44 55 9.4 34 sosui 1 23 -- -- laminin_Nterm 58 304 30 5.4e-12 laminin_Nterm 50 295 37.3 1.6e-12 BNR 171 182 11.7 16 laminin_EGF 297 341 33.3 5.4e-06 laminin_EGF 306 363 35.2 1.5e-06 sosui 419 438 -- -- 13 RasGEFN 114 170 36.7 5.3e-07 RasGEFN 686 742 36.7 5.3e-07 RasGEF 265 442 206.6 3.8e-58 RasGEF 837 1014 206.6 3.8e-58 15 Armadillo_seg 281 319 13.4 2.6 Armadillo_seg 117 155 13.4 2.6 Armadillo_seg 364 406 0.4 84 Armadillo_seg 200 242 0.4 84 HEAT 373 408 10.9 9 HEAT 209 244 10.9 9 HEAT 551 589 10.3 11 HEAT 387 425 10.3 11 Armadillo_seg 590 628 19.8 0.064 Armadillo_seg 426 464 19.8 0.064 HEAT 592 630 1.4 1.1e+02 HEAT 428 466 1.4 1.1e+02 HEAT 718 758 1.7 1e+02 HEAT 554 594 1.7 1e+02 Armadillo_seg 819 857 1.2 68 HEAT 657 695 11.7 7.3 HEAT 821 859 11.6 7.6 Armadillo_seg 695 734 17.3 0.37 Armadillo_seg 859 898 11.4 4.5 17 pkinase 60 311 351.3 1.1e-101 pkinase 56 307 345.6 5.3e-100 UBA 331 370 30.8 3.1e-05 UBA 327 366 31.1 2.6e-05 18 ank 50 83 6.3 36 ank 563 594 4.6 58 ank 84 116 42.3 1.1e-08 ank 627 659 18.1 0.2 ank 117 149 39.4 8.3e-08 ank 660 692 42.8 7.6e-09 ank 150 182 40.1 5e-08 ank 693 725 39.8 6e-08 ank 183 217 18.5 0.16 ank 726 760 25.9 0.00094 ank 253 286 23.4 0.0053 19 Pkinase 221 479 215.7 7e-61 21 Troponin 230 378 -18.4 0.97 Troponin 685 833 -17.8 0.87 22 WW 37 67 4.5 2.3 Sosui 1 23 -- -- WW 76 106 23.4 0.0054 MyTH4 772 890 78.5 1.4e-19 RhoGAP 920 1067 76.1 7.3e-19 23 A_deamin 27 76 17.7 0.0003 A_deamin 63 147 86.3 3.9e-24 A_deamin 220 295 76.3 3.2e-21 A_deamin 431 497 16.1 0.00084 24 sosui 1 19 -- -- sosui 46 68 -- -- sosui 43 65 -- -- sosui 87 108 -- -- sosui 83 104 -- -- sosui 214 236 -- -- sosui 175 197 -- -- sosui 247 269 -- -- sosui 209 231 -- -- sosui 390 412 -- -- sosui 240 262 -- -- sosui 388 410 -- -- 25 PH 1067 1175 77.3 2.6e-20 PH 44 145 49.8 1.4e-12 PH 387 482 75.2 9.6e-20 26 tubulin-binding 747 777 54.8 1.1e-14 tubulin-binding 923 953 54.8 1.1e-14 tubulin-binding 816 846 61.8 9.4e-17 tubulin-binding 992 1022 61.8 9.4e-17 tubulin-binding 847 877 61 1.6e-16 tubulin-binding 1023 1053 61 1.6e-16 tubulin-binding 878 909 36.5 3.2e-09 tubulin-binding 1054 1085 36.5 3.2e-09 27 PH 145 236 78.7 1e-20 PH 91 183 87.8 2.8e-23 Oxysterol_BP 446 868 506.2 2.4e-148 Oxysterol_BP 383 799 770.3 7.5e-228 28 Kelch 32 79 30 5.5e-05 BTB 141 253 127.6 2.3e-34 Kelch 81 126 43.2 6e-09 Kelch 392 436 20.4 0.042 Kelch 128 176 30.1 5.1e-05 Kelch 438 483 44.6 2.3e-09 Kelch 178 218 42.8 7.5e-09 Kelch 485 530 52.7 8.3e-12 Kelch 220 267 48.3 1.7e-10 Kelch 532 579 49.9 5.5e-11 Kelch 581 626 49 1.1e-10 Kelch 628 673 48.9 1.1e-10 29 laminin_G 220 342 76.1 1.6e-20 sosui 7 29 -- -- EGF 361 395 19.3 0.089 F5_F8_type_C 38 178 216.5 4e-61 TSPN 380 577 -42.4 0.71 laminin_G 216 348 62.2 1.5e-16 laminin_G 472 530 8.4 0.37 laminin_G 401 532 48.5 1.3e-12 sosui 639 661 -- -- EGF 558 590 30.3 4.4e-05 laminin_G 827 948 53.8 3.8e-14 EGF 967 1001 18.2 0.19 Laminin_G 1055 1185 15.6 0.0032 30 BR01 66 201 123.2 4.7e-33 HR1 42 114 89.2 8.4e-23 BR01 115 267 276.1 4.6e-79 PDZ 500 577 45 1.6e-09 32 FH2 661 1157 178.1 1.5e-49 FH2 594 1069 187.1 2.7e-52 33 pkinase 316 445 170.2 3.4e-47 pkinase 83 340 326.3 3.5e-94 34 Dynein_heavy 597 1351 920 6.8e-273 Dynein_heavy 3804 4510 910.4 5.1e-270 36 DENN 44 183 111.1 7e-30 DENN 5 78 70 2.2e-18 GRAM 756 842 46.6 3.8e-12 GRAM 650 736 62.4 9.1e-17 PH 1661 1764 68 1e-17 PH 1529 1632 63.6 1.8e-16 37 DDHD 237 484 401.4 8.6e-117 DDHD 614 861 431.3 8.9e-126 38 chromo 8 48 67.7 2.1e-18 chromo 8 48 67.7 2.1e-18 40 GCV_T 4 344 556.6 1.6e-163 DAO 42 403 -70.5 0.0014 Phytoene_dh 44 405 -327.7 0.14 UPF0079 52 149 -47.5 0.26 GCV_T 522 862 593.6 1.2e-174 41 Collagen 5 64 46.8 4.9e-10 TSPN 39 230 289.8 3.3e-83 Collagen 65 124 50.1 5.1e-11 Collagen 469 528 23.8 0.00018 Collagen 125 184 52.1 1.2e-11 Collagen 554 612 27.7 0.00011 Collagen 188 247 48.8 1.2e-10 Collagen 613 672 61.8 1.5e-14 Collagen 251 310 53.8 3.7e-12 Collagen 673 732 60.8 3e-14 Collagen 312 371 58.4 1.5e-13 Collagen 733 792 42.8 7.5e-09 Collagen 384 443 48.5 1.5e-10 Collagen 793 852 37.7 2.7e-07 Collagen 450 509 50.8 3e-11 Collagen 853 912 43.9 3.6e-09 Collagen 534 593 44.8 1.9e-09 Collagen 913 972 59.9 5.4e-14 COLFI 648 706 92.7 1e-35 Collagen 985 1044 54.4 2.5e-12 COLFI 715 831 56.7 1.1e-21 Collagen 1045 1104 55.2 1.5e-12 Collagen 1105 1164 55.7 9.9e-13 Collagen 1165 1224 49.5 7.2e-11 Collagen 1225 1284 46.7 5.3e-10 Collagen 1285 1344 48.9 1.1e-10 Collagen 1345 1404 43.5 4.7e-09 Collagen 1405 1464 46.4 6.3e-10 Collagen 1465 1524 55.9 9.1e-13 Collagen 1525 1584 18.9 0.00032 COLFI 1625 1836 484.1 1.1e-188 42 tubulin 14 347 737 8e-218 43 sosui 16 36 -- -- ig 54 142 25.8 2e-06 ig 71 155 23.8 8e-06 Xlink 159 254 220.3 7.1e-95 Xlink 172 277 162 1.2e-69 Xlink 260 351 196 2.3e-84 Xlink 283 374 132 1.3e-56 44 cadherin 56 143 86.5 5.3e-22 sosui 4 26 -- -- cadherin 157 253 81.7 1.5e-20 cadherin 39 140 14.8 0.04 cadherin 267 360 69.7 6.2e-17 cadherin 154 248 70.4 3.8e-17 cadherin 374 470 50.8 3.1e-11 cadherin 372 454 20.6 0.013 cadherin 486 577 94.6 1.9e-24 cadherin 468 560 69.2 8.8e-17 cadherin 591 682 72.4 9.5e-18 cadherin 574 664 24.7 0.0022 cadherin 722 813 68.8 1.1e-16 cadherin 827 918 98.3 1.5e-25 cadherin 932 1023 96.9 3.9e-25 cadherin 1039 1130 83.9 3.3e-21 cadherin 1144 1236 105.7 8.8e-28 cadherin 1250 1346 41 2.7e-08 cadherin 1363 1447 46.3 6.6e-10 cadherin 1461 1553 53.5 4.7e-12 cadherin 1567 1661 89.5 6.6e-23 cadherin 1675 1759 69.7 6e-17 cadherin 1773 1871 47.7 2.7e-10 cadherin 1887 1973 36.7 5.4e-07 cadherin 1987 2073 29.5 7.9e-05 cadherin 2089 2178 43.9 3.6e-09 cadherin 2190 2277 53.8 3.9e-12 cadherin 2291 2384 96.1 7e-25 cadherin 2398 2486 44.1 3.1e-09 cadherin 2500 2590 48.6 1.4e-10 cadherin 2604 2696 47.1 3.9e-10 cadherin 2710 2802 35.4 1.3e-06 cadherin 2816 2911 81.5 1.8e-20 cadherin 2925 3016 68.3 1.7e-16 cadherin 3030 3118 94.1 2.8e-24 cadherin 3132 3223 99.9 5e-26 cadherin 3237 3328 104.8 1.7e-27 cadherin 3342 3433 106.6 4.8e-28 cadherin 3447 3538 47.2 3.7e-10 cadherin 3553 3634 11.5 0.077 EGF 3796 3828 19.5 0.077 laminin_G 3861 3990 75.5 2.3e-20 EGF 4019 4051 36.8 4.9e-07 EGF 4058 4089 31.7 1.7e-05 EGF 4095 4126 35.6 1.1e-06 EGF 4133 4164 32.9 7.2e-06 45 TPR 11 44 1.6 31 TPR 11 44 1.6 31 TPR 79 112 50.7 3.3e-11 TPR 79 112 50.7 3.3e-11 TPR 113 146 26.3 0.00073 TPR 113 146 26.3 0.00073 TPR 147 180 31 2.8e-05 TPR 147 180 31 2.8e-05 TPR 181 214 39.8 6.1e-08 TPR 181 214 39.8 6.1e-08 TPR 215 248 31.9 1.5e-05 TPR 215 248 31.9 1.5e-05 TPR 249 282 38.8 1.3e-07 TPR 249 282 38.8 1.3e-07 TPR 283 316 39.5 7.4e-08 TPR 283 316 39.5 7.4e-08 TPR 317 350 40.1 5e-08 TPR 317 350 40.1 5e-08 TPR 351 384 39.7 6.4e-08 TPR 351 384 39.7 6.4e-08 TPR 385 418 41.4 2e-08 TPR 385 418 41.4 2e-08 TPR 419 452 38.2 1.9e-07 TPR 419 452 38.2 1.9e-07 46 sosui 179 200 -- -- sosui 266 288 -- -- 47 RhoGEF 737 907 120.3 3.6e-32 spectrin 188 235 12 0.074 PH 921 1032 45.6 2.1e-11 spectrin 279 308 9.6 0.34 spectrin 310 416 23.7 4.2e-05 spectrin 536 642 20.1 0.00043 spectrin 803 877 -9.2 3.5e+04 spectrin 890 937 7 1.8

spectrin 958 1004 7.8 1.1 spectrin 1130 1222 17.6 0.0021 RhoGEF 1285 1455 120.3 3.6e-32 PH 1469 1580 45.6 2.1e-11 48 zf-C2H2 103 125 38.1 1.9e-07 KRAB 13 75 159.5 5.6e-44 zf-C2H2 131 153 31.8 1.6e-05 zf-C2H2 182 200 -1.9 1.3e+02 zf-C2H2 159 181 34.5 2.4e-06 zf-C2H2 210 232 21.8 0.017 zf-C2H2 187 209 35.5 1.2e-06 zf-C2H2 238 260 33.1 6.3e-06 zf-C2H2 215 237 30.8 3.2e-05 zf-C2H2 266 288 34 3.4e-06 zf-C2H2 243 265 30.1 5.2e-05 zf-C2H2 294 316 37.9 2.3e-07 zf-C2H2 271 293 28.6 0.00015 zf-C2H2 322 344 37.9 2.2e-07 zf-C2H2 299 321 29.6 7.4e-05 zf-C2H2 350 372 36.1 7.8e-07 zf-C2H2 352 374 20.2 0.051 zf-C2H2 378 400 34.9 1.8e-06 zf-C2H2 380 402 37.2 3.7e-07 zf-C2H2 406 428 35.3 1.4e-06 zf-BED 393 431 5.6 0.32 zf-C2H2 434 456 35.3 1.4e-06 zf-C2H2 408 430 30.2 4.7e-05 zf-C2H2 462 484 33.8 3.9e-06 zf-C2H2 436 458 38.1 2e-07 zf-C2H2 490 512 37.1 4e-07 zf-C2H2 464 486 37.6 2.9e-07 zf-C2H2 518 540 15.7 1.1 zf-C2H2 492 514 25.4 0.0013 zf-C2H2 546 568 32.4 1.1e-05 zf-C2H2 544 566 22.8 0.0079 zf-C2H2 574 596 34 3.4e-06 zf-C2H2 572 594 37.2 3.7e-07 zf-C2H2 602 624 34.2 3.1e-06 zf-BED 585 623 3.9 0.5 zf-C2H2 630 652 37.9 2.2e-07 zf-C2H2 600 622 34.9 1.9e-06 zf-C2H2 658 680 36.1 7.8e-07 zf-C2H2 628 650 38.2 1.9e-07 zf-C2H2 686 708 34.9 1.8e-06 zf-C2H2 656 678 32.6 9.3e-06 zf-C2H2 714 736 35.3 1.4e-06 zf-C2H2 684 706 24.4 0.0026 zf-C2H2 742 764 36.8 5e-07 zf-C2H2 737 759 20.9 0.03 zf-C2H2 770 792 35 1.7e-06 zf-C2H2 798 820 37.3 3.4e-07 zf-C2H2 826 848 34.8 2e-06 zf-C2H2 854 876 37 4.2e-07 zf-C2H2 885 904 11.3 6.3 zf-C2H2 910 932 38.2 1.9e-07 zf-C2H2 938 960 36.5 5.9e-07 zf-C2H2 966 988 34.3 2.8e-06 zf-C2H2 994 1016 39 1.1e-07 zf-C2H2 1022 1044 35.1 1.6e-06 zf-C2H2 1050 1072 33.8 3.8e-06 zf-C2H2 1078 1100 39 1.1e-07 zf-C2H2 1106 1128 32.9 7.5e-06 zf-C2H2 1134 1156 19.5 0.081 49 SAM 732 795 79.8 5.7e-20 ank 223 256 12.3 6.6 ank 257 289 28 0.00022 ank 290 323 12.6 6 ank 324 356 21.5 0.021 ank 357 389 37.1 4.1e-07 SH3 548 602 36.5 6.2e-07 PDZ 645 738 22.2 0.007 SAM 1741 1804 80.5 3.5e-20 50 PDZ 48 130 51.2 2.3e-11 PDZ 53 135 48.8 1.2e-10 PDZ 148 233 54.1 3e-12 PDZ 153 238 53.5 4.7e-12 PDZ 248 331 42.3 1.1e-08 PDZ 253 336 46.7 5.3e-10 PDZ 456 544 42.5 9.2e-09 PDZ 458 546 39 1.1e-07 PDZ 557 640 62 1.3e-14 PDZ 559 642 55.7 1e-12 PDZ 656 737 69.4 7.5e-17 PDZ 658 739 65.6 1e-15 PDZ 941 1022 36.4 6.5e-07 PDZ 942 1023 26.6 0.0006 52 ank 679 714 6.6 33 ank 23 55 3.5 80 ank 717 749 6.1 38 ank 56 88 43.2 5.7e-09 ank 750 782 33.2 6.2e-06 ank 89 121 45.3 1.4e-09 ank 783 815 4.8 55 ank 122 154 42.7 8.4e-09 ank 823 859 4.1 67 ank 155 183 14.3 2.9 ank 861 893 31.5 1.9e-05 ank 184 216 18.6 0.15 ank 894 926 40 5.4e-08 ank 217 249 36.1 8e-07 ank 927 959 42.3 1.1e-08 ank 250 282 45.6 1.1e-09 ank 960 992 35.7 1.1e-06 ank 283 315 39.3 8.4e-08 ank 993 1025 38.1 2e-07 ank 316 348 39.3 8.8e-08 ank 1026 1058 12.9 5.5 ank 349 381 39.1 9.7e-08 TPR 1072 1105 0.2 43 ank 382 414 46.6 5.5e-10 TPR 1119 1152 16.4 0.7 ank 415 447 39.7 6.7e-08 TPR 1153 1186 25.6 0.0012 ank 448 480 42.6 9.1e-09 ank 481 513 40.2 4.7e-08 ank 514 546 49.7 6.5e-11 ank 547 579 43.6 4.5e-09 ank 580 612 38.3 1.7e-07 ank 613 645 47.2 3.6e-10 ank 646 678 36.3 7e-07 ank 679 711 42.7 8e-09 ank 712 744 43.8 3.9e-09 ank 745 777 41 2.8e-08 ank 778 810 2.2 1.1e+02 ZU5 983 1087 229.6 4.4e-65 death 1479 1562 111.4 1.8e-29 53 sosui 16 38 -- -- sosui 9 30 -- -- Glyco_transf_29 218 512 243.2 3.6e-69 Glyco_transf_29 107 401 448 8.2e-131 54 GSPII_E 1032 1046 8.6 0.092 55 UQ_con 971 1136 0.9 2.6e-06 57 Ca_channel_B 17 75 6.5 0.07 58 DAO 43 404 -61.8 0.00044 DAO 42 403 -70.5 0.0014 Phytoene_dh 45 406 -331.1 0.19 Phytoene_dh 44 405 -327.7 0.14 GCV_T 523 863 556.6 1.6e-163 UPF0079 52 149 -47.5 0.26 GCV_T 522 862 593.6 1.2e-174 59 TPR 285 318 9.6 4.2 TPR 155 189 10.7 3.2 TPR 327 360 21.6 0.018 TPR 198 231 30.9 3e-05 TPR 369 402 8.6 5.4 TPR 240 273 31.3 2.2e-05 TPR 435 468 19.9 0.06 TPR 282 315 15.1 1.1 TPR 477 510 28.8 0.00013 TPR 324 357 30.1 5.3e-05 TPR 519 552 23.6 0.0046 TPR 366 399 18.5 0.16 TPR 561 594 36.5 6.1e-07 TPR 408 441 10.6 3.3 TPR 603 636 19.7 0.071 60 Myb_DNA-binding 300 345 18.8 0.0011 61 ACBP 5 43 -18.1 0.014 ACBP 42 130 199.3 5.9e-56 sosui 405 427 -- -- sosui 503 524 -- -- 62 Dynein_heavy 494 1192 444.2 1.1e-129 63 myosin_head 147 282 81.9 3.4e-23 myosin_head 1208 1871 946.2 8.7e-281 MyTH4 561 673 33.9 2.1e-06 IQ 1887 1907 22.5 0.0097 SH3 1455 1511 8 0.013 IQ 1910 1930 26.1 0.00081 MyTH4 2088 2195 71.8 1.4e-17 MyTH4 3071 3185 108.4 1.4e-28 64 WD40 61 98 22.4 0.011 WD40 12 47 13.6 3.4 WD40 110 145 12.9 4.7 WD40 64 100 19.9 0.059 WD40 150 187 25.3 0.0014 WD40 289 324 13.6 3.4 WD40 341 377 19.9 0.059 65 sosui 152 174 -- -- pkinase 14 265 330.4 2e-95 sosui 193 215 -- -- 66 EGF 12 47 20.7 0.035 EGF 127 162 25.5 0.0013 EGF 53 86 10.6 2.5 EGF 168 203 43.5 4.6e-09 EGF 209 245 27.2 0.00038 EGF 251 286 29.2 9.5e-05 EGF 292 327 30.5 4e-05 EGF 338 373 27.2 0.0004 EGF 379 413 8.6 3.8 EGF 419 454 29.3 9e-05 EGF 524 555 21.3 0.022 EGF 568 598 23.2 0.0061 EGF 611 641 12.3 1.7 EGF 645 686 8.2 4.1 EGF 699 731 2.2 14 EGF 735 773 4.3 9.2 EGF 786 817 21.5 0.02 EGF 830 860 21.4 0.022 EGF 873 904 7.1 5.1 EGF 917 947 17.7 0.27 EGF 960 990 11.4 2.1 EGF 1003 1033 22.8 0.0079 EGF 1046 1076 21.6 0.018 EGF 1089 1119 28.6 0.00015 EGF 1132 1162 18.1 0.21 EGF 1175 1205 21.8 0.017 EGF 1209 1249 0.6 20 EGF 1262 1292 14.5 1.1 EGF 1305 1335 15 1 EGF 1348 1378 22.5 0.0099 EGF 1391 1421 19 0.12 EGF 1434 1464 16.5 0.62 EGF 1477 1507 9.2 3.3 EGF 1520 1550 14.2 1.2 67 EGF 157 187 10.9 2.3 EGF 127 162 25.5 0.0013 EGF 200 230 15.6 0.88 EGF 168 203 43.5 4.6e-09 EGF 243 273 27 0.00045 EGF 209 245 27.2 0.00038 EGF 286 316 25.5 0.0012 EGF 251 286 29.2 9.5e-05 EGF 329 359 26.1 0.0008 EGF 292 327 30.5 4e-05 EGF 372 402 20 0.056 EGF 338 373 27.2 0.0004 EGF 416 448 11.8 1.9 EGF 379 413 8.6 3.8 EGF 461 491 23.2 0.006 EGF 419 454 29.3 9e-05 EGF 504 534 24.9 0.0019 EGF 524 555 21.3 0.022 EGF 547 577 23.9 0.0038 EGF 568 598 23.2 0.0061 EGF 590 620 12.6 1.6 EGF 611 641 12.3 1.7 EGF 633 663 21.6 0.019 EGF 645 686 8.2 4.1 EGF 676 708 9.9 2.9 EGF 699 731 2.2 14 EGF 721 751 15.8 0.84 EGF 735 773 4.3 9.2 EGF 764 794 22 0.014 EGF 786 817 21.5 0.02 EGF 807 837 18.6 0.15 EGF 830 860 21.4 0.022 EGF 850 880 18.2 0.19 EGF 873 904 7.1 5.1 sosui 909 930 -- -- EGF 917 947 17.7 0.27 EGF 960 990 11.4 2.1 EGF 1003 1033 22.8 0.0079 EGF 1046 1076 21.6 0.018 EGF 1089 1119 28.6 0.00015 EGF 1132 1162 18.1 0.21 EGF 1175 1205 21.8 0.017 EGF 1209 1249 0.6 20 EGF 1262 1292 14.5 1.1 EGF 1305 1335 15 1 EGF 1348 1378 22.5 0.0099 EGF 1391 1421 19 0.12 EGF 1434 1464 16.5 0.62 EGF 1477 1507 9.2 3.3 EGF 1520 1550 14.2 1.2 68 WH2 399 417 8.5 22 WH2 463 480 17.2 0.38 69 EGF 45 81 43.6 4.4e-09 EGF 20 56 36.8 4.9e-07 TB 96 137 42.8 7.5e-09 EGF 62 98 37.7 2.6e-07 EGF 162 198 26.5 0.00063 EGF 104 138 31.9 1.5e-05 EGF 204 241 19.5 0.078 TB 153 194 56.9 4.5e-13 EGF 207 243 39.4 8e-08 TB 258 299 74.2 2.8e-18 EGF 325 361 23.4 0.0055 EGF 367 404 18.3 0.18 EGF 410 446 35.7 1e-06 EGF 452 488 24.6 0.0024 EGF 494 529 27.7 0.00027 EGF 535 571 28.8 0.00013 EGF 577 613 17.4 0.33 EGF 619 654 26.5 0.00061 Plexin_repeat 625 674 4.9 0.73 EGF 660 695 31.8 1.5e-05 EGF 701 737 34.8 2e-06 70 zf-C2H2 44 67 6.3 19 zf-C2H2 21 43 20.9 0.031 zf-C2H2 101 124 4.3 31 zf-C2H2 50 73 17.6 0.3 zf-C2H2 202 225 16.1 0.87 zf-C2H2 79 102 15 1.8 zf-C2H2 247 270 5.6 23 zf-C2H2 309 332 15.5 1.3 zf-C2H2 392 415 16.1 0.84 zf-C2H2 429 452 6.3 20 zf-C2H2 499 522 1.8 55 zf-C2H2 578 601 4.5 29 zf-C2H2 624 646 18.9 0.12 zf-C2H2 700 722 11 6.7 zf-C2H2 784 806 19.1 0.1 zf-C2H2 818 840 20.9 0.031 zf-C2H2 847 870 17.6 0.3 zf-C2H2 876 899 15 1.8 zf-C2H2 984 1007 3.8 35 zf-C2H2 1013 1036 15.4 1.4 zf-C2H2 1047 1069 12.8 4.4 zf-C2H2 1093 1115 20.5 0.039 zf-C2H2 1121 1144 16.6 0.58 zf-C2H2 1207 1229 27.4 0.00034

[0120] TABLE-US-00005 TABLE 5 Complete notation of each functional domain Abbreviated notation Complete notation A_deamin Adenosine-deaminase (editase) domain ACBP Acetyl CoA binding protein AMP-binding AMP-binding enzyme ank Ank repeat Armadillo.sub.-- Armadillo/beta-catenin-like repeat seg BNR BNR repeat BR01 BR01-like domain BTB BTB/POZ domain C2 C2 domain Ca_channel_B Dihydropyridine sensitive L-type calcium channel (Beta subunit) cadherin Cadherin domain chromo `chromo` (CHRomatin Organization MOdifier) domain COLFI Fibrillar collagen C-terminal domain Collagen Collagen triple helix repeat (20 copies) DAO FAD dependent oxidoreductase DDHD DDHD domain death Death domain DENN DENN (AEX-3) domain Dynein_heavy Dynein heavy chain EGF EGF-like domain F5_F8_type_C F5/8 type C domain FH2 Formin Homology 2 Domain GCV_T Glycine cleavage T-protein (aminomethyl transferase) Glyco_hydro_47 Glycosyl hydrolase family 47 Glyco_transf_29 Glycosyltransferase family 29 (sialyltransferase) GRAM GRAM domain GSPII_E Bacterial type II secretion system protein HEAT HEAT repeat HR1 Hr1 repeat motif integrin_B Integrins, beta chain IQ IQ calmodulin-binding motif Kelch Kelch motif KRAB KRAB box Laminin_EGF Laminin EGF-like (Domains III and V) laminin_G Laminin G domain Laminin_Nterm Laminin N-terminal (Domain VI) myb_DNA-binding Myb-like DNA-binding domain myosin_head Myosin head (motor domain) MyTH4 MyTH4 domain Oxysterol_BP Oxysterol-binding protein PDZ PDZ domain (Also known as DHR or GLGF). PH PH domain Phytoene_dh Phytoene dehydrogenase related enzyme pkinase Protein kinase domain Plexin_repeat Plexin repeat Pro_dh Proline dehydrogenase RasGEF RasGEF domain RasGEFN Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif RhoGAP RhoGAP domain RhoGEF RhoGEF domain SAM SAM domain (Sterile alpha motif) Sema Sema domain SH3 SH3 domain spectrin Spectrin repeat TB TB domain TIG IPT/TIG domain TPR TPR Domain Troponin Troponin TSPN Thrombospondin N-terminal-like domain tubulin Tubulin/FtsZ family tubulin-binding Tau and MAP protein, Tubulin-binding repeat UBA UBA/TS-N domain UPF0079 Uncharacterised P-loop hydrolase UPF0079 UQ_con Ubiquitin-conjugating enzyme WD40 WD domain, G-beta repeat WH2 WH2 motif WW WW domain Xlink Extracellular link domain zf-BED BED zinc finger zf-C2H2 Zinc finger, C2H2 type ZU5 ZU5 domain

(5) Expression Site

[0121] Expressions in the tissue and the sites of the brain were examined by RT-PCR ELISA. Table 6 lists the sites showing the strongest expression.

(6) Chromosome Position

[0122] Using the DNA nucleotide sequences of the clones as queries, an analysis program BLASTN 2.0.14 (the above-mentioned "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs") was run on human genome sequences corresponding to the library of known sequences, Genbank release 119. The description of the chromosome number from which the clone had been derived was extracted from the definitions for the matched clones as listed in Table 6. TABLE-US-00006 TABLE 6 Expression site of each gene and chromosome position of homologous gene Chromosome Expression site position SEQ ID NO: Tissue Brain Position 1 Brain Caudate nucleus -- 2 Ovary Cerebellum -- 3 Brain -- -- 4 Brain Nucleus of hypothalamus -- 5 Brain Caudate nucleus 2 6 Kidney Caudate nucleus -- 7 Ovary Spinal cord 20 8 Brain Substantia nigra 7 9 Ovary Amygdaloid body -- 10 Brain Caudate nucleus 20 11 Ovary Thalamus 7 12 Brain Amygdaloid body -- 13 Ovary Substantia nigra 9 14 Brain Caudate nucleus 22 15 Brain Thalamus 19 16 Kidney Spinal cord 7 17 Skeletal muscle Caudate nucleus 19 18 Brain Spinal cord 7 19 Heart Amygdaloid body 9 20 -- -- -- 21 Brain Hippocampus 17 22 Brain Spinal cord -- 23 Orchis Corpus callosum -- 24 Kidney Thalamus 7 25 -- Nucleus of hypothalamus 22 26 -- -- 3 27 Brain Thalamus 22 28 Brain Cerebellum 2 29 Brain Spinal cord 16 30 Brain Caudate nucleus 8 31 Ovary Nucleus of hypothalamus 1 32 Heart Amygdaloid body 18 33 Brain Caudate nucleus 3 34 Ovary Caudate nucleus 2 35 Ovary Thalamus 7 36 Ovary Spinal cord 11 37 Brain Cerebellum 14 38 Brain Cerebellum -- 39 Ovary Spinal cord 17 40 Ovary Corpus callosum 16 41 Ovary Cerebellum -- 42 Kidney Spinal cord -- 43 Brain Thalamus 19 44 Brain Corpus callosum -- 45 Kidney Cerebellum X 46 Brain Spinal cord 22 47 Brain Amygdaloid body 3 48 Ovary Spinal cord 17 49 Skeletal muscle Amygdaloid body 22 50 Skeletal muscle Thalamus 3 51 Skeletal muscle Spinal cord -- 52 Ovary Hippocampus -- 53 Brain Cerebellum 2 54 -- -- 3 55 Brain Thalamus -- 56 Kidney Spinal cord 5 57 Brain Caudate nucleus 11 58 -- -- 16 59 Kidney Spinal cord 3 60 -- -- 5 61 Brain Substantia nigra 10 62 Ovary Caudate nucleus 11 63 -- -- 17 64 Skeletal muscle Spinal cord 14 65 Brain Substantia nigra 19 66 Brain Caudate nucleus 3 67 Brain Hippocampus 5 68 -- -- 16 69 -- -- 19 70 Brain Caudate nucleus 19

[0123] According to the above information on homology, homologous genes, each domain, expression sites, chromosome positions and the like, a person skilled in the art can predict based on the grounds shown in Table 1 that the DNAs or the genes of the present invention respectively have each function described in Table 1.

INDUSTRIAL APPLICABILITY

[0124] A single nucleotide polymorphism, SNP, which is a change in one base (nucleotide) among individuals in the DNA or the gene of the present invention, can be found by performing PCR using synthetic DNA primers prepared based on the nucleotide sequence of the DNA or the gene of the present invention or a part thereof, and using chromosome DNA extracted from human blood or tissue so as to determine the nucleotide sequence of the product. Therefore, individual constitution or the like can be predicted, which enables the development of a pharmaceutical preparation suitable for each individual.

[0125] Further, when ortholog (homolog, counterpart) genes for the DNA or the gene of the present invention in model organisms, such as mice, are isolated with cross hybridization, for example, these genes are knocked out to produce human disease model animals, so that the causative genes which cause human diseases can be searched and identified.

[0126] DNA chip, polypeptide chip and antibody chip can be respectively prepared by arraying the DNAs and the polypeptides of the present invention, and antibodies for the polypeptides of the present invention. Specifically, novel DNAs or genes obtained by the present invention are assembled on a so-called DNA chip, and then probes prepared using blood or tissue derived from patients with diseases that relate to the brain, such as mental disease, or as a control using blood or tissue from healthy individuals are hybridized to the chip, so that the chip can be applied to diagnosis and treatment for the diseases. Moreover, antibody chip, on which the antibodies against the polypeptides of the present invention are thoroughly prepared and arrayed, can be applied to diagnosis, treatment of diseases and the like through proteome analysis, such as detection of a difference in expression amount of a protein between a patient and a healthy individual.

[0127] The present application asserts priority based on the three specifications of Japanese Patent Application Nos. 2000-389742, 2001-95524 and 2001-127066, and includes by reference all of the contents as disclosed in these specifications.

Sequence CWU 0 SQTB SEQUENCE LISTING The patent application contains a lengthy "Sequence Listing" section. A copy of the "Sequence Listing" is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20060063152A1). An electronic copy of the "Sequence Listing" will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

0 SQTB SEQUENCE LISTING The patent application contains a lengthy "Sequence Listing" section. A copy of the "Sequence Listing" is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20060063152A1). An electronic copy of the "Sequence Listing" will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

Claims

1. DNA comprising a nucleotide sequence encoding a polypeptide (a) or (b) as follows: (a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; (b) a polypeptide which comprises an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acid(s), and has biological activity which is substantially the same characteristic with the function of the polypeptide of (a).

2. DNA hybridizing to the DNA of claim 1 under stringent conditions, and encoding a polypeptide having biological activity which is substantially the same characteristic with the function of the polypeptide of (a) of claim 1.

3. A gene construct containing the DNA of claim 1 or 2.

4. A polypeptide (a) or (b) as follows: (a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; (b) a polypeptide comprising an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a).

5. A recombinant polypeptide, which is encoded by the gene construct of claim 3.

6. An antibody against the polypeptide of claim 4 or 5.

7. A DNA chip, on which the DNAs of claim 1 or 2 are arrayed.

8. A polypeptide chip, on which the polypeptides of claim 4 or 5 are arrayed.

9. An antibody chip, on which the antibodies of claim 6 are arrayed.