U.S. patent application number 11/167831 was filed with the patent office on 2006-03-23 for proteins encoded by polynucleic acids of porcine reproductive and respiratory syndrome virus (prrsv).
Invention is credited to Prem S. Paul, Yanjin Zhang.
Application Number | 20060062805 11/167831 |
Document ID | / |
Family ID | 46203932 |
Filed Date | 2006-03-23 |
United States Patent
Application |
20060062805 |
Kind Code |
A1 |
Paul; Prem S. ; et
al. |
March 23, 2006 |
Proteins encoded by polynucleic acids of porcine reproductive and
respiratory syndrome virus (PRRSV)
Abstract
The present invention provides an isolated DNA sequence
encoding, for example, at least one polypeptide selected from the
group consisting of proteins encoded by one or more open reading
frames (ORF's) of an Iowa strain of porcine reproductive and
respiratory syndrome virus (PRRSV), specifically ISU-12, and the
polypeptides encoded by the isolated DNA sequences. The present
invention also concerns a vaccine comprising an effective amount of
such a protein; methods of producing antibodies which specifically
bind to such a protein; and methods of protecting a pig against a
PRRSV, and treating a pig infected by a PRRSV.
Inventors: |
Paul; Prem S.; (Ames,
IA) ; Zhang; Yanjin; (San Antonio, TX) |
Correspondence
Address: |
BINGHAM McCUTCHEN, LLP
Three Embarcadero Center
San Francisco
CA
94111-4067
US
|
Family ID: |
46203932 |
Appl. No.: |
11/167831 |
Filed: |
June 28, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10428826 |
May 5, 2003 |
6977078 |
|
|
11167831 |
Jun 28, 2005 |
|
|
|
09601326 |
Sep 25, 2000 |
6773908 |
|
|
PCT/US99/02630 |
Feb 8, 1999 |
|
|
|
10428826 |
May 5, 2003 |
|
|
|
09019793 |
Feb 6, 1998 |
6380376 |
|
|
09601326 |
Sep 25, 2000 |
|
|
|
08478316 |
Jun 7, 1995 |
6251397 |
|
|
09019793 |
Feb 6, 1998 |
|
|
|
08301435 |
Sep 1, 1994 |
6592873 |
|
|
08478316 |
Jun 7, 1995 |
|
|
|
08131625 |
Oct 5, 1993 |
5695766 |
|
|
08301435 |
Sep 1, 1994 |
|
|
|
07969071 |
Oct 30, 1992 |
|
|
|
08131625 |
Oct 5, 1993 |
|
|
|
Current U.S.
Class: |
424/204.1 ;
435/235.1; 435/325; 435/456; 435/69.3; 530/350; 536/23.72 |
Current CPC
Class: |
C12N 2770/10034
20130101; A61P 31/04 20180101; C12N 7/00 20130101; C12N 2770/10021
20130101; A61K 2039/552 20130101; A61P 31/12 20180101; C07K 14/005
20130101; C12N 2770/10022 20130101; A61K 39/00 20130101; A61K 39/12
20130101; C12N 2770/10064 20130101; A61K 2039/51 20130101; A61K
38/00 20130101; A61K 2039/5254 20130101; G01N 33/56983
20130101 |
Class at
Publication: |
424/204.1 ;
435/069.3; 435/456; 435/235.1; 435/325; 530/350; 536/023.72 |
International
Class: |
A61K 39/12 20060101
A61K039/12; C07H 21/04 20060101 C07H021/04; C12N 15/86 20060101
C12N015/86; C07K 14/17 20060101 C07K014/17 |
Claims
1. A DNA sequence encoding a porcine reproductive and respiratory
syndrome virus (PRRSV) consisting of SEQ ID NO:______ (ISU-12).
2. A DNA sequence encoding an open reading frame of the PRRSV of
claim 1 selected from the group consisting of nucleotides 191-7387
of SEQ ID NO:______ (ORF1a), nucleotides 7375-11757 of SEQ ID
NO:______ (ORF 1b), nucleotides 11762-12529 of SEQ ID NO:______
(ORF 2), nucleotides 12385-13116 of SEQ ID NO:______ (ORF 3),
nucleotides 12930-13463 of SEQ ID NO:______ (ORF 4), nucleotides
13477-14076 of SEQ ID NO:______ (ORF 5), nucleotides 14064-14585 of
SEQ ID NO:______ (ORF 6) and nucleotides 14578-14946 of SEQ ID
NO:______ (ORF 7).
3. A polypeptide encoded by the DNA sequence of claim 2.
4. A composition for inducing antibodies against PRRSV comprising
one or more polypeptides encoded by the DNA sequences of claim
2.
5. A DNA sequence encoding a PRRSV consisting of SEQ ID NO:______
(ISU-55).
6. A DNA sequence encoding an open reading frame of the PRRSV of
claim 5 selected from the group consisting of nucleotides 191-7699
of SEQ ID NO:______ (ORF1a), nucleotides 7687-12069 of SEQ ID
NO:______ (ORF 1b), nucleotides 12074-12841 of SEQ ID NO:______
(ORF 2), nucleotides 12692-13458 of SEQ ID NO:______ (ORF 3),
nucleotides 13212-13775 of SEQ ID NO:______ (ORF 4), nucleotides
13789-14388 of SEQ ID NO:______ (ORF 5), nucleotides 14376-14592 of
SEQ ID NO:______ (ORF 6) and nucleotides 14890-15258 of SEQ ID
NO:______ (ORF 7).
7. A polypeptide encoded by the DNA sequence of claim 6.
8. A composition for inducing antibodies against PRRSV comprising
an amount of a PRRSV encoded by SEQ ID NO:______ (ISU-55) effective
to induce said antibodies in a pig, and a physiologically
acceptable carrier.
9. A composition for inducing antibodies against PRRSV comprising
one or more polypeptides encoded by the DNA sequences of claim
6.
10. The composition of claim 8, wherein lung lesions in said
five-week-old colostrum-deprived, caesarean-derived pigs are
reduced by a statistically significant amount wherein said amount
is significant a p value less than 0.01, relative to lung lesions
in uninoculated five-week-old colostrum-deprived, caesarean-derived
pigs.
11. The composition of claim 9, wherein lung lesions in said
five-week-old colostrum-deprived, caesarean-derived pigs are
reduced by a statistically significant amount wherein said amount
is significant a p value less than 0.101, relative to lung lesions
in uninoculated five-week-old colostrum-deprived, caesarean-derived
pigs.
12. The composition of claim 8 further comprising an adjuvant.
13. The composition of claim 9 further comprising an adjuvant.
14. A method of protecting a pig from a porcine reproductive and
respiratory disease, comprising administering an effective amount
of the composition of claim 8 to a pig in need of protection
against said disease.
15. The method of claim 14, wherein said vaccine is administered
orally or parenterally.
16. The method of claim 14, wherein said vaccine is administered
intramuscularly, intradermally, intravenously, intraperioneally,
subcutaneously or intranasally.
17. A method of protecting a pig from a porcine reproductive and
respiratory disease, comprising administering an effective amount
of the composition of claim 9 to a pig in need of protection
against said disease.
18. The method of claim 17, wherein said vaccine is administered
orally or parenterally.
19. The method of claim 17, wherein said vaccine is administered
intramuscularly, intradermally, intravenously, intraperitoneally,
subcutaneously or intranasally.
20. A method of distinguishing PRRSV strain ISU-55 from other
strains of PRRSV comprising: (a) amplifying a DNA sequence of the
PRRSV using the following two primers: TABLE-US-00015 55F
5'-CGTACGGCGATAGGGACACC-3' and 3RFLP
5'-GGCATATATCATCACTGGCG-3';
(b) digesting the amplified sequence of step (a) with DraI; and (c)
correlating the presence of three restriction fragments of 626 bp,
187 bp and 135 bp with a PRRSV ISU-55 strain.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] The present invention concerns polynucleic acids isolated
from a porcine reproductive and respiratory syndrome virus (PRRSV),
a protein and/or a polypeptide encoded by the polynucleic acids, a
vaccine which protects pigs from a PRRSV based on the protein or
polynucleic acids, methods of making the proteins, polypeptides and
polynucleic acids, a method of protecting a pig from PRRS using the
vaccine, a method of producing the vaccine, a method of treating a
pig infected by or exposed to a PRRSV, and a method of detecting a
PRRSV.
[0003] 2. Discussion of the Background
[0004] Porcine reproductive and respiratory syndrome (PRRS), a new
and severe disease in swine, was first reported in the U.S.A. in
1987, and was rapidly recognized in many western European countries
(reviewed by Goyal, J. Vet. Diagn. Invest., 1993, 5:656-664; and in
U.S. application Ser. Nos. 08/131,625 and 08/301,435). The disease
is characterized by reproductive failure in sows and gilts,
pneumonia in young growing pigs, and an increase in preweaning
mortality (Wensvoort et al., Vet. Q., 13:121-130, 1991;
Christianson et al., 1992, Am. J. Vet. Res. 53:485-488; U.S.
application Ser. Nos. 08/131,625 and 08/301,435).
[0005] The causative agent of PRRS, porcine reproductive and
respiratory syndrome virus (PRRSV), was identified first in Europe
and then in the U.S.A. (Collins et al., 1992, J. Vet. Diagn.
Invest., 4:117-126). The European strain of PRRSV, designated as
Lelystad virus (LV), has been cloned and sequenced (Meulenberg et
al., 1993, Virology, 192:62-72 and J. Gen. Virol., 74:1697-1701;
Conzelmann et al., 1993, Virology, 193:329-339).
[0006] PRRSV was classified within a single genus arterivirus in
the new virus family of Arteriviridae, which includes equine
arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV)
and simian hemorrhagic fever virus (SHFV) (Plagemann and Moennig,
1992, Adv. Virus. Res., 41:99-192; Godeny et al., 1993, Virology,
194:585-596; U.S. application Ser. Nos. 08/131,625, 08/301,435 and
Cavanaugh D., 1997, Arch. Virol. 142:629-633). This group of single
plus-strand RNA viruses shares many characteristics such as genome
organization, replication strategy, morphology and macrophage
tropism (Meulenberg et al., 1993; U.S. application Ser. Nos.
08/131,625 and 08/301,435). Subclinical infections and persistent
viremia with concurrent antibody production are also characteristic
histopathologic properties of the arteriviruses.
[0007] Antigenic, genetic and pathogenic variations have been
reported among PRRSV isolates (Wensvoort et al., 1992, J. Vet.
Diagn. Invest., 4:134-138; Mardassi et al., 1994, J. Gen. Virol.,
75:681-685; U.S. application Ser. Nos. 08/131,625 and 08/301,435).
Furthermore, U.S. and European PRRSV represent two distinct
genotypes (U.S. application Ser. Nos. 08/131,625 and 08/301,435).
Antigenic variability also exists among different North American
isolates as well (Wensvoort et al., 1992). Marked differences in
pathogenicity have been demonstrated not only between U.S. and
European isolates, but also among different U.S. isolates (U.S.
application Ser. Nos. 08/131,625 and 08/301,435).
[0008] The genomic organization of arteriviruses resembles
coronaviruses and toroviruses in that their replication involves
the formation of a 3'-coterminal nested set of subgenomic mRNAs (sg
mRNAs) (Chen et al., 1993, J. Gen. Virol. 74:643-660; Den Boon et
al., 1990, J. Virol., 65:2910-2920; De Vries et al., 1990, Nucleic
Acids Res., 18:3241-3247; Kuo et al., 1991, J. Virol.,
65:5118-5123; Kuo et al., 1992; U.S. application Ser. Nos.
08/131,625 and 08/301,435). Partial sequences of several North
American isolates have also been determined (U.S. application Ser.
Nos. 08/131,625 and 08/301,435; Mardassi et al., 1994, J. Gen.
Virol., 75:681-685).
[0009] The genome of PRRSV is polyadenylated, about 15 kb in length
and contains eight open reading frames (ORFs; Meulenberg et al.,
1993; U.S. application Ser. Nos. 08/131,625 and 08/301,435). ORFs
1a and 1b probably encode viral RNA polymerase (Meulenberg et al.,
1993). ORFs 5, 6 and 7 were found to encode a glycosylated membrane
protein (E), an unglycosylated membrane protein (M) and a
nucleocapsid protein (N), respectively (Meulenberg et al., 1995).
ORFs 2 to 4 appear to have the characteristics of
membrane-associated proteins (Meulenberg et al., 1993; U.S.
application Ser. No. 08/301,435). The ORFs 2 to 4 of LV encode
virion-associated proteins designated as GP.sub.2, GP.sub.3 and
GP.sub.4, respectively (Van Nieuwstadt et al, 1996,
70:4767-4772).
[0010] The major envelope glycoprotein of EAV encoded by ORF 5 may
be the virus attachment protein, and neutralizing monoclonal
antibodies (MAbs) are directed to this protein (de Vries, J. Virol.
1992; 66:6294-6303; Faaberg, J. Virol. 1995; 69:613-617). The
primary envelope glycoprotein of LDV, a closely related member of
PRRSV, is also encoded by ORF 5, and several different neutralizing
MAbs were found to specifically immunoprecipitate the ORF 5 protein
(Cafruny et al., Vir. Res., 1986; 5:357-375). Therefore, it is
likely that the major envelope protein of PRRSV encoded by ORF 5
may induce neutralizing antibodies against PRRSV.
[0011] Several hypervariable regions within the ORF5 were
identified and were predicted to be antigenic (U.S. application
Ser. Nos. 08/131,625 and 08/301,435). It has been proposed that
antigenic variation of viruses is the result of direct selection of
variants by the host immune responses (reviewed by Domingo et al.,
J. Gen. Virol. 1993, 74:2039-2045). Thus, these hypervariable
regions are likely due to the host immune selection pressure and
may explain the observed antigenic diversity among PRRSV
isolates.
[0012] The M and N proteins of U.S. PRRSV isolates, including ISU
3927, are highly conserved (U.S. application Ser. No. 08/301,435).
The M and N proteins are integral to preserving the structure of
PRRSV virions, and the N protein may be under strict functional
constraints. Therefore, it is unlikely either that (a) the M and N
proteins are subjected to major antibody selection pressure or that
(b) ORFs 6 and 7, which are likely to encode the M and N proteins,
are responsible for or correlated to viral virulence.
Interestingly, however, higher sequence variation of the LDV M
protein was observed between LDV isolates with differing
neurovirulence (Kuo et al., 1992, Vir. Res. 23:55-72).
[0013] ORFs 1a and 1b are predicted to translate into a single
protein (viral polymerase) by frameshifting. ORFs 2 to 6 may encode
the viral membrane associated proteins.
[0014] In addition to the genomic RNA, many animal viruses produce
one or more sg mRNA species to allow expression of viral genes in a
regulated fashion. In cells infected with PRRSV, seven species of
virus-specific mRNAs representing a 3'-coterminal nested set are
synthesized (mRNAs 1 to 7, in decreasing order of size). mRNA 1
represents the genomic mRNA. Each of the sg mRNAs contains a leader
sequence derived from the 5'-end of the viral genome.
[0015] The numbers of the sg mRNAs differ among arteriviruses and
even among different isolates of the same virus. A nested set of 6
sg mRNAs was detected in EAV-infected cells and European
PRRSV-infected cells. However, a nested set of six (LDV-C) or seven
(LDV-P) sg mRNAs, in addition to the genomic RNA, is present in
LDV-infected cells. The additional sg mRNA 1-1 of LDV-P contains
the 3'-end of ORF 1b and can potentially be translated to a protein
which represents the C-terminal end of the viral polymerase.
Sequence analysis of the sg mRNAs of LDV and EAV indicates that the
leader-mRNA junction motif is conserved. Recently, the leader-mRNA
junction sequences of the European LV were also shown to contain a
common motif, UCAACC, or a highly similar sequence.
[0016] The sg mRNAs have been shown to be packaged into the virions
in some coronaviruses, such as bovine coronavirus (BCV) and
transmissible gastroenteritis virus (TGEV). However, only trace
amounts of the sg mRNAs were detected in purified virions of mouse
hepatitis virus (MHV), another coronavirus. The sg mRNAs of LDV, a
closely related member of PRRSV, are also not packaged in the
virions, and only the genomic RNA was detected in purified LDV
virions.
[0017] The sg mRNAs of LDV and EAV have been characterized in
detail. However, information regarding the sg mRNAs of PRRSV
strains, especially the U.S. PRRSV, is very limited. Thus, a need
is felt for a more thorough molecular characterization of the sg
mRNAs of U.S. PRRSV.
[0018] The packaging signal of MHV is located in the 3'-end of ORF
1b, thus only the genomic RNA of MHV is packaged. The sg mRNAs of
BCV and TGEV, however, are found in purified virions. The packaging
signal of BCV and TGEV has not been determined. The Aura alphavirus
sg mRNA is efficiently packaged into the virions, presumably
because the packaging signal is present in the sg mRNA. The sindbis
virus 26S sg mRNA is not packaged into virions because the
packaging signal is located in the genome segment (not present in
sg mRNA).
[0019] Several mechanisms are involved in the generation of the sg
mRNAs. It has been proposed that coronaviruses utilize a unique
leader RNA-primed transcription mechanism in which a leader RNA is
transcribed from the 3' end of the genome-sized negative-stranded
template RNA, dissociates from the template, and then rejoins the
template RNA at downstream intergenic regions to prime the
transcription of sg mRNAs. The model predicts that the 5'-leader
contains a specific sequence at its 3'-end which is repeated
further downstream in the genome, preceding each of the ORFs 2 to
7. The leader joins to the body of each of the sg mRNAs via the
leader-mRNA junction segment.
[0020] The various strains of PRRSV continue to be characterized
(Halbur et al., J. Vet. Diagn. Invest. 8:11-20 (1996); Meng et al.,
J. Vet. Diagn. Invest. 8:374-381 (1996); Meng et al., J. Gen.
Virol. 77:1265-1270 (1996); Meng et al., J. Gen. Virol.
76:3181-3188 (1995); Meng et al., Arch. Virol. 140:745-755 (1995);
Halbur et al., Vet. Pathol. 32:200-204 (1995); Morozov et al.,
Arch. Virol. 140:1313-1319 (1995); Meng et al., J. Gen Virol.
75:1795-1801 (1994); Halbur et al., J. Vet. Diagn. Invest.
6:254-257 (1994), all of which are incorporated herein by reference
in their entireties.)
[0021] PRRSV is an important cause of pneumonia in nursery and
weaned pigs. PRRSV causes significant economic losses from
pneumonia in nursery pigs (the exact extent of which are not fully
known). Reproductive disease was the predominant clinical outcome
of PRRSV infections during the past few years, due to the early
prevalence of relatively low virulence strains of PRRSV.
Respiratory disease has now become the main problem associated with
PRRSV, due to the increasing prevalence of relatively high
virulence strains of PRRSV. A need is felt for a vaccine to protect
against disease caused by the various strains of PRRSV.
[0022] Surprisingly, the market for animal vaccines in the U.S. and
worldwide is larger than the market for human vaccines. Thus, there
exists an economic incentive to develop new veterinary vaccines, in
addition to the substantial public health benefit which is derived
from protecting farm animals from disease.
SUMMARY OF THE INVENTION
[0023] Accordingly, it is an object of the present invention to
provide a DNA sequence encoding a porcine reproductive and
respiratory syndrome virus (PRRSV) which contains SEQ ID NO: ______
(ISU-12) or SEQ ID NO: ______ (ISU-55).
[0024] It is another object of the invention to provide a DNA
sequence encoding an open reading frame of ISU-12 including
nucleotides 191-7387 of SEQ ID NO:______ (ORF1a), nucleotides
7375-11757 of SEQ ID NO: ______ (ORF 1b), nucleotides 11762-12529
of SEQ ID NO:______ (ORF 2), nucleotides 12385-13116 of SEQ ID
NO:______ (ORF 3), nucleotides 12930-13463 of SEQ ID NO:______ (ORF
4), nucleotides 13477-14076 of SEQ ID NO:______ (ORF 5),
nucleotides 1467-14585 of SEQ ID NO: ______ (ORF 6) and nucleotides
14578-14946 of SEQ ID NO: ______ (ORF 7); [0025] or of ISU-55 of
ISU-12 including nucleotides 191-7699 of SEQ ID NO:______ (ORF1a),
nucleotides 7657-12009 of SEQ ID NO:______ (ORF 1b), nucleotides
12074-12841 of SEQ ID NO:______ (ORF 2), nucleotides 12697-13458 of
SEQ ID NO:______ (ORF 3), nucleotides 13242-13775 of SEQ ID
NO:______ (ORF 4), nucleotides 13789-14388 of SEQ ID NO:______ (ORF
5), nucleotides 14376-14897 of SEQ ID NO:______ (ORF 6) and
nucleotides 14890-15258 of SEQ ID NO:______ (ORF 7).
[0026] It is also an object of the invention to provide a
polypeptide encoded by the DNA sequence encoding ISU-12 or ISU-55,
or one or more ORFs thereof.
[0027] Yet another object of the invention is to provide a
composition for inducing antibodies against PRRSV comprising one or
more polypeptides encoded by the DNA sequences of one or more ORF
of ISU-12 or ISU-55.
[0028] Another object of the invention is to provide a method of
protecting a pig from a porcine reproductive and respiratory
disease, by administering an effective amount of the polypeptides
encoded by the DNA sequences of one or more ORFs of ISU-12 or
ISU-55 to a pig in need of protection against said disease.
[0029] It is yet another object of the invention to provide a
method of distinguishing PRRSV strain ISU-55 from other strains of
PRRSV by:
[0030] (a) amplifying a DNA sequence of the PRRSV using the
following two primers: TABLE-US-00001 55F
5'-CGTACGGCGATAGGGACACC-3' and 3RFLP
5'-GGCATATATCATCACTGGCG-3';
[0031] (b) digesting the amplified sequence of step (a) with DraI;
and [0032] (c) correlating the presence of three restriction
fragments of 626 bp, 187 bp and 135 bp with a PRRSV ISU-55
strain.
[0033] These and other objects, which will become apparent during
the following description of the preferred embodiments, have been
provided by a purified and/or isolated polypeptide selected from
the group consisting of proteins encoded by one or more open
reading frames (ORF's) of an Iowa strain of porcine reproductive
and respiratory syndrome virus (PRRSV), proteins at least 94% but
less than 100% homologous with a protein encoded by an ORF 2 of an
Iowa strain of PRRSV, proteins at least 88% but less than 100%
homologous with a protein encoded by ORF 3 of an Iowa strain of
PRRSV, proteins at least 93% homologous with an ORF 4 of an Iowa
strain of PRRSV, proteins at least 90% homologous with an ORF 5 of
an Iowa strain of PRRSV, proteins at least 97% but less than 100%
homologous with proteins encoded by one or both of ORF 6 and ORF 7
of an Iowa strain of PRRSV, antigenic regions of such proteins
which are at least 5 amino acids in length and which effectively
stimulate protection in a porcine host against a subsequent
challenge with a PRRSV isolate, and combinations thereof; an
isolated polynucleic acid which encodes such a polypeptide or
polypeptides; a vaccine comprising an effective amount of such a
polynucleotide or polypeptide(s); antibodies which specifically
bind to such a polynucleotide or polypeptide; methods of producing
the same; and methods of (i) effectively protecting a pig against
PRRS, (ii) treating a pig exposed to a PRRSV or suffering from
PRRS, and (iii) detecting a PRRSV using the same.
BRIEF DESCRIPTION OF THE FIGURES
[0034] FIGS. 1A, 1B, 1C, 1D, 1E, 1F and 1G shows a nucleotide
sequence comparison of ORFs 2 to 5 of U.S. isolates ISU 79, ISU
1894, ISU 3927, ISU 22 and ISU 55 with other known PRRSV
isolates;
[0035] FIGS. 2A, 2B, 2C and 2D respectively show the alignment of
the deduced amino acid sequences of ORF 2, ORF 3, ORF 4 and ORF 5
of U.S. isolates ISU 79, ISU 1894, ISU 22, ISU 55 and ISU 3927 with
other known PRRSV isolates;
[0036] FIG. 3 shows a phylogenetic tree based on the nucleotide
sequences of ORFs 2 to 7 of seven U.S. PRRSV isolates with
differing virulence;
[0037] FIG. 4 shows a Northern blot analysis of RNAs isolated from
ISU 3927-infected CRL 11171 cells (lane 1) and from purified
virions of ISU 3927 (lane 2);
[0038] FIG. 5 shows a Northern blot analysis of total intracellular
RNAs isolated from CRL 11171 cells infected with ISU22 (lane 1),
ISU 55 (lane 2), ISU 79 (lane 3), ISU 1894 (lane 4) and ISU 3927
(lane 5), respectively;
[0039] FIGS. 6A and 6B show a Northern hybridization of total RNAs
isolated from CRL 11171 cells infected with ISU 79 at different
multiplicities of infection (m.o.i.) (A), and polyadenylated RNA
from cells infected with PRRSV isolates ISU 55 and ISU 79 (B);
[0040] FIGS. 7A and 7B show a Northern blot analysis of total
intracellular mRNAs isolated from CRL 11171 cells infected with ISU
1894 (A) and ISU 79 (B);
[0041] FIGS. 8A and 8B show RT-PCR amplification of the 5'-terminal
sequences of the sg mRNAs 3 and 4 of ISU 1894 (lane 1) and sg mRNAs
3, 4 and 4-1 of ISU 79 (lane 2) (A) where lane L is a 1-kb marker;
and the leader-mRNA junction sequences of sg mRNAs 3 and 4 of ISU
79 and ISU 1894 and of sg mRNA 4-1 of ISU 79 (B), where the
locations of the leader-mRNA junction sequences in the genomes
relative to the start codon of each ORF were indicated by minus (-)
numbers of nucleotides upstream of the ORFs.
[0042] FIGS. 9A, 9B, 9C and 9D shows the sequence alignment of ORFs
2 to 7 of ISU 1894 and ISU 79, where the start codon of each ORF is
indicated by +>, the termination codon of each ORF is indicated
by asterisks (*), the determined or predicted leader-mRNA junction
sequences are underlined and the locations of the leader-mRNA
junction sequences relative to the start codon of each ORF are
indicated by minus (-) numbers of nucleotides upstream of each
ORF.
[0043] FIG. 10. Immunofluorescence assay of the MAbs with
PRRSV-infected cells. Hybridoma supernatant was tested with IFA on
infected ATCC CRL 11171 cells. Typical immunofluorescence from
reaction with protein-specific MAbs is shown here. A. GP4-specific
MAb, PP4bB3; B. E-specific MAb, PP5 dB4; C. N-specific MAb, PPeFl1;
and D. Negative control, PPAc8.
[0044] FIG. 11. Reactivity of the MAbs and detergent extracted
PRRSV antigen in ELISA. Plates were coated with antigen extracted
from PRRSV-infected cells with detergent 1% Triton X-100 and
blocked with 1% BSA. Hybridoma supernatant was tested along with
positive and negative controls, PPeFl1 and PPAc8 respectively.
Specific reactions were detected with anti-mouse IgG peroxidase
conjugate. ABTS substrate was incubated in the plates for 20 min
before A405 was measured. The first four MAbs starting from PP4bB3
are GP4-specific antibodies, and the next six MAbs starting from
PP5bH4 are E-specific antibodies.
[0045] FIG. 12. Reactivity of the E specific MAbs and extract of
PRRSV virions in Immunoblotting. MW standards (in kDa) are
indicated on the left side of the figure. Lanes: 1, PP5 dB4; 2,
PP5bH4; 3, Negative control: PPAc8; 4, Positive control: pig
anti-PRRSV serum; 5, Negative control: normal pig serum.
[0046] FIG. 13. Titers of monoclonal antibodies.
[0047] FIG. 14. Reactivity pattern of PRRSSV isolates with the MAbs
to PRRSV. Titers of the MAbs were shown in FIG. 13. The reactivity
pattern was determined according to the titers of at least 6 MAbs
with any one isolate: <=32--low reactivity; 64 to 128--medium
reactivity; >=256--high reactivity. Those isolates not belonging
to the groups above were grouped as other. Total isolates tested
were 23.
[0048] FIG. 15. Immunofluorescence detection of recombinant protein
expression in insect cells. The High Five.TM. cells were infected
with vAc-P2 (A), vAc-P3 (B), vAc-P4 (C) and wt AcMNPV (D), fixed
with methanol and reacted with pig anti-PRRSV serum. Specific
reactions were detected by fluorescein-labeled goat anti-pig IgG
conjugate and observed under fluorescence microscope.
[0049] FIG. 16. Cell surface expression of recombinant proteins in
High Five.TM. cells. The insect cells were inoculated with vAc-P5
(A), vAc-M (B), vAc-N(C) and wt AcMNPV (D), incubated for 72 hrs,
and stained at 4.degree. C. without fixation and permeabilization.
Pig anti-PRRSV serum was used to react with cell surface
recombinant proteins and fluorescein-labeled goat anti-pig IgG
conjugate was utilized to detect any specific reactions, which was
observed under fluorescence microscope.
[0050] FIG. 17. Immunofluorescence detection of recombinant GP2,
GP3 and GP4 proteins expressed in insect cells. The High Five.TM.
cells were infected with recombinant baculovirus vAc-P2 containing
ORF 2 (A), vAc-P3 containing ORF 3 (B), vAc-P4 containing ORF 4 (C)
or wt AcMNPV (D), fixed with methanol and reacted with pig
anti-PRRSV serum. Specific reactions were detected by
fluorescein-labeled goat anti-pig IgG conjugate and observed under
fluorescence microscope.
[0051] FIG. 18. Immunofluorescence detection of recombinant protein
GP5, M and N expression in insect cells. The High Five.TM. cells
were infected with recombinant baculovirus vAc-P5 containing ORF 5
(A), vAc-M containing the M gene (B), vAc-N containing the N gene
(C) or wt AcMNPV (D), fixed with methanol and reacted with pig
anti-PRRSV serum. Immunofluorescence is present in the cytoplasm in
cells expressing E, M and N proteins.
[0052] FIG. 19. Immunoblotting detection of recombinant protein
expression in insect cells. Whole protein was separated in 15% gel
in SDS-PAGE and transferred to nitrocellulose membrane. Pig
anti-PRRSV serum was used to incubate the membrane and specific
reactions were detected by goat anti-pig IgG peroxidase conjugate.
MW standards (in kDa) are indicated on the left side of the figure.
Lanes: 1. wt AcMNPV infected High Five.TM. cells; 2, vAc-P2
infected High Five.TM. cells; 3. vAc-P3 infected High Five.TM.
cells; 4, vAc-P4 infected High Five.TM. cells; 5, purified PRRSV
virions; 6, normal ATCC CRL 11171 cells. (B). Lanes: 1, vAc-P5
infected High Five.TM. cells; 2, wt AcMNPV infected High Five.TM.
cells; 3, vAc-M infected High Five.TM. cells; 4, vAc-N infected
High Five.TM. cells; 5, purified PRRSV virus; 6, normal ATCC CRL
11171 cells. The arrows indicate the positions or ranges in M, of
recombinant proteins. The images were scanned with Hewlett Packard
ScanJet 3c/T scanner and program of Adobe Photoshop 3.0 (Adobe
System Inc.).
[0053] FIG. 20. Glycosylation analysis of the recombinant proteins
E, M and N expressed in insect cells. (A). Tunicamycin treatment of
insect cells infected with vAc-P2, vAc-P3, vAc-P4 or wt AcMNPV.
(B). Tunicamycin treatment of insect cells infected with vAc-P5,
vAc-M, vAc-N or wt AcMNPV.
[0054] FIG. 21. Primers used to amplify PRRSV ORFs 2 through 7
genes with PCR. The underlined sequence within each primer
indicates the unique restriction enzyme site that was introduced to
facilitate subsequent cloning steps.
[0055] FIG. 22. Recombinant proteins of PRRSV ORFs 2 to 5 expressed
in insect cells. a=predicted M.sub.r of products of PRRSV ORFs 2 to
5 and N-glycosylation sites are based on nucleotide sequence
studies (Meng et al, 1994 & Morozov et al, 1995). b=expressed
products in inset cells. c=bands after tunicamycin treatment were
determined by immunoblotting analysis. d=leader-free core proteins
are determined on the basis of tunicamycin treatment analysis. the
presence of the other bands in the recombinant products after
tunicamycin treatment was possibly due to O-linked glycosylation,
phosphorylation or other post-translational modifications.
[0056] FIG. 23 shows 20 overlapping cDNA clones sequenced from the
VR 2385 cDNA library.
[0057] FIG. 24 shows the DNA alignment of the leader sequence of VR
2385 and LV.
[0058] FIG. 25 shows alignments of ORF1a of VR 2385 and LV. FIG.
25A shows the 5' end alignment. FIG. 25B shows the middle DNA
alignment. FIG. 25C shows the 3' end alignment.
[0059] FIG. 26 shows the results of nested RT PCR with leader and
ORF specific primers to amplify PCR products corresponding to mRNAs
4a, 5a and 7a.
[0060] FIG. 27 shows the DNA sequence alignment of low passage and
high passage ISU-55.
[0061] FIG. 28 shows the ORF maps of ISU-55 high passage and low
passage strains.
[0062] FIG. 29 is a restriction map showing the addition DraI site
in the sequence of the high passage ISU-55 strain.
[0063] FIG. 30 shows the results of a RFLP test on total RNA
isolated from ISU-55 hp, ISU-12 lp and ISU-12hp strains and used in
RT PCR with primers 55F and 3RFLP.
[0064] FIG. 31 shows a genomic map and list of ORFs of
ISU-55hp.
[0065] FIG. 32 shows the nucleotide sequence of ISU-55.
[0066] FIG. 33 shows the nucleotide sequence of ISU-12
(VR2385).
[0067] FIG. 34 shows the alignment of the nucleotide sequence of
ISU-55 and ISU-12 (VR2385).
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0068] In the present application, the nucleotide sequences of the
ORFs 2 to 5 of a low virulence isolate and four other Iowa strain
PRRSV isolates with "moderate" and high virulence have been
determined. Based on comparisons of ORFs 2 to 7 of various PRRSV
isolates, the least virulent U.S. isolate known (ISU 3927) has
relatively high sequence variations in ORFs 2 to 4, as compared to
the variations in other U.S. isolates. Furthermore, based on
analysis of the sequences of the ORFs, at least three minor
genotypes exist within the major genotype of U.S. PRRSV.
[0069] Sequence analysis of the ORF 5 protein of different PRRSV
isolates reveal three hypervariable regions which contained
non-conserved amino acid substitutions. These regions are
hydrophilic and also antigenic as predicted by computer
analysis.
[0070] In the present invention, a "porcine reproductive and
respiratory syndrome virus" or "PRRSV" refers to a virus which
causes the diseases PRRS, PEARS, SIRS, MSD and/or PIP (the term
"PIP" now appears to be disfavored), including the Iowa strain of
PRRSV, other strains of PRRSV found in the United States (e.g., VR
2332), strains of PRRSV found in Canada (e.g., IAF-exp91), strains
of PRRSV found in Europe (e.g., Lelystad virus, PRRSV-10), and
closely-related variants of these viruses which may have appeared
and which will appear in the future.
[0071] The "Iowa strain" of PRRSV includes (a) PRRSV isolates
deposited in the American Type Culture Collection by the present
inventors and/or described in this application and/or in either of
prior U.S. application Ser. Nos. 08/131,625 and 08/301,435, (b)
PRRS viruses which produce more than six sg mRNAs when cultured or
passaged in CRL 11171 cells, (c) PRRSVs which produce at least 40%
gross lung lesions or lung consolidation in 5-week-old
caesarean-derived, colostrum-deprived piglets 10 days
post-infection, (d) a PRRSV isolate having a genome which encodes a
protein having the minimum homology to a PRRSV ORF described in
Table 2 below, and/or (d) any PRRSV isolate having the identifying
characteristics of such a virus.
[0072] The present vaccine is effective if it protects a pig
against infection by a porcine reproductive and respiratory
syndrome virus (PRRSV). A vaccine protects a pig against infection
by a PRRSV if, after administration of the vaccine to one or more
unaffected pigs, a subsequent challenge with a biologically pure
virus isolate (e.g., VR 2385, VR 2386, or other virus isolate
described below) results in a lessened severity of any gross or
histopathological changes (e.g., lesions in the lung) and/or of
symptoms of the disease, as compared to those changes or symptoms
typically caused by the isolate in similar pigs which are
unprotected (i.e., relative to an appropriate control). More
particularly, the present vaccine may be shown to be effective by
administering the vaccine to one or more suitable pigs in need
thereof, then after an appropriate length of time (e.g., 1-4
weeks), challenging with a large sample (10.sup.3-7 TCID.sub.50) of
a biologically pure PRRSV isolate. A blood sample is then drawn
from the challenged pig after about one week, and an attempt to
isolate the virus from the blood sample is then performed (e.g.,
see the virus isolation procedure exemplified in Experiment VIII
below). Isolation of the virus is an indication that the vaccine
may not be effective, and failure to isolate the virus is an
indication that the vaccine may be effective.
[0073] Thus, the effectiveness of the present vaccine may be
evaluated quantitatively (i.e., a decrease in the percentage of
consolidated lung tissue as compared to an appropriate control
group) or qualitatively (e.g., isolation of PRRSV from blood,
detection of PRRSV antigen in a lung, tonsil or lymph node tissue
sample by an immunoperoxidase assay method [described below],
etc.). The symptoms of the porcine reproductive and respiratory
disease may be evaluated quantitatively (e.g., temperature/fever),
semi-quantitatively (e.g., severity of respiratory distress
[explained in detail below], or qualitatively (e.g., the presence
or absence of one or more symptoms or a reduction in severity of
one or more symptoms, such as cyanosis, pneumonia, heart and/or
brain lesions, etc.).
[0074] An unaffected pig is a pig which has either not been exposed
to a porcine reproductive and respiratory disease infectious agent,
or which has been exposed to a porcine reproductive and respiratory
disease infectious agent but is not showing symptoms of the
disease. An affected pig is one which shows symptoms of PRRS or
from which PRRSV can be isolated.
[0075] The clinical signs or symptoms of PRRS may include lethargy,
respiratory distress, "thumping" (forced expiration), fevers,
roughened haircoats, sneezing, coughing, eye edema and occasionally
conjunctivitis. Lesions may include gross and/or microscopic lung
lesions, myocarditis, lymphadenitis, encephalitis and rhinitis. In
addition, less virulent and non-virulent forms of PRRSV and of the
Iowa strain have been found, which may cause either a subset of the
above symptoms or no symptoms at all. Less virulent and
non-virulent forms of PRRSV can be used according to the present
invention to provide protection against porcine reproductive and
respiratory diseases nonetheless.
[0076] The phrase "polynucleic acid" refers to RNA or DNA, as well
as mRNA and cDNA corresponding to or complementary to the RNA or
DNA isolated from the virus or infectious agent. An "ORF" refers to
an open reading frame, or polypeptide-encoding segment, isolated
from a viral genome, including a PRRSV genome. In the present
polynucleic acid, an ORF can be included in part (as a fragment) or
in whole, and can overlap with the 5'- or 3'-sequence of an
adjacent ORF (see for example, FIG. 1 and Experiment 1 below). A
"polynucleotide" is equivalent to a polynucleic acid, but may
define a distinct molecule or group of molecules (e.g., as a subset
of a group of polynucleic acids).
[0077] In the Experiments described hereinbelow, the isolation,
cloning and sequencing of ORFs 2 to 5 of (a) a low virulence U.S.
PRRSV isolate and (b) two other U.S. PRRSV isolates of varying
virulence were determined. The nucleotide and deduced amino acid
sequences of these three U.S. isolates were compared with the
corresponding sequences of other known PRRSV isolates (see, for
example, U.S. application Ser. No. 08/301,435). The results
indicate that considerable genetic variations exist not only
between U.S. PRRSV and European PRRSV, but also among the U.S.
isolates as well.
[0078] The amino acid sequence identity between the seven U.S.
PRRSV isolates studied was 91-99% in ORF 2, 86-98% in ORF 3, 92-99%
in ORF 4 and 88-97% in ORF 5. The least virulent U.S. isolate known
(ISU 3927) has higher sequence variations in ORFs 2 to 4 than in
ORFs 5 to 7, as compared to other U.S. isolates. Three
hypervariable regions with antigenic potential have been identified
in the major envelope glycoprotein encoded by ORF 5.
[0079] Pairwise comparison of the sequences of ORFs 2 to 7 and
phylogenetic tree analysis implied the existence of at least three
groups of PRRSV variants (or minor genotypes) within the major
genotype of U.S. PRRSV. The least virulent U.S. isolate known forms
a distinct branch from other U.S. isolates with differing
virulence. The results of this study have implications for the
taxonomy of PRRSV and vaccine development.
[0080] In a further experiment, the sg mRNAs in PRRSV-infected
cells were characterized. The data showed that a 3'-coterminal
nested set of six or seven sg mRNAs is formed in cells infected
with different isolates of PRRSV. However, unlike some of the
coronaviruses and alphavirus, the sg mRNAs of PRRSV are not
packaged into the virion, and only was the genomic RNA of PRRSV
detected in purified virions. Variations in the numbers of the sg
mRNAs among different PRRSV isolates with differing virulence were
also observed. Further sequence analysis of ORFs 2 to 7 of two U.S.
isolates and their comparison with the European LV reveal the
heterogeneic nature of the leader-mRNA junction sequences of
PRRSV.
[0081] As demonstrated in Experiment 2 below, a 3'-coterminal
nested set of six or more sg mRNAs is formed in cells infected with
different isolates of PRRSV. The presence of a nested set of sg
mRNAs further indicates that U.S. PRRSV, like the European isolate
Lelystad virus (LV), belongs to the newly proposed Arteriviridae
family including LDV, EAV and SHFV. Northern blot analysis with
ORF-specific probes indicates that the structure of the PRRSV sg
mRNAs is polycistronic, and each of the sg mRNAs except for sg mRNA
7 contains multiple ORFs. Therefore, the sequence of each sg mRNA
is contained within the 3'-portion of the next larger sg mRNA, and
not all 5'-ends of the sg mRNAs overlap with the sequences of the
smaller sg mRNAs.
[0082] There is no apparent correlation, however, between the
numbers of sg mRNAs and viral pneumovirulence. An additional
species, sg mRNA 3-1, was found to contain a small ORF (ORF 3-1)
with a coding capacity of 45 amino acids at its 5'-end.
[0083] In Experiment 2 below, the sg mRNAs of PRRSV are shown not
to be packaged into the virions. Whether sg mRNAs are packaged into
virions may depend an whether the sg mRNAs contain a packaging
signal. Since the sg mRNAs of PRRSV are not packaged into virions,
the encapsidation signal of PRRSV is likely localized in the ORF 1
region which is unique to the viral genome, but which is not
present in the sg mRNAs.
[0084] In Experiment 2 below, the junction segments (the
leader-mRNA junction sequences) of sg mRNAs 3 and 4 of two U.S.
isolates of PRRSV, ISU 79 and ISU 1894, are determined. The
knowledge of the leader-mRNA junction sequence identities provides
means for effectively producing (a) chimeric viruses to be used as
an infectious clone and/or as a vaccine, and (b) vectors for
inserting or "shuttling" one or more genes into a suitable,
infectable host. Methods for designing and producing such chimeric
viruses, infectious clones and vectors are known (see, for example,
Sambrook et al, "Molecular Cloning: A Laboratory Manual", 2nd ed.,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
[0085] The leader-mRNA junction sequence of sg mRNAs 3 and 4 of the
two isolates are different (TTGACC for mRNA 3-1 of ISU 79, GTAACC
for mRNA 3, and TTCACC for mRNA 4). Most of the nucleotide
differences in the junctions are present in the first 3
nucleotides. The last 3 nucleotides are invariable, suggesting that
the joining of the leader sequence to the bodies of sg mRNAs occurs
within the 5'-end of the leader-mRNA junction sequence. Similar
observations have been reported for LV, EAV and LDV.
[0086] The acquisition of the additional sg mRNA 3-1 in isolate ISU
79 is due to a single nucleotide substitution which generates a new
leader mRNA junction sequence. This substitution occurs in the last
nucleotide of the junction segment, suggesting that the last
nucleotide of the leader-mRNA junction motif is critical for the
binding of the leader and for the initiation of transcription.
[0087] Although the sequence homology between the leader and the
intergenic regions of coronaviruses led to the hypothesis that
basepairing might be essential in the leader-primed transcription,
no experimental evidence has documented for the requirement of
base-pairing in transcription of the sg mRNAs. For example, the
sequence at the 3'-end of the leader of both coronaviruses and
arteriviruses that is involved in the fusion process remains
unknown.
[0088] Several lines of evidence support the leader-primed
transcription mechanism for coronaviruses, but the presence of
negative-stranded sg mRNAs and sg replicative intermediates (sg RI)
in coronavirus-infected cells suggests that the mechanism involved
in sg mRNA synthesis is more complex than mere base-pairing of the
leader sequence with a junction sequence. However,
negative-stranded sg mRNAs have not been detected in arteriviruses
except for LDV, and sg RIs have been detected only in EAV-infected
cells. Therefore, sg mRNA synthesis in arteriviruses, and
particularly in PRRSV, may be less complicated than in
coronaviruses.
[0089] Sequence analysis of the ORFs 2 to 7 of two U.S. PRRSV
isolates and comparison of the sequences with LV reveals the
heterogeneity of the leader-mRNA junction sequences. The presence
of the leader-mRNA junction motifs at positions which do not
correspond to a sg mRNA raises a question as to whether the short
stretch of only six nucleotides which are conserved in the leader
and junction sequences in the genomes of PRRSV and other
arteriviruses is sufficient for efficient binding of the leader to
these specific junction sites upstream of the ORFs. This apparent
discrepancy, however, may be explained by the following two
possibilities.
[0090] First, additional structural elements, such as secondary
structures or the sequences surrounding the leader-mRNA junction
segment, are expected to be involved in the fusion (binding) of the
leader to the specific sites. It has been shown that, in MHV, the
sequence flanking the consensus sequence (leader-mRNA junction
sequence) of UCUAAAC affects the efficiency of sg DI RNA
transcription, and that the consensus sequence was necessary but
not sufficient in and of itself for the synthesis of the DI
mRNA.
[0091] Second, the distance between two leader-mRNA junction
regions may affect the transcription of sg mRNAs. It has been
demonstrated that the downstream leader-mRNA junction region was
suppressing sg DI RNA synthesis of MHV from the upstream
leader-mRNA junction region. The suppression was significant when
the two leader-mRNA junction sequence separation was less than 35
nucleotides. However, significant inhibition of larger sg DI RNA
synthesis (from the upstream leader-mRNA junction sequence) was not
observed when the two leader-mRNA junction regions were separated
by more than 100 nucleotides.
[0092] The previously reported experimental results are consistent
with the observations reported in Experiment 2 below, where an
additional species of sg mRNA 3-1, in addition to the sg mRNA 4, is
observed in some of the PRRSV isolates. The leader-mRNA junction
sequences of sg mRNAs 4 and 3-1 in the Iowa strain of PRRSV are
separated by about 226 nucleotides. Therefore, the synthesis of the
larger sg mRNA 3-1 from the upstream leader-mRNA junction sequence
is not suppressed by the presence of the downstream leader-mRNA 4
junction sequence.
[0093] In contrast, multiple potential leader-mRNA junction
sequences were found at different positions upstream of ORFs 3, 5,
6 and 7, but there were no sg mRNAs corresponding to these
leader-mRNA junction motifs in the Northern blot analysis. Most of
these leader-mRNA junction sequences are separated by less than 50
nucleotides from the downstream leader-mRNA junction region, except
for ORF 7 (in which the two potential leader-mRNA junction
sequences are separated by 114 nucleotides). However, sg mRNA 7 in
Northern blot analysis showed a widely-diffused band. Therefore,
transcription of the larger sg mRNA 7 from the upstream leader-mRNA
junction sequence may not be significantly suppressed by the
downstream junction sequence, but it is not easily distinguishable
from the abundant sg mRNA 7 by Northern blot analysis.
The Present Polynucleotides and Polypeptides
[0094] ORF's 2-7 of plaque-purified PRRSV isolate ISU-12 (deposited
on Oct. 30, 1992, in the American Type Culture Collection, 12301
Parklawn Drive, Rockville, Md. 20852, U.S.A., under the accession
numbers VR 2385 [3.times. plaque-purified] and VR 2386
[non-plaque-purified]) and ORF's 6-7 of PRRSV isolates ISU-22,
ISU-55, ISU-3927 (deposited on Sep. 29, 1993, in the American Type
Culture Collection under the accession numbers VR 2429, VR 2430 and
VR 2431, respectively), ISU-79 and ISU-1894 (deposited on Aug. 31,
1994, in the American Type Culture Collection under the accession
numbers VR 2474 and VR 2475, respectively) are described in detail
in U.S. application Ser. No. 08/301,435. However, the techniques
used to isolate, clone and sequence these genes can be also applied
to the isolation, cloning and sequencing of the genomic polynucleic
acids of any PRRSV. Thus, the present invention is not limited to
the specific sequences disclosed in the Experiments below.
[0095] For example, primers for making relatively large amounts of
DNA by the polymerase chain reaction (and if desired, for making
RNA by transcription and/or protein by translation in accordance
with known in vivo or in vitro methods) can be designed on the
basis of sequence information where more than one sequence obtained
from a PRRSV genome has been determined (e.g., ORF's 2-7 of VR
2385, VR 2429, VR 2430, VR 2431, VR 2474, ISU-1894, VR 2332 and
Lelystad virus). A region from about 15 to 50 nucleotides in length
having at least 80% and preferably at least 90% identity is
selected from the determined sequences. A region where a deletion
occurs in one of the sequences (e.g., of at least 5 nucleotides)
can be used as the basis for preparing a selective primer for
selective amplification of the polynucleic acid of one strain or
type of PRRSV over another (e.g., for the differential diagnosis of
North American and European PRRSV strains).
[0096] Once the genomic polynucleic acid is amplified and cloned
into a suitable host by known methods, the clones can be screened
with a probe designed on the basis of the sequence information
disclosed herein. For example, a region of from about 50 to about
500 nucleotides in length is selected on the basis of either a high
degree of identity (e.g., at least 90%) among two or more sequences
(e.g., in ORF's 6-7 of the Iowa strains of PRRSV disclosed in
Experiment III below), and a polynucleotide of suitable length and
sequence identity can be prepared by known methods (such as
automated synthesis, or restriction of a suitable fragment from a
polynucleic acid containing the selected region, PCR amplification
using primers which hybridize specifically to the polynucleotide,
and isolation by electrophoresis). The polynucleotide may be
labeled with, for example, .sup.32P (for radiometric
identification) or biotin (for detection by fluorometry). The probe
is then hybridized with the polynucleic acids of the clones and
detected according to known methods.
[0097] The present Inventors have discovered that one or more of
ORFs 2-4 may be related to the virulence of PRRSV. For example, at
least one isolate of PRRSV which shows relatively low virulence
also appears to have a deletion in ORF 4 (see, for example,
Experiments VIII-XI in U.S. application Ser. No. 08/301,435).
Furthermore, the least virulent known isolate (VR 2431) shows a
relatively high degree of variance in both nucleotide and amino
acid sequence information in ORFs 2-4, as compared to other U.S.
PRRSV isolates. Thus, in one embodiment, the present invention
concerns polynucleotides and polypeptides related to ORFs 2-4 of VR
2431.
[0098] In a further embodiment, the present invention is concerned
with a polynucleic acid obtained from a PRRSV isolate which confers
immunogenic protection directly or indirectly against a subsequent
challenge with a PRRSV, but in which the polynucleic acid is
deleted or mutated to an extent which would render a PRRSV
containing the polynucleic acid either low-virulent (i.e., a "low
virulence" (lv) phenotype; see the corresponding explanation in
U.S. application Ser. No. 08/301,435) or non-virulent (a so-called
"deletion mutant"). Preferably, one or more of ORFs 2-4 is/are
deleted or mutated to an extent which would render a PRRS virus
non-virulent. However, it may be desirable to retain regions of one
or more of ORFs 2-4 in the present polynucleic acid which (i)
encode an antigenic and/or immunoprotective peptide fragment and
which (ii) do not confer virulence to a PRRS virus containing the
polynucleic acid.
[0099] The present invention also encompasses a PRRSV per se in
which one or more of ORFs 2-4 is deleted or mutated to an extent
which renders it either low-virulent or non-virulent (e.g., VR
2431). Such a virus is useful as a vaccine or as a vector for
transforming a suitable host (e.g., MA-104, PSP 36, CRL 11171,
MARC-145 or porcine alveolar macrophage cells) with a heterologous
gene. Preferred heterologous genes which may be expressed using the
present deletion mutant may include those encoding a protein or an
antigen other than a porcine reproductive and respiratory syndrome
virus antigen (e.g., pseudorabies and/or swine influenza virus
proteins and/or polypeptide-containing antigens, a porcine growth
hormone, etc.) or a polypeptide-based adjuvant (such as those
discussed in U.S. application Ser. No. 08/301,435 for a vaccine
composition).
[0100] It may also be desirable in certain embodiments of the
present polynucleic acid which contain, for example, the
3'-terminal region of a PRRSV ORF (e.g., from 200 to 700
nucleotides in length), at least part of which may overlap with the
5'-region of the ORF immediately downstream. Similarly, where the
3'-terminal region of an ORF may overlap with the 5'-terminal
region of the immediate downstream ORF, it may be desirable to
retain the 5'-region of the ORF which overlaps with the ORF
immediately downstream.
[0101] The present inventors have also discovered that ORF 5 in the
PRRSV genome appears to be related to replication of the virus in
mammalian host cells capable of sustaining a culture while infected
with PRRSV. Accordingly, the present invention is also concerned
with polynucleic acids obtained from a PRRSV genome in which ORF 5
may be present in multiple copies (a so-called "overproduction
mutant"). For example, the present polynucleic acid may contain at
least two, and more preferably, from 2 to 10 copies of ORF 5 from a
high-replication (hr) phenotype PRRSV isolate.
[0102] Interestingly, the PRRSV isolate ISU-12 has a surprisingly
large number of potential start codons (ATG/AUG sequences) near the
5'-terminus of ORF 5, possibly indicating alternate start sites of
this gene. Thus, alternate forms of the protein encoded by ORF 5 of
a PRRSV isolate may exist, particularly where alternate ORF's
encode a protein having a molecular weight similar to that
determined experimentally (e.g., from about 150 to about 250 amino
acids in length). The most likely coding region for ORF 5 of ISU-12
is indicated in FIG. 1.
[0103] One can prepare deletion and overproduction mutants in
accordance with known methods. For example, one can prepare a
mutant polynucleic acid which contains a "silent" or degenerate
change in the sequence of a region encoding a polypeptide. By
selecting and making an appropriate degenerate mutation, one can
substitute a polynucleic acid sequence recognized by a known
restriction enzyme (see, for example, Experiment 2 below). Thus, if
a silent, degenerate mutation is made at one or two of the 3'-end
of an ORF and the 5'-end of a downstream ORF, one can insert a
synthetic polynucleic acid (a so-called "cassette") which may
contain a polynucleic acid encoding one or multiple copies of an hr
ORF 5 protein product, of a PRRSV or other viral envelope protein
and/or an antigenic fragment of a PRRSV protein. The "cassette" may
be preceded by a suitable initiation codon (ATG), and may be
suitably terminated with a termination codon at the 3'-end (TAA,
TAG or TGA). Of course, an oligonucleotide sequence which does not
encode a polypeptide may be inserted, or alternatively, no cassette
may be inserted. By doing so, one may provide a so-called deletion
mutant.
[0104] The present invention also concerns regions and positions of
the polypeptides encoded by ORFs of VR 2431 which may be
responsible for the low virulence of this isolate. Accordingly, the
present isolated and/or purified polypeptide may be one or more
encoded by a "low-virulence mutation" of one or more of ORFs 2, 3
and 4 of a PRRSV (or a low-virulence fragment thereof at least 5
amino acids in length) in which one or more of positions 12-14 of
the polypeptide encoded by ORF 2 are RGV (in which "R", "G" and "V"
are the one-letter abbreviations for the corresponding amino
acids), positions 44-46 are LPA, position 88 is A, position 92 is
R, position 141 is G, position 183 is H, position 218 is S,
position 240 is S and positions 252-256 are PSSSW, or any
combination thereof. Other amino acid residue identities which can
be further combined with one or more of the above amino acid
position identities include those at position 174 (I) and position
235 (M).
[0105] The present isolated and/or purified polypeptide may also be
one encoded by an ORF 3 of a PRRSV in which one or more of the
specified amino acid identities may be selected from those at
positions 11 (L), 23 (V), 26-28 (TDA), 65-66 (QI), 70 (N), 79 (N),
93 (T), 100-102 (KEV), 134 (K), 140 (N), 223-227 (RQRIS), 234 (A)
and 235 (M), or any combination thereof, which may be further
combined with one or more of positions 32 (F), 38 (M), 96 (P), 143
(L), 213-217 (FQTS), 231 (R), and 252 (A).
[0106] The present isolated and/or purified polypeptide may also be
one encoded by an ORF 4 of a PRRSV in which one or more of the
specified amino acid identities may be selected from those at
positions 0.13 (E), 43 (N), 56 (G), 58-59 (TT), 134 (T), 139 (I)
and any combination thereof, which may be further combined with one
or more of positions 2-3 (AA), 51 (G) and 63 (P).
[0107] The present invention also concerns polynucleotide sequences
encoding polypeptide sequences of 5 or more amino acids, preferably
10 or more amino acids, and up to the full length of the
polypeptide, encoded by any one of ORFs 2-4 of VR 2431, in which
the polynucleotides at the codon(s) corresponding to the amino acid
positions detailed in the preceding three paragraphs are replaced
with polynucleotides encoding the corresponding amino acids of the
proteins encoded by the corresponding ORF of VR 2431.
[0108] In a further embodiment of the present invention, the
polynucleic acid encodes one or more proteins, or antigenic regions
thereof, of a PRRSV. Preferably, the present nucleic acid encodes
at least one antigenic region of a PRRSV membrane (envelope)
protein. More preferably, the present polynucleic acid encodes a
hypervariable region from a ORF 5 PRRSV protein product (see the
discussion below) or (b) contains at least one copy of the ORF-5
gene from a high virulence (hv) phenotype isolate of PRRSV (see the
description of "hv phenotype" in U.S. application Ser. No.
08/301,435) and a sufficiently long fragment, region or sequence of
at least one of ORF-2, ORF-3, ORF-4, ORF-5 and/or ORF-6 from the
genome of a PRRSV isolate to encode an antigenic region of the
corresponding protein(s) and effectively stimulate protection
against a subsequent challenge with, for example, a hv phenotype
PRRSV isolate.
[0109] Even more preferably, at least one entire envelope protein
encoded by ORF-2, ORF-3, ORF-5 and/or ORF-6 of a PRRSV is contained
in the present polynucleic acid, and the present polynucleic acid
excludes or modifies a sufficiently long portion of one of ORFs 2-4
from a PRRSV to render a PRRSV containing the same either
low-virulent or non-virulent. Most preferably, the polynucleic acid
is isolated from the genome of an isolate of the Iowa strain of
PRRSV (for example, VR 2385 (3.times. plaque-purified ISU-12), VR
2386 (non-plaque-purified ISU-12), VR 2428 (ISU-51), VR 2429
(ISU-22), VR 2430 (ISU-55), VR 2431 (ISU-3927), VR 2474 (ISU-79)
and/or ISU-1894).
[0110] A further preferred embodiment of the present invention
includes a polynucleotide encoding an amino acid sequence from a
hypervariable region of ORF 5 of a PRRSV, preferably of an Iowa
strain of PRRSV. Thus, such polynucleotides encode one (or more) of
the following amino acid sequences: TABLE-US-00002 TABLE 1
Hypervariable Region 1 Hypervariable Region 2 Hypervariable Region
3 (positions 32-38) (Positions 57-66) (Pos'ns 120-128) NGNSGSN
ANKFDWAVET LICFVIRLA SNDSSSH ANKFDWAVEP LTCFVIRFA SSSNSSH
AGEFDWAVET LICFVIRFT SANSSSH ADKFDWAVEP LACFVIRFA HSNSSSH
ADRFDWAVEP LTCFVIRFV SNSSSSH SSHFGWAVET LTCFIIRFA NNSSSSH FICFVIRFA
NGGDSST(Y) FVCFVIRAA
[0111] In this embodiment, the polynucleotide may encode further
amino acid sequences of a PRRSV ORF 5 (as disclosed in FIG. 3 or in
U.S. application Ser. Nos. 08/131,625 or 08/301,435), as long as
one or more of the hypervariable regions at positions 32-38, 57-66
and/or 120-128 are included. (The present invention specifically
excludes the proteins and polynucleotides of ORF 5 of LV and VR
2332.)
[0112] A further preferred embodiment of the present invention
concerns a purified preparation which may comprise, consist
essentially of or consist of a polynucleic acid having a sequence
of the formula (I) or (II): 5'-.alpha.-.beta.-3' (I)
5'-.alpha.-.beta.-.gamma.-3' (II) wherein .alpha. encodes at least
one polypeptide, or antigenic or low-virulence fragment thereof
encoded by a polynucleotide selected from the group consisting of
ORFs 2, 3 and 4 of an Iowa strain of PRRSV and regions thereof
encoding such antigenic and/or low-virulence fragments; and .beta.
is at least one copy of an ORF 5 from an Iowa strain of PRRSV or an
antigenic fragment thereof (e.g. one or more hypervariable
regions), preferably a full-length copy from a high replication
(hr) phenotype; and .gamma. encodes at least one polypeptide or
antigenic fragment thereof encoded by a polynucleotide selected
from the group consisting of ORF 6 and ORF 7 of an Iowa strain of
PRRSV and regions thereof encoding the antigenic fragments.
[0113] Alternatively, the present invention may concern a purified
preparation which may comprise, consist essentially of or consist
of a polynucleic acid having a sequence of the formula (III):
5'-.beta.-.delta.-.gamma.-3' (III) where .beta. and .gamma. are as
defined above; and .delta. is either a covalent bond or a linking
polynucleic acid which does not materially affect transcription
and/or translation of the polynucleic acid. Preferably, .beta. is a
polynucleotide encoding at least one hypervariable region of a
protein encoded by an ORF 5 of an Iowa strain of PRRSV, and more
preferably, encodes a full-length protein encoded by an ORF 5 of an
Iowa strain of PRRSV.
[0114] The present invention may also concern a purified
preparation which may comprise, consist essentially of or consist
of a polynucleic acid having a sequence of the formula (IV):
5'-.alpha.-.beta.-.delta.-.gamma.-3' (IV) where .alpha., .beta.,
.gamma. and .delta. are as defined in formulas (I)-(III) above.
[0115] The present invention may also concern a purified
preparation which may comprise, consist essentially of or consist
of a polynucleic acid, an expression vector or a plasmid having a
sequence of the formula (V): 5'-.epsilon.-.zeta.--.kappa.-.xi.-3'
(V) where .epsilon., which is optionally present, is a 5'-terminal
polynucleotide sequence which provides a means for operationally
expressing the polynucleotides .alpha., .beta., .gamma. and
.delta.; .zeta. is a polynucleotide of the formula KTVACC, where K
is T, G or U, and V is A, G or C; is a polynucleotide of at most
about 130 (preferably at most 100) nucleotides in length; .kappa.
is a polynucleotide comprising one or more genes selected from the
group consisting of a conventional marker or reporter gene,
.alpha., .beta., .gamma., and operationally linked combinations
thereof, where .alpha., .beta., and .gamma. are as defined in
formulas (I)-(IV) above; and .xi., which is optionally present, is
a 3'-terminal polynucleotide sequence which does not suppress the
operational expression of the polynucleotides .alpha., .beta.,
.gamma. and .delta., and which may be operationally linked to
.epsilon. (for example, in a plasmid).
[0116] Suitable marker or reporter genes include, e.g., those
providing resistance to an antibiotic such as neomycin,
erythromycin or chloramphenicol; those encoding a known, detectable
enzyme such as .beta.-lactamase, DHFR, horseradish peroxidase,
glucose-6-phosphate dehydrogenase, alkaline phosphatase, and
enzymes disclosed in U.S. Pat. No. 4,190,496, col. 32, line 33
through col. 38, line 44 (incorporated herein by reference), etc.;
and those encoding a known antibody (e.g., mouse IgG, rabbit IgG,
rat IgG, etc.) or known antigenic protein such as Protein A,
Protein G, bovine serum albumin (BSA), keyhole limpet hemocyanin
(KLH), bovine gamma globulin (BGG), lactalbumin, polylysine,
polyglutamate, lectin, etc.
[0117] The polynucleotide is preferably a polynucleotide sequence
at least 80% homologous to a polynucleotide sequence from a PRRSV
genome located between a leader-mRNA junction sequence and the
start codon of the ORF immediately downstream. "About 130"
nucleotides in length refers to a length of the polynucleotide
which does not adversely affect the operational expression of
.kappa.. For example, in ISU 79, a leader-mRNA junction sequence
which does not suppress expression of ORF 7 can be found 129 bases
upstream from the start codon of ORF 7 (see Experiment 2 below).
Suitable exemplary sequences for the polynucleotide can be deduced
from the sequences shown in FIGS. 1 and 9.
[0118] The present polynucleic acid may also comprise, consist
essentially of or consist of combinations of the above sequences,
either as a mixture of polynucleotides or covalently linked in
either a head-to-tail (sense-antisense) or head-to-head fashion.
Polynucleic acids complementary to the above sequences and
combinations thereof (antisense polynucleic acid) are also
encompassed by the present invention. Thus, in addition to
possessing multiple or variant copies of ORF 5, the present
polynucleic acid may also contain multiple or variant copies of one
or more of ORF's 1-7, including antigenic or hypervariable regions
of ORF 5, of Iowa strain PRRSV's.
[0119] Similar to the methods described above and in the
Experiments described below and in U.S. application Ser. Nos.
08/131,625 and 08/301,435, one can prepare a library of recombinant
clones (e.g., using E. coli as a host) containing suitably prepared
restriction fragments of a PRRSV genome (e.g., inserted into an
appropriate plasmid expressible in the host). The clones are then
screened with a suitable probe (e.g, based on a conserved sequence
of ORF's 2-3; see, for example, FIG. 22 of U.S. application Ser.
No. 08/301,435). Positive clones can then be selected and grown to
an appropriate level. The polynucleic acids can then be isolated
from the positive clones in accordance with known methods. A
suitable primer for PCR can then be designed and prepared as
described above to amplify the desired region of the polynucleic
acid. The amplified polynucleic acid can then be isolated and
sequenced by known methods.
[0120] The present purified preparation may also contain a
polynucleic acid selected from the group consisting of sequences
having at least 97% sequence identity (or homology) with at least
one of ORFs 5-7 of VR 2385, VR 2430 and/or VR 2431; and sequences
encoding a polypeptide having at least the minimum sequence
identity (or homology) with at least one of ORF's 2-5 of VR 2385,
VR 2428, VR 2429, VR 2430, VR 2431, VR 2474 and ISU-1894, as
follows: TABLE-US-00003 TABLE 2 Minimum % Homology with ORF:
Relative to Isolate: 2 3 4 5 VR 2385 99 92 95 90 VR 2429 100 99 99
98 VR 2430 98 95 96 90 VR 2431 94 88 93 92 VR 2474 99 97 97 95 ISU
1894 97 97 99 97
[0121] Preferably, the polynucleic acid excludes or modifies a
sufficiently long region or portion of one or more of ORFs 24 of
the hv PRRSV isolates VR 2385, VR 2429, ISU-28, ISU-79 and/or
ISU-984 to render the isolate low-virulent or non-virulent.
[0122] In the context of the present application, "homology" refers
to the percentage of identical nucleotide or amino acid residues in
the sequences of two or more viruses, aligned in accordance with a
conventional method for determining homology (e.g., the MACVECTOR
or GENEWORKS computer programs, aligned in accordance with the
procedure described in Experiment III in U.S. application Ser. No.
08/301,435).
[0123] Preferably, the present isolated polynucleic acid encodes a
protein, polypeptide, or antigenic fragment thereof which is at
least 10 amino acids in length and in which non-homologous amino
acids which are non-essential for antigenicity may be
conservatively substituted. An amino acid residue in a protein,
polypeptide, or antigenic fragment thereof is conservatively
substituted if it is replaced with a member of its polarity group
as defined below:
Basic Amino Acids:
[0124] lysine (Lys), arginine (Arg), histidine (His) Acidic Amino
Acids: [0125] aspartic acid (Asp), glutamic acid (Glu), asparagine
(Asn), glutamine (Gln) Hydrophilic, Nonionic Amino Acids: [0126]
serine (Ser), threonine (Thr), cysteine (Cys), asparagine (Asn),
glutamine (Gln) Sulfur-Containing Amino Acids: [0127] cysteine
(Cys), methionine (Met) Hydrophobic, Aromatic Amino Acids: [0128]
phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp) Hydrophobic,
Nonaromatic Amino Acids: [0129] glycine (Gly), alanine (Ala),
valine (Val), leucine (Leu), isoleucine (Ile), proline (Pro)
[0130] More particularly, the present polynucleic acid encodes one
or more of the protein(s) encoded by the second, third, fourth,
fifth, sixth and/or seventh open reading frames (ORF's 2-7) of the
PRRSV isolates VR 2385, VR 2386, VR 2428, VR 2429, VR 2430, VR
2431, VR 2474 and/or ISU-1894 (e.g., one or more of the sequences
shown in FIG. 3 and/or SEQ ID NOS:15, 17, 19, 43, 45, 47, 49, 51,
53, 55, 57, 59, 61, 63 and 65 of U.S. application Ser. No.
08/301,435).
[0131] ORF's 6 and 7 are not likely candidates for controlling
virulence and replication phenotypes of PRRSV, as the nucleotide
sequences of these genes are highly conserved among high virulence
(hv) and low virulence (lv) isolates (see Experiment III of U.S.
application Ser. No. 08/301,435). However, ORF 5 in PRRSV isolates
appears to be less conserved among high replication (hr) and low
replication (lr) isolates. Therefore, it is believed that the
presence of an ORF 5 from an hr PRRSV isolate in the present
polynucleic acid will enhance the production and expression of a
recombinant vaccine produced from the polynucleic acid.
[0132] Furthermore, ORF 5 of PRRSV contains three hydrophilic,
hypervariable regions typically associated with antigenicity in a
polypeptide. Thus, the present invention also encompasses
polynucleotides encoding a polypeptide comprising one or more
hypervariable regions of a PRRSV ORF 5, preferably a polypeptide of
the formula a-b-c-d-e-f-g, where: [0133] a is an amino group, a
poly(amino acid) corresponding to positions 1-31 of a protein
encoded by a PRSSV ORF 5, or a fragment of such a poly(amino acid)
which does not adversely affect the antigenicity of the
polypeptide; [0134] b is an amino acid sequence selected from the
group consisting of those sequences listed under Hypervariable
Region No. 1 in Table 1 above, [0135] c is an amino acid sequence
corresponding to positions 39-56 of a protein encoded by a PRSSV
ORF 5 (preferably a sequence of the formula LQLIYNLTLCELNGTDWL, in
which one or more [preferably 1-10] amino acids may be
conservatively substituted), [0136] d is an amino acid sequence
selected from the group consisting of those sequences listed under
Hypervariable Region No. 2 in Table 1 above, [0137] e is an amino
acid sequence corresponding to positions 67-119 of a protein
encoded by a PRRSV ORF 5, in which one or more (preferably 1-20,
and more preferably 1-10) amino acid residues may be conservatively
substituted and which does not adversely affect the antigenicity of
the polypeptide, [0138] f is an amino acid sequence selected from
the group consisting of those sequences listed under Hypervariable
Region No. 3 in the Table above, and [0139] g is a carboxy group (a
group of the formula --COOH), an amino acid sequence corresponding
to positions 129-200 of a protein encoded by a PRSSV ORF 5 or a
fragment thereof which does not adversely affect the antigenicity
of the polypeptide.
[0140] Accordingly, it is preferred that the present polynucleic
acid, when used for immunoprotective purposes (e.g., in the
preparation of a vaccine), contain at least one copy of ORF 5 from
a high-replication isolate (i.e., an isolate which grows to a titer
of 10.sup.6-10.sup.7 TCID.sub.50 in, for example, CRL 11171 cells;
also see the discussions in Experiments VIII-XI U.S. application
Ser. No. 08/301,435).
[0141] On the other hand, the lv isolate VR 2431 appears to be a
deletion mutant, relative to hv isolates (see Experiments III and
VIII-XI U.S. application Ser. No. 08/301,435). The deletion appears
to be in ORF 4, based on Northern blot analysis. Accordingly, when
used for immunoprotective purposes, the present polynucleic acid
preferably does not contain a region of ORF 4 from an hv isolate
responsible for high virulence, and more preferably, excludes the
region of ORF 4 which does not overlap with the adjacent ORF's 3
and 5.
[0142] It is also known (at least for PRRSV) that neither the
nucleocapsid protein nor antibodies thereto confer immunological
protection against PRRSV to pigs. Accordingly, the present
polynucleic acid, when used for immunoprotective purposes, contains
one or more copies of one or more regions from ORF's 2, 3, 4, 5 and
6 of a PRRSV isolate encoding an antigenic region of the viral
envelope protein, but which does not result in the symptoms or
histopathological changes associated with PRRS when administered to
a pig. Preferably, this region is immunologically cross-reactive
with antibodies to envelope proteins of other PRRSV isolates.
[0143] Similarly, the protein encoded by the present polynucleic
acid confers protection against PRRS to a pig administered a
composition comprising the protein, and antibodies to this protein
are immunologically cross-reactive with the envelope proteins of
other PRRSV isolates. More preferably, the present polynucleic acid
encodes the entire envelope protein of a PRRSV isolate or a protein
at least 80% homologous thereto and in which non-homologous
residues are conservatively substituted, or alternatively a protein
at least 98% homologous thereto. Most preferably, the present
polynucleotide is one of the sequences shown in FIG. 1,
encompassing at least one of the open reading frames recited
therein.
[0144] Relatively short segments of polynucleic acid (about 20 bp
or longer) in the genome of a virus can be used to screen or
identify tissue and/or biological fluid samples from infected
animals, and/or to identify related viruses, by methods described
herein and known to those of ordinary skill in the fields of
veterinary and viral diagnostics and veterinary medicine.
Accordingly, a further aspect of the present invention encompasses
an isolated (and if desired, purified) polynucleic acid consisting
essentially of a fragment of from 15 to 2000 bp, preferably from 18
to 1000 bp, and more preferably from 21 to 100 bp in length,
derived from ORF's 2-7 of a PRRSV genome (preferably the Iowa
strain of PRRSV). Particularly preferably, the present isolated
polynucleic acid fragments are obtained from a terminus of one or
more of ORF's 2-7 of the genome of the Iowa strain of PRRSV, and
most preferably, are selected from the group consisting of the
primers described in Experiments 1 and 2 below and SEQ ID NOS:1-12,
22 and 28-34 of U.S. application Ser. No. 08/301,435.
[0145] The present invention also concerns a diagnostic kit for
assaying a porcine reproductive and respiratory syndrome virus,
comprising (a) a first primer comprising a polynucleotide having a
sequence of from 10 to 50 nucleotides in length which hybridizes to
a genomic polynucleic acid from an Iowa strain of porcine
reproductive and respiratory syndrome virus at a temperature of
from 25 to 75.degree. C., (b) a second primer comprising a
polynucleotide having a sequence of from 10 to 50 nucleotides in
length, said sequence of said second primer being found in said
genomic polynucleic acid from said Iowa strain of porcine
reproductive and respiratory syndrome virus and being downstream
from the sequence to which the first primer hybridizes, and (c) a
reagent which enables detection of an amplified polynucleic acid.
Preferably, the reagent is an intercalating dye, the fluorescent
properties of which change upon intercalation into double-stranded
DNA.
[0146] The present isolated polynucleic acid fragments can be
obtained by: (i) digestion of the cDNA corresponding to
(complementary to) the viral polynucleic acids with one or more
appropriate restriction enzymes, (ii) amplification by PCR (using
appropriate primers complimentary to the 5' and 3'-terminal regions
of the desired ORF(s) or to regions upstream of the 5'-terminus or
downstream from the 3'-terminus) and cloning, or (iii) synthesis
using a commercially available automated polynucleotide
synthesizer.
[0147] Another embodiment of the present invention concerns one or
more proteins or antigenic fragments thereof from a PRRS virus,
preferably from the Iowa strain of PRRSV. As described above, an
antigenic fragment of a protein from a PRRS virus (preferably from
the Iowa strain of PRRSV) is at least 5 amino acids in length,
particularly preferably at least 10 amino acids in length, and
provides or stimulates an immunologically protective response in a
pig administered a composition containing the antigenic
fragment.
[0148] Methods of determining the antigenic portion of a protein
are known to those of ordinary skill in the art (see the
description above). In addition, one may also determine an
essential antigenic fragment of a protein by first showing that the
full-length protein is antigenic in a host animal (e.g., a pig). If
the protein is still antigenic in the presence of an antibody which
specifically binds to a particular region or sequence of the
protein, then that region or sequence may be non-essential for
immunoprotection. On the other hand, if the protein is no longer
antigenic in the presence of an antibody which specifically binds
to a particular region or sequence of the protein, then that region
or sequence is considered to be essential for antigenicity.
[0149] Three hypervariable regions in ORF 5 of PRRSV have been
identified by comparing the amino acid sequences of the ORF 5
product of all available PRRSV isolates (see, for example, FIG.
2D). Amino acid variations in these three regions are significant,
and are not structurally conserved (FIG. 2D). All three
hypervariable regions are hydrophilic and antigenic. Thus, these
regions are likely to be exposed to the viral membrane and thus be
under host immune selection pressure.
[0150] The present invention also concerns a protein or antigenic
fragment thereof encoded by one or more of the polynucleic acids
defined above, and preferably by one or more of the ORF's of a
PRRSV, more preferably of the Iowa strain of PRRSV. The present
proteins and antigenic fragments are useful in immunizing pigs
against PRRSV, in serological tests for screening pigs for exposure
to or infection by PRRSV (particularly the Iowa strain of PRRSV),
etc.
[0151] For example, the present protein may be selected from the
group consisting of the proteins encoded by ORF's 2-7 of VR 2385,
ISU-22 (VR 2429), ISU-55 (VR 2430), ISU-1894, ISU-79 (VR 2474) and
ISU-3927 (VR 2431) (e.g., one or more of the sequences shown in
FIG. 2 and/or SEQ ID NOS:15, 17, 19, 43, 45, 47, 49, 51, 53, 55,
57, 59, 61, 67, 69 and 71 of U.S. application Ser. No. 08/301,435);
antigenic regions of at least one of these proteins having a length
of from 5 amino acids to less than the full length of the protein;
polypeptides having the minimum homology with the protein encoded
by the PRSSV ORF indicated in Table 2 above; and polypeptides at
least 97% homologous with a protein encoded by one of the ORF's 6-7
of VR 2385, VR 2429, VR 2430, ISU-1894, ISU-79 and VR 2431 (e.g.,
SEQ ID NOS:17, 19, 43, 45, 47, 49, 51, 53, 55, 57, 59 and 61 of
U.S. application Ser. No. 08/301,435). Preferably, the present
protein has a sequence encoded by an ORF selected from the group
consisting of ORFs 2-5 of VR 2385, VR 2428, VR 2429, VR 2430, VR
2431, VR 2474 and ISU-1894 (see, for example, FIG. 2A-D); variants
thereof which provide effective immunological protection to a pig
administered the same and in which from 1 to 100 (preferably from 1
to 50 and more preferably from 1 to 25) deletions or conservative
substitutions in the amino acid sequence exist; and antigenic
fragments thereof at least 5 and preferably at least 10 amino acids
in length which provide effective immunological protection to a pig
administered the same.
[0152] More preferably, the present protein variant or protein
fragment has a binding affinity (or association constant) of at
least 1% and preferably at least 10% of the binding affinity of the
corresponding full-length, naturally-occurring protein to a
monoclonal antibody which specifically binds to the full-length,
naturally-occurring protein (i.e., the protein encoded by a PRRSV
ORF).
[0153] The present invention also concerns a method of producing a
polypeptide, comprising expressing the present polynucleic acid in
an operational expression system, and purifying the expressed
polypeptide from the expression system. Suitable expression systems
include those conventionally used for either in vitro or in vivo
expression of proteins and polypeptides, such as a rabbit
reticulocyte system for in vitro expression, and for in vivo
expression, a modified or chimeric PRRSV (used to infect an
infectable host cell line, such as MA-104, CRL 11171, PSP-36,
PSP-36-SAH, MARC-145 and porcine alveolar macrophages), or a
conventional expression vector containing the present polynucleic
acid, under the operational control of a known promoter (e.g., a
thymidine kinase promoter, SV40, etc.) for use in conventional
expression systems (e.g., bacterial plasmids and corresponding host
bacteria, yeast expression systems and corresponding host yeasts,
etc.). The expressed polypeptide or protein is then purified or
isolated from the expression system by conventional purification
and/or isolation methods.
[0154] Other features of the invention will become apparent in the
course of the following descriptions of exemplary embodiments,
which are given for illustration of the invention, and are not
intended to be limiting thereof.
EXAMPLE 1
Summary:
[0155] The sequences of ORFs 2 to 5 of one low virulence, one
"moderate" virulence and one high virulence U.S. PRRSV isolate have
been determined and analyzed. Comparisons with known sequences of
other PRRSV isolates show that considerable sequence variations at
both nucleotide and amino acid levels exist in ORFs 2 to 5 of seven
U.S. isolates with differing virulence. However, ORFs 6 and 7 of
these seven U.S. isolates are highly conserved (U.S. application
Ser. No. 08/301,435). Extensive sequence variations were also found
in ORFs 2 to 7 between the European LV and the U.S. isolates. The
least virulent U.S. PRRSV isolate known (ISU-3927) displayed the
most sequence variation, in comparison with other U.S.
isolates.
[0156] The phylogenetic relationship of the U.S. isolates was also
analyzed. Phylogenetic analysis of the ORFs 2 to 7 of the U.S.
isolates indicated that there are at least three groups of PRRSV
variants (or minor genotypes) within the major U.S. PRRSV genotype.
Consequently, it is highly likely that a number of additional major
or minor genotypes will be identified as more virus isolates from
different geographic regions are examined.
[0157] Interestingly, the least virulent U.S. isolate known (ISU
3927) forms a branch distinct from other U.S. isolates. Analysis of
the nucleotide and amino acid sequences also showed that the
isolate ISU 3927 exhibits the most variations in ORFs 2 to 4,
relative to other U.S. isolates. Many of these variations in
isolate ISU 3927 result in non-conserved amino acid substitutions.
However, these non-conserved changes in isolate ISU 3927, as
compared to other U.S. isolates, do not appear to be limited to a
particular region; they are present throughout ORFs 2 to 4.
Therefore, a specific correlation between sequence variations and
viral virulence is not yet fully elucidated (although certain
positions in ORF 3 appear to be possibly related to virulence; see
FIG. 2B, positions 30, 48, 54-56, 134, 140, 143, 147, 153, 206, and
215; amino acids at one or more of these positions may serve as a
basis for mutating other known proteins encoded by a PRRSV ORF
3).
Results:
[0158] The amino acid sequence identity between seven U.S. PRRSV
isolates was 91-99% in ORF 2, 86-98% in ORF 3, 92-99% in ORF 4 and
88-97% in ORF 5. The least virulent U.S. isolate known has higher
sequence variations in the ORFs 2 to 4 than in ORFs 5 to 7, as
compared to other U.S. isolates. Three hypervariable regions with
antigenic potential were identified in the major envelope
glycoprotein encoded by ORF 5.
[0159] Pairwise comparison of the sequences of ORFs 2 to 7 and
phylogenetic tree analysis implied the existence of at least three
groups of PRRSV variants (or minor genotypes) within the major
genotype of U.S. PRRSV. The least virulent U.S. isolate known forms
a distinct branch from other U.S. isolates with differing
virulence. The results of this study have implications for the
taxonomy of PRRSV and vaccine development.
[0160] FIG. 1 shows a nucleotide sequence comparison of ORFs 2 to 5
of U.S. isolates ISU 3927, ISU 22 and ISU 55 with other known PRRSV
isolates. The nucleotide sequence of VR 2385 is shown on top, and
only differences are indicated. The start codon of each ORF is
indicated by +>, and the termination codon of each ORF is
indicated by asterisks (*). The leader-mRNA junction sequences for
subgenomic mRNAs 3, 4 and 3-1 are underlined, and the locations of
the junction sequences relative to the start codon of each ORF are
indicated by minus (-) numbers of nucleotides upstream of each ORF.
The sequences of VR 2385 (U.S. application Ser. Nos. 08/131,625 and
08/301,435), VR 2332, ISU 79 and ISU 1894 (U.S. application Ser.
No. 08/301,435) used in this alignment were previously
reported.
Materials and Methods:
[0161] Cells and Viruses:
[0162] The ATCC CRL 11171 cell line was used to propagate the
PRRSV. The cells were grown in Dulbecco's minimal essential medium
(DMEM) supplemented with 10% fetal bovine serum (FBS) and 1.times.
antibiotics (penicillin G 10,000 unit/ml, streptomycin 10,000 mg/ml
and amphotericin B 25 mg/ml).
[0163] Three U.S. isolates of PRRSV used in this study, designated
as ISU 22, ISU 55 and ISU 3927, were isolated from pig lungs
obtained from different farms in Iowa during PRRS outbreaks. All
three isolates were plaque-purified three times on CRL 11171 cells
before further experimentation. Comparative pathogenicity studies
showed that isolate ISU 3927 is the least virulent isolate among 10
different U.S. PRRSV isolates. Isolate ISU 22 is a high virulence
isolate and isolate ISU 55 is "moderately" pathogenic. All of the
three virus isolates used in this experiment were at seventh
passage.
[0164] Isolation of PRRSV Intracellular RNAs:
[0165] Confluent monolayers of CRL 11171 cells were infected with
the three U.S. isolates of PRRSV, ISU 22, ISU 55 and ISU 3927,
respectively, at a multiplicity of infection (m.o.i.) of 0.1. At 24
hrs. postinfection, the infected cells were washed three times with
cold PBS buffer. The total intracellular RNAs were then isolated by
guanidinium isothiocyanate and phenol-chloroform extraction
(Stratagene). The presence of virus-specific RNA species in the RNA
preparation was confirmed by Northern blot hybridization (data not
shown). The total intracellular RNAs were quantified
spectrophotometrically.
[0166] Reverse Transcription and Polymerase Chain Reaction
(RT-PCR):
[0167] First strand complementary (c) DNA was synthesized from the
total intracellular RNAs by reverse transcription using random
primers as described previously (Meng et al., 1993, J. Vet. Diagn.
Invest., 5:254-258). For amplification of the entire protein coding
regions of the ORFs 2 to 5 of the three isolates of PRRSV, two sets
of primers were designed on the basis of the sequences of VR 2385
and LV. Primers JM259 (5'-GGGGATCCTTTTGTGGAGCCGT-3') and JM260
(5'-GGGGAATTCGGGATAGGGAATGTG-3') amplified the sequence of ORFs 4
and 5, and primers XM992 (5'-GGGGGATCCTGTTGG-TAATAG(A)GTCTG-31 and
XM993 (5'-GGTGAATTCGTTTTATTTCCCTCCGGGC-3') amplified the sequence
of ORFs 2 and 3. Unique restriction sites (EcoRI or BamHI) at the
5' end of these primers were introduced to facilitate cloning. A
degenerate base, G (A), was synthesized in primer XM 992 based on
the sequences of VR 2385 and LV (Meulenberg et al., 1993; U.S.
application Ser. No. 08/301,435). PCR was performed as described
previously (Meng et al., 1993, J. Vet. Diagn. Invest.,
5:254-258).
[0168] Cloning and Nucleotide Sequencing:
[0169] The RT-PCR products were analyzed by a 0.8% agarose gel
electrophoresis. The two PCR fragments representing ORFs 2 and 3 as
well as ORFs 4 and 5, respectively, were purified by the glassmilk
procedure (GENECLEAN kit, BIO 101, Inc.). The purified fragments
were each digested with BamHI and EcoRI, and cloned into the vector
pSK+ as described previously (Meng et al., 1993). The E. Coli DH
5.alpha. cells were used for transformation of recombinant
plasmids. White colonies were selected and grown in LB broth
containing 100 mg/ml ampicillin. The E. Coli cells containing
recombinant plasmid were lysed with lysozyme, and the plasmids were
then isolated by using the Qiagen column (QIAGEN Inc.).
[0170] Plasmids containing viral inserts were sequenced with an
automated DNA Sequencer (Applied Biosystem, Inc.). Three or more
independent CDNA clones representing the entire sequence of ORFs 2
to 5 from each of the three PRRSV isolates were sequenced with
universal and reverse primers. Several virus-specific primers,
XM969 (5'-GATAGAGTCTGCCCTTAG-3'), XM970 (5'-GGTTTCACCTAGAATGGC-3'),
XM1006 (5'-GCTTCTGAGATGAGTGA-3'), XM077 (5'-CAACCAGGCGTAAACACT-3')
and XM078 (5'-CTGAGCAATT ACAGAAG-3'), were also used to determine
the sequence of ORFs 2 to 5.
[0171] Sequence Analyses:
[0172] Sequence data were combined and analyzed by using MacVector
(International Biotechnologies, Inc.) and GeneWorks
(IntelliGenetics, Inc.) computer software programs. Phylogenetic
analyses were performed using the PAUP software package version
3.1.1 (David L. Swofford, Illinois Natural History Survey,
Champaign, Ill.). PAUP employs the maximum parsimony algorithm to
construct phylogenetic trees.
Results:
[0173] Nucleotide Sequence Analyses of ORFs 2 to 5:
[0174] The sequences of ORFs 2 to 5 of five PRRSV isolates, ISU 79,
ISU 1894, ISU 22, ISU 55 and ISU 3927, were determined and compared
with other known PRRSV isolates including VR 2385, VR 2332 and LV
(Meulenberg et al., 1993). The sequences of ORFs 6 and 7 of
isolates VR 2385, ISU 22, ISU 55, ISU 79, ISU 1894 and ISU 3927
were reported previously (U.S. application Ser. No. 08/301,435).
The isolates used in this experiment have been shown to differ in
pneumovirulence in experimentally-infected pigs (U.S. application
Ser. Nos. 08/131,625 and 08/301,435). ISU 3927 is the least
virulent isolate among ten different U.S. PRRSV isolates (U.S.
application Ser. No. 08/131,625 and U.S. application Ser. No.
08/301,435).
[0175] Like other U.S. PRRSV isolates, ORFs 2 to 4 of these
isolates overlapped each other (FIG. 1). However, unlike LV, ORFs 4
and 5 of the U.S. isolates are separated by 10 nucleotides (FIG.
1). ORFs 4 and 5 of LV overlapped by one nucleotide. The single
nucleotide substitution from A of the start codon of ORF 5 in LV to
T in the U.S. isolates places the start codon of ORF 5 of the U.S.
isolates 10 nucleotides downstream of the ORF 4 stop codon.
Therefore, a 10-nucleotide noncoding sequence appears between ORFs
4 and 5 of the known U.S. isolates (FIG. 1).
[0176] ORF 2 of ISU 79 is 3 nucleotides shorter than other U.S.
isolates. The single nucleotide substitution from TGG to TAG just
before the stop codon of ORF 2 creates a new stop codon in ISU 79
(FIG. 1). A 3-nucleotide deletion was also found in ORF 5 of ISU
3927, compared to other U.S. isolates (FIG. 1). The size of ORFs 2
to 5 of all the U.S. isolates are identical, except for the ORF 2
of ISU 79 and ORF 5 of ISU 3927, both of which are 3 nucleotides
shorter than the other ORFs (FIG. 1).
[0177] Sequence comparisons of ORFs 2 to 5 of the seven U.S. PRRSV
isolates shown in FIG. 1 indicate that there are considerable
nucleotide sequence variations in ORFs 2 to 5 of the U.S. isolates
(FIG. 1). The nucleotide sequence identity was 96-98% in ORF 2,
92-98% in ORF 3, 92-99% in ORF 4, and 90-98% in ORF 5 between VR
2385, VR 2332, ISU 22, ISU 55, ISU 79, and ISU 1894 (Table 3).
[0178] The least virulent isolate ISU 3927 has the most variations
among the seven U.S. isolates (FIG. 1 and Table 3). The nucleotide
sequence identity between ISU 3927 and other U.S. isolates was
93-94% in ORF 2, 89-90% in ORF 3, and 91-93% in ORF 4 (Table 3).
Like ORFs 6 and 7 (U.S. application Ser. No. 08/301,435), ORF 5 of
ISU 3927 has no significant changes except for a 3-nucleotide
deletion (FIG. 1). ORF 5 of ISU 3927 shares 91-93% nucleotide
sequence identity with the ORF 5 of other U.S. isolates (Table
3).
[0179] However, extensive sequence variation was found in ORFs 2 to
5 between LV and the U.S. isolates (FIG. 1 and Table 3). The
nucleotide sequence identity between LV and the U.S. isolates was
65-67% in ORF 2, 61-64% in ORF 3, 63-66% in ORF 4, and 61-63% in
ORF 5 (Table 3). Extensive genetic variations in ORFs 6 and 7
between LV and U.S. PRRSV also exists (U.S. application Ser. Nos.
08/131,625 and 08/301,435). These results indicate that the least
virulent isolate ISU 3927 is also the most distantly related of the
U.S. isolates, with genetic variations occurring mostly in ORFs 2
to 4.
[0180] The single nucleotide substitution from TGG to TAG before
the stop codon in ORF 2 observed in ISU 79 was also present in
isolates ISU 55 and ISU 3927, both of which produce seven sg mRNAs,
but not in isolates ISU 22, ISU 1894 or VR 2385, which each
synthesize only six sg mRNAs (U.S. application Ser. Nos. 08/131,625
and 08/301,435). The results indicate that the leader-mRNA 3-1
junction sequence of ISU 55 and ISU 3927 is very likely to be the
same as ISU 79 (FIG. 1).
[0181] The leader-mRNA junction sequences for sg mRNAs 3 and 4 of
ISU 79 and ISU 1894 were determined to be GUAACC at 89 nucleotides
upstream of ORF 3 for sg mRNA 3, and UUCACC at 10 nucleotides
upstream of ORF 4 for sg mRNA 4 (U.S. application Ser. No.
08/301,435; see also Experiment 2 below). A sequence comparison of
isolates ISU 22, ISU 55 and ISU 3927 with isolates VR 2385, ISU 79
and ISU 1894 indicates that the leader-mRNA junction sequences for
sg mRNAs 3 and 4 are conserved among the U.S. isolates (FIG.
1).
Analysis of the Deduced Amino Acid Sequences Encoded by ORFs 2 to
5:
[0182] FIG. 2 shows the alignment of the deduced amino acid
sequences of ORF 2 (A), ORF 3 (B), ORF 4 (C) and ORF 5 (D) of U.S.
isolates ISU 22, ISU 55 and ISU 3927 with other known PRRSV
isolates. The sequence of VR 2385 is shown on top, and only
differences are indicated. Deletions are indicated by [0183] (-).
The proposed signal peptide sequence in the ORF 5 of LV (D) is
underlined (Meulenberg et al., 1995). Three hypervariable regions
with antigenic potentials in ORF 5 (D) were indicated by asterisks
(*). The published sequences used in this alignment were LV
(Meulenberg et al., 1993), VR 2385 (U.S. application Ser. Nos.
08/131,625 and 08/301,435), VR 2332, ISU 79 and ISU 1894 (U.S.
application Ser. No. 08/301,435).
[0184] On the basis of its high content of basic amino acids and
its hydrophilic nature, the translation product of ORF 7 is
predicted to be the nucleocapsid protein (U.S. application Ser.
Nos. 08/131,625 and 08/301,435; Meulenberg et al., 1993; Conzelmann
et al., 1993; Mardassi et al., 1994). The ORF 6 product lacks a
potential amino-terminal signal sequence and contains several
hydrophobic regions which may represent the potential transmembrane
fragments. Therefore, the ORF 6 product was predicted to be the M
protein (U.S. application Ser. Nos. 08/131,625 and 08/301,435;
Meulenberg et al., 1993; Conzelmann et al., 1993).
[0185] Computer analysis shows that the products encoded by ORFs 2
to 5 of the U.S. isolates all have hydropathy characteristics
reminiscent of membrane-associated proteins. The translation
products of ORFs 2 to 5 each contain a hydrophobic amino terminus.
The N-terminal hydrophobic sequences may function as a signal
sequence for each of these ORFs, and they may be involved in the
transportation of ORFs 2 to 5 to the endoplasmic reticulum of
infected cells. At least one additional hydrophobic domain in each
of ORFs 2 to 5 was found at the carboxy termini. These additional
hydrophobic domains may function as membrane anchors.
[0186] The deduced amino acid sequences of ORFs 2 to 5 of the seven
U.S. isolates examined also varied considerably (FIG. 2),
indicating that most of the nucleotide differences observed in FIG.
1 are not silent mutations. The amino acid sequence identity
between VR 2385, VR 2332, ISU 22, ISU 55, ISU 79, and ISU 1894 was
95-99% in ORF 2, 90-98% in ORF 3, 94-98% in ORF 4, and 88-97% in
ORF 5 (Table 3).
[0187] Again, the least virulent isolate ISU 3927 displayed more
variations with other U.S. isolates in ORFs 2 to 4 (FIG. 2 and
Table 3) than in ORFs 5 to 7 (U.S. application Ser. No. 08/301,435
and Table 3). ORFs 2 to 5 of LV share only 57-61%, 55-56%, 65-67%,
and 51-55% amino acid sequence identity with those ORFs of the U.S.
isolates, respectively (Table 3). Deletions or insertions were
found throughout ORFs 2 to 5 in comparing European LV and U.S.
isolates (FIG. 2).
[0188] Sequence comparison of the ORF 5 product showed that the
N-terminal region of ORF 5 is extremely variable, both (a) between
U.S. isolates and LV and also (b) among the various U.S. isolates
(FIG. 2D). In LV, the first 32-33 amino acid residues of ORF 5 may
represent the signal sequence (Meulenberg et al., 1995; FIG. 2D).
Therefore, the potential signal sequence of ORF 5 in all the PRRSV
isolates is very heterogeneous. This heterogeneity is not due to
any host immune selection pressure, because the signal peptide will
be cleaved out and not be present in mature virions.
[0189] Three additional hypervariable regions were also identified
by comparing the amino acid sequences of ORF 5 of all the PRRSV
isolates available (FIG. 2D). Amino acid variations in these three
regions are significant, and are not structurally conserved (FIG.
2D). Computer analysis indicates that all three hypervariable
regions are hydrophilic and antigenic. Thus, it is likely that
these regions are exposed to the viral membrane and are under host
immune selection pressure. However, further experiments may be
necessary to confirm the specific functions of these hypervariable
regions as antigenic determinants in the ORF 5 envelope
protein.
The Phylogenetic Relationships Among U.S. Isolates of PRRSV:
[0190] It has been shown previously that U.S. PRRSV and European
PRRSV represent two distinct genotypes, based on analysis of the M
and N genes (U.S. application Ser. No. 08/301,435). To determine
the phylogenetic relationships of U.S. PRRSV isolates, ORFs 2 to 7
of the seven U.S. PRRSV isolates shown in FIGS. 1 and 2 were first
aligned with the GeneWorks program (intelligenetics, Inc.). The
PAUP program (David L. Swofford, Illinois Natural History Survey,
Champaign, Ill.) was then used to construct phylogenetic tree
illustrating relationship among U.S. isolates of PRRSV.
[0191] The phylogenetic tree of FIG. 3 was constructed by maximum
parsimony methods with the aid of the PAUP software package version
3.1.1. The branch with the shortest length (most parsimonious) was
found by implementing the exhaustive search option. The branch
lengths (numbers of amino acid substitutions) are given above each
branch. The sequences used in the analysis are LV, VR 2385, VR
2332, ISU 79 and ISU 1894.
[0192] The phylogenetic tree indicates that at least three groups
of variants (or minor genotypes) exist within the major U.S. PRRSV
genotype. The least virulent U.S. PRRSV isolate ISU 3927 forms a
branch distinct from other U.S. isolates (FIG. 3). Isolates ISU 22,
ISU 79, ISU 1894, and VR 2332 form another branch, representing a
second minor genotype. The third minor genotype is represented by
isolates ISU 79 and VR 2385 (FIG. 3). A very similar tree was also
obtained by analyzing the last 60 nucleotides of ORF 1b of the
seven U.S. isolates presented in FIG. 1 (data not shown). Identical
tree topology was also produced by the unweighted pair-group method
with arithmetic mean (UPGMA) using the GeneWorks program (data not
shown).
[0193] In summary, the different genotypes of PRRSV have been
confirmed and further elucidated. At least three minor genotypes
within the major genotype of U.S. PRRSV have been identified, based
on an analysis of the sequence of ORFs-2 to 7. Genetic variations
not only between the European PRRSV and the U.S. PRRSV but among
the U.S. PRRSV isolates have also been further confirmed as well,
indicating the heterogeneous nature of PRRSV. The least virulent
U.S. PRRSV isolate ISU 3927 has unexpectedly high sequence
variations in ORFs 2 to 4, as compared to other U.S. isolates.
TABLE-US-00004 TABLE 3 Nucleotide and deduced amino acid sequence
identities (%) of ORFs 2 to 5 of PRRSV ORF 2 VR2385 ISU22 ISU55
ISU79 ISU1894 ISU3927 VR2332 LV VR2385 ** 97 96 96 95 91 98 58
ISU22 97 ** 96 98 96 93 99 59 ISU55 98 97 ** 96 95 91 97 61 ISU79
96 97 97 ** 96 91 98 60 ISU1894 96 97 96 96 ** 93 96 57 ISU3927 94
94 94 93 93 ** 93 58 VR2332 97 98 97 98 97 94 ** 59 LV 65 66 66 67
66 65 66 ** ORF 3 VR2385 ** 91 94 92 90 87 91 55 ISU22 92 ** 93 96
96 88 98 56 ISU55 94 93 ** 94 93 87 94 56 ISU79 94 96 94 ** 95 87
96 56 ISU1894 92 97 93 96 ** 86 96 55 ISU3927 90 90 89 90 90 ** 87
55 VR2332 93 98 94 97 97 90 ** 56 LV 64 63 62 63 63 61 63 ** ORF 4
VR2385 ** 94 96 94 95 83 94 66 ISU22 93 ** 94 97 99 93 98 66 ISU55
96 94 ** 96 96 93 95 67 ISU79 93 97 94 ** 98 92 96 66 ISU1894 92 98
94 96 ** 93 98 66 ISU3927 91 93 92 91 91 ** 92 67 VR2332 94 99 95
97 98 92 ** 65 LV 66 66 63 65 66 65 65 ** ORF 5 VR2385 ** 90 91 88
89 91 89 54 ISU22 93 ** 90 94 96 92 97 52 ISU55 94 92 ** 89 89 90
89 51 ISU79 91 95 91 ** 95 89 94 53 ISU1894 92 97 90 94 ** 91 96 53
ISU3927 91 93 91 91 91 ** 91 55 VR2332 93 98 91 95 97 92 ** 53 LV
63 63 63 61 62 63 63 ** Note: The amino acid sequence comparisons
are presented in the upper right half, and the nucleotide sequence
comparisons are presented in the lower left half.
EXAMPLE 2
[0194] During the replication of PRRSV, six subgenomic mRNAs (sg
mRNAs), in addition to the genomic RNA, are synthesized. These sg
mRNAs were characterized in this experiment.
[0195] The sg mRNAs of PRRSV form a 3'-coterminal nested set in
PRRSV-infected cells. Each of these sg mRNAs is polycistronic and
contains multiple open reading frames, except for sg mRNA 7 (as
shown by Northern blot analysis using ORF-specific probes). The sg
mRNAs were not packaged into virions, and only the genomic RNA was
detected in purified virions, suggesting that the encapsidation
signal of PRRSV is likely localized in the ORF 1 region.
[0196] The numbers of sg mRNAs in PRRSV-infected cells varies among
PRRSV isolates with differing virulence. An additional species of
sg mRNA in some PRRSV isolates was shown in Experiment 1 above to
be derived from the sequence upstream of ORF 4, and has been
designated as sg mRNA 3-1.
[0197] The leader-mRNA junction sequences of sg mRNAs 3 and 4 of
isolates ISU 79 and ISU 1894, as well as sg mRNA 3-1 of the isolate
ISU 79, contain a common six nucleotide sequence motif,
T(G)TA(G/C)ACC. Sequence analysis of the genomic RNA of these two
U.S. isolates and comparison with Lelystad virus (LV) revealed
heterogeneity of the leader-mRNA junction sequences among PRRSV
isolates. The numbers, locations and the sequences of the
leader-mRNA junction regions varied between U.S. isolates and LV,
as well as among U.S. isolates. The last three nucleotides, ACC, of
the leader-mRNA junction sequences are invariable. Variations were
found in the first three nucleotides.
[0198] By comparing the 5'-terminal sequence of sg mRNA 3-1 with
the genomic sequence of ISU 79 and ISU 1894, it was found that a
single nucleotide substitution, from T in ISU 1894 to C in ISU 79,
led to a new leader-mRNA junction sequence in ISU 79, and
therefore, an additional species of sg mRNA (sg mRNA 3-1). A small
ORF, designated as ORF 3-1, with a coding capacity of 45 amino
acids was identified at the 5'-end of sg mRNA 3-1.
Materials and Methods
[0199] Viruses and cells. The PRRSV isolates used (ISU 22, ISU 55,
ISU 79, ISU 1894 and ISU 3927) were isolated from pig lungs
obtained from different farms in Iowa. A continuous cell line, ATCC
CRL 11171, was used for isolation and growth (culturing) of
viruses. These PRRSV isolates were biologically cloned by three
rounds of plaque purification and grown on the CRL 11171 cells. All
of the virus isolates used in this study were at the seventh
passage.
[0200] ISU 22 and ISU 79 are highly pathogenic and produce from 50
to 80% consolidation of the lung tissues in experimentally-infected
five-week-old caesarean-derived colostrum-deprived pigs necropsied
at 10 days post-inoculation. By contrast, ISU 55, ISU 1894 and ISU
3927 are of low pathogenicity and produce only 10 to 25%
consolidation of lung tissues in the same experiment (U.S.
application Ser. Nos. 08/131,625 and 08/301,435).
[0201] Preparation of virus-specific total intracellular RNAs, poly
(A).sup.+ RNA and virion RNA. Confluent monolayers of CRL 11171
cells were infected with different isolates of PRRSV at the seventh
passage at a multiplicity of infection (m.o.i.) of 0.1.
PRRSV-specific total intracellular RNAs were isolated from
PRRSV-infected cells by a conventional guanidinium isothiocyanate
method (Stratagene). The poly (A).sup.+ RNA was enriched from the
total intracellular RNAs by oligo (dT)-cellulose column
chromatography (Invitrogen).
[0202] For isolation of PRRSV virion RNA, confluent CRL 11171 cells
were infected with isolate ISU 3927 of PRRSV at a m.o.i. of 0.1.
When more than 70% of the infected cells showed a cytopathic
effect, the cultures were frozen and thawed three times, and the
culture medium was clarified at 1200.times.g for 20 min. at
4.degree. C. The virus was then precipitated with polyethylene
glycol and subsequently purified by cesium chloride gradient
centrifugation as described in U.S. application Ser. No.
08/131,625. The purified virus was treated with RNase A at a final
concentration of 20 .mu./ml for 90 min. at 37.degree. C. The virus
was then pelleted, and the virion RNA was isolated using a
conventional guanidinium isothiocyanate method.
[0203] cDNA synthesis and polymerase chain reaction. cDNA was
synthesized from total intracellular RNAs by reverse transcription
using random primers and amplified by the polymerase chain reaction
(RT-PCR) as described previously (Meng et al., 1993, J. Vet. Diagn.
Invest., 5:254-258).
[0204] Northern blot analyses. Ten .mu.g of total intracellular
RNAs from virus infected cells and mock-infected cells were used
per lane in a formaldehyde-agarose gel. For separation of poly
(A).sup.+ RNA and virion RNA, fifteen ng of virion RNA and 0.2
.mu.g of poly (A).sup.+ RNA were loaded per lane. The RNA was
denatured with formaldehyde according to a conventional method
(Sambrook et al, "Molecular Cloning: A Laboratory Manual", 2nd ed.,
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
Electrophoretic separation of RNA, RNA blotting, and hybridization
were performed as described in U.S. application Ser. No.
08/131,625. In some experiments, glyoxal-DMSO agarose gels were
also performed as described in U.S. application Ser. No.
08/131,625.
[0205] For preparation of probes, a specific cDNA fragment from
each of the ORFs lb to 7 was generated by RT-PCR with ORF-specific
primers. The primers were designed in such a way that each primer
pair amplifies only a specific fragment of a given ORF, and the
overlapping, neighboring ORFs are not included in any given cDNA
probe. The primer pairs for generating cDNA probes representing
ORFs lb through 7 are IM729/IM782 for ORF 1b, IM312/IM313 for ORF
2, XM1022/IM258 for ORF 3, XM1024/XMI 023 for ORF 4, PP287/PP286
for ORF 5, PP289/XM780 for ORF 6, and PP285/PP284 for ORF 7 (Table
4).
[0206] Cloning, sequencing and nucleotide sequence analyses.
Primers for RT-PCR were designed on the basis of PRRSV isolate VR
2385 sequences, which amplified the entire protein coding regions
of ORFs 2 to 5 of PRRSV isolates ISU 79 and ISU 1894. Primers JM259
and JM260 were used for amplification of ORFs 4 and 5, and XM992
and XM993 for amplification of ORFs 2 and 3 (Table 4). Unique
restriction sites (EcoRI and BamHI) at the termini of the PCR
products were introduced, thus enabling a cassette approach to
replacement of these ORFs.
[0207] The PCR products of ORFs 2-3 and ORFs 4-5 of ISU 79 and ISU
1984 were each digested with EcoRI and BamHI, then purified and
cloned into vector pSK+ as described previously (Meng et al., 1993,
J. Vet. Diagn. Invest., 5:254-258). Plasmids containing viral
inserts were sequenced with a conventional automated DNA sequencer
(Applied Biosystem, Inc.). At least three cDNA clones representing
the entire sequence of ORFs 2 to 5 from each virus isolate were
sequenced with universal and reverse primers, as well as other
virus-specific sequencing primers (XM969, XM970, XM1006, XM078 and
XM077; see Table 4).
[0208] To determine the leader-mRNA junction sequences of sg mRNAs
3, 4 and 3-1, primer pair IM755 and DP586 (Table 4) was used for
RT-PCR to amplify the corresponding 5'-terminal sequences. The
resulting PCR products were purified and sequenced by direct PCR
sequencing using virus specific primers XMD77 and XM141 (Table 4).
The sequences were combined and analyzed by MacVector
(International Biotechnologies, Inc.) and GeneWorks
(IntelliGenetics, Inc) computer software programs.
[0209] Oligonucleotides. The synthetic oligonucleotides used in
this study were summarized in Table 4. These oligonucleotides were
synthesized as single stranded DNA using an automated DNA
synthesizer (Applied Biosystem) and purified by high pressure
liquid chromatography (HPLC).
Results
[0210] Sg mRNAs are not packaged into PRRSV virions. To determine
whether the sg mRNAs of PRRSV are packaged, virions of PRRSV
isolate ISU 3927 were purified by CsCl gradient. The purified
virions were treated with RNase A before pelleting the virion and
extracting RNA, to remove any RNA species which may have adhered to
the virion surface. RNAs from RNase A-treated virions along with
the total intracellular RNAs from isolate ISU 3927 of
PRRSV-infected cells were separated in a formaldehyde gel and
hybridized with a probe generated from the 3'-terminal sequence of
the viral genome by PCR with primers PP284 and PP285 (U.S.
application Ser. No. 08/131,625; Table 4).
[0211] Only the genomic RNA was detected in the purified virions of
PRRSV isolate ISU 3927 (FIG. 4), and no detectable amounts of sg
mRNAs were observed in the purified virions even after 3 weeks
exposure. In contrast, seven species of sg mRNAs, in addition to
the genomic RNA, were detected in ISU 3927-infected cells (FIG. 4).
Similar results were observed with two other U.S. isolates, ISU 55
and ISU 79.
[0212] Variation in the numbers of the sg mRNAs among U.S. PRRSV
isolates with differing virulence. All arteriviruses known prior to
the present invention, including U.S. PRRSV and European PRRSV,
have been shown to produce six sg mRNAs, except for three LDV
variants (LDV-P, LDV-a and LDV-v), which synthesize seven sg mRNAs.
However, a nested set of six sg mRNAs is produced in the LDV-C
strain.
[0213] To compare if there are any variations in the sg mRNAs among
U.S. PRRSV isolates, confluent monolayers of CRL 11171 cells were
infected with five different isolates of U.S. PRRSV with differing
virulence at a m.o.i. of 0.1. Total intracellular RNAs were
isolated from virus-infected cells at 24 h post-infection. A cDNA
fragment was generated from the extreme 3'-end of the viral genome
by PCR with primers PP284 and PP285 (Table 4). The cDNA fragment
was labeled with .sup.32P-dCTP by the random primer extension
method, and hybridized with the total intracellular RNAs (separated
on a formaldehyde gel).
[0214] Analyses of the RNAs showed that a nested set of six or more
sg mRNAs, in addition to the genomic RNA, was present in cells
infected with one of the five isolates of U.S. PRRSV with differing
virulence (FIG. 5). Similar results were obtained when the total
intracellular RNAs were separated on a glyoxal-DMSO agarose gel.
PRRSV isolates ISU 55, ISU 79 and ISU 3927 produced seven easily
distinguishable sg mRNAs, whereas isolates ISU 22 and ISU 1894
produced six sg mRNAs (FIG. 5). The U.S. PRRSV isolate VR 2385 also
produces six sg mRNAs (U.S. application Ser. No. 08/131,625). An
additional species of sg mRNA was located between sg mRNAs 3 and 4,
and was designated as sg mRNA 3-1. The sg mRNAs differed little, if
any, in size among the five isolates of PRRSV (FIG. 5). There
appears to be no correlation, however, between the pneumovirulence
and the numbers of the sg mRNAs observed in these five
isolates.
[0215] Sg mRNA 3-1 is not a defective-interfering RNA and is not a
result of nonspecific binding of the probes to ribosomal RNAs. It
has been shown that, in coronaviruses, a variety of defective
interfering RNA (DI RNA) of different sizes were generated when MHV
was serially passaged in tissue culture at a high m.o.i. DI RNAs
were also observed in cells infected with torovirus during
undiluted passage. Therefore, the possibility of sg mRNA 3-1 of
PRRSV being a DI RNA was investigated.
[0216] To exclude this possibility, the original virus stock of
PRRSV isolate ISU 79, which produces the additional species of sg
mRNA 3-1, was passaged four times in CRL 11171 cells at different
m.o.i. of 0.1, 0.01 and 0.001, respectively. In a control
experiment, four undiluted passages of the original virus stock of
ISU 79 were performed. After four passages, total intracellular
RNAs were isolated from virus-infected cells and Northern blot
analysis was repeated with the same probe generated from the
extreme 3'-end of the viral genome.
[0217] Analyses of the sg mRNAs showed that the additional species
of sg mRNA 3-1 was still present in all RNA preparations with
different m.o.i., as well as in RNA preparations from undiluted
passages (FIG. 6A). Moreover, there was no interference or
reduction in the synthesis of other sg mRNAs in the presence of sg
mRNA 3-1, as is usually the case with DI RNA.
[0218] It has been demonstrated that the DI RNAs of MHV disappeared
after two high-dilution passages. Therefore, if the original virus
stock of ISU 79 contained DI RNA, then the DI RNA should disappear
after four high-dilution passages. The experimental data above
suggests that, unlike DI RNA, the replication of sg mRNA 3-1 is
independent of the amount of standard virus. Thus, sg mRNA 3-1 is
not a DI RNA.
[0219] In Northern blot analysis of total intracellular RNAS, the
probes may nonspecifically bind to the 18S and 28S ribosomal RNAs,
which are abundant in total cytoplasmic RNA preparations.
Alternatively, the abundant ribosomal RNAs may cause retardation of
virus-specific sg mRNAs which may co-migrate corrugate with the
ribosomal RNAs in the gel.
[0220] Two additional bands due to the nonspecific binding of
probes to the ribosomal RNAs have been observed in LV-infected
cells and LDV-infected cells. Therefore, it is possible that sg
mRNA 3-1 of PRRSV is due to the nonspecific binding of probes to
the ribosomal RNAs.
[0221] To rule out this possibility, polyadenylated RNA was
isolated from total intracellular RNAs of CRL 11171 cells infected
with either of two PRRSV isolates, ISU 55 and ISU 79. Both ISU 55
and ISU 79 produce the additional species of sg mRNA 3-1 (FIG. 5).
Northern blot analysis of the polyadenylated RNA showed that the
additional species of sg mRNA 3-1 in cells infected with either of
these two isolates was still present (FIG. 6B), indicating that sg
mRNA 3-1 is not due to the nonspecific binding of a probe to the
ribosomal RNAS.
[0222] The sg mRNAs represent a 3'-coterminal nested set and the sg
mRNA 3-1 is derived from the sequence upstream of ORF 4. Six sg
mRNAs, in addition to the genomic RNA, are detected in cells
infected with VR 2385 using a cDNA probe from the extreme 3'-end of
the viral genome (U.S. application Ser. No. 08/131,625). Thus, like
Berne virus (BEV), LDV, EAV, coronaviruses and LV, the replication
of U.S. PRRSV also requires the synthesis of a 3'-coterminal nested
set of sg mRNAs (U.S. application Ser. Nos. 08/131,625 and
08/301,435).
[0223] To analyze these sg mRNAs in more detail, seven cDNA
fragments specific for each of ORFs lb through 7 were amplified by
PCR. The design of primers for PCR was based on the sequence of VR
2385. The sequences and locations of the primers, IM729 and IM782
for ORF 1b, IM312 and IM313 for ORF 2, XM1022 and IM258 for ORF 3,
XM1024 and XM1023 for ORF 4, PP286 and PP287 for ORF 5, PP289 and
XM780 for ORF 6, and PP284 and PP285 for ORF 7 and the 3' noncoding
region (NCR), are shown in Table 4. The primers were designed in
such a way that each set of primers will only amplify a fragment
from a particular ORF, and the overlapping sequences between
neighboring ORFs are not included in any given fragment. Therefore,
each of these seven DNA fragments represents only one particular
ORF except for fragment 7, which represents both ORF 7 and the
3'-NCR.
[0224] These seven DNA fragments were labeled with .sup.32P-dCTP
and hybridized to Northern blots of total intracellular RNAs
extracted from cells infected with either of two U.S. isolates of
PRRSV, ISU 1894 and ISU 79. Total intracellular RNAs isolated from
mock-infected CRL 11171 cells were included as a control.
[0225] Northern blot analyses showed that Probe 1, generated from
ORF 1b, hybridized only with the genomic RNA. Probes 2 through 7
each hybridized with one more additional RNA species besides the
genomic RNA (FIG. 7). The results indicate that a 3'-coterminal
nested set of six (ISU 1894) or more (ISU 79) sg mRNAs is formed in
PRRSV-infected cells (FIGS. 7A and 7B), with the smallest
3'-terminal RNA (sg mRNA 7) encoding ORF 7. The sg mRNAs of U.S.
PRRSV all contain the 3'-end of the genomic RNA, but extend for
various distances towards the 5'-end of the genome, depending on
the size of the given sg mRNA.
[0226] The sg mRNA 3-1 of PRRSV isolate ISU 79 hybridized with
probes 4 through. 7, but not with probes 1, 2 and 3 (FIG. 7B),
suggesting that sg mRNA 3-1 contains ORFs 4 through 7 as well as
the 3'-NCR. Therefore, sg mRNA 3-1 is generated from the sequence
upstream of ORF 4.
[0227] A single nucleotide substitution leads to the acquisition of
the additional species of sg mRNA 3-1. Northern blot hybridization
data showed that sg mRNA 3-1 is derived from the sequence upstream
of ORF 4 (FIG. 7B). To determine the exact location and the
leader-mRNA junction sequence of sg mRNA 3-1, a set of primers,
IM755 and DP586, was designed (Table 4). The forward primer IM755
was based on the 3'-end of the leader sequence of VR 2385, and the
reverse primer DP586 is located in ORF 4 (Table 4).
[0228] RT-PCR with primers IM755 and DP586 was performed using
total intracellular RNAs isolated from cells infected with either
of ISU 1894 or ISU 79. ISU 79 produces sg mRNA 3-1, but ISU 1894
does not (FIG. 5). A 30-second PCR extension time was applied to
preferentially amplify the short fragments representing the
5'-terminal sequences of sg mRNAs 3, 4 and 3-1.
[0229] Analysis of the RT-PCR products showed that two fragments
with sizes of about 1.1 kb and 0.45 kb were amplified from the
total RNAs of ISU 1894 virus-infected cells (FIG. 8A). These two
fragments represent 5'-portions of sg mRNAs 3 and 4, respectively.
In addition to the two fragments observed in the isolate of ISU
1894, a third fragment of about 0.6 kb representing the 5'-portion
of sg mRNA 3-1 was also amplified from total RNAs of cells infected
with ISU 79 (FIG. 8A).
[0230] To determine the leader-mRNA junction sequences of sg mRNAs
3, 4 and 3-1, the RT-PCR products of ISU 79 and ISU 1894 were
purified from an agarose gel using a GENECLEAN kit (Bio 101, Inc.),
and sequenced directly with an automated DNA Sequencer (Applied
Biosystems). The primers used for sequencing the 5'-end of the
RT-PCR products (XM141 and XM077, Table 4) were designed on the
basis of the genomic sequences of ISU 79 and ISU 1894 (FIG. 9). The
leader-mRNA junction sequences (in which the leader joins the mRNA
body during the synthesis of sg mRNAs) of sg mRNAs 3, 4, and 3-1 of
the two U.S. PRRSV isolates were determined by comparing the
sequences of the 5'-end of the sg mRNAs and the genomic RNA of the
two isolates (FIG. 8B).
[0231] The leader-mRNA junction sequences of sg mRNAs 3 and 4 of
ISU 1894 and ISU 79 were identical. For sg mRNA 3, the
leader-junction sequence (GUAACC) is located 89 nucleotides
upstream of ORF 3. For sg mRNA 4, UUCACC is located 10 nucleotides
upstream of ORF 4 (FIG. 8B and FIG. 9). The leader-mRNA junction
sequence of sg mRNA 3-1 of ISU 79 is UUGACC, located 236
nucleotides upstream of ORF 4 (FIGS. 8B and 9).
[0232] Sequence alignment of the genomic sequences of ISU 79 and
ISU 1894 shows that a single nucleotide substitution, from T in ISU
1894 to C in ISU 79, leads to the acquisition of an additional
leader-mRNA junction sequence, UUGACC, in ISU 79 (FIGS. 8B and 9).
Therefore, an additional species of sg mRNA (3-1) is formed (FIG.
5). In addition to ORFs 4 to 7 contained within sg mRNA 4, sg mRNA
3-1 contains at the 5'-end an additional small ORF (ORF 3-1) with a
coding capacity of 45 amino acids (FIG. 9). This small ORF stops
just one nucleotide before the start codon of ORF 4.
[0233] Sequence analyses of ORFs 2 to 7 of two U.S. isolates reveal
heterogeneity of the leader mRNA junction sequences. ORFs 2 to 5 of
ISU 79 and ISU 1894 were cloned and sequenced (see Experiment 1
above). ISU 79 produces seven easily distinguishable sg mRNAs,
whereas ISU 1894 produces six distinguishable sg mRNAs (FIGS. 5 and
7). At least three cDNA clones at any given region of ORFs 2 to 5
were sequenced for each virus isolate, using universal and reverse
primers as well as virus-specific primers XM969, XM970, XM1006,
XM078, and XM077 (Table 4). The sequences of ORFs 6 and 7 of ISU
1894 and ISU 79 are disclosed in U.S. application Ser. No.
08/301,435.
[0234] Sequence analysis showed that the ORFs 2 to 7 of ISU 79 and
ISU 1894 overlap each other except for a 10-nucleotide noncoding
region between ORF 4 and ORF 5. The same observation was previously
made for VR 2385 (U.S. application Ser. No. 08/301,435). This is
very unusual, since all members of the proposed Arteriviridae
family, including LV, contain overlapping ORFs. However, the ORFs
of coronaviruses are separated by intergenic noncoding sequences.
Therefore, U.S. PRRSV appears to be somewhat similar to the
coronaviruses in terms of the genomic organization in junction
regions of ORFs 4 and 5.
[0235] ORF 2 of ISU 1894 was one amino acid longer than that of ISU
79 (FIG. 9). The stop codon of ORF 2, TAG, was changed to TGG in
ISU 1894 immediately followed by a new stop codon (TGA) in ISU 1894
(FIG. 9). The sizes of other ORFs of ISU 79 and ISU 1894 were
identical (FIG. 9). There were no deletions or insertions in ORFs 2
to 7 of these isolates. However, numerous substitutions are present
throughout the entire sequence of ORFs 2 to 7 between ISU 79 and
ISU 1894 (FIG. 9).
[0236] The numbers and locations of the determined or predicted
leader-mRNA junction sequences varied between ISU 1894 and ISU 79
(FIG. 9). In addition to the regular leader-mRNA 4 junction
sequence, TTCACC, 10 nucleotides upstream of ORF 4, there was an
additional leader-mRNA 3-1 junction sequence (TTGACC) located 236
nucleotides upstream of ORF 4 in ISU 79 (FIG. 9). The leader-mRNA
junction sequences of sg mRNAs 4 and 3-1 were separated by 226
nucleotides, which correlated with the estimated sizes of sg mRNAs
4 and 3-1 observed in Northern blot analysis (FIG. 5) and RT-PCR
amplification (FIG. 8A).
[0237] The leader-mRNA 3 junction sequence is identical between ISU
1894 and ISU 79, GTAACC, located 89 nucleotides upstream of ORF 3.
The predicted leader-mRNA junction sequences of sg mRNAs 2 and 6 of
ISU 1894 and ISU 79 were also the same (FIG. 9).
[0238] However, the predicted leader-mRNA 5 junction sequences of
ISU 1894 and ISU 79 are different (FIG. 9). There are 3 potential
leader-mRNA 5 junction sequences for ISU 79 (GCAACC, GAGACC and
TCGACC, located 55, 70 and 105 nucleotides upstream of ORF 5,
respectively). Two potential leader-mRNA 5 junction sequences were
also found in ISU 1894 (GAAACC and TCGACC, located 70 and 105
nucleotides upstream of ORF 5, respectively) (FIG. 9). The
differences were due to the two-nucleotide substitutions in the
predicted leader-mRNA 5 junction sequences of these isolates (FIG.
9).
[0239] In addition to the leader-mRNA 7 junction sequence 15
nucleotides upstream of ORF 7, an additional leader-mRNA 7 junction
sequence was found (ATAACC), located 129 nucleotides upstream of
ORF 7 in each of these two isolates (FIG. 9). However, the sg mRNA
corresponding to this additional leader-mRNA 7 junction sequence
was not clearly distinguishable from the abundant sg mRNA 7 which
produced a widely-diffused band-in the Northern blot (FIGS. 5, 6
and 7).
[0240] Variations in the numbers and locations of the leader-mRNA
junction sequences between LV and the two U.S. isolates analyzed in
this experiment were also found by comparing the leader-mRNA
junction sequences of LV with those of the two U.S. isolates ISU
1894 and ISU 79. Taken together, these data indicate that the sg
mRNAs of PRRSV are polymorphic, and the numbers and the exact sizes
of the sg mRNAs depend on the particular PRRSV isolate analyzed.
However, a nested set of six sg mRNAs most likely reflects the
standard arterivirus genome organization and transcription.
TABLE-US-00005 TABLE 4 Synthetic oligonucleotides used in
Experiment 2 OLigo Name Sequence Location (nucteotides).sup.a
Polarity.sup.b IM729 5'-GACTGATGGTCTGGAAAG-3' ORF1b, -507 to -490
upstream of ORF2 + IM782 5'-CTGTATCCGATTCAAACC-3' ORF1b, -180 to
-163 upstream of ORF2 - IM312 5 -AGGTTGGCTGGTGGTCTT-3' ORF2, 131 to
148 downstream of ORF2 + IM313 5'-TCGCTCACTACCTGTTTC-3' ORF2, 381
to 398 downstream of ORF2 - XM1022 5'-TGTGCCCGCCTTGCCTCA-3' ORF3,
168 to 175 downstream of OEF3 + IM268 5'-AAACCAATTGCCCCCGTC-3'
ORF3, 520 to 537 downstream of ORF3 - XM1024
5'-TATATCACTGTCACAGCC-3' ORF4, 232 to 249 downstream of ORF4 +
XM1023 5'-CAAATTGCCAACAGAATG-3' ORF4, 519 to 536 downstream of ORF4
- PP287 5'-CAACTTGACGCTATGTGAGC-3' ORF5, 129 to 148 downstream of
ORF5 + PP286 5'-GCCGCGGAACCATCAAGCAC-3' ORF5, 538 to 667 downstream
of ORF5 - PP289 5'-GACTGCTAGGGCTTCTGCAC-3' ORF6, 119 to 138
downstream of ORF6 + XM780 5'-CGTTGACCGTAGTGGAGC-3' ORF6, 416 to
433 downstream of ORF6 - PP285 5'-CCCCATTTCCCTCTAGCGACTG-3' ORF7,
157 to 178 downstream of ORF7 + PP284 5'-CGGCCGTGTGGTTCTCGCCAAT-3'
3'NCR, -27 to -6 upstream of poly (A) - JM260
5'-GGGGAATTCGGGATAGGGAATGTG-3' ORF3, 338 to 356 downstream of ORF3
+ JM259 5'-GGGGATCCTTTTGTGGAGCCGT-3' ORF6, 34 to 52 downstream of
ORF6 - XM993 5'-GGTGAATTCGTTTTATTTCCCTCCGGGC-3' ORF1b, -53 to -35
upstream of ORF2 + XM992 5'-GGGGGATCCTGTTGGTAATAG/AGTCTG-3' ORF3,
-50 to -34 upstream of ORF4 - XM970 5'-GGTTTCACCTAGAATGGC-3' ORF2,
522 to 550 downstream of ORF2 + XM969 5'-GATAGAGTCTGCCCTTAG-3'
ORF5, 443 to 460 downstream of ORV6 - XM1006
5'-GCTTCTGAGATGAGTGA-3' ORF4, 316 to 332 downstream of ORF4 + XM078
5'-CTGAGCAATTACAGAAG-3' ORF2, 202 to 218 downstream of ORF2 + XM077
5'-CAACCAGGCGTAAACACT-3' ORF3, 316 to 333 downstream of ORF3 -
XM755 5'-GACTGCTTTACGGTCTCTC-3' Leader, 3'end of the Leader
sequence + 0P586 5'-GATGCCTGACACATTGCC-3' ORF4, 355 to 372
downstream of ORF4 - XM141 5'-CTGCAAGACTCGAACTGAA-3' ORF4, 78 to 97
downstream of ORF4 - .sup.aThe oligonucleotides were designed on
the basis of sequence data presented in this application and U.S.
application Ser. Nos. 08/131,625 and 08/301,435
.sup.bOligonucleotides complementary to the genomic RNA have
negative (-) polarities.
EXAMPLE 3
[0241] Cell line ATCC CRL 11171 was used for the propagation of
PRRSV isolates. The maintenance of the cell line and isolation of
virus were the same as previously described (Meng et al., J. Gen.
Virol. 75:1795-1801 (1994); Meng et al., J. of Veterinary
Diagnostic Investigation 8:374-381 (1996). Plasmacytoma cell line
SP2/O was used for cell fusion in MAb preparation. PRRSV ATCC VR
2385 was used as antigen for screening of hybridomas secreting
PRRSV specific monoclonal antibodies.
[0242] Indirect Immunofluorescence Assay (IFA). Monolayers of ATCC
CRL 11171 cells were inoculated with PRRSV VR 2385 at 0.1
multiplicities of infection, incubated for 48 hrs and fixed with
methanol. Hybridoma supernatant was incubated on the fixed-cell
monolayer at 37.degree. C. for 30 min. Fluorescein-labeled goat
anti-mouse IgG (H+L) conjugate was used to detect the specific
reaction. One PRRSV N(ORF 7 products) specific monoclonal antibody,
PP7eF11 was used as a positive control and cell culture supernatant
from a non-PRRSV specific MAb, PPAc8 was used as a negative
control.
[0243] MAb preparation. The whole cell lysates from insect cells
infected with recombinant baculoviruses of PRRSV ORFs 4 and 5 were
used as immunogen to immunize mice. Construction of the recombinant
baculoviruses containing the PRRSV ORFs 4 and 5 was done with the
strategies as previously described (Bream et al. J. Virol.
67:2665-2663 (1993)). Briefly, PRRSV ORFs 4 and 5 genes were PCR
amplified separately from the template of pPSP.PRRSV2-7 plasmid
(Morozov et al., Archives of Virology 140:1313-1319 (1995)) with
primers containing restriction sites of BamHI and EcoRI. The
amplified fragments were cut with the restriction enzymes indicated
above and ligated into the vector PVL1393 (Invitrogen). The
inserted genes were under control of the polyhedrin gene promoter
(O'Reilly et al., Baculovirus Expression Vectors: A Laboratory
Manual, pages 107-234, 2.sup.nd Edition, New York: W.H. Freeman and
Company (1992)) and verified with restriction enzyme digestion and
PCR amplification. Then the recombinant vector DNA and linearized
Autographa California multinuclear polyhedrosis virus DNA
(Invitrogen) were co-transfected into Sf9 cells as described in the
instruction manual. The inserted genes in the recombinant
baculoviruses were verified with hybridization and PCR
amplification (O'Reilly et al., 1992). The recombinant viruses were
used to inoculate insect cells and the cell lysate was used for
immunization of mice. The immunization was carried out with 3 to 5
times of intraperitoneal injections at two weeks interval.
Spleenocytes were hybridized with SP2/O myeloma cells as previously
described (Brown & Ling, "Murine Moncolonal Antibodies," In
Antibodies: a practical approach, pp. 81-104, Edited by Catty D.
Zoxford, Washing, D. C. IRL Press (1988)). Hybridomas were screened
for secreting PRRSV specific antibodies with IFA to detect reaction
with PRRSV ATCC VR 2385. Positive hybridomas were selected and
cloned three times. Four MAbs were developed to the GP4 and six
Mabs to the protein. Mabs were isotyped with MonoAb ID kits (Zymed
Laboratories Inc).
[0244] Enzyme-linked immunosorbent assay (ELISA). ELISA has been
well described (Harlow & Lane, Antibodies: A laboratory manual,
pp. 471-612, Cold Spring Harbor Laboratory New York (1988); Ausubel
et al., Short protocols in molecular biology, pp. 11.5-11.7,
2.sup.nd Edition, New York, Greene Publishing Associates and John
Wiley & Sons (1992)). Coating antigens were extracted with 1%
Triton X-100 from PRRSV VR 2385-infected cells. MAbs were tested
for binding activity in ELISA with the antigens binding to plates.
Extract from normal cells and cell culture medium from the
non-PRRSV specific MAb, PPAc8 were included as a negative antigen
and a negative antibody controls respectively. The PRRSV N-specific
MAb, PP7eF11 was used as a positive control. Specific reactions
were detected with goat anti-mouse IgG (H+L) peroxidase conjugate
and revealed with substrate 2,2'-azino-bis
(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS). Then the optical
density was measured at 405 nm (A.sub.405).
[0245] Fixed-cell ELISA was conducted as previously reported (van
Nieuwstadt et al., J. Virol. 70:4767-4772 (1991)) to test the
reactivity of MAbs with PRRSV field isolates. Briefly, monolayers
of ATCC CRL 11171 cells were inoculated with PRRSV field isolates
at 0.001 multiplicities of infection, incubated for 48 hrs and
fixed with methanol. Then the cells were blocked with 1% BSA for 1
hour at room temperature. Cell culture supernatant of MAbs were
diluted in two-fold series and added to the fixed-cell plates. The
PP7eF11 and PPAc8 were used as positive and negative controls
respectively. Specific reactions were detected as described
above.
[0246] Immunoblotting. Western immunoblot analyses were carried out
as described previously (Harlow & Lane, Antibodies: A
laboratory manual, pp. 471-612, Cold Spring Harbor Laboratory, New
York (1988)). Protein samples were treated under different
conditions before separated in gel. For denaturing conditions
samples were treated at 100.degree. C. for 3 minutes in Laemmli
sample buffer containing 2% SDS and 5% 2-mercaptoethanol and run in
SDS-PAGE. Under non-denaturing conditions, samples were treated at
40.degree. C. for 20 min in sample buffer containing 1% triton
X-100 and run in PAGE. Then separated proteins were transferred to
nitrocellulose membrane by electrophoresis The nitrocellulose
membrane was blocked with 3% BSA. MAbs were screened for the
reactivity with the antigens on the membrane with multi-screening
apparatus. Pig anti-PRRSV serum was used as a positive control and
cell culture supernatant from PPAc8 as a negative control. Bound
antibodies were detected by incubation with goat anti-mouse
IgG+IgA+IgM peroxidase conjugate or goat anti-pig IgG peroxidase
conjugate followed by color development in 4-chloro-1-naphthol
substrate.
[0247] Virus neutralization (VN) test. Virus neutralizing activity
of MAbs was tested as described previously (Mecham et al., Viral
Immunol. 3:161-170 (1990) & White et al., J. Gen. Virol.
71:4767-4772 (1990)) with some modifications. Hybridoma supernatant
was mixed with the same volume of PRRSV dilution containing 30-70
plaque forming units, which was diluted with DMEM containing 10%
guinea pig complement. The virus-antibody mixture was incubated at
37.degree. C. for 1 hr, and then transferred to the monolayer of
ATCC CRL 11171 cells in six-well plate for 1 more hr incubation at
37.degree. C. Then an agarose-medium mixture overlaid the
monolayer. After 3-day incubation at 37.degree. C., the monolayer
was stained with 0.05% neutral red in agarose. Pig anti-PRRSV serum
was used as a positive control and hybridoma cell culture medium
from a non-PRRSV specific MAb was included as a negative
control.
[0248] PRRSV specific Mabs identified with IFA. Hybridomas were
screened with IFA on PRRSV VR 2385-infected ATCC CRL 11171 cells.
IFA positive hybridomas were selected, amplified and cloned. Six
MAbs were developed against PRRSV E protein and four to the GP4.
All of them showed strong perinuclear fluorescence with a little
difference in intensity, which was different from the cytoplasmic
staining of PRRSV N protein specific MAb (FIG. 10). This result
indicated that the GP4 and E glycoproteins were synthesized and
accumulated in subcellular compartments in PRRSV-infected cells as
transferring of oligosaccharides to a glycoprotein is generally
processed in a particular compartment such as the endoplasmic
reticulum and the Golgi complex (Pfeffer et al., Ann. Rev. Biochem.
56:829-852 (1987)). GP4 and E were predicted as membrane-associated
glycoproteins (Meng et al., 1994 & Morozov et al., Archives of
Virology 140:1313-1319 (1995)). In contrast, the PRRSV N protein is
highly basic and hydrophilic, and is synthesized in the cytoplasm
of PRRSV-infected cells, which was shown by the observation of
cytosol distribution of fluorescence in IFA with N-specific MAb
staining. All the MAbs were identified as subtype IgM.
[0249] Reactivity with PRRSV antigen in ELISA. In order to
determine the sensitivity of the epitopes to detergent treatment,
ELISAs were run to test the reactivity of the MAbs with 1% Triton
X-100 extracted PRRSV antigen. Among the MAbs to the E protein,
only PP5bH4 showed strong reactivity to the PRRSV antigen (FIG.
11). No clear reaction was detected between the rest of the
E-specific MAbs and the PRRSV antigen. Among the MAbs to the GP4,
only PP4bB3 showed a mild reactivity with the PRRSV antigen. The
other three of the MAbs to GP4 failed to show any reactivity. The
negative controls did not show reaction in ELISA.
[0250] Out of the 10 MAbs, only PP5bH4 and PP4bB3 showed reactivity
in the ELISA with detergent extracted PRRSV antigen. This result
indicated that the epitope recognized by PP5bH4 was resistant to
Triton X-100 treatment and the epitope of PP4bB3 was partially
resistant to the detergent. The epitopes recognized by the other 8
MAbs were sensitive to the treatment, and may be conformationally
dependent. Triton X-100 is generally selected to disrupt cell
membranes for its nondenaturing property (Deutscher, "Guide to
protein purification," Methods in Enzymology, Vol. 182, San diego,
Calif., Academic Press, Inc. (1990)), but in this test the epitopes
in the PRRSV proteins were somehow altered during the extraction
process as monitored by the MAb binding.
[0251] Immunoblotting assay. Western-blotting was carried out to
determine the reactivity of the MAbs with PRRSV antigen to confirm
the speculation that the MAbs were against conformationally
dependent epitopes. Under denatured conditions in SDS-PAGE, only
the PP5bH4 recognized a band of purified PRRSV virions in the
position of 26 kDa which corresponded with the putative E detected
with pig anti-PRRSV serum (FIG. 12). Then immunoblotting was
carried out with non-denatured PAGE to test if the epitopes were
preserved under nondenaturing conditions. Among the six MAbs to E,
only PP5bH4 showed reaction with the PRRSV antigen. Of the MAbs to
GP4, none recognized the PRRSV antigen in purified virions or in
infected cells under either conditions in this test (result not
shown).
[0252] The MAbs except PP5bH4 failed to recognize the PRRSV antigen
in immunoblot, which indicated that the epitopes recognized by
these MAbs were not derived from continuous structure. MAb PP5bH4
reacted with PRRSV in the position of 26 kDa, which confirmed the
report about the molecular mass of E (Meulenberg et al., Virology
192:62-72 (1995)). This result showed that the epitopes recognized
by the other 9 MAbs were sensitive to detergent treatment and
corresponded to that of ELISA. Again the result indicated that the
epitopes were conformationally dependent. PP4bB3 failed to show any
reaction with PRRSV antigen in Western-blot, which could be due to
the epitope loss or alternation during PAGE and transfer.
[0253] Virus neutralizing activity. Plaque-reduction assay was run
to test whether there was any virus neutralizing activity among the
MAbs to the E and GP4 proteins. Only one E-specific MAb, PP5 dB4
showed the ability of homologous neutralization to the VR 2385
isolate. All the other MAbs failed to show any neutralizing
activity to this isolate. The positive control, pig anti-PRRSV
serum also showed virus neutralizing activity.
[0254] Among the ten MAbs to GP4 and E, at least PP5 dB4 showed
homologous virus neutralizing activity against PRRSV VR 2385. The
neutralizing epitope was conformationally dependent as PP5 dB4
failed to recognize PRRSV antigen in ELISA and in Western-blot.
Also the neutralizing activity of PP5 dB4 indicates that at least
part of the epitope is located on the virion surface and accessible
by the MAb. The mechanism of neutralizing activity of PP5 dB4 is
not clear. It could be due to blocking of the virus binding or
entry into the cells.
[0255] Reactivity with other PRRSV isolates. PRRSV field isolates
were propagated to test the cross-reactivity of the MAbs in
fixed-cell ELISA and to determine the epitope presence in other
PRRSV isolates (Table 5). Fixed-cell ELISA was used because most of
these MAbs recognized conformationally dependent epitopes and these
epitopes could be preserved in fixed cells. All the MAbs react with
all the isolates but with different titers. The result indicates
that the epitopes recognized by the MAbs were conserved among the
isolates tested. However, there were antigenic differences among
the isolates tested. Reactivity intensity was arbitrarily defined
as high if titers were greater than or equal to 256, as medium if
titers were 64 to 128, and as low if titers were smaller than or
equal to 32. Out of the 23 isolates tested, only PRRSV VR 2385 had
high reactivity with 7 of the 10 MAbs. Five isolates had low
reactivity with at least 6 of the 10 MAbs, 12 isolates had medium
reactivity with at least 6 of the 10 MAbs and the other 5 isolates
had low reactivity with half of the MAbs. The MAb PP4dG6 and PP5bH4
showed lower reactivity with most of the isolates than other MAbs.
The PP4bB3 showed the strongest reactivity among all the MAbs
against GP4 and E proteins. The titer difference was as high as
64-fold for the reaction of one MAb with the different isolates,
such as the titers of MAb PP4cBl 1 reacting with PRRSV RP 10 and RP
12, 16 and 1024 respectively. On the other hand, the titer
difference of MAbs with one isolate was as high as 128-fold, such
as the titers of MAbs PP4bB3 and PP4bC5 reacting with PRRSV RP11,
1024 and 8 respectively. This result indicated that the epitopes
recognized by the different MAbs were different. The positive MAb
control show strong reactivity with all the isolates except the
ISU-51. The reactivity difference of MAbs with PRRSV isolates was
consistent with the report that the amino acid sequence identity of
VR 2385, ISU22, ISU55 and RP45 was 94-98% in ORF 4 and 88-97% in
ORF 5 (Meng et al., J. Gen. Virol. 140:745-755 (1995)).
[0256] In summary, six MAbs were developed to the PRRSV E protein
and four to the GP4. All of them except PP5bH4 were against
conformationally dependent epitopes as determined by ELISA and
immunoblotting. MAb PP5 dB4 showed virus neutralizing activity
against VR 2385. Reactivity pattern of the MAbs with PRRSV field
isolates indicated that there are antigenic difference in PRRSV GP4
and E, which confirmed previous reports on MAbs against PRRSV N and
ORF 3 product (Nelson et al., J. Clinical Microbiology 31:3184-3189
(1993); Drew et al., J. General Virol. 76:1361-1369 (1995);
Wieczorek-Krohmer et al., Veterinary Microbiology 51:257-266
(1996)).
EXAMPLE 4
[0257] Cells and viruses. ATCC CRL11171 cells were used to
propagate PRRSV and PRRSV purification was done as previously
described (Meng et al., J. Gen. Virol., 75:1795-1801(1994); Meng et
al., J. Vet. Diag. Invest. 8:374-381(1996); Halbur et al. Vet.
Pathol. 32:648-660, (1995). PRRSV isolate ATCC VR 2385 (Meng et
al., 1994 & Morozov et al., 1995) was used for PCR
amplification of ORFs 2 to 4 genes.
[0258] Spodoptera frugiperda clone 9 (Sf9) and High Five.TM.
(Invitrogen) insect cells were cultured for propagation of
baculovirus. The baculovirus strain Autographa California
multinuclear polyhedrosis virus (AcMNPV) was used as parent virus
for recombinant baculovirus construction.
[0259] Construction of AcMNPV recombinant transfer vector.
Construction of the baculovirus transfer vectors containing the
PRRSV ORFs 2, 3 and 4 separately was done with the strategies as
previously described (Bream et al., J. Virol. 67:2655-2663(1993).
Briefly, PRRSV ORFs 2 to 4 genes were PCR amplified separately from
the template of pPSP.PRRSV2-7 plasmid with primers containing
restriction sites of BamHI and Pst I for genes of ORFs 2 and 3,
BamHI and EcoRI for ORF 4.
[0260] The forward primer for ORF 2 was 5'GCACGG
ATCCGAATTAACATGAAATGGGGT3' and the reverse primer was 5'CCACCT
GCAGATTCACCGTGAGTTCGAAAG3'. The forward primer for ORF 3 was
5'CGTCGGATCCTCCTACAATGGCTAATAGCT3' and the reverse primer was
5'CGCGCTGCAGTGTCCCTATCGACGTGCGGC3'. The forward primer for ORF 4
was 5'GTATGGATCCGCAATTGGTTTCACCTATAA 3' and the reverse primer was
5'ATAGGAATTCAACAAGACGGCACGATACAC3'. The amplified fragments were
cut with restriction enzymes as indicated above and ligated into
the vector pFastBAC1 (GIBCO BRL) for ORFs 2 and 3 fragments, and
the vector PVL1393 (Invitrogen) for ORF 4 fragment. The inserted
genes were under control of the polyhedrin gene promotor (O'Reilly
et al., Baculovirus Expression Vectors: A Laboratory Manual, W.H.
Freeman & Co., NY (1992) and verified with restriction enzyme
digestion and PCR amplification. Then the recombinant vectors
containing the ORFs 2 to 4 genes separately were isolated and
designated as pPSP.Ac-p2 for ORF 2 transfer vector, pPSP.Ac-p3 for
ORF 3 transfer vector and pPSP.Ac-p4 for ORF 4 transfer vector. For
pPSP.Ac-p2 and pPSP.Ac-p3, their DNA were isolated and transfected
into competent DH10BAC E. Coli cells (GIBCO BRL) containing the
whole genome of baculovirus called Bacmid.
[0261] Transfection and selection of recombinant viruses. For ORFs
2 and 3, recombinant viruses were generated with the BAC-TO-BAC.TM.
expression system (GIBCO BRL). The isolated recombinant Bacmid DNA
were transfected into Sf9 insect cells and then the cell culture
medium was collected as virus stock. For ORF 4 recombinant virus
construction, pPSP.Ac-p4 DNA and linearized AcMNPV DNA (Invitrogen)
were co-transfected into Sf9 cells as described in the instruction
manual. Putative recombinant baculoviruses were selected following
three rounds of occlusion body-negative plaque purification. The
inserted genes in the recombinant viruses were verified with
hybridization and PCR amplification (O'Reilly et al., 1992). Four
recombinants were selected for each of the 3 strains of recombinant
baculoviruses. Indirect immunofluorescence assays with pig
anti-PRRSV serum showed that the four recombinants for each strain
had similar level of protein expression. One was chosen from each
strain for further study and designated as vAc-P2 for recombinant
virus of ORF 2, vAc-P3 for that of ORF 3, and vAc-P4 for that of
ORF 4.
[0262] Indirect Immunofluorescence Assay (IFA). IFA was well
described elsewhere (O'Reilly et al., 1992). Briefly, Monolayer of
High Five.TM. cells were infected with wild type (wt) AcMNPV or
recombinant viruses of vAc-P2, vAc-P3 and vAc-P4 respectively at a
multiplicity of infection of 0.1 and incubated for 72 hrs. Pig
anti-PRRSV serum was used to detect specific proteins expressed in
insect calls. Total protein expression was detected in the infected
cells fixed, stained and observed under fluorescence microscope.
Cell surface expression was detected on unfixed and unpermeabilized
cells incubated with pig anti-PRRSV serum for 1 hr at 4.degree. C.,
stained with fluorescein-labeled goat anti-pig IgG conjugate for 1
hr at 4.degree. C., and then observed under fluorescence
microscope.
[0263] Immunoblotting. Western immunoblotting was conducted as
previously described (Harlow & Lane, Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory (1988)). Cell extract from
insect cells infected with recombinant viruses or wt AcMNPV were
used for this analysis. The proteins were separated with SDS-PAGE
and transferred to nitrocellulose membrane by electrophoresis. The
membrane was incubated with pig anti-PRRSV serum for 1 hour at room
temperature. Specific reactions were detected with goat anti-pig
IgG peroxidase conjugate, followed by color development in
4-chloro-1-naphthol substrate.
[0264] Tunicamycin treatment. High Five.TM. cells were infected
with vAc-P2, vAc-P3, vAc-P4 or wt AcMNPV and incubated with 5
.mu.g/ml tunicamycin in cell-culture medium from 0 to 72 hrs post
infection. Non-treated insect cells were infected at the same time
as controls. Cell lysate was harvested for SDS-PAGE and
immunoblotting (O'Reilly et al., 1992).
[0265] Immunogenicity of the recombinant proteins. Cell lysates of
insect cells infected with vAc-P2, vAc-P3 and vAc-P4 were used to
test the recombinant protein's immunogenicity in rabbits. Two
twelve-week old rabbits were injected intramuscularly and
subcutaneously for each of these recombinant proteins. Blood was
collected 10 days after two booster injections. Antibodies were
tested with indirect ELISA (Ausubel et al., Short Protocols in
Molecular Biology, pp. 11.5-11.7, 2.sup.nd Edition, N.Y. Green
Publishing Associates and John Wiley and Sons (1992)). Purified
PRRSV virions were sonicated and used to coat 96-well plates and
goat anti-rabbit IgG peroxidase conjugate was used to detect
anti-PRRSV antibodies in rabbit serum samples. Pre-immune rabbit
serum was used as negative control. Substrate 2,2'-azino-bis
(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was used to reveal
specific reactions.
Results
[0266] Construction and verification of recombinant viruses.
Details of construction strategy are mentioned under Methods. For
ORFs 2 and 3, the recombinant baculoviruses were selected from E.
coli containing the recombinant Bacmid and then collected from
transfection of Sf9 insect cells. The recombinant viruses were
further confirmed by DNA hybridization and PCR amplification. Both
hybridization of DNA from infected cells with specific probes from
the PRRSV genes of ORFs 2 to 4 and PCR amplification showed that
the recombinant baculoviruses had the right genes cloned (data not
shown).
[0267] Surface immunofluorescence of recombinant viruses vAc-P2,
vAc-P3 and vAc-P4. High Five.TM. cells were infected with vAc-P2,
vAc-P3, vAc-P4, or wt AcMNPV, incubated for 72 hrs, and fixed with
methanol for examination of total protein expression by IFA with
pig anti-PRRSV serum. Unfixed and unpermeabilized insect cells were
stained at 4.degree. C. to detect cell surface immunofluorescence
by IFA. There was weak cytoplasmic fluorescence in vAc-P2 infected
cells, intense cytoplasmic fluorescence in vAc-P3 or vAc-P4
infected insect cells and no specific fluorescence in wt AcMNPV
infected cells (FIG. 17). There was clear cell surface
immunofluorescence in vAc-P2, vAc-P3 and vAc-P4 infected insect
cells stained at 4.degree. C. without fixation and permeabilization
(FIG. 15). No cell surface staining was detected in wt AcMNPV
infected insect cells. Also, recombinant virus infected insect
cells in the absence of antibody did not show any fluorescence
(data not shown).
[0268] Analysis of expressed recombinant proteins. Monolayer of
High Five.TM. cells was infected at a multiplicity of infection of
0.1 with vAc-P2, vAc-P3, vAc-P4, or wt AcMNPV and incubated for 72
hrs. Expression of the recombinant proteins in insect cells was
analyzed with whole cell extracts. Total protein samples were run
on SDS-PAGE, transferred to nitrocellulose membrane by
western-blotting and detected with pig anti-PRRSV serum (FIG. 19A).
Purified PRRS virions were added and analyzed in the same gel. The
ORF 2 product expressed in insect cells was detected as 27 and 29
kDa bands in M.sub.r. The ORF 3 product was detected as 22, 25,
27-31 and 3543 kDa multi-band species. The signals in M.sub.r of
27-31 and 35-43 kDa were hard to differentiate into single bands
and may be due to differential glycosylation or partial
proteolysis. The ORF 4 product was found as 15, 18, 22, 24, 28 and
30 kDa multi-band species. These specific bands were not detected
in wt AcMNPV infected insect cells. There were at least four bands
in purified PRRSV sample: 15, 19, 27-31 and 45 kDa in M.sub.r. The
specific bands detected in purified PRRS virions were not observed
in normal cell control (FIG. 19A).
[0269] The recombinant proteins were glycosylated. Tunicamycin
treatment of insect cells infected with recombinant baculoviruses
or wt AcMNPV was conducted to test if the recombinant proteins were
N-glycosylated as tunicamycin inhibit N-linked glycosylation. After
the treatment, the 29 kDa band of the ORF 2 recombinant protein was
disappeared, a 25 kDa appeared and the 27 kDa species remained
unchanged (FIG. 20A). For the ORF 3 recombinant protein, the
species of 27-31 and 35-43 kDa were disappeared and the 22-27 kDa
bands remained unchanged. The 27 kDa species of ORF 3 recombinant
protein became more abundant after tunicamycin treatment. After the
N-glycosylation inhibition, the ORF 4 recombinant protein was shown
as 15 and 18 kDa species only and the bands of 22-30 kDa were
disappeared. The 15 and 18 kDa bands became sharper and darker
after the tunicamycin treatment. No signal was detected in extracts
from wt AcMNPV infected insect cells.
[0270] Immunogenicity of the recombinant proteins. The recombinant
proteins of ORFs 2 to 4 products were tested for immunogenicity by
immunization of rabbits with lysates of insect cells infected with
vAc-P2, vAc-P3 and vAc-P4. The presence of anti-PRRSV antibodies in
the rabbit serum samples was detected by ELISA. The average titers
of immunized rabbits were 192, 128 and 382 for the groups of
vAc-P2, vAc-P3 and vAc-P4 cell lysate respectively (Table 6).
Discussion
[0271] The genes of ORFs 2 to 4 of PRRSV were cloned into BEVS and
the recombinant proteins were expressed in insect cells. The
cloning strategy for ORFs 2 and 3 was much faster than that for ORF
4 as the selection process of recombinant baculovirus was done in
E. Coli instead of choosing occlusion body-negative plaques on Sf9
cells. Sf9 cells were used for the propagation of baculovirus, and
High Five.TM. cells were used for protein expression as protein
yield in High Five.TM. cells was believed to be higher than that in
Sf9 cells (Wickham et al. Biotechnology Progress 8:391-396 (1992)
& Davis et al., In Vitro Cell and Developmental Biology 29A:
388-390 (1993)). The High Five.TM. cells were adapted to serum free
medium, which benefits for future protein purification, and can be
adapted to suspension culture, which is suitable for large scale
industrial production.
[0272] The recombinant proteins were shown by IFA to express in
insect cells infected with vAc-P2, vAc-P3 and vAc-P4 recombinant
viruses. There was weak cytoplasmic fluorescence in vAc-P2 infected
cells, strong cytoplasmic fluorescence in vAc-P3 and vAc-P4
infected cells. The reason for the weak fluorescence of vAc-P2
infected cells is not known and could be due to epitope alternation
after fixation with methanol. The unfixed and unpermeabilized
insect cells were stained at 4.degree. C. to make sure that the pig
anti-PRRSV antibody reacted with cell surface proteins only and did
not enter into cytoplasm. There was clear cell surface
immunofluorescence on the insect cells infected with vAc-P2, vAc-P3
or vAc-P4, which indicates that the recombinant proteins were
efficiently processed and transported to cell surface. This result
indicates that ORFs 2 to 4 products are membrane-associated
proteins, which is consistent with the predictions from sequence
studies (Morozov et al., Archives of Virology 140:1313-1319
(1995)). However, it is not clear if these products are also
transported to cell surface of PRRSV infected mammalian cells or
assembled into virions as surface proteins. Recent report showed
that the ORFs 3 and 4 products are viral structural proteins (VAN
Nieuwstadt et al, J. Virol. 70:4767-4772 (1996)). Further
experiment is needed to investigate the destiny of these
proteins.
[0273] Immunoblotting results showed that the recombinant proteins
were efficiently expressed in insect cells. The ORF 2 product was
detected as 27 and 29 kDa species in M. Tunicamycin treatment
eliminated the 29 kDa band and introduced the 25 kDa species with
the 27 kDa unchanged, which indicated that the 29 kDa was
N-glycosylated. The predicted M, of PRRSV VR 2385 ORF 2 is 29.5 kDa
with two potential glycosylation sites (Morozov et al., 1995). The
25 kDa species may be the core protein of ORF 2 if the 37-38 signal
sequence (Meulenberg et al., Virology 192:62-72 (1995)) are removed
in the mature protein. The 4 kDa difference between the 29 and 25
kDa bands may be due to carbohydrate structures as one glycosyl
moiety has a M.sub.r of about 2-3 kDa (Trimble et al., J. Biol.
Chem. 250:2562-2567 (1983)). The 27 kDa species was not sensitive
to the tunicamycin treatment and may be modified by 0-linked
glycosylation or other post-translational modifications.
[0274] The ORF 3 product in insect cells was shown as 22-43 kDa
multi-band species detected by immunoblotting. The 28-43 kDa
species were eliminated by tunicamycin treatment of vAc-P3 infected
insect cells, which indicated that they were N-linked glycoproteins
and the multi-bands were due to differential glycosylation. The
predicted Mr of PRRSV VR 2385 ORF 3 product is 28.7 kDa (about 2
kDa less than the counterpart of LV) with 7 potential N-linked
glycosylation sites (Morozov et al., 1995). The 27 kDa species of
ORF 3 recombinant protein may be the core protein because it became
more abundant after tunicamycin treatment (FIG. 20A) and because a
27 kDa band appeared and a 45 kDa band disappeared after
endoglycosidase F treatment of purified PR RSV virion (data not
shown). The species smaller than 27 kDa may be truncated proteins
or products of proteolysis. The 27-43 kDa bands in nontreated
sample are hard to differentiate into individual bands, which may
be due to overloading or partial proteolysis. The 43 kDa species
may be the fully glycosylated product as there are 7 N-linked
glycosylation sites and about 2-3 kDa are counted for each glycosyl
moiety (Trimble et al., 1983). The recent report showed that ORF 3
of LV encode a 45-50 kDa structural protein and that recombinant
proteins of ORF 3 in insect cells were detected as 28-44 kDa in M,
by radioimmunoprecipitation (VAN Nieuwstadt et al., 1996). The 28
kDa species was found as the core protein of LV ORF 3 product. It
seems there is difference in Mr of recombinant proteins from ORF 3
of US PRRSV and LV, which may be due to the different expression
system used or the difference in this gene between the two
isolates. Another report showed that the recombinant fusion protein
of carboxyterminal 199 amino acids of LV ORF 3 expressed in
baculovirus was not N-glycosylated (Katz et al., Vet. Microbiol.
44:65-76 (1995)), which demonstrates the diversity of expressed
products from the same gene.
[0275] The ORF 4 product in insect cells was detected as 15-30 kDa
multi-band species. After tunicamycin treatment the 22-30 kDa bands
were eliminated and the 15, 18 kDa bands remained unchanged, which
indicated that the 22-30 kDa species were N glycosylated to various
degrees. The ORF 4 of PRRSV VR 2385 was predicted to encode a 19.5
kDa protein with 4 potential N glycosylation sites (Morozov et al.,
1995). The 15 kDa species of ORF 4 product may be the core protein
and the 18 kDa band may be the core protein plus 0-linked glycosyl
moiety or other modifications. It was reported that LV ORF 4
encoded a 31-35 kDa structural protein and that the recombinant
protein of ORF 4 expressed in insect cells was detected as 20-29
kDa species with a 17 kDa core protein (VAN Nieuwstadt et al.,
1996). Again, the reason for the difference in Mr may be due to the
cloned gene's difference and the different expression systems.
Another report demonstrated the difference by showing that ORF 4 is
not a well conserved region (Kwang et al., J. Vet. Diag. Invest.
6:293-296 (1994)).
[0276] The immunization of rabbits with the recombinant proteins
showed that they had induced anti-PRRSV antibodies. This result
indicates that these recombinant proteins may have the similar
immunogenicity as their native counterparts in PRRSV infected
mammalian cells.
[0277] This study showed that the ORFs 2 to 4 of PRRSV VR 2385 were
expressed in BEVS and detected both in cytoplasm and on cell
surface of insect cells. The recombinant proteins of ORFs 2 to 4
were N-linked glycoproteins with differential glycosylation. The
purified PRRSV virions were analyzed as the same time and showed 4
bands in immunoblotting. But due to lack of oligoclonal or
monoclonal antibodies it is hard to tell if any of ORFs 2 to 4
products was detected in the purified virions. The reaction of pig
anti-PRRSV serum with the recombinant proteins indicated that the
native counterpart of these proteins induced immune response in
natural host. The induction of anti-PRRSV antibodies in rabbits
indicated that these recombinant proteins had similar
immunogenicity as the native ORFs 2 to 4 products in PRRSV infected
natural host. TABLE-US-00006 TABLE 6 Rabbit antiserum titers tested
with ELISA Groups of insect cells infected with Number of rabbits
Means of titers* vAc-P2 2 192 vAc-P3 2 128 vAc-P4 2 384 *Titers
were expressed as the reciprocals of the highest dilutions shown
positive in ELISA.
EXAMPLE 5
[0278] Cells and viruses. ATCC CRL11171 cells were used to
propagate PRRSV (Meng et al., 1994 and 1996; Halbur et al., 1995).
Spodoptera frugiperda clone 9 (Sf9) and High Five.TM. (Invitrogen)
insect cells were used for propagation of baculovirus. PRRSV
isolate VR 2385 (Meng et al., 1994 and 1996) was used for gene
amplification and cloning into BEVS. PRRSV virions were purified as
previously described (Meng et al., 1994). The baculovirus strain
Autographa California multinuclear polyhedrosis virus (ACMNPV) was
used as parent virus for recombinant virus construction.
[0279] Construction of ACMNPV recombinant transfer vector. The
nucleic acid sequence of the ORFs 5-7 of PRRSV VR2385 was
previously described (Meng et al. 1994). Construction of the
baculovirus transfer vectors containing the PRRSV ORFs 5 to 7
separately was done with the strategies as described previously
(Bream et al. 1993). Briefly, PRRSV ORFs 5 to 7 genes were PCR
amplified separately from the template pPSP.PRRSV2-7 plasmid with
primers containing restriction sites of BamHI and EcoRI. The
forward primer for ORF5 was 5'TGCCAGGATCCGTGTTTAAATATGTTGGGG3' and
the reverse primer was 5'CGTGGAATTCATAGAAAACGCCAAGAGCAC3'. The
forward primer for ORF6 was 5'GGGGATCCAGAGTTTCAGCGG3' and the
reverse primer was 5'GGGAATCCTGGCACAGCTGATTGAC3'. The forward
primer for ORF7 was 5'GGGGATCCTTGTTAAATATGCC3' and the reverse
primer was 5'GGGAATTCACCACGCATTC3'. The fragments amplified were
cut with BamHI and EcoRI, isolated and ligated into vector PVL1393
(Invitrogen) which was also cut with BamHI and EcoRI to insure
correct orientations. The inserted genes were under control of the
polyhedrin gene promotor (O'Reilly et al., 1992) and verified with
restriction enzyme digestion and PCR amplification. The recombinant
vectors containing the ORFs 5 to 7 genes separately were isolated,
pPSP.Ac-E for ORF5, pPSP.Ac-M for ORF6 and pPSP.Ac-N for ORF7
transfer vectors.
[0280] Transfection and selection of recombinant viruses. Sf9
insect cells were cotransfected with linearized AcMNPV DNA
(Invitrogen) and recombinant plasmid DNA of pPSP.Ac-E, pPSP.Ac-M,
and pPSP.Ac-N respectively as per manufacturer's instructions.
Putative recombinant viruses were selected following three-round of
purification of occlusion-negative plaques. The inserted genes in
the recombinant viruses were verified with hybridization and PCR
amplification (O'Reilly et al., 1992). Four recombinants were
selected for each of the 3 strains of recombinant viruses and were
found to be similar in immunofluorescence assays using pig
anti-PRRSV serum. One recombinant virus was chosen arbitrarily from
each strain and designated as vAc-E1 for recombinant virus
containing ORF5, vAc-M1 for that with ORF6, and vAc-N1 for that
with ORF7.
[0281] Immunoblotting. Western immunoblot analyses were carried out
as described previously (Harlow and Lane, 1988). Whole proteins
from infected insect cells, purified PRRSV or normal cells were
used as samples. Proteins were separated with SDS-PAGE and
transferred to nitrocellulose membrane by electrophoresis. The
nitrocellulose membrane was blocked with 3% BSA and reacted with
pig anti-PRRSV serum for 1 hour at room temperature. Bound
antibodies were detected by incubation with goat anti-pig IgG
peroxidase conjugate, followed by color development with
4-chloro-1-naphthol substrate.
[0282] Tunicamycin treatment. Infected High Five.TM. cells were
incubated with 5 .mu.g/ml tunicamycin in cell-culture medium from 0
to 72 hr post infection and harvested for SDS-PAGE (O'Reilly et
al., 1992).
[0283] Cleavage with glycosidases. Endoglycosidase F/N-glycosidase
F mixture (PNGase F) and endoglycosidase H (Boehringer-Mannheim
Biochemicals) were used to treat lysates from infected High
Five.TM. cells (0.1 PFU/cell; 72 hr post infection) in the case of
recombinant proteins or purified PRRSV as per manufacturer's
instructions. Briefly, 10.sup.5 cells were lysed with 30 .mu.g
lysis buffer. Then 10 .mu.g of cell lysates was digested with
PNGase F, endoglycosidase H or kept untreated and used as
non-treated control. The samples were incubated at 37.degree. C.
for 24 hrs before analysis on SDS-PAGE.
[0284] Radioimmunoprecipitation (RIP). High Five.TM. cells infected
with recombinant baculovirus or wild type (wt) AcMNPV and
uninfected High Five.TM. cells were washed once with
methionine-free medium and starved for one hour at 48 hr
post-infection. Then 50 ci/ml Tran.sup.35S-label (methionine and
cystine) (Amersham Life Science Inc.) in methionine-free medium was
added to the infected cells. Three hours later the cells were
rinsed with PBS and laced in RIPA lysis buffer (10 mM Tris-HCl,
pH8.0; 1 mM EDTA; 150 mM NaCl; 1% NP40; 1% sodium deoxycholate;
0.1% SDS). Immunoprecipitation and gel electrophoresis were
performed as described previously (Hutchinson et al., J. Virol.
66:2240-2250 (1992).
[0285] Indirect Immunofluorescence Assay (IFA). IFA was conducted
as previously described (O'Reilly et al., 1992). Monolayer of High
Five.TM. cells were inoculated with wt AcMNPV or recombinant
baculoviruses, incubated for 72 hrs and fixed to detect all
recombinant protein expression with pig anti-PRRSV serum. The
inoculated insect cells were also examined for the presence of cell
surface proteins. Unfixed and unpermeabilized cells were reacted
with the pig antiserum at 4.degree. C. for 1 hr, incubated with
fluorescein-labeled goat anti-pig IgG conjugate for 1 more hr at
4.degree. C. and then observed under fluorescent microscope.
[0286] Immunogenicity of the recombinant proteins. Twelve-week old
rabbits were injected intramuscularly and subcutaneouslly with
lysates of insect cells infected with vAc-E1, vAc-M1 and vAc-N1.
Two rabbits were immunized for each of E, M, and N recombinant
proteins. Two booster injections were given in an interval of three
weeks. The injection dose was cell lysates from 2.times.10.sup.6
insect cells. Blood was collected 10 days after the second booster
injection. Antibodies were tested with indirect ELISA. Purified
PRRSV virions were sonicated and used to coat 96-well plates and
goat anti-rabbit IgG peroxidase conjugate was used to detect
anti-PRRSV antibodies in rabbit serum samples. Pre-immune rabbit
serum was used as negative control. Substrate
2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was
used to reveal specific reactions.
Results
[0287] Confirmation for the presence of PRRSV gene in recombinant
baculovirus. Hybridization and PCR amplification were performed to
verify the presence the cloned genes in recombinant baculovirus.
Hybridization of probes from the PRRSV genes with recombinant
baculovirus showed that the PRRSV genes were present in the
recombinant baculovirus. PCR amplification with specific primers
from PRRSV genes showed single band from the recombinant virus and
absent from the wt AcMNPV (results not shown). These tests
confirmed that the recombinant baculoviruses contain the PRRSV
genes ORFs 5 to 7. Surface immunofluorescence of recombinant
viruses vAc-E1 and vAc-M1, but not vAc-N1. High Five.TM. cells
infected with vAc-E1, vAc-M1, vAc-N1, and wt AcMNPV were examined
for the presence of total expressed protein and cell surface
expression. There was weak cytoplasmic fluorescence in vAc-E1 and
vAc-M1-infected cells. In contrast, there was intense cytoplasmic
fluorescence in vAc-N1-infected insect cells and no fluorescence in
wt AcMNPV infected cells (FIG. 18). Clear cell surface
immunofluorescence was detected in vAc-E1 and vAc-M1 infected
insect cells (FIG. 16). However, there was no surface
immunofluorescence in insect cells infected with vAc-N1 or wt
AcMNPV. Also, in the absence of antibody insect cells infected with
the recombinant viruses did not show any fluorescence (data not
shown).
[0288] Analysis of ORFs 5-7 products expressed in insect cells. To
analyze the expression of the expected proteins in insect cells,
confluent monolayers of High Five.TM. cells were infected at a
multiplicity of infection of 0.1 PFU/cell with vAc-E1, vAc-M1 and
vAc-N1 respectively and incubated for 72 hr. Total protein samples
were run on SDS-PAGE and analyzed by western-blotting using pig
anti-PRRSV serum (FIG. 19A). The recombinant protein E expressed in
insect cells was detected as multi-band species of 16, 18, 20, 24,
and 26 kDa. The E expressed in insect cells showed more diversity
and lower M.sub.r compared with the native E, 26 kDa species, in
the purified PRRSV (FIG. 19A). The M expressed in insect cells was
detected as a 19 kDa band, which corresponded to the native M in
purified PRRSV. The N expressed in insect cells was detected as a
15 kDa band, which also corresponded to the native N in the
purified PRRSV. These specific bands were not detected in normal
insect cells (results not shown) and those infected with wt AcMNPV.
Purified PRRS virions were analyzed in the same gel. There were at
least five bands: 15, 19, 24, 26-30 and 45 kDa. The specific bands
detected in purified PRRS virions were not observed in normal
mammalian cell controls.
[0289] Glycosylation analysis of baculovirus expressed E, M, and N.
To determine if the E, M, and N expressed in insect cells underwent
N-glycosylation, the insect cells infected with the recombinant
baculoviruses were treated with tunicamycin to inhibit N-linked
glycosylation. After tunicamycin treatment, the 20-26 kDa species
were not detected in insect cells infected with the vAc-E1 (FIG.
20B), while the 16 and 18 kDa bands became more abundant. In the
cells infected with vAc-M1 and vAc-N1, no changes in M.sub.r of M
and N proteins were detected after the tunicamycin treatment (FIG.
20B).
[0290] Immunogenicity of the recombinant proteins. The recombinant
proteins E, M, and N were tested for immunogenicity by immunization
of rabbits with lysates of insect cells infected with vAc-E1,
vAc-M1 and vAc-N1. Then ELISA was carried out to test for the
presence of anti-PRRSV antibodies in the rabbit serum samples. The
average titers of E, M and N immunized rabbits were 384, 320 and
2,056 respectively (Table 7).
Discussion
[0291] Recombinant baculoviruses containing the genes E, M, and N
of PRRSV were constructed to express E, M, and N in insect cells.
Sf9 cells were used for the propagation of baculovirus, and High
Five.TM. cells were used for protein expression as protein yield in
High Five.TM. cells was believed to be higher than that in Sf9
cells (Wickham et al., 1992 and Davis et al., 1993).
[0292] Immunofluorescence analysis showed that E, M and N were
expressed in insect cells infected with recombinant viruses
containing those genes and showed that E and M were transported to
the cell surface in insect cells. This result indicates that E and
M expressed in insect cells are membrane-associated proteins and
efficiently processed in post-translational modification. The
reason for low intensity of cytoplasmic immunofluorescence of E and
M in insect cells is unclear. It may be due to the epitope loss or
modification after fixation of the infected insect cells. In insect
cells infected with vAc-N1, only intense cytoplasmic
immunofluorescence was observed and no surface fluorescence was
detected. This result indicated that baculovirus expressed N was
not transported to cell surface but located in the cytosol. This
characteristic is consistent with its nature as a very hydrophilic
nucleocapsid protein as predicated from sequence studies (Meng et
al., 1994).
[0293] The recombinant E protein showed multi-bands in
immunoblotting, the bands with M.sub.r smaller than 26 kDa were not
found in the purified PRRSV. The E expressed in insect cells showed
more diversity and lower M.sub.r compared with the native E, 26 kDa
species, in the purified PRRSV (FIG. 19). The multi-bands may be
due to differential glycosylation in insect cells during
post-translational modification. Tunicamycin treatment eliminated
the 20-26 kDa bands and increased the intensity of the 16 kDa band.
The presence of the 18 kDa band after treatment could be due to
0-linked glycosylation, phosphorylation or other post-translational
modifications. The 20-26 bands represent those of differential
N-glycosylated species of E in insect cells. The 16 kDa band may be
the non-glycosylated leader-free core protein. Preliminary studies
of PNGase F and endoglycosidase H treatment of recombinant protein
E showed that it underwent complex glycosylation. The recombinant M
and N did not undergo N-linked glycosylation as both the
tunicamycin and PNGase F and endoglycosidase H treatments did not
alter the mobilities of the 19 and 15 kDa bands. These results
indicate that the recombinant protein E of 20-26 kDa is
N-glycosylated, and that the recombinant M and N proteins expressed
in insect cells are not N-glycosylated. The changes in mobility
after tunicamycin treatment were consistent with the presence of
two N-linked glycosylation sites in the E polypeptide as determined
from sequence studies (Meng et al., 1994). However, sequence
studies indicated that there are 2 and 1 potential N-linked
glycosylation sites in the M and N polypeptides respectively. In
the baculovirus expressed M and N, there was no N-linked
glycosylation detected. Compared with the native counterparts, the
recombinant proteins in insect cells were much more abundant as
seen from the immunoblot (the loading amount of the recombinant
proteins was about one percent of the PRRSV lane in FIG. 19).
However, it is difficult to measure the difference without
oligoclonal or monoclonal antibodies.
[0294] For the purified PRRSV, there are at least five bands: 15,
19, 24, 26-30 and 45 kDa. This result is consistent with the
previous reports that there are at least three structural proteins
in the PRRSV virion (Conzelmann et al., Virology 193:329-339
(1993); Nelson et al., J. Clin. Microbiol. 31:3184-3189 (1994) and
Mardassi et al., Arch. Virol. 140:1405-1418 (1994)). The 45 kDa
band in the purified PRRSV may be the ORF3 product as reported
(Kapur et al., J. Gen. Virol. 77:1271-1276 (1996)). The nature of
the 24, 27-30 kDa species can not be figured out. After treatment
with PNGase F and endoglycosidase H, the band pattern changed for
the PRRSV sample. In the PNGase F treated PRRSV, the 16-kDa band
may represent the non-glycosylated leader-removed core protein of
E, the 27-kDa band may indicate another structural protein of PRRSV
besides E, M and N. However, the nature of these bands needs to be
determined by oligoclonal or monoclonal antibodies.
[0295] The results from rabbit immunization test indicated that the
antibodies generated from the immunization of rabbits with the
recombinant proteins could recognize the native PRRSV viral
antigens. The recombinant proteins showed the same antigenicity as
their native counterparts in PRRSV infected mammalian cells,
especially the recombinant N which induced higher antibody titers
in rabbits than did E and M. TABLE-US-00007 TABLE 7 Rabbit
antiserum titers tested with ELISA Groups of insect cells infected
with Number of rabbits Means of titers* vAc-E1 2 384 vAc-M1 2 320
vAc-N1 2 2056 *Titers were expressed as the reciprocals of the
highest dilutions of serum that showed positive reading.
EXAMPLE 6
[0296] Porcine Reproductive and Respiratory Syndrome Virus (PRRSV),
Modified Live Virus vaccine was prepared as a lyophilized viral
cake and reconstituted with sterile water and administered by
either the subcutaneous (SC) or intramuscular (IM) route. The
objective of this study was to confirm the immunogenicity of a
PRRSV vaccine in three week-old swine by vaccinating either IM or
SC with one 2 mL dose. Also to be determined was whether the PRRSV
vaccine was safe and efficacious in three week-old pigs vaccinated
with a single 2 mL dose, given with IM or SC, in protecting pigs
against challenge with virulent PRRSV strain ISU-12.
[0297] Animal Selection
[0298] Seventy crossbred PRRSV seronegative pigs (IDEXX ELISA
sample to positive ratio of <0.4) were purchased from Evergreen
Partners, Morris, Minn. and utilized in this study. All pigs were
three weeks old at the time of vaccination.
[0299] Composition of the Vaccine
[0300] The PRRSV vaccine comprising virus strain ISU-55 was
produced at virus passage level X+5. The vaccine was stored between
2.degree.-7.degree. C. prior to use. The vaccine was titrated in
five replicates.
[0301] Vaccination Schedule--Efficacy Testing
[0302] The stock vaccine was prepared by reconstituting the
lyophilized virus portion with sterile water. The stock vaccine was
diluted to the minimum protective dose level (approximately
10.sup.4 TCID.sub.50 per dose) in culture medium. A representative
aliquot of the prepared vaccine was retained at -70.degree. C. for
quantitation of viral antigen. The 70 PRRSV seronegative
susceptible pigs used in this study were randomly distributed into
four treatment groups and vaccinated as follows: TABLE-US-00008
Group Vaccine Route Dose Number Vaccination Group A PRRSV IM 2 mL
20 pigs Vaccination at 3 vaccine weeks of age. Group B PRRSV SC 2
mL 20 pigs Vaccination at 3 vaccine weeks of age. Group C N/A* N/A
N/A 20 pigs N/A (Controls) Group D N/A N/A N/A 10 pigs N/A
(Controls) *N/A--Not applicable
[0303] Injection sites were in the right neck (IM) or in the right
flank fold (SC). The control pigs (Groups C and D) were not
vaccinated with any vaccine or placebo vaccine.
[0304] Prior to vaccination, all pigs were bled for a
prevaccination serology. Control animals were bled prior to
challenge to ensure that they remained seronegative to PRRSV (IDEXX
ELISA S/P ratio<0.4).
[0305] Challenge and Observation Procedure
[0306] Thirty-six (36) days after the vaccination, each of the 20
pigs in Groups A, B and C were commingled in a common isolation
room and challenged with virulent PRRSV. Group D animals were left
as nonchallenged controls. The virulent ISU-12 PRRSV challenge
virus was obtained from Iowa State University, Ames, Iowa. The
virulent ISU-12PRRSV challenge virus was maintained as a frozen
(-70.degree. C.) stock after expansion in PSP36 cells. Individual
pigs were challenged intranasally with 2 mL of the challenge virus.
The PRRSV challenge stock was thawed and diluted to 10.sup.4
TCID.sub.50 per 2 mL just before challenge. The challenge virus was
held on ice during challenge. An aliquot of the challenge virus
preparation was retained and held at -70.degree. C. for subsequent
titration on PSP36 cells. The animals were observed on -1, and 0
days post challenge (DPC) to establish a baseline and 1 to 10 DPC
for various clinical signs.
[0307] Clinical Observation
[0308] The pigs were evaluated each day for post challenge clinical
signs such as inappetence, lethargy, depression, diarrhea,
neurological symptoms, dyspnea, cyanosis and death.
[0309] Lung Lesion Scoring
[0310] The lungs of each individual pig were examined for gross
lesions at necropsy 10 days post challenge. The scorer of gross
lung lesions was blinded to the identity of the treatment group to
which each pig belonged. Briefly, the score for lung lesions in
each lobe were recorded by estimating the percent of the lobe
exhibiting PRRSV-like lesions (based on color and texture) and
multiplied by the number of points possible for that lobe. Maximum
score for each lobe was determined by the relative percentage of
the total lung volume occupied by the lobe. Then the scores from
the dorsal and ventral aspects of all lobes were added to obtain
the total score for each pig. The maximum total score possible for
each animal was 100.
[0311] Statistical Analysis
[0312] The clinical sign and gross lung lesion scores for the
vaccinates and the controls were compared using analysis of
variance (General Linear Model). The use of analysis of variance
models using nonranked gross lung lesion scores was justified by
the fit of the scores within a normal probability distribution. A
comparison of the residuals of the parametric analysis indicated
they were distributed normally, substantiating the major
assumptions for analysis of variance. Therefore, data analysis
using ranked gross lung lesion scores was not necessary. All
statistical analyses were performed on an IBM computer using SAS
software.
[0313] Results and Discussion
[0314] PRRSV Antigen Titers in the VS Code Vaccine
[0315] The PRRSV vaccine antigen titration results are shown in
Table 8. The average PRRSV titer per dose of vaccine from five
replicate titrations was 10.sup.3.92 TCID.sub.50.
[0316] Clinical Observations
[0317] Following vaccination, there were no clinical signs observed
in any of the vaccinated pigs. Following challenge with virulent
PRRSV ISU-12 p6, the vaccinates and control pigs did not show
significant clinical signs of respiratory or neurologic disease
during the 10 day post challenge observation period.
[0318] Gross Lung Lesion Pathology
[0319] The results of gross lung lesion scoring are given in Table
9. Following PRRSV challenge, the gross lung lesion scores ranged
from 0-29 with a mean score of 14.15 in the IM vaccinated pigs
(Group A), from 1-27 with a mean score of 11.20 in the SC
vaccinated pigs (Group B), from 7-57 with a mean score of 25-80 in
the nonvaccinated challenge control pigs (Group C), and 1-28 with a
mean score of 10.90 in the non-vaccinated nonchallenged control
pigs (Group D). Both IM and SC vaccinated pigs had significantly
less lung lesions than the nonvaccinated challenged control pigs
(p<0.05). The vaccinated pigs did not have significantly
different gross lung lesion scores than the gross lung lesion
scores from nonvaccinated nonchallenged pigs (P>0.05). The
nonvaccinated challenged control pigs had significantly higher
gross lung lesions than the nonvaccinated nonchallenged control
pigs (P<0.05).
CONCLUSION
[0320] The results of the study demonstrate that Porcine
Reproductive and Respiratory Syndrome Virus, Modified Live Virus
Vaccine is efficacious for use in healthy pigs three weeks of age
or older as an aid in the prevention of respiratory disease caused
by virulent PRRSV challenge. One hundred percent of the three
week-old pigs vaccinated with the modified live vaccine did not
show any adverse local or systemic clinical effects following
vaccination. These pigs remained healthy and active for the entire
36 day post vaccination observation period. Pigs vaccinated with a
dose of 10.sup.3.92 TCID.sub.50 vaccine either intramuscularly or
subcutaneously showed significant reduction (p<0.05) in gross
lung lesion development over nonvaccinated challenged control pigs
following challenge with a heterologous virulent PRRSV challenge
strain, ISU-12. The post challenge gross lung lesion scores of
vaccinated pigs were statistically indistinguishable from the
nonvaccinated nonchallenged controls (p>0.05). Analysis of the
residuals of the parametric analysis of variance indicated that
they were distributed normally, substantiating the major
assumptions for analysis of variance. One hundred percent of the
vaccinated pigs remained free of clinical signs during the post
challenge period. TABLE-US-00009 TABLE 8 PRRSV Immunogenicity
Study: PRRSV Antigen Level of Vaccine* Replicate Titration Number
Viral Titer per 2 mL dose 1 10.sup.3.80 2 10.sup.3.93 3 10.sup.4.13
4 10.sup.3.93 5 10.sup.3.80 Average 10.sup.3.92 *in log
TCID.sub.50
[0321] TABLE-US-00010 TABLE 9 PRRSV Immunogenicity Study: PRRSV
Gross Lung Lesion Scoring 10 DPC Group C D A B Non Vaccinated Non
Vaccinated Pig IM SC Challenged Non Challenged Number Vaccinates
Vaccinates Controls Controls 1 21 7 53 4 2 1 12 7 8 3 19 5 57 1 4
12 17 12 2 5 29 3 18 3 6 5 18 35 11 7 18 19 20 24 8 6 5 28 14 9 4 7
32 28 10 0 8 41 14 11 16 3 27 12 12 27 19 13 9 16 40 14 29 19 10 15
17 1 24 16 20 13 15 17 26 12 9 18 21 14 9 19 6 13 35 20 12 5 25
Mean 14.15 11.20 25.80 10.90 Standard 8.86 6.84 14.47 9.3
Deviation
EXAMPLE 7
Complete Sequence of PRRSV Isolate VR 2385
Materials and Methods
[0322] Virus and Cells. The PRRSV isolate VR2355, passage 7 was
used in this study. A continuous cell line, ATCC CRL 11171 was used
for growth of the virus and isolation of viral RNA and total RNA
from the virus-infected cell culture.
[0323] Cloning of cDNA and PCR amplification. For characterization
of the ORF 1 region of genome of VR2385 a random cDNA .lamda.
library was constructed using the Uni-Zap cDNA cloning kit
(Stratagene, La Jolla, Calif.). Briefly, the CRL11171 cells were
infected with VR2385 virus at a M.O.I. of 0.1 and the total RNA
from infected cells was isolated at 24 hrs post infection by using
a guanidinium thiocyanate method. Initially, probe specific for 5'
end of ORF2 was used to screen the random cDNA library. Plaques
that hybridized with the probe were isolated and purified. The
phagemids containing viral cDNA inserts were rescued by in vitro
excision using ExAssist helper phage and E. coli SOLR cells
(Stratagene, LaJolla, Calif.). After hybridizations with
ORF1-specific overlapping fragments, several recombinant phagemids
with virus specific cDNA inserts with sizes ranging from 2 to 6 kb
were selected. The plasmids containing virus cDNA inserts were
subsequently purified and sequenced by Sanger's dideoxynucleotide
chain termination method with an automated DNA sequencer (Applied
Biosystems, Foster City, Calif.). Universal, reverse and
PRRSV-specific internal primers were used to determine the
sequence. At least 2 independent cDNA clones representing sequence
of ORFs 1a and 1b were sequenced. One region, not represented in
the library (nt 1950-2050) was PCR amplified with primers 1M687
(5'-CCCCATTGTTGGACCTGTCC-3') and IM2500(5'-GTCACAACAGGGACCGAGC-3')
using Tag DNA polymerase with addition of the proofreading Tag
Extender (Stratagene). The sequencing data were assembled and
analyzed using MacVector (International Biotechnologies, Inc., CT)
and GeneWorks (IntelliGenetics, CA) computer programs.
[0324] Primer extension experiments and RNA sequencing. Primer
extension experiments were performed using SureScript
Preamplification System for First Strand cDNA Synthesis (Gibco
BRL). .sup.32P-labeled oligonucleotide RNS
(5'-CCAAGCTCCCCTGAAGGAGGCTGTCAC-3') was mixed with 0.5 .mu.g of
viral RA of VR2385 in total volume of 12 .mu.l and RNA was
denatured for 10 min at 90.degree. C. The sample was adjusted to a
total volume 19 .mu.l with first strand cDNA buffer and incubated
for 5 min at 42.degree. C. for primer annealing. Super Script II
reverse transcriptase was then added to the reaction and the
reaction mixture was incubated at 42.degree. C. or 50.degree. C.
for min. Samples were analyzed in 40% polyacrylamide gel. Primer
extension products were run next to the sequencing reactions of
pPR59 clone, containing partial sequence of the leader.
Oligonucleotide RNS served as a primer for the sequencing
reaction.
[0325] Direct sequencing of purified viral RNA was performed using
RT RNA Sequencing Kit (USB, Cleveland, Ohio) with
.gamma..sup.32P-labeled oligonucleotide RNS
(5'-CCAAGCTCCCCTGAAGGAGGCT GTCAC-3') and 151Ext
(5'-AGCATCCCAGACATGGTTAAAGGGG-3'). Sequencing was performed
according to the manufacturer's instructions using 0.5 .mu.g of
purified viral RNA per sequencing reaction.
Results
[0326] Leader sequence of PRRSV VR2385. Previously, oligo dT and
random cDNA libraries of PRRSV VR2385 in .lamda.Zap vector and here
constructed the sequence for portion of ORF1b and complete ORFs-2-7
were determined. The partial leader sequence of VR2385, 161
nucleotides upstream of the ATG start codon of ORF1, was obtained
from clone pPR59. It has been shown previously that the leader
sequence of LDV is 156 nucleotides, and that the leader sequence of
LV (a European isolate of PRRSV) was 221 nucleotides. In order to
determine the complete leader sequence of U.S. PRRSV, primer
extension experiments were performed. In one experiment cDNA was
synthesized using SuperScript II reverese transcriptase at
42.degree. C. and 50.degree. C. In another experiment rTth DNA
polymerase in the presence of Mn was used for cDNA synthesis at
60.degree. C. to minimize potential of secondary structures in
leader RNA during cDNA synthesis. In all experiments the length of
generated cDNA fragments were the same, about 190 nucleotides. In
order to detect the complete leader sequence of PRRSV VR2385,
direct sequencing of viral RNA was performed. Virion RNA isolated
from virus purified through sucrose gradient was used in a direct
RNA sequencing reaction. Direct RNA sequencing was performed with a
primer complementary to the leader sequence at positions between 10
and 67 nt upstream of the AUG start codon of ORF1a. In addition to
the 161 nt leader sequence previously detected by screening of the
cDNA library with leader specific probe, an additional 27
nucleotides of the leader sequence were identified. The two
nucleotides at the extreme 5' end of the leader could not be
identified due to the strong bands observed in all four lanes in
the sequencing gel. The size of the leader determined by direct RNA
sequencing correlated with results of the primer extension
experiments. To further confirm the data obtained by direct RNA
sequencing, RT-PCR was performed with a 16 b.p. primer,
corresponding to the extreme 5' end of the leader, and an antisense
primer located 10 nt upstream of the 3' end of the leader. An
expected 180 b.p. PCR fragment was amplified which is in agreement
with the results obtained by direct RNA sequencing. Therefore, the
putative size of the leader of PRRSV VR2385 was 190 nt, which is
smaller than those reported for LV (221 nt), EAV (212 nt) and SHFV
(208 nt), but larger than the leader sequence reported for LDV (156
nt). The sequence of the junction region at the 3' end of the
leader was TTTAACC. The ATG start codon of ORF1a is located
immediately downstream of this sequence. Similar results were also
reported for LV, LDV and SHFV, in which the start codon of ORF1a is
also located after the junction sequence. However, the genome of
EAV leader junction sequence was reported 13 nt upstream of the
start codon of ORF1a. The percentage of nucleotide sequence
identity between the leader sequence of VR2385 and those of LV, LDV
and SHFV were 55%, 47% and 38%, respectively. Surprisingly, only
the last 44 nucleotides at the 3' end of the leader of VR2385
possess significant homology with the leader sequence of LV (86%
identity in this region). Relatively higher homology was also found
in this 44 nt region between VR2385 and LDV (64%) and SHFV (63%).
No significant homology was found between leader sequences of
VR2385 and EAV.
[0327] Cloning and sequencing of PRRSV genome. To analyze ORF1 of
PRRSV VR 2385, a random primed cDNA library in .lamda.Zap vector
was constructed from total RNA of virus-infected cells. More than
twenty overlapping cDNA clones from cDNA library were selected and
sequenced (FIG. 23). For most regions, the sequence was determined
from at least two independent clones. The region corresponding to
nucleotides 1900-2050 was not represented in the cDNA library, and
this genomic region was PCR amplified and sequenced. Sequence
analysis showed that the genomic RNA of PRRSV (U.S. isolate
VR2385), excluding the polyA sequence, is 15100 nucleotides in
length.
[0328] Functional domains in ORFs 1a/1b and homology with related
viruses. The predicted size of ORF1a is 7197 nucleotides. It
extends from nucleotides 191 to 7387 (excluding the stop codon TAG)
and encodes a 2399 amino acid polyprotein. The leader-genome
junction region is similar to that of LV, and the ATG start codon
is located immediately after TTTAACC sequence of the leader.
Differences were identified when compared the ORF1 sequences of LV
and VR2385. ORF 1a in LV is 7188 nucleotides long and encodes 2396
amino acids, which is only 3 amino acids shorter than that of
VR2385. Pairwise comparison of nucleotide sequences of VR2385 and
LV indicated that the 5' end of ORF1a is more divergent than the 3'
end. The nucleotide sequence 55% identities between VR2385 and LV
is 61% in the 3' end of ORF 1a, (from nucleotides 3050 to 7387) in
the first 1500 nucleotides of ORF 1a 55%, and 46% in a region
between nucleotides 1500 to 2500. The most variable region within
ORF1a was located between nucleotides 2500 and 3000, where there
was no significant homology between VR2385 and LV. The amino acid
identity was 49% for region from 1 to 530 aa, 55% for region from
1100 to 2399 amino acids, and no significant homology in the region
extending from amino acids 530 to 1100. Comparison of the ORF1a
sequences of VR2385 and LDV revealed that there is a 52% homology
in first 2000 nucleotides and 55% homology in the last 3800
nucleotides of ORF 1a (corresponding to 3400-7197 nt in VR2385 and
2850-6678 nt in LDV). The region between 2000 to 3400 nt of VR2385
and 2500 to 2850 nt of LDV is highly variable with more than 500 nt
deletion in LDV genome. Comparison of the predicted amino acid
sequences showed that there is a 36% of homology for the region
extended from amino acids 1 to 500, and 39% for the region, that
includes the last 1300 amino acids of predicted proteins (1120 to
2353 aa in VR2385 and 940 to 2226 aa in LDV).
[0329] Analysis of the predicted protein encoded by ORF1a of VR2385
revealed the presence of two papain-like cysteine protease domains
(aa 63-165 and aa 261-347) and one 3C-like serine protease domain
(aa 1542-1644), similar to those described for other arteriviruses
and coronaviruses. The hydrophilic profiles of ORF1a proteins of
VR2385 were similar to those of LV and LDV. The 5' half of the
proteins (first 1100 aa in VR2385) were mostly hydrophilic, the
extreme 3' end (aa 2230-2399 in VR2385) was hydrophilic and the 3'
half of the protein contains 4 hydrophobic regions (1129-1207 aa,
1240-1286 aa, 1478-1643 aa and 1856-2076 regions of VR2385).
[0330] The VR2385 ORF1b is 4389 nucleotides long and it extends
from nucleotide 7369 to 11757 (excluding stop codon TGA), and
encoded a 1463 aa protein. Comparison of the nucleotide and
predicted amino acid sequences of VR2385 ORF1b with those of LV,
LDV and EAV confirmed that ORF1b is more conserved than ORF1a.
Nucleotide and amino acid homology between VR2385 and LV was 64 and
67% in ORF1b and 58 and 53% in ORF1a, respectively. Comparison of
the predicted proteins of VR2385 and EAV showed a 36% homology. The
predicted ORF1b protein of VR2385 contains a putative polymerase
domain (amino acids 373-576), a putative zinc finger domain (amino
acid 647-689), and an RNA helicase domain (amino acids 793-1015)
similar to those described for LV, LDV, EAV and coronaviruses.
[0331] Molecular characterization of ORF1 regions of coronaviruses
and arteriviruses showed that the ORF1 polyprotein is expressed
through two overlapping ORFs, ORF1a and ORF1b. The expression of
ORF1b, which overlaps with ORF1a in -1 frame, takes place through a
so-called ribosomal frameshifting mechanism which allows the
ribosome to bypass the ORF1a stop codon and translate ORF1b-encoded
protein. The frameshift region consists of a "slippery sequence"
followed by pseudoknot structure. Analysis of the ORF1a/ORF1b
junction region of VR2385 indicated that the potential slippery
sequence (5'-UUUAAAC-3') is located 3 nucleotides upstream of the
stop codon of ORF1a and the proposed pseudoknot structure. This
region is very conserved in corona- and arteriviruses and the
nucleotide sequence homology in this region between VR2385 and LV
was 86%.
[0332] Comparison of the leader sequences of VR2385 and LV
indicated that these two viruses diverged from each other by point
mutations and possibly through recombination. The extensive
sequence differences in the leader sequences of these two viruses
indicated the leader that sequence in PRRSV is not conserved, and
is subject to extensive mutational changes. The most conserved
region in the leader was the last 44 nucleotides at the 3' end,
where nucleotide sequence acid identity was 86% between VR2385 and
LV, and 68% between VR2385 and LDV. The putative leader sequence of
VR2385 was 190 nt, which is 31 nt shorter than that of LV, and 35
nt longer than that of LDV. As shown in FIG. 24, there is a 20 nt
deletion in the VR2385 leader (located after nucleotide 145)
compared to the leader sequence of the LV. Comparison of the leader
sequences of VR2385 and LDV indicates that the highest homology
score was obtained when a 20 nt gap was introduced into the
corresponding region of the leader sequence of LDV (FIG. 24).
Similarly, the highest homology score was obtained when a 50 nt gap
was introduced into the LDV leader during alignment of the LV and
LDV leader sequences. This result suggests that this region of the
leader is not critical for virus replication, and deletions may
occur in this region of the leader during virus evolution. This
observation also could explain the observed differences in the
length leader sequences among VR 2385, LV and LDV.
EXAMPLE 8
Characterization of the Leader Sequence and Leader-Body Junction
Sites in Subgenomic mRNAs of PRRSV VR 2385
[0333] In order to determine the complete leader sequence of PRRSV
VR2385, several approaches were utilized including screening of
oligo dT cDNA library with leader-specific .sup.32P-labeled PCR
probe, RNA ligation of the viral RNA (RNA circularization) with T4
RNA ligase followed by RT-PCR with ORF7 and leader specific
primers, and direct sequencing of the 5' end of viral RNA (Example
7). First, a 100 b.p. fragment of leader sequence was used as a
probe to detect cDNA clones containing the leader sequence from an
oligo dT .lamda. library. Eight cDNA clones were analyzed and
sequenced, and these clones were found to represent leader
sequences of mRNAs 7 (5 clones), 6 (2 clones) and 2 (1 clone). The
size of leader sequence varied from 160 to 163 nucleotides in 6 of
the 7 clones. In one of the clones which represents mRNA6, the
leader specific sequence was 172 nucleotides. It is possible that
strong secondary structure within the leader of the virus prevented
complete cDNA synthesis of the leader RNA during the construction
of the .lamda. Zap library. In a second experiment, the 3' and 5'
ends of viral RNA were ligated head to tail by using T4 RNA ligase.
After phenol chloroform extraction and precipitation, the ligated
RNA was subjected to an RT-PCR reaction with primers IM1003
(antisense oligonucleotide, complementary to the 3' end of the
leader sequence) and IM1004 (oligonucleotide, corresponding to a
segment of the 3' non-coding region of the genome, 100 nucleotides
upstream of the poly(A) tail). A diffuse band of the PCR products
with sizes ranging from 250 to 350 nucleotides was purified from
agarose gel, and cloned into the pSK+ vector. Seven independent
clones were sequenced. Sequence analysis indicated that the polyA
sequence at the 3' end of the genome and the leader sequence at the
5' end of the genome were ligated together in all 7 clones, but
only 95-96 nucleotides from the 3' end of the leader sequence were
ligated with 3' end of the viral genome. The sizes of the polyA
sequenced clones varied in each clone ranging from 9 to 42
nucleotides, indicating that sequenced clones were independent. The
putative full-length leader sequence of VR2385 was determined by
direct RNA sequencing of the 5'-end of virion RNA isolated from
sucrose gradient purified virus (Example 7).
[0334] Leader mRNA junction sequences and intergenic regions within
the genome of VR2385. In order to characterize leader body junction
regions of sg RNAs of the VR2385 strain, RT-PCR was performed with
leader specific primer and primers, specific for each sg mRNA.
Total RNAs isolated at 20 hours post infection (h.p.i.) were used
for RT-PCR. The predominant bands were isolated from agarose gel,
cloned and sequenced. Direct sequencing of the PCR products was
also performed. In order to identify leader body junction region in
the genome of the PRRSV, a leader specific .sup.32P-labeled probe
was used to screen a random cDNA library generated from viral RNA,
and several clones containing leader-ORF1a junction regions were
isolated and sequenced. The leader body junction regions of sg
mRNAs 2 to 7 were characterized.
[0335] Table 10 summarizes the leader-body junction regions of all
sg mRNAs and their corresponding regions in the virus genome. Only
a single junction site was detected for sg mRNAs 2,3, and 6,
whereas two sites were detected for sg mRNAs 4, 5 and 7, designated
as 4a, 4b, 5a, 5b and 7a, 7b. The leader genome junction region in
VR2385 was represented by a sequence CCACCCCTTTAACC, which is
similar to that of TABLE-US-00011 TABLE 10 Sequence of the
leader-body junction regions of subgenomic mRNAs of VR2385 RNA
SEQUENCE N of clones 5'-leader CCACCCCTTTAACC 4 mRNA2
CCACCCCttgaacc 3 genome cctgtcattgaacc mRNA3 CCACCCCtgtaacc 2
CCACCCCTTtaacc 1 genome ggtcaaatgtaacc mRNA4a CCACCCCTttgacc 1
genome aaggccacttgacc mRNA4b CCACCCCtttcacc 2 CCACCCCgtttcacc 1
genome caattggtttcacc mRNA5.a CCACCCcgtcaact 1 genome
agtgtgcgtcaact mRNA5.b CCACCCCtttagcc 2 CCACCCCttttagcc 1 genome
caactgttttagcc mRNA6 CCACCCCTgtaacc 3 CCACCCCTTtaacc 1 genome
ctacccctgtaacc mRNA7.a CCACCCCTTtaacc 5 CCACCCCTataacc 1 genome
ggcaaatgataacc mRNA7.b CCACCCCCTtaaacc 1 genome agggagtggtaaacc
[0336] The leader body mRNAs junction regions varied in sg mRNAs 3,
4, 5b, 6 and 7a. Table 11 compares the intergenic regions in
genomes of VR2385, LV, LDV and EAV. The intergenic regions of
VR2385, LV and LDV are very similar. Most variations were found in
the first three nucleotides of these regions, whereas the last four
nucleotides are conserved and in most regions are represented by
the sequence AACC. Variations were also found in the first two
nucleotides of this junction sequence (GACC and CACC in the
intergenic region of ORF4 of VR2385, AGCC in the intergenic region
of ORF5b of VR2385, GACC in the intergenic region of ORF3 in LV,
and ACC in the intergenic region of ORF2 of LDV). The intergenic
region for sg mRNA5a of VR2385 is GUCAACU, which is similar to that
of EAV. TABLE-US-00012 TABLE 11 Sequence of the 3' end of the
leader in the genome (RNA1) and junction sites of subgenotnic mRNAs
2 to 7 of VR2385, LV, LDV and EAV. RNA VR2385 LV LDV EAV 1 UUUAACC
UUUAACC UAUAACC AUCAACU 2 UUGAACC GUAAACC UAU-ACC UUCAACU 3.1
UGUAACC GUUGACC UGUAACC GUCAA-U 3.2 AUCAACU 3.3 AU-AAUU 4a CUUGACC
4b UUUCACC UUCAACC UGUAACC GUCAACU 5.a GUCAACU 5.b UUUAGCC UACAACC
UAUAACC GUCAACU 6 UAUAACC CUCAACC UAAAACC GUCAACC 7.a GAUAACC 7.b
GUAAACC GUUAACC CCUAACC CUCAACU
[0337] The positions of intergenic sites upstream of the start
codon of the corresponding ORFs vary from 4 to 231 nucleotides.
Table 12 compares the location of intergenic sites in the genomes
of VR2385 and LV (numbers represents distance in nucleotides
between the intergenic site and AUG start codon of the
corresponding ORF.) The locations of these sites in the genome of
VR2385 and LV differ in sg mRNAs 3, 4, 5 and 6. Three alternative
intergenic sites for the synthesis of sg mRNAs 4,5 and 7 of VR2385
genome were also identified. Previously, that only six bands of sg
mRNAs were detected in the cells infected with VR2385 by Northern
blot hybridization analysis. To confirm that the additional sg
mRNAs are actually synthesized during the replication of VR2385, a
nested RT-PCR was performed by using leader and ORF specific
primers. The amplified PCR products were similar in sizes
corresponding to additional mRNAs 4a 5a and 7a (FIG. 26). The
results indicated that the intergenic sites 4b and 5b of sg mRNAs 4
and 5 which is located closer to the start codon of the
corresponding ORF were frequently used in sg mRNA synthesis. The sg
mRNAs 4 and 5 were predominantly generated from intergenic sites 4b
and 5b while only a minor population was generated by using
alternative sites 4a and 5a. In the case of sg mRNA7 the integenic
site 7a located 123 nt upstream of start codon of ORF7 was
frequently used, whereas site 7b located 9 nt upstream of start
codon of ORF7 was less involved in sg mRNA7 synthesis.
TABLE-US-00013 TABLE 12 Location of the intergenic sites inside of
the genome of VR2385 and LV. Position of the junction site RNA
VR2385 LV RNA2 20 38 RNA3 83 11 RNA4 231 & 4 83 RNA5 157 &
40 32 RNA6 17 24 RNA7 123 & 9 9
[0338] Comparison of the leader genome junction sequence with
sequences of the intergenic regions and sequences of leader body
junction regions in sg mRNAs indicated that only the last seven
nucleotides of leader (TTTAACC) possess homology with the sequences
of the intergenic regions in the genome of VR2385. The overall
homology varies from 5 to 7 nt, and the only exception was sg mRNA6
where 11 out of 12 nt in the intergenic region are similar to the
3' end of the leader sequence. In the leader body junction regions
of the sg mRNA, the CCACCCC sequence is conserved and generated
from leader. The sequence following CCACCCC, however, varied for
different sg mRNAs, but has a high level of homology with the
TTTAACC sequence at the 3' end of the leader. The variations in the
leader body junction sequences detected for different sg mRNAs
indicates that leader body joining is imprecise. Nucleotide
sequence comparisons between the 3' end of the leader, leader body
junction regions of the sg mRNAs and intergenic regions within the
genome of VR2385 allowed detection of regions of actual joining
between leader and body of sg mRNA (Table II, underlined).
[0339] Conclusions. The mechanism of subgenomic mRNA synthesis of
U.S. isolates of PRRSV is similar to that of LV, LDV and EAV.
Intergenic regions detected in VR2385 were more variable and were
located at different sites when compared to LV. Variations in
leader body junction sequences indicate that leader body joining is
imprecise. The locations of actual leader body joining sites in sg
mRNAs suggest that mechanism(s) other than leader priming may be
involved in the synthesis of sg mRNAs. Alternative leader-body
junction sites in the genomes of U.S. isolates of PRRSV can result
in the variation of the number of sg mRNA among different strains
of PRRSV.
EXAMPLE 9
[0340] The following provides a reliable test for the
identification and differentiation of high passage ISU55 strain of
PRRSV from field isolates of PRRSV. In previous studies the
sequence of the low passage ISU55 strain (passage 7) was determined
and this sequence was used to develop an RFLP test for
differentiation of ISU55 hp strain. As a first step, the sequence
of ISU55 p-7 was analyzed to identify variable regions containing
unique restriction sites. After computer sequence analysis and
comparison with sequences of different PRRSV strains, a specific
region containing two unique restriction sites was identified at
the 3' end of ORF4. These two restriction sites were DraI (TTT/AAA)
at position 1510 and BalI (MscI) (TGG/CCA) at position 1697
relative to the location upstream of the ATG start codon of ORF2 in
ISU55 (p-7) sequence. These two restriction sites were present only
in the corresponding region of ISU55 strain but not in the other
PRRSV strains.
[0341] In order to confirm the results of the computer analysis,
the sequence of high passage ISU55 strain was determined. The
genomic region including ORFs 3 to 7 (2696 b.p.) was amplified by
PCR and sequenced. The sequence of high passage ISU55 was compared
with that of the ISU55 passage 7. The results of this comparison
are shown in FIG. 27 (cDNA alignment), FIG. 28 (ORF maps) and FIG.
29 (restriction pattern with restriction enzymes DraI and BalI).
The sequences of the low passage and high passage of PRRSV ISU55
were very conserved. There were only 15 nucleotide substitutions in
high passage ISU55 strain. The sizes and relative positions of ORFs
3 to 7 remain the same. A single nucleotide change in the high
passage virus created an additional DraI site in the sequence of
the high passage virus compared to the low passage ISU55 (FIG. 29).
This finding affords an opportunity to distinguish the high passage
virus from the low passage ISU55 virus. A BLAST search was
conducted to compare specific regions of ISU55 high passage strain
with other PRRSV sequences available in the GenBank database. The
237b.p. fragment including the unique restriction sites of ISU 55
high passage strain (two DraI sites at position 966 and 1159 and
BalI site at position 1157, restriction map of ISU55 hp.) was used
as the template for comparison. The results of the blast search
indicated that these sites are unique for ISU55 high passage strain
and are not present in 24 other PRRSV isolates available in the
database.
[0342] The ORF5 (603 bp.) of ISU55 high passage strain was also
compared with the ORF5 of other PRRSV strains. As expected, ISU55
passage 7 strain has the highest homology score and there are only
3 nucleotide substitutions. The strain with the second highest
homology score was NADC8 which has 33 nucleotide substitutions in
ORF5 compared to the ORF5 of ISU55 hp strain. The rest of PRRSV
strains compared in the BLAST search displayed more variations (up
to 63 nt changes) in the ORF5. These data clearly indicate that
ISU55 PRRSV strain is different from all other PRRSV strains
characterized so far.
[0343] An PCR-RFLP was developed to differentiate ISU55 high
passage strain from ISU55 lp virus and other strains of PRRSV. For
the RFLP test two primers were synthesized: forward primer 55F
5'-CGTACGGCGATAGGGACACC-3' (pos. 823) and reverse primer 3RFLP
5'-GGCATATATCATCACTGGCG-3' (pos. 1838) (positions from the 5' end
of 2696 bp. sequenced fragment of ISU55 high passage strain). The
reverse primer for the PCR-RFLP test was the same as the one used
in a PCR-RFLP test to differentiate MLV ResPRRSV vaccine strain
since this primer has been used in the PCR-RFLP with a large number
of PRRSV isolates and shown to be specific (Wesley et al, J. Vet.
Diagn. Invest. 10:140-144 (1998); Wesley et al, Amer. Assoc. Of
Swine Practitioners, pp. 141-143 (1996); Andreyev et al, Arch.
Virol. 142:993-1001 (1997); Mengeling, et al, 1997, all of which
are incorporated herein by reference in their entireties). These
two primers amplify a 1026 bp cDNA fragment of PRRSV ISU55 high
passage strain. After digestion with restriction enzyme with DraI
three fragments (626 bp, 187 bp and 135 bp) will be generated.
After digestion with BalI, two fragments with sizes 626 and 322 bp
will be formed. After PCR and restriction enzyme digestions of
other PRRSV strains, a 1026 bp fragment will be formed according to
the analysis of computer data. To validate the PCR-RFLP test, total
RNA was isolated from ISU55 hp, ISU12 lp, ISU12 hp strains and
subjected to RT-PCR with primers 55F and 3RFLP. A 1026 bp fragment
was amplified from all the isolates. These fragments were purified
and digested with restriction enzymes DraI and BalI. The resulting
products were analyzed in 1.5% agarose gel. FIG. 30 shows the
results of the test. Line one shows an untreated 1026 bp PCR
fragment of ISU55hp strain. Line 2 and 5 shows PCR products of
ISU55 hp digested with DraI (line 2) and BalI (line 5). The 626 bp,
187 bp and 135 bp fragments were formed after digestion with DraI,
and 626 and 322 bp. fragments were formed after digestion with
BalI. Lines 3, 4, 6, and 7 show results of DraI digestion (lines 3
and 4) and BalI digestion (lines 6 and 7) of PCR products of ISU12
lp (lines 3 and 6) and ISU12 hp (lines 4 and 7) strains. In all
reactions with ISU12 lp and hp strains a PCR fragment of 1026 bp
was detected. These data correlate with the predictions for the
PCR-RFLP differentiation test for the ISU55 hp strain.
[0344] Obviously, numerous modifications and variations of the
present invention are possible in light of the above teachings. It
is therefore to be understood that within the scope of the appended
claims, the invention may be practiced otherwise than as
specifically described herein.
EXAMPLE 10
[0345] Sequencing of the Genome of the Attenuated PRRSV Vaccine
Strain (ISU55 p49).
[0346] After the sequence of VR2385 strain was determined,
generated sequencing information was used in order to determine
sequence of the attenuated vaccine PRRSV strain (Vaccine Strain).
The entire genome of Vaccine Strain was amplified in 21 overlapping
fragments and sequenced. When sequencing data were combined, the
entire size of the gnome was 15,412 nucleotides, which is 309 nt
longer compare to the length of the genome of VR2385 strain. The
ORFs map and their locations are shown on FIG. 31. Genome
comparison of Vaccine Strain and VR2385 strains showed the same
sizes and relative locations of the ORFs lb through ORF7. The ORF1a
was the most variable and one 309 nucleotides deletion was found in
the genome of VR2385 compared to the sequence of Vaccine Strain.
This deletion was in frame and located in the region of ORF1a at
position 3242 nucleotide from the 5' end of genome of VR2385 PRRSV.
Another three nucleotides were deleted in the region 2504-2515 nt
of the genome causing 1 aa deletion compare to the genome of
Vaccine Strain. Results of genome comparison of different ORFs of
Vaccine Strain and VR2385 strain are summarized in the Table 13.
Overall DNA homology between these strains was about 91% with 14094
nucleotides identical in both strains. Not including 309 nt
deletion DNA homology was 93%. Leader sequence was determined only
for VR2385 strain by direct sequencing of the viral RNA and 17 bp
primer specific for 5' end of the leader of VR2385 was used to
amplify 170 nt portion of the leader of Vaccine Strain. Comparison
of these sequences showed overall homology of 94% with single
nucleotides deletions in both strains: nucleotides A (pos. 75) and
G (pos. 119) of VR2385 leader are missing in the leader of Vaccine
Strain, and nucleotides A (pos. 87) and G (pos. 124) of Vaccine
Strain leader are missing in the leader of VR2385 strain.
[0347] The ORF1a in the Vaccine Strain extends from nts 191 to 7699
and encodes 2503 amino acid (aa) protein, which is 103 aa longer
compare to the ORF 1a protein of VR2385 strain. Overall aa identity
in between ORF1a predicted proteins of the Vaccine Strain and
VR2385 was 88% (92% not including deletion in VR2385). Comparison
with ORF1a protein of LV showed approximately 47% of aa identity
overall, but several regions with different protein similarity can
be identified. Relatively conservative 5' end (aa 1 to 529 in
Vaccine Strain and aa 1 to 521 in LV, 50% aa identity), relatively
conservative 3' end (aa 1232 to 2503 in Vaccine Strain and aa 1115
to 2396 in LV, 58% aa identity), and hypervariable region (HVR) in
between (aa 530 to 1231 in Vaccine Strain and aa 522 to 1114 in LV,
aa identity less than 40%). When we studied homology in HVR in more
details, we were able to detect one short region (94 aa), where aa
homology was 50% between Vaccine Strain and LV. This region extends
from aa 1015 to 1108 in the Vaccine Strain and aa 929 to 1021 in
LV. Interestingly, in exception of the first four aa (ITRK) this
region was deleted in VR2385 strain. To summarize, homology in the
ORF 1a predicted protein can be presented as follows: conservative
region 1 (aa 1 to 529 in the vaccine Strain/VR2385 strain, aa 1 to
521 in LV, 90% a identity between Vaccine Strain and VR2385, 50% aa
identity between Vaccine/VR2385 strains and LV), hypervariable
region (HVR) (aa 530 to 1231 in the Vaccine Strain, aa 520 to 1127
in the VR2385 strain, aa 522 to 1232 in LV, 84% aa identity between
Vaccine Strain and VR2385, 103 aa deletion in the ORF 1a protein of
VR2385, less then 40% aa identity between Vaccine/VR2385 strains
and LV), and conservative region 2 (aa 1232 to 2503 in the Vaccine
Strain, aa 1128 to 2399 in the VR2385 strain, aa 1128 to 2396 in
LV, 96% aa identity between Vaccine Strain and 57% aa identity
between Vaccine/VR2385 strains and LV). The 94 amino acid fragment
(aa 929 to 1021) in the HVR of the Vaccine Strain posses 50% aa
homology with LV, and this region is deleted in VR2385 strain.
[0348] The ORF 1b in the Vaccine Strain extends from nts 7687 to
12069 and encodes 1461 aa protein, which is similar in size to that
of VR2385. Nucleotide and amino acid comparison showed, that ORF1b
is much more conservative compare to ORF1a. Nucleotide homology
between Vaccine Strain and VR2388 was 93%, with 97% homology of
their predicted proteins. Comparison with ORF1b of LV (1462 aa)
showed 67% of aa identity. One variable region was detected at the
3' end of ORF1b (aa 1367-1461) compare to LV.
[0349] The ORF2 to ORF7 region of the vaccine strain showed similar
genome organization to that of VR2385, with similar sizes and
relative locations of the ORFs. Data of homology comparison between
Vaccine Strain and VR2385 are presented in the Table 13, Nucleotide
(amino acid) identity of Vaccine Strain with LV was 66% (61%) for
ORF2, 61% (55%) for ORF3, 66% (67%) for ORF4, 63% (51%) for ORF5,
68% (79%) for ORF6, and 60% (58%) for ORF7. TABLE-US-00014 TABLE 13
Comparison of the ORFs and DNA homology between VR2385 p8, ISU55
p49 (Vaccine Strain) and LV Size of the ORF Homology with
(nucleotides) VR2385:nt(aa) ORF VR2385 ISU55 LV ISU55 LV 1a 7197
7509 7188 89 (88) 1b 4383 4383 4386 93 (97) 64 (67) 2 768 768 747
97 (95) 65 (60) 3 762 762 795 94 (95) 64 (55) 4 534 534 549 96 (97)
66 (66) 5 600 600 603 93 (90) 63 (54) 6 522 522 519 97 (93) 68 (78)
7 369 369 384 96 (94) 60 (57)
EXAMPLE 11
[0350] Analysis of Deletions in VR 2385 Isolates.
[0351] A PCR product amplified from VR 2385 PRRSV showed the
presence of a 445 bp deletion in the ORF1a. The 445 bp deletion, as
well as the 309 bp deletion noted above, were in frame, overlapped
and appeared to of independent origin. It was assumed that after
plaque purification these deletion variants appeared in the
population of VR2385 and the variant with the 445 nt deletion
became predominant in the virus stock. This variant appears to be
stable based on PCR studies of RNA isolated from low passage virus,
high passage virus and from virus passed twice through pig. The 309
bp deletion variant appeared to be minor and could be amplified
from some virus stocks with specific primers only by nested
PCR.
EXAMPLE 12
[0352] Characterization of Serially Passaged PRRSV.
[0353] To determine if attenuation occurs due to cell culture
passage, VR 2385 passage 7 (p7) and VR 2385 passage 85 (p85) were
used to infect 3 week-old pigs. At 10 days post-infection,
estimated gross lung lesions and clinical respiratory scores were
significantly higher in the pigs infected with the lower passage
virus. The ORF 2-7 region of the genome was sequenced and compared.
Genetic analysis of the two passages of VR 2385 shows that ORF 6
was the most conserved, with 100% homology at the amino acid level.
The remaining ORFs showed amino acid homology of 95-98%, with ORF2
of VR 2385 p85 containing a premature stop codon resulting in a
putative 10 amino acid truncation.
Sequence CWU 1
1
175 1 2352 DNA Porcine reproductive and respiratory syndrome virus
1 cctgtcattg aaccaacttt aggcctgaat tgagatgaaa tggggtctat gcaaagcctt
60 tttgacaaaa ttggccaact ttttgtggat gctttcacgg agttcttggt
gtccattgtt 120 gatatcatta tatttttggc cattttgttt ggcttcacca
tcgcaggttg gctggtggtc 180 ttttgcatca gattggtttg ctccgcgata
ctccgtgcgc gccctgccat tcactctgag 240 caattacaga agatcctatg
aggcctttct ctctcagtgc caggtggaca ttcccacctg 300 gggaactaaa
catcctttgg ggatgctttg gcaccataag gtgtcaaccc tgattgatga 360
aatggtgtcg cgtcgaatgt accgcatcat ggaaaaagca ggacaggctg cctggaaaca
420 ggtagtgagc gaggctacgc tgtctcgcat tagtagtttg gatgtggtgg
ctcattttca 480 gcatcttgcc gccattgaag ccgagacctg taaatatctg
gcctctcggc tgcccatgct 540 acaccacctg cgcatgacag ggtcaaatgt
aaccatagtg tataatagta ctttgaatca 600 ggtgtttgct gttttcccaa
cccctggttc ccggccaaag cttcatgatt tccagcaatg 660 gctaatagct
gtacattcct ctatattttc ctctgttgca gcttcttgta ctctttttgt 720
tgtgctgtgg ttgcgggttc caatgctacg tactgttttt ggtttccgct ggttaggggc
780 aatttttctt tcgaactcac ggtgaattac acggtgtgcc cgccttgcct
cacccggcaa 840 gcagccgcag aggcctacga acccggcagg tccctttggt
gcaggatagg gcatgatcga 900 tgtggggagg acgatcatga tgaactaggg
tttgtggtgc cgtctggcct ctccagcgaa 960 ggccacttga ccagtgctta
cgcctggttg gcgtccctgt ccttcagcta tacggcccag 1020 ttccatcccg
agatattcgg gatagggaat gtgagtcgag tctatgttga catcaagcac 1080
caattcattt gcgctgttca tgatgggcag aacaccacct tgccccacca tgacaacatt
1140 tcagccgtgc ttcagaccta ttaccagcat caggtcgacg ggggcaattg
gtttcaccta 1200 gaatgggtgc gtcccttctt ttcctcttgg ttggttttaa
atgtctcttg gtttctcagg 1260 cgttcgcctg caagccatgt ttcagttcga
gtctttcaga catcaagacc aacaccaccg 1320 cagcggcagg ctttgctgtc
ctccaagaca tcagttgcct taggcatcgc aactcggcct 1380 ctgaggcgat
tcgcaaagtc cctcagtgcc gcacggcgat agggacaccc gtgtatatca 1440
ctgtcacagc caatgttacc gatgagaatt atttgcattc ctctgatctt ctcatgcttt
1500 cttcttgcct tttctatgct tctgagatga gtgaaaaggg atttaaggtg
gtatttggca 1560 atgtgtcagg catcgtggca gtgtgcgtca acttcaccag
ttacgtccaa catgtcaagg 1620 aatttaccca acgttccttg gtagttgacc
atgtgcggct gctccatttc atgacgcccg 1680 agaccatgag gtgggcaact
gttttagcct gtctttttac cattctgttg gcaatttgaa 1740 tgtttaagta
tgttggggaa atgcttgacc gcgggctgtt gctcgcaatt gcttttttta 1800
tggtgtatcg tgccgtcttg ttttgttgcg ctcgtcagcg ccaacgggaa cagcggctca
1860 aatttacagc tgatttacaa cttgacgcta tgtgagctga atggcacaga
ttggctagct 1920 aataaatttg actgggcagt ggagtgtttt gtcatttttc
ctgtgttgac tcacattgtc 1980 tcttatggtg ccctcactac tagccatttc
cttgacacag tcggtctggt cactgtgtct 2040 accgctgggt ttgttcacgg
gcggtatgtt ctgagtagca tgtacgcggt ctgtgccctg 2100 gctgcgttga
tttgcttcgt cattaggctt gcgaagaatt gcatgtcctg gcgctactca 2160
tgtaccagat ataccaactt tcttctggac actaagggca gactctatcg ttggcggtcg
2220 cctgtcatca tagagaaaag gggcaaagtt gaggtcgaag gtcacctgat
cgacctcaaa 2280 agagttgtgc ttgatggttc cgcggctacc cctgtaacca
gagtttcagc ggaacaatgg 2340 agtcgtcctt ag 2352 2 2349 DNA Porcine
reproductive and respiratory syndrome virus 2 cctatcattg aaccaacttt
gggtctagac tgaaatgcaa tggggtccat gcaaagcctt 60 tttgacaaga
tcggtcaact ttttgtggat gctttcacgg agttcttggt gtccattgtt 120
gatatcatca tatttttggc cattttgttt ggcttcacca ttgccggctg gctggtggtc
180 ttttgcatca gattggtttg ctccgcgata ctccgtgcgc gccctgccat
tcaccctgag 240 caattacaga agatcctatg aggcctttct ttctcagtgc
caggtggaca ttcccgcctg 300 gggaacaaga catcctttag ggatgctttg
gcaccacaag gtgtcaaccc tgattgatga 360 aatggtgtcg cgtcgaatgt
accgcatcat ggaaaaagca ggacaggctg cctggaaaca 420 ggtggtgagt
gaggctacgc tgtctcgcat tagtggtttg gatgtggtgg cccattttca 480
gcaccttgcc gccattgaag ccgagacttg taaatatttg gcctctcggt tgcccatgct
540 acacaacctg cgtattacag ggtcaaatgt aaccatagtg cataatagta
ctttgaatca 600 ggtgtttgct attttcccaa cccccggttc tcggccaaag
ctccatgatt ttcagcaatg 660 gctaatagct gtacattcct cgatatcctc
ctctgttgca gcttcttgta ctctttttgt 720 tgtgttgtgg ttacggatgc
caatgctacg ttctgttttt ggtttccgct ggttaggggc 780 aatttttcct
tcgagctcat ggtgaattac acggtgtgcc caccttgcct cacccggcaa 840
gcagccgcac agatctacga acccaacagg tctctttggt gcaggatcgg gaatgatcga
900 tgtggtgagg acgatcacga cgaactagga tttacagtac cgcctggcct
ctccaaagaa 960 gtccatttga ccagtgttta cgcctggttg gcgtttctgt
ccttcagtaa cacggcccag 1020 tttcatcccg agatattcgg aatagggaat
gtgagtaagg tctatgttga catcaatcat 1080 caactcattt gtgctgttca
tgacgggcag aacaccacct tgcctcgcca tgacaacatt 1140 tctgccgtgt
ttcagaccta ttaccaacac caagtcgatg gtggcaactg gtttcaccta 1200
gaatggctgc gtcccttctt ttcctcttgg ttggttttga atgtctcctg gtttctcagg
1260 cgttcgcctg caagccatgt ttcagttcga gtctttcaga catcaagacc
aacaccaccg 1320 cggcagcaaa tttcgctgtc ctccaggaca tcggctgcct
taggcatggc aactcgacca 1380 ctgaggcgtt tcgcaaaatc cctcagtgcc
gcacggcgat agggacaccc gtgtatatca 1440 ctatcacagc caatgtaaca
gatgagaact atttgcattc ttctgatctt ctcatgcttt 1500 cctcttgcct
tttctacgct tctgagatga gtgaaaaggg gtttaaggtg gtgtttggca 1560
atgtgtcagg caccgtggct gtgtgcatca attttaccag ctatgtccaa cacgtcaagg
1620 agtttaccca acgctcctta gtggtcgacc atgtgcggct gctccatttc
atgacacctg 1680 aaactatgag gtgggcaact gttttagcct gtcttttcgc
cattctgttg gcaatttgaa 1740 tgtttaagta tgttggggaa atgcttgacc
gcgggctgtt gctcgcgatc gctttttttg 1800 tggtgtatcg tgccgttctg
tcttgctgcg ctcgtcagcg ccaacaacag cagctcccat 1860 ttacagttga
tttataacct gacgctatgt gagctgaatg gcacagactg gctggctaat 1920
aaatttgatt gggcagtgga gagttttgtc atctttcccg tgttgactca cattgtttcc
1980 tatggtgcac tcaccaccag ccatttcctt gacacagtcg gtctggttac
tgtgtctacc 2040 gccgggtttc atcacgggcg gtatgttctg agtagcatct
acgcggtctg tgccctggct 2100 gcgtttattt gcttcgtcat taggtttgcg
aagaactgca tgtcctggcg ctactcttgt 2160 accagatata ccaacttcct
tctggacact aagggcagcc tctatcgttg gcggtcacct 2220 gtcatcatag
agaaaggggg taaggttgag gtcgaaggtc atctgatcga cctaaaaaaa 2280
gttgtgcttg atggttccgc ggcaacccct ttaaccagag tttcagcgga acaatggggt
2340 cgtccctag 2349 3 2352 DNA Porcine reproductive and respiratory
syndrome virus 3 cctatcattg aaccaacttt aggcctgaat tgaaatgaaa
tggggtctat gcaaagcctt 60 tttgacaaaa ttggccaact tttcgtggat
gctttcacgg agttcttggt gtccattgtt 120 gatatcatta tatttttggc
cattttgttt ggcttcacca tcgccggttg gctggtggtc 180 ttttgcatca
gattggtttg ctccgcgata ctccgtgcgc gccctgccat tcactctgag 240
caattacaga agatcctatg aggcctttct ttctcagtgc caggtggaca ttcccacctg
300 gggaattaaa catcctttgg ggatgctttg gcaccataag gtgtcaaccc
tgattgatga 360 aatggtgtcg cgtcgaatgt accgcatcat ggaaaaagca
ggacaggctg cctggaaaca 420 ggtggtgagc gaggctacgc tgtctcgcat
tagtagtttg gatgtggtgg ctcactttca 480 gcatcttgcc gccattgaag
ccgagacctg taaatatttg gcctctcggc tgcccatgct 540 acacaacctg
cgcatgacag ggtcaaatgt aaccatagtg tataatagta ctttgaatca 600
ggtgcttgct attttcccaa cccctggttc ccggccaaag cttcatgatt ttcagcaatg
660 gctaatagct gtacattcct ctatattttc ctctgttgca gcttcttgta
ctctttttgt 720 tgtgctgtgg ttgcgggttc caatgctacg tattgctttt
ggtttccgct ggttaggggc 780 aatttttctt tcgaactcac agtgaactac
acggtgtgtc caccttgcct cacccggcaa 840 gcagccacag aggcctacga
acctggcagg tctctttggt gcaggatagg gtatgatcgc 900 tgtggggagg
acgatcatga tgaactaggg tttgtggtgc cgtctggcct ctccagcgaa 960
ggccacttga ccagtgttta cgcctggttg gcgttcctgt ctttcagtta cacagcccag
1020 ttccatcctg agatattcgg gatagggaat gtgagtcaag tttatgttga
catcaggcat 1080 caattcattt gcgccgttca cgacgggcag aacgccactt
tgcctcgcca tgacaatatt 1140 tcagccgtgt tccagactta ttaccaacat
caagtcgacg gcggcaattg gtttcaccta 1200 gaatggctgc gtcccttctt
ttcctcttgg ttggttttaa atgtctcttg gtttctcagg 1260 cgttcgcctg
caagccatgt ttcagttcga gtcttgcaga cattaagacc aacaccaccg 1320
cagcggcagg ctttgctgtc ctccaagaca tcagttgcct taggtatcgc aactcggcct
1380 ctgaggcgtt tcgcaaaatc cctcagtgtc gtacggcgat agggacaccc
atgtatatta 1440 ctgtcacagc caatgtaacc gatgagaatt atttgcattc
ctctgacctt ctcatgcttt 1500 cttcttgcct tttctacgct tctgagatga
gtgaaaaggg atttaaagtg gtatttggca 1560 atgtgtcagg catcgtggct
gtgtgcgtca actttaccag ctacgtccaa catgtcaagg 1620 aatttaccca
acgctccttg gtagtcgacc atgtgcggct gctccatttc atgacacctg 1680
agaccatgag gtgggcaact gttttagcct gtctttttgc cattctgttg gccatttgaa
1740 tgtttaagta tgttggggaa atgcttgacc gcgggctatt gctcgtcatt
gctttttttg 1800 tggtgtatcg tgccgtcttg gtttgttgcg ctcgccagcg
ccaacagcag caacagctct 1860 catttacagt tgatttataa cttgacgcta
tgtgagctga atggcacaga ttggttagct 1920 ggtgaatttg actgggcagt
ggagtgtttt gtcatttttc ctgtgttgac tcacattgtc 1980 tcctatggtg
ccctcaccac cagccatttc cttgacacag tcggtctggt cactgtgtct 2040
accgccggct tttcccacgg gcggtatgtt ctgagtagca tctacgcggt ctgtgccctg
2100 gctgcgttga tttgcttcgt cattaggttt acgaagaatt gcatgtcctg
gcgctactca 2160 tgtaccagat ataccaactt tcttctggac actaagggca
gactctatcg ttggcggtcg 2220 cctgtcatca tagagaaaag gggtaaagtt
gaggtcgaag gtcatctgat cgacctcaag 2280 agagttgtgc ttgatggttc
cgcggcaacc cctataacca aagtttcagc ggagcaatgg 2340 ggtcgtcctt ag 2352
4 2351 DNA Porcine reproductive and respiratory syndrome virus 4
cctgtcattg aaccaacttt aggcctgaat tgaaatgaaa tgggggccat gcaaagcctt
60 tttgacaaaa ttggccaact ttttgtggat gctttcacgg agttcttggt
gtccattgtt 120 gatatcatta tatttttggc cattttgttt ggcttcacca
tcgccggttg gctggtggtc 180 ttttgcatca gattggtttg ctccgcgata
ctccgtgcgc gccctgccat tcactctgag 240 caattacaga agatcttatg
aggcctttct ttcccagtgc caagtggaca ttcccacctg 300 gggaactaaa
catcctttgg ggatgttgtg gcaccataag gtgtcaaccc tgattgatga 360
aatggtgtcg cgtcgaatgt accgcatcat ggaaaaagca gggcaggctg cctggaaaca
420 ggtggtgagc gaggctacgc tgtctcgcat tagtagtttg gatgtggtgg
ctcattttca 480 gcatcttgct gccattgaag ccgagacctg taaatatttg
gcctcccggc tgcccatgct 540 acacaacctg cgcatgacag ggtcaaatgt
aaccatagtg tataatagta ctttgaatca 600 ggtgtttgct attttcccaa
cccctggttc ccggccaaag cttcatgatt ttcagcaatg 660 gttaatagct
gtacattcct ccatattttc ctctgttgca gcttcctgta ctctttttgt 720
tgtgctgtgg ttgcgggttc caatactacg ttctgttttt ggtttccgct ggttaggggc
780 aatttttctt tcgagctcac ggtgaattac acggtgtgtc caccttgcct
cacccggcaa 840 gcagccgcag agatctacga acccggtagg tctctttggt
gcaggatagg gtatgaccga 900 tgtggggagg acgatcatga cgagctaggg
tttatggtac cacctggctt ctccagcgaa 960 ggccacttga ctagtgttta
cgcctggttg gcgtttttgt ccttcagcta cacggcccag 1020 ttccatcccg
agatattcgg gatagggaac gtgagtcgag tttatgttga catcaaacat 1080
caactcatct gcgccgaaca tgacgggcaa aacaccacct tgcctcgtca tgacaacatt
1140 tcagccgtgt ttcagaccta ttaccaacat caagtcgacg gtggcaattg
gtttcaccta 1200 gaatggcttc gtcccttctt ttcctcatgg ttggttttaa
atgtctcttg gtttctcagg 1260 cgttcgcctg caaaccatgt ttcagttcga
gtcttgcaga tattaagacc aacaccaccg 1320 cagcggcaag ctttgctgtc
ctccaagaca tcggttgcct taggcatcgc gactcggcct 1380 ctgaggcgat
tcgcaaaatc cctcagtgcc gtacggcgat agggacaccc gtgtatatta 1440
ccatcacagc caatgtgaac gatgagaatt atttacattc ttctgatctc ctcatgcttt
1500 cttcttgcct tttctatgct tctgagatga gtgaaaaggg gtttaaggtg
gtatttggca 1560 atgtgtcagg catcgtggct gtgtgtgtca attttaccag
ctatgtccaa catgtcaggg 1620 agtttaccca acgctccttg gtggtcgacc
atgtgcggtt gctccatttc atgacacctg 1680 agaccatgag gtgggcaact
gttttagcct gtctttttgc cattctgttg gcaatttgaa 1740 tgtttaagca
tgttggggaa atgcttgacc gcgggctgtt gctcgcgatt gctttctttg 1800
tggtttatcg tgccgttctg ttttgctgtg ctcgccagcg ccagcaacag cagcagctcc
1860 catctacagt tgatttataa cttgacgcta tgtgagctga atggcacaga
ttggttagct 1920 aataaatttg attgggcagt ggagagtttt gtcatctttc
ccgttttgac tcacattgtc 1980 tcctatggtg ccctcactac cagccatttc
cttgacacag tcgctttagt cactgtgtct 2040 accgccgggt ttgttcacgg
gcggtatgtc ctgagtagca tctacgcggt ctgtgccctg 2100 gctgcgttga
cttgcttcat catcaggttt gcaaagaatt gcatgtcctg gcgctactcg 2160
tgtaccagat ataccaactt tctcctggac actaagggca gactctatcg ttggcggtcg
2220 cctgtcatca tagagaaaag gggcaaagtt gaggtcgaag gtcactgatc
gacctcaaaa 2280 gagttgtgct tgatggttcc gtggcaaccc ctataaccag
agattcagcg gaacaatggg 2340 gtcgtcctta g 2351 5 1947 DNA Porcine
reproductive and respiratory syndrome virus 5 cctgtcattg aaccaacttt
aggcctgaat tgaaatgaaa tggggtccat gcaaagcctt 60 tttgacaaaa
ttggccaact ttttgtggat gctttcacgg agttcttggt gtccattgtt 120
gatatcatta tattcttggc cattttgttt ggcttcacca tcgccggttg gctggtggtc
180 ttttgcatca gattggtttg ctccgcgata ctccgtacgc gccctgccat
tcactctgag 240 caattacaga agatcttatg aggcctttct ttcccagtgc
caagtggaca ttcccacctg 300 gggaactaaa catcctttgg ggatgttttg
gcaccataag gtgtcaaccc tgattgatga 360 gatggtgtcg cgtcgaatgt
accgcatcat ggaaaaagca ggacaggctg cctggaaaca 420 ggtggtgagc
gaggctacgc tgtctcgcat tagtagtttg gatgtggtgg ctcattttca 480
gcatcttgcc gccatcgaag ccgagacctg taaatatttg gcctcccggc tgcccatgct
540 acacaacctg cgcatgacag ggtcaaatgt aaccatagtg tataatagta
ctttgaatcg 600 ggtgtttgct attttcccaa cccctggttc ccggccaaag
cttcatgact ttcagcaatg 660 gctaatagct gtgcattcct ccatattttc
ctctgttgca gcttcttgta ctctctttgt 720 tgtgctgtgg ttgcgggttc
caatactacg tactgttttt ggtttccgct ggttaggggc 780 aatttttctt
tcgaactcat agtgaattac acggtgtgcc caccttgcct cacccggcaa 840
gcagccgcag aggcctacga acccggtagg tctctttggt gcaggatagg gtacgatcga
900 tgtggagagg acgaccatga cgagctaggg tttatgatac cgtctggcct
ctccagcgaa 960 ggccacttga ccagtctgag gcgattcgca aaatccctca
gtgccgtacg gcgataggga 1020 cacctatgta tattaccatc acagccaatg
tgacagatga aaattattta cattcttctg 1080 atctcctcat gctctcttct
tgccttttct atgcttctga gatgagtgaa aagggatttg 1140 aggtggtttt
tggcaatgtg tcaggcatcg tggctgtgtg tgtcaatttt accagctacg 1200
ttcaacatgt cagggagttt acccaacgct ccttgatggt cgaccatgtg cggctgctcc
1260 atttcatgac acctgagacc atgaggtggg caaccgtttt agcctgtctt
tttgctattc 1320 tgttggcaat ttgaatgttt aagtatgttg gggaaatgct
tgaccgtggg ctgttgctcg 1380 cgattgcttt ctttgtggtg tatcgtgccg
ttctgtttta ctgtgctcgc cgacgcccac 1440 agcaacagca gctctcatct
gcaattgatt tacaacttga cgctatgtga gctgaatggc 1500 acagattggc
tagctgatag atttgattgg gcagtggaga gctttgtcat ctttcctgtt 1560
ttgactcaca ttgtctccta tggcgccctc accaccagcc atttccttga cacaattgct
1620 ttagtcactg tgtctaccgc cgggtttgtt cacgggcggt atgtcctaag
tagcatctac 1680 gcggtctgtg ccctggctgc gttgacttgc ttcgtcatta
ggtttgtgaa gaattgcatg 1740 tcctggcgct actcatgtac tagatatacc
aactttcttc tggatactaa gggcagactc 1800 tatcgttggc ggtcgcctgt
catcatagag aagaggggca aagttgaggt cgaaggtcat 1860 ctgatcgatc
tcaaaagagt tgtgcttgat ggttccgtgg caacccctat aaccagagtt 1920
tcagcggaac aatggggtcg tccttag 1947 6 2352 DNA Porcine reproductive
and respiratory syndrome virus 6 cctgtcattg aaccaacttt aggcctgaat
tgagatgaaa tggggtctat gcaaagcctt 60 tttgacaaaa ttggccaact
ttttgtggat gctttcacgg agttcttggt gtccattgtt 120 gatatcatta
tatttttggc cattttgttt ggcttcacca tcgcaggttg gctggtggtc 180
ttttgcatca gattggtttg ctccgcgata ctccgtgcgc gccctgccat tcactctgag
240 caattacaga agatcctatg aggcctttct ctctcagtgc caggtggaca
ttcccacctg 300 gggaactaaa catcctttgg ggatgctttg gcaccataag
gtgtcaaccc tgattgatga 360 aatggtgtcg cgtcgaatgt accgcatcat
ggaaaaagca ggacaggctg cctggaaaca 420 ggtagtgagc gaggctacgc
tgtctcgcat tagtagtttg gatgtggtgg ctcattttca 480 gcatcttgcc
gccattgaag ccgagacctg taaatatctg gcctctcggc tgcccatgct 540
acaccacctg cgcatgacag ggtcaaatgt aaccatagtg tataatagta ctttgaatca
600 ggtgtttgct gttttcccaa cccctggttc ccggccaaag cttcatgatt
tccagcaatg 660 gctaatagct gtacattcct ctatattttc ctctgttgca
gcttcttgta ctctttttgt 720 tgtgctgtgg ttgcgggttc caatgctacg
tactgttttt ggtttccgct ggttaggggc 780 aatttttctt tcgaactcac
ggtgaattac acggtgtgcc cgccttgcct cacccggcaa 840 gcagccgcag
aggcctacga acccggcagg tccctttggt gcaggatagg gcatgatcga 900
tgtggggagg acgatcatga tgaactaggg tttgtggtgc cgtctggcct ctccagcgaa
960 ggccacttga ccagtgctta cgcctggttg gcgtccctgt ccttcagcta
tacggcccag 1020 ttccatcccg agatattcgg gatagggaat gtgagtcgag
tctatgttga catcaagcac 1080 caattcattt gcgctgttca tgatgggcag
aacaccacct tgccccacca tgacaacatt 1140 tcagccgtgc ttcagaccta
ttaccagcat caggtcgacg ggggcaattg gtttcaccta 1200 gaatgggtgc
gtcccttctt ttcctcttgg ttggttttaa atgtctcttg gtttctcagg 1260
cgttcgcctg caagccatgt ttcagttcga gtctttcaga catcaagacc aacaccaccg
1320 cagcggcagg ctttgctgtc ctccaagaca tcagttgcct taggcatcgc
aactcggcct 1380 ctgaggcgat tcgcaaagtc cctcagtgcc gcacggcgat
agggacaccc gtgtatatca 1440 ctgtcacagc caatgttacc gatgagaatt
atttgcattc ctctgatctt ctcatgcttt 1500 cttcttgcct tttctatgct
tctgagatga gtgaaaaggg atttaaggtg gtatttggca 1560 atgtgtcagg
catcgtggca gtgtgcgtca acttcaccag ttacgtccaa catgtcaagg 1620
aatttaccca acgttccttg gtagttgacc atgtgcggct gctccatttc atgacgcccg
1680 agaccatgag gtgggcaact gttttagcct gtctttttac cattctgttg
gcaatttgaa 1740 tgtttaagta tgttggggaa atgcttgacc gcgggctgtt
gctcgcaatt gcttttttta 1800 tggtgtatcg tgccgtcttg ttttgttgcg
ctcgtcagcg ccaacgggaa cagcggctca 1860 aatttacagc tgatttacaa
cttgacgcta tgtgagctga atggcacaga ttggctagct 1920 aataaatttg
actgggcagt ggagtgtttt gtcatttttc ctgtgttgac tcacattgtc 1980
tcttatggtg ccctcactac tagccatttc cttgacacag tcggtctggt cactgtgtct
2040 accgctgggt ttgttcacgg gcggtatgtt ctgagtagca tgtacgcggt
ctgtgccctg 2100 gctgcgttga tttgcttcgt cattaggctt gcgaagaatt
gcatgtcctg gcgctactca 2160 tgtaccagat ataccaactt tcttctggac
actaagggca gactctatcg ttggcggtcg 2220 cctgtcatca tagagaaaag
gggcaaagtt gaggtcgaag gtcacctgat cgacctcaaa 2280 agagttgtgc
ttgatggttc cgcggctacc cctgtaacca gagtttcagc ggaacaatgg 2340
agtcgtcctt ag 2352 7 2352 DNA Porcine reproductive and respiratory
syndrome virus 7 cccgtcattg aaccaacttt aggcctgaat tgaaatgaaa
tggggtccgt gcaaagcctt 60 tttgacaaaa ttggccaact ttttgtggat
gctttcacgg agttcctggt gtccattgtt 120 gatatcatca tatttttggc
cattttgttt ggcttcacca tcgccggttg gctggtggtc 180 ttttgcatca
gattggtttg ctccgcgata ctccgtacgc gccctgccat tcactctgag 240
caattacaga agatcttatg aggccttttt atcccagtgc caagtggaca ttcccacctg
300 gggaactaaa catcctttgg ggatgttttg gcaccataag gtgtcaaccc
tgattgatga 360 aatggtgtcg cgtcgcatgt accgcatcat ggaaaaagca
gggcaggctg cctggaaaca 420 ggtggtgagc gaggctacgc tgtcccgcat
tagtagtttg gatgtggtgg ctcattttca 480 gcatcttgcc gccattgaag
ccgagacttg taaatatttg gcctcccggc tgcccatgct 540 acataacctg
cgcataacag ggtcaaatgt aaccatagtg tataatagta cttcggagca 600
ggtgtttgct attttcccaa cccctggttc ccggccaaag cttcatgatt ttcagcaatg
660
gttaatagct gtacattcct ccatattttc ctctgttgca gcttcttgta ctctttttgt
720 tgtgctgtgg ctgcgggttc caatgctacg tactgttttt ggtttccgct
ggttaggggg 780 aatttttcct tcgaactcat ggtgaattac acggtgtgtc
caccttgcct cacccggcaa 840 gcagccgcag aggtctacga acccggtagg
tctctttggt gcaggatagg gtatgaccga 900 tgtggggagg acgatcatga
cgagctaggg tttatgatac cgcctggcct ctccagcgaa 960 ggccacttga
ctagtgttta cgcctggttg gcgtttttgt ccttcagcta cacggcccag 1020
ttccatcccg agatattcgg gatagggaat gtgagtcgag tttatgttga catcaaacat
1080 caactcattt gcgccgaaca tgacggacag aacgccacct tgcctcgtca
tgacaatatt 1140 tcagccgtgt ttcagaccta ttaccaacat caagtcgatg
gcggcaattg gtttcaccta 1200 gaatggcttc gtcccttctt ttcctcatgg
ttggttttaa atgtctcttg gtatctcagg 1260 cgttcgcctg caaaccatgc
ttcagttcga gtcttgcaga tattaagacc aacactaccg 1320 cagcggcaag
ctttgctgtc ctccaagaca tcagttgcct taggcatcgc aactcggcct 1380
ctgaggcgat tcgcaaaatc cctcagtgcc gtacggcgat agggacaccc gtgtatatta
1440 ccatcacagc caatgtgaca gatgagaatt atttacattc ttctgatctc
ctcatgcttt 1500 cttcttgcct tttctacgct tctgagatga gtgaaaaagg
attcaaggtg gtatttggca 1560 atgtgtcagg catcgtggct gtgtgtgtca
attttaccag ctacgtccaa catgtcaggg 1620 agtttaccca acgctccctg
gtggtcgacc atgtgcggtt gctccatttc atgacacctg 1680 aaaccatgag
gtgggcaact gttttagcct gtctttttgc cattctgctg gcaatttgaa 1740
tgtttaagta tgttggggaa atgcttgacc gcgggctgtt gctcgcgatt gctttctttg
1800 tggtgtatcg tgccgttctg ttttgctgtg ctcgccaacg ccagcgccaa
cagcagctcc 1860 catctacagc tgatttacaa cttgacgcta tgtgagctga
atggcacaga ttggctagct 1920 gataaatttg attgggcagt ggagagtttt
gtcatctttc ccgttttgac tcacattgtc 1980 tcctatggtg ccctcactac
tagccatctc cttgacacag tcgccttagt cactgtgtct 2040 accgccgggt
ttgttcacgg gcggtatgtc ctaagtagca tctacgcggt ctgtgccctg 2100
gctgcgttag cttgcttcgt cattaggttt gcaaagaatt gcatgtcctg gcgctattcg
2160 tgtaccagat ataccaactt tcttctggac actaagggca gactctatcg
ttggcattcg 2220 cctgtcatca tagagaaaag gggcaaagtt gaggtcgaag
gtcatctgat cgacctcaaa 2280 agagttgtgc ttgacggttc cgtggcaacc
cctataacca gagtttcagc ggaacaatgg 2340 ggtcgtcctt ag 2352 8 256 PRT
Porcine reproductive and respiratory syndrome virus 8 Met Lys Trp
Gly Leu Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe 1 5 10 15 Leu
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu 20 25
30 Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Gln Val Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Thr Trp Gly
Thr Lys His Pro Leu Gly 85 90 95 Met Leu Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Met Leu Arg Met Thr Gly
165 170 175 Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Gln Val
Phe Ala 180 185 190 Val Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Phe
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Val Pro Met Leu Arg Thr 225 230 235 240 Val Phe Gly Phe Arg
Trp Leu Gly Ala Ile Phe Leu Ser Asn Ser Arg 245 250 255 9 256 PRT
Porcine reproductive and respiratory syndrome virus 9 Met Lys Trp
Gly Pro Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe 1 5 10 15 Leu
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu 20 25
30 Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Thr Trp Gly
Thr Lys His Pro Leu Gly 85 90 95 Met Leu Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly
165 170 175 Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Gln Val
Phe Ala 180 185 190 Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Phe
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Val Pro Ile Leu Arg Ser 225 230 235 240 Val Phe Gly Phe Arg
Trp Leu Gly Ala Ile Phe Leu Ser Ser Ser Arg 245 250 255 10 255 PRT
Porcine reproductive and respiratory syndrome virus 10 Met Lys Trp
Gly Pro Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe 1 5 10 15 Leu
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu 20 25
30 Ser Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Thr Trp Gly
Thr Lys His Pro Leu Gly 85 90 95 Met Phe Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly
165 170 175 Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Arg Val
Phe Ala 180 185 190 Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Phe
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Val Pro Ile Leu Arg Thr 225 230 235 240 Val Phe Gly Phe Arg
Trp Leu Gly Ala Ile Phe Leu Ser Asn Ser 245 250 255 11 256 PRT
Porcine reproductive and respiratory syndrome virus 11 Met Lys Trp
Gly Leu Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe 1 5 10 15 Ser
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu 20 25
30 Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Thr Trp Gly
Ile Lys His Pro Leu Gly 85 90 95 Met Phe Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly
165 170 175 Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Gln Val
Leu Ala 180 185 190 Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Phe
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Val Pro Met Leu Arg Ile 225 230 235 240 Ala Phe Gly Phe Arg
Trp Leu Gly Ala Ile Phe Leu Ser Asn Ser Gln 245 250 255 12 256 PRT
Porcine reproductive and respiratory syndrome virus 12 Met Lys Trp
Gly Pro Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe 1 5 10 15 Leu
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Ser 20 25
30 Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Thr Trp Gly
Thr Lys His Pro Leu Gly 85 90 95 Met Phe Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Ile Thr Gly
165 170 175 Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Ser Glu Gln Val
Phe Ala 180 185 190 Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Phe
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Val Pro Met Leu Arg Thr 225 230 235 240 Val Phe Gly Phe Arg
Trp Leu Gly Gly Ile Phe Pro Ser Asn Ser Trp 245 250 255 13 256 PRT
Porcine reproductive and respiratory syndrome virus 13 Met Gln Trp
Gly Pro Cys Lys Ala Phe Leu Thr Arg Ser Val Asn Phe 1 5 10 15 Leu
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Ser 20 25
30 Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Leu Pro Ala Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Ala Trp Gly
Thr Arg His Pro Leu Gly 85 90 95 Met Leu Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Gly Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Ile Thr Gly
165 170 175 Ser Asn Val Thr Ile Val His Asn Ser Thr Leu Asn Gln Val
Phe Ala 180 185 190 Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Ser
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Met Pro Met Leu Arg Ser 225 230 235 240 Val Phe Gly Phe Arg
Trp Leu Gly Ala Ile Phe Pro Ser Ser Ser Trp 245 250 255 14 256 PRT
Porcine reproductive and respiratory syndrome virus 14 Met Lys Trp
Gly Pro Cys Lys Ala Phe Leu Thr Lys Leu Ala Asn Phe 1 5 10 15 Leu
Trp Met Leu Ser Arg Ser Ser Trp Cys Pro Leu Leu Ile Ser Leu 20 25
30 Tyr Phe Trp Pro Phe Cys Leu Ala Ser Pro Ser Pro Val Gly Trp Trp
35 40 45 Ser Phe Ala Ser Asp Trp Phe Ala Pro Arg Tyr Ser Val Arg
Ala Leu 50 55 60 Pro Phe Thr Leu Ser Asn Tyr Arg Arg Ser Tyr Glu
Ala Phe Leu Ser 65 70 75 80 Gln Cys Gln Val Asp Ile Pro Thr Trp Gly
Thr Lys His Pro Leu Gly 85 90 95 Met Leu Trp His His Lys Val Ser
Thr Leu Ile Asp Glu Met Val Ser 100 105 110 Arg Arg Met Tyr Arg Ile
Met Glu Lys Ala Gly Gln Ala Ala Trp Lys 115 120 125 Gln Val Val Ser
Glu Ala Thr Leu Ser Arg Ile Ser Ser Leu Asp Val 130 135 140 Val Ala
His Phe Gln His Leu Ala Ala Ile Glu Ala Glu Thr Cys Lys 145 150 155
160 Tyr Leu Ala Ser Arg Leu Pro Met Leu His Asn Leu Arg Met Thr Gly
165 170 175 Ser Asn Val Thr Ile Val Tyr Asn Ser Thr Leu Asn Gln Val
Phe Ala 180 185 190 Ile Phe Pro Thr Pro Gly Ser Arg Pro Lys Leu His
Asp Phe Gln Gln 195 200 205 Trp Leu Ile Ala Val His Ser Ser Ile Phe
Ser Ser Val Ala Ala Ser 210 215 220 Cys Thr Leu Phe Val Val Leu Trp
Leu Arg Val Pro Ile Leu Arg Thr 225 230 235 240 Val Phe Gly Phe Arg
Trp Leu Gly Ala Ile Phe Leu Ser Asn Ser Gln 245 250 255 15 249 PRT
Porcine reproductive and respiratory syndrome virus 15 Met Gln Trp
Gly His Cys Gly Val Lys Ser Ala Ser Cys Ser Trp Thr 1 5 10 15 Pro
Ser Leu Ser Ser Leu Leu Val Trp Leu Ile Leu Pro Phe Ser Leu 20 25
30 Pro Tyr Cys Leu Gly Ser Pro Ser Gln Asp Gly Tyr Trp Ser Phe Phe
35 40 45 Ser Glu Trp Phe Ala Pro Arg Phe Ser Val Arg Ala Leu Pro
Phe Thr 50 55 60 Leu Pro Asn Tyr Arg Arg Ser Tyr Glu Gly Leu Leu
Pro Asn Cys Arg 65 70 75 80 Pro Asp Val Pro Gln Phe Ala Val Lys His
Pro Leu Gly Met Phe Trp 85 90 95 His Met Arg Val Ser His Leu Ile
Asp Glu Met Val Ser Arg Arg Ile 100 105 110 Tyr Gln Thr Met Glu His
Ser Gly Gln Ala Ala Trp Lys Gln Val Val 115 120 125 Gly Glu Ala Thr
Leu Thr Lys Leu Ser Gly Leu Asp Ile Val Thr His 130 135 140 Phe Gln
His Leu Ala Ala Val Glu Ala Asp Ser Cys Arg Phe Leu Ser 145 150 155
160 Ser Arg Leu Val Met Leu Lys Asn Leu Ala Val Gly Asn Val Ser Leu
165 170 175 Gln Tyr Asn Thr Thr Leu Asp Arg Val Glu Leu Ile Phe Pro
Thr Pro 180 185 190 Gly Thr Arg Pro Lys Leu Thr Asp Phe Arg Gln Trp
Leu Ile Ser Val 195 200 205 His Ala Ser Ile Phe Ser Ser Val Ala Ser
Ser Val Thr Leu Phe Ile 210 215 220 Val Leu Trp Leu Arg Ile Pro Ala
Leu Arg Tyr Val Phe Gly Phe His 225 230 235 240 Trp Pro Thr Ala Thr
His His Ser Ser 245 16 254 PRT Porcine reproductive and respiratory
syndrome virus 16 Met Ala Asn Ser Cys Thr Phe Leu Tyr Ile Phe Leu
Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser Phe Cys Cys Ala Val Val Ala
Gly Ser Asn Ala Thr Tyr 20 25 30 Cys Phe Trp Phe Pro Leu Val Arg
Gly Asn Phe Ser Phe Glu Leu Thr 35
40 45 Val Asn Tyr Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala
Ala 50 55 60 Glu Ala Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg Ile
Gly His Asp 65 70 75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly
Phe Val Val Pro Ser 85 90 95 Gly Leu Ser Ser Glu Gly His Leu Thr
Ser Ala Tyr Ala Trp Leu Ala 100 105 110 Ser Leu Ser Phe Ser Tyr Thr
Thr Gln Phe His Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser
Arg Val Tyr Val Asp Ile Lys His Gln Phe Ile 130 135 140 Cys Ala Val
His Asp Gly Gln Asn Thr Thr Leu Pro His His Asp Asn 145 150 155 160
Ile Ser Ala Val Leu Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165
170 175 Asn Trp Phe His Leu Glu Trp Val Arg Pro Phe Phe Ser Ser Trp
Leu 180 185 190 Val Leu Asn Val Ser Trp Phe Leu Arg Arg Ser Pro Ala
Ser His Val 195 200 205 Ser Val Arg Val Phe Gln Thr Ser Arg Pro Thr
Pro Pro Gln Arg Gln 210 215 220 Ala Leu Leu Ser Ser Lys Thr Ser Val
Ala Leu Gly Ile Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala
Lys Ser Leu Ser Ala Ala Arg Arg 245 250 17 254 PRT Porcine
reproductive and respiratory syndrome virus 17 Met Ala Asn Ser Cys
Thr Phe Leu Tyr Ile Phe Leu Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser
Phe Cys Cys Ala Val Val Ala Gly Ser Asn Ala Thr Tyr 20 25 30 Cys
Phe Trp Phe Pro Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Thr 35 40
45 Val Asn Tyr Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala Thr
50 55 60 Glu Ala Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg Ile Gly
Tyr Asp 65 70 75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly Phe
Val Val Pro Ser 85 90 95 Gly Leu Ser Ser Glu Gly His Leu Thr Ser
Val Tyr Ala Trp Leu Ala 100 105 110 Phe Leu Ser Phe Ser Tyr Thr Ala
Gln Phe His Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser Gln
Val Tyr Val Asp Ile Arg His Gln Phe Ile 130 135 140 Cys Ala Val His
Asp Gly Gln Asn Ala Thr Leu Pro Arg His Asp Asn 145 150 155 160 Ile
Ser Ala Val Phe Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165 170
175 Asn Trp Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Ser Trp Leu
180 185 190 Val Leu Asn Val Ser Trp Phe Leu Arg Arg Ser Pro Ala Ser
His Val 195 200 205 Ser Val Arg Val Leu Gln Thr Leu Arg Pro Thr Pro
Pro Gln Arg Gln 210 215 220 Ala Leu Leu Ser Ser Lys Thr Ser Val Ala
Leu Gly Ile Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala Lys
Ser Leu Ser Val Val Arg Arg 245 250 18 254 PRT Porcine reproductive
and respiratory syndrome virus 18 Met Ala Asn Ser Cys Ala Phe Leu
His Ile Phe Leu Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser Leu Cys Cys
Ala Val Val Ala Gly Ser Asn Thr Thr Tyr 20 25 30 Cys Phe Trp Phe
Pro Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Ile 35 40 45 Val Asn
Tyr Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala Ala 50 55 60
Glu Ala Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg Ile Gly Tyr Asp 65
70 75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly Phe Met Ile
Pro Ser 85 90 95 Gly Leu Ser Ser Glu Gly His Leu Thr Ser Val Tyr
Ala Trp Leu Ala 100 105 110 Phe Leu Ser Phe Ser Tyr Thr Ala Gln Phe
His Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser Arg Val Tyr
Val Asp Ile Lys His Gln Leu Ile 130 135 140 Cys Ala Glu His Asp Gly
Gln Asn Thr Thr Leu Pro Arg His Asp Asn 145 150 155 160 Ile Ser Ala
Val Phe Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165 170 175 Asn
Trp Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Ser Trp Leu 180 185
190 Val Leu Asn Val Ser Trp Phe Leu Arg Arg Ser Pro Ala Asn His Val
195 200 205 Ser Val Arg Val Leu Gln Thr Leu Arg Pro Thr Pro Pro Gln
Arg Gln 210 215 220 Ala Leu Leu Ser Ser Lys Thr Ser Val Ala Leu Gly
Ile Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala Lys Ser Leu
Ser Ala Val Arg Arg 245 250 19 254 PRT Porcine reproductive and
respiratory syndrome virus 19 Met Val Asn Ser Cys Thr Phe Leu His
Ile Phe Leu Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser Phe Cys Cys Ala
Val Ala Ala Gly Ser Asn Ala Thr Tyr 20 25 30 Cys Phe Trp Phe Pro
Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Met 35 40 45 Val Asn Tyr
Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala Ala 50 55 60 Glu
Val Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg Ile Gly Tyr Asp 65 70
75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly Phe Met Ile Pro
Pro 85 90 95 Gly Leu Ser Ser Glu Gly His Leu Thr Ser Val Tyr Ala
Trp Leu Ala 100 105 110 Phe Leu Ser Phe Ser Tyr Thr Ala Gln Phe His
Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser Arg Val Tyr Val
Asp Ile Lys His Gln Leu Ile 130 135 140 Cys Ala Glu His Asp Gly Gln
Asn Ala Thr Leu Pro Arg His Asp Asn 145 150 155 160 Ile Ser Ala Val
Phe Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165 170 175 Asn Trp
Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Ser Trp Leu 180 185 190
Val Leu Asn Val Ser Trp Tyr Leu Arg Arg Ser Pro Ala Asn His Ala 195
200 205 Ser Val Arg Val Leu Gln Ile Leu Arg Pro Thr Leu Pro Gln Arg
Gln 210 215 220 Ala Leu Leu Ser Ser Lys Thr Ser Val Ala Leu Gly Ile
Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala Lys Ser Leu Ser
Ala Val Arg Arg 245 250 20 254 PRT Porcine reproductive and
respiratory syndrome virus 20 Met Val Asn Ser Cys Thr Phe Leu His
Ile Phe Leu Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser Phe Cys Cys Ala
Val Val Ala Gly Ser Asn Thr Thr Phe 20 25 30 Cys Phe Trp Phe Pro
Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Thr 35 40 45 Val Asn Tyr
Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala Ala 50 55 60 Glu
Ile Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg Ile Gly Tyr Asp 65 70
75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly Phe Met Val Pro
Pro 85 90 95 Gly Phe Ser Ser Glu Gly His Leu Thr Ser Val Tyr Ala
Trp Leu Ala 100 105 110 Phe Leu Ser Phe Ser Tyr Thr Ala Gln Phe His
Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser Arg Val Tyr Val
Asp Ile Lys His Gln Leu Ile 130 135 140 Cys Ala Glu His Asp Gly Gln
Asn Thr Thr Leu Pro Arg His Asp Asn 145 150 155 160 Ile Ser Ala Val
Phe Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165 170 175 Asn Trp
Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Ser Trp Leu 180 185 190
Val Leu Asn Val Ser Trp Phe Leu Arg Arg Ser Pro Ala Asn His Val 195
200 205 Ser Val Arg Val Leu Gln Ile Leu Arg Pro Thr Pro Pro Gln Arg
Gln 210 215 220 Ala Leu Leu Ser Ser Lys Thr Ser Val Ala Leu Gly Ile
Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala Lys Ser Leu Ser
Ala Val Arg Arg 245 250 21 254 PRT Porcine reproductive and
respiratory syndrome virus 21 Met Ala Asn Ser Cys Thr Phe Leu His
Ile Leu Leu Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser Phe Cys Cys Val
Val Val Thr Asp Ala Asn Ala Thr Phe 20 25 30 Cys Phe Trp Phe Pro
Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Met 35 40 45 Val Asn Tyr
Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala Ala 50 55 60 Gln
Ile Tyr Glu Pro Asn Arg Ser Leu Trp Cys Arg Ile Gly Asn Asp 65 70
75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly Phe Thr Val Pro
Pro 85 90 95 Gly Leu Ser Lys Glu Val His Leu Thr Ser Val Tyr Ala
Trp Leu Ala 100 105 110 Phe Leu Ser Phe Ser Tyr Thr Ala Gln Phe His
Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser Lys Val Tyr Val
Asp Ile Asn His Gln Leu Ile 130 135 140 Cys Ala Val His Asp Gly Gln
Asn Thr Thr Leu Pro Arg His Asp Asn 145 150 155 160 Ile Ser Ala Val
Phe Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165 170 175 Asn Trp
Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Ser Trp Leu 180 185 190
Val Leu Asn Val Ser Trp Phe Leu Arg Arg Ser Pro Ala Ser His Val 195
200 205 Ser Val Arg Val Phe Gln Thr Ser Arg Pro Thr Pro Pro Arg Gln
Gln 210 215 220 Ile Ser Leu Ser Ser Arg Thr Ser Ala Ala Leu Gly Met
Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala Lys Ser Leu Ser
Ala Ala Arg Arg 245 250 22 254 PRT Porcine reproductive and
respiratory syndrome virus 22 Met Val Asn Ser Cys Thr Phe Leu His
Ile Phe Leu Cys Cys Ser Phe 1 5 10 15 Leu Tyr Ser Phe Cys Cys Ala
Val Val Ala Gly Ser Asn Thr Thr Tyr 20 25 30 Cys Phe Trp Phe Pro
Leu Val Arg Gly Asn Phe Ser Phe Glu Leu Thr 35 40 45 Val Asn Tyr
Thr Val Cys Pro Pro Cys Leu Thr Arg Gln Ala Ala Thr 50 55 60 Glu
Ile Tyr Glu Pro Gly Arg Ser Leu Trp Cys Arg Ile Gly Tyr Asp 65 70
75 80 Arg Cys Gly Glu Asp Asp His Asp Glu Leu Gly Phe Met Ile Pro
Pro 85 90 95 Gly Leu Ser Ser Glu Gly His Leu Thr Gly Val Tyr Ala
Trp Leu Ala 100 105 110 Phe Leu Ser Phe Ser Tyr Thr Ala Gln Phe His
Pro Glu Ile Phe Gly 115 120 125 Ile Gly Asn Val Ser Arg Val Tyr Val
Asp Ile Lys His Gln Leu Ile 130 135 140 Cys Ala Glu His Asp Gly Gln
Asn Thr Thr Leu Pro Arg His Asp Asn 145 150 155 160 Ile Ser Ala Val
Phe Gln Thr Tyr Tyr Gln His Gln Val Asp Gly Gly 165 170 175 Asn Trp
Phe His Leu Glu Trp Leu Arg Pro Phe Phe Ser Ser Trp Leu 180 185 190
Val Leu Asn Val Ser Trp Phe Leu Arg Arg Ser Pro Ala Asn His Val 195
200 205 Ser Val Arg Val Leu Gln Ile Leu Arg Pro Thr Pro Pro Gln Arg
Gln 210 215 220 Ala Leu Leu Ser Ser Lys Thr Ser Val Ala Leu Gly Ile
Ala Thr Arg 225 230 235 240 Pro Leu Arg Arg Phe Ala Lys Ser Leu Ser
Ala Val Arg Arg 245 250 23 265 PRT Porcine reproductive and
respiratory syndrome virus 23 Met Ala His Gln Cys Ala Arg Phe His
Phe Phe Leu Cys Gly Phe Ile 1 5 10 15 Cys Tyr Leu Val His Ser Ala
Leu Ala Ser Asn Ser Ser Ser Thr Leu 20 25 30 Cys Phe Trp Phe Pro
Leu Ala His Gly Asn Thr Ser Phe Glu Leu Thr 35 40 45 Ile Asn Tyr
Thr Ile Cys Met Pro Cys Ser Thr Ser Gln Ala Ala Arg 50 55 60 Gln
Arg Leu Glu Pro Gly Arg Asn Met Trp Cys Lys Ile Gly His Asp 65 70
75 80 Arg Cys Glu Glu Arg Asp His Asp Glu Leu Leu Met Ser Ile Pro
Ser 85 90 95 Gly Tyr Asp Asn Leu Lys Leu Glu Gly Tyr Tyr Ala Trp
Leu Ala Phe 100 105 110 Leu Ser Phe Ser Tyr Ala Ala Gln Phe His Pro
Glu Leu Phe Gly Ile 115 120 125 Gly Asn Val Ser Arg Val Phe Val Asp
Lys Arg His Gln Phe Ile Cys 130 135 140 Ala Glu His Asp Gly His Asn
Ser Thr Val Ser Thr Gly His Asn Ile 145 150 155 160 Ser Ala Leu Tyr
Ala Ala Tyr Tyr His His Gln Ile Asp Gly Gly Asn 165 170 175 Trp Phe
His Leu Glu Trp Leu Arg Pro Leu Phe Ser Ser Trp Leu Val 180 185 190
Leu Asn Ile Ser Trp Phe Leu Arg Arg Ser Pro Val Ser Pro Val Ser 195
200 205 Arg Arg Ile Tyr Gln Ile Leu Arg Pro Thr Arg Pro Arg Leu Pro
Val 210 215 220 Ser Trp Ser Phe Arg Thr Ser Ile Val Ser Asp Leu Thr
Gly Ser Gln 225 230 235 240 Gln Arg Lys Arg Lys Phe Pro Ser Glu Ser
Arg Pro Asn Val Val Lys 245 250 255 Pro Ser Val Leu Pro Ser Thr Ser
Arg 260 265 24 178 PRT Porcine reproductive and respiratory
syndrome virus 24 Met Gly Ala Ser Leu Leu Phe Leu Leu Val Gly Phe
Lys Cys Leu Leu 1 5 10 15 Val Ser Gln Ala Phe Ala Cys Lys Pro Cys
Phe Ser Ser Ser Leu Ser 20 25 30 Asp Ile Lys Thr Asn Thr Thr Ala
Ala Ala Gly Phe Ala Val Leu Gln 35 40 45 Asp Ile Ser Cys Leu Arg
His Arg Asn Ser Ala Ser Glu Ala Ile Arg 50 55 60 Lys Val Pro Gln
Cys Arg Thr Ala Ile Gly Thr Pro Val Tyr Ile Thr 65 70 75 80 Val Thr
Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp Leu 85 90 95
Leu Met Leu Ser Ser Cys Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys 100
105 110 Gly Phe Lys Val Val Phe Gly Asn Val Ser Gly Ile Val Ala Val
Cys 115 120 125 Val Asn Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe
Thr Gln Arg 130 135 140 Ser Leu Val Val Asp His Val Arg Leu Leu His
Phe Met Thr Pro Glu 145 150 155 160 Thr Met Arg Trp Ala Thr Val Leu
Ala Cys Leu Phe Thr Ile Leu Leu 165 170 175 Ala Ile 25 178 PRT
Porcine reproductive and respiratory syndrome virus 25 Met Ala Ser
Ser Leu Leu Phe Leu Val Val Gly Phe Lys Cys Leu Leu 1 5 10 15 Val
Ser Gln Ala Phe Ala Cys Lys Pro Cys Phe Ser Ser Ser Leu Ala 20 25
30 Asp Ile Lys Thr Asn Thr Thr Ala Ala Ala Ser Phe Ala Val Leu Gln
35 40 45 Asp Ile Ser Cys Leu Arg His Arg Asp Ser Ala Ser Glu Ala
Ile Arg 50 55 60 Lys Ile Pro Gln Cys Arg Thr Ala Ile Gly Thr Pro
Val Tyr Val Thr 65 70 75 80 Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr
Leu His Ser Ser Asp Leu 85 90 95 Leu Met Leu Ser Ser Cys Leu Phe
Tyr Ala Ser Glu Met Ser Glu Lys 100 105 110 Gly Phe Lys Val Val Phe
Gly Asn Val Ser Gly Ile Val Ala Val Cys 115 120 125 Val Asn Phe Thr
Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg 130 135 140 Ser Leu
Val Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu 145 150 155
160 Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu
165 170 175 Ala Ile 26 178 PRT Porcine reproductive and respiratory
syndrome virus 26 Met
Ala Ala Ser Leu Leu Phe Leu Leu Val Gly Phe Lys Cys Leu Leu 1 5 10
15 Val Ser Gln Ala Phe Ala Cys Lys Pro Cys Phe Ser Ser Ser Leu Ala
20 25 30 Asp Ile Lys Thr Asn Thr Thr Ala Ala Ala Gly Phe Ala Val
Leu Gln 35 40 45 Asp Ile Ser Cys Leu Arg Tyr Arg Asn Ser Ala Ser
Glu Ala Phe Arg 50 55 60 Lys Ile Pro Gln Cys Arg Thr Ala Ile Gly
Thr Pro Met Tyr Ile Thr 65 70 75 80 Val Thr Ala Asn Val Thr Asp Glu
Asn Tyr Leu His Ser Ser Asp Leu 85 90 95 Leu Met Leu Ser Ser Cys
Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys 100 105 110 Gly Phe Lys Val
Val Phe Gly Asn Val Ser Gly Ile Val Ala Val Cys 115 120 125 Val Asn
Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg 130 135 140
Ser Leu Val Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu 145
150 155 160 Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala Ile
Leu Leu 165 170 175 Ala Ile 27 178 PRT Porcine reproductive and
respiratory syndrome virus 27 Met Ala Ser Ser Leu Leu Phe Leu Met
Val Gly Phe Lys Cys Leu Leu 1 5 10 15 Val Ser Gln Ala Phe Ala Cys
Lys Pro Cys Phe Ser Ser Ser Leu Ala 20 25 30 Asp Ile Lys Thr Asn
Thr Thr Ala Ala Ala Ser Phe Ala Val Leu Gln 35 40 45 Asp Ile Ser
Cys Leu Arg His Arg Asn Ser Ala Ser Glu Ala Ile Arg 50 55 60 Lys
Ile Pro Gln Cys Arg Thr Ala Ile Gly Thr Pro Val Tyr Ile Thr 65 70
75 80 Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp
Leu 85 90 95 Leu Met Leu Ser Ser Cys Leu Phe Tyr Ala Ser Glu Met
Ser Glu Lys 100 105 110 Gly Phe Lys Val Val Phe Gly Asn Val Ser Gly
Ile Val Ala Val Cys 115 120 125 Val Asn Phe Thr Ser Tyr Val Gln His
Val Arg Glu Phe Thr Gln Arg 130 135 140 Ser Leu Val Val Asp His Val
Arg Leu Leu His Phe Met Thr Pro Glu 145 150 155 160 Thr Met Arg Trp
Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu 165 170 175 Ala Ile
28 178 PRT Porcine reproductive and respiratory syndrome virus 28
Met Ala Ser Ser Leu Leu Phe Leu Met Val Gly Phe Lys Cys Leu Leu 1 5
10 15 Val Ser Gln Ala Phe Ala Cys Lys Pro Cys Phe Ser Ser Ser Leu
Ala 20 25 30 Asp Ile Lys Thr Asn Thr Thr Ala Ala Ala Ser Phe Ala
Val Leu Gln 35 40 45 Asp Ile Gly Cys Leu Arg His Arg Asp Ser Ala
Ser Glu Ala Ile Arg 50 55 60 Lys Ile Pro Gln Cys Arg Thr Ala Ile
Gly Thr Pro Val Tyr Ile Thr 65 70 75 80 Ile Thr Ala Asn Val Thr Asp
Glu Asn Tyr Leu His Ser Ser Asp Leu 85 90 95 Leu Met Leu Ser Ser
Cys Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys 100 105 110 Gly Phe Lys
Val Val Phe Gly Asn Val Ser Gly Ile Val Ala Val Cys 115 120 125 Val
Asn Phe Thr Ser Tyr Val Gln His Val Arg Glu Phe Thr Gln Arg 130 135
140 Ser Leu Val Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu
145 150 155 160 Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala
Ile Leu Leu 165 170 175 Ala Ile 29 178 PRT Porcine reproductive and
respiratory syndrome virus 29 Met Ala Ala Ser Leu Leu Phe Leu Met
Val Gly Phe Lys Cys Leu Leu 1 5 10 15 Val Ser Gln Ala Phe Ala Cys
Lys Pro Cys Phe Ser Ser Ser Leu Ala 20 25 30 Asp Ile Lys Thr Asn
Thr Thr Ala Ala Ala Ser Phe Ala Val Leu Gln 35 40 45 Asp Ile Ser
Cys Leu Arg His Arg Asn Ser Ala Ser Glu Ala Ile Arg 50 55 60 Lys
Ile Pro Gln Cys Arg Thr Ala Ile Gly Thr Pro Met Tyr Ile Thr 65 70
75 80 Ile Thr Ala Asn Val Thr Asp Glu Asn Tyr Leu His Ser Ser Asp
Leu 85 90 95 Leu Met Leu Ser Ser Cys Leu Phe Tyr Ala Ser Glu Met
Ser Glu Lys 100 105 110 Gly Phe Glu Val Val Phe Gly Asn Val Ser Gly
Ile Val Ala Val Cys 115 120 125 Val Asn Phe Thr Ser Tyr Val Gln His
Val Arg Glu Phe Thr Gln Arg 130 135 140 Ser Leu Met Val Asp His Val
Arg Leu Leu His Phe Met Thr Pro Glu 145 150 155 160 Thr Met Arg Trp
Ala Thr Val Leu Ala Cys Leu Phe Ala Ile Leu Leu 165 170 175 Ala Ile
30 178 PRT Porcine reproductive and respiratory syndrome virus 30
Met Ala Ala Ser Leu Leu Phe Leu Leu Val Gly Phe Glu Cys Leu Leu 1 5
10 15 Val Ser Gln Ala Phe Ala Cys Lys Pro Cys Phe Ser Ser Ser Leu
Ser 20 25 30 Asp Ile Lys Thr Asn Thr Thr Ala Ala Ala Asn Phe Ala
Val Leu Gln 35 40 45 Asp Ile Gly Cys Leu Arg His Gly Asn Ser Thr
Thr Glu Ala Phe Arg 50 55 60 Lys Ile Pro Gln Cys Arg Thr Ala Ile
Gly Thr Pro Val Tyr Ile Thr 65 70 75 80 Ile Thr Ala Asn Val Thr Asp
Glu Asn Tyr Leu His Ser Ser Asp Leu 85 90 95 Leu Met Leu Ser Ser
Cys Leu Phe Tyr Ala Ser Glu Met Ser Glu Lys 100 105 110 Gly Phe Lys
Val Val Phe Gly Asn Val Ser Gly Thr Val Ala Val Cys 115 120 125 Ile
Asn Phe Thr Ser Tyr Val Gln His Val Lys Glu Phe Thr Gln Arg 130 135
140 Ser Leu Val Val Asp His Val Arg Leu Leu His Phe Met Thr Pro Glu
145 150 155 160 Thr Met Arg Trp Ala Thr Val Leu Ala Cys Leu Phe Ala
Ile Leu Leu 165 170 175 Ala Ile 31 183 PRT Porcine reproductive and
respiratory syndrome virus 31 Met Ala Ala Ala Thr Leu Phe Phe Leu
Ala Gly Ala Gln His Ile Met 1 5 10 15 Val Ser Glu Ala Phe Ala Cys
Lys Pro Cys Phe Ser Thr His Leu Ser 20 25 30 Asp Ile Glu Thr Asn
Thr Thr Ala Ala Ala Gly Phe Met Val Leu Gln 35 40 45 Asp Ile Asn
Cys Phe Arg Pro His Gly Val Ser Ala Ala Gln Glu Lys 50 55 60 Ile
Ser Phe Gly Lys Ser Ser Gln Cys Arg Glu Ala Val Gly Thr Pro 65 70
75 80 Gln Tyr Ile Thr Ile Thr Ala Asn Val Thr Asp Glu Ser Tyr Leu
Tyr 85 90 95 Asn Ala Asp Leu Leu Met Leu Ser Ala Cys Leu Phe Tyr
Ala Ser Glu 100 105 110 Met Ser Glu Lys Gly Phe Lys Val Ile Phe Gly
Asn Val Ser Gly Val 115 120 125 Val Ser Ala Cys Val Asn Phe Thr Asp
Tyr Val Ala His Val Thr Gln 130 135 140 His Thr Gln Gln His His Leu
Val Ile Asp His Ile Arg Leu Leu His 145 150 155 160 Phe Leu Thr Pro
Ser Ala Met Arg Trp Ala Thr Thr Ile Ala Cys Leu 165 170 175 Phe Ala
Ile Leu Leu Ala Ile 180 32 200 PRT Porcine reproductive and
respiratory syndrome virus 32 Met Leu Gly Lys Cys Leu Thr Ala Gly
Cys Cys Ser Gln Leu Leu Phe 1 5 10 15 Leu Trp Cys Ile Val Pro Ser
Cys Phe Val Ala Leu Val Ser Ala Asn 20 25 30 Gly Asn Ser Gly Ser
Asn Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys 35 40 45 Glu Leu Asn
Gly Thr Asp Trp Leu Ala Asn Lys Phe Asp Trp Ala Val 50 55 60 Glu
Cys Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser Tyr Gly 65 70
75 80 Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Gly Leu Val Thr
Val 85 90 95 Ser Thr Ala Gly Phe Val His Gly Arg Tyr Val Leu Ser
Ser Met Tyr 100 105 110 Ala Val Cys Ala Leu Ala Ala Leu Ile Cys Phe
Val Ile Arg Leu Ala 115 120 125 Lys Asn Cys Met Ser Trp Arg Tyr Ser
Cys Thr Arg Tyr Thr Asn Phe 130 135 140 Leu Leu Asp Thr Lys Gly Arg
Leu Tyr Arg Trp Arg Ser Pro Val Ile 145 150 155 160 Ile Glu Lys Arg
Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu 165 170 175 Lys Arg
Val Val Leu Asp Gly Ser Ala Ala Thr Pro Val Thr Arg Val 180 185 190
Ser Ala Glu Gln Trp Arg Ser Pro 195 200 33 200 PRT Porcine
reproductive and respiratory syndrome virus 33 Met Leu Glu Lys Cys
Leu Thr Ala Gly Cys Cys Ser Arg Leu Leu Ser 1 5 10 15 Leu Trp Cys
Ile Val Pro Phe Cys Phe Ala Val Leu Ala Asn Ala Ser 20 25 30 Asn
Asp Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys 35 40
45 Glu Leu Asn Gly Thr Asp Trp Leu Ala Asn Lys Phe Asp Trp Ala Val
50 55 60 Glu Ser Phe Val Ile Phe Pro Val Leu Thr His Ile Val Ser
Tyr Gly 65 70 75 80 Ala Leu Thr Thr Ser His Phe Leu Asp Thr Val Ala
Leu Val Thr Val 85 90 95 Ser Thr Ala Gly Phe Val His Gly Arg Tyr
Val Leu Ser Ser Ile Tyr 100 105 110 Ala Val Cys Ala Leu Ala Ala Leu
Thr Cys Phe Val Ile Arg Phe Ala 115 120 125 Lys Asn Cys Met Ser Trp
Arg Tyr Ala Cys Thr Arg Tyr Thr Asn Phe 130 135 140 Leu Leu Asp Thr
Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile 145 150 155 160 Ile
Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu 165 170
175 Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile Thr Arg Val
180 185 190 Ser Ala Glu Gln Trp Gly Arg Pro 195 200 34 200 PRT
Porcine reproductive and respiratory syndrome virus 34 Met Leu Gly
Lys Cys Leu Thr Ala Gly Tyr Cys Ser Ser Leu Leu Phe 1 5 10 15 Leu
Trp Cys Ile Val Pro Ser Trp Phe Val Ala Leu Ala Ser Ala Asn 20 25
30 Ser Ser Asn Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys
35 40 45 Glu Leu Asn Gly Thr Asp Trp Leu Ala Gly Glu Phe Asp Trp
Ala Val 50 55 60 Glu Cys Phe Val Ile Phe Pro Val Leu Thr His Ile
Val Ser Tyr Gly 65 70 75 80 Ala Leu Thr Thr Ser His Phe Leu Asp Thr
Val Gly Leu Val Thr Val 85 90 95 Ser Thr Ala Gly Phe Ser His Gly
Arg Tyr Val Leu Ser Ser Ile Tyr 100 105 110 Ala Val Cys Ala Leu Ala
Ala Leu Ile Cys Phe Val Ile Arg Phe Thr 115 120 125 Lys Asn Cys Met
Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe 130 135 140 Leu Leu
Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile 145 150 155
160 Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp Leu
165 170 175 Lys Arg Val Val Leu Asp Gly Ser Ala Ala Thr Pro Ile Thr
Lys Val 180 185 190 Ser Ala Glu Gln Trp Gly Arg Pro 195 200 35 200
PRT Porcine reproductive and respiratory syndrome virus 35 Met Leu
Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Leu Ser 1 5 10 15
Leu Trp Cys Ile Val Pro Phe Cys Phe Ala Val Leu Ala Asn Ala Ser 20
25 30 Ala Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu
Cys 35 40 45 Glu Leu Asn Gly Thr Asp Trp Leu Ala Asp Lys Phe Asp
Trp Ala Val 50 55 60 Glu Ser Phe Val Ile Phe Pro Val Leu Thr His
Ile Val Ser Tyr Gly 65 70 75 80 Ala Leu Thr Thr Ser His Leu Leu Asp
Thr Val Ala Leu Val Thr Val 85 90 95 Ser Thr Ala Gly Phe Val His
Gly Arg Tyr Val Leu Ser Ser Ile Tyr 100 105 110 Ala Val Cys Ala Leu
Ala Ala Leu Ala Cys Phe Val Ile Arg Phe Ala 115 120 125 Lys Asn Cys
Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe 130 135 140 Leu
Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp His Ser Pro Val Ile 145 150
155 160 Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile Asp
Leu 165 170 175 Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro Ile
Thr Arg Val 180 185 190 Ser Ala Glu Gln Trp Gly Arg Pro 195 200 36
200 PRT Porcine reproductive and respiratory syndrome virus 36 Met
Leu Gly Lys Cys Leu Thr Val Gly Cys Cys Ser Arg Leu Leu Ser 1 5 10
15 Leu Trp Cys Ile Val Pro Phe Cys Phe Thr Val Leu Ala Asp Ala His
20 25 30 Ser Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr
Leu Cys 35 40 45 Glu Leu Asn Gly Thr Asp Trp Leu Ala Asp Arg Phe
Asp Trp Ala Val 50 55 60 Glu Ser Phe Val Ile Phe Pro Val Leu Thr
His Ile Val Ser Tyr Gly 65 70 75 80 Ala Leu Thr Thr Ser His Phe Leu
Asp Thr Ile Ala Leu Val Thr Val 85 90 95 Ser Thr Ala Gly Phe Val
His Gly Arg Tyr Val Leu Ser Ser Ile Tyr 100 105 110 Ala Val Cys Ala
Leu Ala Ala Leu Thr Cys Phe Val Ile Arg Phe Val 115 120 125 Lys Asn
Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe 130 135 140
Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile 145
150 155 160 Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu Ile
Asp Leu 165 170 175 Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr Pro
Ile Thr Arg Val 180 185 190 Ser Ala Glu Gln Trp Gly Arg Pro 195 200
37 199 PRT Porcine reproductive and respiratory syndrome virus 37
Met Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Leu Leu Ser 1 5
10 15 Leu Trp Phe Ile Val Pro Phe Cys Phe Ala Val Leu Ala Ser Ala
Ser 20 25 30 Asn Ser Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu
Thr Leu Cys 35 40 45 Glu Leu Asn Gly Thr Asp Trp Leu Ala Asn Lys
Phe Asp Trp Ala Val 50 55 60 Glu Ser Phe Val Ile Phe Pro Val Leu
Thr His Ile Val Ser Tyr Gly 65 70 75 80 Ala Leu Thr Thr Ser His Phe
Leu Asp Thr Val Ala Leu Val Thr Val 85 90 95 Ser Thr Ala Gly Phe
Val His Gly Arg Tyr Val Leu Ser Ser Ile Tyr 100 105 110 Ala Val Cys
Ala Leu Ala Ala Leu Thr Cys Phe Ile Ile Arg Phe Ala 115 120 125 Lys
Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe 130 135
140 Leu Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val Ile
145 150 155 160 Ile Glu Lys Arg Gly Lys Val Glu Val Glu Gly His Leu
Ile Asp Leu 165 170 175 Lys Arg Val Val Leu Asp Gly Ser Val Ala Thr
Pro Ile Thr Arg Val 180 185 190 Ser Ala Glu Gln Gly Arg Pro 195 38
199 PRT Porcine reproductive and respiratory syndrome virus 38 Met
Leu Gly Lys Cys Leu Thr Ala Gly Cys Cys Ser Arg Ser Leu Phe 1 5 10
15 Leu Trp Cys Ile Val Pro Phe Cys Leu Ala Ala Leu Val Ser Ala Asn
20 25 30 Asn Ser Ser Ser His Leu Gln Leu Ile Tyr Asn Leu Thr Leu
Cys Glu 35 40 45 Leu Asn Gly Thr Asp Trp Leu Ala Asn Lys Phe Asp
Trp Ala Val Glu 50 55 60 Ser Phe Val Ile Phe Pro Val
Leu Thr His Ile Val Ser Tyr Gly Ala 65 70 75 80 Leu Thr Thr Ser His
Phe Leu Asp Thr Val Gly Leu Val Thr Val Ser 85 90 95 Thr Ala Gly
Phe His His Gly Arg Tyr Val Leu Ser Ser Ile Tyr Ala 100 105 110 Val
Cys Ala Leu Ala Ala Phe Ile Cys Phe Val Ile Arg Phe Ala Lys 115 120
125 Asn Cys Met Ser Trp Arg Tyr Ser Cys Thr Arg Tyr Thr Asn Phe Leu
130 135 140 Leu Asp Thr Lys Gly Arg Leu Tyr Arg Trp Arg Ser Pro Val
Ile Ile 145 150 155 160 Glu Lys Gly Gly Lys Val Glu Val Glu Gly His
Leu Ile Asp Leu Lys 165 170 175 Lys Val Val Leu Asp Gly Ser Ala Ala
Thr Pro Leu Thr Arg Val Ser 180 185 190 Ala Glu Gln Trp Gly Arg Pro
195 39 201 PRT Porcine reproductive and respiratory syndrome virus
39 Met Arg Cys Ser His Lys Leu Gly Arg Phe Leu Thr Pro His Ser Cys
1 5 10 15 Phe Trp Trp Leu Phe Leu Leu Cys Thr Gly Leu Ser Trp Ser
Phe Ser 20 25 30 Asp Asn Gly Gly Asp Ser Ser Thr Tyr Gln Tyr Ile
Tyr Asn Leu Thr 35 40 45 Ile Cys Glu Leu Asn Gly Thr Asp Trp Leu
Ser Ser His Phe Gly Trp 50 55 60 Ala Val Glu Thr Phe Val Leu Tyr
Pro Val Ala Thr His Ile Leu Ser 65 70 75 80 Leu Gly Phe Leu Thr Thr
Ser His Phe Phe Asp Ala Leu Gly Leu Gly 85 90 95 Ala Val Ser Thr
Ala Gly Phe Val Gly Gly Arg Tyr Val Leu Cys Ser 100 105 110 Val Tyr
Gly Ala Cys Ala Phe Ala Ala Phe Val Cys Phe Val Ile Arg 115 120 125
Ala Ala Lys Asn Cys Met Ala Cys Arg Tyr Ala Arg Thr Arg Phe Thr 130
135 140 Asn Phe Ile Val Asp Asp Arg Gly Arg Val His Arg Trp Lys Ser
Pro 145 150 155 160 Ile Val Val Glu Lys Leu Gly Lys Ala Glu Val Asp
Gly Asn Leu Val 165 170 175 Thr Ile Lys His Val Val Leu Glu Gly Val
Lys Ala Gln Pro Leu Thr 180 185 190 Arg Thr Ser Ala Glu Gln Trp Glu
Ala 195 200 40 3293 DNA Porcine reproductive and respiratory
syndrome virus 40 gttttatttc cctccgggcc ctgtcattga accaacttta
ggcctgaatt gaaatgaaat 60 ggggtccatg caaagccttt ttgacaaaat
tggccaactt tttgtggatg ctttcacgga 120 gttcttggtg tccattgttg
atatcattat attcttggcc attttgtttg gcttcaccat 180 cgccggttgg
ctggtggtct tttgcatcag attggtttgc tccgcgatac tccgtacgcg 240
ccctgccatt cactctgagc aattacagaa gatcttatga ggcctttctt tcccagtgcc
300 aagtggacat tcccacctgg ggaactaaac atcctttggg gatgttttgg
caccataagg 360 tgtcaaccct gattgatgag atggtgtcgc gtcgaatgta
ccgcatcatg gaaaaagcag 420 gacaggctgc ctggaaacag gtggtgagcg
aggctacgct gtctcgcatt agtagtttgg 480 atgtggtggc tcattttcag
catcttgccg ccatcgaagc cgagacctgt aaatatttgg 540 cctcccggct
gcccatgcta cacaacctgc gcatgacagg gtcaaatgta accatagtgt 600
ataatagtac tttgaatcgg gtgtttgcta ttttcccaac ccctggttcc cggccaaagc
660 ttcatgactt tcagcaatgg ctaatagctg tgcattcctc catattttcc
tctgttgcag 720 cttcttgtac tctctttgtt gtgctgtggt tgcgggttcc
aatactacgt actgtttttg 780 gtttccgctg gttaggggca atttttcttt
cgaactcata gtgaattaca cggtgtgccc 840 accttgcctc acccggcaag
cagccgcaga ggcctacgaa cccggtaggt ctctttggtg 900 caggataggg
tacgatcgat gtggagagga cgaccatgac gagctagggt ttatgatacc 960
gtctggcctc tccagcgaag gccacttgac cagtgtttac gcctggttgg cgttcttgtc
1020 cttcagctac acggcccagt tccaccccga gatattcggg atagggaatg
tgagtcgagt 1080 ttatgttgac atcaaacatc aactcatctg cgccgaacat
gacgggcaga acaccacctt 1140 gcctcgtcat gacaacattt cggccgtgtt
tcagacctat taccaacatc aagtcgacgg 1200 cggcaattgg tttcacctag
aatggctgcg tcccttcttt tcctcatggt tggttttaaa 1260 tgtctcttgg
tttctcaggc gttcgcctgc aaaccatgtt tcagttcgag tcttgcagac 1320
attaagacca acaccaccgc agcggcaagc tttgctgtcc tccaagacat cagttgcctt
1380 aggcatcgca actcggcctc tgaggcgatt cgcaaaatcc ctcagtgccg
tacggcgata 1440 gggacaccta tgtatattac catcacagcc aatgtgacag
atgaaaatta tttacattct 1500 tctgatctcc tcatgctctc ttcttgcctt
ttctatgctt ctgagatgag tgaaaaggga 1560 tttgaggtgg tttttggcaa
tgtgtcaggc atcgtggctg tgtgtgtcaa ttttaccagc 1620 tacgttcaac
atgtcaggga gtttacccaa cgctccttga tggtcgacca tgtgcggctg 1680
ctccatttca tgacacctga gaccatgagg tgggcaaccg ttttagcctg tctttttgct
1740 attctgttgg caatttgaat gtttaagtat gttggggaaa tgcttgaccg
tgggctgttg 1800 ctcgcgattg ctttctttgt ggtgtatcgt gccgttctgt
tttactgtgc tcgccgacgc 1860 ccacagcaac agcagctctc atctgcaatt
gatttacaac ttgacgctat gtgagctgaa 1920 tggcacagat tggctagctg
atagatttga ttgggcagtg gagagctttg tcatctttcc 1980 tgttttgact
cacattgtct cctatggcgc cctcaccacc agccatttcc ttgacacaat 2040
tgctttagtc actgtgtcta ccgccgggtt tgttcacggg cggtatgtcc taagtagcat
2100 ctacgcggtc tgtgccctgg ctgcgttgac ttgcttcgtc attaggtttg
tgaagaattg 2160 catgtcctgg cgctactcat gtactagata taccaacttt
cttctggata ctaagggcag 2220 actctatcgt tggcggtcgc ctgtcatcat
agagaagagg ggcaaagttg aggtcgaagg 2280 tcatctgatc gatctcaaaa
gagttgtgct tgatggttcc gtggcaaccc ctataaccag 2340 agtttcagcg
gaacaatggg gtcgtcctta gatgacttct gttatgatag tacggctcca 2400
caaaaggtgc ttttggcatt ttctattacc tacacgccag taatgatata tgccctaaag
2460 gtgagtcgcg gccgactgct agggcttctg caccttttga ttttcctgaa
ctgtgctttc 2520 accttcgggt acatgacatt catgcacttt cagagtacaa
ataaggtcgc gctcactatg 2580 ggagcagtag ttgcactcct ttggggggtg
tactcagcca tagaaacctg gaaattcatc 2640 acctccagat gccgtttgtg
cttgctaggc cgcaagtaca ttctggcccc tgcccaccac 2700 gttgaaagtg
ccgcaggctt tcatccgatt gcggcaaatg ataaccacgc atttgtcgtc 2760
cggcgtcccg gctccactac ggtcaacggc acattggtgc ccgggttgaa aagcctcgtg
2820 ttgggtggca gaaaagctgt taaacaggga gtggtaaacc ttgtcaaata
tgccaaataa 2880 caacggcaag cagcagaaga gaaagaaggg ggatggccag
ccagtcaatc agctgtgcca 2940 gatgctgggt aagatcatcg cccagcaaaa
ccagtctaga ggcaagggac cgggaaagaa 3000 aaataagaag aaaaacccgg
agaagcccca ttttcctcta gcgactgaag atgatgtcag 3060 acatcacttt
acccctagtg agcggcaatt gtgtctgtcg tcaatccaaa ctgcctttaa 3120
tcaaggcgct gggacttgca ccctgtcaga ttcagggagg ataagttaca ctgtggagtt
3180 tagtttgcct acgcatcata ctgtgcgctt gatccgcgtc acagcatcac
cctcagcatg 3240 atgggctggc attcttgagg catcccagtg tttgaattgg
aagaatgcgt ggt 3293 41 3293 DNA Porcine reproductive and
respiratory syndrome virus 41 gttttatttc cctccgggcc ccgtcattga
accaacttta ggcctgaatt gaaatgaaat 60 ggggtccgtg caaagccttt
ttgacaaaat tggccaactt tttgtggatg ctttcacgga 120 gttcctggtg
tccattgttg atatcatcat atttttggcc attttgtttg gcttcaccat 180
cgccggttgg ctggtggtct tttgcatcag attggtttgc tccgcgatac tccgtacgcg
240 ccctgccatt cactctgagc aattacagaa gatcttatga ggccttttta
tcccagtgcc 300 aagtggacat tcccacctgg ggaactaaac atcctttggg
gatgttttgg caccataagg 360 tgtcaaccct gattgatgaa atggtgtcgc
gtcgcatgta ccgcatcatg gaaaaagcag 420 ggcaggctgc ctggaaacag
gtggtgagcg aggctacgct gtcccgcatt agtagtttgg 480 atgtggtggc
tcattttcag catcttgccg ccattgaagc cgagacttgt aaatatttgg 540
cctcccggct gcccatgcta cataacctgc gcataacagg gtcaaatgta accatagtgt
600 ataatagtac ttcggagcag gtgtttgcta ttttcccaac ccctggttcc
cggccaaagc 660 ttcatgattt tcagcaatgg ttaatagctg tacattcctc
catattttcc tctgttgcag 720 cttcttgtac tctttttgtt gtgctgtggc
tgcgggttcc aatgctacgt actgtttttg 780 gtttccgctg gttaggggga
atttttcctt cgaactcatg gtgaattaca cggtgtgtcc 840 accttgcctc
acccggcaag cagccgcaga ggtctacgaa cccggtaggt ctctttggtg 900
caggataggg tatgaccgat gtggggagga cgatcatgac gagctagggt ttatgatacc
960 gcctggcctc tccagcgaag gccacttgac tagtgtttac gcctggttgg
cgtttttgtc 1020 cttcagctac acggcccagt tccatcccga gatattcggg
atagggaatg tgagtcgagt 1080 ttatgttgac atcaaacatc aactcatttg
cgccgaacat gacggacaga acgccacctt 1140 gcctcgtcat gacaatattt
cagccgtgtt tcagacctat taccaacatc aagtcgatgg 1200 cggcaattgg
tttcacctag aatggcttcg tcccttcttt tcctcatggt tggttttaaa 1260
tgtctcttgg tatctcaggc gttcgcctgc aaaccatgct tcagttcgag tcttgcagat
1320 attaagacca acactaccgc agcggcaagc tttgctgtcc tccaagacat
cagttgcctt 1380 aggcatcgca actcggcctc tgaggcgatt cgcaaaatcc
ctcagtgccg tacggcgata 1440 gggacacccg tgtatattac catcacagcc
aatgtgacag atgagaatta tttacattct 1500 tctgatctcc tcatgctttc
ttcttgcctt ttctacgctt ctgagatgag tgaaaaagga 1560 ttcaaggtgg
tatttggcaa tgtgtcaggc atcgtggctg tgtgtgtcaa ttttaccagc 1620
tacgtccaac atgtcaggga gtttacccaa cgctccctgg tggtcgacca tgtgcggttg
1680 ctccatttca tgacacctga aaccatgagg tgggcaactg ttttagcctg
tctttttgcc 1740 attctgctgg caatttgaat gtttaagtat gttggggaaa
tgcttgaccg cgggctgttg 1800 ctcgcgattg ctttctttgt ggtgtatcgt
gccgttctgt tttgctgtgc tcgccaacgc 1860 cagcgccaac agcagctccc
atctacagct gatttacaac ttgacgctat gtgagctgaa 1920 tggcacagat
tggctagctg ataaatttga ttgggcagtg gagagttttg tcatctttcc 1980
cgttttgact cacattgtct cctatggtgc cctcactact agccatctcc ttgacacagt
2040 cgccttagtc actgtgtcta ccgccgggtt tgttcacggg cggtatgtcc
taagtagcat 2100 ctacgcggtc tgtgccctgg ctgcgttagc ttgcttcgtc
attaggtttg caaagaattg 2160 catgtcctgg cgctattcgt gtaccagata
taccaacttt cttctggaca ctaagggcag 2220 actctatcgt tggcattcgc
ctgtcatcat agagaaaagg ggcaaagttg aggtcgaagg 2280 tcatctgatc
gacctcaaaa gagttgtgct tgacggttcc gtggcaaccc ctataaccag 2340
agtttcagcg gaacaatggg gtcgtcctta gatgacttct gccatgatag tacggctcca
2400 caaaaggtgc ttttggcgtt ttctattacc tacacgccag tgatgatata
tgccctaaag 2460 gtgagtcgcg gccgactgct agggcttctg caccttttga
tcttcctgaa ttgtgctttc 2520 accttcgggt acatgacatt cgtgcacttt
cagagtacaa ataaggtcgc gctcactatg 2580 ggagcagtag ttgcactcct
ttggggggtg tactcagcca tagaaacctg gaaattcatc 2640 acctccagat
gccgtttgtg cttgctaggc cgcaagtaca ttctggcccc tgcccaccac 2700
gttgaaagtg ccgcaggctt tcatccgatt gcggcaaatg ataaccacgc atttgtcgtc
2760 cggcgtcccg gctccactac ggtcaacggc acattggtgc ccgggttgaa
aagcctcgtg 2820 ttgggtggca gaaaagctgt taaacaggga gtggtaaacc
ttgtcaaata tgccaaataa 2880 caacggcaag cagcagaaga gaaagaaggg
ggatggccag ccagtcaatc agctgtgcca 2940 gatgctgggt aagatcatcg
ctcagcaaaa ccagtccaga ggcaagggac cgggaaagaa 3000 aaacaagaag
aaaaacccgg agaagcccca ttttcctcta gcgactgaag atgatgtcag 3060
acatcacttc acccctagtg agcggcaatt gtgtctgtcg tcaatccaga ccgcctttaa
3120 tcaaggcgct gggacttgca ccctgtcaga ttcagggagg ataagttaca
ctgtggagtt 3180 tagtttgcca acgcatcata ctgtgcgctt gatccgcgtc
acagcatcac cctcagcatg 3240 atgggctggc attcttgagg catcccagtg
tttgaattgg aagaatgcgt ggt 3293 42 30 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 42 gcacggatcc
gaattaacat gaaatggggt 30 43 30 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 43 cgtcggatcc tcctacaatg
gctaatagct 30 44 30 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 44 gtatggatcc gcaattggtt
tcacctataa 30 45 30 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 45 tgccaggatc cgtgtttaaa
tatgttgggg 30 46 21 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 46 ggggatccag agtttcagcg g 21 47
22 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 47 ggggatcctt gttaaatatg cc 22 48 30 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
48 ccacctgcag attcaccgtg agttcgaaag 30 49 30 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 49
cgcgctgcag tgtccctatc gacgtgcggc 30 50 30 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 50 ataggaattc
aacaagacgg cacgatacac 30 51 30 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 51 cgtggaattc atagaaaacg
ccaagagcac 30 52 25 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 52 gggaattctg gcacagctga ttgac 25
53 19 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 53 gggaattcac cacgcattc 19 54 15420 DNA
Porcine reproductive and respiratory syndrome virus 54 nngacgtata
ggtgttggct ctatgccttg acattcgtat tgtcaggagc tgtgaccatt 60
ggtacagccc aaaacttgct gcacagaaaa cgcccttctg tgacagcctc cttcagggag
120 cttgggggtc tgtccctagc accttgcttc cggagttgca ctgctttacg
gtctctccac 180 ccttttaacc atgtctggga tacttgatcg gtgtacgtgc
acccccaatg ccagggtgtt 240 tatggcggag ggccaggtct actgcacacg
atgtctcagt gcacggtctc tccttcctct 300 gaatctccag actcccgagc
ttggggtgtt gggtctattc tacaggcccg aagaaccact 360 ccggtggacg
ttgccacgtg cattccccac tgttgagtgt tcccccgctg gggcctgctg 420
gctttctgca atctttccaa ttgcgcgaat gaccagtgga aacctgaact tccaacaaag
480 aatggtacgg gtcgcagctg agctttacag agccggccag ctcacccctg
tcgtcttgaa 540 gactctgcaa gtttacgaac ggggttgccg ctggtacccc
attgttggac ctgtccctgg 600 agtggccgtt ttcgccaact ccctacatgt
gagtgataaa cctttcccag gggcaactca 660 cgtgttaacc aacctgccgc
tcccgcagag acccaagccc gaagacttct gcccctttga 720 atgcgccatg
gccaccgtct atgacattgg tcatgacgct gtcatgtaca tggccggagg 780
gaaagtctcc tgggcccctc gtggcgggga tggagtgaaa tttgaaactg tccccaaggg
840 gttggagtta actgcggacc gactccgctc ctccttcccg ccccaccacg
tagtggacat 900 gtccaggttt gctttcacaa cccctgagtg tggtgcctct
atgcgggtcg gacgccaacg 960 tggctgcctc cccgctggta ctgtccctga
aggcaactgt tggtggagct tgtttggctc 1020 gctcccactg gaagttctga
acaaagaaat tcgctatgcc aaccgatttg gctaccaaac 1080 taagcatggt
gtctctggca agtacctaca gcggaggctg caagttaatg gtctccgggc 1140
agtaactgac acacatggac ctatcgtcat acaatacttc tccgttaagg agagttggat
1200 ccgccacttg agactggcgg aagaacccag cctccctggg tttgaggatc
tcctcagaat 1260 aagggttgag cccaacacat cgccattgct tggcaagggt
gaaaaaatct tccgttttgg 1320 caatcacaaa tggtacggcg ctggaaagag
agcaaggaaa gcacgctcta gtgcgactgc 1380 tacggtcgct gaccgcgctt
tgtccgctcg tgaaacccgg ctggccaagg agcacgaggt 1440 tgccggcgcc
aataaggctg agcacctcaa gcactactcc ccgcctgccg aagggaattg 1500
tggttggcac tgtatttccg ccatcgtcaa ccggatggtg aactccaaat ttgaaaccac
1560 cctccccgag agagtgagac ctccagatga ctgggctact gacgaggatc
ttgcgaacac 1620 catccaaatc ctcaggcttc ctgcggcctt ggacaggggc
ggtgcttgtg ttagcgccaa 1680 gtatgtactt aagctggaag gtgaacattg
gactgtctct gtgacccctg ggatgtctcc 1740 ctctttgctc ccccttgaat
gcgtccaggg ctgttgtgat cataagagcg gtcttggttc 1800 cccagatacg
gtcgaagttt ccggatttga ccctgcctgc cttgaccggc tggctgaggt 1860
gatgcacctg cctagcagtg ccatcccagc cgctctggcc gaaatgtccg gcgattccga
1920 tcgtccggct tccccggtca ccactgtgtg gacggtttcg cagttctttg
cccgccacac 1980 aggagggaat caccctgacc aggtgtgctt aggaaaaatc
attagccttt gtcaagtgct 2040 tgagagttgc tgctgtttcc agaacaaaac
caaccgggcc accccggaag aggtcgcggc 2100 aaaaattgac ctgtacctcc
gcggagcaac aggtcttgaa gaatgcttgg ccaggcttga 2160 gagggctcgc
ccaccgagtg taatggacac ctcctttgat tggaatgttg tgcttcctgg 2220
gtttgaggcg gcaactcaga caaccaaacc gccccaggtc aaccagtgtc gcgctctggt
2280 ccctgttgtg actcaagagt ctttggacaa tggctcggtt cctctgaccg
ccttctcgct 2340 gtccaattac tactaccgcg cgcaaggaga cgaggttcgt
caccgtgata ggttaaacgc 2400 cgtactctcc aagttggagg gtgctgttcg
agaagaatac gggctcatgc caactggacc 2460 tggcccgcga cccgcactgc
cgagtgggct tgacgagctt aaagaccaga tggaggagga 2520 tctgctgaaa
ctagccaatg cccagacaac ttcagaaatg atggcctggg cagccgagca 2580
ggttgatcta aaagcttggg ttaaaaacta cccacggtgg acaccaccgc cccctccacc
2640 aagagtccag cctcgaaaaa caaagcctgt caagagtttg ccagagagca
agcctgtccc 2700 cgccccgcgc aggaaggtta ggtccgattg tggcagcccg
attttattgg gcgacaatgt 2760 tcctaacagt tgggaagatt tgactgttgg
tggccccctt gatctctcga cctcacccga 2820 gccggtgaca cctccgagtg
agcttgcgct catgtccgca ccgcaacaca cttttaggtc 2880 ggtgataccc
ttgggtgaac cggccccagt tcccgcattg cgcaaaactg tgccccgacc 2940
ggtaacaccc ttgagcgagc cgatccctgt gtccgcaccg caatgcaagt ttcagcaggt
3000 ggaaaaagcg gatctggcgg cagcagcgct ggcgtaccag gacgagcccc
tagatttgtc 3060 tgcatcctca caaactgaat atgaggcttc tcccctagaa
ccactgcaga gcatgggcgt 3120 tctaaaggtg gaaggacaag aagctgagga
agtcctgagt ggaatctcgg acatactgga 3180 tgacatcaac ccggtgcctg
tatcatcaaa cggctccctg tcaagcgtga ggatcacacg 3240 cccaaaatac
tcagctcaag ccatcatcga ctcgggcggg ccctgcagtg ggcacctcca 3300
agggataaag gaaacatgcc tcagtatcat gcgtgaggca tgtgatgcga ctaagcttga
3360 tgaccctact acgcaggaat ggctttctcg catgtgggat agggtggaca
tgctgacttg 3420 gcgcaacacg tctgcttacc aggcgcttcg caccttagat
agcaggtttg agtttctccc 3480 aaaaatgata ctcgagacac cgccgcccta
tccgtgtgag tttgtgatga tgcctcacac 3540 gcctgcacct tctgtaagtg
cggagagtga tcttaccatt ggctcagtcg ccactgaaga 3600 tgttccacgc
atcctcggga aaatagaaga tgtcggcgag atgaccaacc agggaccctt 3660
ggcattctcc gaggaagaac cggtggatca ccaacctgcc aagggctccc ggtcattgtc
3720 gcggaggcct gacgagagta caccaactct gtccgcaagc gcaggtggca
ccgacttacc 3780 caccgatttg ccgctttcag acggtgtgga tgcggacggg
ggggggccgt tacggacggt 3840 aaaaaacaaa actcaaaggc tctttgacca
actgagccgt caggttttta acctcgtctc 3900 ccatctccct gttttcttct
cacgccttct cctacctggc ggtggttatt ctccgggtga 3960 ttggggcttt
gcagctttta ctctattgtg cctctttttg tgttatagct acccagcctt 4020
tggtattgct ccccttttgg gtgtattttc tgggtcttct cggcgcgttc gaatgggggt
4080 ttttggctgc tggttggctt ttgctgttgg cctgttcaag cctgtgtccg
acccagtcgg 4140 cactgcttgt gagtttgact cgccagagtg tagaaacatc
cttctttctt ttgagcttct 4200 caaaccttgg gaccctgttc gcagccttgt
tgtgggcccc gtcggtctcg gtcttgccat 4260 tcttggcagg ttactgggcg
gggcacgctg tatctggcac tttttgctta ggcttggcat 4320 tgttacagat
tgtatcctgg ctggagctta tgtgctttct caaggtaggt gtaaaaagtg 4380
ctggggatct tgtataagaa ctgctcctag tgaggtcgcc tttaacgtgt ttccttttac
4440 acgtgcgacc aggtcgtcac ttaccaactt gtgcgatcgg ttttgtgcgc
caaaaggcat 4500 ggaccccatt ttcctcgcca ctgggtggcg cgggtgctgg
accggccgaa
gccccattga 4560 gcaaccctct gaaaaaccca tcgcgtttgc ccagttggat
gaaaagaaga ttacggctaa 4620 gactgtggtc gcccagcctt atgaccccaa
ccaagccgta aagtgtttgc gggtgttaca 4680 ggcgggcggg gtgatggtgg
ctgaggcagt tccaaaagtg gtcaaggttt ccgctgtccc 4740 attccgagcc
cccttctttc ccactggggt gaaagttgat cctgggtgca ggatcgtggt 4800
tgaccccgac accttcactg cagctctccg gtctggttac tccaccacaa acctcgtcct
4860 tggtgtaggg gactttgccc agctgaatgg attaaaaatt aggcaaattt
ccaagccttc 4920 tggaggaggc ccacacctca tggctgccct gcatgttgct
tgctcgatga ccttgcacat 4980 gcttgctggg atttacgtga ctgcggtggg
ttcttgcggc accggcacca acgatccgtg 5040 gtgcgctaac ccgtttgccg
tccctggcta tggacctgga tctctctgca cgtccaaatt 5100 gtgcatctcc
caacatggcc tcaccctgcc cttaacagca cttgttgcgg gattcggtat 5160
tcaggaaatt gccttggtcg ttttgatttt tgtttccatc gggggcatgg ctcataggtt
5220 gagttgtaag gctgatatgc tgtgtgtttt gcttgcaatc gccagctatg
tttgggtacc 5280 tctaacctgg ttgctttgtg tgtttccctg ctggttgcgc
tgtttttctt tgcacccact 5340 caccatccta tggttggtgt ttttcttgat
ttctgtaaat atgccttcag gaatcttggc 5400 catggtgttg ttggtttctc
tttggcttct tggacgttat actaatgtcg ctggtcttgt 5460 caccccttat
gatattcacc attacaccag tggcccccgc ggtgttgccg ccttggctac 5520
agcaccagat gggacctact tggccgctgt ccgccgcgct gcgttgactg gccgcaccat
5580 gctgtttacc ccgtctcagc ttgggtccct tcttgagggc gcttttagaa
ctcaaaagcc 5640 ctcgttgaac accgtcaatg tggtcggtcc tccatgggct
ctggcggggt gttcaccatc 5700 gacgggaaaa tcaagtgcgt aactgccgca
catgtcctta cgggcaattc agctagggtt 5760 tccggggtcg gtttcaacca
aatgcttgac tttgatgtaa aaggagactt cgccatggcc 5820 gattgcccgg
attggcaagg ggctgctccc aagacccaat tctgcaagga tggatggact 5880
ggccgtgcct actggctaac atcctctggc gtcgaacccg gtgtcattgg aaaaggattc
5940 gccttctgct tcaccgcgtg cggcattccg ggtccccagt gatcaccgag
gccggtgagc 6000 ttgtcggtgt ccacacggga tcaaataaac aaggaggagg
catcgtcacg cgcccctcag 6060 gccagttttg taatgtgtca cccgtcaagc
taagcgaatt aagtgaattc tttgctgggc 6120 ctaaggtccc gctcggtgat
gtgaaggttg gcagccatat aatcaaagat ataggcgagg 6180 taccttcaga
tctttgcgcc ttgcttgctg ccaaacctga actggaagga ggcctctcca 6240
ccgtccaact tctgtgtgtg ttttttctcc tgtggaggat gatgggacat gcctggacgc
6300 ccttggttgc tgtggggttc tttatcttga atgaggttct tccagctgtc
ctggtccgga 6360 gtgtcttctc ctttggaatg tttgtgctat cctggctcac
accatggtct gcgcaagttc 6420 tgatgatcag gcttctaaca gcagctctta
acaggaacag aggttcactt gccttttaca 6480 ccctcggtgc aataaccggc
tttgtccaga tcttgcggtt actcagggac atccgttgca 6540 ggcagtgatg
aatttgagca cctatgcatt cctgcctcgg atgatggttg tgacctcacc 6600
agtcccagtg atcgcgtgtg gtgttgcgca cctgcttgcc atcattttgt acttgtttaa
6660 gtaccgcggc ctgcacaaga tccttgttgg cgatggagcg ttctctgcgg
ctttcttcct 6720 gcgatacttt gccgagggaa agttgaggga aggggtgtcg
caatcctgcg gaatgaatca 6780 tgagtcactg actggtgccc tcgccatgaa
actcaatgac gaggacttgg atttccttac 6840 gaaatggact gattttaagt
gctttgtttc tgcatccaac atgaggaatg cagcgggcca 6900 atttatcgag
gctgcctatg ctaaagcact tagagtagaa cttgcccagt tggtacaggt 6960
tgataaggtt cgaggcacta tggccaaact agaagctttt gctgacaccg tggcacccca
7020 actctcgccc ggtgacattg ttgtcgctct tggccatacg cctgttggca
gtatcttcga 7080 cctaaaggtt ggtagcacta agcacaccct ccaagccatt
gagaccagat ttcttgctgg 7140 gtccaaaatg accgtggcgc gtgtcgtcga
cccgaccccc acgcccccac ccgcacccgt 7200 gcccatcccc ctcccaccga
aagttctgga gaatggtccc aacgcttggg gggatgagga 7260 tcgtttgaat
aaaaaaaaaa ggcgcaggat ggaagccctc ggcatctatg ttatgggtgg 7320
gaaaaagtac cagaaatttt gggataagaa ctccggtgat gtgttttatg aggaggtcca
7380 taataacaca gatgagtggg agtgcctcag agttggcgac cctgccgact
ttgaccctga 7440 gaagggaact ctgtgtgggc acgtcaccat tgaggataag
gcttatcatg tttacgcctc 7500 cccatccggt aagaagttcc tggtccccgt
caacccagaa aacggaagag tccaatggga 7560 agctgcaaag ctttccgtgg
agcaggccct tggtatgatg aacgtcgacg gcgaactgac 7620 tgccaaagaa
ctggagaaac tgaaaagaat aattgataaa ctccagtgcc tgactaagga 7680
gcagtgttta aactgctagc cgccagcggc ttgacccgct gtggtcgcgg cggcttggtt
7740 gtcactgaga cagcggtaaa aatagtcaaa tttcacaacc ggaccttcac
cctgggacct 7800 gtgaatttaa aagtggccag tgaggttgag ttaaaagacg
cggtcgagca caaccaacac 7860 ccggttgcaa gaccggttga tggtggtgtt
gtgctcctgc gttctgcagt tccttcactt 7920 atagacgtcc tgatctccgg
tgccgacgca tctcctaagt tgctcgccca tcacgggccg 7980 gggaacactg
ggatcgatgg cacgctttgg gatttcgagt ctgaggccac taaagaggaa 8040
gtcgcactta gtgcgcaaat aatacaggct tgtgacatca ggcgcgggga cgcacccaaa
8100 attgatctcc cctacaagct gtaccctgtt aggggcaacc ctgagcgggt
gaaaggagtt 8160 ctgaggaata caaggtttgg agacatacct tacaagaccc
ccagtgacac tgggagcccg 8220 gtgcacgcgg ccgcctgcct tacgcctaac
gccactccgg tgactgacgg gcgctccatc 8280 ttggccacga ccatgccctc
tgggtttgag ttgtatgtac cgaccattcc agcgtctgtc 8340 cttgattacc
ttgattctag gcctgactgc cctaaacagt tgacagagca cggctgtgaa 8400
gatgccgcac tgagagacct ctccaaatat gacttgtcca cccaaggctt tgttttacct
8460 ggagttcttc gcctcgtgcg gaaatacctg tttgcccatg taggtaagtg
cccacctgtt 8520 caccggcctt ctacttatcc tgctaagaat tctatggctg
gactaaatgg gaacaggttc 8580 ccgaccaagg atattcagag cgtccctgaa
atcgacgttc tgtgcgcgca ggctgtgcgg 8640 aaaactggca gactgttacc
ccttgtaccc ttaagaagca gtattgcggg aagaagaaaa 8700 ctaggacaat
actcggcacc aataacttca tcgcgctggc tcatcgggca gcgttgagtg 8760
gtgtcaccca gggcttcatg aaaaaggcat ttaactcgcc catcgccctc ggaaaaaaca
8820 aatttaagga gctacaaact ccggtcctag gcagatgcct tgaagctgat
cttgcatcct 8880 gcgaccgatc cacacctgca attgtccgtt ggtttgccgc
caatcttctt tatgaacttg 8940 cctgtgctga agatcacctg ccatcttatg
tgctgaactg ttgccacgac ttattggtca 9000 cgcagtctgg cgcagtgact
aagagaggtg gcctgtcatc tggcgacccg atcacctctg 9060 tgtctaacac
catttacagc ttggtgatct atgcacagca catggtgctc agttacttca 9120
aaagtggtca cccccacggc cttctgttct tacaagacca gctaaagttt gaggacatgc
9180 tcaaggttca acccctgatc gtctattcgg acgacctcgt gctgtatgcc
gagtctccca 9240 ccatgccaaa ctaccactgg tgggttgaac atctgaattt
aatgctgggg tttcagacgg 9300 acccaaagaa gacagctata acagactcgc
catcatttct aggctgcagg ataataaatg 9360 gacgccagct agtccctaac
cgtgacagga ttctcgcggc cctcgcctac catatgaagg 9420 cgagtaatgt
ttctcaatac tacgcttcgg cggctgcaat actcatggac agctgtgctt 9480
gtttagagta tgatcctgaa tggtttgaag aacttatagt tggaatatcg cagtgcgccc
9540 gcaaggacgg ctatagcttt cccggtccgc cgttcttctt gtctatgtgg
gaaaaactca 9600 ggtctaatta tgaggggaag aagtcgagag tgtgcgggta
ctgcggggcc ccggccccgt 9660 acgctactgc ctgtggcctc gatgtctgca
tttaccacac ccacttccac cagcattgtc 9720 cggttataat ttggtgtggc
cacccagcgg gttctggttc ttgtagtgag tgcaaatccc 9780 ccgtggggaa
aggcacaagc cctctggacg aggtgttaaa acaagtcccg tataaacccc 9840
cacggaccat aatcatgcat gtggaacagg gtcttacccc ccttgaccca ggcagatacc
9900 agactcgccg cggattggtc tccgttaggc gcggaatcag ggggaatgaa
gttgaactac 9960 cagacggtga ttacgctagt accgccttgc tccccacctg
taaagagatc aacatggtcg 10020 ctgtcgcttc taatgtgttg cgcagcaggt
tcatcatcgg tccgcccggt gctgggaaga 10080 catactggct tctacaacag
gtccaggatg gtgatgtcat ttacacacca actcaccaga 10140 ccatgcttga
catgattaga gctttgggga cgtgccggtt caacgtccca gcaggcacaa 10200
cgctgcaatt ccctgtcccc tcccgtaccg gtccgtgggt tcgcatccta gccggcggtt
10260 ggtgtcctgg caagaattcc ttcctggatg aagcagcgta ttgcaatcac
cttgatgtct 10320 tgaggcttct tagcaaaact accctcacct gtctgggaga
tttcaaacaa ctccacccag 10380 tgggttttga ttctcattgc tatgtttttg
acactatgcc tcagactcaa ctgaagacca 10440 tctggagatt cggacagaat
atttgtgatg ccatccaacc agattacaga gacaaactca 10500 tgtccatggt
caacacaacc cgtgtaacct acgtggagag acctgtcagg catgggcaag 10560
tcctcacccc ctaccacagg gaccgagagg acgacgccat caccattgac tccagccaag
10620 gcgccacatt tgatgtggtt acattgcatt tgcccactaa agattcactc
aacaggcaaa 10680 gagcccttgt tgctatcacc agggcaagac atgctatctt
tgtgtatgac ccacacaggc 10740 aactgcagag cctatttgat cttcctgcga
aaagcacccc tgtcaacctc gcagtgcacc 10800 gcgacgggca gctgatcgtg
ctagatagaa ataacaaaga atgcacggtt gctcaggctc 10860 ttggcaacgg
agataaattt agggccacag acaagcgcgt tgtagactct ctccgcgcca 10920
tttgtgctga tctagaaggg tctagctctc cgctccccaa ggtcgcccac aacttgggat
10980 ttcatttctc acctgatttg acacagtttg ccaaactccc agtagaactt
gcacctcact 11040 ggcccgtggt gacaacccag aacaatgaaa agtggccaga
tcggctggtt gctagccttc 11100 gccctattca taaatatagc cgcgcgtgca
ttggtgccgg ctatatggtg ggcccctcgg 11160 tgtttctagg cacccctggg
gtcgtgtcat actacctcac aaaatttatt aagggcgagg 11220 ctcaagtgct
tccggagacg gtcttcagca ccggtcgaat tgaggtagat tgccgggaat 11280
accttgatga tcgggagcca gaagttgctg cgtccctccc acatgccttc attggcgacg
11340 tcaaaggcac taccgttggg ggatgtcacc atgtcacttc caaatacctt
ccgcgcttcc 11400 ttcctaagga atcagttgcg gtagtcgggg tttcgagccc
cggaaaagcc gcgaaagcag 11460 tgtgcacact gacagatgtg tacctcccag
accttgaagc ctacctccac ccggaaaccc 11520 agtccaagtg ctggaaattg
atgttggact tcaaggaagt ccgactgatg gtctggaaag 11580 acaagacggc
ctatttccaa cttgaaggcc gctatttcac ctggtatcag cttgctagct 11640
acgcctcgta catccgtgtt cctgtcaact ctgcggtgta cttagacccc tgcatgggcc
11700 ctgccctttg caacaggaga gttatcgggt ccactcattg gggagctgac
ctcgcagtca 11760 ccccttatga ttacggtgcc aaaattattt tgtctagtgc
gtaccatggt gaaatgcctc 11820 ccgggtacaa gattctggcg tgcgcagagt
tctcgcttga cgacccagtc aagtacaagc 11880 acacctgggg gtttgaatcg
gatacagcgt atctgtatga gttcaccgga aacggtgagg 11940 actgggagga
ttacaatgat gcgtttcgtg cgcgccagga ggggaaagtc tataaggcca 12000
ctgccaccag catgaagttt tattttcccc cgggccctat cattgaacca actttaggcc
12060 tgaattgaaa tgaaatgggg tctatgcaaa gcctttttga caaaattggc
caacttttcg 12120 tggatgcttt cacggagttc ttggtgtcca ttgttgatat
cattatattt ttggccattt 12180 tgtttggctt caccatcgcc ggttggctgg
tggtcttttg catcagattg gtttgctccg 12240 cgctactccg tgcgcgccct
gccattcact ctgagcaatt acagaagatc ctatgaggcc 12300 tttctttctc
agtgccaggt ggacattccc acctggggat ttaaacatcc tttggggatg 12360
ttttggcacc ataaggtgtc aaccctgatt gatgaaatgg tgtcgcgtcg aatgtaccgc
12420 atcatggata aagcaggaca ggctgcctgg aaacaggtgg tgagcgaggc
tacgctgtct 12480 cgcattagta gtttggatgt ggtggctcac tttcagcatc
ttgccgccat tgaagccgag 12540 acctgtaaat atttggcctc tcggctgccc
atgctacaca acctgcgcat gacagggtca 12600 aatgtaacca tagtgtataa
tagtactttg aatcaggtgc ttgctatttt tccaacccct 12660 ggttcccggc
caaagcttca tgattttcag caatggctaa tagctgtaca ttcctctata 12720
ttttcctctg ttgcagcttc ttgtactctt tttgttgtgc tgtggttgcg ggttccaatg
12780 ctacgtattg cttttggttt ccgctggtta ggggcaattt ttccttcgaa
ctcacagtga 12840 actacacggt gtgtccacct tgcctcaccc ggcaagcagc
catagaggcc tacgaacctg 12900 gcaggtctct ttggtgcagg atagggtatg
atcgctgtgg ggaggacgat catgacgaac 12960 tagggtttgt ggtgccgtct
ggcctctcca gcgaaggcca cttgaccagt gtttacgcct 13020 ggttggcgtt
cctgtctttc agttacacag cccagttcca tcctgagata ttcgggatag 13080
ggaatgtgag tcaagtttat gttgacatca ggcatcaatc catttgcgcc gttcacgacg
13140 ggcagaacgc cactttgcct cgccatgaca atatttcagc cgtgttccag
acttattacc 13200 aacatcaagt cgacggcggc aattggtttc acctagaatg
gctgcgtccc ttcttttcct 13260 cttggttggt tttaaatgtc tcttggtttc
tcaggcgttc gcttgcaagc catgtttcag 13320 ttcgagtctt gcagacatta
agaccaacac caccgcagcg gcaggctttg ctgtcctcca 13380 agacatcagt
tgccttaggt atcgcaactc ggcctctgag gcgtttcgca aaatccctca 13440
gtgtcgtacg gcgataggga cacccatgta tattactgtc acagccaatg taaccgatga
13500 gaattatttg cattcctctg accttctcat gctttcttct tgccttttct
acgcttctga 13560 gatgagtgaa aagggattta aagtggtatt tggcaatgtg
tcaggcatcg tggctgtgtg 13620 cgtcaacttt accagctacg tccaacatgt
caaggaattt acccaacgct ccttggtagt 13680 cgaccatgtg cggctgctcc
atttcatgac acctgagacc atgaggtggg caactgtttt 13740 agcctgtctt
tttgccattc tgttggccat ttaaatgttt gagtatgttg gggaaatgct 13800
tgaccgcggg ctattgctcg tcattgcttt ttttgtggtg tatcgtgccg tcttggtttg
13860 ttgcgctcgc cagcgccaac agcatcaaca gccctcattt acagttgatt
tataacttga 13920 cgctatgtga gctgaatggc acagattggt tagctggtga
atttgactgg gcagtggagt 13980 gttttgtcat ttttcctgtg ttgactcaca
ttgtctccta tggtgccctc accaccagcc 14040 atttccttga cacagtcggt
ctggtcactg tgtctaccgc cggcttttcc cacgggcggt 14100 atgttctgag
tagcatctac gcggtctgtg ccctggctgc gttgatttgc ttcgtcatta 14160
ggtttacgaa gaattgcatg tcctggcgct actcatgtac cagatatacc aactttcttc
14220 tggacactaa gggcagactc tatcgttggc ggtcgcctgt catcatagag
aaaaggggta 14280 aagttgaggt cgaaggtcat ctgatcgacc tcaagagagt
tgtgcttgat ggttccgcgg 14340 caacccctat aaccaaaatt tcagccgagc
aatggggtcg tccttagatg acttctgcca 14400 tgatagcacg gctccactaa
aggtgctttt ggcgttctct attacctaca cgccagtgat 14460 gatatatgcc
ctaaaagtaa gtcgcggccg actgttaggg cttctgcacc ttttgatctt 14520
cctaaattgt gctttcacct tcgggtacat gacattcgtg cactttcaga gcacaaacaa
14580 ggtcgcgctc actatgggag cagtagttgc actcctttgg ggggtgtact
cagccataga 14640 aacctggaaa ttcatcacct ccagatgccg tttgtgcttg
ctaggccgca agtacatttt 14700 ggcccctgcc caccacgttg aaagtgccgc
aggctttcat ccgatagcgg caaatgataa 14760 ccacgcattt gtcgtccggc
gtcccggctc cactacggtt aacggcacat tggtgcccgg 14820 gttgaaaagc
ctcgtgttgg gtggcagaaa agctgtcaaa cagggagtgg taaaccttgt 14880
taaatatgcc aaataacaac ggcaagcagc agaagaaaaa gaagggggat ggccagccag
14940 tcaatcagct gtgccagatg ctgggtaaga tcatcgctca gcaaaaccag
tccagaggca 15000 agggaccggg aaagaaaaac aagaagaaaa acccggagaa
gccccatttt cctctagcga 15060 ctgaagatga tgtcagacat cacttcacct
ctggtgagcg gctattgtgt ctgtcgtcaa 15120 tccagacagc ctttaatcaa
ggcgctggaa tttgtaccct gtcagattca gggaggataa 15180 gttacactgt
ggagtttagt ttgccgacgc atcatactgt gcgcctgatc cgcgtcacag 15240
cgtcaccctc agcatgatga gctggcattc ttgaggcatc ccagtgtttg aattggaaga
15300 atgtgtggtg aatggcactg attgacattg tgcttctaag tcacctattc
aattagggcg 15360 accgtgtggg ggcaaaattt aattggcgtg aaccacgcgg
ccgaaattaa aaaaaaaaaa 15420 55 15103 DNA Porcine reproductive and
respiratory syndrome virus 55 nngacgtata ggtgttggct ctatgccttg
acatttgtat tgtcaggagc tgtggccatt 60 ggcacagccc aaaaacttgc
tcacggaaac acccttctct gacagcctcc ttcaggggag 120 cttggggtct
gtccctagca ccttgcttcc ggagttgcac tgctttaccg tctctccacc 180
cctttaacca tgtctgggat gcttgatcgg tgcacgtgta cccccaatgc cagggtgttt
240 atggcggaag gccaagtcta ctgcacacga tgcctcagtg cacggtctct
ccttcccctg 300 aatctccaag cttctgagct tggggtgcta ggcctattct
acaggcccga agagccactc 360 cggtggacgt tgccacgtgc attccccact
gttgagtgct cccccgccgg agcctgctgg 420 ctttctgcaa tctttccaat
tgcacggatg accagtggaa acctgaactt ccaacaaaga 480 atggtacggg
tcgcagctga gtttaacaga gccggccagt tcacccctgc agttttgaag 540
actctacaag tttatgaacg gggttgccgc tggtacccca ttgttggacc tgtccctgga
600 gtggccgttt tcgccaactc cctacatgtg agtgataaac ctttcccggg
agcaactcac 660 gtgctaacca acctgccgct cccgcagaga cccaagcctg
aagacttttg cccctttgag 720 tgtgctatgg ctactgtcta tgacattggt
catgacgccg tcatgtatgt ggccgagggg 780 aaagtctcct gggcccctcg
tggcggaaat gaagtgaaat ttgaaactgt ccccgaggag 840 ttgaaattga
ttgcggaccg gctccgcacc tccatcccgc cccaccatgt agtggacatg 900
tctaagttcg ccttcacggc tcctgggcgt ggtgtttcta tgcgggttga acgccaacac
960 ggctgcctcc ccactgacac tgtccctgaa ggcaactgct ggtggagctt
gtttaacttg 1020 ctcccactgg aagtccagaa caaagaaatc cgccatgcta
accaatttgg ctaccagacc 1080 aagcatggtg tttctggcaa gtacctacag
cggaggctgc aagttaatgg tctccgagca 1140 gtaactgacc caaatggacc
tatcgtcgta cagtacttct ccgttaagga gagttggatc 1200 cgccacttga
aactggcggg agaacccagc taccctgggt ttgaggacct cctcagaata 1260
agggttgagc ccaatacgtc gccattggct gacaaggatg aaaaaatttt ccggtttggc
1320 agtcacaagt ggtacggcgc tggaaagaga gcaaggaaag cacgctcttg
tgcgactgcc 1380 acagtcgctg gccgcgcttt gtccgttcgt gaaacccggc
aggccaaggg gcacgaggtt 1440 gccggcgcca acaaggctga gcacctcaaa
cattattccc cgcctgccga agggaattgt 1500 ggttggcact gcatttccgc
catcgccaac cggatggtga attccaaatt tgaaaccacc 1560 cttcccgaaa
gagtgagacc tccagatgac tgggctactg acgaggatct tgtgaatgcc 1620
attcaaatcc tcagacttcc tgcggccttg gacaggaacg gtgcttgtgt tagcgccaag
1680 tacgtactta agctggaagg tgagcattgg actgtcactg tgacccctgg
gatgtctcct 1740 tctttgctcc ctcttgaatg tgttcagggc tgttgtgagc
acaagggtgg tcttggttcc 1800 ccagatgcag tcgaggtctt cggatttgac
cctgcctgcc ttgaccggct ggctgaggtg 1860 atgcacctgc ctagcagtgt
tatcccagcc gccctggccg aaatgtccgg cgattccgat 1920 cgttcggctt
ccccggtcac caccgtgtgg actgtttcgc agttctttgc ccgtcacaac 1980
ggagggaatc accctgacca ggcgcgctta gggaaaatta tcagcctttg tcaggtgatt
2040 gaggactgct gctgttccca gaacaaaacc aaccgggtca ccccggagga
ggtcgcagca 2100 aagattgacc tgtacctccg tggtgcaaca aatcttgaag
aatgcttggc caggcttgag 2160 aaagcgcgcc cgccacgcgt aatggacacc
tcctttgatt gggatgttgt gctccctggg 2220 gttgaggcgg caactcagac
gaccgaactg ccccgggtca accagtgtcg cgctctggtc 2280 cctgttgtga
ctcaaaagtc tctggacaat aactcggttc ctctgaccgc cttctcgctg 2340
tccaattact actaccgtgc acaaggtgac gagattcgtc accgtgacag gctaaacgcc
2400 gtactctcta agttggaggg ggctgttcga gaagaatatg ggctcatgcc
gactggacct 2460 ggcccgcgac ccgcactgtc gagcgggctc gatgggctta
aagacagatg gagagatctg 2520 ctgaaactag ccaacgccca gacaacctca
gaaatgatgg cctgggcagc cgagcaggtt 2580 gatctagaag cttgggtcaa
aagctaccca cggtggacac caccaccccc tccgccaaga 2640 gttcagcctc
gaaaagcgaa gcctgtcagg agcttgccag agagcaagcc tgtccctgcc 2700
ccgcgcagga aggttagatc cgatcgtggc agcccggttt tgttgggcga caatgttcct
2760 aacagttggg aagacttgac tgtcggtggc ccccttgatc tcctgacccc
acccgagtca 2820 gtgacacctc cagtgagctt gcgcttacgt ccgcgccgca
acacactttt aggccggtga 2880 cacctttggg tgaaccggcc ccagttcccg
caccgcgcag aactgtgtcc cgaccggtga 2940 catccttgaa tgggccgatc
cttatgtccg caccgcggca caagtttcag caggtggaaa 3000 aagcaaattt
ggcgacagca acgctgacgt accaggacga gcccctagat ttgtctgcat 3060
cctcacagac tgaatatgag gcttttcctc cagcaccact gcagaacatg ggtattccgg
3120 aggtggaagg gcaagaagct gaggaagtcc tgagtggaat ctcgatatac
tggatgacat 3180 caattctgcc ctgtatcatc aagcggttcc ctgtcaagcg
tagcgatcac acgcccaata 3240 ggtgcggaga gtgaccttac cattggctca
gtcgccactg aagatattcc acgcatcctc 3300 gggaaaatag aagatgccgg
tgagatgtcc aaccagggac ccttggcatt ctccgaggaa 3360 aaaccggtag
atgaccaacc taccaaagac ccccggatgt cgtcgcggag gtcagacaag 3420
agcgcaccag ctcggtccgc aggcacaggt ggcgtcggct tgtttactga tttgcccctt
3480 cagacggtgt ggatgcggac ggggggggcc cgttacggac ggtaaaaaca
aaaactgaaa 3540 ggttctttga ccagctgagc cgtcaggttt ttaacctcgt
ctcccatctc cctgttttct 3600 tctcatacct tttcaaacct ggcagtggtt
attctccggg tgattggggt tttgcagctt 3660 ttactctatt gtgcctcttt
ttatgttaca gttatccagc ctttggtatt gctcccctct 3720 tgggtgtatt
ttctgggtct tctcggcgcg tccgaatggg ggtttttggt tgctggttgg 3780
cttttgctgt tggtctgttc aaatctgtgc ccgacccagt cggcactgct tgtgaatttg
3840 actcgccaga gtgcagaaac atccttcatt cttttgagct tctcaaacct
tgggaccctg 3900 ttcgcagcct tgttgtgggc cccgtcggtc tcggccttgc
cattcttggc aggttactgg 3960 gcggggcacg ctacatctgg cactttttgc
ttaggcttgg cattgttgca gattgtatct 4020 tggctggagc ttatgtgctt
tctcaaggta ggtgtaaaaa gtgctgggga tcttgtataa 4080 gaactgctcc
taatgaggtc gcttttaacg tgtttccttt cacacgtgcg
accaggtcgt 4140 cacttgttga cctgtgtgat cggttttgcg cgccaaaagg
catggacccc atttttctcg 4200 ccactgggtg gcgcgggtgc tgggccggcc
gaagccccat tgagcaaccc tctgaaaaac 4260 ctatcgcgtt tgcccagttg
gatgaaaaga aaattacggc taggactgtg gtcgcccagc 4320 cttatgaccc
caaccaagcc gtaaagtgct tgcgggtatt gcaggcgggt ggggtgatgg 4380
tggctgaggc ggtcccaaaa gtggtcaagg tttccgctgt tccattccga gccccctttt
4440 ttcctaccgg agtgaaagtt gaccctgaat gtagggtcgt ggttgaccct
gacactttca 4500 ctgcagctct ccggtctggc tactccacca caaaccttgt
ccttggtgta ggggactttg 4560 cccagctgaa tggattaaaa atcaggcaaa
tttccaagcc ttcaggagga ggcccacatc 4620 tcatggctgc cctgcatgtt
gcctgctcga tggttttgga catgcttgct gggatttatg 4680 tgactgcggt
gggttcttgc ggcaccggca ccaacgatcc gtggtgcgct aacccgtttg 4740
gcgtccctgg ctacggacct gcctccctct gcacgtccag attgtgcatt tcccagcatg
4800 cccttaccct gcccttgaca gcacttgtgg cgggattcgg tatccaagaa
attgccttag 4860 tcgttttgat ttttgtttcc atcggaggca tggctcatag
gttgagttgt aaagctgata 4920 tgctgtgtat tttgcttgca attgccagca
atgtttgggt acctcttacc tggttgcttt 4980 gtgtgtttcc ttgctggttg
cgctgttttt ctttgcaccc ccttaccatc ctatggttgg 5040 tgtttttctt
gatttctgtg aatatgcctt caggaatctt ggccatggtg ttgttggttt 5100
ctctttggct tcttggtcgt aatactaatg ttgctggtct tgtcaccccc tacgacattc
5160 atcattacac cagtggcccc cgcggtgttg ccgccttggc taccgcacca
gatgggactt 5220 acttagccgc tgtccgccgt gctgcgttga ctggccgcac
catgctgttc accccgtccc 5280 agcttgggtc tcttcttgag ggtgctttca
gaactcgaaa gccctcactg aacaccgtca 5340 atgtggtcgg gtcctccatg
ggctctggcg gggtgtttac catcgacggg aaagtcaagt 5400 gcgtaactgc
cgcacatgtc cttacgggta actcagctag ggtttccggg gtcggcttca 5460
atcaaatgct tgactttgac gtaaaggggg atttcgccat agccgattgc ccgaattggc
5520 aaggggctgc ccccaagacc caattctgcg aggatggatg gactggccgt
gcctattggc 5580 taacatcctc tggcgtcgaa cccggcgtca ttggaaaagg
attcgccttc tgcttcaccg 5640 cgtgcggcga ttccgggtcc ccagtgatca
ccgaggccgg tgagcttgtc ggcgttcaca 5700 cgggatcaaa taaacaaggg
ggaggcatcg tcacgcgccc ctcaggccag ttttgtaatg 5760 tggcacccat
caagctaagc gaattaagtg aattctttgc tgggcccaag gtcccgctcg 5820
gtgatgtgga ggttggcaac catataatta aagacatagg cgaagtgcct tcagatcttt
5880 gtgccttgct cgctgccaaa cctgaactgg aaggaggcct ctccaccgtc
caacttcttt 5940 gtgtgttttt tctcctgtgg agaatgatgg gacatgcctg
gacgcccttg gttgctgtgg 6000 gtttctttat cttgaatgag gttctcccag
ccgtcctggt ccggagtatt ttctcctttg 6060 gaatgtttgt gctatcctgg
ctcactccat ggtctgcgca agttctaatg atcaggcttc 6120 taacagcagc
tcttaacagg aacagatggt cacttgcctt tttcagcctt ggtgcggtga 6180
ccggttttgt cgcagatctt gcggccactc aggggcatcc gttgcagaca gtgatgaatt
6240 tgagtaccta tgcattcctg cctcggatga tggttgtgac ctcaccagtc
ccagtgatcg 6300 cgtgcggtgt cgtgcaccta cttgccatca ttttgtactt
gtttaagtac cgtggcctgc 6360 actatatcct tgttggcgat ggagtgttct
ctgcggcttt cttcctgcgg tactttgccg 6420 agggaaagtt gagggaaggg
ttgtcccaat cctgcggaat gaatcatgag tccctaactg 6480 ttgcccttgc
tatgagactc aatgacgagg acttggattt ccttacgaaa tggactgatt 6540
ttaagtgctt tgtttctgcg tccaacatga ggaatgcagc gggtcaattt atcgaggctg
6600 cctatgctaa agcacttaga gtagaacttg cccagttggt gcaggttgat
aaagttcgag 6660 gtactttggc caaacttgaa gcttttgctg ataccgtggc
accccaactc tcgcccggtg 6720 acattgttgt cgctctcggc catacgcctg
ttggcagtat cttcgaccta aaggttggta 6780 gcaccaagca taccctccaa
gccattgaaa ccagagtcct tgcagggtcc aaaatgaccg 6840 tggcgcgcgt
cgtcgacccg acccctacgc ccccacccgc acccctgtcc atccccctcc 6900
caccgaaagt cctggagaat gcccccaacg cttgggggga tgaggaccgt ttgaataaga
6960 agaagaggcc caggatggaa gccctcggca tctatgttat gggtgggaaa
aagtaccaga 7020 aattttggga caagaattcc ggtgatgtgt tttatgagga
ggtccatgac aacacagatg 7080 agtgggagtg tctcagagtc ggcgaccctg
ccgactttga ccctgagaag ggaactctgt 7140 gtggacatgt caccattgaa
gataaggctt accatgttta cacctcctca tctggtaaga 7200 agttcttggt
ccccgtcaac ccagagaatg gaagagtcca gtgggaagct gccaagcttt 7260
ccgtggagca gccccttggc atgatgaacg tcgacggtga actgactgcc aaagaactgg
7320 agaaactgaa aagaataatt gataaactcc agggcctgac taaggagcag
tgtttaaact 7380 gctagccgcc agcggcttga cccgctgtgg tcgcggcggc
ttagttgtta ctgagacagc 7440 ggtgaagatc gtcaaatttc acaaccggac
cttcaccttg ggacctgtga atttaaaagt 7500 ggccagtgag gttgagctga
aagacgcggt tgagcacaac cagcacccgg ttgcaagacc 7560 ggttgatggt
ggtgttgtgc tcctgcgttc tgcagttcct tcgcttgtcg acgtcttaat 7620
ctccggtgct gatgcatctc ccaagttact tgcccatcac gggccgggaa acactgggat
7680 cgatggcacg ctctgggatt ttgagtccga agccattaaa gaggaagtcg
cacttagtgc 7740 gcaaataata caggcttgtg acattaggcg cggtgacgca
cctgaaattg gtctccctta 7800 caaactatac cctgttaggg gcaaccctga
gcgggtaaaa ggagttttgc agaatacaag 7860 gtttggagac ataccttaca
aaacccccag tgacaccgga agcccagtgc acgcggctgc 7920 ctgccttacg
cccaacgcca ccccggtgac tgatgggcgc tctgtcttgg ccacgaccat 7980
gccctccggg ttcgagttgt atgtacccac cattccggcg tctgttcttg attatcttga
8040 ttctaggcct gactgcccta aacagttgac agagcacggc tgtgaagatg
ccgcattgag 8100 agatctctcc aagtatgact tgtccaccca aggctttgtt
ttgcctggag ttcttcgcct 8160 tgtgcggaag tacctgtttg cccacgtggg
taagtgcccg tccgttcatc ggccttccac 8220 ttaccccgcc aaaaattcta
tggctggaat aaatgggaac aggtttccaa ccaaggacat 8280 tcagagcgtc
cctgaaatcg acgttctgtg cgcacaggct gtgcgagaaa actggcaaac 8340
tgttacccct tgtaccctta agaaacagta ctgcgggaag aagaagacta ggaccatact
8400 cggcaccaac aacttcattg cgctggccca ccgggcagcg ttgagtggtg
tcacccaagg 8460 cttcatgaaa aaagcattta actcgcccat cgccctcggg
aaaaacaaat ttaaagagct 8520 acagactccg gtcctcggca ggtgccttga
agctgatctt gcatcctgcg atcgatccac 8580 acctgcaatt gtccgctggt
ttgccgccaa tcttctttat gaactttcct gtgctgaaga 8640 gcatctaccg
tcgtacgtgc tgaactgctg ccacgaccta ctggtcacgc agtccggcgc 8700
agtgactaag agaggtggcc tgtcgtctgg tgacccgatc acctctgtgt ccaacaccat
8760 ttacagcttg gtgatctatg cacagcacat ggtgcttagt tacttcaaaa
gtggtcatcc 8820 ccatggcctt ctgtttttac aagaccagct aaagtttgag
gacatgctca aggtccaacc 8880 cctgatcgtc tattcggacg accttgtgct
gtatgccgag tctcccacca tgccaaacta 8940 ccattggtgg gttgaacatc
tgaatctgat gttggggttt cagacggacc caaagaagac 9000 aaccataaca
gactcaccat catttctagg ctgtagaata gtaaatggac gccagctagt 9060
ccccaaccgt gacaggattc tcgcggccct cgcctaccac atgaaggcga gtaatgtttc
9120 tgaatactac gcctcagcgg ctgcaatact catggacagc tgtgcttgtt
tagagtatga 9180 tcctgaatgg tttgaagaac ttgtagttgg aatagcgcag
tgcgcccgca aggacggcta 9240 cagctttccc ggcacgccgt tcttcatgtc
catgtgggaa aaactcaggt caaattatga 9300 ggggaaaaag tcgagagtgt
gcgggtactg cggggccccg gccccgtacg ctactgcctg 9360 cggccttgac
gtctgcattt accacaccca cttccaccag cattgtccag tcacaatctg 9420
gtgcggccat ccagcgggtt ctggttcttg taatgagtgc aagtccccca tagggaaagg
9480 cacaagcccc ctagacgagg tgctagaaca agtcccgtat aagcccccac
ggaccgtaat 9540 tatgcatgtg gagcagggtc ttacccccct tgacccaggt
aggtaccaga ctcgccgcgg 9600 attagtctcc gtcaggcgtg gaatcaaggg
aaatgaagtt gaactaccag acggtgatta 9660 tgctagtacc gccttgctcc
ccacctgtaa agagatcaac atggtcgctg tcgcttctaa 9720 tgtgttgcgc
agcaggttca tcatcggtcc acccggtgct gggaaaacat actggctcct 9780
tcaacaagtc caggatggtg atgttattta cacaccaact caccagacca tgcttgacat
9840 gatcagagct ttggggacgt gccgattcaa tgtccctaca ggcacaacac
tgcagttccc 9900 tgtcccctcc cgtaccggtc cgtgggttcg catcctagcc
ggtggttggt gtcctggcaa 9960 gaattccttc ctggatgaag cagcgtatta
caatcacctt gatgtcttga ggcttcttag 10020 taaaactacc ctcacctgtc
tgggagactt taaactactc cacccagtgg gttttgattc 10080 ccattgctat
gtttttgaca tcatgcctca gactcaatta aagaccatct ggagatttgg 10140
acagaatatc tgtgatgcca ttcaaccaga ttacagggac aaactcatgt ccatggtcaa
10200 cacaacccgt gtaacttacg tggaaaaacc cgtcaggtat gggcaagtcc
ttacccccta 10260 ccataaggac cgagaggacg gcgccatcac cattgactcc
agtcaaggtg ccacgtttga 10320 tgtggttaca ttgcatttgc ccactaaaga
ttcactcaac aggcaaagag cccttgttgc 10380 tatcactagg gcaagacatg
caatttttgt gtatgaccca cacaagcaac tgcagagcct 10440 gtttgatctc
cctgcaaaag gcacacccgt caacctcgct gtgcaccgcg acgggcagct 10500
tattgtgctg gatagaaata acaaggaatg cacggttgct caggctctag gcaatggaga
10560 taaatttagg gccacagaca aacgcgttgt ggattctctc cgcgccattt
gtgctgatct 10620 agaagggtcg agctctccgc tccccaaggt cgcacacaac
ttgggatttt atttctcacc 10680 tgatttaacg cagtttgcta aactcccagt
agaacttgca ccccactggc ccgtggtgac 10740 aactcagaac aatgaaaagt
ggccagatcg gctggttacc agccttcgcc ctatccataa 10800 atatagccgc
gcgtgcattg gtgccggcta tatggtgggt ccctcggtgt tcctgggcac 10860
tcctggggtc gtgtcatact acctcacaaa atttgttaag ggcgaggctc aagtgcttcc
10920 ggagacgatc ttcagcaccg gccgaattga ggtagattgc cgggaatatc
ttgatgatcg 10980 ggagcgagaa gttgctgcgt ccctcccaca tgccttcatt
ggtgacgtca aaggcactac 11040 cgttggggga tgtcaccatg tcacctccaa
ataccttccg cgcttccttc ccaaggaaac 11100 agttgcggta gtcggggttt
caagccccgg aaaagccgcg aaagcagtgt gcacactgac 11160 agatgtgtac
ctcccagacc ttgaagccta tctccacccg gagactcagt ccaagtgctg 11220
gaaattgatg ttggacttca aggaagttca ctgatggtct ggaaagacaa aacagcctat
11280 ttccaacttg aaggtcgcta cttcacctgg tatcagcttg ctagctatgc
ctcgtacatc 11340 cgtgttcctg tcaactctac ggtgtacttg gacccctgca
tgggccccgc cctttgcaac 11400 aggagagtcg tcgggtccac ccactggggg
gctgacctcg cagtcacccc ttatgattac 11460 ggcgctaaaa tcatcctgtc
tagcgcgtac catggtgaaa tgccccccgg atacaaaatt 11520 ctggcgtgcg
cggaattctc gttggatgac ccagtcaggt ataaacatac ctgggggttt 11580
gaatcggata cagcgtatct atatgagttc accggaaacg gtgaggactg ggaggattac
11640 aatgatgcgt tccgtgcgcg ccagaaaggg aaaatttaca aggccactgc
caccagcatg 11700 aagttttatt tccctccggg ccctgtcatt gaaccaactt
taggcctgaa ttgagatgaa 11760 atggggtcta tgcaaagcct ttttgacaaa
attggccaac tttttgtgga tgctttcacg 11820 gagttcttgg tgtccattgt
tgatatcatt atatttttgg ccattttgtt tggcttcacc 11880 atcgcaggtt
ggctggtggt cttttgcatc agattggttt gctccgcgat actccgtgcg 11940
cgccctgcca ttcactctga gcaattacag aagatcctat gaggcctttc tctctcagtg
12000 ccaggtggac attcccacct ggggaactaa acatcctttg gggatgcttt
ggcaccataa 12060 ggtgtcaacc ctgattgatg aaatggtgtc gcgtcgaatg
taccgcatca tggaaaaagc 12120 aggacaggct gcctggaaac aggtagtgag
cgaggctacg ctgtctcgca ttagtagttt 12180 ggatgtggtg gctcattttc
agcatcttgc cgccattgaa gccgagacct gtaaatatct 12240 ggcctctcgg
ctgcccatgc tacaccacct gcgcatgaca gggtcaaatg taaccatagt 12300
gtataatagt actttgaatc aggtgtttgc tgttttccca acccctggtt cccggccaaa
12360 gcttcatgat ttccagcaat ggctaatagc tgtacattcc tctatatttt
cctctgttgc 12420 agcttcttgt actctttttg ttgtgctgtg gttgcgggtt
ccaatgctac gtactgtttt 12480 tggtttccgc tggttagggg caatttttct
ttcgaactca cggtgaatta cacggtgtgc 12540 ccgccttgcc tcacccggca
agcagccgca gaggcctacg aacccggcag gtccctttgg 12600 tgcaggatag
ggcatgatcg atgtggggag gacgatcatg atgaactagg gtttgtggtg 12660
ccgtctggcc tctccagcga aggccacttg accagtgctt acccctggtt ggcgttcctg
12720 tccttcagct atacggccca gttccatccc gagatattcg ggatagggaa
tgtgagtcga 12780 gtctatgttg acatcaagca ccaattcatt tgcgctgttc
atgatgggca gaacaccacc 12840 ttgccccacc atgacaacat ttcagccgtg
tttcagacct attaccagca tcaggtcgac 12900 gggggcaatt ggtttcacct
agaatggctg cgtcccttct tttcctcttg gttggtttta 12960 aatgtctctt
ggtttctcag gcgttcgcct gcaagccatg tttcagttcg agtctttcag 13020
acatcaagac caacaccacc gcagcggcag gctttgctgt cctccaagac atcagttgcc
13080 ttaggcatcg caactcggcc tctgaggcga ttcgcaaagt ccctcagtgc
cgcacggcga 13140 tagggacacc cgtgtatatc actgtcacag ccaatgttac
cgatgagaat tatttgcatt 13200 cctctgatct tctcatgctt tcttcttgcc
ttttctatgc ttctgagatg agtgaaaagg 13260 gatttaaggt ggtatttggc
aatgtgtcag gcatcgtggc agtgtgcgtc aacttcacca 13320 gttacgtcca
acatgtcaag gaatttaccc aacgttcctt ggtagttgac catgtgcggc 13380
tgctccattt catgacgccc gagaccatga ggtgggcaac tgttttagcc tgtcttttta
13440 ccattctgtt ggcaatttga atgtttaagt atgttgggga aatgcttgac
cgcgggctgt 13500 tgctcgcaat tgcttttttt atggtgtatc gtgccgtctt
gttttgttgc gctcgtcagc 13560 gccaacggga acagcggctc aaatttacag
ctgatttaca acttgacgct atgtgagctg 13620 aatggcacag attggctagc
taataaattt gactgggcag tggagtgttt tgtcattttt 13680 cctgtgttga
ctcacattgt ctcttatggt gccctcacta ctagccattt ccttgacaca 13740
gtcggtctgg tcactgtgtc taccgctggg tttgttcacg ggcggtatgt tctgagtagc
13800 atgtacgcgg tctgtgccct ggctgcgttg atttgcttcg tcattaggct
tgcgaagaat 13860 tgcatgtcct ggcgctactc atgtaccaga tataccaact
ttcttctgga cactaagggc 13920 agactctatc gttggcggtc gcctgtcatc
atagagaaaa ggggcaaagt tgaggtcgaa 13980 ggtcacctga tcgacctcaa
aagagttgtg cttgatggtt ccgcggctac ccctgtaacc 14040 agagtttcag
cggaacaatg gagtcgtcct tagatgactt ctgtcatgat agcacggctc 14100
cacaaaaggt gctcttggcg ttttctatta cctacacgcc agtgatgata tatgccctaa
14160 aggtgagtcg cggccactgc tagggcttct gcaccttttg gtcttcctga
attgtgcttt 14220 caccttcggg tacatgacat tcgtgcactt tcagagtaca
aataaggtcg cgctcactat 14280 gggagcagta gttgcactcc tttggggggt
gtactcagcc atacaaacct ggaaattcat 14340 cacctccaga tgccgtttgt
gctgctaggc cgcaagtaca ttctggcccc tgcccaccac 14400 gttgaaagtg
ccgcaggctt tcatccgatt gcggcaaatg ataaccacgc atttgtcgtc 14460
cggcgtcccg gctccactac ggtcaacggc acattggtgc ccgggttaaa aagcctcgtg
14520 ttggtggcag aaaagctgtt aaacagggag tggtaaacct tgttaaatat
gccaaataac 14580 accggcaagc agcagaagag aaagaagggg gatggccagc
cagtcaatca gctgtgccag 14640 atgctgggta agatcatcgc tcaccaaaac
cagtccagag gcaagggacc gggaaagaaa 14700 aataagaaga aaaacccgga
gaagccccat ttccctctag cgactgaaga tgatgtcaga 14760 catcacttta
cccctagtga gcgtcaattg tgtctgtcgt caatccagac cgcctttaat 14820
caaggcgctg ggacttgcac cctgtcagat tcagggagga taagttacac tgtggagttt
14880 agtttgccta cgcatcatac tgtgcgcctg atccgcgtca cagcatcacc
ctcagcatga 14940 tgggctggca ttcttgaggc atcccagtgt ttgaattgaa
gaatgcgtgg tgaatggcac 15000 tgattgacat tgtgcctcta agtcacctat
tcaattaggg cgaccgtgtg ggggtaagat 15060 ttaattggcg agaaccacac
ggccgaaatt aaaaaaaaaa aaa 15103 56 189 DNA Porcine reproductive and
respiratory syndrome virus 56 nngacgtata ggtgttggct ctatgccttg
acatttgtat tgtcaggagc tgtggccatt 60 ggcacagccc aaaaacttgc
tcacggaaac acccttctct gacagcctcc ttcaggggag 120 cttggggtct
gtccctagca ccttgcttcc ggagttgcac tgctttaccg tctctccacc 180
cctttaacc 189 57 221 DNA Porcine reproductive and respiratory
syndrome virus 57 atgatgtgta gggtattccc cctacataca cgacacttct
agtgtttgtg taccttggag 60 gcgtgcgtac agccccgccc caccccttgg
cccctgttct agcccaacag gtatccttct 120 ctctcggggc gagtgcgccg
cctgctgctc ccttgcagcg ggaaggacct cccgagtatt 180 tccggagagc
acctgcttta cgggatctcc accctttaac c 221 58 1998 DNA Porcine
reproductive and respiratory syndrome virus 58 atgtctggga
tgcttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggaa 60
ggccaagtct actgcacacg atgcctcagt gcacggtctc tccttcccct gaatctccaa
120 gcttctgagc ttggggtgct aggcctattc tacaggcccg aagagccact
ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc tcccccgccg
gagcctgctg gctttctgca 240 atctttccaa ttgcacggat gaccagtgga
aacctgaact tccaacaaag aatggtacgg 300 gtcgcagctg agtttaacag
agccggccag ttcacccctg cagttttgaa gactctacaa 360 gtttatgaac
ggggttgccg ctggtacccc attgttggac ctgtccctgg agtggccgtt 420
ttcgccaact ccctacatgt gagtgataaa cctttcccgg gagcaactca cgtgctaacc
480 aacctgccgc tcccgcagag acccaagcct gaagactttt gcccctttga
gtgtgctatg 540 gctactgtct atgacattgg tcatgacgcc gtcatgtatg
tggccgaggg gaaagtctcc 600 tgggcccctc gtggcggaaa tgaagtgaaa
tttgaaactg tccccgagga gttgaaattg 660 attgcggacc ggctccgcac
ctccatcccg ccccaccatg tagtggacat gtctaagttc 720 gccttcacgg
ctcctgggcg tggtgtttct atgcgggttg aacgccaaca cggctgcctc 780
cccactgaca ctgtccctga aggcaactgc tggtggagct tgtttaactt gctcccactg
840 gaagtccaga acaaagaaat ccgccatgct aaccaatttg gctaccagac
caagcatggt 900 gtttctggca agtacctaca gcggaggctg caagttaatg
gtctccgagc agtaactgac 960 ccaaatggac ctatcgtcgt acagtacttc
tccgttaagg agagttggat ccgccacttg 1020 aaactggcgg gagaacccag
ctaccctggg tttgaggacc tcctcagaat aagggttgag 1080 cccaatacgt
cgccattggc tgacaaggat gaaaaaattt tccggtttgg cagtcacaag 1140
tggtacggcg ctggaaagag agcaaggaaa gcacgctctt gtgcgactgc cacagtcgct
1200 ggccgcgctt tgtccgttcg tgaaacccgg caggccaagg ggcacgaggt
tgccggcgcc 1260 aacaaggctg agcacctcaa acattattcc ccgcctgccg
aagggaattg tggttggcac 1320 tgcatttccg ccatcgccaa ccggatggtg
aattccaaat ttgaaaccac ccttcccgaa 1380 agagtgagac ctccagatga
ctgggctact gacgaggatc ttgtgaatgc cattcaaatc 1440 ctcagacttc
ctgcggcctt ggacaggaac ggtgcttgtg ttagcgccaa gtacgtactt 1500
aagctggaag gtgagcattg gactgtcact gtgacccctg ggatgtctcc ttctttgctc
1560 cctcttgaat gtgttcaggg ctgttgtgag cacaagggtg gtcttggttc
cccagatgca 1620 gtcgaggtct tcggatttga ccctgcctgc cttgaccggc
tggctgaggt gatgcacctg 1680 cctagcagtg ttatcccagc cgccctggcc
gaaatgtccg gcgattccga tcgttcggct 1740 tccccggtca ccaccgtgtg
gactgtttcg cagttctttg cccgtcacaa cggagggaat 1800 caccctgacc
aggcgcgctt agggaaaatt atcagccttt gtcaggtgat tgaggactgc 1860
tgctgttccc agaacaaaac caaccgggtc accccggagg aggtcgcagc aaagattgac
1920 ctgtacctcc gtggtgcaac aaatcttgaa gaatgcttgg ccaggcttga
gaaagcgcgc 1980 ccgccacgcg taatggac 1998 59 1938 DNA Porcine
reproductive and respiratory syndrome virus 59 atgtctggga
cgttctcccg gtgcatgtgc accccggctg cccgggtatt ttggaacgcc 60
ggccaagtct tttgcacacg gtgtctcagt gcgcggtctc ttctctctcc agagcttcag
120 gacactgacc tcggtgcagt tggcttgttt tacaagccta gggacaagct
tcactggaaa 180 gtccctatcg gcatccctca ggtggaatgt actccatccg
ggtgctgttg gctctcagct 240 gttttccctt tggcgcgtat gacctccggc
aatcacaact tcctccaacg acttgtgaag 300 gttgctgatg ttttgtaccg
tgacggttgc ttggcacctc gacaccttcg tgaactccaa 360 gtttacgagc
gcggctgcaa ctggtacccg atcacggggc ccgtgcccgg gatgggtttg 420
tttgcgaact ccatgcacgt atccgaccag ccgttccctg gtgccaccca tgtgttgact
480 aactcgcctt tgcctcaaca ggcttgtcgg cagccgttct gtccatttga
ggaggctcat 540 tctagcgtgt acaggtggaa gaaatttgtg gttttcacgg
actcctccct caacggtcga 600 tctcgcatga tgtggacgcc ggaatccgat
gattcagccg ccctggaggt actaccgcct 660 gagttagaac gtcaggtcga
aatcctcatt cggagttttc ctgctcatca ccctgtcgac 720 ctggccgact
gggagctcac tgagtcccct gagaacggtt tttccttcaa cacgtctcat 780
tcttgcggtc accttgtcca gaaccccgac gtgtttgatg gcaagtgctg gctctcctgc
840 tttttgggcc agtcggtcga agtgcgctgc catgaggaac atctagctga
cgccttcggt 900 taccaaacca agtggggcgt gcatggtaag tacctccagc
gcaggcttca agttcgcggc 960 attcgtgctg tagtcgatcc tgatggtccc
attcacgttg aagcgctgtc ttgcccccag 1020 tcttggatca ggcacctgac
tctggatgat gatgtcaccc caggattcgt tcgcctgaca 1080 tcccttcgca
ttgtgccgaa cacagagcct accacttccc ggatctttcg gtttggagcg 1140
cataagtggt atggcgctgc cggcaaacgg gctcgtgcta agcgtgccgc taaaagtgag
1200 aaggattcgg ctcccacccc caaggttgcc ctgccggtcc ccacctgtgg
aattaccacc 1260 tactctccac cgacagacgg gtcttgtggt tggcatgtcc
ttgccgccat
aatgaaccgg 1320 atgataaatg gtgacttcac gtcccctctg actcagtaca
acagaccaga ggatgattgg 1380 gcttctgatt atgatcttgt tcaggcgatt
caatgtctac gactgcctgc taccgtggtt 1440 cggaatcgcg cctgtcctaa
cgccaagtac cttataaaac ttaacggagt tcactgggag 1500 gtagaggtga
ggtctggaat ggctcctcgc tccctttctc gtgaatgtgt ggttggcgtt 1560
tgctctgaag gctgtgtcgc accgccttat ccagcagacg ggctacctaa acgtgcactc
1620 gaggccttgg cgtctgctta cagactaccc tccgattgtg ttagctctgg
tattgctgac 1680 tttcttgcta atccacctcc tcaggaattc tggaccctcg
acaaaatgtt gacctccccg 1740 tcaccagagc ggtccggctt ctctagtttg
tataaattac tattagaggt tgttccgcaa 1800 aaatgcggtg ccacggaagg
ggctttcatc tatgctgttg agaggatgtt gaaggattgt 1860 ccgagctcca
aacaggccat ggcccttctg gcaaaaatta aagttccatc ctcaaaggcc 1920
ccgtctgtgt ccctggac 1938 60 652 DNA Porcine reproductive and
respiratory syndrome virus 60 aaatttggcg acagcaacgc tgacgtacca
ggacgagccc ctagatttgt ctgcatcctc 60 acagactgaa tatgaggctt
ttcctccagc accactgcag aacatgggta ttccggaggt 120 ggaagggcaa
gaagctgagg aagtcctgag tggaatctcg atatactgga tgacatcaat 180
tctgccctgt atcatcaagc ggttccctgt caagcgtagc gatcacacgc ccaataggtg
240 cggagagtga ccttaccatt ggctcagtcg ccactgaaga tattccacgc
atcctcggga 300 aaatagaaga tgccggtgag atgtccaacc agggaccctt
ggcattctcc gaggaaaaac 360 cggtagatga ccaacctacc aaagaccccc
ggatgtcgtc gcggaggtca gacaagagcg 420 caccagctcg gtccgcaggc
acaggtggcg tcggcttgtt tactgatttg ccccttcaga 480 cggtgtggat
gcggacgggg ggggcccgtt acggacggta aaaacaaaaa ctgaaaggtt 540
ctttgaccag ctgagccgtc aggtttttaa cctcgtctcc catctccctg ttttcttctc
600 ataccttttc aaacctggca gtggttattc tccgggtgat tggggttttg ca 652
61 660 DNA Porcine reproductive and respiratory syndrome virus 61
gaatttgccg aactcaagcg cccgcgtttc tccgcacaag ccttaattga ccgaggcggt
60 ccacttgccg atgtccatgc aaaaataaag aaccgggtat atgaacagtg
cctccaagct 120 tgtgagcccg gtagtcgtgc aaccccagcc accagggagt
ggctcgacaa aatgtgggat 180 agggtggaca tgaaaacttg gcgctgcacc
tcgcagttcc aagctggtcg cattcttgcg 240 tccctcaaat tcctccctga
catgattcaa gacacaccgc ctcctgttcc caggaagaac 300 cgagctagtg
acaatgccgg cctgaagcaa ctggtggcac agtgggatag gaaattgagt 360
gtgacccccc ccccaaaacc ggttgggcca gtgcttgacc agatcgtccc tccgcctacg
420 gatatccagc aagaagatgt caccccctcc gatgggccac cccatgcgcc
ggattttcct 480 agtcgagtga gcacgggcgg gagttggaaa ggccttatgc
tttccggcac ccgtctcgcg 540 gggtctatca gccagcgcct tatgacatgg
gtttttgaag ttttctccca cctcccagct 600 tttatgctca cacttttctc
gccgcggggc tctatggctc caggtgattg gttgtttgca 660 62 3198 DNA Porcine
reproductive and respiratory syndrome virus 62 gaccccattt
ttctcgccac tgggtggcgc gggtgctggg ccggccgaag ccccattgag 60
caaccctctg aaaaacctat cgcgtttgcc cagttggatg aaaagaaaat tacggctagg
120 actgtggtcg cccagcctta tgaccccaac caagccgtaa agtgcttgcg
ggtattgcag 180 gcgggtgggg tgatggtggc tgaggcggtc ccaaaagtgg
tcaaggtttc cgctgttcca 240 ttccgagccc ccttttttcc taccggagtg
aaagttgacc ctgaatgtag ggtcgtggtt 300 gaccctgaca ctttcactgc
agctctccgg tctggctact ccaccacaaa ccttgtcctt 360 ggtgtagggg
actttgccca gctgaatgga ttaaaaatca ggcaaatttc caagccttca 420
ggaggaggcc cacatctcat ggctgccctg catgttgcct gctcgatggt tttggacatg
480 cttgctggga tttatgtgac tgcggtgggt tcttgcggca ccggcaccaa
cgatccgtgg 540 tgcgctaacc cgtttggcgt ccctggctac ggacctgcct
ccctctgcac gtccagattg 600 tgcatttccc agcatgccct taccctgccc
ttgacagcac ttgtggcggg attcggtatc 660 caagaaattg ccttagtcgt
tttgattttt gtttccatcg gaggcatggc tcataggttg 720 agttgtaaag
ctgatatgct gtgtattttg cttgcaattg ccagcaatgt ttgggtacct 780
cttacctggt tgctttgtgt gtttccttgc tggttgcgct gtttttcttt gcaccccctt
840 accatcctat ggttggtgtt tttcttgatt tctgtgaata tgccttcagg
aatcttggcc 900 atggtgttgt tggtttctct ttggcttctt ggtcgtaata
ctaatgttgc tggtcttgtc 960 accccctacg acattcatca ttacaccagt
ggcccccgcg gtgttgccgc cttggctacc 1020 gcaccagatg ggacttactt
agccgctgtc cgccgtgctg cgttgactgg ccgcaccatg 1080 ctgttcaccc
cgtcccagct tgggtctctt cttgagggtg ctttcagaac tcgaaagccc 1140
tcactgaaca ccgtcaatgt ggtcgggtcc tccatgggct ctggcggggt gtttaccatc
1200 gacgggaaag tcaagtgcgt aactgccgca catgtcctta cgggtaactc
agctagggtt 1260 tccggggtcg gcttcaatca aatgcttgac tttgacgtaa
agggggattt cgccatagcc 1320 gattgcccga attggcaagg ggctgccccc
aagacccaat tctgcgagga tggatggact 1380 ggccgtgcct attggctaac
atcctctggc gtcgaacccg gcgtcattgg aaaaggattc 1440 gccttctgct
tcaccgcgtg cggcgattcc gggtccccag tgatcaccga ggccggtgag 1500
cttgtcggcg ttcacacggg atcaaataaa caagggggag gcatcgtcac gcgcccctca
1560 ggccagtttt gtaatgtggc acccatcaag ctaagcgaat taagtgaatt
ctttgctggg 1620 cccaaggtcc cgctcggtga tgtggaggtt ggcaaccata
taattaaaga cataggcgaa 1680 gtgccttcag atctttgtgc cttgctcgct
gccaaacctg aactggaagg aggcctctcc 1740 accgtccaac ttctttgtgt
gttttttctc ctgtggagaa tgatgggaca tgcctggacg 1800 cccttggttg
ctgtgggttt ctttatcttg aatgaggttc tcccagccgt cctggtccgg 1860
agtattttct cctttggaat gtttgtgcta tcctggctca ctccatggtc tgcgcaagtt
1920 ctaatgatca ggcttctaac agcagctctt aacaggaaca gatggtcact
tgcctttttc 1980 agccttggtg cggtgaccgg ttttgtcgca gatcttgcgg
ccactcaggg gcatccgttg 2040 cagacagtga tgaatttgag tacctatgca
ttcctgcctc ggatgatggt tgtgacctca 2100 ccagtcccag tgatcgcgtg
cggtgtcgtg cacctacttg ccatcatttt gtacttgttt 2160 aagtaccgtg
gcctgcacta tatccttgtt ggcgatggag tgttctctgc ggctttcttc 2220
ctgcggtact ttgccgaggg aaagttgagg gaagggttgt cccaatcctg cggaatgaat
2280 catgagtccc taactgttgc ccttgctatg agactcaatg acgaggactt
ggatttcctt 2340 acgaaatgga ctgattttaa gtgctttgtt tctgcgtcca
acatgaggaa tgcagcgggt 2400 caatttatcg aggctgccta tgctaaagca
cttagagtag aacttgccca gttggtgcag 2460 gttgataaag ttcgaggtac
tttggccaaa cttgaagctt ttgctgatac cgtggcaccc 2520 caactctcgc
ccggtgacat tgttgtcgct ctcggccata cgcctgttgg cagtatcttc 2580
gacctaaagg ttggtagcac caagcatacc ctccaagcca ttgaaaccag agtccttgca
2640 gggtccaaaa tgaccgtggc gcgcgtcgtc gacccgaccc ctacgccccc
acccgcaccc 2700 ctgtccatcc ccctcccacc gaaagtcctg gagaatgccc
ccaacgcttg gggggatgag 2760 gaccgtttga ataagaagaa gaggcccagg
atggaagccc tcggcatcta tgttatgggt 2820 gggaaaaagt accagaaatt
ttgggacaag aattccggtg atgtgtttta tgaggaggtc 2880 catgacaaca
cagatgagtg ggagtgtctc agagtcggcg accctgccga ctttgaccct 2940
gagaagggaa ctctgtgtgg acatgtcacc attgaagata aggcttacca tgtttacacc
3000 tcctcatctg gtaagaagtt cttggtcccc gtcaacccag agaatggaag
agtccagtgg 3060 gaagctgcca agctttccgt ggagcagccc cttggcatga
tgaacgtcga cggtgaactg 3120 actgccaaag aactggagaa actgaaaaga
ataattgata aactccaggg cctgactaag 3180 gagcagtgtt taaactgc 3198 63
3228 DNA Porcine reproductive and respiratory syndrome virus 63
gatcctgtgc acttggcaac gggttggcgc gggtgctggc gtggtgagag ccccatccat
60 caaccacacc aaaagcccat agcttatgcc aatttggatg aaaagaaaat
gtctgcccaa 120 acggtggttg ctgtcccata cgatcccagt caggctatca
aatgcctgaa agttctgcag 180 gcgggagggg ccatcgtgga ccagcctaca
cctgaggtcg ttcgtgtgtc cgagatcccc 240 ttctcagccc catttttccc
aaaagttcca gtcaacccag attgcagggt tgtggtagat 300 tcggacactt
ttgtggctgc ggttcgctgc ggttactcga cagcacaact ggttctgggc 360
cggggcaact ttgccaagtt aaatcagacc ccccccagga actctatctc caccaaaacg
420 actggtgggg cctcttacac ccttgctgtg gctcaagtgt ctgcgtggac
tcttgttcat 480 ttcatcctcg gtctttggtt cacatcacct caagtgtgtg
gccgaggaac cgctgaccca 540 tggtgttcaa atcctttttc atatcctacc
tatggccccg gagttgtgtg ctcctctcga 600 ctttgtgtgt ctgccgacgg
ggtcaccctg ccattgttct cagccgtggc acaactctcc 660 ggtagagagg
tggggatttt tattttggtg ctcgtctcct tgactgcttt ggcccaccgc 720
atggctctta aggcagacat gttagtggtc ttttcggctt tttgtgctta cgcctggccc
780 atgagctcct ggttaatctg cttctttcct atactcttga agtgggttac
ccttcaccct 840 cttactatgc tttgggtgca ctcattcttg gtgttttgtc
tgccagcagc cggcatcctc 900 tcactaggga taactggcct tctttgggca
attggccgct ttacccaggt tgccggaatt 960 attacacctt atgacatcca
ccagtacacc tctgggccac gtggtgcagc tgctgtggcc 1020 acagccccag
aaggcactta tatggccgcc gtccggagag ctgctttaac tgggcgaact 1080
ttaatcttca ccccgtctgc agttggatcc cttctcgaag gtgctttcag gactcataaa
1140 ccctgcctta acaccgtgaa tgttgtaggc tcttcccttg gttccggagg
ggttttcacc 1200 attgatggca gaagaactgt cgtcactgct gcccatgtgt
tgaacggcga cacagctaga 1260 gtcaccggcg actcctacaa ccgcatgcac
actttcaaga ccaatggtga ttatgcctgg 1320 tcccatgctg atgactggca
gggcgttgcc cctgtggtca aggttgcgaa ggggtaccgc 1380 ggtcgtgcct
actggcaaac atcaactggt gtcgaacccg gtatcattgg ggaagggttc 1440
gccttctgtt ttactaactg cggcgattcg gggtcacccg tcatctcaga atctggtgat
1500 cttattggaa tccacaccgg ttcaaacaaa cttggttctg gtcttgtgac
aacccctgaa 1560 ggggagacct gcaccatcaa agaaaccaag ctctctgacc
tttccagaca ttttgcaggc 1620 ccaagcgttc ctcttgggga cattaaattg
agtccggcca tcatccctga tgtaacatcc 1680 attccgagtg acttggcatc
gctcctagcc tccgtccctg tagtggaagg cggcctctcg 1740 accgttcaac
ttttgtgtgt ctttttcctt ctctggcgca tgatgggcca tgcctggaca 1800
cccattgttg ccgtgggctt ctttttgctg aatgaaattc ttccagcagt tttggtccga
1860 gccgtgtttt cttttgcact ctttgtgctt gcatgggcca ccccctggtc
tgcacaggtg 1920 ttgatgatta gactcctcac ggcatctctc aaccgcaaca
agctttctct ggcgttctac 1980 gcactcgggg gtgtcgtcgg tttggcagct
gaaatcggga cttttgctgg cagattgtct 2040 gaattgtctc aagctctttc
gacatactgc ttcttaccta gggtccttgc tatgaccagt 2100 tgtgttccca
ccatcatcat tggtggactc cataccctcg gtgtgattct gtggttattc 2160
aaataccggt gcctccacaa catgctggtt ggtgatggga gtttttcaag cgccttcttc
2220 ctacggtatt ttgcagaggg taatctcaga aaaggtgttt cacagtcctg
tggcatgaat 2280 aacgagtccc taacggctgc tttagcttgc aagttgtcac
aggctgacct tgattttttg 2340 tccagcttaa cgaacttcaa gtgctttgta
tctgcttcaa acatgaaaaa tgctgccggc 2400 cagtacattg aagcagcgta
tgccaaggcc ctgcgccaag agttggcctc tctagttcag 2460 attgacaaaa
tgaaaggagt tttgtccaag ctcgaggcct ttgctgaaac agccaccccg 2520
tcccttgaca taggtgacgt gattgttctg cttgggcaac atcctcacgg atccatcctc
2580 gatattaatg tggggactga aaggaaaact gtgtccgtgc aagagacccg
gagcctaggc 2640 ggctccaaat tcagtgtttg tactgtcgtg tccaacacac
ccgtggacgc cttgaccggc 2700 atcccactcc agacaccaac ccctcttttt
gagaatggtc cgcgtcatcg cagcgaggaa 2760 gacgatctta aagtcgagag
gatgaagaaa cactgtgtat ccctcggctt ccacaacatc 2820 aatggcaaag
tttactgcaa aatttgggac aagtctaccg gtgacacctt ttacacggat 2880
gattcccggt acacccaaga ccatgctttt caggacaggt cagccgacta cagagacagg
2940 gactatgagg gtgtgcaaac caccccccaa cagggatttg atccaaagtc
tgaaacccct 3000 gttggcactg ttgtgatcgg cggtattacg tataacaggt
atctgatcaa aggtaaggag 3060 gttctggtcc ccaagcctga caactgcctt
gaagctgcca agctgtccct tgagcaagct 3120 ctcgctggga tgggccaaac
ttgcgacctt acagctgccg aggtggaaaa gctaaagcgc 3180 atcattagtc
aactccaagg tttgaccact gaacaggctt taaactgt 3228 64 2696 DNA Porcine
reproductive and respiratory syndrome virus 64 tgtataatag
tactttgaat caggtgcttg ctattttccc aacccctggt tcccggccaa 60
agcttcatga ttttcagcaa tggctaatag ctgtacattc ctctatattt tcctctgttg
120 cagcttcttg tactcttttt gttgtgctgt ggttgcgggt tccaatgcta
cgtattgctt 180 ttggtttccg ctggttaggg gcaatttttc tttcgaactc
acagtgaact acacggtgtg 240 tccaccttgc ctcacccggc aagcagccac
agaggcctac gaacctggca ggtctctttg 300 gtgcaggata gggtatgatc
gctgtgggga ggacgatcat gacgaactag ggtttgtggt 360 gccgtctggc
ctctccagcg aaggccactt gaccagtgtt tacgcctggt tggcgttcct 420
gtctttcagt tacacagccc agttccatcc tgagatattc gggataggga atgtgagtca
480 agtttatgtt gacatcaggc atcaattcat ttgcgccgtt cacgacgggc
agaacgccac 540 tttgcctcgc catgacaata tttcagccgt gttccagact
tattaccaac atcaagtcga 600 cggcggcaat tggtttcacc tagaatggct
gcgtcccttc ttttcctctt ggttggtttt 660 aaatgtctct tggtttctca
ggcgttcgcc tgcaagccat gtttcagttc gagtcttgca 720 gacattaaga
ccaacaccac cgcagcggca ggctttgctg tcctccaaga catcagttgc 780
cttaggtatc gcaactcggc ctctgaggcg tttcgcaaaa tccctcagtg tcgtacggcg
840 atagggacac ccatgtatat tactgtcaca gccaatgtaa ccgatgagaa
ttatttgcat 900 tcctctgacc ttctcatgct ttcttcttgc cttttctacg
cttctgagat gagtgaaaag 960 ggatttaaag tggtatttgg caatgtgtca
ggcatcgtgg ctgtgtgcgt caactttacc 1020 agctacgtcc aacatgtcaa
ggaatttacc caacgctcct tggtagtcga ccatgtgcgg 1080 ctgctccatt
tcatgacacc tgagaccatg aggtgggcaa ctgttttagc ctgtcttttt 1140
gccattctgt tggccatttg aatgtttaag tatgttgggg aaatgcttga ccgcgggcta
1200 ttgctcgtca ttgctttttt tgtggtgtat cgtgccgtct tggtttgttg
cgctcgccag 1260 cgccaacagc agcaacagct ctcatttaca gttgatttat
aacttgacgc tatgtgagct 1320 gaatggcaca gattggttag ctggtgaatt
tgactgggca gtggagtgtt ttgtcatttt 1380 tcctgtgttg actcacattg
tctcctatgg tgccctcacc accagccatt tccttgacac 1440 agtcggtctg
gtcactgtgt ctaccgccgg cttttcccac gggcggtatg ttctgagtag 1500
catctacgcg gtctgtgccc tggctgcgtt gatttgcttc gtcattaggt ttacgaagaa
1560 ttgcatgtcc tggcgctact catgtaccag atataccaac tttcttctgg
acactaaggg 1620 cagactctat cgttggcggt cgcctgtcat catagagaaa
aggggtaaag ttgaggtcga 1680 aggtcatctg atcgacctca agagagttgt
gcttgatggt tccgcggcaa cccctataac 1740 caaagtttca gccgagcaat
ggggtcgtcc ttagatgact tctgccatga tagcacggct 1800 ccacaaaagg
tgcttttggc gttctctatt acctacacgc cagtgatgat atatgcccta 1860
aaagtaagtc gcggccgact gctagggctt ctgcaccttt tgatcttcct aaattgtgct
1920 ttcaccttcg ggtacatgac attcgtgcac tttcagagca caaacaaggt
cgcgctcact 1980 atgggagcag tagttgcact cctttggggg gtgtactcag
ccatagaaac ctggaaattc 2040 atcacctcca gatgccgttt gtgcttgcta
ggccgcaagt acattttggc ccctgcccac 2100 cacgttgaaa gtgccgcagg
ctttcatccg atagcggcaa atgataacca cgcatttgtc 2160 gtccggcgtc
ccggctccac tacggttaac ggcacattgg tgcccgggtt gaaaagcctc 2220
gtgttgggtg gcagaaaagc tgtcaaacag ggagtggtaa accttgttaa atatgccaaa
2280 taacaacggc aagcagcaga agaaaaagaa gggggatggc cagccagtca
atcagctgtg 2340 ccagatgctg ggtaagatca tcgctcagca aaaccagtcc
agaggcaagg gaccgggaaa 2400 gaaaaacaag aagaaaaacc cggagaagcc
ccattttcct ctagcgactg aagatgatgt 2460 cagacatcac ttcacctctg
gtgagcggca attgtgtctg tcgtcaatcc agacagcctt 2520 taatcaaggc
gctggaactt gtaccctgtc agattcaggg aggataagtt acactgtgga 2580
gtttagtttg ccgacgcatc atactgtgcg cctgatccgc gtcacagcgt caccctcagc
2640 atgatgagct ggcattcttg aggcatccca gtgtttgaat tggaagaatg cgtggt
2696 65 2696 DNA Porcine reproductive and respiratory syndrome
virus 65 tgtataatag tactttgaat caggtgcttg ctatttttcc aacccctggt
tcccggccaa 60 agcttcatga ttttcagcaa tggctaatag ctgtacattc
ctctatattt tcctctgttg 120 cagcttcttg tactcttttt gttgtgctgt
ggttgcgggt tccaatgcta cgtattgctt 180 ttggtttccg ctggttaggg
gcaatttttc cttcgaactc acagtgaact acacggtgtg 240 tccaccttgc
ctcacccggc aagcagccat agaggcctac gaacctggca ggtctctttg 300
gtgcaggata gggtatgatc gctgtgggga ggacgatcat gacgaactag ggtttgtggt
360 gccgtctggc ctctccagcg aaggccactt gaccagtgtt tacgcctggt
tggcgttcct 420 gtctttcagt tacacagccc agttccatcc tgagatattc
gggataggga atgtgagtca 480 agtttatgtt gacatcaggc atcaatccat
ttgcgccgtt cacgacgggc agaacgccac 540 tttgcctcgc catgacaata
tttcagccgt gttccagact tattaccaac atcaagtcga 600 cggcggcaat
tggtttcacc tagaatggct gcgtcccttc ttttcctctt ggttggtttt 660
aaatgtctct tggtttctca ggcgttcgct tgcaagccat gtttcagttc gagtcttgca
720 gacattaaga ccaacaccac cgcagcggca ggctttgctg tcctccaaga
catcagttgc 780 cttaggtatc gcaactcggc ctctgaggcg tttcgcaaaa
tccctcagtg tcgtacggcg 840 atagggacac ccatgtatat tactgtcaca
gccaatgtaa ccgatgagaa ttatttgcat 900 tcctctgacc ttctcatgct
ttcttcttgc cttttctacg cttctgagat gagtgaaaag 960 ggatttaaag
tggtatttgg caatgtgtca ggcatcgtgg ctgtgtgcgt caactttacc 1020
agctacgtcc aacatgtcaa ggaatttacc caacgctcct tggtagtcga ccatgtgcgg
1080 ctgctccatt tcatgacacc tgagaccatg aggtgggcaa ctgttttagc
ctgtcttttt 1140 gccattctgt tggccattta aatgtttgag tatgttgggg
aaatgcttga ccgcgggcta 1200 ttgctcgtca ttgctttttt tgtggtgtat
cgtgccgtct tggtttgttg cgctcgccag 1260 cgccaacagc atcaacagcc
ctcatttaca gttgatttat aacttgacgc tatgtgagct 1320 gaatggcaca
gattggttag ctggtgaatt tgactgggca gtggagtgtt ttgtcatttt 1380
tcctgtgttg actcacattg tctcctatgg tgccctcacc accagccatt tccttgacac
1440 agtcggtctg gtcactgtgt ctaccgccgg cttttcccac gggcggtatg
ttctgagtag 1500 catctacgcg gtctgtgccc tggctgcgtt gatttgcttc
gtcattaggt ttacgaagaa 1560 ttgcatgtcc tggcgctact catgtaccag
atataccaac tttcttctgg acactaaggg 1620 cagactctat cgttggcggt
cgcctgtcat catagagaaa aggggtaaag ttgaggtcga 1680 aggtcatctg
atcgacctca agagagttgt gcttgatggt tccgcggcaa cccctataac 1740
caaaatttca gccgagcaat ggggtcgtcc ttagatgact tctgccatga tagcacggct
1800 ccactaaagg tgcttttggc gttctctatt acctacacgc cagtgatgat
atatgcccta 1860 aaagtaagtc gcggccgact gttagggctt ctgcaccttt
tgatcttcct aaattgtgct 1920 ttcaccttcg ggtacatgac attcgtgcac
tttcagagca caaacaaggt cgcgctcact 1980 atgggagcag tagttgcact
cctttggggg gtgtactcag ccatagaaac ctggaaattc 2040 atcacctcca
gatgccgttt gtgcttgcta ggccgcaagt acattttggc ccctgcccac 2100
cacgttgaaa gtgccgcagg ctttcatccg atagcggcaa atgataacca cgcatttgtc
2160 gtccggcgtc ccggctccac tacggttaac ggcacattgg tgcccgggtt
gaaaagcctc 2220 gtgttgggtg gcagaaaagc tgtcaaacag ggagtggtaa
accttgttaa atatgccaaa 2280 taacaacggc aagcagcaga agaaaaagaa
gggggatggc cagccagtca atcagctgtg 2340 ccagatgctg ggtaagatca
tcgctcagca aaaccagtcc agaggcaagg gaccgggaaa 2400 gaaaaacaag
aagaaaaacc cggagaagcc ccattttcct ctagcgactg aagatgatgt 2460
cagacatcac ttcacctctg gtgagcggct attgtgtctg tcgtcaatcc agacagcctt
2520 taatcaaggc gctggaattt gtaccctgtc agattcaggg aggataagtt
acactgtgga 2580 gtttagtttg ccgacgcatc atactgtgcg cctgatccgc
gtcacagcgt caccctcagc 2640 atgatgagct ggcattcttg aggcatccca
gtgtttgaat tggaagaatg tgtggt 2696 66 1098 DNA Porcine reproductive
and respiratory syndrome virus 66 attccacgca tcctcgggaa aatagaagat
gccggtgaga tgtccaacca gggacccttg 60 gcattctccg aggaaaaacc
ggtagatgac caacctacca aagacccccg gatgtcgtcg 120 cggaggtcag
acaagagcgc accagctcgg tccgcaggca caggtggcgt cggcttgttt 180
actgatttgc cccttcagac ggtgtggatg cggacggggg gggcccgtta cggacggtaa
240 aaacaaaaac tgaaaggttc tttgaccagc tgagccgtca ggtttttaac
ctcgtctccc 300 atctccctgt tttcttctca taccttttca aacctggcag
tggttattct ccgggtgatt 360 ggggttttgc agcttttact ctattgtgcc
tctttttatg ttacagttat ccagcctttg 420 gtattgctcc cctcttgggt
gtattttctg ggtcttctcg gcgcgtccga atgggggttt 480 ttggttgctg
gttggctttt gctgttggtc tgttcaaatc tgtgcccgac ccagtcggca 540
ctgcttgtga atttgactcg ccagagtgca gaaacatcct tcattctttt gagcttctca
600 aaccttggga ccctgttcgc agccttgttg tgggccccgt cggtctcggc
cttgccattc 660 ttggcaggtt actgggcggg gcacgctaca tctggcactt
tttgcttagg cttggcattg 720 ttgcagattg tatcttggct ggagcttatg
tgctttctca aggtaggtgt
aaaaagtgct 780 ggggatcttg tataagaact gctcctaatg aggtcgcttt
taacgtgttt cctttcacac 840 gtgcgaccag gtcgtcactt gttgacctgt
gtgatcggtt ttgcgcgcca aaaggcatgg 900 accccatttt tctcgccact
gggtggcgcg ggtgctgggc cggccgaagc cccattgagc 960 aaccctctga
aaaacctatc gcgtttgccc agttggatga aaagaaaatt acggctagga 1020
ctgtggtcgc ccagccttat gaccccaacc aagccgtaaa gtgcttgcgg gtattgcagg
1080 cgggtggggt gatggtgg 1098 67 1108 DNA Porcine reproductive and
respiratory syndrome virus 67 cctcctgttc ccaggaagaa ccgagctagt
gacaatgccg gcctgaagca actggtggca 60 cagtgggata ggaaattgag
tgtgaccccc cccccaaaac cggttgggcc agtgcttgac 120 cagatcgtcc
ctccgcctac ggatatccag caagaagatg tcaccccctc cgatgggcca 180
ccccatgcgc cggattttcc tagtcgagtg agcacgggcg ggagttggaa aggccttatg
240 ctttccggca cccgtctcgc ggggtctatc agccagcgcc ttatgacatg
ggtttttgaa 300 gttttctccc acctcccagc ttttatgctc acacttttct
cgccgcgggg ctctatggct 360 ccaggtgatt ggttgtttgc aggtgtcgtt
ttacttgctc tcttgctctg tcgttcttac 420 ccgatactcg gatgccttcc
cttattgggt gtcttttctg gttctttgcg gcgtgttcgt 480 ctgggtgttt
ttggttcttg gatggctttt gctgtatttt tattctcgac tccatccaac 540
ccagtcggtt cttcttgtga ccacgattcg ccggagtgtc atgctgagct tttggctctt
600 gagcagcgcc aactttggga acctgtgcgc ggccttgtgg tcggcccctc
aggcctctta 660 tgtgtcattc ttggcaagtt actcggtggg tcacgttatc
tctggcatgt tctcctacgt 720 ttatgcatgc ttgcagattt ggccctttct
cttgtttatg tggtgtccca ggggcgttgt 780 cacaagtgtt ggggaaagtg
tataaggaca gctcctgcgg aggtggctct taatgtattt 840 cctttctcgc
gcgccacccg tgtctctctt gtatccttgt gtgatcgatt ccaaacgcca 900
aaaggggttg atcctgtgca cttggcaacg ggttggcgcg ggtgctggcg tggtgagagc
960 cccatccatc aaccacacca aaagcccata gcttatgcca atttggatga
aaagaaaatg 1020 tctgcccaaa cggtggttgc tgtcccatac gatcccagtc
aggctatcaa atgcctgaaa 1080 gttctgcagg cgggaggggc catcgtgg 1108 68
7193 DNA Porcine reproductive and respiratory syndrome virus 68
atgtctggga tgcttgatcg gtgcacgtgt acccccaatg ccagggtgtt tatggcggaa
60 ggccaagtct actgcacacg atgcctcagt gcacggtctc tccttcccct
gaatctccaa 120 gcttctgagc ttggggtgct aggcctattc tacaggcccg
aagagccact ccggtggacg 180 ttgccacgtg cattccccac tgttgagtgc
tcccccgccg gagcctgctg gctttctgca 240 atctttccaa ttgcacggat
gaccagtgga aacctgaact tccaacaaag aatggtacgg 300 gtcgcagctg
agtttaacag agccggccag ttcacccctg cagttttgaa gactctacaa 360
gtttatgaac ggggttgccg ctggtacccc attgttggac ctgtccctgg agtggccgtt
420 ttcgccaact ccctacatgt gagtgataaa cctttcccgg gagcaactca
cgtgctaacc 480 aacctgccgc tcccgcagag acccaagcct gaagactttt
gcccctttga gtgtgctatg 540 gctactgtct atgacattgg tcatgacgcc
gtcatgtatg tggccgaggg gaaagtctcc 600 tgggcccctc gtggcggaaa
tgaagtgaaa tttgaaactg tccccgagga gttgaaattg 660 attgcggacc
ggctccgcac ctccatcccg ccccaccatg tagtggacat gtctaagttc 720
gccttcacgg ctcctgggcg tggtgtttct atgcgggttg aacgccaaca cggctgcctc
780 cccactgaca ctgtccctga aggcaactgc tggtggagct tgtttaactt
gctcccactg 840 gaagtccaga acaaagaaat ccgccatgct aaccaatttg
gctaccagac caagcatggt 900 gtttctggca agtacctaca gcggaggctg
caagttaatg gtctccgagc agtaactgac 960 ccaaatggac ctatcgtcgt
acagtacttc tccgttaagg agagttggat ccgccacttg 1020 aaactggcgg
gagaacccag ctaccctggg tttgaggacc tcctcagaat aagggttgag 1080
cccaatacgt cgccattggc tgacaaggat gaaaaaattt tccggtttgg cagtcacaag
1140 tggtacggcg ctggaaagag agcaaggaaa gcacgctctt gtgcgactgc
cacagtcgct 1200 ggccgcgctt tgtccgttcg tgaaacccgg caggccaagg
ggcacgaggt tgccggcgcc 1260 aacaaggctg agcacctcaa acattattcc
ccgcctgccg aagggaattg tggttggcac 1320 tgcatttccg ccatcgccaa
ccggatggtg aattccaaat ttgaaaccac ccttcccgaa 1380 agagtgagac
ctccagatga ctgggctact gacgaggatc ttgtgaatgc cattcaaatc 1440
ctcagacttc ctgcggcctt ggacaggaac ggtgcttgtg ttagcgccaa gtacgtactt
1500 aagctggaag gtgagcattg gactgtcact gtgacccctg ggatgtctcc
ttctttgctc 1560 cctcttgaat gtgttcaggg ctgttgtgag cacaagggtg
gtcttggttc cccagatgca 1620 gtcgaggtct tcggatttga ccctgcctgc
cttgaccggc tggctgaggt gatgcacctg 1680 cctagcagtg ttatcccagc
cgccctggcc gaaatgtccg gcgattccga tcgttcggct 1740 tccccggtca
ccaccgtgtg gactgtttcg cagttctttg cccgtcacaa cggagggaat 1800
caccctgacc aggcgcgctt agggaaaatt atcagccttt gtcaggtgat tgaggactgc
1860 tgctgttccc agaacaaaac caaccgggtc accccggagg aggtcgcagc
aaagattgac 1920 ctgtacctcc gtggtgcaac aaatcttgaa gaatgcttgg
ccaggcttga gaaagcgcgc 1980 ccgccacgcg taatggacac ctcctttgat
tgggatgttg tgctccctgg ggttgaggcg 2040 gcaactcaga cgaccgaact
gccccgggtc aaccagtgtc gcgctctggt ccctgttgtg 2100 actcaaaagt
ctctggacaa taactcggtt cctctgaccg ccttctcgct gtccaattac 2160
tactaccgtg cacaaggtga cgagattcgt caccgtgaca ggctaaacgc cgtactctct
2220 aagttggagg gggctgttcg agaagaatat gggctcatgc cgactggacc
tggcccgcga 2280 cccgcactgt cgagcgggct cgatgggctt aaagacagat
ggagagatct gctgaaacta 2340 gccaacgccc agacaacctc agaaatgatg
gcctgggcag ccgagcaggt tgatctagaa 2400 gcttgggtca aaagctaccc
acggtggaca ccaccacccc ctccgccaag agttcagcct 2460 cgaaaagcga
agcctgtcag gagcttgcca gagagcaagc ctgtccctgc cccgcgcagg 2520
aaggttagat ccgatcgtgg cagcccggtt ttgttgggcg acaatgttcc taacagttgg
2580 gaagacttga ctgtcggtgg cccccttgat ctcctgaccc cacccgagtc
agtgacacct 2640 ccagtgagct tgcgcttacg tccgcgccgc aacacacttt
taggccggtg acacctttgg 2700 gtgaaccggc cccagttccc gcaccgcgca
gaactgtgtc ccgaccggtg acatccttga 2760 atgggccgat ccttatgtcc
gcaccgcggc acaagtttca gcaggtggaa aaagcaaatt 2820 tggcgacagc
aacgctgacg taccaggacg agcccctaga tttgtctgca tcctcacaga 2880
ctgaatatga ggcttttcct ccagcaccac tgcagaacat gggtattccg gaggtggaag
2940 ggcaagaagc tgaggaagtc ctgagtggaa tctcgatata ctggatgaca
tcaattctgc 3000 cctgtatcat caagcggttc cctgtcaagc gtagcgatca
cacgcccaat aggtgcggag 3060 agtgacctta ccattggctc agtcgccact
gaagatattc cacgcatcct cgggaaaata 3120 gaagatgccg gtgagatgtc
caaccaggga cccttggcat tctccgagga aaaaccggta 3180 gatgaccaac
ctaccaaaga cccccggatg tcgtcgcgga ggtcagacaa gagcgcacca 3240
gctcggtccg caggcacagg tggcgtcggc ttgtttactg atttgcccct tcagacggtg
3300 tggatgcgga cggggggggc ccgttacgga cggtaaaaac aaaaactgaa
aggttctttg 3360 accagctgag ccgtcaggtt tttaacctcg tctcccatct
ccctgttttc ttctcatacc 3420 ttttcaaacc tggcagtggt tattctccgg
gtgattgggg ttttgcagct tttactctat 3480 tgtgcctctt tttatgttac
agttatccag cctttggtat tgctcccctc ttgggtgtat 3540 tttctgggtc
ttctcggcgc gtccgaatgg gggtttttgg ttgctggttg gcttttgctg 3600
ttggtctgtt caaatctgtg cccgacccag tcggcactgc ttgtgaattt gactcgccag
3660 agtgcagaaa catccttcat tcttttgagc ttctcaaacc ttgggaccct
gttcgcagcc 3720 ttgttgtggg ccccgtcggt ctcggccttg ccattcttgg
caggttactg ggcggggcac 3780 gctacatctg gcactttttg cttaggcttg
gcattgttgc agattgtatc ttggctggag 3840 cttatgtgct ttctcaaggt
aggtgtaaaa agtgctgggg atcttgtata agaactgctc 3900 ctaatgaggt
cgcttttaac gtgtttcctt tcacacgtgc gaccaggtcg tcacttgttg 3960
acctgtgtga tcggttttgc gcgccaaaag gcatggaccc catttttctc gccactgggt
4020 ggcgcgggtg ctgggccggc cgaagcccca ttgagcaacc ctctgaaaaa
cctatcgcgt 4080 ttgcccagtt ggatgaaaag aaaattacgg ctaggactgt
ggtcgcccag ccttatgacc 4140 ccaaccaagc cgtaaagtgc ttgcgggtat
tgcaggcggg tggggtgatg gtggctgagg 4200 cggtcccaaa agtggtcaag
gtttccgctg ttccattccg agcccccttt tttcctaccg 4260 gagtgaaagt
tgaccctgaa tgtagggtcg tggttgaccc tgacactttc actgcagctc 4320
tccggtctgg ctactccacc acaaaccttg tccttggtgt aggggacttt gcccagctga
4380 atggattaaa aatcaggcaa atttccaagc cttcaggagg aggcccacat
ctcatggctg 4440 ccctgcatgt tgcctgctcg atggttttgg acatgcttgc
tgggatttat gtgactgcgg 4500 tgggttcttg cggcaccggc accaacgatc
cgtggtgcgc taacccgttt ggcgtccctg 4560 gctacggacc tgcctccctc
tgcacgtcca gattgtgcat ttcccagcat gcccttaccc 4620 tgcccttgac
agcacttgtg gcgggattcg gtatccaaga aattgcctta gtcgttttga 4680
tttttgtttc catcggaggc atggctcata ggttgagttg taaagctgat atgctgtgta
4740 ttttgcttgc aattgccagc aatgtttggg tacctcttac ctggttgctt
tgtgtgtttc 4800 cttgctggtt gcgctgtttt tctttgcacc cccttaccat
cctatggttg gtgtttttct 4860 tgatttctgt gaatatgcct tcaggaatct
tggccatggt gttgttggtt tctctttggc 4920 ttcttggtcg taatactaat
gttgctggtc ttgtcacccc ctacgacatt catcattaca 4980 ccagtggccc
ccgcggtgtt gccgccttgg ctaccgcacc agatgggact tacttagccg 5040
ctgtccgccg tgctgcgttg actggccgca ccatgctgtt caccccgtcc cagcttgggt
5100 ctcttcttga gggtgctttc agaactcgaa agccctcact gaacaccgtc
aatgtggtcg 5160 ggtcctccat gggctctggc ggggtgttta ccatcgacgg
gaaagtcaag tgcgtaactg 5220 ccgcacatgt ccttacgggt aactcagcta
gggtttccgg ggtcggcttc aatcaaatgc 5280 ttgactttga cgtaaagggg
gatttcgcca tagccgattg cccgaattgg caaggggctg 5340 cccccaagac
ccaattctgc gaggatggat ggactggccg tgcctattgg ctaacatcct 5400
ctggcgtcga acccggcgtc attggaaaag gattcgcctt ctgcttcacc gcgtgcggcg
5460 attccgggtc cccagtgatc accgaggccg gtgagcttgt cggcgttcac
acgggatcaa 5520 ataaacaagg gggaggcatc gtcacgcgcc cctcaggcca
gttttgtaat gtggcaccca 5580 tcaagctaag cgaattaagt gaattctttg
ctgggcccaa ggtcccgctc ggtgatgtgg 5640 aggttggcaa ccatataatt
aaagacatag gcgaagtgcc ttcagatctt tgtgccttgc 5700 tcgctgccaa
acctgaactg gaaggaggcc tctccaccgt ccaacttctt tgtgtgtttt 5760
ttctcctgtg gagaatgatg ggacatgcct ggacgccctt ggttgctgtg ggtttcttta
5820 tcttgaatga ggttctccca gccgtcctgg tccggagtat tttctccttt
ggaatgtttg 5880 tgctatcctg gctcactcca tggtctgcgc aagttctaat
gatcaggctt ctaacagcag 5940 ctcttaacag gaacagatgg tcacttgcct
ttttcagcct tggtgcggtg accggttttg 6000 tcgcagatct tgcggccact
caggggcatc cgttgcagac agtgatgaat ttgagtacct 6060 atgcattcct
gcctcggatg atggttgtga cctcaccagt cccagtgatc gcgtgcggtg 6120
tcgtgcacct acttgccatc attttgtact tgtttaagta ccgtggcctg cactatatcc
6180 ttgttggcga tggagtgttc tctgcggctt tcttcctgcg gtactttgcc
gagggaaagt 6240 tgagggaagg gttgtcccaa tcctgcggaa tgaatcatga
gtccctaact gttgcccttg 6300 ctatgagact caatgacgag gacttggatt
tccttacgaa atggactgat tttaagtgct 6360 ttgtttctgc gtccaacatg
aggaatgcag cgggtcaatt tatcgaggct gcctatgcta 6420 aagcacttag
agtagaactt gcccagttgg tgcaggttga taaagttcga ggtactttgg 6480
ccaaacttga agcttttgct gataccgtgg caccccaact ctcgcccggt gacattgttg
6540 tcgctctcgg ccatacgcct gttggcagta tcttcgacct aaaggttggt
agcaccaagc 6600 ataccctcca agccattgaa accagagtcc ttgcagggtc
caaaatgacc gtggcgcgcg 6660 tcgtcgaccc gacccctacg cccccacccg
cacccctgtc catccccctc ccaccgaaag 6720 tcctggagaa tgcccccaac
gcttgggggg atgaggaccg tttgaataag aagaagaggc 6780 ccaggatgga
agccctcggc atctatgtta tgggtgggaa aaagtaccag aaattttggg 6840
acaagaattc cggtgatgtg ttttatgagg aggtccatga caacacagat gagtgggagt
6900 gtctcagagt cggcgaccct gccgactttg accctgagaa gggaactctg
tgtggacatg 6960 tcaccattga agataaggct taccatgttt acacctcctc
atctggtaag aagttcttgg 7020 tccccgtcaa cccagagaat ggaagagtcc
agtgggaagc tgccaagctt tccgtggagc 7080 agccccttgg catgatgaac
gtcgacggtg aactgactgc caaagaactg gagaaactga 7140 aaagaataat
tgataaactc cagggcctga ctaaggagca gtgtttaaac tgc 7193 69 4382 DNA
Porcine reproductive and respiratory syndrome virus 69 gtgtttaaac
tgctagccgc cagcggcttg acccgctgtg gtcgcggcgg cttagttgtt 60
actgagacag cggtgaagat cgtcaaattt cacaaccgga ccttcacctt gggacctgtg
120 aatttaaaag tggccagtga ggttgagctg aaagacgcgg ttgagcacaa
ccagcacccg 180 gttgcaagac cggttgatgg tggtgttgtg ctcctgcgtt
ctgcagttcc ttcgcttgtc 240 gacgtcttaa tctccggtgc tgatgcatct
cccaagttac ttgcccatca cgggccggga 300 aacactggga tcgatggcac
gctctgggat tttgagtccg aagccattaa agaggaagtc 360 gcacttagtg
cgcaaataat acaggcttgt gacattaggc gcggtgacgc acctgaaatt 420
ggtctccctt acaaactata ccctgttagg ggcaaccctg agcgggtaaa aggagttttg
480 cagaatacaa ggtttggaga cataccttac aaaaccccca gtgacaccgg
aagcccagtg 540 cacgcggctg cctgccttac gcccaacgcc accccggtga
ctgatgggcg ctctgtcttg 600 gccacgacca tgccctccgg gttcgagttg
tatgtaccca ccattccggc gtctgttctt 660 gattatcttg attctaggcc
tgactgccct aaacagttga cagagcacgg ctgtgaagat 720 gccgcattga
gagatctctc caagtatgac ttgtccaccc aaggctttgt tttgcctgga 780
gttcttcgcc ttgtgcggaa gtacctgttt gcccacgtgg gtaagtgccc gtccgttcat
840 cggccttcca cttaccccgc caaaaattct atggctggaa taaatgggaa
caggtttcca 900 accaaggaca ttcagagcgt ccctgaaatc gacgttctgt
gcgcacaggc tgtgcgagaa 960 aactggcaaa ctgttacccc ttgtaccctt
aagaaacagt actgcgggaa gaagaagact 1020 aggaccatac tcggcaccaa
caacttcatt gcgctggccc accgggcagc gttgagtggt 1080 gtcacccaag
gcttcatgaa aaaagcattt aactcgccca tcgccctcgg gaaaaacaaa 1140
tttaaagagc tacagactcc ggtcctcggc aggtgccttg aagctgatct tgcatcctgc
1200 gatcgatcca cacctgcaat tgtccgctgg tttgccgcca atcttcttta
tgaactttcc 1260 tgtgctgaag agcatctacc gtcgtacgtg ctgaactgct
gccacgacct actggtcacg 1320 cagtccggcg cagtgactaa gagaggtggc
ctgtcgtctg gtgacccgat cacctctgtg 1380 tccaacacca tttacagctt
ggtgatctat gcacagcaca tggtgcttag ttacttcaaa 1440 agtggtcatc
cccatggcct tctgttttta caagaccagc taaagtttga ggacatgctc 1500
aaggtccaac ccctgatcgt ctattcggac gaccttgtgc tgtatgccga gtctcccacc
1560 atgccaaact accattggtg ggttgaacat ctgaatctga tgttggggtt
tcagacggac 1620 ccaaagaaga caaccataac agactcacca tcatttctag
gctgtagaat agtaaatgga 1680 cgccagctag tccccaaccg tgacaggatt
ctcgcggccc tcgcctacca catgaaggcg 1740 agtaatgttt ctgaatacta
cgcctcagcg gctgcaatac tcatggacag ctgtgcttgt 1800 ttagagtatg
atcctgaatg gtttgaagaa cttgtagttg gaatagcgca gtgcgcccgc 1860
aaggacggct acagctttcc cggcacgccg ttcttcatgt ccatgtggga aaaactcagg
1920 tcaaattatg aggggaaaaa gtcgagagtg tgcgggtact gcggggcccc
ggccccgtac 1980 gctactgcct gcggccttga cgtctgcatt taccacaccc
acttccacca gcattgtcca 2040 gtcacaatct ggtgcggcca tccagcgggt
tctggttctt gtaatgagtg caagtccccc 2100 atagggaaag gcacaagccc
cctagacgag gtgctagaac aagtcccgta taagccccca 2160 cggaccgtaa
ttatgcatgt ggagcagggt cttacccccc ttgacccagg taggtaccag 2220
actcgccgcg gattagtctc cgtcaggcgt ggaatcaagg gaaatgaagt tgaactacca
2280 gacggtgatt atgctagtac cgccttgctc cccacctgta aagagatcaa
catggtcgct 2340 gtcgcttcta atgtgttgcg cagcaggttc atcatcggtc
cacccggtgc tgggaaaaca 2400 tactggctcc ttcaacaagt ccaggatggt
gatgttattt acacaccaac tcaccagacc 2460 atgcttgaca tgatcagagc
tttggggacg tgccgattca atgtccctac aggcacaaca 2520 ctgcagttcc
ctgtcccctc ccgtaccggt ccgtgggttc gcatcctagc cggtggttgg 2580
tgtcctggca agaattcctt cctggatgaa gcagcgtatt acaatcacct tgatgtcttg
2640 aggcttctta gtaaaactac cctcacctgt ctgggagact ttaaactact
ccacccagtg 2700 ggttttgatt cccattgcta tgtttttgac atcatgcctc
agactcaatt aaagaccatc 2760 tggagatttg gacagaatat ctgtgatgcc
attcaaccag attacaggga caaactcatg 2820 tccatggtca acacaacccg
tgtaacttac gtggaaaaac ccgtcaggta tgggcaagtc 2880 cttaccccct
accataagga ccgagaggac ggcgccatca ccattgactc cagtcaaggt 2940
gccacgtttg atgtggttac attgcatttg cccactaaag attcactcaa caggcaaaga
3000 gcccttgttg ctatcactag ggcaagacat gcaatttttg tgtatgaccc
acacaagcaa 3060 ctgcagagcc tgtttgatct ccctgcaaaa ggcacacccg
tcaacctcgc tgtgcaccgc 3120 gacgggcagc ttattgtgct ggatagaaat
aacaaggaat gcacggttgc tcaggctcta 3180 ggcaatggag ataaatttag
ggccacagac aaacgcgttg tggattctct ccgcgccatt 3240 tgtgctgatc
tagaagggtc gagctctccg ctccccaagg tcgcacacaa cttgggattt 3300
tatttctcac ctgatttaac gcagtttgct aaactcccag tagaacttgc accccactgg
3360 cccgtggtga caactcagaa caatgaaaag tggccagatc ggctggttac
cagccttcgc 3420 cctatccata aatatagccg cgcgtgcatt ggtgccggct
atatggtggg tccctcggtg 3480 ttcctgggca ctcctggggt cgtgtcatac
tacctcacaa aatttgttaa gggcgaggct 3540 caagtgcttc cggagacgat
cttcagcacc ggccgaattg aggtagattg ccgggaatat 3600 cttgatgatc
gggagcgaga agttgctgcg tccctcccac atgccttcat tggtgacgtc 3660
aaaggcacta ccgttggggg atgtcaccat gtcacctcca aataccttcc gcgcttcctt
3720 cccaaggaaa cagttgcggt agtcggggtt tcaagccccg gaaaagccgc
gaaagcagtg 3780 tgcacactga cagatgtgta cctcccagac cttgaagcct
atctccaccc ggagactcag 3840 tccaagtgct ggaaattgat gttggacttc
aaggaagttc actgatggtc tggaaagaca 3900 aaacagccta tttccaactt
gaaggtcgct acttcacctg gtatcagctt gctagctatg 3960 cctcgtacat
ccgtgttcct gtcaactcta cggtgtactt ggacccctgc atgggccccg 4020
ccctttgcaa caggagagtc gtcgggtcca cccactgggg ggctgacctc gcagtcaccc
4080 cttatgatta cggcgctaaa atcatcctgt ctagcgcgta ccatggtgaa
atgccccccg 4140 gatacaaaat tctggcgtgc gcggaattct cgttggatga
cccagtcagg tataaacata 4200 cctgggggtt tgaatcggat acagcgtatc
tatatgagtt caccggaaac ggtgaggact 4260 gggaggatta caatgatgcg
ttccgtgcgc gccagaaagg gaaaatttac aaggccactg 4320 ccaccagcat
gaagttttat ttccctccgg gccctgtcat tgaaccaact ttaggcctga 4380 at 4382
70 768 DNA Porcine reproductive and respiratory syndrome virus 70
atgaaatggg gtctatgcaa agcctttttg acaaaattgg ccaacttttt gtggatgctt
60 tcacggagtt cttggtgtcc attgttgata tcattatatt tttggccatt
ttgtttggct 120 tcaccatcgc aggttggctg gtggtctttt gcatcagatt
ggtttgctcc gcgatactcc 180 gtgcgcgccc tgccattcac tctgagcaat
tacagaagat cctatgaggc ctttctctct 240 cagtgccagg tggacattcc
cacctgggga actaaacatc ctttggggat gctttggcac 300 cataaggtgt
caaccctgat tgatgaaatg gtgtcgcgtc gaatgtaccg catcatggaa 360
aaagcaggac aggctgcctg gaaacaggta gtgagcgagg ctacgctgtc tcgcattagt
420 agtttggatg tggtggctca ttttcagcat cttgccgcca ttgaagccga
gacctgtaaa 480 tatctggcct ctcggctgcc catgctacac cacctgcgca
tgacagggtc aaatgtaacc 540 atagtgtata atagtacttt gaatcaggtg
tttgctgttt tcccaacccc tggttcccgg 600 ccaaagcttc atgatttcca
gcaatggcta atagctgtac attcctctat attttcctct 660 gttgcagctt
cttgtactct ttttgttgtg ctgtggttgc gggttccaat gctacgtact 720
gtttttggtt tccgctggtt aggggcaatt tttctttcga actcacgg 768 71 732 DNA
Porcine reproductive and respiratory syndrome virus 71 atggctaata
gctgtacatt cctctatatt ttcctctgtt gcagcttctt gtactctttt 60
tgttgtgctg tggttgcggg ttccaatgct acgtactgtt tttggtttcc gctggttagg
120 ggcaattttt ctttcgaact cacggtgaat tacacggtgt gcccgccttg
cctcacccgg 180 caagcagccg cagaggccta cgaacccggc aggtcccttt
ggtgcaggat agggcatgat 240 cgatgtgggg aggacgatca tgatgaacta
gggtttgtgg tgccgtctgg cctctccagc 300 gaaggccact tgaccagtgc
ttacccctgg ttggcgttcc tgtccttcag ctatacggcc 360 cagttccatc
ccgagatatt cgggataggg aatgtgagtc gagtctatgt tgacatcaag 420
caccaattca tttgcgctgt tcatgatggg cagaacacca ccttgcccca ccatgacaac
480 atttcagccg tgtttcagac ctattaccag catcaggtcg acgggggcaa
ttggtttcac 540 ctagaatggc tgcgtccctt cttttcctct tggttggttt
taaatgtctc ttggtttctc 600 aggcgttcgc ctgcaagcca tgtttcagtt
cgagtctttc agacatcaag accaacacca 660 ccgcagcggc aggctttgct
gtcctccaag acatcagttg ccttaggcat cgcaactcgg 720 cctctgaggc ga 732
72 534 DNA Porcine reproductive and respiratory syndrome
virus 72 atggctgcgt cccttctttt cctcttggtt ggttttaaat gtctcttggt
ttctcaggcg 60 ttcgcctgca agccatgttt cagttcgagt ctttcagaca
tcaagaccaa caccaccgca 120 gcggcaggct ttgctgtcct ccaagacatc
agttgcctta ggcatcgcaa ctcggcctct 180 gaggcgattc gcaaagtccc
tcagtgccgc acggcgatag ggacacccgt gtatatcact 240 gtcacagcca
atgttaccga tgagaattat ttgcattcct ctgatcttct catgctttct 300
tcttgccttt tctatgcttc tgagatgagt gaaaagggat ttaaggtggt atttggcaat
360 gtgtcaggca tcgtggcagt gtgcgtcaac ttcaccagtt acgtccaaca
tgtcaaggaa 420 tttacccaac gttccttggt agttgaccat gtgcggctgc
tccatttcat gacgcccgag 480 accatgaggt gggcaactgt tttagcctgt
ctttttacca ttctgttggc aatt 534 73 600 DNA Porcine reproductive and
respiratory syndrome virus 73 atgttgggga aatgcttgac cgcgggctgt
tgctcgcaat tgcttttttt atggtgtatc 60 gtgccgtctt gttttgttgc
gctcgtcagc gccaacggga acagcggctc aaatttacag 120 ctgatttaca
acttgacgct atgtgagctg aatggcacag attggctagc taataaattt 180
gactgggcag tggagtgttt tgtcattttt cctgtgttga ctcacattgt ctcttatggt
240 gccctcacta ctagccattt ccttgacaca gtcggtctgg tcactgtgtc
taccgctggg 300 tttgttcacg ggcggtatgt tctgagtagc atgtacgcgg
tctgtgccct ggctgcgttg 360 atttgcttcg tcattaggct tgcgaagaat
tgcatgtcct ggcgctactc atgtaccaga 420 tataccaact ttcttctgga
cactaagggc agactctatc gttggcggtc gcctgtcatc 480 atagagaaaa
ggggcaaagt tgaggtcgaa ggtcacctga tcgacctcaa aagagttgtg 540
cttgatggtt ccgcggctac ccctgtaacc agagtttcag cggaacaatg gagtcgtcct
600 74 519 DNA Porcine reproductive and respiratory syndrome virus
74 atggagtcgt ccttagatga cttctgtcat gatagcacgg ctccacaaaa
ggtgctcttg 60 gcgttttcta ttacctacac gccagtgatg atatatgccc
taaaggtgag tcgcggccac 120 tgctagggct tctgcacctt ttggtcttcc
tgaattgtgc tttcaccttc gggtacatga 180 cattcgtgca ctttcagagt
acaaataagg tcgcgctcac tatgggagca gtagttgcac 240 tcctttgggg
ggtgtactca gccatacaaa cctggaaatt catcacctcc agatgccgtt 300
tgtgctgcta ggccgcaagt acattctggc ccctgcccac cacgttgaaa gtgccgcagg
360 ctttcatccg attgcggcaa atgataacca cgcatttgtc gtccggcgtc
ccggctccac 420 tacggtcaac ggcacattgg tgcccgggtt aaaaagcctc
gtgttggtgg cagaaaagct 480 gttaaacagg gagtggtaaa ccttgttaaa
tatgccaaa 519 75 368 DNA Porcine reproductive and respiratory
syndrome virus 75 atgccaaata acaccggcaa gcagcagaag agaaagaagg
gggatggcca gccagtcaat 60 cagctgtgcc agatgctggg taagatcatc
gctcaccaaa accagtccag aggcaaggga 120 ccgggaaaga aaaataagaa
gaaaaacccg gagaagcccc atttccctct agcgactgaa 180 gatgatgtca
gacatcactt tacccctagt gagcgtcaat tgtgtctgtc gtcaatccag 240
accgccttta atcaaggcgc tgggacttgc accctgtcag attcagggag gataagttac
300 actgtggagt ttagtttgcc tacgcatcat actgtgcgcc tgatccgcgt
cacagcatca 360 ccctcagc 368 76 7194 DNA Porcine reproductive and
respiratory syndrome virus 76 atgtctggga tacttgatcg gtgtacgtgc
acccccaatg ccagggtgtt tatggcggag 60 ggccaggtct actgcacacg
atgtctcagt gcacggtctc tccttcctct gaatctccag 120 actcccgagc
ttggggtgtt gggtctattc tacaggcccg aagaaccact ccggtggacg 180
ttgccacgtg cattccccac tgttgagtgt tcccccgctg gggcctgctg gctttctgca
240 atctttccaa ttgcgcgaat gaccagtgga aacctgaact tccaacaaag
aatggtacgg 300 gtcgcagctg agctttacag agccggccag ctcacccctg
tcgtcttgaa gactctgcaa 360 gtttacgaac ggggttgccg ctggtacccc
attgttggac ctgtccctgg agtggccgtt 420 ttcgccaact ccctacatgt
gagtgataaa cctttcccag gggcaactca cgtgttaacc 480 aacctgccgc
tcccgcagag acccaagccc gaagacttct gcccctttga atgcgccatg 540
gccaccgtct atgacattgg tcatgacgct gtcatgtaca tggccggagg gaaagtctcc
600 tgggcccctc gtggcgggga tggagtgaaa tttgaaactg tccccaaggg
gttggagtta 660 actgcggacc gactccgctc ctccttcccg ccccaccacg
tagtggacat gtccaggttt 720 gctttcacaa cccctgagtg tggtgcctct
atgcgggtcg gacgccaacg tggctgcctc 780 cccgctggta ctgtccctga
aggcaactgt tggtggagct tgtttggctc gctcccactg 840 gaagttctga
acaaagaaat tcgctatgcc aaccgatttg gctaccaaac taagcatggt 900
gtctctggca agtacctaca gcggaggctg caagttaatg gtctccgggc agtaactgac
960 acacatggac ctatcgtcat acaatacttc tccgttaagg agagttggat
ccgccacttg 1020 agactggcgg aagaacccag cctccctggg tttgaggatc
tcctcagaat aagggttgag 1080 cccaacacat cgccattgct tggcaagggt
gaaaaaatct tccgttttgg caatcacaaa 1140 tggtacggcg ctggaaagag
agcaaggaaa gcacgctcta gtgcgactgc tacggtcgct 1200 gaccgcgctt
tgtccgctcg tgaaacccgg ctggccaagg agcacgaggt tgccggcgcc 1260
aataaggctg agcacctcaa gcactactcc ccgcctgccg aagggaattg tggttggcac
1320 tgtatttccg ccatcgtcaa ccggatggtg aactccaaat ttgaaaccac
cctccccgag 1380 agagtgagac ctccagatga ctgggctact gacgaggatc
ttgcgaacac catccaaatc 1440 ctcaggcttc ctgcggcctt ggacaggggc
ggtgcttgtg ttagcgccaa gtatgtactt 1500 aagctggaag gtgaacattg
gactgtctct gtgacccctg ggatgtctcc ctctttgctc 1560 ccccttgaat
gcgtccaggg ctgttgtgat cataagagcg gtcttggttc cccagatacg 1620
gtcgaagttt ccggatttga ccctgcctgc cttgaccggc tggctgaggt gatgcacctg
1680 cctagcagtg ccatcccagc cgctctggcc gaaatgtccg gcgattccga
tcgtccggct 1740 tccccggtca ccactgtgtg gacggtttcg cagttctttg
cccgccacac aggagggaat 1800 caccctgacc aggtgtgctt aggaaaaatc
attagccttt gtcaagtgct tgagagttgc 1860 tgctgtttcc agaacaaaac
caaccgggcc accccggaag aggtcgcggc aaaaattgac 1920 ctgtacctcc
gcggagcaac aggtcttgaa gaatgcttgg ccaggcttga gagggctcgc 1980
ccaccgagtg taatggacac ctcctttgat tggaatgttg tgcttcctgg gtttgaggcg
2040 gcaactcaga caaccaaacc gccccaggtc aaccagtgtc gcgctctggt
ccctgttgtg 2100 actcaagagt ctttggacaa tggctcggtt cctctgaccg
ccttctcgct gtccaattac 2160 tactaccgcg cgcaaggaga cgaggttcgt
caccgtgata ggttaaacgc cgtactctcc 2220 aagttggagg gtgctgttcg
agaagaatac gggctcatgc caactggacc tggcccgcga 2280 cccgcactgc
cgagtgggct tgacgagctt aaagaccaga tggaggagga tctgctgaaa 2340
ctagccaatg cccagacaac ttcagaaatg atggcctggg cagccgagca ggttgatcta
2400 aaagcttggg ttaaaaacta cccacggtgg acaccaccgc cccctccacc
aagagtccag 2460 cctcgaaaaa caaagcctgt caagagtttg ccagagagca
agcctgtccc cgccccgcgc 2520 aggaaggtta ggtccgattg tggcagcccg
attttattgg gcgacaatgt tcctaacagt 2580 tgggaagatt tgactgttgg
tggccccctt gatctctcga cctcacccga gccggtgaca 2640 cctccgagtg
agcttgcgct catgtccgca ccgcaacaca cttttaggtc ggtgataccc 2700
ttgggtgaac cggccccagt tcccgcattg cgcaaaactg tgccccgacc ggtaacaccc
2760 ttgagcgagc cgatccctgt gtccgcaccg caatgcaagt ttcagcaggt
ggaaaaagcg 2820 gatctggcgg cagcagcgct ggcgtaccag gacgagcccc
tagatttgtc tgcatcctca 2880 caaactgaat atgaggcttc tcccctagaa
ccactgcaga gcatgggcgt tctaaaggtg 2940 gaaggacaag aagctgagga
agtcctgagt ggaatctcgg acatactgga tgacatcaac 3000 ccggtgcctg
tatcatcaaa cggctccctg tcaagcgtga ggatcacacg cccaaaatac 3060
tcagctcaag ccatcatcga ctcgggcggg ccctgcagtg ggcacctcca agggataaag
3120 gaaacatgcc tcagtatcat gcgtgaggca tgtgatgcga ctaagcttga
tgaccctact 3180 acgcaggaat ggctttctcg catgtgggat agggtggaca
tgctgacttg gcgcaacacg 3240 tctgcttacc aggcgcttcg caccttagat
agcaggtttg agtttctccc aaaaatgata 3300 ctcgagacac cgccgcccta
tccgtgtgag tttgtgatga tgcctcacac gcctgcacct 3360 tctgtaagtg
cggagagtga tcttaccatt ggctcagtcg ccactgaaga tgttccacgc 3420
atcctcggga aaatagaaga tgtcggcgag atgaccaacc agggaccctt ggcattctcc
3480 gaggaagaac cggtggatca ccaacctgcc aagggctccc ggtcattgtc
gcggaggcct 3540 gacgagagta caccaactct gtccgcaagc gcaggtggca
ccgacttacc caccgatttg 3600 ccgctttcag acggtgtgga tgcggacggg
ggggggccgt tacggacggt aaaaaacaaa 3660 actcaaaggc tctttgacca
actgagccgt caggttttta acctcgtctc ccatctccct 3720 gttttcttct
cacgccttct cctacctggc ggtggttatt ctccgggtga ttggggcttt 3780
gcagctttta ctctattgtg cctctttttg tgttatagct acccagcctt tggtattgct
3840 ccccttttgg gtgtattttc tgggtcttct cggcgcgttc gaatgggggt
ttttggctgc 3900 tggttggctt ttgctgttgg cctgttcaag cctgtgtccg
acccagtcgg cactgcttgt 3960 gagtttgact cgccagagtg tagaaacatc
cttctttctt ttgagcttct caaaccttgg 4020 gaccctgttc gcagccttgt
tgtgggcccc gtcggtctcg gtcttgccat tcttggcagg 4080 ttactgggcg
gggcacgctg tatctggcac tttttgctta ggcttggcat tgttacagat 4140
tgtatcctgg ctggagctta tgtgctttct caaggtaggt gtaaaaagtg ctggggatct
4200 tgtataagaa ctgctcctag tgaggtcgcc tttaacgtgt ttccttttac
acgtgcgacc 4260 aggtcgtcac ttaccaactt gtgcgatcgg ttttgtgcgc
caaaaggcat ggaccccatt 4320 ttcctcgcca ctgggtggcg cgggtgctgg
accggccgaa gccccattga gcaaccctct 4380 gaaaaaccca tcgcgtttgc
ccagttggat gaaaagaaga ttacggctaa gactgtggtc 4440 gcccagcctt
atgaccccaa ccaagccgta aagtgtttgc gggtgttaca ggcgggcggg 4500
gtgatggtgg ctgaggcagt tccaaaagtg gtcaaggttt ccgctgtccc attccgagcc
4560 cccttctttc ccactggggt gaaagttgat cctgggtgca ggatcgtggt
tgaccccgac 4620 accttcactg cagctctccg gtctggttac tccaccacaa
acctcgtcct tggtgtaggg 4680 gactttgccc agctgaatgg attaaaaatt
aggcaaattt ccaagccttc tggaggaggc 4740 ccacacctca tggctgccct
gcatgttgct tgctcgatga ccttgcacat gcttgctggg 4800 atttacgtga
ctgcggtggg ttcttgcggc accggcacca acgatccgtg gtgcgctaac 4860
ccgtttgccg tccctggcta tggacctgga tctctctgca cgtccaaatt gtgcatctcc
4920 caacatggcc tcaccctgcc cttaacagca cttgttgcgg gattcggtat
tcaggaaatt 4980 gccttggtcg ttttgatttt tgtttccatc gggggcatgg
ctcataggtt gagttgtaag 5040 gctgatatgc tgtgtgtttt gcttgcaatc
gccagctatg tttgggtacc tctaacctgg 5100 ttgctttgtg tgtttccctg
ctggttgcgc tgtttttctt tgcacccact caccatccta 5160 tggttggtgt
ttttcttgat ttctgtaaat atgccttcag gaatcttggc catggtgttg 5220
ttggtttctc tttggcttct tggacgttat actaatgtcg ctggtcttgt caccccttat
5280 gatattcacc attacaccag tggcccccgc ggtgttgccg ccttggctac
agcaccagat 5340 gggacctact tggccgctgt ccgccgcgct gcgttgactg
gccgcaccat gctgtttacc 5400 ccgtctcagc ttgggtccct tcttgagggc
gcttttagaa ctcaaaagcc ctcgttgaac 5460 accgtcaatg tggtcggtcc
tccatgggct ctggcggggt gttcaccatc gacgggaaaa 5520 tcaagtgcgt
aactgccgca catgtcctta cgggcaattc agctagggtt tccggggtcg 5580
gtttcaacca aatgcttgac tttgatgtaa aaggagactt cgccatggcc gattgcccgg
5640 attggcaagg ggctgctccc aagacccaat tctgcaagga tggatggact
ggccgtgcct 5700 actggctaac atcctctggc gtcgaacccg gtgtcattgg
aaaaggattc gccttctgct 5760 tcaccgcgtg cggcattccg ggtccccagt
gatcaccgag gccggtgagc ttgtcggtgt 5820 ccacacggga tcaaataaac
aaggaggagg catcgtcacg cgcccctcag gccagttttg 5880 taatgtgtca
cccgtcaagc taagcgaatt aagtgaattc tttgctgggc ctaaggtccc 5940
gctcggtgat gtgaaggttg gcagccatat aatcaaagat ataggcgagg taccttcaga
6000 tctttgcgcc ttgcttgctg ccaaacctga actggaagga ggcctctcca
ccgtccaact 6060 tctgtgtgtg ttttttctcc tgtggaggat gatgggacat
gcctggacgc ccttggttgc 6120 tgtggggttc tttatcttga atgaggttct
tccagctgtc ctggtccgga gtgtcttctc 6180 ctttggaatg tttgtgctat
cctggctcac accatggtct gcgcaagttc tgatgatcag 6240 gcttctaaca
gcagctctta acaggaacag aggttcactt gccttttaca ccctcggtgc 6300
aataaccggc tttgtccaga tcttgcggtt actcagggac atccgttgca ggcagtgatg
6360 aatttgagca cctatgcatt cctgcctcgg atgatggttg tgacctcacc
agtcccagtg 6420 atcgcgtgtg gtgttgcgca cctgcttgcc atcattttgt
acttgtttaa gtaccgcggc 6480 ctgcacaaga tccttgttgg cgatggagcg
ttctctgcgg ctttcttcct gcgatacttt 6540 gccgagggaa agttgaggga
aggggtgtcg caatcctgcg gaatgaatca tgagtcactg 6600 actggtgccc
tcgccatgaa actcaatgac gaggacttgg atttccttac gaaatggact 6660
gattttaagt gctttgtttc tgcatccaac atgaggaatg cagcgggcca atttatcgag
6720 gctgcctatg ctaaagcact tagagtagaa cttgcccagt tggtacaggt
tgataaggtt 6780 cgaggcacta tggccaaact agaagctttt gctgacaccg
tggcacccca actctcgccc 6840 ggtgacattg ttgtcgctct tggccatacg
cctgttggca gtatcttcga cctaaaggtt 6900 ggtagcacta agcacaccct
ccaagccatt gagaccagat ttcttgctgg gtccaaaatg 6960 accgtggcgc
gtgtcgtcga cccgaccccc acgcccccac ccgcacccgt gcccatcccc 7020
ctcccaccga aagttctgga gaatggtccc aacgcttggg gggatgagga tcgtttgaat
7080 aaaaaaaaaa ggcgcaggat ggaagccctc ggcatctatg ttatgggtgg
gaaaaagtac 7140 cagaaatttt gggataagaa ctccggtgat gtgttttatg
aggaggtcca taat 7194 77 4352 DNA Porcine reproductive and
respiratory syndrome virus 77 tgataaactc cagtgcctga ctaaggagca
gtgtttaaac tgctagccgc cagcggcttg 60 acccgctgtg gtcgcggcgg
cttggttgtc actgagacag cggtaaaaat agtcaaattt 120 cacaaccgga
ccttcaccct gggacctgtg aatttaaaag tggccagtga ggttgagtta 180
aaagacgcgg tcgagcacaa ccaacacccg gttgcaagac cggttgatgg tggtgttgtg
240 ctcctgcgtt ctgcagttcc ttcacttata gacgtcctga tctccggtgc
cgacgcatct 300 cctaagttgc tcgcccatca cgggccgggg aacactggga
tcgatggcac gctttgggat 360 ttcgagtctg aggccactaa agaggaagtc
gcacttagtg cgcaaataat acaggcttgt 420 gacatcaggc gcggggacgc
acccaaaatt gatctcccct acaagctgta ccctgttagg 480 ggcaaccctg
agcgggtgaa aggagttctg aggaatacaa ggtttggaga cataccttac 540
aagaccccca gtgacactgg gagcccggtg cacgcggccg cctgccttac gcctaacgcc
600 actccggtga ctgacgggcg ctccatcttg gccacgacca tgccctctgg
gtttgagttg 660 tatgtaccga ccattccagc gtctgtcctt gattaccttg
attctaggcc tgactgccct 720 aaacagttga cagagcacgg ctgtgaagat
gccgcactga gagacctctc caaatatgac 780 ttgtccaccc aaggctttgt
tttacctgga gttcttcgcc tcgtgcggaa atacctgttt 840 gcccatgtag
gtaagtgccc acctgttcac cggccttcta cttatcctgc taagaattct 900
atggctggac taaatgggaa caggttcccg accaaggata ttcagagcgt ccctgaaatc
960 gacgttctgt gcgcgcaggc tgtgcggaaa actggcagac tgttacccct
tgtaccctta 1020 agaagcagta ttgcgggaag aagaaaacta ggacaatact
cggcaccaat aacttcatcg 1080 cgctggctca tcgggcagcg ttgagtggtg
tcacccaggg cttcatgaaa aaggcattta 1140 actcgcccat cgccctcgga
aaaaacaaat ttaaggagct acaaactccg gtcctaggca 1200 gatgccttga
agctgatctt gcatcctgcg accgatccac acctgcaatt gtccgttggt 1260
ttgccgccaa tcttctttat gaacttgcct gtgctgaaga tcacctgcca tcttatgtgc
1320 tgaactgttg ccacgactta ttggtcacgc agtctggcgc agtgactaag
agaggtggcc 1380 tgtcatctgg cgacccgatc acctctgtgt ctaacaccat
ttacagcttg gtgatctatg 1440 cacagcacat ggtgctcagt tacttcaaaa
gtggtcaccc ccacggcctt ctgttcttac 1500 aagaccagct aaagtttgag
gacatgctca aggttcaacc cctgatcgtc tattcggacg 1560 acctcgtgct
gtatgccgag tctcccacca tgccaaacta ccactggtgg gttgaacatc 1620
tgaatttaat gctggggttt cagacggacc caaagaagac agctataaca gactcgccat
1680 catttctagg ctgcaggata ataaatggac gccagctagt ccctaaccgt
gacaggattc 1740 tcgcggccct cgcctaccat atgaaggcga gtaatgtttc
tcaatactac gcttcggcgg 1800 ctgcaatact catggacagc tgtgcttgtt
tagagtatga tcctgaatgg tttgaagaac 1860 ttatagttgg aatatcgcag
tgcgcccgca aggacggcta tagctttccc ggtccgccgt 1920 tcttcttgtc
tatgtgggaa aaactcaggt ctaattatga ggggaagaag tcgagagtgt 1980
gcgggtactg cggggccccg gccccgtacg ctactgcctg tggcctcgat gtctgcattt
2040 accacaccca cttccaccag cattgtccgg ttataatttg gtgtggccac
ccagcgggtt 2100 ctggttcttg tagtgagtgc aaatcccccg tggggaaagg
cacaagccct ctggacgagg 2160 tgttaaaaca agtcccgtat aaacccccac
ggaccataat catgcatgtg gaacagggtc 2220 ttacccccct tgacccaggc
agataccaga ctcgccgcgg attggtctcc gttaggcgcg 2280 gaatcagggg
gaatgaagtt gaactaccag acggtgatta cgctagtacc gccttgctcc 2340
ccacctgtaa agagatcaac atggtcgctg tcgcttctaa tgtgttgcgc agcaggttca
2400 tcatcggtcc gcccggtgct gggaagacat actggcttct acaacaggtc
caggatggtg 2460 atgtcattta cacaccaact caccagacca tgcttgacat
gattagagct ttggggacgt 2520 gccggttcaa cgtcccagca ggcacaacgc
tgcaattccc tgtcccctcc cgtaccggtc 2580 cgtgggttcg catcctagcc
ggcggttggt gtcctggcaa gaattccttc ctggatgaag 2640 cagcgtattg
caatcacctt gatgtcttga ggcttcttag caaaactacc ctcacctgtc 2700
tgggagattt caaacaactc cacccagtgg gttttgattc tcattgctat gtttttgaca
2760 ctatgcctca gactcaactg aagaccatct ggagattcgg acagaatatt
tgtgatgcca 2820 tccaaccaga ttacagagac aaactcatgt ccatggtcaa
cacaacccgt gtaacctacg 2880 tggagagacc tgtcaggcat gggcaagtcc
tcacccccta ccacagggac cgagaggacg 2940 acgccatcac cattgactcc
agccaaggcg ccacatttga tgtggttaca ttgcatttgc 3000 ccactaaaga
ttcactcaac aggcaaagag cccttgttgc tatcaccagg gcaagacatg 3060
ctatctttgt gtatgaccca cacaggcaac tgcagagcct atttgatctt cctgcgaaaa
3120 gcacccctgt caacctcgca gtgcaccgcg acgggcagct gatcgtgcta
gatagaaata 3180 acaaagaatg cacggttgct caggctcttg gcaacggaga
taaatttagg gccacagaca 3240 agcgcgttgt agactctctc cgcgccattt
gtgctgatct agaagggtct agctctccgc 3300 tccccaaggt cgcccacaac
ttgggatttc atttctcacc tgatttgaca cagtttgcca 3360 aactcccagt
agaacttgca cctcactggc ccgtggtgac aacccagaac aatgaaaagt 3420
ggccagatcg gctggttgct agccttcgcc ctattcataa atatagccgc gcgtgcattg
3480 gtgccggcta tatggtgggc ccctcggtgt ttctaggcac ccctggggtc
gtgtcatact 3540 acctcacaaa atttattaag ggcgaggctc aagtgcttcc
ggagacggtc ttcagcaccg 3600 gtcgaattga ggtagattgc cgggaatacc
ttgatgatcg ggagccagaa gttgctgcgt 3660 ccctcccaca tgccttcatt
ggcgacgtca aaggcactac cgttggggga tgtcaccatg 3720 tcacttccaa
ataccttccg cgcttccttc ctaaggaatc agttgcggta gtcggggttt 3780
cgagccccgg aaaagccgcg aaagcagtgt gcacactgac agatgtgtac ctcccagacc
3840 ttgaagccta cctccacccg gaaacccagt ccaagtgctg gaaattgatg
ttggacttca 3900 aggaagtccg actgatggtc tggaaagaca agacggccta
tttccaactt gaaggccgct 3960 atttcacctg gtatcagctt gctagctacg
cctcgtacat ccgtgttcct gtcaactctg 4020 cggtgtactt agacccctgc
atgggccctg ccctttgcaa caggagagtt atcgggtcca 4080 ctcattgggg
agctgacctc gcagtcaccc cttatgatta cggtgccaaa attattttgt 4140
ctagtgcgta ccatggtgaa atgcctcccg ggtacaagat tctggcgtgc gcagagttct
4200 cgcttgacga cccagtcaag tacaagcaca cctgggggtt tgaatcggat
acagcgtatc 4260 tgtatgagtt caccggaaac ggtgaggact gggaggatta
caatgatgcg tttcgtgcgc 4320 gccaggaggg gaaagtctat aaggccactg cc 4352
78 768 DNA Porcine reproductive and respiratory syndrome virus 78
atgaaatggg gtctatgcaa agcctttttg acaaaattgg ccaacttttc gtggatgctt
60 tcacggagtt cttggtgtcc attgttgata tcattatatt tttggccatt
ttgtttggct 120 tcaccatcgc cggttggctg gtggtctttt gcatcagatt
ggtttgctcc gcgctactcc 180 gtgcgcgccc tgccattcac tctgagcaat
tacagaagat cctatgaggc ctttctttct 240 cagtgccagg tggacattcc
cacctgggga tttaaacatc ctttggggat gttttggcac 300 cataaggtgt
caaccctgat tgatgaaatg gtgtcgcgtc gaatgtaccg catcatggat 360
aaagcaggac aggctgcctg gaaacaggtg gtgagcgagg ctacgctgtc tcgcattagt
420 agtttggatg tggtggctca ctttcagcat cttgccgcca ttgaagccga
gacctgtaaa 480 tatttggcct ctcggctgcc catgctacac aacctgcgca
tgacagggtc aaatgtaacc 540 atagtgtata atagtacttt gaatcaggtg
cttgctattt ttccaacccc tggttcccgg 600 ccaaagcttc atgattttca
gcaatggcta atagctgtac attcctctat attttcctct 660 gttgcagctt
cttgtactct ttttgttgtg ctgtggttgc gggttccaat gctacgtatt 720
gcttttggtt tccgctggtt aggggcaatt tttccttcga actcacag 768 79 662 DNA
Porcine reproductive and respiratory syndrome virus 79 atggctaata
gctgtacatt cctctatatt ttcctctgtt gcagcttctt gtactctttt 60
tgttgtgctg tggttgcggg ttccaatgct acgtattgct tttggtttcc gctggttagg
120 ggcaattttt ccttcgaact cacagtgaac tacacggtgt gtccaccttg
cctcacccgg 180 caagcagcca tagaggccta cgaacctggc aggtctcttt
ggtgcaggat agggtatgat 240 cgctgtgggg aggacgatca tgacgaacta
gggtttgtgg tgccgtctgg cctctccagc 300 gaaggccact tgaccagtgt
ttacgcctgg ttggcgttcc tgtctttcag ttacacagcc 360 cagttccatc
ctgagatatt cgggataggg aatgtgagtc aagtttatgt tgacatcagg 420
catcaatcca tttgcgccgt tcacgacggg cagaacgcca ctttgcctcg ccatgacaat
480 atttcagccg tgttccagac ttattaccaa catcaagtcg acggcggcaa
ttggtttcac 540 ctagaatggc tgcgtccctt cttttcctct tggttggttt
taaatgtctc ttggtttctc 600 aggcgttcgc ttgcaagcca tgtttcagtt
cgagtcttgc agacattaag accaacacca 660 cc 662 80 535 DNA Porcine
reproductive and respiratory syndrome virus 80 atggctgcgt
cccttctttt cctcttggtt ggttttaaat gtctcttggt ttctcaggcg 60
ttcgcttgca agccatgttt cagttcgagt cttgcagaca ttaagaccaa caccaccgca
120 gcggcaggct ttgctgtcct ccaagacatc agttgcctta ggtatcgcaa
ctcggcctct 180 gaggcgtttc gcaaaatccc tcagtgtcgt acggcgatag
ggacacccat gtatattact 240 gtcacagcca atgtaaccga tgagaattat
ttgcattcct ctgaccttct catgctttct 300 tcttgccttt tctacgcttc
tgagatgagt gaaaagggat ttaaagtggt atttggcaat 360 gtgtcaggca
tcgtggctgt gtgcgtcaac tttaccagct acgtccaaca tgtcaaggaa 420
tttacccaac gctccttggt agtcgaccat gtgcggctgc tccatttcat gacacctgag
480 accatgaggt gggcaactgt tttagcctgt ctttttgcca ttctgttggc cattt
535 81 600 DNA Porcine reproductive and respiratory syndrome virus
81 atgttgggga aatgcttgac cgcgggctat tgctcgtcat tgcttttttt
gtggtgtatc 60 gtgccgtctt ggtttgttgc gctcgccagc gccaacagca
tcaacagccc tcatttacag 120 ttgatttata acttgacgct atgtgagctg
aatggcacag attggttagc tggtgaattt 180 gactgggcag tggagtgttt
tgtcattttt cctgtgttga ctcacattgt ctcctatggt 240 gccctcacca
ccagccattt ccttgacaca gtcggtctgg tcactgtgtc taccgccggc 300
ttttcccacg ggcggtatgt tctgagtagc atctacgcgg tctgtgccct ggctgcgttg
360 atttgcttcg tcattaggtt tacgaagaat tgcatgtcct ggcgctactc
atgtaccaga 420 tataccaact ttcttctgga cactaagggc agactctatc
gttggcggtc gcctgtcatc 480 atagagaaaa ggggtaaagt tgaggtcgaa
ggtcatctga tcgacctcaa gagagttgtg 540 cttgatggtt ccgcggcaac
ccctataacc aaaatttcag ccgagcaatg gggtcgtcct 600 82 522 DNA Porcine
reproductive and respiratory syndrome virus 82 atggggtcgt
ccttagatga cttctgccat gatagcacgg ctccactaaa ggtgcttttg 60
gcgttctcta ttacctacac gccagtgatg atatatgccc taaaagtaag tcgcggccga
120 ctgttagggc ttctgcacct tttgatcttc ctaaattgtg ctttcacctt
cgggtacatg 180 acattcgtgc actttcagag cacaaacaag gtcgcgctca
ctatgggagc agtagttgca 240 ctcctttggg gggtgtactc agccatagaa
acctggaaat tcatcacctc cagatgccgt 300 ttgtgcttgc taggccgcaa
gtacattttg gcccctgccc accacgttga aagtgccgca 360 ggctttcatc
cgatagcggc aaatgataac cacgcatttg tcgtccggcg tcccggctcc 420
actacggtta acggcacatt ggtgcccggg ttgaaaagcc tcgtgttggg tggcagaaaa
480 gctgtcaaac agggagtggt aaaccttgtt aaatatgcca aa 522 83 469 DNA
Porcine reproductive and respiratory syndrome virus 83 atgccaaata
acaacggcaa gcagcagaag aaaaagaagg gggatggcca gccagtcaat 60
cagctgtgcc agatgctggg taagatcatc gctcagcaaa accagtccag aggcaaggga
120 ccgggaaaga aaaacaagaa gaaaaacccg gagaagcccc attttcctct
agcgactgaa 180 gatgatgtca gacatcactt cacctctggt gagcggctat
tgtgtctgtc gtcaatccag 240 acagccttta atcaaggcgc tggaatttgt
accctgtcag attcagggag gataagttac 300 actgtggagt ttagtttgcc
gacgcatcat actgtgcgcc tgatccgcgt cacagcgtca 360 ccctcagcat
gatgagctgg cattcttgag gcatcccagt gtttgaattg gaagaatgtg 420
tggtgaatgg cactgattga cattgtgctt ctaagtcacc tattcaatt 469 84 20 DNA
Porcine reproductive and respiratory syndrome virus Description of
Artificial SequenceSynthetic DNA 84 cgtacggcga tagggacacc 20 85 20
DNA Porcine reproductive and respiratory syndrome virus Description
of Artificial SequenceSynthetic DNA 85 ggcatatatc atcactggcg 20 86
7 PRT Porcine reproductive and respiratory syndrome virus 86 Asn
Gly Asn Ser Gly Ser Asn 1 5 87 7 PRT Porcine reproductive and
respiratory syndrome virus 87 Ser Asn Asp Ser Ser Ser His 1 5 88 7
PRT Porcine reproductive and respiratory syndrome virus 88 Ser Ser
Ser Asn Ser Ser His 1 5 89 7 PRT Porcine reproductive and
respiratory syndrome virus 89 Ser Ala Asn Ser Ser Ser His 1 5 90 7
PRT Porcine reproductive and respiratory syndrome virus 90 His Ser
Asn Ser Ser Ser His 1 5 91 7 PRT Porcine reproductive and
respiratory syndrome virus 91 Ser Asn Ser Ser Ser Ser His 1 5 92 7
PRT Porcine reproductive and respiratory syndrome virus 92 Asn Asn
Ser Ser Ser Ser His 1 5 93 8 PRT Porcine reproductive and
respiratory syndrome virus 93 Asn Gly Gly Asp Ser Ser Thr Tyr 1 5
94 10 PRT Porcine reproductive and respiratory syndrome virus 94
Ala Asn Lys Phe Asp Trp Ala Val Glu Thr 1 5 10 95 10 PRT Porcine
reproductive and respiratory syndrome virus 95 Ala Asn Lys Phe Asp
Trp Ala Val Glu Pro 1 5 10 96 10 PRT Porcine reproductive and
respiratory syndrome virus 96 Ala Gly Glu Phe Asp Trp Ala Val Glu
Thr 1 5 10 97 10 PRT Porcine reproductive and respiratory syndrome
virus 97 Ala Asp Lys Phe Asp Trp Ala Val Glu Pro 1 5 10 98 10 PRT
Porcine reproductive and respiratory syndrome virus 98 Ala Asp Arg
Phe Asp Trp Ala Val Glu Pro 1 5 10 99 10 PRT Porcine reproductive
and respiratory syndrome virus 99 Ser Ser His Phe Gly Trp Ala Val
Glu Thr 1 5 10 100 9 PRT Porcine reproductive and respiratory
syndrome virus 100 Leu Ile Cys Phe Val Ile Arg Leu Ala 1 5 101 9
PRT Porcine reproductive and respiratory syndrome virus 101 Leu Thr
Cys Phe Val Ile Arg Phe Ala 1 5 102 9 PRT Porcine reproductive and
respiratory syndrome virus 102 Leu Ile Cys Phe Val Ile Arg Phe Thr
1 5 103 9 PRT Porcine reproductive and respiratory syndrome virus
103 Leu Ala Cys Phe Val Ile Arg Phe Ala 1 5 104 9 PRT Artificial
Sequence Description of Artificial SequenceSynthetic DNA 104 Leu
Thr Cys Phe Val Ile Arg Phe Val 1 5 105 9 PRT Artificial Sequence
Description of Artificial SequenceSynthetic DNA 105 Leu Thr Cys Phe
Ile Ile Arg Phe Ala 1 5 106 9 PRT Artificial Sequence Description
of Artificial SequenceSynthetic DNA 106 Phe Ile Cys Phe Val Ile Arg
Phe Ala 1 5 107 9 PRT Artificial Sequence Description of Artificial
SequenceSynthetic DNA 107 Phe Val Cys Phe Val Ile Arg Ala Ala 1 5
108 18 PRT Artificial Sequence Description of Artificial
SequenceSynthetic DNA 108 Leu Gln Leu Ile Tyr Asn Leu Thr Leu Cys
Glu Leu Asn Gly Thr Asp 1 5 10 15 Trp Leu 109 21 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 109
gggatccttt tgtggagccg t 21 110 24 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 110 ggggaattcg
ggatagggaa tgtg 24 111 27 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 111 gggggatcct gttggtaata gagtctg
27 112 28 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 112 ggtgaattcg ttttatttcc ctccgggc 28 113 18
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 113 gatagagtct gcccttag 18 114 18 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 114 ggtttcacct
agaatggc 18 115 17 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 115 gcttctgaga tgagtga 17 116 18
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 116 caaccaggcg taaacact 18 117 17 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 117 ctgagcaatt
acagaag 17 118 18 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 118 gactgatggt ctggaaag 18 119 18 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
119 ctgtatccga ttcaaacc 18 120 18 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 120 aggttggctg
gtggtctt 18 121 18 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 121 tcgctcacta cctgtttc 18 122 18
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 122 tgtgcccgcc ttgcctca 18 123 18 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 123 aaaccaattg
cccccgtc 18 124 18 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 124 tatatcactg tcacagcc 18 125 18
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 125 caaattgcca acagaatg 18 126 20 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 126 caacttgacg
ctatgtgagc 20 127 20 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 127 gccgcggaac catcaagcac 20 128
20 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 128 gactgctagg gcttctgcac 20 129 18 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
129 cgttgaccgt agtggagc 18 130 22 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 130 ccccatttcc
ctctagcgac tg 22 131 22 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 131 cggccgtgtg gttctcgcca at 22
132 24 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 132 ggggaattcg ggatagggaa tgtg 24 133 22 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
133 ggggatcctt ttgtggagcc gt 22 134 28 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 134 ggtgaattcg
ttttatttcc ctccgggc 28 135 27 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 135 gggggatcct gttggtaata
gagtctg 27 136 18 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 136 ggtttcacct agaatggc 18 137 18 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
137 gatagagtct gcccttag 18 138 17 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 138 gcttctgaga
tgagtga 17 139 17 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 139 ctgagcaatt acagaag 17 140 18 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
140 caaccaggcg taaacact 18 141 19 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 141 gactgcttta
cggtctctc 19 142 18 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 142 gatgcctgac acattgcc 18 143 19
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 143 ctgcaagact cgaactgaa 19 144 20 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 144 ccccattgtt
ggacctgtcc 20 145 19 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 145 gtcacaacag ggaccgagc 19 146 27
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 146 ccaagctccc ctgaaggagg ctgtcac 27 147 27 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 147
ccaagctccc ctgaaggagg ctgtcac 27 148 25 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 148 agcatcccag
acatggttaa agggg 25 149 14 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 149 ccaccccttt aacc 14 150 14 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
150 ccaccccttg aacc 14 151 14 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 151 cctgtcattg aacc 14 152 14
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 152 ccacccctgt aacc 14 153 14 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 153 ccaccccttt aacc
14 154 14 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 154 ggtcaaatgt aacc 14 155 14 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 155
ccaccccttt gacc 14 156 14 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 156 aaggccactt gacc 14 157 14 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
157 ccaccccttt cacc 14 158 15 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 158 ccaccccgtt tcacc 15 159 14
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 159 caattggttt cacc 14 160 14 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 160 ccaccccgtc aact
14 161 14 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 161 agtgtgcgtc aact 14 162 14 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 162
ccaccccttt agcc 14 163 15 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 163 ccaccccttt tagcc 15 164 14 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
164 caactgtttt agcc 14 165 14 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 165 ccacccctgt aacc 14 166 14
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 166 ccaccccttt aacc 14 167 14 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 167 ctacccctgt aacc
14 168 14 DNA Artificial Sequence Description of Artificial
SequenceSynthetic DNA 168 ccaccccttt aacc 14 169 14 DNA Artificial
Sequence Description of Artificial SequenceSynthetic DNA 169
ccacccctat aacc 14 170 14 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 170 ggcaaatgat aacc 14 171 15 DNA
Artificial Sequence Description of Artificial SequenceSynthetic DNA
171 ccaccccctt aaacc 15 172 15 DNA Artificial Sequence Description
of Artificial SequenceSynthetic DNA 172 agggagtggt aaacc 15 173 20
DNA Artificial Sequence Description of Artificial SequenceSynthetic
DNA 173 cgtacggcga tagggacacc 20 174 20 DNA Artificial Sequence
Description of Artificial SequenceSynthetic DNA 174 ggcatatatc
atcactggcg 20 175 14 DNA Artificial Sequence Description of
Artificial SequenceSynthetic DNA 175 ccaccccttt aacc 14
* * * * *