U.S. patent application number 11/238025 was filed with the patent office on 2006-03-09 for microorganisms for therapy.
Invention is credited to Aladar A. Szalay, Tatyana Timiryasova, Yong A. Yu, Qian Zhang.
Application Number | 20060051370 11/238025 |
Document ID | / |
Family ID | 34119412 |
Filed Date | 2006-03-09 |
United States Patent
Application |
20060051370 |
Kind Code |
A1 |
Szalay; Aladar A. ; et
al. |
March 9, 2006 |
Microorganisms for therapy
Abstract
Therapeutic methods and microorganisms therefor are provided.
The microorganisms are designed to accumulate in immunoprivileged
tissues and cells, such as in tumors and other proliferating tissue
and in inflamed tissues, compared to other tissues, cells and
organs, so that they exhibit relatively low toxicity to host
organisms. The microorganisms also are designed or modified to
result in leaky cell membranes of cells in which they accumulate,
resulting in production of antibodies reactive against proteins and
other cellular products and also permitting exploitation of
proferating proliferating tissues, particularly tumors, to produce
selected proteins and other products. Vaccines containing the
microorganisms are provided. Combinations of the microorganisms and
anti-cancer agents and uses thereof for treating cancer also are
provided.
Inventors: |
Szalay; Aladar A.;
(Highland, CA) ; Timiryasova; Tatyana; (Scotrun,
PA) ; Yu; Yong A.; (San Diego, CA) ; Zhang;
Qian; (San Diego, CA) |
Correspondence
Address: |
FISH & RICHARDSON, PC
P.O. BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Family ID: |
34119412 |
Appl. No.: |
11/238025 |
Filed: |
September 27, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10872156 |
Jun 18, 2004 |
|
|
|
11238025 |
Sep 27, 2005 |
|
|
|
Current U.S.
Class: |
424/199.1 ;
514/44R |
Current CPC
Class: |
A61K 35/768 20130101;
A61P 35/00 20180101; C12N 15/86 20130101; A61K 2039/5254 20130101;
A61K 35/744 20130101; A61P 35/04 20180101; C12P 21/02 20130101;
A61K 35/74 20130101; A61K 48/00 20130101; C12N 2710/24143 20130101;
C12N 7/00 20130101; C12P 19/34 20130101; C12N 2710/24134 20130101;
A61P 29/00 20180101; A61P 37/04 20180101; C12N 2710/24161 20130101;
C12N 2710/24132 20130101; C07K 16/30 20130101; C07K 16/40 20130101;
A61P 37/02 20180101; A61K 45/06 20130101; A61K 39/00 20130101; A61K
9/0019 20130101; A61K 2039/5256 20130101; A61P 43/00 20180101; A61P
37/00 20180101; A61K 39/285 20130101 |
Class at
Publication: |
424/199.1 ;
514/044 |
International
Class: |
A61K 48/00 20060101
A61K048/00; A61K 39/12 20060101 A61K039/12 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 18, 2003 |
EP |
03 013 826.7 |
Aug 14, 2003 |
EP |
03 018 478.2 |
Oct 22, 2003 |
EP |
03 024 283.8 |
Claims
1. A combination, comprising: a pharmaceutical composition,
comprising a recombinant vaccina virus whose genome contains a
modified thymidine kinase (TK) gene and/or a modified HA gene, and
insertion, deletion or mutation in the locus designated F3; and an
anticancer agent.
2. The combination of claim 1, wherein: (a) the TK gene and/or HA
gene is/are inactivated; and (b) the F3 locus is inactivated
3. The combination of claim 1, wherein inactivation of at least one
of the genes or loci is effected by insertion of heterologous
nucleic acid therein.
4. The combination of claim 1, wherein heterologous nucleic acid is
inerted into the TK and HA genes to inactivate them, and
heterologous nucleic acid is inserted into the F3 locus.
5. The combination of claim 1, wherein the vaccinia virus is a
Lister strain.
6. The combination of claim 2, wherein the vaccinia virus is a
Lister strain.
7. The combination of claim 3, wherein the vaccinia virus is an
LIVP strain.
8. The combination of claim 4, wherein the vaccinia virus is a LIVP
strain.
9. The combination of claim 8, wherein the modification of the F3
locus is at the NotI site within the F3 gene or at a corresponding
locus.
10. The combination of claim 8, wherein the modification of the F3
locus is at position 1475 inside of the HindIII F fragment of the
nucleic acid.
11. The combination of claim 3, wherein the at least one of the TK,
HA gene and F3 locus comprises an insertion of heterologous nucleic
acid that encodes a protein.
12. The combination of claim 11, wherein the heterologous nucleic
acid comprises a regulatory sequence operatively linked to the
nucleic acid encoding the protein.
13. The combination of claim 12, wherein the regulatory sequence
comprises the vaccinia virus early/late promoter p7.5.
14. The combination of claim 12, wherein the regulatory sequence
comprises an early/late vaccinia pE/L promotor.
15. The combination of claim 11, wherein the heterologous nucleic
acid encodes a detectable protein or a protein capable of inducing
a detectable signal.
16. The combination of claim 1, wherein the anticancer agent is a
chemotherapeutic compound.
17. The combination of claim 1, wherein the anticancer agent is
selected from among alkylating agents, antimetabolites, platinum
coordination complexes, anthracenediones, substituted ureas,
methylhydrazine derivatives, adrenocortical suppressants and
anti-cancer polysaccharides.
18. The combination of claim 1, wherein the anticancer agent is
selected from among gancyclovir, 5-fluorouracil, 6-methylpurine
deoxyriboside, cephalosporin-doxorubicin,
4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L-glutamic acid,
acetominophen, indole-3-acetic acid, CB1954,
7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycampotothecin,
bis-(2-chloroethyl)amino-4-hydroxyphenylaminomethanone 28,
1-chloromethyl-5-hydroxy-1,2-dihyro-3H-benz[e]indole,
epirubicin-glucoronide, 5'-deoxy5-fluorouridine, cytosine
arabinoside, and linamarin.
19. The combination of claim 1, wherein the compound and virus are
formulated separately in two compositions
20. The combination of claim 1, wherein the compound and virus are
formulated as single composition.
21. The combination of claim 2, wherein the anticancer agent is
selected from among alkylating agents, antimetabolites, platinum
coordination complexes, anthracenediones, substituted ureas,
methylhydrazine derivatives, adrenocortical suppressants and
anti-cancer polysaccharides.
22. The combination of claim 2, wherein the anticancer agent is
selected from among gancyclovir, 5-fluorouracil, 6-methylpurine
deoxyriboside, cephalosporin-doxorubicin,
4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L-glutamic acid,
acetominophen, indole-3-acetic acid, CB1954,
7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycampotothecin,
bis-(2-chloroethyl)amino-4-hydroxyphenylaminomethanone 28,
1-chloromethyl-5-hydroxy-1,2-dihyro-3H-benz[e]indole,
epirubicin-glucoronide, 5'-deoxy5-fluorouridine, cytosine
arabinoside, and linamarin.
23. The combination of claim 2, wherein the compound and virus are
formulated as single composition
24. A kit, comprising: a combination of claim 1 packaged as a kit;
and optionally instructions for administration thereof for
treatment of cancer.
25. A method of treatment of cancer, comprising: administering the
components of a combination of claim 1 to a subject for treatment
of cancer.
26. A kit, comprising: a combination of claim 2 packaged as a kit;
and optionally instructions for administration thereof for
treatment of cancer.
27. A method of treatment of cancer, comprising: administering the
components of a combination of claim 2 to a subject for treatment
of cancer.
28. A vaccine, comprising a comprising a recombinant vaccina virus
whose genome contains a modified thymidine kinase (TK) gene and/or
a modified HA gene, and an insertion, deletion or mutation in the
locus designated F3.
29. The vaccine of claim 28, wherein: (a) the TK gene and/or HA
gene is/are inactivated; and (b) the F3 locus is inactivated
30. The vaccine of claim 28, wherein inactivation of at least one
of the genes or loci is effected by insertion of heterologous
nucleic acid therein.
31. The vaccine of claim 28, wherein heterologous nucleic acid is
inerted into the TK and HA genes to inactivate them, and
heterologous nucleic acid is inserted into the F3 locus.
32. The vaccine of claim 28, wherein the vaccinia virus is a Lister
strain.
33. The vaccine of claim 28, wherein the vaccinia virus is an LIVP
strain.
34. The vaccine of claim 33, where the vaccinia virus is TK.sup.-,
HA.sup.- and F3.sup.-.
35. The vaccine of claim 34, wherein the vaccinia virus has an
insertion at the NotI site in the F3 locus.
36. The vaccine of claim 29 that is a smallpox vaccine.
37. The vaccine of claim 34 that is a smallpox vaccine.
38. A method of vaccination, comprising administering the vaccine
of claim 29 to a subject.
39. A method of vaccination, comprising administering the vaccine
of claim 34 to a subject.
40. The combination of claim 1, where the vaccinia virus is TK-,
HA- and F3-.
41. The combination of claims 1, wherein the vaccinia virus has an
insertion at the NotI site in the F3 locus.
42. The combination of claim 2, wherein the compound and virus are
formulated separately in two compositions
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/872,156, to Aladar A. Szalay; Tatyana Timiryasova; Yong A.
Yu; Qian Zhang, filed on Jun. 18, 2004, entitled "MICROORGANISMS
FOR THERAPY," which claims the benefit of priority under 35 U.S.C.
.sctn.119(a) to each of EP 03 013 826.7, filed 18 Jun. 2003,
entitled "Recombinant vaccinia viruses useful as tumor-specific
delivery vehicle for cancer gene therapy and vaccination;" EP 03
018 478.2, filed 14 Aug. 2003, entitled "Method for the production
of a polypeptide, RNA or other compound in tumor tissue;" and EP 03
024 283.8, filed 22 Oct. 2003, entitled "Use of a Microorganism or
Cell to Induce Autoimmunization of an Organism Against a Tumor."
The subject matter of each of these applications is incorporated by
reference in its entirety.
[0002] This application also is related to International
Application Serial No. PCT/US04/19866, filed on Jun. 18, 2004. This
application also is related to U.S. Application filed Jun. 10, 2004
Ser. No. 10/866,606, entitled "Light emitting microorganisms and
cells for diagnosis and therapy of tumors," which is a continuation
of U.S. application Ser. No. 10/189,918, filed Jul. 3, 2002; U.S.
Application filed May 19, 2004 Ser. No. 10/849,664, entitled,
"Light emitting microorganisms and cells for diagnosis and therapy
of diseases associated with wounded or inflamed tissue" which is a
continuation of U.S. application Ser. No. 10/163,763, filed Jun. 5,
2003; International PCT Application WO 03/014380, filed Jul. 31,
2002, entitled "Microoroganisms and Cells for Diagnosis and Therapy
of Tumors;" PCT Application WO 03/104485, filed Jun. 5, 2003,
entitled, "Light Emitting Microorganisms and Cells for Diagnosis
and Therapy of Diseases Associated with Wounded or Inflamed
tissue;" EP Application No. 01 118 417.3, filed Jul. 31, 2001,
entitled "Light-emitting microorganisms and cells for tumour
diagnosis/therapy;" EP Application No. 01 125 911.6, filed Oct. 30,
2001, entitled "Light emitting microorganisms and cells for
diagnosis and therapy of tumors;" EP Application No. 02 0794 632.6,
filed Jan. 28, 2004, entitled "Microorganisms and Cells for
Diagnosis and Therapy of Tumors;" and EP Application No. 02 012
552.2, filed Jun. 5, 2002, entitled "Light Emitting Microorganisms
and Cells for Diagnosis and Therapy of Diseases associated with
wounded or inflamed tissue." The subject matter of each of these
applications is incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0003] Vaccines that contain attenuated or modified microorganisms,
including microbes and cells, and methods for preparing the
microorganisms and vaccines are provided. In particular, modified
bacteria, eukaryotic cells and viruses are provided and methods of
use thereof for treatment of proliferative and inflammatory
disorders and for production of products in tumors are
provided.
BACKGROUND
[0004] In the late 19th century, a variety of attempts were made to
treat cancer patients with microorganisms. One surgeon, William
Coley, administered live Streptococcus pyogenes to patients with
tumors with limited success. In the early 20th century, scientists
documented vaccinia viral oncolysis in mice, which led to
administration of several live viruses to patients with tumors from
the 1940s through the 1960s. These forays into this avenue of
cancer treatment were not successful.
[0005] Since that time, a variety of genetically engineered viruses
have been tested for treatment of cancers. In one study, for
example, nude mice bearing nonmetastatic colon adenocarcinoma cells
were systemically injected with a WR strain of vaccinia virus
modified by having a vaccinia growth factor deletion and an
enhanced green fluorescence protein inserted into the thymidine
kinase locus. The virus was observed to have antitumor effect,
including one complete response, despite a lack of exogenous
therapeutic genes in the modified virus (McCart et al. (2001)
Cancer Res 1:8751-8757). In another study, vaccinia melanoma
oncolysate (VMO) was injected into sites near melanoma positive
lymph nodes in a Phase III clinical trial of melanoma patients. As
a control, New York City Board of Health strain vaccinia virus (VV)
was administered to melanoma patients. The melanoma patients
treated with VMO had a survival rate better than that for untreated
patients, but similar to patients treated with the VV control (Kim
et al. (2001) Surgical Oncol 10:53-59).
[0006] Other studies have demonstrated limited success with this
approach. This therapy is not completely effective, particularly
for systemically delivered viruses or bacteria. Limitations on the
control of microbial vehicle function in vivo result in ineffective
therapeutic results as well as raising safety concerns. It would be
desirable to improve this type of therapy or to develop more
effective approaches for treatments of neoplastic disease.
Therefore, among the objects herein, it is an object to provide
therapeutic methods and microorganisms for the treatment of
neoplastic and other diseases.
SUMMARY
[0007] Provided herein are therapeutic methods and microorganisms,
including viruses, bacteria and eukaryotic cells, for uses in the
methods for the treatment of neoplastic diseases and other
diseases. Diseases for treatment are those in which the targeted
tissues and/or cells are immunoprivileged in that they, and often
the local environment thereof, somehow escape or are inaccessible
to the immune system. Such tissues include tumors and other tissues
and cells involved in other proliferative disorders, wounds and
other tissues involved in inflammatory responses. The
microorganisms, which include bacterial cells, viruses and
mammalian cells, are selected or are designed to be non-pathogenic
and to preferentially accumulate in the immunoprivileged tissues.
The microorganisms, once in the tissues or cells or vicinity
thereof, affect the cell membranes of the cells in such tissues so
that they become leaky or lyse, but sufficiently slowly so that the
targeted cells and tumors leak enough antigen or other proteins for
a time sufficient to elicit an immune response.
[0008] The microorganisms are administered by any route, including
systemic administration, such as i.v. or using oral or nasal or
other delivery systems that direct agents to the lymphatics. In
exemplary methods, the microorganisms are used to treat tumors and
to prevent recurrence and metastatic spread. Exemplary
microorganisms include highly attenuated viruses and bacteria, as
well as mammalian cells. The microorganisms are optionally modified
to deliver other products, including other therapeutic products to
the targeted tissues.
[0009] When the microorganisms are administered to a host that
contains tumors, the tumors in the host essentially become antigen
and protein factories. This can be exploited so that the tumors can
be used to produce proteins or other cellular products encoded by
or produced by the microorganisms. In addition, the host sera can
be harvested to isolate antibodies to products produced by the
microorganisms as well as the tumor cells. Hence also provided are
methods for producing gene products by administering the
microorganisms to an animal, generally a non-human animal, and
harvesting the tumors to isolate the product. Also provided are
methods for producing antibodies to selected proteins or cell
products, such as metabolites or intermediates, by administering a
microorganism that expresses or produces the protein or other
product to a host, typically a non-human host; and harvesting serum
from the host and isolating antibodies that specifically bind to
the protein or other product.
[0010] Thus provided are methods and microorganisms for elimination
of immunoprivileged cells or tissues, particularly tumors. The
methods include administration, typically systemic administration,
with a microorganism that preferentially accumulates in
immunoprivileged cells, such as tumor cells, resulting in leakage
proteins and other compounds, such as tumor antigens, resulting in
vaccination of the host against non-host proteins and, such as the
tumor antigens, providing for elimination of the immunoprivileged
cells, such as tumor cells, by the host's immune system. The
microorganisms are selected not for their ability to rapidly lyse
cells, but rather for the ability to accumulate in immunoprivileged
cells, such as tumors, resulting in a leakage of antigens in a
sufficient amount and for a sufficient time to elicit an immune
response.
[0011] Hence provided are uses of microorganisms or cells
containing heterologous DNA, polypeptides or RNA to induce
autoimmunization of an organism against a tumor. In particular, the
microorganisms are selected or designed to accumulate in tumors and
to accumulate very little, if at all (to be non-toxic to the host)
in non-tumorous cells, tissues or organs, and to in some manner
result in the tumor cell lyses or cell membrane disruption such
that tumor antigens leak. Exemplary of such microorganisms are the
LIVP-derived vaccinia virus and the bacteria described herein and
also mammalian cells modified to target the tumors and to disrupt
the cells membrane. The microorganisms can be modified to express
heterologous products that mediate or increase the leakage of the
tumor cell antigens and/or that are therapeutic, such as anti-tumor
compounds.
[0012] Also provided are methods for production of antibodies
against a tumor by (a) injecting a microorganism or cell containing
a DNA sequence encoding a desired polypeptide or RNA into
an-organism bearing a tumor and (b) isolating antibodies against
the tumor.
[0013] Provided are attenuated microorganisms that accumulate in
immunoprivileged tissues and cells, such as tumor cells, but do not
accumulate to toxic levels in non-targeted organs and tissues, and
that upon administration to an animal bearing the immunoprivileged
tissues and cells, result in autoimmunity, such as by production of
anti-tumor (or anti-tumor antigen) antibodies against the
immunoprivileged cells or products thereof. The microorganisms are
selected or produced to render the immunoprivileged cells leaky,
such as by a slow lysis or apoptotic process. The goal is to
achieve such leakiness, but to not lyse the cells so rapidly that
the host cannot mount an immune response.
[0014] Uses of and methods of use of the microorganisms for
eliminating immunoprivileged tissues and cells are provided. The
microorganisms optionally include reporter genes and/or other
heterologous nucleic acids that disrupt genes in the microorganism
and can also encode and provide therapeutic products or products,
such as RNA, including RNAi, that alter gene and/or protein
expression in the cells or tissues where the microorganism
accumulates. Among the viruses provided are attenuated pox viruses
that contain a modified TK and HA gene and a modified F3 gene or
locus that corresponds to the F3 gene in vaccinia. In particular,
provided are recombinant vaccina viruses that contain a modified TK
and HA gene and optionally a modified F3 gene or locus, wherein the
resulting virus does not accumulate to toxic levels in non-targeted
organs. Vaccinia viruses where the TK gene and F3 gene are modified
and vaccinia viruses where the HA and F3 gene are modified, and
viruses where all three genes are modified are provided.
Modification includes inactivation by insertion, deletion or
replacement of one or more nucleotide bases whereby an activity or
product of the virus is altered. Included among the alterations is
insertion of heterologous nucleic acid, such as therapeutic
protein-encoding nucleic acids.
[0015] In exemplary embodiments, the vaccinia viruses are Lister
strain viruses, particularly LIVP strain viruses (LIVP refers to
the Lister virus from the Institute of Viral Preparations, Moscow,
Russia, the original source for this now widely disseminated virus
strain). Modifications include modification of the virus at the
unique NotI site in the locus designed F3. In particular, the
modification can be at position 35 of the F3 locus (gene) or at
position 1475 inside of the HindIII-F fragment of vaccinia virus
DNA strain LIVP.
[0016] The heterologous nucleic acid can include regulatory
sequences operatively linked to the nucleic acid encoding the
protein. Regulatory sequences include promoters, such as the
vaccinia virus early/late promoter p7.5 and an early/late vaccinia
pE/L promoter. The heterologous nucleic acid in the microorganism
can encode a detectable protein or a product capable of inducing a
detectable signal. Inclusion of detectable protein or a product
that can generate a detectable signal permits monitoring of the
distribution of the administered microorganism as well as
monitoring therapeutic efficacy, since the microorganism will be
eliminated when the immunoprivileged cells are eliminated.
[0017] Host cells containing the recombinant viruses, such as the
triple mutant vaccinia virus exemplified herein are provided. Also
contemplated are tumor cells that contain any of the microorganisms
provided herein or used in the methods.
[0018] Pharmaceutical composition containing the microorganisms in
a pharmaceutically acceptable vehicle for use in the methods herein
are provided. The pharmaceutical compositions can be formulated for
any mode of administration, including, but not limited to systemic
administration, such as for intravenous administration or is
formulated. The compositions can contain a delivery vehicle, such
as a lipid-based carrier, including liposomes and micelles
associated with the microorganism.
[0019] Also provided are methods (and uses of the microorganisms)
for eliminating immunoprivileged cells, such as tumor cells in an
animal, by administering the pharmaceutical compositions to an
animal, whereby the virus accumulates in the immunoprivileged
cells, thereby mediating autoimmunization resulting in elimination
of the cells or a reduction in their number.
[0020] Therapeutic methods for eliminating immunoprivileged cells
or tissues, in an animal, by administering a microorganism to an
animal, where the microorganism accumulates in the immunoprivileged
cells; the microorganism does not accumulate in unaffected organs
and tissues and has low toxicity in the animal; and the
microorganism results in leakage of the cell membranes in the
immunoprivileged cells, whereby the animal produces autoantibodies
against the cells or products of the cells are provided. These
methods include tumor treatment, treatment for inflammatory
conditions, including wounds, and proliferative disorders,
including psoriasis, cancers, diabetic retinopathies, restenosis
and other such disorders. It is desirable for the microorganisms to
not accumulate in unaffected organs, particularly the ovaries or
testes.
[0021] The microorganisms attenuated bacteria, an attenuated
viruses and mammalian cells, such as pox viruses and other
cytoplasimc viruses, bacteria such as vibrio, E. coli, salmonella,
streptococcus and listeria and mammalian cells, such as immune
cells, including B cells and lymphocytes, such as T cells, and stem
cells.
[0022] Also provided are methods for production of a polypeptide or
RNA or compound, such as a cellular product and uses of the
microorganism therefore are provided. Such methods can include the
steps of: (a) administering a microorganism containing nucleic acid
encoding the polypeptide or RNA or producing the product compound
to tumor-bearing animal, where the microorganism accumulates in the
immunoprivileged cells; and the microorganism does not accumulate
to toxic levels in organs and tissues that do not comprise
immunoprivileged cells or tissues; (b) harvesting the tumor tissue
from the animal; and (c) isolating the polypeptide or RNA or
compound from the tumor.
[0023] As noted, the microorganisms include eukaryotic cells,
prokaryotic cells and viruses, such as a cytoplasmic virus or an
attenuated bacterium or a stem cell or an immune cell. The
bacterium can be selected from among attenuated vibrio, E. coli,
listeria, salmonella and streptococcus strains. The microorganism
can express or produce detectable products, such as a fluorescent
protein (i.e., green, red and blue fluorescent proteins and
modified variants thereof), and/or luciferase which, when contacted
with a Lucifer produces light, and also can encode additional
products, such as therapeutic products. In the methods and uses
provided herein, the animals can be non-human animals or can
include humans.
[0024] Also provided are methods for simultaneously producing a
polypeptide, RNA molecule or cellular compound and an antibody that
specifically reacts with the polypeptide, RNA molecule or compound,
by: a) administering a microorganism to a tumor-bearing animal,
wherein the microorganism expresses or produces the compound,
polypeptide or RNA molecule; and b) isolating the antibody from
serum in the animal. The method optionally includes, after step a)
harvesting the tumor tissue from the animal; and isolating the
polypeptide, RNA molecule or cellular compound from the tumor
tissue.
[0025] Also provided are methods for eliminating immunoprivileged
cells or tissues in an animal, such as tumor cells, and uses of the
microorganisms therefore by administering at least two
microorganisms, wherein the microorganisms are administered
simultaneously, sequentially or intermittently, wherein the
microorganisms accumulate in the immunoprivileged cells, whereby
the animal is autoimmunized against the immunoprivileged cells or
tissues.
[0026] Uses of at least two microorganisms for formulation of a
medicament for elimination of immunoprivileged cells or tissues,
wherein they accumulate in the immunoprivileged cells, whereby the
animal is autoimmunized against the immunoprivileged cells or
tissues are provided. Combinations containing at least two
microorganisms formulated for administration to an animal for
elimination of immunoprivileged cells or tissues are provided. Kits
containing packaged combination optionally with instructions for
administration and other reagents are provided.
[0027] Uses of a microorganism encoding heterologous nucleic acid
for inducing autoimmunization against products produced in
immunoprivileged cells, wherein, when administered, the
microorganism accumulates in immunoprivileged tissues and does not
accumulate or accumulates at a sufficiently low level in other
tissues or organs to be non-toxic to an animal containing the
immunoprivileged tissues are provided.
[0028] Methods for the production of antibodies against products
produced in immunoprivileged tissues or cells by: (a) administering
a microorganism containing nucleic acid encoding a selected protein
or RNA into an animal containing the immunoprivileged tissues or
cells; and (b) isolating antibodies against the protein or RNA from
the blood or serum of the animal are provided.
[0029] Also provided are methods for inhibiting growth of
immunoprivileged cells or tissue in a subject by: (a) administering
to a subject a modified microorganism, wherein the modified
microorganism encodes a detectable gene product; (b) monitoring the
presence of the detectable gene product in the subject until the
detectable gene product is substantially present only in
immunoprivileged tissue or cells of a subject; and (c)
administering to a subject a therapeutic compound that works in
conjunction with the microorganism to inhibit growth of
immunoprivileged cells or tissue or by: (a) administering to a
subject a modified microorganism that encodes a detectable gene
product; (b) administering to a subject a therapeutic substance
that reduces the pathogenicity of the microorganism; (c) monitoring
the presence of the detectable gene product in the subject until
the detectable gene product is substantially present only in
immunoprivileged tissue or cells of a subject; and (d) terminating
or suspending administration of the therapeutic compound, whereby
the microorganism increases in pathogenicity and the growth of the
immunoprivileged cells or tissue is inhibited.
DESCRIPTION OF THE FIGURES
[0030] FIG. 1: Schematic of the various vaccinia strains described
in the Examples. Results achieved with the viruses are described in
the Examples.
[0031] FIG. 2 sets forth a flow chart for a method for producing
products, such as nucleic acid molecules, proteins and metabolic
compounds or other cellular products in tumors.
DETAILED DESCRIPTION
[0032] A. Definitions
[0033] B. Microorganisms for Tumor-Specific Therapy [0034] 1.
Characteristics [0035] a. Attenuated [0036] i. Reduced toxicity
[0037] ii. Accumulate in tumor, not substantially in other organs
[0038] iii. Ability to Elicit or Enhance Immune Response to Tumor
Cell [0039] iv. Balance of Pathogenicity and Release of Tumor
Antigens [0040] b. Immunogenicity [0041] c. Replication Competent
[0042] d. Genetic Variants [0043] i. Modified Characteristics
[0044] ii. Exogenous Gene Expression [0045] iii. Detectable gene
product [0046] iv. Therapeutic gene product [0047] v. Expressing a
superantigen [0048] vi. Expressing a gene product to be harvested
[0049] 2. Viruses [0050] a. Cytoplasmic viruses [0051] i.
Poxviruses [0052] a. Vaccinia Virus [0053] b. Modified Vaccinia
Viruses [0054] c. The F3 Gene [0055] d. Multiple Modifications
[0056] e. The Lister Strain [0057] ii. Other cytoplasmic viruses
[0058] b. Adenovirus, Herpes, Retroviruses [0059] 3. Bacteria
[0060] a. Aerobic bacteria [0061] b. Anaerobic bacteria [0062] 4.
Eukaryotic cells
[0063] C. Methods for Making an Attenuated Microorganism [0064] 1.
Genetic Modifications [0065] 2. Screening for above
characteristics
[0066] D. Therapeutic Methods [0067] 1. Administration [0068] a.
Steps prior to administering the microorganism [0069] b. Mode of
administration [0070] c. Dosage [0071] d. Number of administrations
[0072] e. Co-administrations [0073] i. Administering a plurality of
microorganisms [0074] ii. Therapeutic compounds [0075] f. State of
subject [0076] 2. Monitoring [0077] a. Monitoring microorganismal
gene expression [0078] b. Monitoring tumor size [0079] c.
Monitoring antibody titer [0080] d. Monitoring general health
diagnostics [0081] e. Monitoring coordinated with treatment
[0082] E. Methods of Producing Gene Products and Antibodies [0083]
1. Production of Recombinant Proteins and RNA molecules [0084] 2.
Production of Antibodies
[0085] F. Pharmaceutical Compositions, combinations and kits [0086]
1. Pharmaceutical Compositions [0087] 2. Host Cells [0088] 3.
Combinations [0089] 4. Kits
[0090] G. Examples
A. Definitions
[0091] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as is commonly understood by one
of skill in the art to which the invention(s) belong. All patents,
patent applications, published applications and publications,
websites and other published materials referred to throughout the
entire disclosure herein, unless noted otherwise, are incorporated
by reference in their entirety. In the event that there are a
plurality of definitions for terms herein, those in this section
prevail. Where reference is made to a URL or other such identifier
or address, it is understood that such identifiers can change and
particular information on the internet can come and go, but
equivalent information is known and can be readily accessed, such
as by searching the internet and/or appropriate databases.
Reference thereto evidences the availability and public
dissemination of such information.
[0092] As used herein, microorganisms refers to isolated cells or
viruses, including eukaryotic cells, such as mammalian cells,
viruses and bacteria. The microorganisms are modified or selected
for their ability to accumulate in tumors and other
immunoprivileged cells and tissues, and to minimize accumulation in
other tissues or organs. Accumulation occurs by virtue of selection
or modification of the microorganisms for particular traits or by
proper selection of cells. The microorganism can be further
modified to alter a trait thereof and/or to deliver a gene product.
The microorganisms provided herein are typically modified relative
to wild type to exhibit one or more characteristics such as reduced
pathogenicity, reduced toxicity, preferential accumulation in
tumors relative to normal organs or tissues, increased
immunogenicity, increased ability to elicit or enhance an immune
response to tumor cells, increased lytic or tumor cell killing
capacity, decreased lytic or tumor cell killing capacity.
[0093] As used herein, immunoprivileged cells and tissues refer to
cells and tissues, such as solid tumors and wounded tissues, which
are sequestered from the immune system. Generally administration of
a microorganism elicits an immune response that clears the
microorganism; immunoprivileged sites, however, are shielded or
sequestered from the immune response, permitting the microorganisms
to survive and generally to replicate. Immunoprivileged tissues
include inflamed tissues, such as wounded tissues, and
proliferating tissues, such as tumor tissues.
[0094] As used herein, "modified" with reference to a gene refers
to a deleted gene, or a gene encoding a gene product having one or
more truncations, mutations, insertions or deletions, typically
accompanied by at least a change, generally a partial loss of
function.
[0095] As used herein F3 gene refers to a gene or locus in a virus,
such as a vaccinia virus, that corresponds to the F3 gene of
vaccinia virus strain LIVP. This includes the F3 gene of any
vaccinia virus strain or poxvirus encoding a gene product having
substantially the same or at least a related biological function or
locus in the genome. F3 genes encompassed herein typically have at
least about 40%, at least about 50%, at least about 60%, at least
about 70%, at least about 80%, at least about 85%, at least about
90%, at least about 93%, at least about 95%, at least about 96%, at
least about 97%, at least about 98%, or at least about 99% identity
along the full length of the sequence of nucleotides set forth in
SEQ ID NO: 1. The proteins encoded by F3 genes encompassed herein
typically have at least about 50%, at least about 60%, at least
about 65%, at least about 70%, at least about 75%, at least about
85%, at least about 90%, at least about 93%, at least about 95%, at
least about 96%, at least about 97%, at least about 98%, or at
least about 99% identity to the sequence of amino acids set forth
SEQ ID NO:2 along the full-length sequence thereof. Also included
are corresponding loci in other viruses that when modified or
eliminated result in reduced toxicity and/or enhanced accumulation
in tumors (compared to non-tumorous cells, tissues and organs). The
corresponding loci in other viruses equivalent to the F3 gene in
LIVP can be determined by the structural location of the gene in
the viral genome: the LIVP F3 gene is located on the HindIII-F
fragment of vaccinia virus between open reading frames F14L and
F15L as defined by Goebel et al., Virology (1990) 179:247-266, and
in the opposite orientation of ORFs F14L and F15L; thus
corresponding loci in other viruses such as poxviruses including
orthopoxviruses are included.
[0096] As used herein, attenuate toxicity of a microorganism means
to reduce or eliminate deleterious or toxic effects to a host upon
administration of the microorganism compared to the unattenuated
microorganism.
[0097] As use herein, a microorganism with low toxicity means that
upon administration a microorganism does not accumulate in organs
and tissues in the host to an extent that results in damage or harm
to organs or that impact on survival of the host to a greater
extent than the disease being treated does.
[0098] As used herein, subject (or organism) refers to an animal,
including a human being.
[0099] As used herein, animal includes any animal, such as, but are
not limited to primates including humans, gorillas and monkeys;
rodents, such as mice and rats; fowl, such as chickens; ruminants,
such as goats, cows, deer, sheep; ovine, and other animals
including pigs, horses, cats, dogs, and rabbits. Non-human animals
exclude humans as the contemplated animal.
[0100] As used herein, accumulation of a microorganism in a
targeted tissue refers to the distribution of the microorganism
throughout the organism after a time period long enough for the
microbes to infect the host's organs or tissues. As one skilled in
the art will recognize, the time period for infection of a microbe
will vary depending on the microbe, the targeted organ(s) or
tissue(s), the immunocompetence of the host, and dosage. Generally,
accumulation can be determined at time-points from about 1 day to
about 1 week after infection with the microbes. For purposes
herein, the microorganisms preferentially accumulate in the target
tissue, such as a tumor, but are cleared from other tissues and
organs in the host to the extent that toxicity of the microorganism
is mild or tolerable and at most not fatal.
[0101] As used herein, preferential accumulation refers to
accumulation of a microorganism at a first location at a higher
level than accumulation at a second location. Thus, a microorganism
that preferentially accumulates in immunoprivileged tissue such as
tumor relative to normal tissues or organs refers to a
microorganism that accumulates in immunoprivileged tissue such as
tumor at a higher level than the microorganism accumulates in
normal tissues or organs.
[0102] As used herein, a "compound" produced in a tumor or other
immunoprivileged site refers to any compound that is produced in
the tumor by virtue of the presence of an introduced microorganism,
generally a recombinant microorganism, expressing one or more
genes. For example, a compound produced in a tumor can be, for
example, a metabolite, an encoded polypeptide or RNA, or compound
that is generated by a recombinant polypeptide (e.g., enzyme) and
the cellular machinery of the tumor or immunoprivileged tissue or
cells.
[0103] As used herein, a delivery vehicle for administration refers
to a lipid-based or other polymer-based composition, such as
liposome, micelle or reverse micelle, that associates with an
agent, such as a microorganism provided herein, for delivery into a
host animal.
[0104] As used herein, the term "viral vector" is used according to
its art-recognized meaning. It refers to a nucleic acid vector
construct that includes at least one element of viral origin and
can be packaged into a viral vector particle. The viral vector
particles can be used for the-purpose of transferring DNA, RNA or
other nucleic acids into cells either in vitro or in vivo. Viral
vectors include, but are not limited to, retroviral vectors,
vaccinia vectors, lentiviral vectors, herpes virus vectors (e.g.,
HSV), baculoviral vectors, cytomegalovirus (CMV) vectors,
papillomavirus vectors, simian virus (SV40) vectors, semliki forest
virus vectors, phage vectors, adenoviral vectors, and
adeno-associated viral (AAV) vectors.
[0105] As used herein, oncolytic viruses refer to viruses that
replicate selectively in tumor cells.
[0106] As used herein, "disease or disorder" refers to a
pathological condition in an organism resulting from, e.g.,
infection or genetic defect, and characterized by identifiable
symptoms.
[0107] As used herein, neoplasm (neoplasia) refers to abnormal new
growth, and thus means the same as tumor, which can be benign or
malignant. Unlike hyperplasia, neoplastic proliferation persists
even in the absence of the original stimulus.
[0108] As used herein, neoplastic disease refers to any disorder
involving cancer, including tumor development, growth, metastasis
and progression.
[0109] As used herein, cancer is a general term for diseases caused
by or characterized by any type of malignant tumor.
[0110] As used herein, malignant, as applies to tumors, refers to
primary tumors that have the capacity of metastasis with loss of
growth control and positional control.
[0111] As used herein, metastasis refers to a growth of abnormal or
neoplastic cells distant from the site primarily involved by the
morbid process.
[0112] As used herein, an anti-cancer agent or compound (used
interchangeably with "anti-tumor or anti-neoplastic agent") refers
to any agents or compounds used in anti-cancer treatment. These
include any agents, when used alone or in combination with other
compounds, that can alleviate, reduce, ameliorate, prevent, or
place or maintain in a state of remission of clinical symptoms or
diagnostic markers associated with neoplastic disease, tumors and
cancer, and can be used in methods, combinations and compositions
provided herein. Exemplary anti-neoplastic agents include the
microorganism provided herein used singly or in combination and/or
in combination with other agents, such as alkylating agents,
antimetabolite, certain natural products, platinum coordination
complexes, anthracenediones, substituted ureas, methylhydrazine
derivatives, adrenocortical suppressants, certain hormones,
antagonists and anti-cancer polysaccharides.
[0113] In general, for practice of the methods herein and when
using the microorganisms provided herein, the original tumor is not
excised, but is employed to accumulate the administered
microorganism and as the cells become leaky or lyse to become an
antigen or other product factor. The antigens can serve to elicit
an immune response in the host. The antigens and products can be
isolated from the tumor.
[0114] As used herein, angiogenesis is intended to encompass the
totality of processes directly or indirectly involved in the
establishment and maintenance of new vasculature
(neovascularization), including, but not limited to,
neovascularization associated with tumors and neovascularization
associated with wounds.
[0115] As used herein, by homologous means about greater than 25%
nucleic acid sequence identity, such as 25%, 40%, 60%, 70%, 80%,
90% or 95%. If necessary the percentage homology will be specified.
The terms "homology" and "identity" are often used interchangeably
but homology for proteins can include conservative amino acid
changes. In general, sequences (protein or nucleic acid) are
aligned so that the highest order match is obtained (see, e.g.:
Computational Molecular Biology, Lesk, A. M., ed., Oxford
University Press, New York, 1988; Biocomputing: Informatics and
Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;
Computer Analysis of Sequence Data, Part I, Griffin, A. M., and
Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence
Analysis in Molecular Biology, von Heinje, G., Academic Press,
1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J.,
eds., M Stockton Press, New York, 1991; Carillo et al. (1988) SIAM
J Applied Math 48:1073). By sequence identity, the number of
identical amino acids is determined by standard alignment algorithm
programs, and used with default gap penalties established by each
supplier. Substantially homologous nucleic acid molecules would
hybridize typically at moderate stringency or at high stringency
all along the length of the nucleic acid or along at least about
70%, 80% or 90% of the full length nucleic acid molecule of
interest. Also provided are nucleic acid molecules that contain
degenerate codons in place of codons in the hybridizing nucleic
acid molecule. (For proteins, for determination of homology
conservative amino acids can be aligned as well as identical amino
acids; in this case percentage of identity and percentage homology
vary). Whether any two nucleic acid molecules have nucleotide
sequences that are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or
99% "identical" can be determined using known computer algorithms
such as the "FASTA" program, using for example, the default
parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA
85:2444 (other programs include the GCG program package (Devereux,
J., et al., Nucleic Acids Research 12(I):387 (1984)), BLASTP,
BLASTN, FASTA Atschul, S. F., et al., J Molec Biol 215:403 (1990);
Guide to Huge Computers, Mrtin J. Bishop, ed., Academic Press, San
Diego, 1994, and Carillo et al. (1988) SIAM J Applied Math
48:1073). For example, the BLAST function of the National Center
for Biotechnology Information database can be used to determine
identity. Other commercially or publicly available programs
include, DNAStar "MegAlign" program (Madison, Wis.) and the
University of Wisconsin Genetics Computer Group (UWG) "Gap" program
(Madison Wis.)). Percent homology or identity of proteins and/or
nucleic acid molecules can be determined, for example, by comparing
sequence information using a GAP computer program (e.g., Needleman
et al. (1970) J. Mol. Biol. 48:443, as revised by Smith and
Waterman ((1981) Adv. Appl. Math. 2:482).
[0116] Briefly, a GAP program defines similarity as the number of
aligned symbols (i.e., nucleotides or amino acids) that are
similar, divided by the total number of symbols in the shorter of
the two sequences. Default parameters for the GAP program can
include: (1) a unary comparison matrix (containing a value of 1 for
identities and 0 for non-identities) and the weighted comparison
matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as
described by Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE
AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358
(1979); (2) a penalty of 3.0 for each gap and an additional 0.10
penalty for each symbol in each gap; and (3) no penalty for end
gaps. Therefore, as used herein, the term "identity" represents a
comparison between a test and a reference polypeptide or
polynucleotide.
[0117] As used herein, recitation that amino acids of a polypeptide
correspond to amino acids in a disclosed sequence, such as amino
acids set forth in the Sequence listing, refers to amino acids
identified upon alignment of the polypeptide with the disclosed
sequence to maximize identity or homology (where conserved amino
acids are aligned) using a standard alignment algorithm, such as
the GAP algorithm.
[0118] As used herein, the term "at least 90% identical to" refers
to percent identities from 90 to 100% relative to the reference
polypeptides. Identity at a level of 90% or more is indicative of
the fact that, assuming for exemplification purposes a test and
reference polynucleotide length of 100 amino acids are compared, no
more than 10% (i.e., 10 out of 100) of amino acids in the test
polypeptide differs from that of the reference polypeptides.
Similar comparisons can be made between a test and reference
polynucleotides. Such differences can be represented as point
mutations randomly distributed over the entire length of an amino
acid sequence or they can be clustered in one or more locations of
varying length up to the maximum allowable, e.g., 10/100 amino acid
difference (approximately 90% identity). Differences are defined as
nucleic acid or amino acid substitutions, insertions or deletions.
At the level of homologies or identities above about 85-90%, the
result should be independent of the program and gap parameters set;
such high levels of identity can be assessed readily, often without
relying on software.
[0119] As used herein, primer refers to an oligonucleotide
containing two or more deoxyribonucleotides or ribonucleotides,
typically more than three, from which synthesis of a primer
extension product can be initiated. Experimental conditions
conducive to synthesis include the presence of nucleoside
triphosphates and an agent for polymerization and extension, such
as DNA polymerase, and a suitable buffer, temperature and pH.
[0120] As used herein, chemiluminescence refers to a chemical
reaction in which energy is specifically channeled to a molecule
causing it to become electronically excited and subsequently to
release a photon thereby emitting visible light. Temperature does
not contribute to this channeled energy. Thus, chemiluminescence
involves the direct conversion of chemical energy to light
energy.
[0121] As used herein, luminescence refers to the detectable EM
radiation, generally, UV, IR or visible EM radiation that is
produced when the excited product of an exergic chemical process
reverts to its ground state with the emission of light.
Chemiluminescence is luminescence that results from a chemical
reaction. Bioluminescence is chemiluminescence that results from a
chemical reaction using biological molecules (or synthetic versions
or analogs thereof) as substrates and/or enzymes.
[0122] As used herein, bioluminescence, which is a type of
chemiluminescence, refers to the emission of light by biological
molecules, particularly proteins. The essential condition for
bioluminescence is molecular oxygen, either bound or free in the
presence of an oxygenase, a luciferase, which acts on a substrate,
a luciferin. Bioluminescence is generated by an enzyme or other
protein (luciferase) that is an oxygenase that acts on a substrate
luciferin (a bioluminescence substrate) in the presence of
molecular oxygen, and transforms the substrate to an excited state,
which, upon return to a lower energy level releases the energy in
the form of light.
[0123] As used herein, the substrates and enzymes for producing
bioluminescence are generically referred to as luciferin and
luciferase, respectively. When reference is made to a particular
species thereof, for clarity, each generic term is used with the
name of the organism from which it derives, for example, bacterial
luciferin or firefly luciferase.
[0124] As used herein, luciferase refers to oxygenases that
catalyze a light emitting reaction. For instance, bacterial
luciferases catalyze the oxidation of flavin mononucleotide (FMN)
and aliphatic aldehydes, which reaction produces light. Another
class of luciferases, found among marine arthropods, catalyzes the
oxidation of Cypridina (Vargula) luciferin, and another class of
luciferases catalyzes the oxidation of Coleoptera luciferin.
[0125] Thus, luciferase refers to an enzyme or photoprotein that
catalyzes a bioluminescent reaction (a reaction that produces
bioluminescence). The luciferases, such as firefly and Gaussia and
Renilla luciferases, are enzymes which act catalytically and are
unchanged during the bioluminescence generating reaction. The
luciferase photoproteins, such as the aequorin photoprotein to
which luciferin is non-covalently bound, are changed, such as by
release of the luciferin, during bioluminescence generating
reaction. The luciferase is a protein that occurs naturally in an
organism or a variant or mutant thereof, such as a variant produced
by mutagenesis that has one or more properties, such as thermal
stability, that differ from the naturally-occurring protein.
Luciferases and modified mutant or variant forms thereof are well
known. For purposes herein, reference to luciferase refers to
either the photoproteins or luciferases.
[0126] Thus, reference, for example, to "Renilla luciferase" means
an enzyme isolated from member of the genus Renilla or an
equivalent molecule obtained from any other source, such as from
another related copepod, or that has been prepared synthetically.
It is intended to encompass Renilla luciferases with conservative
amino acid substitutions that do not substantially alter activity.
Suitable conservative substitutions of amino acids are known to
those of skill in this art and can be made generally without
altering the biological activity of the resulting molecule. Those
of skill in this art recognize that, in general, single amino acid
substitutions in non-essential regions of a polypeptide do not
substantially alter biological activity (see, e.g., Watson et al.
Molecular Biology of the Gene, 4th Edition, 1987, The
Benjamin/Cummings Pub. co., p. 224).
[0127] As used herein, "Aequora GFP" refers to GFPs from the genus
Aequora and to mutants or variants thereof. Such variants and GFPs
from other species are well known and are available and known to
those of skill in the art. This nomenclature encompass GFPs with
conservative amino acid substitutions that do not substantially
alter activity and physical properties, such as the emission
spectra and ability to shift the spectral output of bioluminescence
generating systems. The luciferases and luciferin and activators
thereof are referred to as bioluminescence generating reagents or
components. Typically, a subset of these reagents will be provided
or combined with an article of manufacture. Bioluminescence will be
produced upon contacting the combination with the remaining
reagents. Thus, as used herein, the component luciferases,
luciferins, and other factors, such as O.sub.2, Mg.sup.2+,
Ca.sup.2+ also are referred to as bioluminescence generating
reagents (or agents or components).
[0128] As used herein, bioluminescence substrate refers to the
compound that is oxidized in the presence of a luciferase, and any
necessary activators, and generates light. These substrates are
referred to as luciferins herein, are substrates that undergo
oxidation in a bioluminescence reaction. These bioluminescence
substrates include any luciferin or analog thereof or any synthetic
compound with which a luciferase interacts to generate light.
Typical substrates include those that are oxidized in the presence
of a luciferase or protein in a light-generating reaction.
Bioluminescence substrates, thus, include those compounds that
those of skill in the art recognize as luciferins. Luciferins, for
example, include firefly luciferin, Cypridina (also known as
Vargula) luciferin (coelenterazine), bacterial luciferin, as well
as synthetic analogs of these substrates or other compounds that
are oxidized in the presence of a luciferase in a reaction the
produces bioluminescence.
[0129] As used herein, capable of conversion into a bioluminescence
substrate means susceptible to chemical reaction, such as oxidation
or reduction, that yields a bioluminescence substrate. For example,
the luminescence producing reaction of bioluminescent bacteria
involves the reduction of a flavin mononucleotide group (FMN) to
reduced flavin mononucleotide (FMNH2) by a flavin reductase enzyme.
The reduced flavin mononucleotide (substrate) then reacts with
oxygen (an activator) and bacterial luciferase to form an
intermediate peroxy flavin that undergoes further reaction, in the
presence of a long-chain aldehyde, to generate light. With respect
to this reaction, the reduced flavin and the long chain aldehyde
are substrates.
[0130] As used herein, a bioluminescence generating system refers
to the set of reagents required to conduct a bioluminescent
reaction. Thus, the specific luciferase, luciferin and other
substrates, solvents and other reagents that can be required to
complete a bioluminescent reaction from a bioluminescence system.
Thus a bioluminescence generating system refers to any set of
reagents that, under appropriate reaction conditions, yield
bioluminescence. Appropriate reaction conditions refers to the
conditions necessary for a bioluminescence reaction to occur, such
as pH, salt concentrations and temperature. In general,
bioluminescence systems include a bioluminescence substrate,
luciferin, a luciferase, which includes enzymes, luciferases and
photoproteins, and one or more activators. A specific
bioluminescence system may be identified by reference to the
specific organism from which the luciferase derives; for example,
the Renilla bioluminescence system includes a Renilla luciferase,
such as a luciferase isolated from the Renilla or produced using
recombinant means or modifications of these luciferases. This
system also includes the particular activators necessary to
complete the bioluminescence reaction, such as oxygen and a
substrate with which the luciferase reacts in the presence of the
oxygen to produce light.
[0131] As used herein, a fluorescent protein refers to a protein
that possesses the ability to fluoresce (i.e., to absorb energy at
one wavelength and emit it at another wavelength). For example, a
green fluorescent protein refers to a polypeptide that has a peak
in the emission spectrum at about 510 nm.
[0132] As used herein, genetic therapy or gene therapy involves the
transfer of heterologous nucleic acid, such as DNA, into certain
cells, target cells, of a mammal, particularly a human, with a
disorder or conditions for which such therapy is sought. The
nucleic acid, such as DNA, is introduced into the selected target
cells, such as directly or in a vector or other delivery vehicle,
in a manner such that the heterologous nucleic acid, such as DNA,
is expressed and a therapeutic product encoded thereby is produced.
Alternatively, the heterologous nucleic acid, such as DNA, can in
some manner mediate expression of DNA that encodes the therapeutic
product, or it can encode a product, such as a peptide or RNA that
in some manner mediates, directly or indirectly, expression of a
therapeutic product. Genetic therapy also can be used to deliver
nucleic acid encoding a gene product that replaces a defective gene
or supplements a gene product produced by the mammal or the cell in
which it is introduced. The introduced nucleic acid can encode a
therapeutic compound, such as a growth factor inhibitor thereof, or
a tumor necrosis factor or inhibitor thereof, such as a receptor
therefor, that is not normally produced in the mammalian host or
that is not produced in therapeutically effective amounts or at a
therapeutically useful time. The heterologous nucleic acid, such as
DNA, encoding the therapeutic product can be modified prior to
introduction into the cells of the afflicted host in order to
enhance or otherwise alter the product or expression thereof.
Genetic therapy also can involve delivery of an inhibitor or
repressor or other modulator of gene expression.
[0133] As used herein, heterologous nucleic acid is nucleic acid
that is not normally produced in vivo by the microorganism from
which it is expressed or that is produced by a microorganism but is
at a different locus or expressed differently or that mediates or
encodes mediators that alter expression of endogenous nucleic acid,
such as DNA, by affecting transcription, translation, or other
regulatable biochemical processes. Heterologous nucleic acid is
often not endogenous to the cell into which it is introduced, but
has been obtained from another cell or prepared synthetically.
Heterologous nucleic acid, however, can be endogenous, but is
nucleic acid that is expressed from a different locus or altered in
its expression or sequence. Generally, although not necessarily,
such nucleic acid encodes RNA and proteins that are not normally
produced by the cell or in the same way in the cell in which it is
expressed. Heterologous nucleic acid, such as DNA, also can be
referred to as foreign nucleic acid, such as DNA. Thus,
heterologous nucleic acid or foreign nucleic acid includes a
nucleic acid molecule not present in the exact orientation or
position as the counterpart nucleic acid molecule, such as DNA, is
found in a genome. It also can refer to a nucleic acid molecule
from another organism or species (i.e., exogenous). Any nucleic
acid, such as DNA, that one of skill in the art would recognize or
consider as heterologous or foreign to the cell in which the
nucleic acid is expressed is herein encompassed by heterologous
nucleic acid; heterologous nucleic acid includes exogenously added
nucleic acid that also is expressed endogenously. Examples of
heterologous nucleic acid include, but are not limited to, nucleic
acid that encodes traceable marker proteins, such as a protein that
confers drug resistance, nucleic acid that encodes therapeutically
effective substances, such as anti-cancer agents, enzymes and
hormones, and nucleic acid, such as DNA, that encodes other types
of proteins, such as antibodies. Antibodies that are encoded by
heterologous nucleic acid can be secreted or expressed on the
surface of the cell in which the heterologous nucleic acid has been
introduced.
[0134] As used herein, a therapeutically effective product for gene
therapy is a product that is encoded by heterologous nucleic acid,
typically DNA, (or an RNA product such as dsRNA, RNAi, including
siRNA, that, upon introduction of the nucleic acid into a host, a
product is expressed that ameliorates or eliminates the symptoms,
manifestations of an inherited or acquired disease or that cures
the disease. Also included are biologically active nucleic acid
molecules, such as RNAi and antisense.
[0135] As used herein, cancer or tumor treatment or agent refers to
any therapeutic regimen and/or compound that, when used alone or in
combination with other treatments or compounds, can alleviate,
reduce, ameliorate, prevent, or place or maintain in a state of
remission of clinical symptoms or diagnostic markers associated
with deficient angiogenesis.
[0136] As used herein, nucleic acids include DNA, RNA and analogs
thereof, including peptide nucleic acids (PNA) and mixtures
thereof. Nucleic acids can be single or double-stranded. When
referring to probes or primers, which are optionally labeled, such
as with a detectable label, such as a fluorescent or radiolabel,
single-stranded molecules are provided. Such molecules are
typically of a length such that their target is statistically
unique or of low copy number (typically less than 5, generally less
than 3) for probing or priming a library. Generally a probe or
primer contains at least 14, 16 or 30 contiguous nucleotides of
sequence complementary to or identical to a gene of interest.
Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids
long.
[0137] As used herein, operative linkage of heterologous nucleic
acids to regulatory and effector sequences of nucleotides, such as
promoters, enhancers, transcriptional and translational stop sites,
and other signal sequences refers to the relationship between such
nucleic acid, such as DNA, and such sequences of nucleotides. For
example, operative linkage of heterologous DNA to a promoter refers
to the physical relationship between the DNA and the promoter such
that the transcription of such DNA is initiated from the promoter
by an RNA polymerase that specifically recognizes, binds to and
transcribes the DNA. Thus, operatively linked or operationally
associated refers to the functional relationship of nucleic acid,
such as DNA, with regulatory and effector sequences of nucleotides,
such as promoters, enhancers, transcriptional and translational
stop sites, and other signal sequences. For example, operative
linkage of DNA to a promoter refers to the physical and functional
relationship between the DNA and the promoter such that the
transcription of such DNA is initiated from the promoter by an RNA
polymerase that specifically recognizes, binds to and transcribes
the DNA. In order to optimize expression and/or in vitro
transcription, it can be necessary to remove, add or alter 5'
untranslated portions of the clones to eliminate extra, potentially
inappropriate alternative translation initiation (i.e., start)
codons or other sequences that can interfere with or reduce
expression, either at the level of transcription or translation.
Alternatively, consensus ribosome binding sites (see, e.g., Kozak
J. Biol. Chem. 266:19867-19870 (1991)) can be inserted immediately
5' of the start codon and can enhance expression. The desirability
of (or need for) such modification can be empirically
determined.
[0138] As used herein, a sequence complementary to at least a
portion of an RNA, with reference to antisense oligonucleotides,
means a sequence of nucleotides having sufficient complementarity
to be able to hybridize with the RNA, generally under moderate or
high stringency conditions, forming a stable duplex; in the case of
double-stranded antisense nucleic acids, a single strand of the
duplex DNA (or dsRNA) can thus be tested, or triplex formation can
be assayed. The ability to hybridize depends on the degree of
complementarity and the length of the antisense nucleic acid.
Generally, the longer the hybridizing nucleic acid, the more base
mismatches with an encoding RNA it can contain and still form a
stable duplex (or triplex, as the case can be). One skilled in the
art can ascertain a tolerable degree of mismatch by use of standard
procedures to determine the melting point of the hybridized
complex.
[0139] As used herein, amelioration of the symptoms of a particular
disorder such as by administration of a particular pharmaceutical
composition, refers to any lessening, whether permanent or
temporary, lasting or transient that can be attributed to or
associated with administration of the composition.
[0140] As used herein, antisense polynucleotides refer to synthetic
sequences of nucleotide bases complementary to mRNA or the sense
strand of double-stranded DNA. Admixture of sense and antisense
polynucleotides under appropriate conditions leads to the binding
of the two molecules, or hybridization. When these polynucleotides
bind to (hybridize with) mRNA, inhibition of protein synthesis
(translation) occurs. When these polynucleotides bind to
double-stranded DNA, inhibition of RNA synthesis (transcription)
occurs. The resulting inhibition of translation and/or
transcription leads to an inhibition of the synthesis of the
protein encoded by the sense strand. Antisense nucleic acid
molecules typically contain a sufficient number of nucleotides to
specifically bind to a target nucleic acid, generally at least 5
contiguous nucleotides, often at least 14 or 16 or 30 contiguous
nucleotides or modified nucleotides complementary to the coding
portion of a nucleic acid molecule that encodes a gene of
interest.
[0141] As used herein, antibody refers to an immunoglobulin,
whether natural or partially or wholly synthetically produced,
including any derivative thereof that retains the specific binding
ability of the antibody. Hence antibody includes any protein having
a binding domain that is homologous or substantially homologous to
an immunoglobulin binding domain. Antibodies include members of any
immunoglobulin class, including IgG, IgM, IgA, IgD and IgE.
[0142] As used herein, antibody fragment refers to any derivative
of an antibody that is less then full length, retaining at least a
portion of the full-length antibody's specific binding ability.
Examples of antibody fragments include, but are not limited to,
Fab, Fab', F(ab)2, single-chain Fvs (scFV), FV, dsFV diabody and Fd
fragments. The fragment can include multiple chains linked
together, such as by disulfide bridges. An antibody fragment
generally contains at least about 50 amino acids and typically at
least 200 amino acids.
[0143] As used herein, a Fv antibody fragment is composed of one
variable heavy chain domain (V.sub.H) and one variable light chain
domain linked by noncovalent interactions.
[0144] As used herein, a dsFV refers to an Fv with an engineered
intermolecular disulfide bond, which stabilizes the V.sub.H-V.sub.L
pair.
[0145] As used herein, a F(ab).sub.2 fragment is an antibody
fragment that results from digestion of an immunoglobulin with
pepsin at pH 4.0-4.5; it can be recombinantly produced to produce
the equivalent fragment.
[0146] As used herein, Fab fragments are antibody fragments that
result from digestion of an immunoglobulin with papain; it can be
recombinantly produced to produce the equivalent fragment.
[0147] As used herein, scFVs refer to antibody fragments that
contain a variable light chain (V.sub.L) and variable heavy chain
(V.sub.H) covalently connected by a polypeptide linker in any
order. The linker is of a length such that the two variable domains
are bridged without substantial interference. Included linkers are
(Gly-Ser).sub.n-residues with some Glu or Lys residues dispersed
throughout to increase solubility.
[0148] As used herein, humanized antibodies refer to antibodies
that are modified to include human sequences of amino acids so that
administration to a human does not provoke an immune response.
Methods for preparation of such antibodies are known. For example,
to produce such antibodies, the encoding nucleic acid in the
hybridoma or other prokaryotic or eukaryotic cell, such as an E.
coli or a CHO cell, that expresses the monoclonal antibody is
altered by recombinant nucleic acid techniques to express an
antibody in which the amino acid composition of the non-variable
region is based on human antibodies. Computer programs have been
designed to identify such non-variable regions.
[0149] As used herein, diabodies are dimeric scFV; diabodies
typically have shorter peptide linkers than scFvs, and they
generally dimerize.
[0150] As used herein, production by recombinant means by using
recombinant DNA methods means the use of the well known methods of
molecular biology for expressing proteins encoded by cloned
DNA.
[0151] As used herein the term assessing or determining is intended
to include quantitative and qualitative determination in the sense
of obtaining an absolute value for the activity of a product, and
also of obtaining an index, ratio, percentage, visual or other
value indicative of the level of the activity. Assessment can be
direct or indirect.
[0152] As used herein, biological activity refers to the in vivo
activities of a compound or microorganisms or physiological
responses that result upon in vivo administration thereof or of
composition or other mixture. Biological activity, thus,
encompasses therapeutic effects and pharmaceutical activity of such
compounds, compositions and mixtures. Biological activities can be
observed in in vitro systems designed to test or use such
activities.
[0153] As used herein, an effective amount of a microorganism or
compound for treating a particular disease is an amount that is
sufficient to ameliorate, or in some manner reduce the symptoms
associated with the disease. Such an amount can be administered as
a single dosage or can be administered according to a regimen,
whereby it is effective. The amount can cure the disease but,
typically, is administered in order to ameliorate the symptoms of
the disease. Repeated administration can be required to achieve the
desired amelioration of symptoms.
[0154] As used herein equivalent, when referring to two sequences
of nucleic acids, means that the two sequences in question encode
the same sequence of amino acids or equivalent proteins. When
equivalent is used in referring to two proteins or peptides or
other molecules, it means that the two proteins or peptides have
substantially the same amino acid sequence with only amino acid
substitutions (such as, but not limited to, conservative changes)
or structure and the any changes do not substantially alter the
activity or function of the protein or peptide. When equivalent
refers to a property, the property does not need to be present to
the same extent (e.g., two peptides can exhibit different rates of
the same type of enzymatic activity), but the activities are
usually substantially the same. Complementary, when referring to
two nucleotide sequences, means that the two sequences of
nucleotides are capable of hybridizing, typically with less than
25%, 15% or 5% mismatches between opposed nucleotides. If
necessary, the percentage of complementarity will be specified.
Typically the two molecules are selected such that they will
hybridize under conditions of high stringency.
[0155] As used herein, an agent or compound that modulates the
activity of a protein or expression of a gene or nucleic acid
either decreases or increases or otherwise alters the activity of
the protein or, in some manner, up- or down-regulates or otherwise
alters expression of the nucleic acid in a cell.
[0156] As used herein, a method for treating or preventing
neoplastic disease means that any of the symptoms, such as the
tumor, metastasis thereof, the vascularization of the tumors or
other parameters by which the disease is characterized are reduced,
ameliorated, prevented, placed in a state of remission, or
maintained in a state of remission. It also means that the
hallmarks of neoplastic disease and metastasis can be eliminated,
reduced or prevented by the treatment. Non-limiting examples of the
hallmarks include uncontrolled degradation of the basement membrane
and proximal extracellular matrix, migration, division, and
organization of the endothelial cells into new functioning
capillaries, and the persistence of such functioning
capillaries.
[0157] As used herein, a prodrug is a compound that, upon in vivo
administration, is metabolized or otherwise converted to the
biologically, pharmaceutically or therapeutically active form of
the compound. To produce a prodrug, the pharmaceutically active
compound is modified such that the active compound is regenerated
by metabolic processes. The prodrug can be designed to alter the
metabolic stability or the transport characteristics of a drug, to
mask side effects or toxicity, to improve the flavor of a drug or
to alter other characteristics or properties of a drug. By virtue
of knowledge of pharmacodynamic processes and drug metabolism in
vivo, those of skill in this art, once a pharmaceutically active
compound is known, can design prodrugs of the compound (see, e.g.,
Nogrady (1985) Medicinal Chemistry A Biochemical Approach, Oxford
University Press, New York, pages 388-392).
[0158] As used herein, a promoter region or promoter element or
regulatory region refers to a segment of DNA or RNA that controls
transcription of the DNA or RNA to which it is operatively linked.
The promoter region includes specific sequences that are sufficient
for RNA polymerase recognition, binding and transcription
initiation. This portion of the promoter region is referred to as
the promoter. In addition, the promoter region includes sequences
that modulate this recognition, binding and transcription
initiation activity of RNA polymerase. These sequences can be cis
acting or can be responsive to trans acting factors. Promoters,
depending upon the nature of the regulation, can be constitutive or
regulated. Exemplary promoters contemplated for use in prokaryotes
include the bacteriophage T7 and T3 promoters.
[0159] As used herein, a receptor refers to a molecule that has an
affinity for a ligand. Receptors can be naturally-occurring or
synthetic molecules. Receptors also can be referred to in the art
as anti-ligands. As used herein, the receptor and anti-ligand are
interchangeable. Receptors can be used in their unaltered state or
bound to other polypeptides, including as homodimers. Receptors can
be attached to, covalently or noncovalently, or in physical contact
with, a binding member, either directly or indirectly via a
specific binding substance or linker. Examples of receptors,
include, but are not limited to: antibodies, cell membrane
receptors surface receptors and internalizing receptors, monoclonal
antibodies and antisera reactive with specific antigenic
determinants (such as on viruses, cells, or other materials),
drugs, polynucleotides, nucleic acids, peptides, cofactors,
lectins, sugars, polysaccharides, cells, cellular membranes, and
organelles.
[0160] As used herein, sample refers to anything that can contain
an analyte for which an analyte assay is desired. The sample can be
a biological sample, such as a biological fluid or a biological
tissue. Examples of biological fluids include urine, blood, plasma,
serum, saliva, semen, stool, sputum, cerebral spinal fluid, tears,
mucus, amniotic fluid or the like. Biological tissues are
aggregates of cells, usually of a particular kind together with
their intercellular substance that form one of the structural
materials of a human, animal, plant, bacterial, fungal or viral
structure, including connective, epithelium, muscle and nerve
tissues. Examples of biological tissues also include organs,
tumors, lymph nodes, arteries and individual cell(s).
[0161] As used herein: stringency of hybridization in determining
percentage mismatch is as follows: [0162] 1) high stringency:
0.1.times.SSPE, 0.1% SDS, 65.degree. C. [0163] 2) medium
stringency: 0.2.times.SSPE, 0.1% SDS, 50.degree. C. [0164] 3) low
stringency: 1.0.times.SSPE, 0.1% SDS, 50.degree. C.
[0165] Those of skill in this art know that the washing step
selects for stable hybrids and also know the ingredients of SSPE
(see, e.g., Sambrook, E. F. Fritsch, T. Maniatis, in: Molecular
Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press
(1989), vol. 3, p. B.13, see, also, numerous catalogs that describe
commonly used laboratory solutions). SSPE is pH 7.4
phosphate-buffered 0.18 M NaCl. Further, those of skill in the art
recognize that the stability of hybrids is determined by Tm, which
is a function of the sodium ion concentration and temperature:
(Tm=81.5.degree. C.-16.6(log10[Na+])+0.41 (% G+C)-600/l)), so that
the only parameters in the wash conditions critical to hybrid
stability are sodium ion concentration in the SSPE (or SSC) and
temperature. Any nucleic acid molecules provided herein can also
include those that hybridize under conditions of at least low
stringency, generally moderate or high stringency, along at least
70, 80, 90% of the full length of the disclosed molecule. It is
understood that equivalent stringencies can be achieved using
alternative buffers, salts and temperatures. By way of example and
not limitation, procedures using conditions of low stringency are
as follows (see also Shilo and Weinberg, Proc. Natl. Acad. Sci. USA
78:6789-6792 (1981)):
[0166] Filters containing DNA are pretreated for 6 hours at
40.degree. C. in a solution containing 35% formamide, 5.times.SSC,
50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA,
and 500 .mu.g/ml denatured salmon sperm DNA (10.times.SSC is 1.5 M
sodium chloride, and 0.15 M sodium citrate, adjusted to a pH of 7).
Hybridizations are carried out in the same solution with the
following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100
.mu.g/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and
5-20.times.10.sup.6 cpm .sup.32P-labeled probe is used. Filters are
incubated in hybridization mixture for 18-20 hours at 40.degree.
C., and then washed for 1.5 hours at 55.degree. C. in a solution
containing 2.times.SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and
0.1% SDS. The wash solution is replaced with fresh solution and
incubated an additional 1.5 hours at 60.degree. C. Filters are
blotted dry and exposed for autoradiography. If necessary, filters
are washed for a third time at 65-68.degree. C. and reexposed to
film. Other conditions of low stringency which can be used are well
known in the art (e.g., as employed for cross-species
hybridizations).
[0167] By way of example and not way of limitation, procedures
using conditions of moderate stringency include, for example, but
are not limited to, procedures using such conditions of moderate
stringency are as follows: Filters containing DNA are pretreated
for 6 hours at 55.degree. C. in a solution containing 6.times.SSC,
5.times. Denhart's solution, 0.5% SDS and 100 .mu.g/ml denatured
salmon sperm DNA. Hybridizations are carried out in the same
solution and 5-20.times.10.sup.6 cpm .sup.32P-labeled probe is
used. Filters are incubated in hybridization mixture for 18-20
hours at 55.degree. C., and then washed twice for 30 minutes at
60.degree. C. in a solution containing 1.times.SSC and 0.1% SDS.
Filters are blotted dry and exposed for autoradiography. Other
conditions of moderate stringency which can be used are well-known
in the art. Washing of filters is done at 37.degree. C. for 1 hour
in a solution containing 2.times.SSC, 0.1% SDS. By way of example
and not way of limitation, procedures using conditions of high
stringency are as follows: Prehybridization of filters containing
DNA is carried out for 8 hours to overnight at 65.degree. C. in
buffer composed of 6.times.SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA,
0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 .mu.g/ml denatured
salmon sperm DNA. Filters are hybridized for 48 hours at 65.degree.
C. in prehybridization mixture containing 100 .mu.g/ml denatured
salmon sperm DNA and 5-20.times.10.sup.6 cpm of .sup.32P-labeled
probe. Washing of filters is done at 37.degree. C. for 1 hour in a
solution containing 2.times.SSC, 0.01% PVP, 0.01% Ficoll, and 0.01%
BSA. This is followed by a wash in 0.1.times.SSC at 50.degree. C.
for 45 minutes before autoradiography. Other conditions of high
stringency which can be used are well known in the art.
[0168] The term substantially identical or homologous or similar
varies with the context as understood by those skilled in the
relevant art and generally means at least 60% or 70%, preferably
means at least 80%, more preferably at least 90%, and most
preferably at least 95%, 96%, 97%, 98%, 99% or greater
identity.
[0169] As used herein, substantially identical to a product means
sufficiently similar so that the property of interest is
sufficiently unchanged so that the substantially identical product
can be used in place of the product.
[0170] As used herein, substantially pure means sufficiently
homogeneous to appear free of readily detectable impurities as
determined by standard methods of analysis, such as thin layer
chromatography (TLC), gel electrophoresis and high performance
liquid chromatography (HPLC), used by those of skill in the art to
assess such purity, or sufficiently pure such that further
purification would not detectably alter the physical and chemical
properties, such as enzymatic and biological activities, of the
substance. Methods for purification of the compounds to produce
substantially chemically pure compounds are known to those of skill
in the art. A substantially chemically pure compound can, however,
be a mixture of stereoisomers or isomers. In such instances,
further purification might increase the specific activity of the
compound.
[0171] As used herein, a molecule, such as an antibody, that
specifically binds to a polypeptide typically has a binding
affinity (Ka) of at least about 10.sup.6 l/mol, 10.sup.7 l/mol,
10.sup.8 l/mol, 10.sup.9 l/mol, 10.sup.10 l/mol or greater and
binds to a protein of interest generally with at least 2-fold,
5-fold, generally 10-fold or even 100-fold or greater, affinity
than to other proteins. For example, an antibody that specifically
binds to the protease domain compared to the full-length molecule,
such as the zymogen form, binds with at least about 2-fold,
typically 5-fold or 10-fold higher affinity, to a polypeptide that
contains only the protease domain than to the zymogen form of the
full-length. Such specific binding also is referred to as selective
binding. Thus, specific or selective binding refers to greater
binding affinity (generally at least 2-fold, 5-fold, 10-fold or
more) to a targeted site or locus compared to a non-targeted site
or locus.
[0172] As used herein, the terms a therapeutic agent, therapeutic
compound, therapeutic regimen, or chemotherapeutic include
conventional drugs and drug therapies, including vaccines, which
are known to those skilled in the art.
[0173] As used herein, treatment means any manner in which the
symptoms of a condition, disorder or disease are ameliorated or
otherwise beneficially altered. Treatment also encompasses any
pharmaceutical use of the microorganisms described and provided
herein.
[0174] As used herein, proliferative disorders include any
disorders involving abnormal proliferation of cells. Such disorders
include, but are not limited to, neoplastic diseases, psoriasis,
restenosis, macular degeneration, diabetic retinopathies,
inflammatory responses and disorders, including wound healing
responses.
[0175] As used herein, vector (or plasmid) refers to discrete
elements that are used to introduce heterologous nucleic acid into
cells for either expression or replication thereof. The vectors
typically remain episomal, but can be designed to effect
integration of a gene or portion thereof into a chromosome of the
genome. Also contemplated are vectors that are artificial
chromosomes, such as yeast artificial chromosomes and mammalian
artificial chromosomes. Selection and use of such vectors are well
known to those of skill in the art. An expression vector includes
vectors capable of expressing DNA that is operatively linked with
regulatory sequences, such as promoter regions, that are capable of
effecting expression of such DNA fragments. Thus, an expression
vector refers to a recombinant DNA or RNA construct, such as a
plasmid, a phage, recombinant virus or other vector that, upon
introduction into an appropriate host cell, results in expression
of the cloned DNA. Appropriate expression vectors are well known to
those of skill in the art and include those that are replicable in
eukaryotic cells and/or prokaryotic cells and those that remain
episomal or those which integrate into the host cell genome.
[0176] As used herein, a combination refers to any association
between two or among more items.
[0177] As used herein, a composition refers to any mixture. It can
be a solution, a suspension, an emulsion, liquid, powder, a paste,
aqueous, non-aqueous or any combination thereof.
[0178] As used herein, fluid refers to any composition that can
flow. Fluids thus encompass compositions that are in the form of
semi-solids, pastes, solutions, aqueous mixtures, gels, lotions,
creams and other such compositions.
[0179] As used herein, a kit is a packaged combination optionally
including instructions for use of the combination and/or other
reactions and components for such use.
[0180] For clarity of disclosure, and not by way of limitation, the
detailed description is divided into the subsections that
follow.
B. Microorganisms for Tumor-Specific Therapy
[0181] Provided herein are microorganisms, and methods for making
and using such microorganisms for therapy of neoplastic disease and
other proliferative disorders and inflammatory disorders. The
microbe (or microorganism)-mediated treatment methods provided
herein involve administration of microorganisms to hosts,
accumulation of the microorganism in the targeted cell or tissue,
such as in a tumor, resulting in leaking or lysing of the cells,
whereby an immune response against leaked or released antigens is
mounted, thereby resulting in an inhibition of the tissues or cells
in which the microorganism accumulates.
[0182] In addition to the gene therapeutic methods of cancer
treatment, live attenuated microorganisms can be used for
vaccination, such as in cancer vaccination or antitumor immunity.
Immunization, for example, against a tumor can include a
tumor-specific T-cell-mediated response through microbe-delivered
antigens or cytokines. To do so, the microbes can be specifically
targeted to the tumor tissues, with minimal infection to any other
key organs and also can be modified or provided to produce the
antigens and/or cytokines.
[0183] The microorganisms provided herein and the use of such
microorganisms herein can accumulate in immunoprivileged cells or
immunoprivileged tissues, including tumors and/or metastases, and
also including wounded tissues and cells. While the microorganisms
provided herein can typically be cleared from the subject to whom
the microorganisms are administered by activity of the subject's
immune system, microorganisms can nevertheless accumulate, survive
and proliferate in immunoprivileged cells and tissues such as
tumors because such immunoprivileged areas are sequestered from the
host's immune system. Accordingly, the methods provided herein, as
applied to tumors and/or metastases, and therapeutic methods
relating thereto, can readily be applied to other immunoprivileged
cells and tissues, including wounded cells and tissues.
[0184] 1. Characteristics
[0185] The microorganisms provided herein and used in the methods
herein are attenuated, immunogenic, and replication competent.
[0186] a. Attenuated
[0187] The microbes used in the methods provided herein are
typically attenuated. Attenuated microbes have a decreased capacity
to cause disease in a host. The decreased capacity can result from
any of a variety of different modifications to the ability of a
microbe to be pathogenic. For example, a microbe can have reduced
toxicity, reduced ability to accumulate in non-tumorous organs or
tissue, reduced ability to cause cell lysis or cell death, or
reduced ability to replicate compared to the non-attenuated form
thereof. The attenuated microbes provided herein, however, retain
at least some capacity to replicate and to cause immunoprivileged
cells and tissues, such as tumor cells to leak or lyse, undergo
cell death, or otherwise cause or enhance an immune response to
immunoprivileged cells and tissues, such as tumor cells.
[0188] i. Reduced Toxicity
[0189] Microbes can be toxic to their hosts by manufacturing one or
more compounds that worsen the health condition of the host.
Toxicity to the host can be manifested in any of a variety of
manners, including septic shock, neurological effects, or muscular
effects. The microbes provided herein can have a reduced toxicity
to the host. The reduced toxicity of a microbe of the present
methods and compositions can range from a toxicity in which the
host experiences no toxic effects, to a toxicity in which the host
does not typically die from the toxic effects of the microbes. In
some embodiments, the microbes are of a reduced toxicity such that
a host typically has no significant long-term effect from the
presence of the microbes in the host, beyond any effect on
tumorous, metastatic or necrotic organs or tissues. For example,
the reduced toxicity can be a minor fever or minor infection, which
lasts for less than about a month, and following the fever or
infection, the host experiences no adverse effects resultant from
the fever or infection. In another example, the reduced toxicity
can be measured as an unintentional decline in body weight of about
5% or less for the host after administration of the microbes. In
other examples, the microbe has no toxicity to the host.
[0190] Exemplary vaccinia viruses of the LIVP strain (a widely
available attenuated Lister strain) that have reduced toxicity
compared to other vaccinia viruses employed and are further
modified. Modified LIVP were prepared. These modified LIVP include
insertions in the TK and/or HA genes and in the locus designed F3.
As an example of reduced toxicity, recombinant vaccinia viruses
were tested for their toxicity to mice with impaired immune systems
(nude mice) relative to the corresponding wild type vaccinia virus.
Intravenous (i.v.) injection of wild type vaccinia virus VGL
(strain LIVP) at 1.times.10.sup.7 PFU/mouse causes toxicity in nude
mice: three mice out of seven lost the weight and died (one mouse
died in one week after virus injection, one mouse died ten days
after virus injection. Similar modifications can be made to other
pox viruses and other viruses to reduce toxicity thereof. Such
modifications can be empirically identified, if necessary.
[0191] ii. Accumulate in Immunoprivileged Cells and Tissues, Such
as Tumor, Not Substantially in Other Organs
[0192] Microbes can accumulate in any of a variety of tissues and
organs of the host. Accumulation can be evenly distributed over the
entire host organism, or can be concentrated in one or a few organs
or tissues, The microbes provided herein can accumulate in targeted
tissues, such as immunoprivileged cells and tissues, such as tumors
and also metastases. In some embodiments, the microbes provided
herein exhibit accumulation in immunoprivileged cells and tissues,
such as tumor cells relative to normal organs or tissues that is
equal to or greater than the accumulation that occurs with wild
type microbes. In other embodiments the microbes provided herein
exhibit accumulation in immunoprivileged cells and tissues, such as
tumor cells that is equal to or greater than the accumulation in
any other particular organ or tissue. For example, the microbes
provided herein can demonstrate an accumulation in immunoprivileged
cells and tissues, such as tumor cells that is at least about
2-fold greater, at least about 5-fold greater, at least about
10-fold greater, at least about 100-fold greater, at least about
1,000-fold greater, at least about 10,000-fold greater, at least
about 100,000-fold greater, or at least about 1,000,000-fold
greater, than the accumulation in any other particular organ or
tissue.
[0193] In some embodiments, a microbe can accumulate in targeted
tissues and cells, such as immunoprivileged cells and tissues, such
as tumor cells, without accumulating in one or more selected
tissues or organs. For example, a microbe can accumulate in tumor
cells without accumulating in the brain. In another example, a
microbe can accumulate in tumor cells without accumulating in
neural cells. In another example, a microbe can accumulate in tumor
cells without accumulating in ovaries. In another example, a
microbe can accumulate in tumor cells without accumulating in the
blood. In another example, a microbe can accumulate in tumor cells
without accumulating in the heart. In another example, a microbe
can accumulate in tumor cells without accumulating in the bladder.
In another example, a microbe can accumulate in tumor cells without
accumulating in testes. In another example, a microbe can
accumulate in tumor cells without accumulating in the spleen. In
another example, a microbe can accumulate in tumor cells without
accumulating in the lungs.
[0194] One skilled in the art can determine the desired capability
for the microbes to selectively accumulate in targeted tissue or
cells, such as in an immunoprivileged cells and tissues, such as
tumor rather than non-target organs or tissues, according to a
variety of factors known in the art, including, but not limited to,
toxicity of the microbes, dosage, tumor to be treated,
immunocompetence of host, and disease state of the host.
[0195] Provided herein as an example of selective accumulation in
immunoprivileged cells and tissues, such as tumors relative to
normal organs or tissues, presence of various vaccinia viruses was
assayed in tumor samples and different organs. Wild type VGL virus
(LIVP) was recovered from tumor, testes, bladder, and liver and as
well as from brain. Recombinant virus RVGL9 was found mostly in
tumors, and no virus was recovered from brain tissue in six tested
animals. Therefore, this finding demonstrates the tumor
accumulation properties of a recombinant vaccinia virus of the LIVP
strain with an insertion in the F3 gene for tumor therapy
purposes.
[0196] iii. Ability to Elicit or Enhance Immune Response to Tumor
Cells
[0197] The microorganisms herein cause or enhance an immune
response to antigens in the targeted tissues or cells, such as
immunoprivileged cells and tissues, such as tumor cells. The immune
response can be triggered by any of a variety of mechanisms,
including the presence of immunostimulatory cytokines and the
release antigenic compounds that can cause an immune response.
[0198] Cells, in response to an infection such as a microorganismal
infection, can send out signals to stimulate an immune response
against the cells. Exemplary signals sent from such cells include
antigens, cytokines and chemokines such as interferon-gamma and
interleukin-15. The microorganism provided herein can cause
targeted cells to send out such signals in response to infection by
the microbes, resulting in a stimulation of the host's immune
system against the targeted cells or tissues, such as tumor
cells.
[0199] In another embodiment, targeted cells or tissues, such as
tumor cells, can contain one or more compounds that can be
recognized by the host's immune system in mounting an immune
response against a tumor. Such antigenic compounds can be compounds
on the cell surface or the tumor cell, and can be protein,
carbohydrate, lipid, nucleic acid, or combinations thereof.
Microbe-mediated release of antigenic compounds can result in
triggering the host's immune system to mount an immune response
against the tumor. The amount of antigenic compound released by the
tumor cells is any amount sufficient to trigger an immune response
in a subject; for example, the antigenic compounds released from
one or more tumor cells can trigger a host immune response in the
organism that is known to be accessible to leukocytes.
[0200] The time duration of antigen release is an amount of time
sufficient for the host to establish an immune response to one or
more tumor antigens. In some embodiments, the duration is an amount
of time sufficient for the host to establish a sustained immune
response to one or more tumor antigens. One skilled in the art can
determine such a time duration based on a variety of factors
affecting the time duration for a subject to develop an immune
response, including the level of the tumor antigen in the subject,
the number of different tumor antigens, the antigenicity of the
antigen, the immunocompetence of the host, and the access of the
antigenic material to the vasculature of the host. Typically, the
duration of antigen release can be at least about a week, at least
about 10 days, at least about two weeks, or at least about a
month.
[0201] The microorganism provided herein can have any of a variety
of properties that can cause target cells and tissues, such as
tumor cells, to release antigenic compounds. Exemplary properties
are the ability to lyse cells and the ability to elicit apoptosis
in tumor cells. Microbes that are unable to lyse tumor cells or
cause tumor cell death can nevertheless be used in the methods
provided herein when such microbes can cause some release or
display of antigenic compounds from tumor cells. A variety of
mechanisms for antigen release or display without lysis or cell
death are known in the art, and any such mechanism can be used by
the microbes provided herein, including, but not limited to,
secretion of antigenic compounds, enhanced cell membrane
permeability, or altered cell surface expression or altered MHC
presentation in tumor cells when the tumor cells can be accessed by
the host's immune system. Regardless of the mechanism by which the
host's immune system is activated, the net result of the presence
of the microbes in the tumor is a stimulation of the host's immune
system, at least in part, against the tumor cells. In one example,
the microbes can cause an immune response against tumor cells not
infected by the microbes.
[0202] In one embodiment, the microbes provided herein can cause
tumor cells to release an antigen that is not present on the tumor
cell surface. Tumor cells can produce compounds such as proteins
that can cause an immune response; however, in circumstances in
which the antigenic compound is not on the tumor cell surface, the
tumor can proliferate, and even metastasize, without the antigenic
compound causing an immune response. Within the scope of the
present methods, the microbes provided herein can cause antigenic
compounds within the cell to release away from the cell and away
from the tumor, which can result in triggering an immune response
to such an antigen. Even if not all cells of a tumor are releasing
antigens, the immune response can initially be targeted toward the
"leaky" tumor cells, and the bystander effect of the immune
response can result in further tumor cell death around the "leaky"
tumor cells.
[0203] iv. Balance of Pathogenicity and Release of Tumor
Antigens
[0204] Typical methods of involving treatment of targeted cells and
tissues, such as immunoprivileged cells and tissues, such as
tumors, are designed to cause rapid and complete removal thereof.
For example, many viruses, bacterial or eukaryotic cells can cause
lysis and/or apoptosis in a variety of cells, including tumor
cells. Microorganisms that can vigorously lyse or cause cell death
can be highly pathogenic, and can even kill the host. Furthermore,
therapeutic methods based upon such rapid and complete lysis are
typically therapeutically ineffective.
[0205] In contrast, the microorganisms provided herein are not
aggressive in causing cell death or lysis. They can have only a
limited or no ability to cause cell death as long as they
accumulate in the target cells or tissues and result in alteration
of cell membranes to cause leakage of antigens against which an
immune response is mounted. It is desirable that their apoptotic or
lytic effect is sufficiently slow or ineffective to permit
sufficient antigenic leakage for a sufficient time for the host to
mount an effective immune response against the target tissues. Such
immune response alone or in combination with the lytic/apoptotic
effect of the microorganism results in elimination of the target
tissue and also elimination of future development, such as
metastases and reoccurrence, of such tissues or cells. While the
microbes provided herein can have a limited ability to cause cell
death, the microbes provided herein can nevertheless stimulate the
host's immune system to attack tumor cells. As a result, such
microorganisms also are typically unlikely to have substantial
toxicity to the host.
[0206] In one embodiment, the microbes have a limited, or no,
ability to cause tumor cell death, while still causing or enhancing
an immune response against tumor cells. In one example, the rate of
microorganism-mediated tumor cell death is less than the rate of
tumor cell growth or replication. In another example, the rate of
microorganism-mediated tumor cell death is slow enough for the host
to establish a sustained immune response to one or more tumor
antigens. Typically, the time for of cell death is sufficient to
establish an anti-tumor immune response and can be at least about a
week, at least about 10 days, at least about two weeks, or at least
about a month, depending upon the host and the targeted cells or
tissues.
[0207] In another embodiment, the microbes provided herein can
cause cell death in tumor cells, without causing substantial cell
death in non-tumor tissues. In such an embodiment, the microbes can
aggressively kill tumor cells, as long as no substantial cell death
occurs in non-tumor cells, and optionally, so long as the host has
sufficient capability to mount an immune response against the tumor
cells.
[0208] In one embodiment, the ability of the microbes to cause cell
death is slower than the host's immune response against the
microbes. The ability for the host to control infection by the
microbes can be determined by the immune response (e.g., antibody
titer) against microorganismal antigens. Typically, after the host
has mounted immune response against the microbes, the microbes can
have reduced pathogenicity in the host. Thus, when the ability of
the microbes to cause cell death is slower than the host's immune
response against the microbes, microbe-mediated cell death can
occur without risk of serious disease or death to the host. In one
example, the ability of the microbes to cause tumor cell death is
slower than the host's immune response against the microbes.
[0209] b. Immunogenicity
[0210] The microorganisms provided herein also can be immunogenic.
An immunogenic microorganism can create a host immune response
against the microorganism. In one embodiment, the microorganisms
can be sufficiently immunogenic to result in a large
anti-(microorganism) antibody titer. The microorganisms provided
herein can have the ability to elicit an immune response. The
immune response can be activated in response to viral antigens or
can be activated as a result of microorganismal-infection induced
cytokine or chemokine production. Immune response against the
microorganism can decrease the likelihood of pathogenicity toward
the host organism.
[0211] Immune response against the microorganism also can result in
target tissue or cell, such as tumor cell, killing. In one
embodiment, the immune response against microorganismal infection
can result in an immune response against tumor cells, including
developing antibodies against tumor antigens. In one example, an
immune response mounted against the microorganism can result in
tumor cell killing by the "bystander effect," where uninfected
tumor cells nearby infected tumor cells are killed at the same time
as infected cells, or alternatively, where uninfected tumor cells
nearby extracellular microorganisms are killed at the same time as
the microorganisms. As a result of bystander effect tumor cell
death, tumor cell antigens can be released from cells, and the host
organism's immune system can mount an immune response against tumor
cell antigens, resulting in an immune response against the tumor
itself.
[0212] In one embodiment, the microorganism can be selected or
modified to express one or more antigenic compounds, including
superantigenic compounds. The antigenic compounds such as
superantigens can be endogenous gene products or can be exogenous
gene products. Superantigens, including toxoids, are known in the
art and described elsewhere herein.
[0213] c. Replication Competent
[0214] The microorganisms provided herein can be replication
competent. In a variety of viral or bacterial systems, the
administered microorganism is rendered replication incompetent to
limit pathogenicity risk to the host. While replication
incompetence can protect the host from the microorganism, that also
limits the ability of the microorganism to infect and kill tumor
cells, and typically results in only a short-lived effect. In
contrast, the microorganisms provided herein can be attenuated but
replication competent, resulting in low toxicity to the host and
accumulation mainly or solely in tumors. Thus, the microorganisms
provided herein can be replication competent without creating a
pathogenicity risk to the host.
[0215] Attenuation of the microorganisms provided herein can
include, but is not limited to, reducing the replication competence
of the microorganism. For example, a microorganism can be modified
to decrease or eliminate an activity related to replication, such
as a transcriptional activator that regulates replication in the
microorganism. In an example, a microorganism, such as a virus, can
have the viral thymidine kinase gene modified.
[0216] d. Genetic Variants
[0217] The microorganisms provided herein can be modified from
their wild type form. Modifications can include any of a variety of
changes, and typically include changes to the genome or nucleic
acid molecules of the microorganisms. Exemplary nucleic acid
molecular modifications include truncations, insertions, deletions
and mutations. In an exemplary modification, a microorganismal gene
can be modified by truncation, insertion, deletion or mutation. In
an exemplary insertion, an exogenous gene can be inserted into the
genome of the microorganism.
[0218] i. Modified Characteristics
[0219] Modifications of the microorganisms provided herein can
result in a modification of microorganismal characteristics,
including those provided herein such as pathogenicity, toxicity,
ability to preferentially accumulate in tumor, ability to lyse
cells or cause cell death, ability to elicit an immune response
against tumor cells, immunogenicity, replication competence.
Variants can be obtained by general methods such as mutagenesis and
passage in cell or tissue culture and selection of desired
properties, as is known in the art, as exemplified for respiratory
syncytial virus in Murphy et al., Virus Res. 1994, 32:13-26.
[0220] Variants also can be obtained by mutagenic methods in which
nucleic acid residues of the microorganism are added, removed or
modified relative to the wild type. Any of a variety of known
mutagenic methods can be used, including recombination-based
methods, restriction endonuclease-based methods, and PCR-based
methods. Mutagenic methods can be directed against particular
nucleotide sequences such as genes, or can be random, where
selection methods based on desired characteristics can be used to
select mutated microorganisms. Any of a variety of microorganismal
modifications can be made, according to the selected microorganism
and the particular known modifications of the selected
microorganism.
[0221] ii. Exogenous Gene Expression
[0222] The microorganisms provided herein also can have the ability
to express one or more exogenous genes. Gene expression can include
expression of a protein encoded by a gene and/or expression of an
RNA molecule encoded by a gene. In some embodiments, the
microorganisms can express exogenous genes at levels high enough
that permit harvesting products of the exogenous genes from the
tumor. Expression of endogenous genes can be controlled by a
constitutive promoter, or by an inducible promoter. Expression can
also be influenced by one or more proteins or RNA molecules
expressed by the microorganism. An exemplary inducible promoter
system can include a chimeric transcription factor containing a
progesterone receptor fused to the yeast GAL4 DNA-binding domain
and to the activation domain of the herpes simplex virus protein
VP16, and a synthetic promoter containing a series of GAL4
recognition sequences upstream of the adenovirus major late E1B
TATA box, linked to one or more exogenous genes; in this exemplary
system, administration of RU486 to a subject can result in
induction of the exogenous genes. Exogenous genes expressed can
include genes encoding a therapeutic gene product, genes encoding a
detectable gene product such as a gene product that can be used for
imaging, genes encoding a gene product to be harvested, genes
encoding an antigen of an antibody to be harvested. The
microorganisms provided herein can be used for expressing genes in
vivo and in vitro. Exemplary proteins include reporter proteins (E.
coli .beta.-galactosidase, .beta.-glucuronidase, xanthineguanine
phosphoribosyltransferase), proteins facilitating detection, i.e.,
a detectable protein or a protein capable of inducing a detectable
signal, (e.g., luciferase, green and red fluorescent proteins,
transferrin receptor), proteins useful for tumor therapy
(pseudomonas A endotoxin, diphtheria toxin, p53, Arf, Bax, tumor
necrosis factor-alpha, HSV TK, E. coli purine nucleoside
phosphorylase, angiostatin, endostatin, different cytokines) and
many other proteins.
[0223] iii. Detectable Gene Product
[0224] The microorganisms provided herein can express one or more
genes whose products are detectable or whose products can provide a
detectable signal. A variety of detectable gene products, such as
detectable proteins are known in the art, and can be used with the
microorganisms provided herein. Detectable proteins include
receptors or other proteins that can specifically bind a detectable
compound, proteins that can emit a detectable signal such as a
fluorescence signal, enzymes that can catalyze a detectable
reaction or catalyze formation of a detectable product.
[0225] In some embodiments, the microorganism expresses a gene
encoding a protein that can emit a detectable signal or that can
catalyze a detectable reaction. A variety of DNA sequences encoding
proteins that can emit a detectable signal or that can catalyze a
detectable reaction, such as luminescent or fluorescent proteins,
are known and can be used in the microorganisms and methods
provided herein. Exemplary genes encoding light-emitting proteins
include genes from bacterial luciferase from Vibrio harveyi (Belas
et al., Science 218 (1982), 791-793), bacterial luciferase from
Vibrio fischerii (Foran and Brown, Nucleic acids Res. 16 (1988),
177), firefly luciferase (de Wet et al., Mol. Cell. Biol. 7(1987),
725-737), aequorin from Aequorea victoria (Prasher et al., Biochem.
26 (1987), 1326-1332), Renilla luciferase from Renilla renformis
(Lorenz et al., PNAS USA 88 (1991), 4438-4442) and green
fluorescent protein from Aequorea victoria (Prasher et al., Gene
111 (1987), 229-233). Transformation and expression of these genes
in microorganisms can permit detection of microorganismal colonies,
for example, using a low light imaging camera. Fusion of the lux A
and lux B genes can result in a fully functional luciferase protein
(Escher et al., PNAS 86 (1989), 6528-6532). This fusion gene (Fab2)
has introduced into a variety of microorganisms followed by
microorganismal infection and imaging based on luciferase
expression. In some embodiments, luciferases expressed in bacteria
can require exogenously added substrates such as decanal or
coelenterazine for light emission. In other embodiments,
microorganisms can express a complete lux operon, which can include
proteins that can provide luciferase substrates such as decanal.
For example, bacteria containing the complete lux operon sequence,
when injected intraperitoneally, intramuscularly, or intravenously,
allowed the visualization and localization of bacteria in live mice
indicating that the luciferase light emission can penetrate the
tissues and can be detected externally (Contag et al., Mol.
Microbiol. 18 (1995), 593-603).
[0226] In other embodiments, the microorganism can express a gene
that can bind a detectable compound or that can form a product that
can bind a detectable compound. A variety of gene products, such as
proteins, that can specifically bind a detectable compound are
known in the art, including receptors, metal binding proteins,
ligand binding proteins, and antibodies. Any of a variety of
detectable compounds can be used, and can be imaged by any of a
variety of known imaging methods. Exemplary compounds include
receptor ligands and antigens for antibodies. The ligand can be
labeled according to the imaging method to be used. Exemplary
imaging methods include any of a variety magnetic resonance methods
such as magnetic resonance imaging (MRI) and magnetic resonance
spectroscopy (MRS), and also include any of a variety of
tomographic methods including computed tomography (CT), computed
axial tomography (CAT), electron beam computed tomography (EBCT),
high resolution computed tomography (HRCT), hypocycloidal
tomography, positron emission tomography (PET), single-photon
emission computed tomography (SPECT), spiral computed tomography
and ultrasonic tomography.
[0227] Labels appropriate for magnetic resonance imaging are known
in the art, and include, for example, gadolinium chelates and iron
oxides. Use of chelates in contrast agents is known in the art.
Labels appropriate for tomographic imaging methods are known in the
art, and include, for example, .beta.-emitters such as .sup.11C,
.sup.13N, .sup.15O or .sup.64Cu or (b) .gamma.-emitters such as
.sup.123I. Other exemplary radionuclides that can be used, for
example, as tracers for PET include .sup.55Co, .sup.67Ga,
.sup.68Ga, .sup.60Cu(II), .sup.67Cu(II), .sup.57Ni, .sup.52Fe and
.sup.18F. Examples of useful radionuclide-labeled agents are
.sup.64Cu-labeled engineered antibody fragment (Wu et al., PNAS USA
97 (2002), 8495-8500), .sup.64Cu-labeled somatostatin (Lewis et
al., J. Med. Chem. 42(1999), 1341-1347),
.sup.64Cu-pyruvaldehyde-bis
(N4methylthiosemicarbazone)-(.sup.64Cu-PTSM) (Adonai et al., PNAS
USA 99 (2002), 3030-3035), .sup.52Fe-citrate (Leenders et al., J.
Neural. Transm. Suppl. 43 (1994), 123-132),
.sup.52Fe/.sup.52mMn-citrate (Calonder et al., J. Neurochem.
73(1999), 2047-2055) and .sup.52Fe-labeled iron (III)
hydroxide-sucrose complex (Beshara et al., Br. J. Haematol. 104
(1999), 288-295,296-302).
[0228] iv. Therapeutic Gene Product
[0229] The microorganisms provided herein can express one or more
genes whose products cause cell death or whose products cause an
anti-tumor immune response, such genes can be considered
therapeutic genes. A variety of therapeutic gene products, such as
toxic or apoptotic proteins, or siRNA, are known in the art, and
can be used with the microorganisms provided herein. The
therapeutic genes can act by directly killing the host cell, for
example, as a channel-forming or other lytic protein, or by
triggering apoptosis, or by inhibiting essential cellular
processes, or by triggering an immune response against the cell, or
by interacting with a compound that has a similar effect, for
example, by converting a less active compound to a cytotoxic
compound.
[0230] In some embodiments, the microorganism can express a
therapeutic protein. A large number of therapeutic proteins that
can be expressed for tumor treatment are known in the art,
including, but not limited to tumor suppressors, toxins, cytostatic
proteins, and cytokines. An exemplary, non-limiting list of such
proteins includes WT1, p53, p16, Rb, BRCA1, cystic fibrosis
transmembrane regulator (CFTR), Factor VIII, low density
lipoprotein receptor, beta-galactosidase, alpha-galactosidase,
beta-glucocerebrosidase, insulin, parathyroid hormone,
alpha-1-antitrypsin, rsCD40L, Fas-ligand, TRAIL, TNF, antibodies,
microcin E492, diphtheria toxin, Pseudomonas exotoxin, Escherichia
coli Shig toxin, Escherichia coli Verotoxin 1, and hyperforin.
[0231] In other embodiments, the microorganism can express a
protein that converts a less active compound into a compound that
causes tumor cell death. Exemplary methods of conversion of such a
prodrug compound include enzymatic conversion and photolytic
conversion. A large variety of protein/compound pairs are known in
the art, and include, but are not limited to Herpes simplex virus
thymidine kinase/gancyclovir, varicella zoster thymidine
kinase/gancyclovir, cytosine deaminase/5-fluorouracil, purine
nucleoside phosphorylase/6-methylpurine deoxyriboside, beta
lactamase/cephalosporin-doxorubicin, carboxypeptidase
G2/4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L-glutamic
acid, cytochrome P450/acetominophen, horseradish
peroxidase/indole-3-acetic acid, nitroreductase/CB1954, rabbit
carboxylesterase/7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycam-
ptothecin, mushroom
tyrosinase/bis-(2-chloroethyl)amino-4-hydroxyphenylaminomethanone
28, beta
galactosidase/1-chloromethyl-5-hydroxy-1,2-dihyro-3H-benz[e]indole,
beta glucuronidase/epirubicin glucuronide, thymidine
phosphorylase/5'-deoxy5-fluorouridine, deoxycytidine
kinase/cytosine arabinoside, and linamerase/linamarin.
[0232] In another embodiment, the therapeutic gene product can be
an siRNA molecule. The siRNA molecule can be directed against
expression of a tumor-promoting gene, such as, but not limited to,
an oncogene, growth factor, angiogenesis promoting gene, or a
receptor. The siRNA molecule also can be directed against
expression of any gene essential for cell growth, cell replication
or cell survival. The siRNA molecule also can be directed against
expression of any gene that stabilizes the cell membrane or
otherwise limits the number of tumor cell antigens released from
the tumor cell. Design of an siRNA can be readily determined
according to the selected target of the siRNA; methods of siRNA
design and downregulation of genes are known in the art, as
exemplified in U.S. Pat. Pub. No. 20030198627.
[0233] In one embodiment, the therapeutic compound can be
controlled by a regulatory sequence. Suitable regulatory sequences
which, for example, are functional in a mammalian host cell are
well known in the art. In one example, the regulatory sequence can
contain a natural or synthetic vaccinia virus promoter. In another
embodiment, the regulatory sequence contains a poxvirus promoter.
When viral microorganisms are used, strong late promoters can be
used to achieve high levels of expression of the foreign genes.
Early and intermediate-stage promoters, however, can also be used.
In one embodiment, the promoters contain early and late promoter
elements, for example, the vaccinia virus early/late promoter p7.5,
vaccinia late promoter p11, a synthetic early/late vaccinia pE/L
promoter (Patel et al., (1988), Proc. Natl. Acad. Sci. USA 85,
9431-9435; Davison and Moss, (1989), J Mol Biol 210, 749-769;
Davison et al., (1990), Nucleic Acids Res. 18, 4285-4286;
Chakrabarti et al., (1997), BioTechniques 23, 1094-1097).
[0234] v. Expressing a Superantigen
[0235] The microorganisms provided herein can be modified to
express one or more superantigens. Superantigens are antigens that
can activate a large immune response, often brought about by a
large response of T cells. A variety of superantigens are known in
the art including, but not limited to, diphtheria toxin,
staphylococcal enterotoxins (SEA, SEB, SEC1, SEC2, SED, SEE and
SEH), Toxic Shock Syndrome Toxin 1, Exfoliating Toxins (EXft),
Streptococcal Pyrogenic Exotoxin A, B and C (SPE A, B and C), Mouse
Mammary Tumor Virus proteins (MMTV), Streptococcal M proteins,
Clostridial Perfringens Enterotoxin (CPET), mycoplasma arthritis
superantigens.
[0236] Since many superantigens also are toxins, if expression of a
microorganism of reduced toxicity is desired, the superantigen can
be modified to retain at least some of its superantigenicity while
reducing its toxicity, resulting in a compound such as a toxoid. A
variety of recombinant superantigens and toxoids of superantigens
are known in the art, and can readily be expressed in the
microorganisms provided herein. Exemplary toxoids include toxoids
of diphtheria toxin, as exemplified in U.S. Pat. No. 6,455,673 and
toxoids of Staphylococcal enterotoxins, as exemplified in U.S. Pat.
Pub. No. 20030009015.
[0237] vi. Expressing a Gene Product to be Harvested
[0238] Exemplary genes expressible by a microorganism for the
purpose of harvesting include human genes. An exemplary list of
genes includes the list of human genes and genetic disorders
authored and edited by Dr. Victor A. McKusick and his colleagues at
Johns Hopkins University and elsewhere, and developed for the World
Wide Web by NCBI, the National Center for Biotechnology
Information. Online Mendelian Inheritance in Man, OMIM.TM.. Center
for Medical Genetics, Johns Hopkins University (Baltimore, Md.) and
National Center for Biotechnology Information, National Library of
Medicine (Bethesda, Md.), 1999. and those available in public
databases, such as PubMed and GenBank (see, e.g.,
(ncbi.nlm.nih.gov/entrez/query.fcgi?db=OMIM) These genes include,
but are not limited to: 239f2h9, 3pk, 4ebp1, 4ebp2, al1, al2 m1,
al2 m2, al2 m3, al2 m4, al5, a1b, albg, alst, a2m, a2mr, a2mrap,
aa, aaa, aaa, aabt, aac1, aac2, aact, aadac, aanat, aars, aas, aat,
aavs1, abc1, abc2, abc3, abc7, abc8, abcr, abi1, abl1, abl2, abl1,
abo, abp, abp1, abpa, abpx, abr, acaa, acac, acaca, acacb, acad1,
acadm, acads, acadsb, acadv1, acat, acat1, acat2, acc, accb, accn1,
accn2, accpn, ace1, ach, ache, achm1, achm2, achrb, achrd, achrg,
acls, acly, aco1, aco2, acox, acox1, acox2, acox3, acp1, acp2,
acp5, acpp, acr, acrv1, acs3, acs3, acs4, act2, act35, acta1,
acta2, acta3, actb, actc, actg1, actg2, act11, actn1, actn2, actn3,
actsa, acug, acvr1, acvr2b, acvrl1, acvrlk1, acvrlk2, acvrlk3,
acy1, ad1, ad2, ad3, ad4, ad5, ada, adam10, adam11, adam12, adam3,
adam3a, adam3b, adam8, adar, adarb1, adarb2, adcp1, adcp2, adcy1,
adcy2, adcy3, adcy3, adcy4, adcy5, adcy6, adcy7, adcy8, adcy9,
adcyap1, adcyaplr1, add1, add2, add3, add1, adfn, adh1, adh2, adh3,
adh4, adh5, adh7, adhaps, adhc1@, adhr, adhr, adk, ad1, adm, admlx,
adora1, adora2a, adora2b, adora21, adora21, adora3, adprt, adra1a,
adra1b, adra1c, adra1d, adra2a, adra2b, adra2c, adra211, adra212,
adra2r, adrb1, adrb1r, adrb2, adrb2rl1, adrb3, adrbk1, adrbk2,
ads1, adss, adtb1, adx, adxr, ae1, ae2, ae3, aegl1, aemk, aesi,
af10, af17, af4, af6, af8t, af9, afd1, afdn, afg3, afg311, afm,
afp, afx1, aga, agc1, ager, ag1, agmx1, agmx2, agp1, agp7, agps,
agrn, agrp, agrt, ags, agt, agti1, agtr1, agtr1a, agtr2, agtr11,
agxt, ahc, ahcy, ahd, ahds, ahnak, aho2, ahr, ahsg, ahx, aib1, aic,
aic1, aied, aih1, aih2, aih3, aim1, air, airc, aire, ak1, ak2, ak3,
akap149, akt1, akt2, aku, alad, alas1, alas2, a1b, alb2, alba,
alcam, ald, aldh1, aldh10, aldh2, aldh3, aldh4, aldh5, aldh6,
aldh9, ald11, aldoa, aldob, aldoc, aldr1, alds, alk, alk1, alk2,
alk3, alk6, alms1, alox12, alox15, alox5, alp, alpi, alp1, alpp,
alpp12, alr, alr, als1, als2, als4, als5, alss, ambn, ambp, amcd1,
amcd2b, amcn, amcn1, amcx1, amd1, amdm, amelx, amely, amfr, amg,
amg1, amgx, amh, amhr, amhr2, aml1, amllt1, am12, am13, amog,
ampd1, ampd2, ampd3, amph, amph1, ampk, amt, amy1a, amy1b, amy1c,
amy2a, amy2b, an2, anc, ancr, ang, ang1, anh1, ank1, ank2, ank3,
anop1, anova, anp, anpep, anpra, anprb, anprc, ans, ant1, ant2,
ant3, ant3y, anx1, anx11, anx13, anx2, anx214, anx3, anx4, anx5,
anx6, anx7, anx8, aoah, aoc2, aox1, ap2tf, apah1, apba1, apba2,
apbb1, apbb2, apc, apcs, ape, apeced, apeh, apex, api1, api2, api3,
apj, aplp, aplp1, aplp2, apnh, apo31, apoa1, apoa2, apoa4, apob,
apobec1, apoc1, apoc2, apoc3, apoc4, apod, apoe, apoer2, apoh,
apolnt, apolp1@, apolp2@, app, appbp1, appl1, aprf, aprt, aps,
apt1, aptllg1, apx1, apy, aqdq, aqpo, aqp1, aqp2, aqp21, aqp3,
aqp4, aqp5, aqp6, aqp7, ar, ar1, ara, araf1, araf2, arcn1, ard1,
ard1, areg, arf1, arf2, arf3, arf41, arf5, arg, arg1, args, arh12,
arh6, arh9, arha, arhb, arhc, arhg, arhgap2, arhgap3, arhgap6,
arhgdia, arhgdib, arhh, arix, ar12, armd1, amt, amt1, aro, arp,
arp1, arpkd, arr3, arrb1, arrb2, arsa, arsacs, arsb, arsc1, arsc2,
arsd, arse, arsf, art, art1, art3, art4, art5, arvd1, arvd2, arvd3,
arvd4, as, asat, asb, ascl1, ascl2, asct1, asd1, asd2, asgr1,
asgr2, ash1, asip, as1, asln, asm1, asma, asmd, asmt, asmtlx,
asmty, asnrs, asns, aspa, ass, astm1, astn, asv, at, at1, at2r1,
at3, ata, atbf1, atcay, atf1, ath1, aths, atm, atoh1, atox1,
atp1a1, atp1a2, atp1a3, atp1a11, atp1b1, atp1b2, atp1b3, atp1b11,
atp1g1, atp2a1, atp2a2, atp2a3, atp2b, atp2b1, atp2b2, atp2b2,
atp2b3, atp2b4, atp4a, atp4b, atp5, atp5a, atp5b, atp5g1, atp5g2,
atp5g3, atp5o, atp6a, atp6b1, atp6c, atp6e, atp61n, atp7a, atp7b,
atpm, atpsb, atpsk1, atpsk2, atq1, atr, atr, atr1, atr1, atr2,
atrc1, atrc2, atrx, ats, atsv, atx1, atx2, au, auf1, aufla, aut,
avcd, aved, avp, avpr1a, avpr1b, avpr2, avpr3, avrp, avsd, awa1,
ax1, axl1g, axsf, azf1, azf2, azgp1, azu1, b120, b144, blg1, b29,
b2m, b2mr, b3galt4, b4galt1, ba2r, bab1, bag1, bai1, bai2, bai3,
bak1, bam22, bap1, bap135, bapx1, bard1, bark2, bas, bat1, bat2,
bat3, bat4, bat5, bax, bb1, bbbg1, bbbg2, bbs1, bbs2, bbs3, bbs4,
bbs5, bcas1, bcat1, bcat2, bcate2, bcd1, bcei, bche, bckdha,
bckdhb, bcl1, bcl10, bcl2, bcl2a1, bcl212, bc13, bc15, bc16, bc17,
bc17a, bc18, bc19, bc1w, bcm, bcm1, bcma, bcns, bcns, bcp, bcpm,
bcpr, bcr, bcr12, bcr13, bcr14, bcsg1, bct1, bct2, bdb, bdb1, bdc,
bde, bdkrb1, bdkrb2, bdmf, bdmr, bdnf, bed, bedp, bek, bene, bevi,
bf, bf1, bf2, bfhd, bfic, bf1s, bfnc2, bfp, bfsp1, bft, bglap,
bgmr, bgn, bgp, bhd, bhpcdh, bhr1, bicd1, bid, bigh3, bin1, bir,
bjs, bkma1, blast1, blau, blk, blm, blmh, bltr, blvra, blvrb, blym,
bmal1, bmd, bmh, bmi1, bmp1, bmp2, bmp2a, bmp2b1, bmp3, bmp4, bmp5,
bmp6, bmp7, bmp8, bmpr1a, bmpr1b, bmx, bmyb, bn51t, bnc, bnc1, bnp,
bor, bpad, bpag1, bpag2, bpes, bpes1, bpes2, bpgm, bph1, bpi, br,
br140, braf, brca1, brca2, brca3, brcacox, brcd1, brcd2, brdt,
brf1, brhc, bric, brks, brn3a, brn3b, brn3c, brrn1, brw1c, bs,
bsap, bsep, bsf2, bsg, bsnd, bss1, bst1, bst2, btak, btc, btd,
bteb, bteb1, btg1, btg2, bths, btk, btk1, btn, bts, bub1b, bubr1,
bwr1a, bwr1b, bws, bwscr1a, bwscr1b, bzrp, bzx, c11orf13, c1nh,
c1qa, c1qb, c1qbp, c1qg, c1r, c1s, c2, c21orf1, c21orf2, c21orf3,
c2ta, c3, c3br, c3dr, c3g, c4a, c4b, c4 bpa, c4 bpb, c4f, c4s, c5,
c5ar, c5r1, c6, c7, c8a, c8b, c8g, c9, ca1, ca12, ca125, ca2, ca21
h, ca3, ca4, ca5, ca6, ca7, ca8, ca9, caaf1, cabp9k, cac, cac@,
caca, cacd, cacna1a, cacna1b, cacna1c, cacna1d, cacna1e, cacna1f,
cacna1s, cacna2, cacnb1, cacnb2, cacnb3, cacnb4, cacng, cacn11a1,
cacn11a2, cacn11a3, cacn11a4, cacn11a5, cacn11a6, cacn12a, cacn1b1,
cacn1g, cacp, cact, cacy, cad, cad11, cadasi1, cae1, cae3, caf,
caf1a, caga, cagb, cain, cak, cak1, cal11, ca1b1, calb2, calb3,
calc1, calc2, calca, calcb, calcr, cald1, cal1a, calm1, calm2,
calm3, calm11, calm13, calna, calna3, calnb, calnb1, calr, cals,
calt, calu, cam, camk4, camkg, caml1, camlg, camp, can, canp3,
canx, cap2, cap3, cap37, capb, capg, cap1, capn1, capn2, capn3,
capn4, cappa2, cappb, capr, caps, capza2, capzb, car, carp, cars,
cart1, cas, cas2, casi1, casp1, casp10, casp2, casp3, casp3, casp4,
casp5, casp6, casp7, casp8, casq1, casq2, casr cast, cat, cat1,
cat4, catf1, catm, cav1, cav2, cav3, cbbm, cbd, cbfa1, cbfa2,
cbfa2t1, cbfa3, cbfb, cbg, cb1, cbl2, cbln2, cbp, cbp, cbp2, cbp68,
cbr1, cbs, cbt, cbt1, cc10, cca, cca1, ccal1, ccal2, ccbl1, ccckr5,
ccg1, ccg2, cchl1a1, cchl1a2, cchl1a3, cch1b1, cck, cckar, cckbr,
cc1, ccm1, ccm2, ccm3, ccn1, ccna, ccnb1, ccnc, ccnd1, ccnd2,
ccnd3, ccne, ccnf, ccng1, ccnh, ccnt, ccnt1, cco, ccr10, ccr2,
ccr3, ccr9, ccsp, cct, ccv, cczs, cd, cd10, cd11a, cd11b, cd11c,
cd13, cd137, cd14, cd15, cd151, cd156, cd16, cd164, cd18, cd19,
cd1a, cd1b, cd1c, cd1d, cd1e, cd2, cd20, cd22, cd23, cd24, cd26,
cd27, cd271, cd28, cd281g, cd281g2, cd30, cd32, cd33, cd34, cd36,
cd3611, cd3612, cd37, cd38, cd39, cd3911, cd3d, cd3e, cd3g, cd3z,
cd4, cd40, cd401g, cd41b, cd43, cd44, cd45, cd46, cd47, cd48,
cd49b, cd49d, cd5, cd53, cd57, cd58, cd59, cd51, cd6, cd63, cd64,
cd68, cd69, cd7, cd70, cd71, cd72, cd74, cd79a, cd79b, cd80, cd81,
cd82, cd82, cd86, cd8a, cd8b, cd8b1, cd9, cd94, cd95, cd97, cd99,
cda, cda1, cda3, cdan1, cdan2, cdan3, cdb2, cdc2, cdc20, cdc25a,
cdc25b, cdc25c, cdc27, cdc211, cdc212, cdc214, cdc34, cdc42, cdc51,
cdc7, cdc711, cdcd1, cdcd2, cdcd3, cdc11, cdcre1, cdg1, cdgd1,
cdgg1, cdgs2, cdh1, cdh11, cdh12, cdh13, cdh14, cdh15, cdh16,
cdh16, cdh17, cd2, cdh3, cdh3, cdh5, cdh7, cdh8, cdhb, cdhh, cdhp,
cdhs, cdk2, cdk3, cdk4, cdk5, cdk7, cdk8, cdk9, cdkn1, cdkn1a,
cdkn1b, cdknlc, cdkn2a, cdkn2b, cdkn2d, cdkn3, cdkn4, cdl1, cdm,
cdmp1, cdmt, cdpx1, cdpx2, cdpxr, cdr1, cdr2, cdr3, cdr62a, cdsn,
cdsp, cdtb, cdw50, cdx1, cdx2, cdx3, cdx4, cea, cebp, cebpa, cebpb,
cebpd, cebpe, cecr, ce1, cel1, cen1, cenpa, cenpb, cenpc, cenpc1,
cenpe, cenpf, cerd4, ces, ces1, cetn1, cetp, cf, cf2r, cfag, cfag,
cfc, cfd1, cfeom1, cfeom2, cf1h, cfl1, cf12, cfnd, cfns, cftr, cg1,
cga, cgat, cgb, cgd, cgf1, cgh, cgrp, cgs23, cgt, cgthba, chac,
chat, chc1, chd1, chd2, chd3, chd4, chd5, chdr, che1, che2, ched,
chek1, chga, chgb, chgc, chh, ch311, chip28, chit, chk1, chlr1,
chlr2, chm, chm1, chn, chn1, chn2, chop10, chr, chr39a, chr39b,
chr39c, chmm1, chrm2, chrm3, chrm4, chrm5, chrna1, chrna2, chrna3,
chrna4, chrna5, chrna7, chrnb1, chrnb2, chrnb3, chrnb4, chrnd,
chrne, chrng, chrs, chs1, chx10, ciipx, cip1, cirbp, cish, ck2a1,
ckap1, ckb, ckbb, ckbe, ckm, ckmm, ckmt1, ckmt2, ckn1, ckn2, ckr3,
ckr11, ckr13, c1, cl100, cla1, cla1, clac, clapb1, clapm1, claps3,
clc, clc7, clck2, clcn1, clcn2, clcn3, clcn4, clcn5, clcn6, clcn7,
clcnka, clcnkb, cld, cldn3, cldn5, clg, clg1, clg3, clg4a, clg4b,
cli, clim1, clim2, clk2, clk3, cln1, cln2, cln3, cln5, cln6, cln80,
clns1a, clns1b, clp, clpp, clps, clta, cltb, cltc, cltc11, cltd,
clth, clu, cma1, cmah, cmar, cmd1, cmd1a, cmd1b, cmd1c, cmd1d,
cmd1e, cmd1f, cmd3a, cmdj, cmh1, cmh2, cmh3, cmh4, cmh6, cmkbr1,
cmkbr2, cmkbr3, cmkbr5, cmkbr6, cmkbr7, cmkbr8, cmkbr9, cmkbr12,
cmklr1, cmkr11, cmkr12, cm1, cmm, cmm2, cmoat, cmp, cmpd1, cmpd2,
cmpd2, cmpd3, cmpx1, cmt1a, cmt1b, cmt2a, cmt2b, cmt2d, cmt2d,
cmt4a, cmt4b, cmtnd, cmtx1, cmtx2, cna1, cna2, cnbp1, cnc, cncg1,
cncg2, cncg31, cnd, cng3, cnga1, cnga3, cngb1, cnn1, cnn2, cnn3,
cnp, cnr1, cnsn, cntf, cntfr, cntn1, co, coca1, coca2, coch, cod1,
cod2, coh1, coi1, col10a1, col11a1, col11a2, col12a11, col13a1,
col15a1, col16a1, col17a1, col18a1, col19a1, col1a1, col1a2,
col1ar, col2a1, col3a1, col4a1, col4a2, col4a3, col4a4, col4a5,
col4a6, col5a1, col5a2, col6a1, col6a2, col6a3, col7a1, col8a1,
col8a2, col9a1, col9a1, col9a2, col9a3, colq, comp, comt, copeb,
copt1, copt2, cord1, cord2, cord5, cord6, cort, cot, cox10, cox4,
cox5b, cox6a1, cox6b, cox7a1, cox7a2, cox7a3, cox7am, cox8, cp,
cp107, cp115, cp20, cp47, cp49, cpa1, cpa3, cpb2, cpb2, cpd, cpe,
cpetr2, cpm, cpn, cpn1, cpn2, cpo, cpp, cpp32, cpp32, cppi, cps1,
cpsb, cpsd, cpt1a, cpt1b, cpt2, cpu, cpx, cpx, cpxd, cr1, cr2,
cr3a, crabp1, crabp2, crapb, crarf, crat, crbp1, crbp2, crd, crd1,
creb1, creb2, crebbp, creb11, crem, crfb4, crfr2, crh, crhbp, crhr,
crhr1, crhr2, crip, crk, crk1, crm1, crmp1, crmp2, crp, crp1, crs,
crs1c, crs2, crs3, crsa, crt, crtl1, crtm, crx, cry1, cry2, crya1,
crya2, cryaa, cryab, cryb1, cryb2, cryb3, cryba1, cryba2, cryba4,
crybb1, crybb2, crybb3, cryg1, cryg2, cryg3, cryg4, cryg8, cryg@,
cryga, crygb, crygc, crygd, crygs, crym, cryz, cs, csa, csb, csbp1,
csci, csd, csd2, csda, cse, cse11, csf1, csf1r, csf2, csf2ra,
csf2rb, csf2ry, csf3, csf3r, csh1, csh2, csk, csmf, csn1, csn10,
csn2, csn3, csnb1, csnb2, csnb3, csnk1a1, csnk1d, csnk1e, csnk1g2,
csnk2a1, csnk2a2, csnk2b, csnu3, cso, cspb, cspg1, cspg2, cspg3,
csr, csrb, csrp, csrp1, csrp2, cst1, cst1, cst2, cst3, cst4, cst4,
cst5, cst6, csta, cstb, csx, ct2, ctaa1, ctaa2, ctag, ctb, ctbp1,
ctbp2, ctgf, cth, cthm, ctk, ctla1, ctla3, ctla4, ctla8, ctm,
ctnna1, ctnna2, ctnnb1, ctnnd, ctnnd1, ctnr, ctns, ctp, ctpct,
ctps, ctr1, ctr2, ctrb1, ctr1, ctsa, ctsb, ctsc, ctsd, ctse, ctsg,
ctsg12, ctsh, ctsk, cts1, ctss, ctsw, ctsz, ctx, cubn, cul3, cul4b,
cul5, cutl1, cvap, cvd1, cvl, cx26, cx31, cx32, cx37, cx40, cx43,
cx46, cx50, cxb3s, cxcr4, cxorf4, cyb5, cyb561, cyba, cybb, cyc1,
cyk4, cyld1, cymp, cyp1, cyp11a, cyp11b1, cyp11b2, cyp17, cyp19,
cyp1a1, cyp1a2, cyp1b1, cyp21, cyp24, cyp27, cyp27a1, cyp27b1,
cyp2a, cyp2a3, cyp2a6, cyp2b, cyp2c, cyp2c19, cyp2c9, cyp2d,
cyp2d@, cyp2e, cyp2e1, cyp2f1, cyp2j2, cyp3a4, cyp4a11, cyp4b1,
cyp51, cyp7, cyp7a1, cyr61, cyrn1, cyrn2, czp3, d10s105e, d10s170,
d10s170, d11s302e, d11s636, d11s813e, d11s833e, d12s2489e, d12s53e,
d13s1056e, d13s25, d14s46e, d15s12, d15s226e, d15s227e, d16s2531e,
d16s469e, d17s136e, d17s811e, d18s892e, d19s204, d19s381e, d1s111,
d1s155e, d1s166e, d1s1733e, d1s2223e, d1s61, d2h, d2s201e, d2s448,
d2s488e, d2s69e, d3s1231e, d3s1319e, d3s48e, d4, d4s90, d5s1708,
d5s346, d6, d6s1101, d6s207e, d6s2245e, d6s228e, d6s229e, d6s230e,
d6s231e, d6s51e, d6s52e, d6s54e, d6s81e, d6s82e, d7s437, d8s2298e,
d9s46e, da1, da2b, dab2, dac, dad1, daf, dag, dag1, dag2, dagk1,
dagk4, dam10, dam6, damox, dan, dao, dap, dap3, dap5, dapk1, dar,
dat1, dax1, daxx, daz, dazh, daz1, dba, dbccr1, dbcn, dbh, dbi,
dbi, db1, dbm, dbn1, dbp, dbp, dbp1, dbp2, dbpa, dbt, dbx, dby,
dcc, dce, dci, dck, dcn, dcoh, dcp1, dcr, dcr3, dct, dctn1, dcx,
ddb1, ddb2, ddc, ddh1, ddh2, ddit1, ddit3, ddost, ddp, ddpac, ddr,
ddx1, ddx10, ddx11, ddx12, ddx15, ddx16, ddx2a, ddx3, ddx5, ddx6,
ddx9, dec, decr, def1, def4, def5, def6, defa1, defa4, defa5,
defa6, defb1, defb2, dek, denn, dents, dep1, der12, des, dff1,
dffa, dffrx, dffry, dfn1, dfn2, dfn3, dfn4, dfn6, dfna1, dfna10,
dfna11, dfna12, dfna13, dfna2, dfna2, dfna4, dfna5, dfna6, dfna7,
dfna8, dfna9, dfnb1, dfnb12, dfnb13, dfnb14, dfnb16, dfnb17,
dfnb18, dfnb2, dfnb3, dfnb4, dfnb5, dfnb6, dfnb7, dfnb8, dfnb9,
dgcr, dgcr2, dgcr2, dgcr6, dgi1, dgka, dgkq, dgpt, dgpt, dgs, dgs2,
dgsi, dgu, dhc2, dhcr7, dhfr, dhlag, dhp, dhpr, dhps, dhrd, dhtr,
di, di1, dia, dia1, dia2, dia4, diaphi, diaph2, dif2, diff6, dipi,
dir, dkc, dkc1, dlc1, dld, dlg1, dlg2, dlg3, dlg4, dlst, dlx1,
dlx2, dlx2, d13, dlx4, dlx5, dlx6, dlx7, dlx8, dm, dm2, dmahp,
dmbt1, dmd, dmda1, dmd1, dmh, dmk, dmp1, dmpk, dmsfh, dmt, dmt1,
dmtn, dna21, dnah, dnah1, dnah11, dnah12, dnah2, dnahc1, dnahc11,
dnahc2, dnahc3, dnase1, dnase111, dnase113, dnase2, dnch2, dnc1,
dncm, dnec1, dne11, dn1, dn11, dn111, dnm1, dnmt1, dnmt2, dnpk1,
dns, dntt, do, doc1, doc2, dock1, dock180, dod, dok1, dom, dp1,
dp1, dp2, dp3, dpagt2, dpc4, dpd, dpde1, dpde2, dpde3, dpde4,
dpep1, dph212, dpp, dpp4, dpp6, dpt, dpyd, dpys, dpys11, dpys12,
dr1, dr3, dr31g, dr5, dra, drad, drada, dra1, drd1, drd1b, drd1b,
drd112, drd2, drd3, drd4, drd5, dri11, drp1, drp1, drp2, drp2,
drp3, drp1a, drt, dsc1, dsc2, dsc3, dsc3, dsc4, dscam, dscr, dsg1,
dsg2, dsg3, dsp, dspg3, dspp, dss, dss1, dtd, dtdp2, dtdst, dtna,
dtr, dts, dus, dusp1, dusp11, dusp2, dusp3, dusp4, dusp5, dusp6,
dusp7, dusp8, dut, dv1, dv11, dv11, dv13, dxf68s1e, dxs1272e,
dxs128, dxs1283e, dxs423e, dxs435e, dxs522e, dxs648, dxs707,
dxs8237e, dxys155e, dylx2, dyrk, dys, dysf, dyt1, dyt3, dyt5, dyt6,
dyt7, dyt8, dyt9, dyx1, dyx2, e11s, e14, e1b, e2a, e2f1, e2f2,
e2f3, e2f4, e3, e4f, e4f1, e4tf1a, e4tf1b, ea1, eaac1, eaat1,
eaat2, eac, ead, eag, eap, ear1, ear2, ear3, ebaf, ebf, ebi1, ebm,
ebn1, ebn1, ebn2, ebr2a, ebs1, ebvm1, ebvs1, ec1, eca1, ecb2, ece1,
ecgf1, ech1, echs1, eck, ecm1, ecp, ecs1, ect2, ed1, ed2, ed3, ed4,
eda, eda3, eddr1, edg3, edg6, edh, edh17b2, edh17b2, edh17b3, edm1,
edm2, edm3, edmd, edmd2, edn, edn1, edn2, edn3, ednra, ednrb, eec1,
eec2, eef1a1, eef1a2, eef1b1, eef1b2, eef1b3, eef1b4, eef2, eeg1,
eegv1, eek, een, ef1a, ef2, efe2, efemp1, ef16, efmr, efna1, efna3,
efna4, efnb1, efnb2, efnb3, efp, eftu, egf, egfr, egi, egr1, egr2,
egr3, egr4, ehhadh, ehoc1, ei, eif1a, eif2g A, eif2s3 A, eif3s10,
eif3s6, eif4a1, eif4a2, eif4c, eif4e, eif4ebp1, eif4e2, eif4e11,
eif4e12, eif4g, eif4g1, eif4g2, eif5a, ejm1, el1, ela1, ela2,
elam1, elanh2, elav11, elav12, elav14, elc, ele1, elf3, elk1, elk2,
elk3, elk4, el1, eln, em9, emap, emap1, emd, emd2, emk1, emp1,
emp55, emr1, ems1, emt, emtb, emx1, emx2, en1, en2, ena78, end,
endog, enf12, eng, en1, eno1, eno2, eno3, enpep, ent1, entk, enur1,
enur2, enx2, eos, ep3, ep300, epa, epb3, epb311, epb41, epb4112,
epb42, epb49, epb72, epha1, epha2, epha3, epha8, ephb1, ephb2,
ephb3, ephb4, ephb6, epht1, epht2, epht3, ephx1, ephx2, epim,
eplg1, eplg2, eplg3, eplg4, eplg5, eplg8, epm1, epm2, epm2a, epmr,
epo, epor, eppk, eprs, eps15, eps8, ept, erba1, erba2, erba12,
erba13, erbb2, erbb3, erbb4, erc55, ercc1, ercc2, ercc3, ercc4,
ercc5, ercc6, ercm1, erda1, erf1, erg, erg3, ergic53, erh, erk,
erk1, erk2, erk3, erm, erp11, erv1, erv1, erv3, ervr, ervt1ervt2,
ervt3, ervt4, ervt5, eryf1, es1, es130, esa, esa1, esa4, esat,
esb3, esd, esg, esr, esr1, esr2, esr11, esr12, esrra, esrrb, esrrg,
ess1, est, est, est2, est25263, esx, etfa, etfb, etfdh, etk1, etk2,
etm1, etm2, eto, ets1, ets2, ety1, etv3, etv4, etv5, etv6, evc,
evc1, evda, evdb, evi1, evi2, evi2a, evi2b, evp1, evr1, evx1, evx2,
ews, ewsr1, exlm1, ext1, ext2, ext3, ext11, ext12, eya1, eya2,
eya3, eyc11, eyc13, ezh1, ezh1, ezh2, f10, f11, f12, f13a, f13a1,
f13b, f2, f2r, f2r12, f2r13, f3, f5, f5f8d, f7, f7e, f7r, f8a, f8b,
f8c, f8vwf, f9, fa, fa1, faa, fabp1, fabp2fabp3, fabp4, fabp6,
fac1, faca, facc, facd, face, fac11, fac12, fac13, fac14, facv11,
fad, fadd, fadk, fah, fak2, faldh, fai139, falz, fanca, fancc,
fancd, fance, fancg, fap, fapa, farr, fas, fas1, fasn, fast1, fat,
fau, fbln1, fbln2, fbn1, fbn2, fbn1, fbp1, fcar, fcc1, fce, fce2,
fcer1a, fcer1b, fcer1g, fcer2, fcgr1a, fcgr1b, fcgr1c, fcgr2a,
fcgr3a, fcgrt, fcmd, fcn1, fcn2, fcp, fcp1, fcpx, fct3a, fdc,
fdft1, fdh, fdps11, fdps12, fdps13, fdps14, fdps15, fdx1, fdxr,
fe65, fe6511, fea, feb1, feb2, fecb, fech, fen1, feo, feom, feom1,
feom2, fer, fes, fet1, fevr, ffm, fga, fgarat, fgb, fgc@, fgd1,
fgdy, fgf1, fgf10, fgf11, fgf12, fgf13, fgf14, fgf2, fgf2, fgf3,
fgf4, fgf5, fgf6, fgf7, fgf8, faf9, fgfa, fgfb, fgfr1, fgfr2,
fgfr3,
fgfr4, fgg, fgr, fgs1, fh, fh, fh3, fhc, fnf1, fhf3, fhf4, fhh2,
fhit, fh11, fh12, fhr2, fic1, figf, fih, fim, fim1, fim3, fimg,
fkbp12, fkbp1a, fkbp2, fkh2, fkh11, fkh110, fkh112, fkh115, fkh116,
fkh117, fkh12, fkh15, fkh16, fkh17, fkh18, fkh19, fkhr, fkhr11,
flg, fli1, flii, fln1, fln2, flna, flnb, flnms, flot2, flt1, flt2,
flt3, flt4, fmf, fmn, fmo1, fmo2, fmo3, fmod, fmr1, fmr2, fms, fl1,
fn12, fnra, fnrb, fnrb1, fnta, fntb, folh, folh1, folr1, folr2,
folt, fos, fosb, fos11, fos12, fpah, fpc, fpd1, fpdmm, fpf, fpgs,
fp1, fpp, fpr1, fprh1, fprh2, fpr11, fpr12, fprp, fps12, fps13,
fps14, fps15, fr, frap1, fraxa, fraxe, fraxf, frda, freac2, freac6,
freac9, frg1, frp1, frv1, frv2, frv3, fsg1, fsgs, fshb, fshd1a,
fshmd1a, fshprh1, fshr, fssv, fth1, fth16, ft1, ftz1, ftzf1, fuca1,
fuca2, fur, fus, fuse, fut1, fut2, fut3, fut4, fut5, fut6, fut7,
fut8, fvt1, fxr1, fxy, fy, fyn, fzd1, fzd2, fzd3, fzd5, fzd6, fzd7,
fzr, g0s8, g10p1, g10p2, g17, g17p1, g19p1, g1p1, g1p2, g1p3,
g22p1, g6pc, g6pd, g6pd1, g6pd1, g6pt, g6pt1, g6s, g7p1, ga2, gaa,
gabatr, gabpa, gabpb1, gabra1, gabra2, gabra3, gabra4, gabra5,
gabra6, gabrb1, gabrb2, gabrb3, gabrd, gabre, gabrg1, gabrg2,
gabrg3, gabrr1, gabrr2, gad1, gad2, gad3, gadd153, gadd45, gak,
ga1, galbp, galc, gale, galgt, galk1, galk2, galn, galnact, galnr,
galnr1, galns, galnt1, galnt2, galnt3, galr1, galt, gan, gan1,
ganab, ganc, gap, gap1m, gap43, gapd, gar22, garp, gars, gart, gas,
gas1, gas2, gas41, gas6, gas7, gasr, gast, gata1, gata2, gata3,
gata4, gata6, gay1, gba, gbas, gbbb1, gbbb2, gbe1, gbp1, gbx2, gc,
gcap, gcap2, gcdh, gcf1, gcf2, gcfx, gcg, gcgr, gch1, gck, gckr,
gcn511, gcn512, gcnf, gcnt1, gcnt2, gcp, gcp2, gcs, gcs1, gcsf,
gcsfr, gcsp, gctg, gcy, gda, gde, gdf5, gdf8, gdh, gdi1, gdi2,
gdid4, gdld, gdnf, gdnfr, gdnfra, gdnfrb, gdx, gdxy, ge, gem,
geney, gey, gf1, gf1, gfap, gfer, gfer, gfi1, gfpt, gfra1, gfra2,
ggcx, ggt1, ggt2, ggta1, ggtb1, ggtb2, gh1, gh2, ghc.RTM., ghdx,
ghn, ghr, ghrf, ghrh, ghrhr, ghs, ghv, gif, gifb, gip, gip, gipr,
girk1, girk2, girk3, girk4, gja1, gja3, gja4, gja5, gja8, gjb1,
gjb2, gjb3, gk, gk2, g1a, glat, glb1, glb2, glc1a, glc1b, glc1c,
glc1d, glc1f, glc3a, glc3b, gllc, glclr, glct2, glct3, gldc,
glepp1, glg1, gli, gli2, gli3, gli4, glnn, glns, glo1, glo2, glplr,
glra1, glra2, glra3, glrb, glrx, gls, glud1, glud2, glu1, glur1,
glur2, glur3, glur4, glur5, glur6, glur7, glut1, glut2, glut3,
glut4, glut5, glvr1, glvr2, gly96, glya, glyb, glys1, glyt1, glyt1,
glyt2, gm2a, gma, gmcsf, gmds, gm1, gmpr, gmps, gna11, gna15,
gna16, gnai1, gnai2, gnai2a, gnai2b, gnai21, gnai3, gna1, gnao1,
gnaq, gnas, gnas1, gnat1, gnat2, gnaz, gnb1, gnb2, gnb3, gng5,
gnl1, gnpta, gnrh1, gnrh2, gnrhr, gns, gnt1, golga4, got1, got2,
gp130, gp1ba, gp1bb, gp2, gp2b, gp39, gp3a, gp75, gp78, gp9, gpa,
gpam, gpat, gpb, gpc, gpc1, gpc3, gpc4, gpd, gpd1, gpd2, gpds1,
gpe, gpi, gpi2, gpm6a, gpm6b, gpoa, gpr1, gpr10, gpr11, gpr12,
gpr13, gpr15, gpr17, gpr18, gpr19, gpr2, gpr20, gpr21, gpr22,
gpr23, gpr25, gpr29, gpr3, gpr30, gpr31, gpr32, gpr35, gpr37,
gpr39, gpr4, gpr5, gpr6, gpr7, gpr8, gpr9, gprcy4, gprk21, gprk4,
gprk5, gprk6, gprv28, gpsa, gpsc, gpt, gpx1, gpx2, gpx3, gpx4, gr2,
grb1, grb10, grb2, grf2, gria1, gria2, gria3, gria4, grid2, grik1,
grik2, grik3, grik4, grik5, grin1, grin2a, grin2b, grin2c, grin2d,
grina, grk1, grk5, grk6, gr1, gr111, grm3, grm8, grmp, grn, gro1,
gro2, gro3, grp, grp58, grp78, grpr, grx, gs, gs1, gsas, gsc, gsc1,
gse, gshs, gs1, gsm1, gsn, gsp, gspt1, gsr, gss, gst12, gst11,
gst2, gst2, gst3, gst4, gst5, gsta1, gsta2, gstm1, gstm11, gstm2,
gstm3, gstm4, gstm5, gstp1, gstt2, gt1, gt335, gta, gtb, gtbp, gtd,
gtf2e2, gtf2f1, gtf2h1, gtf2h2, gtf2h4, gtf2i, gtf2s, gtf3a, gtg,
guc1a2, guc1a3, guc1b3, guc2c, guc2d, guc2f, guca1a, guca1b, guca2,
guca2, guca2a, guca2b, gucsa3, gucsb3, gucy1a2, gucy1a3, gucy1b3,
gucy2c, gucy2d, gucy2f, guk1, guk2, gulo, gulop, gusb, gusm, gust,
gxp1, gypa, gypb, gypc, gype, gys, gys1, gys2, gzma, gzmb, gzmh,
gzmm, h, h142t, h19, h1f0, h1f1, h1f2, h1f3, h1f4, h1f5, h1fv, h2a,
h2ax, h2az, h2b, h2b, h3f2, h3f3b, h3 ft, h3t, h4, h4f2, h4f5,
h4fa, h4fb, h4fe, h4fg, h4fh, h4fi, h4fj, h4fk, h4fl, h4fm, h4m,
h6, ha2, habp1, hadha, hadhb, hadhsc, haf, hagh, hah1, haip1, ha1,
hap, hap1, hap2, hars, has2, hat1, hausp, hb1, hb1, hb6, hba1,
hba2, hbac@, hbb, hbbc@, hbd, hbe1, hbegf, hbf2, hbg1, hbg2, hbgr,
hbhr, hbm, hbp, hbq1, hbz, hc2, hc3, hca, hcat2, hccs, hcdh, hcf2,
hcfc1, hcg, hck, h11, hc12, hc13, hcls1, hcp, hcp1, hcs, hcvs, hd,
hdac1, hdc, hdgf, hdhc7, hdlbp, hdld, hdldt1, hdr, hed, hed, hegf1,
hek, hek3, heln1, hem1, hema, hemb, hemc, hempas, hen1, hen2, hep,
hep10, her2, her4, herg, herv1, hes1, hesx1, het, hexa, hexb, hf1,
hf10, hfc1, hfe, hfe2, hfh11, hfsp, hgd, hgf, hgf, hgf1, hg1, hh,
hh72, hhc1, hhc2, hhd, hhh, hhmjg, hhr23a, hht1, hht2, hiap2,
higm1, hilda, hint, hiomt, hip, hip1, hip116, hip2, hir, hira,
his1, his2, hive1, hivep1, hivep2, hjcd, hk1, hk2, hk3, hk33, hke4,
hke6, hkr1, hkr2, hkr3, hkr4, h11, h119, hla-a, hla-b, hla-c,
hla-cda 12, hla-dma, hla-dmb, hla-dna, hla-dob, hla-dpa1 hla-dpb1,
hla-dqa1, hla-dr1b, hla-dra, hla-e, hla-f, hla-g, hla-ha2, hladp,
hlaf, hlals, hlcs, hlm2, hlp, hlp3, hlr1, hlr2, hlt, hlx1, hlxb9,
hmaa, hmab, hmat1, hmbs, hmcs, hmg1, hmg14, hmg17, hmg2, hmgc1,
hmgcr, hmgcs1, hmgcs2, hmgic, hmgiy, hmgx, hmmr, hmn2, hmox1,
hmox2, hmr, hms1, hmsn1, hmx1, hm.times.2, hnd, hnf1a, hnf2, hnf3a,
hnf3b, hnf4a, hnp36, hnpcc6, hnrpa1, hnrpa2b1, hnrpd, hnrpf, hnrpg,
hnrph1, hnrph2, hnrph3, hnrpk, homg, hops, hox10, hox11, hox12,
hox1@, hox1a, hox1b, hox1c, hox1d, hox1e, hox1f, hox1g, hox1h,
hox1i, hox1j, hox2@, hox2a, hox2b, hox2c, hox2d, hox2e, hox2f,
hox2g, hox2h, hox2i, hox3@, hox3a, hox3b, hox3c, hox3d, hox3e,
hox3f, hox3g, hox4@, hox4a, hox4b, hox4c, hox4d, hox4e, hox4f,
hox4g, hox4h, hox4i, hox7, hox8, hoxa1, hoxa10, hoxa11, hoxa13,
hoxa3, hoxa4, hoxa5, hoxa6, hoxa7, hoxa9, hoxa@, hoxb1, hoxb2,
hoxb3, hoxb4, hoxb5, hoxb6, hoxb7, hoxb8, hoxb9, hoxb@, hoxc12,
hoxc13, hoxc4, hoxc5, hoxc6, hoxc8, hoxc9, hoxc@, hoxd1, hoxd10,
hoxd11, hoxd12, hoxd13, hoxd3, hoxd4, hoxd8, hoxd9, hoxd@, hoxhb9,
hp, hp4, hpafp, hpc1, hpc2, hpca, hpca11, hpcx, hpd, hpdr1, hpdr2,
hpe1, hpe2, hpe3, hpe4, hpe5, hpect1, hpfh, hpfh2, hpgd, hplh1,
hplh2, hpn, hpr, hprt, hprt1, hps, hpt, hpt1, hptp, hptx, hpv18i1,
hpv18i2, hpx, hr, hras, hrb, hrc, hrc1, hrca1, hrd, hres1, hrf,
hrg, hrga, hrh1, hrh2, hrmt11, hrpt2, hrx, hrx, hry, hsa1, hsa12,
hsan1, hsas1, hscr2, hsd11, hsd1b1, hsd11b2, hsd11k, hsd11l,
hsd17b1, hsd17b2, hsd17b3, hsd17b4, hsd3b1, hsd3b2, hsh, hsn1,
hsorc1, hsp27, hsp73, hspa1a, hspa1b, hspa11, hspa2, hspa3, hspa4,
hspa5, hspa6, hspa7, hspa8, hspa9, hspb1, hspb2, hspc2, hspca11,
hspca12, hspca13, hspca14, hspcb, hspg1, hspg2, hsr1, hsst, hstd,
hstf1, htc2, htf4, htk, htk1, htl, htlf, htlvr, htn1, htn2, htn3,
htnb, htor, htr1a, htr1b, htr1d, htr1e, htr1e1, htr1f, htr2a,
htr2b, htr2c, htr3, htr4, htr5a, htr6, htr7, htrx1, hts1, htt, htx,
htx1, hub, hud, hup2, hur, hus, hyls, hvbs1, hvbs6, hvbs7, hvem,
hvh2, hvh3, hvh8, hxb, hxb1, hy, hya, hya11, hyd2, hygn1, hy1, hyp,
hyplip1, hypp, hypx, hyr, hyrc1, hys, ia1, ia2, iap, iapp, iar,
iars, ibd1, ibd2, ibm2, ibsp, ica1, icam1, icam2, icam3, icca,
ich1, icr2, icr2b, ics1, id1, id2, id3, id4, ida, idd, iddm1,
iddm10, iddm11, iddm12, iddm13, iddm15, iddm17, iddm2, iddm3,
iddm4, iddm5, iddm6, iddm7, iddm8, iddmx, ide, idg2, idh1, idh2,
idh3a, idh3g, ido, ids, idua, ier1, ier3, iex1, if, ifcr, ifgr2,
ifi16, ifi27, ifi35, ifi4, ifi5111, ifi54, ifi56, ifi616, ifi78,
ifna1, ifna10, ifna13, ifna14, ifna16, ifna17, ifna21, ifna6,
ifna7, ifna8, ifna@, ifnai1, ifnar1, ifnar2, ifnb1, ifnb2, ifnb3,
ifng, ifngr1, ifngr2, ifngt1, ifnr, ifnw1, ifrd2, iga, igat, igb,
igbp1, igd1, igda1, igdc1, igds2, iger, iges, igf1, igf1r, igf2,
igf2r, igfbp1, igfbp10, igfbp2, igfbp3, igfbp4, igfbp6, igfbp7,
igfr1, igfr2, igfr3, igh@, igha1, igha2, ighd, ighdy2, ighe, ighg1,
ighg2, ighg3, ighg4, ighj, ighm, ighmbp2, ighr, ighv@, igi, igj,
igk@, igkc, igkde1, igkj, igkjrb1, igkv, iglc, igll, iglj, iglp1,
iglp2, iglv, igm, igo1, igsf1, ihh, ik1, ikba, il10, il10r, il11,
il11ra, il12a, il12b, il12rb1, il12rb2, il13, il13ra1, il13ra2,
il15, il15ra, il17, il1a, il1b, il1bc, il1r1, il1r2, il1ra, il1rap,
il1rb, il1rn, il2, il2r, il2ra, il2rb, il2rg, il3, il3ra, il3ray,
il4, il4r, il4ra, il5, il5ra, il6, il6r, il6st, il7, il7r, il8,
il8ra, il8rb, il9, il9r, i1a, ilf1, illbp, imd1, imd2, imd4, imd5,
imd6, impa1, impdh1, impdh2, impdh11, impg1, impt1, indx, infa2,
infa4, infa5, ing1, inha, inhba, inhbb, inhbc, inim, ink4b, inlu,
inp10, inpp1, inpp5a, inpp5b, inpp5d, inppl1, ins, insig1, ins1,
ins13, ins14, insr, insrr, int1, int111, int2, int3, int4, int6,
iosca, ip2, ipf1, ipi, ipm150, ipox, ipp, ipp2, ipw, iqgap1, ir10,
ir20, ireb1, ireb2, irf1, irf2, irf4, irf4, irr, irs1, isa, iscw,
is11, islr, isot, issx, it15, itba1, itba2, itf, itf2, itga1,
itga2, itga2b, itga4, itga5, itga6, itga7, itgad, itga1, itgam,
itgav, itgax, itgb1, itgb2, itgb3, itgb4, itgb6, itgb7, iti, itih1,
itih2, itih3, itih4, itih11, iti1, itk, itm1, itpa, itpka, itpkb,
itpr1, itpr2, itpr3, itsn, ivd, iv1, jag1, jak1, jak2, jak3, jbs,
jcap, jh8, jip, jk, jme, jmj, joag, jpd, jrk, jrk1, jtk14, jty1,
jun, junb, jund, jup, jv18, jws, k12t, kai1, kal1, kar, kars,
katp1, kcna1, kcna10, kcna1b, kcna2b, kcna3, kcna4, kcna5, kcna6,
kcna7, kcna8, kcna9, kcnab1, kcnab2, kcnb1, kcnc1, kcnc2, kcnc3,
kcnc4, kcne1, kcnh1, kcnh2, kcnj1, kcnj10, kcnj1, kcnj12, kcnj15,
kcnj3, kcnj4, kcnj5, kcnj6, kcnj6, kcnj7, kcnj8, kcnjn1, kcnk1,
kcnk2, kcnk3, kcnma1, kcnq1, kcnq2, kcnq3, kcnq4, kcns2, kd, kdr,
ke1, kera, kf1, kfs, kfsd, kfs1, khk, kiaa0122, kid, kid1, kif2,
kif3c, kif5b, kip1, kip2, kiss1, kit, klc2, klk1, klk2, klk3, klk3,
klkb1, klkr, klrb1, klrc1, klrc2, klrc3, klrc4, klrd1, klst, kms,
kms, kng, kno, kns1, kns2, kns11, kns14, kox1, kox11, kox12, kox13,
kox15, kox16, kox18, kox19, kox2, kox2, kox22, kox25, kox30, kox32,
kox4, kox5, kox6, kox7, kox9, kpna3, kpps1, kpps2, krag, kras1p,
kras2, krev1, krg2, krn1, krn11, krox20, krt1, krt10, krt12, krt13,
krt14, krt15, krt16, krt17, krt18, krt19, krt2a, krt2e, krt3, krt4,
krt5, krt6a, krt6b, krt7, krt8, krt9, krtha2, krtha5, krthb1,
krthb6, ks, ktn1, ku70, kup, kylqt1, kwe, 11.2, 11 cam, 123mrp,
lab7, lab72, lac, laci, lacs, lad, lad, lad1, laf4, lag3, lag5,
lair1, lak1, lalba, lal1, lam1, lama1, lama2, lama3, lama3, lama4,
lama5, lamb1, lamb2, lamb2, lamb2t, lamb3, lambr, lamc1, lamc2,
lamm, lamnb2, lamp, lamp1, lamp2, lamr1, lams, lap, lap18, laptm5,
lar, lar1, lard, large, lars, lbp, lbr, lca, lca1, lcad, lcamb,
lcat, lccs, lcfs2, lch, lck, lcn1, lcn2, lco, lcp1, lcp2, lct, ld,
ld78, ldb1, ldb2, ldc, ldh1, ldh3, ldha, ldhb, ldhc, ldlr, le,
lect2, lef1, lefty1, lefty2, lep, lepr, lerk5, lerk8, leu1, leu7,
leut, lfa1a, lfa3, lfh11, lfp, lga1s1, lga1s3, lga1s3 bp, lgals7,
lgcr, lgmd1, lgmd1a, lgmd1b, lgmd1c, lgmd1d, lgmd2b, lgmd2c,
lgmd2d, lgmd2e, lgmd2f, lgmd2g, lgmd2h, lgs, lgtn, lhb, lhcgr, lhs,
lhx1, lhx3, li, li2, lif, lifr, lig1, lig3, lig4, lim1, lim2,
limab1, limk1, limpii, lip2, lipa, lipb, lipc, lipd, lipe, lipo,
lis1, lis2, lisx, litaf, lkb1, lkn1, llg11, lman1, lmn1, lmn2,
lmna, lmnb1, lmnb2, lmo1, lmo2, lmo3, lmo4, lmo5, lmp10, lmp2,
lmp7, lmpx, lms, lmx1, lmx1a, lmx1b, lmyc, lnhr, lnrh, locr,
loh11cr2a, lor, lot1, lox, lox1, lox11, lpa, lpaab, lpaata, lpap
lpc1, lpc2d, lpd1, lph, lpi, lp1, lpna3, lpp, lps, lpsa, lqt1,
lqt2, lqt3, lqt4, lr3, lre1, lre2, lrp, lrp1, lrp2, lrp5, lrp7,
lrp8, lrpap1, lrpr1, lrs1, lsamp, lsirf, 1s1, lsn, lsp1, lss, lst1,
lta, lta4h, ltb, ltb4r, ltbp1, ltbp2, ltbp2, ltbp3, ltbp3, ltbr,
ltc4s, ltf, ltk, ltn, lu, lum, luxs, luzp, lw, ly64, ly6e, ly9,
lyam1, lyb2, lyf1, ly11, lyn, lyp, lyst, lyt10, lyz, lztr1, m11s1,
m130, m17s1, m17s2, m195, m1s1, m3s1, m4s1, m6a, m6b, m6p2, m6pr,
m6s1, m7v1, m7vs1, mab211, mac1a, mac2, mac25, macam1, macs, mad,
mad211, madd, madh1, madh2, madh3, madh4, madh5, madh6, madh6,
madh7, madh9, madm, madr1, maf, mafd1, mafd2, mag, mage1, mageb3,
mageb4, mage11, magoh, magp, magp1, magp2, mak, ma1, ma11, man2a2,
mana1, mana2, mana2x, manb, manb1, manba, maoa, maob, map1a,
map1a1c3, map1b, map1b1c3, map2, map4, map80, map97, mapk1,
mapkap3, mapkkk4, mapt, mar, mark3, mars, mas1, masp1, mat1a,
mat2a, mata1, mata2, matk, matn1, matn3, max, maz, mb, mbd1, mb1,
mb12, mbp, mbp1, mbs, mbs2, mc1r, mc2r, mc3r, mc4r, mc5r, mcad,
mcc, mcdc1, mcdr1, mcf2, mcf3, mcfd1, mch2, mch3, mch4, mch5, mckd,
mc1, mc11, mcm, mcm2, mcm2, mcm3, mcm6, mcm7, mcmt, mcop, mcor,
mcp, mcp1, mcp3, mcph1, mcr, mcs, mcsf, mcsp, mct1, md1, mdb, mdc,
mdcr, mddc, mdeg, mdf1, mdg, mdg1, mdh1, mdh2, mdk, mdk, mdm2,
mdm4, mdr1, mdr3, mdrs1, mdrv, mds, mds1, mdu1, mdu2, mdu3, mdx,
me1, me2, mea, mea6, mec11, mecp2, med, mef, mef2a, mef2b, mef2c,
mef2d, mefv, mehmo, meis1, meis2, mekk, mekk1, mekk4, me1, me118,
melf, memo1, men1, men2a, meox1, meox2, mep1a, mep1b, mer2, mer6,
mest, met, metrs, mfap1, mfap2, mfap3, mfap4, mfd1, mfi2, mfs1,
mfs2, mft, mfts, mg50, mga, mga1, mga3, mgat1, mgat2, mgat5, mgc1,
mgcn, mgcr, mgct, mgdf, mgea, mgf, mgi, mgmt, mgp, mgsa, mgst1,
mgst2, mhc, mhc2ta, mhp2, mhs, mhs2, mhs3, mhs4, mhs6, mia, mic10,
mic11, mic12, mic17, mic18, mic2, mic2x, mic2y, mic3, mic4, mic7,
mica, micb, mid1, midas, mif, mif, mig, mip, mip2a, mip2b, mip3b,
mipep, mitf, miwc, mjd, mk, mki67, mkks, mkp2, mkp3, mkpx, mks,
mks, mks1, mks2, mla1, mlck, mlf1, mlf2, mlh1, mlk1, mlk3, ml1,
ml12, ml1t1, ml1t2, ml1t3, ml1t4, ml1t6, ml1t7, mlm, mlm, mln, mlp,
mlr, mlrg, mlrw, mls, mltn, mlvar, mlvi2, mlvt, mmac1, mme, mmp1,
mmp10, mmp11, mmp12, mmp13, mmp14, mmp15, mmp16, mmp17, mmp19,
mmp2, mmp21, mmp22, mmp3, mmp7, mmp8, mmp9, mn, mn, mnb, mnbh,
mnda, mng1, mnk, mns, mnt, mocod, mocs1, mocs2, mody1, mody3, mog,
mok2, mom1, mos, mot2, mov34, mox1, mox2, mox44, moz, mp19, mpb1,
mpd1, mpdz, mpe, mpe16, mpg, mpi, mpif2, mp1, mp11 g, mpo, mpp1,
mpp2, mpp3, mppb, mpri, mpm, mps2, mps3a, mps3c, mps4a, mpsh, mpts,
mpv17, mpz, mr1, mr77, mrbc, mrc1, mre11, mre11a, mrg1, mrgh, mros,
mrp, mrp, mrp1, mrp123, mrs, mrsd, mrsr, mrst, mrx1, mrx14, mrx2,
mrx20, mrx21, mrx23, mrx29, mrx41, mrx48, mrx49, mrx9, mrxa, mrxs1,
mrxs2, mrxs3, mrxs4, mrxs5, mrxs6, mrxs8, ms3315, ms336, msg1,
msh2, msh3, msh4, msh6, msi1, msk16, msk39, msk41, mslr1, msmb,
msn, msr1, mss1, mss4, mss4, msse, mst, mst1, mstlr, mstd, mstn,
msud1, msx1, msx2, mt1a, mt1b, mt1e, mt1f, mt1g, mt1h, mt1i, mt1j,
mt1k, mt11, mt1x, mt2, mt2a, mt3, mtacr1, mtap, mtbt1, mtcp1,
mterf, mtf1, mth1, mthfc, mthfd, mthfr, mtk1, mtm1, mtmr1, mtmx,
mtnr1a, mtnr1b, mtp, mtpa, mtr, mtrns, mtrr, mts, mts, mts1, mts1,
mts2, mttf1, mtx, mtxn, mu, muc1, muc2, muc3, muc4, muc5, muc5ac,
muc5b, muc6, muc8, mu1, mum1, mupp1, musk, mut, mvk, mvlk, mvwf,
mwfe, mx, mx1, mx2, mxi1, mxs1, myb, myb11, myb12, mybpc1, mybpc2,
mybpc3, mybpcf, mybph, myc, myc11, myc12, myclk1, mycn, myd88,
myf3, myf4, myf5, myf6, myh1, myh10, myh11, myh12, myh2, myh3,
myh4, myh6, myh7, myh8, myh9, myk1, my1, my11, my12, my13, my14,
my15, mylk, mymy, myo10, myo15, myo1a, myo1c, myo1d, myo1e, myo5a,
myo6, myo7a, myo9b, myoc, myod1, myog, myp1, myp2, myp3, myr5,
mzf1, n33, nab1, nab2, nabc1, nac1a, naca, nacae, nacp, nadmr,
naga, nagc@, naglu, nagr1, naip, namsd, nanta3, nap114, nap2,
nap21, napb, naptb, nars, nat1, nat1, nat2, nb, nb4s, nbat, nbc3,
nbccs, nbccs, nbia1, nbs, nbs, nbs1, nca, ncad, ncam1, ncan, ncbp,
ncc1, ncc2, ncc3, ncc4, ncct, ncf1, ncf2, ncf4, nck, nc1, ncst2,
ncx1, ncx2, nd, ndhii, ndn, ndp, ndst1, ndufa1, ndufa2, ndufa5,
ndufa6, ndufa7, ndufb8, ndufb9, ndufs1, ndufs2, ndufs4, ndufs7,
ndufs8, ndufv1, ndufv2, ndufv3, neb, nec1, nec2, nedd1, nedd2,
nedd4, nefh, nef1, negf1, negf2, ne111, neb112, nem1, neo1, nep,
net, net1, neu, neu, neud4, neurod, neurod2, neurod3, nf1, nf1a,
nf2, nfatc1, nfatc2, nfatp, nfe1, nfe2, nfe211, nfe212, nfe2u,
nfia, nf1b, nfic, nfix, nfkb1, nfkb2, nfkb3, nfkbia, nfkbi11,
nfrkb, nfya, nfyb, nga1, ngbe, ngfb, ngfg, ngfic, ngfr, ng1, ngn,
nhbp, nhcp1, nhcp2, nhe1, nhe3, nhe4, nhe5, nhlh1, nhlh2, nhp211,
nhs, nid, niddm1, ninj1, nipp1, nipsnap1, nipsnap2, nis, nklr,
nkcc1, nkcc2, nkg2, nkg2a, nkg2c, nkg2e, nkg2f, nkhc, nkna, nknar,
nknb, nkrp1a, nks1, nksf2, nktr, nkx2a, nkx3.2, nkx3a, nkx6a, nli,
nm, nm1, nm23, nmb, nmbr, nmdar1, nmdar2a, nmdar2b, nmdar2c,
nmdar2d, nmdara1, nme1, nme2, nme4, nmor1, nmor2, nms1, nmyc, nnat,
nmnt, nno1, nog, no11, nos1, nos2a, nos2b, nos2c, nos3, not,
notch1, notch2, notch3, notch4, nov, nov, nov2, nova1, nova3, novp,
np, np10, npat, npc, npc1, npd, nph1, nph2, nph12, nphn, nphp1,
nphp2, nphs1, npm1, nppa, nppb, nppc, npps, npr1, npr2, npr3, nps1,
npt1, npt2, nptx2, npy, npy1r, npy2r, npy3r, npy5r, npy6r, nqo2,
nramp, nramp1, nramp2, nrap, nras, nrb54, nrcam, nrd1, nrf1, nrf1,
nrf2, nrgn, nrip1, nrk2, nr1, nrtn, nru, ns1, nsf, nsp, nsp11,
nsrd9, nt4, nt5, nt5, ntcp1, ntcp2, ntf3, ntf4, ntf5, nth11, ntn,
ntn, ntn21, ntrk1, ntrk2, ntrk3, ntrk4, ntrkr1, ntrkr3, nts, ntt,
ntt, nuc1, nucb1, numa1, nup214, nup98, nurr1, ny1, nys1, nys2,
nysa, oa1, oa2, oa3, oar, oasd, oat, oat11, oat22, oat23, oatp,
oaz, ob, ob10, obf1, obp, obr, oca2, ocm, ocp2, ocr1, ocr11, oct,
oct1, oct1, oct2, oct2, oct3, oct7, octn2, octs3, odc1, oddd, odf1,
odg1, odod, ofc1, ofc2, ofc3, ofd1, ofe og22, ogdh, ogg1, ogr1,
ogs1, ogs2, ohds, ohs, oias, oip1, ok, olf1, olfmf, olfr1, olfr2,
omg, omgp, omp, on, op2, opa1, opa2, opa3, opca3, opcm1, opd1,
opg1, ophn1, op11, opn, oppg, oprd1, oprk1, oprm1, oprt, opta2,
optb1, oqt1, orld2, orlf1, orc11, orc21, orc41, orc51, orfx, orm1,
orm2, orw, osbp, osm, osp, ost, ost48, osx, otc, otf1, otf2, otf3,
otm, otof, ots, otx1, otx2, ovc, ovcs, ovo11, ox40, oxa11, oxct,
oxt, oxtr, ozf, p, p, p1, p15, p16, p167, p28, p2rx3, p2rx4, p2ry1,
p2ry2, p2ry4, p2ry7, p2u, p2x3, p2x4, p2y1, p2y2, p2y2, p2y4,
p3p40phox, p450c11, p450c17, p450c2a, p450c2d, p450c2e,
p450scc,
p4ha, p4ha1, p4ha1, p4hb, p5cdh, p79r, pa2g4, pab1, pab2, pabp2,
pabp11, pac1, pac1, pacapr, pace, pace4, paep, paf1, paf2, pafah,
pafah1b1, pafah1b2, pafah1b3, paga, pah, pahx, pai1, pai2, paics,
pak1, pak3, pa1b, pals, pam, pang, pap, papa, papa2, pappa, par1,
par1, par2, par3, par4, par4, par5, park1, park2, park3, pawr,
pax1, pax2, pax3, pax4, pax5, pax6, pax7, pax8, pax9, pbca, pbcra,
pbfe, pbg pbt, pbx1, pbx2, pbx3, pc, pc1, pc2, pc3, pc3, pca1,
pcad, pcap, pcar1, pcbc, pcbd, pcbp1, pcbp2, pcca, pccb, pcdh7,
pcdx, pchc, pchc1, pci, pck1, pc1, pc1p, pcm1, pcm1, pcmt1, pcna,
pcnt, pcolce, pcp, pcp4, pcs, pcsk1, pcsk2, pcsk3, pcsk4, pcsk5,
pcsk6, pctk1, pctk3, pcyt1, pdb, pdb2, pdc, pdc, pdcd1, pdcd2,
pddr, pde1a, pde1b, pde1b1, pde3b, pde4a, pde4b, pde4c, pde4d,
pde5a, pde6a, pde6b, pde6c, pde6d, pde6g, pde6h, pde7a, pdea,
pdea2, pdeb pdeb, pdeg, pdes1b, pdgb, pdgfa, pdgfb, pdgfr, pdgfra,
pdgfrb, pdha1, pdha2, pdhb, pdj, pdk4, pdnp1, pdnp2, pdnp3, pdr,
pds, pds1, pdx1, pdyn, pe1, pea15, pebp2a1, pebp2a3, pecam1, ped,
ped, pedf, pee, peg1, peg3, pemp, penk, pent, peo, peo1, peo2,
pepa, pepb, pepc, pepd, pepe, pepn, peps, per, per2, peta3, pets1,
pex1, pex5, pex6, pex7, pf4, pf4v1, pfas, pfbi, pfc, pfd, pfhb1,
pfic1, pfic2, pfkfb1, pfkfb2, pfk1, pfk-mn, pfkp, pfkx, pf1, pfin,
pfn1, pfn2, pfrx, pga3, pga4, pga5, pgam1, pgam2, pgamm, pgc, pgd,
pgf, pgft, pgk1, pgk2, pgka, pg1, pg11, pg12, pgm1, pgm2, pgm3,
pgm5, pgn, pgp, pgp1, pgr, pgs, pgt, pgy1, pgy3, pha1, pha2, pha2a,
pha2b, phap1, phb, phc, phe1a, phe3, phex, phf1, phhi, phhi, phk,
phka1, phka2, phkb, phkd, phkg1, phkg2, ph1, ph111, phog, phox1,
phox2a, php, php1b, phpx, phyh, pi, pi10, pi3, pi4, pi5, pi6, pi7,
pi8, pi9, piga, pigc, pigf, pigh, pigr, pik3c2b, pik3ca, pik3r1,
pik4cb, pi1, pim1, pin, pin1, pin11, pip, pip5k1b, pir1, pir51,
pit, pit1, pitpn, pitx1, pitx2, pitx3, pjs, pk1, pk120, pk3, pk428,
pkca, pkcb, pkcc, pkcg, pkcs1, pkd1, pkd2, pkd4, pkdts, pkhd1,
pklr, pkm2, pkp1, pks1, pks1, pks2, pku1, p1, pla2, pla2a, pla2b,
pla2g1b, pla2g2a, pla2g4, pla2g4a, pla2g5, pla21, pla21, plag1,
plag11, planh1, planh2, planh3, plat, plau, plaur, p1b, plc, plc1,
plcb3, plcb4, plcd1, plce, plcg1, plcg2, plc1, pld1, plec1, plg,
plgf, plg1, pli, pln, plod, plod2, plos1, plp, pls, pls1, plt1,
pltn, pltp, plzf, pmca1, pmca2, pmca3, pmca4, pmch, pmch11, pmch12,
pmd, pme117, pmi1, pm1, pmm1, pmm2, pmp2, pmp22, pmp35, pmp69,
pmp70, pms1, pms2, pms11, pms12, pmx1, pn1, pnd, pnem, pnkd, pnlip,
pnmt, pnoc, pod1, podx1, pof, pof1, po12rb, po1a, po1b, pold1,
pold2, pole, polg, polr2a, polr2c, polr2e, polr2g, polr2i, polrmt,
polz, pomc, pon, pon1, pon2, pon3, por, porc, potx, poulf1,
pou2af1, pou3f1, pou3f2, pou3f3, pou3f4, pou4f1, pou4f3, pou5f1,
pp, pp4, pp2, pp4, pp5, ppac, ppard, pparg, pparg1, pparg2, ppat,
ppbp, ppcd, ppd, ppef1, ppef2, ppfia3, ppgb, pph, pph1, ppia, ppid,
ppi11, ppkb, ppks1, ppks2, pp1, ppla2, ppmx, ppnd, ppnoc, ppo1,
ppox, ppp1a, ppp1ca, ppp1cb, ppp1cc, ppp1r2, ppp1r5, ppp1r7,
pppd1r8, ppp2b, ppp2ca, ppp2cb, ppp2r1b, ppp2r4, ppp2r5a, ppp2r5b,
ppp2r5c, ppp2r5d, ppp2r5e, ppp3ca, ppp3cb, ppp3 cc, pp3r1, ppp4c,
ppp5c, ppt, ppt2, ppx, ppy, ppyr1, pr@, prad1, prb1, prb2, prb3,
prb4, prca1, prca2, prcc, prcp, prelp, prep, prf1, prg, prg1, prg1,
prgs, prh1, prh2, prim1, prim2a, prim2b, prip, prk1, prkaa1,
prkaa2, prkab1, prkaca, prkacb, prkacg, prkag1, prkag2, prkar1a,
prkar1b, prkar2b, prkca, prkcb1, prkcd, prkcg, prkci, prkcl1,
prkcnh1, prkcq, prkcsh, prkdc, prkg1, prkg1b, prkg2, prkgr1b,
prkgr2, prkm1, prkm3, prkm4, prkm9, prkn, prkr, prkx, prky, pr1,
prlr, prm1, prm2, prmt2, prnp, proa, proc, prodh, prohb, prop1,
pros1, pros30, prox1, prp8, prph, prps1, prps2, pipsap1, prr1,
prr2, prs, prsc1, prss1, prssl1, prss2, prss7, prss8, prssl1,
prtn3, prts, psa, psa, psach, psap, psbg1, psbg2, psc2, psc5, psca,
psd, psen1, psen2, psf1, psf2, psg1, psg11, psg12, psg13, psg2,
psg3, psg4, psg5, psg6, psg7, psg8, psg11, pskh1, psm, psma1,
psma2, psma3, psma5, psmb1, psmb10, psmb2, psmb3, psmb4, psmb5,
psmb8, psmb9, psmc1, psmc2, psmc3, psmc5, psmd7, psmd9, psme1,
psme2, psors1, psors2, psors3, psp, psps1, psps2, pss1, psst, pst,
pst, pst1, psti, ptafr, ptc, ptc, ptc, ptch, ptd, pten, ptgds,
ptger1, ptger2, ptger3, ptgfr, ptgfrn, ptgir, ptgs1, ptgs2, pth,
pthlh, pthr, pthr1, pthr2, ptk1, ptk2, ptk2b, ptk3, ptk7, ptlah,
ptma, ptms, ptn, ptos1, ptp18, ptp1b, ptp4a1, ptp4a2, ptpa, ptpa,
ptpd, ptpg, ptpg1, ptpgmc1, ptpn1, ptpn10, ptpn11, ptpn12, ptpn13,
ptpn14, ptpn2, ptpn5, ptpn6, ptpn7, ptpra, ptprb, ptprc, ptprcap,
ptprd, ptpre, ptprf, ptprg, ptprh, ptprj, ptprk, ptprl1, ptpr12,
ptprm, ptprn, ptpro, ptprs, ptprz1, ptpt, pts, ptslr, ptx1, ptx3,
pujo, pum, pur1, pur1, pura, pva1b, pvr, pvr11, pvr12, pvrr1,
pvrr2, pvs, pvt1, pwcr, pwp2, pwp2h, pws, pxaaa1, pxe, pxe1, pxf,
pxmp1, pxmp11, pxmp3, pxr1, pycr1, pycs, pygb, pyg1, pygm, pyk2,
pyst1, pyst2, pzp, qars, qdpr, qin, qm, qpc, qprs, rab, rab1,
rab13, rab1a, rab21, rab3a, rab3b, rab4, rab5, rab5a, rab6, rab7,
rabgd1a, rabgd1b, rabggta, rabggtb, rabif, rac2, rac3, rad1, rad17,
rad23a, rad23b, rad51a, rad51c, rad51 d, rad5311, rad52, rad54,
rad6a, rad6b, raf1, rafa1, ragi, rag2, rage, rala, ralb, ralgds,
ramp, ranbp211, ranbp3, rao, rap1a, rap1b, rap1ga1, rap1gds1,
rap2a, rap74, rapsn, rara, rarb, rarg, rars, rasa1, rasa2, rasgfr3,
rask2, rb1, rbbp2, rbbp5, rbbp6, rb11, rb12, rbm1, rbm2, rbm3,
rbmyla1, rbp1, rbp2, rbp3, rbp4, rbp5, rbp56, rbp6, rbq3, rbtn1,
rbtn11, rbtn12, rca1, rcac@, rcc1, rccp1, rccp2, rcd1, rcd2, rcdp1,
rcn1, rcn2, rcp, rcv1, rd, rdbp, rdc7, rdp, rdpa, rdrc, rds, rdt,
rdx, reca, recc1, recq1, red1, red2, reg, reg1a, reg1, re1, re1a,
reln, ren, renbp, rens1, rent1, rep8, req, ret, rev3, rev31, rfc1,
rfc2, rfc3, rfc4, rfc5, rfp, rfx1, rfx2, rfx5, rfxank, rfxap, rgc1,
rgr, rgs, rgs1, rgs14, rgs16, rgs2, rgs2, rgs3, rgs5, rh50a, rhag,
rhbd1, rhc, rhce, rhd, rheb2, rho, rho7, rhogap2, rhogap3, rhohl 2,
rhoh6, rhoh9, rhok, rhom1, rhom2, rhom3, rieg1, rieg2, rige, rigui,
ring1, ring10, ring11, ring12, ring3, ring31, ring4, ring5, ring6,
ring7, rip, rip140, riz, rk, r1, rlbp1, rlf, rln1, rln2, rmich1,
rmd1, rmrp, rmrpr, rn5s1, rnase1, rnase2, rnase3, rnase4, rnase5,
rnase6, rnase1, rnaseli, rne1, rnf1, rnf3, rnf4, rnf5, rnh, rnpep,
rnpulz, rnr1, rnr2, rnr3, rnr4, rnr5, rns1, ms2, ms3, ms4, rns4,
ms4i, rntmi, rnu1, rnu15a, rnu17a, rnu17b, rnu1a, rnu2, rnu3, ro52,
rom1, romk1, ron, ror1, rora, rorb, rorc, rorg, ros1, rospi, rox,
rp1, rp10, rp105, rp11, rp12, rp13, rp14, rp15, rp17, rp18, rp19,
rp2, rp22, rp24, rp25, rp3, rp4, rp6, rp7, rp9, rpa1, rpa2, rpa3,
rpd311, rpe, rpe65, rpe 119rp122, rp123a, rp1231, rp129, rp130,
rp135a, rp136a, rp17a, rpms12, rpn1, rpn2, rpo12, rps11, rps14,
rps17, rps17a, rps17b, rps1711, rps1712, rps18, rps20a, rps20b,
rps24, rps25, rps3, rps4x, rps4y, rps6, rps6ka1, rps6ka2, rps6ka3,
rps8, rpsm12, rptpm, rpu1, rpx, rrad, rras, rrbp1, rreb1, rrm1,
rrm2, rrp, rrp22, rs1, rs1, rscla1, rsk1, rsk2, rsk3, rsn, rss,
rsts, rsu1, rt6, rtef1, rtkn, rtn1, rtn2, rts, rts, rtt, rws, rxra,
rxrb, rxrg, ryr1, ryr2, ryr3, rzrb, rzrg, s100a1, s100a10, s100a11,
s100a12, s100a13, s100a2, s100a3, s100a4, s100a5, s100a6, s100a7,
s100a8, s100a9, s100b, s100d, s100e, s100, s100p, s152, s4, s7,
saa1, saa2, saa4, sacs, safb, sag, sah, sahh, sai1, sakap84, sal11,
sal12, sams1, sams2, sap, sap1, sap1, sap2, sap62, sar, sar1, sar2,
sard, sas, sat, satb1, satt, sbma, sc, sc1, sc5d1, sca1, sca10,
sca2, sca2, sca3, sca4, sca5, sca6, sca7, sca8, sca8, scar, scca1,
scca2, sccd, scd, sceh, scg1, scg2, scg3, schad, scida, scidx,
scidx1, sc1, sclc1, scl1, scn, scn1a, scn1b, scn2a, scn2a1, scn2a2,
scn2b, scn3a, scn4a, scn5a, scn6a, scn8a, scnn1a, scnn1b, scnn1d,
scnn1g, scot, scp, scp1, scp2, scpn, scra1, scra1, scs, sctr,
scya1, scya1, scya13, scya14, scya15, scya16, scya19, scya2,
scya21, scya22, scya24, scya25, scya3, scya311, scya4, scya5,
scya7, scya8, scyb5, scyb6, scyd1, sczd1, sczd2, sczd3, sczd4,
sczd5, sczd6, sczd7, sczd8, sdc1, sdc2, sdc4, sdf1, sdf2, sdh1,
sdh2, sdha, sdhb, sdhc, sdhd, sdhf, sds22, sdty3, sdys, se, sea,
sec1311, sec 13r, sec. 141, sec7, sed1, sedt, sef2, sel1l, sele,
sel1, selp, selplg, sema3f, sema4, sema5, semg, semg1, semg2, sen1,
sep, sepp1, serca1, serca3, serk1, ses1, set, sex, sf, sf1, sfa1,
sfd, sfind, sfrs1, sfrs2, sfrs7, sftb3, sftp1, sftp2, sftp4,
sftpa1, sftpa2, sftpb, sftpc, sfipd, sgb, sgca, sgcb, sgcd, sgcg,
sgd, sgk, sglt1, sglt2, sgm1, sgne1, sgp2, sgpa, sgsh, sh2d1a, sh3
bp2, sh3d1a, sh3gbr, sh3p17, shb, shbg, shc1, shc11, shfd1, shfd2,
shfin1, shfin2, shfin3, shh, ship, shmt1, shmt2, shoc2, shot, shox,
shox2, shps1, shs, shsf1, s1, siah1, siah2, siasd, siat1, siat4,
siat4c, siat8, sids, si1, silv, sim1, sim2, sipa1, sis, siv, six1,
six5, sja, sjs, ski, ski2, ski2w, skiv21, skp1a, skp1b, skp2, s1a,
slap, slbp, slc, sic10a1, slc10a2, slc12a1, s1c12a2, s1c12a3,
slc14a1, sic14a2, slc15a1, slc16a1, slc16a2, slc17a1, slc17a2,
slc18a1, slc18a2, sic18a3, sic19a1, slc1a1, slc1a2, slc1a3, slc1a4,
slc1a5, slc20a1, slc20a2, slc20a3, slc21a2, slc21a3, slc22a1,
slc22a2, slc22a5, slc2a1, slc2a2, slc2a3, slc2a4, slc2a5, slc2c,
slc3a1, slc4a1, slc4a2, slc4a6, slc5a1, slc5a2, slc5a3, slc5a5,
slc6a1, slc6a10, slc6a12, slc6a2, slc6a3, slc6a4, slc6a6, slc6a8,
slc6a9, slc7a1, slc7a2, slc7a4, slc7a5, slc7a7, slc8a1, slc8a2,
slc9a1, slc9a2, slc9a3, slc9a4, slc9a5, sld, sle1, sleb1, slim1,
sln, slo, slos, slp76, sls, slug, sm1, sm22, sma4, smad1, smad1,
smad2, smad3, smad4, smad5, smad6, smad7, smad9, sma1, smam1,
smarca1, smarca2, smarca3, smarca5, smarcb1, smax2, smc1, smcc,
smcr, smcx, smcy, sml1, smn, smn1, smn2, smnr, smo, smoh, smpd1,
sms, smt3, smt3h1, smtn, smubp2, sn, snap25, snat, snca, sncb,
sncg, snf2h, snf211, snf212, snf213, snf5, sn1, snn, snrp70, snrpa,
snrpe, snrpn, snt1, snt2b1, snt2b2, sntb1, snt1, snx, soat, sod1,
sod2, sod3, solh, son, sord, sor11, sos1, sos2, sox1, sox10, sox11,
sox2, sox20, sox22, sox3, sox4, sox9, sp1, sp1, sp3, sp3, sp4,
spa1, spag1, spag4, spam1, sparc, spat, spbp, spch1, spd, spf30,
spg3a, spg4, spg5a, spg6, spg7, spg8, spg9, spgp, spgy1a, sph2,
spi1, spink1, spk, spmd, spn, spp1, spp2, sppm, spr, sprk, sprr1a,
sprr1b, sprr2a, sprr2b, sprr2c, sprr3, sps1, spsma, spta1, sptan1,
sptb, sptbn1, sra1, sra2, src, src1, src1, src2, srd5a1, srd5a2,
srebf1, srebf2, sri, srk, srm, srn1, srp14, srp19, srp46, srpr,
srpx, srs, srvx, sry, ss, ss, ssa, ssa1, ssa2, ssadh, ssav1, ssbp,
ssdd, ssr2, ssrc, sst, sstr1, sstr2, sstr3, sstr4, sstr5, ssx1,
ssxt, st2, st3, st4, st5, st6, st8, sta, stac, stam, star, stat,
stat1, stat3, stat4, stat5, ssx1, stc1, stch, std, std, ste, step,
stf1, stfa, stfb, stgd1, stgd2, stgd3, stgd4, sthe, stk1, stk11,
stk15, stk2, stk6, st1, stm, stm2, stm7, stmy1, stmy2, stmy3, stp,
stp1, stp2, sts, sts1, stx, stx1b, stx7, stxbp1, stxbp2, sultl1,
supt6h, sur, sur1, surf1, surf2, surf3, surf4, surf5, surf6, svct2,
svmt, sw, sxi2, syb1, syb2, sybi1, sycp1, syk, sym1, syn1, syn2,
syn3, syngap, syns1, syp, syt, syt1, syt2, syt3, syt4, syt5, t,
t3d, taa16, taclr, tac2, tac2r, tac3, tacr1, tacr2, taf2, taf2a,
taf2a, taf2d, taf2h, taf2n, tafii100, tagln, tak1, tal1, ta12,
taldo1, tam, tan1, tap1, tap2, tapa1, tapbp, tapvr1, tars, tas,
task, tat, taut, tax, tax1, taz, tbg, tbp, tbp1, tbs, tbx1, tbx2,
tbx3, tbx5, tbxa2r, tbxas1, tc1, tc2, tcbp, tcd, tcea1, tceb11,
tceb3, tcf1, tcf12, tcf13, tcf1311, tcf14, tcf15, tcf17, tcf19,
tcf2, tcf20, tcf21, tcf3, tcf4, tcf5, tcf611, tcf612, tcf7, tcf8,
tcf9, tcfeb, tcfl1, tcfl4, tcl1, tcl1a, tcl2, tcl3, tcl4, tcl5,
tcn1, tcn2, tco, tcof1, tcp1, tcp10, tcp11, tcp228, tcpt, tcra,
tcrb, tcrd, tcrg, tcrz, tcs1, tcta, tcte1, tcte3, tcte11, tdf,
tdfa, tdfx, tdg, tdgf1, tdn, tdo, tdo2, tdt, tead4, tec, tec, teck,
tecta, tef, tegt, tek, te1, tem, tep1, terc, terf1, tert, tes1,
tesk1, tex28, tf, tf2s, tf6, tfai, tfam, tfap2a, tfap2b, tfap2c,
tfap4, tfcoup1, tfcoup2, tfcp2, tfdp1, tfdp2, tfe3, tff1, tff2,
tff3, tfiiia, tfn, tfpi, tfpi2, tfr, tfrc, tfs1, tft, tg, tg737,
tgb1, tgb2, tgd, tgfa, tgfb1, tgfb2, tgfb3, tgfb4, tgfbi, tgfbr1,
tgfbr2, tgfbr3, tgfbre, tgfr, tgm1, tgm2, tgm3, tgm4, tgn38, tgn46,
th, thas, thbd, thbp1, thbs1, thbs2, thbs3, thc, thh, th1, thop1,
thpo, thr1, thra, thra1, thra1, thrb, thrm, thrsp, thy1, tial1,
tiam1, tiar, tic, tie, tie1, tie2, tigr, ti1, ti13, ti14, tim,
timp, timp1, timp2, timp3, tinur, titf1, titf2, tjp1, tk1, tk2,
tkc, tkcr, tkr, tkt, tkt2, tkt11, tla519, tlcn, tle1, tle2, tle3,
tlh1, tln, tlr1, tlr2, tlr3, tlr4, tlrS, tm4sf1, tm4sf2, tm7sf2,
tmc, tmd, tmdci, tmem1, tmf1, tmip, tmod, tmp, tmpo, tmprss2, tms,
tmsa, tmsb, tmvcf, tna, tndm, tnf, tnfa, tnfaip1, tnfaip2, tnfaip4,
tnfaip6, tnfar, tnfb, tnfbr, tnfc, tnfcr, tnfr1, tnfr2, tnfrsf10b,
tnfrsf12, tnfrsf14, tnfrsf16, tnfrsf17, tnfrsf1a, tnfrsf1b,
tnfrsf4, tnfrsf5, tnfrsf6, tnfrsf6b, tnfrsf7, tnfrsf8, tnfrsf9,
tnfsf11, tnfsf12, tnfsf5, tnfsf6, tnfsf7, tnnc1, tnnc2, tnni1,
tnni2, tnni3, trnt1, tnnt2, tnnt3, tnp1, tnp2, tnr, tns, tnx, tnxa,
toc, top1, top2, top2a, top2b, top3, tp1, tp120, tp250, tp53, tp53
bp2, tp63, tp73; tpa, tpbg, tpc, tpc, tph, tph2, tpi1, tp12, tpm1,
tpm2, tpm3, tpm4, tpmt, tpo, tpo, tpp2, tpr, tpr1, tprd, tps1,
tps2, tpsn, tpst1, tpst2, tpt, tpt1, tptps, tpx, tpx1, tr, tr2,
tr4, tra1, traf1, traf5, trailr2, tran, trance, trap170, trc3,
trc8, tre, treb36, trek, trf1, trg1, trh, trhr, tric5, trio, trip1,
trip14, trip6, trk, trk1, trka, trkb, trkc, trke, tr11, tr12, trm1,
trm1, trm2, trma, trmi1, trmi2, trn, trn1, tro, trp1, trp1, trp2,
trp3, trpc1, trpm2, trpo, trps1, trps2, trq1, trr, trr3, trrap,
trsp, trt1, trt2, trv1, trv2, trv3, trv4, trv5, try1, try2, ts,
ts13, ts546, tsbn51, tsc tsc1, tsc2, tsd, tse1, tsg101, tsg7, tshb,
tshr, tsix, tsp3, tspy, tssc3, tst1, tst1, tsta3, tsy, ttc1, ttc3,
ttf, ttf1, ttf2, ttg2, ttim1, ttn, ttp, ttp1, ttpa, ttr, tuba3,
tubal1, tubb, tufin, tuft1, tulp1, tuple1, tw, tweak, twik1, twist,
txgp11, txk, txn, txnr, txnrd1, tyh, tyk1, tyk2, tyk3, tyms, tyr,
tyr1, tyro3, tyrp1, tyrp2, tys, ul7hg, ulmp, u22hg, u2af1,
u2aflrs1, u2aflrs2, u2aflrs3, uba52, ubb, ubc, ubc4, ubc7, ubc8,
ubch2, ubc1, ube1, ube2, ube2a, ube2b, ube2e2, ube2g, ube2g2,
ube2h, ube2i, ube211, ube2v1, ube3a, ubh1, ubid4, ub11, uch11, ucn,
ucp1, ucp2, ucp3, udpgdh, uev1, ufd11, ufs, ugalt, ugb, ugcg, ugdh,
ugn, ugp1, ugp2, ugpp2, ugt1, ugt1a1, ugt2b1, ugt2b15, ugt2b17,
ugt2b4, ugt2b7, ugt2b8, ugt2b9, ugt1, uhg, uhx1, ukhc, umod, umph2,
umpk, umps, unc18, unc18b, und, ung, unr, unr, uox, up, upk1b, ups,
uqbp, uqcrb, uqcrc1, uqcrc2, uqcrfs1, uqor1, uqor13, uqor22, urk,
urkr, uroc, urod, uros, usf1, usf2, ush1, ush1a, ush1b, ush1c,
ush1d, ush1e, ush1f, ush2a, ush3, usp11, usp5, usp7, usp9x, usp9y,
ut1, ut2, ute, utr, utrn, utx, uty, uv20, uv24, uvo, vacht, vacm1,
vamp1, vamp2, vars1, vasp, vat1, vat2, vav, vav1, vav2, vbch, vbp1,
vcam1, vcf, vc1, vcp, vdac1, vdac2, vdd1, vdi, vdr, vegf, vegfb,
vegfd, vegfr3, vgf, vg1, vgr1, vh1, vhr, vil1, vi12, vim, vip,
vipr1, vipr2, vis1, vla1, vla5a, vlacs, vlcad, vldlr, vmat1, vmcm,
vmd1, vmd2, vnra, vnt, vp, vpp1, vpp3, vpreb1, vpreb2, vrf, vrk1,
vrk2, vrnf, vrni, vsn11, vtn, vwf, vws, waf1, wars, was, wbs, wd1,
wdr2, wee1, wfrs, wfs, wfs1, wgn1, whcr, wi, wisp1, wisp2, wisp3,
wnd, wnt1, wnt10b, wnt13, wnt14, wnt15, wnt2, wnt3, wnt5a, wnt7a,
wnt7b, wnt8b, wrb, wrn, ws1, ws2a, ws2b, ws4, wsn, wss, wss, wt1,
wt2, wt3, wt4, wt5, wts, wts1, wws, x11, xbp1, xbp2, xce, xdh,
xe169, xe7, xe7y, xg, xgr, xh2, xiap, xic, xist, xk, xla, xla2,
xlp, xlpd, xlrs1, xm, xpa, xpb, xpc, xpcc, xpct, xpf, xpf, xpg,
xpmc2h, xpnpep2, xpo1, xrcc1, xrcc2, xrcc3, xrcc4, xrcc5, xrcc9,
xrs, xs, xwnt2, yb1, yes1, yk140, y11, yrrm1, yt, ywha1, ywhab,
ywhah, ywhaz, yy1, zac, zag, zan, zap70, zf87, zfin1, zfp3, zfp36,
zfp37, zfx, zfy, zic1, zic2, zic3, zipk, znf1, znf10, znf117,
znf11a, znf11b, znf12, znf121, znf123, znf124, znf125, znf126,
znf13, znf14, znf141, znf144, znf146, znf147, znf157, znf16,
znf160, znf162, znf163, znf165, znf169, znf173, znf179, znf189,
znf19, znf192, znf193, znf195, znf198, znf2, znf20, znf200, znf204,
znf217, znf22, znf23, znf24, znf25, znf26, znf27, znf29, znf3,
znf2, znf34, znf35, znf36, znf38, znf4, znf40, znf41, znf42, znf44,
znf45, znf46, znf5, znf6, znf69, znf7, znf70, znf71, znf72, znf73,
znf74, znf75, znf75a, znf75c, znf76, znf77, znf79, znf8, zn80,
znf8, znf83, znf9, znfc150, znfc25, znfxy, znt3, znt4, zp3a, zp3b,
zpk, zws1, and zyx.
[0239] Furthermore, genes from bacteria, plants, yeast, and mammals
(e.g., mice) can be used with the microorganisms provided herein.
Non-limiting examples of E. coli genes include: aarF, aas, aat,
abpS, abs, accA, accB, accC, accD, acd, aceA, aceB, aceE, aceF,
aceK, ackA, ackB, acnA, acnB, acpD, acpP, acpS, acpX, acrA, acrB,
acrC, acrD, acrE, acrF, acrR, acs, ada, add, adhB, adhC, adhE,
adhR, adiA, adiY, adk, aegA, aer, aes, agaA, agaB, agac, agaD,
agaI, agaR, agaS, agaV, agaW, agaZ, agp, ahpC, ahpF, aidB, ais,
alaS, alaT, alaU, alaV, alaW, alaX, aldA, aldB, aldH, alkA, alkB,
alpA, alr, alsA, alsB, alsC, alsE, alsK, alx, amiA, amiB, amn,
ampC, ampD, ampE, ampG, ampH, amtB, amyA, ansA, ansB, apaG, apaH,
aphA, appA, appB, appC, appY, apt, aqpZ, araA, araB, araC, araD,
araE, araF, araG, araH, araJ, arcA, arcB, argA, argB, argc, argD,
argE, argF, argG, argH, argI, argM, argP, argQ, argR, argS, argT,
argU, argV, argW, argX, argY, argZ, aroA, aroB, aroC, aroD, aroE,
aroF, aroG, aroH, aroI, aroK, aroL, aroM, aroP, aroT, arsB, arsC,
arsR, artI, artJ, artM, artP, artQ, ascB, ascF, ascG, asd, aslA,
aslB, asmA, asnA, asnB, asnC, asnS, asnT, asnU, asnV, asnW, aspA,
aspC, aspS, aspT, aspU, aspV, asr, asu, atoA, atoB, atoC, atoD,
atoS, atpA, atpB, atpC, atpD, atpE, atpF, atpG, atpH, atpI, avtA,
azaA, azaB, azl, bacA, baeR, baeS, barA, basR, basS, bax, bcp, bcr,
betA, betB, betI, betT, bfd, bfin, bfr, bglA, bglB, bglF, bglG,
bglJ, bglT, bglX, bioA, bioB, bioC, bioD, bioF, bioH, bioP, bipA,
birA, bisC, bisZ, blc, bolA, bRNQ, brnR, brnS brnT, btuB, btuc,
btuD, btuE, btuR, bymA, cadA, cadB, cadC, cafA, caiA, caiB, caiC,
caiD, caiE, caiF, caiT, calA, caiC, calD, can, carA, carB, cbl,
cbpA, cbt, cca, ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH,
cdd, cde, cdh, cdsA, cdsS, cedA, celA, celB, celC, celD, celF, cfa,
cfcA, chaA, chaB, chaC, cheA, cheB, cheR, cheW, cheY, cheZ, chpA,
chpB, chpR, chpS, cirA, citA, citB, cld, cipA, clpB, clpP, clpX,
cls, cmk, cmlA, cmr, cmtA, cmtB, coaA, cobS, cobT, cobU, codA,
codB, cof, cog?, corA, cpdA, cpdB, cpsA, cpsB, cpsC, cpsD, cpsE,
cpsF, cpsG, cpxA, cpxB, cpxP, cpxR, crcA, crcB, creA, creB, creC,
creD, crg, crl, crp, crr, csdA, csgA, csgB, csgD, csgE, csgF, csgG,
csiA, csiB, csiC, csiD, csiE, csiF, cspA, cspB, cspC, cspD, cspE,
cspG, csrA, csrB, cstA, cstC, cup, cutA, cutC, cutE, cutF,
cvaA(ColV), cvaB(ColV), cvaC(Co-lV), cvi(ColV), cvpA, cxm, cyaA,
cybB, cybC, cycA, cydA, cydB, cydC, cydD, cynR, cynS, cynT, cynX,
cyoA, cyoB, cyoC, cyoD, cyoE, cysA, cysB, cysC, cysD, cysE, cysG,
cysH, cysI, cysJ, cysK, cysM, cysN, cysP, cysQ, cysS, cysT, cysU,
cysW, cysX?, cysZ?, cytR, dacA, dacB, dacC, dacD, dadA, dadB, dadQ,
dadX, dam, dapA, dapB, dapD, dapE, dapF, dbpA, dcd, dcm, dcp, dcrB,
dctA, dctB, dcuA, dcuB, dcuC, ddlA, ddlB, ddpA, ddpB, ddpC, ddpD,
ddpF, ddpX, deaD, dedA, dedD, def, degP, degQ, degS, del, deoA,
deoB, deoC, deoD, deoR, dfp, dgd, dgkA, dgkR, dgoA, dgoD, dgoK,
dgoR, dgoT, dgsA, dgt, dicA, dicB, dicC, dicF, dinB, dinD, dinF,
dinG, dinI, dinY, dipZ, djlA, dksA, dld, dmsA, dmsB, dmsC, dnaA,
dnaB, dnaC, dnaE, dnaG, dnaI, dnaJ, dnaK, dnaL, dnaN, dnaQ, dnaT,
dnaX, dppA, dppB, dppC, dppD, dppF, dppG, dps, dsbA, dsbB, dsbC,
dsbG, dsdA, dsdC, dsdX, dsrA, dsrB, dut, dvl, dxs, ebgA, ebgB,
ebgC, ebgR, ecfa, eco, ecpD, eda, edd, efp, enirA, emrB, emrD,
emrE, endA, eno, entA, entB, entC, entD, entE, entF, envN envP,
envQ, envR, envT, envY, envZ, epd, EppA, minigene, EppB, minigene,
EppC, minigene, EppD, minigene, EppE, minigene, EppG, minigene,
EppH, minigene, era, esp, evgA, evgS, exbB, exbC, exbD, expA, exuR,
exuT, fabA, fabB, fabD, fabF, fabG, fabH, fabI, fabZ, fadA, fadB,
fadD, fadE, fadH, fadL, fadR, farR, fatA, fbaA, fbaB, fbp, fcl,
fcsA, fdhD, fdhE, fdhF, fdnG, fdnH, fdnI, fdoG, fdoH, fdoI, fdrA,
fdx, feaB, feaR, fecA, fecB, fecC, fecD, fecE, fecI, fecR, feoA,
feoB, fepA, fepB, fepC, fepD, fepE, fepG, fes, fexB, ffh, ffs,
fhlA, fhlB, fhuA, fhub, fhuD, fhuE, fhuF, fic, fimA, fimB, fimC,
fimD, fimE, fimF, fimG, fimH, fimI, fipB, fipC, fis, fiu, fixA,
fixB, fixC, fixX, fklB, fkpA, fldA, flgA, flgB, flgC, flgD, figE,
flgF, flgG, flgH, flgI, flgJ, flgK, flgL, flgM, flgN, flhA, flhB,
flhc, flhD, fliA, fliC, fliD, fliE, fliF, fliG, fliH, fliI, fliJ,
fliK, fliL, fliM, fliN, fliO, flip, fliQ, fliR, fliS, fliT, fliY,
fliZ, flk, flu, fmt, fnr, focA, focB, folA, folC, folD, folE, folK,
folP, foIX, fpr, frdA, frdB, frdc, frdD, frr, fruA, fruB, fruK,
fruR, fsr, ftn, ftsA, ftsE, ftsI, ftsJ, ftsK, ftsL, ftsN, ftsQ,
ftsW, ftsX, ftsY, ftsZ, fucA, fucI, fucK, fucO, fucP, fucR, fuimA,
fumB, fumC, fur, fusA, fusB, gabc gabD, gabP, gabT, gadA, gadB,
gadR, galE, galF, galK, galM, galP, gaiR, galS, galT, galU, gapA,
gapC, garA, garB, gatA, gatB, gatc, gatD, gatR, gatY, gatz, gcd,
gcl, gcpE, gcvA, gcvH, gcvP, gcvR, gcvT, gdhA, gef, ggt, gidA,
gidB, gip, glcB, glcC, glcD, glcE, glcG, gldA, glf, gigA, glgB,
glgC, glgP, glgS, glgX, glk, glmM, gimS, glmU, glmX, glnA, glnB,
glnD, glnE, glnG, glnH, glnK, glhL, glnP, glnQ, glnR, ginS, glnT,
glnU, glnV, glnW, glnX, gloA, gipA, gipB, glpC, glpD, gipE, gipF,
gipG, glpK, glpQ, gipR, glpT, glpx, gltA, gltB, gltD, gltE, gltF,
gltH, gltJ, gltK, gltL, gltM, gltP, gltR, gltS, gltT, gltU, gltv,
gltW, gltX, glyA, glyQ, glyS, glyT, glyU, glyv, glyW, glyX, glyY,
gmd, gmk, gmm, gnd, gntK, gntp, gntR, gntS, gntT, gntu, gntv, goaG,
gor, gph, gpmA, gpp, gprA, gprB, gpsA, gpt, greA, greB, groL, groS,
grpE, grxA, grxB, grxc, gshA, gshB, gsk, gsp, gsp*, gst, guaA,
guaB, guaC, gurB, gurC, gutM, gutQ, gyrA, gyrB, hcaB, hcaC, hcaD,
hcaE, hcaF, hcaR, hcaT, hdeA, hdeB, hdeD, hdhA, helD, hemA, hemB,
hemC, hemD, hemE, hemF, hemG, hemH, hemK, hemL, hemM, hemX, hemY,
hepA, het, hflB, hfiC, hflK, hflX, hfq, hha, hipA, hipB, hisA,
hisB, hisC, hisD, hisF, hisG, hisH, hisI, hisJ, hisM, hisP, hisQ,
hisR, hisS, hipA, hlyE, hmp, hns, holA, holB, holC, holD, holE,
hopB, hopC, hopD, hpt, hrpA, hrpB, hrsA, hscA, hscB, hsdM, hsdR,
hsdS, hslC, hslD?, hslE-H, hslJ, hsIK, hsIL-N, hslO-R, hslU, hsIV,
hslW, htgA, htpG, htpx, htrB, htrC, htrE, htrL, hupA, hupB, hyaA,
hyaB, hyaC, hyaD, hyaE, hyaF, hybA, hybB, hybC, hybD, hybE, hybF,
hybG, hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, hycI, hydA,
hydG, hydH, hydN, hyfA, hyfB, hyfC, hyfD, hyfE, hyfF, hyfG, hyfH,
hyfI, hyfJ, hyfR, hypA, hypB, hypc, hypD, hypE, hypF, iadA, iap,
ibpA, ibpB, icd, iclR, ihfA, ihfB, ileR, ileS, ileT, ileU, ileV,
ileX, ileY, ilvA, ilvB, ilvC, ilvD, ilvE, ilvF, ilvG, ilvH, ilvI,
ilvJ ilvM, ilvN, ilvR, ilvU, ilvY, imp, inaA, inaR?, infA, infB,
infC, inm, insA(IS1), intA, isb(IS1), isfA, ispA, ispB, KanR, katE,
katG, kba, kbl, kch, kdgK, kdgR, kdgT, kdpA, kdpB, kdpC, kdpD,
kdpE, kdpF, kdsA, kdsB, kdtA, kdtB, kefB, kefC, kgtp, ksgA, ksgB,
ksgC, ksgD, lacA, lacI, lacY, lacZ, lamB, lar, ldcC, ldhA, lepA,
lepB, leuA, leuB, leuC, leuD, leuJ, leuO, leuP, leuQ, leuR, leuS,
leuT, leuU, leuV, leuW, leuX, leuY, leuZ, lev, lexA, lgt, lhr,
ligA, ligT, linB, lipA, lipB, lit, livF, livG, livH, livJ, livK
livM, lidD, lldP, lldR, lolA, lon, lpcA, lpcB, lpd, lplA, lpp,
lpxA, lpxB, lpxC, lpxD, lpxK, lrb, lrhA, lrp, lrs lspA, lysA, lysC,
lysP, lysQ, lysR, lysS, lysT, lysU, lysV, lysW, lysX, lysY, lysZ,
lytA, lytB, lyx, maa, mac, mae, mafA, mafB, malE, malF, maIG, malI,
malK, malM, malP, malQ, malS, malT, maiX, malY, malZ, manA, manC,
manX, manY, manZ, map, marA, marB, marR, mbrB, mcrA, mcrB, mcrc,
mcrD, mdaB, mdh, mdoB, mdoG, mdoH, meb, melA, melB, melR, menA,
menB, menC, menD, menE, menF, mepA, mesJ, metA, metB, metC, metD,
metE, metF, metG, metH, metJ, metK, metL, metR, metT, metU, metV,
metW, metY, metZ, mfd, mglA, mglB, mglC, mglR, mgsA, mgtA, mhpA,
mhpB, mhpC, mhpD, mhpE, mhpF, mhpR, miaA, miaD, micF, minC, minD,
minE, mioC, mltA, mltB, mltC, mltD, mmrA(rhlB?), mng, mntA, moaA,
moaB, moaC, moaD, moaE, mobA, mobB, moc, modA, modB, modC, modE,
modF, moeA, moeB, mog, molR, motA, motB, mpl, mppA, mprA, mraA--?,
mraY, mrcA, mrcB, mrdA, mrdB, mreB, mreC, mreD, mrp, mrr, msbA,
msbB, mscL, msrA, msyB, mtg, mtgA, mtlA, mtlD, mtlR, mtr, mttA,
mttB, mttC, mukB, mukE, mukF, mul, murA, murB, murC, murD, murE,
murF, murG, murH, murI, mutG(putative), mutH, mutL, mutM, mutS,
mutT, mutY, nac, nadA, nadB, nadC, nadE, nagA, nagB, nagC, nagD,
nagE, nalB, nalD, nanA, nanE, nanK, nanR, nanT, napA, napB, napC,
napD, napF, napG, napH, narG, narH, narI, narJ, narK, narL, narP,
narQ, narU, narV, narW, narX, narY, narZ, ndh, ndk, neaB, nei,
nemA, nfi, nfnA, nfnB, nfo, nfrA, nfrB, nfrD, nfsA, nhaA, nhaB,
nhaR, nikA, nikB, nikC, nikD, nikE, nirB, nirC, nirD, nlpA, nlpB,
nlpC, nlpD, nmpC(qsr'), non, npr, nrdA, nrdB, nrdD, nrdE, nrdF,
nrdG, nrfA, nrfB, nrfc, nrfD, nrfE, nrfF, nrfG, nth, ntpA, nuoA,
nuoB, nuoC, nuoE, nuoF, nuoG, nuoH, nuoI, nuoJ, nuoK, nuoL, nuoM,
nuoN, nupC, nupG, nusA, nusB, nusG, nuvA, nuvC, ogrK, ogt, ompA,
ompC, ompF, ompG, ompR, ompT, ompX, oppA, oppB, oppC, oppD, oppE,
oppF, opr, ops, oraA, ordL, orf-23(purB, reg)orf195(nikA-reg), orn,
osmB, osmC, osmE, osmY, otsA, otsB, oxyR, oxyS, pabA, pabB, pabC,
pac, pal, panB, panC, panD, panF, parC, parE, pat, pbpG, pck, pcm,
pcnB, pdhR, pdxA, pdxB, pdxH, pdxJ, pdxK, pdxL, pdxY, pepA, pepD,
pepE, pepN, pepP, pepQ, pepT, pfkA, pflB, pflA, pflB, pflC, pflD,
pfs, pgi, pgk, pgl, pgm, pgpA, pgpB, pgsA, pheA, pheP, pheS, pheT,
pheU, pheV, phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK,
phnL, phnM, phnN, phnO, phnP, phoA, phoB, phoE, phoH, phoP, phoQ,
phoR, phoU, phrB, phxB, pin, pioO, pit, pldA, pldB, plsB, plsC,
plsX, pmbA, pncA, pncB, pnp, pntA, pntB, pnuC, poaR, polA, polB,
popD, potA, potB, potC, potD, potE, potF, potG, potH, potI, poxA,
poxB, ppa, ppc, pphA, pphB, ppiA, ppiB, ppiC, ppk, pppA, pps, ppx,
pqiA, pqiB, pqqL, pqqM, prc, prfA, prfB, prfC, priA, priB, priC,
priC, prlZ, prmA, prmB, proA, proB, proC, proK, proL, proM, proP,
proQ, proS, proT, proV, proW, proX, prpA, prpC, prpR, prr, prs,
psd, psiF, pspA, pspB, pspC, pspE, pspF, pssA, pssR, pstA, pstB,
pstC, pstS, psu, pta, pth, ptrA, ptrB, ptsG, ptsH, ptsI, ptsN"-",
ptsP, purA, purB, purc, purD, purE, purF, purH, purK, purL, purM,
purN, purP, purR, purT, purU, pus, putA, putP, pykA, pykF, pyrB,
pyrC, pyrD, pyrE, pyrF, pyrG, pyrH, pyrI, qmeC, qmeD, qmeE, qor,
queA, racC, racR, radA, radC, ranA, rarD, ras, rbfA, rbn, rbsA,
rbsB, rbsC, rbsD, rbsK, rbsR, rcsA, rcsB, rcsC, rcsF, rdgA, rdgB,
recA, recB, recC, recD, recE, recF, recG, recJ, recN, recO, recQ,
recR, recT, relA, relB, relE, relF, relX, rep, rer, rfaB, rfaC,
rfaD, rfaF, rfaG, rfaH, rfaI, rfaJ, rfaK, rfaL, rfaP, rfaQ, rfaS,
rfaY, rfaZ, rfbA, rfbB, rfbC, rfbD, rfbX, rfc, rfe, rffA, rffC,
rffD, rffE, rffG, rffhI, rffM, rffT, rhaA, rhaB, rhaD, rhaR, rhaS,
rhaT, rhIB, rhIE, rho, ribA, ribB, ribc, ribD, ribE, ribF, ridA,
ridB, rimB, rimC, rimD, rimE, rimG, rimH, rimI, rimJ, rimK, rimL,
rimM, rit, ripA, rlpB, rluA, rluC, rluD, rmf, rna, rnb, rnc, rnd,
rne, rnhA, rnhB, rnk, rnpA, rnpB, rnr, rnt, rob, rorB, rpe, rph,
rpiA, rpiB, rpiR, rplA, rplB, rplC, rplD, rplE, rplF, rplI, rplJ,
rplK, rplL, rplM, rplN, rplO, rplP, rplQ, rplR, rplS, rplT, rplU,
rplV, rplW, rplX, rplY, rpmA, rpmB, rpmC, rpmD, rpmE, rpmF, rpmG,
rpmH, rpmI, rpmJ, rpoA, rpoB, rpoC, rpoD, rpoE, rpoH, rpoN, rpoS,
rpoZ, rpsA, rpsB, rpsC, rpsD, rpsE, rpsF, rpsG, rpsH, rpsI, rpsJ,
rpsK, rpsL, rpsM, rpsN, rpsO, rpsP, rpsQ, rpsR, rpsS, rpsT, rpsU,
rrfA, rrfB, rrfC, rrfD, rrfE, rrfF, rrfG, rrfH, rrlA, rrlB, rrlC,
rrlD, rrlE, rrlG, rrlH, rrmA, rrsA, rrsB, rrsC, rrsD, rrsE, rrsG,
rrsH, rsd, rseA, rseB, rseC, rspA, rspB, rssA, rssB, rsuA, rtcA,
rtcB, rtcR, rtn, rus(qsr'), ruvA, ruvB, ruvC, sad, sanA, sapA,
sapB, sapC, sapD, sapF, sbaA, sbcB, sbcC, sbcD, sbmA, sbmC(gyrI),
sbp, sdaA, sdaB, sdaC, sdhA, sdhB, sdhC, sdhD, sdiA, sds, secA,
secB, secD, secE, secF, secG, secY, selA, selB, selC, selD, semA,
seqA, serA, serB, serC, serR serS, serT, serU, serV, serW, serX,
sfa, sfcA, sfiC, sfsA, sfsB, shiA, sipC, sipD, sir, sixA, sloB,
slp, slr, slt, slyD, slyX, smp, smtA, sodA, sodB, sodC, sohA, sohB,
solA, soxR, soxS, speA, speB, speC, speD, speE, speF, speG, spf,
spoT, sppA, spr, srlA, srlB, srlD, srlE, srlR, srmB, srA, ssaE,
ssaG, ssaH, ssb, sseA, sseB, sspA, sspB, ssrA, ssrS, ssyA, ssyD
stfZ, stkA, stkB, stkC, stkD, stpA, strC, strM, stsA, sucA, sucB,
sucC, sucD, sufI, sugE, suhA, suhB, sulA, supQ, surA, surE, syd,
tabC, tag, talA, talB, tanA, tanB, tap, tar, tas, tauA, tauB, tauC,
tauD, tbpA, tdcA, tdcB, tdcC, tdcD, tdcE, tdcF, tdcG, tdcR, tdh,
tdi tdk, tehA, tehB, tesA, tesB, tgt, thdA, thdC, thdD, thiB?,
thiC, thiD, thiE, thiF, thiG, thiH, thiI, thiJ, thiK, thiL, thiM,
thrA, thrB, thrC, thrS, thrT, thrU, thrV, thrW, thyA, tig, tktA,
tktB, tldD, tlnA, tmk, tnaA, tnaB, tnaC, tnm, tol-orf1, tol-orf2,
tolA, tolB, tolC, tolD, tolE, tolI, tolJ, tolM, tolQ, toIR, tonB,
topA, topB, torA, torC, torD, torR, torS, torT, tpiA, tpr, tpx,
treA, treB, treC, treF, treR, trg, trkA, trkD, trkG, trkH, trmA,
trmB, trmC, trmD, trmE, trmF, trmH, trmU, trnA, trpA, trpB, trpC,
trpD, trpE, trpR, trpS, trpT, truA, truB, trxA, trxB, trxC, tsaA,
tsf, tsmA, tsr, tsx, ttdA, ttdB, ttk, tufA, tuffB, tus, tynA, tyrA,
tyrB, tyrP, tyrR, tyrS, tyrT, tyrU, tyrV, ubiA, ubiB, ubiC, ubiD,
ubiE, ubiF, ubiG, ubiH, ubiX, ucpA[ ], udk, udp, ugpA, ugpB, ugpC,
ugpE, ugpQ, uhpA, uhpB, uhpC, uhpT, uidA, uidB, uidR, umuC, umuD,
ung, upp, uppS, ups, uraA, usg-l, usbA, uspA, uup, uvh, uvrA, uvrB,
uvrC, uvrD, uvs, uxaA, uxaB, uxaC, uxuA, uxuB, uxuR, valS, valT,
valU, valV, valW, valX, valY, vaIZ, vsr, wrbA, xapA, xapB, xapR,
xasA, xerC, xerD, xni, xseA, xseB, xthA, xylA, xylB, xylE, xylF,
xylG, xylH, xylR, yccA, yhhP, yihG, yjaB, fl47, yjaD, yohF, yqiE,
yrfE, zipA, zntA, znuA, znuB, znuC, zur, and zwf.
[0240] Non-limiting examples of mouse genes include: Ilr1, Ilr2,
Gas10, Tnp1, Inhbb, Inha, Creb1, Mpmv34, Acrd, Acrg, Il110, Otf1,
Rab11b-r, Abl1, ald, Amh-rs1, Bc12B, Cchlla3, Ccnb1-rs2, Gpcr16,
Htr5b, Idd5, Igfbp2, Igfbp5, I18rb, Kras2-rs1, Mov7, Mpmv6, Mpmv16,
Mpmv22, Mpmv25, Mpmv29, Mpmv42, Mtv7, Mtv27, Mtv39, Oprk1,
Otf3-rs1, Otf8, Otf11-rs1, Ptgs2, Ren1, Ren2, Ril3, Sxv, Taz4-rs1,
Tgfb2, Wnt6, Xmmv6, Xmmv9, Xmmv36, Xmmv61, Xmmv74, Xmv21, Xmv32,
Xmv41, I12ra, Ab1, Mpmv3, Rapla-ps2, anx, Mpmv43, Ryr3, Ras12-4,
Adra2b, Avp, Glvr1, Il1a, Il1b, Mpmv28, Oxt, Pcsk2, a, Xmv10, Tcf4,
Acra, Acra4, Ak1, Bdnf, bs, Cyct, Cyp24, Dbh, Fshb, Gcg, Gdf5,
Gnas, Gpcr8, Grin1, Hcs4, Hior2, Hsp84-2, Idd12, Ilrn, Jund2,
Kras3, Mc3r, Mpmv14, Mtv40, Mxi1-rs1, Otf3-rs2, Ptgs1, Ptpra,
Rapsn, Src, Svp1, Svp3, Tcf3b, Wt1, Xmmv71, Xmv48, Ccna, Fgf2,
Fth-rs1, Csfm, Mov10, Egf, Acrb2, Cap1, Crh, Fim3, Fps11, Glut2,
Gpcr2, Gria2, Hsd3b-1, Hsd3b-2, Hsd3b-3, Hsd3b-4, Hsp86-ps2, Idd3,
I12, I17, Mpvmv9, Mpmv20, Mtv4.8, Ngfb, Npra, Nras, Nras, Ntrk,
Otf3-rs3, Otf3-rs4, Rap1a, Tshb, Xmmv22, Xmmv65, Mos, Ras12-7, Lyr,
Ifa, Ifb, Jun, azh, db, Ipp, Mp1, Do1, Ak2, Ccnb1-rs4, Cdc211, Cga,
Fgr, Foc1, Fps12, Gabrr1, Gabrr2, Gdf6, Glut1, Gnb1, Gpcr14,
Grb2-ps, Grik3, Grik5, Hsp86-1ps4, Htr1da, Htr1db, Idd9, Ifa1,
Ifa2, Ifa3, Ifa4, Ifa5, Ifa6, Ifa7, Ifa8, Ifa9, Ifa10, Lap18,
Lmyc1, Mpmv19, Mpmv44, Mtv13, Mtv14, Mtv17, Nppb, Otf6, Otf7, Ri12,
Ski, Tnfr2, Wnt4, Xmmv8, Xmmv23, Xmmv62, Xmv1, Xmv2, Xmv8, Xmv9,
Xmv14, Xmv44, Xpa, Tec, Fgf5, Nos1, Tcf1, Epo, Gnb2, Flt1, Flt3,
Ache, Adra2c, Adrbk2, Afp, Alb1, Ccnb1-rs1, Clock, Cyp3, Cyp3a11,
Cyp3a13, Drd1b, Drd5, Fgfr3, Flk1, Gc, Gnrhr, Gpcr1, Hcs5, Hnf1,
Htr5a, I15r, I16, Kit, Ltrm3, Mgsa, Mpmv7, Mpmv13, Mpmv23, Mtv32,
Mtv41, Pdgfa, Pdgfra, Por, Txk, Xmmv3, Xmmv5, Xmmv52, Xmv17, Xmv28,
Xmv34, Xmv38, Xmv45, Zp3, Trh, Raf1, Fth-rs2, Ntf3, Kras2, Pthlh,
Mov1, Alox5, Braf2, Cftr, Egr4, Fpsl10, Fgf6, Gdf3, Ghrfr, Glut3,
Grin2a, Hior3, Hoxa10, hop, Ica1, I15r, Int41, Itpr1, Krag, Mad,
Met, Mi, Mtv8, Mtv23, Mtv29, Mtv33, Mtv34, Nkna, Npy, ob, Otf3-rs5,
Tgfa, Tnfr1, Wnt2, Wnt5B, Wnt7A, Xmmv27, Xmv24, Xmv61, Fosb, Ryr1,
Ngfa, Ufo, Xrcc1, Abpa, Abpga, Gabra4, Gas2, Acra7, Ccnb1-rs7,
Egfbp3, Xmv30, Zp2, Fes, Pcsk3, Calc, Ccnb1-rs10, Pth, Ad, Bc13,
Cea, Cea2, Cea3, Cea4, Cea5, Cea6, Cebp, Dm9, Dm15, Drd4, Egfbp1,
Egfbp2, Ercc2, Fgf3, Fgfr2, Gabra5, Gabrb3, Gtx, Hcs1, Igf1r, Igf2,
I14r, Ins2, Int40, Lhb, Mpmv1, Mtv1, Mtv35, Ngfg, Ntf5, Otf2, 2,
Pkcc, Ras14, Rras, Ryr, Svp2, Tcf3g, Tgfb1, tub, Xmmv31, Xmmv35,
Xmmv73, Xmv33, Xmv53, Taz83, Adrb3, Junb, Jund1, Me1, Gpcr19-rs2,
Agt, Cadp, Ccnb1-rs9, E, Fgfr1, Gas6, Gnb-rs1, Hcs2, Insr, Maf,
Mov34, Mpmv21, Mpmv41, Mtv21, Mtnr1a, Plat, Ras15-2, Ras16, Sntb2,
Xmmv29, Xmv12, Xmv26, Xmv62, Epor, Gpcr13, Otf11, Pthr, Acra3,
Acra5, Acrb4, Camk1, Cdc25Mm, Crbp, Crbp2, Csk, Cyp11a, Cyp19,
Drd2, Ets1, Fli1, Gnai2, Gnat1, Gpcr6, Gria4, Hgf1, Hior1, Hpx,
Hsp86-1ps3, Hst2, Idd2, I11bc, Lag-rs1, Lap18-rs1, M11, Mpmv27,
Penk, Pgr, Ras12-2, Tp11, Trf, Xmmv2, Xmmv67, Xrny15, Xmv16, Xmv25,
Xmv60, Mgf, Amh, Braf, Cdc2a, Dmd1, Estr, Fps13, Fps14, Fps15, Gli,
Gpcr17, Grik2, Ifgr, Igf1, Mpmv5, Mpmv12, Mpmv40, Myb, Oprm, Pg,
Pmch, Ros1, Xmv31, Xmv51, Xmv54, Camk2b, Egfr, Int6, Lif, Mtv44,
Ews, Csfgm, Flt4, I13, I14, I15, Irf1, Gria1, Glut4, Crhr, Csfg,
Mov9, Xmv20, Acrb, Mpmv4, Mpmv15, Ngfr, Nos2, Rara, Taz4, Tcf2,
Xmv42, Mtv3, Adra1, Crko, df, Erbb2, Gabra1, Gabra6, Gabrg2, Gh,
Glra1, Grb2, Hnf1b, Hsp86-ps1, Idd4, Igfbp1, Igfbp3, I113, Int4,
Mpmv2, Mpmv8, Mpmv18, Mtv45, nu, Pkca, Rab1, Re1, Shbg, Tcf7, Thra,
Tnz1, Trp53, Wnt3, Wnt3A, Xmv4, Xmv5, Xmv47, Xmv49, Xmv63, Akt,
Amh-rs4, Ccs1, Fps16, Fos, Gdf7, Hcs3, Hsp70-2, Hsp84-3, Hsp86-1,
hyt, Ltrm1, Max, Mpmv11, Mpmv24, Mtv9, Mtv30, Pomc1, Tcf3a, Tda2,
Tgfb3, Tpo, Tshr, Xrnmv21, Xmmv25, Xmmv34, Xmmv50, Gli3, Xmv55,
Ryr2, Inhba, Gas1, Pcsk1, Amh-rs2, Ccnb1-rs6, Ccnb1-rs13, Crhpb,
Dat1, Drd1a, Fgfr4, Fps17, Fim1, Gpcr15, Gpcr18, Hbvi, Hilda,
Htr1a, Idd11, I19, Ltrm4, Mak, mes, P11, P12, Pr1, Ra1, Rasa,
Srd5a1, Tpbp, Xmv13, Xmv27, Rarb, Rbp3, Htr2, Rb1, Acra2, Camkg,
Cch11a2, Ccnb1-rs5, Ccnb1-rs12, Gnrh, Mty11, Nras-ps, Otf3-rs6,
Plau, Ptprg, Trp53-ps, Wnt5A, Xmv19, Ghr, I17r, Lifr, Mlvi2, Prlr,
Myc, Ril1, cog, Amh-rs7, I12rb, Pdgfb, Acr, CP2, Rarg, Sp1-1, Wnt1,
Afr1, Atf4, Bzrp, Ccnb1-rs11, Cyp11b, I13rb1, I13rb2, Ins3, Itga,
Mlvi1, Mlvi3, Mtv36, Pdgfec, Svp5, Tef, Trhr, Wnt7B, Xmmv55,
Xmmv72, Xmv37, Tnp2, Ets2, Casr, Chuck-rs1, din, Drd3, Erg, G22p1,
Gap43, Gas4, Grik1, Htr1f, Ifgt, Int53, Ltrm2, Mpmv17, Mtv6, Mtvr1,
Pit1, Xmv3, Xmv35, Xmv50, Igf2r, Mas, Tcd3, Glp1r, Idd1, Tla, Aeg1,
Ccnb1-rs3, Cdc2b, Csi, Cyp21, Cyp21-ps1, Fps18, Gna-rs1,
Gpcr19-rs1, Grr1, Grr2, Hom1, Hsc70t, Hsp70, Hsp70-1, Hsp70-3,
Hsp84-1, Hst1, Hst4, Hst5, Hst6, Hye, Int3, Itpr3, Lap18-rs2, Otf3,
Ptprs, Rab11b, Ras12-1, Ras12-3, Ras13, Rrs, Rxrb, Tas, Tcd1, Tcd2,
Tera1, Tla-rs, Tnfa, Tnfb, Tpx1, Tpx2, Xmmv15, Xmv36, Xmv57,
Csfinr, Pdgfrb, Adrb2, Apc, Camk2a, Camk4, Dcc, Fgf1, Gna1, Gpcr7,
Gr11, Grp, Hsp74, Mcc, Mtv2, Mtv38, Ptpn2, Tp12, Xmv22, Xmv23,
Xmv29, Fth, Csfgmra, Mxi1, Adra2a, Adrb1, Adrbk1, Chuck, Cyp17,
Gna14, Gnb-ps1, Hcs6, Htr7, Ide, Ins1, Lpc1, Pomc2, Seao, Tlx1,
Xmmv42, Xmv18, Tcfe3, Araf, Avpr2, mdx, Ar, Zfx, Otf9, Ccg1,
Ccnb1-rs8, Fps19, Gabra3, Glra2, Glra4, Gria3, Grpr, Hsp74-ps1,
Hst3, Htr1c, I12rg, Mov14, Mov15, Mtv28, Otf3-rs8, Sts, Sxa, Sxr,
Xta, Tdy, Hya, Zfy1, Zfy2, Mov15, Mov24, Mtv31, Mtv42, Sdma, Spy,
Sts, Sxa, Sxr, XmmvY, Xmv7, Xmv11, and Xmv40.
[0241] Non-limiting examples of Phaseolus vulgaris genes include:
Acc, ace, Adk, Am, Amv-1, Amv-2, Ane, aph, Arc, Are, arg, Ar1
(Arc), asp, B, bc-u, bc-1.sup.1, bc-1.sup.2, bc-2.sup.1,
bc-2.sup.2, bc-3, Bcm, Beg, Bip, blu, Bpm, Bsm, By-1, By-2, C, C/c,
c.sup.cr, C.sup.cir, C.sup.ma (M, R.sup.ma), C.sup.r, C.sup.res,
C.sup.rho, C.sup.st, [C.sup.st R Acc] (Aeq), c.sup.u (inh,
i.sub.e), [c.sup.u Prp.sup.i] (Prp, c.sup.ui, Nud),
[c.sup.uprp.sup.st] (prp.sup.st), [C Prp] (Prp), c.sup.v, [C R]
(R), [C r] (r), Ca, Cam, Cav, cc, ch1, c1, cm1, Co-1 (A), Co-2
(Are), Co-3 (Mexique 1), Co-3.sup.2, Co-4 (Mexique 2), Co-5
(Mexique 3), Co-6, Co-7, cr-1 cr-2, cry, cs, Ct, ctv-1 ctv-2, cyv
(by-3), D (Can, Ins), Da, Db, def, dgs (g1, le), dia, Diap-1,
Diap-2, diff, dis, Dl -1 Dl -2 (DL.sub.1 DL.sub.2), do, ds (te),
dt-1.sup.a dt-2.sup.a, dt-1.sup.b dt-2.sup.b, dw-1 dw-2, Ea Eb, ers
(restr), ers-2, Est-1, Est-2, exp, F, Fa, fast, Fb Fc, fa fb fc,
Fcr, Fcr-2, fd, Fe-1 Fe-2, Fin (in), Fop-1, Fop-2, Fr, Fr-2, G
(Flav, Ca, Och), Ga, gas, glb, Gpi-cl, Gr, Hb1 (L.sub.HB-1), Hbnc
(SC.sub.HB-1), Ibp (PD.sub.HB-1), hmb, Hss, Hsw, Ht-1 Ht-2 (L-1
L-2), I, 1a 1b, ian-1 ian-2 (1a), lbd, ico, Igr (Ih), ilo, ip,
iter, iv, iw, J (Sh), Ke, L, la, Lan, Ld, Lds (Ds), Lec, Li (L),
10, Ir-1 Ir-2, mar, Me, Mel (Me), Mel-2 (Me-2), mel-3 (me-3), Mf,
mi, mia, Mic (Mip), miv, Mrf, Mrf.sup.2, mrf, ms-1, Mue, mu
mutator, Nag, Nd-1 Nd-2 (D-1 D-2), nie, nnd (sym-1), nnd-2, No, nts
(nod), Nudus, o1, P, p.sup.gri (Gri, v.sup.Pal), pa, pc, pg
(pa.sub.1), Pha, Pmv, ppd (neu), Pr, prc (pc), Prx, punc, ram, Rbcs
(rbcS), rf-1, rf-2, rf-3, rfi (i), Rfs (m), Rk, rk, rk.sup.d (lin),
rn-1 rn-2 (r r), rnd, Ro, Sa1, sb, sb.sup.ms, sb-2, sb-3, si1,
Skdh, s1, Smv, St, Sur, sw-1 sw-2, T, t (z-1), Th-1 Th-2, Tm, To,
Tor (T), Tr, tri, trv, Ts, tw, uni, Uni-2, uni.sup.nde,
uni.sup.nie, Ur-1, Ur-2, Ur-2.sup.2, Ur-3 (Ur-3, Ur-4), Ur-3.sup.2,
Ur-4, (Up-2, Ur-C), Ur-5, (B-190), Ur-6 (Ur.sub.a, Ur-G), Ur-7
(R.sub.B11), Ur-8 (Up-1), Ur-9 (Ur.sub.p), us, V (B1), v.sup.lae
(Cor), v, var, vi (vir.sub.f), wb, Wmv, X.sup.su, y, and Z.
[0242] Non-limiting examples of Saccharomyces cerevisiae genes
include: PRE3, PUP1, PUP3, PRE2, PRE10, PRE1, PRE8, SCL1, PUP2,
PRE5, PRE7, PRE4, RPT2, RPT3, RPN3, RPN11, RPN12, RPT6, RPN1, RPN2,
RPT1, RPT5, RPT4, SKI6, RRP4, DIS3, TSC10, RAT1, GND1, EXO70,
ERG10, ACC1, RPP0, ACT1, ARP100, ARP3, PAN1, ARP2, ARP4, ARP9,
SPE2, CYR1, ALA1, TPS1, TUB1, ABF1, DED81, NIP1, YHC1, SNU71, ATM1,
MAK5, ROK1, DED1, SPB4, AUR1, PSE1, ALG1, TUB2, BPL1, MSL5, ERG24,
ERG26, ERG25, CMD1, HCA4, SHE9, SHE10, CAK1, PIS1, CHO1, CDS1,
ESR1, NUD1, CDC47, CDC13, CDC37, CDC1, CDC4, CDC20, CDC6, CDC46,
CDC3, KAR1, BBP1, HRP1, CCT2, CCT3, HSP10, SMC1, SMC2, CHC1, CFT2,
CLP1, COP1, SEC26, SEC27, RET2, SEC21, COF1, CCT4, CCT1, CCT6,
SEC24, SEC7, PCF11, RNA15, RNA14, FIP1, YSH1, TFB4, TSM1, APC2,
APC5, SEC31, TAF47, TAP42, MPP10, CDC53, CKS1, CDC28, KIN28, CNS1,
ERG11, DBP10, DBP8, PRO3, DYS1, ALR1, TID3, DNA2, SSL2, RAD3, RFA3,
RFA2, RFA1, RFC4, RFC5, RFC3, RFC2, RFC1, TOP2, RAP1, RPC25, PRI2,
PRI1, POL1, POL12, HUS2, CDC2, POL2, DPB2, RPB10, RPA135, RPA190,
RPA43, RPB8, RPO26, RPB5, RPC40, RPC19, SRB7, SRB4, RGR1, RPB11,
SRB6, RPB2, RPB7, RPO21, RET1, RPO31, RPC31, RPC34, RPC53, RPC82,
RPB12, RPB3, DPM1, DIP2, RNT1, CDC8, CDC14, DUT1, UBA2, UBA1, UBC9,
CDC34, ENP1, ERD2, SSS1, SEC61, SEC63, SEC62, GNA1, GPI8, DAM1,
DUO1, IRR1, PRP3, TIM9, HSH49, SUP35, EXM2, MEX67, ERG9, ERG20,
FAS2, FAS1, NOP1, FAD1, AOS1, FBA1, NCB2, BRN1, TUB4, GDI1, GOG5,
SRM1, CDC25, SPT16, YIF2, BET4, CDC43, MRS6, BET2, PRO1, GLN1,
GLN4, GRS1, YIP1, FOL2, GPA1, CDC42, SAR1, YPT1, SEC4, GSP1, TEM1,
RHO1, CDC24, RNA1, GUK1, VMA16, PMA1, HKR1, SIS1, MGE1, HSP60,
HSF1, HAS1, MOT3, HTS1, ESA1, HSL7, HOM6, RIB7, SLY1, CSL4, PUR5,
CSE1, IPP1, MDM1, USO1, SOFI, MAK11, LAS1, TEL2, DPB11, SGD1, FAL1,
MTR3, MTR4, SPP2, SIK1, RRP7, POP4, RRP1, POP3, BFR2, CDC5, NRD1,
MET30, MCM6, RRP46, SAS10, SCC2, ECO1, PRP43, BET3, BET5, STN1,
NFS1, IDI1, SRP1, KAP95, CBF2, SKP1, CEP3, CTF13, ERG7, KRS1, PSA1,
PMI40, ALG2, SSF1, MED7, RSC4, CDC54, MCM2, AFG2, ERG12, MVD1,
CDC48, MHP1, ERV1, SSC1, TIM44, TIM17, TIM23, TOM22, TOM40, MAS1,
MCD1, MMC1, STU1, JAC1, ABD1, CEG1, PAB1, MTR2, SEC16, ROT1, INO1,
MLC1, MYO2, GPI2, SPT14, NAT2, NMT1, TRM1, NCP1, NBP1, ACF2, SPP41,
NUT2, LCP5, PRP19, NMD3, RFT1, NNF1, NDC1, CRM1, KAR2, NIP29, NAB2,
NIC96, NUP145, NUP49, NUP57, NUP159, NSP1, NUP82, CDC39, NPL4,
POP7, NTF2, MAK16, NPL3, NOP2, NOP4, NHP2, NOP10, GAR1, NBP35,
WBP1, STT3, SWP1, OST2, OST1, ORC1, ORC6, ORC5, ORC4, ORC3, RRR1,
SAT2, PWP2, PEX3, TOR2, PIK1, SEC14, STT4, MSS4, PCM1, GPM1, SEC53,
ERG8, YPD1, PAP1, NAB3, RRN7, SEN1, CFT1, PRP11, PRP21, PRP39,
PRP24, PRP9, SLU7, PRP28, PRP31, IFH1, PTA1, SUB2, FMI1, MAS2,
ESS1, PFY1, POL30, POP1, PDI1, RAM2, CDC7, SMP3, CDC15, YTH1, QR12,
YAE1, SF11, SEC1, BET1, SEC6, SEC13, SEC2, SEC8, CBF5, CDC19, YRB1,
RHC18, DBF4, SDS22, MCM3, CEF1, ALG11, GAA1, MOB1, NIP7, TIP20,
SEC5, SEC10, GPI10, RRP3, CDC45, DIB1, MIF2, HOP2, PBN1, NOP5,
RPP1, POP5, POP8, POP6, ERO1, MPT1, DNA43, ESP1, SMC3, LST8, STS1,
RPM2, RNR1, RNR2, RNR4, RPS20, RPL25, RPL3, RPL30, RPL32, RPL37A,
RPL43A, RPL5, RPL10, RPS3, CET1, YRA1, SNM1, GLE1, DBP5, DRS1,
DBP6, BRR2, RRN3, RRN6, RRN11, MED6, PRP16, RPR2, DIM1, RRP43,
RRP42, RRP45, SEC20, BOS1, CDC12, GLC7, PKC1, IPL1, SGV1, NRK1,
RAD53, LCB2, LCB1, MPS1, SES1, SPC3, SEC11, RIO1, ARP7, NEO1, YJU2,
POB3, ARH1, IQG1, HRT1, HYM1, MAK21, FUN20, FUN9, NBN1, STB5, YIF1,
SMX4, YKT6, SFT1, SMD1, PRP6, LSM2, NUF1, SPC97, SPC42, SPC98,
CDC31, SPC19, SPC25, SPC34, SPC24, NUF2, PRP40, MCD4, ERG1, SMC4,
CSE4, KRR1, SME1, TRA1, RLP7, SCH9, SMD3, SNP2, SSF2, SPC72, CDC27,
CDC23, CDC16, APC1, APC11, APC4, ARC19, RPN6, RPN5, RSC6, RSC8,
STH1, SFH1, TIM12, TIM22, TIM10, SQT1, SLS1, JSN1, STU2, SCD5,
SSU72, ASM4, SED5, UFE1, SYF1, SYF2, CCT5, TBF1, TOA2, TOA1, SUA7,
TAF90, TAF61, TAF25, TAF60, TAF17, TAF145, TAF19, TAF40, TAF67,
TFA2, TFA1, FCP1, TFG1, TFG2, TFB1, CCL1, SSL1, TFB3, TFB2, PZF1,
BRF1, TFC5, TFC4, TFC3, TFC7, TFC6, TFC1, SPT15, TH180, THS1, SPT6,
SPT5, ROX3, REB1, MCM1, MED4, MOT1, MED8, EFB1, YEF3, SUI1, CDC95,
TIF11, SUI3, GCD11, SUI2, GCD6, GCD7, GCD2, GCD1, RPG1, GCD10,
PRT1, TIF34, CDC33, TIF5, SUP45, GCD14, TIM54, SEC17, TPT1, TRL1,
CCA1, SEN54, SEN2, SEN15, SEN34, WRS1, SLN1, TYS1, SNU56, PRP42,
CUS1, PRP4, PRP8, SNU114, USS1, UFD1, SMT3, RSP5, QR11, ALG7, UGP1,
VTI1, VAS1, SEC18, CTR86, and ZPR1.
[0243] 2. Viruses
[0244] The microorganisms provided herein include viruses. Such
viruses typically have one or more of the microorganism
characteristics provided herein. For example, viruses provided
herein can have attenuated pathogenicity, reduced toxicity,
preferential accumulation in immunoprivileged cells and tissues,
such as tumor, ability to activate an immune response against tumor
cells, immunogenic, replication competent, and are able to express
exogenous proteins, and combinations thereof. In some embodiments,
the viruses have an ability to activate an immune response against
tumor cells without aggressively killing the tumor cells.
[0245] The viruses provided herein can be cytoplasmic viruses, such
as poxviruses, or can be nuclear viruses such as adenoviruses. The
viruses provided herein can have as part of their life cycle lysis
of the host cell's plasma membrane. Alternatively, the viruses
provided herein can have as part of their life cycle exit of the
host cell by non-lytic pathways such as budding or exocytosis. The
viruses provided herein can cause a host organism to develop an
immune response to virus-infected tumor cells as a result of lysis
or apoptosis induced as part of the viral life cycle. The viruses
provided herein also can be genetically engineered to cause a host
organism to develop an immune response to virus-infected tumor
cells as a result of lysis or apoptosis, regardless of whether or
not lysis or apoptosis is induced as part of the viral life cycle.
In some embodiments, the viruses provided herein can cause the host
organism to mount an immune response against tumor cells without
lysing or causing cell death of the tumor cells.
[0246] One skilled in the art can select from any of a variety of
viruses, according to a variety of factors, including, but not
limited to, the intended use of the virus (e.g., exogenous protein
production, antibody production or tumor therapy), the host
organism, and the type of tumor.
[0247] a. Cytoplasmic Viruses
[0248] The viruses provided herein can be cytoplasmic viruses,
where the life cycle of the virus does not require entry of viral
nucleic acid molecules in to the nucleus of the host cell. A
variety of cytoplasmic viruses are known, including, but not
limited to, pox viruses, African swine flu family viruses, and
various RNA viruses such as picoma viruses, calici viruses, toga
viruses, corona viruses and rhabdo viruses. In some embodiments,
viral nucleic acid molecules do not enter the host cell nucleus
throughout the viral life cycle. In other embodiments, the viral
life cycle can be performed without use of host cell nuclear
proteins. In other embodiments, the virulence or pathogenicity of
the virus can be modulated by modulating the activity of one or
more viral proteins involved in viral replication.
[0249] i. Poxviruses
[0250] In one embodiment, the virus provided herein is selected
from the pox virus family. Pox viruses include Chordopoxyirinae
such as orthopoxvirus, parapoxvirus, avipoxvirus, capripoxvirus,
leporipoxvirus, suipoxvirus, molluscipoxvirus and yatapoxvirus, as
well as Entomopoxyirinae such as entomopoxvirus A, entomopoxvirus
B, and entomopoxvirus A. Chordopoxyirinae are vertebrate poxviruses
and have similar antigenicities, morphologies and host ranges;
thus, any of a variety of such poxviruses can be used herein. One
skilled in the art can select a particular genera or individual
chordopoxyirinae according to the known properties of the genera or
individual virus, and according to the selected characteristics of
the virus (e.g., pathogenicity, ability to elicit and immune
response, preferential tumor localization), the intended use of the
virus, the tumor type and the host organism. Exemplary
chordopoxyirinae genera are orthopoxvirus and avipoxvirus.
[0251] Avipoxviruses are known to infect a variety of different
birds and have been administered to humans. Exemplary avipoxviruses
include canarypox, fowlpox, juncopox, mynahpox, pigeonpox,
psittacinepox, quailpox, peacockpox, penguinpox, sparrowpox,
starlingpox, and turkeypox viruses.
[0252] Orthopoxviruses are known to infect a variety of different
mammals including rodents, domesticated animals, primates and
humans. Several orthopoxviruses have a broad host range, while
others have narrower host range. Exemplary orthopoxviruses include
buffalopox, camelpox, cowpox, ectromelia, monkeypox, raccoon pox,
skunk pox, tatera pox, uasin gishu, vaccinia, variola and volepox
viruses. In some embodiments, the orthopoxvirus selected can be an
orthopoxvirus known to infect humans, such as cowpox, monkeypox,
vaccinia or variola virus. Optionally, the orthopoxvirus known to
infect humans can be selected from the group of orthopoxviruses
with a broad host range, such as cowpox, monkeypox, or vaccinia
virus.
[0253] a. Vaccinia Virus
[0254] One exemplary orthopoxvirus is vaccinia virus. A variety of
vaccinia virus strains are available, including Western Reserve
(WR), Copenhagen, Tashkent, Tian Tan, Lister, Wyeth, 1HD-J, and
IHD-W, Brighton, Ankara, MVA, Dairen I, L-IPV, LC16M8, LC16MO,
LIVP, WR 65-16, Connaught, New York City Board of Health. Exemplary
vaccinia viruses are Lister or LIVP vaccinia viruses. Any known
vaccinia virus, or modifications thereof that correspond to those
provided herein or known to those of skill in the art to reduce
toxicity of a vaccinia virus. Generally, however, the mutation will
be a multiple mutant and the virus will be further selected to
reduce toxicity.
[0255] The linear dsDNA viral genome of vaccinia virus is
approximately 200 kb in size, encoding a total of approximately 200
potential genes. Viral gene expression can be divided into three
stages. In the early stage, gene expression is mainly for viral
replication, and for defense against the host's immune system. In
the intermediate stage, genes not available for expression in the
early stage can be expressed, including late stage transactivators.
In the late stage, active transcription is mainly for viral
structural components for building mature viruses.
[0256] Vaccinia virus possesses a variety of features for use in
cancer gene therapy and vaccination. It has a broad host and cell
type range. Vaccinia is a cytoplasmic virus, thus, it does not
insert its genome into the host genome during its life cycle.
Unlike many other viruses that require the host's transcription
machinery, vaccinia virus can support its own gene expression in
the host cell cytoplasm using enzymes encoded in the viral genome.
The vaccinia virus genome has a large carrying capacity for foreign
genes, where up to 25 kb of exogenous DNA fragments (approximately
12% of the vaccinia genome size) can be inserted. The genomes of
several of the vaccinia strains have been completely sequenced, and
many essential and nonessential genes identified. Due to high
sequence homology among different strains, genomic information from
one vaccinia strain can be used for designing and generating
modified viruses in other strains. Finally, the techniques for
production of modified vaccinia strains by genetic engineering are
well established (Moss, Curr. Opin. Genet. Dev. 3 (1993), 86-90;
Broder and Earl, Mol. Biotechnol. 13 (1999), 223-245; Timiryasova
et al., Biotechniques 31 (2001), 534-540).
[0257] Historically, vaccinia virus was used to immunize against
smallpox infection. More recently, modified vaccinia viruses are
being developed as vaccines to combat a variety of diseases.
Attenuated vaccinia virus can trigger a cell-mediated immune
response. Strategies such as prime/boost vaccination, vaccination
with nonreplicating vaccinia virus or a combination of these
strategies, have shown promising results for the development of
safe and effective vaccination protocols. Mutant vaccinia viruses
from previous studies exhibit a variety of shortcomings, including
a lack of efficient delivery of the viral vehicle to the desired
tissue only (e.g., specific accumulation in a tumors), a lack of
safety because of possible serious complications (e.g., in young
children, eczema vaccinatum and encephalitis, and in adults
disseminated or progressive vaccinia may result if the individual
is severely immunodeficient).
[0258] b. Modified Vaccinia Viruses
[0259] Provided herein are vaccinia viruses with insertions,
mutations or deletions, as described more generally elsewhere
herein. The vaccinia viruses are modified or selected to have low
toxicity and to accumulate in the target tissue. Exemplary of such
viruses are those from the LIVP strain.
[0260] Exemplary insertions, mutations or deletions are those that
result in an attenuated vaccinia virus relative to the wild type
strain. For example, vaccinia virus insertions, mutations or
deletions can decrease pathogenicity of the vaccinia virus, for
example, by reducing the toxicity, reducing the infectivity,
reducing the ability to replicate, or reducing the number of
non-tumor organs or tissues to which the vaccinia virus can
accumulate. Other exemplary insertions, mutations or deletions
include, but are not limited to, those that increase antigenicity
of the microorganism, those that permit detection or imaging, those
that increase toxicity of the microorganism (optionally, controlled
by an inducible promoter). For example, modifications can be made
in genes that are involved in nucleotide metabolism, host
interactions and virus formation. Any of a variety of insertions,
mutations or deletions of the vaccinia virus known in the art can
be used herein, including insertions, mutations or deletions of:
the thymidine kinase (TK) gene, the hemagglutinin (HA) gene, the
VGF gene (as taught in U.S. Pat. Pub. No. 20030031681); a
hemorrhagic region or an A type inclusion body region (as taught in
U.S. Pat. No. 6,596,279); Hind III F, F13L, or Hind III M (as
taught in U.S. Pat. No. 6,548,068); A33R, A34R, A36R or B5R genes
(see, e.g., Katz et al., J. Virology 77:12266-12275 (2003)); SalF7L
(see, e.g., Moore et al., EMBO J. 1992 11:1973-1980); NIL (see,
e.g., Kotwal et al., Virology 1989 171:579-587); Ml lambda (see,
e.g., Child et al., Virology. 1990 174:625-629); HR, HindIII-MK,
HindIII-MKF, HindIII-CNM, RR, or BaniF (see, e.g., Lee et al., J.
Virol. 1992 66:2617-2630); or C21L (see, e.g., Isaacs et al., Proc
Natl Acad Sci USA. 1992 89:628-632).
[0261] c. The F3 Gene
[0262] In addition to the mutations known in the art, the vaccinia
viruses provided herein can have an insertion, mutation or deletion
of the F3 gene (SEQ ID No: 1; an exemplary F3 gene is provided in
GenBank Accession No. M57977, which contains the nucleotide and
predicted amino acid sequences for LIVP strain F3; see also
Mikryukov et al., Biotekhnologiya 4:442-449 (1988)). For example,
the F3 gene has been modified at the unique single NotI restriction
site located within the F3 gene at position 35 or at position 1475
inside of the HindIII-F fragment of vaccinia virus DNA strain LIVP
(Mikryukov et al., Biotekhnologiy 4 (1988), 442-449) by insertion
of a foreign DNA sequence into the NotI digested virus DNA. As
provided herein, an insertion of a nucleic acid molecule, such as
one containing lacZ, into the NotI site of the F3 gene of the LIVP
strain (nucleotides 1473-1480 in M57977, or nucleotides 33-40 of
SEQ ID NO: 1) can result in decreased accumulation of vaccinia
viruses in non-tumorous organs of nude mice, including brain and
heart, relative to wild type vaccinia virus. Thus for use in the
methods provided herein, vaccinia viruses can contain an insertion,
mutation or deletion of the F3 gene or a mutation of a
corresponding locus. For example, as provided herein,
F3-interrupted modified LIVP vaccinia virus can selectively
replicate in tumor cells in vivo. Therefore, modified vaccinia
viruses (e.g., modified strain LIVP) with the interrupted F3 gene
can be used in the methods provided herein, such as methods of
tumor-directed gene therapy and for detection of tumors and
metastases.
[0263] Thus, provided herein are vaccinia viruses having a
modification of the F3 gene. For example, the vaccinia viruses
provided herein can contain an insertion of foreign DNA into the F3
gene. An exemplary insertion of foreign DNA is an insertion at a
site equivalent to the NotI site of the F3 gene in vaccinia strain
LIVP, or at position 35 of SEQ ID NO: 1. An F3-modified vaccinia
virus provided herein can colonize in tumors specifically, and
therefore, can be used for tumor-specific therapeutic gene
delivery. A GenBank data analysis with BLAST (Basic Local Alignment
Search Tool) on nucleotide sequences of different strains of
vaccinia virus was performed. Based on this analysis, it was found
that in vaccinia virus strain Copenhagen (Goebel et al., Virology
179 (1990), 247-266) the NotI restriction site is located between
two open reading frames (ORF) encoding F14L and F15L genes.
Therefore, insertion of foreign genes into NotI site of the VV
genome strain Copenhagen will not interrupt any vital genes. In VV
strain LIVP, the NotI restriction site is located in the ORF
encoding the F3 gene with unknown function (Mikryukov et al.,
Biotekhnologiya 4 (1988), 442-449). Thus, the insertion of foreign
genes into the NotI site of the F3 gene interrupted the F3 gene.
The ability to modify the F3 gene suggests that it may have a
nonessential role for virus replication. Although the F3 gene is
likely nonessential for virus replication, the results of the
animal experiments suggest that interruption of the F3 gene is
correlated with decreased viral virulence, the inability to
replicate in brain or ovary, and the ability to replicate
preferentially in tumor tissue.
[0264] The F3 gene is conserved in a variety of different vaccinia
virus strains, including WR (nucleotides 4223842387 of GenBank
Accession No. AY243312.1, Ankara (nucleotides 37155-37304 of
GenBank Accession No. U94848.1), Tian Tan (nucleotides 41808-41954
of GenBank Accession No. AF095689), Acambis 3000 (nucleotides
31365-31514 of GenBank Accession No. AY603355.1) and Copenhagen
(nucleotides 45368-45517 of GenBank Accession No. M35027.1)
strains. The F3 gene also is conserved in the larger family of
poxviruses, particularly among orthopoxviruses such as cowpox
(nucleotides 58498-58647 of GenBank Accession No. X94355.2),
rabbitpox (nucleotides 4696947118 of GenBank Accession No.
AY484669.1), camelpox (nucleotides 43331-43480 of GenBank Accession
No. AY009089.1), ectromelia (nucleotides 51008-51157 of GenBank
Accession No. AF012825.2), monkeypox (nucleotides 42515-42660 of
GenBank Accession No. AF380138.1), and variola viruses (nucleotides
33100-33249 of GenBank Accession No. X69198.1). Accordingly, also
provided are modifications of the equivalent of the F3 gene in
poxviruses, such as orthopoxviruses including a variety of vaccinia
virus strains. One skilled in the art can identify the location of
the equivalent F3 gene in a variety of poxviruses, orthopoxviruses
and vaccinia viruses. For example, an equivalent of the F3 gene in
poxviruses, orthopoxviruses and vaccinia viruses can include a gene
that contains at least 80%, at least 85%, at least 90%, at least
92%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, or at least 99% identity with the nucleotide sequence of
the F3 gene in SEQ ID NO: 1. In another example, an equivalent of
the F3 gene in poxviruses, orthopoxviruses and vaccinia viruses can
include a gene that contains at least 80%, at least 85%, at least
90%, at least 92%, at least 94%, at least 95%, at least 96%, at
least 97%, at least 98%, or at least 99% identity with the amino
acid sequence of F3 in SEQ ID NO:2. In another example, the
equivalent to the F3 gene in LIVP can be determined by its
structural location in the viral genome: the F3 gene is located on
the HindIII-F fragment of vaccinia virus between open reading
frames F14L and F15L as defined by Goebel et al., Virology (1990)
179:247-266, and in the opposite orientation of ORFs F 14L and F
15L; one skilled in the art can readily identify the gene located
in the structurally equivalent region in a large variety of related
viruses, such as a large variety of pox viruses.
[0265] Comparative protein sequence analysis revealed some insight
into protein function. The closest match with the protein encoded
by the F3 gene (strain LIVP) is a prolyl 4-hydroxylase alpha
subunit precursor (4-PH alpha) from the nematode Caenorhabditis
elegans (Veijola et al., J. Biol. Chem. 269 (1994), 26746-26753).
This alpha subunit forms an active alpha-beta dimer with the human
protein disulfide isomerase beta subunit. Prolyl 4-hydroxylase (EC
1.14.11.2) catalyzes the formation of 4-hydroxyproline in collagen.
The vertebrate enzyme is an alpha 2-beta 2 tetramer, the beta
subunit of which is identical to the protein disulfide-isomerase
(PDI). The importance of this protein for vaccinia viral
replication is unknown, but a deficiency of this protein can result
in retargeting vaccinia virus to tumor tissue.
[0266] d. Multiple Modifications
[0267] The vaccinia viruses provided herein also can contain two or
more insertions, mutations or deletions. Thus, included are
vaccinia viruses containing two or more insertions, mutations or
deletions of the loci provided herein or other loci known in the
art. In one embodiment, a vaccinia virus contains an insertion,
mutation or deletion in the F3 gene, and one or more additional
insertions, mutations or deletions. In one embodiment of the
modified vaccinia virus, at least the F3 gene has been modified by
insertion of a foreign nucleotide sequence. Modifications such as
modification of the F3 gene will typically result in at least
partial inactivation of the gene or gene product. In one example,
the F3 gene and the TK gene have been modified by insertion of a
foreign nucleotide sequence. In another example, the F3 gene and
the HA gene have been modified by insertion of a foreign nucleotide
sequence. In another example, the F3 gene and both the TK and HA
genes have been modified by insertion of a foreign nucleotide
sequence. In another example, the HA gene and the TK gene have been
modified by insertion of a foreign nucleotide sequence.
Accordingly, the present compositions and methods include a
modified vaccinia virus wherein two or more of (a) the F3 gene, (b)
the TK gene, and (c) the HA gene have been modified. In one
embodiment, at least two of the F3 gene, TK gene and HA gene have
been inactivated, for example by insertion, deletion and/or
replacement of nucleotide(s) within the coding region, or
regulatory sequences of two or more of these genes have been
inactivated by insertion, deletion or mutation.
[0268] e. The Lister Strain
[0269] In another embodiment, the viruses and methods provided
herein can be based on modifications to the Lister strain of
vaccinia virus. Lister (also referred to as Elstree) vaccinia virus
is available from any of a variety of sources. For example, the
Elstree vaccinia virus is available at the ATCC under Accession
Number VR-1549. The Lister vaccinia strain has high transduction
efficiency in tumor cells with high levels of gene expression.
[0270] In one embodiment, the Lister strain can be an attenuated
Lister strain, such as the LIVP (Lister virus from the Institute of
Viral Preparations, Moscow, Russia) strain, which was produced by
further attenuation of the Lister strain. The LIVP strain was used
for vaccination throughout the world, particularly in India and
Russia, and is widely available.
[0271] The LIVP strain has a reduced pathogenicity while
maintaining a high transduction efficiency. For example, as
provided herein, F3-interrupted modified LIVP vaccinia virus can
selectively replicate in tumor cells in vivo. In one embodiment,
provided herein are modified LIVP viruses, including viruses having
a modified TK gene, viruses having a modified HA gene, viruses
having a modified F3 gene, and viruses having two or more of:
modified HA gene, modified TK gene, and modified F3 gene.
[0272] ii. Other Cytoplasmic Viruses
[0273] Also provided herein are cytoplasmic viruses that are not
poxviruses. Cytoplasmic viruses can replicate without introducing
viral nucleic acid molecules into the nucleus of the host cell. A
variety of such cytoplasmic viruses are known in the art, and
include African swine flu family viruses and various RNA viruses
such as arenaviruses, picornaviruses, caliciviruses, togaviruses,
coronaviruses, paramyxoviruses, flaviviruses, reoviruses, and
rhaboviruses. Exemplary togaviruses include Sindbis viruses.
Exemplary arenaviruses include lymphocytic choriomeningitis virus.
Exemplary rhaboviruses include vesicular stomatitis viruses.
Exemplary paramyxo viruses include Newcastle Disease viruses and
measles viruses. Exemplary picornaviruses include polio viruses,
bovine enteroviruses and rhinoviruses. Exemplary flaviviruses
include Yellow fever virus; attenuated Yellow fever viruses are
known in the art, as exemplified in Barrett et al., Biologicals
25:17-25 (1997), and McAllister et al., J. Virol. 74:9197-9205
(2000).
[0274] Also provided herein are modifications of the viruses
provided above to enhance one or more characteristics relative to
the wild type virus. Such characteristics can include, but are not
limited to, attenuated pathogenicity, reduced toxicity,
preferential accumulation in tumor, increased ability to activate
an immune response against tumor cells, increased immunogenicity,
increased or decreased replication competence, and are able to
express exogenous proteins, and combinations thereof. In some
embodiments, the modified viruses have an ability to activate an
immune response against tumor cells without aggressively killing
the tumor cells. In other embodiments, the viruses can be modified
to express one or more detectable genes, including genes that can
be used for imaging. In other embodiments, the viruses can be
modified to express one or more genes for harvesting the gene
products and/or for harvesting antibodies against the gene
products.
[0275] b. Adenovirus, Herpes, Retroviruses
[0276] Further provided herein are viruses that include in their
life cycle entry of a nucleic acid molecule into the nucleus of the
host cell. A variety of such viruses are known in the art, and
include herpesviruses, papovaviruses, retroviruses, adenoviruses,
parvoviruses and orthomyxoviruses. Exemplary herpesviruses include
herpes simplex type I viruses, cytomegaloviruses, and Epstein-Barr
viruses. Exemplary papovaviruses include human papillomavirus and
SV40 viruses. Exemplary retroviruses include lentiviruses.
Exemplary orthomyxoviruses include influenza viruses. Exemplary
parvoviruses include adeno associated viruses.
[0277] Also provided herein are modifications of the viruses
provided above to enhance one or more characteristics relative to
the wild type virus. Such characteristics can include, but are not
limited to, attenuated pathogenicity, reduced toxicity,
preferential accumulation in tumor, increased ability to activate
an immune response against tumor cells, increased immunogenicity,
increased or decreased replication competence, and are able to
express exogenous proteins, and combinations thereof. In some
embodiments, the modified viruses have an ability to activate an
immune response against tumor cells without aggressively killing
the tumor cells. In other embodiments, the viruses can be modified
to express one or more detectable genes, including genes that can
be used for imaging. In other embodiments, the viruses can be
modified to express one or more genes for harvesting the gene
products and/or for harvesting antibodies against the gene
products.
[0278] 3. Bacteria
[0279] Bacteria can also be used in the methods provided herein.
Any of a variety of bacteria possessing the desired characteristics
can be used. In one embodiment, aerobic bacteria can be used. In
another embodiment, anaerobic bacteria can be used; In another
embodiment, extracellular bacteria can be used. In another
embodiment, intracellular bacteria can be used.
[0280] In some embodiments, the bacteria provided herein can be
extracellular bacteria. A variety of extracellular bacteria are
known in the art and include vibrio, lactobacillus, streptococcus,
escherichia. Exemplary bacteria include Vibrio cholerae,
Streptococcus pyogenes, and Escherichia coli. In other embodiments,
the bacteria provided herein can be intracellular bacteria. A
variety of intracellular bacteria are known in the art and include
listeria, salmonella, clostridium, and bifodobacterium. Exemplary
intracellular bacteria include Listeria monocytogenes, Salmonella
typhimurium, Clostridium histolyticus, Clostridium butyricum,
Bifodobacterium longum, and Bifodobacterium adolescentis.
Additional bacteria include plant bacteria such as Clavibacter
michiganensis subsp. michiganensis, Agrobacterium tumefaciens,
Erwinia herbicola, Azorhizobium caulinodans, Xanthomonas campestris
pv. vesicatoria, and Xanthomonas campestris pv. campestris.
[0281] A further example of a bacteria provided herein are magnetic
bacteria. Such bacteria allow tumor detection through the
accumulation of iron-based contrast agents. Magnetic bacteria can
be isolated from fresh and marine sediments. Magnetic bacteria can
produce magnetic particles (Fe304) (Blakemore, Annu. Rev.
Microbiol. 36 (1982), 217-238). To do so, the magnetic bacteria
have efficient iron uptake systems, which allow them to utilize
both insoluble and soluble forms of iron. Magnetospirillum magnetic
AMB-1 is an example of such magnetic bacteria that has been
isolated and cultured for magnetic particle production (Yang et
al., Enzyme Microb. Technol. 29 (2001), 13-19). As provided herein,
these magnetic bacteria (naturally occurring or genetically
modified), when injected intravenously, can selectively accumulate
in tumor. Accordingly, these bacteria can be used for accumulating
iron-based contrast agents in the tumors, which in turn allows
tumor detection by MRI. Similarly, other naturally isolated metal
accumulating strains of bacteria can be used for tumor targeting,
absorption of metals from contrast agents, and tumor imaging.
[0282] Also provided herein are modifications of bacteria to
enhance one or more characteristics relative to the wild type
bacteria. Such characteristics can include, but are not limited to,
attenuated pathogenicity, reduced toxicity, preferential
accumulation in tumor, increased ability to activate an immune
response against tumor cells, increased immunogenicity, increased
or decreased replication competence, and are able to express
exogenous proteins, and combinations thereof. In some embodiments,
the modified bacteria have an ability to activate an immune
response against tumor cells without aggressively killing the tumor
cells. In other embodiments, the bacteria can be modified to
express one or more detectable genes, including genes that can be
used for imaging. In other embodiments, the bacteria can be
modified to express one or more genes for harvesting the gene
products and/or for harvesting antibodies against the gene
products.
[0283] a. Aerobic Bacteria
[0284] Previous studies have postulated that anaerobic bacteria are
preferred for administration to tumors (Lemmon et al., 1997 Gene
Therapy 4:791-796). As provided herein, it has been determined that
aerobic bacteria can survive and grow in tumors. Accordingly, a
bacteria used in the methods provided herein can include a bacteria
that can survive and grow in an oxygenated environment. In some
embodiments, the bacteria must be in an oxygenated environment in
order to survive and grow. A variety of aerobic bacteria are known
in the art, including lactobacilli, salmonella, streptococci,
staphylococci, vibrio, listeria, and escherichia. Exemplary
bacteria include Vibrio cholerae, Listeria monocytogenes,
Salmonella typhimurium, Streptococcus pyogenes, Escherichia coli,
Lactobacillus bulgaricus, Lactobacillus casei, Lacto bacillus
acidophilus, Lactobacillus brevis, Lactobacillus paracasei,
Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus
salivarius, Lactobacillus sporogenes, Lactobacillus lactis,
Lactobacillus fermentum, Streptococcus thermophilus, Bacillus
subtilis, Bacillus megaterium, Bacillus polymyxa, Myobacterium
smegmatis, Mycobacterium vaccae, Mycobacterium microti,
Mycobacterium habana, Enterococcus faecalis, Pseudomonas
fluorescens, and Pseudomonas putida.
[0285] b. Anaerobic Bacteria
[0286] A bacteria used in the methods provided herein can include a
bacteria that does not require oxygen to survive and grow. In some
embodiments, the bacteria must be in an oxygen-free environment in
order to survive and grow. A variety of aerobic bacteria are known
in the art, including clostridium, bifodobacterium. Exemplary
bacteria include Clostridium histolyticus, Clostridium butyricum,
Clostridium novyi, Clostridium sordellii, Clostridium absonum,
Clostridium bifermentans, Clostridium difficile, Clostridium
histolyticum, Clostridium perfringens, Clostridium beijerinckii,
Clostridium sporogenes, Staphylococcus aureus, Staphylococcus
epidernidis, Bifidobacterium longum, Bifidobacterium adolescentis,
Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium
laterosporus, Bifidobacterium animalis, Actinomyces israelii,
Eubacterium lentum, Peptostreptococcus anaerobis, Peptococcus
prevotti, and Acidaminococcus fermentans.
[0287] 4. Eukaryotic Cells
[0288] Also encompassed within the microorganisms provided herein
and the methods of making and using such microorganisms are
eukaryotic cells, including cells from multicellular eukaryotes,
including mammals such as primates, where exemplary cells are human
cells. Typically the cells are isolated cells. For example,
eukaryotic cells can be tumor cells, including mammalian tumor
cells such as primate tumor cells, where exemplary primate tumor
cells are human tumor cells such as human breast cancer cells. In
another example, eukaryotic cells can include fibrosarcoma cells
such as human fibrosarcoma cells. Exemplary human fibrosarcoma
cells include HT1080 (ATCC Accession Nos. CCL-121, CRL-12011 or
CRL-12012). In another example, eukaryotic cells can include stem
cells, including mammalian stem cells such as primate stem cells,
where exemplary primate stem cells are human stem cells.
[0289] Also provided herein are modifications of eukaryotic cells
to enhance one or more characteristics relative to the wild type
cells. Such characteristics can include, but are not limited to,
attenuated pathogenicity, reduced toxicity, preferential
accumulation in tumor, increased ability to activate an immune
response against tumor cells, increased immunogenicity, increased
or decreased replication competence, and are able to express
exogenous proteins, and combinations thereof. In some embodiments,
the modified eukaryotic cells have an ability to activate an immune
response against tumor cells without aggressively killing the tumor
cells. In other embodiments, the eukaryotic cells can be modified
to express one or more detectable genes, including genes that can
be used for imaging. In other embodiments, the eukaryotic cells can
be modified to express one or more genes for harvesting the gene
products and/or for harvesting antibodies against the gene
products.
C. Methods for Making a Modified Microorganism
[0290] The microorganisms provided herein can be formed by standard
methodologies well known in the art for modifying microorganisms
such as viruses, bacteria and eukaryotic cells. Briefly, the
methods include introducing into microorganisms one or more genetic
modification, followed by screening the microorganisms for
properties reflective of the modification or for other desired
properties.
[0291] 1. Genetic Modifications
[0292] Standard techniques in molecular biology can be used to
generate the modified microorganisms provided herein. Such
techniques include various nucleic acid manipulation techniques,
nucleic acid transfer protocols, nucleic acid amplification
protocols, and other molecular biology techniques known in the art.
For example, point mutations can be introduced into a gene of
interest through the use of oligonucleotide mediated site-directed
mutagenesis. Alternatively, homologous recombination can be used to
introduce a mutation or exogenous sequence into a target sequence
of interest. Nucleic acid transfer protocols include calcium
chloride tranformation/transfection, electroporation, liposome
mediated nucleic acid transfer,
N-[1-(2,3-Dioloyloxy)propyl]-N,N,N-trimethylammonium methylsulfate
meditated transformation, and others. In an alternative mutagenesis
protocol, point mutations in a particular gene can also be selected
for using a positive selection pressure. See, e.g., Current
Techniques in Molecular Biology, (Ed. Ausubel, et al.). Nucleic
acid amplification protocols include but are not limited to the
polymerase chain reaction (PCR). Use of nucleic acid tools such as
plasmids, vectors, promoters and other regulating sequences, are
well known in the art for a large variety of viruses and cellular
organisms. Further a large variety of nucleic acid tools are
available from many different sources including ATCC, and various
commercial sources. One skilled in the art will be readily able to
select the appropriate tools and methods for genetic modifications
of any particular virus or cellular organism according to the
knowledge in the art and design choice.
[0293] Any of a variety of modifications can be readily
accomplished using standard molecular biological methods known in
the art. The modifications will typically be one or more
truncations, deletions, mutations or insertions of the
microorganismal genome. In one embodiment, the modification can be
specifically directed to a particular sequence. The modifications
can be directed to any of a variety of regions of the
microorganismal genome, including, but not limited to, a regulatory
sequence, to a gene-encoding sequence, or to a sequence without a
known role. Any of a variety of regions of microorganismal genomes
that are available for modification are readily known in the art
for many microorganisms, including the microorganisms specifically
listed herein. As a non-limiting example, the loci of a variety of
vaccinia genes provided hereinelsewhere exemplify the number of
different regions that can be targeted for modification in the
microorganisms provided herein. In another embodiment, the
modification can be fully or partially random, whereupon selection
of any particular modified microorganism can be determined
according to the desired properties of the modified the
microorganism.
[0294] In some embodiments, the microorganism can be modified to
express an exogenous gene. Exemplary exogenous gene products
include proteins and RNA molecules. The modified microorganisms can
express a detectable gene product, a therapeutic gene product, a
gene product for manufacturing or harvesting, or an antigenic gene
product for antibody harvesting. The characteristics of such gene
products are described hereinelsewhere. In some embodiments of
modifying an organism to express an exogenous gene, the
modification can also contain one or more regulatory sequences to
regulate expression of the exogenous gene. As is known in the art,
regulatory sequences can permit constitutive expression of the
exogenous gene or can permit inducible expression of the exogenous
gene. Further, the regulatory sequence can permit control of the
level of expression of the exogenous gene. In some examples,
inducible expression can be under the control of cellular or other
factors present in a tumor cell or present in a
microorganism-infected tumor cell. In other examples, inducible
expression can be under the control of an administerable substance,
including IPTG, RU486 or other known induction compounds. Any of a
variety of regulatory sequences are available to one skilled in the
art according to known factors and design preferences. In some
embodiments, such as gene product manufacture and harvesting, the
regulatory sequence can result in constitutive, high levels of gene
expression. In some embodiments, such as anti-(gene product)
antibody harvesting, the regulatory sequence can result in
constitutive, lower levels of gene expression. In tumor therapy
embodiments, a therapeutic protein can be under the control of an
internally inducible promoter or an externally inducible
promoter.
[0295] In other embodiments, organ or tissue-specific expression
can be controlled by regulatory sequences. In order to achieve
expression only in the target organ, for example, a tumor to be
treated, the foreign nucleotide sequence can be linked to a tissue
specific promoter and used for gene therapy. Such promoters are
well known to those skilled in the art (see e.g., Zimmermann et
al., (1994) Neuron 12, 11-24; Vidal et al.; (1990) EMBO J. 9,
833-840; Mayford et al., (1995), Cell 81 891-904; Pinkert et al.,
(1987) Genes & Dev. 1, 268-76).
[0296] In some embodiments, the microorganisms can be modified to
express two or more proteins, where any combination of the two or
more proteins can be one or more detectable gene products,
therapeutic gene products, gene products for manufacturing or
harvesting, or antigenic gene products for antibody harvesting. In
one embodiment, a microorganism can be modified to express a
detectable protein and a therapeutic protein. In another
embodiment, a microorganism can be modified to express two or more
gene products for detection or two or more therapeutic gene
products. For example, one or more proteins involved in
biosynthesis of a luciferase substrate can be expressed along with
luciferase. When two or more exogenous genes are introduced, the
genes can be regulated under the same or different regulatory
sequences, and the genes can be inserted in the same or different
regions of the microorganismal genome, in a single or a plurality
of genetic manipulation steps. In some embodiments, one gene, such
as a gene encoding a detectable gene product, can be under the
control of a constitutive promoter, while a second gene, such as a
gene encoding a therapeutic gene product, can be under the control
of an inducible promoter. Methods for inserting two or more genes
in to a microorganism are known in the art and can be readily
performed for a wide variety of microorganisms using a wide variety
of exogenous genes, regulatory sequences, and/or other nucleic acid
sequences.
[0297] In an example of performing microorganismal modification
methods, vaccinia virus strain LIVP was modified to contain
insertions of exogenous DNA in three different locations of the
viral genome. Using general methods known in the art, known
molecular biology tools, and sequences known in the art or
disclosed herein can be used to create modified vaccinia virus
strains, including viruses containing insertions in the F3 gene, TK
gene and/or HA gene. See, e.g., Mikryukov, et al., Biotekhnologya 4
(1998), 442-449; Goebel et al., Virology 179 (1990), 247-266;
Antoine et al., Virology 244 (1998), 365-396; Mayr et al., Zentbl.
Bakteriol. Hyg. Abt 1 Orig. B 167 (1978), 375-390; Ando and
Matumoto, Jpn. J. Microbial. 14 (1979), 181-186; Sugimoto et al.,
Microbial. Immuol. 29 (1985), 421-428; Takahashi-Nishimaki et al.,
J. Gen. Virol. 68 (1987), 2705-2710). These methods include, for
example, in vitro recombination techniques, synthetic methods and
in vivo recombination methods as described, for example, in
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd
edition, Cold Spring Harbor Laboratory Press, cold Spring Harbor
N.Y. (1989), and in the Examples disclosed herein. The person
skilled in the art can isolate the gene encoding the gene product
of F3 (or a related gene product) from any vaccinia strain using,
for example, the nucleotide sequence of the F3 gene of SEQ ID NO:1
or SEQ ID NOS: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, or
a fragment thereof as a probe for screening a library.
[0298] Methods of producing recombinant microorganisms are known in
the art. Provided herein for exemplary purposes are methods of
producing a recombinant vaccinia virus. A recombinant vaccinia
virus with an insertion in the F3 gene (NotI site of LIVP) can be
prepared by the following steps: (a) generating (i) a vaccinia
shuttle plasmid containing the modified F3 gene inserted at
restriction site X and (ii) a dephosphorylated wt VV (VGL) DNA
digested at restriction site X; (b) transfecting host cells
infected with PUV-inactivated helper VV (VGL) with a mixture of the
constructs of (i) and (ii) of step a; and (c) isolating the
recombinant vaccinia viruses from the transfectants. One skilled in
the art knows how to perform such methods, for example by following
the instructions given in Example 1 and the legend to FIG. 1; see
also Timiryasova et al., Biotechniques 31 (2001), 534-540. In one
embodiment, restriction site X is a unique restriction site. A
variety of suitable host cells also are known to the person skilled
in the art and include many mammalian, avian and insect cells and
tissues which are susceptible for vaccinia virus infection,
including chicken embryo, rabbit, hamster and monkey kidney cells,
for example, HeLa cells, RK.sub.13, CV-1, Vero, BSC40 and BSC-1
monkey kidney cells.
[0299] 2. Screening for Above Characteristics
[0300] Modified microorganisms can be screened for any desired
characteristics, including the characteristics described herein
such as attenuated pathogenicity, reduced toxicity, preferential
accumulation in tumor, increased ability to activate an immune
response against tumor cells, increased immunogenicity, increased
or decreased replication competence, and are able to express
exogenous proteins, and combinations thereof. For example, the
modified microorganisms can be screened for the ability to activate
an immune response against tumor cells without aggressively killing
the tumor cells. In another example, the microorganisms can be
screened for expression of one or more detectable genes, including
genes that can be used for imaging, or for expression of one or
more genes for manufacture or harvest of the gene products and/or
for harvest of antibodies against the gene products.
[0301] Any of a variety of known methods for screening for such
characteristics can be performed, as demonstrated in the Examples
provided herein. One Exemplary method for screening for desired
characteristics includes, but is not limited to, monitoring growth,
replication and/or gene expression (including expression of an
exogenous gene) in cell culture or other in vitro medium. The cell
culture can be from any organism, and from any tissue source, and
can include tumorous tissues. Other exemplary methods for screening
for desired characteristics include, but are not limited to,
administering a microorganism to animal, including non-human
animals such as a mouse, monkey or ape, and optionally also
including humans, and monitoring the microorganism, the tumor, and
or the animal; monitoring can be performed by in vivo imaging of
the microorganism and/or the tumor (e.g., low light imaging of
microorganismal gene expression or ultrasonic tumor imaging),
external monitoring of the tumor (e.g., external measurement of
tumor size), monitoring the animal (e.g., monitoring animal weight,
blood panel, antibody titer, spleen size, or liver size). Other
exemplary methods for screening for desired characteristics
include, but are not limited to, harvesting a non-human animal for
the effects and location of the microorganism and expression by the
microorganism, including methods such as harvesting a variety of
organs including a tumor to determine presence of the microorganism
and/or gene expression by the microorganism in the organs or tumor,
harvesting of organs associated with an immune response or
microorganismal clearance such as the spleen or liver, harvesting
the tumor to determine tumor size and viability of tumor cells,
harvesting antibodies or antibody producing cells. Such screening
and monitoring methods can be used in any of a variety of
combinations, as is known in art. In one embodiment, a
microorganism can be screened by administering the microorganism to
an animal such as a non-human animal or a human, followed by
monitoring by in vivo imaging. In another embodiment, a
microorganism can be screened by administering the microorganism to
an animal such as a non-human animal, monitoring by in vivo
imaging, and then harvesting the animal. Thus, provided herein are
methods for screening a microorganism for desired characteristics
by administering the microorganism to an animal such as an animal
with a tumor, and monitoring the animal, tumor (if present), and/or
microorganism in the animal for one or more characteristics. Also
provided herein are methods for screening a microorganism for
desired characteristics by administering the microorganism to a
non-human animal such as a non-human animal with a tumor,
harvesting the animal, and assaying the animal's organs, antibody
titer, and/or tumor (if present) for one or more
characteristics.
[0302] Provided herein are methods for screening a microorganism
for attenuated pathogenicity or reduced toxicity, where the
pathogenicity or toxicity can be determined by a variety of
techniques, including, but not limited to, assessing the health
state of the subject, measuring the body weight of a subject, blood
or urine analysis of a subject, and monitoring tissue distribution
of the microorganism within the subject; such techniques can be
performed on a living subject in vivo, or can be performed post
mortem. Methods also can include the ability of the microorganisms
to lyse cells or cause cell death, which can be determined in vivo
or in vitro.
[0303] When a subject drops below a threshold body weight, the
microorganism can be considered pathogenic to the subject.
Exemplary thresholds can be a drop of about 5% or more, a drop of
about 10% or more, or a drop of about 15% or more in body weight
relative to a reference. A body weight reference can be selected
from any of a variety of references used in the art; for example, a
body weight reference can be the weight of the subject prior to
administration of the microorganism, the body weight reference can
be a control subject having the same condition as the test subject
(e.g., normal or tumor-injected), where the change in weight of the
control is compared to the change in weight of the test subject for
the time period after administration of the microorganism.
[0304] Blood or urine analysis of the subject can indicate level of
immune response, level of toxins in the subject, or other levels of
stress to cells, tissues or organs of the subject such as kidneys,
pancreas, liver and spleen. Levels increased above established
threshold levels can indicate pathogenicity of the microorganism to
the subject. Threshold levels of components of blood or urine for
indicating microorganismal pathogenicity are well known in the art,
and any such thresholds can be selected herein according to the
desired tolerance of pathogenicity or toxicity of the
microorganism.
[0305] Tissue distribution of a microorganism in a subject can
indicate pathogenicity or toxicity of the microorganism. In one
embodiment, tissue distribution of a microorganism that is not
pathogenic or toxic can be mostly in tumor relative to other
tissues or organs. Microorganisms located mostly in tumor can
accumulate, for example, at least about 2-fold greater, at least
about 5-fold greater, at least about 10-fold greater, at least
about 100-fold greater, at least about 1,000-fold greater, at least
about 10,000-fold greater, at least about 100,000-fold greater, or
at least about 1,000,000-fold greater, than the microorganisms
accumulate in any other particular organ or tissue.
[0306] Provided herein are methods for screening a microorganism
for tissue distribution or accumulation, where the tissue
distribution can be determined by a variety of techniques,
including, but not limited to, harvesting a non-human subject, in
vivo imaging a detectable gene product in subject. Harvesting can
be accomplished by euthanizing the non-human subject, and
determining the accumulation of microorganisms in tumor and,
optionally, the accumulation in one or more additional tissues or
organs. The accumulation can be determined by any of a variety of
methods, including, but not limited to, detecting gene products
such as detectable gene products (e.g., gfp or beta galactosidase),
histological or microscopic evaluation of tissue, organ or tumor
samples, or measuring the number of plaque or colony forming units
present in a tissue, organ or tumor sample. In one embodiment, the
desired amount of tissue distribution of a microorganism can be
mostly in tumor relative to other tissues or organs. Microorganisms
located mostly in tumor can accumulate, for example, at least about
2-fold greater, at least about 5-fold greater, at least about
10-fold greater, at least about 100-fold greater, at least about
1,000-fold greater, at least about 10,000-fold greater, at least
about 100,000-fold greater, or at least about 1,000,000-fold
greater, than the microorganisms accumulate in any other particular
organ or tissue.
[0307] Also provided herein are methods of screening for
microorganisms that can elicit an immune response, where the immune
response can be against the tumor cells or against the
microorganisms. A variety of methods for measuring the ability to
elicit an immune response are known in the art, and include
measuring an overall increase in immune activity in a subject,
measuring an increase in anti-microorganism or anti-tumor
antibodies in a subject, testing the ability of a
microorganism-treated (typically a non-human) subject to prevent
later infection/tumor formation or to rapidly eliminate
microorganisms or tumor cells. Methods also can include the ability
of the microorganisms to lyse cells or cause cell death, which can
be determined in vivo or in vitro.
[0308] Also provided herein are methods for determining increased
or decreased replication competence, by monitoring the speed of
replication of the microorganisms. Such measurements can be
performed in vivo or in vitro. For example, the speed of
replication in a cell culture can be used to determine replication
competence of a microorganism. In another example, the speed of
replication in a tissue, organ or tumor in a subject can be used to
measure replication competence. In some embodiments, decreased
replication competence in non-tumor tissues and organs can be the
characteristic to be selected in a screen. In other embodiments,
increased replication competence in tumors can be the
characteristic to be selected in a screen.
[0309] Also provided herein are methods for determining the ability
of a microorganism to express genes, such as exogenous gene. Such
methods can be performed in vivo or in vitro. For example, the
microorganisms can be screened on selective plates for the ability
to express a gene that permits survival of the microorganism or
permits the microorganism to provide a detectable signal, such as
turning X-gal blue. Such methods also can be performed in vivo,
where expression can be determined, for example, by harvesting
tissues, organs or tumors a non-human subject or by in vivo imaging
of a subject.
[0310] Also provided herein are methods for determining the ability
of a microorganism to express genes toward which the subject can
develop antibodies, including exogenous genes toward which the
subject can develop antibodies. Such methods can be performed in
vivo using any of a variety of non-human subjects. For example,
gene expression can be determined, for example, by bleeding a
non-human subject to which a microorganism has been administered,
and assaying the blood (or serum) for the presence of antibodies
against the microorganism-expressed gene, or by any other method
generally used for polyclonal antibody harvesting, such as
production bleeds and terminal bleeds.
[0311] Also provided herein are methods for screening a
microorganism that has two or more characteristics provided herein,
including screening for attenuated pathogenicity, reduced toxicity,
preferential accumulation in tumor, increased ability to activate
an immune response against tumor cells, increased immunogenicity,
increased or decreased replication competence, ability to express
exogenous proteins, and ability to elicit antibody production
against a microorganismally expressed gene product. A single
monitoring technique, such as in vivo imaging, can be used to
verify two or more characteristics, or a variety of different
monitoring techniques can be used, as can be determined by one
skilled in the art according to the selected characteristics and
according to the monitoring techniques used.
D. Therapeutic Methods
[0312] Provided herein are therapeutic methods, including methods
of treating or preventing immunoprivileged cells or tissue,
including cancerous cells, tumor and metastasis. The methods
provided herein include administering a microorganism to a subject
containing a tumor and/or metastases. The methods provided herein
do not require the microorganism to kill tumor cells or decrease
the tumor size. Instead, the methods provided herein include
administering to a subject a microorganism that can cause or
enhance an anti-tumor immune response in the subject. In some
embodiments, the microorganisms provided herein can be administered
to a subject without causing microorganism-induced disease in the
subject. In some embodiments, the microorganisms can accumulate in
tumors or metastases. In some embodiments, the microorganisms can
elicit an anti-tumor immune response in the subject, where
typically the microorganism-mediated anti-tumor immune response can
develop over several days, such as a week or more, 10 days or more,
two weeks or more, or a month or more, as a result of little or no
microorganism-cause tumor cell death. In some exemplary methods,
the microorganism can be present in the tumor, and can cause an
anti-tumor immune response without the microorganism itself causing
enough tumor cell death to prevent tumor growth.
[0313] In some embodiments, provided herein are methods for
eliciting or enhancing antibody production against a selected
antigen or a selected antigen type in a subject, where the methods
include administering to a subject a microorganism that can
accumulate in a tumor and/or metastasis, and can cause release of a
selected antigen or selected antigen type from the tumor, resulting
in antibody production against the selected antigen or selected
antigen type. The administered microorganisms can posses one or
more characteristics including attenuated pathogenicity, low
toxicity, preferential accumulation in tumor, ability to activate
an immune response against tumor cells, immunogenicity, replication
competence, ability to express exogenous genes, and ability to
elicit antibody production against a microorganismally expressed
gene product.
[0314] Any of a variety of antigens can be targeted in the methods
provided herein, including a selected antigen such as an exogenous
gene product expressed by the microorganism, or a selected antigen
type such as one or more tumor antigens release from the tumor as a
result of microorganism infection of the tumor (e.g., by lysis,
apoptosis, secretion or other mechanism of causing antigen release
from the tumor). In at least some embodiments, it can be desirable
to maintain release of the selected antigen or selected antigen
type over a series of days, for example, at least a week, at least
ten days, at least two weeks or at least a month.
[0315] Also provided herein are methods for providing a sustained
antigen release within a subject, where the methods include
administering to a subject a microorganism that can accumulate in a
tumor and/or metastasis, and can cause sustained release of an
antigen, resulting in antibody production against the antigen. The
sustained release of antigen can last for several days, for
example, at least a week, at least ten days, at least two weeks or
at least a month. The administered microorganisms can posses one or
more characteristics including attenuated pathogenicity, low
toxicity, preferential accumulation in tumor, ability to activate
an immune response against tumor cells, immunogenicity, replication
competence, ability to express exogenous genes, and ability to
elicit antibody production against a microorganismally expressed
gene product. The sustained release of antigen can result in an
immune response by the microorganism-infected host, in which the
host can develop antibodies against the antigen, and/or the host
can mount an immune response against cells expressing the antigen,
including an immune response against tumor cells. Thus, the
sustained release of antigen can result in immunization against
tumor cells. In some embodiments, the microorganism-mediated
sustained antigen release-induced immune response against tumor
cells can result in complete removal or killing of all tumor
cells.
[0316] Also provided herein are methods for inhibiting tumor growth
in a subject, where the methods include administering to a subject
a microorganism that can accumulate in a tumor and/or metastasis,
and can cause or enhance an anti-tumor immune response. The
anti-tumor immune response induced as a result of tumor or
metastases-accumulated microorganisms can result in inhibition of
tumor growth. The administered microorganisms can posses one or
more characteristics including attenuated pathogenicity, low
toxicity, preferential accumulation in tumor, ability to activate
an immune response against tumor cells, immunogenicity, replication
competence, ability to express exogenous genes, and ability to
elicit antibody production against a microorganismally expressed
gene product.
[0317] Also provided herein are methods for inhibiting growth or
formation of a metastasis in a subject, where the methods include
administering to a subject a microorganism that can accumulate in a
tumor and/or metastasis, and can cause or enhance an anti-tumor
immune response. The anti-tumor immune response induced as a result
of tumor or metastasis-accumulated microorganisms can result in
inhibition of metstasis growth or formation. The administered
microorganisms can posses one or more characteristics including
attenuated pathogenicity, low toxicity, preferential accumulation
in tumor, ability to activate an immune response against tumor
cells, immunogenicity, replication competence, ability to express
exogenous genes, and ability to elicit antibody production against
a microorganismally expressed gene product.
[0318] Also provided herein are methods for decreasing the size of
a tumor and/or metastasis in a subject, where the methods include
administering to a subject a microorganism that can accumulate in a
tumor and/or metastasis, and can cause or enhance an anti-tumor
immune response. The anti-tumor immune response induced as a result
of tumor or metastasis-accumulated microorganisms can result in a
decrease in the size of the tumor and/or metastasis. The
administered microorganisms can posses one or more characteristics
including attenuated pathogenicity, low toxicity, preferential
accumulation in tumor, ability to activate an immune response
against tumor cells, immunogenicity, replication competence,
ability to express exogenous genes, and ability to elicit antibody
production against a microorganismally expressed gene product.
[0319] Also provided herein are methods for eliminating a tumor
and/or metastasis from a subject, where the methods include
administering to a subject a microorganism that can accumulate in a
tumor and/or metastasis, and can cause or enhance an anti-tumor
immune response. The anti-tumor immune response induced as a result
of tumor or metastasis-accumulated microorganisms can result in
elimination of the tumor and/or metastasis from the subject. The
administered microorganisms can posses one or more characteristics
including attenuated pathogenicity, low toxicity, preferential
accumulation in tumor, ability to activate an immune response
against tumor cells, immunogenicity, replication competence,
ability to express exogenous genes, and ability to elicit antibody
production against a microorganismally expressed gene product.
[0320] Methods of reducing inhibiting tumor growth, inhibiting
metastatis growth and/or formation, decreasing the size of a tumor
or metastasis, eliminating a tumor or metastasis, or other tumor
therapeutic methods provided herein include causing or enhancing an
anti-tumor immune response in the host. The immune response of the
host, being anti-tumor in nature, can be mounted against tumors
and/or metastases in which microorganisms have accumulated, and can
also be mounted against tumors and/or metastases in which
microorganisms have not accumulated, including tumors and/or
metastases that form after administration of the microorganisms to
the subject. Accordingly, a tumor and/or metastasis whose growth or
formation is inhibited, or whose size is decreased, or that is
eliminated, can be a tumor and/or metastasis in which the
microorganisms have accumulated, or also can be a tumor and/or
metastasis in which the microorganisms have not accumulated.
Accordingly, provided herein are methods of reducing inhibiting
tumor growth, inhibiting metastatis growth and/or formation,
decreasing the size of a tumor or metastasis, eliminating a tumor
or metastasis, or other tumor therapeutic methods, where the method
includes administering to a subject a microorganism, where the
microorganism accumulates in at least one tumor or metastasis and
causes or enhances an anti-tumor immune response in the subject,
and the immune response also is mounted against a tumor and/or
metastasis in which the microorganism cell did not accumulate. In
another embodiment, methods are provided for inhibiting or
preventing recurrence of a neoplastic disease or inhibiting or
preventing new tumor growth, where the methods include
administering to a subject a microorganism that can accumulate in a
tumor and/or metastasis, and can cause or enhance an anti-tumor
immune response, and the anti-tumor immune response can inhibit or
prevent recurrence of a neoplastic disease or inhibit or prevent
new tumor growth.
[0321] The tumor or neoplastic disease therapeutic methods provided
herein, such as methods of reducing inhibiting tumor growth,
inhibiting metastatis growth and/or formation, decreasing the size
of a tumor or metastasis, eliminating a tumor or metastasis, or
other tumor therapeutic methods, also can include administering to
a subject a microorganism that can cause tumor cell lysis or tumor
cell death. Such a microorganism can be the same microorganism as
the microorganism that can cause or enhance an anti-tumor immune
response in the subject. Microorganisms, such as the microorganisms
provided herein, can cause cell lysis or tumor cell death as a
result of expression of an endogenous gene or as a result of an
exogenous gene. Endogenous or exogenous genes can cause tumor cell
lysis or inhibit cell growth as a result of direct or indirect
actions, as is known in the art, including lytic channel formation
or activation of an apoptotic pathway. Gene products, such as
exogenous gene products can function to activate a prodrug to an
active, cytotoxic form, resulting in cell death where such genes
are expressed.
[0322] Such methods of antigen production or tumor and/or
metastasis treatment can include administration of a modified
microorganism described herein or a microorganism having
modifications with a functional equivalence to the vaccinia virus
provided herein containing a modification of the F3 gene and the TK
gene and/or the HA gene, for therapy, such as for gene therapy, for
cancer gene therapy, or for vaccine therapy. Such a microorganism
can be used to stimulate humoral and/or cellular immune response,
induce strong cytotoxic T lymphocytes responses in subjects who may
benefit from such responses. For example, the microorganism can
provide prophylactic and therapeutic effects against a tumor
infected by the microorganism or other infectious diseases, by
rejection of cells from tumors or lesions using microorganisms that
express immunoreactive antigens (Earl et al. (1986), Science 234,
728-831; Lathe et al. (1987), Nature (London) 326, 878-880),
cellular tumor-associated antigens (Bernards et al., (1987), Proc.
Natl. Acad. Sci. USA 84, 6854-6858; Estin et al. (1988), Proc.
Natl. Acad. Sci. USA 85, 1052-1056; Kantor et al. (1992), J. Natl.
Cancer Inst. 84, 1084-1091; Roth et al. (1996), Proc. Natl. Acad.
Sci. USA 93, 47814786) and/or cytokines (e.g., IL-2, IL-12),
costimulatory molecules (B7-1, B7-2) (Rao et al. (1996), J.
Immunol. 156, 3357-3365; Chamberlain et al. (1996), Cancer Res. 56,
2832-2836; Oertli et al. (1996), J. Gen. Virol. 77, 3121-3125; Qin
and Chatterjee (1996), Human Gene Ther. 7, 1853-1860; McAneny et
al. (1996), Ann. Surg. Oncol. 3,495-500), or other therapeutic
proteins.
[0323] Provided herein, solid tumors can be treated with
microorganisms, such as vaccinia viruses, resulting in an enormous
tumor-specific microorganism replication, which can lead to tumor
protein antigen and viral protein production in the tumors. As
provided herein, vaccinia virus administration to mice resulted in
lysis of the infected tumor cells and a resultant release of
tumor-cell-specific antigens. Continuous leakage of these antigens
into the body led to a very high level of antibody titer (in
approximately 7-14 days) against tumor proteins, viral proteins,
and the virus encoded engineered proteins in the mice. The newly
synthesized antitumor antibodies and the enhanced macrophage,
neutrophils count were continuously delivered via the vasculature
to the tumor and thereby provided for the recruitment of an
activated immune system against the tumor. The activated immune
system then eliminated the foreign compounds of the tumor including
the viral particles. This interconnected release of foreign
antigens boosted antibody production and continuous response of the
antibodies against the tumor proteins to function like an
autoimmunizing vaccination system initiated by vaccinia viral
infection and replication, followed by cell lysis, protein leakage
and enhanced antibody production. Thus, the present methods can
provide a complete process that can be applied to all tumor systems
with immunoprivileged tumor sites as site of privileged viral,
bacterial, and mammalian cell growth, which can lead to tumor
elimination by the host's own immune system.
[0324] In other embodiments, methods are provided for immunizing a
subject, where the methods include administering to the subject a
microorganism that expresses one or more antigens against which
antigens the subject will develop an immune response. The
immunizing antigens can be endogenous to the microorganism, such as
vaccinia antigens on a vaccinia virus used to immunize against
smallpox, or the immunizing antigens can be exogenous antigens
expressed by the microorganism, such as influenza or HIV antigens
expressed on a viral capsid or bacterial cell surface. Thus, the
microorganisms provided herein, including the modified vaccinia
viruses can be used as vaccines.
[0325] 1. Administration
[0326] In performing the methods provided herein, a microorganism
can be administered to a subject, including a subject having a
tumor or having neoplastic cells, or a subject to be immunized. An
administered microorganism can be a microorganism provided herein
or any other microorganism known for administration to a subject,
for example, any known microorganism known for therapeutic
administration to a subject, including antigenic microorganisms
such as any microorganism known to be used for vaccination. In some
embodiments, the microorganism administered is a microorganism
containing a characteristic such as attenuated pathogenicity, low
toxicity, preferential accumulation in tumor, ability to activate
an immune response against tumor cells, high immunogenicity,
replication competence, and ability to express exogenous proteins,
and combinations thereof. [0327] a. Steps Prior to Administering
the Microorganism
[0328] In some embodiments, one or more steps can be performed
prior to administration of the microorganism to the subject. Any of
a variety of preceding steps can be performed, including, but not
limited to diagnosing the subject with a condition appropriate for
microorganismal administration, determining the immunocompetence of
the subject, immunizing the subject, treating the subject with a
chemotherapeutic agent, treating the subject with radiation, or
surgically treating the subject.
[0329] For embodiments that include administering a microorganism
to a tumor-bearing subject for therapeutic purposes, the subject
has typically been previously diagnosed with a neoplastic
condition. Diagnostic methods also can include determining the type
of neoplastic condition, determining the stage of the neoplastic
conditions, determining the size of one or more tumors in the
subject, determining the presence or absence of metastatic or
neoplastic cells in the lymph nodes of the subject, or determining
the presence of metastases of the subject. Some embodiments of
therapeutic methods for administering a microorganism to a subject
can include a step of determination of the size of the primary
tumor or the stage of the neoplastic disease, and if the size of
the primary tumor is equal to or above a threshold volume, or if
the stage of the neoplastic disease is at or above a threshold
stage, a microorganism is administered to the subject. In a similar
embodiment, if the size of the primary tumor is below a threshold
volume, or if the stage of the neoplastic disease is at or below a
threshold stage, the microorganism is not yet administered to the
subject; such methods can include monitoring the subject until the
tumor size or neoplastic disease stage reaches a threshold amount,
and then administering the microorganism to the subject. Threshold
sizes can vary according to several factors, including rate of
growth of the tumor, ability of the microorganism to infect a
tumor, and immunocompetence of the subject. Generally the threshold
size will be a size sufficient for a microorganism to accumulate
and replicate in or near the tumor without being completely removed
by the host's immune system, and will typically also be a size
sufficient to sustain a microorganismal infection for a time long
enough for the host to mount an immune response against the tumor
cells, typically about one week or more, about ten days or more, or
about two weeks or more. Exemplary threshold tumor sizes for
viruses such as vaccinia viruses are at least about 100 mm.sup.3,
at least about 200 mm.sup.3, at least about 300 mm.sup.3, at least
about 400 mm.sup.3, at least about 500 mm.sup.3, at least about 750
mm.sup.3, at least about 1000 mm.sup.3, or at least about 1500
mm.sup.3. Threshold neoplastic disease stages also can vary
according to several factors, including specific requirement for
staging a particular neoplastic disease, aggressiveness of growth
of the neoplastic disease, ability of the microorganism to infect a
tumor or metastasis, and immunocompetence of the subject. Generally
the threshold stage will be a stage sufficient for a microorganism
to accumulate and replicate in a tumor or metastasis without being
completely removed by the host's immune system, and will typically
also be a size sufficient to sustain a microorganismal infection
for a time long enough for the host to mount an immune response
against the neoplastic cells, typically about one week or more,
about ten days or more, or about two weeks or more. Exemplary
threshold stages are any stage beyond the lowest stage (e.g., Stage
I or equivalent), or any stage where the primary tumor is larger
than a threshold size, or any stage where metastatic cells are
detected.
[0330] In other embodiments, prior to administering to the subject
a microorganism, the immunocompetence of the subject can be
determined. The methods of administering a microorganism to a
subject provided herein can include causing or enhancing an immune
response in a subject. Accordingly, prior to administering a
microorganism to a subject, the ability of a subject to mount an
immune response can be determined. Any of a variety of tests of
immunocompetence known in the art can be performed in the methods
provided herein. Exemplary immunocompetence tests can examine ABO
hemagglutination titers (IgM), leukocyte adhesion deficiency (LAD),
granulocyte function (NBT), T and B cell quantitation, tetanus
antibody titers, salivary IgA, skin test, tonsil test, complement
C3 levels, and factor B levels, and lymphocyte count. One skilled
in the art can determine the desirability to administer a
microorganism to a subject according to the level of
immunocompetence of the subject, according to the immunogenicity of
the microorganism, and, optionally, according to the immunogenicity
of the neoplastic disease to be treated. Typically, a subject can
be considered immunocompetent if the skilled artisan can determine
that the subject is sufficiently competent to mount an immune
response against the microorganism.
[0331] In some embodiments, the subject can be immunized prior to
administering to the subject a microorganism according to the
methods provided herein. Immunization can serve to increase the
ability of a subject to mount an immune response against the
microorganism, or increase the speed at which the subject can mount
an immune response against a microorganism. Immunization also can
serve to decrease the risk to the subject of pathogenicity of the
microorganism. In some embodiments, the immunization can be
performed with an immunization microorganism that is similar to the
therapeutic microorganism to be administered. For example, the
immunization microorganism can be a replication-incompetent variant
of the therapeutic microorganism. In other embodiments, the
immunization material can be digests of the therapeutic
microorganism to be administered. Any of a variety of methods for
immunizing a subject against a known microorganism are known in the
art and can be used herein. In one example, vaccinia viruses
treated with, for example, 1 microgram of psoralen and ultraviolet
light at 365 nm for 4 minutes, can be rendered replication
incompetent. In another embodiment, the microorganism can be
selected as the same or similar to a microorganism against which
the subject has been previously immunized, e.g., in a childhood
vaccination.
[0332] In another embodiment, the subject can have administered
thereto a microorganism without any previous steps of cancer
treatment such as chemotherapy, radiation therapy or surgical
removal of a tumor and/or metastases. The methods provided herein
take advantage of the ability of the microorganisms to enter or
localize near a tumor, where the tumor cells can be protected from
the subject's immune system; the microorganisms can then
proliferate in such an immunoprotected region and can also cause
the release, typically a sustained release, of tumor antigens from
the tumor to a location in which the subject's immune system can
recognize the tumor antigens and mount an immune response. In such
methods, existence of a tumor of sufficient size or sufficiently
developed immunoprotected state can be advantageous for successful
administration of the microorganism to the tumor, and for
sufficient tumor antigen production. If a tumor is surgically
removed, the microorganisms may not be able to localize to other
neoplastic cells (e.g., small metastases) because such cells may
not yet have matured sufficiently to create an immunoprotective
environment in which the microorganisms can survive and
proliferate, or even if the microorganisms can localize to
neoplastic cells, the number of cells or size of the mass may be
too small for the microorganisms to cause a sustained release of
tumor antigens in order for the host to mount an anti-tumor immune
response. Thus, for example, provided herein are methods of
treating a tumor or neoplastic disease in which microorganisms are
administered to a subject with a tumor or neoplastic disease
without removing the primary tumor, or to a subject with a tumor or
neoplastic disease in which at least some tumors or neoplastic
cells are intentionally permitted to remain in the subject. In
other typical cancer treatment methods such as chemotherapy or
radiation therapy, such methods typically have a side effect of
weakening the subject's immune system. This treatment of a subject
by chemotherapy or radiation therapy can reduce the subject's
ability to mount an anti-tumor immune response. Thus, for example,
provided herein are methods of treating a tumor or neoplastic
disease in which microorganisms are administered to a subject with
a tumor or neoplastic disease without treating the subject with an
immune system-weakening therapy, such as chemotherapy or radiation
therapy.
[0333] In an alternative embodiment, prior to administration of a
microorganism to the subject, the subject can be treated in one or
more cancer treatment steps that do not remove the primary tumor or
that do not weaken the immune system of the subject. A variety of
more sophisticated cancer treatment methods are being developed in
which the tumor can be treated without surgical removal or
immune-system weakening therapy. Exemplary methods include
administering a compound that decreases the rate of proliferation
of the tumor or neoplastic cells without weakening the immune
system (e.g,. by administering tumor suppressor compounds or by
administering tumor cell-specific compounds) or administering an
angiogenesis-inhibiting compound. Thus, combined methods that
include administering a microorganism to a subject can further
improve cancer therapy. Thus, provided herein are methods of
administering a microorganism to a subject, along with prior to or
subsequent to, for example, administering a compound that slows
tumor growth without weakening the subject's immune system or a
compound that inhibits vascularization of the tumor. [0334] b. Mode
of Administration
[0335] Any mode of administration of a microorganism to a subject
can be used, provided the mode of administration permits the
microorganism to enter a tumor or metastasis. Modes of
administration can include, but are not limited to, intravenous,
intraperitoneal, subcutaneous, intramuscular, topical, intratumor,
multipuncture (e.g., as used with smallpox vaccines), inhalation,
intranasal, oral, intracavity (e.g., administering to the bladder
via a catheter, administering to the gut by suppository or enema),
aural, or ocular administration. One skilled in the art can select
any mode of administration compatible with the subject and the
microorganism, and that also is likely to result in the
microorganism reaching tumors and/or metastases. The route of
administration can be selected by one skilled in the art according
to any of a variety of factors, including the nature of the
disease, the kind of tumor, and the particular microorganism
contained in the pharmaceutical composition. Administration to the
target site can be performed, for example, by ballistic delivery,
as a colloidal dispersion system, or systemic administration can be
performed by injection into an artery.
[0336] c. Dosage
[0337] The dosage regimen can be any of a variety of methods and
amounts, and can be determined by one skilled in the art according
to known clinical factors. As is known in the medical arts, dosages
for any one patient can depend on many factors, including the
subject's species, size, body surface area, age, sex,
immunocompetence, and general health, the particular microorganism
to be administered, duration and route of administration, the kind
and stage of the disease, for example, tumor size, and other
compounds such as drugs being administered concurrently. In
addition to the above factors, such levels can be affected by the
infectivity of the microorganism, and the nature of the
microorganism, as can be determined by one skilled in the art. At
least some of the viruses used the in the methods provided herein
can be more infectious than the bacteria used herein. Thus, in some
embodiments of the present methods, virus can be administered at
lower levels than bacteria. In the present methods, appropriate
minimum dosage levels of microorganisms can be levels sufficient
for the microorganism to survive, grow and replicate in a tumor or
metastasis. Exemplary minimum levels for administering a virus to a
65 kg human can include at least about 5.times.10.sup.5 plaque
forming units (pfu), at least about 1.times.10.sup.6 pfu, at least
about 5.times.10.sup.6 pfu, at least about 1.times.10.sup.7 pfu, or
at least about 1.times.10.sup.8 pfu. Exemplary minimum levels for
administering a bacterium to a 65 kg human can include at least
about 5.times.10.sup.6 colony forming units (cfu), at least about
1.times.10.sup.7 cfu, at least about 5.times.10.sup.7 cfu, at least
about 1.times.10.sup.8 cfu, or at least about 1.times.10.sup.9 cfu.
In the present methods, appropriate maximum dosage levels of
microorganisms can be levels that are not toxic to the host, levels
that do not cause splenomegaly of 3.times. or more, levels that do
not result in colonies or plaques in normal tissues or organs after
about 1 day or after about 3 days or after about 7 days. Exemplary
maximum levels for administering a virus to a 65 kg human can
include no more than about 5.times.10.sup.10 pfu, no more than
about 1.times.10.sup.10 pfu, no more than about 5.times.10.sup.9
pfu, no more than about 1.times.10.sup.9 pfu, or no more than about
1.times.10.sup.8 pfu. Exemplary maximum levels for administering a
bacterium to a 65 kg human can include no more than about
5.times.10.sup.11 pfu, no more than about 1.times.10.sup.10 pfu, no
more than about 5.times.10.sup.10 pfu, no more than about
1.times.10.sup.10 pfu, or no more than about 1.times.10.sup.9
pfu.
[0338] d. Number of Administrations
[0339] The methods provided herein can include a single
administration of a microorganism to a subject or multiple
administrations of a microorganism to a subject. In some
embodiments, a single administration is sufficient to establish a
microorganism in a tumor, where the microorganism can proliferate
and can cause or enhance an anti-tumor response in the subject;
such methods do not require additional administrations of a
microorganism in order to cause or enhance an anti-tumor response
in a subject, which can result, for example in inhibition of tumor
growth, inhibition of metastasis growth or formation, reduction in
tumor or metastasis size, elimination of a tumor or metastasis,
inhibition or prevention of recurrence of a neoplastic disease or
new tumor formation, or other cancer therapeutic effects. In other
embodiments, a microorganism can be administered on different
occasions, separated in time typically by at least one day.
Separate administrations can increase the likelihood of delivering
a microorganism to a tumor or metastasis, where a previous
administration may have been ineffective in delivering a
microorganism to a tumor or metastasis. Separate administrations
can increase the locations on a tumor or metastasis where
microorganism proliferation can occur or can otherwise increase the
titer of microorganism accumulated in the tumor, which can increase
the scale of release of antigens or other compounds from the tumor
in eliciting or enhancing a host's anti-tumor immune response, and
also can, optionally, increase the level of microorganism-based
tumor lysis or tumor cell death. Separate administrations of a
microorganism can further extend a subject's immune response
against microorganismal antigens, which can extend the host's
immune response to tumors or metastases in which microorganisms
have accumulated, and can increase the likelihood of a host
mounting an anti-tumor immune response.
[0340] When separate administrations are performed, each
administration can be a dosage amount that is the same or different
relative to other administration dosage amounts. In one embodiment,
all administration dosage amounts are the same. In other
embodiments, a first dosage amount can be a larger dosage amount
than one or more subsequent dosage amounts, for example, at least
10.times. larger, at least 100.times. larger, or at least
1000.times. larger than subsequent dosage amounts. In one example
of a method of separate administrations in which the first dosage
amount is greater than one or more subsequent dosage amounts, all
subsequent dosage amounts can be the same, smaller amount relative
to the first administration.
[0341] Separate administrations can include any number of two or
more administrations, including two, three, four, five or six
administrations. One skilled in the art can readily determine the
number of administrations to perform or the desirability of
performing one or more additional administrations according to
methods known in the art for monitoring therapeutic methods and
other monitoring methods provided herein. Accordingly, the methods
provided herein include methods of providing to the subject one or
more administrations of a microorganism, where the number of
administrations can be determined by monitoring the subject, and,
based on the results of the monitoring, determining whether or not
to provide one or more additional administrations. Deciding
on-whether or not to provide one or more additional administrations
can be based on a variety of monitoring results, including, but not
limited to, indication of tumor growth or inhibition of tumor
growth, appearance of new metastases or inhibition of metastasis,
the subject's anti-microorganism antibody titer, the subject's
anti-tumor antibody titer, the overall health of the subject, the
weight of the subject, the presence of microorganism solely in
tumor and/or metastases, the presence of microorganism in normal
tissues or organs.
[0342] The time period between administrations can be any of a
variety of time periods. The time period between administrations
can be a function of any of a variety of factors, including
monitoring steps, as described in relation to the number of
administrations, the time period for a subject to mount an immune
response, the time period for a subject to clear microorganism from
normal tissue, or the time period for microorganismal proliferation
in the tumor or metastasis. In one example, the time period can be
a function of the time period for a subject to mount an immune
response; for example, the time period can be more than the time
period for a subject to mount an immune response, such as more than
about one week, more than about ten days, more than about two
weeks, or more than about a month; in another example, the time
period can be less than the time period for a subject to mount an
immune response, such as less than about one week, less than about
ten days, less than about two weeks, or less than about a month. In
another example, the time period can be a function of the time
period for a subject to clear microorganism from normal tissue; for
example, the time period can be more than the time period for a
subject to clear microorganism from normal tissue, such as more
than about a day, more than about two days, more than about three
days, more than about five days, or more than about a week. In
another example, the time period can be a function of the time
period for microorganismal proliferation in the tumor or
metastasis; for example, the time period can be more than the
amount of time for a detectable signal to arise in a tumor or
metastasis after administration of a microorganism expressing a
detectable marker, such as about 3 days, about 5 days, about a
week, about ten days, about two weeks, or about a month.
[0343] e. Co-Administrations
[0344] Also provided are methods in which an additional therapeutic
substance, such as a different therapeutic microorganism or a
therapeutic compound is administered. These can be administered
simultaneously, sequentially or intermittently with the first
microorganism. The additional therapeutic substance can interact
with the microorganism or a gene product thereof, or the additional
therapeutic substance can act independently of the
microorganism.
[0345] i. Administration of a Plurality of Microorganisms
[0346] Methods are provided for administering to a subject two or
more microorganisms. Administration can be effected simultaneously,
sequentially or intermittently. The plurality of microorganisms can
be administered as a single composition or as two or more
compositions. The two or more microorganisms can include at least
two bacteria, at least two viruses, at least two eukaryotic cells,
or two or more selected from among bacteria, viruses and eukaryotic
cells. The plurality of microorganisms can be provided as
combinations of compositions containing and/or as kits that include
the microorganisms packaged for administration and optionally
including instructions therefore. The compositions can contain the
microorganisms formulated for single dosage administration (i.e.,
for direct administration) and can require dilution or other
additions.
[0347] In one embodiment, at least one of the microorganisms is a
modified microorganism such as those provided herein, having a
characteristic such as low pathogenicity, low toxicity,
preferential accumulation in tumor, ability to activate an immune
response against tumor cells, immunogenic, replication competent,
ability to express exogenous proteins, and combinations thereof.
The microorganisms can be administered at approximately the same
time, or can be administered at different times. The microorganisms
can be administered in the same composition or in the same
administration method, or can be administered in separate
composition or by different administration methods.
[0348] In one example, a bacteria and a virus can be administered
to a subject. The bacteria and virus can be administered at the
same time, or at different times. For example, the virus can be
administered prior to administering the bacteria, or the bacteria
can be administered prior to administering the virus; typically the
virus is administered prior to administering the bacteria. As
provided herein, administering to a subject a virus prior to
administering to the subject a bacterium can increase the amount of
bacteria that can accumulate and/or proliferate in a tumor,
relative to methods in which bacteria alone are administered.
[0349] Accordingly, the methods provided herein that include
administration of virus prior to administration of bacteria permit
the administration of a lower dosage amount of bacteria than would
otherwise be administered in a method in which bacteria alone are
administered or a method in which bacteria are administered at the
same time as or prior to administration of a virus. For example, in
some embodiments, a bacterium to be administered can have one or
more properties that limit the ability of the bacterium to be used,
such properties can include, but are not limited to toxicity, low
tumor specificity of accumulation, and limited proliferation
capacity. A bacterium to be administered that has one or more
limiting properties can require administration in lower dosage
amounts, or can require assistance in tumor-specific accumulation
and/or proliferation. Provided herein are methods of administering
such a bacterium with limiting properties, where prior to
administering the bacterium, a virus is administered such that the
limited bacterium can be administered in smaller quantities, can
accumulate in tumor with increased specificity, and/or can have an
increased ability to proliferate in a tumor.
[0350] The time period between administrations can be any time
period that achieves the desired effects, as can be determined by
one skilled in the art. Selection of a time period between
administrations of different microorganisms can be determined
according to parameters similar to those for selecting the time
period between administrations of the same microorganism, including
results from monitoring steps, the time period for a subject to
mount an immune response, the time period for a subject to clear
microorganism from normal tissue, or the time period for
microorganismal proliferation in the tumor or metastasis. In one
example, the time period can be a function of the time period for a
subject to mount an immune response; for example, the time period
can be more than the time period for a subject to mount an immune
response, such as more than about one week, more than about ten
days, more than about two weeks, or more than about a month; in
another example, the time period can be less than the time period
for a subject to mount an immune response, such as less than about
one week, less than about ten days, less than about two weeks, or
less than about a month. In another example, the time period can be
a function of the time period for a subject to clear microorganism
from normal tissue; for example, the time period can be more than
the time period for a subject to clear microorganism from normal
tissue, such as more than about a day, more than about two days,
more than about three days, more than about five days, or more than
about a week. In another example, the time period can be a function
of the time period for microorganismal proliferation in the tumor
or metastasis; for example, the time period can be more than the
amount of time for a detectable signal to arise in a tumor or
metastasis after administration of a microorganism expressing a
detectable marker, such as about 3 days, about 5 days, about a
week, about ten days, about two weeks, or about a month. In one
example a virus can first be administered, and a bacteria can be
administered about 5 days after administration of the virus. In
another example, a virus can be first administered, and a bacterium
can be administered upon detection of a virally-encoded detectable
gene product in the tumor of the subject, optionally when the
virally-encoded detectable gene product is detected only in the
tumor of the subject.
[0351] ii. Therapeutic Compounds
[0352] The methods can include administering one or more
therapeutic compounds to the subject in addition to administering a
microorganism or plurality thereof to a subject. Therapeutic
compounds can act independently, or in conjunction with the
microorganism, for tumor therapeutic effects. Therapeutic compounds
that can act independently include any of a variety of known
chemotherapeutic compounds that can inhibit tumor-growth, inhibit
metastasis growth and/or formation, decrease the size of a tumor or
metastasis, eliminate a tumor or metastasis, without reducing the
ability of a microorganism to accumulate in a tumor, replicate in
the tumor, and cause or enhance an anti-tumor immune response in
the subject.
[0353] Therapeutic compounds that act in conjunction with the
microorganisms include, for example, compounds that alter the
expression of the microorganism or compounds that can interact with
a microorganism-expressed gene, or compounds that can inhibit
microorganismal proliferation, including compounds toxic to the
microorganism. Therapeutic compounds that can act in conjunction
with the microorganism include, for example, therapeutic compounds
that increase the proliferation, toxicity, tumor cell killing, or
immune response eliciting properties of a microorganism, and also
can include, for example, therapeutic compounds that decrease the
proliferation, toxicity, or cell killing properties of a
microorganism. Thus, provided herein are methods of administering
to a subject one or more therapeutic compounds that can act in
conjunction with the microorganism to increase the proliferation,
toxicity, tumor cell killing, or immune response eliciting
properties of a microorganism. Also provided herein are methods of
administering to a subject one or more therapeutic compounds that
can act in conjunction with the microorganism to decrease the
proliferation, toxicity, or cell killing properties of a
microorganism.
[0354] In one embodiment, therapeutic compounds that can act in
conjunction with the microorganism to increase the proliferation,
toxicity, tumor cell killing, or immune response eliciting
properties of a microorganism are compounds that can alter gene
expression, where the altered gene expression can result in an
increased killing of tumor cells or an increased anti-tumor immune
response in the subject. A gene expression-altering compound can,
for example, cause an increase or decrease in expression of one or
more microorganismal genes, including endogenous microorganismal
genes and/or exogenous microorganismal genes. For example, a gene
expression-altering compound can induce or increase transcription
of a gene in a microorganism such as an exogenous gene that can
cause cell lysis or cell death, that can provoke an immune
response, that can catalyze conversion of a prodrug-like compound,
or that can inhibit expression of a tumor cell gene. Any of a wide
variety of compounds that can alter gene expression are known in
the art, including IPTG and RU486. Exemplary genes whose expression
can be up-regulated include proteins and RNA molecules, including
toxins, enzymes that can convert a prodrug to an anti-tumor drug,
cytokines, transcription regulating proteins, siRNA, and ribozymes.
In another example, a gene expression-altering compound can inhibit
or decrease transcription of a gene in a microorganism such as an
exogenous gene that can reduce microorganismal toxicity or reduces
microorganismal proliferation. Any of a variety of compounds that
can reduce or inhibit gene expression can be used in the methods
provided herein, including siRNA compounds, transcriptional
inhibitors or inhibitors of transcriptional activators. Exemplary
genes whose expression can be down-regulated include proteins and
RNA molecules, including microorganismal proteins or RNA that
suppress lysis, nucleotide synthesis or proliferation, and cellular
proteins or RNA molecules that suppress cell death,
immunoreactivity, lysis, or microorganismal replication.
[0355] In another embodiment, therapeutic compounds that can act in
conjunction with the microorganism to increase the proliferation,
toxicity, tumor cell killing, or immune response eliciting
properties of a microorganism are compounds that can interact with
a microorganism-expressed gene product, and such interaction can
result in an increased killing of tumor cells or an increased
anti-tumor immune response in the subject. A therapeutic compound
that can interact with a microorganism-expressed gene product can
include, for example a prodrug or other compound that has little or
no toxicity or other biological activity in its
subject-administered form, but after interaction with a
microorganism-expressed gene product, the compound can develop a
property that results in tumor cell death, including but not
limited to, cytotoxicity, ability to induce apoptosis, or ability
to trigger an immune response. A variety of prodrug-like substances
are known in the art and an exemplary set of such compounds are
disclosed elsewhere herein, where such compounds can include
gancyclovir, 5-fluorouracil, 6-methylpurine deoxyriboside,
cephalosporin-doxorubicin,
4-[(2-chloroethyl)(2-mesuloxyethyl)amino]benzoyl-L-glutamic acid,
acetominophen, indole-3-acetic acid, CB1954,
7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin,
bis-(2-chloroethyl)amino-4-hydroxyphenylaminomethanone 28,
1-chloromethyl-5-hydroxy-1,2-dihyro-3H-benz[e]indole,
epirubicin-glucuronide, 5'-deoxy5-fluorouridine, cytosine
arabinoside, and linamarin.
[0356] In another embodiment, therapeutic compounds that can act in
conjunction with the microorganism to decrease the proliferation,
toxicity, or cell killing properties of a microorganism are
compounds that can inhibit microorganismal replication, inhibit
microorganismal toxins, or cause microorganismal death. A
therapeutic compound that can inhibit microorganismal replication,
inhibit microorganismal toxins, or cause microorganismal death can
generally include a compound that can block one or more steps in
the microorganismal life cycle, including, but not limited to,
compounds that can inhibit microorganismal DNA replication,
microorganismal RNA transcription, viral coat protein assembly,
outer membrane or polysaccharide assembly. Any of a variety of
compounds that can block one or more steps in a microorganismal
life cycle are known in the art, including any known antibiotic,
microorganismal DNA polymerase inhibitors, microorganismal RNA
polymerase inhibitors, inhibitors of proteins that regulate
microorganismal DNA replication or RNA transcription. In one
example, when a microorganism is a bacteria, a compound can be an
antibiotic. In another example, a microorganism can contain a gene
encoding a microorganismal life cycle protein, such as DNA
polymerase or RNA polymerase that can be inhibited by a compound
that is, optionally, non-toxic to the host organism.
[0357] f. State of Subject
[0358] In another embodiment, the methods provided herein for
administering a microorganism to a subject can be performed on a
subject in any of a variety of states, including an anesthetized
subject, an alert subject, a subject with elevated body
temperature, a subject with reduced body temperature, or other
state of the subject that is known to affect the accumulation of
microorganism in the tumor. As provided herein, it has been
determined that a subject that is anesthetized can have a decreased
rate of accumulation of a microorganism in a tumor relative to a
subject that is not anesthetized. Further provided herein, it has
been determined that a subject with decreased body temperature can
have a decreased rate o accumulation of a microorganism in a tumor
relative to a subject with a normal body temperature. Accordingly,
provided herein are methods of administering a microorganism to a
subject, where the methods can include administering a
microorganism to a subject where the subject is not under
anesthesia, such as general anesthesia; for example, the subject
can be under local anesthesia, or can be unanesthetized. Also
provided herein are methods of administering a microorganism to a
subject, where the methods can include administering a
microorganism to a subject with altered body temperature, where the
alteration of the body temperature can influence the ability of the
microorganism to accumulate in a tumor; typically, a decrease in
body temperature can decrease the ability of a microorganism to
accumulate in a tumor. Thus, in one exemplary embodiment, a method
is provided for administering a microorganism to a subject, where
the method includes elevating the body temperature of the subject
to a temperature above normal, and administering a microorganism to
the subject, where the microorganism can accumulate in the tumor
more readily in the subject with higher body temperature relative
to the ability of the microorganism to accumulate in a tumor of a
subject with a normal body temperature.
[0359] 2. Monitoring
[0360] The methods provided herein can further include one or more
steps of monitoring the subject, monitoring the tumor, and/or
monitoring the microorganism administered to the subject. Any of a
variety of monitoring steps can be included in the methods provided
herein, including, but not limited to, monitoring tumor size,
monitoring anti-(tumor antigen) antibody titer, monitoring the
presence and/or size of metastases, monitoring the subject's lymph
nodes, monitoring the subject's weight or other health indicators
including blood or urine markers, monitoring anti-(microorganismal
antigen) antibody titer, monitoring microorganismal expression of a
detectable gene product, and directly monitoring microorganismal
titer in a tumor, tissue or organ of a subject.
[0361] The purpose of the monitoring can be simply for assessing
the health state of the subject or the progress of therapeutic
treatment of the subject, or can be for determining whether or not
further administration of the same or a different microorganism is
warranted, or for determining when or whether or not to administer
a compound to the subject where the compound can act to increase
the efficacy of the therapeutic method, or the compound can act to
decrease the pathogenicity of the microorganism administered to the
subject.
[0362] a. Monitoring Microorganismal Gene Expression
[0363] In some embodiments, the methods provided herein can include
monitoring one or more microorganismally expressed genes.
Microorganisms, such as those provided herein or otherwise known in
the art, can express one or more detectable gene products,
including but not limited to, detectable proteins.
[0364] As provided herein, measurement of a detectable gene product
expressed in a microorganism can provide an accurate determination
of the level of microorganism present in the subject. As further
provided herein, measurement of the location of the detectable gene
product, for example, by imaging methods including tomographic
methods, can determine the localization of the microorganism in the
subject. Accordingly, the methods provided herein that include
monitoring a detectable microorganismal gene product can be used to
determine the presence or absence of the microorganism in one or
more organs or tissues of a subject, and/or the presence or absence
of the microorganism in a tumor or metastases of a subject.
Further, the methods provided herein that include monitoring a
detectable microorganismal gene product can be used to determine
the titer of microorganism present in one or more organs, tissues,
tumors or metastases. Methods that include monitoring the
localization and/or titer of microorganisms in a subject can be
used for determining the pathogenicity of a microorganism; since
microorganismal infection, and particularly the level of infection,
of normal tissues and organs can indicate the pathogenicity of the
probe, methods of monitoring the localization and/or amount of
microorganisms in a subject can be used to determine the
pathogenicity of a microorganism. Since methods provided herein can
be used to monitor the amount of microorganisms at any particular
location in a subject, the methods that include monitoring the
localization and/or titer of microorganisms in a subject can be
performed at multiple time points, and, accordingly can determine
the rate of microorganismal replication in a subject, including the
rate of microorganismal replication in one or more organs or
tissues of a subject; accordingly, the methods of monitoring a
microorganismal gene product can be used for determining the
replication competence of a microorganism. The methods provided
herein also can be used to quantitate the amount of microorganism
present in a variety of organs or tissues, and tumors or
metastases, and can thereby indicate the degree of preferential
accumulation of the microorganism in a subject; accordingly, the
microorganismal gene product monitoring methods provided herein can
be used in methods of determining the ability of a microorganism to
accumulate in tumor or metastases in preference to normal tissues
or organs. Since the microorganisms used in the methods provided
herein can accumulate in an entire tumor or can accumulate at
multiple sites in a tumor, and can also accumulate in metastases,
the methods provided herein for monitoring a microorganismal gene
product can be used to determine the size of a tumor or the number
of metastases are present in a subject. Monitoring such presence of
microorganismal gene product in tumor or metastasis over a range of
time can be used to assess changes in the tumor or metastasis,
including growth or shrinking of a tumor, or development of new
metastases or disappearance of metastases, and also can be used to
determine the rate of growth or shrinking of a tumor, or
development of new metastases or disappearance of metastases, or
the change in the rate of growth or shrinking of a tumor, or
development of new metastases or disappearance of metastases.
Accordingly, the methods of monitoring a microorganismal gene
product can be used for monitoring a neoplastic disease in a
subject, or for determining the efficacy of treatment of a
neoplastic disease, by determining rate of growth or shrinking of a
tumor, or development of new metastases or disappearance of
metastases, or the change in the rate of growth or shrinking of a
tumor, or development of new metastases or disappearance of
metastases.
[0365] Any of a variety of detectable proteins can be detected in
the monitoring methods provided herein; an exemplary, non-limiting
list of such detectable proteins includes any of a variety of
fluorescence proteins (e.g., green fluorescence proteins), any of a
variety of luciferases, transferrin or other iron binding proteins;
or receptors, binding proteins, and antibodies, where a compound
that specifically binds the receptor, binding protein or antibody
can be a detectable agent or can be labeled with a detectable
substance (e.g., a radionuclide or imaging agent).
[0366] b. Monitoring Tumor Size
[0367] Also provided herein are methods of monitoring tumor and/or
metastasis size and location. Tumor and/or metastasis size can be
monitored by any of a variety of methods known in the art,
including external assessment methods or tomographic or magnetic
imaging methods. In addition to the methods known in the art,
methods provided herein, for example, monitoring microorganismal
gene expression, can be used for monitoring tumor and/or metastasis
size.
[0368] Monitoring size over several time points can provide
information regarding the increase or decrease in size of a tumor
or metastasis, and can also provide information regarding the
presence of additional tumors and/or metastases in the subject.
Monitoring tumor size over several time points can provide
information regarding the development of a neoplastic disease in a
subject, including the efficacy of treatment of a neoplastic
disease in a subject.
[0369] c. Monitoring Antibody Titer
[0370] The methods provided herein also can include monitoring the
antibody titer in a subject, including antibodies produced in
response to administration of a microorganism to a subject. The
microorganisms administered in the methods provided herein can
elicit an immune response to endogenous microorganismal antigens.
The microorganisms administered in the methods provided herein also
can elicit an immune response to exogenous genes expressed by a
microorganism. The microorganisms administered in the methods
provided herein also can elicit an immune response to tumor
antigens. Monitoring antibody titer against microorganismal
antigens, microorganismally expressed exogenous gene products, or
tumor antigens can be used in methods of monitoring the toxicity of
a microorganism, monitoring the efficacy of treatment methods, or
monitoring the level of gene product or antibodies for production
and/or harvesting.
[0371] In one embodiment, monitoring antibody titer can be used to
monitor the toxicity of a microorganism. Antibody titer against a
microorganism can vary over the time period after administration of
the microorganism to the subject, where at some particular time
points, a low anti-(microorganismal antigen) antibody titer can
indicate a higher toxicity, while at other time points a high
anti-(microorganismal antigen) antibody titer can indicate a higher
toxicity. The microorganisms used in the methods provided herein
can be immunogenic, and can, therefore, elicit an immune response
soon after administering the microorganism to the subject.
Generally, a microorganism against which a subject's immune system
can quickly mount a strong immune response can be a microorganism
that has low toxicity when the subject's immune system can remove
the microorganism from all normal organs or tissues. Thus, in some
embodiments, a high antibody titer against microorganismal antigens
soon after administering the microorganism to a subject can
indicate low toxicity of a microorganism. In contrast, a
microorganism that is not highly immunogenic may infect a host
organism without eliciting a strong immune response, which can
result in a higher toxicity of the microorganism to the host.
Accordingly, in some embodiments, a high antibody titer against
microorganismal antigens soon after administering the microorganism
to a subject can indicate low toxicity of a microorganism.
[0372] In other embodiments, monitoring antibody titer can be used
to monitor the efficacy of treatment methods. In the methods
provided herein, antibody titer, such as anti-(tumor antigen)
antibody titer, can indicate the efficacy of a therapeutic method
such as a therapeutic method to treat neoplastic disease.
Therapeutic methods provided herein can include causing or
enhancing an immune response against a tumor and/or metastasis.
Thus, by monitoring the anti-(tumor antigen) antibody titer, it is
possible to monitor the efficacy of a therapeutic method in causing
or enhancing an immune response against a tumor and/or metastasis.
The therapeutic methods provided herein also can include
administering to a subject a microorganism that can accumulate in a
tumor and can cause or enhance an anti-tumor immune response.
Accordingly, it is possible to monitor the ability of a host to
mount an immune response against microorganisms accumulated in a
tumor or metastasis, which can indicate that a subject has also
mounted an anti-tumor immune response, or can indicate that a
subject is likely to mount an anti-tumor immune response, or can
indicate that a subject is capable of mounting an anti-tumor immune
response.
[0373] In other embodiments, monitoring antibody titer can be used
for monitoring the level of gene product or antibodies for
production and/or harvesting. As provided herein, methods can be
used for producing proteins, RNA molecules or other compounds by
expressing an exogenous gene in a microorganism that has
accumulated in a tumor. Further provided herein are methods for
producing antibodies against a protein, RNA molecule or other
compound produced by exogenous gene expression of a microorganism
that has accumulated in a tumor. Monitoring antibody titer against
the protein, RNA molecule or other compound can indicate the level
of production of the protein, RNA molecule or other compound by the
tumor-accumulated microorganism, and also can directly indicate the
level of antibodies specific for such a protein, RNA molecule or
other compound.
[0374] d. Monitoring General Health Diagnostics
[0375] The methods provided herein also can include methods of
monitoring the health of a subject. Some of the methods provided
herein are therapeutic methods, including neoplastic disease
therapeutic methods. Monitoring the health of a subject can be used
to determine the efficacy of the therapeutic method, as is known in
the art. The methods provided herein also can include a step of
administering to a subject a microorganism. Monitoring the health
of a subject can be used to determine the pathogenicity of a
microorganism administered to a subject. Any of a variety of health
diagnostic methods for monitoring disease such as neoplastic
disease, infectious disease, or immune-related disease can be
monitored, as is known in the art. For example, the weight, blood
pressure, pulse, breathing, color, temperature or other observable
state of a subject can indicate the health of a subject. In
addition, the presence or absence or level of one or more
components in a sample from a subject can indicate the health of a
subject. Typical samples can include blood and urine samples, where
the presence or absence or level of one or more components can be
determined by performing, for example, a blood panel or a urine
panel diagnostic test. Exemplary components indicative of a
subject's health include, but are not limited to, white blood cell
count, hematocrit, c-reactive protein concentration.
[0376] e. Monitoring Coordinated with Treatment
[0377] Also provided herein are methods of monitoring a therapy,
where therapeutic decisions can be based on the results of the
monitoring. Therapeutic methods provided herein can include
administering to a subject a microorganism, where the microorganism
can preferentially accumulate in a tumor and/or metastasis, and
where the microorganism can cause or enhance an anti-tumor immune
response. Such therapeutic methods can include a variety of steps
including multiple administrations of a particular microorganism,
administration of a second microorganism, or administration of a
therapeutic compound. Determination of the amount, timing or type
of microorganism or compound to administer to the subject can be
based on one or more results from monitoring the subject. For
example, the antibody titer in a subject can be used to determine
whether or not it is desirable to administer a microorganism or
compound, the quantity of microorganism or compound to administer,
and the type of microorganism or compound to administer, where, for
example, a low antibody titer can indicate the desirability of
administering additional microorganism, a different microorganism,
or a therapeutic compound such as a compound that induces
microorganismal gene expression. In another example, the overall
health state of a subject can be used to determine whether or not
it is desirable to administer a microorganism or compound, the
quantity of microorganism or compound to administer, and the type
of microorganism or compound to administer, where, for example,
determining that the subject is healthy can indicate the
desirability of administering additional microorganism, a different
microorganism, or a therapeutic compound such as a compound that
induces microorganismal gene expression. In another example,
monitoring a detectable microorganismally expressed gene product
can be used to determine whether or not it is desirable to
administer a microorganism or compound, the quantity of
microorganism or compound to administer, and the type of
microorganism or compound to administer. Such monitoring methods
can be used to determine whether or not the therapeutic method is
effective, whether or not the therapeutic method is pathogenic to
the subject, whether or not the microorganism has accumulated in a
tumor or metastasis, and whether or not the microorganism has
accumulated in normal tissues or organs. Based on such
determinations, the desirability and form of further therapeutic
methods can be derived.
[0378] In one embodiment, determination of whether or not a
therapeutic method is effective can be used to derive further
therapeutic methods. Any of a variety of methods of monitoring can
be used to determine whether or not a therapeutic method is
effective, as provided herein or otherwise known in the art. If
monitoring methods indicate that the therapeutic method is
effective, a decision can be made to maintain the current course of
therapy, which can include further administrations of a
microorganism or compound, or a decision can be made that no
further administrations are required. If monitoring methods
indicate that the therapeutic method is ineffective, the monitoring
results can indicate whether or not a course of treatment should be
discontinued (e.g., when a microorganism is pathogenic to the
subject), or changed (e.g., when a microorganism accumulates in a
tumor without harming the host organism, but without eliciting an
anti-tumor immune response), or increased in frequency or amount
(e.g., when little or no microorganism accumulates in tumor).
[0379] In one example, monitoring can indicate that a microorganism
is pathogenic to a subject. In such instances, a decision can be
made to terminate administration of the microorganism to the
subject, to administer lower levels of the microorganism to the
subject, to administer a different microorganism to a subject, or
to administer to a subject a compound that reduces the
pathogenicity of the microorganism. In one example, administration
of a microorganism that is determined to be pathogenic can be
terminated. In another example, the dosage amount of a
microorganism that is determined to be pathogenic can be decreased
for subsequent administration; in one version of such an example,
the subject can be pre-treated with another microorganism that can
increase the ability of the pathogenic microorganism to accumulate
in tumor, prior to re-administering the pathogenic microorganism to
the subject. In another example, a subject can have administered
thereto a bacteria or virus that is pathogenic to the subject;
administration of such a pathogenic microorganism can be
accompanied by administration of, for example an antibiotic,
anti-microorganismal compound, pathogenicity attenuating compound
(e.g., a compound that down-regulates the expression of a lytic or
apoptotic gene product), or other compound that can decrease the
proliferation, toxicity, or cell killing properties of a
microorganism, as described herein elsewhere. In one variation of
such an example, the localization of the microorganism can be
monitored, and, upon determination that the microorganism is
accumulated in tumor and/or metastases but not in normal tissues or
organs, administration of the antibiotic, anti-microorganismal
compound or pathogenicity attenuating compound can be terminated,
and the pathogenic activity of the microorganism can be activated
or increased, but limited to the tumor and/or metastasis. In
another variation of such an example, after terminating
administration of an antibiotic, anti-microorganismal compound or
pathogenicity attenuating compound, the presence of the
microorganism and/or pathogenicity of the microorganism can be
further monitored, and administration of such a compound can be
reinitiated if the microorganism is determined to pose a threat to
the host by, for example, spreading to normal organs or tissues,
releasing a toxin into the vasculature, or otherwise having
pathogenic effects reaching beyond the tumor or metastasis.
[0380] In another example, monitoring can determine whether or not
a microorganism has accumulated in a tumor or metastasis of a
subject. Upon such a determination, a decision can be made to
further administer additional microorganism, a different
microorganism or a compound to the subject. In one example,
monitoring the presence of a virus in a tumor or metastasis can be
used in deciding to administer to the subject a bacterium, where,
for example, the quantity of bacteria administered can be reduced
according to the presence and/or quantity of virus in a tumor or
metastasis. In a similar example, monitoring the presence of a
virus in a tumor or metastasis can be used in deciding when to
administer to the subject a bacterium, where, for example, the
bacteria can be administered upon detecting to the presence and/or
a selected quantity of virus in a tumor or metastasis. In another
example, monitoring the presence of a microorganism in a tumor can
be used in deciding to administer to the subject a compound, where
the compound can increase the pathogenicity, proliferation, or
immunogenicity of a microorganism or the compound can otherwise act
in conjunction with the microorganism to increase the
proliferation, toxicity, tumor cell killing, or immune response
eliciting properties of a microorganism; in one variation of such
an example, the microorganism can, for example have little or no
lytic or cell killing capability in the absence of such a compound;
in a further variation of such an example, monitoring of the
presence of the microorganism in a tumor or metastasis can be
coupled with monitoring the absence of the microorganism in normal
tissues or organs, where the compound is administered if the
microorganism is present in tumor or metastasis and not at all
present or substantially not present in normal organs or tissues;
in a further variation of such an example, the amount of
microorganism in a tumor or metastasis can be monitored, where the
compound is administered if the microorganism is present in tumor
or metastasis at sufficient levels.
E. Methods of Producing Gene Products and Antibodies
[0381] Provided herein are microorganisms, and methods for making
and using such microorganisms for production products of exogenous
genes and/or for production of antibodies specific for exogenous
gene products. The methods provided herein result in efficient
recombinant production of biologically active proteins. In EP A1 1
281 772, it is disclosed that when vaccinia virus (LIVP strain)
carrying the light emitting fusion gene construct rVV-ruc-gfp
(RVGL9) was injected intravenously into nude mice, the virus
particles were found to be cleared from all internal organs within
4 days, as determined by extinction of light emission. In contrast,
when the fate of the injected vaccinia virus was similarly followed
in nude mice bearing tumors grown from subcutaneously implanted C6
rat glioma cells, virus particles were found to be retained over
time in the tumor tissues, resulting in lasting light emission. The
presence and amplification of the virus-encoded fusion proteins in
the same tumor were monitored in live animals by observing GFP
fluorescence under a stereomicroscope and by detecting
luciferase-catalyzed light emission under a low-light video-imaging
camera. Tumor-specific light emission was detected 4 days after
viral injection in nude mice carrying subcutaneous C6 glioma
implants. Tumor accumulation of rVV-ruc-gfp (RVGL9) virus particles
was also seen in nude mice carrying subcutaneous tumors developed
from implanted PC-3 human prostate cells, and in mice with
orthotopically implanted MCF-7 human breast tumors. Further,
intracranial C6 rat glioma cell implants in immunocompetent rats
and MB49 human bladder tumor cell implants in C57 mice were also
targeted by the vaccinia virus. In addition to primary breast
tumors, small metastatic tumors were also detected externally in
the contralateral breast region, as well as in nodules on the
exposed lung surface, suggesting metastasis to the contralateral
breast and lung. In summary it was shown that light-emitting cells
or microorganisms, for example, vaccinia virus can be used to
detect and treat metastatic tumors.
[0382] Similar results were obtained with light-emitting bacteria
(Salmonella, Vibrio, Listeria, E. coli) which were injected
intravenously into mice and which could be visualized in whole
animals under a low light imager immediately. No light emission was
detected twenty four hours after bacterial injection in both
athymic (nu/nu) mice and immunocompetent C57 mice as a result of
clearing by the immune system. In nude mice bearing tumors
developed from implanted C6 glioma cells, light emission was
abolished from the animal entirely twenty four hours after delivery
of bacteria, similar to mice without tumors. However, forty eight
hours post-injection, a strong, rapidly increasing light emission
originated only from the tumor regions was observed. This
observation indicated a continuous bacterial replication in the
tumor tissue. The extent of light emission was dependent on the
bacterial strain used. The homing-in process together with the
sustained light emission was also demonstrated in nude mice
carrying prostate, bladder, and breast tumors. In addition to
primary tumors, metastatic tumors could also be visualized as
exemplified in the breast tumor model. Tumor-specific light
emission was also observed in immunocompetent C57 mice, with
bladder tumors as well as in Lewis rats with brain glioma implants.
Once in the tumor, the light-emitting bacteria were not observed to
be released into the circulation and to re-colonize subsequently
implanted tumors in the same animal. Further, mammalian cells
expressing the Ruc-GFP fusion protein, upon injection into the
bloodstream, were also found to home in to, and propagate in,
glioma tumors. These findings opened the way for designing
multifunctional viral vectors useful for the detection of tumors
based on signals such as light emission, for suppression of tumor
development and angiogenesis signaled by, for example, light
extinction and the development of bacterial and mammalian
cell-based tumor targeting systems in combination with therapeutic
gene constructs for the treatment of cancer. These systems have the
following advantages: (a) They target the tumor specifically
without affecting normal tissue; (b) the expression and secretion
of the therapeutic gene constructs can be, optionally, under the
control of an inducible promoter enabling secretion to be switched
on or off; and (c) the location of the delivery system inside the
tumor can be verified by direct visualization before activating
gene expression and protein delivery.
[0383] As provided herein, the system described above based on the
accumulation of bacteria, viruses and eukaryotic cells in tumors
can be used for simple, quick, and inexpensive production of
proteins and other biological compounds originating from cloned
nucleotide sequences. This system also is useful for the
concomitant overproduction of polypeptides, RNA or other biological
compounds (in tumor tissue) and antibodies against those compounds
(in the serum) in the same animal. As provided herein, after
intravenous injection, a microorganism such as vaccinia virus can
enter the tumor of an animal and, due to the immunoprivileged state
of the tumor, can replicate preferentially in the tumor tissues and
thereby can overproduce the inserted gene encoded protein in the
tumors. After harvesting the tumor tissues, the localized and
overexpressed protein can be isolated by a simple procedure from
tumor homogenates. In addition, based on the findings that only 0.2
to 0.3% of the desired proteins produced in the tumor were found in
the blood stream of the same animal, a simultaneous vaccination of
the mouse and efficient antibody production against the
overproduced protein was achieved. Thus, serum from the same mouse
(or any other animal) can be harvested and used as mouse-derived
antibodies against the proteins or other products overproduced in
the tumor.
[0384] Thus, provided herein are methods of producing gene products
and or antibodies in a non-human subject, by administering to a
subject containing a tumor, a microorganism, where the
microorganism expresses a selected protein or RNA to be produced, a
protein or RNA whose expression can result in the formation of a
compound to be produced, or a selected protein or RNA against which
an antibody is to be produced. The methods provided herein can
further include administering to a subject containing a tumor, a
microorganism expressing an exogenous gene encoding a selected
protein or RNA to be produced, a protein or RNA whose expression
can result in the formation of a compound to be produced, or a
selected protein or RNA against which an antibody is to be
produced. The methods provided herein can further include
administering to a subject containing a tumor, a microorganism
expressing a gene encoding a selected protein or RNA to be
produced, a protein or RNA whose expression can result in the
formation of a compound to be produced, or a selected protein or
RNA against which an antibody is to be produced, where such gene
expression can be regulated, for example, by a transcriptional
activator or inducer, or a transcriptional suppressor. The methods
provided herein for producing a protein, RNA, compound or antibody
can further include monitoring the localization and/or level of the
microorganism in the subject by detecting a detectable protein,
where the detectable protein can indicate the expression of the
selected gene, or can indicate the readiness of the microorganism
to be induced to express the selected gene or for suppression of
expression to be terminated or suspended. Also provided herein are
methods of producing gene products and or antibodies in a non-human
subject, by administering to a subject containing a tumor, a
microorganism, where the microorganism expresses a selected protein
or RNA to be produced, a protein or RNA whose expression can result
in the formation of a compound to be produced, or a selected
protein or RNA against which an antibody is to be produced, where
the subject to which the microorganism is administered is not a
transgenic animal. Also provided herein are methods of producing
gene products and or antibodies in a non-human subject, by
administering to a subject containing a tumor, a microorganism,
where the microorganism expresses a selected protein to be
produced, where the tumor within the subject is selected according
to its ability to post-translationally process the selected
protein.
[0385] The advantages of the system, include: [0386] (a) No
production of a transgenic animal carrying the novel
polypeptide-encoding cassette is required; [0387] (b) the tumor
system is more efficient than tissue culture; [0388] (c) proteins
interfering with animal development and other toxic proteins can be
overproduced in tumors without negative effects to the host animal;
[0389] (d) the system is fast: within 4 to 6 weeks from cDNA
cloning to protein and antisera purification; [0390] (e) the system
is relatively inexpensive and can be scaled up easily; [0391] (f)
correct protein folding and modifications can be achieved; [0392]
(g) high antigenicity can be achieved, which is beneficial for
better antibody production; and [0393] (h)
species-specific-cell-based production of proteins in animals such
as mice, with tumors as fermentors can be achieved.
[0394] Depiction of an exemplary method for production of gene
products and/or antibodies against gene products is provided in
FIG. 2.
[0395] In one embodiment, methods are provided for producing a
desired polypeptide, RNA or compound, the method including the
following steps: (a) injecting a microorganism containing a
nucleotide sequence encoding the desired polypeptide or RNA into an
animal bearing a tumor; (b) harvesting the tumor tissue from the
animal; and (c) isolating the desired polypeptide, RNA or compound
from the tumor tissue.
[0396] Steps of an exemplary method can be summarized as follows
(shown for a particular embodiment, i.e. vaccinia virus
additionally containing a gene encoding a light-emitting protein):
[0397] (1) Insertion of the desired DNA or cDNA into the vaccinia
virus genome; [0398] (2) modification of the vaccinia virus genome
with light-emitting protein construct as expression marker; [0399]
(3) recombination and virus assembly in cell culture; [0400] (4)
screening of individual viral particles carrying inserts followed
by large scale virus production and concentration; [0401] (5)
administration of the viral particles into mice or other animals
bearing tumors of human, non-human primate or other mammalian
origins; [0402] (6) verification of viral replication and protein
overproduction in animals based on light emission; [0403] (7)
harvest of tumor tissues and, optionally, the blood (separately);
and [0404] (8) purification of overexpressed proteins from tumors
and, optionally, antisera from blood using conventional
methods.
[0405] Any microorganism can be used in the methods provided
herein, provided that they replicate in the animal, are not
pathogenic for the animal, for example, are attenuated, and are
recognized by the immune system of the animal. In some embodiments,
such microorganisms also can express exogenous genes. Suitable
microorganisms and cells are, for example, disclosed in EP A1 1 281
772 and EP A1 1 281 767. The person skilled in the art also knows
how to generate animals carrying the desired tumor (see, e.g., EP
A1 1 281 767 or EP A1 1 281 777).
[0406] Also provide is a method for simultaneously producing a
desired polypeptide, RNA or compound and an antibody directed to
the polypeptide, RNA or compound, the method having the following
steps: (a) administering a microorganism containing a nucleotide
sequence encoding the desired polypeptide or RNA into an animal
bearing a tumor; (b) harvesting the tumor tissue from the animal;
(c) isolating the desired polypeptide, RNA or compound from the
tumor tissue; and (d) isolating the antibody directed to the
polypeptide, RNA or compound from the serum obtained from the
animal. This approach can be used for generating polypeptides
and/or antibodies against the polypeptides which are toxic or
unstable, or which require species specific cellular environment
for correct folding or modifications.
[0407] In another embodiment, the microorganism can further contain
a nucleotide sequence encoding a detectable protein, such as a
luminescent or fluorescent protein, or a protein capable of
inducing a detectable signal.
[0408] Typically in methods for transfecting the microorganisms or
cells with nucleotide sequences encoding the desired polypeptide or
RNA and, optionally, a nucleotide sequence encoding a detectable
protein such as a luminescent or fluorescent protein, or a protein
capable of inducing a detectable signal, the nucleotide sequences
are present in a vector or an expression vector. A person skilled
in the art is familiar with a variety of expression vectors, which
can be selected according to the microorganism used to infect the
tumor, the cell type of the tumor, the organism to be infected, and
other factors known in the art. In some embodiments, the
microorganism can be a virus, including the viruses disclosed
herein. Thus, the nucleotide sequences can be contained in a
recombinant virus containing appropriate expression cassettes.
Suitable viruses for use herein, include, but are not limited to,
baculovirus, vaccinia, Sindbis virus, Sendai virus, adenovirus, an
AAV virus or a parvovirus, such as MVM or H-1. The vector can also
be a retrovirus, such as MoMULV, MoMuLV, HaMuSV, MuMTV, RSV or
GaLV. For expression in mammalian cells, a suitable promoter is,
for example, human cytomegalovirus immediate early promoter (pCMV).
Furthermore, tissue and/or organ specific promoters can be used.
For example, the nucleotide sequences can be operatively linked
with a promoter allowing high expression. Such promoters can
include, for example, inducible promoters; a variety of such
promoters are known to persons skilled in the art.
[0409] For generating protein or RNA-encoding nucleotide sequences
and for constructing expression vectors or viruses that contain the
nucleotide sequences, it is possible to use general methods known
in the art. These methods include, for example, in vitro
recombination techniques, synthetic methods and in vivo
recombination methods as known in the art, and exemplified in
Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd
edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. Methods of transfecting cells, of phenotypically
selecting transfectants cells, of phenotypically selecting
transfectants and of expressing the nucleotide sequences by using
vectors containing protein or RNA-encoding DNA are known in the
art.
[0410] In some embodiments, the protein or RNA to be produced in
the tumor can be linked to an inducible promoter, such as a
promoter that can be induced by a substance endogenous to the
subject, or by a substance that can be administered to a subject.
Accordingly, provided herein are methods of producing a protein or
RNA in a tumor, where the production can be induced by
administration of a substance to a subject, and, optionally,
harvesting the tumor and isolating the protein or RNA from the
tumor. Such induction methods can be coupled with methods of
monitoring a microorganism in a subject. For example, a
microorganism can be monitored by detecting a detectable protein.
In methods that include monitoring, detection of a desired
localization and/or level of microorganism in the subject can be
coordinated with induction of microorganismal gene expression. For
example, when a microorganismally expressed detectable protein is
detected in tumor, but not appreciably in normal organs or tissues,
an inducer can be administered to the subject. In another example,
when a microorganismally expressed detectable protein is detected
in tumor, and also in normal organs or tissues, administration of
an inducer can be suspended or postponed until the detectable
protein is no longer detected in normal organs or tissues. In
another example, when a microorganismally expressed detectable
protein is detected at sufficient levels in tumor, an inducer can
be administered to the subject. In another example, when a
microorganismally expressed detectable protein is not detected at
sufficient levels in tumor administration of an inducer can be
suspended or postponed until the detectable protein is detected at
sufficient levels in the tumor.
[0411] Also provided herein are methods of producing a protein or
RNA in a tumor, by administering a microorganism encoding the
protein or RNA, and a suppressor of gene expression. The suppressor
of gene expression can be administered for a pre-defined period of
time, or until the microorganism accumulated in tumor but not in
normal organs or tissues, or until sufficient levels of the
microorganism have accumulated in the tumor, at which point
administration of the suppressor can be terminated or suspended,
which can result in expression of the protein or RNA. As will be
recognized by one skilled in the art, methods similar to those
provided herein in regard to monitoring a detectable protein and
administering an inducer, can also apply for terminating or
suspending administration of a suppressor.
[0412] In one embodiment, the microorganism is a bacterium, for
example, an attenuated bacterium, such as those provided herein.
Exemplary bacteria include attenuated Salmonella thyphimurium,
attenuated Vibrio cholerae, attenuated Listeria monocytogenes or E.
coli. Alternatively, viruses such as vaccinia virus, AAV, a
retrovirus can be used in the methods provided herein. In exemplary
methods, the virus is vaccinia virus. Other cells that can be used
in the present methods include mammalian cells, such as fibroma
cells, including human cells such as human fibroma cells.
[0413] Any of a variety of animals, including laboratory or
livestock animals can be used, including for example, mice, rats
and other rodents, rabbits, guinea pigs, pigs, sheep, goats, cows
and horses. Exemplary animals are mice. The tumor can be generated
by implanting tumor cells into the animal. Generally, for the
production of a desired polypeptide, RNA, or compound, any solid
tumor type can be used, such as a fast growing tumor type.
Exemplary fast growing tumor types include C6 rat glioma and HCT116
human colon carcinoma. Generally, for the production of a desired
antibody, a relatively slow growing tumor type can be used.
Exemplary slow growing tumor types include HT1080 human
fibrosarcoma and GI-101A human breast carcinoma. For T-independent
antibody production, nu-/nu- mice bearing allogenic tumor or
xenografts can be used; while for T-dependent antibody production,
immunocompetent mice with syngenic tumors can be used. In some
embodiments, such as where the compound to be produced is a
protein, the microorganism selected can be a microorganism that
uses the translational components (e.g., proteins, vesicles,
substrates) of the tumor cells, such as, for example, a virus that
uses the translational components of a tumor cell. In such
instances, the tumor cell type can be selected according to the
desired post-translational processing to be performed on the
protein, including proteolysis, glycosylation, lipidylation,
disulfide formation, and any refolding or multimer assembly that
can require cellular components for completing. In some examples,
the tumor cell type selected can be the same species as the protein
to be expressed, thus resulting in species-specific
post-translational processing of the protein; an exemplary tumor
cell type-expressed protein species is human.
[0414] 1. Production of Recombinant Proteins and RNA Molecules
[0415] The tumor tissue can be surgically removed from the animal.
After homogenization of the tumor tissue, the desired polypeptide,
RNA or other biological compound can be purified according to
established methods. For example, in the case of a recombinant
polypeptide, the polypeptide might contain a bindable tag such as a
his-tag, and can be purified, for example, via column
chromatography. The time necessary for accumulation of sufficient
amounts of the polypeptide or RNA in the tumor of the animal
depends on many factors, for example, the kind of animal or the
kind of tumor, and can be determined by the skilled person by
routine experimentation. In general, expression of the desired
polypeptide can be detected two days after virus injection. The
expression peaks approximately two weeks after injection, and lasts
up to two months. In some embodiments, the amount of desired
polypeptide or RNA in the tumor can be determined by monitoring a
microorganismally expressed detectable substance, where the
concentration of the detectable substance can reflect the amount of
desired polypeptide or RNA in the tumor.
[0416] In another embodiment, the desired polypeptide, RNA or other
compound can be manufactured in the subject, and provide a
beneficial effect to the subject. In one example, a microorganism
can encode a protein or RNA, or a protein that manufactures a
compound that is not manufactured by the subject. In one example, a
microorganism can encode a peptide hormone or cytokine, such as
insulin, which can be released into the vasculature of a subject
lacking the ability to produce insulin or requiring increased
insulin concentrations in the vasculature. In another example,
blood clotting factors can be manufactured in a subject with blood
clotting deficiency, such as a hemophiliac. In some embodiments,
the protein or RNA to be produced in the tumor can be linked to an
inducible promoter, such as a promoter that can be induced by
increased glucose concentrations. In such instances, the
manufacture of the protein or RNA can be controlled in response to
one or more substances in the subject or by one or more substances
that can be administered to a subject, such as a compound that can
induce transcription, for example, RU486. Thus, in some
embodiments, the methods provided herein can include administering
to a subject having a tumor, a microorganism that can express one
or more genes encoding a beneficial gene product or a gene product
that can manufacture a beneficial compound.
[0417] 2. Production of Antibodies
[0418] Also provided are methods for producing a desired antibody,
the method comprising the following steps: (a) administering a
microorganism containing a nucleotide sequence encoding an antigen
into an animal bearing a tumor; and (b) isolating the antibody
directed to the antigen from the serum obtained from the animal.
The antibodies directed to the antigen can be isolated and purified
according to well known methods. Antibodies that are directed
against specific contaminating antigens (e.g., bacteria antigens)
can be removed by adsorption, and the antibodies directed against
the target antigen can be separated from contaminating antibodies
by affinity purification, for example, by immuno affinity
chromatography using the recombinant antigen as the ligand of the
column, by methods known in the art. Antibodies can be collected
from the animal in a single harvest, or can be collected over time
by collection bleeds, as is known in the art.
[0419] F. Pharmaceutical Compositions, Combinations and Kits
[0420] Provided herein are pharmaceutical compositions,
combinations and kits containing a microorganism provided herein
and one or more components. Pharmaceutical compositions can include
a microorganism and a pharmaceutical carrier. Combinations can
include two or more microorganisms, a microorganism and a
detectable compound, a microorganism and a microorganism expression
modulating compound, a microorganism and a therapeutic compound.
Kits can include the pharmaceutical compositions and/or
combinations provided herein, and one or more components such as
instructions for use, a device for detecting a microorganism in a
subject, a device for administering a compound to a subject, and a
device for administering a compound to a subject.
[0421] 1. Pharmaceutical Compositions
[0422] Also provided herein are pharmaceutical compositions
containing a modified microorganism and a suitable pharmaceutical
carrier. Examples of suitable pharmaceutical carriers are known in
the art and include phosphate buffered saline solutions, water,
emulsions, such as oil/water emulsions, various types of wetting
agents, sterile solutions, etc. Such carriers can be formulated by
conventional methods and can be administered to the subject at a
suitable dose. Colloidal dispersion systems that can be used for
delivery of microorganisms include macromolecule complexes,
nanocapsules, microspheres, beads and lipid-based systems including
oil-in-water emulsions (mixed), micelles, liposomes and lipoplexes.
An exemplary colloidal system is a liposome. Organ-specific or
cell-specific liposomes can be used in order to achieve delivery
only to the desired tissue. The targeting of liposomes can be
carried out by the person skilled in the art by applying commonly
known methods. This targeting includes passive targeting (utilizing
the natural tendency of the liposomes to distribute to cells of the
RES in organs which contain sinusoidal capillaries) or active
targeting (for example by coupling the liposome to a specific
ligand, for example, an antibody, a receptor, sugar, glycolipid,
protein etc., by well known methods). In the present methods,
monoclonal antibodies can be used to target liposomes to specific
tissues, for example, tumor tissue, via specific cell-surface
ligands.
[0423] 2. Host Cells
[0424] Also provided herein are host cells that contain a
microorganism provided herein such as a modified vaccinia virus.
These host cells can include any of a variety of mammalian, avian
and insect cells and tissues that are susceptible to
microorganisms, such as vaccinia virus infection, including chicken
embryo, rabbit, hamster and monkey kidney cells, for example, CV-1,
BSC40, Vero, BSC40 and BSC-1, and human HeLa cells. Methods of
transforming these host cells, of phenotypically selecting
transformants etc., are known in the art.
[0425] 3. Combinations
[0426] Combinations can include a microorganism and one or more
components. Any combination herein also can, in place of a
microorganism, contain a pharmaceutical composition and/or a host
cell containing a microorganism and one or more components.
[0427] Exemplary combinations can contain two or more
microorganisms, a microorganism and a detectable compound, a
microorganism and a microorganism expression modulating compound,
or a microorganism and a therapeutic compound. Combinations that
contain two or more microorganisms can contain, for example, two or
more microorganisms that can both be administered to a subject in
performing the methods provided herein, including sequentially
administering the tow microorganisms. In one example, a combination
can contain a virus and a bacterium, where, for example, the virus
can first be administered to the subject, and the bacterium can be
subsequently administered to the subject.
[0428] Combinations provided herein can contain a microorganism and
a detectable compound. A detectable compound can include a ligand
or substrate or other compound that can interact with and/or bind
specifically to a microorganismally expressed protein or RNA
molecule, and can provide a detectable signal, such as a signal
detectable by tomographic, spectroscopic or magnetic resonance
techniques. Exemplary detectable compounds can be, or can contain,
an imaging agent such as a magnetic resonance, ultrasound or
tomographic imaging agent, including a radionuclide. The detectable
compound can include any of a variety of compounds as provided
elsewhere herein or are otherwise known in the art. Typically, the
detectable compound included with a microorganism in the
combinations provided herein will be a compound that is a
substrate, a ligand, or can otherwise specifically interact with, a
protein or RNA encoded by the microorganism; in some examples, the
protein or RNA is an exogenous protein or RNA. Exemplary
microorganisms/detectable compounds include a microorganism
encoding luciferase/luciferin,
.beta.-galactosidase/(4,7,10-tri(acetic
acid)-1-(2-.beta.-galactopyranosylethoxy)-1,4,7,10-tetraazacyclododecane)
gadolinium (Egad), and other combinations known in the art.
[0429] Combinations provided herein can contain a microorganism and
a microorganism gene expression modulating compound. Compounds that
modulate gene expression are known in the art, and include, but are
not limited to, transcriptional activators, inducers,
transcriptional suppressors, RNA polymerase inhibitors, and RNA
binding compounds such as siRNA or ribozymes. Any of a variety of
gene expression modulating compounds known in the art can be
included in the combinations provided herein. Typically, the gene
expression modulating compound included with a microorganism in the
combinations provided herein will be a compound that can bind,
inhibit, or react with one or more compounds active in gene
expression such as a transcription factor or RNA, of the
microorganism of the combination. An exemplary
microorganism/expression modulator can be a microorganism encoding
a chimeric transcription factor complex having a mutant human
progesterone receptor fused to a yeast GAL4 DNA-binding domain an
activation domain of the herpes simplex virus protein VP16 and also
containing a synthetic promoter containing a series of GAL4
recognition sequences upstream of the adenovirus major late E1B
TATA box, where the compound can be RU486 (see, e.g., Yu et al.,
Mol Genet Genomics 2002 268:169-178). A variety of other
microorganism/expression modulator combinations known in the art
also can be included in the combinations provided herein.
[0430] Combinations provided herein can contain a microorganism and
a therapeutic compound. Therapeutic compounds can include compounds
that are substrates for microorganismally expressed enzymes,
compound that can kill or inhibit microorganism growth or toxicity,
or other therapeutic compounds provided herein or known in the art
to act in concert with a microorganism. Typically, the therapeutic
compound included with a microorganism in the combinations provided
herein will be a compound that can act in concert with a
microorganism, such as a substrate of an enzyme encoded by the
microorganism, or an antimicroorganismal agent known to be
effective against the microorganism of the combination. Exemplary
microorganism/therapeutic compound combinations can include a
microorganism encoding Herpes simplex virus thymidine
kinase/gancyclovir, and streptococcus pyogenes/penicillin. Any of a
variety of known combinations provided herein or otherwise known in
the art can be included in the combinations provided herein.
[0431] 4. Kits
[0432] Kits are packaged in combinations that optionally include
other reagents or devices, or instructions for use. Any kit
provided herein also can, in place of a microorganism, contain a
pharmaceutical composition, a host cell containing a microorganism,
and/or a combination, and one or more components.
[0433] Exemplary kits can include the microorganisms provided
herein, and can optionally include one or more components such as
instructions for use, a device for detecting a microorganism in a
subject, a device for administering a compound to a subject, and a
device for administering a compound to a subject.
[0434] In one example, a kit can contain instructions. Instructions
typically include a tangible expression describing the
microorganism and, optionally, other components included in the
kit, and methods for administration, including methods for
determining the proper state of the subject, the proper dosage
amount, and the proper administration method, for administering the
microorganism. Instructions can also include guidance for
monitoring the subject over the duration of the treatment time.
[0435] In another example, a kit can contain a device for detecting
a microorganism in a subject. Devices for detecting a microorganism
in a subject can include a low light imaging device for detecting
light, for example emitted from luciferase, or fluoresced from
green fluorescence protein, a magnetic resonance measuring device
such as an MRI or NMR device, a tomographic scanner, such as a PET,
CT, CAT, SPECT or other related scanner, an ultrasound device, or
other device that can be used to detect a protein expressed by the
microorganism within the subject. Typically, the device of the kit
will be able to detect one or more proteins expressed by the
microorganism of the kit. Any of a variety of kits containing
microorganisms and detection devices can be included in the kits
provided herein, for example, a microorganism expressing luciferase
and a low light imager, or a microorganism expressing green
fluorescence protein and a low light imager.
[0436] Kits provided herein also can include a device for
administering a microorganism to a subject. Any of a variety of
devices known in the art for administering medications or vaccines
can be included in the kits provided herein. Exemplary devices
include a hypodermic needle, an intravenous needle, a catheter, a
needle-less injection device, an inhaler, and a liquid dispenser
such as an eyedropper. Typically, the device for administering a
microorganism of the kit will be compatible with the microorganism
of the kit; for example, a needle-less injection device such as a
high pressure injection device can be included in kits with
microorganisms not damaged by high pressure injection, but is
typically not included in kits with microorganisms damaged by high
pressure injection.
[0437] Kits provided herein also can include a device for
administering a compound to a subject. Any of a variety of devices
known in the art for administering medications to a subject can be
included in the kits provided herein. Exemplary devices include a
hypodermic needle, an intravenous needle, a catheter, a needle-less
injection an inhaler, and a liquid dispenser. Typically the device
for administering the compound of the kit will be compatible with
the desired method of administration of the compound. For example,
a compound to be delivered subcutaneously can be included in a kit
with a hypodermic needle and syringe.
G. EXAMPLES
[0438] The following examples are included for illustrative
purposes only and are not intended to limit the scope of the
invention.
Example 1
Generation of Recombinant Viruses
[0439] A Wild type vaccinia virus (VV) strain LIVP (the well known
viral strain, originally derived by attenuation of the strain
Lister from the ATCC under Accession Number VR-1 549, from the
Institute of Viral Preparations, Moscow, Russia; see, Al'tshtein et
al., (1983) Dokl. Akad. Nauk USSR 285:696-699) designed as VGL was
used as a parental virus for the construction of recombinant
viruses designated RVGLX herein. All vaccinia viruses were purified
using sucrose gradient (Yoklik). VVs were propagated and titers
were determined by plaque assays using CV-1 cells (ATCC No.
CCL-70). Methods for constructing recombinant vaccinia viruses are
known to those of skill in the art (see, e.g., Chakrabarti et al.,
(1985 Mol. Cell Biol. 5:3403 and U.S. Pat. No. 4,722,848)). Table 1
summarizes the recombinant VV strains described in this
Example.
[0440] Inactivation of VV by PUV Treatment
[0441] LIVP VV (3.times.108 pfu/ml) was incubated with 1 .mu.g/ml
psoralen (Calbiochem, La Jolla, Calif.), suspended in Hank's buffer
at room temperature for 10 min, and then irradiated for 5 min in
Stratalinker 1800 UV crosslinking unit (Stratagene, La Jolla
Calif.) equipped with five 365 nm long wave UV bulb to produce
PUV-VV.
[0442] RVGL8: LacZ insertion into F3 of LIVP Construction of
recombinant vaccinia virus RVGL8 containing a lacZ gene inserted
the NotI site was prepared as described in Timiryasova et al.
(2001), BioTechniques 31, 534-540. Briefly it was prepared as
follows. The BamHI/SmaI fragment (3293 bp) of pSC65 (see,
Chakrabarti et al. (1997), BioTechniques 23, 1094-1097; see, also
Current Protocols in Molecular Biology, Green Publishing and
Wiley-Interscience Supplement 15:16.17.2 (1992); see also SEQ ID
NO: 5 herein and SEQ ID NO: 57 in PCT International application No.
WO 99/32646) containing the lacZ gene under the control of the
vaccinia p7.5 promoter and strong synthetic vaccinia pE/L promoter
was isolated by digestion with restriction enzymes, blunted with
Klenow enzyme, and cloned into SmaI site of pNT8 plasmid
(Timiryasova et al. (2001), BioTechniques 31: 534-540) to produce
pNZ2a shuttle plasmid.
[0443] To construct pNT8, the NotI region of the wild type VV
strain LIVP was amplified using the following primers: [0444]
Forward: 5'-GGGAATTCTTATACATCCTGTTCTATC-3' (SEQ ID NO: 3); [0445]
Reverse: 5'-CCAAGCTTATGAGGAGTATTGCGGGGCTAC-3' (SED ID NO: 4) with
the VV as a template. The resulting 972 bp fragment contained
flanking EcoRI and HindIII sites at the 5' and 3' ends,
respectively. The PCR product was cleaved with EcoRI and HindIII
and inserted in pUC28 (Benes et al., (1993) Gene 130: 151. Plasmid
pUC28 is prepared from pUC18 (available from the ATCC under
Accession Number 37253 by introducing a synthetic oligo adaptor
using primers: [0446] pUC28 I: 5'AATTCAGATCTCCATGGATCGATGAGCT 3'
(SEQ ID NO: 6); [0447] pUC28 II: 3'GTCTAGAGGTACCTAGCTAC 5' (SEQ ID
NO: 7) into the EcoRI and SstI sites of pUC18. This introduces
BglII, ClaI, and NcoI sites into the polylinker of pUC18.
[0448] Plasmid pNZ2 contains cDNA encoding the E. coli lacZ gene
under the control of the vaccinia virus early/late promoter p7.5
and a synthetic early/late vaccinia pE/L promoter derived from the
plasmid pSC65 (see, Chakrabarti et al. (1997), BioTechniques 23,
1094 1097; see, also Current Protocols in Molecular Biology, Green
Publishing and Wiley-Interscience Supplement 15:16.17.2 (1992); see
also SEQ ID NO: 5 herein and SEQ ID NO: 57 in PCT International
application No. WO 99/32646). Plasmid pNZ2 provides for homologous
recombination of lacZ into the NotI site of the VGL virus (ATCC
VR-1549), to produce the recombinant vaccinia virus designated
RVGL8. The complex of wild type vaccinia virus DNA digested with
NotI and not digested plasmid DNA pNZ2 was transfected for in vivo
recombination into PUV VV infected cells to produce RVGL8 (see FIG.
1). RVGL8 and the other recombinant vaccinia viruses described
herein are listed in Table 1, below.
[0449] Mutant Virus Formation/Transfection
[0450] CV-1 African green monkey kidney fibroblasts (ATCC No.
CCL-70) grown on 60 mm dishes (Corning, Corning, N.Y., USA) were
infected with PUV-VV (strain LIVP treated with psoralen and UV;
see, e.g., Tsung et al. (1996), J. Virol. 70, 165-171; Timiryasova
et al. (2001), BioTechniques 31, 534-540; Timiryasova et al.
(2001), J. Gene 3 Med. 3, 468-477) at multiplicity of infection
(MOI) of 1.
[0451] Two hours post-infection, the cells were transfected with a
mixture of NotI-digested viral DNA (4 .mu.g) and intact plasmid DNA
(4 .mu.g). Lipid-mediated transfection of cells was carried out
using 5 .mu.l of GenePORTER reagent (Gene Therapy Systems, San
Diego, Calif., USA) per jig of the DNA according to manufacturers'
instructions. Cells were incubated in transfection mixture for 4 h
and then supplemented with a medium containing 20% of fetal bovine
serum. Cytopathic effects were monitored daily by light microscopy.
Cells were incubated for 5-7 days until formation of the virus
plaques and complete cytopathic effect. Then, infected cells were
harvested, resuspended in 0.5 ml of medium, and frozen and thawed
three times to release the virus. Single virus plaques were
selected for the preparation of small and large recombinant virus
stocks and analyzed for the insertion and expression of the
genes.
[0452] Confirm Mutant
[0453] Viral DNA was analyzed by Southern blots. Briefly, to
isolate viral DNA, confluent monolayers of CV-1 cells, grown on 10
cm plates, were infected with the wild type VV (strain LIVP) or VV
of the virus stock obtained from a single recombinant plaque. When
the cytopathic effect was complete, cells were harvested and the
pellet was resuspended in 3 ml of 10 mM Tris-HCl, pH 9.0. Viral
particles were lysed, treated with proteinase K, and the virus DNA
was isolated by phenol/chloroform extraction, followed by ethanol
precipitation. The DNA was resuspended in 100 .mu.l 1 of sterile
water. The viral DNA samples were digested by NotI overnight at
37.degree. C., followed by phenol-chloroform treatment,
precipitated and 10 .mu.g of DNA samples were separated through a
0.8% agarose gel. The DNA was transferred to a positively charged
nylon membrane (Roche Diagnostics Corporation, Indianapolis, Ind.,
USA) and fixed to the membrane using a GS Gene Linker (Bio-Rad
Laboratories, Hercules, Calif., USA). The DIG-labeling of DNA was
performed using a nonradioactive DNA labeling and detection kit
(Roche Diagnostics Corporation) and incubating for 60 min at
37.degree. C. The membrane was hybridized with a denatured
DIG-labeled 3357 bp NotI-NotI DNA fragment of the plasmid pNZ2
encoding the lacZ gene. Hybridization conditions and blot
development were performed as suggested by the manufacturer.
[0454] The predicted size of the band is 3357 bp. The hybridization
of NotI digested viral DNAs with a 3357 bp DNA probe confirmed the
integration of the lacZ gene into NotI site of virus genome.
[0455] Construction of RVGL2 and RVGL23 Viruses with a Single TK
Gene Mutation
[0456] Vaccinia virus LIVP was used for the construction of
recombinant virus RVGL2. Vaccinia virus Western Reserve (WR) was
used for the construction of recombinant virus RVGL23. The cDNA of
Renilla luciferase and Aequorea GFP fusion (ruc-gfp; 1788 bp; see,
Wang et al., (1996) Bioluminescence Chemiluminescence 9:419-422;
Wang et al., (2002) Mol. Genet. Genomics 268:160-168; Wang et al.
(1997) pp 419-422 in Bioluminescence and Chemiluminescence:
molecular reporting with photons, Hastings et al., eds., Wiley,
Chicheser UK; see, also U.S. Pat. No. 5,976,796; see also SEQ ID
NO: 8 herein, which sets forth a sequence for a ruc-gfp construct)
was excised from plasmid pcDNA-ruc-gfp (RG), which is described in
Wang et al., (1996) Bioluminescence Chemiluminescence 9:419-422 and
Wang et al., (2002) Mol. Genet. Genomics 268:160-168 and briefly
below, by restriction endonuclease PmeI and inserted into the SmaI
site of pSC65 plasmid (see SEQ ID NO: 5; see, also herein and SEQ
ID NO: 57 in PCT International application No. WO 99/32646),
resulting in pSC65-RG-1 plasmid DNA.
[0457] Briefly to prepare pcDNA-ruc-gfp, the EcoRI-NotI fragment
encoding the modified Renilla luciferase-ending DNA (see, Wang et
al. (1997) pp 419-422 in Bioluminescence and Chemiluminescence:
molecular reporting with photons, Hastings et al., eds., Wiley,
Chicheser UK) was cloned into the pcDNA3.1 vector (Invitrogen,
Carlsbad, Calif.), placing expression of the Renilla luciferase
under control of the CMV promoter. The stop codon at the end of the
Renilla luciferase ORF was removed, and the resulting plasmid
digested with NotI. The NotI fragment containing the ORF encoding
humanized Aequorea GFP (Zolotukhin et al., (1996) J. Virol.
70:4646-4654) was excised from the pTR-.beta.-actin plasmid and
inserted into the NotI site of the plasmid encoding the Renilla
luciferase. The resulting plasmid was designated pcDNA-ruc- the
ruc-gfp.
[0458] New plasmid pSC65-RG-1 containing ruc-gfp fusion under the
control of the vaccinia PE/L promoter and E. coli
.beta.-galactosidase under control of p7.5 promoter of VV was used
for the construction of a single TK gene interrupted virus RVGL2 of
strain LIVP and RVGL23 of strain WR. CV-1 cells were infected with
wt LIVP or wt WR virus at MOI of 0.1, and two hours later,
pSC65-RG-1 plasmid DNA was transfected using FuGene6 transfection
reagent (Roche). After 24 h of incubation, cells were three times
frozen and thawed to release the virus. Recombinant viruses were
screened on CV-cells in the presence of substrate
5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside (X-gal,
Stratagene, Cedar Creek, Tex., USA). After four cycles of virus
purification, all virus plaques were positive for
.beta.-galactosidase expression. The expression of the ruc-gfp
fusion protein was confirmed by luminescence assay and fluorescence
microscopy, respectively. Schematic maps of the viruses are set
forth in FIG. 1.
[0459] Construction of RVGL5 and RVGL9 Viruses with Single Gene
Mutations
[0460] Recombinant vaccinia virus RVGL5 contains the lacZ gene
under the control of the vaccinia late p11 promoter inserted int
the HA gene of vaccinia genome (Timiryasova et al. (1993) Mol Biol
27:392-402; see, also, Timiryasova et al., (1992) Oncol. Res
11:133-144.). Recombinant vaccinia virus RVGL9 contains a fusion of
the Renilla luciferase gene (ruc) and cDNA of green fluorescence
protein (GFP) under the control of a synthetic early/late vaccinia
promoter (PE/L) inserted into the F3 gene of the VV genome
(Timiryasova et al., (2000)) pp. 457-459 in Proceedings of the 11th
International Symposium on Bioluminescence and Chemiluminescence,
Case et al., eds). RVGP5 and RVGLP9 were constructed as described
for RVGLP2 and RVGLP23.
[0461] Construction of RVGL20 Virus with Double TK and F3 Gene
Mutations
[0462] The cDNA of human transferrin receptor (hTR) (2800 bp) with
polyA sequence was isolated from pCDTR1 plasmid (ATCC Accession No.
59324 and 59325) by BamHI, treated with Klenow and inserted into
SalI site of pSC65 plasmid (SEQ ID NO: 5 herein and SEQ ID NO: 57
in PCT International application No. WO 99/32646), resulting in
pSC-TfR and pSC-rTfR. Plasmid pSC-rTfR contains cDNA hTR in an
orientation opposite to the vaccinia PE/L promoter and E. coli
.beta.-galactosidase under control of the early/late vaccinia p7.5
promoter flanked by vaccinia sequences for insertion into vaccinia
TK gene. pSC-rTfR was used for the construction of RVGL20 virus.
RVGL9, a recombinant virus with single deletion carrying ruc-gfp
fusion in the F3 gene locus, which contains a unique NotI site in
the LIVP strain (see above, see, also, Timiryasova et al., (2000)
pp. 457-459 in Proceedings of the 11.sup.th International Symposium
on Bioluminescence and Chemiluminescence, Case et al., eds), was
used as a parental virus for the creation of RVGL20 virus by
homologous recombination as described above. A schematic of RVGL20
virus is set forth in FIG. 1.
[0463] Construction of RVGL21 Virus with Triple TK, F3 and HA Gene
Mutations
[0464] The cDNA of the .beta.-glucuronidase (gus) of E. coli (1879
bp) was released from pLacGus plasmid (Invitrogen; see SEQ ID NO: 9
herein) with XbaI (blunt ended with Klenow fragment) and HindIII,
and cloned into pSCII plasmid pSC65 (Chakrabarti et al. (1985) Mol.
Cell Biol. 5:3403-3409; SEQ ID NO: 5 herein and SEQ ID NO: 57 in
PCT International application No. WO 99/32646) digested with XhoI
(treated with Klenow) and HindIII under the control of a vaccinia
p11 late promoter, resulting in a plasmid pSC-GUS. The SmaI-HindIII
fragment from pSC-GUS plasmid was inserted into pVY6 plasmid, a
vector for inserting antigen genes into the hemagglutinin gene of
vaccinia (see, e.g., Flexner et al., (1988) Nature 355:259-262;
Flexner et al., (1988) Virology 166: 339-349; see also U.S. Pat.
No. 5,718,902) digested with SmaI and BamHI, resulting in pVY-GUS
plasmid. The resulting plasmid, designated pVY-GUS plasmid,
contains the cDNA encoding gus under the control of the vaccinia
late promoter p11 flanked by vaccinia sequences for insertion into
the hemagglutinin (HA) gene. Recombinant virus RVGL20 with double
deletions was used as the parental virus for the construction of
RVGL21 virus. CV-1 cells were infected with RVGL20 virus at MOI of
0.1. Two hours after infection, cells were transected with pVY-GUS
plasmid DNA using FuGene6 transfection reagent (Roche). Recombinant
virus plagues were selected in CV-1 cells by color screening upon
addition of .beta.-glucuronidase substrate
5-bromo-4-chloro-3-indolyl-.beta.-D-glucuronicacid (X-GlcA)
(Research Products Int. Co., Mt. Prospect, Ill., USA) into agar
medium. After eight cycles of purification in agar medium in the
presence of X-GlcA pure recombinant virus RVGL21 was selected.
RVGL21 virus has interruptions of TK, F3 and HA genes and is
presented schematically in FIG. 1.
[0465] In Vitro Virus Growth
[0466] CV-1, C6 (ATCC No. CCL-107), B16-F10 (ATCC No. CRL-6475),
and GI-101A (Rumbaugh-Goodwin Institute for Cancer Research Inc.
Plantation, Fla.; U.S. Pat. No. 5,693,533) cells were seeded in
24-well plates at the density of 1.times.10.sup.5,
2.times.10.sup.5, 4.times.10.sup.5, and 2.times.10.sup.5
cells/well, respectively. The next day, the cells were
simultaneously infected with 0.001 or 0.01 PFU/cell of a wild type
LIVP and its mutants. The virus suspension was added to cell
monolayer (0.15 ml/well) and incubated at 37.degree. C. for 1 h
with brief agitation every 10 min. Then, the virus was removed,
appropriate complete growth medium was added (1 ml/well), and the
cells were then incubated at 37.degree. C. for 24, 48, 72 and 96 h
after virus infection. To establish resting cell culture, a
confluent monolayer of CV-1 cells was incubated for 6 days in DMEM
with 5% FBS at 37.degree. C. These resting cells were infected and
harvested at the same time points after infection as described
above. Virus from the infected cells was released by one cycle of
freezing and thawing. Viral titers were determined in duplicates by
plaque assay on CV-1 cells and expressed as PFU/ml. TABLE-US-00001
TABLE 1 List of recombinant vaccinia viruses (VV) Prior
InsertionLocus/ Designation Designation Description loci Reference
VGL wt VV strain LIVP No Publicly available VV Insertions RVGL1
recVV2 (p7.5) Luc- HindIII-N- Timiryasova TM, (p11) LacZ of
Interrupted Kopylova-Sviridova TN, LIVP VV Fodor I. Mol. Biol.
(Russian) 27: 392-401 (1993); Timiryasova TM, Li J, Chen B. Chong
D. Langridge WHR, Gridley DS, Fodor I. Oncol. Res. 11: 133-144
(1999) RVGL5 recVV8 (p11) LacZ of HA- Timiryasova TM, LIVP VV
Interrupted Kopylova-Sviridova TN, Fodor I. Mol. Biol. (Russian)
27: 392-401 (1993) RVGL7 rVV-EGFP (PE/L) EGFP- TK- Umphress S,
Timiryasova T., or (p7.5) LacZ of Interrupted Arakawa T, Hilliker
S, rVV-GFP LIVP VV Fodor I, Langridge W. Transgenics 4: 19-33
(2003) RVGL8 rVV-Not-LacZ (p7.5) LacZ of NotI (F3)- Timiryasova TM,
or LIVP VV Interrupted Chen B, Fodor N, rVV-Not-LZ Fodor I.
BioTechniques 31: 534-540 (2001) RVGL9 rVV-RG (PE/L) NotI (F3)-
Timiryasova TM, Yu Ya, or Ruc-GFP of Interrupted Shabahang S,
rVV-ruc-gfp LIVP VV Fodor I, Szalay AA. Proceedings of the
11.sup.th International Symposium on Bioluminescence &
Chemiluminescence pp.457-460 (2000) RVGL12 Same as RVGL7, except
that HSV TK is inserted in place of gfp RVGL19 (PE/L) TK- and
Herein Trf-(p7.5) NotI (F3)- LacZ in Tk Interrupted locus (PE/L)
Ruc-GFP in F3 locus of LIVP VV RVGL20 (PE/L) Tk- and Herein
rTrf-(p7.5) NotI (F3)- LacZ in TK Interrupted locus (PE/L) Ruc-GFP
in F3 locus of LIVP V RVGL21 (PE/L) Tk-, HA- Herein rTrf-(p7.5)
interrupted LacZ in TK and NotI locus, (p11) (F3)- LacZ in HA
Interrupted locus, (PE/L) Ruc-GFP in F3 locus of LIVP VV RVGL23
(PE/L) Tk- Herein rTrf-(p7.5) Interrupted LacZ in TK locus of WR
VV
Example 2
In Vitro Analysis of Virus Levels
[0467] LacZ
[0468] Analysis of lacZ expression induced by recombinant vaccinia
virus was performed as described previously (Timiryasova et al.
(2001), BioTechniques 31, 534-540). Briefly, CV-1 cells grown
6-well plates (Corning, Corning, N.Y., USA) were infected with
ten-fold dilutions of the virus stock. The virus was allowed to
absorb for 1 h at 37.degree. C. with occasional rocking. Then, the
virus inoculum was replaced with a complete medium containing 1% of
agar, and the incubation was carried out for 48 h. To visualize the
virus plaques, 300 .mu.g of X-Gal (Molecular Probes, Eugene, Oreg.,
USA) per ml and 0.1% of neutral red (Sigma, St. Louis, Mo., USA)
were added to the second agar overlay, and plaques were counted and
isolated after 12 h incubation at 37.degree. C. Levels of vaccinia
virus in cells in vitro could also be determined by measuring the
plaque forming units (PFU) in the cells.
In Vitro Infectivity of VV's Measured by Plaque Forming Units
[0469] The ability of wt LIVP virus and its mutants to infect and
replicate was analyzed in dividing and resting CV-1 cells as well
as in three tumor cell lines (C6, GI-101A, B16-F10). The results
demonstrate that vaccinia mutants can efficiently infect and
replicate in dividing CV-1 cells at an MOI of 0.001. A significant
yield of vaccinia virus was obtained from dividing CV-1 cells. The
yield of wt W and its mutants in dividing CV-1 cells was about 10
times higher than in resting CV-1 cells. There was no significant
difference in viral recovery between vaccinia mutants and wt virus
in vitro studies. The interruption of TK, F3 and HA genes made no
difference to W mutants replication in the dividing CV-1 cells.
Three tumor cells were tested. The relative sensitivities to
cytopathic effects at MOI of 0.001 were follows: CV-1 (dividing,
highest), CV-1 (resting), C6, GI-101A, B16-F10 (lowest). Mouse
B16-F10 melanoma cells were not sensitive to virus infection at MOI
of 0.001. Very low viral titer was recovered from melanoma cells
infected at MOI of 0.011. Also observed was that wt WR strain was
able to infect melanoma cells in vitro more efficiently compared to
LIVP strain and virus recovery was higher compared to LIVP
strain.
Example 3
Animal Models and Assays
Animal Models
[0470] Athymic nude mice (nu/nu) and C57BL/6 mice (Harlan Animal
Res., Inc., Wilmington, Mass.) at 6-8 weeks of age were used for
animal studies. Mice in groups of five or four were infected i.v.
with 10.sup.7 PFU of VV in a volume of 0.1 ml i.v. Mice were imaged
by low-light imager and fluorescence imager for ruc and for gfp
expression, respectively. The study was approved prior to
initiation by the Animal Research Committee of LAB Research
International Inc. (San Diego, Calif., USA). All animal care was
performed under the direction of a licensed veterinarian of LAB
Research International Inc. (San Diego, Calif., USA).
[0471] Glioma Model
[0472] To establish subcutaneous glioma tumor, rat glioma C6 cells
(ATCC No. CCL-107) were collected by trypsinization, and
5.times.10.sup.5 cells/0.1 ml/mouse were injected subcutaneously
(s.c.) into right hind leg of 6-8 week old male athymic mice. On
day 7 after C6 cell implantation when median tumor size was about
150 mm.sup.3, viruses at the dose of 10.sup.7 PFU/0.1 ml/mouse were
injected intravenously (i.v.). Mice were sacrificed 14 days after
virus injection. In the kinetic studies using of RVGL9 virus, mice
were sacrificed at 20 min, 1 h, 4 h, 18 h, 36 h, 3 d, 5 d, 7 d and
14 days after virus injection.
[0473] Breast Tumor Model
[0474] To develop sub cutaneous (s.c). breast tumor, human breast
cancer GI-101 A cells (Rumbaugh-Goodwin Institute for Cancer
Research Inc. Plantation, Fla.; U.S. Pat. No. 5,693,533) at the
dose of 5.times.10.sup.6 cells/0.1 ml/mouse were injected s.c. into
the right hind leg of 6-8 week old female athymic mice. On day 30
after GI-101A cell implantation, when median tumor size was about
500 mm.sup.3, viruses at the dose of 10.sup.7 PFU/mouse were
injected i.v. Mice were sacrificed on day 14 after virus injection.
Mice for survival experiments and breast tumor therapy studies were
kept for long time periods (more than 100 days after virus
injection). Mice that developed tumor with the size about 4000
mm.sup.3, and/or lost 50% of body weight were sacrificed.
[0475] Melanomal Model
[0476] For a melanoma model, mouse melanoma B16-F10 cells (ATCC No.
CRL-6475) at the dose of 2.times.10.sup.5 cells/0.04 ml/mouse were
injected into the foot pad of 6-8 week old male C57BL/6 mice. When
the tumor was established (median size of tumor about 100
mm.sup.3), on day 18 after cell implantation, viruses at the dose
of 10.sup.7/mouse were injected i.v. Mice were sacrificed 10 days
after virus injection.
Vaccinia Virus in Animal Models
[0477] Vaccinia virus recovery from tumor and organs of nude
mice
[0478] From sacrificed animals blood was collected, and organs
(lung, liver, spleen, kidneys, testes, ovaries, bladder, brain,
heart) and tumors were harvested and homogenized in PBS containing
a mixture of protease inhibitors. Scissors and forceps were changed
after each organ dissection or incision to avoid
cross-contamination of the tissues. Samples were frozen and thawed,
centrifuged at 1,000 g for 5 min. Viral titer was determined in the
supernatant diluted in serum-free medium on CV-1 cells by plaque
assay and staining them with 1% (wt/vol) crystal violet solution
after 48 h incubation. Each sample was assayed in duplicate and
viral titer was expressed as mean PFU/g of tissue.
Assay Measurements
[0479] Survival studies were performed on 6-week old nude mice
bearing s.c. human breast tumor. Mice were injected i.v. with
10.sup.7 of vaccinia viruses and followed for survival. Individual
body weight was measured twice a week. Gain/loss of body weight
after virus infection was calculated as the percentage: body weight
(g)-tumor weight (g) on day of virus injection/body weight
(g)-tumor weight (g) on day of monitoring.times.100%. Spleens were
excised from euthanized animals and weighed. The RSW was calculated
as follows: RSW=weight of spleen (g).times.10.sup.4/animal body
weight (g)-tumor weight (g). Mice were euthanized when the mean
tumor volume reached 3000 mm.sup.3 or developed the signs of
disease. Rapid CO.sub.2 euthanasia was humanely performed in
compliance with the NIH Guide for the Care and Use of Laboratory
Animals.
Reporter Genes Assays
[0480] LacZ
[0481] E. coli .beta.-galactosidase activity in tissue samples and
in the serum of the mice was determined using chemiluminescent
Galacto-Light Plus.TM. Assay system (Applied Biosystems, Bedford,
Mass., USA) according to the instructions of the kit manufacturer.
Briefly, 1-20 .mu.l of the sample was transferred into the tube
with 200 .mu.l of 1:100 diluted Reaction Buffer Diluent and
incubated at RT for 30 min. A 300 .mu.l aliquot of accelerator
(-II) was added into the tube with the sample, mixed quickly and
the signal was read using luminometer. .beta.-galactosidase
activity was expressed as relative light units (RLU) per g of
tissue. Purified E. coli .beta.-galactosidase (Sigma) was used as a
positive control and to generate a standard curve.
[0482] Luciferase
[0483] Renilla luciferase activity was measured in the supernatant
of the tissue samples after they had been homogenized using a
Turner TD 20e luminometer (Turner Designs, Sunnyvale, Calif., USA)
as described previously (Yu and Szalay, 2002) with some
modifications. In brief, 20 .mu.l of the samples was added into 500
.mu.l of luciferase assay buffer (0.5 M NaCl, 1 mM EDTA, 0.1 M
potassium phosphate pH 7.4) containing a substrate coelentrazine.
Luciferase activity was measured during 10-s interval and expressed
as RLU per g of tissue.
Assay Results
[0484] Presence of RVGL9 Over Time
[0485] A vaccinia virus RVGL9 with a single F3 gene mutation and
carrying ruc-gfp was used to assess the pattern of vector tissue
distribution following i.v. administration into immunocompromised
athymic mice bearing s.c. glioma tumors. The tissue distribution
data using this recombinant virus showed virus distribution and
tumor targeting by this VV strain. Kinetics studies were performed
by noninvasive imaging of virus replication in the mice based on
ruc and gfp expression. Four to five animals per group bearing s.c.
rat glioma C6 tumor were injected with 10.sup.7 of RVGL9 virus via
the tail vein. The animals were sacrificed at 20 min, 1,4, 18 and
36 hours, 3, 5, and 14 days after virus injection. No viable viral
particles were recovered from brain, bladder or testes at any time
point after i.v. injection of virus. Some viral particles were
recovered from spleen, heart and lung at early time points after
virus injection. After 18 h post-infection, the titer of RVGL9
virus in these organs decreased. No virus was recovered in the
heart tissue after 18 h; around 156.5 and 44 PFU/g tissue was
recovered from spleen and lung, respectively, on day 14 as compared
to 3221.0 and 3521.9 PFU/g tissue at 20 min after virus injection,
respectively. The pattern of virus recovery from liver and kidneys
was different from the pattern in the spleen, heart, or lung. No
virus in the kidneys and 174.9 PFU/g tissue of virus was recovered
from liver at an early time after virus injection. On day 5 after
virus injection, the titer of virus in these organs increased and
went down on day 14 post virus injection. In tumor tissue virus was
detected starting 18 h after virus administration
(1.6.times.10.sup.3 PFU/g tissue), and dramatically increased over
the time of observation (1.8.times.10.sup.8 PFU/g tissue on day 7).
Virus in the tumor tissue was detectable for more then 60 days
after a single i.v. virus injection. The results demonstrate
tumor-specific replication of these vaccinia mutants. A correlation
was observed between the virus recovery and the transgene
expression in tumors and in organs. Based on the data of-RVGL9
virus kinetics, day 10 or day 14 was used for tissue distribution
studies of different vaccinia mutants in melanoma and glioma and
breast tumor models, respectively.
[0486] Presence of Various VV in Mice Bearing a Glioma Tumor
[0487] To examine tissue distribution of vaccinia virus in
immunodeficient mice bearing an s.c. glioma tumor, viruses were
injected i.v. at a dose of 1.times.10.sup.7 PFU/0.1 ml/mouse on day
7 after C6 rat glioma cell implantation. Fourteen days after virus
injection, mice were sacrificed and virus titer was determined in
different tissues. Mice injected with wt WR virus were sick and
dying due to viral pathogenicity. Hence, WR-injected mice were
sacrificed on day 7 after virus injection. Wild type LIVP virus was
recovered from all analyzed tissues as well as from brain. The
amount of recovered virus particles from the mice injected with wt
LIVP was much lower than wt WR strain of VV. The results presented
in Table 1A TABLE-US-00002 TABLE 1A Viral recovery from nude mice
tissues in glioma model..sup.a RVGL21 LIVP RVGL2 RVGL5 RVGL9 RVGL20
TK-, F3-, WR.sup.b RVGL23 Wt TK- HA- F3- TK-, F3- HA- Wt TK-, WR
Brain 1.2 .times. 10.sup.3 1.4 .times. 10.sup.3 0 0 0 0 1.4 .times.
10.sup.7 1.9 .times. 10.sup.6 Kidneys 6.1 .times. 10.sup.2 6.7
.times. 10.sup.2 1.6 .times. 10.sup.2 34.6 33.3 36.6 5.4 .times.
10.sup.6 7.9 .times. 10.sup.2 Lung 2.9 .times. 10.sup.3 0 1.6
.times. 10.sup.2 1.4 .times. 10.sup.4 6.7 .times. 10.sup.3 2.4
.times. 10.sup.3 1.9 .times. 10.sup.6 2.1 .times. 10.sup.3 Spleen
1.9 .times. 10.sup.2 0 1.8 .times. 10.sup.2 1.0 .times. 10.sup.3
1.0 .times. 10.sup.2 1.7 .times. 10.sup.2 1.6 .times. 10.sup.6 1.8
.times. 10.sup.3 Testes 5.8 .times. 10.sup.4 64.3 6.4 .times.
10.sup.2 7.5 .times. 10.sup.2 0 0 9.8 .times. 10.sup.4 1.7 .times.
10.sup.3 Bladder 6.4 .times. 10.sup.3 0 0 2.9 .times. 10.sup.3 0 0
2.8 .times. 10.sup.5 1.2 .times. 10.sup.3 Liver 3.4 .times.
10.sup.4 63.6 4.2 .times. 10.sup.2 33.6 96.6 30.8 7.1 .times.
10.sup.3 5.6 .times. 10.sup.3 Heart 6.0 .times. 10.sup.3 0 0 0 0 0
1.4 .times. 10.sup.5 0 Serum.sup.c 0 0 0 0 0 0 6.0 .times. 10.sup.2
0 Tumor 5.4 .times. 10.sup.7 1.5 .times. 10.sup.7 3.8 .times.
10.sup.7 2.9 .times. 10.sup.7 3.9 .times. 10.sup.7 1.9 .times.
10.sup.7 1.9 .times. 10.sup.8 3.7 .times. 10.sup.7
The results demonstrate that 10000-fold more virus was recovered in
the brain of mice injected with WR strain versus wt LIVP strain.
Wild type WR strain virus was recovered from the serum (600 PFU/20
.mu.l) of mice on day 7 after virus injection. No virus was
recovered in the serum of the mice injected with LIVP mutants on
day 14. The level of wt LIVP in serum was not tested on day 7.
About 1.9.times.10.sup.6 PFU/g tissue of TK-mutant of WR strain
(RVGL23) was found in the brain tissue compared to
1.4.times.10.sup.3 PFU/g tissue for mice injected with the
TK-mutant of LIVP strain (RVGL2).
[0488] All other mutants of VV strain LIVP were found mostly in
tumor only and no virus was recovered from brain tissue of mice
injected with a double or triple mutant (Table 1A). Three times as
many virus particles were recovered from the tumors of mice
injected with WR compared to wt LIVP. The mean of viral recovery in
tumor tissue of the mutants of LIVP strain was similar to the wt
LIVP and equivalent to TK-mutant of WR strain.
[0489] Presence of Various VV in Mice Bearing a Breast Tumor
[0490] Data for tissue distribution in immunocompromised mice
bearing s.c. GI-101A human breast are presented in Table 1B:
TABLE-US-00003 TABLE 1B Viral recovery from nude mice tissues in
breast cancer model. RVGL21 LIVP RVGL2 RVGL5 RVGL9 RVGL20 TK-, F3-,
WR.sup.b RVGL23 Wt TK- HA- F3- TK-, F3- HA- Wt TK-, WR Brain 0 0 0
0 0 0 7.2 .times. 10.sup.6 1.6 .times. 10.sup.4 Kidneys 3.6 .times.
10.sup.3 38.3 27 3.3 .times. 10.sup.2 25.8 0 3.2 .times. 10.sup.7
2.8 .times. 10.sup.5 Lung 8.6 .times. 10.sup.3 5.5 .times. 10.sup.2
29.1 1.6 .times. 10.sup.3 1.6 .times. 10.sup.3 1.0 .times. 10.sup.3
2.1 .times. 10.sup.6 3.7 .times. 10.sup.3 Spleen 5.5 .times.
10.sup.3 99.5 0 1.8 .times. 10.sup.2 0 0 1.6 .times. 10.sup.6 1.8
.times. 10.sup.3 Ovaries 1.6 .times. 10.sup.3 0 0 0 0 0 8.0 .times.
10.sup.7 2.7 .times. 10.sup.7 Bladder 3.9 .times. 10.sup.3 0 0 0 0
0 2.8 .times. 10.sup.4 1.2 .times. 10.sup.3 Liver 1.2 .times.
10.sup.4 0 1.7 .times. 10.sup.2 5.2 .times. 10.sup.2 1.7 .times.
10.sup.2 1.0 .times. 10.sup.2 4.0 .times. 10.sup.5 4.8 .times.
10.sup.5 Heart 1.4 .times. 10.sup.2 0 0 58.2 4.6 .times. 10.sup.2 0
6.3 .times. 10.sup.4 2.2 .times. 10.sup.3 Serum.sup.c 0 0 0 0 0 0
2.4 .times. 10.sup.3 0 Tumor 8.6 .times. 10.sup.8 1.0 .times.
10.sup.9 2.5 .times. 10.sup.8 1.1 .times. 10.sup.9 5.6 .times.
10.sup.8 1.0 .times. 10.sup.9 2.9 .times. 10.sup.9 6.6 .times.
10.sup.8
About 10-fold more viral particles were recovered from breast tumor
tissue compared to glioma tumor tissue. No virus particles were
recovered from the brain tissue of mice injected with either wt
LIVP or its mutants. 7.2.times.10.sup.6 and 1.6.times.10.sup.4
PFU/g was recovered from brain tissue of mice injected with wt WR
and TK-virus of WR strain UV, respectively (Table 1B). During the
dissection of organs from euthanized mice, it was found that the
ovaries from the mice being injected with wt WR and TK- of WR 0.10
virus were drastically enlarged as compared to all other groups of
mice. The analysis of viral recovery from ovaries demonstrated high
titer of wt WR and TK-WR strain in ovaries, for example,
8.0.times.10.sup.7 and 2.7.times.10.sup.7 PFU/g, respectively.
About 1.6.times.10.sup.3 PFU/g was recovered from the ovaries of
the mice injected with wt LIVP virus, however no virus particles at
all were recovered from either ovaries or from brain of mice
injected with the mutants derived from LIVP strain (Table 1B).
[0491] Presence of Various VV in Mice Bearing a Melanoma Tumor
[0492] The tissue distribution of VV in the immunocompetent mice
bearing melanoma tumors on foot pads also were studied. BL/6 mice
on day 17 after B 16F10 melanoma cell implantation were i.v.
injected with the viruses at the dose of 10.sup.7 PFU/mouse via the
tail vein. All groups of mice were sacrificed on day 10 after virus
injection due to huge tumor size in the PBS-injected control group.
The results are set forth in Table 1C: TABLE-US-00004 TABLE 1C
Viral recovery from C57BL/6 mice tissues in melanoma model. RVGL21
LIVP RVGL2 RVGL5 RVGL9 RVGL20 TK-, F3-, WR.sup.b RVGL23 Wt TK- HA-
F3- TK-, F3- HA- Wt TK-, WR Tumor 5.4 .times. 10.sup.6 3.9 .times.
10.sup.6 3.7 .times. 10.sup.5 9.5 .times. 10.sup.5 2.5 .times.
10.sup.5 2.4 .times. 10.sup.5 9.9 .times. 10.sup.6 2.2 .times.
10.sup.6 Tissues.sup.e 0 0 0 0 0 0 0 0 .sup.aMean of viral recovery
PFU/g of tissue for 3-5 mice/group. .sup.bMice were sacrificed on
day 7 after virus injection. .sup.cPFU/20 .mu.l of serum .sup.dMice
were sacrificed on day 9 after virus injection. .sup.eNo virus was
recovered in all tested tissue.
No virus was recovered from kidneys, lung, spleen, brain, testes,
bladder, liver, heart, and serum of the immunocompetent mice
injected with the viruses. Virus was only recovered from the tumor
tissue. About 10-fold virus particles were recovered from the
tumors of mice injected with wt LIVP, TK-LIVP, wt WR, and TK-WR
compared to other groups.
Example 4
Reduction of Human Breast Tumor Implanted in Nude Mice by
Recombinant Vaccinia Viruses RVGL7, RVGL9 and RVGL21
[0493] RVGL7 and RVGL9
[0494] FIG. 1 shows a schematic representation of the recombinant
vaccinia viruses used for these experiments. RVGL7 was prepared as
described for the preparation of RVGL9. RVGL7 contains nucleic acid
encoding EGFP and lacZ, and includes pE/L and p7.5 regulator
regions inserted into the TK gene.
[0495] Luminescence and Fluorescence Images of Tumors in a Nude
Mouse
[0496] Human breast GI-101A cancer cells (5.times.10.sup.6
cells/mouse) were subcutaneously implanted into the right thigh of
the mice. Thirty days after cell implantation RVGL9, the NotI
(F3)-interrupted virus expressing a fusion of Renilla luciferase
and green fluorescence protein (RVGL9=rVV-RG=rVVruc-gfp) was
injected intravenously via tail vein at a dose of 1.times.10.sup.7
PFU/mouse. A fluorescence image of GFP and low-light image of
luciferase expression were taken nine days after virus injection,
i.e. 39 days post cell implantation showing dissemination of the
virus.
[0497] Reduction of Human Breast Tumor Implanted into Nude Mice by
Vaccinia Viruses RVGL7 or RVGL9
[0498] Human breast GI-101A cancer cells (5.times.10.sup.6
cells/mouse) were subcutaneously implanted into the right thigh of
the mice. Mice were injected i.v. with RVGL7=rVV-GFT=TK- or
RVGL9-rVV-ruc-gfp=NotI (3)-interrupted viruses (1.times.10.sup.7
PFU/mouse in 0.1 ml) and PBS control on day 30 after cell
implantation. Images were taken on day 65 after GI-101A cell
implantation and 35 days after virus or PBS injection. The results
demonstrate drastic reduction of tumor volume in the mice injected
with TK- or NotI (F3)-interrupted vaccinia viruses compared with
the tumor in the mice injected with PBS.
[0499] GFP in Human Breast Tumor After Viral Administration
[0500] Human breast GI-101A cancer cells (5.times.10.sup.6
cells/mouse) were subcutaneously implanted into the right thigh of
the mice. Mice were injected i.v. with RVGL7=rVV-GFP=TK- or
RVGL9=rVV-RG-rVV-ruc-gfp-NotI (F3)-interrupted viruses
(1.times.10.sup.7 PFU/mouse in 0.1 ml) on day 30 after cell
implantation. The data demonstrate GFP expression in tumor area in
the mice injected with TK.sup.- or NotI (F3)-interrupted vaccinia
viruses. No GFP signals were observed in other parts of the mice
bodies. The results also showed that expression of GFP can be
visualized as early as 48 h after virus injection through the tail
vein. On day 16 after virus injection very strong signals of GFP
which correspond to a tumor volume of about 1300-1620 mm.sup.3 for
TK- or NotI (F3)-interrupted virus, respectively were observed.
Reduced GFP signals were observed on day 25 (1218-1277 mm.sup.3 for
TK- or NotI (F3)-interrupted virus, respectively) and 32 (514-887
mm.sup.3 for TK- or NotI (F3)-interrupted virus, respectively) due
to reduction of tumor volume.
Time Course of Breast Tumor Volume Over Time
[0501] G1-101A breast cancer cells were implanted subcutaneously
into the right thigh of 4-5-week old female athymic (nu/nu) mice in
the dose of 5.times.10.sup.6 cells/mouse. Thirty days after tumor
implantation, when the tumor reached about 500 mm.sup.3 in volume,
a single dose (1.times.10.sup.7 PFU/mouse in 0.1 ml) of
RVGL7=rVV-GFP=TK- or RVGL9=rVV-RG=rVV-ruc-gfp=NotI (F3)-interrupted
vaccinia viruses or PBS control was injected intravenously (via
tail vein). Tumor dimensions were measured with vernier caliper
twice a week and volumes were calculated as (L.times.H.times.W)/2,
where L, H and W represent the length, width, and height of the
tumor, respectively and expressed in mm.sup.3. The data demonstrate
significant (60-80% on day 65) tumor reduction in the mice injected
with TK-, NotI (F3)-interrupted vaccinia viruses. In contrast,
tumors grew very rapidly in the mice injected with PBS.
Monitoring of Tumor Regression by Light Extinction.
[0502] Subcutaneous GI-101A breast tumor reduction occurred in 100%
of immunocompromised mice treated with a single i.v. injection of
wt LIVP, single F3-, single TK-, and double F3-, TK-, mutants of
LIVP strain. Some degree of toxicity was seen in the mice treated
with the above viruses. RVGL21 virus with the triple deletions TK,
F3 and HA genes which showed no toxicity in nude mice; hence this
virus was used for long-term studies. The difference in antitumor
activity and survival between high and low doses of treatment using
the triple mutant RVGL21 virus was not significant. GFP expression
in tumor area in the mice injected with RVGL21 was monitored. No
GFP signals were observed in other parts of the mice bodies.
Expression of GFP can be visualized as early as 48 h after virus
injection through the tail vein. On day 16 after virus injection we
observed very strong signals of GFP, which corresponded to tumor
volume of about 1300-1620 mm.sup.3 and reduced GFP signals on days
25 (1218-1277 mm.sup.3) and 32 (514-887 mm.sup.3) due to reduction
of tumor volume. Tumor volume reduction also was apparent by visual
inspection of the mice.
Example 5
Reduction of Vaccinia Virus Toxicity and Virulence
[0503] Reduction of Vaccinia Virus Pathogenicity by Monitoring
Mouse Body Weight and Survival
[0504] The percentage of body weight change in athymic and
immunocompetent mice bearing different s.c. tumors after i.v.
administration of the viruses was examined. Injection of wt LIVP
and wt WR and some mutants at the dose of 10.sup.7 pfu/mouse via
the tail vein led to a progressive vaccinia virus infection within
a two week observation period. At one week after challenge, the
mice showed typical blister formation on the tail and footpad.
Later, weight loss, sometimes accompanied by swelling of the mouth
region, in several cases led to death of the mice. In the case of
wt WR strain of VV, mice started to die on day 7 after i.v.
injection of virus. While mice receiving the recombinant LIVP
viruses gained weight or remained the same weight over the same
time period.
[0505] Body Weight in Glioma Model Nude Mice
[0506] Rat glioma C6 cells at the dose of 5.times.10.sup.5/0.1
ml/mouse were implanted s.c. into the right thigh of nude mice (5-6
old male mice) on day 0. Vaccinia viruses were injected i.v. (via
tail vein) at the dose of 1.times.10.sup.7 PFU/0.1 ml/mouse on day
7. Animals were weighed twice a week. Gain/loss of body weight on
day 14 post infection was calculated as the percentage: body
weight-tumor weight on day of virus injection (g)/body weight-tumor
weight on day 14 (g).times.100%. Injection of VGL (wild type
vaccinia virus, strain LIVP) and RVGL5 (HindIII-N-interrupted)
causes toxicity in nude mice: mice continue to lose the weight.
Recombinant vaccinia viruses RVGL5 (HA-interrupted), RVGL7
(TK-interrupted), RVGL8 (NotI(F3)-interrupted), RVGL19 (double, TK-
and NotI (F3)-interrupted) were less toxic in nude mice: after
losing some body weight, 10 days post-infection, mice started to
gain the body weight.
[0507] Nude mice with glioma that were injected with wild type WR
strain of VV lost 31.9% of body weight on day 7 after virus
injection. Mice injected with TK-virus of WR strain lost 22.4% of
body weight on day 14 after virus injection compared to 1.5% in the
group of mice injected with TK-virus of LIVP strain of VV. All mice
injected with wild type LIVP strain survived for at least 14 days
(the duration of the experiment). Mice without tumor injected with
VGL (wt UV, strain LIVP) lost 11.23% of body weight. Mice bearing
tumor injected with VGL (wt VV) or with RVGL1
(HindIII-N-interrupted) lost 15.79% and 10.18% of body weight,
respectively. Mice in the wt LIVP group lost 15.8% of body weight
versus 9.4% in the PBS injected group. Tumor-bearing mice injected
with RVGL2 (TK-), RVGL5 (HA-), RVGL7 (TK-), RVGL8 (F3-), RVGL9
(F3-), RVGL20 (TK-, F3-), RVGL21 (TK-, F3-, HA-) on day 14 after
virus injection lost only 1.5%, 0.4%, 2.1%, 5.0%, 7.3%, 2.4%, and
3.2% of body weight, respectively. Tumor-bearing mice injected with
virus carrying double gene interruption, RVGL19 (TK- and F3-)
demonstrated 0.73% gain of body weight compared to the body weight
on day 0. Based on the results of body weight, a single
interruption of HA, TK, F3 (NotI site) and double interruption of
TK, F3 (NotI site) genes in vaccinia virus genome reduces virulence
and toxicity of the vaccinia virus strain LIVP.
[0508] Injection of wt VV strain WR, however, was extremely toxic
to nude mice, which died on day 7 after virus injection. Wild type
and mutant VVs of strain LIVP were less toxic in nude mice.
Although nude mice injected with various LIVP strains lost some
body weight, after day 10-post infection mice started to gain the
body weight.
[0509] Body Weight in Breast Tumor Model Athymic Mice
[0510] The body weight change of athymic mice with s.c. GI-101A
human breast tumor after i.v. injection of vaccinia viruses was
monitored. Mice injected with wt WR strain lost 25.6% of body
weight and died due to virus toxicity. Although mice injected with
wt LIVP virus survived for longer time, mice lost 26.4% of body
weight. Mice injected with TK-WR strain lost 17.8% of body weight,
while mice injected with TK-LIVP virus gained 1.9% of body weight.
All mice injected with other mutants of LIVP strain were stable; no
virus related toxicity was observed in these mice.
[0511] Body Weight in Melanoma Model Immunocompetent Mice
[0512] The toxicity of the vaccinia viruses in immunocompetent
C57BL/6 mice bearing mouse B16-F10 melanoma on their foot pad was
studied. Although mice in all groups survived during the
experiment, wt WR strain was more toxic in immunocompetent mice
compared to wt LIVP and recombinant strains. Mice injected with wt
WR strain lost about 11.4% of body weight on day 10 after i.v.
injection of virus, while mice injected with wt LIVP strain and its
double (RVGL20) and triple (RVGL21) mutants lost only 2.2%, 1.3%,
and 0.6% of body weight, respectively, versus to 7.1% of body
weight lost in PBS injected mice. Mice administered i.v. with RVGL2
(TK-), RVGL5 (HA-), RVGL9 (F3-), and RVGL23 (TK-WR strain)
continued to gain weight over this same period.
[0513] Long-Term Survival After Viral Infection for Breast
Tumor-Bearing Mice
[0514] To examine the effect of different mutations on long-term
survival, mice bearing s.c. GI-101A human breast tumor received
doses of 10.sup.7 virus i.v., and were observed for survival after
viral infection. The results showed that there are differences in
survival depending upon the virus injected. Injection of the nude
mice bearing s.c. breast tumor with wt WR strain (i.v.,
1.times.10.sup.7/mouse) resulted in 100% mortality: four mice of
five died on day 9 and one mouse died on day 11 after virus
injection. Mice injected with strain LIVP survived for 35 days.
Mice injected with a single mutated virus RVGL9 (F3-) developed the
toxicity and 25% of mice died on day 34 after virus injection,
however the deletion of F3 gene in LIVP strain prolonged the
survival of mice up to 57-days. Mice injected with double mutant
virus RVGL20 (F3-, TK-) began to die on day 34 after virus
injection, but survived longer than F3-injected mice. The RVGL20
virus injected mice reached 50% survival point on day 65 and showed
significantly longer survival time up to 116 days. The single
mutant TK-virus of LIVP virus was less pathogenic than the single
mutant F3-or double mutant F3-, TK-viruses; all mice were alive on
day 80 after injection with TK-virus and 14.3% of the mice survived
130 days. All mice injected with the triple mutant TK-, F3-, and
HA-virus (RVGL21) survived 130 days (duration of the experiment)
and continued to live without any signs of virus toxicity compared
to other groups of mice.
[0515] Splenomegaly in Various Mice
[0516] Immunocompetent C57BL/6 Mice
[0517] Several groups of the animals demonstrated enlargement of
the spleen; therefore the relative spleen weight (RSW) was
calculated. The results are shown in Table 2 as follows:
TABLE-US-00005 TABLE 2 Relative spleen weight (RSW) in mice with or
without tumors. Breast Glioma model cancer model Melanoma model
Groups nu/nu mice nu/nu mice C57BL/6 mice No tumor, PBS 43.6 .+-.
4.1.sup.a 50.5 .+-. 11.2.sup.d 30.1 .+-. 2.8.sup.g No tumor, LIVP
67.2 .+-. 11.9 48.0 .+-. 13.1 68.1 .+-. 9.4 Tumor, PBS 92.4 .+-.
7.4.sup.b 84.1 .+-. 14.6.sup.e 106.0 .+-. 46.1.sup.h LIVP 98.2 .+-.
28.2.sup.c 108.4 .+-. 39.4.sup.f 148.4 .+-. 44.8.sup.i RVGL2 96.0
.+-. 34.9 112.7 .+-. 15.6 51.9 .+-. 6.6 RVGL5 143.8 .+-. 20.5 169.6
.+-. 31.7 61.6 .+-. 2.9 RVGL9 73.9 .+-. 10.5 151.8 .+-. 27.9 63.3
.+-. 34.9 RVGL20 84.9 .+-. 6.6 159.9 .+-. 22.7 106.7 .+-. 36.0
RVGL21 114.4 .+-. 12.5 117.7 .+-. 15.3 63.0 .+-. 24.6 WR 37.3 .+-.
3.5 57.9 .+-. 10.9 70.5 .+-. 1.8 RVGL23 46.9 .+-. 15.7 73.1 .+-.
19.3 97.0 .+-. 43.9 Mean .+-. SD for n = 4-8 mice/group. RSW =
weight of spleen (g) .times. 10.sup.4/(animal body weight (g) -
tumor weight (g)). .sup.ap .ltoreq. 02.02 vs. all groups, except no
tumor LIVP, WR, RVGL23 .sup.bp .ltoreq. 0.039 vs. no tumor PBS, no
tumor LIVP, RVGL5, WR, RVGL23 .sup.cp .ltoreq. 0.046 vs. all
groups, except PBS, RVGL2, RVGL20, RVGL21 .sup.dp .ltoreq. 0.006
vs. all groups except no tumor LIVP, PBS, WR, RVGL23 .sup.ep
.ltoreq. 0.048 vs. all groups, except no tumor PBS, LIVP, RVGL2,
WR, RVGL23 .sup.fp .ltoreq. 0.045 vs. all groups, except PBS,
RVGL2, RVGL21 .sup.gp .ltoreq. 0.035 vs.PBS, LIVP, RVGL20, WR,
RVGL23 .sup.hp .ltoreq. 0.049 vs. all other groups, except no tumor
LIVP, RVGL20, WR, RVGL23 .sup.ip .ltoreq. 0.049 vs. all other
groups.
As shown in the Table 2 above, some degree of splenomegaly was
observed in mice. For immunocompetent C57BL/6 mice, a statistically
significant difference (p<0.035) was found in tumorous mice
injected with PBS, LIVP, RVGL20, WR and RVG123 compared to
non-tumorous mice. In mice injected with wt VV strain LIVP spleen
was enlarged greatly (p<0.049) versus all other groups. In
contrast, the smallest spleens were found in the mice without
tumor.
[0518] Nude Mice with a Glioma Tumor
[0519] In nude mice with or without s.c. glioma tumor, mice
injected with wt WR or TK- of WR virus had the lowest RSW 37.3 or
46.9, respectively, which was similar to the RSW from the mice
without tumor and injected with PBS (43.6). The largest RSW 143.8
and 114.4 was observed in RVGL5 (HA-) and RVGL21 (TK-, F3-, HA-)
groups, respectively. No statistically significant difference was
found among the groups of mice injected with wt LIVP, RVGL2, RVGL9,
RVGL20 versus the PBS injected group.
[0520] Nude Mice with Breast Tumor
[0521] The results of RSW in the immunocompromised mice bearing s.c
human breast tumor indicate that all mice injected with wt LIVP and
its mutants have an enlarged spleen compared to the mice injected
with wt WR or TK-WR viruses (p<0.045). The largest spleen was
found in the mice injected with single HA-, single F3-, double F3-,
TK-mutants of LIVP strain.
[0522] Other Results Using RVGL21 for Injection
[0523] Two mice, #437 and #458, survived more then 190 days after
RVGL21 injection (10.sup.7 and 4.times.10.sup.5, respectively,
i.v.) without any signs of diseases or virus related
toxicities.
[0524] On day 30 after GI-101A cell implantation (tumor
volume=594.9 mm.sup.3), 10.sup.7 of RVGL21 was injected i.v. into
mouse #437. On day 101 after virus injection (s.c. tumor size=220.4
mm.sup.3), metastasis (hard tissue) in chest area under the skin
was observed. The size of the tumor was 1223.6 mm.sup.3, which
disappeared by day 148. The s.c. tumor did not disappear, it
started to grow back, but the mouse remained metastasis-free.
[0525] Mouse #458 had a first s.c. tumor (GI-101A) on the right
hind quarter. When the first tumor started to shrink (day 29 after
RVGL21 virus injection, tumor size=1924.3 mm.sup.3), a second
syngeneic tumor was implanted s.c. on the left hind quarter. The
second tumor grew slowly, reached the size of 1205.7 mm.sup.3 and
started to shrink. The mouse was free of the first tumor on day 127
post virus injection; the size of the second tumor was 439.6
mm.sup.3. The tumor continued to shrink and the cells died. The
body gradually absorbed remaining tumor tissues that were
contributed by the host (such as the tumor vascular skeleton that
was coming from the host). Since these remains are not considered
foreign, the immune system doesn't destroy them. The tumor cells,
on the other hand, were long gone and cleared by the immune system
and the virus. Reduction of the second syngeneic tumor demonstrates
that this mouse developed antibodies against the tumor cells. The
antibodies resulted in the reduction of the second syngeneic
tumor.
Example 6
Use of a Microorganism or Cell to Induce Autoimmunization of an
Organism Against a Tumor
[0526] This example shows that the method provided herein and in
priority application EP 03 018 478.2 relating to "The production of
a polypeptide, RNA or other compound in a tumor tissue" also can be
used for the production of antibodies against the tumor tissue.
These antibodies provide for autoimmunization of the organism
bearing the tumor. Furthermore, these antibodies can be isolated
and used for the treatment of tumors in other organisms.
[0527] Methods and uses of microorganisms, including cells, which
can contain DNA encoding a desired polypeptide or RNA, to induce
autoimmunization of an organism against a tumor are provided. Also
provided are methods for the production of antibodies against a
tumor by: (a) injecting a microorganism, such as a virus or cell,
optionally containing a DNA sequence encoding a desired polypeptide
or RNA, into an organism bearing a tumor and (b) isolating
antibodies against the tumor.
[0528] This Example further demonstrates that administration of
microorganisms, such as the triple mutant vaccinia virus strain
provided herein, which accumulate in tumors, causing them to
release tumor antigens for a sufficient time to permit production
of antibodies by the host. This is exemplified by showing a
reduction and elimination of xenogeneic GI-101A solid breast
carcinoma tumors and their metastases in nu-/nu- mice (T cell
deficient mice). [0529] Step#1: Female nu-/nu- mice of 5 weeks age
were chosen, and the GI-101A cells grown in RPMI1640 medium,
supplemented with estrogen and progesterone. The confluence was
reached, cells were harvested, washed with phosphate buffered
saline. Cells (5.times.10.sup.6 cells per mouse) were then injected
subcutaneously into mice. The tumor growth was carefully monitored
every two days. [0530] Step#2: At two stages of tumor growth (at
tumor size of 400-600 mm.sup.3, and at tumor size of .about.1700
mm.sup.3), purified vaccinia viral particles (RVGL12) were
delivered to each tumorous mice by intravenous injection through
tail vein. The colony purified virus was amplified in CV-1 cell
line and the intracellular viral particles were purified by
centrifugation in sucrose gradient. Two concentrations of virus
(10.sup.6 .mu.l/100 .mu.l and 10.sup.7 pfu/100 .mu.l resuspended in
PBS solution) were injected. The viral replication was monitored
externally by visualization of virus-mediated green fluorescence
protein expression. The tumor development was monitored by tumor
volume determination with a digital caliper.
[0531] Vaccinia viruses RVGL12+GCV(gancyclovir), and RVGL12 (RVGL12
is the same as RVGL7, except that the nucleic acid encoding gfp is
replaced by herpes simplex virus thymidine kinase (HSV TK; see, SEQ
ID NOS: 35 and 36) were injected 67 days after GI-101A cellular
implantation. A second administration referred to as RVGL12a, was
injected 30 days after cellular implantation. [0532] Step#3: After
viral administration, it was determined that first the tumors
continued to grow to a size of .about.900 mm.sup.3 (from 400-600
mm.sup.3 at the time of viral injection), and to a size of
.about.2400 mm3 (from 1700 mm.sup.3). Then the growth rate leveled
off for approximately 6-8 days. [0533] Step#4: Approximately 14
days after viral injection, the tumor volume started to decline
rapidly. Forty days after viral application, all the treated
animals showed more than 60% tumor regression. Sixty-five days
after viral treatment and many of the animals had complete
regression of tumors. [0534] Step#5: Some of the animals were
completely tumor-free for several weeks and their body weight
returned to normal. RVGL-12+GCV treatment resulted in 86.3%
reduction of tumor size (Day 52 after viral injection) from their
peak volumes on Day 13, RVGL-12 treatment resulted in 84.5%
reduction of tumor size (Day 52) from their peak volumes (Day 13).
RVGL-12a treatment resulted in 98.3% reduction of tumor size (Day
89) from their peak volumes (Day 12). After PBS+GCV control
treatment, the average volume of tumors were increased by 91.8% in
38 days [0535] Step#6: The level of immune activation was
determined. Sera were obtained from the animals with regressing
tumors and the immune titer determined against a foreign protein
(e.g. green fluorescent protein), vaccinia viral proteins, and
GI-101A cancer cell proteins were determined. The following
antisera obtained from the following sources were used to analyze
the following listed samples. Samples: [0536] 1). Mouse cell lysate
(control); [0537] 2). Purified and denatured vaccinia viral
particles; [0538] 3). GI-101A tumor cell lysate; [0539] 4).
Purified green fluorescent protein; [0540] 5). Purified luciferase
protein; [0541] 6). Purified beta-galactosidase protein. Antisera:
[0542] a). Antiserum from nontumorous mouse; [0543] b). Antiserum
from GI-101A tumorous mouse; [0544] c). Antiserum from GI-101A
tumorous mouse 14 days after vaccinia i.v. injection; [0545] d).
Antiserum from GI-101A tumorous mouse 65 days after vaccinia i.v.
injection; [0546] e). Antiserum from tumor-free mouse (after
elimination of GI-101A tumor) 80 days after vaccinia i.v.
injection.
[0547] The results showed that there was enormous tumor-specific
vaccinia virus replication in the tumors, which led to tumor
protein antigen and viral protein production in the tumors. In
addition, the vaccinia virus did lyse the infected tumor cells
thereby releasing tumor-cell-specific antigens. The continuous
leakage of these antigens into the body led to a very high level of
antibody titer (in approximately 7-14 days) against foreign cell
proteins (tumor proteins), viral proteins, and the virus encoded
engineered proteins in the mouse body. The newly synthesized
antitumor antibodies and the enhanced macrophages, neutrophils
counts were continuously delivered via the vasculature into the
tumor and thereby providing for the recruitment of an activated
immune system in the inside of the tumor. The active immune system
then eliminated the tumor including the viral particles. This
interconnected release of foreign antigens boosted antibody
production and continuous return of the antibodies against the
tumor-contained proteins function as an autoimmunization
vaccination system, initiated by vaccinia viral replication,
followed by cell lyses, protein leakage and enhanced antibody
production.
Example 7
Production of .beta.-Galactosidase and Anti .beta.-Galactosidase
via Vaccinia Virus Delivered lacZ in Tumor Bearing Mice
[0548] Thirty five athymic nu/nu mice (5 weeks old, 25 g, male)
were used to demonstrate the biodistribution and tumor targeting of
vaccinia virus (strain LIVP) with different deletions in the
genome. Mice were divided into 7 groups with 5 in each group as
presented in Table 1 TABLE-US-00006 No. Group mice Tumor implanted
Virus Injected Insertion locus 1 5 None VGL wtLIVP 2 5 C6, s.c. 5
.times. 10.sup.5 cells VGL wtLIVP 3 5 C6, s.c. 5 .times. 10.sup.5
cells RVGL1 N-luc, lacZ 4 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL5
HA-lacZ 5 5 C6, s.c. 5 .times. 10.sup.5 cells RVGL7 TK-egfp, lacZ 6
5 C6, s.c. 5 .times. 10.sup.5 cells RVGL8 NotI-lacZ 7 5 C6, s.c. 5
.times. 10.sup.5 cells RVGL19 TK-rTrf, lacZ, NotI-RG
C6 gliomas were subcutaneously developed in Groups 2 to 7. Five
days after tumor cell implantation (5.times.10.sup.5 cells/mouse),
each animal was treated with 0.1 ml of virus at a multiplicity of
infection (MOI) of 1.times.10.sup.7 via tail vein injection. Two
weeks after virus injection, all mice were sacrificed and blood
samples were collected. Various organs and tumors also were taken
from animals for virus titer and .beta.-galactosidase analysis.
[0549] The .beta.-galactosidase analysis was performed using the
Galacto-Light Plus system (Applied Biosystems), a chemiluminescent
reporter gene assay system for the detection of
.beta.-galactosidase, according to the manufacturer's
instructions.
.beta.-Galactosidase Expression Measurements
[0550] In non-tumorous mice as well as in tumorous mice injected
with wild type vaccinia virus (without reporter genes and without
.beta.-galactosidase gene) no .beta.-galactosidase expression was
detected in organs, blood and tumor samples. By contrast, in the
tumors of mice infected with .beta.-galactosidase expressing virus,
high levels of .beta.-galactosidase was expressed.
.beta.-galactosidase also was detected in blood samples as shown in
Table 3, but no virus was recovered from blood samples.
TABLE-US-00007 TABLE 3 Production of .beta. galactosidase by
vaccinia virus in tumor and blood from tumor bearing mice (day 14
after virus injection) .beta.-gal in tumor Est. total .beta.- Est.
total .beta.- Virus .mu.g/mg of total .beta.-gal in serum gal/tumor
gal/5 ml Group Injected protein .mu.g/ml of total protein (.mu.g)
blood (.mu.g) 3 RVGL1 1.59 .+-. 0.41 1.38 .times. 10.sup.-2 .+-.
1.09 .times. 10.sup.-2 489.84 4.00 4 RVGL5 1.51 .+-. 0.37 1.16
.times. 10.sup.-2 .+-. 1.08 .times. 10.sup.-2 330.21 3.62 5 RVGL7
1.35 .+-. 0.59 0.95 .times. 10.sup.-2 .+-. 1.47 .times. 10.sup.-2
616.60 1.83 6 RVGL8 1.81 .+-. 0.42 0.86 .times. 10.sup.-2 .+-. 0.33
.times. 10.sup.-2 962.36 2.38 7 RVGL19 1.30 .+-. 0.44 0.26 .times.
10.sup.-2 .+-. 0.16 .times. 10.sup.-2 463.75 0.60
Anti-.beta.-Galactosidase Antibody Production
[0551] To determine whether the amount of .beta.-galactosidase
presented in mouse blood was sufficient to elicit antibody
production, sera taken from two mice (mouse #116 from Group 5, and
#119 from Group 6) were collected and tested for primary antibodies
against .beta.-galactosidase in Western analysis.
.beta.-galactosidase from E. coli (Roche, 567 779) was used as the
antigen standard, and the mouse monoclonal anti
.beta.-galactosidase from E. coli (Sigma, G6282) was used as the
antibody positive control. As additional sources of
.beta.-galactosidase, total protein was obtained from CV-1 cells 24
hours after infection with RVGL7 at MOI of 1 pfu/cell, and the
tumor protein sample from mouse designated #143 (treated with
RVGL7) was obtained.
[0552] The protein samples were prepared in triplicate, each set
including a .beta.-galactosidase antigen control, a cell lysate
from RVGL7 infected CV-1 cells, and tumor lysate from mouse #143.
All protein samples were separated by electrophoresis using a 10%
polyacrylamide gel, and transferred to NitroBind nitrocellulose
membrane (MSI) using a BioRad semidry blotting system.
Immunoblotting was performed with either 1:3000 mouse monoclonal
anti .beta.-galactosidase, or 1:3000 mouse serum taken from either
mouse #116 or #119, and 1:3000 Goat AntiMouse IgG-HRP (BioRad). An
Amplified Opti-4CN Detection Kit (BioRad) was used for
detection.
[0553] The results showed that sera taken from mouse #116 and #119
exhibited similar levels of antibody when compared to a commercial
mouse anti-.beta.-galactosidase standard, and demonstrated that the
tumor bearing mice #116 and #119 produced antibodies against
.beta.-galactosidase.
Example 8
Mammalian Cells for Tumor Therapy
[0554] As shown herein, certain bacteria, viruses, and mammalian
cells (BVMC), when administered systemically, again enter and
selectively replicate in tumors Hence, systemically injected
mammalian cells and certain bacterial (anaerobic bacteria, such as
Salmonella, Clostridium sp., Vibrio, E. coli) cells gain entry into
solid tumors and replicate in tumor-bearing organisms.
Genetically-labeled cells can be used for tumor detection and
therapy. In addition to gene expression in tumors through BVMC
targeting, tumor-specific gene expression can be achieved by
linking transgenes to tissue/tumor-specific promoters. To obtain
tumor specific gene expression, a variety of systemic targeting
schemes can be employed. These strategies include the use of
tissue/tumor-specific promoters that allow the activation of gene
expression only in specific organs, such as prostate-specific
promoter-directed viral gene expression; the use of extracellular
matrix (i.e. collagen)-targeted viral vectors; and the use of
antibody-directed viral vectors. Conditionally-replicating viruses
have also been explored as tumor-specific delivery vehicles for
marker genes or therapeutic genes, such as oncolytic adenovirus
vector particles, replication-selective HSV, vaccinia viruses and
other such viruses.
[0555] When light-emitting protein encoded BVMC are injected
systemically into rodents, tumor-specific marker gene expression is
achieved and is detected in real time based on light emission.
Consequently, the locations of primary tumors and previously
unknown metastases in animals are revealed in vivo. Hence diagnosis
can be coupled to therapy and to monitoring of therapy. The
impaired lymphatic system in tumors may be responsible for the lack
of clearance of bacteria from tumors by the host immunosurveillance
after escaping the vascular system.
Example 9
Tumor Development is Inhibited Following S. pyogenes
Administration
[0556] This Example and following examples demonstrate the use of
bacterial cells to colonize tumors, use of reporter in the cells to
quantitate colonization; use of the colonized attenuated bacterial
cells for tumor inhibition. Co-administration-or sequential
administration of bacteria and viruses. Admistration of virus
before bacteria increase tumor colonization by the bacteria.
Administer bacteria that expresses an enzyme that will activate a
prodrug, thereby targeting colonized cells.
Bacterial Strains
[0557] Streptococcus pyogenes M-type 1 T-type 1 (ATCC catalog no.
700294) was transformed with pDC123-luxF plasmid) that contains the
bacterial luciferase expression cassette (Lamberton G R, Pereau M
J, Illes K, Kelly I L, Chrisler J, Childers B J, Oberg K C, Szalay
A A. 2002. Construction and characterization of a bioluminescent
Streptococcus pyogenes. Proceedings of the 12th International
Symposium on Bioluminescence and Chemiluminescence, Case J F,
Herring P J, Robison B H, Haddock S H D, Kricka L J, Stanley P E
(eds). Chichester: Wiley, pp 85-88. Luciferase can be detected in
the presence of exogenous decanal.
[0558] Transformed S. pyogenes were grown overnight in BH1 media in
the presence of 20 .mu.g/ml of chloramphenicol at 37.degree. C.
After overnight growth, the bacteria were counted at OD.sub.600 and
bacteria were resuspended in BH1 media at the indicated density for
injection.
Tumor Development and Bacterial Injection
[0559] Twenty 5-week old mice were injected subcutaneously in the
right lateral thigh. Each mouse was injected with 5.times.10.sup.5
C6 glioma cells transformed with pLEIN-derived retrovirus
(Clontech; see also WO 03/14380). The subcutaneous tumors were
developed for 7 days after implantation before bacterial
injection.
[0560] For bacterial injection, the tumor-bearing mice were
anesthetized with isofluorane. The suspensions were injected
intravenously with a 1-cc insulin syringe equipped with a
291/2-gauge needle through a surgically exposed femoral vein. After
the injections, the incisions were sutured.
[0561] Tumor growth was monitored twice a week following bacterial
injection using a digital caliper. In addition, fluorescence
imaging and photographic images of the animals were taken at the
end time points. The presence of luminescent bacteria was analyzed
by intravenously injecting the animals with 30 .mu.l of decanal.
Analysis of whole animals for bacterial luciferase activity,
followed methods similar to Yu et al. (2004) Nature Biotechnology
22(3): 313-20. Briefly, anesthetized animals were placed inside the
dark box for photon counting (ARGUS 100 low light Imager,
Hamamatsu). Photon collection was for 1 minute from ventral and
dorsal sides of the animal and the images were recorded with Image
Pro Plus 3.1 software (Media Cybernetics) and/or Lighttools.RTM.
macroimaging system. A light image also was recorded. The
luminescent images were superimposed on the light image to localize
the luminescent activity on the animal. Total intensity of photon
emission in localized regions, e.g. in the tumor region, also was
recorded. S. pyogenes was isolated from removed tumors and ground
tissue was plated on LB-chloramphenicol (20 .mu.g/ml) plates.
Luminescent bacteria were counted in the presence of decanal
vapor.
Results
[0562] Four groups of mice were tested. Each group contained five
mice. TABLE-US-00008 Group S. Pyogenes 1 None 2 1 .times. 10.sup.6
3 1 .times. 10.sup.7 4 5 .times. 10.sup.7
Tumor volume was measured after 7 days of tumor development and the
injection of S. pyogenes, through 21 days post-tumor
development.
[0563] The control group of mice with no S. pyogenes had continuous
and accelerating tumor growth over the 2-week period. The mice
injected with S. pyogenes had slower tumor growth. Groups 3 and 4
had the slowest tumor growth rates. Both groups maintained a slower
linear rate throughout the monitoring period, whereas the control
group, not injected with bacteria, exhibited tumor growth that
accelerated at later time periods.
[0564] At all time points following bacterial injection, tumor
volumes were smaller in Groups 3 and 4 mice than in the control
mice (Group 1). At day 21, the average tumor volume of the control
group was approximately 2.5-3 fold greater than the average tumor
volumes in Groups 3 and 4. Group 2, injected with the lowest titer
of bacteria, also had a reduced tumor volume from the control group
at the later time points, although the tumor volume was larger than
Groups 3 and 4.
[0565] Bacterial colonization and tumor inhibition also is assayed
in a fibrosarcoma model. HT1080 fibrosarcoma cells transformed with
the pLEIN retrovirus are injected subcutaneously into the right
lateral thigh of five week old nude male mice 5.times.10.sup.5
cells/mouse). S. pyogenes transformed with pDC123-luxF is injected
into the femoral vein of the animals after 8 or 14 days of tumor
growth (5 animals on each day). A group of 5 animals are not
injected as serve as a control group. Tumor growth and luciferase
activity is monitored at subsequent time points. S. pyogenes is
isolated from tumors and cultured on BH1+chloramphenicol (20
.mu.g/ml) plates. Luminescent bacterial colonies are counted in the
presence of decanal vapor.
Example 10
Vibrio Cholera Localization to Tumors
Plasmids and Bacterial Strains
[0566] Attenuated Vibrio Cholerae, strain Bengal 2 serotype 0139,
M010 DattRS1, was transformed with pLITE201 which contains the
luxCDABE cassette (Voisey et al. (1998) Biotechniques 24:56-58).
The transformed strain is a light emitting strain due to the
expression of the luciferase genes.
Tumor Development and Bacterial Injection
[0567] Groups of nude mice (n>20) were implanted with C6 glioma
tumors (500 mm.sup.3) as described in the Examples herein.
1.times.10.sup.8 transformed bacteria (V. Cholerae) were suspended
in 100 .mu.l of phosphate buffered saline (PBS). The bacterial
suspension was injected into the right hind leg of each mouse. The
animals were then monitored after injection under a low light
imager as described in Example 3.
[0568] In a separate experiment, for comparison, groups of nude
mice (n>20) were implanted with C6 glioma tumors (500 mm.sup.3)
as described in the Examples herein. These mice were injected with
1.times.10.sup.8 pfu/mouse of rVV-RUC-GFP (RVGL9) virus (see
Example 1).
Results
[0569] Titer and Luciferase Activity
[0570] Mice from each of the two injected groups were sacrificed at
time points after injection. Tumors were excised and homogenized.
Bacterial and viral titers and luciferase activities were measured
as described in the Examples herein.
[0571] Both bacterial and viral titer increased following
injection. The increase in bacterial growth over time was
proportional to luciferase levels in the tumors. A log-log plot of
bacterial titer versus luciferase activity in tumors in the mice
injected with V. cholera demonstrated a linear relationship between
bacterial titer and luciferase activity. The groups of mice
injected with rVV-RUC-GFP virus, also demonstrated a linear
relationship between virus titer and luciferase activity.
TABLE-US-00009 Time after V. Cholera/pLITE injection 4 hrs 8 hrs 16
hrs 32 hrs Bacterial Titer 3.79 .times. 10.sup.4 .+-. 2.93 3.14
.times. 10.sup.6 .+-. 2.45 1.08 .times. 10.sup.8 .+-. 1.3 5.97
.times. 10.sup.8 .+-. 4.26 (cfu/tumor) Time after rVV-ruc-gfp virus
injection 36 hrs Day 3 Day 5 Day 7 ViralTiter 3.26 .times. 10.sup.6
.+-. 3.86 7.22 .times. 10.sup.7 .+-. 3.67 1.17 .times. 10.sup.8
.+-. 0.76 3.77 .times. 10.sup.8 .+-. 1.95 (pfu/tumor)
The experiments demonstrated a linear relationship between titer
and luciferase activity. Thus, luciferase activity of the injected
bacteria and/or virus can be used a correlative measurement of
titer. Localization
[0572] Localization of V. cholera was performed as detailed in the
Examples herein for virus. Briefly, organs and blood samples were
isolated from animals euthanized with CO.sub.2 gas. The organs were
ground and plated on agar plates with chloramphenicol drug
selection for analysis of bacterial titer.
[0573] Bacterial titer was assayed in tumor, liver, testes, spleen,
kidney, lung, heart, bladder and brain of the injected mice.
Samples were taken from mice sacrificed at zero, and subsequent
times up to 150 hours following V. cholera injection.
[0574] At the time point immediately following injection (t-0), V.
cholera was present in all samples, with the highest levels in the
liver and spleen. By 50 hours post-injection, titer of V. cholera
in all tissues had reduced with the exception of tumor tissue. In
contrast, V. cholera titer had increased about 4 orders of
magnitude as compared to time zero. This level increased slightly
and then stayed constant throughout the remainder of the
experiment. By 150 hours post-infection, titer in all samples
except tumor had decreased. For example, the titer in liver had
decreased by approximately 5 orders of magnitude from the time zero
point. At the 150 hour point, the V. cholera titer in the tumor
tissue was about 6 orders of magnitude greater than any other
tissue sample.
Example 11
Co-Administration and Sequential Administration of Bacteria and
Virus
[0575] V. Cholera/pLITE (see Example 10) and vaccinia virus RVGL2
(see Example 1) were administered together or sequentially. Groups
of nude mice with C6 glioma tumors were injected with bacteria
and/or virus as shown in the Table below. Three male mice were
injected per group. Bacteria and/or virus were injected on day 11
and day 16 following tumor implantation. Tumor growth, luciferase
and GFP activity were monitored as described in the Examples
herein. TABLE-US-00010 Group Day 11 injection Day 16 injection 1 1
.times. 10.sup.7 VV-TK.sup.--gfp-lacZ 1 .times. 10.sup.7 V.
Cholera/pLITE 2 None 1 .times. 10.sup.7 V. Cholera/pLITE 3 1
.times. 10.sup.7 V. Cholera/pLITE 1 .times. 10.sup.7
VV-TK.sup.--gfp-lacZ 4 None 1 .times. 10.sup.7 VV-TK.sup.--gfp-lacZ
5 None 1 .times. 10.sup.7 VV-TK.sup.--gfp-lacZ and 1 .times.
10.sup.7 V. Cholera/pLITE
Results
[0576] On day 21 (21 days post tumor implantation) animals were
sacrificed. Tumors were excised from each animal and ground. Viral
titer was assayed on Groups 3, 4 and 5. Bacterial titer was assed
on Groups 1,2 and 5. Titers (colony forming units and plaque
forming units) were performed as previously described in the
Examples.
[0577] A comparison of the bacterial titer in tumors Groups 1, 2
and 5 demonstrated that bacterial titer was highest in Group 1 that
had been injected first with vaccinia virus at day 11, and followed
by V. cholera injection on day 16. Co-injection of bacteria and
virus at day 16 (Group 5) gave an intermediate bacterial titer.
Group 2, injected only with V. cholera at day 16, had a lower
bacterial titer in the tumor tissue than either of groups 1 or 5.
Thus, tumors were more susceptible to bacterial colonization when
first colonized by VV-TK.sup.--gfp-lacZ virus.
[0578] A comparison of the viral titer in Groups 3, 4 and 5
demonstrated that Group 4, with only virus injection at day 16, had
the highest viral titer followed by Groups 5 and 3. The viral titer
of Group 5 was slightly higher than Group 3, but not apparently
significantly different. One mouse in Group 4 had a viral titer
that was an extreme outlier in comparison to the viral titer of the
other 2 mice in Group 4. When the numbers were reassessed without
this mouse, the general trend remained the same. The average viral
titer in Group 4 was much closer to the viral titers of Groups 3
and 5. The data from the three groups in this analysis was not
significantly different. Thus, pre-administration of bacteria
followed by administration of virus did not significantly change
the viral colonization of the tumor as compared with viral
administration alone.
Example 12
[0579] Tumor Inhibition by Administering PNP-expressing bacteria
and prodrug Plasmids pSOD-DeoD contains the bacterial purine
nucleoside phosphorylase gene (PNP) (Sorcher et al. (1994) Gene
Ther. 1(4):223-238), under the control of the constitutive SOD
(superoxide dismutase) promoter. Plasmid pSOD-DeoD-lux, contains
the luxCDABE expression cassette (Voisey et al. (1998)
Biotechniques 24:56-58) inserted into pSOD-DeoD.
[0580] PNP converts the non-toxic prodrug 6-methylpurine
deoxyribose (6-MPDR) to 6-methyl purine which inhibits DNA
replication, transcription and translation (Sorcher et al. (1994)
GeneTher. 1(4):223-238).
Tumor Growth Inhibition
[0581] Nude mice were injected with pLEIN retrovirus transformed C6
glioma cells. The pLEIN retrovirus expresses EGFP under the control
of the viral promoter LTR (Clontech; see also WO 03/14380). E. coli
DH5.alpha. expressing the bacterial purine nucleoside phosphorylase
gene was injected at day 8 following tumor implantation with or
without prodrug (6-methylpurine deoxyribose (6-MPDR)). Tumor volume
was monitored at subsequent time points (as performed in previous
examples). TABLE-US-00011 Group Administered 1 E. coli/PNP +
prodrug 2 E. coli/PNP 3 E. coli control + prodrug
Groups 2 and 3 exhibited equal tumor growth over time points from 8
to 21 days post tumor implantation. Group 1, which received both
the E. coli expressing PNP and the prodrug exhibited .about.20%
reduction in tumor size as compared to the control Groups 2 and 3
at the end time points.
[0582] To further test bacterial colonization and prodrug effects
on tumor growth, a human breast cancer model, GI-101A
adenocarcinoma in nude mice, was chosen. GI-101A was derived from
GI-101. GI-101 originated from a local first recurrence of an
infiltrating duct adenocarcinoma (stage IIIa, T3N2MX) in a 57 year
old female patient by researchers at Rumbaugh-Goodwin Institute for
Cancer Research. In the subcutaneous xenograft nude mice model, the
tumor consistently metastasizes to the lungs. The GI-101A is a
slower growing tumor model as compared to the C6 glioma tumor
model.
[0583] Fifteen 4 week old female nude mice are each injected
subcutaneously in the right lateral thigh with GI-101A cells.
Thirty days after tumor development, bacteria are injected.
Escherichia coli DH5.alpha. is transformed with pSOD-DeoD or
pSOD-DeoD-lux. The bacteria are grown overnight in LB media in the
presence of 20 .mu.g/ml of chloramphenicol at 37.degree. C. After
overnight growth, the bacteria are counted at OD.sub.600 and
bacteria resuspended in BH1 media at the indicated density. The
suspensions are injected intravenously with a 1-cc insulin syringe
equipped with a 291/2-gauge needle into the animal through a
surgically exposed vein or as otherwise indicated. After the
injections, the incisions are sutured.
[0584] Prodrug is administered to groups of mice every four days
following injection of bacteria. Tumor growth is monitored twice
per week using a digital caliper. Luciferase imaging is performed
as described in the Examples herein. At the end point, the animal
are sacrificed and organs are assayed as described in Example 9.
Histological analyses are performed to determine the degree of
tumor necrosis due to bacterial colonization and/or drug
treatment.
[0585] Since modifications will be apparent to those of skill in
this art, it is intended that this invention be limited only by the
scope of the appended claims.
Sequence CWU 0
0
SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 36 <210>
SEQ ID NO 1 <211> LENGTH: 148 <212> TYPE: DNA
<213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: LIVP F3 <400> SEQUENCE: 1
aatatagcaa cagtagttct tgctcctcct tgattctagc atcctcttca ttattttctt
60 ctacgtacat aaacatgtcc aatacgttag acaacacacc gacgatggcg
gccgctacag 120 acacgaatat gactaaaccg atgaccat 148 <210> SEQ
ID NO 2 <211> LENGTH: 49 <212> TYPE: PRT <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Translation LIVP F3 <400> SEQUENCE: 2 Met
Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10
15 Gly Val Leu Ser Asn Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn
20 25 30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu
Leu Leu 35 40 45 Tyr <210> SEQ ID NO 3 <211> LENGTH: 27
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Forward primer
<400> SEQUENCE: 3 gggaattctt atacatcctg ttctatc 27
<210> SEQ ID NO 4 <211> LENGTH: 30 <212> TYPE:
DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:
<223> OTHER INFORMATION: Reverse primer <400> SEQUENCE:
4 ccaagcttat gaggagtatt gcggggctac 30 <210> SEQ ID NO 5
<211> LENGTH: 7252 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: psc65 <300> PUBLICATION INFORMATION:
<308> DATABASE ACCESSION NUMBER: GenBank No. AX003206
<309> DATABASE ENTRY DATE: 2000-08-24 <400> SEQUENCE: 5
agcttttgcg atcaataaat ggatcacaac cagtatctct taacgatgtt cttcgcagat
60 gatgattcat tttttaagta tttggctagt caagatgatg aaatcttcat
tatctgatat 120 attgcaaatc actcaatatc tagactttct gttattatta
ttgatccaat caaaaaataa 180 attagaagcc gtgggtcatt gttatgaatc
tctttcagag gaatacagac aattgacaaa 240 attcacagac tttcaagatt
ttaaaaaact gtttaacaag gtccctattg ttacagatgg 300 aagggtcaaa
cttaataaag gatatttgtt cgactttgtg attagtttga tgcgattcaa 360
aaaagaatcc tctctagcta ccaccgcaat agatcctgtt agatacatag atcctcgtcg
420 caatatcgca ttttctaacg tgatggatat attaaagtcg aataaagtga
acaataatta 480 attctttatt gtcatcatga acggcggaca tattcagttg
ataatcggcc ccatgttttc 540 aggtaaaagt acagaattaa ttagacgagt
tagacgttat caaatagctc aatataaatg 600 cgtgactata aaatattcta
acgataatag atacggaacg ggactatgga cgcatgataa 660 gaataatttt
gaagcattgg aagcaactaa actatgtgat ctcttggaat caattacaga 720
tttctccgtg ataggtatcg atgaaggaca gttctttcca gacattgttg aattagatcg
780 ataaaaatta attaattacc cgggtaccag gcctagatct gtcgacttcg
agcttattta 840 tattccaaaa aaaaaaaata aaatttcaat ttttaagctt
tcactaattc caaacccacc 900 cgctttttat agtaagtttt tcacccataa
ataataaata caataattaa tttctcgtaa 960 aagtagaaaa tatattctaa
tttattgcac ggtaaggaag tagatcataa ctcgagcatg 1020 ggagatcccg
tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat 1080
cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat
1140 cgcccttccc aacagttgcg cagcctgaat ggcgaatggc gctttgcctg
gtttccggca 1200 ccagaagcgg tgccggaaag ctggctggag tgcgatcttc
ctgaggccga tactgtcgtc 1260 gtcccctcaa actggcagat gcacggttac
gatgcgccca tctacaccaa cgtaacctat 1320 cccattacgg tcaatccgcc
gtttgttccc acggagaatc cgacgggttg ttactcgctc 1380 acatttaatg
ttgatgaaag ctggctacag gaaggccaga cgcgaattat ttttgatggc 1440
gttaactcgg cgtttcatct gtggtgcaac gggcgctggg tcggttacgg ccaggacagt
1500 cgtttgccgt ctgaatttga cctgagcgca tttttacgcg ccggagaaaa
ccgcctcgcg 1560 gtgatggtgc tgcgttggag tgacggcagt tatctggaag
atcaggatat gtggcggatg 1620 agcggcattt tccgtgacgt ctcgttgctg
cataaaccga ctacacaaat cagcgatttc 1680 catgttgcca ctcgctttaa
tgatgatttc agccgcgctg tactggaggc tgaagttcag 1740 atgtgcggcg
agttgcgtga ctacctacgg gtaacagttt ctttatggca gggtgaaacg 1800
caggtcgcca gcggcaccgc gcctttcggc ggtgaaatta tcgatgagcg tggtggttat
1860 gccgatcgcg tcacactacg tctcaacgtc gaaaacccga aactgtggag
cgccgaaatc 1920 ccgaatctct atcgtgcggt ggttgaactg cacaccgccg
acggcacgct gattgaagca 1980 gaagcctgcg atgtcggttt ccgcgaggtg
cggattgaaa atggtctgct gctgctgaac 2040 ggcaagccgt tgctgattcg
aggcgttaac cgtcacgagc atcatcctct gcatggtcag 2100 gtcatggatg
agcagacgat ggtgcaggat atcctgctga tgaagcagaa caactttaac 2160
gccgtgcgct gttcgcatta tccgaaccat ccgctgtggt acacgctgtg cgaccgctac
2220 ggcctgtatg tggtggatga agccaatatt gaaacccacg gcatggtgcc
aatgaatcgt 2280 ctgaccgatg atccgcgctg gctaccggcg atgagcgaac
gcgtaacgcg aatggtgcag 2340 cgcgatcgta atcacccgag tgtgatcatc
tggtcgctgg ggaatgaatc aggccacggc 2400 gctaatcacg acgcgctgta
tcgctggatc aaatctgtcg atccttcccg cccggtgcag 2460 tatgaaggcg
gcggagccga caccacggcc accgatatta tttgcccgat gtacgcgcgc 2520
gtggatgaag accagccctt cccggctgtg ccgaaatggt ccatcaaaaa atggctttcg
2580 ctacctggag agacgcgccc gctgatcctt tgcgaatacg cccacgcgat
gggtaacagt 2640 cttggcggtt tcgctaaata ctggcaggcg tttcgtcagt
atccccgttt acagggcggc 2700 ttcgtctggg actgggtgga tcagtcgctg
attaaatatg atgaaaacgg caacccgtgg 2760 tcggcttacg gcggtgattt
tggcgatacg ccgaacgatc gccagttctg tatgaacggt 2820 ctggtctttg
ccgaccgcac gccgcatcca gcgctgacgg aagcaaaaca ccagcagcag 2880
tttttccagt tccgtttatc cgggcaaacc atcgaagtga ccagcgaata cctgttccgt
2940 catagcgata acgagctcct gcactggatg gtggcgctgg atggtaagcc
gctggcaagc 3000 ggtgaagtgc ctctggatgt cgctccacaa ggtaaacagt
tgattgaact gcctgaacta 3060 ccgcagccgg agagcgccgg gcaactctgg
ctcacagtac gcgtagtgca accgaacgcg 3120 accgcatggt cagaagccgg
gcacatcagc gcctggcagc agtggcgtct ggcggaaaac 3180 ctcagtgtga
cgctccccgc cgcgtcccac gccatcccgc atctgaccac cagcgaaatg 3240
gatttttgca tcgagctggg taataagcgt tggcaattta accgccagtc aggctttctt
3300 tcacagatgt ggattggcga taaaaaacaa ctgctgacgc cgctgcgcga
tcagttcacc 3360 cgtgcaccgc tggataacga cattggcgta agtgaagcga
cccgcattga ccctaacgcc 3420 tgggtcgaac gctggaaggc ggcgggccat
taccaggccg aagcagcgtt gttgcagtgc 3480 acggcagata cacttgctga
tgcggtgctg attacgaccg ctcacgcgtg gcagcatcag 3540 gggaaaacct
tatttatcag ccggaaaacc taccggattg atggtagtgg tcaaatggcg 3600
attaccgttg atgttgaagt ggcgagcgat acaccgcatc cggcgcggat tggcctgaac
3660 tgccagctgg cgcaggtagc agagcgggta aactggctcg gattagggcc
gcaagaaaac 3720 tatcccgacc gccttactgc cgcctgtttt gaccgctggg
atctgccatt gtcagacatg 3780 tataccccgt acgtcttccc gagcgaaaac
ggtctgcgct gcgggacgcg cgaattgaat 3840 tatggcccac accagtggcg
cggcgacttc cagttcaaca tcagccgcta cagtcaacag 3900 caactgatgg
aaaccagcca tcgccatctg ctgcacgcgg aagaaggcac atggctgaat 3960
atcgacggtt tccatatggg gattggtggc gacgactcct ggagcccgtc agtatcggcg
4020 gaattcagct gagcgccggt cgctaccatt accagttggt ctggtgtcaa
aaataataat 4080 aaccgggcag gggggatcct tctgtgagcg tatggcaaac
gaaggaaaaa tagttatagt 4140 agccgcactc gatgggacat ttcaacgtaa
accgtttaat aatattttga atcttattcc 4200 attatctgaa atggtggtaa
aactaactgc tgtgtgtatg aaatgcttta aggaggcttc 4260 cttttctaaa
cgattgggtg aggaaaccga gatagaaata ataggaggta atgatatgta 4320
tcaatcggtg tgtagaaagt gttacatcga ctcataatat tatatttttt atctaaaaaa
4380 ctaaaaataa acattgatta aattttaata taatacttaa aaatggatgt
tgtgtcgtta 4440 gataaaccgt ttatgtattt tgaggaaatt gataatgagt
tagattacga accagaaagt 4500 gcaaatgagg tcgcaaaaaa actgccgtat
caaggacagt taaaactatt actaggagaa 4560 ttattttttc ttagtaagtt
acagcgacac ggtatattag atggtgccac cgtagtgtat 4620 ataggatctg
ctcccggtac acatatacgt tatttgagag atcatttcta taatttagga 4680
gtgatcatca aatggatgct aattgacggc cgccatcatg atcctatttt aaatggattg
4740 cgtgatgtga ctctagtgac tcggttcgtt gatgaggaat atctacgatc
catcaaaaaa 4800 caactgcatc cttctaagat tattttaatt tctgatgtga
gatccaaacg aggaggaaat 4860 gaacctagta cggcggattt actaagtaat
tacgctctac aaaatgtcat gattagtatt 4920 ttaaaccccg tggcgtctag
tcttaaatgg agatgcccgt ttccagatca atggatcaag 4980 gacttttata
tcccacacgg taataaaatg ttacaacctt ttgctccttc atattcagct 5040
gaaatgagat tattaagtat ttataccggt gagaacatga gactgactcg ggccgcgttg
5100
ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
5160 cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc
tggaagctcc 5220 ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat
acctgtccgc ctttctccct 5280 tcgggaagcg tggcgctttc tcaatgctca
cgctgtaggt atctcagttc ggtgtaggtc 5340 gttcgctcca agctgggctg
tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta 5400 tccggtaact
atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca 5460
gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
5520 tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc
tctgctgaag 5580 ccagttacct tcggaaaaag agttggtagc tcttgatccg
gcaaacaaac caccgctggt 5640 agcggtggtt tttttgtttg caagcagcag
attacgcgca gaaaaaaagg atctcaagaa 5700 gatcctttga tcttttctac
ggggtctgac gctcagtgga acgaaaactc acgttaaggg 5760 attttggtca
tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga 5820
agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta
5880 atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt
tgcctgactc 5940 cccgtcgtgt agataactac gatacgggag ggcttaccat
ctggccccag tgctgcaatg 6000 ataccgcgag acccacgctc accggctcca
gatttatcag caataaacca gccagccgga 6060 agggccgagc gcagaagtgg
tcctgcaact ttatccgcct ccatccagtc tattaattgt 6120 tgccgggaag
ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt 6180
gctgcaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc
6240 caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt
tagctccttc 6300 ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt
tatcactcat ggttatggca 6360 gcactgcata attctcttac tgtcatgcca
tccgtaagat gcttttctgt gactggtgag 6420 tactcaacca agtcattctg
agaatagtgt atgcggcgac cgagttgctc ttgcccggcg 6480 tcaacacggg
ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa 6540
cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa
6600 cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt
ttctgggtga 6660 gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa
gggcgacacg gaaatgttga 6720 atactcatac tcttcctttt tcaatattat
tgaagcattt atcagggtta ttgtctcatg 6780 agcggataca tatttgaatg
tatttagaaa aataaacaaa taggggttcc gcgcacattt 6840 ccccgaaaag
tgccacctga cgtctaagaa accattatta tcatgacatt aacctataaa 6900
aataggcgta tcacgaggcc ctttcgtctt cgaataaata cctgtgacgg aagatcactt
6960 cgcagaataa ataaatcctg gtgtccctgt tgataccggg aagccctggg
ccaacttttg 7020 gcgaaaatga gacgttgatc ggcacgtaag aggttccaac
tttcaccata atgaaataag 7080 atcactaccg ggcgtatttt ttgagttatc
gagattttca ggagctaagg aagctaaaat 7140 ggagaaaaaa atcactggat
ataccaccgt tgatatatcc caatggcatc gtaaagaaca 7200 ttttgaggca
tttcagtcag ttgctcaatg tacctataac cagaccgttc ag 7252 <210> SEQ
ID NO 6 <211> LENGTH: 28 <212> TYPE: DNA <213>
ORGANISM: Artificial Sequence <220> FEATURE: <223>
OTHER INFORMATION: Primer pUC28 I <400> SEQUENCE: 6
aattcagatc tccatggatc gatgagct 28 <210> SEQ ID NO 7
<211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: Primer pUC28 II <400> SEQUENCE: 7 catcgatcca
tggagatctg 20 <210> SEQ ID NO 8 <211> LENGTH: 1665
<212> TYPE: DNA <213> ORGANISM: Artificial Sequence
<220> FEATURE: <223> OTHER INFORMATION: Renilla
luciferase-Aequeora GFP fusion gene <400> SEQUENCE: 8
atgacttcga aagtttatga tccagaacaa aggaaacgga tgataactgg tccgcagtgg
60 tgggccagat gtaaacaaat gaatgttctt gattcattta ttaattatta
tgattcagaa 120 aaacatgcag aaaatgctgt tattttttta catggtaacg
cggcctcttc ttatttatgg 180 cgacatgttg tgccacatat tgagccagta
gcgcggtgta ttataccaga tcttattggt 240 atgggcaaat caggcaaatc
tggtaatggt tcttataggt tacttgatca ttacaaatat 300 cttactgcat
ggtttgaact tcttaattta ccaaagaaga tcatttttgt cggccatgat 360
tggggtgctt gtttggcatt tcattatagc tatgagcatc aagataagat caaagcaata
420 gttcacgctg aaagtgtagt agatgtgatt gaatcatggg atgaatggcc
tgatattgaa 480 gaagatattg cgttgatcaa atctgaagaa ggagaaaaaa
tggttttgga gaataacttc 540 ttcgtggaaa ccatgttgcc atcaaaaatc
atgagaaagt tagaaccaga agaatttgca 600 gcatatcttg aaccattcaa
agacaaaggt gaagttcgtc gtccaacatt atcatggcct 660 cgtgaaatcc
cgttagtaaa aggtggtaaa cctgacgttg tacaaattgt taggaattat 720
aatgcttatc tacgtgcaag tgatgattta ccaaaaatgt ttattgaatc ggatccagga
780 ttcttttcca atgctattgt tgaaggcgcc aagaagtttc ctaatactga
atttgtcaaa 840 gtaaaaggtc ttcatttttc gcaagaagat gcacctgatg
aaatgggaaa atatatcaaa 900 tcgttcgttg agcgagttct caaaaatgaa
caagcggccg caccgcatat gagtaaagga 960 gaagaacttt tcactggagt
tgtcccaatt cttgttgaat tagatggtga tgttaatggg 1020 cacaaatttt
ctgtcagtgg agagggtgaa ggtgatgcaa catacggaaa acttaccctt 1080
aaatttattt gcactactgg aaaactacct gttccatggc caacacttgt cactactttc
1140 tcttatggtg ttcaatgctt ttcaagatac ccagatcata tgaaacagca
tgactttttc 1200 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta
tatttttcaa agatgacggg 1260 aactacaaga cacgtgctga agtcaagttt
gaaggtgata cccttgttaa tagaatcgag 1320 ttaaaaggta ttgattttaa
agaagatgga aacattcttg gacacaaatt ggaatacaac 1380 tataactcac
acaatgtata catcatggca gacaaacaaa agaatggaat caaagttaac 1440
ttcaaaatta gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa
1500 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct
gtccacacaa 1560 tctgcccttt cgaaagatcc caacgaaaag agagaccaca
tggtccttct tgagtttgta 1620 acagctgctg ggattacaca tggcatggat
gaactataca aataa 1665 <210> SEQ ID NO 9 <211> LENGTH:
11096 <212> TYPE: DNA <213> ORGANISM: Artificial
Sequence <220> FEATURE: <223> OTHER INFORMATION:
pLacGus Plasmid <400> SEQUENCE: 9 aagcttgcat gcctgcagca
attcccgagg ctgtagccga cgatggtgcg ccaggagagt 60 tgttgattca
ttgtttgcct ccctgctgcg gtttttcacc gaagttcatg ccagtccagc 120
gtttttgcag cagaaaagcc gccgacttcg gtttgcggtc gcgagtgaag atccctttct
180 tgttaccgcc aacgcgcaat atgccttgcg aggtcgcaaa atcggcgaaa
ttccatacct 240 gttcaccgac gacggcgctg acgcgatcaa agacgcggtg
atacatatcc agccatgcac 300 actgatactc ttcactccac atgtcggtgt
acattgagtg cagcccggct aacgtatcca 360 cgccgtattc ggtgatgata
atcggctgat gcagtttctc ctgccaggcc agaagttctt 420 tttccagtac
cttctctgcc gtttccaaat cgccgctttg gacataccat ccgtaataac 480
ggttcaggca cagcacatca aagagatcgc tgatggtatc ggtgtgagcg tcgcagaaca
540 ttacattgac gcaggtgatc ggacgcgtcg ggtcgagttt acgcgttgct
tccgccagtg 600 gcgcgaaata ttcccgtgca ccttgcggac gggtatccgg
ttcgttggca atactccaca 660 tcaccacgct tgggtggttt ttgtcacgcg
ctatcagctc tttaatcgcc tgtaagtgcg 720 cttgctgagt ttccccgttg
actgcctctt cgctgtacag ttctttcggc ttgttgcccg 780 cttcgaaacc
aatgcctaaa gagaggttaa agccgacagc agcagtttca tcaatcacca 840
cgatgccatg ttcatctgcc cagtcgagca tctcttcagc gtaagggtaa tgcgaggtac
900 ggtaggagtt ggccccaatc cagtccatta atgcgtggtc gtgcaccatc
agcacgttat 960 cgaatccttt gccacgcaag tccgcatctt catgacgacc
aaagccagta aagtagaacg 1020 gtttgtggtt aatcaggaac tgttcgccct
tcactgccac tgaccggatg ccgacgcgaa 1080 gcgggtagat atcacactct
gtctggcttt tggctgtgac gcacagttca tagagataac 1140 cttcacccgg
ttgccagagg tgcggattca ccacttgcaa agtcccgcta gtgccttgtc 1200
cagttgcaac cacctgttga tccgcatcac gcagttcaac gctgacatca ccattggcca
1260 ccacctgcca gtcaacagac gcgtggttac agtcttgcgc gacatgcgtc
accacggtga 1320 tatcgtccac ccaggtgttc ggcgtggtgt agagcattac
gctgcgatgg attccggcat 1380 agttaaagaa atcatggaag taagactgct
ttttcttgcc gttttcgtcg gtaatcacca 1440 ttcccggcgg gatagtctgc
cagttcagtt cgttgttcac acaaacggtg atacgtacac 1500 ttttcccggc
aataacatac ggcgtgacat cggcttcaaa tggcgtatag ccgccctgat 1560
gctccatcac ttcctgatta ttgacccaca ctttgccgta atgagtgacc gcatcgaaac
1620 gcagcacgat acgctggcct gcccaacctt tcggtataaa gacttcgcgc
tgataccaga 1680 cgttgcccgc ataattacga atatctgcat cggcgaactg
atcgttaaaa ctgcctggca 1740 cagcaattgc ccggctttct tgtaacgcgc
tttcccacca acgctgatca attccacagt 1800 tttcgcgatc cagactgaat
gcccacaggc cgtcgagttt tttgatttca cgggttgggg 1860 tttctacagg
acgtaacatt ctagacatta tagttttttc tccttgacgt taaagtatag 1920
aggtatatta acaatttttt gttgatactt ttattacatt tgaataagaa gtaatacaaa
1980 ccgaaaatgt tgaaagtatt agttaaagtg gttatgcagt ttttgcattt
atatatctgt 2040 taatagatca aaaatcatcg gttcgctgat taattacccc
agaaataagg ctaaaaaact 2100 aatcgcatta tcatccctcg agctatcacc
gcaagggata aatatctaac accgtgcgtg 2160 ttgactattt tacctctggc
ggtgataatg ctcgaggtaa gattagatat ggatatgtat 2220 atggatatgt
atatggtggt aatgccatgt aatatgatta ttaaacttct ttgcgtccat 2280
ccaaaaaaaa agtaagaatt tttgaaaatt caatataaat gacagctcag ttacaaagtg
2340
aaagtacttc taaaattgtt ttggttacag gtggtgctgg atacattggt tcacacactg
2400 tggtagagct aattgagaat ggatatgact gtgttgttgc tgataacctg
tcgaatagat 2460 cgacctgaag tctaggtccc tatttatttt tttatagtta
tgttagtatt aagaacgtta 2520 tttatatttc aaatttttct tttttttctg
tacagacgcg tgtacgaatt tcgacctcga 2580 ccggccggtt ttacaaatca
gtaagcaggt cagtgcgtac gccatggccg gagtggctca 2640 cagtcggtgg
tccggcagta caatggattt ccttacgcga aatacgggca gacatggcct 2700
gcccggttat tattattttt gacaccagac caactggtaa tggtagcgac cggcgctcag
2760 ctggaattcc gccgatactg acgggctcca ggagtcgtcg ccaccaatcc
ccatatggaa 2820 accgtcgata ttcagccatg tgccttcttc cgcgtgcagc
agatggcgat ggctggtttc 2880 catcagttgc tgttgactgt agcggctgat
gttgaactgg aagtcgccgc gccactggtg 2940 tgggccataa ttcaattcgc
gcgtcccgca gcgcagaccg ttttcgctcg ggaagacgta 3000 cggggtatac
atgtctgaca atggcagatc ccagcggtca aaacaggcgg cagtaaggcg 3060
gtcgggatag ttttcttgcg gccctaatcc gagccagttt acccgctctg ctacctgcgc
3120 cagctggcag ttcaggccaa tccgcgccgg atgcggtgta tcgctcgcca
cttcaacatc 3180 aacggtaatc gccatttgac cactaccatc aatccggtag
gttttccggc tgataaataa 3240 ggttttcccc tgatgctgcc acgcgtgagc
ggtcgtaatc agcaccgcat cagcaagtgt 3300 atctgccgtg cactgcaaca
acgctgcttc ggcctggtaa tggcccgccg ccttccagcg 3360 ttcgacccag
gcgttagggt caatgcgggt cgcttcactt acgccaatgt cgttatccag 3420
cggtgcacgg gtgaactgat cgcgcagcgg cgtcagcagt tgttttttat cgccaatcca
3480 catctgtgaa agaaagcctg actggcggtt aaattgccaa cgcttattac
ccagctcgat 3540 gcaaaaatcc atttcgctgg tggtcagatg cgggatggcg
tgggacgcgg cggggagcgt 3600 cacactgagg ttttccgcca gacgccactg
ctgccaggcg ctgatgtgcc cggcttctga 3660 ccatgcggtc gcgttcggtt
gcactacgcg tactgtgagc cagagttgcc cggcgctctc 3720 cggctgcggt
agttcaggca gttcaatcaa ctgtttacct tgtggagcga catccagagg 3780
cacttcaccg cttgccagcg gcttaccatc cagcgccacc atccagtgca ggagctcgtt
3840 atcgctatga cggaacaggt attcgctggt cacttcgatg gtttgcccgg
ataaacggaa 3900 ctggaaaaac tgctgctggt gttttgcttc cgtcagcgct
ggatgcggcg tgcggtcggc 3960 aaagaccaga ccgttcatac agaactggcg
atcgttcggc gtatcgccaa aatcaccgcc 4020 gtaagccgac cacgggttgc
cgttttcatc atatttaatc agcgactgat ccacccagtc 4080 ccagacgaag
ccgccctgta aacggggata ctgacgaaac gcctgccagt atttagcgaa 4140
accgccaaga ctgttaccca tcgcgtgggc gtattcgcaa aggatcagcg ggcgcgtctc
4200 tccaggtagc gaaagccatt ttttgatgga ccatttcggc acagccggga
agggctggtc 4260 ttcatccacg cgcgcgtaca tcgggcaaat aatatcggtg
gccgtggtgt cggctccgcc 4320 gccttcatac tgcaccgggc gggaaggatc
gacagatttg atccagcgat acagcgcgtc 4380 gtgattagcg ccgtggcctg
attcattccc cagcgaccag atgatcacac tcgggtgatt 4440 acgatcgcgc
tgcaccattc gcgttacgcg ttcgctcatc gccggtagcc agcgcggatc 4500
atcggtcaga cgattcattg gcaccatgcc gtgggtttca atattggctt catccaccac
4560 atacaggccg tagcggtcgc acagcgtgta ccacagcgga tggttcggat
aatgcgaaca 4620 gcgcacggcg ttaaagttgt tctgcttcat cagcaggata
tcctgcacca tcgtctgctc 4680 atccatgacc tgaccatgca gaggatgatg
ctcgtgacgg ttaacgcctc gaatcagcaa 4740 cggcttgccg ttcagcagca
gcagaccatt ttcaatccgc acctcgcgga aaccgacatc 4800 gcaggcttct
gcttcaatca gcgtgccgtc ggcggtgtgc agttcaacca ccgcacgata 4860
gagattcggg atttcggcgc tccacagttt cgggttttcg acgttcagac gtagtgtgac
4920 gcgatcggca taaccaccac gctcatcgat aatttcaccg ccgaaaggcg
cggtgccgct 4980 ggcgacctgc gtttcaccct gccataaaga aactgttacc
cgtaggtagt cacgcaactc 5040 gccgcacatc tgaacttcag cctccagtac
agcgcggctg aaatcatcat taaagcgagt 5100 ggcaacatgg aaatcgctga
tttgtgtagt cggtttatgc agcaacgaga cgtcacggaa 5160 aatgccgctc
atccgccaca tatcctgatc ttccagataa ctgccgtcac tccagcgcag 5220
caccatcacc gcgaggcggt tttctccggc gcgtaaaaat gcgctcaggt caaattcaga
5280 cggcaaacga ctgtcctggc cgtaaccgac ccagcgcccg ttgcaccaca
gatgaaacgc 5340 cgagttaacg ccatcaaaaa taattcgcgt ctggccttcc
tgtagccagc tttcatcaac 5400 attaaatgtg agcgagtaac aacccgtcgg
attctccgtg ggaacaaacg gcggattgac 5460 cgtaatggga taggtcacgt
tggtgtagat gggcgcatcg taaccgtgca tctgccagtt 5520 tgaggggacg
acgacagtat cggcctcagg aagatcgcac tccagccagc tttccggcac 5580
cgcttctggt gccggaaacc aggcaaagcg ccattcgcca ttcaggctgc gcaactgttg
5640 ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaaag
ggggatgtgc 5700 tgcaaggcga ttaagtcggg aaacctgtcg tgccagctgc
attaatgaat cggccaacgc 5760 gcggggagag gcggtttgcg tattgggcgc
cagggtggtt tttcttttca ccagtgagac 5820 gggcaacagc caagctccgg
atccgggctt ggccaagctt ggaattccgc acttttcggc 5880 caatggtctt
ggtaattcct ttgcgctaga attgaactca ggtacaatca cttcttctga 5940
atgagattta gtcattatag ttttttctcc ttgacgttaa agtatagagg tatattaaca
6000 attttttgtt gatactttta ttacatttga ataagaagta atacaaaccg
aaaatgttga 6060 aagtattagt taaagtggtt atgcagtttt tgcatttata
tatctgttaa tagatcaaaa 6120 atcatcgctt cgctgattaa ttaccccaga
aataaggcta aaaaactaat cgcattatca 6180 tcccctcgac gtactgtaca
tataaccact ggttttatat acagcagtac tgtacatata 6240 accactggtt
ttatatacag cagtcgacgt actgtacata taaccactgg ttttatatac 6300
agcagtactg gacatataac cactggtttt atatacagca gtcgaggtaa gattagatat
6360 ggatatgtat atggatatgt atatggtggt aatgccatgt aatatgatta
ttaaacttct 6420 ttgcgtccat ccaaaaaaaa agtaagaatt tttgaaaatt
caatataaat gacagctcag 6480 ttacaaagtg aaagtacttc taaaattgtt
ttggttacag gtggtgctgg atacattggt 6540 tcacacactg tggtagagct
aattgagaat ggatatgact gtgttgttgc tgataacctg 6600 tcgaattcca
agctcggatc cccgagctcg gatcccccta agaaaccatt attatcatga 6660
cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg
6720 acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt
ctgtaagcgg 6780 atgccgggag cagacaagcc cgtcagggcg cgtcagcggg
tgttggcggg tgtcggggct 6840 ggcttaacta tgcggcatca gagcagattg
tactgagagt gcaccataac gcatttaagc 6900 ataaacacgc actatgccgt
tcttctcatg tatatatata tacaggcaac acgcagatat 6960 aggtgcgacg
tgaacagtga gctgtatgtg cgcagctcgc gttgcatttt cggaagcgct 7020
cgttttcgga aacgctttga agttcctatt ccgaagttcc tattctctag ctagaaagta
7080 taggaacttc agagcgcttt tgaaaaccaa aagcgctctg aagacgcact
ttcaaaaaac 7140 caaaaacgca ccggactgta acgagctact aaaatattgc
gaataccgct tccacaaaca 7200 ttgctcaaaa gtatctcttt gctatatatc
tctgtgctat atccctatat aacctaccca 7260 tccacctttc gctccttgaa
cttgcatcta aactcgacct ctacattttt tatgtttatc 7320 tctagtatta
ctctttagac aaaaaaattg tagtaagaac tattcataga gtgaatcgaa 7380
aacaatacga aaatgtaaac atttcctata cgtagtatat agagacaaaa tagaagaaac
7440 cgttcataat tttctgacca atgaagaatc atcaacgcta tcactttctg
ttcacaaagt 7500 atgcgcaatc cacatcggta tagaatataa tcggggatgc
ctttatcttg aaaaaatgca 7560 cccgcagctt cgctagtaat cagtaaacgc
gggaagtgga gtcaggcttt ttttatggaa 7620 gagaaaatag acaccaaagt
agccttcttc taaccttaac ggacctacag tgcaaaaagt 7680 tatcaagaga
ctgcattata gagcgcacaa aggagaaaaa aagtaatcta agatgctttg 7740
ttagaaaaat agcgctctcg ggatgcattt ttgtagaaca aaaaagaagt atagattctt
7800 tgttggtaaa atagcgctct cgcgttgcat ttctgttctg taaaaatgca
gctcagattc 7860 tttgtttgaa aaattagcgc tctcgcgttg catttttgtt
ttacaaaaat gaagcacaga 7920 ttcttcgttg gtaaaatagc gctttcgcgt
tgcatttctg ttctgtaaaa atgcagctca 7980 gattctttgt ttgaaaaatt
agcgctctcg cgttgcattt ttgttctaca aaatgaagca 8040 cagatgcttc
gttgcttccg tgtggaagaa cgattacaac aggtgttgtc ctctgaggac 8100
ataaaataca caccgagatt catcaactca ttgctggagt tagcatatct acaattcaga
8160 agaactcgtc aagaaggcga tagaaggcga tgcgctgcga atcgggagcg
gcgataccgt 8220 aaagcacgag gaagcggtca gcccattcgc cgccaagctc
ttcagcaata tcacgggtag 8280 ccaacgctat gtcctgatag cggtccgcca
cacccagccg gccacagtcg atgaatccag 8340 aaaagcggcc attttccacc
atgatattcg gcaagcaggc atcgccatgg gtcacgacga 8400 gatcctcgcc
gtcgggcatg ctcgccttga gcctggcgaa cagttcggct ggcgcgagcc 8460
cctgatgctc ttcgtccaga tcatcctgat cgacaagacc ggcttccatc cgagtacgtg
8520 ctcgctcgat gcgatgtttc gcttggtggt cgaatgggca ggtagccgga
tcaagcgtat 8580 gcagccgccg cattgcatca gccatgatgg atactttctc
ggcaggagca aggtgagatg 8640 acaggagatc ctgccccggc acttcgccca
atagcagcca gtcccttccc gcttcagtga 8700 caacgtcgag cacagctgcg
caaggaacgc ccgtcgtggc cagccacgat agccgcgctg 8760 cctcgtcttg
cagttcattc agggcaccgg acaggtcggt cttgacaaaa agaaccgggc 8820
gcccctgcgc tgacagccgg aacacggcgg catcagagca gccgattgtc tgttgtgccc
8880 agtcatagcc gaatagcctc tccacccaag cggccggaga acctgcgtgc
aatccatctt 8940 gttcaatcat gcgaaacgat cctcatcctg tctcttgatc
agagcttgat cccctgcgcc 9000 atcagatcct tggcggcaag aaagccatcc
agtttacttt gcagggcttc ccaaccttac 9060 cagagggcgc cccagctggc
aattccggtt cgcttgctgt ccataaaacc gcccagtcta 9120 gctatcgcca
tgtaagccca ctgcaagcta cctgctttct ctttgcgctt gcgttttccc 9180
ttgtccagat agcccagtag ctgacattca tccggggtca gcaccgtttc tgcggactgg
9240 ctttctacgt gaaaaggatc taggtgaaga tcctttttga taatctcatg
accaaaatcc 9300 cttaacgtga gttttcgttc cactgagcgt cagaccccgt
agaaaagatc aaaggatctt 9360 cttgagatcc tttttttctg cgcgtaatct
gctgcttgca aacaaaaaaa ccaccgctac 9420 cagcggtggt ttgtttgccg
gatcaagagc taccaactct ttttccgaag gtaactggct 9480 tcagcagagc
gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact 9540
tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg
9600 ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag
ttaccggata 9660 aggcgcagcg gtcgggctga acggggggtt cgtgcacaca
gcccagcttg gagcgaacga 9720 cctacaccga actgagatac ctacagcgtg
agctatgaga aagcgccacg cttcccgaag 9780 ggagaaaggc ggacaggtat
ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg 9840
agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac
9900 ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa
aacgccagca 9960 acgcggcctt tttacggttc ctggcctttt gctggccttt
tgctcacatg atataattca 10020 attgaagctc taatttgtga gtttagtata
catgcattta cttataatac agttttttag 10080 ttttgctggc cgcatcttct
caaatatgct tcccagcctg cttttctgta acgttcaccc 10140 tctaccttag
catcccttcc ctttgcaaat agtcctcttc caacaataat aatgtcagat 10200
cctgtagaga ccacatcatc cacggttcta tactgttgac ccaatgcgtc tcccttgtca
10260 tctaaaccca caccgggtgt cataatcaac caatcgtaac cttcatctct
tccacccatg 10320 tctctttgag caataaagcc gataacaaaa tctttgtcgc
tcttcgcaat gtcaacagta 10380 cccttagtat attctccagt agatagggag
cccttgcatg acaattctgc taacatcaaa 10440 aggcctctag gttcctttgt
tacttcttct gccgcctgct tcaaaccgct aacaatacct 10500 gggcccacca
caccgtgtgc attcgtaatg tctgcccatt ctgctattct gtatacaccc 10560
gcagagtact gcaatttgac tgtattacca atgtcagcaa attttctgtc ttcgaagagt
10620 aaaaaattgt acttggcgga taatgccttt agcggcttaa ctgtgccctc
catggaaaaa 10680 tcagtcaaga tatccacatg tgtttttagt aaacaaattt
tgggacctaa tgcttcaact 10740 aactccagta attccttggt ggtacgaaca
tccaatgaag cacacaagtt tgtttgcttt 10800 tcgtgcatga tattaaatag
cttggcagca acaggactag gatgagtagc agcacgttcc 10860 ttatatgtag
ctttcgacat gatttatctt cgtttcctgc aggtttttgt tctgtgcagt 10920
tgggttaaga atactgggca atttcatgtt tcttcaacac tacatatgcg tatatatacc
10980 aatctaagtc tgtgctcctt ccttcgttct tccttctgtt cggagattac
cgaatcaaaa 11040 aaatttcaag gaaaccgaaa tcaaaaaaaa gaataaaaaa
aaaatgatga attgaa 11096 <210> SEQ ID NO 10 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Vaccinia
Virus/LIVP <300> PUBLICATION INFORMATION: <308>
DATABASE ACCESSION NUMBER: GenBank No. M57977 <309> DATABASE
ENTRY DATE: 2000-04-14 <400> SEQUENCE: 10 atggtcatcg
gtttagtcat attcgtgtct gtggcggccg ccatcgtcgg tgtgttgtct 60
aacgtattgg acatgcttat gtacgtagaa gaaaataatg aagaggatgc tagaatcaag
120 gaggagcaag aactactgtt gctatattga 150 <210> SEQ ID NO 11
<211> LENGTH: 49 <212> TYPE: PRT <213> ORGANISM:
Vaccinia Virus/LIVP <300> PUBLICATION INFORMATION:
<308> DATABASE ACCESSION NUMBER: GenBank No. AAA48282
<309> DATABASE ENTRY DATE: 2000-04-14 <400> SEQUENCE:
11 Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val
1 5 10 15 Gly Val Leu Ser Asn Val Leu Asp Met Leu Met Tyr Val Glu
Glu Asn 20 25 30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu
Leu Leu Leu Leu 35 40 45 Tyr <210> SEQ ID NO 12 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Vaccinia
Virus/WR <300> PUBLICATION INFORMATION: <308> DATABASE
ACCESSION NUMBER: GenBank No. AY243312 <309> DATABASE ENTRY
DATE: 2003-04-10 <400> SEQUENCE: 12 tcaatatagc aacagtagtt
cttgctcctc cttgattcta gcatcctctt cattattttc 60 ttctacgtac
ataagcatgt ccaatacgtt agacaacaca ccgacgatgg cggccgccac 120
agacacgaat atgactagac cgatgaccat 150 <210> SEQ ID NO 13
<211> LENGTH: 49 <212> TYPE: PRT <213> ORGANISM:
Vaccinia Virus/WR <400> SEQUENCE: 13 Met Val Ile Gly Leu Val
Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15 Gly Val Leu Ser
Asn Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20 25 30 Asn Glu
Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40 45
Tyr <210> SEQ ID NO 14 <211> LENGTH: 150 <212>
TYPE: DNA <213> ORGANISM: Vaccinia Virus/Ankara <300>
PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER:
GenBank No. U94848.1 <309> DATABASE ENTRY DATE: 2003-04-14
<400> SEQUENCE: 14 tcaatatagc aacagtagtt cttgctcctc
cttgattcta gcatcctctt cattattttc 60 ttctacgtac ataaacatgt
ccaatacgtt agacaacaca ccgacgatgg cggccgccac 120 agacacgaat
atgactaaac cgatgaccat 150 <210> SEQ ID NO 15 <211>
LENGTH: 49 <212> TYPE: PRT <213> ORGANISM: Vaccinia
Virus/Ankara <400> SEQUENCE: 15 Met Val Ile Gly Leu Val Ile
Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15 Gly Val Leu Ser Asn
Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn 20 25 30 Asn Glu Glu
Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40 45 Tyr
<210> SEQ ID NO 16 <211> LENGTH: 146 <212> TYPE:
DNA <213> ORGANISM: Vaccinia Virus/Tian Tan <300>
PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER:
GenBank No. AF095689 <309> DATABASE ENTRY DATE: 2000-02-14
<400> SEQUENCE: 16 caatatagca acagtagttc ttgctcctcc
ttgattctag catcctcttc attattttct 60 tctacgtaca taaacatgtc
caatacgtta gacaacacac cgacgatggc cgccacagac 120 acgaatatga
ctagaccgat gaccat 146 <210> SEQ ID NO 17 <211> LENGTH:
48 <212> TYPE: PRT <213> ORGANISM: Vaccinia Virus/Tian
Tan <400> SEQUENCE: 17 Met Val Ile Gly Leu Val Ile Phe Val
Ser Val Ala Ala Ile Val Gly 1 5 10 15 Val Leu Ser Asn Val Leu Asp
Met Phe Met Tyr Val Glu Glu Asn Asn 20 25 30 Glu Glu Asp Ala Arg
Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu Tyr 35 40 45 <210>
SEQ ID NO 18 <211> LENGTH: 150 <212> TYPE: DNA
<213> ORGANISM: Vaccinia Virus/Acambis 3000 MVA <300>
PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER:
GenBank No. AY603355 <309> DATABASE ENTRY DATE: 2004-05-15
<400> SEQUENCE: 18 tcaatatagc aacagtagtt cttgctcctc
cttgattcta gcatcctctt cattattttc 60 ttctacgtac ataaacatgt
ccaatacgtt agacaacaca ccgacgatgg cggccgccac 120 agacacgaat
atgactaaac cgatgaccat 150 <210> SEQ ID NO 19 <211>
LENGTH: 49 <212> TYPE: PRT <213> ORGANISM: Vaccinia
Virus/Acambis 3000 MVA <400> SEQUENCE: 19 Met Val Ile Gly Leu
Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15 Gly Val Leu
Ser Asn Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn 20 25 30 Asn
Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40
45 Tyr <210> SEQ ID NO 20 <211> LENGTH: 150 <212>
TYPE: DNA <213> ORGANISM: Vaccinia Virus/Copenhagen
<300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION
NUMBER: GenBank No. M35027.1 <309> DATABASE ENTRY DATE:
1993-08-03 <400> SEQUENCE: 20 tcaatatagc aacagtagtt
cttgctcctc cttgattcta gcatcctctt cattattttc 60 ttctacgtac
ataaacatgt ccaatacgtt agacaacaca ccgacgatgg cggccgccac 120
agacacgaat atgactagac cgatgaccat 150 <210> SEQ ID NO 21
<211> LENGTH: 49 <212> TYPE: PRT <213> ORGANISM:
Vaccinia Virus/Copenhagen <400> SEQUENCE: 21 Met Val Ile Gly
Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15
Gly Val Leu Ser Asn Val Leu Asp Met Phe Met Tyr Val Glu Glu Asn 20
25 30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu
Leu 35 40 45 Tyr <210> SEQ ID NO 22 <211> LENGTH: 150
<212> TYPE: DNA <213> ORGANISM: Cowpox Virus
<300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION
NUMBER: GenBank No. X94355.2 <309> DATABASE ENTRY DATE:
2003-05-09 <400> SEQUENCE: 22 tcaatatagc aacagtagtt
cttgctcctc cttgattcta gcatcctctt cattattttc 60 ttctacgtac
ataagcatgt ccaatacgtt agacaacaca ccgacgatgg cggccgccac 120
agacacgaat atgactagac cgatgaccat 150 <210> SEQ ID NO 23
<211> LENGTH: 49 <212> TYPE: PRT <213> ORGANISM:
Cowpox Virus <400> SEQUENCE: 23 Met Val Ile Gly Leu Val Ile
Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15 Gly Val Leu Ser Asn
Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20 25 30 Asn Glu Glu
Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40 45 Tyr
<210> SEQ ID NO 24 <211> LENGTH: 150 <212> TYPE:
DNA <213> ORGANISM: Rabbitpox Virus <300> PUBLICATION
INFORMATION: <308> DATABASE ACCESSION NUMBER: GenBank No.
AY484669 <309> DATABASE ENTRY DATE: 2004-03-30 <400>
SEQUENCE: 24 tcaatatagc aacagtagtt cttgctcctc cttgattcta gcatcctctt
cattattttc 60 ttctacgtac ataagcatgt ccaatacgtt agacaacaca
ccgacgatgg cggccgccac 120 agacacgaat atgactagac cgatgaccat 150
<210> SEQ ID NO 25 <211> LENGTH: 49 <212> TYPE:
PRT <213> ORGANISM: Rabbitpox Virus <400> SEQUENCE: 25
Met Val Ile Gly Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5
10 15 Gly Val Leu Ser Asn Val Leu Asp Met Leu Met Tyr Val Glu Glu
Asn 20 25 30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu
Leu Leu Leu 35 40 45 Tyr <210> SEQ ID NO 26 <211>
LENGTH: 150 <212> TYPE: DNA <213> ORGANISM: Camelpox
Virus/CMS <300> PUBLICATION INFORMATION: <308> DATABASE
ACCESSION NUMBER: GenBank No. AY009089 <309> DATABASE ENTRY
DATE: 2002-07-30 <400> SEQUENCE: 26 tcaatatagc aacagtagtt
cttgctcctc cttaattcta gcatcttctt cattattttc 60 ttctacatac
ataagcatgt ccaatacgtt agacaacaca ccgacgatgg cggccgccac 120
agacacgaat atgactagac cgatgaccat 150 <210> SEQ ID NO 27
<211> LENGTH: 49 <212> TYPE: PRT <213> ORGANISM:
Camelpox Virus/CMS <400> SEQUENCE: 27 Met Val Ile Gly Leu Val
Ile Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15 Gly Val Leu Ser
Asn Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20 25 30 Asn Glu
Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40 45
Tyr <210> SEQ ID NO 28 <211> LENGTH: 150 <212>
TYPE: DNA <213> ORGANISM: Ectromelia Virus/Moscow <300>
PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER:
GenBank No. AF012825 <309> DATABASE ENTRY DATE: 2002-08-06
<400> SEQUENCE: 28 tcaatatagc aacaacagtt cttgctcctc
cttgattcta gcatcctctt cattattttc 60 ttctacgtac ataagcatgt
ccaatacgtt agacaacaca ccgacaatgg cggccgccac 120 agacacgaat
atgactagac cgaggaccat 150 <210> SEQ ID NO 29 <211>
LENGTH: 49 <212> TYPE: PRT <213> ORGANISM: Ectromelia
Virus/Moscow <400> SEQUENCE: 29 Met Val Leu Gly Leu Val Ile
Phe Val Ser Val Ala Ala Ala Ile Val 1 5 10 15 Gly Val Leu Ser Asn
Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20 25 30 Asn Glu Glu
Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40 45 Tyr
<210> SEQ ID NO 30 <211> LENGTH: 146 <212> TYPE:
DNA <213> ORGANISM: Monkeypox Virus/Zaire <300>
PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER:
GenBank No. AF380138 <309> DATABASE ENTRY DATE: 2001-12-13
<400> SEQUENCE: 30 tatagcaaca gtaattcttg ctcctccttg
attttagcat cctcttcatt attttcttct 60 acgtacataa gcatgtccaa
tacgttagac aacacaccga cgatggtggc cgccacagac 120 acgaatatga
ctagaccgat gaccat 146 <210> SEQ ID NO 31 <211> LENGTH:
48 <212> TYPE: PRT <213> ORGANISM: Monkeypox
Virus/Zaire <400> SEQUENCE: 31 Met Val Ile Gly Leu Val Ile
Phe Val Ser Val Ala Ala Thr Ile Val 1 5 10 15 Gly Val Leu Ser Asn
Val Leu Asp Met Leu Met Tyr Val Glu Glu Asn 20 25 30 Asn Glu Glu
Asp Ala Lys Ile Lys Glu Glu Gln Glu Leu Leu Leu Leu 35 40 45
<210> SEQ ID NO 32 <211> LENGTH: 150 <212> TYPE:
DNA <213> ORGANISM: Variola Virus <300> PUBLICATION
INFORMATION: <308> DATABASE ACCESSION NUMBER: GenBank No.
X69198.1 <309> DATABASE ENTRY DATE: 1996-12-13 <400>
SEQUENCE: 32 tcaatatagc aacagtagtt cttgctcctc cttaattcta gcatcttctt
cattattttc 60 ttctacatac ataagcatct ccaatacgtt agacagcaca
ccgatgatgg cggccgccac 120 agacacgaat atgactagac tgatgaccat 150
<210> SEQ ID NO 33 <211> LENGTH: 49 <212> TYPE:
PRT <213> ORGANISM: Variola Virus <400> SEQUENCE: 33
Met Val Ile Ser Leu Val Ile Phe Val Ser Val Ala Ala Ala Ile Ile 1 5
10 15 Gly Val Leu Ser Asn Val Leu Glu Met Leu Met Tyr Val Glu Glu
Asn 20 25 30 Asn Glu Glu Asp Ala Arg Ile Lys Glu Glu Gln Glu Leu
Leu Leu Leu 35 40 45 Tyr <210> SEQ ID NO 34 <211>
LENGTH: 186854 <212> TYPE: DNA <213> ORGANISM:
Artificial Sequence <220> FEATURE: <223> OTHER
INFORMATION: LIVP Complete Genome <400> SEQUENCE: 34
ttccactatc tgtggtacga acggtttcat cttctttgat gccatcaccc agatgttcta
60 taaacttggt atcctcgtcc gatttcatat cctttgccaa ccaatacata
tagctaaact 120 caggcatatg ttccacacat cctgaacaat gaaattctcc
agaagatgtt acaatgtcta 180 gatttggaca tttggtttca accgcgttaa
catatgagtg aacacaccca tacatgaaag 240 cgatgagaaa taggattctc
atcttgccaa aatatcacta gaaaaaattt atttatcaat 300 tttaaaggta
taaaaaatac ttattgttgc tcgaatattt tgtatttgat ggtatacgga 360
agattagaaa tgtaggtatt atcatcaact gattctatgg ttttatgtat tctatcatgt
420 ttcactattg cgttggaaat aatatcatat gcttccacat atattttatt
ttgttttaac 480 tcataatact cacgtaattc tggattattg gcatatctat
gaataatttt agctccatga 540 tcagtaaata ttaatgagaa catagtatta
ccacctacca ttattttttt catctcattc 600
aattcttaat tgcaaagatc tatataatca ttatagcgtt gacttatgga ctctggaatc
660 ttagacgatg tacagtcatc tataatcatg gcatatttaa tacattgttt
tatagcatag 720 tcgttatcta cgatgttaga tatttctctc aatgaatcaa
tcacacaatc taatgtaggt 780 ttatgacata atagcatttt cagcagttca
atgtttttag attcgttgat ggcaatggct 840 atacatgtat atccgttatt
tgatctaatg ttgacatctg aaccggattc tagcagtaaa 900 gatactagag
attgtttatt atatctaaca gccttgtgaa gaagtgtttc tcctcgtttg 960
tcaatcatgt taatgtcttt aagataaggt aggcaaatgt ttatagtact aagaattggg
1020 caagcataag acatgtcaca aagacccttt tttgtatgta taagtgtaaa
aattataaca 1080 tccatagttg gatttacata ggtgtccaat cgggatctct
ccatcatcga gataattgat 1140 ggcatctccc ttcctttttt agtagatatt
tcatcgtgta agaatcaata ttaatatttc 1200 taaagtatcc gtgtatagcc
tctttattta ccacagctcc atattccact agagggatat 1260 cgccgaatgt
catatactca attagtatat gttggaggac atccgagttc attgttttca 1320
atatcaaaga gatggtttcc ttatcatttc tccatagtgg tacaatacta cacattattc
1380 cgtgcggctt tccattttcc aaaaacaatt tgaccaaatc taaatctaca
tctttattgt 1440 atctataatc actatttaga taatcagcca taattcctcg
agtgcaacat gttagatcgt 1500 ctatatatga ataagcagtg ttatctattc
ctttcattaa caatttaacg atgtctatat 1560 ctatatgaga tgacttaata
taatattgaa gagctgtaca atagttttta tctataaaag 1620 acggcttgat
tccgtgatta attagacatt taacaacttc cggacgcaca tatgctctcg 1680
tatccgactc tgaatacaga tgagagatga tatacagatg caatacggta ccgcaatttc
1740 gtagttgata atcatcatac gcgtatcagt actcgtcctc ataaagaaca
ctgcagccat 1800 tttctatgaa caaatcaata attttagaaa caggatcatt
gtcattacat aattttctat 1860 aactgaacga tggttttcac atttaacact
caagtcaaat ccatgttcta ccaacacctt 1920 tatcaagtca acgtctacat
ttttggattt catatagctg aatatattaa agttatttat 1980 gttgctaaat
ccagtggctt ctagtagagc catcgctata tccttattaa ctttaacatg 2040
tctactattt gtgtattctt ctaatggggt aagctgtctc caatttttgc gtaatggatt
2100 agtgccactg tctagtagta gtttgacgac ctcgacatta ttacaatgct
cattaaaaag 2160 gtatgcgtgt aaagcattat tcttgaattg gttcctggta
tcattaggat ctctgtcttt 2220 caacatctgt ttaagttcat caagagccac
ctcctcattt tccaaatagt caaacatttt 2280 gactgaatga gctactgtga
actctataca cccacacaac taatgtcatt aaatatcatg 2340 tcaaaaactt
gtacaattat taataaaaat aatttagtgt ttaaatttta ccagttccag 2400
attttacacc tccgttaata cctccattaa ccccactgga cgatcctcct ccccacattc
2460 caccgccacc agatgtataa gttttagatc ctttattact accatcatgt
ccatggataa 2520 agacactcca catgccgcca ctaccccctt tagaagacat
attaataaga cttaaggaca 2580 agtttaacaa taaaattaat cacgagtacc
ctactaccaa cctacactat tatatgatta 2640 tagtttctat ttttacagta
ccttgactaa agtttctagt cacaagagca atactaccaa 2700 cctacactat
tatatgatta tagtttctat ttttatagga acgcgtacga gaaaatcaaa 2760
tgtctaattt ctaacggtag tgttgataaa cgattgttat ccgcggatac ctcctctatc
2820 atgtcgtcta ttttcttact ttgttctatt aacttattag cattatatat
tatttgatta 2880 taaaacttat attgcttatt agcccaatct gtaaatatcg
gattattaac atatcgtttc 2940 tttgtaggtt tatttaacat gtacatcact
gtaagcatgt ccttaccatt tattttaatt 3000 tgacgcatat ccgcaatttc
tttttcgcag tcggttataa attctatata tgatggatac 3060 atgctacatg
tgtacttata atcgactaat atgaagtact tgatacatat tttcagtaac 3120
gatttattat taccacctat gaataagtac ctgtgatcgt ctaggtaatc aactgttttc
3180 ttaatacatt cgatggttgg taatttactc agaataattt ccaatatctt
aatatataat 3240 tctgctattt ctgggatata tttatctgcc agtataacac
aaatagtaat acatgtaaac 3300 ccatattttg ttattatatt aatgtctgcg
ccattatcta ttaaccattc tactaggctg 3360 acactatgcg actcaataca
atgataaagt atactacatc catgtttatc tattttgttt 3420 atatcatcaa
tatacggctt acaaagtttt agtatcgata acacatccaa ctcacgcata 3480
gagaaggtag ggaataatgg cataatattt attaggttat catcattgtc attatctaca
3540 actaagtttc cattttttaa aatatactcg acaactttag gatctctatt
gccaaatttt 3600 tgaaaatatt tatttatatg cttaaatcta tataatgtag
ctccttcatc aatcatacat 3660 ttaataacat tgatgtatac tgtatgataa
gatacatatt ctaacaatag atcttgtata 3720 gaatctgtat atcttttaag
aattgtggat attaggatat tattacataa actattacac 3780 aattctaaaa
tataaaacgt atcacggtcg aataatagtt gatcaactat ataattatcg 3840
attttgtgat ttttcttcct aaactgttta cgtaaatagt tagatagaat attcattagt
3900 tcatgaccac tatagttact atcgaataac gcgtcaaata tttcccgttt
aatatcgcat 3960 ttgtcaagat aataatagag tgtggtatgt tcacgataag
tataataacg catctctttt 4020 tcgtgtgaaa ttaaatagtt tattacgtcc
aaagatgtag cataaccatc ttgtgaccta 4080 gtaataatat aataatagag
aactgtttta cccattctat catcataatc agtggtgtag 4140 tcgtaatcgt
aatcgtctaa ttcatcatcc caattataat attcaccagc acgtctaatc 4200
tgttctattt tgatcttgta tccatactgt atgttgctac atgtaggtat tcctttatcc
4260 aataatagtt taaacacatc tacattggga tttgatgttg tagcgtattt
ttctacaata 4320 ttaataccat ttttgatact atttatttct atacctttcg
aaattagtaa tttcaataag 4380 tctatattga tgttatcaga acatagatat
tcgaatatat caaaatcatt gatattttta 4440 tagtcgactg acgacaataa
caaaatcaca acatcgtttt tgatattatt atttttcttg 4500 gtaacgtatg
cctttaatgg agtttcacca tcatactcat ataatggatt tgcaccactt 4560
tctatcaatg attgtgcact gctggcatcg atgttaaatg ttttacaact atcatagagt
4620 atcttatcgt taaccatgat tggttgttga tgctatcgca ttttttggtt
tctttcattt 4680 cagttatgta tggatttagc acgtttggga agcatgagct
catatgattt cagtactgta 4740 gtgtcagtac tattagtttc aataagatca
atctctagat ctatagaatc aaaacacgat 4800 aggtcagaag ataatgaata
tctgtaggct tcttgttgta ctgtaacttc tggttttgtt 4860 agatggttgc
atcgtgcttt aacgtcaatg gtacaaattt tatcctcgct ttgtgtatca 4920
tattcgtccc tactataaaa ttgtatattc agattatcat gcgatgtgta tacgctaacg
4980 gtatcaataa acggagcaca ccatttagtc ataaccgtaa tccaaaaatt
tttaaagtat 5040 atcttaacga aagaagttgt gtcattgtct acggtgtatg
gtactagatc ctcataagtg 5100 tatatatcta gagtaatgtt taatttatta
aatggttgat aatatggatc ctcgtgacaa 5160 tttccgaaga tggaaataag
acataaacac gcaataaatc taattgcgga catggttact 5220 ccttaaaaaa
atacgaataa tcaccttggc tatttagtaa gtgtcattta acactatact 5280
catattaatc catggactca taatctctat acgggattaa cggatgttct atatacgggg
5340 atgagtagtt ctcttcttta actttatact ttttactaat catatttaga
ctgatgtatg 5400 ggtaatagtg tttgaagagc tcgttctcat catcagaata
aatcaatatc tctgtttttt 5460 tgttatacag atgtattaca gcctcatata
ttacgtaata gaacgtgtca tctaccttat 5520 taactttcac cgcatagttg
tttgcaaata cggttaatcc tttgacctcg tcgatttccg 5580 accaatctgg
gcgtataatg aatctaaact ttaattgctt gtaatcattc gaaataattt 5640
ttagtttgca tccgtagtta tcccctttat gtaactgtaa atttctcaac gcgatatctc
5700 cattaataat gatgtcgaat tcgtgctgta tacccatact gaatggatga
acgaataccg 5760 acggcgttaa tagtaattta ctttttcatc tttacatatt
gggtactagt tttactatca 5820 taagtttata aattccacaa gctactatgg
aataagccaa ccatcttagt ataccacaca 5880 tgtcttaaag tttattaatt
aattacatgt tgttttatat atatcgctac gaatttaaag 5940 agaaattagt
ttaggaagaa aaattatcta tctacatcat cacgtctctg tattctacga 6000
tagagtgcta ctttaagatg cgacagatcc gtgtcatcaa atatatactc cattaaaatg
6060 attattccgg cagcgaactt gatattggat atatcacaac ctttgttaat
atctacgaca 6120 atagacagca gtcccatggt tccataaaca gtgagtttat
ctttctttga agagatattt 6180 tgtagagatc ttataaaact gtcgaatgac
atcgcattta tatctttagc taaatcgtat 6240 atgttaccat cgtaatatct
aaccgcgtct atcttaaacg tttccatcgc tttaaagacg 6300 tttccgatag
atggtctcat ttcatcagtc atactgagcc aacaaatata atcgtgtata 6360
acatctttga tagaatcaga ctctaaagaa aacgaatcgg ctttattata cgcattcatg
6420 ataaacttaa tgaaaaatgt ttttcgttgt ttaagttgga tgaatagtat
gtcttaataa 6480 ttgttattat ttcattaatt aatatttagt aacgagtaca
ctctataaaa acgagaatga 6540 cataactaat cataactagt tatcaaagtg
tctaggacgc gtaattttca tatggtatag 6600 atcctgtaag cattgtctgt
attctggagc tattttctct atcgcattag tgagttcaga 6660 atatgttata
aatttaaatc gaataacgaa cataacttta gtaaagtcgt ctatattaac 6720
tcttttattt tctagccatc gtaataccat gtttaagata gtatattctc tagttactac
6780 gatctcatcg ttgtctagaa tatcacatac tgaatctaca tccaatttta
gaaattggtc 6840 tgtgttacat atctcttcta tattattgtt gatgtattgt
cgtagaaaac tattacgtag 6900 accattttct ttataaaacg aatatatagt
actccaatta tctttaccga tatatttgca 6960 cacataatcc attctctcaa
tcactacatc tttaagattt tcgttgttaa gatatttggc 7020 taaactatat
aattctatta gatcatcaac agaatcagta tatatttttc tagatccaaa 7080
gacgaactct ttggcgtcct ctataatatt cccagaaaag atattttcgt gttttagttt
7140 atcgagatct gatctgttca tatacgccat gattgtacgg tacgttatga
taaccgcata 7200 aaataaaaat ccattttcat ttttaaccaa tactattcat
aattgagatt gatgtaatac 7260 tttgttactt tgaacgtaaa gacagtacac
ggatccgtat ctccaacaag cacgtagtaa 7320 tcaaatttgg tgttgttaaa
cttcgcaata ttcatcaatt tagatagaaa cttatactca 7380 tcatctgttt
taggaatcca tgtattatta ccactttcca acttatcatt atcccaggct 7440
atgtttcgtc catcatcgtt gcgcagagtg aataattctt ttgtattcgg tagttcaaat
7500 atatgatcca tgcatagatc ggcaaagcta ttgtagatgt gatttttcct
aaatctaata 7560 taaaactcgt ttactagcaa acactttcct gatttatcga
ccaagacaca tatggtttct 7620 aaatctatca agtggtgggg atccatagtt
atgacgcagt aacatatatt attacattct 7680 tgactgtcgc taatatctaa
atatttattg ttatcgtatt ggattctgca tatagatggc 7740 ttgtatgtca
aagatataga acacataacc aatttatagt cgcgctttac attctcgaat 7800
ctaaagttaa gagatttaga aaacattata tcctcggatg atgttatcac tgtttctgga
7860 gtaggatata ttaaagtctt tacagatttc gtccgattca aataaatcac
taaataatat 7920 cccacattat catctgttag agtagtatca ttaaatctat
tatattttat gaaagatata 7980 tcactgctca cctctatatt tcgtacattt
ttaaactgtt tgtataatat ctctctgata 8040 caatcagata tatctattgt
gtcggtagac gataccgtta catttgaatt aatggtgttc 8100
cattttacaa cttttaacaa gttgaccaat tcatttctaa tagtatcaaa ctctccatga
8160 ttaaatattt taatagtatc cattttatat cactacggac acaaagtagc
tgacataaac 8220 cattgtataa tttttatgtt ttatgtttat tagcgtacac
attttggaag ttccggcttc 8280 catgtatttc ctggagagca agtagatgat
gaggaaccag atagtttata tccgtacttg 8340 cacttaaagt ctacattgtc
gttgtatgag tatgatcttt taaacccgct agacaagtat 8400 ccgtttgata
ttgtaggatg tggacattta acaatctgac acgtgggtgg atcggaccat 8460
tctcctcctg aacacaggac actagagtta ccaatcaacg aatatccact attgcaacta
8520 taagttacaa cgctcccatc ggtataaaaa tcctcgtatc cgttatgtct
tccgttggat 8580 atagatggag gggattggca tttaacagat tcacaaatag
gtgcctcggg attccatacc 8640 atagatccag tagatcctaa ttcacaatac
gatttagatt caccgatcaa ctgatatccg 8700 ctattacaag agtacgttat
actagagcca aagtctactc caccaatatc aagttggcca 8760 ttatcgatat
ctcgaggcga tgggcatctc cgtttaatac attgattaaa gagtgtccat 8820
ccagtacctg tacatttagc atatataggt cccatttttt gctttctgta tccaggtaga
8880 catagatatt ctatagtgtc tcctatgttg taattagcat tagcatcagt
ctccacacta 8940 ttcttaaatt tcatattaat gggtcgtgac ggaatagtac
agcatgatag aacgcatcct 9000 attcccaaca atgtcaggaa cgtcacgctc
tccaccttca tatttattta tccgtaaaaa 9060 tgttatcctg gacatcgtac
aaataataaa aagcccatat atgttcgcta ttgtagaaat 9120 tgtttttcac
agttgctcaa aaacgatggc agtgacttat gagttacgtt acactttgga 9180
gtctcatctt tagtaaacat atcataatat tcgatattac gagttgacat atcgaacaaa
9240 ttccaagtat ttgattttgg ataatattcg tattttgcat ctgctataat
taagatataa 9300 tcaccgcaag aacacacgaa catctttcct acatggttaa
agtacatgta caattctatc 9360 catttgtctt ccttaactat atatttgtat
agataattac gagtctcgtg agtaattcca 9420 gtaattacat agatgtcgcc
gtcgtactct acagcataaa ctatactatg atgtctaggc 9480 atgggagact
tttttatcca acgattttta gtgaaacatt ccacatcgtt taatactaca 9540
tatttctcat acgtggtata aactccaccc attacatata tatcatcgtt tacgaatacc
9600 gacgcgcctg aatatctagg agtaattaag tttggaagtc ttatccattt
cgaagtgccg 9660 tgtttcaaat attctgccac acccgttgaa atagaaaatt
ctaatcctcc tattacatat 9720 aactttccat cgttaacaca agtactaact
tctgatttta acgacgacat attagtaacc 9780 gttttccatt ttttcgtttt
aagatctacc cgcgatacgg aataaacatg tctattgtta 9840 atcatgccgc
caataatgta tagacaatta tgtaaaacat ttgcattata gaattgtcta 9900
tctgtattac cgactatcgt ccaatattct gttctaggag agtaatgggt tattgtggat
9960 atataatcag agtttttaat gactactata ttatgtttta taccatttcg
tgtcactggc 10020 tttgtagatt tggatatagt taatcccaac aatgatatag
cattgcgcat agtattagtc 10080 ataaacttgg gatgtaaaat gttgatgata
tctacatcgt ttggattttt atgtatccac 10140 tttaataata tcatagctgt
aacatcctca tgatttacgt taacgtcttc gtgggataag 10200 atagttgtca
gttcatcctt tgataatttt ccaaattctg gatcggatgt caccgcagta 10260
atattgttga ttatttctga catcgacgca ttatatagtt ttttaattcc atatctttta
10320 gaaaagttaa acatccttat acaatttgtg aaattaatat tatgaatcat
agtttttaca 10380 catagatcta ctacaggcgg aacatcaatt attatggcag
caactagtat catttctaca 10440 ttgtttatgg tgatgtttat cttcttccag
cgcatatagt ctaatagcga ttcaaacgcg 10500 tgatagttta taccattcaa
tataatcgct tcatccttta gatggtgatc ctgaatgcgt 10560 ttaaaaaaat
tatacggaga cgccgtaata atttccttat tcacttgtat aatttcccca 10620
ttgatagaaa atattacgct ttccattctt aaagtactat aagtaattat agtataatgt
10680 aaacgtttat atattcaata tttttataaa aatcattttg acattaattc
ctttttaaat 10740 ttccgtctat catctataga aacgtattct atgaatttat
aaaatgcttt tacgtgtcct 10800 atcgtaggcg atagaaccgc taaaaagcct
atcgaatttc tacaaaagaa tctgttatat 10860 ggtataggga gagtataaaa
cattaaatgt ccgtacttat taaagtattc agtagccaat 10920 cctaactctt
tcgaatactt attaatggct cttgttctgt acgaatctat ttttttgaac 10980
aacggaccta gtggtatatc ttgttctatg tatctaaaat aatgtctgac tagatccgtt
11040 agtttaatat ccgcagtcat cttgtctaga atggcaaatc taactgcggg
tttaggcttt 11100 agtttagttt ctatatctac atctatgtct ttatctaaca
ccaaaaatat aatagctaat 11160 attttattac aatcatccgg atattcttct
acgatctcac taactaatgt ttctttggtt 11220 atactagtat agtcactatc
ggacaaataa agaaaatcag atgatcgatg aataatacat 11280 ttaaattcat
catctgtaag atttttgaga tgtctcatta gaatattatt agggttagta 11340
ctcattatca ttcggcagct attacttatt ttattatttt tcaccatata gatcaatcat
11400 tagatcatca aaatatgttt caatcatcct aaagagtatg gtaaatgact
cttcccatct 11460 aatttctgaa cgttcaccaa tgtctctagc cactttggca
ctaatagcga tcattcgctt 11520 agcgtcttct atattattaa ctggttgatt
caatctatct agcaatggac cgtcggacag 11580 cgtcattctc atgttcttaa
tcaatgtaca tacatcgccg tcatctacca attcatccaa 11640 caacataagc
tttttaaaat catcattata ataggtttga tcgttgtcat ttctccaaag 11700
aatatatcta ataagtagag tcctcatgct tagttaacaa ctatttttta tgttaaatca
11760 attagtacac cgctatgttt aatacttatt catattttag tttttaggat
tgagaatcaa 11820 tacaaaaatt aatgcatcat taattttaga aatacttagt
ttccacgtag tcaatgaaac 11880 atttgaactc atcgtacagg acgttctcgt
acaggacgta actataaacc ggtttatatt 11940 tgttcaagat agatacaaat
ccgataactt tttttacgaa ttctacggga tccactttaa 12000 aagtgtcata
ccgggttctt tttatttttt taaacagatc aatggtgtga tgttgattag 12060
gtcttttacg aatttgatat agaatagcgt ttacatatcc tccataatgg tcaatcgcca
12120 tttgttcgta tgtcataaat tctttaatta tatgacactg tgtattattt
agttcatcct 12180 tgttcattgt taggaatcta tccaaaatgg caattatact
agaactatag gtgcgttgta 12240 tacacatatt gatgtgtctg tttatacaat
caatgctact accttcgggt aaaattgtag 12300 catcatatac catttctagt
actttaggtt cattattatc cattgcagag gacgtcatga 12360 tcgaatcata
aaaaaatata ttatttttat gttattttgt taaaaataat catcgaatac 12420
ttcgtaagat actccttcat gaacataatc agttacaaaa cgtttatatg aagtaaagta
12480 tctacgattt ttacaaaagt ccggatgcat aagtacaaag tacgcgataa
acggaataat 12540 aatagattta tctagtctat ctttttctat agctttcata
gttagataca tggtctcaga 12600 agtaggatta tgtaacatca gcttcgataa
aatgactggg ttatttagtc ttacacattc 12660 gctcatacat gtatgaccgt
taactacaga gtctacacta aaatgattga acaatagata 12720 gtctaccatt
gtttcgtatt cagatagtac agcgtagtac atggcatctt cacaaattat 12780
atcattgtct aatagatatt tgacgcatct tatggatccc acttcaacag ccatcttaaa
12840 atcggtagaa tcatattgct ttcctttatc attaataatt tctagaacat
catctctatc 12900 ataaaagata caaatattaa ctgtttgatc cgtaataaca
ttgctagtcg atagcaattt 12960 gttaataaga tgcgctgggc tcaatgtctt
aataagaagt gtaagaggac tatctccgaa 13020 tttgttttgt ttattaacat
ccgttgatgg aagtaaaaga tctataatgt ctacattctt 13080 gactgtttta
gagcatacaa tatggagagg tgtatttcca tcatgatctg gttttgaggg 13140
actaattcct agtttcatca tccatgagat tgtagaagct tttggattgt ctgacataag
13200 atgtctatga atatgatttt tgccaaattt atccactatc ctggcttcga
atccgatgga 13260 cattattttt ttaaacactc tttctgaagg atctgtacac
gccaacaacg gaccacatcc 13320 ttcttcatca accgagttgt taatcttggc
tccatactgt accaataaat ttattctctc 13380 tatgacttca tcatctgttc
ccgagagata atatagaggc gttttatgct gtttatcaca 13440 cgcgtttgga
tctgcgccgt gcgtcagcag catcgcgact attctattat tattaatttt 13500
agaagctata tgcaatggat aatttccatc atcatccgtc tcatttggag agtatcctct
13560 atgaagaagt tcttcgacaa atcgttcatc tagtccttta attccacaat
acgcatgtag 13620 aatgtgataa ttatttccag aaggttcgat agcttgtagc
atattcctaa atacatctaa 13680 atttttacta ttatatttgg cataaagaga
tagataatac tcggccgaca taatgttgtc 13740 cattgtagta taaaaattaa
tatttctatt tctgtatatt tgcaacaatt tactctctat 13800 aacaaatatc
ataacttagt tcttttatgt caagaaggca ctggtttagt tcatctataa 13860
atgtcacgcc ataactacca cgcatgccat actcagaatt atgataaaga tatttatcct
13920 tggggtgtag gtaatgggga ttaatctttg ttggatcagt ctctaagtta
acacatgtca 13980 cacatgatcc atttatagtt atatcacacg atgatgattt
atgaattgat tccggaagat 14040 cgctatcgta ttttgtggtt ccacaattca
tttccataca tgttattgtc acactaatat 14100 tatgatgaac tttatctagc
cgctgagtgg taaacaacag aacagatagt ttattatctt 14160 taccaacacc
ctcagccgct gccacaaatc tctgatccgt atccatgatg gtcatgttta 14220
tttctagtcc gtatccagtc aacactatgt tagcatttct gtcgatatag ctttcactca
14280 tatgacactc accaataata gtagaattaa tgtcgtaatt tacaccaata
gtgagttcgg 14340 cggcaaagta ccaataccgg taatcttgtc gaggaggaca
tatagtattc ttgtattcta 14400 ccgaataccc gagagatgcg atacaaaaga
gcaagactaa tttgtaaacc atcttactca 14460 aaatatgtaa caatagtacg
atgcaatgag taagacaata ggaaatctat cttatataca 14520 cataattatt
ctatcaattt taccaattag ttagtgtaat gttaacaaaa atgtgggaga 14580
atctaattag tttttcttta cacaattgac gtacatgagt ctgagttcct tgtttttgct
14640 aattatttca tccaatttat tattcttgac gatatcgaga tcttttgtat
aggagtcaaa 14700 cttgtattca acatgctttt ctataatcat tttagctatt
tcggcatcat ccaatagtac 14760 attttccaga ttagcagaat agatattaat
gtcgtatttg aacagagcct gtaacatctc 14820 aatgtcttta ttatctatag
ccaatttaat gtccggaatg aagagaaggg aattattggt 14880 gtttgtcgac
gtcatatagt cgagcaagag aatcatcata tccacgtgtc cattttttat 14940
agtgatgtga atacaactaa ggagaatagc cagatcaaaa gtagatggta tctctgaaag
15000 aaagtaggaa acaatactta catcattaag catgacggca tgataaaatg
aagttttcca 15060 tccagttttc ccatagaaca tcagtctcca atttttctta
acaaacagtt ttaccgtttg 15120 catgttacca ctatcaaccg cataatacaa
tgcggtgttt cccttgtcat caaattgtga 15180 atcatccagt ccactgaata
gcaaaatctt tactattttg gtatcttcca atgtggctgc 15240 ctgatgtaat
ggaaattcat tctctagaag atttttcaat gctccagcgt tcaacaacgt 15300
acatactaga cgcacgttat tatcagctat tgcataatac aaggcactat gtccatggac
15360 atccgcctta aatgtatctt tactagagag aaagcttttc agctgcttag
acttccaagt 15420 attaattcgt gacagatcca tgtctgaaac gagacgctaa
ttagtgtata ttttttcatt 15480 ttttataatt ttgtcatatt gcaccagaat
taataatatc tttaatagat ctgattagta 15540 gatacatggc tatcgcaaaa
caacatatac acatttaata aaaataatat ttattaagaa 15600 aattcagatt
tcacgtaccc atcaatataa ataaaataat gattccttac accgtaccca 15660
tattaaggag attccacctt acccataaac aatataaatc cagtaatatc atgtctgatg
15720 atgaacacaa atggtgtatt aaattccagt ttttcaggag atgatctcgc
cgtagctacc 15780 ataatagtag atgcctctgc tacagttcct tgttcgtcga
catctatctt tgcattctga 15840 aacattttat aaatatataa tgggtcccta
gtcatatgtt taaacgacgc attatctgga 15900 ttaaacatac taggagccat
catttcggct atcgacttaa tatccctctt attttcgata 15960 gaaaatttag
ggagtttaag attgtacact ttattcccta attgagacga ccaatagtct 16020
aattttgcag ccgtgataga atctgtgaaa tgggtcatat tatcacctat tgccaggtac
16080 atactaatat tagcatcctt atacggaagg cgtaccatgt catattcttt
gtcatcgatt 16140 gtgattgtat ttccttgcaa tttagtaact acgttcatca
tgggaaccgt tttcgtaccg 16200 tacttattag taaaactagc attgcgtgtt
ttagtgatat caaacggata ttgccatata 16260 cctttaaaat atatagtatt
aatgattgcc catagagtat tattgtcgag catattagaa 16320 tctactacat
tagacatacc ggatctacgt tctactatag aattaatttt attaaccgca 16380
tctcgtctaa agtttaatct atataggccg aatctatgat attgttgata atacgacggt
16440 ttaatgcaca cagtattatc tacgaaactt tgataagtta gatcagtgta
cgtatattta 16500 gatgttttca gcttagctaa tcctgatatt aattctgtaa
atgctggacc cagatctctt 16560 tttctcaaat ccatagtctt caataattct
attctagtat tacctgatgc aggcaatagc 16620 gacataaaca tagaaaacga
ataaccaaac ggtgagaaga caatattatc atcttgaata 16680 tttttatacg
ctactatacc ggcattggta aatccttgta gacgataggc ggacgctgaa 16740
cacgctaacg atagtatcaa taacgcaatc atgattttat ggtattaata attaacctta
16800 tttttatgtt cggtataaaa aaattattga tgtctacaca tccttttgta
attgacatct 16860 atatatcctt ttgtataatc aactctaatc actttaactt
ttacagtttt ccctaccagt 16920 ttatccctat attcaacata tctatccata
tgcatcttaa cactctctgc caagatagct 16980 tcagagtgag gatagtcaaa
aagataaata tatagagcat aatcattctc gtatactctg 17040 ccctttatta
catcacccgc attgggcaac gaataacaaa atgcaagcat cttgttaacg 17100
ggctcgtaaa ttgggataaa aattatgttt ttattgtctt atatctattt tattcaagag
17160 aatattcagg aatttctttt tccggttgta tctcgtcgca gtatatatca
tttgtacatt 17220 gtttcatatt ttttaatagt ttacaccttt tagtaggact
agtatcgtac aattcatagc 17280 tgtattttga attccaatca cgcataaaaa
tatcttccaa ttgttgacga agacctaatc 17340 catcatccgg tgtaatatta
atagatgctc cacatgtatc cgtaaagtaa tttcctgtcc 17400 aatttgaggt
acctatatag gccgttttat cggttaccat atatttggca tggtttaccc 17460
tagaatacgg aatgggagga tcagcatctg gtacaataaa tagctttact tctatattta
17520 tgtttttaga ttttagcata gcgatagatc ttaaaaagtt tctcatgata
aacgaagatc 17580 gttgccagca actaatcaat agcttaacgg atacttgtct
gtctatagcg gatcttctta 17640 attcatcttc tatataaggc caaaacaaaa
ttttacccgc cttcgaataa ataataggga 17700 taaagttcat aacagataca
taaacgaatt tactcgcatt tctaatacat gacaataaag 17760 cggttaaatc
attggttctt tccatagtac atagttgttg cggtgcagaa gcaataaata 17820
cagagtgtgg aacgccgctt acgttaatac taagaggatg atctgtatta taatacgacg
17880 gataaaagtt tttccaatta tatggtagat tgttaactcc aagataccag
tatacctcaa 17940 aaatttgagt gagatccgct gccaagttcc tattattgaa
gatcgcaata cccaattcct 18000 tgacctgagt tagtgatctc caatccatgt
tagcgcttcc taaataaata tgtgtattat 18060 cagatatcca aaattttgta
tgaagaactc ctcctaggat atttgtaata tctatgtatc 18120 gtacttcaac
tccggccatt tgtagtcttt caacatcctt taatggtttg ttagatttat 18180
taacggctac tctaactcgt actcctcttt tgggtaattg tacaatctcg tttaatatta
18240 tcgtgccgaa attcgtaccc acttcatccg ataaactcca ataaaaagat
gatatatcta 18300 gtgtttttgt ggtattggat agaatttccc tccacatgtt
aaatgtagac aaatatactt 18360 tatcaaattg catacctata ggaatagttt
ctgtaatcac tgcgattgta ttatccggat 18420 tcattttatt tgttaaaaga
ataatcctat atcacttcac tctattaaaa atccaagttt 18480 ctatttcttt
catgactgat tttttaactt catccgtttc cttatgaaga tgatgtttgg 18540
caccttcata aatttttatt tctctattac aatttgcatg ttgcatgaaa taatatgcac
18600 ctaaaacatc gctaatctta ttgtttgttc cctggagtat gagagtcggg
ggggtgttaa 18660 tcttggaaat tatttttcta accttgttgg tagccttcaa
gacctgacta gcaaatccag 18720 ccttaatttt ttcatgattg actaatgggt
cgtattggta tttataaact ttatccatat 18780 ctctagatac tgattctgga
catagctttc cgactggcgc atttggtgtg atggttccca 18840 taagtttggc
agctagcaga ttcagtcttg aaacagcatc tgcattaact agaggagaca 18900
ttagaatcat tgctgtaaac aagtttggat tatcgtaaga ggctagctcc catggaatga
18960 cccaataagt agatttaata gttaccacgt gctgtaccaa agtcatcaat
catcattttt 19020 tcaccattac ttcttccatg tccaatatga tcatgtgaga
atactaaaat tcctaacgat 19080 gatatgtttt cagctagttc gtcataacgt
ccagaatgtt taccagctcc atgacttatg 19140 aatactaatg ccttaggata
tgtaataggt ttccaatatt tacaatatat gtaatcattg 19200 tccagattga
acatacagtt tgcactcatg attcacgtta tataactatc aatattaaca 19260
gttcgtttga tgatcatatt atttttatgt tttattgata attgtaaaaa catacaatta
19320 aatcaatata gaggaaggag acggctactg tcttttgtaa gatagtcatg
gcgactaaat 19380 tagattatga ggatgctgtt ttttactttg tggatgatga
taaaatatgt agtcgcgact 19440 ccatcatcga tctaatagat gaatatatta
cgtggagaaa tcatgttata gtgtttaaca 19500 aagatattac cagttgtgga
agactgtaca aggaattgat gaagttcgat gatgtcgcta 19560 tacggtacta
tggtattgat aaaattaatg agattgtcga agctatgagc gaaggagacc 19620
actacatcaa ttttacaaaa gtccatgatc aggaaagttt attcgctacc ataggaatat
19680 gtgctaaaat cactgaacat tggggataca aaaagatttc agaatctaga
ttccaatcat 19740 tgggaaacat tacagatttg atgaccgacg ataatataaa
catcttgata ctttttctag 19800 aaaaaaaatt gaattgatga tataggggtc
ttcataacgc ataattatta cgttagcatt 19860 ctatatccgt gttaaaaaaa
attatcctat catgtatttg agagttttat atgtagcaaa 19920 catgatagct
gtgatgccaa taagctttag atattcacgc gtgctagtgt tagggatggt 19980
attatctggt ggtgaaatgt ccgttatata atctacaaaa caatcatcgc atatagtatg
20040 cgatagtaga gtaaacattt ttatagtttt tactggattc atacatcgtc
tacccaattc 20100 ggttataaat gaaattgtcg ccaatcttac acccaacccc
ttgttatcca ttagcatagt 20160 attaacttcg ttatttatgt cataaactgt
aaatgatttt gtagatgcca tatcatacat 20220 gatattcatg tccctattat
aatcattact aactttatca caatatatgt tgataatatc 20280 tatatatgat
ctagtctttg tgggcaactg tctatacaag tcgtctaaac gttgtttact 20340
catatagtat cgaacagcca tcattacatg gtcccgttcc gttgatagat aatcgagtat
20400 gttagtggac ttgtcaaatc tatataccat attttctgga agtggatata
catagtcgtg 20460 atcaacatta ttgctagcct catcttctat atcctgtact
ataccattat ctatatcatc 20520 tacataatct atgatattat tacacataaa
catcgacaac atactattgt ttattatcta 20580 agtcctgttg atccaaaccc
ttgatctcct ctatttgtac tatctagaga ttgtacttct 20640 tccagttctg
gataatatat acgttgatag attagctgag ctattctatc tccagtattt 20700
acattaaacg tacattttcc attattaata agaatgactc ctatgtttcc cctataatct
20760 tcgtctatta caccacctcc tatatcaatg ccttttagtg acagaccaga
cctaggagct 20820 attctaccat agcagaactt aggcatggac atactaatat
ctgtcttaat taactgtctt 20880 tctcctggag ggatagtata atcgtaagcg
ctatacaaat catatccggc agcacccggc 20940 gattgcctag taggagattt
agctctgtta gtttccttaa caaatctaac tggtgagtta 21000 atattcatgt
tgaacataaa actaatattt tatttcaaaa ttatttacca tcccatatat 21060
tccatgaata agtgtgatga ttgtacactt ctatagtatc tatatacgat ccacgataaa
21120 atcctcctat caatagcagt ttattatcca ctatgatcaa ttctggatta
tccctcggat 21180 aaataggatc atctatcaga gtccatgtat tgctggattc
acaataaaat tccgcatttc 21240 taccaaccaa gaataacctt ctaccgaaca
ctaacgcgca tgatttataa tgaggataat 21300 aagtggatgg tccaaactgc
cactgatcat gattgggtag caaatattct gtagttgtat 21360 cagtttcaga
atgtcctccc attacgtata taacattgtt tatggatgcc actgctggat 21420
tacatctagg tttcagaaga ctcggcatat taacccaagc agcatccccg tggaaccaac
21480 gctcaacaga tgtgggattt ggtagacctc ctactacgta taatttattg
ttagcgggta 21540 tcccgctagc atacagtctg gggctattca tcggaggaat
tggaatccaa ttgtttgata 21600 tataatttac cgctatagca ttgttatgta
tttcattgtt catccatcca ccgatgagat 21660 atactacttc tccaacatga
gtacttgtac acatatggaa tatatctata atttgatcca 21720 tgttcatagg
atactctatg aatggatact tgtatgattt gcgtggttgt ttatcacaat 21780
gaaatatttt ggtacagtct agtatccatt ttacattatt tatacctctg ggagaaagat
21840 aatttgacct gattacattt ttgataagga gtagcagatt tcctaattta
tttcttcgct 21900 ttatatacca cttaatgaca aaatcaacta cataatcctc
atctggaaca tttagttcat 21960 cgctttctag aataagtttc atagatagat
aatcaaaatt gtctatgatg tcatcttcca 22020 gttccaaaaa gtgtttggca
ataaagtttt tagtatgaca taagagattg gatagtccgt 22080 attctatacc
catcatgtaa cactcgacac aatattcctt tctaaaatct cgtaagataa 22140
agtttataca agtgtagatg ataaattcta cagaggttaa tatagaagca cgtaataaat
22200 tgacgacgtt atgactatct atatatacct ttccagtata cgagtaaata
actatagaag 22260 ttaaactgtg aatgtcaagg tctagacaaa ccctcgtaac
tggatcttta tttttcgtgt 22320 atttttgacg taaatgtgtg cgaaagtaag
gagataactt tttcaatatc gtagaattga 22380 ctattatatt gcctcctatg
gcatcaataa ttgttttgaa tttcttagtc atagacaatg 22440 ctaatatatt
cttacagtac acagtattga caaatatcgg catttatgtt tctttaaaag 22500
tcaacatcta gagaaaaatg attatctttt tgagacataa ctcccatttt ttggtattca
22560 cccacacgtt tttcgaaaaa attagttttt ccttccaatg atatattttc
catgaaatca 22620 aacggattgg taacattata aattttttta aatcccaatt
cagaaatcaa tctatccgcg 22680 acgaattcta tatatgtttt catcatttca
caattcattc ctataagttt aactggaaga 22740 gccgcagtaa gaaattcttg
ttcaatggat actgcatctg ttataataga tctaacggtt 22800 tcttcactcg
gtggatgcaa taaatgttta aacatcaaac atgcgaaatc gcagtgcaga 22860
ccctcgtctc tactaattag ttcgttggaa aacgtgagtc cgggcattag gccacgcttt
22920 ttaagccaaa atatggaagc gaatgatccg gaaaagaaga ttccttctac
tgcagcaaag 22980 gcaataagtc tctctccata accggcgctg tcatgtatcc
acttttgagc ccaatcggcc 23040 ttctttttta cacaaggcat cgtttctatg
gcattaaaga gatagttttt ttcattacta 23100 tctttaacat aagtatcgat
caaaagacta tacatttccg aatgaatgtt ttcaatggcc 23160
atctgaaatc cgtagaaaca tctagcctcg gtaatctgta cttctgtaca aaatcgttcc
23220 gccaaatttt cattcactat tccgtcactg gctgcaaaaa acgccaatac
atgttttata 23280 aaatattttt cgtctggtgt tagtttattc caatcattga
tatctttaga tatatctact 23340 tcttccactg tccaaaatga tgcctctgcc
tttttataca tgttccagat gtcatgatat 23400 tggattggga aaataacaaa
tctatttgga tttggtgcaa ggatgggttc cataactaaa 23460 ttaacaataa
caataaattt tttttcagtt atctatatgc ctgtacttgg attttttgta 23520
catcgatatc gccgcaatca ctacaataat tacaagtatt attgatagca ttgttattag
23580 tactatcata attaaattat ctacattcat gggtgctgaa taatcgttat
tatcatcatt 23640 atcattttgt aattgtgaca tcatactaga taaatcgttt
gcgagattgt tgtgggaagc 23700 gggcatggag gatgcattat cattattatt
taacgccttc catttggatt cacaaatgtt 23760 acgcacattc aacattttat
ggaaactata attttgtgaa aacaaataac aagaaaactc 23820 gtcatcgttc
aaatttttaa cgatagtaaa ccgattaaac gtcgagctaa tttctaacgc 23880
tagcgactct gttggatatg ggtttccaga tatatatctt ttcagttccc ctacgtatct
23940 ataatcatct gtaggaaatg gaagatattt ccatttatct actgttccta
atatcatatg 24000 tggtggtgta gtagaaccat taagcgcgaa agatgttatt
tcgcatcgta ttttaacttc 24060 gcaataattt ctggttagat aacgcactct
accagtcaag tcaatgatat tagcctttac 24120 agatatattc atagtagtcg
taacgatgac tccatctttt agatgcgata ctcctttgta 24180 tgtaccagaa
tcttcgtacc tcaaactcga tatatttaaa caagttaatg agatattaac 24240
gcgttttatg aatgatgata tataaccaga agttttatcc tcggtggcta gcgctataac
24300 cttatcatta taataccaac tagtgtgatt aatatgtgac acgtcagtgt
gggtacaaat 24360 atgtacatta tcgtctacgt cgtattcgat acatccgcat
acagccaaca aatataaaat 24420 gacaaatact ctaacgccgt tcgtacccat
cttgatgcgg tttaataaat gttttgattt 24480 caatttattg taaaaaaaga
ttcggtttta tactgttcga tattctcatt gcttatattt 24540 tcatctatca
tctccacaca gtcaaatccg tggttagcat gcacctcatc aaccggtaaa 24600
agactatcgg actcttctat cattataact ctagaatatt taatttggtc attattaatc
24660 aagtcaatta tcttattttt aacaaacgtg agtattttac tcatttttta
taaaaacttt 24720 tagaaatata cagactctat cgtgtgtcta tatcttcttt
ttatatccaa tgtatttatg 24780 tctgattttt cttcatttat catatataat
ggtccaaatt ctacacgtgc ttcggattca 24840 tccagatcat taaggttctt
ataattgtaa catccttctc ttccctcttc tacatcttcc 24900 ttcttattct
tattcttagc gtcacagaat ctaccacagc aggatcccat gacgagcgtc 24960
atattaaact aatccatttt caattataat atatgattag taatgaccat taaaataaaa
25020 aatattcttc ataaccggca agaaagtgaa aagttcacat tgaaactatg
tcagtagtat 25080 acatcatgaa atgatgatat atatatactc tattttggtg
gaggattata tgatataatt 25140 cgtggataat catttttaag acacatttct
ttattcgtaa atcttttcac gttaaatgag 25200 tgtccatatt ttgcaatttc
ttcatatgat ggcggtgtac gtggacgagg ctgctcctgt 25260 tcttgttgtg
gtcgccgact gtcgtgtctg cgtttagatc cctccattat cgcgattgcg 25320
tagatggagt actattttat accttgtaat taaatttttt tattaattaa acgtataaaa
25380 acgttccgta tctgtattta agagccagat ttcgtctaat agaacaaata
gctacagtaa 25440 aaataactag aataattgct acacccacta gaaaccacgg
atcgtaatac ggcaatcggt 25500 tttcgataat aggtggaacg tatattttat
ttaaggactt aacaattgtc tgtaaaccac 25560 aatttgcttc cgcggatcct
gtattaacta tctgtaaaag catatgttga ccgggcggag 25620 ccgaacattc
tccgatatct aatttctgta tatctataat attattaacc tccgcatacg 25680
cattacagtt cttttctagc ttggataccg cactaggtac atcgtctaga tctattccta
25740 tttcctcagc gatagctctt ctatcctttt ccggaagcaa tgaaatcact
tcaataaatg 25800 attcaaccat gagtgtgaaa ctaagtcgag aattactcat
gcatttgtta gttattcgga 25860 gcgcgcaatt tttaaactgt cctataacct
ctcctatatg aatagcacaa gtgacattag 25920 tagggataga atgttgagct
aatttttgta aataactatc tataaaaaga ttatacaaag 25980 ttttaaactc
tttagtttcc gccatttatc cagtctgaga aaatgtctct cataataaat 26040
ttttccaaga aactaattgg gtgaagaatg gaaaccttta atctatattt atcacagtct
26100 gttttggtac acatgatgaa ttcttccaat gccgtactaa attcgatatc
tttttcgatt 26160 tctggatatg tttttaataa agtatgaaca aagaaatgga
aatcgtaata ccagttatgt 26220 ttaactttga aattgttttt tattttcttg
ttaatgattc cagccacttg ggaaaagtca 26280 aagtcgttta atgccgattt
aatacgttca ttaaaaacaa actttttatc ctttagatga 26340 attattattg
gttcattgga atcaaaaagt aagatattat cgggtttaag atctgcgtgt 26400
aaaaagttgt cgcaacaggg tagttcgtag attttaatgt ataacagagc catctgtaaa
26460 aagataaact ttatgtattg taccaaagat ttaaatccta atttgatagc
taactcggta 26520 tctactttat ctgccgaata cagtgctagg ggaaaaatta
taatgtttcc tctttcatat 26580 tcgtagttag ttctcttttc atgttcgaaa
aagtgaaaca tgcggttaaa atagtttata 26640 acattaatat tactgttaat
aactgccgga taaaagtggg atagtaattt cacgaatttg 26700 atactgtcct
ttctctcgtt aaacgccttt aaaaaaactt tagaagaata tctcaatgag 26760
agttcctgac catccatagt ttgtatcaat aatagcaaca tatgaagaac acgtttatac
26820 agagtatgta aaaatgttaa tttatagttt aatcccatgg cccacgcaca
cacgattaat 26880 tttttttcat ctccctttag attgttgtat agaaatttgg
gtactgtgaa ctccgccgta 26940 gtttccatgg gactatataa ttttgtggcc
tcgaatacaa attttactac atagttatct 27000 atcttaaaga ctataccata
tcctcctgta gatatgtgat aaaaatcgtc gtttatagga 27060 taaaatcgtt
tatccttttg ttggaaaaag gatgaattaa tgtaatcatt ctcttctatc 27120
tttagtagtg tttccttatt aaaattctta aaataattta acaatctaac tgacggagcc
27180 caattttggt gtaaatctaa ttgggacatt atattgttaa aatacaaaca
gtctcctaat 27240 ataacagtat ctgataatct atggggagac atccattgat
attcagggga tgaatcattg 27300 gcaacaccca tttattgtac aaaaagcccc
aatttacaaa cgaaagtcca ggtttgatag 27360 agacaaacaa ttaactattt
tgtctctgtt tttaacacct ccacagtttt taatttcttt 27420 agtaatgaaa
ttattcacaa tatcagtatc ttctttatct accagagatt ttactaactt 27480
gataaccttg gctgtctcat tcaatagggt agtaatattt gtatgtgtga tattgatatc
27540 tttttgaatt gtttctttta gaagtgattc tttgatggtg ccagcatacg
aattacaata 27600 atgcagaaac tcggttaaca tgcaggaatt atagtaagcc
aattccaatt gttgcctgtg 27660 ttgtattaga gtgtcaatat gagcaatggt
gtccttgcgt ttctctgata gaatgcgagc 27720 agcgattttg gcgttatcat
ttgacgatat ttctggaatg acgaatcctg tttctactaa 27780 ctttttggta
ggacaaagtg aaacaatcaa gaagatagct tctcctccta tttgtggaag 27840
aaattgaact cctctagatg atctactgac gatagtatct ccttgacaga tattggaccg
27900 aattacagaa gtacctggaa tgtaaagccc tgaaaccccc tcatttttta
agcagattgt 27960 tgccgtaaat cctgcactat gcccaagata gagagctcct
ttggtgaatc catctctatg 28020 tttcagttta accaagaaac agtcagctgg
tctaaaattt ccatctctat ctaatacagc 28080 atctaacttg atgtcaggaa
ctatgaccgg tttaatgtta tatgtaacat tgagtaaatc 28140 cttaagttca
taatcatcac tgtcatcagt tatgtacgat ccaaacaatg tttctaccgg 28200
catagtggat acgaagatgc tatccatcag aatgtttccc tgattagtat tttctatata
28260 gctattcttc tttaaacgat tttccaaatc agtaactatg ttcatttttt
taggagtagg 28320 acgcctagcc agtatggaag aggattttct agatcctctc
ttcaacatct ttgatctcga 28380 tggaatgcaa aaccccatag tgaaacaacc
aacgataaaa ataatattgt ttttcacttt 28440 ttataatttt accatctgac
tcatggattc attaatatct ttataagagc tactaacgta 28500 taattcttta
taactgaact gagatatata caccggatct atggtttcca taattgagta 28560
aatgaatgct cggcaataac taatggcaaa tgtatagaac aacgaaatta tactagagtt
28620 gttaaagtta atattttcta tgagctgttc caataaatta tttgttgtga
ctgcgttcaa 28680 gtcataaatc atcttgatac tatccagtaa accgttttta
agttctggaa tattatcatc 28740 ccattgtaaa gcccctaatt cgactatcga
atatcctgct ctgatagcag tttcaatatc 28800 gacggacgtc aatactgtaa
taaaggtggt agtattgtca tcatcgtgat aaactacggg 28860 aatatggtcg
ttagtaggta cggtaacttt acacaacgcg atatataact ttccttttgt 28920
accattttta acgtagttgg gacgtcctgc agggtattgt tttgaagaaa tgatatcgag
28980 aacagatttg atacgatatt tgttggattc ctgattattc actataatat
aatctagaca 29040 gatagatgat tcgataaata gagaaggtat atcgttggta
ggataataca tccccattcc 29100 agtattctcg gatactctat tgatgacact
agttaagaac atgtcttcta ttctagaaaa 29160 cgaaaacatc ctacatggac
tcattaaaac ttctaacgct cctgattgtg tctcgaatgc 29220 ctcgtacaag
gatttcaagg atgccataga ttctttgacc aacgatttag aattgcgttt 29280
agcatctgat ttttttatta aatcgaatgg tcggctctct ggtttgctac cccaatgata
29340 acaatagtct tgtaaagata aaccgcaaga aaatttatac gcatccatcc
aaataaccct 29400 agcaccatcg gatgatatta atgtattatt atagattttc
catccacaat tattgggcca 29460 gtatactgtt agcaacggta tatcgaatag
attactcatg taacctacta gaatgatagt 29520 tcgtgtacta gtcataatat
ctttaatcca atctaaaaaa tttaaaatta gattttttac 29580 actgttaaag
ttaacaaaag tattacccgg gtacgtggat atcatatatg gcattggtcc 29640
attatcagta atagctccat aaactgatac ggcgatggtt tttatatgtg tttgatctaa
29700 cgaggaagaa attcgcgccc acaattcatc tctagatatg tatttaatat
caaacggtaa 29760 cacatcaatt tcgggacgcg tatatgtttc taaattttta
atccaaatat aatgatgacc 29820 tatatgccct attatcatac tgtcaactat
agtacaccta gggaacttac gatacatctg 29880 tttcctataa tcgttaaatt
ttacaaatct ataacatgct aaaccttttg acgacagcca 29940 ttcattaatt
tctgatatgg aatctgtatt ctcgataccg tatcgttcta aagccagtgc 30000
tatatctccc tgttcgtggg aacgctttcg tataatatcg atcaacggat aatctgaagt
30060 ttttggagaa taatatgact catgatctat ttcgtccata aacaatctag
acataggaat 30120 tggaggcgat gatcttaatt ttgtgcaatg agtcgtcaat
cctataactt ctaatcttgt 30180 aatattcatc atcgacataa tactatctat
gttatcatcg tatattagta taccatgacc 30240 ttcttcattt cgtgccaaaa
tgatatacag tcttaaatag ttacgcaata tctcaatagt 30300 ttcataattg
ttagctgttt tcatcaaggt ttgtatcctg tttaacatga tggcgttcta 30360
taacgtctct attttctatt tttaattttt taaattttta acgatttact gtggctagat
30420 acccaatctc tctcaaatat ttttttagcc tcgcttacaa gctgtttatc
tatactatta 30480 aaactgacga atccgtgatt ttggtaatgg gttccgtcga
aatttgccga agtgatatga 30540 acatattcgt cgtcgactat caacaatttt
gtattattct gaatagtgaa aaccttcaca 30600 gatagatcat tttgaacaca
caacgcatct agacttttgg cggttgccat agaatatacg 30660 tcgttcttat
cccaattacc aactagaagt ctgatcttaa ctcctctatt aatggctgct 30720
tctataatgg agttgtaaat gtcgggccaa tagtagctat taccgtcgac acgtgtagtg
30780 ggaactatgg ccaaatgttc aatatctata ctagtcttag ctgacctgag
tttatcaata 30840 actacatcgg tatctagatc tctagaatat cccaataggt
gttccggaga atcagtaaag 30900 aacactccac ctataggatt cttaatatga
tacgcagtgc taactggcaa acaacaagcc 30960 gcagagcata aattcaacca
tgaatttttt gcgctattaa aggctttaaa agtatcaaat 31020 cttctacgaa
gatctgtggc cagcggggga taatcagaat atacacctaa cgttttaatc 31080
gtatgtatag atcctccagt aaatgacgcg tttcctacat aacatctttc atcatctgac
31140 acccaaaaac aaccgagtag tagtcccaca ttattttttt tatctatatt
aacggttata 31200 aaatttatat ccgggcagtg actttgtagc tctcccagat
ttcttttccc tcgttcatct 31260 agcaaaacta ttattttaat ccctttttca
gatgcctctt ttagtttatc aaaaataagc 31320 gctcccctag tcgtactcag
aggattacaa caaaaagatg ctatgtatat atatttctta 31380 gctagagtga
taatttcgtt aaaacattca aatgttgtta aatgatcgga tctaaaatcc 31440
atattttctg gtagtgtttc taccagccta cattttgctc ccgcaggtac cgatgcaaat
31500 ggccacattt agttaacata aaaacttata catcctgttc tatcaacgat
tctagaatat 31560 catcggctat atcgctaaaa ttttcatcaa agtcgacatc
acaacctaac tcagtcaata 31620 tattaagaag ttccatgatg tcatcttcgt
ctatttctat atccgtatcc attgtagatt 31680 gttgaccgat tatcgagttt
aaatcattac taatactcaa tccttcagaa tacaatctgt 31740 gtttcattgt
aaatttatag gcggtgtatt taagttggta gattttcaat tatgtattaa 31800
tatagcaaca gtagttcttg ctcctccttg attctagcat cctcttcatt attttcttct
31860 acgtacataa acatgtccaa tacgttagac aacacaccga cgatggcggc
cgctacagac 31920 acgaatatga ctaaaccgat gaccatttaa aaacccctct
ctagctttca cttaaactgt 31980 atcgatcatt cttttagcac atgtataata
taaaaacatt attctatttc gaatttaggc 32040 ttccaaaaat ttttcatccg
taaaccgata ataatatata tagacttgtt aatagtcgga 32100 ataaatagat
taatgcttaa actatcatca tctccacgat tagagataca atatttacat 32160
tctttttgct gtttcgaaac tttatcaata cacgttaata caaacccagg aaggagatat
32220 tgaaactgag gctgttgaaa atgaaacggt gaatacaata attcagataa
tgtaaaatca 32280 tgattccgta ttctgatgat attagaactg ctaatggatg
tcgatggtat gtatctagga 32340 gtatctattt taacaaagca tcgatttgct
aatatacaat tatccttttg attaattgtt 32400 attttattca tattcttaaa
aggtttcata tttatcaatt cttctacatt aaaaatttcc 32460 atttttaatt
tatgtagccc cgcaatactc ctcattacgt ttcatttttt gtctataata 32520
tccattttgt tcatctcggt acatagatta tccaattgag aagcgcattt agtagttttg
32580 tacattttaa gtttattgac gaatcgtcga aaactagtta tagttaacat
tttattattt 32640 gataccctga tattaatacc cctgccgtta ctattattta
taactgatgt aatccacgta 32700 acattggaat taactatcga tagtaatgca
tcgacgcttc caaaattgtc tattataaac 32760 tcaccgataa tttttttatt
gcatgttttc atattcatta ggattatcaa atctttaatc 32820 ttattacgat
tgtatgcgtt gatattacaa gacgtcattc taaaagacgg aggatctcca 32880
tcaaatgcca gacaatcacg tacaaagtac atggaaatag gttttgttct attgcgcatc
32940 atagatttat atagaacacc cgtagaaata ctaatttgtt ttactctata
aaatactaat 33000 gcatctattt catcgttttg tataacgtct ttccaagtgt
caaattccaa atttttttca 33060 ttgatagtac caaattcttc tatctcttta
actacttgca tagataggta attacagtga 33120 tgcctacatg ccgttttttg
aaactgaata gatgcgtcta gaagcgatgc tacgctagtc 33180 acaatcacca
ctttcatatt tagaatatat atatgtaaaa atatagtaga atttcatttt 33240
gtttttttct atgctataaa tgaattctca ttttgcatct gctcatactc cgttttatat
33300 taataccaaa gaaggaagat atctggttct aaaagccgtt aaagtatgcg
atgttagaac 33360 tgtagaatgc gaaggaagta aagcttcctg cgtactcaaa
gtagataaac cctcatcgcc 33420 cgcgtgtgag agaagacctt cgtccccgtc
cagatgcgag agaatgaata accctggaaa 33480 acaagttccg tttatgagga
cggacatgct acaaaatatg ttcgcggcta atcgcgataa 33540 tgtagcttct
agacttttgt cctaaaatac tattatatcc ttttcgatat taataaatcc 33600
gtgtcgtcca ggttttttat ctctttcagt atgtgaatag ataggtattt tatctctatt
33660 catcatcgaa tttaagagat ccgataaaca ttgtttgtat tctccagatg
tcagcatctg 33720 atacaacaat atatgtgcac ataaacctct ggcacttatt
tcatgtacct tccccttatc 33780 actaaggaga atagtatttg agaaatatgt
atacatgata ttatcatgaa ttagatatac 33840 agaatttgta acactctcga
aatcacacga tgtgtcggcg ttaagatcta atatatcact 33900 cgataacaca
ttttcatcta gatacactag acatttttta aagctaaaat agtctttagt 33960
agtaacagta actatgcgat tattttcatc gatgatacat ttcatcggca tattattacg
34020 cttaccatca aagactatac catgtgtata tctaacgtat tctagcatgg
ttgccatacg 34080 cgcattaaac ttttcaggat ctttggatag atcttccaat
ctatctattt gagaaaacat 34140 ttttatcatg ttcaatagtt gaaacgtcgg
atccactata tagatattat ctataaagat 34200 tttaggaact acgttcatgg
tatcctggcg aatattaaaa ctatcaatga tatgattatc 34260 gttttcatct
tttatcacca tatagtttct aagatatggg attttactta atataatatt 34320
atttcccgtg ataaatttta ttagaaaggc caaatctata agaaaagtcc tagaattagt
34380 ctgaagaata tctatatcgc cgtatagtat atttggatta attagatata
gagaatatga 34440 tccgtaacat atacaacttt tattatggcg tctaagatat
tcttccatca acttattaac 34500 atttttgact agggaagata cattatgacg
tcccattact tttgccttgt ctattactgc 34560 gacgttcata gaatttagca
tatctcttgc caattcttcc attgatgtta cattataaga 34620 aattttagat
gaaattacat ttggagcttt aatagtaaga actcctaata tgtccgtgta 34680
tgtggtcact aatacagatt gtagttctat aatcgtaaat aatttaccta tattatatgt
34740 ttgagtctgt ttagaaaagt agctaagtat acgatctttt atttctgatg
cagatgtatt 34800 aacatcggaa aaaaatcttt ttttattctt ttttactaaa
gatacaaata tgtctttgtt 34860 aaaaacagtt attttctgaa tatttctagc
ttgtaatttt aacatatgat attcgttcac 34920 actaggtact ctgcctaaat
aggtttctat aatctttaat gtaatattag gaaaagtatt 34980 ctgatcagga
ttcctattca ttttgaggat ttaaaactct gattattgtc taatatggtc 35040
tctacgcaaa ctttttcaca gagcgataga gtttttgata actcgttttt cttaagaaat
35100 ataaaactac tgtctccaga gctcgctcta tcttttattt tatctaattc
gatacaaact 35160 cctgatactg gttcagaaag taattcatta attttcagtc
ctttatagaa gatatttaat 35220 atagataata caaaatcttc agtttttgat
atcgatctga ttgatcctag aactagatat 35280 attaataacg tgctcattag
gcagtttatg gcagcttgat aattagatat agtatattcc 35340 agttcatatt
tattagatac cgcattgccc agattttgat attctatgaa ttcctctgaa 35400
aataaatcca aaataactag acattctatt ttttgtggat tagtgtactc tcttccctct
35460 atcatgttca ctactggtgt ccacgatgat aaatatctag agggaatata
atatagtcca 35520 taggatgcca atctagcaat gtcgaataac tgtaatttta
ttcttcgctc ttcattatga 35580 attgattctt gaggtataaa cctaacacaa
attatattat tagacttttc gtatgtaatg 35640 tctttcatgt tataagtttt
taatcctgga atagaatcta ttttaatgag gcttttaaac 35700 gcagagttct
ccaacgagtc aaagcataat actctgttgt ttttcttata tacgatgtta 35760
cgattttctt ctttgaatgg aataggtttt tgaattagtt tataattaca acataataga
35820 taaggaagtg tgcaaatagt acgcggaaaa aacataatag ctcccctgtt
ttcatccatg 35880 gttttaagta aatgatcact ggcttcttta gtcaatggat
attcgaacat taaccgtttc 35940 atcatcattg gacagaatcc atatttctta
atgtaaagag tgatcaaatc attgtgttta 36000 ttgtaccatc ttgttgtaaa
tgtgtattcg gttatcggat ctgctccttt ttctattaaa 36060 gtatcgatgt
caatctcgtc taagaattca actatatcga catatttcat ttgtatacac 36120
ataaccatta ctaacgtaga atgtatagga agagatgtaa cgggaacagg gtttgttgat
36180 tcgcaaacta ttctaataca taattcttct gttaatacgt cttgcacgta
atctattata 36240 gatgccaaga tatctatata attattttgt aagatgatgt
taactatgtg atctatataa 36300 gtagtgtaat aattcatgta ttttgatata
tgttccaact ctgtctttgt gatgtctagt 36360 ttcgtaatat ctatagcatc
ctcaaaaaat atattcgcat atattcccaa gtcttcagtt 36420 ctatcttcta
aaaaatcttc aacgtatgga atataataat ctattttacc tcttctgata 36480
tcattaatga tatagttttt gacactatct tctgtcaatt gattcttatt cactatatct
36540 aagaaacgga tagcgtccct aggacgaact actgccatta atatctctat
tatagcttct 36600 ggacataatt catctattat accagaatta atgggaacta
ttccgtatct atctaacata 36660 gttttaagaa agtcagaatc taagacttga
tgttcatata ttggttcata catgaaatga 36720 tctctattga tgatagtgac
tatttcattc tctgaaaatt ggtaactcat tctatatatg 36780 ctttccttgt
tgatgaagga tagaatatac tcaatagaat ttgtaccaac aaactgttct 36840
cttatgaatc gtatatcatc atctgaaata atcatgtaag gcatacattt aacaattaga
36900 gacttgtctc ctgttatcaa tatactattc ttgtgataat ttatgtgtga
ggcaaatttg 36960 tccacgttct ttaattttgt tatagtagat atcaaatcca
atggagctac agttcttggc 37020 ttaaacagat atagtttttc tggaacaaat
tctacaacat tattataaag gactttgggt 37080 aaataagtgg gatgaaatcc
tattttaatt aatgcgatag ccttgtcctc gtgcagatat 37140 ccaaacgctt
ttgtgatagt atggcattca ttgtctagaa acgctctacg aatatctgtg 37200
acagatatca tctttagaga atatactagt cgcgttaata gtactacaat ttgtattttt
37260 taatctatct caataaaaaa attaatatgt atgattcaat gtataactaa
actactaact 37320 gttattgata actagaatca gaatctaatg atgacgtacc
caagaagttt atctactgcc 37380 aatttagctg cattattttt agcatctcgt
ttagattttc catctgcctt atcgaatact 37440 cttccgtcga tatctacaca
ggcataaaat gtaggagagt tactaggccc aactgattca 37500 atacgaaaag
accaatctct cttagttatt tggcagtact cattaataac ggtgacaggg 37560
ttagcatctt tccaatcaat aattttttta gccggaataa catcatcaaa agacttatga
37620 tcctctctca ttgatttttc gcgggataca tcatctatta tgacgtcagc
cataacatca 37680 gcatccggct tatccgcctc cgttgtcata aaccaacgag
gaggaatatc gtcggagctg 37740 tacaccatag cactacgttg aagatcgtac
agagctttat taacttctcg cttctccata 37800 ttaagttgtc tagttagttg
tgcagcagta gctccttcga ttccaatggt tttaatagcc 37860 tcacacacaa
tctctgcgtt agaacgttcg tcgatataga ttttagacat ttttagagag 37920
aactaacaca accagcaata aaactgaacc tactttatca tttttttatt catcatcctc
37980 tggtggttcg tcgttcctat caaatgtagc tctgattaac ccgtcatcta
taggtgatgc 38040 tggttctgga gattctggag gagatggatt attatctgga
agaatctctg ttatttcctt 38100 gttttcatgt atcgattgcg ttgtaacatt
aagattgcga aatgctctaa atttgggagg 38160 cttaaagtgt tgtttgcaat
ctctacacgc gtgtctaact agtggaggtt cgtcagctgc 38220
tctagtttga atcatcatcg gcgtagtatt cctactttta cagttaggac acggtgtatt
38280 gtatttctcg tcgagaacgt taaaataatc gttgtaactc acatccttta
ttttatctat 38340 attgtattct actcctttct taatgcattt tataccgaat
aagagatagc gaaggaattc 38400 tttttcggtg ccgctagtac ccttaatcat
atcacatagt gttttatatt ccaaatttgt 38460 ggcaatagac ggtttatttc
tatacgatag tttgtttctg gaatcctttg agtattctat 38520 accaatatta
ttctttgatt cgaatttagt ttcttcgata ttagattttg tattacctat 38580
attcttgatg tagtactttg atgatttttc catggcccat tctattaagt cttccaagtt
38640 ggcatcatcc acatattgtg atagtaattc tcggatatca gtagcggcta
ccgccattga 38700 tgtttgttca ttggatgagt aactactaat gtatacattt
tccatttata acacttatgt 38760 attaactttg ttcatttata ttttttcatt
attatgttga tattaacaaa agtgaatata 38820 tatatatgtt aataattgta
ttgtggttat acggctacaa ttttataatg agtgaaagtc 38880 agtgtccgat
gatcaatgac gatagcttta ctctgaaaag aaagtatcaa atcgatagtg 38940
cggagtcaac aataaaaatg gataagaaga ggataaagtt tcagaataga gccaaaatgg
39000 taaaagaaat aaatcagaca ataagagcag cacaaactca ttacgagaca
ttgaaactag 39060 gatacataaa atttaagaga atgattagga ctactactct
agaagatata gcaccatcta 39120 ttccaaataa tcagaaaact tataaactat
tctcggacat ttcagccatc ggcaaagcat 39180 cacagaatcc gagtaagatg
gtatatgctc tgctgcttta catgtttccc aatttgtttg 39240 gagatgatca
tagattcatt cgttatagaa tgcatccaat gagtaaaatc aaacacaaga 39300
tcttctctcc tttcaaactt aatcttatta gaatattagt ggaagaaaga ttctataata
39360 atgaatgcag atctaataaa tggaaaataa ttggaacaca agttgataaa
atgttgatag 39420 ctgaatctga taaatataca atagatgcaa ggtataacct
aaaacccatg tatagaatca 39480 agggagaatc tgaagaagat accctcttca
tcaaacagat ggtagaacaa tgtgtgacat 39540 cccaggaatt ggtggaaaaa
gtgttgaaga tactgtttag agatttgttc aagagtggag 39600 aatacaaagc
gtacagatac gatgatgatg tagaaaatgg atttattgga ttggatacac 39660
taaaattaaa cattgttcat gatatagttg aaccatgtat gcctgttcgt aggccagtgg
39720 ctaagatact gtgtaaagaa atggtaaata aatactttga gaatccgcta
catattattg 39780 gtaagaatct tcaagagtgc attgactttg ttagtgaata
ggcatttcat ctttctccaa 39840 tactaattca aattgttaaa ttaataatgg
atagtataaa tagtaaaaat aattattaga 39900 ataagagtgt agtatcatag
ataactctct tctataaaaa tggattttat tcgtagaaag 39960 tatcttatat
acacagtaga aaataatata gattttttaa aggatgatac attaagtaaa 40020
gtaaacaatt ttaccctcaa tcatgtacta gctctcaagt atctagttag caattttcct
40080 caacacgtta ttactaagga tgtattagct aataccaatt tttttgtttt
catacatatg 40140 gtacgatgtt gtaaagtgta cgaagcggtt ttacgacacg
catttgatgc acccacgttg 40200 tacgttaaag cattgactaa gaattattta
tcgtttagta acgcaataca atcgtacaag 40260 gaaaccgtgc ataaactaac
acaagatgaa aaatttttag aggttgccga atacatggac 40320 gaattaggag
aacttatagg cgtaaattat gacttagttc ttaatccatt atttcacgga 40380
ggggaaccca tcaaagatat ggaaatcatt tttttaaaac tgtttaagaa aacagacttc
40440 aaagttgtta aaaaattaag tgttataaga ttacttattt gggcatacct
aagcaagaaa 40500 gatacaggca tagagtttgc ggataatgat agacaagata
tatatactct atttcaacaa 40560 actggtagaa tcgtccatag caatctaaca
gaaacgttta gagattatat ctttcccgga 40620 gataagacta gctattgggt
gtggttaaac gaaagtatag ctaatgatgc ggatatcgtt 40680 cttaatagac
ccgccattac catgtatgat aaaattctta gttatatata ctctgagata 40740
aaacaaggac gcgttaataa aaacatgctt aagttagttt atatctttga gcctgaaaaa
40800 gatatcagag aacttctgct agaaatcata tatgatattc ctggagatat
cctatctatt 40860 attgatgcaa aaaacgacga ttggaaaaaa tattttatta
gtttttataa agctaatttt 40920 attaacggta atacatttat tagtgataga
acgtttaacg aggacttatt cagagttgtt 40980 gttcaaatag atcccgaata
tttcgataat gaacgaatta tgtctttatt ctctacgagt 41040 gctgcggaca
ttaaacgatt tgatgagtta gatattaata acagttatat atctaatata 41100
atttatgagg tgaacgatat cacattagat acaatggatg atatgaagaa gtgtcaaatc
41160 tttaacgagg atacgtcgta ttatgttaag gaatacaata catacctgtt
tttgcacgag 41220 tcggatccca tggtcataga gaacggaata ctaaagaaac
tgtcatctat aaaatccaag 41280 agtagacggc tgaacttgtt tagcaaaaac
attttaaaat attatttaga cggacaattg 41340 gctcgtctag gtcttgtgtt
agatgattat aaaggagact tgttagttaa aatgataaac 41400 catcttaagt
ctgtggagga tgtatccgca ttcgttcgat tttctacaga taaaaaccct 41460
agtattcttc catcgctaat caaaactatt ttagctagtt ataatatttc catcatcgtc
41520 ttatttcaaa ggtttttgag agataatcta tatcatgtag aagaattctt
ggataaaagc 41580 atccatctaa ccaagacgga taagaaatat atacttcaat
tgataagaca cggtagatca 41640 tagaacagac caaatatatt attaataatt
tgtatataca tagatataat tatcacacat 41700 ttttgataaa tgggaactgc
tgcaacaatt cagactccca ccaaattaat gaataaagaa 41760 aatgcagaaa
tgattttgga aaaaattgtt gatcatatag ttatgtatat tagtgacgaa 41820
tcaagtgatt cagaaaataa tcctgaatat attgattttc gtaacagata cgaagactat
41880 agatctctca ttataaaaag tgatcacgag tttgtaaagc tatgtaaaaa
tcatgcggag 41940 aaaagttctc cagaaacgca acaaatgatt atcaaacaca
tatacgaaca atatcttatt 42000 ccagtatctg aagtactatt aaaacctata
atgtccatgg gtgacataat tacatataac 42060 ggatgtaaag acaatgaatg
gatgctagaa caactctcta ccctaaactt taacaatctc 42120 cgcacatgga
actcatgtag cataggcaat gtaacgcgtc tgttttatac attttttagt 42180
tatctgatga aagataaact aaatatataa gtataatccc attctaatac tttaacctga
42240 tgtattagca tcttattaga atattaacct aactaaaaga cataacataa
aaactcatta 42300 catagttgat aaaaagcggt aggatataaa tattatggct
gccaccgttc cgcgttttga 42360 cgacgtgtac aaaaatgcac aaagaagaat
tctagatcaa gaaacatttt ttagtagagg 42420 tctaagtaga ccgttaatga
aaaacacata tctatttgat aattacgcgt atggatggat 42480 accagaaact
gcaatttgga gtagtagata cgcaaactta gatgcaagtg actattatcc 42540
catttcgttg ggattactta aaaagttcga gtttctcatg tctctatata aaggtcctat
42600 tccagtatac gaagaaaaag taaatactga attcattgct aatggatctt
tctccggtag 42660 atacgtatca tatcttagaa agttttctgc tcttccaaca
aacgagttta ttagtttttt 42720 gttactgact tccattccaa tctataatat
cttgttctgg tttaaaaata ctcagtttga 42780 tattactaaa cacacattat
tcagatacgt ctatacagat aatgccaaac acctggcgtt 42840 ggctaggtat
atgtatcaaa caggagacta taagcctttg tttagtcgtc tcaaagagaa 42900
ttatatattt accggtcccg ttccaatatg tatcaaagat atagatcacc ctaatcttag
42960 tagagcaaga agtccatccg attatgagac attagctaat attagtacta
tattgtactt 43020 taccaagtat gatccggtat taatgttttt attgttttac
gtacctgggt attcaattac 43080 tacaaaaatt actccagccg tagaatatct
aatggataaa ctgaatctaa caaagagcga 43140 cgtacaactg ttgtaaatta
ttttatgctt cgtaaaatgt aggttttgaa ccaaacattc 43200 tttcaaagaa
tgagatgcat aaaactttat tatccaatag attgactatt tcggacgtca 43260
atcgtttaaa gtaaacttcg taaaatattc tttgatcact gccgagttta aaacttctat
43320 cgataattgt ttcatatgtt ttaatattta caagtttttt ggtccatggt
ccattaggac 43380 aaatatatgc aaaataatat cgttctccaa gttctatagt
ctctggatta tttttattat 43440 attcagtaac caaatacata ttagggttat
ctgcggattt ataatttgag tgatgcattc 43500 gactcaacat aaataattct
agaggagacg atctactatc aaattcggat cgtaaatctg 43560 tttctaaaga
acggagaata tctatacata cctgattaga attcatccgt ccttcagaca 43620
acatctcaga cagtctggtt ttgtacatct taatcatatt cttatgaaac ttggaaacat
43680 ctcttctagt ttcactagta cctttattaa ttctctcagg tacagatttt
gaattcgacg 43740 atgctgagta tttcatcgtt gtatatttct tcttcgattg
cataatcaga ttcttatata 43800 ccgcctcaaa ctctatttta aaattattaa
acaatactct attattaatc agtcgttcta 43860 actctttcgc tatttctata
gacttatcta catcttgact gtctatctct gtaaacacgg 43920 agtcggtatc
tccatacacg ctacgaaaac gaaatctgta atctataggc aacgatgttt 43980
tcacaatcgg attaatatct ctatcgtcca tataaaatgg attacttaat ggattggcaa
44040 accgtaacat accgttagat aactctgctc catttagtac cgattctaga
tacaagatca 44100 ttctacgtcc tatggatgtg caactcttag ccgaagcgta
tgagtataga gcactatttc 44160 taaatcccat cagaccatat actgagttgg
ctactatctt gtacgtatat tgcatggaat 44220 catagatggc cttttcagtt
gaactggtag cctgttttag catcttttta tatctggctc 44280 tctctgccaa
aaatgttctt aatagtctag gaatggttcc ttctatcgat ctatcgaaaa 44340
ttgctatttc agagatgagg ttcggtagtc taggttcaca atgaaccgta atatatctag
44400 gaggtggata tttctgaagc aatagctgat tatttatttc ttcttccaat
ctattggtac 44460 taacaacgac accgactaat gtttccggag atagatttcc
aaagatacac acattaggat 44520 acagactgtt ataatcaaag attaatacat
tattactaaa cattttttgt tttggagcaa 44580 ataccttacc gccttcataa
ggaaactttt gttttgtttc tgatctaact aagatagttt 44640 tagtttccaa
caatagcttt aacagtggac ccttgatgac tgtactcgct ctatattcga 44700
ataccatgga ttgaggaagc acatatgttg acgcacccgc gtctgttttt gtttctactc
44760 cataatactc ccacaaatac tgacacaaac aagcatcatg aatacagtat
ctagccatat 44820 ctaaagctat gtttagatta taatccttat acatctgagc
taaatcaacg tcatcctttc 44880 cgaaagataa tttatatgta tcattaggta
aagtaggaca taatagtacg actttaaatc 44940 cattttccca aatatcttta
cgaattactt tacatataat atcctcatca acagtcacat 45000 aattacctgt
ggttaaaacc tttgcaaatg cagcggcttt gcctttcgcg tctgtagtat 45060
cgtcaccgat gaacgtcatt tctctaactc ctctatttaa tactttaccc atgcaactga
45120 acgcgttctt ggatatagaa tccaatttgt acgaatccaa tttttcaaat
ttttgaatga 45180 atgaatatag atcgaaaaat atagttccat tattgttatt
aacgtgaaac gtagtattgg 45240 ccatgccgcc tactccctta tgactagact
gatttctctc ataaatacag agatgtacag 45300 cttccttttt gtccggagat
ctaaagataa ttttctctcc tgttaataac tctagacgat 45360 tagtaatata
tctcagatca aagttatgtc cgttaaaggt aacgacgtag tcgaacgtta 45420
gttccaacaa ttgtttagct attcgtaaca aaactatttc agaacataga actagttctc
45480 gttcgtaatc catttccatt agtgactgta tcctcaaaca tcctctatcg
acggcttctt 45540 gtatttcctg ttccgttaac atctcttcat taatgagcgt
aaacaataat cgtttaccac 45600 ttaaatcgat ataacagtaa cttgtatgcg
agattgggtt aataaataca gaaggaaact 45660 tcttatcgaa gtgacactct
atatctagaa ataagtacga tcttgggata tcgaatctag 45720 gtattttttt
agcgaaacag ttacgtggat cgtcacaatg ataacatcca ttgttaatct 45780
ttgtcaaata ttgctcgtcc aacgagtaac atccgtctgg agatatcccg ttagaaatat
45840 aaaaccaact aatattgaga aattcatcca tggtggcatt ttgtatgctg
cgtttctttg 45900 gctcttctat caaccacata tctgcgacgg agcattttct
atctttaata tctagattat 45960 aacttattgt ctcgtcaatg tctatagttc
tcatctttcc caacggcctc gcattaaatg 46020 gaggaggaga caatgactga
tatatttcgt ccgtcactac gtaataaaag taatgaggaa 46080 atcgtataaa
tacggtctca ccatttcgac atctggattt cagatataaa aatctgtttt 46140
caccgtgact ttcaaaccaa ttaatgcacc gaacatccat ttatagaatt tagaaatata
46200 ttttcattta aatgaatccc aaacattggg gaagagccgt atggaccatt
atttttatag 46260 tactttcgca agcgggttta gacggcaaca tagaagcgtg
taaacgaaaa ctatatacta 46320 tagttagcac tcttccatgt cctgcatgta
gacggcacgc gactatcgct atagaggaca 46380 ataatgtcat gtctagcgat
gatctgaatt atatttatta ttttttcatc agattattta 46440 acaatttggc
atctgatccc aaatacgcga tcgatgtgac aaaggttaac cctttataaa 46500
cttaacccat tataaaactt atgattagtc acaactgaaa taaccgcgtg attatttttt
46560 ggtataattc tacacggcat ggtttctgtg actatgaatt caacccccgt
tacattagtg 46620 aaatctttaa caaacagcaa gggttcgtca aagacataaa
actcattgtt tacaatcgaa 46680 atagaccccc tatcacactt aaaataaaaa
atatccttat cctttaccac caaataaaat 46740 tctgattggt caatgtgaat
gtattcactt aacagttcca caaatttatt tattaactcc 46800 gaggcacata
catcgtcggt attttttatg gcaaacttta ctcttccagc atccgtttct 46860
aaaaaaatat taacgagttc catttatatc atccaatatt attgaaatga cgttgatgga
46920 cagatgatac aaataagaag gtacggtacc tttgtccacc atctcctcca
attcatgctc 46980 tattttgtca ttaactttaa tgtatgaaaa cagtacgcca
catgcttcca tgacagtgtg 47040 taacactttg gatacaaaat gtttgacatt
agtataattg ttcaagactg tcaatctata 47100 atagatagta gctataatat
attctatgat ggtattgaag aagatgacaa ccttggcata 47160 ttgatcattt
aacacagaca tggtatcaac agatagcttg aatgaaagag aatcagtaat 47220
tggaataagc gtcttctcga tagagtgtcc gtataccaac atgtctgata ttttgatgta
47280 ttccattaaa ttatttagtt ttttcttttt attctcgtta aacagcattt
ctgtcaacgg 47340 accccaacat cgttgaccga ttaagttttg attgattttt
ccgtgtaagg cgtatctagt 47400 cagatcgtat agcctatcca ataatccatc
atctgtgcgt agatcacatc gtacactttt 47460 taattctcta tagaagagcg
acagacatct ggagcaatta cagacagcaa tttctttatt 47520 ctctacagat
gtaagatact tgaagacatt cctatgatga tgcagaattt tggataacac 47580
ggtattgatg gtatctgtta ccataattcc tttgatggct gatagtgtca gagcacaaga
47640 tttccaatct ttgacaattt ttagcaccat tatctttgtt ttgatatcta
tatcagacag 47700 catggtgcgt ctgacaacac agggattaag acggaaagat
gaaatgattc tctcaacatc 47760 ttcaatagat accttgctat tttttctggc
attatctata tgtgcgagaa tatcctctag 47820 agaatcagta tcctttttga
tgatagtgga tctcaatgac atgggacgtt taaaccttct 47880 tattctatca
ccagattgca tggtgatttg tcttctttct tttatcataa tgtaatctct 47940
aaattcatcg gcaaattgtc tatatctaaa atcataatat gagatgttta cctctacaaa
48000 tatctgttcg tccaatgtta gagtatttac atcagttttg tattccaaat
taaacatggc 48060 aacggattta attttatatt cctctattaa gtcctcgtcg
ataataacag aatgtagata 48120 atcatttaat ccatcgtaca tggttggaag
atgcttgttg acaaaatctt taattgtctt 48180 gatgaaggtg ggactatatc
taacatcttg attaataaaa tttataacat tgtccatagg 48240 atactttgta
actagtttta tacacatctc ttcatcggta agtttagaca gaatatcgtg 48300
aacaggtggt atattatatt catcagatat acgaagaaca atgtccaaat ctatattgtt
48360 taatatatta tatagatgta gcgtagctcc tacaggaata tctttaacta
agtcaatgat 48420 ttcatcaacc gttagatcta ttttaaagtt aatcatatag
gcattgattt ttaaaaggta 48480 tgtagccttg actacattct cattaattaa
ccattccaag tcactgtgtg taagaagatt 48540 atattctatc ataagcttga
ctacatttgg tcccgatacc attaaagaat tcttatgata 48600 taaggaaaca
gcttttaggt actcatctac tctacaagaa ttttggagag ccttaacgat 48660
atcagtgacg tttattattt caggaggaaa aaacctaaca ttgagaatat cggaattaat
48720 agcttccaga tacagtgatt ttggcaatag tccgtgtaat ccataatcca
gtaacacgag 48780 ctggtgcttg ctagacacct tttcaatgtt taattttttt
gaaataagct ttgataaagc 48840 cttcctcgca aattccggat acatgaacat
gtcggcgaca tgattaagta ttgttttttc 48900 attattttct caatacccca
atagatgata gaatatcacc caatgcgtcc atgttgtcta 48960 tttccaacag
gtcgctatat ccaccaatag aagtttttcc aaaaaagatt ctaggaacag 49020
ttctaccacc agtaatttgt tcaaaatagt cacgcaattc attttcgggt ttaaattctt
49080 taatatcgac aatttcatac gctcctcttt tgaaactaaa cttatttaga
atatccagtg 49140 catttctaca aaaaggacat gtatacttga caaaaattgt
cactttgtta ttggccaacc 49200 tttgttgtac aaattcctcg gccattttaa
tatttaagtg atataaaact atctcgactt 49260 atttaactct ttagtcgaga
tatatggacg cagatagcta tatgatagcc aactacagaa 49320 ggcaaacgct
ataaaaaaca taattacgac gagcatattt ataaatattt ttattcagca 49380
ttacttgata tagtaatatt aggcacagtc aaacattcaa ccactctcga tacattaact
49440 ctctcatttt ctttaacaaa ttctgcaata tcttcgtaaa aagattcttg
aaacttttta 49500 gaatatctat cgactctaga tgaaatagcg ttcgtcaaca
tactatgttt tgtatacata 49560 aaggcgccca ttttaacagt ttctagtgac
aaaatgctag cgatcctagg atcctttaga 49620 atcacataga ttgacgattc
gtctctctta gtaactctag taaaataatc atacaatcta 49680 gtacgcgaaa
taatattatc cttgacttga ggagatctaa acaatctagt tttgagaaca 49740
tcgataagtt catcgggaat gacatacata ctatctttaa tagaactctt ttcatccagt
49800 tgaatggatt cgtccttaac caactgatta atgagatctt ctattttatc
attttccaga 49860 tgatatgtat gtccattaaa gttaaattgt gtagcgcttc
tttttagtct agcagccaat 49920 actttaacat cactaatatc gatatacaaa
ggagatgatt tatctatggt attaagaatt 49980 cgtttttcga catccgtcaa
aaccaattcc tttttgcctg tatcatccag ttttccatcc 50040 tttgtaaaga
aattattttc tactagacta ttaataagac tgataaggat tcctccataa 50100
ttgcacaatc caaacttttt cacaaaacta gactttacaa gatctacagg aatgcgtact
50160 tcaggttttt tagcttgtga ttttttcttt tgcggacatt ttcttgtgac
caactcatct 50220 accatttcat tgattttagc agtgaaataa gctttcaatg
cacgggcact gatactattg 50280 aaaacgagtt gatcttcaaa ttccgccatt
taagttcacc aaacaacttt taaatacaaa 50340 tatatcaata gtagtagaat
aagaactata aaaaaaataa taattaacca ataccaaccc 50400 caacaaccgg
tattattagt tgatgtgact gttttctcat cacttagaac agatttaaca 50460
atttctataa agtctgtcaa atcatcttcc ggagacccca taaatacacc aaatatagcg
50520 gcgtacaact tatccattta tacattgaat attggctttt ctttatcgct
atcttcatca 50580 tattcatcat caatatcaac aagtcccaga ttacgagcca
gatcttcttc tacattttca 50640 gtcattgata cacgttcact atctccagag
agtccgataa cgttagccac cacttctcta 50700 tcaatgatta gtttcttgag
cgcgaaagta atttttgttt ccgttccgga tctatagaag 50760 acgataggtg
tgataattgc cttggccaat tgtctttctc ttttactgag tgattctagt 50820
tcaccttcta tagatctgag aatggatgat tctccagtcg aaacatattc taccatggat
50880 ccgtttaatt tgttgatgaa gatggattca tccttaaatg ttttctctgt
aatagtttcc 50940 accgaaagac tatgcaaaga atttggaatg cgttccttgt
gcttaatgtt tccatagacg 51000 gcttctagaa gttgatacaa cataggacta
gccgcggtaa cttttatttt tagaaagtat 51060 ccatcgcttc tatcttgttt
agatttattt ttataaagtt tagtctctcc ttccaacata 51120 ataaaagtgg
aagtcatttg actagataaa ctatcagtaa gttttataga gatagacgaa 51180
caattagcgt attgagaagc atttagtgta acgtattcga tacattttgc attagattta
51240 ctaatcgatt ttgcatactc tataacaccc gcacaagtct gtagagaatc
gctagatgca 51300 gtaggtcttg gtgaagtttc aactctcttc ttgattacct
tactcatgat taaacctaaa 51360 taattgtact ttgtaatata atgatatata
ttttcacttt atctcatttg agaataaaaa 51420 tgtttttgtt taaccactgc
atgatgtaca gatttcggaa tcgcaaacca ccagtggttt 51480 tattttatcc
ttgtccaatg tgaattgaat gggagcggat gcgggtttcg tacgtagata 51540
gtacattccc gtttttagac cgagactcca tccgtaaaaa tgcatactcg ttagtttgga
51600 ataactcgga tctgctatat ggatattcat agattgactt tgatcgatga
aggctcccct 51660 gtctgcagcc atttttatga tcgtcttttg tggaatttcc
caaatagttt tataaactcg 51720 cttaatatct tctggaaggt ttgtattctg
aatggatcca ccatctgcca taatcctatt 51780 cttgatctca tcattccata
attttctctc ggttaaaact ctaaggagat gcggattaac 51840 tacttgaaat
tctccagaca atactctccg agtgtaaata ttactggtat acggttccac 51900
cgactcatta tttcccaaaa tttgagcagt tgatgcagtc ggcataggtg ccaccaataa
51960 actatttcta agaccgtatg ttctgatttt atcttttaga ggttcccaat
tccaaagatc 52020 cgacggtaca acattccaaa gatcatattg tagaataccg
ttactggcgt acgatcctac 52080 atatgtatcg tatggtcctt ccttctcagc
tagttcacaa ctcgcctcta atgcaccgta 52140 ataaatggtt tcgaagatct
tcttatttag atcttgtgct tccaggctat caaatggata 52200 atttaagaga
ataaacgcgt ccgctaatcc ttgaacacca ataccgatag gtctatgtct 52260
cttattagag atttcagctt ctggaatagg ataataatta atatctataa ttttattgag
52320 atttctgaca attactttga ccacatcctt cagtttgaga aaatcaaatc
gcccatctat 52380 tacaaacatg ttcaaggcaa cagatgccag attacaaacg
gctacctcat tagcatccgc 52440 atattgtatt atctcagtgc aaagattact
acacttgata gttcctaaat tttgttgatt 52500 actctttttg ttacacgcat
ccttataaag aatgaatgga gtaccagttt caatctgaga 52560 ttctataatc
gctttccaga cgactcgagc ctttattata gatttgtatc tcctttctct 52620
ttcgtatagt gtatacaatc gttcgaactc gtctccccaa acattgtcca atccaggaca
52680 ttcatccgga cacatcaacg accactctcc gtcatccttc actcgtttca
taaagagatc 52740 aggaatccaa agagctataa atagatctct ggttctatgt
tcctcgtttc ctgtattctt 52800 tttaagatcg aggaacgcca taatatcaga
atgccacggt tccaagtata tggccataac 52860 tccaggccgt ttgtttcctc
cctgatctat gtatctagcg gtgttattat aaactctcaa 52920 cattggaata
ataccgtttg atataccatt ggtaccggag atatagcttc cactggcacg 52980
aatattacta attgatagac ctattccccc tgccatttta gagattaatg cgcatcgttt
53040 taacgtgtca tagataccct ctatgctatc atcgatcatg ttaagtagaa
aacagctaga 53100 catttggtga cgactagttc ccgcattaaa taaggtagga
gaagcgtgcg taaaccattt 53160 ttcagaaagt agattgtacg tctcaatagc
tgagtctata tcccattgat gaattcctac 53220 tgcgacacgc attaacatgt
gctgaggtct ttcaacgatc ttgttgttta ttttcaacaa 53280
gtaggatttt tccaaagttt taaaaccaaa atagttgtat gaaaagtctc gttcgtaaat
53340 aataaccgag ttgagtttat ccttatattt gttaactata tccatggtga
tacttgaaat 53400 aatcggagaa tgtttcccat ttttaggatt aacatagttg
aataaatcct ccatcacttc 53460 actaaatagt ttttttgttt ccttgtgtag
atttgatacg gctattctgg cggctagaat 53520 ggcataatcc ggatgttgtg
tagtacaagt ggctgctatt tcggctgcca gagtgtccaa 53580 ttctaccgtt
gttactccat tatatattcc ttgaataacc ttcatagcta ttttaatagg 53640
atctatatga tccgtgttta agccataaca taattttcta atacgagacg tgattttatc
53700 aaacatgaca ttttccttgt atccatttcg tttaatgaca aacatttttg
ttggtgtaat 53760 aaaaaaatta tttaactttt cattaatagg gatttgacgt
atgtagcgta caaaatgatc 53820 gttcctggta tatagataaa gagtcctata
tatttgaaaa tcgttacggc tcgattaaac 53880 tttaatgatt gcatagtgaa
tatatcatta ggatttaact ccttgactat catggcggcg 53940 ccagaaatta
ccatcaaaag cattaataca gttatgccga tcgcagttaa aacggttata 54000
gcatccacca tttatatcta aaaattagat caaagaatat gtgacaaagt cctagttgta
54060 tactgagaat tgacgaaaca atgtttctta catatttttt tcttattagt
aactgactta 54120 atagtaggaa ctggaaagct agacttgatt attctataag
tatagatacc cttccagata 54180 atgttctctt tgataaaagt tccagaaaat
gtagaatttt ttaaaaagtt atcttttgct 54240 attaccaaga ttgtgtttag
acgcttatta ttaatatgag tgatgaaatc cacaccgcct 54300 ctagatatcg
cctttatttc cacattagat ggtaaatcca atagtgaaac tatcttttta 54360
ggaatgtatg gactcgcgtt tagaggagtg aacgtcttgg gcgtcggaaa ggatgattcg
54420 tcaaacgaat aaacaatttc acaaatggat gttaatgtat tagtaggaaa
ttttttgacg 54480 ctagtggaat tgaagattct aatggatgat gttctaccta
tttcatccga taacatgtta 54540 atttccgaca ccaacggttt taatatttcg
atgatatacg gtagtctctc tttcggactt 54600 atatagctta ttccacaata
cgagtcatta tatactccaa aaaacaaaat aactagtata 54660 aaatctgtat
cgaatgggaa aaacgaaatt atcgacatag gtatagaatc cggaacattg 54720
aacgtattaa tacttaattc tttttctgtg gtaagtaccg ataggttatt gacattgtat
54780 ggttttaaat attctataac ttgagacttg atagatatta gtgatgaatt
gaaaattatt 54840 tttatcacca cgtgtgtttc aggatcatcg tcgacgcccg
tcaaccaacc gaatggagta 54900 aaataaatat cattaatata tgctctagat
attagtattt ttattaatcc tttgattatc 54960 atcttctcgt aggcgaatga
ttccatgatc aagagtgatt tgagaacatc ctccggagta 55020 ttaatgggct
tagtaaacag tccatcgttg caataataaa agttatccaa gttaaaggat 55080
attatgcatt cgtttaaaga tatcacctca tctgacggag acaatttttt ggtaggtttt
55140 agagactttg aagctacttg tttaacaaag ttattcatcg tcgtctacta
ttctatttaa 55200 ttttgtagtt aatttatcac atatcacatt aattgacttt
ttggtccatt tttccatacg 55260 tttatattct tttaatcctg cgttatccgt
ttccgttata tccagggata gatcttgcaa 55320 gttaaataga atgctcttaa
ataatgtcat tttcttatcc gctaaaaatt taaagaatgt 55380 ataaaccttt
ttcagagatt tgaaactctt aggtggtgtc ctagtacaca atatcataaa 55440
caaactaata aacattccac attcagattc caacagctga ttaacttcca cattaataca
55500 gcctattttc gctccaaatg tacattcgaa aaatctgaat aaaacatcga
tgtcacaatt 55560 tgtattatcc aatacagaat gtttgtgatt cgtgttaaaa
ccatcggaga aggaatagaa 55620 ataaaaatta ttatagtggt ggaattcagt
tggaatattg cctccggagt cataaaagga 55680 tactaaacat tgttttttat
cataaattac acatttccaa tgagacaaat aacaaaatcc 55740 aaacattaca
aatctagagg tagaactttt aattttgtct ttaagtatat acgataagat 55800
atgtttattc ataaacgcgt caaatttttc atgaatcgct aaggagttta agaatctcat
55860 gtcaaattgt cctatataat ccacttcgga tccataagca aactgagaga
ctaagttctt 55920 aatacttcga ttgctcatcc aggctcctct ctcaggctct
attttcatct tgacgacctt 55980 tggattttca ccagtatgta ttcctttacg
tgataaatca tcgattttca aatccatttg 56040 tgagaagtct atcgccttag
atactttttc ccgtagtcga ggtttaaaaa aatacgctaa 56100 cggtatacta
gtaggtaact caaagacatc atatatagaa tggtaacgcg tctttaactc 56160
gtcggttaac tctttctttt gatcgagttc gtcgctacta ttgggtctgc tcaggtgccc
56220 cgactctact agttccaaca tcataccgat aggaatacaa gacactttgc
cagcggttgt 56280 agatttatca tatttctcca ctacatatcc gttacaattt
gttaaaaatt tagatacatc 56340 tatattgcta cataatccag ctagtgaata
tatatgacat aataaattgg taaatcctag 56400 ttctggtatt ttactaatta
ctaaatctgt atatctttcc atttatcatg gaaaagaatt 56460 taccagatat
cttctttttt ccaaactgcg ttaatgtatt ctcttacaaa tattcacaag 56520
atgaattcag taatatgagt aaaacggaac gtgatagttt ctcattggcc gtgtttccag
56580 ttataaaaca tagatggcat aacgcacacg ttgtaaaaca taaaggaata
tacaaagtta 56640 gtacagaagc acgtggaaaa aaagtatctc ctccatcact
aggaaaaccc gcacacataa 56700 acctaaccgc gaagcaatat atatacagtg
aacacacaat aagctttgaa tgttatagtt 56760 ttctaaaatg tataacaaat
acagaaatca attcgttcga tgagtatata ttaagaggac 56820 tattagaagc
tggtaatagt ttacagatat tttccaattc cgtaggtaaa cgaacagata 56880
ctataggtgt actagggaat aagtatccat ttagcaaaat tccattggcc tcattaactc
56940 ctaaagcaca acgagagata ttttcagcgt ggatttctca tagacctgta
gttttaactg 57000 gaggaactgg agtgggtaag acgtcacagg tacccaagtt
attgctttgg tttaattatt 57060 tatttggtgg attctctact ctagataaaa
tcactgactt tcacgaaaga ccagtcattc 57120 tatctcttcc taggatagct
ttagttagat tgcatagcaa taccatttta aaatcattgg 57180 gatttaaggt
actagatgga tctcctattt ctttacggta cggatctata ccggaagaat 57240
taataaacaa acaaccaaaa aaatatggaa ttgtattttc tacccataag ttatctctaa
57300 caaaactatt tagttatggc actcttatta tagacgaagt tcatgagcat
gatcaaatag 57360 gagatattat tatagcagta gcgagaaagc atcatacgaa
aatagattct atgtttttaa 57420 tgactgccac gttagaggat gacagggaac
ggctaaaagt atttttacct aatcccgcat 57480 ttatacatat tcctggagat
acactgttta aaattagcga ggtatttatt cataataaga 57540 taaatccatc
ttccagaatg gcatacatag aagaagaaaa gagaaattta gttactgcta 57600
tacagatgta tactcctcct gatggatcat ccggtatagt ctttgtggca tccgttgcac
57660 agtgtcacga atataaatca tatttagaaa aaagattacc gtatgatatg
tatattattc 57720 atggtaaggt cttagatata gacgaaatat tagaaaaagt
gtattcatca cctaatgtat 57780 cgataattat ttctactcct tatttggaat
ccagcgttac tatacgcaat gttacacaca 57840 tttatgatat gggtagagtt
tttgtccccg ctccttttgg aggatcgcaa caatttattt 57900 ctaaatctat
gagagatcaa cgaaaaggaa gagtaggaag agttaatcct ggtacatacg 57960
tctatttcta tgatctgtct tatatgaagt ctatacagcg aatagattca gaatttctac
58020 ataattatat attgtacgct aataagttta atctaacact ccccgaagat
ttgtttataa 58080 tccctacaaa tttggatatt ctatggcgta caaaggaata
tatagactcg ttcgatatta 58140 gtacagaaac atggaataaa ttattatcca
attattatat gaagatgata gagtatgcta 58200 aactttatgt actaagtcct
attctcgctg aggagttgga taactttgag aggacgggag 58260 aattaactag
tattgtacga gaagccattt tatctctaaa tttacaaatt aagattttaa 58320
attttaaaca taaagatgat gatacgtata tacacttttg taaaatatta ttcggtgtct
58380 ataacggaac aaacgctact atatattatc atagacctct aacgggatat
atgaatatga 58440 tttcagatac tatatttgtt cctgtagata ataactaaaa
atcaaactct aatgaccaca 58500 tcttttttta gagatgaaaa attttccaca
tctccttttg tagacacgac taaacatttt 58560 gcagaaaaaa gtttattagt
gtttagataa tcgtatactt catcagtgta gatagtaaat 58620 gtgaacagat
aaaaggtatt cttgctcaat agattggtaa attccataga atatattaat 58680
cctttcttct tgagatccca catcatttca accagagacg ttttatccaa tgatttacct
58740 cgtactatac cacatacaaa actagatttt gcagtgacgt cgtacctggt
attcctacca 58800 aacaaaattt tacttttagt tcttttagaa aattctaagg
tagaatctct atttgccaat 58860 atgtcatcta tggaattacc actagcaaaa
aatgatagaa atatatattg atacatcgca 58920 gctggttttg atctactata
ctttaaaaac gaatcagatt ccataattgc ctgtatatca 58980 tcagctgaaa
aactatgttt tacacgtatt ccttcggcat ttctttttaa tgatatatct 59040
tgtttagaca atgataaagt tatcatgtcc atgagagacg cgtctccgta tcgtataaat
59100 atttcattag atgttagacg cttcattagg ggtatacttc tataaggttt
cttaatcagt 59160 ccatcattgg ttgcgtcaag aactactatc ggatgttgtt
gggtatctct agtgttacac 59220 atggccttac taaagtttgg gtaaataact
atgatatctc tattaattat agatgcatat 59280 atttcattcg tcaaggatat
tagtatcgac ttgctatcgt cattaatacg tgtaatgtaa 59340 tcatataaat
catgcgatag ccaaggaaaa tttaaataga tgttcatcat ataatcgtcg 59400
ctataattca tattaatacg ttgacattga ctaatttgta atatagcctc gccacgaaga
59460 aagctctcgt attcagtttc atcgataaag gataccgtta aatataactg
gttgccgata 59520 gtctcatagt ctattaagtg gtaagtttcg tacaaataca
gaatccctaa aatattatct 59580 aatgttggat taatctttac cataactgta
taaaatggag acggagtcat aactatttta 59640 ccgtttgtac ttactggaat
agatgaagga ataatctccg gacatgctgg taaagaccca 59700 aatgtctgtt
tgaagaaatc caatgttcca ggtcctaatc tcttaacaaa aattacgata 59760
ttcgatcccg atatcctttg cattctattt accagcatat cacgaactat attaagatta
59820 tctatcatgt ctattctccc accgttatat aaatcgcctc cgctaagaaa
cgttagtata 59880 tccatacaat ggaatacttc atttctaaaa tagtattcgt
tttctaattc tttaatgtga 59940 aatcgtatac tagaaaggga aaaattatct
ttgagttttc cgttagaaaa gaaccacgaa 60000 actaatgttc tgattgcgtc
cgattccgtt gctgaattaa tggatttaca ccaaaaactc 60060 atataacttc
tagatgtaga agcattcgct aaaaaattag tagaatcaaa ggatataagt 60120
agatgttcca acaagtgagc aattcccaag atttcatcta tatcattctc gaatccgaaa
60180 ttagaaattc ccaagtagat atcctttttc atccgatcgt tgatgaaaat
acgaacttta 60240 ttcggtaaga caatcattta ctaaggagta aaataggaag
taatgttcgt atgtcgttat 60300 catcgtataa attaaaggtg tgttttttac
cattaagtga cattataatt ttaccaatat 60360 tggaattata atataggtgt
atttgcgcac tcgcgacggt tgatgcatcg gtaaatatag 60420 ctgtatctaa
tgttctagtc ggtatttcat catttcgctg tctaataata gcgttttctc 60480
tatctgtttc cattacagct gcctgaagtt tattggtcgg ataatatgta aaataataag
60540 aaatacatac gaataacaaa aataaaataa gatataataa agatgccatt
tagagatcta 60600 attttgttta acttgtccaa attcctactt acagaagatg
aggaatcgtt ggagatagtg 60660 tcttccttat gtagaggatt tgaaatatct
tataatgact tgataactta ctttccagat 60720 aggaaatacc ataaatatat
ttataaagta tttgaacatg tagatttatc ggaggaatta 60780 agtatggaat
tccatgatac aactctgaga gatttagtct atcttagatt gtacaagtat 60840
tccaagtgta tacggccgtg ttataaatta ggagataatc taaaaggcat agttgttata
60900 aaggacagga atatttatat tagggaagca aatgatgact tgatagaata
tctcctcaag 60960 gaatacactc ctcagattta tacatattct aatgagcgcg
tccccataac tggttcaaaa 61020 ttaattcttt gtggattttc tcaagttaca
tttatggcgt atacaacgtc gcatataaca 61080 acaaataaaa aggtagatgt
tctcgtttcc aaaaaatgta tagatgaact agtcgatcca 61140 ataaattatc
aaatacttca aaatttattt gataaaggaa gcggaacaat aaacaaaata 61200
ctcaggaaga tattttattc ggtaacaggt ggccaaactc cataggtagc tttttctatt
61260 tcggatttta gaatttccaa attcaccagc gatttatcgg ttttggtgaa
atccaaggat 61320 ttattaatgt ccacaaatgc catttgtttt gtctgtggat
tgtatttgaa aatggaaacg 61380 atgtagttag atagatgcgc tgcgaagttt
cctattaggg ttccgcgctt cacgtcaccc 61440 agcatacttg aatcaccatc
ctttaaaaaa aatgataaga tatcaacatg gagtatatca 61500 tactcggatt
ttaattcttc tactgcatca ctgacatttt cacaaatact acaatacggt 61560
ttaccgaaaa taatcagtac gttcttcatt tatgggtatc aaaaacttaa aatcgttact
61620 gctggaaaat aaatcactga cgatattaga tgataattta tacaaagtat
acaatggaat 61680 atttgtggat acaatgagta tttatatagc cgtcgccaat
tgtgtcagaa acttagaaga 61740 gttaactacg gtattcataa aatacgtaaa
cggatgggta aaaaagggag ggcatgtaac 61800 cctttttatc gatagaggaa
gtataaaaat taaacaagac gttagagaca agagacgtaa 61860 atattctaaa
ttaaccaagg acagaaaaat gttagaatta gaaaagtgta catccgaaat 61920
acaaaatgtt accggattta tggaagaaga aataaaggca gaaatgcaat taaaaatcga
61980 taaactcaca tttcaaatat atttatctga ttctgataac ataaaaatat
cattgaatga 62040 gatactaaca catttcaaca ataatgagaa tgttacatta
ttttattgtg atgaacgaga 62100 cgcagaattc gttatgtgtc tcgaggctaa
aacacatttc tctaccacag gagaatggcc 62160 gttgataata agtaccgatc
aggatactat gctatttgca tctgctgata atcatcctaa 62220 gatgataaaa
aacttaactc aactgtttaa atttgttccc tcggcagagg ataactattt 62280
agcaaaatta acggcgttag tgaatggatg tgatttcttt cctggactct atggggcatc
62340 tataacaccc accaacttaa acaaaataca attgtttagt gattttacaa
tcgataatat 62400 agtcactagt ttggcaatta aaaattatta tagaaagact
aactctaccg tagacgtgcg 62460 taatattgtt acgtttataa acgattacgc
taatttagac gatgtctact cgtatattcc 62520 tccttgtcaa tgcactgttc
aagaatttat attttccgca ttagatgaaa aatggaatga 62580 atttaaatca
tcttatttag aaagcgtgcc gttaccctgc caattaatgt acgcgttaga 62640
accacgcaag gagattgatg tttcagaagt taaaacttta tcatcttata tagatttcga
62700 aaatactaaa tcagatatcg atgttataaa atctatatcc tcgatcttcg
gatattctaa 62760 cgaaaactgt aacacgatag tattcggcat ctataaggat
aatttactac tgagtataaa 62820 taattcattt tactttaacg atagtctgtt
aataaccaat actaaaagtg ataatataat 62880 aaatataggt tactagatta
aaaatggtgt tccaactcgt gtgctctaca tgcggtaaag 62940 atatttctca
cgaacgatat aaattgatta tacgaaaaaa atcattaaag gatgtactcg 63000
tcagtgtaaa gaacgaatgt tgtaggttaa aattatctac acaaatagaa cctcaacgta
63060 acttaacagt gcaacctcta ttggatataa actaatatgg atccggttaa
ttttatcaag 63120 acatatgcgc ctagaggttc tattattttt attaattata
ccatgtcatt aacaagtcat 63180 ttgaatccat cgatagaaaa acatgtgggt
atttattatg gtacgttatt atcggaacac 63240 ttggtagttg aatctaccta
tagaaaagga gttcgaatag tcccattgga tagttttttt 63300 gaaggatatc
ttagtgcaaa agtatacatg ttagagaata ttcaagttat gaaaatagca 63360
gctgatacgt cattaacttt attgggtatt ccgtatggat ttggtcataa tagaatgtat
63420 tgttttaaat tggtagctga ctgttataaa aatgccggta ttgatacatc
gtctaaacga 63480 atattgggca aagatatttt tctgagccaa aacttcacag
acgataatag atggataaag 63540 atatatgatt ctaataattt aacattttgg
caaattgatt accttaaagg gtgagttaat 63600 atgcataact actcctccgt
tgttttttcc ctcgttcttt ttcttaacgt tgtttgccat 63660 cactctcata
atgtaaagat attctaaaat ggtaaacttt tgcatatcgg acgcagaaat 63720
tggtataaat gttgtaattg tattatttcc cgtcaatgga ctagtcacag ctccatcagt
63780 tttatatcct ttagagtatt tctcactcgt gtctaacatt ctagagcatt
ccatgatctg 63840 tttatcgttg atattggccg gaaagataga ttttttattt
tttattatat tactattggc 63900 aattgtagat ataacttctg gtaaatattt
ttctaccttt tcaatctctt ctattttcaa 63960 gccggctata tattctgcta
tattgttgct agtatcaata ccttttctgg ctaagaagtc 64020 atatgtggta
ttcactatat cagttttaac tggtagttcc attagccttt ccacttctgc 64080
agaataatca gaaattggtt ctttaccaga aaatccagct actataatag gctcaccgat
64140 gatcattggc aaaatcctat attgtaccag attaatgaga gcatatttca
tttccaataa 64200 ttctgctagt tcttgagaca ttgatttatt tgatgaatct
agttggttct ctagatactc 64260 taccatttct gccgcataca ataacttgtt
agataaaatc agggttatca aagtgtttag 64320 cgtggctaga atagtgggct
tgcatgtatt aaagaatgcg gtagtatgag taaaccgttt 64380 taacgaatta
tatagtctcc agaaatctgt ggcgttacat acatgagccg aatgacatcg 64440
aagattgtcc aatattttta atagctgctc tttgtccatt atttctatat ttgactcgca
64500 acaattgtag ataccattaa tcaccgattc ctttttcgat gccggacaat
agcacaattg 64560 tttagctttg gactctatgt attcagaatt aatagatata
tctctcaata cagattgcac 64620 tatacatttt gaaactatgt caaaaattgt
agaacgacgc tgttctgcag ccatttaact 64680 ttaaataatt tacaaaaatt
taaaatgagc atccgtataa aaatcgataa actgcgccaa 64740 attgtggcat
atttttcaga gttcagtgaa gaagtatcta taaatgtaga ctcgacggat 64800
gagttaatgt atatttttgc cgccttgggc ggatctgtaa acatttgggc cattatacct
64860 ctcagtgcat cagtgtttta ccgaggagcc gaaaatattg tgtttaatct
tcctgtgtcc 64920 aaggtaaaat cgtgtttgtg tagttttcac aatgatgcca
tcatagatat agaacctgat 64980 ctggaaaata atctagtaaa actttctagt
tatcatgtag taagtgtcga ttgtaacaag 65040 gaactgatgc ctattaggac
agatactact atttgtctaa gtatagatca aaagaaatct 65100 tacgtgttta
attttcacaa gtatgaagaa aaatgttgtg gtagaaccgt cattcattaa 65160
gtgacattat aattttacca atattggaat tataatatag gtgtatttgc gcacttgcga
65220 cggttgatgc atcggtaaat atagctgtat ctaatgttct agtcggtatt
tcatcatttc 65280 gctgtctaat aatagcgttt tctctatctg tttccattac
agctgcctga agtttattgg 65340 tcggataata tgtaaaataa taagaaatac
atacgaataa caaaaataaa ataagatata 65400 ataaagatgc catttagaga
tctaattttg tttaacttgt ccaaattcct acttacagaa 65460 gatgaggaat
cgttggagat agtgtcttcc ttatgtagag gatttgaaat atcttataat 65520
gacttgataa cttactttcc agataggaaa taccataaat atatttataa agtatttgaa
65580 catgtagatt tatcggagga attaagtatg gaattccatg atacaactct
gagagattta 65640 gtctatctta gattgtacaa gtattccaag tgtatacggc
cgtgttataa attaggagat 65700 aatctaaaag gcatagttgt tataaaggac
aggaatattt atattaggga agcaaatgat 65760 gacttgatag aatatctcct
caaggaatac actcctcaga tttatacata ttctaatgag 65820 cgcgtcccca
taactggttc aaaattaatt ctttgtggat tttctcaagt tacatttatg 65880
gcgtatacaa cgtcgcatat aacaacaaat aaaaaggtag atgttctcgt ttccaaaaaa
65940 tgtatagatg aactagtcga tccaataaat tatcaaatac ttcaaaattt
atttgataaa 66000 ggaagcggaa caataaacaa aatactcagg aagatatttt
attcggtaac aggtggccaa 66060 actccatagg tagctttttc tatttcggat
tttagaattt ccaaattcac cagcgattta 66120 tcggttttgg tgaaatccaa
ggatttatta atgtccacaa atgccatttg ttttgtctgt 66180 ggattgtatt
tgaaaatgga aacgatgtag ttagatagat gcgctgcgaa gtttcctatt 66240
agggttccgc gcttcacgtc acccagcata cttgaatcac catcctttaa aaaaaatgat
66300 aagatatcaa catggagtat atcatactcg gattttaatt cttctactgc
atcactgaca 66360 ttttcacaaa tactacaata cggtttaccg aaaataatca
gtacgttctt catttatggg 66420 tatcaaaaac ttaaaatcgt tactgctgga
aaataaatca ctgacgatat tagatgataa 66480 tttatacaaa gtatacaatg
gaatatttgt ggatacaatg agtatttata tagccgtcgc 66540 caattgtgtc
agaaacttag aagagttaac tacggtattc ataaaatacg taaacggatg 66600
ggtaaaaaag ggagggcatg taaccctttt tatcgataga ggaagtataa aaattaaaca
66660 agacgttaga gacaagagac gtaaatattc taaattaacc aaggacagaa
aaatgctaga 66720 attagaaaag tgtacatccg aaatacaaaa tgttaccgga
tttatggaag aagaaataaa 66780 ggcagaaatg caattaaaaa tcgataaact
cacatttcaa atatatttat ctgattctga 66840 taacataaaa atatcattga
atgagatact aacacatttc aacaataatg agaatgttac 66900 attattttat
tgtgatgaac gagacgcaga attcgttatg tgtctcgagg ctaaaacaca 66960
tttctctacc acaggagaat ggccgttgat aataagtacc gatcaggata ctatgctatt
67020 tgcatctgct gataatcatc ctaagatgat aaaaaactta actcaactgt
ttaaatatgt 67080 tccatctgca gaggataact atttagcaaa attaacggcg
ttagtgaatg gatgtgattt 67140 ctttcctgga ctctatgggg catctataac
acccaccaac ttaaacaaaa tacaattgtt 67200 tagtgatttt acaatcgata
atatagtcac tagtttggca attaaaaatt attatagaaa 67260 gactaactct
accgtagacg tgcgtaatat tgttacgttt ataaacgatt acgctaattt 67320
agacgatgtc tactcgtatg ttcctccttg tcaatgcact gttcaagaat ttatattttc
67380 cgcattagat gaaaaatgga atgaatttaa atcatcttat ttagagaccg
tgccgttacc 67440 ctgtcaatta atgtacgcgt tagaaccacg taaggagatt
gatgtttcag aagttaaaac 67500 tttatcatct tatatagatt tcgaaaatac
taaatcagat atcgatgtta taaaatctat 67560 atcctcgatc ttcggatatt
ctaacgaaaa ctgtaacacg atagtattcg gcatctataa 67620 ggataattta
ctactgagta taaataattc attttacttt aacgatagtc tgttaataac 67680
caatactaaa agtgataata taataaatat aggttactag attaaaaatg gtgttccaac
67740 tcgtgtgctc tacatgcggt aaagatattt ctcacgaacg atataaattg
attatacgaa 67800 aaaaatcatt aaaggatgta ctcgtcagtg taaagaacga
atgttgtagg ttaaaattat 67860 ctacacaaat agaacctcaa cgtaacttaa
cagtgcaacc tctattggat ataaactaat 67920 atggatccgg ttaattttat
caagacatat gcgcctagag gttctattat ttttattaat 67980 tataccatgt
cattaacaag tcatttgaat ccatcgatag aaaaacatgt gggtatttat 68040
tatggtacgt tattatcgga acacttggta gttgaatcta cctatagaaa aggagttcga
68100 atagtcccat tggatagttt ttttgaagga tatcttagtg caaaagtata
catgttagag 68160 aatattcaag ttatgaaaat agcagctgat acgtcattaa
ctttattggg tattccgtat 68220 ggatttggtc ataatagaat gtattgtttt
aaattggtag ctgactgtta taaaaatgcc 68280 ggtattgata catcgtctaa
acgaatattg ggcaaagata tttttctgag ccaaaacttc 68340
acagacgata atagatggat aaagatatat gattctaata atttaacatt ttggcaaatt
68400 gattacctta aagggtgagt taatatgcat aactactcct ccgttgtttt
ttccctcgtt 68460 ctttttctta acgttgtttg ccatcactct cataatgtaa
agatattcta aaatggtaaa 68520 cttttgcata tcggacgcag aaattggtat
aaatgttgta attgtattat ttccatatta 68580 ttatgaagac tcctggtaat
actgatggcg ttttccaggg aatattctat gactgaatgt 68640 tctcaagaac
tacaaaagtt ttctttcaaa atagctatct cgtctctcaa caaactacga 68700
ggattcaaaa agagagtcaa tgtttttgaa actagaatcg taatggataa tgacgataac
68760 attttaggaa tgttgttttc ggatagagtt caatccttta agatcaacat
ctttatggcg 68820 tttttagatt aatactttca atgagataaa tatgggtggc
ggagtaagtg ttgagctccc 68880 taaacgggat ccgcacccgg gagtacccac
tgatgagatg ttattaaacg tggataaaat 68940 gcatgacgtg atagctcccg
ctaagctttt agaatatgtg catataggac cactagcaaa 69000 agataaagag
gataaagtaa agaaaagata tccagagttt agattagtca acacaggacc 69060
cggtggtctt tcggcattgt taagacaatc gtataatgga accgcaccca attgctgtcg
69120 cacttttaat cgtactcatt attggaagaa ggatggaaag atatcagata
agtatgaaga 69180 gggtgcagta ttagaatcgt gttggccaga cgttcacgac
actggaaaat gcgatgttga 69240 tttattcgac tggtgtcagg gggatacgtt
cgatagaaac atatgccatc agtggatcgg 69300 ttcagccttt aataggagta
atagaactgt agagggtcaa caatcgttaa taaatctgta 69360 taataagatg
caaacattat gtagtaaaga tgctagtgta ccaatatgcg aatcattttt 69420
gcattattta cgcgcacaca atacagaaga tagcaaagag atgatcgatt atattctaag
69480 acaacagtct gcggacttta aacagaaata tatgagatgt agttatccca
ctagagataa 69540 gttagaagag tcattaaaat atgcggaacc tcgagaatgt
tgggatccag agtgttcgaa 69600 tgccaatgtt aatttcttac taacacgtaa
ttataataat ttaggacttt gcaatattgt 69660 acgatgtaat accagcgtga
acaacttaca gatggataaa acttcctcat taagattgtc 69720 atgtggatta
agcaatagtg atagattttc tactgttccc gtcaatagag caaaagtagt 69780
tcaacataat attaaacact cgttcgacct aaaattgcat ttgatcagtt tattatctct
69840 cttggtaata tggatactaa ttgtagctat ttaaatgggt gccgcggcaa
gcatacagac 69900 gacggtgaat acactcagcg aacgtatctc gtctaaatta
gaacaagaag cgaacgctag 69960 tgctcaaaca aaatgtgata tagaaatcgg
aaatttttat atccgacaaa accatggatg 70020 taacctcact gttaaaaata
tgtgctctgc ggacgcggat gctcagttgg atgctgtgtt 70080 atcagccgct
acagaaacat atagtggatt aacaccggaa caaaaagcat acgtgccagc 70140
tatgtttact gctgcgttaa acattcagac gagtgtaaac actgttgtta gagattttga
70200 aaattatgtg aaacagactt gtaattctag cgcggtcgtc gataacaaat
taaagataca 70260 aaacgtaatc atagatgaat gttacggagc cccaggatct
ccaacaaatt tggaatttat 70320 taatacagga tctagcaaag gaaattgtgc
cattaaagcg ttgatgcaat tgacgactaa 70380 ggccactact caaatagcac
ctagacaagt tgctggtaca ggagttcagt tttatatgat 70440 tgttatcggt
gttataatat tggcagcgtt gtttatgtac tatgccaagc gtatgttgtt 70500
cacatccacc aatgataaaa tcaaacttat tttagccaat aaggaaaacg tccattggac
70560 tacttacatg gacacattct ttagaacttc tccgatggtt attgctacca
cggatatgca 70620 aaactgaaaa tatattgata atattttaat agattaacat
ggaagttatc gctgatcgtc 70680 tagacgatat agtgaaacaa aatatagcgg
atgaaaaatt tgtagatttt gttatacacg 70740 gtctagagca tcaatgtcct
gctatacttc gaccattaat taggttgttt attgatatac 70800 tattatttgt
tatagtaatt tatattttta cggtacgtct agtaagtaga aattatcaaa 70860
tgttgttggt ggtgctagtc atcacattaa ctatttttta ttactttata ctataatagt
70920 actagactga cttctaacaa acatctcacc tgccataaat aaatgcttga
tattaaagtc 70980 ttctatttct aacactattc catctgtgga aaataatact
ctgacattat cgctaattga 71040 cacatcggtg agtgatatgc ctataaagta
ataatcttct ttgggcacat ataccagtgt 71100 accaggttct aacaacctat
ttactggtgc tcctgtagca tactttttct ttaccttgag 71160 aatatccatc
gtttgcttgg tcaatagcga tatgtgattt tttatcaacc actcaaaaaa 71220
gtaattggag tgttcatatc ctctacgggc tattgtctca tggccgtgta tgaaatttaa
71280 gtaacacgac tgtggtagat ttgttctata gagccgattg ccgcaaatag
atagaactac 71340 caatatgtct gtacaaatgt taaacattaa ttgattaaca
gaaaaaacaa tgttcgttct 71400 gggaatagaa accagatcaa aacaaaattc
gttagaatat atgccacgtt tatacatgga 71460 atataaaata actacagttt
gaaaaataac agtatcattt aaacatttaa cttgcggggt 71520 taatctcaca
actttactgt ttttgaactg ttcaaaatat agcatcgatc cgtgagaaat 71580
acgtttagcc gcctttaata gaggaaatcc caccgccttt ctggatctca ccaacgacga
71640 tagttctgac cagcaactca tttcttcatc atccacctgt tttaacatat
aataggcagg 71700 agatagatat ccgtcattgc aatattcctt ctcgtaggca
cacaatctaa tattgataaa 71760 atctccattc tcttctctgc atttattatc
ttgtctcggt ggctgattag gctgtggtct 71820 tggtttaggc cttggtctat
cgttgttgaa tctattttgg tcattaaatc tttcatttct 71880 tcctggtata
tttctatcac ctcgtttggt tggatttttg tctatattat cgtttgtaac 71940
atcggtacgg gtattcattt atcacaaaaa aaacttctct aaatgagtct actgctagaa
72000 aacctcatcg aagaagatac catatttttt gcaggaagta tatctgagta
tgatgattta 72060 caaatggtta ttgccggcgc aaaatccaaa tttccaagat
ctatgctttc tatttttaat 72120 atagtaccta gaacgatgtc aaaatatgag
ttggagttga ttcataacga aaatatcaca 72180 ggagcaatgt ttaccacaat
gtataatata agaaacaatt tgggtctagg agatgataaa 72240 ctaactattg
aagccattga aaactatttc ttggatccta acaatgaagt tatgcctctt 72300
attattaata atacggatat gactgccgtc attcctaaaa aaagtggtag gagaaagaat
72360 aagaacatgg ttatcttccg tcaaggatca tcacctatct tgtgcatttt
cgaaactcgt 72420 aaaaagatta atatttataa agaaaatatg gaatccgcgt
cgactgagta tacacctatc 72480 ggagacaaca aggctttgat atctaaatat
gcgggaatta atgtcctgaa tgtgtattct 72540 ccttccacat ccataagatt
gaatgccatt tacggattca ccaataaaaa taaactagag 72600 aaacttagta
ctaataagga actagaatcg tatagttcta gccctcttca agaacccatt 72660
aggttaaatg attttctggg actattggaa tgtgttaaaa agaatattcc tctaacagat
72720 attccgacaa aggattgatt actataaatg gagaatgttc ctaatgtata
ctttaatcct 72780 gtgtttatag agcccacgtt taaacattct ttattaagtg
tttataaaca cagattaata 72840 gttttatttg aagtattcgt tgtattcatt
ctaatatatg tattttttag atctgaatta 72900 aatatgttct tcatgcctaa
acgaaaaata cccgatccta ttgatagatt acgacgtgct 72960 aatctagcgt
gtgaagacga taaattaatg atctatggat taccatggat gacaactcaa 73020
acatctgcgt tatcaataaa tagtaaaccg atagtgtata aagattgtgc aaagcttttg
73080 cgatcaataa atggatcaca accagtatct cttaacgatg ttcttcgcag
atgatgattc 73140 attttttaag tatttggcta gtcaagatga tgaatcttca
ttatctgata tattgcaaat 73200 cactcaatat ctagactttc tgttattatt
attgatccaa tcaaaaaata aattagaagc 73260 tgtgggtcat tgttatgaat
ctctttcaga ggaatacaga caattgacaa aattcacaga 73320 ctttcaagat
tttaaaaaac tgtttaacaa ggtccctatt gttacagatg gaagggtcaa 73380
acttaataaa ggatatttgt tcgactttgt gattagtttg atgcgattca aaaaagaatc
73440 ctctctagct accaccgcaa tagatcctgt tagatacata gatcctcgtc
gtgatatcgc 73500 attttctaac gtgatggata tattaaagtc gaataaagtg
aacaataatt aattctttat 73560 tgtcatcatg aacggcggac atattcagtt
gataatcggc cccatgtttt caggtaaaag 73620 tacagaatta attagacgag
ttagacgtta tcaaatagct caatataaat gcgtgactat 73680 aaaatattct
aacgataata gatacggaac gggactatgg acgcatgata agaataattt 73740
tgaagcattg gaagcaacta aactatgtga tgtcttggaa tcaattacag atttctccgt
73800 gataggtatc gatgaaggac agttctttcc agacattgtt taattctgtg
agcgtatggc 73860 aaacgaagga aaaatagtta tagtagccgc actcgatggg
acatttcaac gtaaaccgtt 73920 taataatatt ttgaatctta ttccattatc
tgaaatggtg gtaaaactaa ctgctgtgtg 73980 tatgaaatgc tttaaggagg
cttccttttc taaacgattg ggtgaggaaa ccgagataga 74040 gataatagga
ggtaatgata tgtatcaatc ggtgtgtaga aagtgttacg tcggctcata 74100
atattatatt ttttatctaa aaaactaaaa ataaacattg attaaatttt aatataatac
74160 ttaaaaatgg atgttgtgtc gttagataaa ccgtttatgt attttgagga
aattgataat 74220 gagttagatt acgaaccaga aagtgcaaat gaggtcgcaa
aaaaactgcc gtatcaagga 74280 cagttaaaac tattactagg agaattattt
tttcttagta agttacagcg acacggtata 74340 ttagatggtg ccaccgtagt
gtatatagga tcggctcctg gtacacatat acgttatttg 74400 agagatcatt
tctataattt aggagtgatc atcaaatgga tgctaattga cggccgccat 74460
catgatccta ttttaaatgg attgcgtgat gtaactctag tgactcggtt cgttgatgag
74520 gaatatctac gatccatcaa aaaacaactg catccttcta agattatttt
aatttctgat 74580 gtaagatcca aacgaggagg aaatgaacct agtacggcgg
atttactaag taattacgct 74640 ctacaaaatg tcatgattag tattttaaac
cccgtggcat ctagtcttaa atggagatgc 74700 ccgtttccag atcaatggat
caaggacttt tatatcccac acggtaataa aatgttacaa 74760 ccttttgctc
cttcatattc agctgaaatg agattattaa gtatttatac cggtgagaac 74820
atgagactga ctcgagttac caaattagac gctgtaaatt atgaaaaaaa gatgtactac
74880 cttaataaga tcgtccgtaa caaagtagtt gttaactttg attatcctaa
tcaggaatat 74940 gactattttc acatgtactt tatgctgagg accgtgtact
gcaataaaac atttcctact 75000 actaaagcaa aggtactatt tctacaacaa
tctatatttc gtttcttaaa tattccaaca 75060 acatcaactg aaaaagttag
tcatgaacca atacaacgta aaatatctag caaaaattct 75120 atgtctaaaa
acagaaatag caagagatcc gtacgcggta ataaatagaa acgtactact 75180
gagatatact accgatatag agtataatga tttagttact ttaataaccg ttagacataa
75240 aattgattct atgaaaactg tgtttcaggt atttaacgaa tcatccataa
attatactcc 75300 ggttgatgat gattatggag aaccaatcat tataacatcg
tatcttcaaa aaggtcataa 75360 caagtttcct gtaaattttc tatacataga
tgtggtaata tctgacttat ttcctagctt 75420 tgttagacta gatactacag
aaactaatat agttaatagt gtactacaaa caggcgatgg 75480 taaaaagact
cttcgtcttc ccaaaatgtt agagacggaa atagttgtca agattctcta 75540
tcgccctaat ataccattaa aaattgttag atttttccgc aataacatgg taactggagt
75600 agagatagcc gatagatctg ttatttcagt cgctgattaa tcaattagta
gagatgagat 75660 aagaacatta taataatcaa taatatatct tatatcttat
atcttatatc ttatatcttg 75720 tttagaaaaa tgctaatatt aaaatagcta
acgctagtaa tccaatcgga agccatttga 75780 tatctataat agggtatcta
atttcctgat ttaaatagcg gacagctata ttctcggtag 75840 ctactcgttt
ggaatcacaa acattattta catctaattt actatctgta atggaaacgt 75900
ttcccaatga aatggtacaa tccgatacat tgcattttgt tatatttttt tttaaagagg
75960 ctggtaacaa cgcatcgctt cgtttacatg gctcgtacca acaataatag
ggtaatcttg 76020 tatctattcc tatccgtact atgcttttat caggataaat
acatttacat cgtatatcgt 76080 ctttgttagc atcacagaat gcataaattt
gttcgtccgt catgataaaa atttaaagtg 76140 taaatataac tattattttt
atagttgtaa taaaaaggga aatttgattg tatactttcg 76200 gttctttaaa
agaaactgac ttgataaaaa tggctgtaat ctctaaggtt acgtatagtc 76260
tatatgatca aaaagagatt aatgctacag atattatcat tagtcatgtt aaaaatgacg
76320 acgatatcgg taccgttaaa gatggtagac taggtgctat ggatggggca
ttatgtaaga 76380 cttgtgggaa aacggaattg gaatgtttcg gtcactgggg
taaagtaagt atttataaaa 76440 ctcatatagt taagcctgaa tttatttcag
aaattattcg tttactgaat catatatgta 76500 ttcactgcgg attattgcgt
tcacgagaac cgtattccga cgatattaac ctaaaagagt 76560 tatcgggaca
cgctcttagg agattaaagg ataaaatatt atccaagaaa aagtcatgtt 76620
ggaacagtga atgtatgcaa ccgtatcaaa aaattacttt ttcaaagaaa aaggtttgtt
76680 tcgtcaacaa gttggatgat attaacgttc ctaattctct catctatcaa
aagttaattt 76740 ctattcatga aaagttttgg ccattattag aaattcatca
atatccagct aacttatttt 76800 atacagacta ctttcccatc cctccgttga
ttattagacc ggctattagt ttttggatag 76860 atagtatacc caaagagacc
aatgaattaa cttacttatt aggtatgatc gttaagaatt 76920 gtaacttgaa
tgctgatgaa caggttatcc agaaggcggt aatagaatac gatgatatta 76980
aaattatttc taataacact accagtatca atttatcata tattacatcc ggcaaaaata
77040 atatgattag aagttatatc gtcgcccgac gaaaagatca gaccgctaga
tctgtaattg 77100 gtcccagtac atctatcacc gttaatgagg taggaatgcc
cgcatatatt agaaatacac 77160 ttacagaaaa gatatttgtt aatgccttta
cagtggataa agttaaacaa ctattagcgt 77220 caaaccaagt taaattttac
tttaataaac gattaaacca attaacaaga atacgccaag 77280 gaaagtttat
taaaaataaa atacatttat tgcctggtga ttgggtagaa gtagctgttc 77340
aagaatatac aagtattatt tttggaagac agccgtctct acatagatac aacgtcatcg
77400 cttcatctat cagagctacc gaaggagata ctatcaaaat atctcccgga
attgccaact 77460 ctcaaaatgc tgatttcgac ggggatgagg aatggatgat
attagaacaa aatcctaaag 77520 ctgtaattga acaaagtatt cttatgtatc
cgacgacgtt actcaaacac gatattcatg 77580 gagcccccgt ttatggatct
attcaagatg aaatcgtagc agcgtattca ttgtttagga 77640 tacaagatct
ttgtttagat gaagtattga acatcttggg gaaatatgga agagagttcg 77700
atcctaaagg taaatgtaaa ttcagcggta aagatatcta tacttacttg ataggtgaaa
77760 agattaatta tccgggtctc ttaaaggatg gtgaaattat tgcaaacgac
gtagatagta 77820 attttgttgt ggctatgagg catctgtcat tggctggact
cttatccgat cataagtcga 77880 acgtggaagg tatcaacttt attatcaagt
catcttatgt ttttaagaga tatctatcta 77940 tttacggttt tggggtgaca
ttcaaagatc tgagaccaaa ttcgacgttc actaataaat 78000 tggaggccat
caacgtagaa aaaatagaac ttatcaaaga agcatacgcc aaatatctca 78060
acgatgtaag agacgggaaa atagttccat tatctaaagc tttagaggcg gactatgtgg
78120 aatccatgtt atccaacttg acaaatctta atatccgaga gatagaagaa
catatgagac 78180 aaacgctgat agatgatcca gataataacc tcctgaaaat
ggccaaagcg ggttataaag 78240 taaatcccac agaactaatg tatattctag
gtacgtatgg acaacaaagg attgatggtg 78300 aaccagcaga gactcgagta
ttgggtagag ttttacctta ctatcttcca gactctaagg 78360 atccagaagg
aagaggttat attcttaatt ctttaacaaa aggattaacg ggttctcaat 78420
attacttttc gatgctggtt gcaagatctc aatctactga tatcgtctgt gaaacatcac
78480 gtaccggaac actggctaga aaaatcatta aaaagatgga ggatatggtg
gtcgacggat 78540 acggacaagt agttataggt aatacgctca tcaagtacgc
cgccaattat accaaaattc 78600 taggctcagt atgtaaacct gtagatctta
tctatccaga tgagtccatg acttggtatt 78660 tggaaattag tgctctgtgg
aataaaataa aacagggatt cgtttactct cagaaacaga 78720 aacttgcaaa
gaagacattg gcgccgttta atttcctagt attcgtcaaa cccaccactg 78780
aggataatgc tattaaggtt aaggatctgt acgatatgat tcataacgtc attgatgatg
78840 tgagagagaa atacttcttt acggtatcta atatagattt tatggagtat
atattcttga 78900 cgcatcttaa tccttctaga attagaatta caaaagaaac
ggctatcact atctttgaaa 78960 agttctatga aaaactcaat tatactctag
gtggtggaac tcctattgga attatttctg 79020 cacaggtatt gtctgagaag
tttacacaac aagccctgtc cagttttcac actactgaaa 79080 aaagtggtgc
cgtcaaacaa aaacttggtt tcaacgagtt taataacttg actaatttga 79140
gtaagaataa gaccgaaatt atcactctgg tatccgatga tatctctaaa cttcaatctg
79200 ttaagattaa tttcgaattt gtatgtttgg gagaattaaa tccaaacatc
actcttcgaa 79260 aagaaacaga taggtatgta gtagatataa tagtcaatag
attatacatc aagagagcag 79320 aaataaccga attagtcgtc gaatatatga
ttgaacgatt catctccttt agcgtcattg 79380 taaaggaatg gggtatggag
acattcattg aggacgagga taatattaga tttactgtct 79440 acctaaattt
cgttgaaccg gaagaattga atcttagtaa gtttatgatg gttcttccgg 79500
gggcagccaa caagggaaag attagtaaat tcaagattcc tatctctgac tatacgggat
79560 atgacgactt caatcaaaca aaaaagctca ataagatgac tgtagaactc
atgaatctaa 79620 aagaattggg ttctttcgat ttggaaaacg tcaacgtgta
tcctggagta tggaatacat 79680 acgatatctt cggtatcgag gccgctcgtg
aatacttgtg cgaagccatg ttaaacacct 79740 atggagaagg gttcgattat
ctgtatcagc cttgtgatct tctcgctagt ttactatgtg 79800 ctagttacga
accagaatca gtgaataaat tcaagttcgg cgcagctagt actcttaaga 79860
gagctacgtt cggagacaat aaagcattgt taaacgcggc tcttcataaa aagtcagaac
79920 ctattaacga taatagtagc tgccactttt ttagcaaggt ccctaatata
ggaactggat 79980 attacaaata ctttatcgac ttgggtcttc tcatgagaat
ggaaaggaaa ctatctgata 80040 agatatcttc tcaaaagatc aaggaaatgg
aagaaacaga agacttttaa ttcttatcaa 80100 taacatattt ttctatgatc
tgtcttttaa acgatggatt ttccacaaat gcgcctctca 80160 agtccctcat
agaatgatac acgtataaaa aatatagcat aggcaatgac tccttatttt 80220
tagacattag atatgccaaa atcatagccc cgcttctatt tactcccgca gcacaatgaa
80280 ccaacacggg ctcgtttcgt tgatcacatt tagataaaaa ggcggttacg
tcgtcaaaat 80340 atttactaat atcggtagtt gtatcatcta ccaacggtat
atgaataata ttaatattag 80400 agttaggtaa tgtatattta tccatcgtca
aatttaaaac atatttgaac ttaacttcag 80460 atgatggtgc atccatagca
tttttataat ttcccaaata cacattattg gttacccttg 80520 tcattatagt
gggagatttg gctctgtgca tatctccagt tgaacgtagt agtaagtatt 80580
tatacaaact tttcttatcc atttataacg tacaaatgga taaaactact ttatcggtaa
80640 acgcgtgtaa tttagaatac gttagagaaa aggctatagt aggcgtacaa
gcagccaaaa 80700 catcaacact tatattcttt gttattatat tggcaattag
tgcgctatta ctctggtttc 80760 agacgtctga taatccagtc tttaatgaat
taacgagata tatgcgaatt aaaaatacgg 80820 ttaacgattg gaaatcatta
acggatagca aaacaaaatt agaaagtgat agaggtagac 80880 ttctagccgc
tggtaaggat gatatattcg acttcaaatg tgtggatttc ggcgcctatt 80940
ttatagctat gcgattggat aagaaaacat atctgccgca agctattagg cgaggtactg
81000 gagacgcgtg gatggttaaa aaggcggcaa aggtcgatcc atctgctcaa
caattttgtc 81060 agtatttgat aaaacacaag tctaataatg ttattacttg
tggtaatgag atgttaaatg 81120 aattaggtta tagcggttat tttatgtcac
cgcattggtg ttccgatttt agtaatatgg 81180 aatagtgtta gataaatgcg
gtaacgaatg ttcctgtaag gaaccataac agcttagatt 81240 taacgttaaa
gatgagcata aacataataa acaaaattac aatcaaactt ataacattaa 81300
tatcaaacaa tccaaaaaat gaaatcagtg gagtagtaaa cgcgtacata actcctggat
81360 aacgtttagc agctgccgtt cctattctag accaaaaatt cggtttcatg
ttttcgaaac 81420 ggtattctgc aacaagtcga ggatcgtgtt ctacatattt
ggcggcatta tccagtatct 81480 gcctattgat cttcatttcg ttttcaattc
tggctatttc aaaataaaat cccgatgata 81540 gacctccaga ctttataatt
tcatctacga tgttcagcgc cgtagtaact ctaataatat 81600 aggctgataa
gctaacatca taccctcctg tatatgtgaa tatggcatga tttttgtcca 81660
ttacaagctc ggttttaact ttattgcctg taataatttc tctcatctgt aggatatcta
81720 tttttttgtc atgcattgcc ttcaagacgg gacgaagaaa cgtaatatcc
tcaataacgt 81780 tatcgttttc tacaataact acatattcta cctttttatt
ttctaactcg gtaaaaaaat 81840 tagaatccca tagggctaaa tgtctagcga
tatttctttt cgtttcctct gtacacatag 81900 tgttacaaaa ccctgaaaag
aagtgagtat acttgtcatc atttctaatg tttcctccag 81960 tccactgtat
aaacgcataa tccttgtaat gatctggatc atccttgact accacaacat 82020
ttcttttttc tggcataact tcgttgtcct ttacatcatc gaacttctga tcattaatat
82080 gctcatgaac attaggaaat gtttctgatg gaggtctatc aataactggc
acaacaataa 82140 caggagtttt caccgccgcc atttagttat tgaaattaat
catatacaac tctttaatac 82200 gagttatatt ttcgtctatc cattgtttca
cattgacata tttcgacaaa aagatataaa 82260 atgcgtattc caatgcttct
ctgtttaatg aattactaaa atatacaaac acgtcactgt 82320 ctggcaataa
atgatatctt agaatattgt aacaatgtaa ggaaccataa cagtttagat 82380
ttaacgttaa agatgagcat aaacataata aacaaaatta caatcaaacc tataacatta
82440 atatcaaaca atccaaaaaa tgaaatcagt ggagtagtaa acgcgtacat
aactcctgga 82500 taacgtttag cagctgccgt tcctattcta gaccaaaaat
ttggtttcat gttttcgaaa 82560 cggtattctg caacaagtcg gggatcgtgt
tctacatatt tggcggcatt atccagtatc 82620 tgcctattga tcttcatttc
gttttcgatt ctggctattt caaaataaaa tcccgatgat 82680 agacctccag
actttataat ttcatctacg atgttcagcg ccgtagtaac tctaataata 82740
taggctgata agctaacatc ataccctcct gtatatgtga atatggcatg atttttgtcc
82800 attacaagct cggttttaac tttattgcct gtaataattt ctctcatctg
taggatatct 82860 atttttttgt catgcattgc cttcaagacg ggacgaagaa
acgtaatatc ctcaataacg 82920 ttatcgtttt ctacaataac tacatattct
acctttttat tttctaactc ggtaaaaaaa 82980 ttagaatccc atagggctaa
atgtctagcg atatttcttt tcgtttcctc tgtacacata 83040 gtgttacaaa
accctgaaaa gaagtgagta tacttgtcat catttctaat gtttcctcca 83100
gtccactgta taaacgcata atccttgtaa tgatctggat catccttgac taccacaaca
83160 tttctttttt ctggcataac ttcgttgtcc tttacatcat cgaacttctg
atcattaata 83220 tgctcatgaa cattaggaaa tgtttctgat ggaggtctat
caataactgg cacaacaata 83280 acaggagttt tcaccgccgc catttagtta
ttgaaattaa tcatatacaa ctctttaata 83340 cgagttatat tttcgtctat
ccattgtttc acatttacat atttcgacaa aaagatataa 83400
aatgcgtatt ccaatgcttc tctgtttaat gaattactaa aatatacaaa cacgtcactg
83460 tctggcaata aatgatatct tagaatattg taacaattta ttttgtattg
cacatgttcg 83520 tgatctatga gttcttcttc gaatggcata ggatctccga
atctgaaaac gtataaatag 83580 gagttagaat aataatattt gagagtattg
gtaatatata aactctttag cggtataatt 83640 agtttttttc tctcaatttc
tatttttaga tgtgatggaa aaatgactaa ttttgtagca 83700 ttagtatcat
gaactctaat caaaatctta atatcttcgt cacacgttag ctctttgaag 83760
tttttaagag atgcatcagt tggttctaca gatggagtag gtgcaacaat tttttgttct
83820 acacatgtat gtactggagc cattgtttta actataatgg tgcttgtatc
gaaaaacttt 83880 aatgcagata gcggaagctc ttcgccgcga ctttctacgt
cgtaattggg ttctaacgcc 83940 gatctctgaa tggatactag ttttctaagt
tctaatgtga ttctctgaaa atgtaaatcc 84000 aattcctccg gcattataga
tgtgtataca tcggtaaata aaactatagt atccaacgat 84060 cccttctcgc
aaattctagt cttaaccaaa aaatcgtata taaccacgga gatggcgtat 84120
ttaagagtgg attcttctac cgttttgttc ttggatgtca tataggaaac tataaagtcc
84180 gcactactgt taagaatgat tactaacgca actatatagt ttaaattaag
cattttggaa 84240 acataaaata actctgtaga cgatacttga ctttcgaata
agtttgcaga caaacgaaga 84300 aagaacagac ctctcttaat ttcagaagaa
aacttttttt cgtattcctg acgtctagag 84360 tttatatcaa taagaaagtt
aagaattagt cggttaatgt tgtatttcat tacccaagtt 84420 tgagatttca
taatattatc aaaagacatg ataatattaa agataaagcg ctgactatga 84480
acgaaatagc tatatggttc gctcaagaat atagtcttgt taaacgtgga aacgataact
84540 gtatttttaa tcacgtcagc ggcatctaaa ttaaatatag gtatatttat
tccacacact 84600 ctacaatatg ccacaccatc ttcataataa ataaattcgt
tagcaaaatt attaatttta 84660 gtgaaatagt tagcgtcaac tttcatagct
tccttcaatc taatttgatg ctcacacggt 84720 gcgaattcca ctctaacatc
ccttttccat gcctcaggtt catcgatctc tataatatct 84780 agttttttgc
gtttcacaaa cacaggctcg tctctcgcga tgagatctgt atagtaacta 84840
tgtaaatgat aactagatag aaagatgtag ctatatagat gacgatcctt taagagaggt
84900 ataataactt taccccaatc agatagactg ttgttatggt cttcggaaaa
agaattttta 84960 taaatttttc cagtattttc caaatatacg tacttaacat
ctaaaaaatc cttaatgata 85020 ataggaatgg ataatccgtc tattttataa
agaaatacat atcgcacatt atactttttt 85080 ttggaaatgg gaataccgat
gtgtctacat aaatatgcaa agtctaaata ttttttagag 85140 aatcttagtt
ggtccaaatt cttttccaag tacggtaata gatttttcat attgaacggt 85200
atcttcttaa tctctggttc tagttccgca ttaaatgatg aaactaagtc actattttta
85260 taactaacga ttacatcacc tctaacatca tcatttacca gaatactgat
cttcttttgt 85320 cgtaaataca tgtctaatgt gttaaaaaaa agatcataca
agttatacgt catttcatct 85380 gtggtattct tgtcattgaa ggataaactc
gtactaatct cttctttaac agcctgttca 85440 aatttatatc ctatatacga
aaaaatagca accagtgttt gatcatccgc gtcaatattc 85500 tgttctatcg
tagtgtataa caatcgtata tcttcttctg tgatagtcga tacgttataa 85560
aggttgataa cgaaaatatt tttatttcgt gaaataaagt catcgtagga ttttggactt
85620 atattcgcgt ctagtagata tgcttttatt tttggaatga tctcaattag
aatagtctct 85680 ttagagtcca tttaaagtta caaacaacta ggaaattggt
ttatgatgta taattttttt 85740 agtttttata gattctttat tctatactta
aaaaatgaaa ataaatacaa aggttcttga 85800 gggttgtgtt aaattgaaag
cgagaaataa tcataaatta tttcattatc gcgatatccg 85860 ttaagtttgt
atcgtaatgg cgtggtcaat tacgaataaa gcggatacta gtagcttcac 85920
aaagatggct gaaatcagag ctcatctaaa aaatagcgct gaaaataaag ataaaaacga
85980 ggatattttc ccggaagatg taataattcc atctactaag cccaaaacca
aacgagccac 86040 tactcctcgt aaaccagcgg ctactaaaag atcaaccaaa
aaggaggaag tggaagaaga 86100 agtagttata gaggaatatc atcaaacaac
tgaaaaaaat tctccatctc ctggagtcag 86160 cgacattgta gaaagcgtgg
ccgctgtaga gctcgatgat agcgacgggg atgatgaacc 86220 tatggtacaa
gttgaagctg gtaaagtaaa tcatagtgct agaagcgatc tctctgacct 86280
aaaggtggct accgacaata tcgttaaaga tcttaagaaa attattacta gaatctctgc
86340 agtatcgacg gttctagagg atgttcaagc agctggtatc tctagacaat
ttacttctat 86400 gactaaagct attacaacac tatctgatct agtcaccgag
ggaaaatcta aagttgttcg 86460 taaaaaagtt aaaacttgta agaagtaaat
gcgtgcactt ttttataaag atggtaaact 86520 ctttaccgat aataattttt
taaatcctgt atcagacgat aatccagcgt atgaggtttt 86580 gcaacatgtt
aaaattccta ctcatttaac agatgtagta gtatatgaac aaacgtggga 86640
ggaggcgtta actagattaa tttttgtggg aagcgattca aaaggacgta gacaatactt
86700 ttacggaaaa atgcatgtac agaatcgcaa cgctaaaaga gatcgtattt
ttgttagagt 86760 atataacgtt atgaaacgaa ttaattgttt tataaacaaa
aatataaaga aatcgtccac 86820 agattccaat tatcagttgg cggtttttat
gttaatggaa actatgtttt ttattagatt 86880 tggtaaaatg aaatatctta
aggagaatga aacagtaggg ttattaacac taaaaaataa 86940 acacatagaa
ataagtcccg atgaaatagt tatcaagttt gtaggaaagg acaaagtttc 87000
acatgaattt gttgttcata agtctaatag actatataaa ccgctattga aactgacgga
87060 tgattctagt cccgaagaat ttctgttcaa caaactaagt gaacgaaagg
tatacgaatg 87120 tatcaaacag tttggtatta gaatcaagga tctccgaacg
tatggagtca attatacgtt 87180 tttatataat ttttggacaa atgtaaagtc
catatctcct cttccgtcac caaaaaagtt 87240 aatagcgtta actatcaaac
aaactgctga agtggtaggt catactccat caatttcaaa 87300 aagagcttat
atggcaacga ctattttaga aatggtaaag gataaaaatt ttttagatgt 87360
agtatctaaa actacgttcg atgaattcct atctatagtc gtagatcacg ttaaatcatc
87420 tacggatgga tgatatagat ctttacacaa ataattacaa gaccgataaa
tggaaatgga 87480 taagcgtatg aaatctctcg caatgacagc tttcttcgga
gagctaagca cattagatat 87540 tatggcattg ataatgtcta tatttaaacg
ccatccaaac aataccattt tttcagtgga 87600 taaggatggt cagtttatga
ttgatttcga atacgataat tataaggctt ctcaatattt 87660 ggatctgacc
ctcactccga tatctggaga tgaatgcaag actcacgcat cgagtatagc 87720
cgaacaattg gcgtgtgtgg atattattaa agaggatatt agcgaatata tcaaaactac
87780 tccccgtctt aaacgattta taaaaaaata ccgcaataga tcagatactc
gcatcagtcg 87840 agatacagaa aagcttaaaa tagctctagc taaaggcata
gattacgaat atataaaaga 87900 cgcttgttaa taagtaaatg aaaaaaaact
agtcgtttat aataaaacac gatatggatg 87960 ccaacgtagt atcatcttct
actattgcga cgtatataga cgctttagcg aagaatgctt 88020 cagaattaga
acagaggtct accgcatacg aaataaataa tgaattggaa ctagtattta 88080
ttaagccgcc attgattact ttgacaaatg tagtgaatat ctctacgatt caggaatcgt
88140 ttattcgatt taccgttact aataaggaag gtgttaaaat tagaactaag
attccattat 88200 ctaaggtaca tggtctagat gtaaaaaatg tacagttagt
agatgctata gataacatag 88260 tttgggaaaa gaaatcatta gtgacggaaa
atcgtcttca caaagaatgc ttgttgagac 88320 tatcgacaga ggaacgtcat
atatttttgg attacaagaa atatggatcc tctatccgac 88380 tagaattagt
caatcttatt caagcaaaaa caaaaaactt tacgatagac tttaagctaa 88440
aatattttct aggatccggt gcccaatcta aaagttcttt gttgcacgct attaatcatc
88500 caaagtcaag gcctaataca tctctggaaa tagaattcac acctagagac
aatgaaacag 88560 ttccatatga tgaactaata aaggaattga cgactctctc
gcgtcatata tttatggctt 88620 ctccagagaa tgtaattctt tctccgccta
ttaacgcgcc tataaaaacc tttatgttgc 88680 ctaaacaaga tatagtaggt
ttggatctgg aaaatctata tgccgtaact aagactgacg 88740 gcattcctat
aactatcaga gttacatcaa acgggttgta ttgttatttt acacatcttg 88800
gttatattat tagatatcct gttaagagaa taatagattc cgaagtagta gtctttggtg
88860 aggcagttaa ggataagaac tggaccgtat atctcattaa gctaatagag
cccgtgaatg 88920 ctatcagtga tagactagaa gaaagtaagt atgttgaatc
taaactagtg gatatttgtg 88980 atcggatagt attcaagtca aagaaatacg
aaggtccgtt tactacaact agtgaagtcg 89040 tcgatatgtt atctacatat
ttaccaaagc aaccagaagg tgttattctg ttctattcaa 89100 agggacctaa
atctaacatt gattttaaaa ttaaaaagga aaatactata gaccaaactg 89160
caaatgtagt atttaggtac atgtccagtg aaccaattat ctttggagaa tcgtctatct
89220 ttgtagagta taagaaattt agcaacgata aaggctttcc taaagaatat
ggttctggta 89280 agattgtgtt atataacggc gttaattatc taaataatat
ctattgtttg gaatatatta 89340 atacacataa tgaagtgggt attaagtccg
tggttgtacc tattaagttt atagcagaat 89400 tcttagttaa tggagaaata
cttaaaccta gaattgataa aaccatgaaa tatattaact 89460 cagaagatta
ttatggaaat caacataata tcatagtcga acatttaaga gatcaaagca 89520
tcaaaatagg agatatcttt aacgaggata aactatcgga tgtgggacat caatacgcca
89580 ataatgataa atttagatta aatccagaag ttagttattt tacgaataaa
cgaactagag 89640 gaccgttggg aattttatca aactacgtca agactcttct
tatttctatg tattgttcca 89700 aaacattttt agacgattcc aacaaacgaa
aggtattggc gattgatttt ggaaacggtg 89760 ctgacctgga aaaatacttt
tatggagaga ttgcgttatt ggtagcgacg gatccggatg 89820 ctgatgctat
agctagagga aatgaaagat acaacaaatt aaactctgga attaaaacca 89880
agtactacaa atttgactac attcaggaaa ctattcgatc cgatacattt gtctctagtg
89940 tcagagaagt attctatttt ggaaagttta atatcatcga ctggcagttt
gctatccatt 90000 attcttttca tccgagacat tatgctaccg tcatgaataa
cttatccgaa ctaactgctt 90060 ctggaggcaa ggtattaatc actaccatgg
acggagacaa attatcaaaa ttaacagata 90120 aaaagacttt tataattcat
aagaatttac ctagtagcga aaactatatg tctgtagaaa 90180 aaatagctga
tgatagaata gtggtatata atccatcaac aatgtctact ccaatgactg 90240
aatacattat caaaaagaac gatatagtca gagtgtttaa cgaatacgga tttgttcttg
90300 tagataacgt tgatttcgct acaattatag aacgaagtaa aaagtttatt
aatggcgcat 90360 ctacaatgga agatagaccg tctacaaaaa actttttcga
actaaataga ggagccatta 90420 aatgtgaagg tttagatgtc gaagacttac
ttagttacta tgttgtttat gtcttttcta 90480 agcggtaaat aataatatgg
tatgggttct gatatccccg ttctaaatgc attaaataat 90540 tccaatagag
cgatttttgt tcctatagga ccttccaact gtggatactc tgtattgtta 90600
atagatatat taatactttt gtcgggtaac agaggttcta cgtcttctaa aaataaaagt
90660 tttataacat ctggcctgtt cataaataaa aacttggcga ttctatatat
actcttatta 90720 tcaaatctag ccattgtctt atagatgtga gctactgtag
gtgtaccatt tgattttctt 90780 tctaatacta tatatttctc tcgaagaagt
tcttgcacat catctgggaa taaaatacta 90840 ctgttgagta aatcagttat
tttttttata tcgatattga tggacatttt tatagttaag 90900 gataataagt
atcccaaagt cgataacgac gataacgaag tatttatact tttaggaaat 90960
cacaatgact ttatcagatt aaaattaaca aaattaaagg agcatgtatt tttttctgaa
91020 tatattgtga ctccagatac atatggatct ttatgcgtcg aattaaatgg
gtctagtttt 91080 cagcacggtg gtagatatat agaggtggag gaatttatag
atgctggaag acaagttaga 91140 tggtgttcta catccaatca tatatctaaa
gatatacccg aagatatgca cactgataaa 91200 tttgtcattt atgatatata
cacttttgac gctttcaaga ataaacgatt ggtattcgta 91260 caggtacctc
cgtcgttagg agatgatagt catttgacta atccgttatt gtctccgtat 91320
tatcgtaatt cagtagccag acaaatggtc aataatatga tttttaatca agattcattt
91380 ttaaaatatt tattagaaca tctgattaga agccactata gagtttctaa
acatataaca 91440 atagttagat acaaggatac cgaagaatta aatctaacga
gaatatgtta taatagagat 91500 aagtttaagg cgtttgtatt cgcttggttt
aacggcgttt cggaaaatga aaaggtacta 91560 gatacgtata aaaaggtatc
taatttgata taatgaattc agtgactgta tcacacgcgc 91620 catatactat
tacttatcac gatgattggg aaccagtaat gagtcaattg gtagagtttt 91680
ataacgaagt agccagttgg ctgctacgag acgagacgtc gcctattcct gataagttct
91740 ttatacagtt gaaacaaccg cttagaaata aacgagtatg tgtgtgcggt
atagatccgt 91800 atccgaaaga tggaactggt gtaccgttcg aatcaccaaa
ttttacaaaa aaatcaatta 91860 aggagatagc ttcatctata tctagattaa
ccggagtaat tgattataaa ggttataacc 91920 ttaatataat agacggggtt
ataccctgga attattactt aagttgtaaa ttaggagaaa 91980 caaaaagtca
cgcgatctac tgggataaga tttccaagtt actgctgcag catataacta 92040
aacacgttag tgttctttat tgtttgggta aaacagattt ctcgaatata cgggcaaagt
92100 tagaatcccc ggtaactacc atagtcggat atcatccagc ggctagagac
cgccaattcg 92160 agaaagatag atcatttgaa attatcaacg ttttactgga
attagacaac aaggcaccta 92220 taaattgggc tcaagggttt atttattaat
gctttagtga aattttaact tgtgttctaa 92280 atggatgcgg ctattagagg
taatgatgtt atctttgttc ttaagactat aggtgtcccg 92340 tcagcgtgca
gacaaaatga agatccaaga tttgtagaag catttaaatg cgacgagtta 92400
gaaagatata ttgagaataa tccagaatgt acactattcg aaagtcttag ggatgaggaa
92460 gcatactcta tagtcagaat tttcatggat gtagatttag acgcgtgtct
agacgaaata 92520 gattatttaa cggctattca agattttatt atcgaggtgt
caaactgtgt agctagattc 92580 gcgtttacag aatgcggtgc cattcatgaa
aatgtaataa aatccatgag atctaatttt 92640 tcattgacta agtctacaaa
tagagataaa acaagttttc atattatctt tttagacacg 92700 tataccacta
tggatacatt gatagctatg aaacgaacac tattagaatt aagtagatca 92760
tctgaaaatc cactaacaag atcgatagac actgccgtat ataggagaaa aacaactctt
92820 cgggttgtag gtactaggaa aaatccaaat tgcgacacta ttcatgtaat
gcaaccaccg 92880 catgataata tagaagatta cctattcact tacgtggata
tgaacaacaa tagttattac 92940 ttttctctac aacaacgatt ggaggattta
gttcctgata agttatggga accagggttt 93000 atttcattcg aagacgctat
aaaaagagtt tcaaaaatat tcattaattc tataataaac 93060 tttaatgatc
tcgatgaaaa taattttaca acggtaccac tggtcataga ttacgtaaca 93120
ccttgtgcat tatgtaaaaa acgatcgcat aaacatccgc atcaactatc gttggaaaat
93180 ggtgctatta gaatttacaa aactggtaat ccacatagtt gtaaagttaa
aattgttccg 93240 ttggatggta ataaactgtt taatattgca caaagaattt
tagacactaa ctctgtttta 93300 ttaaccgaac gaggagacca tatagtttgg
attaataatt catggaaatt taacagcgaa 93360 gaacccttga taacaaaact
aattttgtca ataagacatc aactacctaa ggaatattca 93420 agcgaattac
tctgtccgag gaaacgaaag actgtagaag ctaacatacg agacatgtta 93480
gtagattcag tggagaccga tacctatccg gataaacttc cgtttaaaaa tggtgtattg
93540 gacctggtag acggaatgtt ttactctgga gatgatgcta aaaaatatac
gtgtactgta 93600 tcaaccggat ttaaatttga cgatacaaag ttcgtcgaag
acagtccaga aatggaagag 93660 ttaatgaata tcattaacga tatccaacca
ttaacggatg aaaataagaa aaatagagag 93720 ctatatgaaa aaacattatc
tagttgttta tgcggtgcta ccaaaggatg tttaacattc 93780 ttttttggag
aaactgcaac tggaaagtcg acaaccaaac gtttgttaaa gtctgctatc 93840
ggtgacctgt ttgttgagac gggtcaaaca attttaacag atgtattgga taaaggacct
93900 aatccattta tcgctaacat gcatttgaaa agatctgtat tctgtagcga
actacctgat 93960 tttgcatgta gtgggtcaaa gaaaatcaga tctgataata
ttaaaaagtt gacagaacct 94020 tgtgtcattg gaagaccgtg tttctccaat
aaaattaata atagaaacca tgcgacaatc 94080 attatcgata ctaattacaa
acctgttttt gataggatag ataacgcatt aatgagaaga 94140 attgccgtcg
tgcgattcag aacacacttt tctcaacctt ctggtagaga ggctgctgaa 94200
aataatgacg cgtacgataa agtcaaacta ttagacgagg ggttagatgg taaaatacaa
94260 aataatagat atagattcgc atttctatac ttgttggtga aatggtacag
aaaatatcat 94320 gttcctatta tgaaactata tcctacaccc gaagagattc
ctgactttgc attctatctc 94380 aaaataggta ctctgttggt atctagctct
gtaaagcata ttccattaat gacggacctc 94440 tccaaaaagg gatatatatt
gtacgataat gtggtcactc ttccgttgac tactttccaa 94500 cagaaaatat
ccaagtattt taattctaga ctatttggac acgatataga gagcttcatc 94560
aatagacata agaaatttgc caatgttagt gatgaatatc tgcaatatat attcatagag
94620 gatatttcat ctccgtaaat atatgctcat atatttatag aagatatcac
atatctaaat 94680 gaataccgga atcatagatt tatttgataa tcatgttgat
agtataccaa ctatattacc 94740 tcatcagtta gctactctag attatctagt
tagaactatc atagatgaga acagaagcgt 94800 gttattgttc catattatgg
gatcaggtaa aacaataatc gctttgttgt tcgccttggt 94860 agcttccaga
tttaaaaagg tttacattct agtgccgaac atcaacatct taaaaatttt 94920
caattataat atgggtgtag ctatgaactt gtttaatgac gaattcatag ctgagaatat
94980 ctttattcat tccacaacaa gtttttattc tcttaattat aacgataacg
tcattaatta 95040 taacggatta tctcgctaca ataactctat ttttatcgtt
gatgaggcac ataatatctt 95100 tgggaataat actggagaac ttatgaccgt
gataaaaaat aaaaacaaga ttcctttttt 95160 actattgtct ggatctccca
ttactaacac acctaatact ctgggtcata ttatagattt 95220 aatgtccgaa
gagacgatag attttggtga aattattagt cgtggtaaga aagtaattca 95280
gacacttctt aacgaacgcg gtgtgaatgt acttaaggat ttgcttaaag gaagaatatc
95340 atattacgaa atgcctgata aagatctacc aacgataaga tatcacggac
gtaagtttct 95400 agatactaga gtagtatatt gtcacatgtc taaacttcaa
gagagagatt atatgattac 95460 tagacgacag ctatgttatc atgaaatgtt
tgataaaaat atgtataacg tgtcaatggc 95520 agtattggga caacttaatc
tgatgaataa tttagatact ttatttcagg aacaggataa 95580 ggaattgtac
ccaaatctga aaataaataa tggcgtgtta tacggagaag aattggtaac 95640
gttaaacatt agttccaaat ttaaatactt tattaatcgg atacagacac tcaacggaaa
95700 acattttata tacttttcta attctacata tggcggattg gtaattaaat
atatcatgct 95760 cagtaatgga tattctgaat ataatggttc tcagggaact
aatccacata tgataaacgg 95820 caaaccaaaa acatttgcta tcgttactag
taaaatgaaa tcgtctttag aggatctatt 95880 agatgtgtat aattctcctg
aaaacgatga tggtagtcaa ttgatgtttt tgttttcatc 95940 aaacattatg
tccgaatcct atactctaaa agaggtaagg catatttggt ttatgactat 96000
cccagatact ttttctcaat acaaccaaat tcttggacga tctattagaa aattctctta
96060 cgccgatatt tctgaaccag ttaatgtata tcttttagcc gccgtatatt
ccgatttcaa 96120 tgacgaagtg acgtcattaa acgattacac acaggatgaa
ttaattaatg ttttaccatt 96180 tgacatcaaa aagctgttgt atctaaaatt
taagacgaaa gaaacgaata gaatatactc 96240 tattcttcaa gagatgtctg
aaacgtattc tcttccacca catccatcaa ttgtaaaagt 96300 tttattggga
gaattggtca gacaattttt ttataataat tctcgtatta agtataacga 96360
taccaagtta cttaaaatgg ttacatcagt tataaaaaat aaagaagacg ctaggaatta
96420 catagatgat attgtaaacg gtcacttctt tgtatcgaat aaagtatttg
ataaatctct 96480 tttatacaaa tacgaaaacg atattattac agtaccgttt
agactttcct acgaaccatt 96540 tgtttgggga gttaactttc gtaaagaata
taacgtggta tcttctccat aaaactgatg 96600 agatatataa agaaataaat
gtcgagcttt gttaccaatg gatacctttc cgttacattg 96660 gaacctcatg
agctgacgtt agacataaaa actaatatta ggaatgccgt atataagacg 96720
tatctccata gagaaattag tggtaaaatg gccaagaaaa tagaaattcg tgaagacgtg
96780 gaattacctc tcggcgaaat agttaataat tctgtagtta taaacgttcc
gtgtgtaata 96840 acctacgcgt attatcacgt tggggatata gtcagaggaa
cattaaacat cgaagatgaa 96900 tcaaatgtaa ctattcaatg tggagattta
atctgtaaac taagtagaga ttcgggtact 96960 gtatcattta gcgattcaaa
gtactgcttt tttcgaaatg gtaatgcgta tgacaatggc 97020 agcgaagtca
ctgccgttct aatggaggct caacaaggta tcgaatctag ttttgttttt 97080
ctcgcgaata tcgtcgactc ataaaaaaga gaatagcggt aagtataaac acgaatacta
97140 tggcaataat tgcgaatgtt ttattctctt cgatatattt ttgataatat
gaaaaacatg 97200 tctctctcaa atcggacaac catctcataa aatagttctc
gcgcgctgga gaggtagttg 97260 ccgctcgtat aatctctcca gaataatata
cttgcgtgtc gtcgttcaat ttatacggat 97320 ttctatagtt ctctgttata
taatgcggtt tgccctcatg attagacgac gacaatagtg 97380 ttctaaattt
agatagttga tcagaatgaa tgtttattgg cgttggaaaa attatccata 97440
cagcgtctgc agagtggttg atagttgttc ctagatatgt aaaataatcc aacttactag
97500 gcagcaaatt gtctagataa aatactgaat caaacggtgc agacgtattg
gcggatctaa 97560 tggaatccaa ttgattaact atcttttgaa aatatacatt
tttatgatcc aatacttgta 97620 agaatataga aataatgata agtccatcat
cgtgtttttt tgcctcttca taagaactat 97680 attttttctt attccaatga
acaagattaa tctctccaga gtatttgtac acatctatca 97740 agtgattgga
tccataatcg tcttcctttc cccaatatat atgtagtgat gataacacat 97800
attcattggg gagaaaccct ccacttatat atcctccttt aaaattaatc cttactagtt
97860 ttccagtgtt ctggatagtg gttggtttcg actcattata atgtatgtct
aacggcttca 97920 atcgcgcgtt agaaattgct tttttagttt ctatattaat
aggagatagt tgttgcggca 97980 tagtaaaaat gaaatgataa ctgtttaaaa
atagctctta gtatgggaat tacaatggat 98040 gaggaagtga tatttgaaac
tcctagagaa ttaatatcta ttaaacgaat aaaagatatt 98100 ccaagatcaa
aagacacgca tgtgtttgct gcgtgtataa caagtgacgg atatccgtta 98160
ataggagcta gaagaacttc attcgcgttc caggcgatat tatctcaaca aaattcagat
98220 tctatcttta gagtatccac taaactatta cggtttatgt actacaatga
actaagagaa 98280 atctttagac ggttgagaaa aggttctatc aacaatatcg
atcctcactt tgaagagtta 98340 atattattgg gtggtaaact agataaaaag
gaatctatta aagattgttt aagaagagaa 98400 ttaaaagagg aaagtgatga
acgtataaca gtaaaagaat ttggaaatgt aattctaaaa 98460
cttacaacac gggataaatt atttaataaa gtatatataa gttattgcat ggcgtgtttt
98520 attaatcaat cgttggagga tttatcgcat actagtattt acaatgtaga
aattagaaag 98580 attaaatcat taaatgattg tattaacgac gataaatacg
aatatctgtc ttatatttat 98640 aatatgctag ttaatagtaa atgaactttt
acagatctag tataattagt cagattatta 98700 agtataatag acgactagct
aagtctatta tttgcgagga tgactctcaa attattacac 98760 tcacggcatt
cgttaaccaa tgcctatggt gtcataaacg agtatccgtg tccgctattt 98820
tattaactac tgataacaaa atattagtat gtaacagacg agatagtttt ctctattctg
98880 aaataattag aactagaaac atgtttagaa agaaacgatt atttctgaat
tattccaatt 98940 atttgaacaa acaggaaaga agtatactat cgtcattttt
ttctctagat ccagctacta 99000 ctgataatga tagaatagac gctatttatc
cgggtggcat acccaaaagg ggtgagaatg 99060 ttccagagtg tttatccagg
gaaattaaag aagaagttaa tatagacaat tcttttgtat 99120 tcatagacac
tcggtttttt attcatggca tcatagaaga taccattatt aataaatttt 99180
ttgaggtaat cttctttgtc ggaagaatat ctctaacgag tgatcaaatc attgatacat
99240 ttaaaagtaa tcatgaaatc aaggatctaa tatttttaga tccgaattca
ggtaatggac 99300 tccaatacga aattgcaaaa tatgctctag atactgcaaa
acttaaatgt tacggccata 99360 gaggatgtta ttatgaatca ttaaaaaaat
taactgagga tgattgatta aaaaatataa 99420 attaatttac catcgtgtat
ttttataacg ggattgtccg gcatatcatg tagatagtta 99480 ccgtctacat
cgtatactcg accatctacg cctttaaatc ctctatttat tgacattaat 99540
ctattagaat tggaatacca aatattagta ccctcaatta gtttattggt aatatttttt
99600 ttagacgata gatcgatggc tcttgaaacc aaggttttcc aaccggactc
attgtcgatc 99660 ggtgagaagt ctttttcatt agcatgaatc cattctaatg
atgtatgttt aaacactcta 99720 aacaattgga caaattcttt tgatttgctt
tgaatgattt caaataggtc ttcgtctaca 99780 gtaggcatac cattagataa
tctagccatt ataaagtgca cgtttacata tctacgttct 99840 ggaggagtaa
gaacgtgact attgagacga atggctcttc ctactatctg acgaagagac 99900
gcctcgttcc atgtcatatc taaaatgaag atatcattaa ttgagaaaaa actaataccc
99960 tcgcctccac tagaagagaa tacgcatgtt ttaatgcatt ctccgttagt
gtttgattct 100020 tggttaaact cagccaccgc cttgattcta gtatcttttg
ttctagatga gaactctata 100080 ttagagatac caaagacttt gaaatatagt
aataagattt ctattcctga ctgattaaca 100140 aatggttcaa agactagaca
tttaccatgg gatgctaata ttcccaaaca tacatctata 100200 aatttgacgc
ttttctcttt taattcagta aatagagaga tatcagccgc actagcatcc 100260
cctttcaata gttctccctt tttaaaggta tctaatgcgg atttagaaaa ctctctatct
100320 cttaatgaat ttttaaaatc attatatagt gttgctatct cttgcgcgta
ttcgcccgga 100380 tcacgatttt gtctttcagg aaagctatcg aacgtaaacg
tagtagccat acgtctcaga 100440 attctaaatg atgatatacc tgtttttatt
tcagcgagtt tagccttttg ataaatttct 100500 tcttgctttt tcgacatatt
aacgtatcgc attaatactg ttttcttagc gaatgatgca 100560 gacccttcta
cgtcatcaaa aatagaaaac tcgttattaa ctatatacga acatagtcct 100620
cctagtttgg agactaattc tttttcatcg actagacgtt tattctcaaa tagtgattgg
100680 tgttgtaagg atcctggtcg tagtaagtta accaacatgg tgaattcttg
cacactattg 100740 acgataggtg tagccgataa acaaatcatc ttatggtttt
ttaacgcaat ggtcttagat 100800 aaaaaattat atactgaacg agtaggacgg
atcttaccat cttctttgat taatgattta 100860 gaaatgaagt tatgacattc
atcaatgatg acgcatattc tactcttgga attaatagtt 100920 ttgatattag
taaaaaattt atttctaaaa ttttgatcat cgtaattaat aaaaatacaa 100980
tccttcgtta tctctggagc gtatctgagt atagtgttca tccaaggatc ttctatcaaa
101040 gcctttttca ccaataagat aatagcccaa ttcgtataaa tatccttaag
atgtttgaga 101100 atatatacag tagtcattgt tttaccgaca cccgtttcat
ggaacaataa aagagaatgc 101160 atactgtcta atcctaagaa aactcttgct
acaaaatgtt gataatcctt gaggcgtact 101220 acgtccgacc ccatcatttc
aacgggcata ttagtagttc tgcgtaaggc ataatcgata 101280 taggccgcgt
gtgatttact catttatgag tgataagtaa taactatgtt ttaaaaatca 101340
cagcagtagt ttaactagtc ttctctgatg tttgttttcg atactttttg aatcagaagt
101400 catactagaa taaagcaacg agtgaacgta atagagagct tcgtatactc
tattcgaaaa 101460 ctctaagaac ttattaatga attccgtatc cactggattg
tttaaaatac taaattgaac 101520 actgttcaca tccttccaag aagaagactt
agtgacggac ttaacatgag acataaataa 101580 atccaaattt tttttacaaa
catcactagc caccataatg gcgctatctt tcaaccagct 101640 atcgcttacg
cattttagca gtctaacatt tttaaagaga ctacaatata ttctcatagt 101700
atcgattaca cctctaccga ataaagttgg aagtttaata atacaatatt tttcgtttac
101760 aaaatcaaat aatggtcgaa acacgtcgaa ggttaacatc ttataatcgc
taatgtatag 101820 attgttttca gtgagatgat tattagattt aatagcatct
cgttcacgtt tgaacagttt 101880 attgcgtgcg ctgaggtcgg caactacggc
gtccgcttta gtactcctcc cataatactt 101940 tacgctatta atctttaaaa
tttcatagac tttatctaga tcgctttctg gtaacatgat 102000 atcatgtgta
aaaagtttta acatgtcggt cggcattcta tttagatcat taactctaga 102060
aatctgaaga aagtaattag ctccgtattc cagactaggt aatgggcttt tacctagaga
102120 cagattaagt tctggcaatg tttcataaaa tggaagaagg acatgcgttc
cctcccggat 102180 attttttaca atttcatcca tttacaactc tatagtttgt
tttcattatt attagttatt 102240 atctcccata atcttggtaa tacttacccc
ttgatcgtaa gataccttat acaggtcatt 102300 acatacaact accaattgtt
tttgtacata atagattgga tggttgacat ccatggtgga 102360 ataaactact
cgaacagata gtttatcttt ccccctagat acattagccg taatagttgt 102420
cggcctaaag aatatctttg gtgtaaagtt aaaagttagg gttcttgttc cattattgct
102480 ttttgtcagt agttcattat aaattctcga gatgggtccg ttctctgaat
atagaacatc 102540 atttccaaat ctaacttcta gtctagaaat aatatcggtc
ttattcttaa aatctattcc 102600 cttgatgaag ggatcgttaa tgaacaaatc
cttggccttt gattcggctg atctattatc 102660 tccgttatag acgttacgtt
gactagtcca aagacttaca ggaatagatg tatcgatgat 102720 gttgatacta
tgtgatatgt gagcaaagat tgttctctta gtggcatcac tatatgttcc 102780
agtaatggcg gaaaactttt tagaaatgtt atatataaaa gaattttttc gtgttccaaa
102840 cattagcaga ttagtatgaa gataaacact catattatca ggaacattat
caatttttac 102900 atacacatca gcatcttgaa tagaaacgat accatcttct
ggaacctcta cgatctcggc 102960 agactccgga taaccagtcg gtgggccatc
gctaacaata actagatcat ccaacaatct 103020 actcacatat gcatctatat
aatctttttc atcttgtgag taccctggat acgaaataaa 103080 tttattatcc
gtatttccat aataaggttt agtataaaca gagagagatg ttgccgcatg 103140
aacttcagtt acagtcgccg ttggttggtt tatttgacct attactctcc taggtttctc
103200 tataaacgat ggtttaattt gtacattctt aaccatatat ccaataaagc
tcaattcagg 103260 aacataaaca aattctttgt tgaacgtttc aaagtcgaac
gaagagtcac gaataacgat 103320 atcggatact ggattgaagg ttaccgttac
ggtaattttt gaatcggata gtttaagact 103380 gctgaatgta tcttccacat
caaacggagt tttaatataa acgtatactg tagatggttc 103440 tttaatagtg
tcattaggag ttaggccaat agaaatatca ttaagttcac tagaatatcc 103500
agagtgtttc aaagcaattg tattattgat acaattatta tataattctt cgccctcaat
103560 ttcccaaata acaccgttac acgaagagat agatacgtga ttaatacatt
tatatccaac 103620 atatggtacg taactgaatc ttcccatacc tttaacttct
ggaagttcca aactcagaac 103680 caaatgatta agcgcagtaa tatactgatc
cctaatttcg aagctagcga tagcctgatt 103740 gtctggacca tcgtttgtca
taactccgga tagagaaata tattgcggca tatataaagt 103800 tggaatttga
ctatcgactg cgaagacatt agaccgttta atagagtcat ccccaccgat 103860
caaagaatta atgatagtat tattcatttt ctatttaaaa tggaaaaagc ttacaataaa
103920 ctccgtagag aaatatctat aatttgtgag ttttccttaa agtaacagct
tccgtaaacg 103980 ccgtctttat ctcttagtag gtttattgta tttatgacct
tttccttatc ttcatagaat 104040 actaaaggca acaaagaaat ttttggttct
tctctaagag ctacgtgaga cttaaccata 104100 gaagccaacg aatccctaca
tattttagaa cagaaatacc ctacttcacc acccttgtat 104160 gtctcaatac
taataggtct aaaaaccaaa tcttgattac aaaaccaaca cttatcaatt 104220
acactatttg tcttaataga cacatctgcc atagatttat aatactttgg tagtatacaa
104280 gcgagtgctt cttctttagc gggcttaaag actgctttag gtgctgaaat
aaccacatct 104340 ggaaggctta ctcgcttagc catttaatta cggaactatt
tttttatact tctaatgagc 104400 aagtagaaaa cctctcatct acaaaaacgt
actcgtgtcc ataatcctct accatagtta 104460 cacgtttttt agatctcata
tgtgctaaaa agttttccca tactaattgg ttactattat 104520 ttttcgtata
atttttaaca gtttgaggtt ttagattttt agttacagaa gtgatatcga 104580
atattttatc caaaaagaat gaataattaa ttgtcttaga aggagtgttt tcttggcaaa
104640 agaataccaa gtgcttaaat atttctacta cttcattaat cttttctgta
ctcagattca 104700 gtttctcatc ttttacttga ttgattattt caaagactaa
cttataatcc tttttattta 104760 ttctctcgtt agccttaaga aaactagata
caaaatttgc atctacatca tccgtggata 104820 tttgattttt ttccatgata
tccaagagtt ccgagataat ttctccagaa cattgatgag 104880 acaataatct
ccgcaataca tttctcaaat gaataagttt attagacacg tggaagtttg 104940
actttttttg tacctttgta catttttgaa ataccgactc gcaaaaaata caatattcat
105000 atccttgttc agatactata ccgttatgtc tacaaccgct acataatcgt
agattcatgt 105060 taacactcta cgtatctcgt cgtccaatat tttatataaa
aacattttat ttctagacgt 105120 tgccagaaaa tcctgtaata tttttagttt
tttgggctgt gaataaagta tcgccctaat 105180 attgttaccg tcttccgcca
atatagtagt taaattatcc gcacatgcag aagaacaccg 105240 cttaggcgga
ttcagtacaa tgttatattt ttcgtaccaa ctcatttaaa tatcataatc 105300
taaaatagtt ctgtaatatg tctagcgcta atatattgat cataatcctg tgcataaatt
105360 aagatacaac aatgtctcga aatcatcgac atggcttctt ccatagttag
aagatcgtcg 105420 tcaaagttag caacgtgatt catcaacatt tgctgttttg
aggcagcaaa tactgaaccg 105480 tcgccattca accattcata aaaaccatcg
tctgaatcca ttgataattt cttgtactgg 105540 tttttgagag ctcgcatcaa
tctagcattt ctagctcccg gattgaaaac agaaagagga 105600 tcgtacatcc
agggtccatt ttctgtaaat agaatcgtat aatgtccctt caagaagata 105660
tcagacgatc cacaatcaaa gaattggtct ccgagtttgt aacaaactgc ggactttaac
105720 ctatacatga taccgtttag cataatttct ggtgatacgt caatcggagt
atcatctatt 105780 agagatctaa agccggtgta acattctcca ccaaacatat
tcttattctg acgtcgttct 105840 acataaaaca tcattgctcc attaacgata
acaggggaat gaacagcact acccatcaca 105900 ttagttccca atggatcaat
gtgtgtaact ccagaacatc ttccatagcc tatgttagga 105960 ggagcgaaca
ccactcttcc actattgcca tcgaatgcca tagaataaat atccttggaa 106020
ttgatagaaa tcggactgtc ggatgttgtg atcatcttca taggattaac aactatgtat
106080 ggtgccgcct gaagtttcat atcgtaactg atgccgttta taggtctagc
cacagaaacc 106140 aacgtaggtc taaatccaac tatagacaaa atagaagcca
atatctgttc ctcatctgtc 106200 ataacttgag agcatccagt atgaataatc
ttcattagat ggggatctac cgcatcatca 106260 tcgttacaat aaaaaattcc
cattctaatg ttcataattg cttttctaat catggtatgc 106320 atgtttgctc
tctgaatctc tgtggaaatt agatctgata cacctgtaat cactatcgga 106380
ttatcctccg taagacgatt aaccaacaac atataattat aagactttac ttttctaaat
106440 tcataaagtt gctggattag gctataggtg tctccatgta catacgcgtt
ctcgagcgca 106500 ggaagtttaa taccgaatag tgccatcaga ataggatgaa
tatagtaatt agtttctggt 106560 tttctataaa taaaagacaa atcttgtgaa
ctagacatat cggtaaaatg catggattgg 106620 aatcgtgtag tcgacagaag
aatatgatga ttagatggag agtatatttt atctaactct 106680 ttgagttggt
caccgattct aggactagct cgagaatgaa taagtactaa aggatgagta 106740
catttcacag aaacactagc attgttcaat gtgctcttta catgggtaag gagttgaaat
106800 agctcgtttc tatttgttct gacaatattt agtttattca taatgttaag
catatcctga 106860 atagtaaagt tagatgtgtc atacttgtta gtagttagat
atttagcaat tgcattccca 106920 tcatttctca atctcgtact ccaatcatgt
gtagatgcta cttcgtcgat ggaaaccata 106980 caatcctttt tgataggctg
ttgagattga tcatttcctg cacgtttagg tttggtacgt 107040 tgatttctag
cccctgcgga tataaagtca tcgtctacaa tttgggacaa tgaattgcat 107100
acactacaag acaaagattt atcagaagtg tgaatatgat cttcatctac caaagaaaga
107160 gtttgattag tataactaga ttttagtcct gcgttagatg ttaaaaaaac
atcgctattg 107220 accacggctt ccattattta tattcgtagt ttttactcga
aagcgtgatt ttaatatcca 107280 atcttattac ttttggaatc gttcaaaacc
tttgactagt tgtagaattt gatctattgc 107340 cctacgcgta tactcccttg
catcatatac gttcgtcacc agatcgtttg tttcggcctg 107400 aagttggtgc
atatctcttt caacattcga catgagatcc ttaagggcca tatcgtctag 107460
attttgttga gatgctgctc ctggatttgg attttgttgt gctgttgtac atactgtacc
107520 accagtaggt gtaggagtac atacagtggc cacaatagga ggttgagaaa
gtgtaaccgt 107580 tggagtagta caagaaatac ttccatccga ttgttgtgta
catgtagttg ttggtaacgt 107640 ctgagaaggt tgggtagatg gcggcgtcgt
cgttttttga tctttattaa atttagagat 107700 aatatcctga acagcattgc
tcggcgtcaa cgctggaagg agtgaactcg ccggcgcatc 107760 agtatcttca
gacagccaat caaaaagatt agacatatca gatgatgtat tagtttgttg 107820
tcgtggtttt ggtgtaggag cagtactact aggtagaaga ataggagccg atgtagctgt
107880 tggaaccggc tgtggagtta tatgaatagt tggttgtagc ggttggatag
gctgtctgct 107940 ggcggccatc atattatctc tagctagttg ttctcgcaac
tgtctttgat aatacgactc 108000 ttgagacttt agtcctattt caatcgcttc
atcctttttc gtatccggat ccttttcttc 108060 agaataatag attgacgact
ttggtgtaga ggattctgcc agcctctgtg agaacttgtt 108120 aaagaagtcc
atttaaggct ttaaaattga attgcgatta taagattaaa tggcagacac 108180
agacgatatt atcgactatg aatccgatga tctcaccgaa tacgaggatg atgaagaaga
108240 ggaagaagat ggagagtcac tagaaactag tgatatagat cccaaatctt
cttataagat 108300 tgtagaatca gcatccactc atatagaaga tgcgcattcc
aatcttaaac atatagggaa 108360 tcatatatct gctcttaaac gacgctatac
tagacgtata agtctatttg aaatagcggg 108420 tataatagca gaaagctata
acttgcttca acgaggaaga ttacctctag tttcagaatt 108480 ttctgacgaa
acgatgaagc aaaatatgct acatgtaatt atacaagaga tagaggaggg 108540
ttcttgtcct atagtcatcg aaaagaacgg agaattgttg tcggtaaacg attttgacaa
108600 agatggtcta aaattccatc tagactatat tatcaaaatt tggaaacttc
aaaaacgata 108660 ttagaattta tacgaatatc gttctctaaa tgtcacaatc
aagtctcgca tgttcagcaa 108720 tttattgtcg tactttatat cgtgttcatt
aacgatatct tgcaaaatag taatgattct 108780 atcttccttc gatagatatt
cttcagagat tattgtctta tattctttct tgttatcaga 108840 tatgaatttg
ataagacttt gaacattatt gatacccgtc tgtttaattt tttctacaga 108900
tattttagtt ttggcagatt ctatcgtatc tgtcaataga catccaacat cgacattcga
108960 cgtcaattgt ctataaatca acgtataaat tttagaaata acattagcga
attgttgtgc 109020 gttgatgtcg ttattctgaa acagtatgat tttaggtagc
attttcttaa caaagagaac 109080 gtatttattg ttactcagtt gaacagatga
tatatccaga ttactaacgc atctgattcc 109140 gtataccaaa ctttcagaag
aaatggtata caattgtttg tattcattca atgtctcttt 109200 ttcagaaatt
agtttagagt cgaatactgc aataattttc aagagatagt tttcatcaga 109260
taagatttta tttagtgtag atatgataaa actattgttt tgttggagaa cttgatacgc
109320 cgcgttctct gtagtcgacg ctctcaaatg ggaaacaatc tccattattt
ttttggaatc 109380 ggatactata tcttcggtat cttgacgcag tctagtatac
atagagttaa gagagattag 109440 agtttgtaca ttaagcaaca tgtctctaaa
tgtggctaca aacttttcct ttttcacatc 109500 atctagttta ttatataccg
atttcacaac ggcaccagat ttaaggaacc agaatgaaaa 109560 actctgataa
ctacaatatt tcatcatagt tacgatttta tcatcttcta tagttggtgt 109620
aatagcgcat acctttttct ccaagactgg aaccaacgtc ataaaaatgt ttaaatcaaa
109680 atccatatca acatctgatg cgctaagacc agtctcgcgt tcaagattat
ctttactaat 109740 ggtgacgaac tcatcgtata aaactctaag tttgtccatt
atttatttac agatttagtt 109800 gtttaattta tttgtgctct tccagagttg
ggatagtatt tttctaacgt cggtattata 109860 ttattaggat ctacgttcat
atgtatcata atattaatca tccacgtttt gataaatcta 109920 tctttagctt
ctgaaataac gtatttaaac aaaggagaaa aatatttagc tacggcatca 109980
gacgcaataa cattttttgt aaatgtaacg tatttagacg acagatcttc gttaaaaagt
110040 tttccatcta tgtagaatcc atcggttgtt aacaccattc ccgcgtcaga
ttgaatagga 110100 gtttgaatag tttgttttgg aaatagatcc ttcaataact
tatagttggg tgggaaaaaa 110160 tcgattttat cactagactc tttctttttt
actatcatta cctcatgaac tatttcttga 110220 atgagtatat gtattttctt
tcctatatcg gacgcgttca ttggaaaata taccatgtcg 110280 ttaactataa
gaatattttt atcctcgttt acaaactgaa taatatcaga tgtagttcgt 110340
aaacgaacta tatcatcacc agcacaacat ctaactatat gatatccact agtttccttt
110400 agccgtttat tatcttgttc catattagca gtcattccat catttaagaa
ggcgtcaaag 110460 ataataggga gaaatgacat tttggattct gttacgactt
taccaaaatt aaggatatac 110520 ggacttacta tctttttctc aacgtcaatt
tgatgaacac acgatgaaaa tgtgcttcta 110580 tgagattgat catgtagaaa
acaacaaggg atacaatatt tccgcatatc atgaaatata 110640 ttaagaaatc
ccaccttatt atatttcccc aaaggatcca tgcacgtaaa cattatgccg 110700
ttatcattaa taaagacttc tttctcatcg gatctgtaaa agttgttact gatttttttc
110760 attccaggat ctagataatt aataatgatg ggttttctat tcttattctt
tgtattttgg 110820 catatcctag accagtaaac agtttccact ttggtaaaat
cagcagactt ttgaacgcta 110880 ttaaacatgg cattaatggc aataactaaa
aatgtaaaat atttttctat gttaggaata 110940 tggtttttca ctttaataga
tatatggttt ttggccaaaa tgatagatat ttttttatcc 111000 gaggatagta
aaatattatt agtcgccgtc tctataaaaa tgaagctagt ctcgatatcc 111060
aattttattc tagaattgat aggagtcgcc aaatgtacct tatacgttat atctcccttg
111120 atgcgttcca tttgtgtatc tatatcggac acaagatctg taaatagttt
tacgttatta 111180 atcatcacgg tatcgccgtc gctagataac gctaatgtac
catccaagtc ccaaatggag 111240 agatttaact gttcatcgtt tagaataaaa
tgattaccgg tcatattaat aaagtgttca 111300 tcgtatctag ataacaacga
cttataatta atgtccaagt cttgaactcg ctgaatgatc 111360 ttttttaacc
cagttagttt tagattggta cgaaatatat tgttaaactt tgattctaca 111420
gtaatgtcca aatctagttg tggaaatact tccatcaaca ttgtttcaaa cttgataata
111480 ttattatcta catcttcgta cgatccaaat tccggaatag atgtatcgca
cgctctggcc 111540 acccagataa ccaaaaagtc acacgctcca ggatatacat
tgtataaaaa gctatcgttt 111600 tttagtaggg tttttttctg cgtgtatacg
aagggattaa aaatagtatt atcaacgtaa 111660 ctatattcca aattattctt
atgagaatag ataataatat cgtccttaat atctaacaaa 111720 tttcctaaat
atccctttaa ttgagtcatt cgaagcgtca atagaatatg tctcttaact 111780
atttccggct gttgtatatt taaatgactt cgtaaaaaat aatatatggg cgacttctca
111840 tctatgtaat catatggagt gagatatagg gctcgttcta cctcctgccc
cttacccacc 111900 tgtaatacca attgcggact tactatatat cgcatattta
tatcgtgggg taaagtgaaa 111960 atctactacc gatgatgtaa gtcttacaat
gttcgaacca gtaccagatc ttaatttgga 112020 ggcctccgta gaactagggg
aggtaaatat agatcaaaca acacctatga taaaggagaa 112080 tagcggtttt
atatcccgca gtagacgtct attcgcccat agatctaagg atgatgagag 112140
aaaactagca ctacgattct ttttacaaag actttatttt ttagatcata gagagattca
112200 ttatttgttc agatgcgttg acgctgtaaa agacgtcact attaccaaaa
aaaataacat 112260 tatcgtggcg ccttatatag cacttttaac tatcgcatca
aaaggatgca aacttacaga 112320 aacaatgatt gaagcattct ttccagaact
atataatgaa catagtaaga aatttaaatt 112380 caactctcaa gtatccatca
tccaagaaaa actcggatac cagtttggaa actatcacgt 112440 ttatgatttt
gaaccgtatt actctacagt agctctggct attcgagatg aacattcatc 112500
tggcattttt aatatccgtc aagagagtta tctggtaagt tcattatctg aaataacata
112560 tagattttat ctaattaatc taaaatctga tcttgttcaa tggagtgcta
gtacgggcgc 112620 tgtaattaat caaatggtaa atactgtatt gattacagtg
tatgaaaagt tacaactggt 112680 catagaaaat gattcacaat ttacatgttc
attggctgtg gaatcaaaac ttccaataaa 112740 attacttaaa gatagaaatg
aattatttac aaaattcatt aacgagttaa aaaagaccag 112800 ttcattcaag
ataagcaaac gcgataagga tacgctacta aaatatttta cttaggactg 112860
gagttagaat ttatagacga ctcatttcgt ttatcattgt tactattatt actattacta
112920 tcattattag tgttggcatt attagtattc ttcttgtcat cttgttcaga
aatatacagc 112980 aatgctatac ctaatactaa atacattatc atgctcgcaa
tggctctaac aacaacgaac 113040 caaaatgaat ttggtcgtag cttttgttca
caaaaataca taaagaaatg tctacataaa 113100 tctatggcgc cattggctac
ttgaaatagc gccagtcctc ctacagattt taatatagct 113160 gtataacatg
acatttattc atcatcaaaa gagacagagt caccatctgt catatttaga 113220
ttttttttca tgtgttcaaa gtatcctcta ctcatttcat tataatagtt tatcatactt
113280 agaattttag gacggatcaa tgagtaagac ttgactagat cgtcagtagt
aatttgtgca 113340 tcgtctattc tgcatccgct tcgtcgaata atgtatagca
tcgctttgag attctccata 113400 gctatcaagt ctttatacaa tgacatggaa
atatctgtga atactttata cttctccaac 113460 atcgatgcct taacatcatc
gcctacttta gcattgaaaa tacgttctat tgtgtagatg 113520
gatgtagcaa gatttttaaa caacaatgcc atcttacacg atgattgcct caagtctcca
113580 atcgtttgtt tagaacgatt agctacagag tccaatgctt ggctgactag
catattatta 113640 tctttagaaa ttgtattctt caatgaggcg tttatcatat
ctgtgatttc gttagtcata 113700 ttacagtctg actgggttgt aatgttatcc
aacatatcac ctatggatac ggtacacgta 113760 ccagcatttg taataatcct
atctaagatg ttgtatggca ttgcgcagaa aatatcttct 113820 cctgtaatat
ctccactctc gataaatcta ctcagattat tcttaaatgc cttattctct 113880
ggagaaaaga tatcagtgtc catcatttca ttaatagtat acgcagaaaa gataccacga
113940 gtatcaattc tatccaagat acttatcggt tccgagtcac agataatggt
ttcctctcct 114000 tcgggagatc ctgcatagaa atatctagga caatagtttc
tatactgtct gtaactctga 114060 taatctctaa agtcactaac tgataccatg
aaattgagaa gatcaaacgc tgaagtaatt 114120 aatttttctg cctcgttttt
actacaacta gttttcatca atgtagtgac gatgtattgt 114180 ttagttactt
ttggtctaat actgatgata gagatattat tgcttcccat aatggatctt 114240
ctagtagtca ccttaaagcc cattgatgcg aatagcagat agataaagtc ttggtatgac
114300 tcctttctaa tatagtacgg actacctttg tcacccaact ttatacccac
ataagccata 114360 acaacctctt taatagccgt ttcatgaggt ttatcagcca
tgagcctgag tagttggaag 114420 aatctcatga atcccgtctc agaaagtcct
atatgcatga tagatttatc tttcctggga 114480 aactctcgta tagtcataga
tgaaatactc tttaaagttt ctgaaataag attagtaaca 114540 gtcttacctc
cgactactct aggtaacaaa caaactctaa taggtgtttt ctctgcggag 114600
ataatatcag aaaggataga gcaataagta gtattattgt gattataaag accgaataca
114660 taacaggtag aatttataaa catcatgtcc tgaaggtttt tagacttgta
ttcctcgtaa 114720 tccataccgt cccaaaacat ggatttggta actttgatag
ccgtagatct ttgttccttc 114780 gccaacaggt taaagaaatt aataaagaat
ttgttgtttc tatttatgtc cacaaattgc 114840 acgtttggaa gcgccacggt
tacattcact gcagcatttt gaggatcgcg agtatgaagt 114900 acgatgttat
tgtttactgg tatatctgga aagaaatcta ccagtctagg aataagagat 114960
tgatatcgca tagaaatagt aaagtttata atctcatcat cgaagagcat tttgttacca
115020 ttgtaataaa tatccactct gtcatatgta taaatgaagt actgttcaaa
catgatgaga 115080 tgtttatatg ttggcatagt agtgagatcg acgtttggta
atggcaatgt attaagatta 115140 actccataat gtctagcagc atctgcgatg
ttataagcgt cgtcaaagcg gggtcgatct 115200 tgtattgtta tatattgtct
aacacctata agattatcaa aatcttgtct gcttaataca 115260 ccgttaacaa
tttttgcctt gaattctttt attggtgcat taataacatc cttatagagg 115320
atgttaaaca aataagtgtt atcaaagtta agatctggat atttcttttc tgctagaaca
115380 tccattgagt cggagccatc tggtttaata taaccaccga taaatctagc
tctgtattct 115440 gtatccgtca atctaatatt aagaaggtgt tgagtgaaag
gtggaagatc gtaaaagctg 115500 tgagtattaa tgataggatt agtttccgaa
ctaatgttaa ttggggtatt aataatatct 115560 atatttccag cgttaagtgt
aacattaaac agttttaatt cacgtgacgt ggtatcaatt 115620 aaataattaa
tgcccaattt ggatatagca gcctgaagct catcttgttt agttacggat 115680
cctaatgagt tattaagcaa tatatcgaac ggatgaacga aggttgtttt aagttggtca
115740 catactttgt aatctagaca tagatgcgga agaacggtag aaactatacg
aaataaatat 115800 tcagagtcct ctaattgatc aagagtaact attgacttaa
taggcatcat ttatttagta 115860 ttaaatgacg accgtaccag tgacggatat
acaaaacgat ttaattacag agttttcaga 115920 agataattat ccatctaaca
aaaattatga aataactctt cgtcaaatgt ctattctaac 115980 tcacgttaac
aacgtggtag atagagaaca taatgccgcc gtagtgtcat ctccagagga 116040
aatatcctca caacttaatg aagatctatt tccagatgat gattcaccgg ccactattat
116100 cgaacgagta caacctcata ctactattat tgacgatact ccacctccta
cgtttcgtag 116160 agagttatta atatcggaac aacgtcaaca acgagaaaaa
agatttaata ttacagtatc 116220 gaaaaatgct gaagcaataa tggaatctag
atctatgata acttctatgc caacacaaac 116280 accatccttg ggagtagttt
atgataaaga taaaagaatt cagatgttag aggatgaagt 116340 ggttaatctt
agaaatcaac gatctaatac aaaatcatct gataatttag ataattttac 116400
caaaatacta tttggtaaga ctccgtacaa atcaacagaa gttaataagc gtatagccat
116460 cgttaattat gcaaatttga acgggtcccc cttatcagtc gaggacttgg
atgtttgttc 116520 ggaggatgaa atagatagaa tctataaaac gattaaacaa
tatcacgaaa gtagaaaacg 116580 aaaaattatc gtcactaacg tgattattat
tgtcataaac attatcgagc aggcattgct 116640 aaaactcgga tttgaagaaa
tcaaaggact gagtaccgat atcacttcag aaattatcga 116700 tgtggagatc
ggagatgact gcgatgctgt agcatctaaa ctaggaatcg gtaacagtcc 116760
ggttcttaat attgtattgt ttatactcaa gatattcgtt aaacgaatta aaattattta
116820 atttaataca ttcccatatc cagacaacaa tcgtctggat taatctgttc
ctgtcgtctc 116880 ataccggacg acatattaat ctttttatta gtgggcatct
ttttagatgg tttctttttc 116940 ccagcattaa ctgagtcgat acctagaaga
tcgtgattga tctctccgac cattccacga 117000 acttctaatt ggccgtctct
gacggtacca taaactattt taccagcatt agtaacagct 117060 tggacaatct
gaccatccat cgcattgtac gatgtagtag taactgttgt tctacgtcta 117120
ggagcaccag aagtattttt ggagcccttg gatgttgatg tagaagaaga cgaggatttt
117180 gattttggtt tacatgtaat acattttgaa ctctttgatt ttgtatcaca
tgcgccggca 117240 gtcacatctg tttgagaatt aagattattg ttgcctcctt
tgacggctgc atctccaccg 117300 atttgcgcta gtagattttt aagctgtggt
gtaatcttat taactgtttc gatataatca 117360 tcgtaactgc ttctaacggc
taaatttttt ttatccgcca tttagaagct aaaaatattt 117420 ttatttatgc
agaagattta actagattat acaatgaact aatatgatcc ttttccagat 117480
tatttacaaa cttggtattt tttggttctg gaggaggcga atttaaattc ggacttggat
117540 tcggattttg taagttcttg atcttattat acatcgagta taggatggcg
acagtaactg 117600 ctacacaaat accgatcaaa agaagaatac caatcattta
ttgacaataa cttcactatt 117660 gatcaagtat gcaatatatc atcttttcac
taaataagta gtaataatga ttcaacaatg 117720 tcgagatata tggacgataa
taatttagtt catggaaata tcgctatgat tggtgtgaat 117780 gactccgcta
actctgtggg gtgcgcagtg ctttccccac atagaataaa ttagcattcc 117840
gactgtgata ataataccaa gtataaacgc cataatactc aatactttcc atgtacgagt
117900 gggactggta gacttactaa agtcaataaa ggcgaagata cacgaaagaa
tcaaaagaat 117960 gattccagcg attagcacgc cggaaaaata atttccaatc
ataagcatca tgtccattta 118020 actaataaaa attttaaatc gccgaatgaa
caaagtggaa tataaaccat ataaaaacaa 118080 tagtttgtac tgcaaaaata
atatctattt ttgttttcga agatatggta aaattaaata 118140 gtagtacaca
gcatgttata actaacagca gcaacggctc gtaattactt atcatttact 118200
agacgaaaag gtggtgggat attttcttgc tcaaataata cgaatatatc acccatccat
118260 tttatgcgat gtttatatac tctaatcttt aatagatcta tagacgacgg
gtttaccaac 118320 aatatagatt ttatcgattc atctaattta aacccttcct
taaacgtgaa tgatctatta 118380 tctggcataa cgatgaccct acctgatgaa
tcggacaatg tactgggcca tgtagaataa 118440 attatcaacg aattatcgtc
tacgaacatt tatatcattt gttttaattt taggacgcga 118500 ataaatggat
ataaaataga aaataacaga tattacaacc agtgttatgg ccgcgcccaa 118560
ccaggtaggc agttttattt tatcttttac tacaggttct cctggatgta cgtcaccaac
118620 ggcggacgta gttctagtac aattagacgt aagttccgct tgggaatttt
ttaacgctaa 118680 agagttaacg ttaatcgtgc acccaacgta tttacatcta
gttcgttgaa catcttgatt 118740 ataatataac cattttctat ctctagattc
gtcagtgcac tcatgtaacc aacataccct 118800 aggtcctaaa tatttatctc
cggaattaga ttttggataa ttcgcgcacc aacaatttct 118860 atttccttta
tgatcgttac aaaagacgta taatgccgta tccccaaaag taaaataatc 118920
aggacgaata attctaataa actcagaaca atatctcgca tccatatgtt tggagcaaat
118980 atcggaataa gtagacatag ccggtttccg ttttgcacgt aaccattcta
aacaattggg 119040 gtttccagga tcgtttctac aaaatccagt catgaaatcg
tcacaatgtt ctgtcttgta 119100 attattatta aatatttttg gacagtgttt
ggtatttgtc ttagaacaac attttgccac 119160 gctatcacta tcgcccagga
gataatcctt ttttataaaa tgacatcgtt gcccggatgc 119220 tatataatca
gtagcgtgtt ttaaatcctt aatatattca ggagttacct cgttctgata 119280
atagattaat gatccaggac gaaatttgaa agaactacat ggttctccat gaattaatac
119340 atattgttta gcaaattcag gaactataaa actactacaa tgatctatcg
acataccatc 119400 tatcaaacaa aacttgggtt taatttctcc cggagatgtt
tcataatagt acgtataact 119460 ttcttctgca aacttaacag ctctattata
ttcaggataa ttaaaaccta attccatata 119520 tttgtctcgt atatctgcta
ttcctggtgc tattttgatt ctattaagag taacagctgc 119580 ccccattctt
aataatcgtc agtatttaaa ctgttaaatg ttggtatatc aacatctacc 119640
ttatttcccg cagtataagg tttgttgcag gtatactgtt caggaatggt tacatttata
119700 cttcttctat agtcctgtct ttcgatgttc atcacatatg caaagaacag
aataaacaaa 119760 ataatgtaag aaataatatt aaatatctgt gaattcgtaa
atacattgat tgccataata 119820 attacagcag ctacaataca cacaatagac
attcccacag tgttgccatt acctccacga 119880 tacatttgag ttactaagca
ataggtaata actaagctag taagaggcaa tagaaaagat 119940 gagataaata
tcatcaatat agagattaga ggagggctat atagagccaa gacgaacaaa 120000
atcaaaccga gtaacgttct aacatcatta tttttgaaga ttcccaaata atcattcatt
120060 cctccataat cgttttgcat catacctcca tctttaggca taaacgattg
ctgctgttcc 120120 tctgtaaata aatctttatc aagcactcca gcacccgcag
agaagtcgtc aagcatattg 120180 taatatctta aataactcat ttatatatta
aaaaatgtca ctattaaaga tggagtataa 120240 tctttatgcc gaactaaaaa
aaatgacttg tggtcaaccc ctaagtcttt ttaacgaaga 120300 cggggatttc
gtagaagttg aaccgggatc atcctttaag tttctgatac ctaagggatt 120360
ttacgcctct ccttccgtaa agacgagtct agtattcgag acattaacaa cgaccgataa
120420 taaaatcact agtatcaatc caacaaatgc gccaaagtta tatcctcttc
aacgcaaagt 120480 cgtatctgaa gtagtttcta atatgaggaa aatgatcgaa
tcaaaacgtc ctctatacat 120540 tactcttcac ttggcgtgtg gatttggtaa
gactattacc acgtgttatc ttatggctac 120600 acacggtaga aaaaccgtca
tttgcgtacc caataaaatg ttaatacatc aatggaagac 120660 acaggtagag
gcagtcggat tggaacataa gatatccata gatggagtaa gtagtctatt 120720
aaaggaacta aagactcaaa gtccggatgt attaatagta gtcagtagac atctgacaaa
120780 cgatgccttt tgtaaatata tcaataagca ttatgatttg ttcatcttgg
atgaatcaca 120840 tacgtataat ctgatgaaca atacagcagt tacaagattt
ttagcgtatt atcctccgat 120900 gatgtgttat tttttaactg ctacacctag
accatctaac cgaatttatt gtaacagtat 120960 tattaatatt gccaagttat
ccaatctaaa aaaaactatc tatgcagtag atagtttttt 121020 tgagccatat
tccacagata atattagaca tatggtaaaa cgactagatg gaccatctaa 121080
taaatatcat atatataccg agaagttatt atctgtagac gagcctagaa atcaacttat
121140 tcttgatacc ctggtagaag aattcaagtc aggaactatt aatcgcattt
tagttattac 121200 taaactacgt gaacatatgg tattattcta caaacgatta
ttagattttt tcggaccaga 121260 ggttgtattt ataggagacg cccaaaatag
acgtactcca gatatggtca aatcaatcaa 121320 ggaactaaat agatttatat
tcgtatccac cttattttat tccggtactg gtttagatat 121380 tcctagtttg
gattcgttgt tcatttgctc ggcagtaatc aacaatatgc aaatagagca 121440
attactaggg agggtatgtc gagaaacaga actattagat aggacggtat atgtatttcc
121500 taacacatcc atcaaagaaa taaagtacat gataggaaat ttcatgcaac
gaattattag 121560 tctgtctgta gataaactag gatttaaaca aaaaagttat
cggaaacatc aagaatccga 121620 tcccacttct gcatgtacaa catcatccag
agaagaacgt gtattaaata gaatatttaa 121680 ctcgcaaaat cgttaagaag
tttaagcgac gatccgcatg ctgcgcaggc cagtgtatta 121740 cccctcatag
tattaatata atccaatgat acttttgtga tgtcggaaat cttaaccaat 121800
ttagactgac aggcagaaca cgtcatgcaa tcatcatcgt catcgataac tgtagtcttg
121860 ggcttctttt tgcgactctt cattccggaa cgcacattgg tgctatccat
ttaggtagta 121920 aaaaataagt cagaatatgc cctataacac gatcgtgcaa
aacctggtat atcgtctcta 121980 tctttatcac aatatagtgt atcgacattt
ttattattat tgacctcgtt tatcttggaa 122040 catggaatgg gaacattttt
gttatcaacg gccatctttg ccttaattcc agatgttgta 122100 aaattataac
taaacagtct atcatcgaca caaatgaaat tcttgtttag acgtttgtag 122160
tttacgtatg cggctcgttc gcgtctcatt ttttcagata ttgcaggtac tataatatta
122220 aaaataagaa tgaaataaca taggattaaa aataaagtta tcatgacttc
tagcgctgat 122280 ttaactaact taaaagaatt acttagtctg tacaaaagtt
tgagattttc agattctgcg 122340 gctatagaaa agtataattc tttggtagaa
tggggaacat ctacttactg gaaaataggc 122400 gtgcaaaagg tagctaatgt
cgagacgtca atatctgatt attatgatga ggtaaaaaat 122460 aaaccgttta
atattgatcc gggctattac attttcttac cggtatattt tgggagcgtc 122520
tttatttatt cgaagggtaa aaatatggta gaacttggat ctggaaactc ttttcaaata
122580 ccagatgata tgcgaagtgc gtgtaacaaa gtattagaca gcgataacgg
aatagacttt 122640 ctgagatttg ttttgttaaa caatagatgg ataatggaag
atgctatatc aaaatatcag 122700 tctccagtta atatatttaa actagctagt
gagtacggat taaacatacc caaatattta 122760 gaaattgaaa tagaggaaga
cacattattt gacgacgagt tatactctat tatagaacgc 122820 tctttcgatg
ataaatttcc aaaaatatcc atatcgtata ttaagttggg agaacttaga 122880
cggcaagttg tagacttttt caaattctca ttcatgtata ttgagtccat caaggtagat
122940 cgtataggag ataatatttt tattcctagc gttataacaa aatcaggaaa
aaagatatta 123000 gtaaaagatg tagaccattt aatacgatcc aaggttagag
aacatacatt tgtaaaagta 123060 aaaaagaaaa acacattttc cattttatac
gactatgatg gaaacggaac agaaactaga 123120 ggagaagtaa taaaacgaat
tatagacact ataggacgag actattatgt taacggaaag 123180 tatttctcta
aggttggtag tgcaggctta aagcaattga ctaataaatt agatattaat 123240
gagtgcgcaa ctgtcgatga gttagttgat gagattaata aatccggaac tgtaaaacga
123300 aaaataaaaa accaatcagc atttgattta agcagagaat gtttgggata
tccagaagcg 123360 gattttataa cgttagttaa taacatgcgg ttcaaaatag
aaaattgtaa ggttgtaaat 123420 ttcaatattg aaaatactaa ttgtttaaat
aacccgagta ttgaaactat atatggaaac 123480 tttaaccagt tcgtctcaat
ctttaatgtc gtcaccgatg tcaaaaaaag attattcgag 123540 tgaaataata
tgcgcctttg atataggtgc aaaaaatcct gccagaactg ttttagaagt 123600
caaggataac tccgttaggg tattggatat atcaaaatta gactggagtt ctgattggga
123660 aaggcgcata gctaaagatt tgtcacaata tgaatacact acagttcttc
tagaacgtca 123720 gcctagaagg tcgccgtatg ttaaatttat ctattttatt
aaaggctttt tatatcatac 123780 atcggctgcc aaagttattt gcgtctcgcc
tgtcatgtct ggtaattcat atagagatcg 123840 aaaaaagaga tcggtcgaag
catttcttga ttggatggac acattcggat tgcgagactc 123900 cgttccggat
agacgcaaat tagacgatgt agcggatagt ttcaatttgg ctatgagata 123960
cgtattagat aaatggaata ctaattatac accttataat aggtgtaaat ctagaaatta
124020 cataaaaaaa atgtaataac gttagtaacg ccattatgga taatctattt
acctttctac 124080 atgaaataga agatagatat gccagaacta tttttaactt
tcatctaata agttgcgatg 124140 aaataggaga tatatatggt cttatgaaag
aacgcatttc ctcagaggat atgtttgata 124200 atatagtgta taataaagat
atacatcctg ccattaagaa actagtgtat tgcgacatcc 124260 aacttactaa
acacattatt aatcagaata cgtatccggt atttaacgat tcttcacaag 124320
tgaaatgttg tcattatttc gacataaact cagataatag caatattagc tctcgtacag
124380 tagagatatt tgagagggaa aagtcatctc ttgtatcata tattaaaact
accaataaga 124440 agagaaaggt caattacggc gaaataaaga aaactgttca
tggaggcact aatgcaaatt 124500 acttttccgg taaaaagtct gacgagtatc
tgagtactac agttagatcc aacattaatc 124560 aaccttggat caaaaccatc
tctaagagga tgagagttga tatcattaat cactctatag 124620 taacgcgtgg
aaaaagctct atattacaaa ctatagaaat tatttttact aatagaacat 124680
gtgtgaaaat attcaaggat tctactatgc acattattct atccaaggac aaggatgaaa
124740 aggggtgtat acacatgatt gacaaattat tctatgtcta ttataattta
tttctgttgt 124800 tcgaagatat catccaaaac gagtacttta aagaagtagc
taatgttgta aaccacgtac 124860 tcacggctac ggcattagat gagaaattat
tcctaattaa gaaaatggct gaacacgatg 124920 tttatggagt tagcaatttc
aaaataggga tgtttaacct gacatttatt aagtcgttgg 124980 atcataccgt
tttcccctct ctgttagatg aggatagcaa aataaagttt tttaagggga 125040
aaaagctcaa tattgtagca ttacgatctc tggaggattg tataaattac gtgactaaat
125100 ccgagaatat gatagaaatg atgaaggaaa gatcgactat tttaaatagc
atagatatag 125160 aaacggaatc ggtagatcgt ctaaaagaat tgcttctaaa
atgaaaaaaa acactaattc 125220 agaaatggat caacgactag ggtataagtt
tttggtgcct gatcctaaag ccggagtttt 125280 ttatagaccg ttacatttcc
aatatgtatc gtattctaat tttatattgc atcgattgca 125340 tgaaatcttg
accgtcaagc ggccactctt atcgtttaag aataatacag aacgaattat 125400
gatagaaatt agcaatgtta aagtgactcc tccagattac tcacctataa tcgcgagtat
125460 taaaggtaag agttatgacg cattagccac gttcactgta aatatcttta
aagaggtaat 125520 gaccaaagag ggtatatcca tcactaaaat aagtagttat
gagggaaaag attctcattt 125580 gataaaaatt ccgctactaa taggatacgg
gaataaaaat ccacttgata cagccaagta 125640 tcttgttcct aatgtcatag
gtggagtctt tatcaataaa caatctgtcg aaaaagtagg 125700 aattaatcta
gtagaaaaga ttacaacatg gccaaaattt agggttgtta agccaaactc 125760
attcactttc tcgttttcct ccgtatcccc tcctaatgta ttaccgacaa gatatcgcca
125820 ttacaagata tctctggata tatcacaatt ggaagcgttg aatatatcat
cgacaaagac 125880 atttataacg gtcaatattg ttttgctgtc tcaatattta
tctagagtga gtctagaatt 125940 cattagacgt agtttatcat acgatatgcc
tccagaagtt gtctatctag taaacgcgat 126000 aatagatagt gctaaacgaa
ttactgaatc tattactgac tttaatattg atacatacat 126060 taatgacctg
gtggaagctg aacacattaa acaaaaatct cagttaacga ttaacgagtt 126120
caaatatgaa atgctgcata actttttacc tcatatgaac tatacacccg atcaactaaa
126180 gggattttat atgatatctt tactaagaaa gtttctctac tgtatcttcc
acacttctag 126240 atatccagat agagattcga tggtttgtca tcgcatccta
acgtacggca aatattttga 126300 gacgttggca catgatgaat tagagaatta
cataggcaac atccgaaacg atatcatgaa 126360 caatcacaag aacagaggca
cttacgcggt aaacattcat gtactaacaa ctcccggact 126420 taatcacgcg
ttttctagct tattgagtgg aaagttcaaa aagtcagacg gtagttatcg 126480
aacacatcct cactattcat ggatgcagaa tatttctatt cctaggagtg ttggatttta
126540 tccggatcaa gtaaagattt caaagatgtt ttctgtcaga aaataccatc
caagtcaata 126600 tctttacttt tgttcatcag acgttccgga aagaggtcct
caggtaggtt tagtatctca 126660 attgtctgtc ttgagttcca ttacaaatat
actaacgtct gagtatttgg atttggaaaa 126720 gaaaatttgt gagtatatca
gatcatatta taaagatgat ataagttact ttgaaacagg 126780 atttccaatc
actatagaaa atgctctagt cgcatctctt aatccaaata tgatatgtga 126840
ttttgtaact gactttagac gtagaaaacg gatgggattc ttcggtaact tggaggtagg
126900 tattacttta gttagggatc acatgaatga aattcgcatt aatattggag
cgggaagatt 126960 agtcagacca ttcttggttg tggataacgg agagctcatg
atggatgtgt gtccggagtt 127020 agaaagcaga ttagacgaca tgacattctc
tgacattcag aaagagtttc cgcatgtcat 127080 cgaaatggta gatatagaac
aatttacttt tagtaacgta tgtgaatcgg ttcaaaaatt 127140 tagaatgatg
tcaaaggatg aaagaaagca atacgattta tgtgactttc ctgccgaatt 127200
tagagatgga tatgtagcat cttcactagt gggaatcaat cacaattctg gacccagagc
127260 tattcttgga tgtgctcaag ctaaacaagc tatctcttgt ctgagttcgg
atatacgaaa 127320 taaaatagac aatggaattc atttgatgta tccagagagg
ccaatcgtga ttagtaaggc 127380 tttagaaact tcaaagattg cggctaattg
cttcggccaa catgttacta tagcattaat 127440 gtcgtacaaa ggtatcaatc
aagaggatgg aattatcatc aaaaaacaat ttattcagag 127500 aggcggtctc
gatattgtta cagccaagaa acatcaagta gaaattccat tggaaaactt 127560
taataacaaa gaaagagata ggtctaacgc ctattcaaaa ttagaaagta atggattagt
127620 tagactgaat gctttcttgg aatccggaga cgctatggca cgaaatatct
catcaagaac 127680 tcttgaagat gattttgcta gagataatca gattagcttc
gatgtttccg agaaatatac 127740 cgatatgtac aaatctcgcg ttgaacgagt
acaagtagaa cttactgaca aagttaaggt 127800 acgagtatta accatgaaag
aaagaagacc cattctagga gacaaattta ccactagaac 127860 gagtcaaaag
ggaacagtcg cgtatgtcgc ggatgaaacg gaacttccat acgacgaaaa 127920
tggtatcaca ccagatgtca ttattaattc tacatccatc ttctctagaa aaactatatc
127980 tatgttgata gaagttattt taacagccgc atattctgct aagccgtaca
acaataaggg 128040 agaaaaccga cctgtctgtt ttcctagtag taacgaaaca
tccatcgata catatatgca 128100 attcgctaaa caatgttatg agcattcaaa
tccgaaattg tccgatgaag aattatcgga 128160 taaaatcttt tgtgaaaaga
ttctctatga tcctgaaacg gataagcctt atgcatccaa 128220 agtatttttt
ggaccaattt attacttgcg tctgaggcat ttaactcagg acaaggcaac 128280
cgttagatgt agaggtaaaa agacgaagct cattagacag gcgaatgagg gacgaaaacg
128340 tggaggaggt atcaagttcg gagaaatgga gagagactgt ttaatagcgc
atggtgcagc 128400 caatactatt acagaagttt tgaaagattc ggaagaagat
tatcaagatg tgtatgtttg 128460 tgaaaattgt ggagacatag cagcacaaat
caagggtatt aatacatgtc ttagatgttc 128520 aaaacttaat ctctctcctc
tcttaacaaa aattgatacc acgcacgtat ctaaagtatt 128580
tcttactcaa atgaacgcca gaggcgtaaa agtcaaatta gatttcgaac gaaggcctcc
128640 ttcgttttat aaaccattag ataaagttga tctcaagccg tcttttctgg
tgtaatattc 128700 tagtttggta gtagatacat atcaatatca tcaaattcga
gatccgaatt ataaaatggg 128760 cgtggattgt taactataga atcggacgtc
tgatattcga aaatctgtgg agtttcaggt 128820 tttggtggag gtgtaactgc
tacttgggat actgaagtct gatattcaga aagctgtgga 128880 tgttctggtt
cggcatccac cgatggtgtc acatcactaa tcggttcggt aacgtctgtg 128940
gatggaggtg ctacttctac agaacctgta gcctcagttg tcaacggaga tacattttta
129000 atgcgagaaa atgtataatt tggtaatggt ttcttatgtg gatctgaaga
agaggtaaga 129060 tatctactag aaagataccg atcacgttct agttctcttt
tgtagaactt aactttttct 129120 ttctccgcat ctagttgata ttccaacctc
ttcacgttac tacgttcaga ttccaattca 129180 cgttcgcatg ggttacctcc
gcagttttta cgagcgattt cacgttcagc cttcatgcgt 129240 ctctccctct
ctctatcgag tttatcagag cagtctttct gaaggcgatc gaactccata 129300
aatttctcca acgctttgat tgtttccata gatttccgaa gttcagcttt taggactgtg
129360 attctttttc tttcgaattc acagctggat gtacaaccgt ttccattacc
gccatctcta 129420 agtttctttt ctagatcggc aacatttcat ccccatgcct
tttacattcc tcgagtctac 129480 tgtcgtcgaa atatcgttcc agctcctttt
cgacatcaat aactttagca cgttgtctct 129540 caagctctct tttgtagtta
tctgattccc tggcacgttt aagatcttca tgcaattgag 129600 tcagctctta
acttcctctc ttgcttcttc gtcatagtac gcgcaatcac tgtgagatcc 129660
attgttacca cgtctacact cggcgagctc gcgtttaaga gattcaattt cccgtttgta
129720 ttggtccatg tttccattgc taccaccatt agatttacag gctgctagtt
gtcgttcgag 129780 atcagaaata cgggttttct tggaattgat ttcgtcgatg
tacttggcat cgaaacactt 129840 attaagttct ttttccaatt ctacgatttt
atttctttcg cgagtcaatt ccctcctgta 129900 gtaactatct gttttgtcag
attcacgctc tctacgtaga ctttcttgca agttactaat 129960 ttgttcccta
gcacgtccga gtttagtttt atatgctgaa tagagttctg attcatcctt 130020
tgagcagatc tctagcgatc gtttaagatt cctaattcta gtctttagcc tatttacctc
130080 ctcagaagat gttccgttac cgttgcgttt acactcgtta agctgtctat
caagatccat 130140 gattctatct ctaagacgtt gcatctctct ttccatatca
gcattgcttt cattattacg 130200 tctgcagtca ctcaactgtc tttcaatatc
tgagattcta tctctaagac gtcgcatctc 130260 tctctgtttc ggcattggtt
tcattattac gtctacagtc gttcaactgt ctttcaagat 130320 ctgatattct
agattggagt ctgctaatct ctgtagcatt ttcacggcat tcactcagtt 130380
gtctttcaag atctgaaatt ttagattgga gtctgctaat ctctgtaaga tttcctcctc
130440 cgctctcgat gcagtcggtc aacttattct ctagttctct aatacgcgaa
cgcagtgcat 130500 caacttcttg cgtgtcttcc tggttgcgtg tacattcatc
gagtctagat tcgagatctc 130560 taacgcgtcg tcgttcttcc tcaagttctc
tgcgtactac agaaagcgtg tccttatctt 130620 gttgatattt agcaatttct
gattctagag tactgatttt gcttacgtag ttactaatat 130680 ttgtcttggc
cttatcaaga tcctccttgt atttgtcgca ttccttgata tccctacgaa 130740
gtctggacag ttcccattcg acattacgac gtttatcgat ttcagctcgg agatcgtcat
130800 cgcgttgttt tagccacata cgactgagtt caagttctcg ttgacaagat
ccatctactt 130860 ttccattcct aatagtatcc agttcctttt ctagttctga
acgcatttct cgttccctat 130920 caagcgattc tctcaattct cggatagtct
tcttatcaat ttctaataaa tctgaaccat 130980 catctgtccc attttgaata
tccctgtgtt ctttgatctc ttttgtaagt cggtcgattc 131040 tttcggtttt
ataaacagaa tccctttcca aagtcctaat cttactgagt ttatcactaa 131100
gttctgcatt caattcggtg agttttctct tggcttcttc caactctgtt ttaaactctc
131160 cactatttcc gcattcttcc tcgcatttat ctaaccattc aattagttta
ttaataacta 131220 gttggtaatc agcgattcct atagccgttc ttgtaattgt
gggaacataa ttaggatctt 131280 ctaatggatt gtatggcttg atagcatcat
ctttatcatt attaggggga tggacaacct 131340 taattggttg gtcctcatct
cctccagtag cgtgtggttc ttcaatacca gtgttagtaa 131400 taggcttagg
caaatgcttg tcgtacgcgg gcacttcctc atccatcaag tatttataat 131460
cgggttctac ttcagaatat tcttttctaa gagacgcgac ttcgggagtt agtagaagaa
131520 ctctgtttct gtatctatca acgctggaat caatactcaa gttaaggata
gcgaatacct 131580 catcgtcatc atccgtatct tctgaaacac catcatatga
catttcatga agtctaacgt 131640 attgataaat agaatcagat ttagtattaa
acagatcctt aaccttttta gtaaacgcat 131700 atgtatattt tagatctcca
gatttcataa tatgatcaca tgccttaaat gtcagtgctt 131760 ccatgatata
atctggaaca ctaatgggtg acgaaaaaga tacagcacca tatgctacgt 131820
tgataaataa atctgaacca ctaagtagat aatgattaat gttaagaaag aggaaatatt
131880 cagtgtatag gtatgtcttg gcgtcatatc ttgtactaaa cacgctaaac
agtttgttaa 131940 tgtgatcaat ttccaataga ttaattagag cagcgggaat
accaacaaac atattaccac 132000 atccgtattt tctatgaata tcacatatca
tgttaaaaaa tcttgataga agagcgaata 132060 tctcgtctga cttaatgagt
cgtagttcag cagcaacata agtcataact gtaaatagaa 132120 catactttcc
tgtagtgttg attctagact ccacatcaac accattatta aaaatagttt 132180
tatatacatc tttaatctgc tctccgttaa tcgtcgaacg ttctagtata cggaaacact
132240 ttgatttctt atctgtagtt aatgacttag tgatatcacg aagaatatta
cgaattacat 132300 ttcttgtttt tcttgagaga cctgattcag aactcaactc
atcgttccat agtttttcta 132360 cctcagtggc gaaatctttg gagtgcttgg
tacatttttc aataaggttc gtgacctcca 132420 tttattataa aaaatttatt
caaaacttaa ctacaatcgg gtaattataa aatcgtagat 132480 ctcccatgtg
gcggaatact accatctatc gcatgtggat ggacagtagg taatggccat 132540
gggaacagta atgtttgcat atttatcttt cttgccagta ttactgcata ttgtcccaat
132600 gtttcgatgt gatgttctaa cctatcaact gccgctgtat cacaacaata
gtgtccgatg 132660 aaattaagat tatgatccaa tgtgtttaat atatgattat
caagtcttat acgatccgcg 132720 tcttttttga caggatcagg ttcttctaca
ggaagaagtt tcggcctctt atgatattca 132780 tgtctgggaa acggtggtct
agggtgaggc tccggtatcg gagtgggttt tggattataa 132840 tcatcatcgt
ctatgacatc atcttcgact tcgatattta ttttgctatc ttgatgatgt 132900
cctgtatcag ttgcattttc agcactcgac tgaatattag cgcattcatt gtctattatt
132960 accatatttc taaacccaaa atgtatgtgt tgaacatcag tactatcgtt
gatgagtctt 133020 atagcatgaa ttcgcttatc gttatcgggt ttatcttctg
tcaccttagc aattcctttt 133080 ttattaaact ctacataatc atatccattt
ctattgtttg ttctaatata aacgagtata 133140 gcatcattgc taaatttttc
aatagtatca aaaacagaat atcctaaacc atataatata 133200 tattcaggaa
cactcaaact aaatgtccag gattctccta aatacgtaaa ctttaatagt 133260
gcgaaatcat tcaaaaatct accacttata gatagatagt acataaatgc gtatagtagt
133320 ctacctatct ctttattatg aaaaccggca ttacgatcat atatgtcgtg
atatacctgt 133380 gatccgttta cgttaaacca taaatacatg ggtgatccta
taaacatgaa tttatttcta 133440 attctcagag ctatagttaa ttgaccgtgt
aatatttgct tacatgcata cttgatacgc 133500 ttattaataa gatttttatc
attgctcgtt atttcagaat cgtatatata aggagtacca 133560 tcgtgattct
taccagatat tatacaaaat actatatata aaatatattg acccacgtta 133620
gtaatcatat aaatgtttaa cgttttaaat tttgtattca atgatccatt atcatacgct
133680 atcatggtct tgtaatattc attctttaaa atataatatt gtgttagcca
ttgcattgga 133740 gctcctaatg gagattttct attctcatcc attttaggat
aggctttcat aaagtcccta 133800 ataacttcgt gaataatgtt tctatgtttt
ctactgatgc atgtatttgc ttcgattttt 133860 ttatcccatg tttcatctat
catagattta aacgcagtaa tgctcgcaac attaacatct 133920 tgaaccgttg
gtacaattcc gttccataaa tttataatgt tcgccattta tataactcat 133980
tttttgaata tacttttaat taacaaaaga gttaagttac tcatatggac gccgtccagt
134040 ctgaacatca atctttttag ccagagatat catagccgct cttagagttt
cagcgtgatt 134100 ttccaaccta aatagaactt catcgttgcg tttacaacac
ttttctattt gttcaaactt 134160 tgttgttaca ttagtaatct ttttttccaa
attagttagc cgttgtttga gagtttcctc 134220 attgtcgtct tcatcggctt
taacaattgc ttcgcgttta gcctctggct ttttagcagc 134280 ctttgtagaa
aaaaattcag ttgctggaat tgcaagatcg tcatctccgg ggaaaagagt 134340
tccgtccatt taaagtacag attttagaaa ctgacactct gcgttattta tatttggtac
134400 aacacatgga ttataaatat tgatgttaat aacatcagaa aatgtaaagt
ctatacattg 134460 ttgcatcgtg ttaaattttc taatggatct agtattattg
ggtccaactt ctgcctgaaa 134520 tccaaatatg gaagcggata caaaaccgtt
tcctggataa accacacatc tccacttttg 134580 ctttacatca gaaattgtgt
cgttgacatc ttgaactctc ctatctaatg ccggtgttcc 134640 acctatagat
tttgaatatt cgaatgctgc atgagtagca ttaaattcct taatattgcc 134700
ataattttca tatattgagt aaccctggat aaaaagtaaa cacaccgcag ccgtcgctac
134760 cacaataaaa aaaattgata gagagttcat ttataatcta ttagaagctg
acaaaatttt 134820 tttacacgca tcagacaatg ctttaataaa tagttcaaca
tctacttttg tcatatcgaa 134880 ccgatggtat gattctaacc tagaattaca
tccgaaaaag ttgactatgt tcatagtcat 134940 taagtcatta acaaacaaca
ttccagactc tggattataa gacgatactg tttcgtcaca 135000 attacctacc
ttaatcatgt gattatgaat attggctatt agagcacctt ctaagaaatc 135060
tataatatct ttgaaacacg atttaaaatc aaaccacgaa tatacttcta cgaagaaagt
135120 tagtttaccc ataggagaaa taactataaa tggagatcta aatacaaaat
ccggatctat 135180 gatagtttta acattattat attctctatt aaatacctcc
acatctaaaa atgttaattt 135240 tgaaactatg tcttcgttta ttaccgtacc
tgaactaaac gctataagct ctattgtttg 135300 agaactcttt aaacgatatt
cttgaaatac atgtaacaaa gtttccttta actcggtcgg 135360 tttatctacc
atagttacag aatttgtatc cttatctata atataataat caaaatcgta 135420
taaagttata taattatcgc gttcagattg ggatcttttc aaatagacta aaaaccccat
135480 ttctctagta agtatcttat gtatatgttt gtaaaatatc ttcatggtgg
gaatatgctc 135540 taccgcagtt agccattcct cattgacagc ggtagatgta
ttagacaaaa ctattccaat 135600 gtttaacaag ggccatttta cgagattatt
aaatccttgt ttgataaatg tagccaatga 135660 gggttcgagt tcaacgacga
ttgaattctc ttcccgcgga tgctgcatga tgaacgacgg 135720 gatgttgttc
gattgatttg gaattctttt tcgacttttt gtttatatta aatattttaa 135780
aatttatagc ggatagcaat tcatgtacca cggataatgt agacgcgtat tgcgcatcga
135840 tatctttatt attagataaa tttatcaata aatgtgagaa gtttgcctcg
ttaaggtctt 135900 ccatttaaat attatataaa catttgtgtt tgtaacttat
tcgtctttta tggaatagtt 135960 ttttactagt aaagctgcaa ttacacactt
tgtccgtaaa acataaatat aaacaccagc 136020 ttttatcaat cgttccaaaa
agtcgacggc ggacattttt aacatggcat ctattttaaa 136080 tacacttagg
tttttggaaa aaacatcatt ttataattgt aacgattcaa taactaaaga 136140
aaagattaag attaaacata agggaatgtc atttgtattt tataagccaa agcattctac
136200 cgttgttaaa tacttgtctg gaggaggtat atatcatgat gatttggttg
tattggggaa 136260 ggtaacaatt aataatctaa agatgatgct attttacatg
gatttatcat atcatggagt 136320 gacaagtagt ggagcaattt acaaattggg
atcgtctatc gatagacttt ctctaaatag 136380 gactattgtt acaaaagtta
ataattatga tgatacattt tttgacgacg atgattgatc 136440 gctattgcac
aattttgttt ttgtactttc taatatagtg tttaggttct ttttcatatg 136500
agaatattga tttactaaaa tatctatgtt taacttttgt tctatgacgt ccttatcggc
136560 ggtatcggta catatacgta attcaccttc acaaaatacg gagtcttcga
taataatagc 136620 caatcgatta ttggatctag ctgtctgtat catattcaac
atgtttaata tatcctttcg 136680 tttccccttt acaggcatcg atcgtagcat
attttccgcg tctgatatgg aaatgttaaa 136740 actacaaaaa tgcgtaatgt
tagcccgtcc taatattggt acgtgtctat aagtttggca 136800 tagtagaata
atagacgtgt ttaaatgcct tccaaagttt aagaattcta ttagagtatt 136860
gcattttgat agtttatcgc ctacatcatc aaaaataagt aaaaagtgtg ctgatttttt
136920 atgattttgt gcgacagcaa tacatttttc tatgttactt ttagttcgta
tcagattata 136980 ttctagagat tcctgactac taacgaaatt aatatgattt
ggccaaatgt atccatcata 137040 atctgggtta taaacgggtg taaacaagaa
tatatgttta tattttttaa ctagtgtaga 137100 aaacagagat agtaaataga
tagtttttcc agatccagat cctcctgtta aaaccattct 137160 aaacggcatt
tttaataaat tttctcttga aaattgtttt tcttggaaac aattcataat 137220
tatatttaca gttactaaat taatttgata ataaatcaaa atatggaaaa ctaaggttgt
137280 tagtagggag gagaacaaag aaggcacatc gtgatataaa taacatttat
tatcatgatg 137340 acaccagaaa acgacgaaga gcagacatct gtgttctccg
ctactgttta cggagacaaa 137400 attcagggaa agaataaacg caaacgcgtg
attggtctat gtattagaat atctatggtt 137460 atttcactac tatctatgat
taccatgtcc gcgtttctca tagtgcgcct aaatcaatgc 137520 atgtctgcta
acgaggctgc tattactgac gccgctgttg ccgttgctgc tgcatcatct 137580
actcatagaa aggttgcgtc tagcactaca caatatgatc acaaagaaag ctgtaatggt
137640 ttatattacc agggttcttg ttatatatta cattcagact accagttatt
ctcggatgct 137700 aaagcaaatt gcactgcgga atcatcaaca ctacccaata
aatccgatgt cttgactacc 137760 tggctcattg attatgttga ggatacatgg
ggatctgatg gtaatccaat tacaaaaact 137820 acatccgatt atcaagattc
tgatgtatca caagaagtta gaaagtattt ttgtgttaaa 137880 acaatgaact
aatatttatt tttgtacatt aataaatgaa atcgcttaat agacaaactg 137940
taagtaggtt taagaagttg tcggtgccgg ccgctataat gatgatactc tcaaccatta
138000 ttagtggcat aggaacattt ctgcattaca aagaagaact gatgcctagt
gcttgcgcca 138060 atggatggat acaatacgat aaacattgtt atttagatac
taacattaaa atgtctacag 138120 ataatgcggt ttatcagtgt cgtaaattac
gagctagatt gcctagacct gatactagac 138180 atctgagagt attgtttagt
attttttata aagattattg ggtaagttta aaaaagacca 138240 atgataaatg
gttagatatt aataatgata aagatataga tattagtaaa ttaacaaatt 138300
ttaaacaact aaacagtacg acggatgctg aagcgtgtta tatatacaag tctggaaaac
138360 tggttaaaac agtatgtaaa agtactcaat ctgtactatg tgttaaaaaa
ttctacaagt 138420 gacaacaaaa aatgaattaa taataagtcg ttaacgtacg
ccgccatgga cgccgcgttt 138480 gttattactc caatgggtgt gttgactata
acagatacat tgtatgatga tctcgatatc 138540 tcaatcatgg actttatagg
accatacatt ataggtaaca taaaaactgt ccaaatagat 138600 gtacgggata
taaaatattc cgacatgcaa aaatgctact ttagctataa gggtaaaata 138660
gttcctcagg attctaatga tttggctaga ttcaacattt atagcatttg tgccgcatac
138720 agatcaaaaa ataccatcat catagcatgc gactatgata tcatgttaga
tatagaagat 138780 aaacatcagc cattttatct attcccatct attgatgttt
ttaacgctac aatcatagaa 138840 gcgtataacc tgtatacagc tggagattat
catctaatca tcaatccttc agataatctg 138900 aaaatgaaat tgtcgtttaa
ttcttcattc tgcatatcag acggcaatgg atggatcata 138960 attgatggga
aatgcaatag taatttttta tcataaaagt tgtaaagtaa ataataaaac 139020
aataaatatt gaactagtag tacgtatatt gagcaatcag aaatgatgct ggtacctctt
139080 atcacggtga ccgtagttgc gggaacaata ttagtatgtt atatattata
tatttgtagg 139140 aaaaagatac gtactgtcta taatgacaat aaaattatca
tgacaaaatt aaaaaagata 139200 aagagttcta attccagcaa atctagtaaa
tcaactgata gcgaatcaga ctgggaggat 139260 cactgtagtg ctatggaaca
aaacaatgac gtagataata tttctaggaa tgagatattg 139320 gacgatgata
gcttcgctgg tagtttaata tgggataacg aatccaatgt tatggcgcct 139380
agcacagaac acatttacga tagtgttgct ggaagcacgc tgctaataaa taatgatcgt
139440 aatgaacaga ctatttatca gaacactaca gtagtaatta atgaaacgga
gactgttgaa 139500 gtacttaatg aagataccaa acagaatcct aactattcat
ccaatccttt cgtaaattat 139560 aataaaacca gtatttgtag caagtcaaat
ccgtttatta cagaacttaa caataaattt 139620 agtgagaata atccgtttag
acgagcacat agcgatgatt atcttaataa gcaagaacaa 139680 gatcatgaac
acgatgatat agaatcatcg gtcgtatcat tggtgtgatt agtttccttt 139740
ttataaaatt gaagtaatat ttagtattat tgctgccgtc acgttgtaca aatggagata
139800 ttccctgtat tcggcatttc taaaattagc aattttattg ctaataatga
ctgtagatat 139860 tatatagata cagaacatca aaaaattata tctgatgaga
tcaatagaca gatggatgaa 139920 acggtacttc ttaccaacat cttaagcgta
gaagttgtaa atgacaatga gatgtaccat 139980 cttattcctc atagattatc
gacgattata ctctgtatta gttctgtcgg aggatgtgtt 140040 atctctatag
ataatgacat caatggcaaa aatattctaa cctttcccat tgatcatgct 140100
gtaatcatat ccccactgag taaatgtgtc gtagttagca agggtcctac aaccatattg
140160 gttgttaaag cggatatacc tagcaaacga ttggtaacat cgtttacaaa
cgacatacta 140220 tatgtaaaca atctgtcact gattaattat ttgccgttgt
ctgtattcat tattagacga 140280 gtcaccgact atttggatag acacatatgc
gatcagatat ttgctaataa taagtggtat 140340 tcccttataa ccatcgacga
taagcaatat cctattccat caaactgtat aggtatgtcc 140400 tctgccaagt
acataaattc tagcatcgag caagatactt taatccatgt ttgtaacctc 140460
gagcatccgt tcgactcagt atacaaaaaa atgcagtcgt acaattctct acctatcaag
140520 gaacaaatat tgtacggtag aattgataat ataaatatga gcattagtat
ttctgtggat 140580 taatagattt ctagtatggg gatcattaat catctctaat
ctctaaatac ctcataaaac 140640 gaaaaaaaag ctattatcaa atactgtacg
gaatggattc attctcttct ctttttatga 140700 aactctgttg tatatctact
gataaaactg gaagcaaaaa atctgataga aagaataaga 140760 ataagatcaa
ggattatatg gaacacgatt attataaaat aacaatagtt cctggttcct 140820
cttccacgtc tactagctcg tggtattata cacatgccta gtaatagtct ctttgcgttg
140880 acggaaagca gactagaaat aacaggctaa aatgttcaga caccataata
gttcccaacc 140940 cagataataa cagagttcca tcaacacatt cctttaaact
caatcccaaa cccaaaaccg 141000 ttaaaatgta tccggccaat tgatagtaga
taatgaggtg tacagcgcat gataatttac 141060 acagtaacca aaatgaaaat
actttagtaa ttataagaaa tatagacggt aatgtcatca 141120 tcaacaatcc
gataatatgc ctgagagtaa acattgacgg ataaaacaaa aatgctccgc 141180
ataactctat catggcaata acacaaccaa atacttgtaa gattcctaaa ttagtagaaa
141240 atacaacgaa tatcgatgta taagtgatct cgagaaataa taagaataaa
gtaatgcccg 141300 taaagataaa catcaacatt gtttggtaat cattaaacca
attagtatga agttgaacta 141360 atttcacagt agattttatt ccagtgttat
cctcgcatgt ataagtacct ggtaagatat 141420 ctttatattc cataatcaat
gagacatcac tatctgataa cgaatgaagt ctagcactag 141480 tatgccattt
acttaatatt gtcgtcttgg aagttttatt ataagttaaa atatcatggt 141540
tatccaattt ccatctaata tactttgtcg gattatctat agtacacgga ataatgatgg
141600 tatcattaca tgctgtatac tctatggtct ttgtagttgt tataacaacc
aacgtataga 141660 ggtatatcaa cgatattcta actcttgaca ttttttattt
atttaaaatg atacctttgt 141720 tatttatttt attctatttt gctaacggta
ttgaatggca taagtttgaa acgagtgaag 141780 aaataatttc tacttactta
ttagacgacg tattatacac gggtgttaat ggggcggtat 141840 acacattttc
aaataataaa ctaaacaaaa ctggtttaac taataataat tatataacaa 141900
catctataaa agtagaggat gcggataagg atacattagt atgcggaacc aataacggaa
141960 atcccaaatg ttggaaaata gacggttcag acgacccaaa acatagaggt
agaggatacg 142020 ctccttatca aaatagcaaa gtaacgataa tcagtcacaa
cggatgtgta ctatctgaca 142080 taaacatatc aaaagaagga attaaacgat
ggagaagatt tgacggacca tgtggttatg 142140 atttattcac ggcggataac
gtaattccaa aagatggttt acgaggagca ttcgtcgata 142200 aagacggtac
ttatgacaaa gtttacattc ttttcactga tactatcggc tcaaagagaa 142260
ttgtcaaaat tccgtatata gcacaaatgt gcctaaacga cgaaggtggt ccatcatcat
142320 tgtctagtca tagatggtcg acgtttctca aagtcgaatt agaatgtgat
atcgacggaa 142380 gaagttatag acaaattatt cattctagaa ctataaaaac
agataatgat acgatactat 142440 atgtattctt cgatagtcct tattccaagt
ccgcattatg tacctattct atgaatacca 142500 ttaaacaatc tttttctacg
tcaaaattgg aaggatatac aaagcaattg ccgtctccag 142560 ctcctggtat
atgtttacca gctggaaaag ttgttccaca taccacgttt gaagtcatag 142620
aacaatataa tgtactagat gatattataa agcctttatc taaccaacct atcttcgaag
142680 gaccgtctgg tgttaaatgg ttcgatataa aggagaagga aaatgaacat
cgggaatata 142740 gaatatactt cataaaagaa aattctatat attcgttcga
tacaaaatct aaacaaactc 142800 gtagctcgca agtcgatgcg cgactatttt
cagtaatggt aactgcgaaa ccgttattta 142860 tagcagatat agggatagga
gtaggaatgc cacaaatgaa aaaaatactt aaaatgtaat 142920 cttaatcgag
tacaccacac gacaatgaac aaacataaga cagattatgc tggttatgct 142980
tgctgcgtaa tatgcggtct aattgtcgga attattttta cagcgacact attaaaagtt
143040 gtagaacgta aattagttca tacaccatta atagataaaa cgataaaaga
tgcatatatt 143100 agagaagatt gtcctactga ctggataagc tataataata
aatgtatcca tttatctact 143160 gatcgaaaaa cctgggagga aggacgtaat
gcatgcaaag ctctaaattc aaattcggat 143220 ctaattaaga tagagactcc
aaacgagtta agttttttaa gaagccttag acgaggctat 143280 tgggtaggag
aatccgaaat attaaaccag acaaccccat ataattttat agctaagaat 143340
gccacgaaga atggaactaa aaaacggaaa tatatttgta gcacaacgaa tactcccaaa
143400 ctgcattcgt gttacactat ataacaatta cactacattt ttatcatacc
actacttcgg 143460 ttagatgttt tagaaaaaaa taaatatcgc cgtaccgttc
ttgtttttat aaaaataaca 143520 attaacaatt atcaaatttt ttctttaata
ttttacgtgg ttgaccattc ttggtggtaa 143580 aataatctct tagtgttgga
atggaatgct gtttaatgtt tccacactca tcgtatattt 143640
tgacgtatgt agtcacatcg tttacgcaat agtcagactg tagttctatc atgcttccta
143700 catcagaagg aggaacagtt ttaaagtctc ttggttttaa tctattaccg
ttagttttca 143760 tgaaatcctt tgttttatcc acttcacatt ttaaataaat
gtccactata cattcttttg 143820 ttaattttac tagatcgtca tgggtcatag
aatttatagg ttccgtagtc catggatcca 143880 aactagcaaa cttcgcgtat
acggtatcgc gattagtgta tacaccaact gtatgaaaat 143940 taagaaaaca
gtttaataaa tcaacagaaa tatttaatcc tccgtttgat acagatgcgc 144000
catatttatg gatttcggat tcacacgttg tttgtctgag gtgttcgtct agtgttgctt
144060 ctacgtaaac ttcgattccc atatattctt tattgtcaga atcgcatacc
gatttatcat 144120 catacactgt ttgaaaacta aatggtatac acatcaaaat
aataaataat aacgagtaca 144180 ttctgcaata ttgttatcgt aattggaaaa
atagtgttcg agtgagttgg attatgtgag 144240 tattggattg tatattttat
tttatatttt gtaataagaa taaaatgcta atgtcaagtt 144300 tattccaata
gatgtcttat taaaaacata tataataaat aacaatggct gaatggcata 144360
aaattatcga ggatatctca aaaaataata agttcgagga tgccgccatc gttgattaca
144420 agactacaaa gaatgttcta gctgctattc ctaacagaac atttgccaag
attaatccgg 144480 gtgaaattat tcctctcatc actaatcgta atattctaaa
acctcttatt ggtcagaaat 144540 attgtattgt atatactaac tctctaatgg
atgagaacac gtatgctatg gagttgctta 144600 ctgggtacgc ccctgtatct
ccgatcgtta tagcgagaac tcataccgca cttatatttt 144660 tgatgggtaa
gccaacaaca tccagacgtg acgtgtatag aacgtgtaga gatcacgcta 144720
cccgtgtacg tgcaactggt aattaaaata aaaagtaata ttcatatgta gtgtcaattt
144780 taaatgatga tgatgaaatg gataatatcc atattgacga tgtcaataat
gccggtattg 144840 gcatacagtt catcgatttt tagatttcat tcagaggatg
tggaattatg ttatgggcat 144900 ttgtattttg ataggatcta taatgtagta
aatataaaat ataatccgca tattccatat 144960 agatataatt ttattaatcg
cacgttaacc gtagatgaac tagacgataa tgtctttttt 145020 acacatggtt
attttttaaa acacaaatat ggttcactta atcctagttt gattgtctca 145080
ttatcaggaa acttaaaata taatgatata caatgctcag taaatgtatc gtgtctcatt
145140 aaaaatttgg caacgagtac atctactata ttaacatcta aacataagac
ttattctcta 145200 catcggtcca cgtgtattac tataatagga tacgattcta
ttatatggta taaagatata 145260 aatgacaagt ataatgacat ctatgatttt
actgcaatat gtatgctaat agcgtctaca 145320 ttgatagtga ccatatacgt
gtttaaaaaa ataaaaatga actcttaatt atgctatgct 145380 attagaaatg
gataaaatca aaattacggt tgattcaaaa attggtaatg ttgttaccat 145440
atcgtataac ttggaaaaga taactattga tgtcacacct aaaaagaaaa aagaaaagga
145500 tgtattatta gcgcaatcag ttgctgtcga agaggcaaaa gatgtcaagg
tagaagaaaa 145560 aaatattatc gatattgaag atgacgatga tatggatgta
gaaagcgcat aatacgatct 145620 ataaaaataa gtatataaat actttttatt
tactgtactc ttactgtgta gtggtgatac 145680 cctactcgat tattttttta
aaaaaaaaat acttattctg attcttctaa ccatttccgt 145740 gttcgttcga
atgccacatc gacgtcaaag ataggggagt agttaaaatc tagttctgca 145800
ttgttggtac acaccttaaa tgtagtgttg gatatcttca acgtatagtt gttgagtagt
145860 gatggttttc taaatagaat tctcttcata tcattcttgc acgcgtacat
ttttagcatc 145920 catcttggaa accttaactt tcgaggttat tggttgtgga
tcttctacaa tatctatgac 145980 tctgatttct tgaacatcat ctgcactaat
taacagtttt actatatacc tgcctagaaa 146040 tccggcacca ccagtaaccg
cgtacacggc cattgctgcc actcataata tcagactact 146100 tattctattt
tactaaataa tggctgtttg tataatagac cacgataata tcagaggagt 146160
tatttacttt gaaccagtcc atggaaaaga taaagtttta ggatcagtta ttggattaaa
146220 atccggaacg tatagtttga taattcatcg ttacggagat attagtcaag
gatgtgattc 146280 cataggcagt ccagaaatat ttatcggtaa catctttgta
aacagatatg gtgtagcata 146340 tgtttattta gatacagatg taaatatatc
tacaattatt ggaaaggcgt tatctatttc 146400 aaaaaatgat cagagattag
cgtgtggagt tattggtatt tcttacataa atgaaaagat 146460 aatacatttt
cttacaatta acgagaatgg cgtttgatat atcagttaat gcgtctaaaa 146520
caataaatgc attagtttac ttttctactc agcaaaataa attagtcata cgtaatgaag
146580 ttaatgatac acactacact gtcgaatttg atagggacaa agtagttgac
acgtttattt 146640 catataatag acataatgac accatagaga taagaggggt
gcttccagag gaaactaata 146700 ttggttgcgc ggttaatacg ccggttagta
tgacttactt gtataataag tatagtttta 146760 aactgatttt agcagaatat
ataagacaca gaaatactat atccggcaat atttattcgg 146820 cattgatgac
actagatgat ttggctatta aacagtatgg agacattgat ctattattta 146880
atgagaaact taaagtagac tccgattcgg gactatttga ctttgtcaac tttgtaaagg
146940 atatgatatg ttgtgattct agaatagtag tagctctatc tagtctagta
tctaaacatt 147000 gggaattgac aaataaaaag tataggtgta tggcattagc
cgaacatata tctgatagta 147060 ttccaatatc tgagctatct agactacgat
acaatctatg taagtatcta cgcggacaca 147120 ctgagagcat agaggataaa
tttgattatt ttgaagacga tgattcgtct acatgttctg 147180 ccgtaaccga
cagggaaacg gatgtataat tttttttata gcgtgaagga tatgataaaa 147240
aatataattg ttgtatttat cccattccaa tcaccttata tgattctgta acacaataaa
147300 ggagtcttat agatgtatag aggtcagata ctggtttgat aaactgttta
ttccacataa 147360 gtatgtttga ctttatggtt agacccgcat actttaacaa
atcactgaaa attggagtta 147420 ggtattgacc tctcagaatc agttgccgtt
ctggaacatt aaatgtattt tttatgatat 147480 actccaacgc atttatgtgg
gcatacaaca agtcattact aatggaatat tccaagagtt 147540 ttagttgtct
agtatttaac aagagaagag atttcaacag actgtttatg aactcgaatg 147600
ccgcctcatt gtcgcttata ttgatgatgt cgaattctcc caatatcatc accgatgagt
147660 agctcatctt gttatcggga tccaagtttt ctaaagatgt cattaaaccc
tcgatcatga 147720 atggatttat catcatcgtt tttatgttgg acatgagctt
agtccgtttg tccacatcta 147780 tagaagatga tttctgaatt atttcatata
tctctctctt taactccagg aacttgtcag 147840 gatggtctac tttaatatgt
tctcgtctaa gagatgaaaa tctttggatg gttgcacgcg 147900 acttttctct
aaaggatgac gttgcccaag atcctctctt aaatgaatcc atcttatcct 147960
tggacaagat ggacagtcta ttttccttag atggtttaat atttttgtta cccatgatct
148020 ataaaggtag acctaatcgt ctcggatgac catatattta ttttcagttt
tattatacgc 148080 ataaattgta aaaaatatgt taggtttaca aaaatgtctc
gtggggcatt aatcgttttt 148140 gaaggattgg acaaatctgg aaaaacaaca
caatgtatga acatcatgga atctataccg 148200 gcaaacacga taaaatatct
taactttcct cagagatcca ctgtcactgg aaaaatgata 148260 gatgactatc
taactcgtaa aaaaacctat aatgatcata tagttaatct attattttgt 148320
gcaaatagat gggagtttgc atcttttata caagaacaac tagaacaggg aattacttta
148380 atagttgata gatacgcatt ttctggagta gcgtatgccg ccgctaaagg
cgcgtcaatg 148440 actctcagta agagttatga atctggattg cctaaacccg
acttagttat attcttggaa 148500 tctggtagca aagaaattaa tagaaacgtc
ggcgaggaaa tttatgaaga tgttacattc 148560 caacaaaagg tattacaaga
atataaaaaa atgattgaag aaggagatat tcattggcaa 148620 attatttctt
ctgaattcga ggaagatgta aagaaggagt tgattaagaa tatagttata 148680
gaggctatac acacggttac tggaccagtg gggcaactgt ggatgtaata gtgaaattac
148740 attttttata aatagatgtt agtacagtgt tataaatgga tgaagcatat
tactctggca 148800 acttggaatc agtactcgga tacgtgtccg atatgcatac
cgaactcgca tcaatatctc 148860 aattagttat tgccaagata gaaactatag
ataatgatat attaaacaag gacattgtaa 148920 attttatcat gtgtagatca
aacttggata atccatttat ctctttccta gatactgtat 148980 atactattaa
aaataactag ttataagttt gaatccgtca attttgattc caaaattgaa 149040
tggactgggg atggtctata caatatatcc cttaaaaatt atggcatcaa gacgtggcaa
149100 acaatgtata caaatgtacc agaaggaaca tacgacatat ccgcatttcc
aaagaatgat 149160 ttcgtatctt tctgggttaa atttgaacaa ggcgattata
aagtggaaga gtattgtacg 149220 ggactatgcg tcgaagtaaa aattggacca
ccgactgtaa cattaactga atacgacgac 149280 catatcaatt tgtacatcga
gcatccgtat gctactagag gtagcaaaaa gattcctatt 149340 tacaaacgcg
gtgacatgtg tgatatctac ttgttgtata cggctaactt cacattcgga 149400
gattctaaag aaccagtacc atatgatatc gatgactacg attgcacgtc tacaggttgc
149460 agcatagact ttgtcacaac agaaaaagtg tgcgtgacag cacagggagc
cacagaaggg 149520 tttctcgaaa aaattactcc atggagttcg aaagtatgtc
tgacacctaa aaagagtgta 149580 tatacatgcg caattagatc caaagaagat
gttcccaatt tcaaggacaa aatggccaga 149640 gttatcaaga gaaaatttaa
tacacagtct caatcttatt taactaaatt tctcggtagc 149700 acatcaaatg
atgttaccac ttttcttagc atgcttaact tgactaaata ttcataatta 149760
ttttttatta atgatacaaa aacgaaataa aactgcatat tatacactgg ttaacgccct
149820 tataggctct aaccattttc aagatgaggt ccctgattat agtccttctg
ttcccctcta 149880 tcatctactc catgtctatt agacgatgtg agaagactga
agaggaaaca tggggattga 149940 aaatagggtt gtgtataatt gccaaagatt
tctatcccga aagaactgat tgcagtgttc 150000 atctcccaac tgcaagtgaa
ggattgataa ctgaaggcaa tggattcagg gatatacgaa 150060 acaccgataa
attataaaaa aagcaatgtg tccgctgttt ccgttaataa tactattttc 150120
gtaactggcg gattattcat aaataactct aatagcacga tcgtggacat ttataaagac
150180 aaacaatggt cgattataga aatggctagg gtatatcacg gcatcgactc
gacatttgga 150240 atgttatatt ttgccggagg tctatccgtt accgaacaat
atggtaattt agagaaaaac 150300 aacgagatat cttgttacaa tcctagaacg
aataagtggt ttgatatttc atatactatt 150360 tataagatat ccatatcatc
attgtgtaaa ctaaataacg tcttctatgt atttagtaag 150420 gacattggat
atgtggaaaa gtatgatggt gcatggaagt tagtacatga tcgtctcccc 150480
gctataaagg cattatcaac ttctccttat tgattgaaaa tgaaaatata aatagttttt
150540 atgtatagca gtattaccct atagttttat tgcttactac taacatggat
acagatgtta 150600 caaatgtaga agatatcata aatgaaatag atagagagaa
agaagaaata ctaaaaaatg 150660 tagaaattga aaataataaa aacattaaca
agaatcatcc caatgaatat attagagaag 150720 cactcgttat taataccagt
agtaatagtg attccattga taaagaagtt atagaatgta 150780 tcagtcacga
tgtaggaata tagatcatat ctactaattt ttataatcga tacaaaacat 150840
aaaaaacaac tcgttattac atagcaggca tggaatcctt caagtattgt tttgataacg
150900 atggcaagaa atggattatc ggaaatactt tatattctgg taattcaata
ctctataagg 150960 tcagaaaaaa tttcactagt tcgttctaca attacgtaat
gaagatagat cacaaatcac 151020 acaagccatt gttgtctgaa atacgattct
atatatctgt attggatcct ttgactatcg 151080 acaactggac acgggaacgt
ggtataaagt atttggctat tccagatctg tatggaattg 151140 gagaaaccga
tgattatatg ttcttcgtta taaagaattc gggaagagta ttcgccccaa 151200
aggatactga atcagtcttc gaagcatgcg tcactatgat aaacacgtta gagtttatac
151260 actctcgagg atttacccat ggaaaaatag aaccgaggaa tatactgatt
agaaataaac 151320 gtctttcact aattgactat tctagaacta acaaactata
caagagtgga aactcacata 151380 tagattacaa cgaggacatg ataacttcag
gaaatatcaa ttatatgtgt gtagacaatc 151440 atcttggagc aacagtttca
agacgaggag atttagaaat gttgggatat tgcatgatag 151500 aatggttcgg
tggcaaactt ccatggaaaa acgaaagtag tataaaagta ataaaacaaa 151560
aaaaagaata taaaaaattt atagctactt tctttgagga ctgttttcct gaaggaaatg
151620 aacctctgga attagttaga tatatagaat tagtatacac gttagattat
tctcaaactc 151680 ctaattatga cagactacgt aaactgttta tacaagattg
aaattatatt ctttttttta 151740 tagagtgtgg tagtgttacg gatatctaat
attaatatta gactatctct atcgcgctac 151800 acgaccaata tcgattacta
tggatatctt ctatgaaagg agagaatgta tttatttctc 151860 cagcgtcaat
ctcgtcagta ttgacaatac tgtattatgg agctaatgga tccactgctg 151920
aacagctatc aaaatatgta gaaacggagg agaacacgga taaggttagc gctcagaata
151980 tctcattcaa atccatgaat aaagtatatg ggcgatattc tgccgtgttt
aaagattcct 152040 ttttgagaaa aattggcgat aagtttcaaa ctgttgactt
cactgattgt cgcactatag 152100 atgcaatcaa caagtgtgta gatatcttta
ctgaggggaa aatcaatcca ctattggatg 152160 aaccattgtc tcctagcaat
tagtgccgta tactttaaag caaaatggtt gacgccattc 152220 gaaaaggaat
ttaccagtga ttatcccttt tacgtatctc cgacggaaat ggtagacgta 152280
agtatgatgt ctatgtacgg caaggcattt aatcacgcat ctgtaaaaga atcattcggc
152340 aacttttcaa tcatagaact gccatatgtt ggagatacta gtatgatggt
cattcttcca 152400 gacaagattg atggattaga atccatagaa caaaatctaa
cagatacaaa ttttaagaaa 152460 tggtgtgact ttatggatgc tatgtttata
gatgttcaca ttcccaagtt taaggtaaca 152520 ggctcgtata atctggtgga
tactctagta aagtcaggac tgacagaggt gttcggttca 152580 actggagatt
atagcaatat gtgtaattta gatgtgagtg tcgacgctat gatccacaaa 152640
acgtatatag atgtcaatga agagtataca gaagcagctg cagcaacttc tgtactagtg
152700 gcagactgtg catcaacaat tacaaatgag ttctgtgcag atcatccgtt
catctatgtg 152760 attaggcatg ttgatggaaa aattcttttc gttggtagat
attgctctcc gacaactaat 152820 tgttaaccat tttttttaaa aaaaacaatg
ggtgatggat acacttgatg gtataatgat 152880 gaatgaacgc gatgtttctg
taagcgttgg caccggaata ctattcatgg aaatgttttt 152940 ccgttacaat
aaaaatagta tcaacaatca actaatgtat gatataatta atagcgtatc 153000
tataagtgta gctaattata gatatagaag ctgcttttaa cgacgatggt atatacatcc
153060 gtagaaatat gattaacaag ttgtacggat acgcatctct aactactatt
ggcacgatcg 153120 ctggaggtgt ttgttattat ctgttgatgc atctagttag
tttgtataaa taattatttc 153180 aatatactag ttaaaatttt aagattttaa
atgtataaaa aactaataac gtttttattt 153240 gtaataggtg cattagcatc
ctattcgaat aatgagtaca ctccgtttaa taaactgagt 153300 gtaaaactct
atatagatgg agtagataat atagaaaatt catatactga tgataataat 153360
gaattggtgt taaattttaa agagtacaca atttctatta ttacagagtc atgcgacgtc
153420 ggatttgatt ccatagatat agatgttata aacgactata aaattattga
tatgtatacc 153480 attgactcgt ctactattca acgcagaggt cacacgtgta
gaatatctac caaattatca 153540 tgccattatg ataagtaccc ttatattcac
aaatatgatg gtgatgagcg acaatattct 153600 attactgcag agggaaaatg
ctataaagga ataaaatatg aaataagtat gatcaacgat 153660 gatactctat
tgagaaaaca tactcttaaa attggatcta cttatatatt tgatcgtcat 153720
ggacatagta atacatatta ttcaaaatat gatttttaaa aatttaaaat atattatcac
153780 ttcagtgaca gtagtcaaat aacaaacaac accatgagat atattataat
tctcgcagtt 153840 ttgttcatta atagtataca cgctaaaata actagttata
agtttgaatc cgtcaatttt 153900 gattccaaaa ttgaatggac tggggatggt
ctatacaata tatcccttaa aaattatggc 153960 atcaagacgt ggcaaacaat
gtatacaaat gtaccagaag gaacatacga catatccgca 154020 tttccaaaga
atgatttcgt atctttctgg gttaaatttg aacaaggcga ttataaagtg 154080
gaagagtatt gtacgggact atgcgtcgaa gtaaaaattg gaccaccgac tgtaacattg
154140 actgaatacg acgaccatat caatttgtac atcgagcatc cgtatgctac
tagaggtagc 154200 aaaaagattc ctatttacaa acgcggtgac atgtgtgata
tctacttgtt gtatacggct 154260 aacttcacat tcggagattc taaagaacca
gtaccatatg atatcgatga ctacgattgc 154320 acgtctacag gttgcagcat
agactttgtc acaacagaaa aagtgtgcgt gacagcacag 154380 ggagccacag
aagggtttct cgaaaaaatt actccatgga gttcgaaagt atgtctgaca 154440
cctaaaaaga gtgtatatac atgcgcaatt agatccaaag aagatgttcc caatttcaag
154500 gacaaaatgg ccagagttat caagagaaaa tttaatacac agtctcaatc
ttatttaact 154560 aaatttctcg gtagcacatc aaatgatgtt accacttttc
ttagcatgct taacttgact 154620 aaatattcat aactaatttt tattaatgat
acaaaaacga aataaaactg catattatac 154680 actggttaac gcccttatag
gctctaacca ttttcaagat gaggtccctg attatagtcc 154740 ttctgttccc
ctccatgtct attagacgat gtgagaagac tgaagaggaa acatggggat 154800
tgaaaatagg gttgtgtata attgccaaag atttttatcc cgaaagaact gattgcagtg
154860 ttcatctccc aactgcaagt gaaggattga taactgaagg caatggattc
agggatatac 154920 gaaacaccga taaattataa aaaaagcaat gtgtccgctg
tttccgttaa taatactatt 154980 ttcgtaactg gcggattatt cataaataac
tctaatagca cgatcgtgga catttataaa 155040 gacaaacaat ggtcgattat
agaaatggct agggtatatc acggcatcga ctcgacattt 155100 ggaatgttat
attttgccgg aggtctatcc gttaccgaac aatatggtaa tttatagaaa 155160
aacaacgaga tatcttgtta caatcctaga acgaataagt ggtttgatat ttcatatact
155220 atttataaga tatccatatc atcattgtgt aaactaaata acgtcttcta
tgtatttagt 155280 aaggacattg gatatgtgga aaagtatgat ggtgcatgga
agttagtaca tgatcgtctc 155340 cccgctataa aggcattatc aacttctcct
tattgattga aaatgaaaat ataaatagtt 155400 tttatgtata gcagtattac
cctatagttt tattgcttac tactaacatg gatacagatg 155460 ttacaaatgt
agaagatatc ataaatgaaa tagatagaga gaaagaagaa atactaaaaa 155520
atgtagaaat tgaaaataat aaaaacatta acaagaatca tcccaatgaa tatattagag
155580 aagcactcgt tattaatacc agtagtaata gtgattccat tgataaagaa
gttatagaat 155640 gtatcagtca cgatgtagga atatagatca tatctactaa
tttttataat cgatacaaaa 155700 cataaaaaac aactcgttat tacatagcag
gcatggaatc cttcaagtat tgttttgata 155760 acgatggcaa gaaatggatt
atcggaaata ctttatattc tggtaattca atactctata 155820 aggtcagaaa
aaatttcact agttcgttct acaattacgt aatgaagata gatcacaaat 155880
cacacaagcc attgttgtct gaaatacgat tctatatatc tgtattggat cctttgacta
155940 tcgacaactg gacacgggaa cgtggtataa agtatttggc tattccagat
ctgtatggaa 156000 ttggagaaac cgatggatta tatgttcttc gttataaaga
attcgggaag agtattcgcc 156060 ccaaaggata ctgaatcagt cttcgaagca
tgcgtcacta tgataaacac gttagagttt 156120 atacactctc gaggatttac
ccatggaaaa atagaaccga ggaatataat attaaaactt 156180 accacgtaaa
acttaaaatt taaaatgata tttcattgac agatagatca cacattatga 156240
actttcaagg acttgtgtta actgacaatt gcaaaaatca atgggtcgtt ggaccattaa
156300 taggaaaagg tggatttggt agtatttata ctactaatga caataattat
gtagtaaaaa 156360 tagagcccaa agctaacgga tcattattta ccgaacaggc
attttatact agagtactta 156420 aaccatccgt tatcgaagaa tggaaaaaat
ctcacaatat aaagcacgta ggtcttatca 156480 cgtgcaaggc atttggtcta
tacaaatcca ttaatgtgga atatcgattc ttggtaatta 156540 atagattagg
tgcagatcta gatgcggtga tcagagccaa taataataga ctaccaaaaa 156600
ggtcggtgat gttgatcgga atcgaaatct taaataccat acaatttatg cacgagcaag
156660 gatattctca cggagatatt aaagcgagta atatagtctt agatcaaata
gataagaata 156720 aattatatct agtggattac ggattggttt ctaaattcat
gtctaatggc gaacatgttc 156780 catttataag aaatccaaat aaaatggata
acggtactct agaatttaca cctatagatt 156840 cgcataaagg atacgttgta
tctagacgtg gagatctaga aacacttgga tattgtatga 156900 ttagatggtt
gggaggtatc ttaccatgga ctaagatatc tgaaacaaag aattgtgcat 156960
tagtaagtgc cacaaaacag aaatatgtta acaatactgc gactttgtta atgaccagtt
157020 tgcaatatgc acctagagaa ttgctgcaat atattaccat ggtaaactct
ttgacatatt 157080 ttgaggaacc caattacgac aagtttcggc acatattaat
gcagggtgta tattattaag 157140 tgtggtgttt ggtcgataaa aattaaaaaa
taacttaatt tattattgat ctcgtgtgta 157200 caaccgaaat catggcgatg
ttttacgcac acgctctcgg tgggtacgac gagaatcttc 157260 atgcctttcc
tggaatatca tcgactgttg ccaatgatgt caggaaatat tctgttgtgt 157320
cagtttataa taacaagtat gacattgtaa aagacaaata tatgtggtgt tacagtcagg
157380 tgaacaagag atatattgga gcactgctgc ctatgtttga gtgcaatgaa
tatctacaaa 157440 ttggaaatcc gatccatgat caagaaggaa atcaaatctc
tatcatcaca tatcgccaca 157500 aaaactacta tgctctaagc ggaatcgggt
acgagagtct agacttgtgt ttggaaggag 157560 tagggattca tcatcacgta
cttgaaacag gaaacgctgt atatggaaaa gttcaacatg 157620 attattctac
tatcaaagag aaggccaaag aaatgagtgc acttagtcca ggacctatca 157680
tcgattacca cgtctggata ggagattgta tctgtcaagt tactgctgtg gacgtacatg
157740 gaaaggaaat tatgaaaatg agattcaaaa agggtgcggt gcttccgatc
ccaaatctgg 157800 taaaagttaa acttggggag aatgatacag aaaatctttc
ttctactata tcggcgacac 157860 catcgaggta accacctctc tggaagacag
cgtgaataat gtactcatga aacgtttgga 157920 aactatacgc catatgtggt
ctgttgtata tgatcatttt gatattgtga atggtaaaga 157980 atgctgttat
gtgcatacgc atttgtctaa tcaaaatctt ataccgagta ctgtaaaaac 158040
aaatttgtac atgaagacta tgggatcatg cattcaaatg gattccatgg aagctctaga
158100 gtatcttagc gaactgaagg aatcaggtgg atggagtccc agaccagaaa
tgcaggaatt 158160 tgaatatcca gatggagtgg aagacactga atcaattgag
agattggtag aggagttctt 158220 caatagatca gaacttcagg ctggtgaatc
agtcaaattt ggtaattcta ttaatgttaa 158280 acatacatct gtttcagcta
agcaactaag aacacgtata cggcagcagc ttccttctat 158340 actctcatct
tttaccaaca caaagggtgg atatttgttc attggagttg ataataatac 158400
acacaaagta tttggattca cggtgggtta cgactacctc agactgatag agaatgatat
158460 agaaaagcat atcaaaagac tttgtgttgt gtatttctgt gagaagaaag
aggacatcaa 158520 gtacgcgtgt cgattcatca aggtatataa acctggggat
gaggctacct cgacatacgt 158580 gtgcgctatc aaagtggaaa gatgctgttg
tgctgtgttt gcagattggc cagaatcatg 158640 gtatatggat actaatggta
tcaagaagta ttctccagat gaatgggtgt cacatataaa 158700
attttaatta atgtaactat agagaacaaa taataaggtt gtaatatcat atagacaata
158760 actaacaatt aattagtaac tgttatctct tttttaatta accaactaac
tatataccta 158820 ttaatacatc gtaattatag ttcttaacat ctattaatca
ttaattcgct tctttaattt 158880 tttataaact aacattgtta attgaaaagg
gataacatgt tacagaatat aaattatata 158940 tggatttttt taaaaaggaa
atacttgact ggagtatata tttatctctt cattatatag 159000 cacgcgtgtt
ttccaatttt tccacatccc atataataca ggattataat ctcgttcgaa 159060
catacgagaa agtggataaa acaatagttg attttttatc taggttgcca aatttattcc
159120 atattttaga atatggggaa aatattctac atatttattc tatggatgat
gctaatacga 159180 atattataat tttttttcta gatagagtat taaatattaa
taagaacggg tcatttatac 159240 acaatctcgg gttatcatca tccattaata
taaaagaata tgtatatcaa ttagttaata 159300 atgatcatcc agataatagg
ataagactaa tgcttgaaaa tggacgtaga acaagacatt 159360 ttttgtccta
tatatcagat acagttaata tctatatatg tattttaata aatcatggat 159420
tttatataga tgccgaagac agttacggtt gtacattatt acatagatgt atatatcact
159480 ataagaaatc agaatcagaa tcatacaatg aattaattaa gatattgtta
aataatggat 159540 cagatgtaga taaaaaagat acgtacggaa acacaccttt
tatcctatta tgtaaacacg 159600 atatcaacaa cgtggaattg tttgagatat
gtttagagaa tgctaatata gactctgtag 159660 actttaatag atatacacct
cttcattatg tctcatgtcg taataaatat gattttgtaa 159720 agttattaat
ttctaaagga gcaaatgtta atgcgcgtaa taaattcgga actactccat 159780
tttattgtgg aattatacac ggtatctcgc ttataaaact atatttggaa tcagacacag
159840 agttagaaat agataatgaa catatagttc gtcatttaat aatttttgat
gctgttgaat 159900 ctttagatta tctattatcc agaggagtta ttgatattaa
ctatcgtact atatacaacg 159960 aaacatctat ttacgacgct gtcagttata
atgcgtataa tacgttggtc tatctattaa 160020 acaaaaatgg tgattttgag
acgattacta ctagtggatg tacatgtatt tcggaagcag 160080 tcgcaaacaa
caacaaaata ataatggaag tactattgtc taaacgacca tctttgaaaa 160140
ttatgataca gtctatgata gcaattacta aacataaaca gcataatgca gatttattga
160200 aaatgtgtat aaaatatact gcgtgtatga ccgattatga tactcttata
gatgtacagt 160260 cgctacagca atataaatgg tatattttaa gatgtttcga
tgaaatagat atcatgaaga 160320 gatgttatat aaaaaataaa actgtattcc
aattagtttt ttgtatcaaa gacattaata 160380 ctttaatgag atacggtaaa
catccttctt tcgtgaaatg cactagtctc gacgtatacg 160440 gaagtcgtgt
acgtaatatc atagcatcta ttagatatcg tcagagatta attagtctat 160500
tatccaagaa gctggatcct ggagataaat ggtcgtgttt tcctaacgaa ataaaatata
160560 aaatattgga aaactttaac gataacgaac tatccacata tctaaaaatc
ttataaacat 160620 tattaaaata taaaatctaa gtaggataaa atcacactac
atcattgttt ccttttagtg 160680 ctcgacagtg tatactattt ttaacgctca
taaataaaaa tgaaaacgat ttccgttgtt 160740 acgttgttat gcgtactacc
tgctgttgtt tattcaacat gtactgtacc cactatgaat 160800 aacgctaaat
taacgtctac cgaaacatcg tttaatgata accagaaagt tacgtttaca 160860
tgtgatcagg gatatcattc tttggatcca aatgctgtct gtgaaacaga taaatggaaa
160920 tacgaaaatc catgcaaaaa aatgtgcaca gtttctgatt atgtctctga
actatataat 160980 aaaccgctat acgaagtgaa ttccaccatg acactaagtt
gcaacggcga aacaaaatat 161040 tttcgttgcg aagaaaaaaa tggaaatact
tcttggaatg atactgttac gtgtcctaat 161100 gcggaatgtc aacctcttca
attagaacac ggatcgtgtc aaccagttaa agaaaaatac 161160 tcatttgggg
aatatatgac tatcaactgt gatgttggat atgaggttat tggtgcttcg 161220
tacataagtt gtacagctaa ttcttggaat gttattccat catgtcaaca aaaatgtgat
161280 atgccgtctc tatctaacgg attaatttcc ggatctacat tttctatcgg
tggcgttata 161340 catcttagtt gtaaaagtgg ttttacacta acggggtctc
catcatccac atgtatcgac 161400 ggtaaatgga atcccatact cccaatatgt
gtacgaacta acgaaaaatt tgatccagtg 161460 gatgatggtc ccgacgatga
gacagatttg agcaaactct cgaaagacgt tgtacaatat 161520 gaacaagaaa
tagaatcgtt agaagcaact tatcatataa tcatagtggc gttgacaatt 161580
atgggcgtca tatttttaat ctccgttata gtattagttt gttcctgtga caaaaataat
161640 gaccaatata agttccataa attgctaccg taaatataaa tccgttaaaa
taattaataa 161700 tttaataaca aacaagtatc aaaagattaa agacttatag
ctagaatcaa ttgagatgtc 161760 ttcttcagtg gatgttgata tctacgatgc
cgttagagca tttttactca ggcactatta 161820 taacaagaga tttattgtgt
atggaagaag taacgccata ttacataata tatacaggct 161880 atttacaaga
tgcgccgtta taccgttcga tgatatagta cgtactatgc caaatgaatc 161940
acgtgttaaa caatgggtga tggatacact taatggtata atgatgaatg aacgcgatgt
162000 ttctgtaagc gttggcaccg gaatactatt catggaaatg tttttcgatt
acaataaaaa 162060 tagtatcaac aatcaactaa tgtatgatat aattaatagc
gtatctataa ttctagctaa 162120 tgagagatat agaagcgctt ttaacgacga
tggtatatac atccgtagaa atatgattaa 162180 caagttgtac ggatacgcat
ctctaactac tattggcacg atcgctggag gtgtttgtta 162240 ttatctgttg
atgcatctag ttagtttgta taaataatta tttcaatata ctagttaaaa 162300
ttttaagatt ttaaatgtat aaaaaactaa taacgttttt atttgtaata ggtgcattag
162360 catcctattc gaataatgag tacactccgt ttaataaact gagtgtaaaa
ctctatatag 162420 atggagtaga taatatagaa aattcatata ctgatgataa
taatgaattg gtgttaaatt 162480 ttaaagagta cacaatttct attattacag
agtcatgcga cgtcggattt gattccatag 162540 atatagatgt tataaacgac
tataaaatta ttgatatgta taccattgac tcgtctacta 162600 ttcaacgcag
aggtcacacg tgtagaatat ctaccaaatt atcatgccat tatgataagt 162660
acccttatat tcacaaatat gatggtgatg agcgacaata ttctattact gcagagggaa
162720 aatgctataa aggaataaaa tatgaaataa gtatgatcaa cgatgatact
ctattgagaa 162780 aacatactct taaaattgga tctacttata tatttgatcg
tcatggacat agtaatacat 162840 attattcaaa atatgatttt taaaaattta
aaatatatta tcacttcagt gacagtagtc 162900 aaataacaaa caacaccatg
agatatatta taattctcgc agttttgttc attaatagta 162960 tacatgctaa
aataactagt tataagtttg aatccgtcaa ttttgattcc aaaattgaat 163020
ggactgggga tggtctatac aatatatccc ttaaaaatta tggcatcaag acgtggcaaa
163080 caatgtatac aaatgtacca gaaggaacat acgacatatc cgcatttcca
aagaatgatt 163140 tcgtatcttt ctgggttaaa tttgaacaag gcgattataa
agtggaagag tattgtacgg 163200 gactatgcgt cgaagtaaaa attggaccac
cgactgtaac attgactgaa tacgacgacc 163260 ataaacagaa aaagtgtgcg
tgacagcaca gggagccaca gaagggtttc tcgaaaaaat 163320 tactccatgg
agttcgaaag tatgtctgac acctaaaaag agtgtatata catgcgcaat 163380
tagatccaaa gaagatgttc ccaatttcaa ggacaaaatg gccagagtta tcaagagaaa
163440 atttaataca cagtctcaat cttatttaac taaatttctc ggtagcacat
caaatgatgt 163500 taccactttt cttagcatgc ttaacttgac taaatattca
taactaattt ttattaatga 163560 tacaaaaacg aaataaaact gcatattata
cactggttaa cgcccttata ggctctaacc 163620 attttcaaga tgaggtccct
gattatagtc cttctgttcc cctctatcat ctactccatg 163680 tctattagac
gatgtgagaa gactgaagag gaaacatggg gattgaaaat agggttgtgt 163740
ataattgcca aagatttcta tcccgaaaga actgattgca gtgttcatct cccaactgca
163800 agtgaaggat tgataactga aggcaatgga ttcagggata tacgaaacac
cgataaatta 163860 taaaaaaagc aatgtgtccg ctgtttccgt taataatact
attttcgtaa ctggcggatt 163920 attcataaat aactctaata gcacgatcgt
ggttaacaat atggaaaaac ttgacattta 163980 taaagacaaa caatggtcga
ttatagaaat gcctatggct agggtatatc acggcattga 164040 ctcgacattt
ggaatgttat attttgccgg aggtctatcc gttaccgaac aatatggtaa 164100
tttagagaaa aacaacgaga tatcttgtta caatcctaga acgaataagt ggtttgatat
164160 ttcatatact atttataaga tatccatatc atcattgtgt aaactaaata
acgtcttcta 164220 tgtatttagt aaggacattg gatatgtgga aaagtatgat
ggtgcatgga agttagtaca 164280 tgatcgtctc cccgctataa aggcattatc
aacttctcct tattgattga aaatataaat 164340 agtttttatg tatagcagta
ttaccctata gttttattgc ttactactaa catggataca 164400 gatgttacaa
atgtagaaga tatcataaat gaaatagata gagagaaaga agaaatacta 164460
aaaaatgtag aaattgaaaa taataaaaac attaacaaga atcatcccaa tgaatatatt
164520 agagaagcac tcgttattaa taccagtagt aatagtgatt ccattgataa
agaagttata 164580 gaatgtatca gtcacgatgt aggaatatag atcatatcta
ctaattttta taatcgatac 164640 aaaacataaa aaacaactcg ttattacata
gcaggcatgg aatccttcaa gtattgtttt 164700 gataacgatg gcaagaaatg
gattatcgga aatactttat attctggtaa ttcaatactc 164760 tataaggtca
gaaaaaattt cactagttcg ttctacaatt acgtaatgaa gatagatcac 164820
aaatcacaca agccattgtt gtctgaaata cgattctata tatctgtatt ggatcctttg
164880 actatcgaca actggacacg ggaacgtggt ataaagtatt tggctattcc
agatctgtat 164940 ggaattggag aaaccgatga ttatatgttc ttcgttataa
agaattcggg aagagtattc 165000 gccccaaagg atactgaatc agtcttcgaa
gcatgcgtca ctatgataaa cacgttagag 165060 tttatacact ctcgaggatt
tacccatgga aaaatagaac cgaggaatat actgattaga 165120 aataaacgtc
tttcactaat tgactattct agaactaaca aactatacaa gagtggaaac 165180
tcacatatag attacaacga ggacatgata acttcaggaa atatcaatta tatgtgtgta
165240 gacaatcatc ttggagcaac agtttcaaga cgaggagatt tagaaatgtt
gggatattgc 165300 atgatagaat ggttcggtgg caaacttcca tggaaaaacg
aaagtagtat aaaagtaata 165360 aaacaaaaaa aagaatataa aaaatttata
gctactttct ttgaggactg ttttcctgaa 165420 ggaaatgaac ctctggaatt
agttagatat atagaattag tatacacgtt agattattct 165480 caaactccta
attatgacag actacgtaaa ctgtttatac aagattgaaa ttatattctt 165540
ttttttatag agtgtggtag tgttacggat atctaatatt aatattagac tatctctatc
165600 gcgctacacg accaatatcg attactatgg atatcttcta tgaaaggaga
gaatgtattt 165660 atttctccag cgtcaatctc gtcagtattg acaatactgt
attatggagc taatggatcc 165720 actgctgaac agctatcaaa atatgtagaa
acggaggaga acacggataa ggttagcgct 165780 cagaatatct cattcaaatc
catgaataaa gtatatgggc gatattctgc cgtgtttaaa 165840 gattcctttt
tgagaaaaat tggcgataag tttcaaactg ttgacttcac tgattgtcgc 165900
actatagatg caatcaacaa gtgtgtagat atctttactg aggggaaaat caatccacta
165960 ttggatgaac cattgtctcc tagcaattag tgccgtatac tttaaagcaa
aatggttgac 166020 gccattcgaa aaggaattta ccagtgatta tcccttttac
gtatctccga cggaaatggt 166080 agacgtaagt atgatgtcta tgtacggcaa
ggcatttaat cacgcatctg taaaagaatc 166140 attcggcaac ttttcaatca
tagaactgcc atatgttgga gatactagta tgatggtcat 166200 tcttccagac
aagattgatg gattagaatc catagaacaa aatctaacag atacaaattt 166260
taagaaatgg tgtgacttta tggatgctat gtttatagat gttcacattc ccaagtttaa
166320 ggtaacaggc tcgtataatc tggtggatac tctagtaaag tcaggactga
cagaggtgtt 166380 cggttcaact ggagattata gcaatatgtg taatttagat
gtgagtgtcg acgctatgat 166440 ccacaaaacg tatatagatg tcaatgaaga
gtatacagaa gcagctgcag caacttctgt 166500 actagtggca gactgtgcat
caacaattac aaatgagttc tgtgcagatc atccgttcat 166560 ctatgtgatt
aggcatgttg atggaaaaat tcttttcgtt ggtagatatt gctctccgac 166620
aactaattgt taaccatttt ttttaaaaaa aatagaaaaa acatgtggta ttagtgcagg
166680 tcgttgttct tccaattgca attggtaaga tgacggccaa ctttagtacc
cacgtctttt 166740 caccacagca ctgtggatgt gacagactga ccagtattga
tgacgtcaaa caatgtttga 166800 ctgaatatat ttattggtcg tcctatgcat
accgcaacag gcaatgcgct ggacaattgt 166860 attccacact cctctctttt
agagatgatg cggaattagt gttcatcgac attcgcgagc 166920 tggtaaaaaa
tatgccgtgg gatgatgtca aagattgtac agaaatcatc cgttgttata 166980
taccggatga gcaaaaaacc atcagagaga tttcggccat catcggactt tgtgcatatg
167040 ctgctactta ctggggaggt gaagaccatc ccactagtaa cagtctgaac
gcattgtttg 167100 tgatgcttga gatgctaaat tacgtggatt ataacatcat
attccggcgt atgaattgat 167160 gagttgtaca tcttgacatt ttctttcttc
tcttctccct ttcttctctt ctcccttcct 167220 ccctcttctc cctttcccag
aaacaaactt ttttacccac tataaaataa aatgagtata 167280 ctacctgtta
tatttctttc tatatttttt tattcttcat tcgttcagac ttttaacgcg 167340
tctgaatgta tcgacaaagg gcaatatttt gcatcattca tggagttaga aaacgagcca
167400 gtaatcttac catgtcctca aataaatacg ctatcatccg gatataatat
attagatatt 167460 ttatgggaaa aacgaggagc ggataatgat agaattatac
cgatagataa tggtagcaat 167520 atgctaattc tgaacccgac acaatcagac
tctggtattt atatatgcat taccacgaac 167580 gaaacctact gtgacatgat
gtcgttaaat ttgacaatcg tgtctgtctc agaatcaaat 167640 atagatttta
tctcgtatcc acaaatagta aatgagagat ctactggcga aatggtatgt 167700
cccaatatta atgcatttat tgctagtaac gtaaacgcag atattatatg gagcggacat
167760 cgacgcctta gaaataagag acttaaacaa cggacacctg gaattattac
catagaagat 167820 gttagaaaaa atgatgctgg ttattataca tgtgttttag
aatatatata cggtggcaaa 167880 acatataacg taaccagaat tgtaaaatta
gaggtacggg ataaaataat accttctact 167940 atgcaattac cagatggcat
tgtaacttca ataggtagta atttgactat tgcatcgttg 168000 agacctccca
caacggatgc agacgtcttt tggataagta atggtatgta ttacgaagaa 168060
gatgatgggg acggaaacgg tagaataagt gtagcaaata aaatctatat gaccgataag
168120 agacgtgtta ttacatcccg gttaaacatt aatcctgtca aggaagaaga
tgctacaacg 168180 tttacgtgta tggcgtttac tattcctagc atcagcaaaa
cagttactgt tagtataacg 168240 tgaatgtatg ttgttacatt tccatgtcaa
ttgagtttat aagaattttt atacattatc 168300 ttccaacaaa caattgacga
acgtattgct atgattaact cccacgatac tatgcatatt 168360 attaatcatt
aacttgcaga ctatacctag tgctattttg acatactcat gttcttgtgt 168420
aattgcggta tctatattat taaagtacgt aaatctagct atagttttat tatttaattt
168480 tagataatat accgtctcct tatttttaaa aattgccaca tcctttatta
aatcatgaat 168540 gggaatttct atgtcatcgt tagtatattg tgaacaacaa
gagcagatat ctataggaaa 168600 gggtggaatg cgatacattg atctatgtag
ttttaaaaca cacgcgaact ttgaagaatt 168660 tatataaatc attccatcga
tacatccttc tatgttgaga tgtatatatc caggaattcg 168720 tttattaata
tcgggaaatg tataaactaa aacattgccc gaaagcggtg cctctatctg 168780
cgttatatcc gttcttaact tacaaaatgt aaccaatacc tttgcatgac ttgttttgtt
168840 cggcaacgtt agtttaaact tgacgaatgg attaattaca atagcatgat
ccgcgcatct 168900 attaagtttt tttactttaa cgcccttgta tgtttttaca
gagactttat ctaaatttct 168960 agtgcttgta tgtgttataa atataacggg
atatagaacc gaatcaccta ccttagatac 169020 ccaattacat tttatcagat
ccagataata aacaaatttt gtcgccctaa ctaattctat 169080 attgttatat
attttacaat tggttatgat atcatgtaat aacttggagt ctaacgcgca 169140
tcgtcgtacg tttatacaat tgtgatttag tgtagtatat ctacacatgt atttttccgc
169200 actatagtat tctggactag tgataaaact atcgttatat ctatcttcaa
tgaactcatc 169260 gagatattgc tctctgtcat attcatacac ctgcataaac
tttctagaca tcttacaatc 169320 cgtgttattt taggatcata tttacatatt
tacgggtata tcaaagatgt tagattagtt 169380 aatgggaatc gtctataata
atgaatatta aacaattata tgaggacttt taccacaaag 169440 catcataaaa
atgagtcgtc gtctgattta tgttttaaat atcaaccgca aatcaactca 169500
taaaatacaa gagaatgaaa tatatacata ttttagtcat tgcaatatag accatacttc
169560 tacagaactt gattttgtag ttaaaaacta tgatctaaac agacgacaac
ctgtaactgg 169620 gtatactgca ctacactgct atttgtataa taattacttt
acaaacgatg tactgaagat 169680 attattaaat catggagtgg atgtaacgat
gaaaaccagt agcggacgta tgcctgttta 169740 tatattgctt actagatgtt
gtaatatttc acatgatgta gtgatagata tgatagacaa 169800 agataaaaac
cacttattac atagagacta ttccaaccta ttactagagt atataaaatc 169860
tcgttacatg ttattaaagg aagaggatat cgatgagaac atagtatcca ctttattaga
169920 taagggaatc gatcctaact ttaaacaaga cggatataca gcgttacatt
attattattt 169980 gtgtctcgca cacgtttata aaccaggtga gtgtagaaaa
ccgataacga taaaaaaggc 170040 caagcgaatt atttctttgt ttatacaaca
tggagctaat ctaaacgcgt tagataattg 170100 tggtaataca ccattccatt
tgtatcttag tattgaaatg tgtaataata ttcatatgac 170160 taaaatgctg
ttgactttta atccgaattt cgaaatatgt aataatcatg gattaacgcc 170220
tatactatgt tatataactt ccgactacat acaacacgat attcttgtta tgttaataca
170280 tcactatgaa acaaatgttg gagaaatgcc gatagatgag cgtcgtatga
tcgtattcga 170340 gtttatcaaa acatattcta cacgtccggc agattcgata
acttatttga tgaataggtt 170400 taaaaatata aatatttata cccgctatga
aggaaagaca ttattacacg tagcatgtga 170460 atataataat acacacgtaa
tagattatct tatacgtatc aacggagata taaatgcgtt 170520 aaccgacaat
aacaaacacg ctacacaact cattatagat aacaaagaaa attccccata 170580
taccattaat tgtttactgt atatacttag atatattgta gataagaatg tgataagatc
170640 gttggtggat caacttccat ctctacctat cttcgatata aaatcatttg
agaaattcat 170700 atcctactgt atacttttag atgacacatt ttacgatagg
cacgttaaga atcgcgattc 170760 taaaacgtat cgatacgcat tttcaaaata
catgtcgttt gataaatacg atggtataat 170820 aactaaatgt cacgacgaaa
caatgttact caaactgtcc actgttctag acactacact 170880 atatgcagtt
ttaagatgtc ataattcgag aaagttaaga agatacctca acgagttaaa 170940
aaaatataat aacgataagt cctttaaaat atattctaat attatgaatg agagatacct
171000 taatgtatat tataaagata tgtacgtgtc aaaggtatat gataaactat
ttcctgtttt 171060 cacagataaa aattgtctac taacattact accttcagaa
attatatacg aaatattata 171120 catgctgaca attaacgatc tttataatat
atcgtatcca cctaccaaag tatagttgta 171180 tttttctcat gcgatgtgtg
taaaaaaact gatattatat aaatatttta gtgccgtata 171240 ataaagatga
cgatgaaaat gatggtacat atatatttcg tatcattatt gttattgcta 171300
ttccacagtt acgccataga catcgaaaat gaaatcacag aattcttcaa taaaatgaga
171360 gatactctac cagctaaaga ctctaaatgg ttgaatccag catgtatgtt
cggaggcaca 171420 atgaatgata tagccgctct aggagagcca ttcagcgcaa
agtgtcctcc tattgaagac 171480 agtcttttat cgcacagata taaagactat
gtggttaaat gggagaggct agaaaagaat 171540 agacggcgac aggtttctaa
taaacgtgtt aaacatggtg atttatggat agccaactat 171600 acatctaaat
tcagtaaccg taggtatttg tgcaccgtaa ctacaaagaa tggtgactgt 171660
gttcagggta tagttagatc tcatattaaa aaacctcctt catgcattcc aaaaacatat
171720 gaactaggta ctcatgataa gtatggcata gacttatact gtggaattct
ttacgcaaaa 171780 cattataata atataacttg gtataaagat aataaggaaa
ttaatatcga cgacattaag 171840 tattcacaaa cgggaaagga attaattatt
cataatccag agttagaaga tagcggaaga 171900 tacgactgtt acgttcatta
cgacgacgtt agaatcaaga atgatatcgt agtatcaaga 171960 tgtaaaatac
ttacggttat accgtcacaa gaccacaggt ttaaactaat actagatccg 172020
aaaatcaacg taacgatagg agaacctgcc aatataacat gcactgctgt gtcaacgtca
172080 ttattgatcg acgatgtact gattgaatgg gaaaatccat ccggatggct
tataggattc 172140 gattttgatg tatactctgt tttaactagt agaggcggta
tcaccgaggc gaccttgtac 172200 tttgaaaatg ttactgaaga atatataggt
aatacatata aatgtcgtgg acacaactat 172260 tattttgaaa aaacccttac
aactacagta gtattggagt aaatatacaa tgcattttta 172320 tatacattac
tgaattatta ttactgaatt attattactg aattattatt aattatatcg 172380
tatttgtgct atagaatgga tgaagatacg cgactatcta ggtatttgta tctcaccgat
172440 agagaacata taaatgtaga ctctattaaa cagttgtgta aaatatcaga
tcctaatgca 172500 tgttatagat gtggatgtac ggctttacat gagtactttt
ataattatag atcagtcaac 172560 ggaaaataca agtatagata caacggttac
tatcaatatt attcatctag cgattatgaa 172620 aattataatg aatattatta
tgatagaact ggtatgaaca gtgagagtga taatatatca 172680 atcaaaacag
aatatgaatt ctatgatgaa acacaagatc aaagtacaca actagtaggt 172740
tacgacatta aactcaaaac caatgaggat gattttatgg ctatgataga tcagtgggtg
172800 tccatgatta tatagatgaa tcaattaata aagtagtata tggaagagag
tctcacgtaa 172860 gatggcggga tatatggcaa gaacataatg atggcgtata
cagtatagga aaggagtgca 172920 tagataatat atacgaagac aaccataccg
tagacgaatt ctacaagata gacagcgtat 172980 cagatgtaga tgacgcggaa
cacatatctc cgataactaa aaaaccatag aatcagttga 173040 tgataatacc
tacatttcta atcttccgta taccatcaaa tacaaaatat tcgagcaaca 173100
ataagtattt tttatacctt taaaactgat aaataaattt tttctagtga tattttggca
173160 agatgagaat cctatttctc atcgctttca tgtatgggtg tgttcactca
tatgttaacg 173220 cggttgaaac caaatgtcca aatctagaca ttgtaacatc
ttctggagaa tttcattgtt 173280 caggatgtgt ggaacatatg cctgagttta
gctatatgta ttggttggca aaggatatga 173340 aatcggacga ggataccaag
tttatagaac atctgggtga tggcatcaaa gaagatgaaa 173400 ccgttcgtac
cacagatagt ggaatcgtca ctctacgtaa agtccttcat gtaaccgata 173460
ctaataaatt tgataattat aggttcactt gtgtcctcac tacgatagat ggcgtttcaa
173520 aaaagaatat ttggctgaag tagtgcgtgc tactattttt atttatgata
taatctaatg 173580 gaattaattt gaattgatat ttatccaata ctaaagatta
tattagaatc aaattaatct 173640 tttatacgag aaaaaataac gacatacgtc
gtcaacaaat taaacttttt atttattagt 173700 taactagctt atagaacttg
ctcattgtta tgtttctaaa acgggtacgg catataggac 173760
aattatccga cgcaccggtt tctcttcgtg ttctatgcca tatattgatg catgttatgc
173820 aaaatatatg agtacacgaa tccaataaac caaagtatct atcgttttga
gtaaacaact 173880 tcatagcaaa ttccacattc tttttcttta cttactctat
acacgtcctc gtatttattt 173940 agtattttga tgatatccaa ctcagaaatg
gttgttgtat tattgggtgt ataggtatta 174000 ttagctatgt accaatttac
caaccctctt aatattgatt gataatcaca tcggttatcc 174060 aatcaataac
cacattaata actaaattgt agtgtatata tagaccatat atgtttctat 174120
ttttttgaca gttacgtata gtttcagtaa gttttgattg ttgtattcct gtatctctag
174180 ataagttagt catatagtcc cttccggcga tacgtttttt ccaagcccga
aattgattag 174240 ccaaatgtgt atttattttt gtgatattga tataatattt
cggataatgc atactgttag 174300 tcttatatca tttggttcat ctatgtattg
taatattgtt acatgatcta tagatgatgt 174360 attgattttg gcaggatcga
attccatatc cgcgactaaa cagtgaaaaa aatgtaaata 174420 ctttttaaat
tttaaattag taaaactttt ttttattttt tatgattcca aaaatactga 174480
atacaaagtc ctaaattata aatatggaga tcatactacc acaacttatt attatgtata
174540 caaggccggt gtaatagata gatatatata attctattac accggcagac
aattaccgac 174600 cggtatttgt cgttaccaac ataccgtata atatgtaata
tacaattcca taacccattg 174660 acagttgtta tacatcaaaa ttgcaattct
tttgattacg atgttataag aatgtagtta 174720 attgatgtat gatgttaatg
tgtcctcttt cctcttataa catcgtaatc aaaaactttt 174780 ttataatata
tacctaataa tgtgtcttaa tagttctcgt gattcgtcaa acaatcattc 174840
ttataaaata taataaagca acgtaaaaac acataaaaat aagcgtaact aataagacaa
174900 tggatattta cgacgataaa ggtctacaga ctattaaact gtttaataat
gaatttgatt 174960 gtataaggaa tgacatcaga gaattattta aacatgtaac
tgattccgat agtatacaac 175020 ttccgatgga agacaattct gatattatag
aaaatatcag aaaaatacta tatagacgat 175080 taaaaaatgt agaatgtgtt
gacatcgata acacaataac ttttatgaaa tacgatccaa 175140 atgatgataa
taagcgtacg tgttctaatt gggtaccctt aactaataac tatatggaat 175200
attgtctagt aatatatttg gaaacaccga tatgtggagg caaaataaaa ttataccacc
175260 ctacaggaaa tataaagtcg gataaggata ttatgtttgc aaagactcta
gactaagata 175320 gacagcgtat cagatgtaga tgacgcggaa cacatatctc
ctataactaa tgatgtatct 175380 acacaaacat gggaaaagaa atcagagtta
gatagataca tggaatcgta tcctcgtcat 175440 agatatagta aacattctgt
atttaaggga ttttctgata aagttagaaa aaatgattta 175500 gacatgaatg
tggtaaaaga attactttct aacggtgcat ctctaacaat caaggatagc 175560
agtaataagg atccaattgc tgtttatttt agaagaacga taatgaattt agaaatgatt
175620 gatattatta acaaacatac aactattgat gaacgaaagt atatagtaca
ctcctatcta 175680 aaaaattata gaaatttcga ttatccattt ttcaggaagt
tagttttgac taataaacat 175740 tgtctcaaca attattataa tataagcgac
agcaaatatg gaacaccgct acatatattg 175800 gcgtctaata aaaaattaat
aactcctaat tacatgaagt tattagtgta taacggaaat 175860 gatataaacg
cacgaggtga agatacacaa atgcgaacca actcagaaat ggttgttgta 175920
ttattgggtg tataggtatt attagctatg taccaattta ccaaccctct taatattgat
175980 tgataatcac atcggttatc caattaataa ctaaattgta gtgtatatat
agaccatata 176040 tgtttctatt tttttgacag ttacgtatag tttcagtaag
ttttgattgt tgtattcctg 176100 tatctctaga taagttagtc atatagtccc
ttccggcgat acgttttttc caagcccgaa 176160 attgattagc caaatgtgta
tttatttttg tgatattgat ataatatttc ggataatgca 176220 tactgttagt
cttatatcat ttggttcatc tatgtattgt aatattgtta catgatctat 176280
agatgatgta ttgattttgg caggatcgaa ttccatatcc gcgactaaac agtgaaaaaa
176340 atgtaaatac tttttaaatt ttaaattagt aaaacttttt tttatttttt
atgattccaa 176400 aaatactgaa tacaaagtcc taaattataa atatggagat
catactacca caacttatta 176460 ttatgtatac aaggccggtg taatagatag
atatatataa ttctattaca ccggcagaca 176520 attaccgacc ggtatttgtc
gttaccaaca taccgtataa tatgtaatat acaattccat 176580 aacccattga
cagttgttat acatcaaaat tgcaattctt ttgattacga tgttataaga 176640
atgtagttaa ttgatgtatg atgttaatgt gtcctctttc ctcttataac atcgtaatca
176700 aaaacttttt tataatatat acctaataat gtgtcttaat agttctcgtg
attcgtcaaa 176760 caatcattct tataaaatat aataaagcaa cgtaaaaaca
cataaaaata agcgtaacta 176820 ataagacaat ggatatttac gacgataaag
gtctacagac tattaaactg tttaataatg 176880 aatttgattg tataaggaat
gacatcagag aattatttaa acatgtaact gattccgata 176940 gtatacaact
tccgatggaa gacaattctg atattataga aaatatcaga aaaatactat 177000
atagacgatt aaaaaatgta gaatgtgttg acatcgataa cacaataact tttatgaaat
177060 acgatccaaa tgatgataat aagcgtacgt gttctaattg ggtaccctta
actaataact 177120 atatggaata ttgtctagta atatatttgg aaacaccgat
atgtggaggc aaaataaaat 177180 tataccaccc tacaggaaat ataaagtcgg
ataaggatat tatgtttgca aagactctag 177240 actttaaatc aacgaaagtg
ttaactggac gtaaaacaat tgccgttcta gacatatccg 177300 tttcatataa
tagatcaatg actactattc actacaacga cgacgttgat atagatatac 177360
atactgataa aaatggaaaa gagttatgtt attgttatat aacaatagat gatcattact
177420 tggttgatgt ggaaactata ggagttatag tcaatagatc tggaaaatgt
ctgttagtaa 177480 ataaccatct aggtataggt atcgttaaag ataaacgtat
aagcgatagt tttggagatg 177540 tatgtatgga tacaatattt gacttttctg
aagcacgaga gttattttca ttaactaatg 177600 atgataacag gaatatagca
tgggacactg ataaactaga cgatgataca gatatatgga 177660 ctcccgtcac
agaagatgat tacaaatttc tttctagact agtattgtat gcaaaatctc 177720
aatcggatac tgtatttgac tattatgttc ttactggtga tacggaacca cccactgtat
177780 tcattttcaa ggtaactaga ttttacttta atatgccgaa ataaaaaatt
tttgtataat 177840 atctagaggt agaggtattg tttagataaa tacaaataac
atagatacat cgcatactta 177900 gcatttttat aaatatacat aagacataca
ctttatacat ttttgtaaaa atactcataa 177960 aaaaatttat aaaaattatg
gcacaaccat atcttgtata ggtagtttag ttcgtcgagt 178020 gaacctataa
acagataata gacaacacat aataatgcct actaatacaa gcataatacc 178080
gggagatggg atatatgacg ttgtagtgtt tgggttttct gaacgttgat agtctactaa
178140 tactacatgc tgacatctaa tgcctgtata accatgagag catctacaat
acataccgtc 178200 aatatctcta gcgtggatac agtcaccgtg taaacaatat
ccatctccct ctggaccgca 178260 taatctgata gctggaatat ctgttgtagc
gtttgtaatt tctggcaatg tcgtttcgat 178320 agcgttacca ctatcggcga
atgatctgat tatcatagca gcgaacaaca acatcagata 178380 atttatcaac
atttttgatg gattctgtgt ttatgctgtt tctcagtgtg tgtttatgac 178440
aagattggga attttatatt attaattcag taatataaac taataatata ttgttaattg
178500 tgtaaataat ataaaaataa caatacaata ttgaatgtgt tgctgttaaa
aatgtatgtg 178560 ttaatataat agaataaaat aaatgagtat gatcatttta
gataacgatt gattttatca 178620 ttaccgcttc attcttatat tctttgctta
cggaacctat atttagaaac atctactaac 178680 aattttttat gcttgcatta
ttaatggtat gtaatatgat tgattgtgta cgcaatacca 178740 atttgttaag
tatgaatacg gggtacaaac ataaattgaa atttaacatt atttatttat 178800
gatatatatc gttatcgtta ggtctatacc atggatatct ttaaagaact aatcttaaaa
178860 caccctgatg aaaatgtttt gatttctcca gtttccattt tatctacttt
atctattcta 178920 aatcatggag cagctggttc tacagctgaa caactatcaa
aatatataga gaatatgaat 178980 gagaatacac ccgatgacaa taatgatgac
atggaggtag atattccgta ttgtgcgaca 179040 ctagctaccg caaataaaat
atacggtagc gatagtatcg agttccacgc ctccttccta 179100 caaaaaataa
aagacgattt tcaaactgta aactttaata atgctaacca aacaaaggaa 179160
ctaatcaacg aatgggttaa gacaatgaca aatggtaaaa ttaattcctt attgactagt
179220 ccgctatcca ttaatactcg tatgacagtt gttagcgccg tccattttaa
agcaatgtgg 179280 aaatatccat tttctaaaca tcttacatat acagacaagt
tttatatttc taagaatata 179340 gttaccagcg ttgatatgat ggtgggtacc
gagaataact tgcaatatgt acatattaat 179400 gaattattcg gaggattctc
tattatcgat attccatacg agggaaactc tagtatggta 179460 attatactac
cggacgacat agaaggtata tataacatag aaaaaaatat aacagatgaa 179520
aaatttaaaa aatggtgtgg tatgttatct actaaaagta tagacttgta tatgccaaag
179580 tttaaagtgg aaatgacaga accgtataat ctggtaccga ttttagaaaa
tttaggactt 179640 actaatatat tcggatatta tgcagatttt agcaagatgt
gtaatgaaac tatcactgta 179700 gaaaaatttc tacatacgac gtttatagat
gttaatgagg agtatacaga agcatcggcc 179760 gttacaggag tatttacgat
taacttttcg atggtatatc gtacgaaggt ctacataaac 179820 catccattca
tgtacatgat taaagacacc acaggacgta tactttttat agggaaatac 179880
tgctatccgc aataaatata aacaaataga cttttataaa gagtcttcaa cgataagtat
179940 atcgacatac tacttatgct gcgaaagatt ctgaacgaga acgactatct
caccctcttg 180000 gatcatatcc gcactgctaa atactaaatc tccactacac
tttttatcat cttatgagga 180060 atgattgcct tcgtgaaata ggaataatta
gcaccagaat agctatggat tattgtggta 180120 gagagtgcac tattctatgt
cgtctactgg atgaagatgt gacgtacaaa aaaataaaac 180180 tagaaattga
aacgtgtcac aacttatcaa aacatataga tagacgagga aacaatgcgc 180240
tacattgtta cgtctccaat aaatgcgata cagacattaa gattgttctc tcgcggagtc
180300 gagagacttt gtagaaacaa cgaaggatta actccgctag gagtatacag
taagcataga 180360 tacgtaaaat ctcagattgt gcatctactg atatccagct
attcaaattc ctctaacgaa 180420 ctcaagtcga atataaatga tttcgatctg
tattcggata atatcgactt acgtctgcta 180480 aaatacctaa ttgtggataa
acggatacgt ccgtccaaga atacgaatta tgcaatcaat 180540 ggtctcggat
tggtggatat atacgtaacg acgcctaatc cgagaccaga agtattgcta 180600
tggcttctta aatcagaatg ttacagcacc ggttacgtat ttcgtacctg tatgtacgac
180660 agtgatatgt gtaagaactc tcttcattac tatatatcgt ctcatagaga
atctcaatct 180720 ctatccaagg atgtaattaa atgtttgatc gataacaatg
tttccatcca tggcagagac 180780 gaaggaggat ctttacccat ccaatactac
tggtctttct caaccataga tatagagatt 180840 gttaaattat tattaataaa
ggatgtggac acgtgtagag tatacgacgt cagccctata 180900 ttagaggcgt
attatctaaa caagcgattt agagtaaccc catataatgt agacatggaa 180960
atcgttaatc ttcttattga gagacgtcat actcttgtcg acgtaatgcg tagtattact
181020 tcgtacgatt ccagagaata taaccactac atcatcgata acattctaaa
gagatttaga 181080 caacaggatg tacaagccat gttgataaac tacttacatt
acggcgatat ggtcgttcga 181140 tgcatgttag ataacggaca acaactatcc
tctgcacgac tactttgtta ataataatct 181200 cgtcgatgta aacgtcgtaa
ggtttatcgt ggaaaatatg gacacgcggc tgtaaatcac 181260 gtatcgaaca
atggccgtct atgtatgtac ggtctgatat tatcgagatt taataattgc 181320
gggtatcact gttatgaaac catactgata gatgtatttg atatactaag caagtacatg
181380 gatgatatag atatgatcga taactctact atattacgcg gtcgatgtca
ataatataca 181440 atttgcaaag cggttattgg aatatggagc gagtgtcacg
ctcgataatc aatacggcca 181500 tccagaaaag cagttaccaa agagaaaaca
aaacgaagct agttgattta ttactgagtt 181560 accatcccac tctagagact
atgattgacg catttaatag agatatacgc tatctatatc 181620 ctgaaccatt
attcgcctgt atcagatacg ccttaatcct agatgatgat tttccttcta 181680
aagtaaagta tgatatcgcc ggtcgtcata aggaactaaa gcgctataga gtagacatta
181740 atagaatgaa gaatgtctac atatcaggcg tctccatgtt tgatatatta
tttaaacgaa 181800 gcaaacgcca caaattgaga tacgcaaaga atccgacatc
aaatggtaca aaaaagaact 181860 aacgtccatc attacagaaa ctgtaaagaa
caatgagagg atcgactcca tagtggacaa 181920 cattaataca gacgataact
tgatttcgaa attacccatg gagatacttt attactccat 181980 taaataattt
atcatggagc gataatgtcc tgtttcattt gtttccatga catattacaa 182040
aatcgattcc gtccaagatg ataaaaacat ttaccggcat cataaacacg gagtttattt
182100 tatatgtctc gcataaacat tactaaaaaa atatattgtc gataacttga
tttcgaaatt 182160 acccatggag atactttatt actccattaa ataatttatc
atggagcgat aatgtcctgt 182220 ttcatttgtt tccatgacat attacaaaat
cgattccgtc caagatgata aaaacattta 182280 ccggcatcat aaacacggag
tttattttat atgtctcgca taaacattac taaaaaaata 182340 tattgttctg
tttttctttc acatctttaa ttatgaaaaa gtaaatcatt atgagatgga 182400
cgagattgta cgcatcgttc gcgacagtat gtggtacata cctaacgtat ttatggacga
182460 cggtaagaat gaaggtcacg tttctgtcaa caatgtctgt catatgtatt
ttacgttctt 182520 tgatgtggat acatcgtctc atctgtttaa gctagttatt
aaacactgcg atctgaataa 182580 acgaggtaac tctccattac attgctatac
gatgaataca cgatttaatc catctgtatt 182640 aaagatattg ttacaccacg
gcatgcgtaa ctttgatagc aaggatgacc actatcaatc 182700 gataacaaga
tctttgatat actaacggac accattgatg actttagtaa atcatccgat 182760
ctattgctgt gttatcttag atataaattc aatgggagct taaactatta cgttctgtac
182820 aaaggatccg accctaattg cgccgacgag gatgaactca cttctcttca
ttactactgt 182880 aaacacatat ccacgttcta cgaaagcaat tattacaagt
taagtcacac taagatgcga 182940 gccgagaagc gattcatcta cgcgataata
gattatggag caaacattaa cgcggttaca 183000 cacttacctt caacagtata
ccaaacatag tcctcgtgtg gtgtatgctc ttttatctcg 183060 aggagccgat
acgaggatac gtaataatct tgattgtaca cccatcatgg aacgattgtg 183120
caacaggtca tattctcata atgttactca attggcacga acaaaaggaa gaaggacaac
183180 atctacttta tctattcata aaacataatc aaggatacac tctcaatata
ctacggtatc 183240 tattagatag gttcgacatt cagaaagacg aatactataa
taccgccttt caaaattgta 183300 acaacaatgt tgcctcatac atcggatacg
acatcaacct tccgactaaa gacggtattc 183360 gacttggtgt ttgaaaacag
aaacatcata tacaaggcgg atgttgtgaa tgacatcatc 183420 caccacagac
tgaaagtatc tctacctatg attaaatcgt tgttctacaa gatgtctctc 183480
cctacgacga ttactacgta aaaaagatac tagcctactg cctattaagg gacgagtcat
183540 tcgcggaact acatagtaaa ttctgtttaa acgaggacta taaaagtgta
tttatgaaaa 183600 atatatcatt cgataagata gattccatca tcgtgacata
agtcgcctca aagagattcg 183660 aatctccgac accgacctgt atacggtatc
acagctatct taaagccata cattcagaca 183720 gtcacatttc atttcccatg
tacgacgatc tcatagaaca gtgccatcta tcgatggagc 183780 gtaaaagtaa
actcgtcgac aaagcactca ataaattaga gtctaccatc ggtcaatcta 183840
gactatcgta tttgcctccg gaaattatgc gcaatatcat ctaaacagta tgttgtacgg
183900 aaagaaccat tacaaatatt atccatgata gaaagaaaat atctatatga
ttggagaagt 183960 aggaaacagg aacaagacaa cgattactac attattaaat
catgaagtcc gtattatact 184020 cgtatatatt gtttctctca tgtataataa
taaacggaag agatatagca ccgcatgcac 184080 catccgatgg aaagtgtaaa
gacaacgaat acaaacgcca taatttgtgt ccgggaacat 184140 acgcttccag
attatgcgat agcaagacta acacacgatg tacgccgtgt ggttcgggta 184200
ccttcacatc tcgcaataat catttacccg cttgtctaag ttgtaacgga agacgcgatc
184260 gtgtaacacg actcacaata gaatctgtga atgctctccc ggatattatt
gtcttctcaa 184320 aggatcatcc ggatgcaagg catgtgtttc ccaaacaaaa
tgtggaatag gatacggagt 184380 atccggagac gtcatctgtt ctccgtgtgg
tctcggaaca tattctcaca ccgtctcttc 184440 cgcagataaa tgcgaacccg
tacccagaaa tacgtttaac tatatcgatg tggaaattaa 184500 cctgtatcca
gttaacgaca cgtcgtgtac tcggacgacc actaccggtc tcagcgaatc 184560
catctcaacg tcggaactaa ctattactat gaatcataaa gactgtaatc ccgtatttcg
184620 tgatggatac ttctccgttc ttaataaggt agcgacttca ggtttcttta
caggagaaag 184680 gtgtgcactc tgaatttcga gattaaatgc aataacaaag
attcttcctc caaacagtta 184740 acgaaagcaa agaatgatac tatcatgccg
cattcggaga cagtaactct agtgggcgac 184800 atctatatac tatatagtaa
taccaatact caagactacg aaactgatac aatctcttat 184860 catgtgggta
atgttctcga tgtcgatagc catatgcccg gtagttgcga tatacataaa 184920
ctgatcacta attccaaacc cacccacttt ttatagtaag tttttcaccc ataaataata
184980 aatacaataa ttaatttctc gtaaaagtag aaaatatatt ctaatttatt
gcacggtaag 185040 gaagtagaat cataaagaac agtactcaat caatagcaat
tatgaaacaa tatatcgtcc 185100 tggcatgcat gtgcctggcg gcagctgcta
tgcctgccag tcttcagcaa tcatcctcat 185160 cctcctcctc gtgtacggaa
gaagaaaaca aacatcatat gggaatcgat gttattatca 185220 aagtcacaaa
gcaagaccaa acaccgacca atgataagat ttgccaatcc gtaacggaaa 185280
ttacagagtc cgagtcagat ccagatcccg aggtggaatc agaagatgat tccacatcag
185340 tcgaggatgt agatcctcct accacttatt actccatcat cggtggaggt
ctgagaatga 185400 actttggatt caccaaatgt cctcagatta aatccatctc
agaatccgct gatggaaaca 185460 cagtgaatgc tagattgtcc agcgtgtccc
caggacaagg taaggactct cccgcgatca 185520 ctcatgaaga agctcttgct
atgatcaaag actgtgaagt gtctatcgac atcagatgta 185580 gcgaagaaga
gaaagacagc gacatcaaga cccatccagt actcgggtct aacatctctc 185640
ataagaaagt gagttacgaa gatatcatcg gttcaacgat cgtcgataca aaatgcgtca
185700 agaatctaga gtttagcgtt cgtatcggag acatgtgcaa ggaatcatct
gaacttgagg 185760 tcaaggatgg attcaagtat gtcgacggat cggcatctga
aggtgcaacc gatgatactt 185820 cactcatcga ttcaacaaaa ctcaaagcgt
gtgtctgaat cgataactct attcatctga 185880 aattggatga gtagggttaa
tcgaacgatt caggcacacc acgaattaaa aaagtgtacc 185940 ggacactata
ttccggtttg caaaacaaaa atgttcttaa ctacattcac aaaaagttac 186000
ctctcgcgac ttcttctttt tctgtctcaa tagtgtgata cgattatgac actattccta
186060 ttcctattcc tatttccttt cagagtatca caaaaatatt aaacctcttt
ctgatggtct 186120 cataaaaaaa gttttacaaa aatattttta ttctctttct
ctctttgatg gtctcataaa 186180 aaaagtttta caaaaatatt tttattctct
ttctctcttt gatggtctca taaaaaaagt 186240 tttacaaaaa tatttttatt
ctctttctct ctttgatggt ctcataaaaa aagttttaca 186300 aaaatatttt
tattctcttt ctctctttga tggtctcata aaaaaagttt tacaaaaata 186360
tttttattct ctttctctct ttgatggtct cataaaaaaa gttttacaaa aatattttta
186420 ttctctttct ctctttgatg gtctcataaa aaaagtttta caaaaatatt
tttattctct 186480 ttctctcttt gatggtctca taaaaaaagt tttacaaaaa
tatttttatt ctctttctct 186540 ctttgatggt ctcataaaaa aagttttaca
aaaatatttt tattctcttt ctctctttga 186600 tggtctcata aaaaaagttt
tacaaaaata tttttattct ctttctctct ttgatggtct 186660 cataaaaaaa
gttttacaaa aatattttta ttctctttct ctctttgatg gtctcataaa 186720
aaaagtttta caaaaatatt tttattctct ttctctcttt gatggtctca taaaaaaagt
186780 tttacaaaaa tatttttatt ctctttctct ctttgatggt ctcataaaaa
aagttttaca 186840 aaaatatttt tatt 186854 <210> SEQ ID NO 35
<211> LENGTH: 1131 <212> TYPE: DNA <213>
ORGANISM: Human Herpesvirus-1 <300> PUBLICATION INFORMATION:
<308> DATABASE ACCESSION NUMBER: GenBank No. NC_00180
<309> DATABASE ENTRY DATE: 2004-01-13 <400> SEQUENCE:
35 atggcttcgt acccctgcca tcaacacgcg tctgcgttcg accaggctgc
gcgttctcgc 60 ggccataaca accgacgtac ggcgttgcgc cctcgccggc
aacaaaaagc cacggaagtc 120 cgcctggagc agaaaatgcc cacgctactg
cgggtttata tagacggtcc ccacgggatg 180 gggaaaacca ccaccacgca
actgctggtg gccctgggtt cgcgcgacga tatcgtctac 240 gtacccgagc
cgatgactta ctggcgggtg ttgggggctt ccgagacaat cgcgaacatc 300
tacaccacac aacaccgcct cgaccagggt gagatatcgg ccggggacgc ggcggtggta
360 atgacaagcg cccagataac aatgggcatg ccttatgccg tgaccgacgc
cgttctggct 420 cctcatatcg ggggggaggc tgggagctca catgccccgc
ccccggccct caccctcatc 480 ttcgaccgcc atcccatcgc cgccctcctg
tgctacccgg ccgcgcgata ccttatgggc 540 agcatgaccc cccaggccgt
gctggcgttc gtggccctca tcccgccgac cttgcccggc 600 acaaacatcg
tgttgggggc ccttccggag gacagacaca tcgaccgcct ggccaaacgc 660
cagcgccccg gcgagcggct tgacctggct atgctggccg cgattcgccg cgtttatggg
720 ctgcttgcca atacggtgcg gtatctgcag ggcggcgggt cgtggcggga
ggattgggga 780 cagctttcgg gggcggccgt gccgccccag ggtgccgagc
cccagagcaa cgcgggccca 840 cgaccccata tcggggacac gttatttacc
ctgtttcggg cccccgagtt gctggccccc 900 aacggcgacc tgtataacgt
gtttgcctgg gctttggacg tcttggccaa acgcctccgt 960 cccatgcatg
tctttatcct ggattacgac caatcgcccg ccggctgccg ggacgccctg 1020
ctgcaactta cctccgggat ggtccagacc cacgtcacca ccccaggctc cataccgacg
1080 atctgcgacc tggcgcgcac gtttgcccgg gagatggggg aggctaactg a 1131
<210> SEQ ID NO 36 <211> LENGTH: 376 <212> TYPE:
PRT <213> ORGANISM: Human Herpesvirus-1 <300>
PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER:
GenBank No. NP_04462 <309> DATABASE ENTRY DATE: 2004-01-13
<400> SEQUENCE: 36 Met Ala Ser Tyr Pro Cys His Gln His Ala
Ser Ala Phe Asp Gln Ala 1 5 10 15 Ala Arg Ser Arg Gly His Asn Asn
Arg Arg Thr Ala Leu Arg Pro Arg
20 25 30 Arg Gln Gln Lys Ala Thr Glu Val Arg Leu Glu Gln Lys Met
Pro Thr 35 40 45 Leu Leu Arg Val Tyr Ile Asp Gly Pro His Gly Met
Gly Lys Thr Thr 50 55 60 Thr Thr Gln Leu Leu Val Ala Leu Gly Ser
Arg Asp Asp Ile Val Tyr 65 70 75 80 Val Pro Glu Pro Met Thr Tyr Trp
Arg Val Leu Gly Ala Ser Glu Thr 85 90 95 Ile Ala Asn Ile Tyr Thr
Thr Gln His Arg Leu Asp Gln Gly Glu Ile 100 105 110 Ser Ala Gly Asp
Ala Ala Val Val Met Thr Ser Ala Gln Ile Thr Met 115 120 125 Gly Met
Pro Tyr Ala Val Thr Asp Ala Val Leu Ala Pro His Ile Gly 130 135 140
Gly Glu Ala Gly Ser Ser His Ala Pro Pro Pro Ala Leu Thr Leu Ile 145
150 155 160 Phe Asp Arg His Pro Ile Ala Ala Leu Leu Cys Tyr Pro Ala
Ala Arg 165 170 175 Tyr Leu Met Gly Ser Met Thr Pro Gln Ala Val Leu
Ala Phe Val Ala 180 185 190 Leu Ile Pro Pro Thr Leu Pro Gly Thr Asn
Ile Val Leu Gly Ala Leu 195 200 205 Pro Glu Asp Arg His Ile Asp Arg
Leu Ala Lys Arg Gln Arg Pro Gly 210 215 220 Glu Arg Leu Asp Leu Ala
Met Leu Ala Ala Ile Arg Arg Val Tyr Gly 225 230 235 240 Leu Leu Ala
Asn Thr Val Arg Tyr Leu Gln Gly Gly Gly Ser Trp Arg 245 250 255 Glu
Asp Trp Gly Gln Leu Ser Gly Ala Ala Val Pro Pro Gln Gly Ala 260 265
270 Glu Pro Gln Ser Asn Ala Gly Pro Arg Pro His Ile Gly Asp Thr Leu
275 280 285 Phe Thr Leu Phe Arg Ala Pro Glu Leu Leu Ala Pro Asn Gly
Asp Leu 290 295 300 Tyr Asn Val Phe Ala Trp Ala Leu Asp Val Leu Ala
Lys Arg Leu Arg 305 310 315 320 Pro Met His Val Phe Ile Leu Asp Tyr
Asp Gln Ser Pro Ala Gly Cys 325 330 335 Arg Asp Ala Leu Leu Gln Leu
Thr Ser Gly Met Val Gln Thr His Val 340 345 350 Thr Thr Pro Gly Ser
Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe 355 360 365 Ala Arg Glu
Met Gly Glu Ala Asn 370 375
* * * * *