U.S. patent application number 11/256548 was filed with the patent office on 2006-03-09 for erbb4 receptor-specific neuregulin related ligands and uses therefor.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Paul J. Godowski, Melanie Rose Mark, Dong-Xiao Zhang.
Application Number | 20060051351 11/256548 |
Document ID | / |
Family ID | 26732085 |
Filed Date | 2006-03-09 |
United States Patent
Application |
20060051351 |
Kind Code |
A1 |
Godowski; Paul J. ; et
al. |
March 9, 2006 |
ErbB4 receptor-specific neuregulin related ligands and uses
therefor
Abstract
The invention concerns a novel neuregulin related ligand (NRG3)
including fragments and variants thereof, as new members of the
neuregulin family of compounds. The invention also concerns methods
and means for producing NRG3. The native polypeptides of the
invention are characterized by containing an extracellular domain
including an EGF-like domain; a transmembrane domain and a
cytoplasmic domain. Isolated nucleotide sequences encoding such
polypeptides, expression vectors containing the nucleotide
sequences, recombinant host cells transformed with the vectors, and
methods for the recombinant production for the novel NRG3s are also
within the scope of the invention.
Inventors: |
Godowski; Paul J.;
(Burlingame, CA) ; Mark; Melanie Rose;
(Burlingame, CA) ; Zhang; Dong-Xiao; (Burlingame,
CA) |
Correspondence
Address: |
GENENTECH, INC.
1 DNA WAY
SOUTH SAN FRANCISCO
CA
94080
US
|
Assignee: |
Genentech, Inc.
|
Family ID: |
26732085 |
Appl. No.: |
11/256548 |
Filed: |
October 21, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09107979 |
Jun 30, 1998 |
|
|
|
11256548 |
Oct 21, 2005 |
|
|
|
60053641 |
Jul 24, 1997 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
530/388.22; 530/399 |
Current CPC
Class: |
C07K 14/4756 20130101;
C07K 2319/00 20130101; A61K 48/00 20130101; A61K 38/00 20130101;
C07K 2319/30 20130101 |
Class at
Publication: |
424/133.1 ;
530/388.22; 530/399 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C07K 16/28 20060101 C07K016/28; C07K 14/485 20060101
C07K014/485 |
Claims
1. A polypeptide comprising an amino acid sequence encoding an
EGF-like domain, wherein the amino acid sequence has the binding
characteristics of NRG3.
2. The polypeptide of claim 1 wherein the binding characteristics
of NRG3 comprise (a) binding to ErbB4 receptor but not to ErbB2
receptor or ErbB3 receptor under experimentally comparable
conditions; and (b) activation of ErbB4 receptor tyrosine
phosphorylation.
3. The polypeptide of claim 1 wherein the amino acid sequence has
at least 75% amino acid sequence homology to the amino acid
sequence SEQ ID NO:4.
4. The polypeptide of claim 1, wherein the polypeptide binds to the
ErbB4 receptor and stimulates tyrosine phosphorylation of the ErbB4
receptor.
5. A polypeptide that binds ErbB4 receptor, which polypeptide is
selected from the group consisting of (a) a polypeptide comprising
an amino acid sequence having at least 75% sequence homology to the
extracellular domain NRG3 (SEQ ID NO:3 or 7). (b) a polypeptide
comprising an amino acid sequence having at least 75% sequence
homology to SEQ ID NO:2 or SEQ ID NO:6; (c) a further mammalian
homologue of polypeptide (a) or (b): (d) a soluble form of any of
the polypeptides (a)-(c) having a transmembrane domain that cannot
anchor the polypeptide in a cell membrane; and (e) a derivative of
any of the polypeptides (a)-(d) having the binding characteristics
of NRG3.
6. The polypeptide of claim 1 encoded by a NRG3 nucleic acid open
reading frame sequence in ATCC deposit 209156 (pLXSN.mNRG3).
7. The polypeptide of claim 1 encoded by a NRG3 nucleic acid open
reading frame sequence in ATCC deposit 209157
(pRK5.tk.neo.hNRG3B1).
8. The polypeptide of claim 1 encoded by a NRG3 nucleic acid open
reading frame sequence in ATCC deposit 209297
(pRK5.tk.neo.hNRG3B2).
9. The polypeptide of claim 1 which is devoid of a cytoplasmic
domain, or devoid of a transmembrane domain that can anchor the
polypeptide in a cell membrane, or both.
10. The polypeptide of claim 1 unaccompanied by native
glycosylation.
11. The polypeptide of claim 1 which has a variant
glycosylation.
12. An antagonist of the polypeptide of claim 1.
13. An agonist of the polypeptide of claim 1.
14. An isolated nucleic acid molecule encoding the polypeptide of
claim 1.
15. The nucleic acid molecule of claim 14 further encoding the
extracellular domain of a mammalian NRG3.
16. The nucleic acid molecule of claim 15, wherein the encoded
extracellular domain has at least 75% amino acid sequence identity
to the amino acid sequence of SEQ ID NO:3 or SEQ ID NO:7.
17. The nucleic acid molecule of claim 14 wherein the encoded amino
acid sequence is devoid of a cytoplasmic domain or a transmembrane
domain that can anchor the polypeptide in a cell membrane, or
both.
18. An expression vector comprising the nucleic acid molecule of
claim 14 operably linked to control sequences recognized by a host
cell transformed with the vector.
19. An expression vector according to claim 18 obtainable as ATCC
209156 (pLXSN.mNRG3).
20. An expression vector according to claim 18 obtainable as ATCC
209157 (pRK5.tk.neo.hNRG3B1).
21. An expression vector according to claim 18 obtainable as ATCC
209297 (pRK5.tk.neo.hNRG3B2).
22. A host cell comprising the vector of claim 18.
23. The host cell of claim 22 which is a mammalian cell.
24. The host cell of claim 23 which is a Chinese hamster ovary cell
line.
25. A method for producing the amino acid sequence encoding an
EGF-like domain that binds ErbB4 receptor, the method comprising:
a) culturing a cell comprising the nucleic acid of claim 14; and b)
recovering the polypeptide from the cell culture.
26. The method of claim 25 wherein the polypeptide is secreted into
the culture medium and recovered from the culture medium.
27. An antibody that specifically binds to the polypeptide of claim
1.
28. A hybridoma cell line producing the antibody of claim 27.
29. An immunoadhesin comprising the polypeptide of claim 1 fused to
an immunoglobulin sequence.
30. The immunoadhesin of claim 29, further comprising the EGF-like
domain of SEQ ID NO:4.
31. The immunoadhesin of claim 29 wherein the immunoglobulin
sequence is an immunoglobulin heavy chain constant domain
sequence.
32. The immunoadhesin of claim 31 wherein the immunoglobulin
sequence is a constant domain sequence of an IgG-1, IgG-2 or
IgG-3.
33. A method of detecting an NRG3 in a sample, the method
comprising: a) contacting the antibody of claim 27 with the sample;
b) detecting binding of the antibody to a polypeptide in the
sample, wherein the polypeptide is an NRG3.
34. A method of detecting ErbB4 receptor in a sample, the method
comprising: a) contacting the polypeptide of claim 1 with the
sample; and b) detecting binding of the amino acid sequence to a
protein in the sample.
35. The method of claim 34 wherein the sample comprises a cell
expressing ErB4 receptor on its surface.
36. The method of claim 35 wherein the sample is a mammalian tissue
sample.
37. A method of administering a NRG3 polypeptide to a mammal
experiencing a disorder treatable with NRG3, wherein the method
comprises introducing into the mammal a cell comprising the nucleic
acid of claim 14, and wherein the NRG3 polypeptide is secreted by
the cell.
38. The method of claim 37 wherein the cell is contained within a
porous matrix and the matrix is administered to the mammal.
Description
RELATED APPLICATION
[0001] This application is a non-provisional application filed
under 37 CFR 1.53(b)(1), claiming, priority under 35 USC 119(e) to
provisional application No. 60\053,641 filed Jul. 24, 1997, the
contents of which are incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention concerns novel neuregulin related
ligands. More particularly, the invention relates to a new member
of the neuregulin family and functional derivatives of the novel
polypeptide.
BACKGROUND OF THE INVENTION
[0003] Signal transduction affecting cell growth and
differentiation is regulated in part by phosphorylation of various
cellular proteins. Protein tyrosine kinases are enzymes that
catalyze this process. Receptor protein tyrosine kinases are
believed to direct cellular growth via ligand-stimulated tyrosine
phosphorylation of intracellular substrates. Growth factor receptor
protein tyrosine kinases of the class I subfamily include the 170
kDa epidermal growth factor receptor (EGFR) encoded by the erbB1
gene. erbB1 has been causally implicated in human malignancy. In
particular, increased expression of this gene has been observed in
more aggressive carcinomas of the breast, bladder, lung and
stomach. The second member of the class I subfamily, p185.sup.neu,
was originally identified as the product of the transforming gene
from neuroblastomas of chemically treated rats. The neu gene (also
called erbB2 and HER2) encodes a 185 kDa receptor protein tyrosine
kinase. Amplification and/or overexpression of the human HER2 gene
correlates with a poor prognosis in breast and ovarian cancers
(Slamon et al., (1987) Science 235:177-182; and Slamon et al.,
(1989) Science 244:707-712). Overexpression of HER2 has been
correlated with other carcinomas including carcinomas of the
stomach, endometrium, salivary gland, lung, kidney, colon and
bladder. A further related gene, called erbB3 or HER3, has also
been described (Kraus et al., (1989) Proc. Natl. Acad. Sci. USA
86:9193-9197). Kraus et al. (1989) discovered that markedly
elevated levels of erbB3 mRNA were present in certain human mammary
tumor cell lines indicating that erbB3, like erbB1 and erbB2, may
play a role in human malignancies. The erbB3 gene has been found to
be overexpressed in breast (Lemoine et al. (1992) Br. J. Cancer
66:1116-1121), gastrointestinal (Poller et al. (1992) J. Pathol.
168:275-280, Rajkumer et al. (1993) J. Pathol. 170:271-278, and
Sanidas et al. (1993) Int. J. Cancer 54:935-940, and pancreatic
cancers (Lemoine et al. (1992) J. Pathol. 168:269-273, and Friess
et al. (1995) Clinical Cancer Research 1:1413-1420).
[0004] The class I subfamily of growth factor receptor protein
tyrosine kinases has been further extended to include the HER4/Erb4
receptor (EP Pat Appln No 599,274; Plowman et al. (1993) Proc.
Natl. Acad; Sci. USA 9. 1746-1750; and Plowman et al. (1993) Nature
36473-475. Plowman et al. found that increased HER4 expression
closely correlated with certain carcinomas of epithelial origin,
including breast adenocarcinomas. Diagnostic methods for detection
of human neoplastic conditions (especially breast cancers) which
evaluate HER4 expression are described in EP Pat Appln No.
599,274.
[0005] The quest for the activator of the HER2 oncogene has lead to
the discovery of a family of polypeptides, collectively called
neuregulins (NRG1). These proteins appear to result from alternate
splicing of a single gene which was mapped to the short arm of
human chromosome 8 by Orr-Urtreger et al. (1993) Proc. Natl. Acad.
Sci. USA 90:1867-1871.
[0006] Holmes et al. isolated and cloned a family of polypeptide
activators for the HER2 receptor which they called
heregulin-.alpha. (HRG-.alpha.), heregulin-.beta.1 (HRG-.beta.1),
heregulin-.beta.2 (HRG-.beta.2), heregulin-.beta.2-like
(HRG-.beta.2-like), and heregulin-.beta.3 (HRG-.beta.3). See Holmes
et al. (1992) Science 256:1205-1210; WO 92/20798; and U.S. Pat. No.
5,367,060. The 45 kDa polypeptide, HRG-.alpha., was purified from
the conditioned medium of the MDA-MB-231 human breast cancer cell
line. These researchers demonstrated the ability of the purified
heregulin polypeptides to activate tyrosine phosphorylation of the
HER2 receptor in MCF7 breast tumor cells. Furthermore, the
mitogenic activity of the heregulin polypeptides on SK-BR-3 cells
(which express high levels of the HER2 receptor) was illustrated.
Like other growth factors which belong to the EGF family, soluble
HRG polypeptides appear to be derived from a membrane bound
precursor (called pro-HRG) which is proteolytically processed to
release the 45 kDa soluble form. These pro-HRGs lack a N-terminal
signal peptide.
[0007] While heregulins are substantially identical in the first
213 amino acid residues, they are classified into two major types,
.alpha. and .beta., based on two variant EGF-like domains which
differ in their C-terminal portions. Nevertheless, these EGF-like
domains are identical in the spacing of six cysteine residues
contained therein. Based on an amino acid sequence comparison,
Holmes et al. found that between the first and sixth cysteines in
the EGF-like domain, HRGs were 45% similar to heparin-binding
EGF-like growth factor (HB-EGF), 35% identical to amphiregulin
(AR), 32% identical to TGF-.alpha., and 27% identical to EGF.
[0008] The 44 kDa neu differentiation factor (NDF), which is the
rat equivalent of human HRG, was first described by Peles et al.
(1992) Cell 69:205-216; and Wen et al. (1992) Cell 69:559-572. Like
the HRG polypeptides, NDF has an immunoglobulin (Ig) homology
domain followed by an EGF-like domain and lacks a N-terminal signal
peptide. Subsequently, Wen et al. (1994) Mol. Cell. Biol.
14(3):1909-1919 carried out cloning experiments to extend the
family of NDFs. This work revealed six distinct fibroblastic
pro-NDFs. Adopting the nomenclature of Holmes et al., the NDFs are
classified as either .alpha. or .beta. polypeptides based on the
sequences of the EGF-like domains. Isoforms 1 to 4 are
characterized on the basis of the region between the EGF-like
domain and transmembrane domain. Also, isoforms a, b and c are
described which have variable length cytoplasmic domains. These
researchers conclude that different NDF isoforms are generated by
alternative splicing and perform distinct tissue-specific
functions. See also EP 505 148; WO 93/22424; and WO 94/28133
concerning NDF.
[0009] Falls et al. (1993) Cell 72:801-815 describe another member
of the heregulin family which they call acetylcholine receptor
inducing activity (ARIA) polypeptide. The chicken-derived ARIA
polypeptide stimulates synthesis of muscle acetylcholine receptors.
See also WO 94/08007. ARIA is a .beta.-type heregulin and lacks the
entire spacer region rich in glycosylation sites between the
Ig-like domain and EGF-like domain of HRG.alpha., and
HRG.beta.1-.beta.3.
[0010] Marchionni et al. identified several bovine-derived proteins
which they call glial growth factors (GGFs), (Marchionni. et al,.
(1993) Nature 362:312-318). These GGFs share the Ig-like domain and
EGF-like domain with the other heregulin proteins described above,
but also have an amino-terminal kringle domain. GGFs generally do
not have the complete glycosylated spacer region between the
Ig-like domain and EGF-like domain. Only one of the GGFs, GGFII,
possessed a N-terminal signal peptide. See also WO 92/18627; WO
94/00140; WO 94/04560; WO 94/26298; and WO 95/32724 which refer to
GGFs and uses thereof.
[0011] Ho et al. in (1995) J. Biol. Chem. 270(4):14523-14532
describe another member of the heregulin family called sensory and
motor neuron-derived factor (SMDF). This protein has an EGF-like
domain characteristic of all other heregulin polypeptides but a
distinct N-terminal domain. The major structural difference between
SMDF and the other heregulin polypeptides is the lack in SMDF of
the Ig-like domain and the "glyco" spacer characteristic of all the
other heregulin polypeptides. Another feature of SMDF is the
presence of two stretches of hydrophobic amino acids near the
N-terminus.
[0012] While the heregulin polypeptides were first identified based
on their ability to activate the HER2 receptor (see Holmes et al.,
supra), it was discovered that certain ovarian cells expressing neu
and neu-transfected fibroblasts did not bind or crosslink to NDF,
nor did they respond to NDF to undergo tyrosine phosphorylation
(Peles et al. (1993) EMBO J. 12:961-971). This indicated that
another cellular component was necessary for conferring full
heregulin responsiveness. Carraway et al. subsequently demonstrated
that .sup.125I-rHRG.beta.1.sub.177-244 bound to NIH-3T3 fibroblasts
stably transfected with bovine erbB3 but not to non-transfected
parental cells. Accordingly, they conclude that ErbB3 is a receptor
for HRG and mediates phosphorylation of intrinsic tyrosine residues
as well as phosphorylation of ErbB2 receptor in cells which express
both receptors. Caraway et al. (1994) J. Biol. Chem.
269(19):14303-14306. Sliwkowski et al. (1994) J. Biol. Chem.
269(20):14661-14665 found that cells transfected with HER3 alone
show low affinities for heregulin, whereas cells transfected with
both HER2 and HER3 show higher affinities.
[0013] This observation correlates with the "receptor
cross-talking" described previously by Kokai et al., Cell
58:287-292 (1989); Stern et al. (1988) EMBO J. 7:995-1001; and King
et al., 4:13-18 (1989). These researchers found that binding of EGF
to the EGFR resulted in activation of the EGFR kinase domain and
cross-phosphorylation of p185.sup.HER2. This is believed to be a
result of ligand-induced receptor heterodimerization and the
concomitant cross-phosphorylation of the receptors within the
heterodimer (Wada et al. (1990) Cell 61:1339-1347).
[0014] Plowman and his colleagues have similarly studied
p185.sup.HER4/p185.sup.HER2 activation. They expressed
p185.sup.HER2 alone, p185.sup.HER4 alone, or the two receptors
together in human T lymphocytes and demonstrated that heregulin is
capable of stimulating tyrosine phosphorylation of p185.sup.HER4,
but could only stimulate p185.sup.HER2 phosphorylation in cells
expressing both receptors. Plowman et al., Nature 336:473-475
(1993). Thus, heregulin is the only known example of a member of
the EGF growth factor family that can interact with several
receptors. Carraway and Cantley (1994) Cell 78:5-8.
[0015] The biological role of heregulin has been investigated by
several groups. For example, Falls et al., (discussed above) found
that ARIA plays a role in myotube differentiation, namely affecting
the synthesis and concentration of neurotransmitter receptors in
the postsynaptic muscle cells of motor neurons. Corfas and
Fischbach demonstrated that ARIA also increases the number of
sodium channels in chick muscle. Corfas and Fischbach (1993) J.
Neuroscience 13(5): 2118-2125. It has also been shown that GGFII is
mitogenic for subconfluent quiescent human myoblasts and that
differentiation of clonal human myoblasts in the continuous
presence of GGFII results in greater numbers of myotubes after six
days of differentiation (Sklar et al. (1994) J. Cell Biochem.,
Abst. W462, 18D, 540). See also WO 94/26298 published Nov. 24,
1994.
[0016] Holmes et al., supra, found that HRG exerted a mitogenic
effect on mammary cell lines (such as SK-BR-3 and MCF-7). The
mitogenic activity of GGFs on Schwann cells has also been reported.
See, e.g., Brockes et al. (1980) J. Biol. Chem. 255(18)-8374-8377;
Lemke and Brockes (1984) J. Neurosci. 4:75-83; Brockes et al.
(1984) J. Neuroscience 4(1):75-83; Brockes et al. (1986) Ann.
Neurol. 20(3):317-322; Brockes, J. (1987) Methods in Enzym.
147:217-225 and Marchionni et al., supra. Schwann cells constitute
important glial cells which provide myelin sheathing around the
axons of neurons, thereby forming individual nerve fibers. Thus, it
is apparent that Schwann cells play an important role in the
development, function and regeneration of peripheral nerves. The
implications of this from a therapeutic standpoint have been
addressed by Levi et al. (1994) J. Neuroscience 14(3):1309-1319.
Levi et al. discuss the potential for construction of a cellular
prosthesis comprising human Schwann cells which could be
transplanted into areas of damaged spinal cord. Methods for
culturing Schwann cells ex vivo have been described. See WO
94/00140 and Li et al. (1996) J. Neuroscience 16(6):2012-2019.
[0017] Pinkas-Kramarski et al. found that NDF seems to be expressed
in neurons and glial cells in embryonic and adult rat brain and
primary cultures of rat brain cells, and suggested that it may act
as a survival and maturation factor for astrocytes
(Pinkas-Kramarski et al. (1994) PNAS, USA 91:9387-9391). Meyer and
Birchmeier (1994) PNAS, USA 91:1064-1068 analyzed expression of
heregulin during mouse embryogenesis and in the perinatal animal
using in situ hybridization and RNase protection experiments. These
authors conclude that, based on expression of this molecule,
heregulin plays a role in vivo as a mesenchymal and neuronal
factor. Also, their findings imply that heregulin functions in the
development of epithelia. Similarly, Danilenko et al. (1994)
Abstract 3101, FASEB 8(4-5):A535, found that the interaction of NDF
and the HER2 receptor is important in directing epidermal migration
and differentiation during wound repair.
[0018] Although NRG1 was initially proposed to be the ligand for
the receptor tyrosine kinase ErbB2, further studies have
demonstrated that activation of ErbB2 frequently occurred as a
result of NRG1 binding to ErbB3 (Sliwkowski, M. X., et al. (1994)
J. Biol. Chem. 26:14661-14665) or ErbB4 (Plowman, G. D. et al.
(1993) Nature 366:473-475; and Carraway, K. L. and Cantley, L. C.
(1994) Cell 78:5-8) receptors. Recent studies have begun to
highlight the roles of NRG1, ErbB2 receptor and ErbB4 receptor in
the development of the heart. Mice lacking ErbB4 receptor, ErbB2
receptor or NRG1 die during mid-embryogenesis (embryonic day 10.5)
from the aborted development of myocardial trabeculae in the
ventricle (Meyer & Birchmeier (1995) Nature 378:386-90;
Gassmann et al. (1995) Nature 378:390-4; and Lee et al. (1995)
Nature 378:394-8). These results are consistent with the view that
NRG1, expressed in the endocardium, is an important ligand required
for the activation of ErbB2 and ErbB4 receptors in the
myocardium.
[0019] These same studies suggest that NRG1 and ErbB2 receptor may
play a different role than ErbB4 receptor in the development of the
hind brain. NRG1 is expressed in the neuroepithelium and cells
arising from rhombomeres 2, 4 and 6, while ErbB4 receptor is
expressed in rhombomeres 3 and 5. NRG1 and ErbB2 receptor knockout
mice exhibit a loss of cells and axons of the cranial sensory
ganglia. In contrast, ErbB4 receptor deficient mice do not exhibit
a loss of cellularity in the cranial ganglia. Rather, the
organization, spacing and pattern of innervation of these ganglia
to and from the central nervous system is disrupted (Gassmann et
al., supra). One possible reason for this difference in hindbrain
phenotypes of NRG1 and ErbB4 receptor knockout mice is that
additional ligand(s) distinct from NRG1 may be recognized by ErbB4
in the CNS (Gassmann et al., supra).
SUMMARY OF THE INVENTION
[0020] The present invention is based on the identification,
recombinant production and characterization of a novel member of
the family of neuregulins (NRG1). More specifically, the invention
concerns a novel polypeptide, NRG3, comprising an EGF-like domain
distinct from EGF-like domains of NRG1 and NRG2. In addition, the
NRG3 disclosed herein displays distinct receptor binding
characteristics relative to other neuregulin-like polypeptides.
[0021] In analyzing the homologous sequence motif, homology to the
EGF-like domain of NRG1 was observed in the subset of amino acids
that are conserved in most neuregulins. Based upon this observation
and the observed ErbB4 receptor binding characteristics, the novel
protein, NRG3, has been identified as a new member of the family of
neuregulins. The novel protein contains domains that are distantly
related to, but distinct from, those found in the other members of
the NRG1 family. In addition, it is expressed primarily in
embryonic and adult tissues of the central nervous system. NRG3
represents a novel member of the neuregulin family of compounds,
members of which are involved in cell proliferation and
differentiation, epithelial development, cardiac development,
neurological development, as well as acting as glial cell mitogens,
and as mesenchymal and neuronal factors.
[0022] In one aspect, the present invention concerns a novel
isolated mammalian NRG3 polypeptide having an EGF-like domain, and
functional derivatives of the novel NRG3, which polypeptides bind
the ErbB4 receptor. The native polypeptides within the scope of the
present invention are characterized as containing an extracellular
domain including an EGF-like domain, a transmembrane domain and a
cytoplasmic domain. The present invention specifically includes the
soluble forms of the novel NRG3 ligand molecules of the invention,
which have a transmembrane domain that cannot associate with a cell
membrane, and optionally devoid of all or part of the cytoplasmic
domain. By "transmembrane domain" is meant a domain of the
polypeptide that contains a sufficient number of hydrophobic amino
acids to allow the polypeptide to insert and anchor in a cell
membrane. By "transmembrane domain that cannot associate with a
cell membrane" is meant a transmembrane domain that has been
altered by mutation or deletion such that is insufficiently
hydrophobic to allow insertion or other association with a cell
membrane. Such a transmembrane domain does not preclude, for
example, the fusion of the NRG3 of the invention, or fragment
thereof, with a secretion signal sequence useful for secretion of
the polypeptide from the cell, an insufficient number of
hydrophobic amino acid side chains are present devoid of an active
transmembrane domain does not insert into a cell membrane.
Mutations or alterations of the amino acid sequence useful to
achieve an inactive transmembrane domain include, but are not
limited to, deletion or substitution of amino acids within the
transmembrane domain.
[0023] In a particular embodiment, the invention concerns isolated
polypeptides, preferably NRG3 ligands, having at least 75% amino
acid identity to polypeptides selected from the group consisting
of
[0024] (1) a polypeptide comprising the amino acid sequence
encoding the EGF-like domain shown in FIG. 3 (SEQ ID NO:4);
[0025] (2) a polypeptide comprising the amino acid sequence
encoding the extracellular domain of mouse or human NRG3 shown in
FIG. 3 (SEQ ID NO: 3 or SEQ ID NO:7, respectively);
[0026] (3) a polypeptide comprising the amino acid sequence of the
native mouse or human NRG3 polypeptide shown in FIG. 3 (SEQ ID NO:
2 and SEQ ID NO:6, respectfully);
[0027] (4) a further mammalian homologue of polypeptide
(1)-(3);
[0028] (5) a soluble form of any of the polypeptides (1)-(4) devoid
of an active transmembrane domain; and
[0029] (6) a derivative of any of the polypeptides (1)-(5),
retaining the qualitative EGF-like domain and NRG3 receptor binding
properties of a polypeptide (1)-(5).
[0030] While the native NRG3 polypeptides of the present invention
are glycoproteins, the present invention also encompasses variant
molecules unaccompanied by native glycosylation or having a variant
glycosylation pattern. Preferably, the EGF-like domain of the NRG3
polypeptide is unglycosylated.
[0031] In a further embodiment, the invention includes an
antagonist of a novel NRG3 of the present invention. The antagonist
of the invention may be a peptide that binds an NRG3 such as an
anti-NRG3 antibody or binding fragment thereof. Preferably, the
NRG3 antagonist of the invention substantially reduces binding of a
natural ErbB4 receptor ligand, such as an NRG3, to the ErbB4
receptor, thereby preventing or limiting activation of the
receptor. In a preferred embodiment, the antagonist reduces NRG3
binding to its receptor to less than 50% , preferably less than 20%
, most preferably less than 10% of the binding of an NRG3 under
like conditions.
[0032] In yet another embodiment, the invention includes an agonist
of a novel NRG3 of the present invention. The agonist of the
invention may be a NRG3, or it may be an anti-NRG3 receptor
antibody or receptor binding fragment. An agonist NRG3 of the
invention may also be an polypeptide encoded by an alternatively
spliced form of the native NRG3-encoding gene, preferably
comprising the NRG3 EGF-like domain disclosed herein. In an
embodiment of the agonist of the invention, the NRG3 agonist is an
anti-ErbB4 receptor antibody, which antibody binds to and activates
the ErbB4 receptor. Preferably, the binding affinity of the agonist
is at least 25% of the affmity of the native ligand, more
preferably at least 50% , and most preferably at least 90% of the
affinity of the native ligand. Similarly, it is preferred that the
agonist of the invention activate the ErbB4 receptor at the level
of at least 25% , more preferably at least 50% , most preferably at
least 90% of activation of the native NRG3.
[0033] The invention further concerns a nucleic acid molecule
encoding a novel NRG3 of the present invention, vectors containing
such nucleic acid, and host cells transformed with the vectors. The
nucleic acid preferably encodes at least the EGF-like domain of a
native or variant ErbB4 receptor-specific NRG3 of the present
invention. The invention further includes nucleic acids hybridizing
under stringent conditions to the complement of a nucleic acid
encoding a native ErbB4 receptor-specific NRG3 of the present
invention, and encoding a protein retaining the qualitative ErbB4
receptor-specific binding properties of a native NRG3 disclosed
herein. In addition, the invention includes a nucleic acid
deposited with the American Type Culture Collection as ATCC 209156
(pLXSN.mNRG3), which nucleic acid is an expression vector
comprising nucleic acid encoding the mouse NRG3 open reading frame
(SEQ ID NO:1). The invention also includes a nucleic acid deposited
with the American Type Culture Collection as ATCC 209157
(pRK5.tk.neo.hNRG3B1), which nucleic acid is an expression vector
comprising nucleic acid encoding a human NRG3 nucleic acid (SEQ ID
NO:5). The invention also includes a nucleic acid deposited with
the American Type Culture Collection as ATCC 209297
(pRK5.tk.neo.hNRG3B2), which nucleic acid is an expression vector
comprising nucleic acid encoding an alternatively spliced form of
human NRG3 nucleic acid (SEQ ID NO:22) lacking nucleic acids 1585
to 1656 of SEQ ID NO:5. The deduced amino acid sequence of the
alternatively spliced human NRG3B2 is found in SEQ ID NO:23 which
lacks amino acids 529 to 552 of SEQ ID NO:6. A comparison of the
hNRG3B1 and hNRG3B2 amino acid sequences is shown in FIG. 4B. The
invention further includes NRG3 amino acid sequences of mouse and
human NRG3, alternatively spliced forms or fragments thereof,
encoded by the deposited expression vectors.
[0034] In another aspect, the invention concerns a process for
producing a NRG3 of the invention, which process comprises
transforming a host cell with nucleic acid encoding the desired
NRG3, culturing the transformed host cell and recovering the NRG3
produced from the host cell or host cell culture.
[0035] As an alternative to production of the NRG3 in a transformed
host cell, the invention provides a method for producing NRG3
comprising: (a) transforming a cell containing an endogenous NRG3
gene with a homologous DNA comprising an amplifiable gene and a
flanking sequence of at least about 150 base pairs that is
homologous with a DNA sequence within or in proximity to the
endogenous NRG3 gene, whereby the homologous DNA integrates into
the cell genome by recombination; (b) culturing the cell under
conditions that select for amplification of the amplifiable gene,
whereby the NRG3 gene is also amplified; and thereafter (c)
recovering NRG3 from the cell.
[0036] In a further aspect, the invention concerns an antibody that
binds specifically to a NRG3 of the present invention, and to a
hybridoma cell line producing such an antibody.
[0037] In a still further aspect, the invention concerns an
immunoadhesin comprising a novel NRG3 sequence, as disclosed
herein, fused to an immunoglobulin sequence. The NRG3 sequence is
preferably a transmembrane-domain-deleted form of a native or
variant polypeptide fused to an immunoglobulin constant domain
sequence, and comprises at least the EGF-like domain of the
extracellular domain of a native NRG3 of the present invention. In
another preferred embodiment, the NRG3 sequence present in the
immunoadhesin shows at least about 80% sequence homology with the
extracellular domain of the sequence shown in SEQ ID NO:3 NRG3 or
SEQ ID NO:7 for mouse or human NRG3, respectively. The
immunoglobulin constant domain sequence preferably is that of an
IgG-1, IgG-2 or IgG-3 molecule, but may also be an IgA or IgM
molecule.
[0038] In a further aspect, the invention encompasses a transgenic
animal comprising an altered NRG3 gene in which the polypeptide
encoded by the altered gene is not biologically active
(non-functional), deleted, or has no more than 70% wild type
activity, preferably no more that 50% activity and more preferably
no more than 25% activity of the native NRG3 polypeptide. In
addition, a transgenic animal of the invention includes a
taansgenic animal comprising and expressing a native NRG3,
alternatively spliced form of NRG3, or a fragment or variant
thereof. Such transgenic animals are useful for the screening of
potential NRG3 agonists and antagonists.
[0039] The invention further concerns pharmaceutical compositions
comprising a NRG3 as hereinabove defined in admixture with a
pharmaceutically acceptable carrier. Dosages and administration of
NRG3 in a pharmaceutical composition may be determined by one of
ordinary skill in the art of clinical pharmacology or
pharmacokinetics (see, for example, Mordenti, J. and Rescigno, A.
(1992) Pharmaceutical Research 9:17-25; Morenti, J. et al. (1991)
Pharmaceutical Research 8:1351-1359; and Mordenti, J. and Chappell,
W. (1989) "The use of interspecies scaling in toxicokinetics" in
Toxicokinetics and New Drug Development, Yacobi et al. (eds),
Pergamon Press, NY, pp. 42-96, each of which references are herein
incorporated by reference in its entirety).
[0040] In an aspect of the invention, the isolated nucleic acid
encoding the NRG3 of the invention, or fragment thereof, may also
be used for in vivo or ex vivo gene therapy.
[0041] In an embodiment of the invention, a nucleic acid sequence
encoding an NRG3, or fragment or variant thereof, is introduced
into a cell of an animal as part of an expression cassette such
that the NRG3-encoding nucleic acid sequence is expressed in the
cell. Preferably, the NRG3 encoding nucleic acid sequence comprises
sequences (such as a promotor sequence) for the control of NRG3
expression within the cell. Preferably, the expression cassette
comprises a retroviral vector for delivery of the nucleic acid
sequence to a cell of the animal.
[0042] In a further embodiment of the invention, a host cell
expressing an NRG3 or NRG3 agonist is introduced into an animal,
preferably a human, such that NRG3 or NRG3 agonist produced by the
host cell is effective in treating a disorder responsive to
increased local or systemic NRG3 administration. Cells genetically
engineered to express an NRG3, fragment or variant thereof, can be
implanted in the host to provide effective levels of factor or
factors. The cells can be prepared, encapsulated, and implanted as
provided in U.S. Pat. Nos. 4,892,538, and 5,011,472, WO 92/19195,
WO 95/05452, or Aebischer et al. (1996) Nature Medicine 2:696-699,
for example, which references are herein incorporated by reference
in their entirety.
[0043] The present invention includes methods of enhancing
survival, proliferation or differentiation of cells comprising the
ErbB4 receptor in vivo and in vitro. Normally, the cells will be
treated with the NRG3 polypeptide or fragment or variant thereof.
However, gene therapy approaches have been described in the art and
are encompassed by the present invention. These techniques include
gene delivery to a cell using adenovirus, herpes simplex I virus or
adeno-associated virus as well as lipid-based delivery systems
(e.g. liposomes). Retroviruses are useful for ex vivo gene therapy
approaches. Accordingly, it is possible to administer the nucleic
acid encoding NRG3, resulting in expression of the NRG3
polypeptide, fragment or variant in the patient or in tissue
culture. For exemplary gene therapy techniques see WO 93/25673 and
the references cited therein.
[0044] An aspect of the invention is a method of treating a
disorder by administering to a mammal a cell encoding an NRG3 or
fragment thereof, or agonist or antagonist of the NRG3 as necessary
to treat the disorder, which cell secretes the NRG3 of the
invention. An embodiment of the invention is a method for
preventing or treating damage to a nerve or damage to other
NRG3-expressing or NRG3-responsive cells, e.g. brain, heart, or
kidney cells, which method comprises implanting cells that secrete
NRG3, or fragment or agonist thereof, or antagonist as may be
required for the particular condition, into the body of patients in
need thereof.
[0045] A further embodiment of the invention includes an
implantation device, for preventing or treating nerve damage or
damage to other cells as taught herein, containing a semipermeable
membrane and a cell that secretes NRG3, or fragment or agonist
thereof, (or antagonist as may be required for the particular
condition) encapsulated within the membrane, the membrane being
permeable to NRG3, or fragment agonist thereof, and impermeable to
factors from the patient detrimental to the cells. The patient's
own cells, transformed to produce NRG3 ex vivo, could be implanted
directly into the patient, optionally without such encapsulation.
The methodology for the membrane encapsulation of living cells is
familiar to those of ordinary skill in the art, and the preparation
of the encapsulated cells and their implantation in patients may be
accomplished readily as is known in the art.
[0046] In accordance with the in vitro methods of the invention,
cells comprising the ErbB4 receptor are placed in a cell culture
medium. Examples of ErbB4-receptor-containing cells include neural
cells, e.g., brain cells (such as neurons of the neocortex,
cerebellum and hippocampus); cardiac cells; skeletal and smooth
muscle cells; and cultured cells transformed with a recombinant
NRG3.
[0047] Suitable tissue culture media are well known to persons
skilled in the art and include, but are not limited to, Minimal
Essential Medium (MEM), RPMI-1640, and Dulbecco's Modified Eagle's
Medium (DMEM). These tissue culture medias are commercially
available from Sigma Chemical Company (St. Louis, Mo.) and GIBCO
(Grand Island, N.Y.). The cells are then cultured in the cell
culture medium under conditions sufficient for the cells to remain
viable and grow in the presence of an effective amount of NRG3. The
cells can be cultured in a variety of ways, including culturing in
a clot, agar, or liquid culture.
[0048] The cells are cultured at a physiologically acceptable
temperature such as 37.degree. C., for example, in the presence of
an effective amount of NRG3, fragment or variant. The amount of
NRG3 may vary, but preferably is in the range of about 0.1 ng/ml to
about 1 mg/ml preferably about 0.1 ng/ml to about 0.1 ng/ml. The
NRG3 can of course be added to the culture at a dose determined
empirically by those in the art without undue experimentation. The
concentration of NRG3 in the culture will depend on various
factors, such as the conditions under which the cells and NRG3 are
cultured. The specific temperature and duration of incubation, as
well as other culture conditions, can be varied depending on such
factors as, e.g., the concentration of the NRG3, and the type of
cells and medium. Those skilled in the art will be able to
determine operative and optimal culture conditions without undue
experimentation. Proliferation, differentiation and/or survival of
the cells (e.g. neurons) in the cultures can be determined by
various assays known in the art such as those described above.
[0049] It is contemplated that using NRG3 to enhance cell survival,
growth and/or differentiation in vitro will be useful in a variety
of ways. For instance, neural cells cultured in vitro in the
presence of NRG3 can be infused into a mammal suffering from
reduced levels of the cells. Stable in vitro cultures can also be
used for isolating cell-specific factors and for expression of
endogenous or recombinantly introduced proteins in the cell. NRG3,
fragments or variants thereof may also be used to enhance cell
survival, proliferation and/or differentiation of cells which
support the growth and/or differentiation of other cells in cell
culture.
[0050] The invention also provides in vivo uses for NRG3. Based on
the neuronal cell expression pattern of NRG3, it is believed that
this molecule will be particularly useful for treating diseases
which involve neural cell growth such as demyelination, or damage
or loss of glial cells (e.g. multiple sclerosis).
[0051] The invention further provides a method for treating a
mammal comprising administering a therapeutically effective amount
of NRG3, NRG3 fragment, or NRG3 agonist to the mammal. For example,
the mammal may be suffering from a neurological or muscular
disorder. Where the disorder is a neurological disorder, NRG3 is
believed to be useful in promoting the development, maintenance,
and/or regeneration of neurons in vivo, including central (brain
and spinal chord), peripheral (sympathetic, parasympathetic,
sensory, and enteric neurons), and motoneurons. Accordingly, NRG3
may be utilized in methods for the diagnosis and/or treatment of a
variety of neurologic diseases or disorders which affect the
nervous system of a mammal, such as a human.
[0052] Such diseases or disorders may arise in a patient in whom
the nervous system has been damaged by, e.g., trauma, surgery,
stroke, ischemia, infection, metabolic disease, nutritional
deficiency, malignancy, or toxic agents. The agent is designed to
promote the survival or growth of neurons. For example, NRG3 can be
used to promote the survival or growth of motoneurons that are
damaged by trauma or surgery. Also, NRG3 can be used to treat
motoneuron disorders, such as amyotrophic lateral sclerosis (Lou
Gehrig's disease), Bell's palsy, and various conditions involving
spinal muscular atrophy, or paralysis. NRG3 can be used to treat
human "neurodegenerative disorders", such as Alzheimer's disease,
Parkinson's disease, epilepsy, multiple sclerosis, Huntington's
chorea, Down's Syndrome, nerve deafness, and Meniere's disease.
[0053] Further, NRG3 can be used to treat neuropathy, and
especially peripheral neuropathy. "Peripheral neuropathy" refers to
a disorder affecting the peripheral nervous system, most often
manifested as one or a combination of motor, sensory, sensorimotor,
or autonomic neural dysfunction. The wide variety of morphologies
exhibited by peripheral neuropathies can each be attributed
uniquely to an equally wide number of causes. For example,
peripheral neuropathies can be genetically acquired, can result
from a systemic disease, or can be induced by a toxic agent.
Examples include but are not limited to distal sensorimotor
neuropathy, or autonomic neuropathies such as reduced motility of
the gastrointestinal tract or atony of the urinary bladder.
Examples of neuropathies associated with systemic disease include
post-polio syndrome; examples of hereditary neuropathies include
Charcot-Marie-Tooth disease, Refsum's disease,
Abetalipoproteinemia, Tangier disease, Krabbe's disease,
Metachromatic leukodystrophy, Fabry's disease, and Dejerine-Sottas
syndrome; and examples of neuropathies caused by a toxic agent
include those caused by treatment with a chemotherapeutic agent
such as vincristine, cisplatin, methotrexate, or
3'-azido-3'-deoxythymidine.
[0054] The invention further provides a method for treating a
mammal comprising administering a therapeutically effective amount
of a NRG3 antagonist to the mammal. The mammal in this latter case
is one which could benefit from a reduction in NRG3
levels/biological activity.
[0055] These and other objects, advantages and features of the
present invention will become apparent to those persons skilled in
the art upon reading the details of the structure, synthesis, and
usage as more fully set forth below. Each reference cited herein is
herein incorporated by reference in its entirety with particular
attention to the description of subject matter associated with the
context of the citation.
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] FIG. 1 shows the nucleic acid coding sequence of mouse NRG3
cDNA (mNRG3, SEQ ID NO:1) in which the start (ATG) and stop (TGA)
codons of the coding sequence are indicated by underlining.
[0057] FIG. 2 shows the nucleic acid coding sequence of human NRG3
cDNA (hNRG3B1, SEQ ID NO:5) in which the start (ATG) and stop (TGA)
codons of the coding sequence are indicated by underlining.
[0058] FIG. 3 shows the nucleic acid coding sequence of an
alternatively spliced form of human NRG3 cDNA (hNRG3B2; SEQ ID
NO:22) in which the start (ATG) and stop (TGA) codons of the coding
sequence are indicated by underlining.
[0059] FIGS. 4A-4B. FIG. 4A shows the deduced amino acid sequences
from mouse (mNRG3) and human (hNRG3B1) cDNA as shown in FIGS. 1 and
2. Mouse NRG3 deduced amino acid sequence is depicted by SEQ ID
NO:2 and human NRG3B1 deduced amino acid sequence is depicted by
SEQ ID NO:6. Various putative domains within the amino acid
sequences are shown. The EGF-like domain, the N-terminal
hydrophobic segment (double underline), the serine/threonine-rich
portion, and a predicted transmembrane domain (single underline)
are highlighted. FIG. 4B shows the deduced amino acid sequences
from hNRG3B1 and hNRG3B2 cDNA as shown in FIGS. 2 and 3. Human
NRGB1 deduced amino acid sequence is depicted by SEQ ID NO:6 and
human NRG3B2 deduced amino acid sequence is depicted by SEQ ID
NO:23. The region of the NRG3 amino acid sequence that differs
between the two human sequences is illustrated.
[0060] FIG. 5 shows a sequence alignment of the EGF-like domains of
human NRG3B1 (hNRG3.egf; SEQ ID NO:4); chicken ARIA (cARIA.egf; SEQ
ID NO:9); human amphiregulin (hAR.egf; SEQ ID NO:10); human
betacellulin (hBTC.egf; SEQ ID NO:11); human EGF (hEGF.egf; SEQ ID
NO:12); human heparin-binding EGF-like growth factor (hHB-EGF.egf;
SEQ ID NO:13); human heregulin-.alpha. (hHRG.alpha.; SEQ ID NO:14);
human heregulin-.beta. (hHRG.beta..egf; SEQ ID. NO:15); human
TGF-.alpha. (hTGF.alpha..egf; SEQ ID NO:16) and mouse epiregulin
(mEPR.egf; SEQ ID NO:17). The sequences were analyzed using
Sequence Analysis Programs, Genentech, Inc.
[0061] FIGS. 6A-6H are FACS plots demonstrating binding of
NRG3.sup.EGF.Fc to ErbB4 receptor expressed on the surface of
cells. In FIGS. 6A-6D, parental K562 cells (FIG. 6A) or K562 cells
expressing either ErbB2 receptor (K562.sup.erbB2 cells; FIG. 6B),
ErbB3 receptor (K562.sup.erbB3 cells; FIG. 6C) or ErbB4 receptor
(K562.sup.erbB4 cells; FIG. 6D) were examined for the expression of
corresponding receptors. Cells were incubated with anti-ErbB2
receptor, anti-ErbB3 receptor or anti-ErbB4 receptor antibodies as
indicated before PE-conjugated secondary antibody was added. "LOG
PE" represents relative fluorescent intensity and "Counts"
represents cell numbers. In FIGS. 6E-6H, NRG3.sup.EGF.Fc is shown
by FACS analysis to bind to ErbB4 receptor expressing cells.
Parental K562 cells (FIG. 6E), K562.sup.erbB2 cells (FIG. 6F),
K562.sup.erbB3 cells (FIG. 6G) and K562.sup.erbB4 cells (FIG. 6H)
were incubated with or without NRG3.sup.EGF.Fc (containing gD tag)
for 1 hour, followed by anti-gD-tag primary antibody and
PE-conjugated secondary antibody.
[0062] FIG. 7 is a graphical analysis showing competitive
inhibition of .sup.125I-NRG3.sup.EGF.Fc binding to immobilized
soluble ErbB4 receptor by NRG3.sup.EGF.Fc or NRG.sup.EGF. Soluble
ErbB4 receptor was immobilized on 96-well plates, and was incubated
with various concentrations of unlabeled NRG3.sup.EGF.Fc or
NRG.sup.EGF and constant amount of .sup.125I-labeled
NRG3.sup.EGF.Fc for 1.5 hour at room temperature. The fraction of
radioactivity bound over total .sup.125I-NRG3.sup.EGF.Fc input is
plotted against the concentration of competitor. Data of a
representative experiment from four independent assays is shown.
Error bars indicate standard deviation of quadruplicate
samples.
[0063] Before the present polypeptides, nucleic acids, vectors, and
host cells and processes for making such are described, it is to be
understood that this invention is not limited to the particular
compositions of matter and processes described, as such compounds
and methods may, of course, vary. It is also to be understood that
the terminology used herein is for the purpose of describing
particular embodiments only, and is not intended to be limiting
since the scope of the present invention will be limited only by
the appended claims.
DESCRIPTION OF THE EMBODIMENTS
Definitions
[0064] The phrases "novel neuregulin related ligand", "novel NRG3",
"novel ErbB4 receptor-specific NRG3" are used interchangeably and
refer to a new member of the family of neuregulins, which NRG3 is
expressed specifically in the brain and nervous system of the
embryo and adults, and to functional derivatives of such native
polypeptides.
[0065] The term "NRG3" or "neuregulin related ligand" is defined
herein to be any polypeptide sequence that possesses at least one
biological property (as defined below) of native amino acid
sequence NRG3 of SEQ ID NO:2 or 6 (mouse or human, respectively)
and additionally includes an alternatively spliced form of human
NRG3 having the amino acid sequence of SEQ ID NO:23. This
definition encompasses not only the polypeptide isolated from a
native NRG3 source such as human MDA-MB-175 cells or from another
source, such as another animal species or alternatively spliced
forms of NRG3, but also the polypeptide prepared by recombinant or
synthetic methods. It also includes variant forms including
functional derivatives, allelic variants, naturally occurring
isoforms and analogues thereof. Sometimes the NRG3 is "native NRG3"
which refers to endogenous NRG3 polypeptide which has been isolated
from a mammal. The NRG3 can also be "native sequence NRG3" insofar
as it has the same amino acid sequence as a native NRG3 (e.g. mouse
(SEQ ID NO:2) or human (SEQ ID NO:6 or SEQ ID NO:23) NRG3 shown in
FIGS. 4A and 4B). However, "native sequence NRG3" encompasses the
polypeptide produced by recombinant or synthetic means. "Mature
NRG3" is soluble or secreted NRG3 released from the cell (i.e.
lacking an N-terminal hydrophobic sequence). In this context, NRG3
refers to novel NRG3s comprising an EGF-like domain within an
extracellular domain, a transmembrane domain and a cytoplasmic
domain, with or without a native signal sequence, and naturally
occurring soluble forms of such NRG3s, with or without the
initiating methionine, whether purified from native source,
synthesized, produced by recombinant DNA technology or by any
combination of these and/or other methods. The native NRG3s of the
present invention specifically include the murine NRG3, the amino
acid sequence of which is shown in FIG. 4 (SEQ. ID. NO:2), and the
human NRG3s having the amino acid sequences shown in FIG. 4 (SEQ.
ID. NO:6 or SEQ ID NO:23), and fragments or mammalian homologues or
alternatively spliced forms of these native ligands. The novel
native murine and human NRG3s of the present invention are about
713 and 720 amino acids in length, respectively, and comprise an
EGF-like domain, the N-terminal hydrophobic segment, the
serine/threonine-rich portion, a predicted transmembrane domain,
and a predicted intracellular domain. The boundaries of these
domain are indicated in FIG. 4 for the novel murine and human NRG3
sequences.
[0066] Optionally, the NRG3 is not associated with native
glycosylation. "Native glycosylation" refers to the carbohydrate
moieties which are covalently attached to native NRG3 when it is
produced in the mammalian cell from which the native NRG3 is
derived. Accordingly, human NRG3 produced in a non-human could be
described as not being associated with native glycosylation, for
example it may be glycosylated other than the native glycosylation.
Sometimes, the NRG3 is not associated with any glycosylation
whatsoever (e.g. as a result of being produced recombinantly in a
prokaryote).
[0067] The term "EGF-like domain" refers to an extracellular
epidermal growth factor (EGF)-like domain of a polypeptide,
preferably a NRG3 polypeptide of the invention. The EGF-like domain
is sufficient to bind neuregulin receptors and stimulate cellular
responses (Holmes, W. E., et al. (1992) Science 256:1205-1210).
Preferably, an EGF-like domain of the NRG3 of the invention has the
amino acid sequence of the NRG3s shown in SEQ ID NO:4 (mouse or
human NRG3 EGF-like domain), where the EGF-like domain is from
about amino acid 284 to about amino acid 332 of human NRG3, and
from about amino acid 286 to about amino acid 334 of mouse NRG3.
The NRG3 of the invention encompasses a polypeptide encoded by an
alternatively spliced form the NRG3 encoding gene, which
alternatively spliced form comprises the NRG3 EGF-like domain.
[0068] The term "ErbB" when used herein refers to any one or more
of the mammalian ErbB receptors (i.e. ErbB1 or epidermal growth
factor (EGF) receptor; ErbB2 or HER2 receptor; ErbB3 or HER3
receptor; ErbB4 or HER4 receptor; and any other member(s) of this
class I tyrosine kinase family to be identified in the future) and
"erbB" refers to the mammalian erbB genes encoding these
receptors.
[0069] The terms "soluble form", "soluble receptor", "soluble
NRG3", "soluble NRG3", and grammatical variants thereof, refer to
variants of the native or variant NRG3s of the present invention
which are devoid of a functional transmembrane domain. In the
soluble receptors the transmembrane domain may be deleted,
truncated or otherwise inactivated such that they are not capable
of cell membrane anchorage. If desired, such soluble forms of the
NRG3s of the present invention might additionally have their
cytoplasmic domains fully or partially deleted or otherwise
inactivated.
[0070] A "functional derivative" of a polypeptide is a compound
having a qualitative biological activity in commons with the native
polypeptide. Thus, a functional derivative of a native novel NRG3
of the present invention is a compound that has a qualitative
biological activity in common with such native NRG3. "Functional
derivatives" include, but are not limited to, fragments of native
polypeptides from any animal species (including humans),
derivatives of native (human and non-human) polypeptides and their
fragments, and peptide and non-peptide analogs of native
polypeptides, provided that they have a biological activity in
common with a respective native polypeptide.
[0071] As used herein, the term "fragments" refers to regions
within the sequence of a mature native polypeptide. Preferably NRG3
fragments will have a consecutive sequence of at least 20, and more
preferably at least 50, amino acid residues of the EGF-like domain
of NRG3. The preferred fragments have about 30-150 amino acid
residues which are identical to a portion of the sequence of NRG3
in SEQ ID NO:2 (from mouse), or in SEQ ID NO:6 or SEQ ID NO:23
(from human). The term "derivative" is used to define amino acid
sequence and glycosylation variants, and covalent modifications of
a native polypeptide. "Non-peptide analogs" are organic compounds
which display substantially the same surface as peptide analogs of
the native polypeptides. Thus, the non-peptide analogs of the
native novel NRG3s of the present invention are organic compounds
which display substantially the same surface as peptide analogs of
the native NRG3s. Such compounds interact with other molecules in a
similar fashion as the peptide analogs, and mimic a biological
activity of a native NRG3 of the present invention. Preferably,
amino acid sequence variants of the present invention retain at
least one domain of a native NRG3, preferably an EGF-like domain,
or have at least about 60% amino acid. sequence identity, more
preferably at least about 75% amino acid sequence identity, and
most preferably at least about 90% amino acid sequence identity
with a domain of a native NRG3 of the present invention. The amino
acid sequence variants preferably show the highest degree of amino
acid sequence homology with the EGF-like domain of native NRG3s of
the present invention. These are the domains which show the highest
percentage amino acid conservation between the novel NRG3s of the
present invention and other members of the NRG3 family (see FIG.
4).
[0072] The terms "isolated" or "substantially pure" refer to a
polypeptide or nucleic acid which is free of other polypeptides or
nucleic acids as well as lipids, carbohydrates or other materials
with which it is naturally associated. An exception is made for
glycosylation wherein sugar moieties are covalently attached to
amino acids of the NRG3 polypeptide of the invention. One of
ordinary skill in the art can purify a NRG3 polypeptide or nucleic
acid encoding the polypeptide using standard techniques appropriate
for each type of molecule.
[0073] The term "percent amino acid sequence identity" with respect
to the NRG3 sequence is defined herein as the percentage of amino
acid residues in the candidate sequence that are identical with the
residues in the NRG3 sequence having the deduced amino acid
sequence described in FIG. 1, after aligning the sequences and
introducing gaps, if necessary, to achieve the maximum percent
sequence identity, and not considering any conservative
substitutions as part of the sequence identity. N-terminal,
C-terminal, or internal extensions, deletions, or insertions into
the NRG3 sequence shall be construed as affecting sequence identity
or homology.
[0074] Another type of NRG3 variant is "chimeric NRG3", which term
encompasses a polypeptide comprising full-length NRG3 or a fragment
thereof fused or bonded to a heterologous polypeptide. The chimera
will normally share at least one biological property with NRG3.
Examples of chimeric NRG3s include immunoadhesins and epitope
tagged NRG3. In another embodiment, the heterologous polypeptide is
thioredoxin, a salvage receptor binding epitope, cytotoxic
polypeptide or enzyme (e.g., one which converts a prodrug to an
active drug).
[0075] The terms "covalent modification" and "covalent derivatives"
are used interchangeably and include, but are not limited to,
modifications of a native polypeptide or a fragment thereof with an
organic proteinaceous or non-proteinaceous derivatizing agent,
fusions to heterologous polypeptide sequences, and
post-translational modifications. Covalent modifications are
traditionally introduced by reacting targeted amino acid residues
with an organic derivatizing agent that is capable of reacting with
selected sides or terminal residues, or by harnessing mechanisms of
post-translational modifications that function in selected
recombinant host cells. Certain post-translational modifications
are the result of the action of recombinant host cells on the
expressed polypeptide. Glutaminyl and asparaginyl residues are
frequently post-translationally deanidated to the corresponding
glutamyl and aspartyl residues. Alternatively, these residues are
deamidated under mildly acidic conditions. Other post-translational
modifications include hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl, tyrosyl or threonyl
residues, methylation of the .alpha.-amino groups of lysine,
arginine, and histidine side chains (T. E. Creighton (1983)
Proteins: Structure and Molecular Properties, W. H. Freeman &
Co., San Francisco, pp. 79-86). Covalent derivatives/modifications
specifically include fusion proteins comprising native NRG3
sequences of the present invention and their amino acid sequence
variants, such as immunoadhesins, and N-terminal fusions to
heterologous signal sequences.
[0076] The term "biological activity" in the context of the present
invention is defined as the possession of at least one adhesive,
regulatory or effector function qualitatively in common with a
native polypeptide. Preferred functional derivatives within the
scope of the present invention are unified by retaining an EGF-like
domain and ErbB4 receptor-specific binding of a native NRG3 of the
present invention.
[0077] The phrase "activating an ErbB receptor" refers to the act
of causing the intracellular kinase domain of an ErbB receptor to
phosphorylate tyrosine residues. Generally, this will involve
binding of NRG3 to an ErbB4 receptor or ErbB4 receptor homodimer,
which binding activates a kinase domain of one or more of the
receptors and thereby results in phosphorylation of tyrosine
residues in one or more of the receptors, and/or phosphorylation of
tyrosine residues in additional substrate polypeptide(s). ErbB
receptor phosphorylation can be quantified using the tyrosine
phosphorylation assays described below. It is understood that the
NRG3 of the invention may itself be activated by interaction with
an ErbB receptor via the intracellular domain of NRG3. Thus, an
NRG3-activating ligand that binds to the NRG3 (preferably binding
to the extracellular domain, more preferably the EGF-like domain)
includes, but is not limited to, a ligand, an antibody, or a
receptor. Activation of the NRG3 may be through phosphorylation of
the intracellular domain or other like event common to
receptor/ligand mediated cell signaling. As a mediator of cell
signaling, the NRG3 of the invention is expected to be associated
with apoptosis, metabolic signaling, differentiation or cell
proliferation.
[0078] "Identity" or "homology" with respect to a native
polypeptide and its functional derivative is defined herein as the
percentage of amino acid residues in the candidate sequence that
are identical with the residues of a corresponding native
polypeptide, after aligning the sequences and introducing gaps, if
necessary, to achieve the maximum percent homology, and not
considering any conservative substitutions as part of the sequence
identity. Neither N- or C-terminal extensions nor insertions shall
be construed as reducing identity or homology. Methods and computer
programs for the alignment are well known in the art. For example,
the sequences disclosed herein were analyzed using Sequence
Analysis Programs, Genentech, Inc, Inc.
[0079] The term "agonist" is used to refer to peptide and
non-peptide analogs of the native NRG3s of the present invention
and to antibodies specifically binding such native NRG3s provided
that they retain at least one biological activity of a native NRG3.
Preferably, the agonists of the present invention retain the
qualitative EGF-like domain binding recognition properties of the
native NRG3 polypeptides.
[0080] The term "antagonist" is used to refer to a molecule
inhibiting a biological activity of a native NRG3 of the present
invention. Preferably, the antagonists herein inhibit the binding
of a native NRG3 of the present invention. Preferred antagonists
essentially completely block the binding of a native NRG3 to an
ErbB4 receptor to which it otherwise binds. A NRG3 "antagonist" is
a molecule which prevents, or interferes with, a NRG3 effector
function (e.g. a molecule which prevents or interferes with binding
and/or activation of an ErbB4 receptor by NRG3). Such molecules can
be screened for their ability to competitively inhibit ErbB
receptor activation by NRG3 in the tyrosine phosphorylation assay
disclosed herein, for example. Preferred antagonists are those
which do not substantially interfere with the interaction of other
heregulin polypeptides with ErbB receptor(s). Examples of NRG3
antagonists include neutralizing antibodies against NRG3 and
antisense polynucleotides against the NRG3 gene.
[0081] Ordinarily, the terms "amino acid" and "amino acids" refer
to all naturally occurring L-.alpha.-amino acids. In some
embodiments, however, D-amino acids may be present in the
polypeptides or peptides of the present invention in order to
facilitate conformational restriction. For example, in order to
facilitate disulfide bond formation and stability, a D amino acid
cysteine may be provided at one or both termini of a peptide
functional derivative or peptide antagonist of the native NRG3s of
the present invention. The amino acids are identified by either the
single-letter or three-letter designations: TABLE-US-00001 Asp D
aspartic acid Thr T threonine Ser S serine Glu E glutamic acid Pro
P proline Gly G glycine Ala A alanine Cys C cysteine Val V valine
Met M methionine Ile I isoleucine Leu L leucine Tyr Y tyrosine Phe
F phenylalanine His H histidine Lys K lysine Arg R arginine Trp W
tryptophan Gln Q glutamine Asn N asparagine
[0082] The term "amino acid sequence variant" refers to molecules
with some differences in their amino acid sequences as compared to
a native amino acid sequence.
[0083] Substitutional variants are those that have at least one
amino acid residue in a native sequence removed and a different
amino acid inserted in its place at the same position.
[0084] Insertional variants are those with one or more amino acids
inserted immediately adjacent to an amino acid at a particular
position in a native sequence. Immediately adjacent to an amino
acid means connected to either the .alpha.-carboxy or .alpha.-amino
functional group of the amino acid.
[0085] Deletional variants are those with one or more amino acids
in the native amino acid sequence removed.
[0086] "Antibodies (Abs)" and "immunoglobulins (Igs)" are
glycoproteins having the same structural characteristics. While
antibodies exhibit binding specificity to a specific antigen,
immunoglobulins include both antibodies and other antibody-like
molecules which lack antigen specificity. Polypeptides of the
latter kind are, for example, produced at low levels by the lymph
system and at increased levels by myelomas.
[0087] Native antibodies and immunoglobulins are usually
heterotetrameric glycoproteins of about 150,000 Daltons, composed
of two identical light (L) chains and two identical heavy (H)
chains. Each light chain is linked to a heavy chain by one covalent
disulfide bond, while the number of disulfide linkages varies
between the heavy chains of different immunoglobulin isotypes. Each
heavy and light chain also has regularly spaced intrachain
disulfide bridges. Each heavy chain has at one end a variable
domain (V.sub.H) followed by a number of constant domains. Each
light chain has a variable domain at one and (V.sub.L) and a
constant domain at its other end; the constant domain of the light
chain is aligned with the first constant domain of the heavy chain,
and the light chain variable domain is aligned with the variable
domain of the heavy chain. Particular amino acid residues are
believed to form an interface between the light and heavy chain
variable domains (Clothia et al. (1985) J. Mol. Biol. 186, 651-663;
Novotny and Haber (1985) Proc. Natl. Acad. Sci. USA
82:4592-4596).
[0088] The light chains of antibodies (immunoglobulins) from any
vertebrate species can be assigned to one of two clearly distinct
types, called kappa and lambda (.lamda.), based on the amino acid
sequences of their constant domains.
[0089] Depending on the amino acid sequence of the constant domain
of their heavy chains, immunoglobulins can be assigned to different
classes. There are five major classes of immunoglobulins: IgA, IgD,
IgE, IgG and IgM, and several of these may be further divided into
subclasses (isotypes), e.g. IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1
and IgA-2. The heavy chain constant domains that correspond to the
different classes of immunoglobulins are called .alpha., delta,
epsilon, .gamma., and .mu., respectively. The subunit structures
and three-dimensional configurations of different classes of
immunoglobulins are well known.
[0090] The term "antibody" is used in the broadest sense and
specifically covers single monoclonal antibodies (including agonist
and antagonist antibodies), antibody compositions with polyepitopic
specificity, as well as antibody fragments (e.g., Fab,
F(ab').sub.2, and Fv), so long as they exhibit the desired
biological activity.
[0091] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally occurring
mutations that may be present in minor amounts. The modifier
"monoclonal" indicates the character of the antibody as being
obtained from a substantially homogeneous population of antibodies,
and is not to be construed as requiring production of the antibody
by any particular method. For example, the monoclonal antibodies to
be used in accordance with the present invention may be made by the
hybridoma method first described by Kohler and Milstein (1975)
Nature 256:495, or may be made by recombinant DNA methods (see,
e.g. U.S. Pat. No. 4,816,567 (Cabilly et al.) and Mage and Lamoyi
(1987) in Monoclonal Antibody Production Techniques and
Applications, pp. 79-97, Marcel Dekker, Inc., New York). The
monoclonal antibodies may also be isolated from phage libraries
generated using the techniques described in McCafferty et al.
(1990) Nature 348:552-554, for example.
[0092] "Humanized" forms of non-human.(e.g. murine) antibodies are
specific chimeric immunoglobulins, immunoglobulin chains or
fragments thereof (such as Fv, Fab, Fab', F(ab).sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from the complementarity determining regions
(CDRs) of the recipient antibody are replaced by residues from the
CDRs of a non-human species (donor antibody) such as mouse, rat or
rabbit having the desired specificity, affinity and capacity. In
some instances, Fv framework region (FR) residues of the human
immunoglobulin are replaced by corresponding non-human FR residues.
Furthermore, the humanized antibody may comprise residues which are
found neither in the recipient antibody nor in the imported CDR or
FR sequences. These modifications are made to further refine and
optimize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR residues are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin. For further
details see: Jones et al. (1986) Nature 321:522-525; Reichmann et
al. (1988) Nature 332:323-329; EP-B-239 400 published 30 September
1987; Presta (1992) Curr. Op. Struct. Biol. 2:593-596; and EP-B451
216 published Jan. 24, 1996), which references are herein
incorporated by reference in their entirety. The humanized antibody
includes a Primatized.TM. antibody wherein the antigen-binding
region of the antibody is derived from an antibody produced by
immunizing macaque monkeys with the antigen of interest.
[0093] By "neutralizing antibody" is meant an antibody molecule as
herein defined which is able to block or significantly reduce an
effector function of native sequence NRG3. For example, a
neutralizing antibody may inhibit or reduce the ability of NRG3 to
activate an ErbB receptor, preferably an ErbB4 receptor, in the
tyrosine phosphorylation assay described herein. The neutralizing
antibody may also block the mitogenic activity of NRG3 in the cell
proliferation assay disclosed herein.
[0094] The monoclonal antibodies herein specifically include
"chimeric" antibodies (immunoglobulins) in which a portion of the
heavy and/or light chain is identical with or homologous to
corresponding sequences in antibodies derived from a particular
species or belonging to a particular antibody class or subclass,
while the remainder of the chain(s) is identical with or homologous
to corresponding sequences in antibodies derived from another
species or belonging to another antibody class or subclass, as well
as fragments of such antibodies, so long as they exhibit the
desired biological activity (U.S. Pat. No. 4,816,567 (Cabilly et
al.; Morrison et al. (1984) Proc. Natl. Acad. Sci. USA
81:6851-6855).
[0095] In the context of the present invention the expressions
"cell", "cell line", and "cell culture" and "host cell" are used
interchangeably, and all such designations include progeny. It is
also understood that all progeny may not be precisely identical in
DNA content, due to deliberate or inadvertent mutations. Mutant
progeny that have the same function or biological property, as
screened for in the originally transformed cell, are included.
Methods of stable transfer, meaning that the foreign DNA is
continuously maintained in the host, are known in the art.
[0096] The terms "replicable expression vector", "expression
vector" and "vector" refer to a piece of DNA, usually
double-stranded, which may have inserted into it a piece of foreign
DNA. Foreign DNA is defined as heterologous DNA, which is DNA not
naturally found in the host cell. The vector is used to transport
the foreign or heterologous DNA into a suitable host cell. Once in
the host cell, the vector can replicate independently of the host
chromosomal DNA, and several copies of the vector and its inserted
(foreign) DNA may be generated. In addition, the vector contains
the necessary elements that permit translating the foreign DNA into
a polypeptide. Many molecules of the polypeptide encoded by the
foreign DNA can thus be rapidly synthesized.
[0097] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, a ribosome binding site, and
possibly, other as yet poorly understood sequences. Eukaryotic
cells are known to utilize promoters, polyadenylation signals, and
enhancer.
[0098] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or a secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, then synthetic oligonucleotide adaptors or linkers are used
in accord with conventional practice.
[0099] "Oligonucleotides" are short-length, single- or
double-stranded polydeoxynucleotides that are chemically
synthesized by known methods, such as phosphotriester, phosphite,
or phosphoramidite chemistry, using solid phase techniques such as
those described in EP 266,032, published May 4, 1988, or via
deoxynucleoside H-phosphanate intermediates as described by
Froehler et al. (1986) Nucl. Acids Res. 14:5399. They are then
purified on polyacrylamide gels.
[0100] By "solid phase" is meant a non-aqueous matrix to which a
reagent of interest (e.g., NRG3 or an antibody thereto) can adhere.
Examples of solid phases encompassed herein include those formed
partially or entirely of glass (e.g., controlled pore glass),
polysaccharides (e.g., agarose), polyacrylamides, polystyrene,
polyvinyl alcohol and silicones. In certain embodiments, depending
on the context, the solid phase can comprise the well of an assay
plate; in others it is a purification column (e.g., an affinity
chromatography column). This term also includes a discontinuous
solid phase of discrete particles, such as those described in U.S.
Pat. No. 4,275,149, herein incorporated by reference in its
entirety.
[0101] The terms "transformation" and "transfection" are used
interchangeably herein and refer to the process of introducing DNA
into a cell. Following transformation or transfection, the NRG3 DNA
may integrate into the host cell genome, or may exist as an
extrachromosomal element. If prokaryotic cells or cells that
contain substantial cell wall constructions are used as hosts, the
preferred methods of transfection of the cells with DNA is the
calcium treatment method described by Cohen et al. (1972) Proc.
Natl. Acad. Sci. U.S.A., 69:2110-2114 or the polyethylene glycol
method of Chung et al. (1988) Nuc. Acids. Res. 16:3580. If yeast
are used as the host, transfection is generally accomplished using
polyethylene glycol, as taught by Hinnen (1978) Proc. Natl. Acad.
Sci. U.S.A. 75:1929-1933. If mammalian cells are used as host
cells, transfection generally is carried out by the calcium
phosphate precipitation method, Graham et al. (1978) Virology
52:546, Gorman et al. (1990) DNA and Protein Eng. Tech. 2:3-10.
However, other known methods for introducing DNA into prokaryotic
and eukaryotic cells, such as nuclear injection, electroporation,
or protoplast fusion also are suitable for use in this
invention.
[0102] Particularly useful in this invention are expression vectors
that provide for the transient expression in mammalian cells of DNA
encoding NRG3. In general, transient expression involves the use of
an expression vector that is able to efficiently replicate in a
host cell, such that the host cell accumulates many copies of the
expression vector and, in turn, synthesizes high levels of a
desired polypeptide encoded by the expression vector. Transient
expression systems, comprising a suitable expression vector and a
host cell, allow for the convenient positive identification of
polypeptides encoded by cloned DNAs, as well as for the rapid
screening of such polypeptides for desired biological or
physiological properties.
[0103] It is further envisioned that the NRG3 of this invention may
be produced by homologous recombination, as provided for in WO
91/06667, published May 16, 1991. Briefly, this method involves
transforming a cell containing an endogenous NRG3 gene with a
homologous DNA, which homologous DNA comprises (a) an amplifiable
gene (e.g. a gene encoding dihydrofolate reductase (DHFR)), and (b)
at least one flanking sequence, having a length of at least about
150 base pairs, which is homologous with a nucleotide sequence in
the cell genome that is within or in proximity to the gene encoding
NRG3. The transformation is carried out under conditions such that
the homologous DNA integrates into the cell genome by
recombination. Cells having integrated the homologous DNA are then
subjected to conditions which select for amplification of the
amplifiable gene, whereby the NRG3 gene is amplified concomitantly.
The resulting cells are then screened for production of desired
amounts of NRG3. Flanking sequences that are in proximity to a gene
encoding NRG3 are readily identified, for example, by the method of
genomic walking, using as a starting point the nucleotide sequence,
or fragment thereof, of mouse NRG3 of FIG. 1 (SEQ ID NO:1), or
human NRG3 of FIG. 2 (SEQ ID NO:5) or FIG. 3 (SEQ ID NO:22). DNA
encoding the mouse and human NRG3 polypeptides is deposited with
the American Type Culture Collection as ATCC 209156 (mouse;
pLXSN.mNRG3), ATCC 209157 (human; pRK5.tk.neo.hNRG3B1), or ATCC
209297 (human; pRK5.tk.neo.hNRG3B2).
[0104] The expression "enhancing survival of a cell" refers to the
act of increasing the period of existence of a cell, relative to an
untreated cell which has not been exposed to NRG3, either in vitro
or in vivo.
[0105] The phrase "enhancing proliferation of a cell" encompasses
the step of increasing the extent of growth and/or reproduction of
the cell, relative to an untreated cell, either in vitro or in
vivo. An increase in cell proliferation in cell culture can be
detected by counting the number of cells before and after exposure
to NRG3 (see the Example below). The extent of proliferation can be
quantified via microscopic examination of the degree of confluency.
Cell proliferation can also be quantified by measuring .sup.3H
uptake by the cells.
[0106] By "enhancing differentiation of a cell" is meant the act of
increasing the extent of the acquisition or possession of one or
more characteristics or functions which differ from that of the
original cell (i.e. cell specialization). This can be detected by
screening for a change in the phenotype of the cell (e.g.
identifying morphological changes in the cell).
[0107] "Muscle cells" include skeletal, cardiac or smooth muscle
tissue cells. This term encompasses those cells which differentiate
to form more specialized muscle cells (e.g. myoblasts).
[0108] "Isolated NRG3 nucleic acid" is RNA or DNA free from at
least one contaminating source nucleic acid with which it is
normally associated in the natural source and preferably
substantially free of any other mammalian RNA or DNA. The phrase
"free from at least one contaminating source nucleic acid with
which it is normally associated" includes the case where the
nucleic acid is present in the source or natural cell but is in a
different chromosomal location or is otherwise flanked by nucleic
acid sequences not normally found in the source cell. An example of
isolated NRG3 nucleic acid is RNA or DNA that encodes a
biologically active NRG3 sharing at least 75% , more preferably at
least 80% , still more preferably at least 85% , even more
preferably 90% , and most preferably 95% sequence identity with the
mouse NRG3 shown in FIG. 1 (SEQ ID NO:1), or human NRG3 shown in
FIG. 2 (SEQ ID NO:4) or FIG. 3 (SEQ ID NO:22).
[0109] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0110] Hybridization is preferably performed under "stringent
conditions" which means (1) employing low ionic strength and high
temperature for washing, for example, 0.015 sodium chloride/0.0015
M sodium citrate/0.1% sodium dodecyl sulfate at 50.degree. C., or
(2) employing during hybridization a denaturing agent, such as
formamide, for example, 50% (vol/vol) formaamidce with 0.1% bovine
serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 nM sodium
phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM
sodium citrate at 42.degree. C. Another example is use of 50%
formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM
sodium phosphate (pH 6/8), 0.1% sodium pyrophosphate, 5.times.
Denhardt's solution, sonicated salmon sperm DNA (50 .mu.g/ml), 0.1%
SDS, and 10% dextran sulfate at 42.degree. C., with washes at
42.degree. C. in 0.2.times.SSC and 0.1% SDS. Yet another example is
hybridization using a buffer of 10% dextran sulfate, 2.times.SSC
(sodium chloride/sodium citrate) and 50% formamide at 55.degree.
C., followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C.
[0111] "Immunoadhesins" or "NRG3-immunoglobulin chimeras" are
chimeric antibody-like molecules that combine the functional
domain(s) of a binding protein (usually a receptor, a cell-adhesion
molecule or a ligand) with the an immunoglobulin sequence. The most
common example of this type of fusion protein combines the hinge
and Fc regions of an immunoglobulin (Ig) with domains of a
cell-surface receptor that recognizes a specific ligand. This type
of molecule is called an "immunoadhesin", because it combines
"immune" and "adhesion" functions; other frequently used names are
"Ig-chimera", or "Ig-" or "Fc-fusion protein", or
"receptor-globulin."
[0112] "Treatment" refers to both therapeutic treatment and
prophylactic or preventative measures. those in need of treatment
include those already with the disorder as well as those prone to
have the disorder of those in which the disorder is to be
prevented.
[0113] "Mammal" for purposes of treatment refers to any animal
classified as a mammal, including humans, domestic and farm
animals, and zoo, sports, or pet animals, such as sheep, dogs,
horses, cats, cows, and the like. Preferably, the mammal herein is
a human.
[0114] "Carriers" as used herein include pharmaceutically
acceptable carriers, excipients, or stabilizers which are nontoxic
to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often the physiologically acceptable
carrier is an aqueous pH buffered solution. Examples of
physiologically acceptable carriers include buffers such as
phosphate, citrate, and other organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues)
polypeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone;
amino acids such as glycine, glutamine, asparagine, arginine or
lysine; monosaccharides, disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as
EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming
counterions such as sodium; and/or nonionic surfactants such as
Tween.TM., polyethylene glycol (PEG), and Pluronics.TM..
General Procedures for the Production of an NRG3 by Recombinant DNA
Technology
[0115] A. Identification and Isolation of Nucleic Acid Encoding
Novel Neuregulin Related Ligand, NRG3.
[0116] The native NRG3s of the present invention may be isolated
from cDNA or genomic libraries. For example, a suitable cDNA
library can be constructed by obtaining polyadenylated mRNA from
cells known to express the desired NRG3, and using the mRNA as a
template to synthesize double stranded cDNA. Suitable sources of
the mRNA are embryonic and adult mammalian tissues. mRNA encoding
native NRG3s of the present invention is expressed, for example, in
adult mammalian, brain, nervous system, heart, muscle, and testis.
The gene encoding the novel NRG3s of the present invention can also
be obtained from a genomic library, such as a human genomic cosmid
library, or a mouse-derived embryonic stem cell (ES) genomic
library.
[0117] Libraries, either cDNA or genomic, are screened with probes
designed to identify the gene of interest or the protein encoded by
it. For cDNA expression libraries, suitable probes include
monoclonal and polyclonal antibodies that recognize and
specifically bind to a NRG3 of the invention. For cDNA libraries,
suitable probes include carefully selected oligonucleotide probes
(usually of about 20-80 bases in length) that encode known or
suspected portions of a NRG3 polypeptide from the same or different
species, and/or complementary or homologous cDNAs or fragments
thereof that encode the same or a similar gene. Appropriate probes
for screening genomic DNA libraries include, without limitation,
oligonucleotides, cDNAs, or fragments thereof that encode the same
or a similar gene, and/or homologous genomic DNAs or fragments
thereof. Screening the cDNA or genomic library with the selected
probe may be conducted using standard procedures as described in
Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory
Manual, New York, Cold Spring Harbor Laboratory Press, 1989, herein
incorporated by reference in its entirety.
[0118] If DNA encoding a NRG3 of the present invention is isolated
by using carefully selected oligonucleotide sequences to screen
cDNA libraries from various tissues, the oligonucleotide sequences
selected as probes should be sufficient in length and sufficiently
unambiguous that false positive selections are minimized. The
actual nucleotide sequence(s) is/are usually designed based on
regions that have the least codon redundance. The oligonucleotides
may be degenerate at one or more positions. The use of degenerate
oligonucleotides is of particular importance where a library is
screened from a species in which preferential codon usage is not
known.
[0119] The oligonucleotide must be labeled such that it can be
detected upon hybridization to DNA in the library being screened.
The preferred method of labeling is to use ATP (e.g.
.gamma..sup.32P) and polynucleotide kinase to radiolabel the 5' end
of the oligonucleotide. However, other methods may be used to label
the oligonucleotide, including, but not limited to, biotinylation
or enzyme labeling.
[0120] cDNAs encoding the novel NRG3s can also be identified and
isolated by other known techniques of recombinant DNA technology,
such as by direct expression cloning, or by using the polymerase
chain reaction (PCR) as described in U.S. Pat. No. 4,683,195,
issued Jul. 28, 1987, in section 14 of Sambrook et al., supra, or
in Chapter 15 of Current Protocols in Molecular Biology, Ausubel et
al. eds., Greene Publishing Associates and Wiley-Interscience 1991,
which references are herein incorporated by reference in their
entirety.
[0121] Once cDNA encoding a new native ErbB4 receptor-specific NRG3
from one species has been isolated, cDNAs from other species can
also be obtained by cross-species hybridization. According to this
approach, human or other mammalian cDNA or genomic libraries are
probed by labeled oligonucleotide sequences selected from known
NRG3 sequences (such as murine or human sequences) in accord with
known criteria. Preferably, the probe sequence should be sufficient
in length and sufficiently unambiguous that false positives are
minimized. Typically, a .sup.32P-labeled oligonucleotide having
about 30 to 50 bases is sufficient, particularly if the
oligonucleotide contains one or more codons for methionine or
tryptophan. Isolated nucleic acid will be DNA that is identified
and separated from contaminant nucleic acid encoding other
polypeptides from the source of nucleic acid. Hybridization is
preferably performed under "stringent conditions", as defined
herein.
[0122] Once the sequence is known, the gene encoding a particular
NRG3 can also be obtained by chemical synthesis, following one of
the methods described in Engels and Uhlmann, Agnew (1989) Chem.
Int. Ed. Engl. 28:716, herein incorporated by reference in its
entirety. These methods include triester, phosphite,
phosphoramidite and H-phosphonate methods, PCR and other autoprimer
methods, and oligonucleotide syntheses on solid supports.
[0123] B. Cloning and Expression of Nucleic Acid Encoding the Novel
NRG3s.
[0124] Once the nucleic acid encoding a novel NRG3 is available, it
is generally ligated into a replicable expression vector for
further cloning (amplification of the DNA), or for expression.
[0125] Expression and cloning vectors are well known in the art and
contain a nucleic acid sequence that enables the vector to
replicate in one or more selected host cells. The selection of the
appropriate vector will depend on 1) whether it is to be used for
DNA amplification or for DNA expression, 2) the size of the DNA to
be inserted into the vector, and 3) the host cell to be transformed
with the vector. Each vector contains various components depending
on its function (amplification of DNA of expression of DNA) and the
host cell for which it is compatible. The vector components
generally include, but are not limited to, one or more of the
following: a signal sequence, an origin of replication, one or more
marker genes, an enhancer element, a promoter, and a transcription
termination sequence. Construction of suitable vectors containing
one or more of the above listed components, the desired coding and
control sequences, employs standard ligation techniques. Isolated
plasmids or DNA fragments are cleaved, tailored, and religated in
the form desired to generate the plasmids required. For analysis to
confirm correct sequences in plasmids constructed, the ligation
mixtures are commonly used to transform E. coli cells, e.g. E. coli
K12 strain 294 (ATCC 31,446) and successful transformants selected
by ampicillin or tetracycline resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by
restriction endonuclease digestion, and/or sequenced by the method
of Messing et al. (1981) Nucleic Acids Res. 9:309 or by the method
of Maxam et al. (1980) Methods in Enzymology 65:499.
[0126] The polypeptides of the present invention may be expressed
in a variety of prokaryotic and eukaryotic host cells. Suitable
prokaryotes include gram negative or gram positive organisms, for
example E. coli or bacilli. A preferred cloning host is E. coli 294
(ATCC 31,446) although other gram negative or gram positive
prokaryotes such as E. coli B, E. coli X1776 (ATCC 31,537), E. coli
W3110 (ATCC 27,325), Pseudomonas species, or Serratia Marcesans are
suitable.
[0127] In addition to prokayotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable hosts for vectors herein.
Saccharomyces cerevisiae, or common baker's yeast, is the most
commonly used among lower eukaryotic host microorganisms. However,
a number of other genera, species and strains are commonly
available and useful herein, such as S. pombe (Beach and Nurse
(1981) Nature 290:140), Kluyveromyces lactis (Louvencourt et al.
(1983) J. Bacteriol. 737); yarrowia (EP 402,226); Pichia pastoris
(EP 183,070), Trichoderma reesia (EP 244,234), Neurospora crassa
(Case et al. (1979) Proc. Natl. Acad. Sci. USA 76:5259-5263); and
Aspergillus hosts such as A. nidulans (Ballance et al. (1983)
Biochem. Biophys. Res. Commun. 112:284-289; Tilburn et al. (1983)
Gene 26:205-221; Yelton et al. (1984) Proc. Natl. Acad. Sci. USA
81:1470-1474) and A. niger (Kelly and Hynes (1985) EMBO J.
4:475-479).
[0128] Suitable host cells may also derive from multicellular
organisms. Such host cells are capable of complex processing and
glycosylation activities. In principle, any higher eukaryotic cell
culture is workable, whether from vertebrate or invertebrate
culture, although cells from mammals such as humans are preferred.
Examples of invertebrate cells include plants and insect cells.
Numerous baculoviral strains and variants and corresponding
permissive insect host cells from hosts such as Spodoptera
frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes
albopictus (mosquito), Drosophila melangaster (fruitfly), and
Bombyx mori host cells have been identified. See, e.g. Luckow et
al. (1988) Bio/Technology 6:47-55; Miller et al., in Genetic
Engineering, Setlow, J. K. et al., eds., Vol. 8 (Plenum Publishing,
1986), pp. 277-279; and Maeda et al. (1985) Nature 315:592-594. A
variety of such viral strains are publicly available, e.g. the L-1
variant of Autographa californica NPV, and such viruses may be used
as the virus herein according to the present invention,
particularly for transfection of Spodoptera frugiperda cells.
[0129] Plant cell cultures of cotton, corn, potato, soybean,
petunia, tomato, and tobacco can be utilized as hosts. Typically,
plant cells are transfected by incubation with certain strains of
the bacterium Agrobacterium tumefaciens, which has been previously
manipulated to contain the NRG3 DNA. During incubation of the plant
cell culture with A. tumefaciens, the DNA encoding a NRG3 is
transferred to the plant cell host such that it is transfected, and
will, under appropriate conditions, express the NRG3, DNA. In
addition; regulatory and signal sequences compatible with plant
cells are available, such as the nopaline synthase promoter and
polyadenylation signal sequences. Depicker et al. (1982) J. Mol.
Appl. Gen. 1:561. In addition, DNA segments isolated from the
upstream region of the T-DNA 780 gene are capable of activating or
increasing transcription levels of plant-expressible genes in
recombinant DNA-containing plant tissue. See EP 321,196 published
Jun. 21, 1989.
[0130] However, interest has been greatest in vertebrate cells, and
propagation of vertebrate cells in culture (tissue culture) is per
se well known (see for example, Tissue Culture, Academic Press,
Kruse and Patterson, editors (1973)). Examples of useful mammalian
host cell lines are monkey kidney CV1 line transformed by SV40
(COS-7, ATCC CRL 1651); human embryonic kidney cell line (293 or
293 cells subcloned for growth in suspension culture, Graham et al.
1977) J. Gen. Virol. 36:59); baby hamster kidney cells (BHK, ATCC
CCL 10); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin
(1980) Proc. Natl. Acad. Sci. USA 77:4216); mouse sertolli cells
(TM4, Mather (1980) Biol. Reprod. 23:243-251); monkey kidney cells
(CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC
CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2);
canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells
(BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL75); human
liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562,
ATCC CCL51); TRI cells (Mather et al. (1982) Annals N.Y. Acad. Sci.
383:44068); MRC 5 cells; FS4 cells; and a human hepatoma cell line
(Hep G2). Preferred host cells are human embryonic kidney 293 and
Chinese hamster ovary cells.
[0131] Particularly useful in the practice of this invention are
expression vectors that provide for the expression in mammalian
cells of DNA encoding a novel NRG3 herein. Where transient
expression is preferred, expression involves the use of an
expression vector that is able to replicate efficiently in a host
cell, such that the host cell accumulates many copies of the
expression vector and, in turn, synthesizes high levels of a
desired polypeptide encoded by the expression vector. Transient
systems, comprising a suitable expression vector and a host cell,
allow for the convenient positive identification of polypeptides
encoded by cloned DNAs, as well as for the rapid screening of such
polypeptides for desired biological or physiological properties.
Thus, transient expression systems are particularly useful in the
invention for purposes of identifying analogs and variants of a
native NRG3 of the invention.
[0132] Other methods, vectors, and host cells suitable for
adaptation to the synthesis of the NRG3s in recombinant vertebrate
cell culture are described for example, in Getting et al. (1981)
Nature 293:620-625; Mantel et al. (1979) Nature 281:40-46; Levinson
et al.; EP 117,060 and EP 117,058. Particularly useful plasmids for
mammalian cell culture expression of the NRG3 polypeptides are pRK5
(EP 307,247), or pSVI6B (PCT Publication No. WO 91/08291).
[0133] Other cloning and expression vectors suitable for the
expression of the NRG3s of the present invention in a variety of
host cells are, for example, described in EP 457,758 published Nov.
27, 1991. A large variety of expression vectors is now commercially
available. An exemplary commercial yeast expression vector is
pPIC.9 (Invitrogen), while an commercially available expression
vector suitable for transformation of E. coli cells is PET15b
(Novagen).
[0134] C. Culturing the Host Cells.
[0135] Prokaryote cells used to produced the NRG3s of this
invention are cultured in suitable media as describe generally in
Sambrook et al., supra.
[0136] Mammalian cells can be cultured in a variety of media.
Commercially available media such as Ham's F10 (Sigma), Minimal
Essential Medium (MEM, Sigma), RPMI-1640 (Sigma), and Dulbecco's
Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing
the host cells. In addition, any of the media described in Ham and
Wallace (1979) Meth. Enzymol. 58:44; Barnes and Sato (1980) Anal.
Biochem. 102:255, U.S. Pat. No. 4,767,704; 4,657,866; 4,927,762; or
4,560,655; WO 90/03430; WO 87/00195 or U.S. Pat. Re. 30,985 may be
used as culture media for the host cells. Any of these media may be
supplemented as necessary with hormones and/or other growth factors
(such as insulin, transferrin, or epidermal growth factor), salts
(such as sodium chloride, calcium, magnesium, and phosphate),
buffers (such as HEPES), nucleosides (such as adenosine and
thymidine), antibiotics (such as Gentamycin.TM. drug) trace
elements (defined as inorganic compounds usually present at final
concentrations in the micromolar range), and glucose or an
equivalent energy source. Any other necessary supplements may also
be included at appropriate concentrations that would be known to
those skilled in the art. The culture conditions, such as
temperature, pH and the like, suitably are those previously used
with the host cell selected for cloning or expression, as the case
may be, and will be apparent to the ordinary artisan.
[0137] The host cells referred to in this disclosure encompass
cells in in vitro cell culture as well as cells that are within a
host animal or plant.
[0138] It is further envisioned that the NRG3s of this invention
may be produced by homologous recombination, or with recombinant
production methods utilizing control elements introduced into cells
already containing DNA encoding the particular NRG3.
[0139] D. Detecting Gene Amplification and/or Expression.
[0140] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription of mRNA (Thomas
(1980) Proc. Natl. Acad. Sci. USA 77:5201-5205), dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Various labels may
be employed, most commonly radioisotopes, particularly .sup.32P.
However, other techniques may also be employed, such as using
biotin-modified nucleotides for introduction into a polynucleotide.
The biotin then serves as a site for binding to avidin or
antibodies, which may be labeled with a wide variety of labels,
such as radionuclides, fluorescers, enzymes, or the like.
Alternatively, antibodies may be employed that can recognize
specific duplexes, including DNA duplexes, RNA duplexes, and
DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in
turn may be labeled and the assay may be carried out where the
duplex is bound to the surface, so that upon the formation of
duplex on the surface, the presence of antibody bound to the duplex
can be detected.
[0141] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
tissue sections and assay of cell culture or body fluids, to
quantitate directly the expression of gene product. A particularly
sensitive staining technique suitable for use in the present
invention is described by Hse et al. (1980) Am. J. Clin. Pharm.
75:734-738.
[0142] Antibodies useful for immunohistochemical staining and/or
assay of sample fluids may be either monoclonal or polyclonal, and
may be prepared in any animal. Conveniently, the antibodies may be
prepared against a native NRG3 polypeptide, or against a synthetic
peptide based on the DNA sequence disclosed herein.
[0143] E. Amino Acid Sequence Variants of a Native NRG3.
[0144] Amino acid sequence variants of native NRG3s are prepared by
methods known in the art by introducing appropriate nucleotide
changes into a native NRG3 DNA, or by in vitro synthesis of the
desired polypeptide. There are two principal variables in the
construction of amino acid sequence variants: the location of the
mutation site and the nature of the mutation. With the exception of
naturally-occurring alleles, which do not require the manipulation
of the DNA sequence encoding the native NRG3, the amino acid
sequence variants of NRG3s are preferably constructed by mutating
the DNA, either to arrive at an allele or an amino acid sequence
variant that does not occur in nature.
[0145] One group of mutations will be created within the
extracellular domain or within the EGF-like domain of a novel
native mouse or human NRG3 of the present invention (see FIG. 3 for
the delineation of the extracellular domain (SEQ ID NO:3 or SEQ ID
NO:7) and EGF-like domain (SEQ ID NO:4) within human or mouse NRG3
amino acid sequences, respectively. Since these domains are
believed to be functionally important, alterations such as
non-conservative substitutions, insertions and/or deletions in
these regions are expected to result in genuine changes in the
properties of the native receptor molecules such as in ErbB4
receptor binding and activation. Accordingly, amino acid
alterations in this region are also believed to result in variants
with properties significantly different from the corresponding
native polypeptides. Non-conservative substitutions within these
functionally important domains may result in variants which lose
the ErbB4 receptor recognition and binding ability of their native
counterparts, or have increased ErbB4 receptor recognition
properties, enhanced selectivity, or enhanced activation properties
as compared to the corresponding native proteins.
[0146] Alternatively or in addition, amino acid alterations can be
made at sites that differ in novel NRG3s from various species, or
in highly conserved regions, depending on the goal to be achieved.
Sites at such locations will typically be modified in series, e.g.
by (1) substituting first with conservative choices and then with
more radical selections depending upon the results achieved, (2)
deleting the target residue or residues, or (3) inserting residues
of the same or different class adjacent to the located site, or
combinations of options 1-3. One helpful technique for such
modifications is called "alanine scanning" (Cunningham and Wells
(1989) Science 244:1081-1085).
[0147] In yet another group of the variant NRG3s of the present
invention, one or more of the functionally less significant domains
may be deleted or inactivated. For example, the deletion or
inactivation of the transmembrane domain yields soluble variants of
the native proteins. Alternatively, or in addition, the cytoplasmic
domain may be deleted, truncated or otherwise altered.
[0148] Naturally-occurring amino acids are divided into groups
based on common side chain properties: [0149] (1) hydrophobic:
norleucine, met, ala, val, leu, ile; [0150] (2) neutral
hydrophobic: cys, ser, thr; [0151] (3) acidic: asp, glu; [0152] (4)
basic: asn, gin, his, lys, arg; [0153] (5) residues that influence
chain orientation: gly, pro; and [0154] (6) aromatic: trp, tyr,
phe.
[0155] Conservative substitutions involve exchanging a member
within one group for another member within the same group, whereas
non-conservative substitutions will entail exchanging a member of
one of these classes for another. Substantial changes in function
or immunological identity are made by NRG3 substitutions that are
less conservative, i.e. differ more significantly in their effect
on maintaining (a) the structure of the polypeptide backbone in the
area of substitution, for example as a sheet or helical
conformation, (b) the charge or hydrophobicity of the molecule at
the target site or (c) the bulk of the side chain. The
substitutions which in general are expected to produce the greatest
changes in the properties of the novel native NRG3s of the present
invention will be those in which (a) a hydrophilic residue, e.g.
seryl or threonyl, is substituted for (or by) a hydrophobic
residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b)
a cysteine or proline is substituted for (or by) any other residue;
(c) a residue having an electropositive side chain, e.g. lysyl,
arginyl, or histidyl, is substituted for (or by) an electronegative
residue, e.g., glutamyl or aspartyl; or (d) a residue having a
bulky side chain, e.g., phenylalanine, is substituted for (or by)
one not having a side chain, e.g. glycine. Such substitutions are
expected to have their most significant effect when made within the
extracellular domain, such as in the EGF-like domain.
[0156] Substitutional variants of the novel NRG3s of the present
invention also include variants where functionally homologous
(having at least about 40%-50% homology) domains of other proteins
are substituted by routine methods for one or more of the
above-identified domains within the novel NRG3 structure, such as
the extracellular domain or EGF-like domain.
[0157] Amino acid sequence deletions generally range from about 1
to 30 residues, more preferably about 1 to 10 residues, and
typically are contiguous. Typically, the transmembrane and
cytoplasmic domains, or only the transmembrane domains are deleted.
However, deletion from the C-terminus to any suitable amino acid
N-terminal to the transmembrane region which preserves the
biological activity or immunological cross-reactivity of a native
NRG3 is suitable. The transmembrane region (TM) of each of the
human and mouse NRG3 consensus sequences is shown in FIGS. 4A and
4B to range from about amino acid 362 to about amino acid 384
(human SEQ ID NO:6 and SEQ ID NO:23), and about amino acid 360 to
about amino acid 382 (mouse SEQ ID NO:2).
[0158] A preferred class of substitutional and/or deletional
variants of the present invention are those involving a
transmembrane region of a novel NRG3 molecule. Transmembrane
regions are highly hydrophobic or lipophilic domains that are the
proper size to span the lipid bilayer of the cellular membrane.
They are believed to anchor the NRG3 in the cell membrane, and
allow for homo- or heteropolymeric complex formation. Inactivation
of the transmembrane domain, typically by deletion or substitution
of transmembrane domain hydroxylation residues, will facilitate
recovery and formulation by reducing its cellular or membrane lipid
affinity and improving its aqueous solubility. If the transmembrane
and cytoplasmic domains are deleted one avoids the introduction of
potentially immunogenic epitopes, whether by exposure of otherwise
intracellular polypeptides that might be recognized by the body as
foreign or by insertion of heterologous polypeptides that are
potentially immunogenic. Inactivation of the membrane insertion
function is accomplished by deletion of sufficient residues to
produce a substantially hydrophilic hydropathy profile in the
transmembrane or by substituting with heterologous residues which
accomplish the same result.
[0159] A principle advantage of the transmembrane inactivated
variants of the NRG3s of the present invention is that they may be
secreted into the culture medium of recombinant hosts. These
variants are soluble in body fluids such as blood and do not have
an appreciable affinity for cell membrane lipids, thus considerably
simplifying their recovery from recombinant cell culture. As a
general proposition, such soluble variants will retain a functional
extracellular domain or fragment thereof, will not have a
functional transmembrane domain, and preferably will not have a
functional cytoplasmic domain.
[0160] For example, the transmembrane domain may be substituted by
any amino acid sequence, e.g. a random or predetermined sequences
of about 5 to 50 serine, threonine, lysine, arginine, glutamine,
aspartic acid and like hydrophilic residues, which altogether
exhibit a hydrophilic hydropathy profile. Like the deletional
(truncated) soluble variants, these variants are secreted into the
culture medium of recombinant hosts.
[0161] Amino acid insertions include amino- and/or
carboxyl-terminal fusions ranging in length from one residue to
polypeptides containing a hundred or more residues, as well as
intrasequence insertions of single or multiple amino acid residues.
Intrasequence insertions (i.e. insertions within the novel NRG3
amino acid sequence) may range generally from about 1 to 10
residues, more preferably 1 to 5 residues, more preferably 1 to 3
residues. An example of a terminal insertion includes fusion of a
heterologous N-terminal signal sequence to the N-terminus of the
NRG3 molecule to facilitate the secretion of the mature NRG3 or a
fragment thereof from recombinant host cells. Such signal sequences
will generally be obtained from, and thus be homologous to, a
signal sequence of the intended host cell species. Suitable
sequences include STII or Ipp for E. coli, alpha factor for yeast,
and viral signals such as herpes gD for mammalian cells.
[0162] Other insertional variants of the native NRG3 molecules
include the fusion of the N- or C-terminus of the NRG3 molecule to
immunogenic polypeptides, e.g. bacterial polypeptides such as
beta-lactamase or an enzyme encoded by the E. coli trp locus, or
yeast protein, and C-terminal fusions with proteins having a long
half-life such as immunoglobulin regions (preferably immunoglobulin
constant regions), albumin, or ferritin, as described in WO
89/02922 published on Apr. 6, 1989.
[0163] Further insertional variants are immunologically active
derivatives of the novel NRG3s, which comprise the EGF-like domain
and a polypeptide containing an epitope of an immunologically
competent extraneous polypeptide, i.e. a polypeptide which is
capable of eliciting an immune response in the animal to which the
fusion is to be administered or which is capable of being bound by
an antibody raised against an extraneous polypeptide. Typical
examples of such immunologically competent polypeptides are
allergens, autoimmune epitopes, or other potent immnunogens or
antigens recognized by pre-existing antibodies in the fusion
recipient, including bacterial polypeptides such as trpLE,
.beta.-glactosidase, viral polypeptides such as herpes gD protein,
and the like.
[0164] Immunogenic fusions are produced by cross-linking in vitro
or by culture of cells transformed with recombinant DNA encoding an
immunogenic polypeptide. It is preferable that the immunogenic
fusion be one in which the immunogenic sequence is joined to or
inserted into a novel NRG3 molecule or fragment thereof by one or
more peptide bonds. These products therefore consist of a linear
polypeptide chain containing the NRG3 epitope and at least one
epitope foreign to the NRG3. It will be understood that it is
within the scope of this invention to introduce the epitopes
anywhere within a NRG3 molecule of the present invention or a
fragment thereof. These immunogenic insertions are particularly
useful when formulated into a pharmacologically acceptable carrier
and administered to a subject in order to raise antibodies against
the NRG3 molecule, which antibodies in turn are useful as
diagnostics, in tissue-typing, or in purification of the novel
NRG3s by standard immunoaffinity techniques. Alternatively, in the
purification of the NRG3s of the present invention, binding
partners for the fused extraneous polypeptide, e.g. antibodies,
receptors or ligands, are used to adsorb the fusion from impure
admixtures, after which the fusion is eluted and, if desired, the
novel NRG3 is recovered from the fusion, e.g. by enzymatic
cleavage.
[0165] Since it is often difficult to predict in advance the
characteristics of a variant NRG3, it will be appreciated that some
screening will be needed to select the optimum variant. Such
screening includes, but is not limited to, arrays of ErbB4 receptor
binding.
[0166] After identifying the desired mutation(s), the gene encoding
a NRG3 variant can, for example, be obtained by chemical synthesis
as described herein. More preferably, DNA encoding a NRG3 amino
acid sequence variant is prepared by site-directed mutagenesis of
DNA that encodes an earlier prepared variant or a nonvariant
version of the NRG3. Site-directed (site-specific) mutagenesis
allows the production of NRG3 variants through the use of specific
oligonucleotide sequences that encode the DNA sequence of the
desired mutation, as well as a sufficient number of adjacent
nucleotides, to provide a primer sequence of sufficient size and
sequence complexity to form a stable duplex on both sides of the
deletion junction being traversed. Typically, a primer of about 20
to 25 nucleotides in length is preferred, with about 5 to 10
residues on both sides of the junction of the sequence being
altered. In general, the techniques of site-specific mutagenesis
are well known in the art, as exemplified by publications such as,
Edelman et al. (1983) DNA 2:183. As will be appreciated, the
site-specific mutagenesis technique typically employs a phage
vector that exists in both a single-stranded and double-stranded
form. Typical vectors useful in site-directed mutagenesis include
vectors such as the M13 phage, for example, as disclosed by Messing
et al., Third Cleveland Symposium on Macromolecules and Recombinant
DNA, A. Walton, ed., Elsevier, Amsterdam (1981). This and other
phage vectors are commercially available and their use is well
known to those skilled in the art. A versatile and efficient
procedure for the construction of oligodeoxyribonucleotide directed
site-specific mutations in DNA fragments using M13-derived vectors
was published by Zoller, M. J. and Smith, M. (1982) Nucleic Acids
Res. 10:6487-6500). Also, plasmid vectors that contain a
single-stranded phage origin of replication (Veira et al. (1987)
Meth. Enzymol. 153:3) may be employed to obtain single-stranded
DNA. Alternatively, nucleotide substitutions are introduced by
synthesizing the appropriate DNA fragment in vitro, and amplifying
it by PCR procedures known in the art.
[0167] The PCR amplification technique may also be used to create
amino acid sequence variants of a novel NRG3. In a specific example
of PCR mutagenesis, template plasmid DNA (1 .mu.g) is linearized by
digestion with a restriction endonuclease that has a unique
recognition site in the plasmid DNA outside of the region to be
amplified. Of this material, 100 ng is added to a PCR mixture
containing PCR buffer, which contains the four deoxynucleotide
triphosphates and is included in the GeneAmp.sup.R kits (obtained
from Perkin-Elmer Cetus, Norwalk, CT and Emeryville, Calif.), and
25 pmole of each oligonucleotide primer, to a final volume of 50
.mu.l. The reaction mixture is overlayered with 35 .mu.l mineral
oil. The reaction is denatured for 5 minutes at 100.degree. C.,
placed briefly on ice, and then 1 .mu.l Thermus aquaticus (Taq) DNA
polymerase (5 units/l), purchased from Perkin-Elmer Cetus, Norwalk,
Conn. and Emeryville, Calif.) is added below the mineral oil layer.
The reaction mixture is then inserted into a DNA Thermal Cycler
(Perkin-Elmer Cetus) programmed as follows: (as an example) [0168]
2 min. 55.degree. C., [0169] 30 sec. 72.degree. C., then 19 cycles
of the following: [0170] 30 sec. 94.degree. C., [0171] 30 sec.
55.degree. C., and [0172] 30 sec. 72.degree. C.
[0173] At the end of the program, the reaction vial is removed from
the thermal cycler and the aqueous phase transferred to a new vial,
extracted with phenol/chloroform (50:50 vol), and ethanol
precipitated, and the DNA is recovered by standard procedures. This
material is subsequently subjected to appropriate treatments for
insertion into a vector.
[0174] Cassette mutagenesis is another method useful for preparing
variants and is based on the technique described by Wells et al.
(1985) Gene 34:315.
[0175] Additionally, the so-called phagemid display method may be
useful in making amino acid sequence variants of native or variant
NRG3s or their fragments. This method involves 1) constructing a
replicable expression vector comprising a first gene encoding a
receptor to be mutated, a second gene encoding at least a portion
of a natural or wild-type phage coat protein wherein the first and
second genes are heterologous, and a transcription regulatory
element operably linked to the first and second genes, thereby
forming a gene fusion encoding a fusion protein; 2) mutating the
vector at one or more selected positions within the first gene
thereby forming a family of related plasmids; 3) transforming
suitable host cells with the plasmids; 4) infecting the transformed
host cells with a helper phage having a gene encoding the phage
coat protein; 5) culturing the transformed infected host cells
under conditions suitable for forming recombinant phagemid
particles containing at least a portion of the plasmid and capable
of transforming the host, the conditions adjusted so that no more
than a minor amount of phagemid particles display more than one
copy of the fusion protein on the surface of the particle; 6)
contacting the phagemid particles with a suitable antigen so that
at least a portion of the phagemid particles bind to the antigen;
and 7) separating the phagemid particles that bind from those that
do not. Steps 4 through 7 can be repeated one or more times.
Preferably in this method the plasmid is under tight control of the
transcription regulatory element, and the culturing conditions are
adjusted so that the amount or number of phagemid particles
displaying more than one copy of the fusion protein on the surface
of the particle is less than about 1% . Also, preferably, the
amount of phagemid particles displaying more than one copy of the
fusion protein is less than 10% of the amount of phagemid particles
displaying a single copy of the fusion protein. Most preferably,
the amount is less than 20% . Typically in this method, the
expression vector will further contain a secretory signal sequence
fused to the DNA encoding each subunit of the polypeptide and the
transcription regulatory element will be a promoter system.
Preferred promoter systems are selected from lac Z, .lamda..sub.PL,
tac, T7 polymerase, tryptophan, and alkaline phosphatase promoters
and combinations thereof. Also, normally the method will employ a
helper phage selected from M13K07, M13R408, M13-VCS, and Phi X 174.
The preferred helper phage is M13K07, and the preferred coat
protein is the M13 Phage gene III coat protein. The preferred host
is E. coli, and protease-deficient strains of E. coli.
[0176] Further details of the foregoing and similar mutagenesis
techniques are found in general textbooks, such as, for example,
Sambrook et al., supra, and Current Protocols in Molecular Biology,
Ausubel et al. eds., supra.
[0177] F. Glycosylation Variants.
[0178] Glycosylation variants are included within the scope of the
present invention. They include variants completely lacking in
glycosylation (unglycosylated), variants having at least one less
glycosylated site than the native form (deglycosylated) as well as
variants in which the gycosylation has been changed. Included are
deglycosylated and unglycosylated amino acid sequences variants,
deglycosylated and unglycosylated native NRG3s or fragments thereof
and other glycosylation variants. For example, substitutional or
deletional mutagenesis may be employed to eliminate the N- or
O-linked glycosylation sites in the a native or variant NRG3 of the
present invention, e.g. the asparagine residue may be deleted or
substituted for another basic residue such as lysine or histidine.
Alternatively, flanking residues making up the glycosylation site
may be substituted or deleted, even though the asparagine residues
remain unchanged, in order to prevent glycosylation by eliminating
the glycosylation recognition site. Where the preferred NRL variant
is the EGF-like domain of NRG3, the fragment is preferably
unglycosylated.
[0179] Additionally, unglycosylated NRG3s which have the
glycosylation sites of a native molecule may be produced in
recombinant prokaryotic cell culture because prokaryotes are
incapable of introducing glycosylation into polypeptides.
[0180] Glycosylation variants may be produced by appropriate host
cells or by in vitro methods. Yeast and insect cells, for example,
introduce glycosylation which varies significantly from that of
mammalian systems. Similarly, mammalian cells having a different
species (e.g. hamster, murine, porcine, bovine or ovine), or tissue
origin (e.g. lung, liver, lymphoid, mesenchymal or epidermal) than
the source of the NRG3 are routinely screened for the ability to
introduce variant glycosylation as characterized for example by
elevated levels of mannose or variant ratios of mannose, fucose,
sialic acid, and other sugars typically found in mammalian
glycoproteins. In vitro processing of the NRG3 typically is
accomplished by enzymatic hydrolysis, e.g. neuraminidate
digestion.
[0181] G. Covalent Modifications.
[0182] Covalent modifications of the novel NRG3s of the present
invention are included within the scope of the invention. Such
modifications are traditionally introduced by reacting targeted
amino acid residues of the NRG3s with an organic derivatizing agent
that is capable of reacting with selected amino acid side chains or
terminal residues, or by harnessing mechanisms of
post-translational modifications that function in selected
recombinant host cells. The resultant covalent derivatives are
useful in programs directed at identifying residues important for
biological activity, for immunoassays of the NRG3, or for the
preparation of anti-NRG3 antibodies for immunoaffinity purification
of the recombinant. For example, complete inactivation of the
biological activity of the protein after reaction with ninhydrin
would suggest that at least one arginyl or lysyl residue is
critical for its activity, whereafter the individual residues which
were modified under the conditions selected are identified by
isolation of a peptide fragment containing the modified amino acid
residue. Such modifications are within the ordinary skill in the
art and are performed without undue experimentation.
[0183] Derivatization with bifunctional agents is useful for
preparing intramolecular aggregates of the NRG3s with polypeptides
as well as for cross-linking the NRG3 polypeptide to a water
insoluble support matrix or surface for use in assays or affinity
purification. In addition, a study of interchain cross-links will
provide direct information on conformational structure. Commonly
used cross-linking agents include
1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde,
N-hydroxysuccinimide esters, homobifunctional imidoesters, and
bifunctional maleimides. Derivatizing agents such as
methyl-3-[(p-azidophenyl)dithio]propioimidate yield
photoactivatable intermediates which are capable of forming
cross-links in the presence of light. Alternatively, reactive water
insoluble matrices such as cyanogen bromide activated carbohydrates
and the systems reactive substrates described in U.S. Pat. Nos.
3,959,642; 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537;
4,055,635; and 4,330,440 are employed for protein immobilization
and cross-linking.
[0184] Certain post-translational modifications are the result of
the action of recombinant host cells on the expressed polypeptide.
Glutaminyl and aspariginyl residues are frequently
post-translationally deamidated to the corresponding glutamyl and
aspartyl residues. Alternatively, these residues are deamidated
under mildly acidic conditions. Either form of these residues falls
within the scope of this invention.
[0185] Other post-translational modifications include hydroxylation
of proline and lysine, phosphorylation of hydroxyl groups of seryl,
threonyl or tyrosyl residues, methylation of the .alpha.-amino
groups of lysine, arginine, and histidine side chains (T. E.
Creighton (1983) Proteins: Structure and Molecular Properties, W.H.
Freeman & Co., San Francisco, pp. 79-86).
[0186] Further derivatives of the NRG3s herein are the so called
"immunoadhesins", which are chimeric antibody-like molecules
combining the functional domain(s) of a binding protein (usually a
receptor, a cell-adhesion molecule or a ligand) with the an
immunoglobulin sequence. The most common example of this type of
fusion protein combines the hinge and Fc regions of an
immunoglobulin (Ig) with domains of a cell-surface receptor that
recognizes a specific ligand. This type of molecule is called an
"immunoadhesin", because it combines "immune" and "adhesion"
functions; other frequently used names are "Ig-chimera", "Ig-" or
"Fc-fusion protein", or "receptor-globulin."
[0187] Immunoadhesins reported in the literature include, for
example, fusions of the T cell receptor (Gascoigne et al. (1987)
Proc. Natl. Acad. Sci. USA 84:2936-2940); CD4 (Capon et al. (1989)
Nature 337:525-531; Traunecker et al. (1989) Nature 339:68-70;
Zettmeissl et al. (1990) DNA Cell Biol. USA 9:347-353; Byrn et al.
(1990) Nature 344:667-670); L-seNRG3 (homing receptor) (Watson et
al. (1990) J. Cell. Biol. 110:2221-2229); Watson et al. (1991)
Nature 349:164-167); E-seNRG3 (Mulligan et al. (1993) J. Immunol.
151:6410-17; Jacob et al. (1995) Biochemistry 34:1210-1217);
P-seNRG3 (Mulligan et al., supra; Hollenbaugh et al. (1995)
Biochemistry 34:5678-84); ICAM-1 (Stauton et al. (1992) J. Exp.
Med. 176:1471-1476; Martin et al. (1993) J. Virol. 67:3561-68; Roep
et al. (1994) Lancet 343:1590-93); ICAM-2 (Damle et al. (1992) J.
Immunol. 148:665-71); ICAM-3 (Holness et al. (1995) J. Biol. Chem.
270:877-84); LFA-3 (Kanner et al. (1992) J. Immunol. 148:23-29); L1
glycoprotein (Doherty et al. (1995) Neuron 14:57-66); TNF-R1
(Ashkenazi et al., (1991) Proc. Natl. Acad. Sci. USA 88:10535-539);
Lesslauer et al. (1991) Eur. J. Immunol. 21:2883-86; Peppel et al.
(1991) J. Exp. Med. 174:1483-1489); TNF-R2 (Zack et al. (1993)
Proc. Natl. Acad. Sci. USA 90:2335-39; Wooley et al. (1993) J.
Immunol. 151:6602-07); CD44 (Aruffo et al. (1990) Cell
61:1303-1313); CD28 and B7 (Linsley et al. (1991) J. Exp. Med.
173:721-730); CTLA-4 (Lisley et al. (1991) J. Exp. Med.
174:561-569); CD22 (Stamenkovic et al. (1991) Cell 66:1133-1144);
NP receptors (Bennett et al. (1991) J. Biol. Chem.
266:23060-23067); IgE receptor .alpha. (Ridgway and Gorman (1991)
J. Cell. Biol. 115:1448 abstr.); IFN-.GAMMA.R .alpha.- and
.beta.-chain (Marsters et al. (1995) Proc. Natl. Acad. Sci. USA
92:5401-05); trk-A, -B, and -C (Shelton et al. (1995) J. Neurosci.
15:477-91); IL-2 (Landolfi (1991) J. Immunol. 146:915-19); IL-10
(Zheng et al. (1995) J. Immunol. 154:5590-5600).
[0188] The simplest and most straightforward immunoadhesin design
combines the binding region(s) of the `adhesin` protein with the
hinge and Fc regions of an immunoglobulin heavy chain. Ordinarily,
when preparing the NRG3-immunoglobulin chimeras of the present
invention, nucleic acid encoding the desired NRG3 polypeptide will
be fused at the C-terminus of the desired sequence to the
N-terminus of a nucleic acid sequence encoding an immunoglobulin
constant domain sequence, however fusion to the N-terminus of the
desired NRG3 sequence is also possible. Typically, in such fusions
the encoded chimeric polypeptide will retain at least functionally
active hinge, CH2 and CH3 domains of the constant region of an
immunoglobulin heavy chain. Fusions are also made to the C-terminus
of the Fc portion of a constant domain, or immediately N-terminal
to the CH1 of the heavy chain or the corresponding region of the
light chain. The precise site at which the fusion is made is not
critical; particular sites are well known and may be selected in
order to optimize the biological activity, secretion or binding
characteristics of the NRG3-immunoglobulin chimeras.
[0189] In a preferred embodiment, the sequence of a native, mature
NRG3 polypeptide, or a soluble form thereof such as a
(transmembrane domain-inactivated or EGF-like domain polypeptide)
form thereof, is fused to the N-terminus of the C-terminal portion
of an antibody (in particular the Fc domain), containing the
effector functions of an immunoglobulin, e.g. IgG-1. It is possible
to fuse the entire heavy chain constant region to the NRG3
sequence. However, more preferably, a sequence beginning in the
hinge region just upstream of the papain cleavage site (which
defines IgG Fc chemically; residue 216, taking the first residue of
heavy chain constant region to be 114 (Kobet et al., supra), or
analogous sites of other immunoglobulins) is used in the fusion. In
a particularly preferred embodiment, the NRG3 sequence (full length
or soluble) is fused to the hinge region and CH2 and CH3 or CH1,
hinge, CH2 and CH3 domains of an IgG-1, IgG-2, or IgG-3 heavy
chain. The precise site at which the fusion is made is not
critical, and the optimal site can be determined by routine
experimentation.
[0190] In some embodiments, the NRG3-immunoglobulin chimeras are
assembled as multimers, and particularly as homo-dimers or
-tetramers (WO 91/08298). Generally, these assembled
immunoglobulins will have known unit structures. A basic four chain
structural unit is the form in which IgG, IgD, and IgE exist. A
four unit is repeated in the higher molecular weight
immunoglobulins; IgM generally exists as a pentamer of basic four
units held together by disulfide bonds. IgA globulin, and
occasionally IgG globulin, may also exist in multimeric form in
serum. In the case of multimer, each four unit may be the same or
different.
[0191] Various exemplary assembled NRG3-immunoglobulin chimeras
within the scope of the invention are schematically diagrammed
below: [0192] (a) AC.sub.L-AC.sub.L; [0193] (b) AC.sub.H-[AC.sub.H,
AC.sub.L-AC.sub.H, AC.sub.L-V.sub.HC.sub.H, or
V.sub.LC.sub.L-AC.sub.H]; [0194] (c)
AC.sub.L-AC.sub.H-[AC.sub.L-AC.sub.H, AC.sub.L-V.sub.HC.sub.H,
V.sub.LC.sub.L-AC.sub.H, or V.sub.LC.sub.L-V.sub.HC.sub.H]; [0195]
(d) AC.sub.L-V.sub.HC.sub.H-[AC.sub.H, or AC.sub.L-V.sub.HC.sub.H,
or V.sub.LC.sub.L-AC.sub.H]; [0196] (e)
V.sub.LC.sub.L-AC.sub.H-[AC.sub.L-V.sub.HC.sub.H, or
V.sub.LC.sub.L-AC.sub.H]; and [0197] (f)
[A-Y].sub.n-[V.sub.LC.sub.L-V.sub.HC.sub.H].sub.2, wherein [0198]
each A represents identical or different novel NRG3 polypeptide
amino acid sequences; [0199] V.sub.L is an immunoglobulin light
chain variable domain; [0200] V.sub.H is an immunoglobulin heavy
chain variable domain; [0201] C.sub.L is an immunoglobulin light
chain constant domain; [0202] C.sub.H is an immunoglobulin heavy
chain constant domain; [0203] n is an integer greater than 1;
[0204] Y designates the residue of a covalent cross-linking
agent.
[0205] In the interest of brevity, the foregoing structures only
show key features; they do not indicate joining (J) or other
domains of the immunoglobulins, nor are disulfide bonds shown.
However, where such domains are required for binding activity, they
shall be constructed as being present in the ordinary locations
which they occupy in the immunoglobulin molecules.
[0206] Although the presence of an immunoglobulin light chain is
not required in the immunoadhesins of the present invention, an
immunoglobulin light chain might be present either covalently
associated to an NRG3-immunoglobulin heavy chain fusion
polypeptide, or directly fused to the NRG3 polypeptide. In the
former case, DNA encoding an immunoglobulin light chain is
typically coexpressed with the DNA encoding the NRG3-immunoglobulin
heavy chain fusion protein. Upon secretion, the hybrid heavy chain
and the light chain will be covalently associated to provide an
immunoglobulin-like structure comprising two disulfide-linked
immunoglobulin heavy chain-light chain pairs. Methods suitable for
the preparation of such structures are, for example, disclosed in
U.S. Pat. No. 4,816,567 issued Mar. 28, 1989.
[0207] In a preferred embodiment, the immunoglobulin sequences used
in the construction of the immunoadhesins of the present invention
are from an IgG immunoglobulin heavy chain constant domain. For
human immunoadhesins, the use of human IgG-1 and IgG-3
immunoglobulin sequences is preferred. A major advantage of using
IgG-1 is that IgG-1 immunoadhesins can be purified efficiently on
immobilized protein A. In contrast, purification of IgG-3 requires
protein G, a significantly less versatile medium. However, other
structural and functional properties of immunoglobulins should be
considered when choosing the Ig fusion partner for a particular
immunoadhesin construction. For example, the IgG-3 hinge is longer
and more flexible, so it can accommodate larger `adhesin` domains
that may not fold or function properly when fused to IgG-1. While
IgG immunoadhesins are typically mono- or bivalent, other Ig
subtypes like IgA and IgM may give rise to dimeric or pentameric
structures, respectively, of the basic Ig homodimer unit.
Multimeric immunoadhesins are advantageous in that they can bind
their respective targets with greater avidity than their IgG-based
counterparts. Reported examples of such structures are CD4-IgM
(Traunecker et al., supra); ICAM-IgM (Martin et al. (1993) J.
Virol. 67:3561-68); and CD2-IgM (Arulanandam et al. (1993) J. Exp.
Med. 177:1439-50).
[0208] For NRG3-Ig immunoadhesins, which are designed for in vivo
application, the pharmacokinetic properties and the effector
functions specified by the Fc region are important as well.
Although IgG-1, IgG-2 and IgG4 all have in vivo half-lives of 21
days, their relative potencies at activating the complement system
are different. IgG-4 does not activate complement, and IgG-2 is
significantly weaker at complement activation than IgG-1. Moreover,
unlike IgG-1, IgG-2 does not bind to Fc receptors on mononuclear
cells or neutrophils. While IgG-3 is optimal for complement
activation, its in vivo half-life is approximately one third of the
other IgG isotypes. Another important consideration for
immunoadhesins designed to be used as human therapeutics is the
number of allotypic variants of the particular isotype. In general,
IgG isotypes with fewer serologically-defined allotypes are
preferred. For example, IgG-1 has only four serologically-defined
allotypic sites, two of which (G1m and 2) are located in the Fc
region; and one of these sites G1m1, is non-immunogenic. In
contrast, there are 12 serologically-defined allotypes in IgG-3,
all of which are in the Fc region; only three of these sites (G3m5,
11 and 21) have one allotype which is nonimmunogenic. Thus, the
potential immunogenicity of a .gamma.3 immunoadhesin is greater
than that of a .gamma.1 immunoadhesin.
[0209] NRG3-Ig immunoadhesins are most conveniently constructed by
fusing the cDNA sequence encoding the NRG3 portion in-frame to an
Ig cDNA sequence. However, fusion to genomic Ig fragments can also
be used (see, e.g. Gascoigne et al. (1987) Proc. Natl. Acad. Sci.
USA 84:2936-2940; Aruffo et al. (1990) Cell 61:1303-1313,
Stamenkovic et al. (1991) Cell 66:1133-1144). The latter type of
fusion requires the presence of Ig regulatory sequences for
expression. cDNAs encoding IgG heavy-chain constant regions can be
isolated based on published sequence from cDNA libraries derived
from spleen or peripheral blood lymphocytes, by hybridization or by
polymerase chain reaction (PCR) techniques.
[0210] Other derivatives of the novel NRG3s of the present
invention, which possess a longer half-life than the native
molecules comprise the NRG3, NRG3 fragment (such as the EGF-like
domain) or a NRG3-immunoglobulin chimera, covalently bonded to a
nonproteinaceous polymer. The nonproteinaceous polymer ordinarily
is a hydrophilic synthetic polymer, i.e., a polymer not otherwise
found in nature. However, polymers which exist in nature and are
produced by recombinant or in vitro methods are useful, as are
polymers which are isolated from native sources. Hydrophilic
polyvinyl polymers fall within the scope of this invention, e.g.
polyvinylalcohol and polyvinylpyrrolidone. Particularly useful are
polyalkylene ethers such as polyethylene glycol (PEG);
polyelkylenes such as polyoxyethylene, polyoxypropylene, and block
copolymers of polyoxyethylene and polyoxypropylene (Pluronics);
polymethacrylates; carbomers; branched or unbranched
polysaccharides which comprise the saccharide monomers D-mannose,
D- and L-galactose, fucose, fructose, D-xylose, L-arabinose,
D-glucuronic acid, sialic acid, D-galacturonic acid, D-mannuronic
acid (e.g. polymannuronic acid, or alginic acid), D-glucosamine,
D-galactosamine, D-glucose and neuraminic acid including
homopolysaccharides and heteropolysaccharides such as lactose,
amylopectin, starch, hydroxyethyl starch, amylose, dextrane
sulfate, dextran, dextrins, glycogen, or the polysaccharide subunit
of acid mucopolysaccharides, e.g. hyaluronic acid; polymers of
sugar alcohols such as polysorbitol and polymannitol; heparin or
heparon. The polymer prior to cross-linking need not be, but
preferably is, water soluble, but the final conjugate must be water
soluble. In addition, the polymer should not be highly immunogenic
in the conjugate form, nor should it possess viscosity that is
incompatible with intravenous infusion or injection if it is
intended to be administered by such routes.
[0211] Preferably the polymer contains only a single group which is
reactive. This helps to avoid cross-linking of protein molecules.
However, it is within the scope herein to optimize reaction
conditions to reduce cross-linking, or to purify the reaction
products through gel filtration or chromatographic sieves to
recover substantially homogenous derivatives.
[0212] The molecular weight of the polymer may desirably range from
about 100 to 500,000, and preferably is from about 1,000 to 20,000.
The molecular weight chosen will depend upon the nature of the
polymer and the degree of substitution. In general, the greater the
hydrophilicity of the polymer and the greater the degree of
substitution, the lower the molecular weight that can be employed.
Optimal molecular weights will be determined by routine
experimentation.
[0213] The polymer generally is covalently linked to the novel
NRG3, NRG3 fragment or to the NRG3-immunoglobulin chimeras through
a multifunctional crosslinking agent which reacts with the polymer
and one or more amino acid or sugar residues of the NRG3 or
NRG3-immunoglobulin chimera to be linked. However, it is within the
scope of the invention to directly crosslink the polymer by
reacting a derivatized polymer with the hybrid, or vice versa.
[0214] The covalent crosslinking site on the NRG3 or NRG3-Ig
includes the N-terminal amino group and epsilon amino groups found
on lysine residues, as well as other amino, imino, carboxyl,
sulfhydryl, hydroxyl or other hydrophilic groups. The polymer may
be covalently bonded directly to the hybrid without the use of a
multifunctional (ordinarily bifunctional) crosslinking agent.
Covalent binding to amino groups is accomplished by known
chemistries based upon cyanuric chloride, carbonyl diimidazole,
aldehyde reactive groups (PEG alkoxide plus diethyl acetal of
bromoacetaldehyde; PEG plus DMSO and acetic anhydride, or PEG
chloride plus the phenoxide of 4-hydroxybenzaldehyde, succinimidyl
active esters, activated dithiocarbonate PEG,
2,4,5-trichlorophenylcloroformate or P-nitrophenylcloroformate
activated PEG.) Carboxyl groups are derivatized by coupling
PEG-amine using carbodiimide.
[0215] Polymers are conjugated to oligosaccharide groups by
oxidation using chemicals, e.g. metaperiodate, or enzymes, e.g.
glucose or galactose oxidase, (either of which produces the
aldehyde derivative of the carbohydrate), followed by reaction with
hydrazide or amino derivatized polymers, in the same fashion as is
described by Heitzmann et al. (1974) P.N.A.S. 71:353741 or Bayer et
al. (1979) Methods in Enzymology 62:310, for the labeling of
oligosaccharides with biotin or avidin. Further, other chemical or
enzymatic methods which have been used heretofore to link
oligosaccharides are particularly advantageous because, in general,
there are fewer substitutions than amino acid sites for
derivatization, and the oligosaccharide products thus will be more
homogenous. The oligosaccharide substituents also are optionally
modified by enzyme digestion to remove sugars, e.g. by
neuraminidase digestion, prior to polymer derivatization.
[0216] The polymer will bear a group which is directly reactive
with an amino acid side chain, or the N- or C-terminus of the
polypeptide linked, or which is reactive with the multifunctional
cross-linking agent. In general, polymers bearing such reactive
groups are known for the preparation of immobilized proteins. In
order to use such chemistries here, one should employ a water
soluble polymer otherwise derivatized in the same fashion as
insoluble polymers heretofore employed for protein immobilization.
Cyanogen bromide activation is a particularly useful procedure to
employ in crosslinking polysaccharides.
[0217] "Water soluble" in reference to the starting polymer means
that the polymer or its reactive intermediate used for conjugation
is sufficiently water soluble to participate in a derivatization
reaction. "Water soluble" in reference to the polymer conjugate
means that the conjugate is soluble in physiological fluids such as
blood.
[0218] The degree of substitution with such a polymer will vary
depending upon the number of reactive sites on the protein, whether
all or a fragment of the protein is used, whether the protein is a
fusion with a heterologous protein (e.g. a NRG3-immunoglobulin
chimera), the molecular weight, hydrophilicity and other
characteristics of the polymer, and the particular protein
derivatization sites chosen. In general, the conjugate contains
about from 1 to 10 polymer molecules, while any heterologous
sequence may be substituted with an essentially unlimited number of
polymer molecules so long as the desired activity is not
significantly adversely affected. The optimal degree of
cross-linking is easily determined by an experimental matrix in
which the time, temperature and other reaction conditions are
varied to change the degree of substitution, after which the
ability of the conjugates to function in the desired fashion is
determined.
[0219] The polymer, e.g. PEG, is cross-linked by a wide variety of
methods known per se for the covalent modification of proteins with
nonproteinaceous polymers such as PEG. Certain of these methods,
however, are not preferred for the purposes herein. Cyanuronic
chloride chemistry leads to many side reactions, including protein
cross-linking. In addition, it may be particularly likely to lead
to inactivation of proteins containing sulfhydryl groups. Carbonyl
diimidazole chemistry (Beauchamp et al. (1983) Anal Biochem.
131:25-33) requires high pH (>8.5), which can inactivate
proteins. Moreover, since the "activated PEG" intermediate can
react with water, a very large molar excess of "activated PEG" over
protein is required. The high concentrations of PEG required for
the carbonyl diimidazole chemistry also led to problems in
purification, as both gel filtration chromatography and hydrophilic
interaction chromatography are adversely affected. In addition, the
high concentrations of "activated PEG" may precipitate protein, a
problem that per se has been noted previously (Davis, U.S. Pat. No.
4,179,337). On the other hand, aldehyde chemistry (Royer, U.S. Pat.
No. 4,002,531) is more efficient since it requires only a 40-fold
molar excess of PEG and a 1-2 hr incubation. However, the manganese
dioxide suggested by Royer for preparation of the PEG aldehyde is
problematic "because of the pronounced tendency of PEG to form
complexes with metal-based oxidizing agents" (Harris et al. (1984)
J. Polym. Sci. Polym. Chem. Ed. 22:341-52). The use of a Moffatt
oxidation, utilizing DMSO and acetic anhydride, obviates this
problem. In addition, the sodium borohydride suggested by Royer
must be used at high pH and has a significant tendency to reduce
disulfide bonds. In contrast, sodium cyanoborohydride, which is
effective at neutral pH and has very little tendency to reduce
disulfide bonds is preferred.
[0220] The long half-life conjugates of this invention are
separated from the unreacted starting materials by gel filtration.
Heterologous species of the conjugates are purified from one
another in the same fashion. The polymer also may be
water-insoluble, as a hydrophilic gel.
[0221] The novel NRG3s may be entrapped in microcapsules prepared,
for example, by coacervation techniques or by interfacial
polymerization, in colloidal drug delivery systems (e.g. liposomes,
albumin microspheres, microemulsions, nano-particles and
nanocapsules), or in macroemulsions. Such techniques are disclosed
in Remington's Pharmaceutical Sciences, 16th Edition, Osol, A., Ed.
(1980).
[0222] H. Antibody Preparation.
[0223] (i) Polyclonal Antibodies
[0224] Polyclonal antibodies to a NRG3, or fragment thereof (such
as the EGF-like domain) of the present invention generally are
raised in animals by multiple subcutaneous (sc) or intraperitoneal
(ip) injections of the NRG3 and an adjuvant. It may be useful to
conjugate the NRG3 or a fragment containing the target amino acid
sequence to a protein that is immunogenic in the species to be
immunized, e.g. keyhole limpet hemocyanin, serum albumin, bovine
thyroglobulin, or soybean trypsin inhibitor using a bifunctional or
derivatizing agent, for example maleimidobenzoyl sulfosuccinimide
ester (conjugation through cysteine residues), N-hydroxysuccinimide
(through lysine residues), glutaraldehyde, succinic anhydride,
SOCl.sub.2, or R.sup.1N.dbd.C.dbd.NR, where R and R.sup.1 are
different alkyl groups.
[0225] Animals are immunized against the immunogenic conjugates or
derivatives by combining 1 mg or 1 .mu.g of conjugate (for rabbits
or mice, respectively) with 3 volumes of Freud's complete adjuvant
and injecting the solution intradermally at multiple sites. One
month later the animals are boosted with 1/5 to 1/10 the original
amount of conjugate in Freud's complete adjuvant by subcutaneous
injection at multiple sites. 7 to 14 days later the animals are
bled and the serum is assayed for anti-NRG3 antibody titer. Animals
are boosted until the titer plateaus. Preferably, the animal
boosted with the conjugate of the same NRG3, but conjugated to a
different protein and/or through a different cross-linking reagent.
Conjugates also can be made in recombinant cell culture as protein
fusions. Also, aggregating agents such as alum are used to enhance
the immune response.
[0226] (ii) Monoclonal Antibodies
[0227] Monoclonal antibodies are obtained from a population of
substantially homogeneous antibodies, i.e., the individual
antibodies comprising the population are identical except for
possible naturally-occurring mutations that may be present in minor
amounts. Thus, the modifier "monoclonal" indicates the character of
the antibody as not being a mixture of discrete antibodies. For
example, the anti-NRG3 monoclonal antibodies of the invention may
be made using the hybridoma method first described by Kohler and
Milstein (1975) Nature 256:495, or may be made by recombinant DNA
methods (Cabilly, et al., U.S. Pat. No. 4,816,567).
[0228] DNA encoding the monoclonal antibodies of the invention is
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences,
Morrison, et al. (1984) Proc. Nat. Acad. Sci. 81:6851, or by
covalently joining to the immunoglobulin coding sequence all or
part of the coding sequence for a non-immunoglobulin polypeptide.
In that manner, "chimeric" or "hybrid" antibodies are prepared that
have the binding specificity of a NRG3 monoclonal antibody
herein.
[0229] Typically such non-immunoglobulin polypeptides are
substituted for the constant domains of an antibody of the
invention, or they are substituted for the variable domains of one
antigen-combining site of an antibody of the invention to create a
chimeric bivalent antibody comprising one antigen-combining site
having specificity for a NRG3 and another antigen-combining site
having specificity for a different antigen.
[0230] Chimeric or hybrid antibodies also may be prepared in vitro
using known methods in synthetic protein chemistry, including those
involving crosslinking agents. For example, immunotoxins may be
constructed using a disulfide exchange reaction or by forming a
thioether bond. Examples of suitable reagents for this purpose
include iminothiolate and methyl-4-mercaptobutyrimidate.
[0231] For diagnostic applications, the antibodies of the invention
typically will be labeled with a detectable moiety. The detectable
moiety can be any one which is capable of producing, either
directly or indirectly, a detectable signal. For example, the
detectable moiety may be a radioisotope, such as .sup.3H, .sup.14C,
.sup.32P,.sup.35S, or .sup.125I, a fluorescent or chemiluminescent
compound, such as fluorescein isothiocyanate, rhodamine, or
luciferin; biotin; radioactive isotopic labels, such as, e.g.,
.sup.125I, .sup.32P, .sup.14C, or .sup.3H, or an enzyme, such as
alkaline phosphatase, beta-galactosidase or horseradish
peroxidase.
[0232] Any method known in the art for separately conjugating the
antibody to the detectable moiety may be employed, including those
methods described by Hunter, et al. (1962) Nature 144:945; David,
et al. (1974) Biochemistry 13:1014; Pain, et al. (1981) J. Immunol.
Meth. 40:219; and Nygren (1982) J. Histochem. and Cytochem.
30:407.
[0233] The antibodies of the present invention may be employed in
any known assay method, such as competitive binding assays, direct
and indirect sandwich assays, and immunoprecipitation assays. Zola,
Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC
Press, Inc., 1987).
[0234] (iii) Humanized Antibodies
[0235] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers (Jones et al. (1986)
Nature 321:522-525; Riechmann et al. (1988) Nature 332:323-327;
Verhoeyen et al. (1988) Science 239:1534-1536), by substituting
rodent CDRs or CDR sequences for the corresponding sequences of a
human antibody. Accordingly, such "humanized" antibodies are
chimeric antibodies (Cabilly, supra), wherein substantially less
than an intact human variable domain has been substituted by the
corresponding sequence from a non-human species. In practice,
humanized antibodies are typically human antibodies in which some
CDR residues and possibly some FR residues are substituted by
residues from analogous sites in rodent antibodies.
[0236] It is important that antibodies be humanized with retention
of high affinity for the antigen and other favorable biological
properties. To achieve this goal, according to a preferred method,
humanized antibodies are prepared by a process of analysis of the
parental sequences and various conceptual humanized products using
three dimensional models of the parental and humanized sequences.
Three dimensional immunoglobulin models are commonly available and
are familiar to those skilled in the art. Computer programs are
available which illustrate and display probable three-dimensional
conformational structures of selected candidate immunoglobulin
sequences. Inspection of these displays permits analysis of the
likely role of the residues in the functioning of the candidate
immunoglobulin sequence, i.e. the analysis of residues that
influence the ability of the candidate immunoglobulin to bind its
antigen. In this way, FR residues can be selected and combined from
the consensus and import sequence so that the desired antibody
characteristic, such as increased affinity for the target
antigen(s), is achieved. In general, the CDR residues are directly
and most substantially involved in influencing antigen binding. For
further details see PCT/US93/07832, which is a continuation-in-part
of PCT/US92/05126, which references are herein incorporated by
reference in their entirety.
[0237] Alternatively, it is now possible to produce transgenic
animals (e.g. mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy chain
joining region (J.sub.H) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array in such
germ-line mutant mice will result in the production of human
antibodies upon antigen challenge. See, e.g. Jakobovits et al.
(1993) Proc. Natl. Acad. Sci. USA 90:2551-255; Jakobovits et al.
(1993) Nature 362:255-258.
[0238] (iv) Bispecific Antibodies
[0239] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for a NRG3 of the present invention the other one
is for any other antigen, for example, another member of the NRG3
family. Such constructs can also be referred to as bispecific
immunoadhesins.
[0240] Traditionally, the recombinant production of bispecific
antibodies is based on the coexpression of two immunoglobulin heavy
chain-light chain pairs, where the two heavy chains have different
specificities (Millstein and Cuello (1983) Nature 305:537-539).
Because of the random assortment of immunoglobulin heavy and light
chains, these hybridomas (quadromas) produce a potential mixture of
10 different antibody molecules, of which only one has the correct
bispecific structure. The purification of the correct molecule,
which is usually done by affinity chromatography steps, is rather
cumbersome, and the product yields are low. Similar procedures are
disclosed in PCT application publication No. WO 93/08829 (published
May 13, 1993), and in Traunecker et al. (1991) EMBO 10:3655-3659.
This problem may be overcome by selecting a common light chain for
each arm o the bispecific antibody such that binding specificity of
each antibody is maintained, as disclosed in U.S. application Ser.
No. 08/850058, filed May 5, 1997.
[0241] According to a different and more preferred approach,
antibody variable domains with the desired binding specificities
(antibody-antigen combining sites) are fused to immunoglobulin
constant domain sequences. The fusion preferably is with an
immunoglobulin heavy chain constant domain, comprising at least
part of the hinge, and second and third constant regions of an
immunoglobulin heavy chain (CH2 and CH3). It is preferred to have
the first heavy chain constant region (CH1) containing the site
necessary for light chain binding, present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are cotransfected into a suitable
host organism. This provides for great flexibility in adjusting the
mutual proportions of the three polypeptide fragments in
embodiments when unequal ratios of the three polypeptide chains
used in the construction provide the optimum yields. It is,
however, possible to insert the coding sequences for two or all
three polypeptide chains in one expression vector when the
expression of at least two polypeptide chains in equal ratios
results in high yields or when the ratios are of no particular
significance. In a preferred embodiment of this approach, the
bispecific antibodies are composed of a hybrid immunoglobulin heavy
chain with a first binding specificity in one arm, and a hybrid
immunoglobulin heavy chain-light chain pair (providing a second
binding specificity) in the other arm. It was found that this
asymmetric structure facilitates the separation of the desired
bispecific compound from unwanted immunoglobulin chain
combinations, as the presence of an immunoglobulin light chain in
only one half of the bispecific molecule provides for a facile way
of separation. This approach is disclosed in PCT application WO
94/04690 published Mar. 3, 1994.
[0242] For further details of generating bispecific antibodies see,
for example, Suresh et al. (1986) Methods in Enzymology
121:210.
[0243] (v) Heteroconjugate Antibodies
[0244] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells (U.S.
Pat. No. 4,676,980), and for treatment of HIV infection (PCT
application publication Nos. WO 91/00360 and WO 92/200373; EP
03089). Heteroconjugate antibodies may be made using any convenient
cross-linking methods. Suitable cross-linking agents are well known
in the art, and are disclosed in U.S. Pat. No. 4,676,980, along
with a number of cross-linking techniques.
[0245] I. Diagnostic Kits and Articles of Manufacture.
[0246] Since the invention provides a diagnostic assay (i.e. for
detecting neurological disorders and for detecting the presence of
NRG3 in a sample using antibodies or DNA markers) as a matter of
convenience, the reagents for these assays can be provided in a
kit, i.e., a packaged combination of reagents, for combination with
the sample to be tested. The components of the kit will normally be
provided in predetermined ratios. Thus, a kit may comprise the
antibody or NRG3 (DNA or polypeptide or fragment thereof) labeled
directly or indirectly with a suitable label. Where the detectable
label is an enzyme, the kit will include substrates and cofactors
required by the enzyme (e.g. a substrate precursor which provides
the detectable chromophore or fluorophore). In addition, other
additives may be included such as stabilizers, buffers and the
like. The relative amounts of the various reagents may be varied
widely to provide for concentrations in solution of the reagents
which substantially optimize the sensitivity of the assay.
Particularly, the reagents may be provided as dry powders, usually
lyophilized, including excipients which on dissolution will provide
a reagent solution having the appropriate concentration. The kit
also suitably includes instructions for carrying out the
bioassay.
[0247] In another embodiment of the invention, an article of
manufacture containing materials useful for the treatment of the
neurological disorders described herein is provided. The article of
manufacture comprises a container and a label. Suitable containers
include, for example, bottles, vials, syringes, and test tubes. The
containers may be formed from a variety of materials such as glass
or plastic. The container holds a composition which is effective
for treating the condition and may have a sterile access port (for
example the container may be an intravenous solution bag or a vial
having a stopper pierceable by a hypodermic injection needle). The
active agent in the composition is NRG3 or an agonist or antagonist
thereof. The label on, or associated with, the container indicates
that the composition is used for treating the condition of choice.
The article of manufacture may further comprise a second container
comprising a pharmaceutically-acceptable buffer, such as
phosphate-buffered saline, Ringer's solution and dextrose solution.
It may further include other materials desirable from a commercial
and user standpoint, including other buffers, diluents, filters,
needles, syringes, and package inserts with instructions for
use.
[0248] J. Peptide and Non-Peptide Analogs.
[0249] Peptide analogs of the NRG3s of the present invention are
modeled based upon the three-dimensional structure of the native
polypeptides. Peptides may be synthesized by well known techniques
such as the solid-phase synthetic techniques initially described in
Merrifield (1963) J. Am. Chem. Soc. 15:2149-2154. Other peptide
synthesis techniques are, for examples, described in Bodanszky et
al., Peptide Synthesis, John Wiley & Sons, 2nd Ed., 1976, as
well as in other reference books readily available for those
skilled in the art. A summary of peptide synthesis techniques may
be found in Stuart and Young, Solid Phase Peptide Synthelia, Pierce
Chemical Company, Rockford, Ill. (1984). Peptides may also be
prepared by recombinant DNA technology, using a DNA sequence
encoding the desired peptide.
[0250] In addition to peptide analogs, the present invention also
contemplates non-peptide (e.g. organic) compounds which display
substantially the same surface as the peptide analogs of the
present invention, and therefore interact with other molecules in a
similar fashion.
[0251] K. Uses of the NRG3s.
[0252] Amino acid sequence variants of the native NRG3s of the
present invention may be employed therapeutically to compete with
the normal binding of the native proteins to their receptor, ErbB4.
The NRG3 amino acid sequence variants are, therefore, useful as
competitive inhibitors of the biological activity of native
NRG3s.
[0253] Native NRG3s and their amino acid sequence variants are
useful in the identification and purification of the native ErbB4
receptor. The purification is preferably performed by
immunoadhesins comprising a NRG3 amino acid sequence retaining the
qualitative ability of a native NRG3 of the present invention to
recognize its native ErbB4 receptor.
[0254] The native NRG3s of the present invention are further useful
as molecular markers of the tissues in which the ErbB4 receptor is
expressed.
[0255] Furthermore, the NRG3s, preferably the EGF-like domain of
the NRG3 of the present invention, provide valuable sequence motifs
which can be inserted or substituted into other native members of
the NRG3 family of molecules, such as the heregulins. The
alteration of these native proteins by the substitution or
insertion of sequences from the novel NRG3s of the present
invention can yield variant molecules with altered biological
properties, such as receptor binding affinity or receptor
specificity. For example, one or more NRG3 domains of another
member of the NRG3 family may be entirely or partially replaced by
NRG3 domain sequences derived from the NRG3s of the present
invention. Similarly, EGF-like domain sequences from the NRG3s
herein may be substituted or inserted into the amino acid sequences
of other NRG3s.
[0256] Nucleic acid encoding the NRG3s of the present invention is
also useful in providing hybridization probes for searching cDNA
and genomic libraries for the coding sequence of other NRG3s.
[0257] Additionally, NRG3s of the invention are useful in kits for
the diagnosis of disease related to NRG3 and for methods of
detecting the presence or absence of NRG3 in a sample, such as a
body fluid, as described herein.
[0258] Binding and activation of the ErbB4 receptor by NRG3 is
expected to mediate such physiological responses in cells
expressing the ErbB4 receptor as cell growth, cell proliferation,
and cell differentiation particularly in neural tissue. As a
result, mammalian NRG3, or an ErbB4 receptor binding and activating
fragment thereof, is useful in the treatment of diseases in which
neural cell growth, proliferation and/or differentiation alleviate
symptoms of the disease. The NRG3 may be the full length amino acid
sequence of the murine NRG3 (SEQ ID NO:2) or the human NRG3s (SEQ
ID NO:6 or SEQ ID NO:23); the full length amino acid sequence from
another mammalian species having at least approximately 75%
homology to the murine and human NRG3 at the amino acid level,
preferably about 90% amino acid sequence homology in the EGF-like
binding domain; and an amino acid sequence comprising the EGF-like
domain of NRG3, which sequence binds to the ErbB4 receptor. Where
the NRG3 or ErbB4 receptor binding fragment is agonist, the NRG3 or
fragment binds to and activates ErbB4 receptor. Where the NRG3 or
fragment is an antagonist, the NRG3 or fragment binds to but does
not activate ErbB4 receptor, thereby preventing activation by the
naturally occurring NRG3 or agonist.
[0259] Diseases treatable by administration of NRG3 or an agonist
thereof (such as a polypeptide comprising an NRG3 EGF-like domain)
include, but are not limited to, disorders that may arise in a
patient in whom the nervous system has been damaged by, e.g.,
trauma, surgery, stroke, ischemia, infection, metabolic disease,
nutritional deficiency, malignancy, or toxic agents; motoneuron
disorders, such as amyotrophic lateral sclerosis (Lou Gehrig's
disease), Bell's palsy, and various conditions involving spinal
muscular atrophy, or paralysis; human "neurodegenerative
disorders", such as Alzheimer's disease, Parkinson's disease,
epilepsy, multiple sclerosis, Huntington's chorea, Down's Syndrome,
nerve deafness, and Meniere's disease; neuropathy, and especially
peripheral, referring to a disorder affecting the peripheral
nervous system, most often manifested as one or a combination of
motor, sensory, sensorimotor, or autonomic neural dysfunction, such
as distal sensorimotor neuropathy, or autonomic neuropathies
including reduced motility of the gastrointestinal tract or atony
of the urinary bladder. Examples of neuropathies associated with
systemic disease include post-polio syndrome; examples of
hereditary neuropathies include Charcot-Marie-Tooth disease,
Refsum's disease, Abetalipoproteinemia, Tangier disease, Krabbe's
disease, Metachromatic leukodystrophy, Fabry's disease, and
Dejerine-Sottas syndrome; and examples of neuropathies caused by a
toxic agent include those caused by treatment with a
chemotherapeutic agent such as vincristine, cisplatin,
methotrexate, or 3'-azido-3'-deoxythymidine. Also, NRG3 or
biologically active fragments thereof (such as an EGF-like domain
of an NRG3) may be used to treat diseases of skeletal muscle of
smooth muscle, such as muscular dystrophy or diseases caused by
skeletal or smooth muscle wasting.
[0260] Semipermeable, implantable membrane devices are useful as
means for delivering drugs in certain circumstances. For example,
cells that secrete soluble NRG3, or agonist thereof, or chimeras
can be encapsulated, and such devices can be implanted into a
patient, for example, into the brain of patients suffering from
Parkinson's Disease. See, U.S. Pat. No. 4,892,538 of Aebischer et
al.; U.S. Pat. No. 5,011,472 of Aebischer et al.; U.S. Pat. No.
5,106,627 of Aebischer et al.; PCT Application WO 91/10425; PCT
Application WO 91/10470; Winn et al. (1991) Exper. Neurology 113
:322-329; Aebischer et al. (1991) Exper. Neurology 111:269-275; and
Tresco et al. (1992) ASAIO 38:17-23. Accordingly, also included is
a method for preventing or treating damage to a nerve or damage to
other NRG3-expressing or NRG3-responsive cells, e.g. brain, heart,
or kidney cells, as taught herein, which method comprises
implanting cells that secrete NRG3, or fragment or agonist thereof,
or antagonist as may be required for the particular condition, into
the body of patients in need thereof. Finally, the present
invention includes an implantation device, for preventing or
treating nerve damage or damage to other cells as taught herein,
containing a semipermeable membrane and a cell that secretes NRG3,
or fragment or agonist thereof, (or antagonist as may be required
for the particular condition) encapsulated within the membrane, the
membrane being permeable to NRG3, or fragment agonist thereof, and
impermeable to factors from the patient detrimental to the cells.
The patient's own cells, transformed to produce NRG3 ex vivo, could
be implanted directly into the patient, optionally without such
encapsulation. The methodology for the membrane encapsulation of
living cells is familiar to those of ordinary skill in the art, and
the preparation of the encapsulated cells and their implantation in
patients may be accomplished readily as is known in the art. The
present invention includes, therefore, a method for preventing or
treating cell damage, preferably nerve damage, by implanting cells
into the body of a patient in need thereof, the cells either
selected for their natural ability to generate NRG3, or fragment or
agonist thereof, or engineered to secrete NRG3, or fragment or
agonist thereof. Preferably, the secreted NRG3 is soluble, human
NRG3 when the patient is human. The implants are preferably
non-immunogenic and/or prevent immunogenic implanted cells from
being recognized by the immune system. For CNS delivery, a
preferred location for the implant is the cerebral spinal fluid of
the spinal cord.
[0261] The administration of the NRG3, fragment or variant thereof,
of the present invention can be done in a variety of ways, e.g.,
those routes known for specific indications, including, but not
limited to, orally, subcutaneously, intravenously, intracerebrally,
intranasally, transdermally, intraperitoneally, intramuscularly,
intrapulmonary, vaginally, rectally, intraarterially,
intralesionally, intraventricularly in the brain, or intraocularly.
The NRG3 may be administered continuously by infusion into the
fluid reservoirs of the CNS, although bolus injection is
acceptable, using techniques well known in the art, such as pumps
or implantation. Sustained release systems can be used. Where the
disorder permits, one may formulate and dose the NRG3 variant for
site-specific delivery. Administration can be continuous or
periodic. Administration can be accomplished by a constant- or
programmable-flow implantable pump or by periodic injections.
[0262] Semipermeable, implantable membrane devices are useful as
means for delivering drugs in certain circumstances. For example,
cells that secrete soluble NGF variant can be encapsulated, and
such devices can be implanted into a patient, for example, into the
brain or spinal chord (CSF) of a patient suffering from Parkinson's
Disease. See, U.S. Pat. No. 4,892,538 of Aebischer et al.; U.S.
Pat. No. 5,011,472 of Aebischer et al.; U.S. Pat. No. 5,106,627 of
Aebischer et al.; PCT Application WO 91/10425; PCT Application WO
91/10470; Winn et al. (1991) Exper. Neurology 113:322-329;
Aebischer et al. (1991) Exper. Neurology 111:269-275; and Tresco et
al. (1992) ASAIO 38:17-23. Finally, the present invention includes
an implantation device, for preventing or treating nerve damage or
damage to other cells as taught herein, containing a semipermeable
membrane and a cell that secretes an NRG3, the cell being
encapsulated within the membrane, and the membrane being permeable
to NRG3, but impermeable to factors from the patient detrimental to
the cells. The patient's own cells, transformed to produce NRG3 ex
vivo, optionally could be implanted directly into the patient
without such encapsulation. The methodology for the membrane
encapsulation of living cells is familiar to those of ordinary
skill in the art, and the preparation of the encapsulated cells and
their implantation in patients may be accomplished readily as is
known in the art. Preferably, the secreted NRG3, fragment or
variant thereof, is a human NRG3 when the patient is human. The
implants are preferably non-immunogenic and/or prevent immunogenic
implanted cells from being recognized by the immune system. For CNS
delivery, a preferred location for the implant is the cerebral
spinal fluid of the spinal cord.
[0263] The pharmaceutical compositions of the present invention
comprise a NRG3 in a form suitable for administration to a patient.
In the preferred embodiment, the pharmaceutical compositions are in
a water soluble form, and may include such physiologically
acceptable materials as carriers, excipients, stabilizers, buffers,
salts, antioxidants, hydrophilic polymers, amino acids,
carbohydrates, ionic or nonionic surfactants, and polyethylene or
propylene glycol. The NRG3 may be in a time-release form for
implantation, or may be entrapped in microcapsules using techniques
well known in the art.
[0264] An effective amount of NRG3 or NRG3 agonist or antagonist to
be employed therapeutically will depend, for example, upon the
therapeutic objectives, the route of administration, and the
condition of the patient. Accordingly, it will be necessary for the
therapist to titer the dosage and modify the route of
administration as required to obtain the optimal therapeutic
effect. A typical daily dosage might range from about 10 ng/kg to
up to 100 mg/kg of patient body weight or more per day, preferably
about 1 .mu.g/kg/day to 10 mg/kg/day. Typically, the clinician will
administer NRG3 or NRG3 agonist or antagonist until a dosage is
reached that achieves the desired effect for treatment of the above
mentioned disorders.
[0265] L. Transgenic and Knockout Animals
[0266] Nucleic acids which encode novel NRG3 from non-human
species, such as the murine NRG3, can be used to generate either
transgenic animals or "knock out" animals which, in turn, are
useful in the development and screening of therapeutically useful
reagents. A transgenic animal (e.g., a mouse) is an animal having
cells that contain a transgene, which transgene was introduced into
the animal or an ancestor of the animal at a prenatal, e.g., an
embryonic stage. A transgene is a DNA which is integrated into the
genome of a cell from which a transgenic animal develops. In one
embodiment, murine cDNA encoding NRG3 or an appropriate sequence
thereof can be used to clone genomic DNA encoding NRG3 in
accordance with established techniques and the genomic sequences
used to generate transgenic animals that contain cells which
express DNA encoding NRG3. Methods for generating transgenic
animals, particularly animals such as mice, have become
conventional in the art and are described, for example, in U.S.
Pat. Nos. 4,736,866 and 4,870,009. Typically, particular
cells,-such as neuronal cells, would be targeted for NRG3 transgene
incorporation with tissue-specific enhancers, which could result in
altered cell differentiation, cell proliferation, or cellular
apoptosis, depending upon the ligand interaction with the expressed
polypeptide. Transgenic animals that include a copy of a transgene
encoding NRG3 introduced into the germ line of the animal at an
embryonic stage can be used to examine the effect of increased
expression of DNA encoding NRG3. Such animals can be used as tester
animals for reagents thought to confer protection from, for
example, diseases associated with abnormal neuronal differentiation
and neuronal cell proliferation, for example. In accordance with
this facet of the invention, an animal is treated with the reagent
and a reduced incidence of the disease, compared to untreated
animals bearing the transgene, would indicate a potential
therapeutic intervention for the disease.
[0267] Alternatively, the non-human homologues of NRG3 can be used
to construct a NRG3 "knock out" animal which has a defective or
altered gene encoding NRG3 as a result of homologous recombination
between the endogenous gene encoding NRG3 and altered genomic DNA
encoding NRG3 introduced into an embryonic cell of the animal. For
example, murine cDNA encoding NRG3 can be used to clone genomic DNA
encoding NRG3 in accordance with established techniques. A portion
of the genomic DNA encoding NRG3 can be deleted or replaced with
another gene, such as a gene encoding a selectable marker which can
be used to monitor integration. Typically, several kilobases of
unaltered flanking DNA (both at the 5' and 3' ends) are included in
the vector (see e.g., Thomas and Capecchi, Cell 51:503 (1987) for a
description of homologous recombination vectors). The vector is
introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced DNA has
homologously recombined with the endogenous DNA are selected (see,
e.g., Li et al., Cell 69: 915 (1992)). The selected cells are then
injected into a blastocyst of an animal (e.g., a mouse) to form
aggregation chimeras (see, e.g., Bradley, in Teratocarcinomas and
Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed.
(IRL, Oxford, 1987), pp. 113-152). A chimeric embryo can then be
implanted into a suitable pseudopregnant female foster animal and
the embryo brought to term to create a "knock out" animal. Progeny
harboring the homologously recombined DNA in their germ cells can
be identified by standard techniques and used to breed animals in
which all cells of the animal contain the homologously recombined
DNA. Knockout animals can be used in the selection of potential
therapeutic agents, such as NRG3 agonists, that restore the
cellular processes initiated or maintained by native NRG3; or the
knockout animals can be used in the study of the effects of nrg3
mutations.
[0268] The instant invention is shown and described herein in what
is considered to be the most practical, and the preferred
embodiments. It is recognized, however, that departures may be made
therefrom which are within the scope of the invention, and that
obvious modifications will occur to one skilled in the art upon
reading this disclosure.
EXAMPLES
[0269] The following examples are provided so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make the compounds and compositions of the
invention and how to practice the methods of the invention and are
not intended to limit the scope of what the inventors regard as
their invention. Efforts have been made to insure accuracy with
respect to numbers used (e.g. amounts, temperature, etc.), but some
experimental errors and deviation should be accounted for. Unless
indicated otherwise, parts are parts by weight, temperature is in
degrees C, and pressure is at or near atmospheric.
Example 1
Molecular Cloning of a Mouse and Human Novel NRG3
[0270] Novel NRG3 cDNAs were identified using an expressed sequence
tag shown below:
AATTTCTGCCGAAAACTGATTCCATCTTATCGGATCCAACAGACCACTTGGGGATTG
AATTCATGGAGAGTGAAGAAGTTTATCAAAGGCAGGTGCTGTCAATTTCATGTATCA
TCTTTGGAATTGTCATCGTGGGCATGTTCTGTGCAGCATTCTACTTCAAAAGCAAGA
AACAAGCTAAACAAATCCAAGAGCAGCTGAAAGTGCCACAAAATGGTAAAAGCTAC
AGTCTCAAAGCATCCAGCACAATGGCAAAGTCAGAGAACTTGGTGAAGAGCCATGT
CCAGCTGCAAAATAAAATGTCAGGCTTCTGAGCCCAAGCTAAGCCATCATATCCCCT
GTNGACCTGCACGTGCACATCCNGATGGCCCGTTTCCTGCCTTTTNTGATGACATTTN
CACCACAAATGNAGTGAAAATGGGNCTTTTCNTGCCTTAACTGGTTGACNTTTTTNC
CCCAAAAGGAG (EST; SEQ ID NO:21; Genbank entry H23651) from the
National Center for Biotechnology Information (NCBI) database of
ESTs. This EST from a human brain cDNA library, encodes an amino
acid sequence having approximately 62% identity to amino acids
232-316 of heregulin-.beta.1 (also designated neuregulin-.beta.1,
or NRG1).
[0271] To obtain a partial human cDNA clone, a 50-base single
stranded oligonucleotide probe
(5'-TGGTAAAAGCTACAGTCTCAAAGCATCCAGCACAATGGCAAAGTCAGAGA-3'; SEQ ID
NO:18) was synthesized based on the EST sequence. The probe was
used to screen 1.5.times.10.sup.6 plaques from a .lamda.gt10 cDNA
library prepared from human fetal brain RNA (HL3003a, Clontech) as
described by Godowski et al. (Godowski, P. J. et al. (1989) PNAS
USA 86:8083-8087, herein incorporated by reference in its
entirety). Nine positive plaques were obtained and the sequences of
both strands of the largest inserts were determined by standard
sequencing techniques. From these cloned overlapping sequences, a
partial cDNA sequence of the human NRG3 was obtained.
[0272] Additional 5' human NRG3 sequence was obtained by anchored
PCR of human hippocampus RNA (Clontech). The complete human open
reading frame nucleic acid sequence deduced from direct sequencing
of hNRG3B1 cDNA is shown in FIG. 2 (SEQ ID NO:5). ATCC 209157 is
nucleic acid comprising an expression vector and the nucleotide
sequence of the human NRG3B1 open reading frame. An alternatively
spliced form of human NRG3 was cloned as pRK5.tk.neo.hNRG3B2 (SEQ
ID NO:22) encoding the deduced amino acid sequence of SEQ ID NO:23,
which amino acid sequence lacks amino acids 529 to 552 of SEQ ID
NO:6 (see FIG. 4B). Since this alternatively spliced form of human
NRG3 comprises the EGF-like domain of the other NRG3s as well as
high amino acid sequence homology, it is expected to exhibit the
biological properties of the NRG3s disclosed herein.
[0273] To clone murine NRG3 cDNA sequences, two degenerate primers
were designed based on regions proximal to the transmembrane domain
of the partial human cDNA, encoding the amino acid sequences
NDGECFVI (SEQ ID NO:19) and EFMESEEVY (SEQ ID NO:20). A mouse brain
cDNA library (Clontech, ML1042a) was screened, and a clone (C5a)
containing a partial murine NRG3 cDNA was obtained by standard
techniques. Using a probe derived from the C5a sequence, two
additional mouse brain cDNA libraries (ML1034h, Clontech; and
936309, Stratagene) were screened. Both strands of two overlapping
murine partial NRG3 clones, SWAJ-3 and ZAP-1 were sequenced and,
together were found to encode an entire open reading frame (ORF) of
2139 bp having the DNA sequence SEQ ID NO:1 and the deduced amino
acid sequence SEQ ID NO:2 shown in FIG. 4A. Nucleic acid comprising
the murine NRG3 open reading frame cloned into an expression vector
is designated pLXSN.mNRG3 (ATCC 209156).
[0274] The chromosomal localization of human NRG3 was mapped to
10q22 by PCR analysis of somatic cell hybrid DNA, whereas the NRG1
gene is located at 8p11-22 (Lee, J. and Wood, W. I. (1993) Genomics
16:790-791; and Orr-Urtreger, A. et al. (1993) Proc. Natl. Acad.
Sci. USA 90:1867-1871). Thus, NRG3 is a novel member of the
EGF-like family of protein ligands.
Example 2
Characterization of the Mouse and Human NRG3 Deduced Amino Acid
Sequences
[0275] The cDNAs of human and murine NRG3 contained open reading
frames encoding proteins of 720 and 713 amino acids respectively,
with predicted MW of 77,901 Da for human NRG3 and 77,370 Da for
murine NRG3 (FIG. 4). The two species of NRG3 are 93% identical in
amino acid sequence.
[0276] Analysis of the amino acid sequence of human NRG3 revealed
that it contained homology to NRG1 family members (i.e. 23% and 19%
sequence identity to SMDF (Ho, W. H. et al. (1995) J. Biol. Chem.
270:14523-32) and heregulin-.beta.1 (Holmes, W. E. et al. (1992)
Science 256:1205-10) respectively). A hydropathy analysis indicated
two hydrophobic segments: W.sup.66-V.sup.91 and L.sup.362-F.sup.383
(amino acid numbers according to human NRG3). Similar to NRG1, the
C-terminal hydrophobic segment may serve as the transmembrane
domain and the N-terminal region may act as internal signal
sequence (Wickner, W. T. and Lodish, H. F. (1985) Science
230:400-7; Sabatini, D. D. et al. (1982) J. Cell Biol. 9:1-22; and
Blobel, G. (1980) Proc. Natl. Acad. Sci. USA 77:1496-500). In
contrast to many neuregulin family members, the extracellular
domain of NRG3 is devoid of Ig-like or kringle domains. Instead,
NRG3 contains a unique Ala/Gly rich segment at the N-terminus, a
mucin-like Ser/Thr rich region containing abundant sites for
O-linked glycosylation, and an EGF motif. There are no predicted
sites for N-linked glycosylation. The EGF-like domain of NRG3 is
distinct from those encoded by the NRG1 (31% identity compared with
neuregulin-.beta.1 EGF-like domain) and NRG2 (39% identity with
neuregulin-.beta.1 EGF-like domain), suggesting that NRG3 is not an
alternatively spliced NRG1 isoform. A diagrammatic comparison of
EGF-like domains of EGF family members is shown in FIG. 5. The
putative intracellular domain of NRG3 contains only approximately
13% sequence identity to the intracellular domain of NRG1. The
EGF-like domains of the EGF family members were obtained from the
following sources, each reference herein incorporated by reference
in its entirety. The sequences compared in FIG. 5 include the
EGF-like domain of human NRG3 (hNRG3.egf; SEQ ID NO:4; disclosed
herein); chicken ARIA (cARIA.egf; SEQ ID NO:9) (Falls, D. L. et al.
(1993) Cell 72:801-815), human amphiregulin (hAR.egf; SEQ ID NO:10)
(Plowman, G. D. et al. (1990) Mol. Cell. Biol. 10:1969-81.); human
betacellulin (hBTC.egf; SEQ ID NO:11) (Sasada, R. et al. (1993)
Biochem. Biophy. Res. Com. 190:1173-9); human EGF (hEGF.egf; SEQ ID
NO:12)(Nagai, M. et al. (1985) Gene 36:183-8.); human
heparin-binding EGF-like growth factor (hHB-EGF.egf; SEQ ID NO:13)
(Higashiyama, S. et al. (1991) Science 251:936-9.); human
heregulin-.alpha. (hHRG.alpha.; SEQ ID NO:14); human
heregulin-.beta. (hHRG.beta..egf; SEQ ID NO:15)(Holmes, W. E. et
al. (1992) Science 256:1205-12210); human TGF-.alpha.
(hTGF.alpha..egf; SEQ ID NO:16) (Derynck, R. et al. (1984) Cell
38:287-97.); and mouse epiregulin (mEPR.egf; SEQ ID NO:17) (Toyoda,
H. et al. (1995) FEBS Lett. 377:403-7.).
Example 3
Expression of Murine and Human NRG3
[0277] A. Northern Blot Analysis of Human tissue. The tissue
expression profile of the human NRG3 was examined by Northern blot
analysis. A multi-tissue RNA blot containing 2 .mu.g each of
poly(A).sup.+ RNA from human tissues were purchased from Clontech.
The region of the human NRG3 nucleic acid sequence encoding amino
acids 394 to 536 was used to generate DNA hybridization probes by
PCR amplification. The DNA probes were labeled with
.alpha.-.sup.32P-dCTP by random priming (Promega). The RNA blot was
hybridized with 50% formamide, 5.times.SSC, 50 mM potassium
phosphate (pH 7.0), 5.times. Denhardt's, 10% dextran sulfate at
42.degree. C. for 20 hr. The blot was washed with 0.1.times.SSC,
0.1% SDS at 50.degree. C. for 30 min and exposed in
PhosphoImager.TM.. Expression of NRG3 is mixtures of tissues was
used as a guide to determine expression in specific tissues by in
situ hybridization.
[0278] B. In situ Hybridization Analysis of Mouse Tissues.
Formalin-fixed, paraffin-embedded mouse embryos (embryonic days 13,
14, 16), and glutaraldehyde-fixed, paraffin-embedded or
paraformaldehyde-fixed, frozen adult mouse brain, ovary, jejunum,
kidney, adrenal, lung, stomach, spleen, skeletal muscle, liver and
colon were sectioned and processed for in situ hybridization by the
method of Lu and Gillett (Lu, L. H. and Gillett, N. A. (1994) Cell
Vision 1:169-176) with modifications. Briefly, the in situ
hybridization probe was generated by in vitro transcription
directly from a PCR fragment, rather than from a plasmid DNA as
described. .sup.32P-UTP-labeled sense and antisense riboprobes were
generated by labeling PCR products of a cDNA fragment encoding
amino acids C.sup.292 to N.sup.482 of murine NRG3.
[0279] C. Northern Blot And In Situ Hybridization Analyses Reveal a
Neural Expression Pattern of NRG3. A 4.4 kb mRNA transcript that
hybridized to the probe derived from amino acids 394 to 536 of
human NRG3 was highly expressed in brain. In a Northern blot of
various brain tissues, NRG3 expression was detected at high levels
in most regions of the brain with the exception of corpus callosum.
A lower level expression of a 1.9-kb transcript was detected in
testis. The 4.4-kb transcript, but not the 1.9-kb transcript, is of
sufficient size to encode NRG3, suggesting that the smaller
transcript may encode an alternatively spliced form of NRG3. A
similar pattern of expression of NRG3 was observed in RNA blots
from murine tissues using a probe derived from the region of murine
NRG3 that overlaps the EGF-like domain.
[0280] The tissue distribution of NRG3 expression was characterized
by in situ hybridization using tissues of embryonic and adult mice.
At embryonic day 13 (E13) (the earliest time point examined), NRG3
mRNA was confined to the nervous system. A strong signal for NRG3
mRNA in the brain, spinal cord, trigeminal, vestibular-cochlear and
spinal ganglia of embryonic day 16 (E16) mice was also
demonstrated. Regions of the telencephalon containing
differentiating cells (e.g., the cortical plate) displayed an
intense NRG3 signal, whereas the underlying regions containing
proliferating or migrating cells (ventricular and subventricular
zones), showed little expression. Thus, NRG3 appeared to be
expressed mainly in the nervous system of embryonic mice. In adult
animals NRG3 antisense probes hybridized to mRNA in spinal cord and
numerous brain regions including deep cerebellar nuclei, vestibular
nuclei, cerebral cortex, piriform cortex, anterior olfactory
nucleus, medial habenula, hippocampus, hypothalamus and
thalamus.
Example 4
Characterization of the Binding Characteristics of NRG3
Fragments
[0281] A. Expression and Purification of NRG3EGF Fusion Protein in
Mammalian Cells
[0282] To examine the binding characteristics of the NRG3 EGF-like
domain as well as to demonstrate the functionality of an NRG3
fragment of the invention, a soluble fusion protein was prepared
comprising a sequence of EGF-like domain, which domain has the same
amino acid sequence in mouse and human NRG3.
[0283] A secreted, epitope tagged polypeptide comprising the
EGF-like domain of murine NRG3.sub.284-344 was constructed by
linking in the expressed N-terminal to C-terminal direction 1) the
coding sequence for the gD signal sequence and epitope tag (Mark,
M. R. et al. (1994) J. Biol. Chem. 269, 10720-10728); 2) the
sequences encoding amino acids 284-344 of murine NRG3 (identical to
human NRG3 amino acids 282 to 342); and 3) the coding sequences of
the Fc portion of human IgG.sub.1 in pSAR.SD5 vector (psar.SD5,
from A. Shen, Genentech, Inc.). The plasmid encoding these
sequences was designated NRG3.sup.EGF.Fc. The NRG3.sup.EGF.Fc
expression plasmid was transfected using LipofectAMINE (GIBCO/BRL,
Bethesda, Md.) into DHFR.sup.- Chinese hamster ovary cells
(CHO/DP12; ATCC designation CCL 9096). Clones were selected in
glycine/hypoxanthine/thymidine minus medium see, for example,
(Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory (1989)), pooled, and expanded. The encoded
fusion protein was expressed in cultures of the selected clones.
Conditioned media from these cells were collected and the
recombinant protein purified by a HiTrap protein A affinity column
(Pharmacia).
[0284] A monomeric fusion protein designated NRG3.sup.EGF.H6 fusion
protein was produced in the same system as the Fc-fusion protein
and purified through a cobalt affinity column. NRG3.sup.EGF.H.sub.6
comprises the N-terminal gD tag, murine NRG3.sub.284-344, and a
coding sequence for six histidine residues. Purification was based
on the affinity of the histidine side chains for immobilized cobalt
using a cobalt affinity column (Cobalt affinity column, R. Vandlen,
Genentech, Inc.). Protein concentration was determined by BioRad
Protein Assay (BioRad, Richmond, Calif.).
[0285] B. Generation of K562.sup.erbB Cell Lines. Stable cell lines
that expressed human ErbB2, ErbB3 or ErbB4 receptors were derived
from K562 cells (K562 cells have ATCC designation CCL 243). cDNAs
of human erbB2, erbB3 and erbB4 were from L. Bald and G. Scoffer,
Genentech (Sliwkowski, M. et al. (1994), J. Biol Chem.
269:14661-14665). These cDNAs were subcloned into CMV-based
expression vectors and introduced into the K562 human myeloid
leukemia cell line by electroporation (1180 mF, 350 V). The
transfectants were cultured in RPMI 1640 supplemented with 10%
fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, 100 mg/ml
streptomycin, and 10 mM HEPES containing 0.8 mg/ml G418. Resistant
clones were obtained by limiting dilution, and receptor expression
was confirmed by western blot and NRG binding assays. Receptor
expression was confirmed by western blot analysis using antibodies
for each of the ErbB receptors (antibodies prepared at Genentech,
Inc.) Phorbol ester stimulation was found to significantly enhance
receptor expression in both the ErbB3 and ErbB4 transfectants, and
the stably transfected K562 cell lines were cultured in medium
containing 10 ng/ml Phorbol, 12-Myristate, 12-Acetate-(PMA)
overnight prior to use.
[0286] C. FACS Analysis. For each binding reaction,
5.times.10.sup.5 stably transfected K562 cells were suspended in
PBS/2% BSA at 4.degree. C. for 30 min followed by incubation with 5
.mu.g of isolated, purified NRG3.sup.EGF.Fc (MW 90 kDa) in a volume
of 0.25 ml on ice for 60 min. 1 .mu.g of primary antibody (anti-gD
or anti-ErbB receptor) and secondary PE-conjugated (CALTAG, CA.,
goat anti-mouse, 1:100 dilution) antibodies were added sequentially
with 30-60 min incubation time and extensive washes before each
addition. FACS analyses were performed on a Becton & Dickson
FACS instrument. Anti-gD (5B6), anti-ErbB2 receptor (4D5),
anti-ErbB3 receptor (2F9) and anti-ErbB4 receptor (3B9) monoclonal
antibodies were prepared using standard techniques by the
Monoclonal Antibody Group, Genentech, Inc.
[0287] D. The EGF-Like domain of NRG3 Binds Specifically to the
ErbB4 Receptor Tyrosine Kinase. To identify the receptor(s) for
NRG3, the ability of NRG3 to bind to any of the known neuregulin
receptors was investigated. Stable cell lines were generated which
expressed receptors ErbB2, ErbB3, or ErbB4. The parental cell line
K562 does not express detectable levels of ErbB receptors (FIG.
6A). K562.sup.erb2, K562.sup.erb3 and K562.sup.erb4 cells expressed
only the corresponding receptors (FIGS. 6B-6D).
[0288] Since the EGF-like domain determines the binding specificity
of NRG1 to their receptors, a protein containing an epitope tagged
version of the EGF-like domain of NRG3 fused to the Fc portion of
human IgG was expressed and purified. Using a FACS assay, it was
observed that NRG3.sup.EGF.Fc bound to cells expressing ErbB4
receptor (FIG. 6H). Binding was specific in that NRG3.sup.EGF.Fc
did not bind to either the parental K562 cells, or cells expressing
either ErbB2 or ErbB3 (FIGS. 6E-6G). A control fusion protein,
RSE.Fc, did not bind to any of these cell lines. This binding of
NRG3.sup.EGF.Fc to K562.sup.erb4 cells was competed in a
dose-dependent fashion by the EGF-like domain of heregulin-.beta.1
(NRG1.sup.EGF), but not by RSE.Fc, suggesting that NRG3.sup.EGF.Fc
interacts directly with ErbB4 receptors on the cell surface.
[0289] A soluble form of the ErbB4 receptor was
co-immunoprecipitated by NRG3.sup.EGF.Fc in vitro, further
demonstrating the binding of NRG3.sup.EGF.Fc to ErbB4 receptor.
[0290] The binding of NRG3.sup.EGF.Fc to ErbB4 receptor was further
analyzed by direct competitive binding assays using
.sup.125I-labeled NRG3.sup.EGF.Fc. Purified NRG3.sup.EGF.Fc was
radio-iodinated using the lactoperoxidase method as described by
Sliwkowski et al. (Sliwkowski, M. X. et al. (1994) J. Biol. Chem.
269, 14661-5). The average specific activity of the radiolabeled
protein was 300 .mu.Ci/.mu.g. Binding of .sup.125I-NRG3.sup.EGF.Fc
to immobilized ErbB4.Fc was competed by either NRG3.sup.EGF.Fc or
EGF domain of NRG1.sup.EGF (rHRG.beta.1.sub.177-244) in a
concentration dependent manner.
[0291] The displacement binding assays were performed in Maxisorp C
96-wells (Nunc, Naperville, Ill.). Goat anti-human antibody
(Boehringer Mannheim, Germany) was coated on the plate at a
concentration of 0.2 .mu.g/well in 100 .mu.l of 50 mM sodium
carbonate buffer (pH 9.6) at 4.degree. C., overnight. The plate was
blocked by 1% BSA in TBST buffer (25 mM Tris, pH 7.5, 150 mM NaCl,
0.02% Tween 20) for 30 min at room temperature (RT). A soluble form
of ErbB4 receptor was added at 15 ng/well in 1% BSA/TBST and
incubated for 1.5 hr at RT. To prevent radiolabeled protein from
interacting with residual goat anti-human antibodies, 1 .mu.M of a
humanized monoclonal antibody (rhuMAB HER2; Carter, P. et al.
(1992) Proc. Natl. Acad. Sci. USA 89:4285-9) was added to the plate
for 20 min and was included in the subsequent binding reaction.
[0292] The competitive binding assay was then initiated by the
addition of 80 pM (200,000 cpm) of .sup.125I-NRG3.sup.EGF.Fc along
with various concentrations of unlabeled NRG3.sup.EGF.Fc or
NRG1.sup.EGF (E. coli-expressed, without Fc). NRG1.sup.EGF is the
EGF domain of NRG1, corresponding to amino acids 177-244 of the
neuregulin-.beta.1 isoform (Holmes, W. E. et al. (1992) Science
256:1205-10) and obtained from J. A. Lofgren, Genentech, Inc. The
final incubation volume was 100 .mu.l in binding buffer (F-12/DMEM
medium, 50 mM HEPES, pH7.5, 2% BSA) and the reaction was allowed to
proceed at RT for 1.5 hr. The unbound material was washed by TBST
extensively, and the bound radioactivity was counted on a Beckman
IsoData gamma-counter (Smith-Kline Beckman, Pa.). Data was analyzed
using a nonlinear regression computer program.
[0293] Based on the results of the binding experiments as shown in
FIGS. 6A-6H, the estimated affinity (K.sub.i) for NRG3.sup.EGF.Fc
for binding to ErbB4.Fc was determined to be 9.+-.4 nM (n=4), and
the apparent K.sub.i of NRG1.sup.EGF was approximately 1 nM. The
shallowness of the displacement curve of NRG3.sup.EGF.Fc may be due
to the fact that the NRG3.sup.EGF.Fc is expressed as a bivalent Fc
fusion protein (FIG. 7). The results of the control experiments
showed that .sup.125I-NRG3.sup.EGF.Fc did not bind control receptor
RSE.Fc in the same experiment, and RSE.Fc did not compete
.sup.125I-NRG3.sup.EGF.Fc bound to ErbB4.Fc.
[0294] E. Tyrosine Phosphorylation Assay. NRG1 binds and activates
ErbB2, ErbB3 and ErbB4 receptor resulting in tyrosine
phosphorylation and downstream signaling events (Sliwkowski, M. X.,
et al. (1994), supra; Plowman, G. D. et al. (1993) supra; and
Carraway, K. L. and Cantley, L. C. (1994), surpa). As demonstrated
in the preceding example, NRG3 binds ErbB4 receptor, but not ErbB2
or ErbB3 receptors at a detectable level. The ability of the
EGF-like domain of NRG3 (NR.sub.3.sup.EGF) to activate ErbB4
receptor, K562.sup.erbB4 cells was examined.
[0295] K562.sup.erbB4 cells or MDA-MB-453 cells (negative control;
ATCC designation HB 131) were cultured in medium lacking serum for
12 hours and then stimulated with NRG3.sup.EGF.Fc, NRG.sup.EGF.H6
or NRG1.sup.EGF. K562.sup.erbB4 cells were treated with 2.5 nM or
25 nM of NRG3.sup.EGF.Fc for 3 min or 8 min. As a positive control,
the cells were similarly treated with NRG1.sup.EGF.
[0296] ErbB4 receptor tyrosine phosphorylation was detected by
immunoprecipitation and Western blot according to the following
procedure. Cells were lysed with lysis buffer (20 mM Tris, pH 7.5,
100 mM NaCl, 30 mM NaF, 2 mM EDTA, 2 mM EGTA, 0.1% SDS, 1% Triton
X-100, 2 mM sodium vanadate, 2 mM sodium molybdate, 2 mM of PMSF).
After removing cell debris by centrifugation, 1 .mu.g of anti-ErbB4
receptor monoclonal antibody (C-18, Santa Cruz Biotechnology, Santa
Cruz, Calif.) was added together with 20 .mu.l of protein A-agarose
slurry (Sigma, St. Louis, Mo.). Immunoprecipitation was performed
at 4.degree. C. overnight, complexes were collected by
centrifugation and washed three times with 1 ml lysis buffer.
Proteins were separated by reducing SDS-polyacrylamide gel
electrophoresis (SDS-PAGE) on Novex 4%-12% minigels and transferred
to nitrocellulose. The blots were probed with peroxidase conjugated
anti-phosphotyrosine antibody (Transduction Laboratory). The blot
was stripped and reprobed with anti-ErbB4 receptor antibody
followed by peroxidase conjugated goat anti-rabbit IgG antibody
(Sigma) to visualize ErbB4 receptor proteins.
[0297] Based on these experiments, it was demonstrated that
NRG3.sup.EGF.Fc stimulated ErbB4 receptor tyrosine phosphorylation
at both time points and in a dose dependent manner.
[0298] To confirm the ability of NRG3.sup.EGF to activate the ErbB4
receptor tyrosine phosphorylation, receptor activation in the human
breast cancer cell line MDA-MB-453 was examined. This cell line
expresses high level of ErbB2 and ErbB3 receptors, and low levels
of ErbB4 receptor. Treatment of MDA-MB-453 cells with
NRG3.sup.EGF.Fc or with a monomeric form of the EGF domain
(NRG3.sup.EGF.H.sub.6) resulted in substantial increase of tyrosine
phosphorylation of ErbB4 receptor.
[0299] NRG family members and other members in the EGF family
display a complex pattern of receptor binding. In most cases, one
ligand is able to bind several combinations of receptor homo- and
heterodimers (Karunagaran, D. et al. (1996) EMBO J
15:254-264,Beerli, R. R. and Hynes, N. E. (1996) J. Biol. Chem.
271:6071-6076). For example, NRGs bind ErbB2/ErbB3 receptor
heterodimers and ErbB4/ErbB4 receptor homodimers with high affinity
but ErbB3/ErbB3 receptor homodimers with low affinity (Sliwkowski,
M. X. et al. (1994) J. Biol. Chem. 269, 14661-5, Carraway, K. L.
and Cantley, L. C. (1994) Cell 78, 5-8, Tzahar, E. et al. (1994) J.
Biol. Chem. 269, 25226-33, Carraway, K. L. r. et al. (1994) J.
Biol. Chem. 269, 14303-6, and Kita, Y. A. et al. (1994) FEBS Lett.
349, 13943). Betacellulin binds both EGFR and ErbB4 homodimers
(Riese, D. J. et al. (1995) Mol. Cell. Biol. 15:5770-6). The
EGF-like domains of EGF and NRG1 family members determine the
specificity of receptor activation (Barbacci, E. G. et al. (1995)
J. Biol. Chem. 270:9585-9589). The limited amino acid sequence
homology in the EGF-like domains of NRG3 and NRG1 suggests that
NRG3 may have a different spectrum of receptor interactions
relative to members of the NRG family, but with potentially
overlapping binding sites, since binding of the EGF-like domain of
NRG3 to ErbB4 can be competed by the EGF-like domain of NRG1.
[0300] NRG3.sup.EGF.Fc did not bind to K562 cells that express
either ErbB2 or ErbB3 (FIGS. 6E-6G), or to MDA-MB-486 cells which
express high levels of the EGFR. An increase in phosphorylation of
either the EGFR, ErbB2 or ErbB3 in MDA-MB-453 cells treated with
NRG3 also was not observed.
[0301] Most variants of NRGs, with the exception of the neural
specific form of SMDF, are widely expressed in numerous tissues
including brain, heart, skeletal muscle, breast, liver, lung, among
others. Betacellulin, a ligand for both EGFR and ErbB4, also
displays broad tissue expression patterns (Shing, Y. et al. (1993)
Science 259, 1604-7; Sasada, R. et al. (1993) Biochem. Biophy. Res.
Com. 190, 1173-9). In contrast, the expression of NRG3 is
strikingly restricted to neural tissues as disclosed herein by
Northern analysis and in situ hybridization. Developmentally, NRG3
mRNA can be detected as early as E11 (but not E4) in mouse as
judged by Northern blot and E13 by in situ hybridization (the
earliest age examined). ErbB4 is predominantly expressed in brain,
heart and skeletal muscle (Plowman, G. D. et al. (1993) Proc. Natl.
Acad. Sci. USA 90, 1746-50). ErbB4 was also shown to be broadly
distributed in the brains of chick embryos (E14, E17, predominantly
in neurons) (Francoeur, J. R. et al. (1995) J. Neur. Res. 41,
836-45), in rat retina cultures (Bermingham-McDonogh, O. et al.
(1996) Development 122, 1427-38.), at neuromuscular synapses (Zhu,
X. et al. (1995) EMBO J. 14, 5842-8.), but not in cultured human
and rat Schwann cells (Grinspan, J. B. et al. (1996) J.
Neuroscience 16, 6107-6118,Levi, A. D. et al. (1995) J.
Neuroscience 15, 1329-40.). Recently, ErbB4 was found to
co-localize with GABA.sup.+ cells (Weber, J. et al. (1996) Soc
Neurosci Abstr 22, 1579.). Thus, the same receptor may mediate
distinct biological functions in different tissues or cell types
when interacted with corresponding tissue-specific ligands. For
example, NRG1 may serve as a ligand for ErbB4 during heart
development, betacellulin may act as a mitogenic ligand for ErbB4
in variety of cell types, while neural specific ligand(s) (such as
NRG3) may function as trophic or guidance molecules on ErbB4
receptor expressing cells in the central or peripheral nervous
systems.
Example 5
Binding and ErbB4 Receptor Tyrosine Kinase Activation by Full
Length Mouse and Human NRG3s
[0302] A full length murine NRG3 or human NRG3 was synthesized
based on the murine and human consensus nucleic acid sequences SEQ
ID NO:1 and SEQ ID NO:5, respectively and the NRG3s were expressed
as amino acid sequences. Based on the experiments described herein
for the characterization of NRG3-EGF binding and ErbB4 receptor
activation, analogous experiments are performed for the full length
consensus NRG3 from mouse and human sources. Adjustments to the
reaction conditions are made to optimize pH, solutes and their
concentrations, and other relevant parameters to allow ErbB4
receptor-binding of the full length consensus NRG3 and ErbB4
receptor activation.
[0303] Alternatively, a murine or human NRG3 polypeptide fragment
comprising the EGF-like domain but lacking the transmembrane domain
is synthesized and tested for ErbB4 receptor binding and activation
as described herein. Such a NRG3 fragment may, for example, include
the extracellular domain of a NRG3, which extracellular domain
contains the EGF-like domain.
[0304] A NRG3 extracellular domain may optionally be fused to an
immunoglobulin constant region, as shown herein for the NRG3-EGF-Fc
fusion proteins. As an Fc fusion protein, the NRG3 extracellular
domain-Fc protein is expected to form a dimer. The immunoglobulin
constant region is preferably from IgG, but may also be taken from
IgM, IgA and IgE and remain within the scope of the invention.
[0305] Where a monomeric fusion protein is desired that retains
binding activity or binding and activation ability, the
extracellular domain is fused to, for example, a series of
histidine residues as disclosed herein for the NRG3-EGF-H6
immunoadhesion.
[0306] Adjustments to the binding reaction conditions are made to
optimize pH, solutes and their concentrations and other relevant
parameters to allow ErbB4 receptor-binding of the NRG3 fragment and
ErbB4 receptor activation.
Example 6
Enhancement of Cellular Proliferation
[0307] Enhancement of cellular proliferation is exemplified by the
following assay in which cells expressing ErbB4 receptor on their
surface are treated with NRG3. It is understood that according to
the invention, the cells may be treated with a NRG3 fragment (such
as the NRG3 EGF-like domain) or a NRG3 variant.
[0308] As an example, rat retina cells which naturally express
ErbB4 receptor (Bermingham-McDonogh, O. et al. (1996) Development
122, 1427-38) are cultured by standard techniques. The cultured
cells are contacted with NRG3 in a dose dependent manner and an
increase in cell number (e.g. a 30% percent increase at 48 hours)
and EC50 is determined.
[0309] NRG3 treatment may also alter the morphology of these cells;
untreated cells were multipolar with numerous branched processes
whereas NRG3-treated cells may become spindle-shaped smooth
processes and/or align themselves in a parallel array.
[0310] NRG3 is believed to stimulate neuronal cell growth in a dose
dependent manner. NRG3 alone is expected to produce a significant
increase in neuronal cell number compared to control medium. A
synergistic effect may be observed between other neuronal
proliferation enhancers such as gas6 (growth arrest-specific gene;
see, for example, Schneider et al., Cell 54:787-793 (1988); and
Manfioletti et al. in Molec. Cell Biol. 13(8):4976-4985 (1993))
and/or heregulin. NRG3 is expected to increase both cell number and
thymidine incorporation as measures of cell proliferation.
[0311] NRG3 is expected to have an effect on cell morphology as
determined by viewing phase contrast micrographs of ErbB4
receptor-expressing neuronal cells grown in various media
containing NRG3 alone or NRG3 plus other cell proliferation
enhancing compounds such as heregulin, gas6, fetal bovine serum,
and the like. Photomicrographs are taken after 96 hours of culture.
The cells grown in the presence of NRG3 are expected to have
processes which are not observed in cells grown in the absence of
NRG3.
[0312] Cells are stained by immunofluorescence for markers specific
for the cultured neuronal cells. Briefly, passaged ErbB4
receptor-expressing neuronal cells are contacted with NRG3 and
cultured for 24 hours on laminin coated Chamber slides and fixed in
10% formalin in PBS. Fixed cells are blocked with 10% goat serum
and incubated with rabbit derived anti-marker antibody at dilutions
recommended by the distributor. Specific binding of the primary
antibody is observed by staining with goat anti-rabbit IgG
(Fab').sub.2-FITC conjugates. Cells are counter-stained with DNA
dye propidium iodide. Negative controls are run on WI-38 cells
which stain negative. Cells grown under these conditions are
expected to show 100% immunofluorescent staining for the cell
markers.
[0313] The ability of NRG3 to stimulate proliferation in ErbB4
receptor-expressing neuronal cells through the ErbB4 tyrosine
kinase receptors may be investigated as follows. Cells are
stimulated with various amounts of NRG3 (for example, 0 to 200 nM)
for 15 min in a 37.degree. C. incubator. Cell lysates are prepared
and immunoprecipitated with an anti-ErbB4 receptor antibody.
Tyrosine phosphorylation of ErbB4 receptor is detected with 4G10
anti-phosphorylation antibody. Approximately 10.sup.6 cells are
grown to near confluence in defined media. Cells are treated with
NRG3 for 15 min in a 37.degree. C. incubator and lysed on ice with
1 ml of lysis buffer (20 mM HEPES, pH7.4, 135 mM NaCl, 50 mM NaF, 1
mM sodium vanadate and 1 mM sodium molybdate, 2 mM EDTA and 2 mM
EGTA, 10% glycerol, 1% NP40, 1 .mu.M okadaic acid, 1 mM PMSF and 1
mM AEBSF). Cell lysates are clarified by centrifuging at
14000.times.g at 4.degree. C. for 10 min. Immunoprecipitations are
performed using approximately 1 .mu.g of rabbit anti-ErbB4 receptor
antibody or 2 .mu.l of rabbit anti-ErbB4 receptor antiserum.
Immunocomplexes are collected with 10 .mu.l of Protein A Sepharose
CL-4B beads. Proteins are separated on Novex 4-12% gradient gel and
transferred onto nitrocellulose membrane. Anti-phosphotyrosine
immunoblots are performed using 4G10 mouse anti-phosphotyrosine
antibody (UBI), goat anti-mouse horseradish peroxidase conjugate
and ECL developing kit (Amersham). Addition of NRG3 to ErbB4
receptor-expressing neuronal cells is expected to cause
autophosphoralation of ErbB4 receptor tyrosine residue(s).
[0314] It is beneficial to have populations of mammalian neuronal
cells (preferably human cells) for use as cellular prostheses for
transplantation into areas of damaged spinal cord in an effort to
influence regeneration of interrupted central axons, for assisting
in the repair of peripheral nerve injuries and as alternatives to
multiple autografts. See Levi et al., J. Neuroscience
14(3):1309-1319 (1994). The use of cell culture techniques to
obtain an abundant source of autologous graft material from a small
biopsy has already met with clinical success in providing human
epidermal cells to cover extensive burns (Gallico et al., N. Eng J.
Med. 311:338451 (1984)). Accordingly, it is expected that the above
approach will meet with success in mammals, including humans.
[0315] All documents cited throughout the specification as well as
the references cited therein are hereby expressly incorporated by
reference in their entirety. While the present invention is
illustrated with reference to specific embodiments, the invention
is not so limited. It will be understood that further modifications
and variations are possible without diverting from the overall
concept of the invention. All such modifications are intended to be
within the scope of the present invention.
Deposit of Material
[0316] The following materials have been deposited with the
American Type Culture Collection, 12301 Parklawn Drive, Rockville,
Md., USA (ATCC): TABLE-US-00002 ATCC Material Dep. No. Deposit Date
mouse NRG3 pLXSN.mNRG3 209156 Jul. 22, 1997 human NRG3B1
pRK5.tk.neo.hNRG3B1 209157 Jul. 22, 1997 human NRG3B2
pRK5.tk.neo.hNRG3B2 209297 Sep. 23, 1997
[0317] These deposits are made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposit will be made available by ATCC under the terms
of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn.122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn.1.14
with particular reference to 886 OG 638).
[0318] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0319] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
* * * * *