U.S. patent application number 11/174467 was filed with the patent office on 2006-02-23 for apo-3 polypeptide.
This patent application is currently assigned to Genentech, Inc.. Invention is credited to Avi J. Ashkenazi.
Application Number | 20060041106 11/174467 |
Document ID | / |
Family ID | 26701848 |
Filed Date | 2006-02-23 |
United States Patent
Application |
20060041106 |
Kind Code |
A1 |
Ashkenazi; Avi J. |
February 23, 2006 |
Apo-3 polypeptide
Abstract
Novel polypeptides, designated Apo-3, which are capable of
stimulating or inducing apoptosis are provided. Compositions
including Apo-3 chimeras, nucleic acid encoding Apo-3, and
antibodies to Apo-3 are also provided.
Inventors: |
Ashkenazi; Avi J.; (San
Mateo, CA) |
Correspondence
Address: |
SIDLEY AUSTIN BROWN & WOOD LLP;ATTN: DC PATENT DOCKETING
1501 K STREET, NW
WASHINGTON
DC
20009
US
|
Assignee: |
Genentech, Inc.
|
Family ID: |
26701848 |
Appl. No.: |
11/174467 |
Filed: |
July 6, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10112193 |
Mar 28, 2002 |
|
|
|
11174467 |
Jul 6, 2005 |
|
|
|
08928069 |
Sep 11, 1997 |
6462176 |
|
|
10112193 |
Mar 28, 2002 |
|
|
|
60026943 |
Sep 23, 1996 |
|
|
|
Current U.S.
Class: |
530/350 ;
530/359; 530/388.25 |
Current CPC
Class: |
C07K 2317/73 20130101;
C07K 2319/00 20130101; A61K 2039/505 20130101; C07K 14/4747
20130101; C07K 14/70578 20130101; C07K 16/2878 20130101; C07K
2319/30 20130101; A61K 38/00 20130101 |
Class at
Publication: |
530/350 ;
530/359; 530/388.25 |
International
Class: |
C07K 14/705 20060101
C07K014/705; C07K 16/28 20060101 C07K016/28 |
Claims
1-26. (canceled)
27. An isolated polypeptide comprising amino acid residues 25-417
of SEQ ID NO:10.
28. An isolated polypeptide comprising a secreted form of the amino
acid sequence encoded by SEQ ID NO:11.
29. An isolated polypeptide comprising a secreted form of the amino
acid sequence encoded by cDNA clone contained in ATCC Deposit No.
55820.
30. The isolated protein of claim 27, which is produced by a
recombinant host cell.
31. The isolated protein of claim 27, which comprises a
heterologous polypeptide.
32. A composition comprising the isolated protein of claim 27 and a
pharmaceutically acceptable carrier.
33. An isolated protein comprising amino acid residues 338-417 of
SEQ ID NO:10.
34. The isolated protein of claim 33, which is produced by a
recombinant host cell.
35. The isolated protein of claim 33, which comprises a
heterologous polypeptide.
36. A composition comprising the isolated protein of claim 33 and a
pharmaceutically acceptable carrier.
Description
RELATED APPLICATIONS
[0001] This application is a non-provisional application claiming
priority under 35 USC Section 119(e) to provisional application No.
60/026,943 filed Sep. 23, 1996, the contents of which are
incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates generally to the
identification, isolation, and recombinant production of novel
polypeptides, designated herein as "Apo-3".
BACKGROUND OF THE INVENTION
[0003] Control of cell numbers in mammals is believed to be
determined, in part, by a balance between cell proliferation and
cell death. One form of cell death, sometimes referred to as
necrotic cell death, is typically characterized as a pathologic
form of cell death resulting from some trauma or cellular injury.
In contrast, there is another, "physiologic" form of cell death
which usually proceeds in an orderly or controlled manner. This
orderly or controlled form of cell death is often referred to as
"apoptosis" [see, e.g., Barr et al., Bio/Technology, 12:487-493
(1994)]. Apoptotic cell death naturally occurs in many
physiological processes, including embryonic development and clonal
selection in the immune system [Itoh et al., Cell, 66:233-243
(1991)]. Decreased levels of apoptotic cell death have been
associated with a variety of pathological conditions, including
cancer, lupus, and herpes virus infection [Thompson, Science,
267:1456-1462 (1995)]. Increased levels of apoptotic cell death may
be associated with a variety of other pathological conditions,
including AIDS, Alzheimer's disease, Parkinson's disease,
amyotrophic lateral sclerosis, multiple sclerosis, retinitis
pigmentosa, cerebellar degeneration, aplastic anemia, myocardial
infarction, stroke, reperfusion injury, and toxin-induced liver
disease [see, Thompson, supra].
[0004] Apoptotic cell death is typically accompanied by one or more
characteristic morphological and biochemical changes in cells, such
as condensation of cytoplasm, loss of plasma membrane microvilli,
segmentation of the nucleus, degradation of chromosomal DNA or loss
of mitochondrial function. A variety of extrinsic and intrinsic
signals are believed to trigger or induce such morphological and
biochemical cellular changes [Raff, Nature, 356:397-400 (1992);
Steller, Science, 267:1445-1449 (1995); Sachs et al., Blood, 82:15
(1993)]. For instance, they can be triggered by hormonal stimuli,
such as glucocorticoid hormones for immature thymocytes, as well as
withdrawal of certain growth factors [Watanabe-Fukunaga et al.,
Nature, 356:314-317 (1992)]. Also, some identified oncogenes such
as myc, rel, and ElA, and tumor suppressors, like p53, have been
reported to have a role in inducing apoptosis. Certain chemotherapy
drugs and some forms of radiation have likewise been observed to
have apoptosis-inducing activity [Thompson, supra].
[0005] Various molecules, such as tumor necrosis factor-.alpha.
("TNF-.alpha."), tumor necrosis factor-.beta. ("TNF-.beta." or
"lymphotoxin"), CD30 ligand, CD27 ligand, CD40 ligand, OX-40
ligand, 4-1BB ligand, Apo-1 ligand (also referred to as Fas ligand
or CD95 ligand), TRAIL, and Apo-2 ligand have been identified as
members of the tumor necrosis factor ("TNF") family of cytokines
[See, e.g., Gruss and Dower, Blood, 85:3378-3404 (1995); Wiley et
al., Immunity, 3:673-682 (1995); Pitti et al., J. Biol. Chem.,
271:12687-12690 (1996)]-Among these molecules, TNF-.alpha.,
TNF-.beta., CD30 ligand, 4-1BB ligand, Apo-1 ligand, TRAIL, and
Apo-2 ligand have been reported to be involved in apoptotic cell
death. Both TNF-.alpha. and TNF-.beta. have been reported to induce
apoptotic death in susceptible tumor cells [Schmid et al., Proc.
Natl. Acad. Sci., 83:1881 (1986); Dealtry et al., Eur. J. Immunol.,
17:689 (1987)]. Zheng et al. have reported that TNF-.alpha. is
involved in post-stimulation apoptosis of CD8-positive T cells
[Zheng et al., Nature, 377:348-351 (1995)]. Other investigators
have reported that CD30 ligand may be involved in deletion of
self-reactive T cells in the thymus [Amakawa et al., Cold Spring
Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No.
10, (1995)].
[0006] Mutations in the mouse Fas/Apo-1 receptor or ligand genes
(called lpr and gld, respectively) have been associated with some
autoimmune disorders, indicating that Apo-1 ligand may play a role
in regulating the clonal deletion of self-reactive lymphocytes in
the periphery [Krammer et al., Curr. Op. Immunol., 6:279-289
(1994); Nagata et al., Science, 267:1449-1456 (1995)]. Apo-1 ligand
is also reported to induce post-stimulation apoptosis in
CD4-positive T lymphocytes and in B lymphocytes, and may be
involved in the elimination of activated lymphocytes when their
function is no longer needed [Krammer et al., supra; Nagata et al.,
supra]. Agonist mouse monoclonal antibodies specifically binding to
the Apo-1 receptor have been reported to exhibit cell killing
activity that is comparable to or similar to that of TNF-.alpha.
[Yonehara et al., J. Exp. Med., 169:1747-1756 (1989)].
[0007] Induction of various cellular responses mediated by such TNF
family cytokines is believed to be initiated by their binding to
specific cell receptors. Two distinct TNF receptors of
approximately 55-kDa (TNFR1) and 75-kDa (TNFR2) have been
identified [Hohman et al., J. Biol. Chem., 264:14927-14934 (1989);
Brockhaus et al., Proc. Natl. Acad. Sci., 87:3127-3131 (1990); EP
417,563, published Mar. 20, 1991] and human and mouse cDNAs
corresponding to both receptor types have been isolated and
characterized [Loetscher et al., Cell, 61:351 (1990); Schall et
al., Cell, 61:361 (1990); Smith et al., Science, 248:1019-1023
(1990); Lewis et al., Proc. Natl. Acad. Sci., 88:2830-2834 (1991);
Goodwin et al., Mol. Cell. Biol., 11:3020-3026 (1991)]. Extensive
polymorphisms have been associated with both TNF receptor genes
[see, e.g., Takao et al., Immunogenetics 37:199-203 (1993)]. Both
TNFRs share the typical structure of cell surface receptors
including extracellular, transmembrane and intracellular regions.
The extracellular portions of both receptors are found naturally
also as soluble TNF-binding proteins [Nophar, Y. et al., EMBO J.,
9:3269 (1990); and Kohno, T. et al., Proc. Natl. Acad. Sci. U.S.A.,
87:8331 (1990)]. More recently, the cloning of recombinant soluble
TNF receptors was reported by Hale et al. [J. Cell. Biochem.
Supplement 15F, 1991, p. 113 (P424)].
[0008] The extracellular portion of type 1 and type 2 TNFRs (TNFR1
and TNFR2) contains a repetitive amino acid sequence pattern of
four cysteine-rich domains (CRDs) designated 1 through 4, starting
from the NH.sub.2-terminus. Each CRD is about 40 amino acids long
and contains 4 to 6 cysteine residues at positions which are well
conserved [Schall et al., supra; Loetscher et al., supra; Smith et
al., supra; Nophar et al., supra; Kohno et al., supra]. In TNFR1,
the approximate boundaries of the four CRDs are as follows:
CRD1-amino acids 14 to about 53; CRD2-amino acids from about 54 to
about 97; CRD3-amino acids from about 98 to about 138; CRD4-amino
acids from about 139 to about 167. In TNFR2, CRD1 includes amino
acids 17 to about 54; CRD2-amino acids from about 55 to about 97;
CRD3-amino acids from about 98 to about 140; and CRD4-amino acids
from about 141 to about 179 [Banner et al., Cell, 73:431-435
(1993)]. The potential role of the CRDs in ligand binding is also
described by Banner et al., supra.
[0009] A similar repetitive pattern of CRDs exists in several other
cell-surface proteins, including the p75 nerve growth factor
receptor (NGFR) [Johnson et al., Cell, 47:545 (1986); Radeke et
al., Nature, 325:593 (1987)], the B cell antigen CD40 [Stamenkovic
et al., EMBO J., 8:1403 (1989)], the T cell antigen OX40 [Mallet et
al., EMBO J., 9:1063 (1990)] and the Fas antigen [Yonehara et al.,
supra and Itoh et al., supra]. CRDs are also found in the soluble
TNFR (sTNFR)-like T2 proteins of the Shope and myxoma poxviruses
[Upton et al., Virology, 160:20-29 (1987); Smith et al., Biochem.
Biophys. Res. Commun., 176:335 (1991); Upton et al., Virology,
184:370 (1991)]. Optimal alignment of these sequences indicates
that the positions of the cysteine residues are well conserved.
These receptors are sometimes collectively referred to as members
of the TNF/NGF receptor superfamily. Recent studies on p75NGFR
showed that the deletion of CRD1 [Welcher, A. A. et al., Proc.
Natl. Acad. Sci. USA, 88:159-163 (1991)] or a 5-amino acid
insertion in this domain [Yan, H. and Chao, M. V., J. Biol. Chem.,
266:12099-12104 (1991)] had little or no effect on NGF binding
[Yan, H. and Chao, M. V., supra]. p75 NGFR contains a proline-rich
stretch of about 60 amino acids, between its CRD4 and transmembrane
region, which is not involved in NGF binding [Peetre, C. et al.,
Eur. J. Hematol., 41:414-419 (1988); Seckinger, P. et al., J. Biol.
Chem., 264:11966-11973 (1989); Yan, H. and Chao, M. V., supra]. A
similar proline-rich region is found in TNFR2 but not in TNFR1.
[0010] Itoh et al. disclose that the Apo-1 receptor can signal an
apoptotic cell death similar to that signaled by the 55-kDa TNFR1
[Itoh et al., supra]. Expression of the Apo-1 antigen has also been
reported to be down-regulated along with that of TNFR1 when cells
are treated with either TNF-.alpha. or anti-Apo-1 mouse monoclonal
antibody [Krammer et al., supra; Nagata et al., supra] Accordingly,
some investigators have hypothesized that cell lines that
co-express both Apo-1 and TNFR1 receptors may mediate cell killing
through common signaling pathways [Id.].
[0011] The TNF family ligands identified to date, with the
exception of lymphotoxin-.alpha., are type II transmembrane
proteins, whose C-terminus is extracellular. In contrast, the
receptors in the TNF receptor (TNFR) family identified to date are
type I transmembrane proteins. In both the TNF ligand and receptor
families, however, homology identified between family members has
been found mainly in the extracellular domain ("ECD"). Several of
the TNF family cytokines, including TNF-.alpha., Apo-1 ligand and
CD40 ligand, are cleaved proteolytically at the cell surface; the
resulting protein in each case typically forms a homotrimeric
molecule that functions as a soluble cytokine. TNF receptor family
proteins are also usually cleaved proteolytically to release
soluble receptor ECDs that can function as inhibitors of the
cognate cytokines.
[0012] Two of the TNFR family members, TNFR1 and Fas/Apol (CD95),
can activate apoptotic cell death [Chinnaiyan and Dixit, Current
Biology, 6:555-562 (1996); Fraser and Evan, Cell; 85:781-784
(1996)]. TNFR1 is also known to mediate activation of the
transcription factor, NF-.kappa.B [Tartaglia et al., Cell,
74:845-853 (1993); Hsu et al., Cell, 84:299-308 (1996)]. In
addition to some ECD homology, these two receptors share homology
in their intracellular domain (ICD) in an oligomerization interface
known as the death domain [Tartaglia et al., supra]. Death domains
are also found in several metazoan proteins that regulate
apoptosis, namely, the Drosophila protein, Reaper, and the
mammalian proteins referred to as FADD/MORT1, TRADD, and RIP
[Cleaveland and Ihle, Cell, 81:479-482 (1995)]. Using the yeast-two
hybrid system, Raven et al. report the identification of protein,
wsl-1, which binds to the TNFR1 death domain [Raven et al.,
Programmed Cell Death Meeting, Sep. 20-24, 1995, Abstract at page
127; Raven et al., European Cytokine Network, 7:Abstr. 82 at page
210 (April-June 1996)]. The wsl-1 protein is described as being
homologous to TNFR1 (48% identity) and having a restricted tissue
distribution. According to Raven et al., the tissue distribution of
wsl-1 is significantly different from the TNFR1 binding protein,
TRADD.
[0013] Upon ligand binding and receptor clustering, TNFR1 and CD95
are believed to recruit FADD into a death-inducing signalling
complex. CD95 purportedly binds FADD directly, while TNFR1 binds
FADD indirectly via TRADD [Chinnaiyan et al., Cell, 81:505-512
(1995); Boldin et al., J. Biol. Chem., 270:387-391 (1995); Hsu et
al., supra; Chinnaiyan et al., J. Biol. Chem., 271:4961-4965
(1996)]. It has been reported that FADD serves as an adaptor
protein which recruits the thiol protease MACH.alpha./FLICE into
the death signalling complex [Boldin et al., Cell, 85:803-815
(1996); Muzio et al., Cell, 85:817-827 (1996)]. MACH.alpha./FLICE
appears to be the trigger that sets off a cascade of apoptotic
proteases, including the interleukin-1 converting enzyme (ICE) and
CPP32/Yama, which may execute some critical aspects of the cell
death programme [Fraser and Evan, supra].
[0014] It was recently disclosed that programmed cell death
involves the activity of members of a family of cysteine proteases
related to the C. elegans cell death gene, ced-3, and to the
mammalian IL-1-converting enzyme, ICE [Martin, cite (1995)]. The
activity of the ICE and CPP32/Yama proteases can be inhibited by
the product of the cowpox virus gene, crmA [Ray et al., Cell,
69:597-604 (1992); Tewari et al., Cell, 81:801-809 (1995)]. Recent
studies show that CrmA can inhibit TNFR1- and CD95-induced cell
death [Enari et al., Nature, 375:78-81 (1995); Tewari et al., J.
Biol. Chem., 270:3255-3260 (1995)].
[0015] For a review of the TNF family of cytokines and their
receptors, see Gruss and Dower, supra.
SUMMARY OF THE INVENTION
[0016] Applicants have identified cDNA clones that encode novel
polypeptides, designated in the present application as "Apo-3." The
Apo-3 polypeptide has surprisingly been found to stimulate or
induce apoptotic activity in mammalian cells. It is believed that
Apo-3 is a member of the TNFR family; full-length native sequence
human Apo-3 polypeptide exhibits some similarities to some known
TNFRs, including TNFR1 and CD95. In particular, full-length native
sequence human Apo-3 exhibits similarity to the TNFR family in its
extracellular cysteine-rich repeats and resembles TNFR1 and CD95 in
that it contains a cytoplasmic death domain sequence.
[0017] In one embodiment, the invention provides isolated Apo-3
polypeptide. In particular, the invention provides isolated native
sequence Apo-3 polypeptide, which in one embodiment, includes an
amino acid sequence comprising residues 1 to 417 of FIG. 8 (SEQ ID
NO:10). In other embodiments, the isolated Apo-3 polypeptide
comprises at least about 80% identity with native sequence Apo-3
polypeptide comprising residues 1 to 417 of FIG. 8 (SEQ ID
NO:10)
[0018] In another embodiment, the invention provides an isolated
extracellular domain sequence found in native sequence Apo-3
polypeptide. The isolated extracellular domain sequence preferably
comprises residues 1 to 198 of FIG. 8 (SEQ ID NO:10).
[0019] In another embodiment, the invention provides an isolated
death domain sequence found in native sequence Apo-3 polypeptide.
The isolated death domain sequence preferably comprises residues
338 to 417 of FIG. 8 (SEQ ID NO:10).
[0020] In another embodiment, the invention provides chimeric
molecules comprising Apo-3 polypeptide fused to a heterologous
polypeptide or amino acid sequence. An example of such a chimeric
molecule comprises an Apo-3 fused to an immunoglobulin sequence.
Another example comprises an extracellular domain sequence of Apo-3
fused to a heterologous polypeptide or amino acid sequence, such as
an immunoglobulin sequence.
[0021] In another embodiment, the invention provides an isolated
nucleic acid molecule encoding Apo-3 polypeptide. In one aspect,
the nucleic acid molecule is RNA or DNA that encodes an Apo-3
polypeptide or a particular domain of Apo-3, or is complementary to
such encoding nucleic acid sequence, and remains stably bound to it
under stringent conditions. In one embodiment, the nucleic acid
sequence is selected from: [0022] (a) the coding region of the
nucleic acid sequence of FIG. 8 (SEQ ID NO:11) that codes for
residue 1 to residue 417 (i.e., nucleotides 89-91 through
1337-1339), inclusive; or [0023] (b) the coding region of the
nucleic acid sequence of FIG. 8 (SEQ ID NO:11) that codes for
residue 1 to residue 198 (i.e., nucleotides 89-91 through 680-682),
inclusive; [0024] (c) the coding region of the nucleic acid
sequence of FIG. 8 (SEQ ID NO:11) that codes for residue 338 to
residue 417 (i.e., nucleotides 1100-1102 through 1337-1339),
inclusive; or [0025] (d) a sequence corresponding to the sequence
of (a), (b) or (c) within the scope of degeneracy of the genetic
code.
[0026] In a further embodiment, the invention provides a vector
comprising the nucleic acid molecule encoding the Apo-3 polypeptide
or particular domain of Apo-3. A host cell comprising the vector or
the nucleic acid molecule is also provided. A method of producing
Apo-3 is further provided.
[0027] In another embodiment, the invention provides an antibody
which specifically binds to Apo-3. The antibody may be an
agonistic, antagonistic or neutralizing antibody.
[0028] In another embodiment, the invention provides non-human,
transgenic or knock-out animals.
[0029] A further embodiment of the invention provides articles of
manufacture and kits that include Apo-3 or Apo-3 antibodies.
[0030] Another embodiment of the invention provides a novel
polypeptide, designated "Apo-2 ligand inhibitor." In one
embodiment, the polypeptide sequence comprises amino acid residues
1 to 181 of FIG. 1 (SEQ ID NO:1).
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 shows the nucleotide sequence of human Apo-2 ligand
inhibitor cDNA and its derived amino acid sequence.
[0032] FIG. 2 shows an alignment of the amino acid sequence encoded
by clone 18.1 of Apo-2 ligand inhibitor with extracellular regions
of other members of the human TNF receptor family.
[0033] FIG. 3 shows a silver-stained gel of a protein A purified
Apo-2 ligand inhibitor immunoadhesin analyzed under non-reducing
(lanes 3-5) or reducing (lanes 7-9) conditions.
[0034] FIG. 4 shows the nucleotide sequence of human Apo-2 ligand
cDNA and its derived amino acid sequence.
[0035] FIG. 5 shows the size and subunit structure of recombinant,
His.sub.10 epitope-tagged soluble Apo-2 ligand expressed in
recombinant baculovirus-infected insect cells and purified by
Ni.sup.2+-chelate affinity chromatography, as determined with
(lanes 1, 2) or without (lane 3) chemical crosslinking followed by
SDS-PAGE and silver staining.
[0036] FIGS. 6A-6E show the induction of apoptosis in B and T
lymphocyte cell lines by Apo-2 ligand. Apoptotic cells were
identified by characteristic morphological changes (A); by positive
fluorescence staining with propidium iodide ("PI") and
FITC-conjugated annexin V, measured by flow cytometry (B-D); and by
analysis of internucleosomal DNA fragmentation (E).
[0037] FIGS. 7A-7C show the time course and the dose-dependence of
Apo-2 ligand-induced apoptosis and the lack of inhibition of Apo-2
ligand-induced apoptosis by soluble receptor-IgG-fusion proteins
based on the Fas/Apo-1 receptor, TNFR1 receptor, or TNFR2
receptor.
[0038] FIG. 8 shows the nucleotide sequence of native sequence
human Apo-3 cDNA and its derived amino acid sequence. The putative
signal sequence and transmembrane domain are underlined, the death
domain sequence is boxed, and the potential N-linked glycosylation
sites are marked with an asterisk. Also boxed is the alanine
residue which was present in the fetal lung but not in the fetal
heart cDNA clone (discussed in Example 9 below).
[0039] FIG. 9 shows an alignment and comparison of the ECD
sequences of native sequence human Apo-3, TNFR1 and CD95.
[0040] FIG. 10 shows an alignment and comparison of the death
domain sequences of native sequence human Apo-3, TNFR1, CD95, FADD,
TRADD, RIP and Drosophila Reaper.
[0041] FIG. 11 shows ectopic expression of Apo-3 in HEK 293 cells.
Cells were transfected with pRK5-Apo-3 plus pRK5 (5 .mu.g each)
(lane 1); pRK5 alone (10 .mu.g) (lane 2); or pRK5-Apo-3 plus
pRK5-CrmA (5 .mu.g each) (lane 3). Cells were metabolically labeled
with .sup.35S-Met and .sup.35S-Cys. Cell lysates were then analyzed
by radioimmunoprecipitation using mouse anti-Apo-3 antiserum. The
molecular weight standards are shown on the left in kDa.
[0042] FIGS. 12a-j illustrate the induction of apoptosis by ectopic
expression of Apo-3 in HEK 293 cells. Apoptosis was examined 36
hours after transfection, by morphological analysis (FIGS. 12 a-d);
by FACS analysis (FIGS. 12 e-i); and by DNA laddering (FIG. 12 j).
Cells were transfected with pRK5 alone (10 .mu.g) (FIGS. 12 a; e;
j, lane 1); pRK5 plus pRK5-Apo-3 (5 .mu.g each) (FIGS. 12 b; f; j,
lane 2); pRK5 plus pRK5-CrmA (5 .mu.g each) (FIGS. 12 c; g; j, lane
3); or pRK5-Apo-3 plus pRK5-CrmA (5 .mu.g each) (FIGS. 12 d; h; j,
lane 4). Cells in FIGS. 12 a-d were photographed at 400.times.
magnification using Hoffmann optics-based light microscopy. As
measured by the total number of annexin V-positive cells, the
percent apoptosis in FIGS. 12 e-h, respectively, was 37%, 66%, 36%
and 26%. Cells in FIG. 12 i were transfected with the indicated
amount of pRK5-Apo-3 or pRK5-TNFR1 and the appropriate amount of
pRK5 plasmid to bring the total amount of DNA to 20 .mu.g.
[0043] FIG. 13 shows activation of NF-.kappa.B by ectopic
expression of Apo-3. HEK 293 cells were transfected with 10 .mu.g
pRK5 (lanes 1, 4, 7); pRK5-Apo-3 (lanes 2, 5, 7); or pRK5-TNFR1
(lanes 3, 6, 9). Nuclear extracts were prepared 36 hours later and
reacted with an irrelevant .sup.32P-labelled oligonucleotide probe
(lanes 1-3); or with a .sup.32P-labelled NF-.kappa.B-specific probe
alone (lanes 4-6) or in the presence of 50-fold excess unlabelled
oligonucleotide of the same sequence (lanes 7-9).
[0044] FIG. 14 illustrates expression of Apo-3 mRNA in human
tissues as determined by Northern blot hybridization. In the left
hand panel are shown fetal brain (1); lung (2); liver (3); kidney
(4). In the right hand panel are shown adult spleen (1); thymus
(2); prostate (3); testis (4); ovary (5); small intestine (6);
colon (7); and peripheral blood lymphocytes (8). The sizes of the
molecular weight standards are shown on the left in kb.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
I. Definitions
[0045] The terms "Apo-3 polypeptide" and "Apo-3" when used herein
encompass native sequence Apo-3 and Apo-3 variants (each of which
is defined herein). These terms encompass Apo-3 from a variety of
mammals, including humans. The Apo-3 may be isolated from a variety
of sources, such as from human tissue types or from another source,
or prepared by recombinant or synthetic methods.
[0046] A "native sequence Apo-3" comprises a polypeptide having the
same amino acid sequence as an Apo-3 derived from nature. Thus, a
native sequence Apo-3 can have the amino acid sequence of
naturally-occurring Apo-3 from any mammal. Such native sequence
Apo-3 can be isolated from nature or can be produced by recombinant
or synthetic means. The term "native sequence Apo-3" specifically
encompasses naturally-occurring truncated or secreted forms of the
Apo-3 (e.g., an extracellular domain sequence), naturally-occurring
variant forms (e.g., alternatively spliced forms) and
naturally-occurring allelic variants of the Apo-3. A
naturally-occurring variant form of the Apo-3 includes an Apo-3
having an amino acid deletion at residue 236 in the amino acid
sequence shown in FIG. 8 (SEQ ID NO:10). In one embodiment of the
invention, the native sequence Apo-3 is a mature or full-length
native sequence Apo-3 comprising the amino acid sequence of SEQ ID
NO:10. The present definition of native sequence Apo-3 excludes
known EST sequences, such as GenBank W71984.
[0047] "Apo-3 variant" means a biologically active Apo-3 as defined
below having less than 100% sequence identity with Apo-3 having the
deduced amino acid sequence shown in FIG. 8 (SEQ ID NO:10) for a
full-length native sequence human Apo-3. Such Apo-3 variants
include, for instance, Apo-3 polypeptides wherein one or more amino
acid residues are added at the N- or C-terminus of, or within, the
sequence of SEQ ID NO:10; from about one to 24 amino acid residues
are deleted (including a single amino acid deletion at residue 236
in the amino acid sequence shown in FIG. 8 (SEQ ID NO:10), or
optionally substituted by one or more amino acid residues; and
derivatives thereof, wherein an amino acid residue has been
covalently modified so that the resulting product has a
non-naturally occurring amino acid. Ordinarily, an Apo-3 variant
will have at least about 80% sequence identity, more preferably at
least about 90% sequence identity, and even more preferably at
least about 95% sequence identity with the sequence of FIG. 8 (SEQ
ID NO:10). The present definition of Apo-3 variant excludes known
EST sequences, such as GenBank W71984.
[0048] The terms "Apo-2 ligand inhibitor" and "Apo-2LI" are used
herein to refer to a polypeptide sequence which includes amino acid
residues 34 to 71, inclusive, residues 1 to 71, inclusive, residues
72 to 115, inclusive, residues 116 to 163, inclusive, residues 164
to 181, inclusive, or residues 1 to 181, inclusive, of the amino
acid sequence shown in FIG. 1, as well as deletional, insertional,
or substitutional variants of the above sequences. In a preferred
embodiment, the polypeptide sequence comprises residues 1 to 181 of
FIG. 1 (SEQ ID NO:1). In another preferred embodiment, the variants
have at least about 80% sequence identity, more preferably at least
about 90% sequence identity, and even more preferably, at least
about 95% sequence identity with any one of the above Apo-2LI
sequences. Optionally, the Apo-2 ligand inhibitor includes one or
more cysteine-rich domains, and preferably includes one or more
cysteine-rich domains comprising amino acids 34 to 71, amino acids
72 to 115, amino acids 116 to 163, or amino acids 164 to 181 of
FIG. 1. The definition encompasses Apo-2 ligand inhibitor isolated
from an Apo-2 ligand inhibitor source, such as from human tissue
types (including blood or urine) or from another source, or
prepared by recombinant or synthetic methods. The present
definition of Apo-2 ligand inhibitor excludes known EST sequences,
such as GenBank H41522, H46424, H46211, H46374, H46662, H41851,
H49675, H22502, H46378 and H19739.
[0049] The terms "Apo-2 ligand" and "Apo-2L" are used herein to
refer to a polypeptide sequence which includes amino acid residues
114 to 281, inclusive, residues 41 to 281, inclusive, residues 15
to 281, inclusive, or residues 1 to 281, inclusive, of the amino
acid sequence shown in FIG. 4, as well as deletional, insertional,
or substitutional variants of the above sequences. In a preferred
embodiment, the polypeptide sequence comprises residues 114 to 281
of FIG. 4. In another preferred embodiment, the variants have at
least about 80% sequence identity, more preferably at least about
90% sequence identity, and even more preferably, at least about 95%
sequence identity with any one of the above Apo-2L sequences. The
definition encompasses Apo-2 ligand isolated from an Apo-2 ligand
source, such as from human tissue types or from another source, or
prepared by recombinant or synthetic methods. The present
definition of Apo-2 ligand excludes known EST sequences, such as
GenBank HHEA47M, T90422, R31020, H43566, H44565, H44567, H54628,
H44772, H54629, T82085, and T10524.
[0050] The term "epitope tagged" when used herein refers to a
chimeric polypeptide comprising Apo-3, or a portion thereof, fused
to a "tag polypeptide". The tag polypeptide has enough residues to
provide an epitope against which an antibody can be made, yet is
short enough such that it does not interfere with activity of the
Apo-3. The tag polypeptide preferably also is fairly unique so that
the antibody does not substantially cross-react with other
epitopes. Suitable tag polypeptides generally have at least six
amino acid residues and usually between about 8 to about 50 amino
acid residues (preferably, between about 10 to about 20
residues).
[0051] "Isolated," when used to describe the various polypeptides
disclosed herein, means polypeptide that has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would typically interfere with diagnostic or
therapeutic uses for the polypeptide, and may include enzymes,
hormones, and other proteinaceous or non-proteinaceous solutes. In
preferred embodiments, the polypeptide will be purified (1) to a
degree sufficient to obtain at least 15 residues of N-terminal or
internal amino acid sequence by use of a spinning cup sequenator,
or (2) to homogeneity by SDS-PAGE under non-reducing or reducing
conditions using Coomassie blue or, preferably, silver stain.
Isolated polypeptide includes polypeptide in situ within
recombinant cells, since at least one component of the Apo-3
natural environment will not be present. Ordinarily, however,
isolated polypeptide will be prepared by at least one purification
step.
[0052] An "isolated" Apo-3 nucleic acid molecule is a nucleic acid
molecule that is identified and separated from at least one
contaminant nucleic acid molecule with which it is ordinarily
associated in the natural source of the Apo-3 nucleic acid. An
isolated Apo-3 nucleic acid molecule is other than in the form or
setting in which it is found in nature. Isolated Apo-3 nucleic acid
molecules therefore are distinguished from the Apo-3 nucleic acid
molecule as it exists in natural cells. However, an isolated Apo-3
nucleic acid molecule includes Apo-3 nucleic acid molecules
contained in cells that ordinarily express Apo-3 where, for
example, the nucleic acid molecule is in a chromosomal location
different from that of natural cells.
[0053] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation
signals, and enhancers.
[0054] Nucleic acid is "operably linked" when it is placed into a
functional relationship with another nucleic acid sequence. For
example, DNA for a presequence or secretory leader is operably
linked to DNA for a polypeptide if it is expressed as a preprotein
that participates in the secretion of the polypeptide; a promoter
or enhancer is operably linked to a coding sequence if it affects
the transcription of the sequence; or a ribosome binding site is
operably linked to a coding sequence if it is positioned so as to
facilitate translation. Generally, "operably linked" means that the
DNA sequences being linked are contiguous, and, in the case of a
secretory leader, contiguous and in reading phase. However,
enhancers do not have to be contiguous. Linking is accomplished by
ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide adaptors or linkers are used
in accordance with conventional practice.
[0055] The term "antibody" is used in the broadest sense and
specifically covers single anti-Apo-3 monoclonal antibodies
(including agonist, antagonist, and neutralizing antibodies) and
anti-Apo-3 antibody compositions with polyepitopic specificity.
[0056] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, i.e., the individual antibodies comprising the
population are identical except for possible naturally-occurring
mutations that may be present in minor amounts. Monoclonal
antibodies are highly specific, being directed against a single
antigenic site. Furthermore, in contrast to conventional
(polyclonal) antibody preparations which typically include
different antibodies directed against different determinants
(epitopes), each monoclonal antibody is directed against a single
determinant on the antigen.
[0057] The monoclonal antibodies herein include hybrid and
recombinant antibodies produced by splicing a variable (including
hypervariable) domain of an anti-Apo-3 antibody with a constant
domain (e.g. "humanized" antibodies), or a light chain with a heavy
chain, or a chain from one species with a chain from another
species, or fusions with heterologous proteins, regardless of
species of origin or immunoglobulin class or subclass designation,
as well as antibody fragments (e.g., Fab, F(ab') 2, and Fv), so
long as they exhibit the desired biological activity. See, e.g.
U.S. Pat. No. 4,816,567 and Mage et al., in Monoclonal Antibody
Production Techniques and Applications, pp. 79-97 (Marcel Dekker,
Inc.: New York, 1987).
[0058] Thus, the modifier "monoclonal" indicates the character of
the antibody as being obtained from a substantially homogeneous
population of antibodies, and is not to be construed as requiring
production of the antibody by any particular method. For example,
the monoclonal antibodies to be used in accordance with the present
invention may be made by the hybridoma method first described by
Kohler and Milstein, Nature, 256:495 (1975), or may be made by
recombinant DNA methods such as described in U.S. Pat. No.
4,816,567. The "monoclonal antibodies" may also be isolated from
phage libraries generated using the techniques described in
McCafferty et al., Nature, 348:552-554 (1990), for example.
[0059] "Humanized" forms of non-human (e.g. murine) antibodies are
specific chimeric immunoglobulins, immunoglobulin chains, or
fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other
antigen-binding subsequences of antibodies) which contain minimal
sequence derived from non-human immunoglobulin. For the most part,
humanized antibodies are human immunoglobulins (recipient antibody)
in which residues from a complementary determining region (CDR) of
the recipient are replaced by residues from a CDR of a non-human
species (donor antibody) such as mouse, rat, or rabbit having the
desired specificity, affinity, and capacity. In some instances, Fv
framework region (FR) residues of the human immunoglobulin are
replaced by corresponding non-human residues. Furthermore, the
humanized antibody may comprise residues which are found neither in
the recipient antibody nor in the imported CDR or framework
sequences. These modifications are made to further refine and
optimize antibody performance. In general, the humanized antibody
will comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region or domain (Fc), typically that of a human
immunoglobulin.
[0060] "Biologically active" and "desired biological activity" for
the purposes herein mean having the ability to induce or stimulate
apoptosis in at least one type of mammalian cell in vivo or ex
vivo.
[0061] The terms "apoptosis" and "apoptotic activity" are used in a
broad sense and refer to the orderly or controlled form of cell
death in mammals that is typically accompanied by one or more
characteristic cell changes, including condensation of cytoplasm,
loss of plasma membrane microvilli, segmentation of the nucleus,
degradation of chromosomal DNA or loss of mitochondrial function.
This activity can be determined and measured, for instance, by cell
viability assays, FACS analysis or DNA electrophoresis, all of
which are known in the art.
[0062] The terms "treating," "treatment," and "therapy" as used
herein refer to curative therapy, prophylactic therapy, and
preventative therapy.
[0063] The term "mammal" as used herein refers to any mammal
classified as a mammal, including humans, cows, horses, dogs and
cats. In a preferred embodiment of the invention, the mammal is a
human.
II. Compositions and Methods of the Invention
[0064] The present invention provides newly identified and isolated
Apo-3 polypeptides. In particular, Applicants have identified and
isolated various human Apo-3 polypeptides. The properties and
characteristics of some of these Apo-3 polypeptides are described
in further detail in the Examples below. Based upon the properties
and characteristics of the Apo-3 polypeptides disclosed herein, it
is Applicants' present belief that Apo-3 is a member of the TNFR
family.
[0065] Another novel polypeptide, the polypeptide identified herein
as "Apo-2 ligand inhibitor," is also provided in the present
application. The properties and characteristics of human Apo-2
ligand inhibitor are described in further detail in the Examples
below. Although not being bound to any particular theory, it is
presently believed that Apo-2LI comprising residues 1 to 181 of
FIG. 1 (SEQ ID NO:1) may be a soluble, truncated or secreted form
of Apo-3.
[0066] A description follows as to how Apo-3, as well as Apo-3
chimeric molecules and anti-Apo-3 antibodies, may be prepared. It
is contemplated that the methods and materials described below (and
in the Examples herein) may also be employed to prepare Apo-2LI,
Apo-2LI chimeric molecules and anti-Apo-2LI antibodies.
[0067] A. Preparation of Apo-3
[0068] The description below relates primarily to production of
Apo-3 by culturing cells transformed or transfected with a vector
containing Apo-3 nucleic acid. It is of course, contemplated that
alternative methods, which are well known in the art, may be
employed to prepare Apo-3.
[0069] 1. Isolation of DNA Encoding Apo-3
[0070] The DNA encoding Apo-3 may be obtained from any cDNA library
prepared from tissue believed to possess the Apo-3 mRNA and to
express it at a detectable level. Accordingly, human Apo-3 DNA can
be conveniently obtained from a cDNA library prepared from human
tissues, such as the bacteriophage libraries of human fetal heart
and lung cDNA described in Example 9. The Apo-3-encoding gene may
also be obtained from a genomic library or by oligonucleotide
synthesis.
[0071] Libraries can be screened with probes (such as antibodies to
the Apo-3 or oligonucleotides of at least about 20-80 bases)
designed to identify the gene of interest or the protein encoded by
it. Examples of oligonucleotide probes are provided in Example 9.
Screening the cDNA or genomic library with the selected probe may
be conducted using standard procedures, such as described in
Sambrook et al., Molecular Cloning: A Laboratory Manual (New York:
Cold Spring Harbor Laboratory Press, 1989). An alternative means to
isolate the gene encoding Apo-3 is to use PCR methodology [Sambrook
et al., supra; Dieffenbach et al., PCR Primer:A Laboratory Manual
(Cold Spring Harbor Laboratory Press, 1995)].
[0072] A preferred method of screening employs selected
oligonucleotide sequences to screen cDNA libraries from various
human tissues. Example 9 below describes techniques for screening a
cDNA library with different oligonucleotide probes. The
oligonucleotide sequences selected as probes should be of
sufficient length and sufficiently unambiguous that false positives
are minimized. The oligonucleotide is preferably labeled such that
it can be detected upon hybridization to DNA in the library being
screened. Methods of labeling are well known in the art, and
include the use of radiolabels like .sup.32P-labeled ATP,
biotinylation or enzyme labeling.
[0073] Nucleic acid having all the protein coding sequence may be
obtained by screening selected cDNA or genomic libraries using the
deduced amino acid sequence disclosed herein for the first time,
and, if necessary, using conventional primer extension procedures
as described in Sambrook et al., supra, to detect precursors and
processing intermediates of mRNA that may not have been
reverse-transcribed into cDNA.
[0074] Apo-3 variants can be prepared by introducing appropriate
nucleotide changes into the Apo-3 DNA, or by synthesis of the
desired Apo-3 polypeptide. Those skilled in the art will appreciate
that amino acid changes may alter post-translational processes of
the Apo-3, such as changing the number or position of glycosylation
sites or altering the membrane anchoring characteristics.
[0075] Variations in the native sequence Apo-3 as described above
can be made using any of the techniques and guidelines for
conservative and non-conservative mutations set forth in U.S. Pat.
No. 5,364,934. These include oligonucleotide-mediated
(site-directed) mutagenesis, alanine scanning, and PCR
mutagenesis.
[0076] 2. Insertion of Nucleic Acid into a Replicable Vector
[0077] The nucleic acid (e.g., cDNA or genomic DNA) encoding Apo-3
may be inserted into a replicable vector for further cloning
(amplification of the DNA) or for expression. Various vectors are
publicly available. The vector components generally include, but
are not limited to, one or more of the following: a signal
sequence, an origin of replication, one or more marker genes, an
enhancer element, a promoter, and a transcription termination
sequence, each of which is described below.
[0078] (i) Signal Sequence Component
[0079] The Apo-3 may be produced recombinantly not only directly,
but also as a fusion polypeptide with a heterologous polypeptide,
which may be a signal sequence or other polypeptide having a
specific cleavage site at the N-terminus of the mature protein or
polypeptide. In general, the signal sequence may be a component of
the vector, or it may be a part of the Apo-3 DNA that is inserted
into the vector. The heterologous signal sequence selected
preferably is one that is recognized and processed (i.e., cleaved
by a signal peptidase) by the host cell. The signal sequence may be
a prokaryotic signal sequence selected, for example, from the group
of the alkaline phosphatase, penicillinase, lpp, or heat-stable
enterotoxin II leaders. For yeast secretion the signal sequence may
be, e.g., the yeast invertase leader, alpha factor leader
(including Saccharomyces and Kluyveromyces .alpha.-factor leaders,
the latter described in U.S. Pat. No. 5,010,182), or acid
phosphatase leader, the C. albicans glucoamylase leader (EP 362,179
published 4 Apr. 1990), or the signal described in WO 90/13646
published 15 Nov. 1990. In mammalian cell expression the native
Apo-3 presequence that normally directs insertion of Apo-3 in the
cell membrane of human cells in vivo is satisfactory, although
other mammalian signal sequences may be used to direct secretion of
the protein, such as signal sequences from secreted polypeptides of
the same or related species, as well as viral secretory leaders,
for example, the herpes simplex glycoprotein D signal.
[0080] The DNA for such precursor region is preferably ligated in
reading frame to DNA encoding Apo-3.
[0081] (ii) Origin of Replication Component
[0082] Both expression and cloning vectors contain a nucleic acid
sequence that enables the vector to replicate in one or more
selected host cells. Generally, in cloning vectors this sequence is
one that enables the vector to replicate independently of the host
chromosomal DNA, and includes origins of replication or
autonomously replicating sequences. Such sequences are well known
for a variety of bacteria, yeast, and viruses. The origin of
replication from the plasmid pBR322 is suitable for most
Gram-negative bacteria, the 2.mu. plasmid origin is suitable for
yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
BPV) are useful for cloning vectors in mammalian cells. Generally,
the origin of replication component is not needed for mammalian
expression vectors (the SV40 origin may typically be used because
it contains the early promoter).
[0083] Most expression vectors are "shuttle" vectors, i.e., they
are capable of replication in at least one class of organisms but
can be transfected into another organism for expression. For
example, a vector is cloned in E. coli and then the same vector is
transfected into yeast or mammalian cells for expression even
though it is not capable of replicating independently of the host
cell chromosome.
[0084] DNA may also be amplified by insertion into the host genome.
This is readily accomplished using Bacillus species as hosts, for
example, by including in the vector a DNA sequence that is
complementary to a sequence found in Bacillus genomic DNA.
Transfection of Bacillus with this vector results in homologous
recombination with the genome and insertion of Apo-3 DNA. However,
the recovery of genomic DNA encoding Apo-3 is more complex than
that of an exogenously replicated vector because restriction enzyme
digestion is required to excise the Apo-3 DNA.
[0085] (iii) Selection Gene Component
[0086] Expression and cloning vectors typically contain a selection
gene, also termed a selectable marker. This gene encodes a protein
necessary for the survival or growth of transformed host cells
grown in a selective culture medium. Host cells not transformed
with the vector containing the selection gene will not survive in
the culture medium. Typical selection genes encode proteins that
(a) confer resistance to antibiotics or other toxins, e.g.,
ampicillin, neomycin, methotrexate, or tetracycline, (b) complement
auxotrophic deficiencies, or (c) supply critical nutrients not
available from complex media, e.g., the gene encoding D-alanine
racemase for Bacilli.
[0087] One example of a selection scheme utilizes a drug to arrest
growth of a host cell. Those cells that are successfully
transformed with a heterologous gene produce a protein conferring
drug resistance and thus survive the selection regimen. Examples of
such dominant selection use the drugs neomycin [Southern et al., J.
Molec. Appl. Genet., 1:327 (1982)], mycophenolic acid [Mulligan et
al., Science, 209:1422 (1980)] or hygromycin [Sugden et al., Mol.
Cell. Biol., 5:410-413 (1985)]. The three examples given above
employ bacterial genes under eukaryotic control to convey
resistance to the appropriate drug G418 or neomycin (geneticin)
xgpt (mycophenolic acid), or hygromycin, respectively.
[0088] Another example of suitable selectable markers for mammalian
cells are those that enable the identification of cells competent
to take up the Apo-3 nucleic acid, such as DHFR or thymidine
kinase. The mammalian cell transformants are placed under selection
pressure that only the transformants are uniquely adapted to
survive by virtue of having taken up the marker. Selection pressure
is imposed by culturing the transformants under conditions in which
the concentration of selection agent in the medium is successively
changed, thereby leading to amplification of both the selection
gene and the DNA that encodes Apo-3. Amplification is the process
by which genes in greater demand for the production of a protein
critical for growth are reiterated in tandem within the chromosomes
of successive generations of recombinant cells. Increased
quantities of Apo-3 are synthesized from the amplified DNA. Other
examples of amplifiable genes include metallothionein-I and -II,
adenosine deaminase, and ornithine decarboxylase.
[0089] Cells transformed with the DHFR selection gene may first be
identified by culturing all of the transformants in a culture
medium that contains methotrexate (Mtx), a competitive antagonist
of DHFR. An appropriate host cell when wild-type DHFR is employed
is the Chinese hamster ovary (CHO) cell line deficient in DHFR
activity, prepared and propagated as described by Urlaub et al.,
Proc. Natl. Acad. Sci. USA, 77:4216 (1980). The transformed cells
are then exposed to increased levels of methotrexate. This leads to
the synthesis of multiple copies of the DHFR gene, and,
concomitantly, multiple copies of other DNA comprising the
expression vectors, such as the DNA encoding Apo-3. This
amplification technique can be used with any otherwise suitable
host, e.g., ATCC No. CCL61 CHO-K1, notwithstanding the presence of
endogenous DHFR if, for example, a mutant DHFR gene that is highly
resistant to Mtx is employed (EP 117,060).
[0090] Alternatively, host cells (particularly wild-type hosts that
contain endogenous DHFR) transformed or co-transformed with DNA
sequences encoding Apo-3, wild-type DHFR protein, and another
selectable marker such as aminoglycoside 3'-phosphotransferase
(APH) can be selected by cell growth in medium containing a
selection agent for the selectable marker such as an
aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or G418. See
U.S. Pat. No. 4,965,199.
[0091] A suitable selection gene for use in yeast is the trp1 gene
present in the yeast plasmid YRp7 [Stinchcomb et al., Nature,
282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et
al., Gene, 10:157 (1980)]. The trp1 gene provides a selection
marker for a mutant strain of yeast lacking the ability to grow in
tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics,
85:12 (1977)]. The presence of the trp1 lesion in the yeast host
cell genome then provides an effective environment for detecting
transformation by growth in the absence of tryptophan. Similarly,
Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are
complemented by known plasmids bearing the Leu2 gene.
[0092] In addition, vectors derived from the 1.6 .mu.m circular
plasmid pKD1 can be used for transformation of Kluyveromyces yeasts
[Bianchi et al., Curr. Genet., 12:185 (1987)]. More recently, an
expression system for large-scale production of recombinant calf
chymosin was reported for K. lactis [Van den Berg, Bio/Technology,
8:135 (1990)]. Stable multi-copy expression vectors for secretion
of mature recombinant human serum albumin by industrial strains of
Kluyveromyces have also been disclosed [Fleer et al.,
Bio/Technology, 9:968-975 (1991)].
[0093] (iv) Promoter Component
[0094] Expression and cloning vectors usually contain a promoter
that is recognized by the host organism and is operably linked to
the Apo-3 nucleic acid sequence. Promoters are untranslated
sequences located upstream (5') to the start codon of a structural
gene (generally within about 100 to 1000 bp) that control the
transcription and translation of particular nucleic acid sequence,
such as the Apo-3 nucleic acid sequence, to which they are operably
linked. Such promoters typically fall into two classes, inducible
and constitutive. Inducible promoters are promoters that initiate
increased levels of transcription from DNA under their control in
response to some change in culture conditions, e.g., the presence
or absence of a nutrient or a change in temperature. At this time a
large number of promoters recognized by a variety of potential host
cells are well known. These promoters are operably linked to Apo-3
encoding DNA by removing the promoter from the source DNA by
restriction enzyme digestion and inserting the isolated promoter
sequence into the vector. Both the native Apo-3 promoter sequence
and many heterologous promoters may be used to direct amplification
and/or expression of the Apo-3 DNA.
[0095] Promoters suitable for use with prokaryotic hosts include
the .beta.-lactamase and lactose promoter systems [Chang et al.,
Nature, 275:615 (1978); Goeddel et al., Nature, 281:544 (1979)],
alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel,
Nucleic Acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters
such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci.
USA, 80:21-25 (1983)]. However, other known bacterial promoters are
suitable. Their nucleotide sequences have been published, thereby
enabling a skilled worker operably to ligate them to DNA encoding
Apo-3 [Siebenlist et al., Cell, 20:269 (1980)] using linkers or
adaptors to supply any required restriction sites. Promoters for
use in bacterial systems also will contain a Shine-Dalgarno (S.D.)
sequence operably linked to the DNA encoding Apo-3.
[0096] Promoter sequences are known for eukaryotes. Virtually all
eukaryotic genes have an AT-rich region located approximately 25 to
30 bases upstream from the site where transcription is initiated.
Another sequence found 70 to 80 bases upstream from the start of
transcription of many genes is a CXCAAT region where X may be any
nucleotide. At the 3' end of most eukaryotic genes is an AATAAA
sequence that may be the signal for addition of the poly A tail to
the 3' end of the coding sequence. All of these sequences are
suitably inserted into eukaryotic expression vectors.
[0097] Examples of suitable promoting sequences for use with yeast
hosts include the promoters for 3-phosphoglycerate kinase [Hitzeman
et al., J. Biol. Chem., 255:2073 (1980)] or other glycolytic
enzymes [Hess et al., J. Adv. Enzyme Reg., 7:149 (1968); Holland,
Biochemistry, 17:4900 (1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase.
[0098] Other yeast promoters, which are inducible promoters having
the additional advantage of transcription controlled by growth
conditions, are the promoter regions for alcohol dehydrogenase 2,
isocytochrome C, acid phosphatase, degradative enzymes associated
with nitrogen metabolism, metallothionein,
glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible
for maltose and galactose utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP
73,657. Yeast enhancers also are advantageously used with yeast
promoters.
[0099] Apo-3 transcription from vectors in mammalian host cells is
controlled, for example, by promoters obtained from the genomes of
viruses such as polyoma virus, fowlpox virus (UK 2,211,504
published 5 Jul. 1989), adenovirus (such as Adenovirus 2), bovine
papilloma virus, avian sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and most preferably Simian Virus 40
(SV40), from heterologous mammalian promoters, e.g., the actin
promoter or an immunoglobulin promoter, from heat-shock promoters,
and from the promoter normally associated with the Apo-3 sequence,
provided such promoters are compatible with the host cell
systems.
[0100] The early and late promoters of the SV40 virus are
conveniently obtained as an SV40 restriction fragment that also
contains the SV40 viral origin of replication [Fiers et al.,
Nature, 273:113 (1978); Mulligan and Berg, Science, 209:1422-1427
(1980); Pavlakis et al., Proc. Natl. Acad. Sci. USA, 78:7398-7402
(1981)]. The immediate early promoter of the human cytomegalovirus
is conveniently obtained as a HindIII E restriction fragment
[Greenaway et al., Gene, 18:355-360 (1982)]. A system for
expressing DNA in mammalian hosts using the bovine papilloma virus
as a vector is disclosed in U.S. Pat. No. 4,419,446. A modification
of this system is described in U.S. Pat. No. 4,601,978 [See also
Gray et al., Nature, 295:503-508 (1982) on expressing cDNA encoding
immune interferon in monkey cells; Reyes et al., Nature,
297:598-601 (1982) on expression of human .beta.-interferon cDNA in
mouse cells under the control of a thymidine kinase promoter from
herpes simplex virus; Canaani and Berg, Proc. Natl. Acad. Sci. USA
79:5166-5170 (1982) on expression of the human interferon .beta.1
gene in cultured mouse and rabbit cells; and Gorman et al., Proc.
Natl. Acad. Sci. USA, 79:6777-6781 (1982) on expression of
bacterial CAT sequences in CV-1 monkey kidney cells, chicken embryo
fibroblasts, Chinese hamster ovary cells, HeLa cells, and mouse
NIH-3T3 cells using the Rous sarcoma virus long terminal repeat as
a promoter].
[0101] (v) Enhancer Element Component
[0102] Transcription of a DNA encoding the Apo-3 of this invention
by higher eukaryotes may be increased by inserting an enhancer
sequence into the vector. Enhancers are cis-acting elements of DNA,
usually about from 10 to 300 bp, that act on a promoter to increase
its transcription. Enhancers are relatively orientation and
position independent, having been found 5' [Laimins et al., Proc.
Natl. Acad. Sci. USA, 78:993 (1981]) and 3' [Lusky et al., Mol.
Cell Bio., 3:1108 (1983]) to the transcription unit, within an
intron [Banerji et al., Cell, 33:729 (1983)], as well as within the
coding sequence itself [Osborne et al., Mol. Cell Bio., 4:1293
(1984)]. Many enhancer sequences are now known from mammalian genes
(globin, elastase, albumin, .alpha.-fetoprotein, and insulin).
Typically, however, one will use an enhancer from a eukaryotic cell
virus. Examples include the SV40 enhancer on the late side of the
replication origin (bp 100-270), the cytomegalovirus early promoter
enhancer, the polyoma enhancer on the late side of the replication
origin, and adenovirus enhancers. See also Yaniv, Nature, 297:17-18
(1982) on enhancing elements for activation of eukaryotic
promoters. The enhancer may be spliced into the vector at a
position 5' or 3' to the Apo-3 coding sequence, but is preferably
located at a site 5' from the promoter.
[0103] (vi) Transcription Termination Component
[0104] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human, or nucleated cells from other
multicellular organisms) will also contain sequences necessary for
the termination of transcription and for stabilizing the mRNA. Such
sequences are commonly available from the 5' and, occasionally 3',
untranslated regions of eukaryotic or viral DNAs or cDNAs. These
regions contain nucleotide segments transcribed as polyadenylated
fragments in the untranslated portion of the mRNA encoding
Apo-3.
[0105] (vii) Construction and Analysis of Vectors
[0106] Construction of suitable vectors containing one or more of
the above-listed components employs standard ligation techniques.
Isolated plasmids or DNA fragments are cleaved, tailored, and
re-ligated in the form desired to generate the plasmids
required.
[0107] For analysis to confirm correct sequences in plasmids
constructed, the ligation mixtures can be used to transform E. coli
K12 strain 294 (ATCC 31,446) and successful transformants selected
by ampicillin or tetracycline resistance where appropriate.
Plasmids from the transformants are prepared, analyzed by
restriction endonuclease digestion, and/or sequenced by the method
of Messing et al., Nucleic Acids Res., 9:309 (1981) or by the
method of Maxam et al., Methods in Enzymology, 65:499 (1980).
[0108] (viii) Transient Expression Vectors
[0109] Expression vectors that provide for the transient expression
in mammalian cells of DNA encoding Apo-3 may be employed. In
general, transient expression involves the use of an expression
vector that is able to replicate efficiently in a host cell, such
that the host cell accumulates many copies of the expression vector
and, in turn, synthesizes high levels of a desired polypeptide
encoded by the expression vector [Sambrook et al., supra].
Transient expression systems, comprising a suitable expression
vector and a host cell, allow for the convenient positive
identification of polypeptides encoded by cloned DNAs, as well as
for the rapid screening of such polypeptides for desired biological
or physiological properties. Thus, transient expression systems are
particularly useful in the invention for purposes of identifying
Apo-3 variants.
[0110] (ix) Suitable Exemplary Vertebrate Cell Vectors
[0111] Other methods, vectors, and host cells suitable for
adaptation to the synthesis of Apo-3 in recombinant vertebrate cell
culture are described in Gething et al., Nature, 293:620-625
(1981); Mantei et al., Nature, 281:40-46 (1979); EP 117,060; and EP
117,058.
[0112] 3. Selection and Transformation of Host Cells
[0113] Suitable host cells for cloning or expressing the DNA in the
vectors herein are the prokaryote, yeast, or higher eukaryote cells
described above. Suitable prokaryotes for this purpose include but
are not limited to eubacteria, such as Gram-negative or
Gram-positive organisms, for example, Enterobacteriaceae such as
Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella,
Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g.,
Serratia marcescans, and Shigella, as well as Bacilli such as B.
subtilis and B. licheniformis (e.g., B. licheniformis 41P disclosed
in DD 266,710 published 12 Apr. 1989), Pseudomonas such as P.
aeruginosa, and Streptomyces. Preferably, the host cell should
secrete minimal amounts of proteolytic enzymes.
[0114] In addition to prokaryotes, eukaryotic microbes such as
filamentous fungi or yeast are suitable cloning or expression hosts
for Apo-3-encoding vectors. Saccharomyces cerevisiae, or common
baker's yeast, is the most commonly used among lower eukaryotic
host microorganisms. However, a number of other genera, species,
and strains are commonly available and useful herein.
[0115] Suitable host cells for the expression of glycosylated Apo-3
are derived from multicellular organisms. Such host cells are
capable of complex processing and glycosylation activities. In
principle, any higher eukaryotic cell culture is workable, whether
from vertebrate or invertebrate culture. Examples of invertebrate
cells include plant and insect cells. Numerous baculoviral strains
and variants and corresponding permissive insect host cells from
hosts such as Spodoptera frugiperda (caterpillar), Aedes aegypti
(mosquito), Aedes albopictus (mosquito), Drosophila melanogaster
(fruitfly), and Bombyx mori have been identified [See, e.g., Luckow
et al., Bio/Technology, 6:47-55 (1988); Miller et al., in Genetic
Engineering, Setlow et al., eds., Vol. 8 (Plenum Publishing, 1986),
pp. 277-279; and Maeda et al., Nature, 315:592-594 (1985)]. A
variety of viral strains for transfection are publicly available,
e.g., the L-1 variant of Autographa californica NPV and the Bm-5
strain of Bombyx mori NPV.
[0116] Plant cell cultures of cotton, corn, potato, soybean,
petunia, tomato, and tobacco can be utilized as hosts. Typically,
plant cells are transfected by incubation with certain strains of
the bacterium Agrobacterium tumefaciens. During incubation of the
plant cell culture with A. tumefaciens, the DNA encoding the Apo-3
can be transferred to the plant cell-host such that it is
transfected, and will, under appropriate conditions, express the
Apo-3-encoding DNA. In addition, regulatory and signal sequences
compatible with plant cells are available, such as the nopaline
synthase promoter and polyadenylation signal sequences [Depicker et
al., J. Mol. Appl. Gen., 1:561 (1982)]. In addition, DNA segments
isolated from the upstream region of the T-DNA 780 gene are capable
of activating or increasing transcription levels of
plant-expressible genes in recombinant DNA-containing plant tissue
[EP 321,196 published 21 Jun. 1989].
[0117] Propagation of vertebrate cells in culture (tissue culture)
is also well known in the art [See, e.g., Tissue Culture, Academic
Press, Kruse and Patterson, editors (1973)]. Examples of useful
mammalian host cell lines are monkey kidney CV1 line transformed by
SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or
293 cells subcloned for growth in suspension culture, Graham et
al., J. Gen Virol., 36:59 (1977)); baby hamster kidney cells (BHK,
ATCC CCL 10); Chinese hamster ovary cells/-DHFR(CHO, Urlaub and
Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli
cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); monkey
kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells
(VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA,
ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat
liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC
CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor
(MMT 060562, ATCC CCL51); TR1 cells (Mather et al., Annals N.Y.
Acad. Sci., 383:44-68 (1982)); MRC 5 cells; and FS4 cells.
[0118] Host cells are transfected and preferably transformed with
the above-described expression or cloning vectors for Apo-3
production and cultured in conventional nutrient media modified as
appropriate for inducing promoters, selecting transformants, or
amplifying the genes encoding the desired sequences.
[0119] Transfection refers to the taking up of an expression vector
by a host cell whether or not any coding sequences are in fact
expressed. Numerous methods of transfection are known to the
ordinarily skilled artisan, for example, CaPO.sub.4 and
electroporation. Successful transfection is generally recognized
when any indication of the operation of this vector occurs within
the host cell.
[0120] Transformation means introducing DNA into an organism so
that the DNA is replicable, either as an extrachromosomal element
or by chromosomal integrant. Depending on the host cell used,
transformation is done using standard techniques appropriate to
such cells. The calcium treatment employing calcium chloride, as
described in Sambrook et al., supra, or electroporation is
generally used for prokaryotes or other cells that contain
substantial cell-wall barriers. Infection with Agrobacterium
tumefaciens is used for transformation of certain plant cells, as
described by Shaw et al., Gene, 23:315 (1983) and WO 89/05859
published 29 Jun. 1989. In addition, plants may be transfected
using ultrasound treatment as described in WO 91/00358 published 10
Jan. 1991.
[0121] For mammalian cells without such cell walls, the calcium
phosphate precipitation method of Graham and van der Eb, Virology,
52:456-457 (1978) is preferred. General aspects of mammalian cell
host system transformations have been described in U.S. Pat. No.
4,399,216. Transformations into yeast are typically carried out
according to the method of Van Solingen et al., J. Bact., 130:946
(1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829
(1979). However, other methods for introducing DNA into cells, such
as by nuclear microinjection, electroporation, bacterial protoplast
fusion with intact cells, or polycations, e.g., polybrene,
polyornithine, may also be used. For various techniques for
transforming mammalian cells, see Keown et al., Methods in
Enzymology, 185:527-537 (1990) and Mansour et al., Nature,
336:348-352 (1988).
[0122] 4. Culturing the Host Cells
[0123] Prokaryotic cells used to produce Apo-3 may be cultured in
suitable media as described generally in Sambrook et al.,
supra.
[0124] The mammalian host cells used to produce Apo-3 may be
cultured in a variety of media. Examples of commercially available
media include Ham's F10 (Sigma), Minimal Essential Medium ("MEM",
Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium
("DMEM", Sigma). Any such media may be supplemented as necessary
with hormones and/or other growth factors (such as insulin,
transferrin, or epidermal growth factor), salts (such as sodium
chloride, calcium, magnesium, and phosphate), buffers (such as
HEPES), nucleosides (such as adenosine and thymidine), antibiotics
(such as Gentamycin.TM. drug), trace elements (defined as inorganic
compounds usually present at final concentrations in the micromolar
range), and glucose or an equivalent energy source. Any other
necessary supplements may also be included at appropriate
concentrations that would be known to those skilled in the art. The
culture conditions, such as temperature, pH, and the like, are
those previously used with the host cell selected for expression,
and will be apparent to the ordinarily skilled artisan.
[0125] In general, principles, protocols, and practical techniques
for maximizing the productivity of mammalian cell cultures can be
found in Mammalian Cell Biotechnology: a Practical Approach, M.
Butler, ed. (IRL Press, 1991).
[0126] The host cells referred to in this disclosure encompass
cells in culture as well as cells that are within a host
animal.
[0127] 5. Detecting Gene Amplification/Expression
[0128] Gene amplification and/or expression may be measured in a
sample directly, for example, by conventional Southern blotting,
Northern blotting to quantitate the transcription. of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Various labels may
be employed, most commonly radioisotopes, and particularly
.sup.32P. However, other techniques may also be employed, such as
using biotin-modified nucleotides for introduction into a
polynucleotide. The biotin then serves as the site for binding to
avidin or antibodies, which may be labeled with a wide variety of
labels, such as radionucleotides, fluorescers or enzymes.
Alternatively, antibodies may be employed that can recognize
specific duplexes, including DNA duplexes, RNA duplexes, and
DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in
turn may be labeled and the assay may be carried out where the
duplex is bound to a surface, so that upon the formation of duplex
on the surface, the presence of antibody bound to the duplex can be
detected.
[0129] Gene expression, alternatively, may be measured by
immunological methods, such as immunohistochemical staining of
cells or tissue sections and assay of cell culture or body fluids,
to quantitate directly the expression of gene product. With
immunohistochemical staining techniques, a cell sample is prepared,
typically by dehydration and fixation, followed by reaction with
labeled antibodies specific for the gene product coupled, where the
labels are usually visually detectable, such as enzymatic labels,
fluorescent labels, or luminescent labels.
[0130] Antibodies useful for immunohistochemical staining and/or
assay of sample fluids may be either monoclonal or polyclonal, and
may be prepared in any mammal. Conveniently, the antibodies may be
prepared against a native sequence Apo-3 polypeptide or against a
synthetic peptide based on the DNA sequences provided herein or
against exogenous sequence fused to Apo-3 DNA and encoding a
specific antibody epitope.
[0131] 6. Purification of Apo-3 Polypeptide
[0132] Forms of Apo-3 may be recovered from culture medium or from
host cell lysates. If the Apo-3 is membrane-bound, it can be
released from the membrane using a suitable detergent solution
(e.g. Triton-X 100) or its extracellular region may be released by
enzymatic cleavage.
[0133] When Apo-3 is produced in a recombinant cell other than one
of human origin, the Apo-3 is free of proteins or polypeptides of
human origin. However, it may be desired to purify Apo-3 from
recombinant cell proteins or polypeptides to obtain preparations
that are substantially homogeneous as to Apo-3. As a first step,
the culture medium or lysate may be centrifuged to remove
particulate cell debris. Apo-3 thereafter is purified from
contaminant soluble proteins and polypeptides, with the following
procedures being exemplary of suitable purification procedures: by
fractionation on an ion-exchange column; ethanol precipitation;
reverse phase HPLC; chromatography on silica or on a
cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE;
ammonium sulfate precipitation; gel filtration using, for example,
Sephadex G-75; and protein A Sepharose columns to remove
contaminants such as IgG.
[0134] Apo-3 variants in which residues have been deleted,
inserted, or substituted can be recovered in the same fashion as
native sequence Apo-3, taking account of any substantial changes in
properties occasioned by the variation. For example, preparation of
an Apo-3 fusion with another protein or polypeptide, e.g., a
bacterial or viral antigen, immunoglobulin sequence, or receptor
sequence, may facilitate purification; an immunoaffinity column
containing antibody to the sequence can be used to adsorb the
fusion polypeptide. Other types of affinity matrices also can be
used.
[0135] A protease inhibitor such as phenyl methyl sulfonyl fluoride
(PMSF) also may be useful to inhibit proteolytic degradation during
purification, and antibiotics may be included to prevent the growth
of adventitious contaminants. One skilled in the art will
appreciate that purification methods suitable for native sequence
Apo-3 may require modification to account for changes in the
character of Apo-3 or its variants upon expression in recombinant
cell culture.
[0136] 7. Covalent Modifications of APo-3 Polypeptides
[0137] Covalent modifications of Apo-3 are included within the
scope of this invention. One type of covalent modification of the
Apo-3 is introduced into the molecule by reacting targeted amino
acid residues of the Apo-3 with an organic derivatizing agent that
is capable of reacting with selected side chains or the N- or
C-terminal residues of the Apo-3.
[0138] Derivatization with bifunctional agents is useful for
crosslinking Apo-3 to a water-insoluble support matrix or surface
for use in the method for purifying anti-Apo-3 antibodies, and
vice-versa. Derivatization with one or more bifunctional agents
will also be useful for crosslinking Apo-3 molecules to generate
Apo-3 dimers. Such dimers may increase binding avidity and extend
half-life of the molecule in vivo. Commonly used crosslinking
agents include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane,
glutaraldehyde, N-hydroxysuccinimide esters, for example, esters
with 4-azidosalicylic acid, homobifunctional imidoesters, including
disuccinimidyl esters such as
3,3'-dithiobis(succinimidyl-propionate), and bifunctional
maleimides such as bis-N-maleimido-1,8-octane. Derivatizing agents
such as methyl-3-[(p-azidophenyl)-dithio]propioimidate yield
photoactivatable intermediates that are capable of forming
crosslinks in the presence of light. Alternatively, reactive
water-insoluble matrices such as cyanogen bromide-activated
carbohydrates and the reactive substrates described in U.S. Pat.
Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and
4,330,440 are employed for protein immobilization.
[0139] Other modifications include deamidation of glutaminyl and
asparaginyl residues to the corresponding glutamyl and aspartyl
residues, respectively, hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the .alpha.-amino groups of lysine, arginine, and
histidine side chains [T. E. Creighton, Proteins: Structure and
Molecular Properties, W. H. Freeman & Co., San Francisco, pp.
79-86 (1983)], acetylation of the N-terminal amine, and amidation
of any C-terminal carboxyl group. The modified forms of the
residues fall within the scope of the present invention.
[0140] Another type of covalent modification of the Apo-3
polypeptide included within the scope of this invention comprises
altering the native glycosylation pattern of the polypeptide.
"Altering the native glycosylation pattern" is intended for
purposes herein to mean deleting one or more carbohydrate moieties
found in native sequence Apo-3, and/or adding one or more
glycosylation sites that are not present in the native sequence
Apo-3.
[0141] Glycosylation of polypeptides is typically either N-linked
or O-linked. N-linked refers to the attachment of the carbohydrate
moiety to the side chain of an asparagine residue. The tripeptide
sequences asparagine-X-serine and asparagine-X-threonine, where X
is any amino acid except proline, are the recognition sequences for
enzymatic attachment of the carbohydrate moiety to the asparagine
side chain. Thus, the presence of either of these tripeptide
sequences in a polypeptide creates a potential glycosylation site.
O-linked glycosylation refers to the attachment of one of the
sugars N-aceylgalactosamine, galactose, or xylose to a
hydroxylamino acid, most commonly serine or threonine, although
5-hydroxyproline or 5-hydroxylysine may also be used.
[0142] Addition of glycosylation sites to the Apo-3 polypeptide may
be accomplished by altering the amino acid sequence such that it
contains one or more of the above-described tripeptide sequences
(for N-linked glycosylation sites). The alteration may also be made
by the addition of, or substitution by, one or more serine or
threonine residues to the native sequence Apo-3 (for O-linked
glycosylation sites). The Apo-3 amino acid sequence may optionally
be altered through changes at the DNA level, particularly by
mutating the DNA encoding the Apo-3 polypeptide at preselected
bases such that codons are generated that will translate into the
desired amino acids. The DNA mutation(s) may be made using methods
described above and in U.S. Pat. No. 5,364,934, supra.
[0143] Another means of increasing the number of carbohydrate
moieties on the Apo-3 polypeptide is by chemical or enzymatic
coupling of glycosides to the polypeptide. Depending on the
coupling mode used, the sugar(s) may be attached to (a) arginine
and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups
such as those of cysteine, (d) free hydroxyl groups such as those
of serine, threonine, or hydroxyproline, (e) aromatic residues such
as those of phenylalanine, tyrosine, or tryptophan, or (f) the
amide group of glutamine. These methods are described in WO
87/05330 published 11 Sep. 1987, and in Aplin and Wriston, CRC
Crit. Rev. Biochem., pp. 259-306 (1981).
[0144] Removal of carbohydrate moieties present on the Apo-3
polypeptide may be accomplished chemically or enzymatically or by
mutational substitution of codons encoding for amino acid residues
that serve as targets for glycosylation. For instance, chemical
deglycosylation by exposing the polypeptide to the compound
trifluoromethanesulfonic acid, or an equivalent compound can result
in the cleavage of most or all sugars except the linking sugar
(N-acetylglucosamine or N-acetylgalactosamine), while leaving the
polypeptide intact. Chemical deglycosylation is described by
Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 (1987) and by
Edge et al., Anal. Biochem., 118:131 (1981). Enzymatic cleavage of
carbohydrate moieties on polypeptides can be achieved by the use of
a variety of endo- and exo-glycosidases as described by Thotakura
et al., Meth. Enzmmol., 138:350 (1987).
[0145] Glycosylation at potential glycosylation sites may be
prevented by the use of the compound tunicamycin as described by
Duskin et al., J. Biol. Chem., 257:3105 (1982). Tunicamycin blocks
the formation of protein-N-glycoside linkages.
[0146] Another type of covalent modification of Apo-3 comprises
linking the Apo-3 polypeptide to one of a variety of
nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene
glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat.
Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
4,179,337.
[0147] 8. Apo-3 Chimeras
[0148] The present invention also provides chimeric molecules
comprising Apo-3 fused to another, heterologous polypeptide or
amino acid sequence.
[0149] In one embodiment, the chimeric molecule comprises a fusion
of the Apo-3 with a tag polypeptide which provides an epitope to
which an anti-tag antibody can selectively bind. The epitope tag is
generally placed at the amino- or carboxyl-terminus of the Apo-3.
The presence of such epitope-tagged forms of the Apo-3 can be
detected using an antibody against the tag polypeptide. Also,
provision of the epitope tag enables the Apo-3 to be readily
purified by affinity purification using an anti-tag antibody or
another type of affinity matrix that binds to the epitope tag.
[0150] Various tag polypeptides and their respective antibodies are
well known in the art. Examples include the flu HA tag polypeptide
and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165
(1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10
antibodies thereto [Evan et al., Molecular and Cellular Biology,
5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D
(gD) tag and its antibody [Paborsky et al., Protein Engineering,
3(6):547-553 (1990)]. Other tag polypeptides include the
Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; the
KT3 epitope peptide [Martin et al., Science, 255:192-194 (1992)];
an .alpha.-tubulin epitope peptide [Skinner et al., J. Biol. Chem.,
266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag
[Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397
(1990)]. Once the tag polypeptide has been selected, an antibody
thereto can be generated using the techniques disclosed herein.
[0151] Generally, epitope-tagged Apo-3 may be constructed and
produced according to the methods described above. Apo-3-tag
polypeptide fusions are preferably constructed by fusing the cDNA
sequence encoding the Apo-3 portion in-frame to the tag polypeptide
DNA sequence and expressing the resultant DNA fusion construct in
appropriate host cells. Ordinarily, when preparing the Apo-3-tag
polypeptide chimeras of the present invention, nucleic acid
encoding the Apo-3 will be fused at its 3' end to nucleic acid
encoding the N-terminus of the tag polypeptide, however 5' fusions
are also possible. For example, a polyhistidine sequence of about 5
to about 10 histidine residues may be fused at the N-terminus or
the C-terminus and used as a purification handle in affinity
chromatography.
[0152] Epitope-tagged Apo-3 can be purified by affinity
chromatography using the anti-tag antibody. The matrix to which the
affinity antibody is attached may include, for instance, agarose,
controlled pore glass or poly(styrenedivinyl)benzene. The
epitope-tagged Apo-3 can then be eluted from the affinity column
using techniques known in the art.
[0153] In another embodiment, the chimeric molecule comprises an
Apo-3 polypeptide fused to an immunoglobulin sequence. The chimeric
molecule may also comprise a particular domain sequence of Apo-3,
such as the extracellular domain sequence of native Apo-3 (see FIG.
8) fused to an immunoglobulin sequence. This includes chimeras in
monomeric, homo- or heteromultimeric, and particularly homo- or
heterodimeric, or -tetrameric forms; optionally, the chimeras may
be in dimeric forms or homodimeric heavy chain forms. Generally,
these assembled immunoglobulins will have known unit structures as
represented by the following diagrams. ##STR1##
[0154] A basic four chain structural unit is the form in which IgG,
IgD, and IgE exist. A four chain unit is repeated in the higher
molecular weight immunoglobulins; IgM generally exists as a
pentamer of basic four-chain units held together by disulfide
bonds. IgA globulin, and occasionally IgG globulin, may also exist
in a multimeric form in serum. In the case of multimers, each four
chain unit may be the same or different.
[0155] The following diagrams depict some exemplary monomer, homo-
and heterodimer and homo- and heteromultimer structures. These
diagrams are merely illustrative, and the chains of the multimers
are believed to be disulfide bonded in the same fashion as native
immunoglobulins. ##STR2##
[0156] In the foregoing diagrams, "A" means an Apo-3 sequence or an
Apo-3 sequence fused to a heterologous sequence; X is an additional
agent, which may be the same as A or different, a portion of an
immunoglobulin superfamily member such as a variable region or a
variable region-like domain, including a native or chimeric
immunoglobulin variable region, a toxin such a pseudomonas exotoxin
or ricin, or a sequence functionally binding to another protein,
such as other cytokines (i.e., IL-1, interferon-.gamma.) or cell
surface molecules (i.e., NGFR, CD40, OX40, Fas antigen, T2 proteins
of Shope and myxoma poxviruses), or a polypeptide therapeutic agent
not otherwise normally associated with a constant domain; Y is a
linker or another receptor sequence; and V.sub.L, V.sub.H, C.sub.L
and C.sub.H represent light or heavy chain variable or constant
domains of an immunoglobulin. Structures comprising at least one
CRD of an Apo-3 sequence as "A" and another cell-surface protein
having a repetitive pattern of CRDs (such as TNFR) as "X" are
specifically included.
[0157] It will be understood that the above diagrams are merely
exemplary of the possible structures of the chimeras of the present
invention, and do not encompass all possibilities. For example,
there might desirably be several different "A"s, "X"s, or "Y"s in
any of these constructs. Also, the heavy or light chain constant
domains may be originated from the same or different
immunoglobulins. All possible permutations of the illustrated and
similar structures are all within the scope of the invention
herein.
[0158] In general, the chimeric molecules can be constructed in a
fashion similar to chimeric antibodies in which a variable domain
from an antibody of one species is substituted for the variable
domain of another species. See, for example, EP 0 125 023; EP
173,494; Munro, Nature, 312:597 (13 Dec. 1984); Neuberger et al.,
Nature, 312:604-608 (13 Dec. 1984); Sharon et al., Nature,
309:364-367 (24 May 1984); Morrison et al., Proc. Nat'l. Acad. Sci.
USA, 81:6851-6855 (1984); Morrison et al., Science, 229:1202-1207
(1985); Boulianne et al., Nature, 312:643-646 (13 Dec. 1984); Capon
et al., Nature, 337:525-531 (1989); Traunecker et al., Nature,
339:68-70 (1989).
[0159] Alternatively, the chimeric molecules may be constructed as
follows. The DNA including a region encoding the desired sequence,
such as an Apo-3 and/or TNFR-sequence, is cleaved by a restriction
enzyme at or proximal to the 3' end of the DNA encoding the
immunoglobulin-like domain(s) and at a point at or near the DNA
encoding the N-terminal end of the Apo-3 or TNFR polypeptide (where
use of a different leader is contemplated) or at or proximal to the
N-terminal coding region for TNFR (where the native signal is
employed). This DNA fragment then is readily inserted proximal to
DNA encoding an immunoglobulin light or heavy chain constant region
and, if necessary, the resulting construct tailored by deletional
mutagenesis. Preferably, the Ig is a human immunoglobulin when the
chimeric molecule is intended for in vivo therapy for humans. DNA
encoding immunoglobulin light or heavy chain constant regions is
known or readily available from cDNA libraries or is synthesized.
See for example, Adams et al., Biochemistry, 19:2711-2719 (1980);
Gough et al., Biochemistry, 19:2702-2710 (1980); Dolby et al.,
Proc. Natl. Acad. Sci. USA, 77:6027-6031 (1980); Rice et al., Proc.
Natl. Acad. Sci., 79:7862-7865 (1982); Falkner et al., Nature,
298:286-288 (1982); and Morrison et al., Ann. Rev. Immunol.,
2:239-256 (1984).
[0160] Further details of how to prepare such fusions are found in
publications concerning the preparation of immunoadhesins.
Immunoadhesins in general, and CD4-Ig fusion molecules specifically
are disclosed in WO 89/02922, published 6 Apr. 1989). Molecules
comprising the extracellular portion of CD4, the receptor for human
immunodeficiency virus (HIV), linked to IgG heavy chain constant
region are known in the art and have been found to have a markedly
longer half-life and lower clearance than the soluble extracellular
portion of CD4 [Capon et al., supra; Byrn et al., Nature, 344:667
(1990)]. The construction of specific chimeric TNFR-IgG molecules
is also described in Ashkenazi et al. Proc. Natl. Acad. Sci.,
88:10535-10539 (1991); Lesslauer et al. [J. Cell. Biochem.
Supplement 15F, 1991, p. 115 (P 432)]; and Peppel and Beutler, J.
Cell. Biochem. Supplement 15F, 1991, p. 118 (P 439)].
[0161] B. Therapeutic and Non-Therapeutic Uses for Apo-3
[0162] Apo-3, as disclosed in the present specification, can be
employed therapeutically to induce apoptosis in mammalian cells.
This therapy can be accomplished for instance, using in vivo or ex
vivo gene therapy techniques and includes the use of the death
domain sequences disclosed herein. The Apo-3 chimeric molecules
(including the chimeric molecules containing the extracellular
domain sequence of Apo-3) comprising immunoglobulin sequences can
also be employed therapeutically to inhibit apoptosis or
NF-.kappa.B induction.
[0163] The Apo-3 of the invention also has utility in
non-therapeutic applications. Nucleic acid sequences encoding the
Apo-3 may be used as a diagnostic for tissue-specific typing. For
example, procedures like in situ hybridization, Northern and
Southern blotting, and PCR analysis may be used to determine
whether DNA and/or RNA encoding Apo-3 is present in the cell
type(s) being evaluated. Apo-3 nucleic acid will also be useful for
the preparation of Apo-3 by the recombinant techniques described
herein.
[0164] The isolated Apo-3 may be used in quantitative diagnostic
assays as a control against which samples containing unknown
quantities of Apo-3 may be prepared. Apo-3 preparations are also
useful in generating antibodies, as standards in assays for Apo-3
(e.g., by labeling Apo-3 for use as a standard in a
radioimmunoassay, radioreceptor assay, or enzyme-linked
immunoassay), in affinity purification techniques, and in
competitive-type receptor binding assays when labeled with, for
instance, radioiodine, enzymes, or fluorophores.
[0165] Modified forms of the Apo-3, such as the Apo-3-IgG chimeric
molecules (immunoadhesins) described above, can be used as
immunogens in producing anti-Apo-3 antibodies.
[0166] Nucleic acids which encode Apo-3 or its modified forms can
also be used to generate either transgenic animals or "knock out"
animals which, in turn, are useful in the development and screening
of therapeutically useful reagents. A transgenic animal (e.g., a
mouse or rat) is an animal having cells that contain a transgene,
which transgene was introduced into the animal or an ancestor of
the animal at a prenatal, e.g., an embryonic stage. A transgene is
a DNA which is integrated into the genome of a cell from which a
transgenic animal develops. In one embodiment, cDNA encoding Apo-3
or an appropriate sequence thereof can be used to clone genomic DNA
encoding Apo-3 in accordance with established techniques and the
genomic sequences used to generate transgenic animals that contain
cells which express DNA encoding Apo-3. Methods for generating
transgenic animals, particularly animals such as mice or rats, have
become conventional in the art and are described, for example, in
U.S. Pat. Nos. 4,736,866 and 4,870,009. Typically, particular cells
would be targeted for Apo-3 transgene incorporation with
tissue-specific enhancers. Transgenic animals that include a copy
of a transgene encoding Apo-3 introduced into the germ line of the
animal at an embryonic stage can be used to examine the effect of
increased expression of DNA encoding Apo-3. Such animals can be
used as tester animals for reagents thought to confer protection
from, for example, pathological conditions associated with
excessive apoptosis. In accordance with this facet of the
invention, an animal is treated with the reagent and a reduced
incidence of the pathological condition, compared to untreated
animals bearing the transgene, would indicate a potential
therapeutic intervention for the pathological condition. In another
embodiment, transgenic animals that carry a soluble form of Apo-3
such as the Apo-3 ECD or an immunoglobulin chimera of such form
could be constructed to test the effect of chronic neutralization
of the ligand of Apo-3.
[0167] Alternatively, non-human homologues of Apo-3 can be used to
construct a Apo-3 "knock out" animal which has a defective or
altered gene encoding Apo-3 as a result of homologous recombination
between the endogenous gene encoding Apo-3 and altered genomic DNA
encoding Apo-3 introduced into an embryonic cell of the animal. For
example, cDNA encoding Apo-3 can be used to clone genomic DNA
encoding Apo-3 in accordance with established techniques. A portion
of the genomic DNA encoding Apo-3 can be deleted or replaced with
another gene, such as a gene encoding a selectable marker which can
be used to monitor integration. Typically, several kilobases of
unaltered flanking DNA (both at the 5' and 3' ends) are included in
the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for
a description of homologous recombination vectors]. The vector is
introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced DNA has
homologously recombined with the endogenous DNA are selected [see
e.g., Li et al., Cell, 69:915 (1992)]. The selected cells are then
injected into a blastocyst of an animal (e.g., a mouse or rat) to
form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas
and Embryonic Stem Cells: A Practical Approach, E. J. Robertson,
ed. (IRL, Oxford, 1987), pp. 113-152]. A chimeric embryo can then
be implanted into a suitable pseudopregnant female foster animal
and the embryo brought to term to create a "knock out" animal.
Progeny harboring the homologously recombined DNA in their germ
cells can be identified by standard techniques and used to breed
animals in which all cells of the animal contain the homologously
recombined DNA. Knockout animals can be characterized for instance,
for their ability to defend against certain pathological conditions
and for their development of pathological conditions due to absence
of the Apo-3 polypeptide, including for example, development of
tumors.
[0168] C. Anti-Apo-3 Antibody Preparation
[0169] The present invention further provides anti-Apo-3
antibodies. Antibodies against Apo-3 may be prepared as follows.
Exemplary antibodies include polyclonal, monoclonal, humanized,
bispecific, and heteroconjugate antibodies.
[0170] 1. Polyclonal Antibodies
[0171] The Apo-3 antibodies may comprise polyclonal antibodies.
Methods of preparing polyclonal antibodies are known to the skilled
artisan. Polyclonal antibodies can be raised in a mammal, for
example, by one or more injections of an immunizing agent and, if
desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The immunizing agent may include the
Apo-3 polypeptide or a fusion protein thereof. An example of a
suitable immunizing agent is a Apo-3-IgG fusion protein or chimeric
molecule (including an Apo-3 ECD-IgG fusion protein). Cells
expressing Apo-3 at their surface may also be employed. It may be
useful to conjugate the immunizing agent to a protein known to be
immunogenic in the mammal being immunized. Examples of such
immunogenic proteins which may be employed include but are not
limited to keyhole limpet hemocyanin, serum albumin, bovine
thyroglobulin, and soybean trypsin inhibitor. An aggregating agent
such as alum may also be employed to enhance the mammal's immune
response. Examples of adjuvants which may be employed include
Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl
Lipid A, synthetic trehalose dicorynomycolate). The immunization
protocol may be selected by one skilled in the art without undue
experimentation. The mammal can then be bled, and the serum assayed
for antibody titer. If desired, the mammal can be boosted until the
antibody titer increases or plateaus.
[0172] 2. Monoclonal Antibodies
[0173] The Apo-3 antibodies may, alternatively, be monoclonal
antibodies. Monoclonal antibodies may be prepared using hybridoma
methods, such as those described by Kohler and Milstein, supra. In
a hybridoma method, a mouse, hamster, or other appropriate host
animal, is typically immunized (such as described above) with an
immunizing agent to elicit lymphocytes that produce or are capable
of producing antibodies that will specifically bind to the
immunizing agent. Alternatively, the lymphocytes may be immunized
in vitro.
[0174] The immunizing agent will typically include the Apo-3
polypeptide or a fusion protein thereof. An example of a suitable
immunizing agent is a Apo-3-IgG fusion protein or chimeric
molecule. Cells expressing Apo-3 at their surface may also be
employed. Generally, either peripheral blood lymphocytes ("PBLs")
are used if cells of human origin are desired, or spleen cells or
lymph node cells are used if non-human mammalian sources are
desired. The lymphocytes are then fused with an immortalized cell
line using a suitable fusing agent, such as polyethylene glycol, to
form a hybridoma cell [Goding, Monoclonal Antibodies: Principles
and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell
lines are usually transformed mammalian cells, particularly myeloma
cells of rodent, bovine and human origin. Usually, rat or mouse
myeloma cell lines are employed. The hybridoma cells may be
cultured in a suitable culture medium that preferably contains one
or more substances that inhibit the growth or survival of the
unfused, immortalized cells. For example, if the parental cells
lack the enzyme hypoxanthine guanine phosphoribosyl transferase
(HGPRT or HPRT), the culture medium for the hybridomas typically
will include hypoxanthine, aminopterin, and thymidine ("HAT
medium"), which substances prevent the growth of HGPRT-deficient
cells.
[0175] Preferred immortalized cell lines are those that fuse
efficiently, support stable high level expression of antibody by
the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More preferred immortalized cell lines
are murine myeloma lines, which can be obtained, for instance, from
the Salk Institute Cell Distribution Center, San Diego, Calif. and
the American Type Culture Collection, Rockville, Md. Human myeloma
and mouse-human heteromyeloma cell lines also have been described
for the production of human monoclonal antibodies [Kozbor, J.
Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody
Production Techniques and Applications, Marcel Dekker, Inc., New
York, (1987) pp. 51-63].
[0176] The culture medium in which the hybridoma cells are cultured
can then be assayed for the presence of monoclonal antibodies
directed against Apo-3. Preferably, the binding specificity of
monoclonal antibodies produced by the hybridoma cells is determined
by immunoprecipitation or by an in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay
(ELISA). Such techniques and assays are known in the art. The
binding affinity of the monoclonal antibody can, for example, be
determined by the Scatchard analysis of Munson and Pollard, Anal.
Biochem., 107:220 (1980).
[0177] After the desired hybridoma cells are identified, the clones
may be subcloned by limiting dilution procedures and grown by
standard methods [Goding, supra]. Suitable culture media for this
purpose include, for example, Dulbecco's Modified Eagle's Medium
and RPMI-1640 medium. Alternatively, the hybridoma cells may be
grown in vivo as ascites in a mammal.
[0178] The monoclonal antibodies secreted by the subclones may be
isolated or purified from the culture medium or ascites fluid by
conventional immunoglobulin purification procedures such as, for
example, protein A-Sepharose, hydroxylapatite chromatography, gel
electrophoresis, dialysis, or affinity chromatography.
[0179] The monoclonal antibodies may also be made by recombinant
DNA methods, such as those described in U.S. Pat. No. 4,816,567.
DNA encoding the monoclonal antibodies of the invention can be
readily isolated and sequenced using conventional procedures (e.g.,
by using oligonucleotide probes that are capable of binding
specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells of the invention serve as a
preferred source of such DNA. Once isolated, the DNA may be placed
into expression vectors, which are then transfected into host cells
such as simian COS cells, Chinese hamster ovary (CHO) cells, or
myeloma cells that do not otherwise produce immunoglobulin protein,
to obtain the synthesis of monoclonal antibodies in the recombinant
host cells. The DNA also may be modified, for example, by
substituting the coding sequence for human heavy and light chain
constant domains in place of the homologous murine sequences [U.S.
Pat. No. 4,816,567; Morrison et al., supra] or by covalently
joining to the immunoglobulin coding sequence all or part of the
coding sequence for a non-immunoglobulin polypeptide. Such a
non-immunoglobulin polypeptide can be substituted for the constant
domains of an antibody of the invention, or can be substituted for
the variable domains of one antigen-combining site of an antibody
of the invention to create a chimeric bivalent antibody.
[0180] The antibodies may be monovalent antibodies. Methods for
preparing monovalent antibodies are well known in the art. For
example, one method involves recombinant expression of
immunoglobulin light chain and modified heavy chain. The heavy
chain is truncated generally at any point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively, the relevant
cysteine residues are substituted with another amino acid residue
or are deleted so as to prevent crosslinking.
[0181] In vitro methods are also suitable for preparing monovalent
antibodies. Digestion of antibodies to produce fragments thereof,
particularly, Fab fragments, can be accomplished using routine
techniques known in the art. For instance, digestion can be
performed using papain. Examples of papain digestion are described
in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566.
Papain digestion of antibodies typically produces two identical
antigen binding fragments, called Fab fragments, each with a single
antigen binding site, and a residual Fc fragment. Pepsin treatment
yields an F(ab').sub.2 fragment that has two antigen combining
sites and is still capable of cross-linking antigen.
[0182] The Fab fragments produced in the antibody digestion also
contain the constant domains of the light chain and the first
constant domain (CH.sub.1) of the heavy chain. Fab' fragments
differ from Fab fragments by the addition of a few residues at the
carboxy terminus of the heavy chain CH.sub.1 domain including one
or more cysteines from the antibody hinge region. Fab'-SH is the
designation herein for Fab' in which the cysteine residue(s) of the
constant domains bear a free thiol group. F(ab').sub.2 antibody
fragments originally were produced as pairs of Fab' fragments which
have hinge cysteines between them. Other chemical couplings of
antibody fragments are also known.
[0183] 3. Humanized Antibodies
[0184] The Apo-3 antibodies of the invention may further comprise
humanized antibodies or human antibodies. Humanized forms of
non-human (e.g., murine) antibodies are chimeric immunoglobulins,
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab',
F(ab').sub.2 or other antigen-binding subsequences of antibodies)
which contain minimal sequence derived from non-human
immunoglobulin. Humanized antibodies include human immunoglobulins
(recipient antibody) in which residues from a complementary
determining region (CDR) of the recipient are replaced by residues
from a CDR of a non-human species (donor antibody) such as mouse,
rat or rabbit having the desired specificity, affinity and
capacity. In some instances, Fv framework residues of the human
immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues which are found
neither in the recipient antibody nor in the imported CDR or
framework sequences. In general, the humanized antibody will
comprise substantially all of at least one, and typically two,
variable domains, in which all or substantially all of the CDR
regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR regions are those of a human
immunoglobulin consensus sequence. The humanized antibody optimally
also will comprise at least a portion of an immunoglobulin constant
region (Fc), typically that of a human immunoglobulin [Jones et
al., Nature, 321:522-525 (1986); Reichmann et al., Nature,
332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596
(1992)].
[0185] Methods for humanizing non-human antibodies are well known
in the art. Generally, a humanized antibody has one or more amino
acid residues introduced into it from a source which is non-human.
These non-human amino acid residues are often referred to as
"import" residues, which are typically taken from an "import"
variable domain. Humanization can be essentially performed
following the method of Winter and co-workers [Jones et al.,
Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327
(1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by
substituting rodent CDRs or CDR sequences for the corresponding
sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567),
wherein substantially less than an intact human variable domain has
been substituted by the corresponding sequence from a non-human
species. In practice, humanized antibodies are typically human
antibodies in which some CDR residues and possibly some FR residues
are substituted by residues from analogous sites in rodent
antibodies.
[0186] The choice of human variable domains, both light and heavy,
to be used in making the humanized antibodies is very important in
order to reduce antigenicity. According to the "best-fit" method,
the sequence of the variable domain of a rodent antibody is
screened against the entire library of known human variable domain
sequences. The human sequence which is closest to that of the
rodent is then accepted as the human framework (FR) for the
humanized antibody [Sims et al., J. Immunol., 151:2296 (1993);
Chothia and Lesk, J. Mol. Biol., 196:901 (1987)]. Another method
uses a particular framework derived from the consensus sequence of
all human antibodies of a particular subgroup of light or heavy
chains. The same framework may be used for several different
humanized antibodies [Carter et al., Proc. Natl. Acad. Sci. USA,
89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993)].
[0187] It is further important that antibodies be humanized with
retention of high affinity for the antigen and other favorable
biological properties. To achieve this goal, according to a
preferred method, humanized antibodies are prepared by a process of
analysis of the parental sequences and various conceptual humanized
products using three dimensional models of the parental and
humanized sequences. Three dimensional immunoglobulin models are
commonly available and are familiar to those skilled in the art.
Computer programs are available which illustrate and display
probable three-dimensional conformational structures of selected
candidate immunoglobulin sequences. Inspection of these displays
permits analysis of the likely role of the residues in the
functioning of the candidate immunoglobulin sequence, i.e., the
analysis of residues that influence the ability of the candidate
immunoglobulin to bind its antigen. In this way, FR residues can be
selected and combined from the consensus and import sequence so
that the desired antibody characteristic, such as increased
affinity for the target antigen(s), is achieved. In general, the
CDR residues are directly and most substantially involved in
influencing antigen binding [see, WO 94/04679 published 3 Mar.
1994].
[0188] Transgenic animals (e.g., mice) that are capable, upon
immunization, of producing a full repertoire of human antibodies in
the absence of endogenous immunoglobulin production can be
employed. For example, it has been described that the homozygous
deletion of the antibody heavy chain joining region (J.sub.H) gene
in chimeric and germ-line mutant mice results in complete
inhibition of endogenous antibody production. Transfer of the human
germ-line immunoglobulin gene array in such germ-line mutant mice
will result in the production of human antibodies upon antigen
challenge [see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci.
USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362:255-258
(1993); Bruggermann et al., Year in Immuno., 7:33 (1993)]. Human
antibodies can also be produced in phage display libraries
[Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et
al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cote et al.
and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cote et al., Monoclonal Antibodies and
Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J.
Immunol., 147(1):86-95 (1991)].
[0189] 4. Bispecific Antibodies
[0190] Bispecific antibodies are monoclonal, preferably human or
humanized, antibodies that have binding specificities for at least
two different antigens. In the present case, one of the binding
specificities is for the Apo-3, the other one is for any other
antigen, and preferably for a cell-surface protein or receptor or
receptor subunit.
[0191] Methods for making bispecific antibodies are known in the
art. Traditionally, the recombinant production of bispecific
antibodies is based on the co-expression of two immunoglobulin
heavy-chain/light-chain pairs, where the two heavy chains have
different specificities [Millstein and Cuello, Nature, 305:537-539
(1983)]. Because of the random assortment of immunoglobulin heavy
and light chains, these hybridomas (quadromas) produce a potential
mixture of ten different antibody molecules, of which only one has
the correct bispecific structure. The purification of the correct
molecule is usually accomplished by affinity chromatography steps.
Similar procedures are disclosed in WO 93/08829, published 13 May
1993, and in Traunecker et al., EMBO J., 10:3655-3659 (1991).
[0192] According to a different and more preferred approach,
antibody variable domains with the desired binding specificities
(antibody-antigen combining sites) are fused to immunoglobulin
constant domain sequences. The fusion preferably is with an
immunoglobulin heavy-chain constant domain, comprising at least
part of the hinge, CH2, and CH3 regions. It is preferred to have
the first heavy-chain constant region (CH1) containing the site
necessary for light-chain binding present in at least one of the
fusions. DNAs encoding the immunoglobulin heavy-chain fusions and,
if desired, the immunoglobulin light chain, are inserted into
separate expression vectors, and are co-transfected into a suitable
host organism. This provides for great flexibility in adjusting the
mutual proportions of the three polypeptide fragments in
embodiments when unequal ratios of the three polypeptide chains
used in the construction provide the optimum yields. It is,
however, possible to insert the coding sequences for two or all
three polypeptide chains in one expression vector when the
expression of at least two polypeptide chains in equal ratios
results in high yields or when the ratios are of no particular
significance. In a preferred embodiment of this approach, the
bispecific antibodies are composed of a hybrid immunoglobulin heavy
chain with a first binding specificity in one arm, and a hybrid
immunoglobulin heavy-chain/light-chain pair (providing a second
binding specificity) in the other arm. It was found that this
asymmetric structure facilitates the separation of the desired
bispecific compound from unwanted immunoglobulin chain
combinations, as the presence of an immunoglobulin light chain in
only one half of the bispecific molecule provides for a facile way
of separation. This approach is disclosed in WO 94/04690 published
3 Mar. 1994. For further details of generating bispecific
antibodies see, for example, Suresh et al., Methods in Enzymology,
121:210 (1986).
[0193] 5. Heteroconjugate Antibodies
[0194] Heteroconjugate antibodies are also within the scope of the
present invention. Heteroconjugate antibodies are composed of two
covalently joined antibodies. Such antibodies have, for example,
been proposed to target immune system cells to unwanted cells [U.S.
Pat. No. 4,676,980], and for treatment of HIV infection [WO
91/00360; WO 92/200373; EP 03089]. It is contemplated that the
antibodies may be prepared in vitro using known methods in
synthetic protein chemistry, including those involving crosslinking
agents. For example, immunotoxins may be constructed using a
disulfide exchange reaction or by forming a thioether bond.
Examples of suitable reagents for this purpose include
iminothiolate and methyl-4-mercaptobutyrimidate and those
disclosed, for example, in U.S. Pat. No. 4,676,980.
[0195] D. Therapeutic and Non-Therapeutic Uses for Apo-3
Antibodies
[0196] The Apo-3 antibodies of the invention have therapeutic
utility. Agonistic Apo-3 antibodies, for instance, may be employed
to activate or stimulate apoptosis in cancer cells. Alternatively,
antagonistic antibodies may be used to block excessive apoptosis
(for instance in neurodegenerative disease) or to block potential
autoimmune/inflammatory effects of Apo-3 resulting from NF-.kappa.B
activation.
[0197] Apo-3 antibodies may further be used in diagnostic assays
for Apo-3, e.g., detecting its expression in specific cells,
tissues, or serum. Various diagnostic assay techniques known in the
art may be used, such as competitive binding assays, direct or
indirect sandwich assays and immunoprecipitation assays conducted
in either heterogeneous or homogeneous phases [Zola, Monoclonal
Antibodies: A Manual of Techniques, CRC Press, Inc. (1987) pp.
147-158]. The antibodies used in the diagnostic assays can be
labeled with a detectable moiety. The detectable moiety should be
capable of producing, either directly or indirectly, a detectable
signal. For example, the detectable moiety may be a radioisotope,
such as .sup.3H, .sup.14C, .sup.32P, .sup.35S, or .sup.125I, a
fluorescent or chemiluminescent compound, such as fluorescein
isothiocyanate, rhodamine, or luciferin, or an enzyme, such as
alkaline phosphatase, beta-galactosidase or horseradish peroxidase.
Any method known in the art for conjugating the antibody to the
detectable moiety may be employed, including those methods
described by Hunter et al., Nature, 144:945 (1962); David et al.,
Biochemistry, 13:1014 (1974); Pain et al., J. Immunol. Meth.,
40:219 (1981); and Nygren, J. Histochem. and Cytochem., 30:407
(1982).
[0198] Apo-3 antibodies also are useful for the affinity
purification of Apo-3 from recombinant cell culture or natural
sources. In this process, the antibodies against Apo-3 are
immobilized on a suitable support, such a Sephadex resin or filter
paper, using methods well known in the art. The immobilized
antibody then is contacted with a sample containing the Apo-3 to be
purified, and thereafter the support is washed with a suitable
solvent that will remove substantially all the material in the
sample except the Apo-3, which is bound to the immobilized
antibody. Finally, the support is washed with another suitable
solvent that will release the Apo-3 from the antibody.
[0199] E. Kits Containing Apo-3 or Apo-3 Antibodies
[0200] In a further embodiment of the invention, there are provided
articles of manufacture and kits containing Apo-3 or Apo-3
antibodies which can be used, for instance, for the therapeutic or
non-therapeutic applications described above. The article of
manufacture comprises a container with a label. Suitable containers
include, for example, bottles, vials, and test tubes. The
containers may be formed from a variety of materials such as glass
or plastic. The container holds a composition which includes an
active agent that is effective for therapeutic or non-therapeutic
applications, such as described above. The active agent in the
composition is Apo-3 or an Apo-3 antibody. The label on the
container indicates that the composition is used for a specific
therapy or non-therapeutic application, and may also indicate
directions for either in vivo or in vitro use, such as those
described above.
[0201] The kit of the invention will typically comprise the
container described above and one or more other containers
comprising materials desirable from a commercial and user
standpoint, including buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use.
[0202] The following examples are offered for illustrative purposes
only, and are not intended to limit the scope of the present
invention in any way.
[0203] All references cited in the present specification are hereby
incorporated by reference in their entirety.
EXAMPLES
[0204] All restriction enzymes referred to in the examples were
purchased from New England Biolabs and used according to
manufacturer's instructions. All other commercially available
reagents referred to in the examples were used according to
manufacturer's instructions unless otherwise indicated. The source
of those cells identified in the following examples, and throughout
the specification, by ATCC accession numbers is the American Type
Culture Collection, Rockville, Md.
Example 1
Isolation of cDNA Clones Encoding Human Apo-2 Ligand Inhibitor
[0205] To isolate a cDNA for Apo-2 ligand inhibitor, a lambda gt10
bacteriophage library of human thymus cDNA (about 1.times.10.sup.6
clones) (HL1074a, commercially available from Clontech) was
screened by hybridization with synthetic oligonucleotide probes
based on an EST sequence (GenBank locus H41522), which showed some
degree of homology to human Fas/Apo-1. The EST sequence of H41522
is 433 bp and when translated in its +1 frame, shows 20 identities
to a 78 amino acid region of human Fas/Apo-1. The sequence of
H41522 is as follows: TABLE-US-00001 (SEQ ID NO:2)
CTGCTGGGGGCCCGGGCCAGNGGCGGCACTCGTAGCCCCAGGTGTGACTG
TGCCGGTGACTTCCACAAGAAGATTGGTCTGTTTTGTTGCAGAGGCTGCC
CAGCGGGGCAACTACCTGAAGGCCCCTTGCACGGAGCCCTGCGCAACTCC
ACCTGCCTTGTGTGTCCCCAAGACACCTTCTTGGCCTGGGAGAACCACCA
TAATTCTGAATGTGCCCGCTGCCAGGCCTGTGATGAGCAGGCCTCCCAGG
TGGCGCTGGAGAACTGTTCAGCAGTGGCCGACACCCGCTGTGGCTGTAAG
CAGGGCTGGTTTGTGGAGTGCCAGGGTCAGCCAATGTGTCAGCAGTTTCA
CCCTTCTAATGCCAACCATGCCTAGACTGCGGGGCCCTGCAACGCAACAC
ACGGCTAATNTGTTTCCCGCAGAGATNATTGTT
[0206] The oligonucleotide probes employed in the screening were 28
bp long, with the following respective sequences: TABLE-US-00002
CCCGCTGCCAGGCCTGTGATGAGCAGGC (SEQ ID NO:3)
CAGGGCCCCGCAGTCTAGGCATGGTTGG (SEQ ID NO:4)
Hybridization was conducted with a 1:1 mixture of the two probes
overnight at room temperature in buffer containing 20% formamide,
5.times.SSC, 10% dextran sulfate, 0.1% NaPiPO.sub.4, 0.05M
NaPO.sub.4, 0.05 mg salmon sperm DNA, and 0.1% sodium dodecyl
sulfate, followed consecutively by one wash at room temperature in
6.times.SSC, two washes at 37.degree. C. in 1.times.SSC/0.1% SDS,
two washes at 37.degree. C. in 0.5.times.SSC/0.1% SDS, and two
washes at 37.degree. C. in 0.2.times.SSC/0.1 SDS. Four positive
clones were identified in the cDNA library, and the positive clones
were confirmed to be specific by PCR using the above hybridization
probes as PCR primers. Single phage plaques containing each of the
four positive clones were isolated by limiting dilution and the DNA
was purified using a Wizard Lambda Prep DNA purification kit
(commercially available from Promega).
[0207] The cDNA inserts from the four bacteriophage clones were
excised from the vector arms by digestion with EcoRI, gel-purified,
and subcloned into pRK7 [EP 278,776 published Aug. 17, 1988] that
was predigested with EcoRI. Three of the clones (18.1, 24.1, and
28.1) contained an identical open reading frame; therefore further
analysis was done with only one clone, 18.1. Clone 18.1 was
approximately 1.4 kb long.
[0208] The entire nucleotide sequence of Apo-2 ligand inhibitor is
shown in FIG. 1 (SEQ ID NO:5). The cDNA contained one open reading
frame with a translational initiation site assigned to the ATG
codon at nucleotide positions 377-379. The surrounding sequence at
this site is in reasonable agreement with the proposed consensus
sequence for initiation sites [Kozak, J. Cell. Biol., 115:887-903
(1991)]. The open reading frame ends at the termination codon TAA
at nucleotide positions 919-921.
[0209] The predicted amino acid sequence of the Apo-2 ligand
inhibitor encoded by clone 181 contains 181 amino acids, and has a
calculated molecular weight of approximately 19.3 kDa and an
isoelectric point of approximately 7.1. Hydropathy analysis
indicated the presence of a hydrophobic signal sequence at the
N-terminus of approximately 20 amino acids. Two potential N-linked
glycosylation sites are located at residues 67 and 105 of the
polypeptide precursor.
[0210] An alignment (using the Align.TM. computer program) of the
amino acid sequence encoded by clone 18.1 with the extracellular
regions of other known members of the human TNF receptor family
showed the following percentages of identity: 30.2% identity to
Fas/Apo-1; 28.7% to type 1 TNF receptor (TNFR1); 22.5% to the low
affinity NGF receptor (LNGFR) and to CD40; 21.8% to CD30; 21.5% to
CD27; 21.4% to OX40; 20.5% to type 2 TNF receptor (TNFR2); 20.1% to
TNF receptor related protein (TNFRrp). (See also, FIG. 2)
[0211] TNF receptor family proteins are typically characterized by
the presence of multiple (usually four) cysteine-rich domains in
their extracellular regions--each cysteine-rich domain being
approximately 45 amino acid long and contains approximately 6,
regularly spaced, cysteine residues. Based on the crystal structure
of the type 1 TNF receptor, the cysteines in each domain typically
form three disulfide bonds in which usually cysteines 1 and 2, 3
and 5, and 4 and 6 are paired together. Applicants found that the
polypeptide encoded by clone 18.1 contains three cysteine-rich
domains and an apparently truncated fourth cysteine-rich domain
that contains only three cysteines and stops 5 amino acids
C-terminally to the third cysteine.
[0212] Amino acids 1 to 181 of the Apo-2LI clone 18.1 shown in FIG.
1 (SEQ ID NO:1) are identical to the amino acids 1 to 181 of the
Apo-3 polypeptide, as described in Example 9 below, and shown in
FIG. 8 (SEQ ID NO:10). Compared to Apo-3 polypeptide described in
Example 9 below, the polypeptide encoded by clone 18.1 is truncated
within the C-terminal region of the ECD and lacks some
extracellular sequence as well as the transmembrane and cytoplasmic
sequences of Apo-3. The truncation is believed to occur by
alternative splicing of the mRNA which introduces a stop codon 5
amino acids downstream of the third cysteine of the fourth
cysteine-rich domain. The 3' untranslated region is distinct from
that of the Apo-3 clone FL8A.53 and contains a distinct
polyadenylation site, suggesting that clone 18.1 represents a
naturally-occurring mRNA.
Example 2
[0213] Expression of Apo-2 Ligand Inhibitor Clone 18.1
[0214] A pRK7 plasmid (described in Example 1) containing the Apo-2
ligand inhibitor cDNA (as described in Example 1) in the forward
orientation, or a control pRK5 plasmid [Schall et al., Cell,
61:361-370 (1990); Suva, Science, 237:893-896 (1987)] containing
the Apo-2 ligand inhibitor cDNA in the reverse orientation, were
transfected transiently into human 293 cells (ATCC CRL 1573) by
calcium phosphate precipitation. After 24 hours, the medium was
replaced by serum free medium, and the cells were incubated for an
additional 48 hours. The serum free conditioned media were then
collected, cleared by centrifugation, and concentrated 5-fold by
centrifugation in centricon tubes.
Example 3
[0215] Expression of APo-2 Ligand Inhibitor Immunoadhesin
[0216] An immunoadhesin was constructed that consisted of the Apo-2
ligand inhibitor coding region (as described in Example 1),
including its endogenous signal sequence, fused C-terminally to
residues 183-211 of type 1 TNF receptor, which was fused in turn to
the hinge and Fc regions of human IgG1 heavy chain, as described
previously by Ashkenazi et al., supra.
[0217] The pRK5 plasmid encoding the chimeric Apo-2 ligand
inhibitor immunoadhesin was transiently transfected into human 293
cells (described in Example 2) by calcium phosphate precipitation.
After 24 hours, the medium was replaced by serum free medium, and
the cells were incubated for an additional 6 days. The serum free
conditioned media were then collected, cleared by centrifugation,
and purified by protein A affinity chromatography, as described
previously by Ashkenazi et al., supra. Gel electrophoresis showed
that the purified protein exhibited a molecular weight of
approximately 110 kDa under non-reducing conditions (FIG. 3, lanes
3-5) and approximately 55 kDa under reducing conditions (100 mM
DTT, FIG. 3, lanes 7-9), thus indicating a disulfide-bonded
homodimeric immunoadhesin structure. Higher molecular weight bands
observed for non-reducing conditions are believed to be due to some
aggregation of the immunoadhesin during sample preparation.
Example 4
Isolation of cDNA Clones Encoding Human Apo-2 Ligand
[0218] To isolate a full-length cDNA for Apo-2 ligand, a lambda
gt11 bacteriophage library of human placental cDNA (about
1.times.10.sup.6 clones) (HL10756, commercially available from
Clontech) was screened by hybridization with synthetic
oligonucleotide probes based on an EST sequence (GenBank locus
HHEA47M), which showed some degree of homology to human Fas/Apo-1
ligand. The EST sequence of HHEA47M is 390 bp and when translated
in its +3 frame, shows 16 identities to a 34 amino acid region of
human Apo-1 ligand. The sequence of HHEA47M is as follows:
TABLE-US-00003 (SEQ ID NO:6)
GGGACCCCAATGACGAAGAGAGTATGAACAGCCCCTGCTGGCAAGTCAAG
TGGCAACTCCGTCAGCTCGTTAGAAAGATGATTTTGAGAACCTCTGAGGA
AACCATTTCTACAGTTCAAGAAAAGCAACAAAATATTTCTCCCCTAGTGA
GAGAAAGAGGTCCTCAGAGAGTAGCAGCTCACATAACTGGGACCAGAGGA
AGAAGCAACACATTGTCTTCTCCAAACTCCAAGAATGAAAAGGCTCTGGG
CCGCAAAATAAACTCCTGGGAATCATCAAGGAGTGGGCATTCATTCCTGA
GCAACTTGCACTTGAGGAATGGTGAACTGGTCATCCATGAAAAAGGGTTT
TACTACATCTATTCCCAAACATACTTTCGATTTCAGGAGG
[0219] A 60 bp oligonucleotide probe with the following sequence
was employed in the screening: TABLE-US-00004 (SEQ ID NO:7)
TGACGAAGAGAGTATGAACAGCCCCTGCTGGCAAGTCAAGTGGCAACTCC GTCAGCTCGT
[0220] Hybridization was conducted overnight at room temperature in
buffer containing 20% formamide, 5.times.SSC, 10 dextran sulfate,
0.1% NaPiPO.sub.4, 0.05M NaPO.sub.4, 0.05 mg salmon sperm DNA, and
0.1% sodium dodecyl sulfate, followed by several washes at
42.degree. C. in 5.times.SSC, and then in 2.times.SSC. Twelve
positive clones were identified in the cDNA library, and the
positive clones were rescreened by hybridization to a second 60 bp
oligonucleotide probe (not overlapping the first probe) having the
following sequence: TABLE-US-00005 (SEQ ID NO:8)
GGTGAACTGGTCATCCATGAAAAAGGGTTTTACTACATCTATTCCCAAAC ATACTTTCGA
Hybridization was conducted as described above.
[0221] Four resulting positive clones were identified and amplified
by polymerase chain reaction (PCR) using a primer based on the
flanking 5' vector sequence and adding an external ClaI restriction
site and a primer based on the 3' flanking vector sequence and
adding an external HindIII restriction site. PCR products were gel
purified and subcloned into pGEM-T (commercially available from
Promega) by T-A ligation. Three independent clones from different
PCRs were then subjected to dideoxy DNA sequencing. DNA sequence
analysis of these clones demonstrated that they were essentially
identical, with some length variation at their 5' region.
[0222] The nucleotide sequence of the coding region of Apo-2 ligand
is shown in FIG. 4. Sequencing of the downstream 3' end region of
one of the clones revealed a characteristic polyadenylation site
(data not shown). The cDNA contained one long open reading frame
with an initiation site assigned to the ATG codon at nucleotide
positions 91-93. The surrounding sequence at this site is in
reasonable agreement with the proposed consensus sequence for
initiation sites [Kozak, supra]. The open reading frame ends at the
termination codon TAA at nucleotide positions 934-936.
[0223] The predicted mature amino acid sequence of human Apo-2
ligand contains 281 amino acids, and has a calculated molecular
weight of approximately 32.5 kDa and an isoelectric point of
approximately 7.63. There is no apparent signal sequence at the
N-terminus, although hydropathy analysis (data not shown) indicated
the presence of a hydrophobic region between residues 15 and 40.
The absence of a signal sequence and the presence of an internal
hydrophobic region suggests that Apo-2 ligand is a type II
transmembrane protein. The putative cytoplasmic, transmembrane and
extracellular regions are 14, 26 and 241 amino acids long,
respectively. The putative transmembrane region is underlined in
FIG. 4. A potential N-linked glycosylation site is located at
residue 109 in the putative extracellular domain.
[0224] An alignment (using the Align.TM. computer program) of the
amino acid sequence of the C-terminal region of Apo-2 ligand with
other known members of the TNF cytokine family showed that, within
the C-terminal region, Apo-2 ligand exhibits 23.2% identity to
Apo-1 ligand. The alignment analysis showed a lesser degree of
identity with other TNF family members: CD40L (20.8%), LT-.alpha.
(20.2%), LT-.beta. (19.6%), TNF-.alpha. (19.0%), CD30L and CD27L
(15.5%), OX-40L (14.3%), and 4-1BBL (13.7%). In the TNF cytokine
family, residues within regions which are predicted to form .beta.
strands, based on the crystal structures of TNF-.alpha. and
LT-.alpha. [Eck et al., J. Bio. Chem., 264:17595-17605 (1989); Eck
et al., J. Bio. Chem., 267:2119-2122 (1992)], tend to be more
highly conserved with other TNF family members than are residues in
the predicted connecting loops. It was found that Apo-2 ligand
exhibits greater homology to other TNF family members in its
putative .beta. strand regions, as compared to homology in the
predicted connecting loops. Also, the loop connecting putative
.beta. strands, B and B', is markedly longer in Apo-2 ligand.
Example 5
Expression of Human Apo-2 Ligand (ECD)
[0225] A soluble Apo-2 ligand extracellular domain ("ECD") fusion
construct was prepared, in which another sequence was fused
upstream of the C-terminal region of Apo-2 ligand.
[0226] A Met Gly His.sub.10 sequence (derived from the plasmid
pET19B, Novagen), followed by a 12 amino acid enterokinase cleavage
site Met Gly His His His His His His His His His His Ser Ser Gly
His Ile Asp Asp Asp Asp Lys His Met (SEQ ID NO:9)
[0227] was fused upstream to codons 114-281 of Apo-2 ligand within
a baculovirus expression plasmid (pVL1392, Pharmingen). Briefly,
the Apo-2 ligand codon 114-281 region was amplified by PCR from the
parent pRK5 Apo-2 ligand plasmid with primers complementary to the
5' and 3' regions which incorporate flanking NdeI and BamHI
restriction sites respectively. The product was subcloned into
pGEM-T (Promega) by T-A ligation, and the DNA sequence was
confirmed. The insert was then excised by digestion with NdeI and
BamHI and subcloned into a modified baculovirus expression vector
pVL1392 (commercially available from Pharmingen) containing an
amino terminal Met Gly His.sub.10 tag and enterokinase cleavage
site.
[0228] Recombinant baculovirus was generated by co-transfecting the
His.sub.10-Apo-2 ECD plasmid and BaculoGold.TM. virus DNA
(Pharmingen) into Spodoptera frugiperda ("Sf9") cells (ATCC CRL
1711) using lipofectin (commercially available from GIBCO-BRL).
After 4-5 days of incubation at 28.degree. C., the released viruses
were harvested and used for further amplifications. Viral infection
and protein expression was performed as described by O'Reilley et
al., Baculovirus expression vectors: A laboratory Manual,
Oxford:Oxford University Press (1994). The protein was purified by
Ni.sup.2+-chelate affinity chromatography, as described in Example
6 below.
Example 6
Purification of Recombinant Human Apo-2 Ligand (ECD)
[0229] Extracts were prepared from recombinant virus-infected and
mock-infected Sf9 cells (see Example 5) as described by Rupert et
al., Nature, 362:175-179 (1993). Briefly, Sf9 cells were washed,
resuspended in sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM
MgCl.sub.2; 0.1 MM EDTA; 10% Glycerol; 0.1% NP-40; 0.4 M KCl), and
sonicated twice for 20 seconds on ice. The sonicates were cleared
by centrifugation, and the supernatant was diluted 50-fold in
loading buffer (50 mM phosphate, 300 mM NaCl, 10% Glycerol, pH 7.8)
and filtered through a 0.45 .mu.m filter. A Ni.sup.2+-NTA agarose
column (commercially available from Qiagen) was prepared with a bed
volume of 5 mL, washed with 25 mL of water and equilibrated with 25
mL of loading buffer. The filtered cell extract was loaded onto the
column at 0.5 mL per minute. The column was washed to baseline
A.sub.280 with loading buffer, at which point fraction collection
was started. Next, the column was washed with a secondary wash
buffer (50 mM phosphate; 300 mM NaCl, 10% Glycerol, pH 6.0), which
eluted nonspecifically bound protein. After reaching A.sub.280
baseline again, the column was developed with a 0 to 500 mM
Imidazole gradient in the secondary wash buffer. One mL fractions
were collected and analyzed by SDS-PAGE and silver staining or
western blot with Ni.sup.2+-NTA-conjugated to alkaline phosphatase
(Qiagen). Fractions containing the eluted His.sub.10-Apo-2 ligand
protein were pooled and dialyzed against loading buffer.
[0230] An identical procedure was repeated with mock-infected Sf9
cells as the starting material, and the same fractions were pooled,
dialyzed, and used as control for the purified human Apo-2
ligand.
[0231] SDS-PAGE analysis of the purified protein revealed a
predominant band of Mr 24 kDa, corresponding with the calculated
molecular weight of 22.4 kDa for the His.sub.10-Apo-2 ligand
monomer (FIG. 5, lane 3); protein sequence microanalysis (data not
shown) confirmed that the 24 kDa band represents the
His.sub.10-Apo-2 ligand polypeptide. Minor 48 kDa and 66 kDa bands
were also observed, and probably represent soluble Apo-2 ligand
homodimers and homotrimers. Chemical crosslinking of the purified
His.sub.10-Apo-2 ligand by incubation with sulfo-NHS (5 mM) (Pierce
Chemical) and EDC (Pierce Chemical) at 25 mM and 50 mM (FIG. 5,
lanes 1 and 2, respectively), shifted the protein into the 66 kDa
band primarily. These results suggest that the predominant form of
Apo-2 ligand in solution is homotrimeric and that these trimers
dissociate into dimers and monomers in the presence of SDS.
Example 7
Apoptotic Activity of Apo-2 Ligand on Human Lymphoid Cell Lines
[0232] Apoptotic activity of purified, soluble Apo-2 ligand
(described in Example 6) was examined using several human lymphoid
cell lines. In a first study, the effect of Apo-2 ligand on 9D
cells (Genentech, Inc.), derived from Epstein-Barr virus
(EBV)-transformed human peripheral blood B cells, was examined. The
9D cells (5.times.10.sup.4 cells/well in RPMI 1640 medium plus 10%
fetal calf serum) were incubated for 24 hours with either a media
control, Apo-2 ligand (3 .mu.g/ml, prepared as described in Example
6 above), or anti-Apo-1 monoclonal antibody, CH11 (1 .mu.g/ml)
[described by Yonehara et al., supra; commercially available from
Medical and Biological Laboratories Co.]. The CH11 anti-Apo-1
antibody is an agonistic antibody which mimicks Fas/Apo-1 ligand
activity.
[0233] After the incubation, the cells were collected onto cytospin
glass slides, and photographed under an inverted light microscope.
Both Apo-2 ligand and the anti-Apo-1 monoclonal antibody induced a
similar apoptotic effect, characterized by cytoplasmic condensation
and reduction in cell numbers. (see FIG. 6A).
[0234] The effects of the Apo-2 ligand on the 9D cells, as well as
on Raji cells (human Burkitt's lymphoma B cell line, ATCC CCL 86)
and Jurkat cells (human acute T cell leukemia cell line, ATCC TIB
152) were further analyzed by FACS. The FACS analysis was
conducted, using established criteria for apoptotic cell death,
namely, the relation of fluorescence staining of the cells with two
markers: (a) propidium iodide ("PI") dye, which stains apoptotic
but not live cells, and (b) a fluorescent derivative of the
protein, annexin V, which binds to the exposed phosphatidylserine
found on the surface of apoptotic cells, but not on live cells
[Darzynkiewicz et al., Methods in Cell Biol., 41:15-38 (1994);
Fadok et al., J. Immunol., 148:2207-2214 (1992); Koopman et al.,
Blood, 84:1415-1420 (1994)].
[0235] The 9D cells (FIG. 6B), Raji cells (FIG. 6C), and Jurkat
cells (FIG. 6D) were incubated (1.times.10.sup.6 cells/well) for 24
hours with a media control (left panels), Apo-2 ligand (3 .mu.g/ml,
prepared as described in Example 6) (center panels), or anti-Apo-1
ligand antibody, CH11 (1 .mu.g/ml) (right panels). The cells were
then washed, stained with PI and with fluorescein thiocyanate
(FITC)-conjugated annexin V (purchased from Brand Applications) and
analyzed by flow cytometry. Cells negative for both PI and annexin
V staining (quadrant 3) represent live cells; PI-negative, annexin
V-positive staining cells (quadrant 4) represent early apoptotic
cells; PI-positive, annexin V-positive staining cells (quadrant 2)
represent primarily cells in late stages of apoptosis.
[0236] The Apo-2 ligand treated 9D cells exhibited elevated
extracellular annexin V binding, as well as a marked increase in
uptake of PI (FIG. 6B), indicating that Apo-2 ligand induced
apoptosis in the cells. Comparable results were obtained with
anti-Apo-1 antibody, CH11 (FIG. 6B). The Apo-2 ligand induced a
similar response in the Raji and Jurkat cells, as did the
anti-Apo-1 antibody. (see FIGS. 6C and 6D). The induction of
apoptosis (measured as the % apoptotic cells) in these cell lines
by Apo-2 ligand, as compared to the control and to the anti-Apo-1
antibody, is also shown in Table 1 below. TABLE-US-00006 TABLE 1 %
apoptotic cells Cell line Control Apo-2L Anti-Apo-1 Ab Lymphoid 9D
22.5 92.4 90.8 Raji 35.9 73.4 83.7 Jurkat 5.9 77.0 18.1
[0237] The activation of internucleosomal DNA fragmentation by
Apo-2 ligand was also analyzed. Jurkat cells (left lanes) and 9D
cells (right lanes) were incubated (2.times.10.sup.6 cells/well)
for 6 hours with a media control or Apo-2 ligand (3 .mu.g/ml,
prepared as described in Example 6), The DNA was then extracted
from the cells and labeled with .sup.32P-ddATP using terminal
transferase. The labeled DNA samples were subjected to
electrophoresis on 2% agarose gels and later analyzed by
autoradiography [Moore et al., Cytotechnology, 17:1-11 (1995)]. The
Apo-2 ligand induced internucleosomal DNA fragmentation in both the
Jurkat cells and 9D cells (FIG. 6E). Such DNA fragmentation is
characteristic of apoptosis [Cohen, Advances in Immunol., 50:55-85
(1991)].
[0238] To examine the time-course of the Apo-2 ligand apoptotic
activity, 9D cells were incubated in microtiter dishes
(5.times.10.sup.4 cells/well) with a media control or Apo-2 ligand
(3 .mu.g/ml, prepared as described in Example 6) for a period of
time ranging from 0 hours to 50 hours. Following the incubation,
the numbers of dead and live cells were determined by microscopic
examination using a hemocytometer.
[0239] As shown in FIG. 7A, maximal levels of cell death were
induced in 9D cells within 24 hours.
[0240] To determine dose-dependency of Apo-2 ligand-induced cell
death, 9D cells were incubated (5.times.10.sup.4 cells/well) for 24
hours with serial dilutions of a media control or Apo-2 ligand
(prepared as described in Example 6). The numbers of dead and live
cells following the incubation were determined as described above.
The results are illustrated in FIG. 7B. Specific apoptosis was
determined by subtracting the % apoptosis in the control from %
apoptosis in Apo-2 ligand treated cells. Half-maximal activation of
apoptosis occurred at approximately 0.1 .mu.g/ml (approximately 1
nM), and maximal induction occurred at about 1 to about 3 .mu.g/ml
(approximately 10 to 30 nM).
Example 8
Inhibition Assay Using Fas/Apo-1 and TNF Receptors
[0241] An assay was conducted to determine if the Fas/Apo-1
receptor, as well as the type 1 and type 2 TNF receptors (TNFR1 and
TNFR2), are involved in mediating the apoptotic activity of Apo-2
ligand by testing if soluble forms of these receptors are capable
of inhibiting the apoptotic activity of purified, soluble Apo-2
ligand (described in Example 6).
[0242] 9D cells were incubated (5.times.10.sup.4 cells/well) for 24
hours with a media control or Apo-2 ligand (0.3 .mu.g/ml, prepared
as described in Example 6) in the presence of buffer control,
CD4-IgG control (25 .mu.g/ml), soluble Apo-1-IgG (25 .mu.g/ml),
soluble TNFR1-IgG (25 .mu.g/ml) or soluble TNFR2-IgG fusion protein
(25 .mu.g/ml). Soluble derivatives of the Fas/Apo-1, TNFR1 and
TNFR2 receptors were produced as IgG fusion proteins as described
in Ashkenazi et al., Methods, 8:104-115 (1995). CD4-IgG was
produced as an IgG fusion protein as described in Byrn et al.,
Nature, 344:667-670 (1990) and used as a control.
[0243] As shown in FIG. 7C, none of the receptor-fusion molecules
inhibited Apo-2 ligand apoptotic activity on the 9D cells. These
results indicate that Apo-2 ligand apoptotic activity is
independent of Fas/Apo-1 and of TNFR1 and TNFR2.
Example 9
Isolation of cDNA Clones Encoding Human Apo-3
[0244] Human fetal heart and human fetal lung lgt10 bacteriophage
cDNA libraries (both purchased from Clontech) were screened by
hybridization with synthetic oligonucleotide probes based on an EST
(Genbank locus W71984), which showed some degree of homology to the
intracellular domain (ICD) of human TNFR1 and CD95. W71984 is a 523
bp EST, which in its -1 reading frame has 27 identities to a 43
amino acid long sequence in the ICD of human TNFR1. The
oligonucleotide probes used in the screening were 27 and 25 bp
long, respectively, with the following sequences:
GGCGCTCTGGTGGCCCTTGCAGAAGCC [SEQ ID NO:12] and
TTCGGCCGAGAAGTTGAGAAATGTC [SEQ ID NO:13].
[0245] Hybridization was done with a 1:1 mixture of the two probes
overnight at room temperature in buffer containing 20% formamide,
5.times.SSC, 10% dextran sulfate, 0.1% NaPiPO.sub.4. 0.05 M
NaPO.sub.41 0.05 mg salmon sperm DNA, and 0.1% sodium dodecyl
sulfate (SDS), followed consecutively by one wash at room
temperature in 6.times.SSC, two washes at 37.degree. C. in
1.times.SSC/0.1% SDS, two washes at 37.degree. C. in
0.5.times.SSC/0.1% SDS, and two washes at 37.degree. C. in
0.2.times.SSC/0.1% SDS. One positive clone from each of the fetal
heart (FH20A.57) and fetal lung (FL8A.53) libraries were confirmed
to be specific by PCR using the respective above hybridization
probes as primers. Single phage plaques containing each of the
positive clones were isolated by limiting dilution and the DNA was
purified using a Wizard lambda prep DNA purification kit
(Promega).
[0246] The cDNA inserts were excised from the lambda vector arms by
digestion with EcoRI, gel-purified, and subcloned into pRK5 that
was predigested with EcoRI. The clones were then sequenced in
entirety.
[0247] Clone FH20A.57 (also referred to as Apo 3 clone FH20.57
deposited as ATCC 55820, as indicated below) contains a single open
reading frame with an apparent translational initiation site at
nucleotide positions 89-91 and ending at the stop codon found at
nucleotide positions 1340-1342 (FIG. 8; SEQ ID NO:11) [Kozak et
al., supra]. The cDNA clone also contains a polyadenylation
sequence at its 3' end. The predicted polypeptide precursor is 417
amino acids long and has a calculated molecular weight of
approximately 45 kDa and a PI of about 6.4. Hydropathy analysis
(not shown) suggested the presence of a signal sequence (residues
1-24), followed by an extracellular domain (residues 25-198), a
transmembrane domain (residues 199-224), and an intracellular
domain (residues 225-417) (FIG. 8; SEQ ID NO:10). There are two
potential N-linked glycosylation sites at amino acid positions 67
and 106.
[0248] The ECD contains 4 cysteine-rich repeats which resemble the
corresponding regions of human TNFR1 (4 repeats), of human CD95 (3
repeats) (FIG. 9) and of the other known TNFR family members (not
shown). The ICD contains a death domain sequence that resembles the
death domains found in the ICD of TNFR1 and CD95 and in cytoplasmic
death signalling proteins such as human FADD/MORT1, TRADD, RIP, and
Drosophila Reaper (FIG. 10). Both globally and in individual
regions, Apo-3 is related more closely to TNFR1 than to CD95; the
respective amino acid identities are 29.3% and 22.8% overall, 28.2%
and 24.7% in the ECD, 31.6% and 18.3% in the ICD, and 47.5% and 20%
in the death domain.
[0249] The fetal lung cDNA clone, clone 5L8A.53, was identical to
the fetal heart clone, with the following two exceptions: (1) it is
172 bp shorter at the 5' region; and (2) it lacks the Ala residue
at position 236, possibly due to differential mRNA splicing via two
consecutive splice acceptor consensus sites (FIG. 10).
[0250] As mentioned in Example 1 above, amino acids 1 to 181 of the
Apo-2LI clone 18.1 shown in FIG. 1 (SEQ ID NO:1) are identical to
the amino acids 1 to 181 of the Apo-3 polypeptide, shown in FIG. 8
(SEQ ID NO:10).
Example 10
Expression of Apo-3
[0251] A pRK5 mammalian expression plasmid (described in Example 2)
carrying clone FH20A.57 (referred to in Example 9) was transfected
transiently into HEK293 cells (referred to in the Examples above)
by calcium phosphate precipitation and into HeLa-S3 cells (ATCC No.
CCL 2.2) by standard electroporation techniques.
[0252] Lysates of metabolically labeled transfected 293 cells were
analyzed by immunoprecipitation with a mouse antiserum raised
against an Apo-2LI-IgG fusion protein. Transfected cells
(5.times.10.sup.5 per lane) were labeled metabolically by addition
of 50 .mu.Ci .sup.35S-Met and .sup.35S-Cys to the growth media 24
hours after transfection. After a 6 hour incubation, the cells were
washed several times with PBS, lysed and subjected to
immunoprecipitation by anti-Apo-3 antiserum as described in
Marsters et al., Proc. Natl. Acad. Sci., 92:5401-5405 (1995). The
anti-Apo-3 antiserum was raised in mice against a fusion protein
containing the Apo-2LI ECD (as described in Example 3).
[0253] A predominant radioactive band with a relative molecular
weight of about 47 kDa was observed in the pRK5-Apo-3-transfected
cells, but not in the cells transfected with pRK5 alone (control)
(See FIG. 11, lanes 1, 2). Given the potential glycosylation sites
of Apo-3, the observed size is consistent with the size of
approximately 45 kDa predicted for the Apo-3 polypeptide
precursor.
Example 11
Apoptotic Activity of Apo-3
[0254] The transiently transfected HEK293 and HeLa cells described
in Example 10 were tested and analyzed for apoptotic activity 36
hours after transfection. Apoptosis was assessed morphologically or
quantitated by FACS analysis of cells stained with
fluoresceinisothiocyanate (FITC)-conjugated annexin V (Brand
Applications) and propidium iodide (PI), as described in Example 7.
The annexin V-positive/PI negative cells are in early stages of
apoptosis and double-positive cells are in late apoptosis, while
annexin V-negative/PI-positive cells are necrotic. Apoptosis was
also assessed by DNA fragmentation testing.
[0255] Microscopic examination of the HEK 293 cells transfected
with the pRK5-Apo-3 expression plasmid (see Example 10) showed a
substantial loss of cell viability as compared to control cells
transfected with pRK5 alone; many of the Apo-3 transfected cells
exhibited a characteristic apoptotic morphology of membrane
blebbing and loss of cell volume (FIGS. 12 a and b), suggesting
cell death by apoptosis [Cohen, Advances in Immunology, 50:55-85
(1990)].
[0256] The FACS analysis also revealed that the Apo-3-transfected
cells died by apoptosis, by virtue of the presence of exposed
phosphatidylserine on their surface (FIGS. 12 e-i). It was found
that the transient transfection efficiency of the HEK 293 cells was
60-70%; therefore, to target FACS analysis to cells that had taken
up the plasmid DNA, the 293 cells were co-transfected with a
pRK5-CD4 expression vector (3 .mu.g) as a marker and gated on
CD4-positive cells (using phycoerythrin-conjugated anti-CD4
antibody) for analysis. For the co-transfection, the total amount
of plasmid DNA was kept constant, but divided between different
plasmids. The Apo-3-transfected cells showed a marked increase in
PI and annexin V-FITC staining as compared to pRK5-transfected
control cells indicating induction of apoptosis by Apo-3. (FIGS. 12
e and f).
[0257] The effect of the dose of plasmid on apoptosis was also
tested in the FACS assay. (FIG. 12i). Transfection of 293 cells
with either Apo-3 or TNFR1 expression plasmids was associated with
a dose-dependent increase in apoptosis; the effect of Apo-3 was
more pronounced than that of TNFR1 (FIG. 12i). Similar results were
obtained upon Apo-3 transfection of the HeLa cells (data not
shown).
[0258] Apoptosis was also assayed by extraction of DNA from the
cells, terminal transferase-mediated .sup.32P-labelling of 3' ends
of DNA and 1.5% agarose gel electrophoresis as described by Moore
et al., Cytotechnology, 17:1-11 (1995). Analysis of the cellular
DNA revealed that the Apo-3-transfected cells showed a marked
increase in DNA fragmentation as compared to controls (FIG. 12j,
lanes 1, 2). The fragmented DNA migrated on agarose gels as a
ladder of bands, indicating internucleosomal DNA cleavage, an
indication of programmed cell death [Cohen, supra].
Example 12
Inhibition Assay Using CrmA
[0259] To investigate whether proteases such as ICE and CPP32/Yama
play a role in apoptosis-induction by Apo-3, an assay was conducted
to determine if CrmA inhibits Apo-3 function.
[0260] Co-transfection of HEK293 cells by a pRK5-CrmA expression
plasmid (CrmA sequence reported in Ray et al., supra) and
pRK5-Apo-3 did not affect the apparent levels of Apo-3 expressed by
the cells (FIG. 11, lane 3). CrmA, however, blocked Apo-3
associated apoptosis as analyzed by morphological examination
(FIGS. 12 c and d), FACS (FIGS. 12 g and h) and DNA fragmentation
(FIG. 12j, lanes 3,4) methods described in Example 11. A similar
inhibitory effect of CrmA was observed in Apo-3-transfected HeLa
cells (data not shown).
[0261] CrmA, a poxvirus-derived inhibitor of the death proteases
ICE and CPP32/Yama, blocks death signalling by TNFR1 and CD95.
Accordingly, the assay results suggest that Apo-3, TNFR1 and CD95
engage a common signalling pathway to activate apoptotic cell
death. In particular, the results suggest that proteases such as
ICE and CPP32/Yama may be required for Apo-3 induced apoptosis.
Example 13
Activation of NF-.kappa.B by Apo-3
[0262] An assay was conducted to determine whether Apo-3 activates
NF-.kappa.B.
[0263] HEK 293 cells were harvested 36 hours after transfection
(see Example 10) and nuclear extracts were prepared and 1 .mu.g of
nuclear protein was reacted with a .sup.32P-labelled
NF-.kappa.B-specific synthetic oligonucleotide probe
ATCAGGGACTTTCCGCTGGGGACTTTCCG (SEQ ID NO:14) [see, also, MacKay et
al., J. Immunol., 153:5274-5284 (1994)], alone or together with a
50-fold excess of unlabelled probe, or with an irrelevant
.sup.32P-labelled synthetic oligonucleotide
AGGATGGGAAGTGTGTGATATATCCTTGAT (SEQ ID NO:15). DNA binding was
analyzed by an electrophoretic mobility shift assay as described by
Hsu et al., supra; Marsters et al., supra, and MacKay et al.,
supra.
[0264] The results are shown in FIG. 13. The radioactive band at
the bottom of the gel in all lanes is the free labelled probe, the
two other radioactive bands seen in lanes 1-3 represent
non-specific interaction, as does the band common to lanes 1-3 and
lanes 4-6. The top radioactive band in lanes 4-6 represents the
labelled NF-.kappa.B probe, whose migration is delayed by specific
interaction with activated NF-.kappa.B protein in the nuclear
extracts.
[0265] Apo-3 transfected cells showed a significant increase in
NF-.kappa.B-specific DNA binding activity relative to
pRK5-transfected controls. TNFR1-transfected cells showed
NF-.kappa.B activation as well; this activation appeared to be
enhanced as compared to the Apo-3-transfected cells. The data thus
shows that Apo-3 is capable of regulating transcription of
inflammatory response genes and in particular, may be linked to a
NF-.kappa.B activation pathway.
Example 14
Northern Blot Analysis
[0266] Expression of Apo-3 mRNA in human tissues was examined by
Northern blot analysis. Human RNA blots were hybridized to a 206 bp
.sup.32P_labelled DNA probe based on the 3' untranslated region of
Apo-3; the probe was generated by PCR with the 27 and 25 bp probes
(described in Example 9) as PCR primers. Human fetal RNA blot MTN
(Clontech) and human adult RNA blot MTN-II (Clontech) were
incubated with the DNA probes. Blots were incubated with the probes
in hybridization buffer (5.times.SSPE; 2.times. Denhardt's
solution; 100 mg/mL denatured sheared salmon sperm DNA; 50%
formamide; 2% SDS) for 60 hours at 42.degree. C. The blots were
washed several times in 2.times.SSC; 0.05% SDS for 1 hour at room
temperature, followed by a 30 minute wash in 0.1.times.SSC; 0.1%
SDS at 50.degree. C. The blots were developed after overnight
exposure.
[0267] As shown in FIG. 14, a predominant mRNA transcript of
approximately 4 kb was detected in adult spleen, thymus, and
peripheral blood lymphocytes, and less abundantly in small
intestine, colon, fetal lung, and fetal kidney. Additional
transcripts of approximately 7 and 9 kb were seen mainly in fetal
brain, lung and kidney, and in adult spleen and ovary. These
results suggest that Apo-3 mRNA is expressed in several types of
tissues, including both lymphoid and non-lymphoid tissues.
Example 15
Chromosomal Localization of the Apo-3 Gene
[0268] Chromosomal localization of the Apo-3 gene was examined by
fluorescence in situ hybridization ("FISH") to normal human
lymphocyte chromosomes.
[0269] Initial testing by direct hybridization with the Apo-2LI
(clone 18.1) cDNA (see Example 1 and FIG. 1) as a probe gave a
relatively poor signal to background ratio (data not shown) but
suggested that the gene is located on chromosome 1p36. Further
testing was conducted using the Apo-3 cDNA probe and FISH mapping
[as described by Lichter et al., Science, 247:64-69 (1990)] of a
human genomic p1-derived artificial chromosome (PAC) library
(obtained from Dr. L. C. Tsui, University of Toronto, Toronto,
Canada). The Apo-3 probes were biotinylated and detected with
avidin-FITC. The normal human lymphocyte chromosomes were
counterstained with PI and DAPI [Heng and Tsui, Chromosome,
102:325-332 (1993)]. In addition to the "direct" FISH using the
Apo-3 cDNA as a probe, the probe was used to identify clones in the
genomic PAC library that contain the Apo-3 gene, and the PACs were
used as confirmatory probes in FISH. The regional assignment of the
genomic probe was determined by the analysis of 20 well-spread
metaphases.
[0270] A positive PAC clone was mapped by FISH to the short arm of
chromosome 1, at position 1p36.3. A second Apo-3-positive genomic
PAC was mapped to the same position (data not shown). Positive
hybridization signals at 1p36.3 were noted at >95% of the cells.
Signals were seen in both chromosome 1 homologues in >90% of the
positive spreads.
[0271] Recent reports disclose that a genomic region which is
deleted in certain human neuroblastomas maps within 1p36.2-1p36.3,
indicating that a tumor suppressor gene may be present at this
locus. Four additional TNFR gene family members, TNFR2, CD30, 4.1BB
and OX40, reside in 1p36 [see Gruss and Dower, supra] but are
outside the deleted region [White et al., Proc. Natl. Acad. Sci.,
92:5520-5524 (1995)].
Deposit of Material
[0272] The following materials have been deposited with the
American Type Culture Collection, 12301 Parklawn Drive, Rockville,
Md., USA (ATCC): TABLE-US-00007 Material ATCC Dep. No. Deposit Date
2935-pRK5-hApo-2L- CRL-12014 Jan. 3, 1996 myc clone 2.1 Apo-2LI
clone 18.1 97493 Mar. 27, 1996 Apo-3 clone FH20.57 55820 Sep. 5,
1996
[0273] This deposit was made under the provisions of the Budapest
Treaty on the International Recognition of the Deposit of
Microorganisms for the Purpose of Patent Procedure and the
Regulations thereunder (Budapest Treaty). This assures maintenance
of a viable culture of the deposit for 30 years from the date of
deposit. The deposit will be made available by ATCC under the terms
of the Budapest Treaty, and subject to an agreement between
Genentech, Inc. and ATCC, which assures permanent and unrestricted
availability of the progeny of the culture of the deposit to the
public upon issuance of the pertinent U.S. patent or upon laying
open to the public of any U.S. or foreign patent application,
whichever comes first, and assures availability of the progeny to
one determined by the U.S. Commissioner of Patents and Trademarks
to be entitled thereto according to 35 USC .sctn.122 and the
Commissioner's rules pursuant thereto (including 37 CFR .sctn.1.14
with particular reference to 886 OG 638).
[0274] The assignee of the present application has agreed that if a
culture of the materials on deposit should die or be lost or
destroyed when cultivated under suitable conditions, the materials
will be promptly replaced on notification with another of the same.
Availability of the deposited material is not to be construed as a
license to practice the invention in contravention of the rights
granted under the authority of any government in accordance with
its patent laws.
[0275] The foregoing written specification is considered to be
sufficient to enable one skilled in the art to practice the
invention. The present invention is not to be limited in scope by
the construct deposited, since the deposited embodiment is intended
as a single illustration of certain aspects of the invention and
any constructs that are functionally equivalent are within the
scope of this invention. The deposit of material herein does not
constitute an admission that the written description herein
contained is inadequate to enable the practice of any aspect of the
invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the claims to the specific
illustrations that it represents. Indeed, various modifications of
the invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description and fall within the scope of the appended claims.
Sequence CWU 1
1
* * * * *