U.S. patent application number 10/968629 was filed with the patent office on 2006-02-23 for tagged epitope protein transposable element.
This patent application is currently assigned to Oregon Health & Science University. Invention is credited to Dolph D. Ellefson, Fred L. Heffron, David C. Parker.
Application Number | 20060040382 10/968629 |
Document ID | / |
Family ID | 34067647 |
Filed Date | 2006-02-23 |
United States Patent
Application |
20060040382 |
Kind Code |
A1 |
Heffron; Fred L. ; et
al. |
February 23, 2006 |
Tagged epitope protein transposable element
Abstract
A transposable element is provided that has a 3' and a 5' end.
The transposable element includes a 5' recombining site 5' of a
nucleic acid sequence encoding a selectable marker, a 3'
recombining site 3' of the nucleic acid sequence encoding a
selectable marker, a nucleic acid sequence encoding an MHC epitope
5' to the 5' recombining site or 3' to the 3' recombining site, and
an insertion end comprising an inverted repeat sequence sufficient
for integration of the transposable element at the 5' and the 3'
end of the transposable element. In one embodiment, a transposable
element is provided that has a 5' and a 3' end. The transposable
element includes a 5' loxP sequence 5' of a nucleic acid encoding a
selectable marker, a 3' loxP sequence 3' of a nucleic acid encoding
the selectable marker, an MHC epitope 5' to the 5' loxP sequences
or 3' of the 3' loxP sequence, an insertion end at the 5' end of
the transposable element, and an insertion end at the 3' of the
transposable element. A method is provided for detecting an
antigenic epitope of a pathogen by infecting a pathogenic cell with
a transposable element of the invention, wherein the infection
results in the integration of the transposable element in a nucleic
acid sequence of the bacterial cell; transforming the pathogenic
cell with a vector comprising a transposase; contacting a
eukaryotic cell that can internalize the pathogenic cell with the
pathogenic cell infected with the transposable element; contacting
the eukaryotic cell with a specific binding partner that recognizes
the MHC epitope; identifying the labeled eukaryotic cells and
externalizing the bacteria cell. The externalized bacterial cell
may be grown to produce a population of bacterial cells, and the
nucleic acid sequence of the bacterial cell that has the integrated
transposable element is identified. This nucleic acid sequence
encodes the antigenic element of the pathogen. A method is also
provided for generating a carrier vaccine by infecting a bacterial
cell with the transposable element of the invention, wherein the
transposable further comprises an antigen associated with a disease
operably linked to the MHC epitope of the transposable element. The
infection of the bacteria results in the integration of the
transposable element in a nucleic acid sequence of the bacterial
cell. The pathogenic cell is then internalized into a eukaryotic
cell and the eukaryotic cell is exposed to a specific binding agent
that recognizes the MHC epitope, identifying labeled eukaryotic
cells are identified and lysed to externalize the bacteria cell,
which is cultured to produce a population of bacterial cells. The
nucleic acid sequence of the bacterial cell that has the integrated
transposable element is identified, wherein the nucleic acid
sequence encodes the antigenic element of the pathogen, The growing
bacterial cell identified, and may be used as the carrier
vaccine.
Inventors: |
Heffron; Fred L.; (West
Linn, OR) ; Parker; David C.; (Portland, OR) ;
Ellefson; Dolph D.; (Portland, OR) |
Correspondence
Address: |
KLARQUIST SPARKMAN, LLP
121 SW SALMON STREET
SUITE 1600
PORTLAND
OR
97204
US
|
Assignee: |
Oregon Health & Science
University
|
Family ID: |
34067647 |
Appl. No.: |
10/968629 |
Filed: |
October 18, 2004 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09979338 |
Nov 21, 2001 |
6846622 |
|
|
PCT/US00/14687 |
May 26, 2000 |
|
|
|
10968629 |
Oct 18, 2004 |
|
|
|
60136210 |
May 26, 1999 |
|
|
|
Current U.S.
Class: |
435/320.1 ;
435/252.3; 435/473 |
Current CPC
Class: |
C12N 15/63 20130101;
A61K 39/02 20130101; Y02A 50/30 20180101; C12Q 1/689 20130101; C07K
14/70539 20130101; C12N 2800/30 20130101; C12N 2740/16034 20130101;
A61K 39/12 20130101; C12N 15/1065 20130101; A61K 39/0011 20130101;
C12N 2800/90 20130101; A61K 39/21 20130101; C12N 15/1051
20130101 |
Class at
Publication: |
435/320.1 ;
435/252.3; 435/473 |
International
Class: |
C12N 15/74 20060101
C12N015/74 |
Claims
1-36. (canceled)
37. A method for identifying a protein secreted by an intracellular
pathogen having access to an MHC class II pathway of a eukaryotic
cell infected with the intracellular pathogen, comprising: (i)
transfecting an intracellular pathogen with a transposable element,
wherein the transposable element has a 3' and a 5' end and
comprises a 5' recombining site 5' of a nucleic acid sequence
encoding a selectable marker, a 3' recombining site 3' of the
nucleic acid sequence encoding a selectable marker, a nucleic acid
sequence encoding an MHC class II epitope 5' to the 5' recombining
site or 3' to the 3' recombining site, and an insertion end
comprising an inverted repeat sequence sufficient for integration
of the transposable element at the 5' and the 3' end of the
transposable element, and wherein the transfection results in the
integration of the transposable element in a nucleic acid sequence
of the intracellular pathogen; (ii) transforming the intracellular
pathogen with a vector comprising a transposase; (iii) contacting a
eukaryotic cell that can internalize the pathogenic cell with the
pathogen transfected with the transposable element, wherein an MHC
class II haplotype of the eukaryotic cell is matched to the MHC II
epitope; (iv) contacting the eukaryotic cell with a labeled
antibody that recognizes the MHC class II epitope, thereby
generating a labeled eukaryotic cell; (v) identifying the labeled
eukaryotic cell; (vi) lysing the labeled eukaryotic cell to
externalize the intracellular pathogen; (vii) growing the
externalized intracellular pathogen to produce a population of
intracellular pathogen; and (viii) identifying the nucleic acid
sequence of the intracellular pathogen that has the integrated
transposable element, wherein the nucleic acid sequence encodes the
secreted protein having access to an MHC class II pathway of a
eukaryotic cells infected with the intracellular pathogen.
38. The method of claim 37, wherein the eukaryotic cell is a cell
of the immune system.
39. The method of claim 38, wherein the cell of the immune system
is a macrophage.
40. The method of claim 37, wherein the identification of the
labeled eukaryotic cell is by fluorescence activated cell
sorting.
41. (canceled)
42. (canceled)
43. The method of claim 37, wherein the pathogen is a bacterial
cell.
44. The method of claim 37, wherein the pathogen is Salmonella,
Mycobacterium tuberculosis, Plasmodium, or Listeria
monocytogenes.
45. A method for identifying a protein secreted by an intracellular
pathogen and having access to an MHC class II pathway of a
eukaryotic cell infected with the intracellular pathogen,
comprising: (i) transfecting an intracellular pathogen expressing a
tranposase with a transposable element, wherein the transposable
element has a 3' and a 5' end and comprises a 5' recombining site
5' of a nucleic acid sequence encoding a selectable marker, a 3'
recombining site 3' of the nucleic acid sequence encoding a
selectable marker, a nucleic acid sequence encoding an MHC class II
epitope 5' to the 5' recombining site or 3' to the 3' recombining
site, and an insertion end comprising an inverted repeat sequence
sufficient for integration of the transposable element at the 5'
and the 3' end of the transposable element, and wherein the
transfection results in the integration of the transposable element
in a nucleic acid sequence of the intracellular pathogen; (ii)
contacting a eukaryotic cell that can internalize the intracellular
pathogen the pathogen transfected with the transposable element,
wherein an MHC class II haplotype of the eukaryotic cell is matched
to the MHC class II epitope; (iiii) contacting the eukaryotic cell
with a labeled antibody that recognizes the MHC class II epitope,
thereby generating a labeled eukaryotic cell; (iv) identifying the
labeled eukaryotic cell; (v) lysing the labeled eukaryotic cell to
externalize the intracellular pathogen; (vi) growing the
externalized pathogen to produce a population of intracellular
pathogen; and (vii) identifying the nucleic acid sequence of the
intracellular pathogen that has the integrated transposable
element, wherein the nucleic acid sequence encodes the secreted
protein having access to an MHC class II pathway of the
intracellular pathogen.
46. A method for identifying a secreted protein having access to an
MHC class II pathway of an intracellualr pathogen, comprising: (i)
transfecting an intracellular pathogen with a transposable element,
wherein the transposable element has a 3' and a 5' end and
comprises a 5' recombining site 5' of a nucleic acid sequence
encoding a selectable marker, a 3' recombining site 3' of the
nucleic acid sequence encoding a selectable marker, a nucleic acid
sequence encoding an MHC class II epitope 5' to the 5' recombining
site or 3' to the 3' recombining site, an insertion end comprising
an inverted repeat sequence sufficient for integration of the
transposable element at the 5' and the 3' end of the transposable
element, and a transposase, and wherein the transfection results in
the integration of the transposable element in a nucleic acid
sequence of the intracellular pathogen; (ii) contacting a
eukaryotic cell that can internalize the intracellular pathogen
with the pathogen transfected with the transposable element,
wherein an MHC class II haplotype of the eukaryotic cell is matched
to the MHC class II epitope; (iii) contacting the eukaryotic cell
with a labeled antibody that recognizes the MHC class II epitope,
thereby generating a labeled eukaryotic cell; (iv) identifying the
labeled eukaryotic cell; (v) lysing the labeled eukaryotic cell to
externalize the intracellular pathogen; (vi) growing the
externalized intracellular pathogen to produce a population of
intracellular pathogen; and (vii) identifying the nucleic acid
sequence of the intracellular pathogen that has the integrated
transposable element, wherein the nucleic acid sequence encodes the
secreted protein having access to an MHC class II pathway of the
intracellular pathogen.
47. (canceled)
48. (canceled)
49. (canceled)
50. (canceled)
51. (canceled)
52. (canceled)
53. (canceled)
54. (canceled)
55. The method of claim 37, wherein the 5' recombining site or the
3' recombining site is a loxP recombining site, a fit recombining
site, a TN3 recombining site, a mariner recombining site, or a
gamma/delta recombining site.
56. The method of claim 37, wherein the 5' recombining site or the
3' recombining site is a loxP recombining site.
57. The method of claim 56, wherein the loxP sequence comprises the
sequence shown in SEQ ID NO: 11.
58. The method of claim 37, wherein the MHC class II epitope is
ASFEAQGALANIAVDKA (SEQ ID NO: 20) and the MHC class II haplotype of
the eukaryotic cell is I-A.sup.b.
59. The method of claim 37, wherein the selectable marker is a
nucleic acid encoding antibiotic resistance.
60. The method of claim 59, wherein the antibiotic resistance is
ampicillin, kanamycin, zeomycin, hygromycin, tetracycline,
puromycin or bleomycin resistance.
61. The method of claim 37, wherein the selectable marker is
detected by spectrophotometric properties.
62. The method of claim 37, wherein the selectable marker is
beta-galactosidase or green fluorescent protein.
63. The method of claim 37, wherein the insertion end at the 5' end
of the transposable element is SEQ ID NO: 4 or SEQ ID NO: 5.
64. The method of claim 37, wherein the insertion end at the 3' end
of the transposable element is SEQ ID NO: 3 or SEQ ID NO: 4.
65. The method of claim 63, wherein the insertion end at the 5' end
of the transposable element comprises the sequence shown in SEQ ID
NO: 5.
66. The method of claim 64, wherein the insertion end at the 3' end
of the transposable element comprises the sequence shown in SEQ ID
NO: 3.
67. The method of claim 37, wherein the transposable element
further comprises a nucleic acid sequence encoding a
transposase.
68. The method of claim 67, wherein the transposase is a Cre
transposase.
69. The method of claim 37, wherein the transposable element
further comprises an affinity tag.
70. The method of claim 69, wherein the affinity tag is 6.times.
histidine, S-tag, glutathione-S-transferase, or streptavidin.
71. The method of claim 70, wherein the affinity tag is 6.times.
histidine.
72. The method of claim 69, wherein the nucleic acid sequence
encoding an affinity tag is 5' of the 5' recombining site.
73. The method of claim 69, wherein the nucleic acid sequence
encoding an affinity tag is 3' of the 3' recombining site.
74. The method of claim 45, wherein the 5' recombining site or the
3' recombining site is a loxP recombining site, a fit recombining
site, a TN3 recombining site, a mariner recombining site, or a
gamma/delta recombining site.
75. The method of claim 74, wherein the 5' recombining site or the
3' recombining site is a loxP recombining site.
76. The method of claim 75, wherein the loxP sequence comprises the
sequence shown in SEQ ID NO: 11.
77. The method of claim 45, wherein the MHC class II epitope is
ASFEAQGALANIAVDKA (SEQ ID NO: 20) and the MHC class II haplotype of
the eukaryotic cell is I-A.sup.b.
78. The method of claim 45, wherein the selectable marker is a
nucleic acid encoding antibiotic resistance.
79. The method of claim 45, wherein the selectable marker is
detected by spectrophotometric properties.
80. The method of claim 45, wherein the insertion end at the 5' end
of the transposable element is SEQ ID NO: 4 or SEQ ID NO: 5.
81. The method of claim 45, wherein the insertion end at the 3' end
of the transposable element is SEQ ID NO: 3 or SEQ ID NO: 4.
82. The method of claim 45, wherein the transposable element
further comprises an affinity tag.
83. The method of claim 82, wherein the affinity tag is 6.times.
histidine, S-tag, glutathione-S-transferase, or streptavidin.
84. The method of claim 82, wherein the nucleic acid sequence
encoding an affinity tag is 5' of the 5' recombining site.
85. The method of claim 82, wherein the nucleic acid sequence
encoding an affinity tag is 3' of the 3' recombining site.
86. The method of claim 46, wherein the 5' recombining site or the
3' recombining site is a loxP recombining site, a fit recombining
site, a TN3 recombining site, a mariner recombining site, or a
gamma/delta recombining site.
87. The method of claim 86, wherein the 5' recombining site or the
3' recombining site is a loxP recombining site.
88. The method of claim 87, wherein the loxP sequence comprises the
sequence shown in SEQ ID NO: 11.
89. The method of claim 46, wherein the MHC class II epitope is
ASFEAQGALANIAVDKA (SEQ ID NO: 20) and the MHC class II haplotype of
the eukaryotic cell is I-A.sup.b.
90. The method of claim 46, wherein the selectable marker is a
nucleic acid encoding antibiotic resistance.
91. The method of claim 46, wherein the selectable marker is
detected by spectrophotometric properties.
92. The method of claim 46, wherein the insertion end at the 5' end
of the transposable element is SEQ ID NO: 4 or SEQ ID NO: 5.
93. The method of claim 46, wherein the insertion end at the 3' end
of the transposable element is SEQ ID NO: 3 or SEQ ID NO: 4.
94. The method of claim 46, wherein the transposable element
further comprises an affinity tag.
95. The method of claim 94, wherein the affinity tag is 6.times.
histidine, S-tag, glutathione-S-transferase, or streptavidin.
96. The method of claim 94, wherein the nucleic acid sequence
encoding an affinity tag is 5' of the 5' recombining site.
97. The method of claim 94, wherein the nucleic acid sequence
encoding an affinity tag is 3' of the 3' recombining site.
98. The method of claim 37, wherein the MHC class II epitope is
anti-I-A.sup.k/Hen Egg Lysozyme (HEL.sub.46-61) or
anti-I-A.sup.k/Hen Egg Lysozyme (HEL.sub.116-129), and the MHC
class II haplotype of the eukaryotic cell is I-A.sup.b.
99. The method of claim 45, wherein the MHC class II epitope is
anti-I-A.sup.k/Hen Egg Lysozyme (HEL.sub.46-61) or
anti-I-A.sup.k/Hen Egg Lysozyme (HEL.sub.116-129), and the MHC
class II haplotype of the eukaryotic cell is I-Ab.
100. The method of claim 46, wherein the MHC class II epitope is
anti-I-A.sup.k/Hen Egg Lysozyme (HEL.sub.46-61) or
anti-I-A.sup.k/Hen Egg Lysozyme (HEL.sub.116-129), and the MHC
class II haplotype of the eukaryotic cell is I-A.sup.b.
Description
FIELD
[0001] This invention relates to transposons, specifically to the
use of transposons to insert into a genome to identify antigenic
epitopes. This invention also relates to the identification of
vaccine antigens.
BACKGROUND
[0002] The immune system is alerted to the presence of foreign
infectious agents by the presentation of complexes on the surface
of the infected cell. The complexes are composed of antigens
derived from the pathogen and proteins of the Major
Histocompatability Complex (MHC). Two separate pathways, MHC I and
MHC II, drive cellular and humoral immune responses, respectively.
In general, MHC I-presented antigens are derived from cytoplasmic
proteins. However in antigen presenting cells (APC), the MHC I
presented antigens are derived from an alternate pathway through a
lysosomal compartment (Morrison et al. J. Exp. Med. 163:903-21,
1986; Pfeifer et al. Nature 361:359-62, 1993.) MHC II antigens are
generally derived from pinocytotic or phagocytic mechanisms
(Morrison et al. J. Exp. Med. 163:903-21, 1986).
[0003] Of the many pathogenic bacteria capable of mediating disease
in humans and animals, intracellular pathogens present unique
challenges in attempting to understand bacteria/host cell
interactions. Intracellular pathogens are divided into two groups:
those that reside within a phagolysosomal compartment (Salmonella
sp, Mycobacterium tuberculosis, etc.) and those which reside within
the cytoplasm (Listeria monocytogenes, Shigella sp, etc.).
Intracellular pathogens adapt to their host cell environment by the
selective secretion of proteins designed to alter the normal
structural and metabolic machinery of the host cell, thus promoting
bacterial survival and avoidance of host immune surveillance. Both
phagolysosomal and cytoplasmic intracellular pathogens secrete
proteins known to mediate their effects specifically within the
host cell cytoplasm (Cornelis and Wolf-Watz, Mol. Microbiol.
23:861-7, 1997; Collazo and Galan, Mol. Microbiol. 24:747-56, 1997;
Fu and Galan, Mol. Microbiol. 27:359-68, 1998). Because cytoplasmic
localization of the bacterial protein also infers access to the
degradative machinery of the host cell proteosome, these proteins
were named Class I Accessible Proteins (CAPs).
[0004] Vaccination with Salmonella results in the production of a
strong cellular and humoral response against the bacteria itself
(Sztein et al., J. Immunol. 155:3987-93, 1995). However, the
heterologous-antigen specific immune response is variable and
depends on several factors, including the nature of the antigen
itself, the type of cell and tissue in which the antigen is
expressed, the level of expression, and whether the antigen is
presented and processed by the class I or class II MHC pathways.
Results using either the SIV capsid antigen or the malaria
circumsporozoite antigen, demonstrate that antigen-specific
cytotoxic T lymphocyte (CTL) responses are induced when the antigen
is expressed in Salmonella (Flynn et al., Mol. Microbiol. 4:2111-8,
1990; Sadoff et al., Science, 240:336-8, 1988; Valentine et al.,
Vaccine. 14:13846, 1996). Other antigens have failed to elicit a
CTL response even in similar expression systems (Tite et al.,
Immunology 70(4):540-6 1990). A plasmid containing a gene for a
foreign antigen expressed from a eukaryotic promoter resulted in a
strong cell-mediated response against the foreign antigen (Darji et
al., Cell 91(6):765-75 1997); Schodel and Curtiss, Dev. Biol. Stand
84:245-53, 1995).
[0005] A significant advance in the area of cancer vaccination has
been the identification of tumor-specific epitopes. In general,
cancer vaccines attempt to elicit an immune response to tumors by
directing tumor-specific epitopes to various compartments of the
immune system. Several strategies, which include vaccines composed
of DNA, proteins, peptides, whole cells, carbohydrates and
recombinant vectors, have been used to generate tumor vaccines. The
use of recombinant vectors includes the use of live carrier vectors
such as vaccinia, BCG, canarypox, and Salmonella, which are
designed to stimulate the appropriate immune responses to tumors
and infectious agents as a by-product of infection. Effective
vaccines need to elicit strong, long-term, and multi-haplotype
protection against a tenacious cancer. An ideal vaccine would
satisfy these requirements and elicit an inescapable immune
response by delivering a wide-variety of antigens.
SUMMARY
[0006] A transposable element is provided that has a 3' and a 5'
end. The transposable element includes a 5' recombining site 5' of
a nucleic acid sequence encoding a selectable marker, a 3'
recombining site 3' of the nucleic acid sequence encoding a
selectable marker, a nucleic acid sequence encoding an MHC epitope
5' to the 5' recombining site or 3' to the 3' recombining site, and
an insertion end comprising an inverted repeat sequence sufficient
for integration of the transposable element at the 5' and the 3'
end of the transposable element.
[0007] In one embodiment, a transposable element is provided that
has a 5' and a 3' end. The transposable element includes a 5' loxP
sequence 5' of a nucleic acid encoding a selectable marker, a 3'
loxP sequence 3' of a nucleic acid encoding the selectable marker,
an MHC epitope 5' to the 5' loxP sequences or 3' of the 3' loxP
sequence, an insertion end at the 5' end of the transposable
element, and an insertion end at the 3' of the transposable
element.
[0008] In another embodiment, a transposable element is provided
that has a 5' and a 3' end. The transposable element includes an
antibiotic resistance cassette, a 5' loxP sequence 5' of the
antibiotic resistance cassette and a 3' loxP sequence 3' of the
antibiotic resistance cassette, an MHC epitope 5' to the 5' loxP
sequence or 3' of the 3' loxP sequence, an affinity tag, an
insertion end at the 5' end of the transposable element; and an
insertion end at the 3' of the transposable element.
[0009] In yet another embodiment a transposable element is provided
that has a 5' and a 3' end. The transposable element includes a
kanamycin antibiotic resistance cassette, a loxP sequence
comprising the sequence shown in SEQ ID NO 11 located 5' and 3' to
the antibiotic resistance cassette, a nucleic acid sequence
encoding a transposase, a nucleic acid sequence encoding a MHC
epitope, a nucleic acid sequence encoding a 6.times. histidine
affinity tag, an insertion end at the 5' end of the transposable
element; and an insertion end at the 3' of the transposable
element.
[0010] Transposable elements have been engineered which can
introduce in-frame insertions throughout the chromosome of a
bacterium. This system "tags" the gene and resulting protein, for
use in identifying proteins secreted across the membranes of the
cell infected by the bacterium.
[0011] One particular embodiment of the method includes infecting a
pathogenic cell with a transposable element of the invention,
wherein the infection results in the integration of the
transposable element in a nucleic acid sequence of the bacterial
cell, transforming the pathogenic cell with a vector comprising a
transposase, contacting a eukaryotic cell that can internalize the
pathogenic cell with the pathogenic cell infected with the
transposable element, contacting the eukaryotic cell with a labeled
antibody that recognizes the MHC epitope, identifying the labeled
eukaryotic cells, lysing the labeled eukaryotic cells to
externalize the bacteria cell, growing the externalized bacterial
cell to produce a population of bacterial cells; and identifying
the nucleic acid sequence of the bacterial cell that has the
integrated transposable element, wherein this nucleic acid sequence
encodes the antigenic element of the pathogen.
[0012] In another embodiment, a method is provided for generating a
carrier vaccine. The method includes infecting a bacterial cell
with the transposable element of the invention, wherein the
transposable element further comprises an antigen associated with a
disease operably linked to the MHC epitope of the transposable
element, wherein the infection of the bacteria results in the
integration of the transposable element in a nucleic acid sequence
of the bacterial cell. The method also includes contacting a
eukaryotic cell that can internalize the pathogenic cell with the
pathogenic cell infected with the transposable element, contacting
the eukaryotic cell with a labeled antibody that recognizes the MHC
epitope, identifying the labeled eukaryotic cells, lysing the
labeled eukaryotic cells to externalize the bacteria cell, growing
the externalized bacterial cell to produce a population of
bacterial cells; identifying the nucleic acid sequence of the
bacterial cell that has the integrated transposable element,
wherein the nucleic acid sequence encodes the antigenic element of
the pathogen; and growing the identified bacterial cell identified.
The identified bacterial cell is the carrier vaccine.
BRIEF DESCRIPTION OF THE FIGURES
[0013] FIG. 1 is a schematic representation of the Tn5-DICE
transposon.
[0014] FIG. 2 is a schematic representation showing the in-frame
resolution of Tn5-DICE which was used to generate the expression of
fusion proteins containing the SIINFEKL epitope and a
6.times.-histidine tag.
[0015] FIG. 3 is a schematic representation of some plasmids used
for DICE analysis. A. Plasmid carrying a Tn5-DICE resolvable
transposon; B. Arabinose inducible cre recombinase plasmid
pBAD33cre.
[0016] FIG. 4 is a schematic representation showing one embodiment
of the method developed to sequencing the Tn5-DICE-resolved CAPs.
A. Suicide plasmid pAV353, containing a resolved copy of Tn5-DICE,
was conjugated into a naladixic acid resistant, Cre expressing
Tn5-DICE mutant. B. An ampicillin and naladixic acid resistant
transconjugant was obtained via Cre-loxP recombination. C. Isolated
chromosomal DNA was restricted with EcoRI or SalI to clone 5'- or
3'-sequences flanking the original SIINFEKL inaction,
respectively.
[0017] FIG. 5 is a schematic representation showing the
Tn5-HER2/neu/SOB (HER2/neu/String of Beads) construct.
[0018] FIG. 6 is a schematic representation showing the
Tn5-HIV1/SOB construct.
[0019] FIG. 7 is a schematic representation of a DICE I
transposome, which does not contain transposase, and can be used to
identify CAPs presented by the MHC I pathway.
[0020] FIG. 8 is a schematic representation of a DICE II
transposome, which does not contain transposase, and can be used to
identify CAPs presented by the MHC II pathway.
[0021] FIG. 9 is a schematic representation of a
Salmonella-HER2/neu epitope carrier vaccine.
[0022] FIG. 10 is a schematic representation of a Salmonella-HIV
epitope carrier vaccine.
[0023] FIG. 11 shows the Tn5 Mosaic end sequences.
[0024] FIG. 12 shows the DICE-I Resolved Sequence.
[0025] FIG. 13 shows the DICE-II Resolved Sequence.
SEQUENCE LISTING
[0026] The nucleic and amino acid sequences listed in the
accompanying sequence listing are shown using standard letter
abbreviations for nucleotide bases, and three letter code for amino
acids. Only one strand of each nucleic acid sequence is shown, but
the complementary strand is understood as included by any reference
to the displayed strand.
[0027] SEQ ID NO 1 is the nucleic acid sequence of a primer that
can be used to sequence the gene in which a transposable element
inserted.
[0028] SEQ ID NO 2 is the nucleic acid sequence of a primer that
can be used to sequence the gene in which a transposable element
inserted.
[0029] SEQ ID NO 3 is the sequence of the O end.
[0030] SEQ ID NO 4 is the sequence of a mosaic end.
[0031] SEQ ID NO 5 is the sequence of an I end.
[0032] SEQ ID NO 6 is the SIINFEKL epitope.
[0033] SEQ ID NO 7 is the LLFGYPVYV epitope.
[0034] SEQ ID NO 8 is the ASFEAQGALANIAVDKA epitope.
[0035] SEQ ID NO 9 is the sequence of a 5' PCR site, shown as
position 54-77 of FIG. 12.
[0036] SEQ ID NO 10 is the sequence of the 6.times. histidine,
shown as position 82-100 of FIG. 12.
[0037] SEQ ID NO 11 is the sequence of the loxP, shown a position
109-143 of FIG. 12.
[0038] SEQ ID NO 12 is the sequence of the 3' PCR site, shown as
position 145-167 of FIG. 12.
[0039] SEQ ID NO 13 is the sequence of a 5' PCR site, shown as
position 25-45 of FIG. 13.
[0040] SEQ ID NO14 is the sequence of the 5' asparyginyl
endopeptidase cleavage site, shown as position 34-45 of FIG.
13.
[0041] SEQ ID NO 15 is the sequence of the 3' asparyginyl
endopeptidase cleavage site, shown as position 97-108 of FIG.
13.
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
[0042] Transposable elements have been engineered which can
introduce in-frame insertions throughout the chromosome of a
bacterium. This system "tags" the gene and resulting protein,
allowing the identification of proteins secreted across the
membranes of the cell infected by the bacterium. In one embodiment,
the transposable elements contain an antibiotic resistance
cassette, two minimal loxP recombination sites, an MHC class I or
class II epitope, and flanking insertion ends. A transposase, such
as the cre recombinase protein is expressed in trans from a
plasmid, or can be included in the transposable element. The cre
recombinase loops out the intervening sequences containing the
antibiotic resistance cassette. When the transposable elements
insert within a gene, the resolved insertion places the MHC class I
or class II epitope in frame with the gene. Restriction sites allow
the introduction of other marker proteins.
[0043] Certain embodiments of this technology, termed Disseminated
Insertions of Class-I Epitopes (DICE-I) (DICE-II for class II
epitopes), allow the rapid and accurate identification of proteins
involved in bacterial pathogenesis. Uses for this technology
include the identification of vaccine and drug targets for therapy
of a variety of bacteria pathogenic to humans and animals. In
addition, this system can facilitate the assignment of function to
genes previously identified through genomic analysis. This method
is also directly applicable to the generation of haplotype
independent cytotoxic T lymphocyte (CTL) response to a given
antigen as a way of assessing patient immune response; measuring
CTL response as a way of diagnosing specific infections;
development of human and animal vaccines that require a strong CTL
response; identification of new bacterial carrier proteins that can
be used to generate a CTL response to infection; and augmentation
of the immune response by delivery of eukaryotic immune
effectors.
[0044] The identification of CAPs secreted by the MHC class I or
class II pathway in response to host cell interactions are
invaluable in the design of better bacterial carrier vaccines and
to identify entire new classes of potentially useful vaccine target
proteins from different pathogens and tumors, since CAPs possess
unique access to the host's antigen processing and presentation
machinery. In addition, because a substantial proportion of open
reading frames derived from whole genome analysis have no known
function, a system which allows the identification of CAPs secreted
in response to host cell interactions, is an invaluable tool for
understanding many levels of pathogen/host cell interactions.
Furthermore, CAPs represent useful vehicles for the delivery of
foreign epitopes by bacterial vaccine strains, such as
Salmonella.
[0045] DICE-I and DICE-II have several inherent strengths in the
identification of CAPs. In some embodiments, DICE selection is
conditional, host class I-accessible proteins are isolated as a
consequence of being processed and presented in the context of
H-2K.sup.b, and host class II-accessible proteins are isolated as a
consequence of being processed and presented in the context of
I-A.sup.b. Moreover, only in-frame insertions, which do not alter
secretory signals, are recovered. Selection can be made simple and
powerful, with interesting strains quickly recovered from a large
population of infected cells by flow cytometry. Since selection is
specific, bacteria cannot be recovered from macrophages that have
presented a MHC epitope from non-secreted intracellular proteins
derived by bacterial attrition within the phago-lysosome because
these bacteria would not be viable. Moreover, because the
transposable elements can carry an affinity tag such as
6.times.-hisitdine, the subcellular location of the protein can be
visualized by microscopy, thereby enabling functional and
phenotypic inferences to be drawn about proteins with no known
homology. Also, the protein can be readily assessed as an epitope
carrier by attenuating the strain and immunizing the appropriate
animal model.
Abbreviations and Definitions
[0046] The following definitions and methods are provided to better
define the present invention and to guide those of ordinary skill
in the art in the practice of the present invention. As used herein
and in the appended claims, the singular forms "a" or "an" or "the"
include plural referents unless the context clearly indicates
otherwise. Thus, for example, reference to "a transposon" includes
a plurality of such transposons and reference to "the antigen"
includes reference to one or more antigens and equivalents thereof
known to those skilled in the art, and so forth.
[0047] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this invention belongs.
TABLE-US-00001 MOI multiplicity of infection RT room
temperature
[0048] Affinity Tag: A sequence which can be included in a
transposable element which can aid in the purification of the
protein in which the transposable element inserts. The term
affinity tag refers to the nucleic acid sequence for the tag, and
the tag protein sequence encoded by the nucleic acid sequence.
Examples of affinity tags include, but are not limited to:
histidine, such as 6.times. histidine, S-tag,
glutathione-S-transferase (GST) and streptavidin.
[0049] Animal: Living multicellular vertebrate organisms, a
category which includes, for example, mammals, primates, and
birds.
[0050] Antibiotic resistance cassette: A selectable marker that is
a nucleic acid sequence which confers resistance to that antibiotic
in a host cell in which the nucleic acid is translated. Examples of
antibiotic resistance cassettes include, but are not limited to
kanamycin, ampicillin, tetracycline, chloramphenicol, neomycin,
hygromycin, zeocin.
[0051] Cancer: Malignant neoplasm that has undergone characteristic
anaplasia with loss of differentiation, increased rate of growth,
invasion of surrounding tissue, and is capable of metastasis.
[0052] CAPs: MHC Class I or Class II accessible proteins.
[0053] cDNA (complementary DNA): A piece of DNA lacking internal,
non-coding segments (introns) and regulatory sequences which
determine transcription. cDNA may be synthesized in the laboratory
by reverse transcription from messenger RNA extracted from
cells.
[0054] Deletion: The removal of a sequence of DNA, the regions on
either side being joined together.
[0055] DNA: Deoxyribonucleic acid. DNA is a long chain polymer
which comprises the genetic material of most living organisms (some
viruses have genes comprising ribonucleic acid, RNA). The repeating
units in DNA polymers are four different nucleotides, each of which
comprises one of the four bases, adenine, guanine, cytosine and
thymine bound to a deoxyribose sugar to which a phosphate group is
attached. Triplets of nucleotides, referred to as codons, in DNA
molecules code for amino acid in a polypeptide. The term codon is
also used for the corresponding (and complementary) sequences of
three nucleotides in the mRNA into which the DNA sequence is
transcribed.
[0056] Insertion Ends: Nucleic acid sequences that bind
transposase. In general, insertion ends are 19 base pairs in
length. In the constructs described herein they are located 5' (the
5' insertion end) to the MHC epitope and 3' (the 3' insertion end)
to the 3' lox P sequence. Examples of 5' insertion ends include,
but are not limited to, the I end of IS50R (e.g. SEQ ID NO:5,
Genbank Accession No. U32991.1) and the mosaic sequence (SEQ ID
NO:4, see Goryshin and Reznikoff Journal of Biological Chemistry
273(13):7367-74). Examples of 3' insertion ends include, but are
not limited to, the 0 end of IS50R (e.g. SEQ ID NO:3, Genbank
accession No. U00004.1 and the mosaic sequence shown herein (see
FIG. 11).
[0057] IS50R: Insertion sequence (IS) type 50R. This IS element
ends in short inverted terminal repeats, designated the I and O
ends (insertion ends) (e.g. see Genbank Accession Nos. U32991.1 and
U00004.1, respectively).
[0058] Isolated: An "isolated" biological component (such as a
nucleic acid, peptide or protein) has been substantially separated,
produced apart from, or purified away from other biological
components in the cell of the organism in which the component
naturally occurs, i.e., other chromosomal and extrachromosomal DNA
and RNA, and proteins. Nucleic acids, peptides and proteins which
have been "isolated" thus include nucleic acids and proteins
purified by standard purification methods. The term also embraces
nucleic acids, peptides and proteins prepared by recombinant
expression in a host cell as well as chemically synthesized nucleic
acids.
[0059] loxP sequence: A target sequence recognized by the bacterial
cre recombinase; loxP is the recombination site for the enzyme Cre
recombinase. The loxP sequence was originally derived from
bacteriophage P1 (see Hoekstra et. Al., Proceedings of the National
Academy of Sciences 88(12):5457-61 1991). In one embodiment, loxP
sites are defined by the sequence ATAACTTCGTATAATGTATGCTA
TACGAAGTTAT. A "minimal" loxP sequence is the minimal sequence
recognized by the cre recombinase. In one embodiment, minimal loxP
sequence is as described in Hoekstra et. Al., Proceedings of the
National Academy of Sciences 88(12):5457-61 1991. Specific,
non-limiting examples include, but are not limited to, the sequence
listed as Genbank accession No. M10494.1. The 5' and 3' loxP
sequences must be identical. The loxP sites are represented by the
sequence defined above to prevent premature transcriptional
termination.
[0060] As used herein, these sequences are located upstream and
downstream (5' and 3', respectively) to a sequence encoding a
selectable marker.
[0061] Mammal: This term includes both human and non-human mammals.
Similarly, the terms "subject," "patient," and "individual" include
human and veterinary subjects.
[0062] MHC Epitopes: Epitopes presented through the class I or
class II MHC pathway, for which at least one antibody is available.
The antibody binds preferentially to the epitope complexed with MHC
molecules, not to the free epitope. Examples of class I MHC
epitopes include, but are not limited to the ovalbumin epitope,
SIINFEKL (SEQ ID NO 6), and the HLA-A2 restricted human T-cell
epitope LLFGYPVYV (SEQ ID NO 7) from HTLV-1 (see Genbank Accession
No. B45714). Examples of class I MHC epitopes include, but are not
limited to, the I-A.sup.b restricted T-cell epitope,
ASFEAQGALANIAVDKA (SEQ ID NO 8).
[0063] A MHC epitope "adjoins" a recombining site (i.e., a 5' or 3'
recombining site) when the nucleic acid sequence encoding the MHC
epitope is located either 5' of the 5' recombining site of 3' of
the 3' recombining site in a transposable element. Upon
recombination of a transposable element with a genome, insertion a
of the MHC epitope in the genome occurs, and the MHC epitope is
expressed along with a cellular protein. In one embodiment, the MHC
epitope is located within about 5000 bp of the recombining site.
Alternatively, the MHC epitope can be located within about 1000
bp., 500 bp, 100 bp, 20 bp, 10 bp, or 0 by from the recombining
site.
[0064] Oligonucleotide: A linear polynucleotide sequence of up to
about 200 nucleotide bases in length, for example a polynucleotide
(such as DNA or RNA) which is at least 6 nucleotides, for example
at least 15, 50, 100 or even 200 nucleotides long.
[0065] Operably linked: A first nucleic acid sequence is operably
linked with a second nucleic acid sequence when the first nucleic
acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably
linked to a coding sequence if the promoter affects the
transcription or expression of the coding sequence. Generally,
operably linked DNA sequences are contiguous and, where necessary
to join two protein coding regions, in the same reading frame.
[0066] ORF (open reading frame): A series of nucleotide triplets
(codons) coding for amino acids without any termination codons.
These sequences are usually translatable into a peptide.
[0067] Ortholog: Two nucleotide sequences are orthologs of each
other if they share a common ancestral sequence, and diverged when
a species carrying that ancestral sequence split into two species.
Orthologous sequences are also homologous sequences.
[0068] PCR: polymerase chain reaction. Describes a technique in
which cycles of denaturation, annealing with primer, and then
extension with DNA polymerase are used to amplify the number of
copies of a target DNA sequence.
[0069] Pharmaceutically acceptable carriers: The pharmaceutically
acceptable carriers useful in this invention are conventional.
Remington's Pharmaceutical Sciences, by E. W. Martin, Mack
Publishing Co., Easton, Pa., 15th Edition (1975), describes
compositions and formulations suitable for pharmaceutical delivery
of the DNA, RNA, and proteins herein disclosed. Embodiments of the
invention comprising medicaments can be prepared with conventional
pharmaceutically acceptable carriers, adjuvants and counterions as
would be known to those of skill in the art.
[0070] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations usually comprise injectable fluids that
include pharmaceutically and physiologically acceptable fluids such
as water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol, ethanol, sesame oil, combinations thereof, or
the like, as a vehicle. The medium may also contain conventional
pharmaceutical adjunct materials such as, for example,
pharmaceutically acceptable salts to adjust the osmotic pressure,
buffers, preservatives and the like. The carrier and composition
can be sterile, and the formulation suits the mode of
administration. For solid compositions (e.g., powder, pill, tablet,
or capsule forms), conventional non-toxic solid carriers can
include, for example, pharmaceutical grades of mannitol, lactose,
starch, sodium saccharine, cellulose, magnesium carbonate, or
magnesium stearate. In addition to biologically-neutral carriers,
pharmaceutical compositions to be administered can contain minor
amounts of non-toxic auxiliary substances, such as wetting or
emulsifying agents, preservatives, and pH buffering agents and the
like, for example sodium acetate or sorbitan monolaurate.
[0071] The composition can be a liquid solution, suspension,
emulsion, tablet, pill, capsule, sustained release formulation, or
powder. The composition can be formulated as a suppository, with
traditional binders and carriers such as triglycerides.
[0072] Probes and primers: Nucleic acid probes and primers may
readily be prepared based on the amino acid sequences provided by
this invention. A probe is an isolated nucleic acid attached to a
detectable label or reporter molecule. Typical labels include
radioactive isotopes, ligands, chemiluminescent agents, and
enzymes. Methods for labeling and guidance in the choice of labels
appropriate for various purposes are discussed, e.g., in Sambrook
et al., in Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory Press (1989) and Ausubel et al., in Current
Protocols in Molecular Biology, Greene Publishing Associates and
Wiley-Intersciences (1987).
[0073] Primers are short nucleic acids, such as DNA
oligonucleotides 15 nucleotides or more in length. Primers may be
annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand, and then extended along the target DNA strand by a DNA
polymerase enzyme. Primer pairs can be used for amplification of a
nucleic acid sequence, e.g., by the polymerase chain reaction (PCR)
or other nucleic-acid amplification methods known in the art.
[0074] Methods for preparing and using probes and primers are
described, for example, in Sambrook et al. (Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989),
Ausubel et al., in Current Protocols in Molecular Biology, Greene
Publishing Associates and Wiley-Intersciences (1987), and Innis et
al., PCR Protocols, A Guide to Methods and Applications, 1990,
Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, Calif.
PCR primer pairs can be derived from a known sequence, for example,
by using computer programs intended for that purpose such as Primer
(Version 0.5, .COPYRGT.1991, Whitehead Institute for Biomedical
Research, Cambridge, Mass.). One of skill in the art will
appreciate that the specificity of a particular probe or primer
increases with its length. Thus, for example, a primer comprising
20 consecutive nucleotides of a cDNA or gene will anneal to a
target sequence such as a homolog of that gene contained within a
cDNA or genomic DNA library with a higher specificity than a
corresponding primer of only 15 nucleotides. Thus, in order to
obtain greater specificity, probes and primers may be selected that
comprise 20, 25, 30, 35, 40, 50 or more consecutive nucleotides of
the nucleic acid sequences herein disclosed.
[0075] The invention thus includes isolated nucleic acid molecules
that comprise specified lengths of the disclosed gene sequences.
Such molecules may comprise at least 20, 21, 25, 30, 35, 40, 50 or
100 or more consecutive nucleotides of these sequences and may be
obtained from any region of the disclosed sequences. By way of
example, the cDNA and gene sequences may be apportioned into halves
or quarters based on sequence length, and the isolated nucleic acid
molecules may be derived from the first or second halves of the
molecules, or any of the four quarters. In particular, the DNA
sequences may code for a unique portion of the protein, which has
not been previously disclosed.
[0076] Purified: the term purified does not require absolute
purity; rather, it is intended as a relative term. Thus, for
example, a purified protein preparation is one in which the protein
is more pure than the protein in its natural environment within a
cell. In one embodiment, a preparation of a protein is purified
such that the protein represents at least 50% of the total protein
content of the preparation.
[0077] Recombinant: A recombinant nucleic acid is one that has a
sequence that is not naturally occurring or has a sequence that is
made by an artificial combination of two otherwise separated
segments of sequence. This artificial combination is often
accomplished by chemical synthesis or, more commonly, by the
artificial manipulation of isolated segments of nucleic acids,
e.g., by genetic engineering techniques.
[0078] Recombining sites: Nucleic acid sequences that include
inverted palindromes separated by an asymmetric sequence at which a
site-specific recombination reaction can occur. In one specific,
non-limiting example, a recombining site is a Lox P site (see
above). In another specific non-limiting example, a recombining
site is a Flt sites. The FRT consists of two inverted 13-base-pair
(bp) repeats and an 8-bp spacer that together comprise the minimal
FRT site, plus an additional 13-bp repeat which may augment
reactivity of the minimal substrate (e.g. see U.S. Pat. No.
5,654,182). In other, specific non-limiting examples, a recombining
site is a recombining site from a TN3, a mariner, or a gamma/delta
transposon.
[0079] Recombinase: A protein which catalyses recombination of
recombining sites (reviewed in Kilby et al., TIG, 9, 413-421
(1993); Landy, Current Opinion in Genetics and Development, 3,
699-707 (1993); Argos et al., EMBO J., 5, 433440 (1986)). One
specific, non-limiting example of a recombinase is a Cre protein.
Another specific, non-limiting example a recombinase is a Flp
protein. Other specific, non-limiting examples of a recombinase are
Tn3 recombinase, the recombinase of transposon gamma/delta, and the
recombinase from transposon mariner.
[0080] The Cre and Flp proteins belong to the lambda. integrase
family of DNA recombinases. The Cre and Flp recombinases show
striking similarities, both in terms of the types of reactions they
carry out and in the structure of their target sites and mechanism
of recombination (see, e.g., Jayaram, TIBS, 19, 78-82 (1994); Lee
et al., J. Biolog. Chem., 270, 4042-4052 (1995). For instance, the
recombination event is independent of replication and exogenous
energy sources such as ATP, and functions on both supercoiled and
linear DNA templates.
[0081] The recombinases exert their effects by promoting
recombination between two of their recombining sites. In the case
of Cre, the recombining site is a Lox site, and in the case of Flp
the recombining site is a Frt. Similar sites are found in
transposon gamma/delta, TN3, and transposon mariner. These
recombining sites are comprised of inverted palindromes separated
by an asymmetric sequence (see, e.g., Mack et al., Nucleic Acids
Research, 20, 4451-4455 (1992); Hoess et al., Nucleic Acids
Research, 14, 2287-2300 (1986); Kilby et al., supra). Recombination
between target sites arranged in parallel (i.e., so-called "direct
repeats") on the same linear DNA molecule results in excision of
the intervening DNA sequence as a circular molecule. Recombination
between direct repeats on a circular DNA molecule excises the
intervening DNA and generates two circular molecules. Both the
Cre/Lox and Flp/Frt recombination systems have been used for a wide
array of purposes such as site-specific integration into plant,
insect, bacterial, yeast and mammalian chromosomes has been
reported (see, e.g., Sauer et al., Proc. Natl. Acad. Sci., 85,
5166-5170 (1988)). Positive and negative strategies for selecting
or screening recombinants have been developed (see, e.g., Sauer et
al., J. Mol. Biol., 223, 911-928 (1992)). The use of the
recombinant systems or components thereof in transgenic mice,
plants and insects among others reveals that hosts express the
recombinase genes with no apparent deleterious effects, thus
confirming that the proteins are generally well-tolerated (see,
e.g., Orbin et al., Proc. Natl. Acad. Sci., 89, 6861-6865
(1992)).
[0082] Sample: Includes biological samples containing genomic DNA,
RNA, or protein obtained from body cells, such as those present in
peripheral blood, urine, saliva, tissue biopsy, surgical specimen,
amniocentesis samples and autopsy material.
[0083] Selectable Marker: A polypeptide used to identify a cell of
interest that express the polypeptide. A selectable can be detected
using any method known to one of skill in the art, including
enzymatic assays, spectrophotometric assays, antibiotic resistance
assays, and assays utilizing antibodies (e.g. ELISA or
immunohistochemistry). Specific non-limiting examples of a
selectable maker are luciferase, green fluorescent protein (GFP),
or beta-galactosidase. In one embodiment, a selectable marker is an
enzyme. In another embodiment, a selectable marker is an enzyme. In
further embodiment, a selectable marker is an antigenic epitope.
Specific, non-limiting examples of selectable markers of use are
proteins that make a cell drug resistance (e.g. zeomycin,
hygromycin, tetracycline, puromycin or bleomycin resistant).
[0084] Sequence identity: The similarity between two nucleic acid
sequences, or two amino acid sequences, is expressed in terms of
the similarity between the sequences, otherwise referred to as
sequence identity. Sequence identity is frequently measured in
terms of percentage identity (or similarity or homology); the
higher the percentage, the more similar the two sequences are.
Homologs of the nucleic acid and protein sequences of the DICE
transposons of the present invention will possess a relatively high
degree of sequence identity when aligned using standard methods.
This homology will be more significant when the orthologous
proteins or cDNAs are derived from species which are more closely
related, compared to species more distantly related.
[0085] Typically, homologs of the DICE transposomes of the present
invention are at least 50% identical at the nucleotide level and at
least 50% identical at the amino acid level when comparing DICE
transposomes of the present invention to a homologous DICE
transposomes. Greater levels of homology are also possible, for
example at least 75%, 90%, 95% or 98% identical at the nucleotide
level.
[0086] Methods of alignment of sequences for comparison are well
known in the art. Various programs and alignment algorithms are
described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981;
Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson &
Lipman, Proc. Natl. Acad. Sci USA 85:2444, 1988; Higgins &
Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3,
1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et
al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson
et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol.
Biol. 215:403-10, 1990, presents a detailed consideration of
sequence alignment methods and homology calculations.
[0087] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul
et al. J. Mol. Biol. 215:403-10, 1990) is available from several
sources, including the National Center for Biotechnology
Information (NCBI, Bethesda, Md.) and on the Internet, for use in
connection with the sequence analysis programs blastp, blastn,
blastx, tblastn and tblastx. It can be accessed at the NCBI web
site.
[0088] Homologs of the disclosed DICE transposomes amino acid
sequence may possess at least 60%, 70%, 80%, 90%, 95%, 98% or at
least 99% sequence identity counted over full-length alignment with
the amino acid sequence of the disclosed DICE transposomes using
the NCBI Blast 2.0, gapped blastp set to default parameters.
Queries searched with the blastn program are filtered with DUST
(Hancock, and Armstrong, 1994, Comput. Appl. Biosci. 10:67-70).
Other programs use SEG.
[0089] For comparisons of amino acid sequences of greater than
about 30 amino acids, the Blast 2 sequences function is employed
using the default BLOSUM62 matrix set to default parameters, (gap
existence cost of 11, and a per residue gap cost of 1). When
aligning short peptides (fewer than around 30 amino acids), the
alignment should be performed using the Blast 2 sequences function,
employing the PAM30 matrix set to default parameters (open gap 9,
extension gap 1 penalties). Proteins with even greater similarity
to the reference sequence will show increasing percentage
identities when assessed by this method, such as at least 70%, 75%,
80%, 90%, 95%, 98%, or at least 99% sequence identity. When less
than the entire sequence is being compared for sequence identity,
homologs will typically possess at least 75% sequence identity over
short windows of 10-20 amino acids, and may possess sequence
identities of at least 85% or at least 90% or 95% depending on
their similarity to the reference sequence.
[0090] Alternatively, one may manually align the sequences and
count the number of identical amino acids in the original sequence
and a reference sequence that is compared to the original sequence.
This number of identical amino acids is divided by the total number
of amino acids in the reference sequence and multiplied by 100 to
result in the percent identity.
[0091] One of ordinary skill in the art will appreciate that these
sequence identity ranges are provided for guidance only; it is
entirely possible that strongly significant homologs could be
obtained that fall outside of the ranges provided. The present
invention provides not only the peptide homologs that are described
above, but also nucleic acid molecules that encode such
homologs.
[0092] One indication that two nucleic acid sequences are
substantially identical is that the polypeptide which the first
nucleic acid encodes is immunologically cross reactive with the
polypeptide encoded by the second nucleic acid.
[0093] Nucleic acid sequences that do not show a high degree of
identity may nevertheless encode similar amino acid sequences, due
to the degeneracy of the genetic code. It is understood that
changes in nucleic acid sequence can be made using this degeneracy
to produce multiple nucleic acid sequences that all encode
substantially the same protein.
[0094] An alternative indication that two nucleic acid molecules
are closely related is that the two molecules hybridize to each
other under stringent conditions.
[0095] The present invention provides not only the peptide homo
logs that are described above, but also nucleic acid molecules that
encode such homologs.
[0096] Subject: Living multicellular vertebrate organisms, a
category which includes, both human and veterinary subjects for
example, mammals, birds and primates.
[0097] Transformed: A transformed cell is a cell into which has
been introduced a nucleic acid molecule by molecular biology
techniques. As used herein, the term transformation encompasses all
techniques by which a nucleic acid molecule might be introduced
into such a cell, including transfection with viral vectors,
transformation with plasmid vectors, and introduction of naked DNA
by electroporation, lipofection, and particle gun acceleration.
[0098] Transgenic Cell: Transformed cells which contain foreign,
non-native DNA.
[0099] Transposable Element: Small, mobile DNA sequences that can
replicate and insert copies at random sites within a chromosome. In
general a transposable element has nearly identical sequences at
each end, and oppositely oriented (inverted) repeats. Naturally
occurring transposable elements (transposons) code for the enzyme,
transposase, that catalyses their insertion. Bacteria have two
types of transposons; simple transposons that have only the genes
needed for insertion, and complex transposons that contain genes in
addition to those needed for insertion. Eukaryotes contain two
classes of mobile genetic elements; the first are like bacterial
transposons in that DNA sequences move directly. The second class
(retrotransposons) move by producing RNA that is transcribed, by
reverse transcriptase, into DNA which is then inserted at a new
site.
[0100] The term "transposable element" includes transposons and
transposomes. Using the method described herein, a transposable
element can be used to identify CAPs from the MHC class I or class
II pathway.
[0101] Transposase: The enzyme responsible for transposition of
transposons. As used herein, refers to both the nucleic acid
sequence (e.g., see Genbank Accession No. AAB60064, and the amino
acid sequence (e.g. see Genbank Accession No. U15573)
[0102] Transposome: Mobile genetic element, which is able to
transport itself to other locations within a genome. As used
herein, refers to a transposable element refers to a mobile genetic
element which does not contain transposase. Examples include, but
are not limited to DICE-I and DICE-II shown in FIGS. 7 and 8,
respectively.
[0103] Transposon: A mobile genetic element, which is able to
transport itself to other locations within a genome. As used
herein, refers to a transposable element containing transposase.
Examples include, but are not limited to Tn5-DICE shown in FIG. 2,
Tn5-HER/neu/SOB shown in FIG. 5 and Tn5-HIV1/SOB shown in FIG.
6.
[0104] Vector: A nucleic acid molecule as introduced into a host
cell, thereby producing a transformed host cell. A vector may
include nucleic acid sequences that permit it to replicate in the
host cell, such as an origin of replication. A vector may also
include one or more selectable marker genes and other genetic
elements known in the art.
[0105] Variants of Amino Acid and Nucleic Acid Sequences: The
production of the disclosed DICE transposons can be accomplished in
a variety of ways. One of ordinary skill in the art will appreciate
that the DNA can be altered in numerous ways without affecting the
biological activity of the encoded protein. For example, PCR may be
used to produce variations in the DNA sequence which encodes the
disclosed DICE transposomes. Such variants may be variants that are
optimized for codon preference in a host cell that is to be used to
express the protein, or other sequence changes that facilitate
expression.
[0106] Two types of cDNA sequence variant may be produced. In the
first type, the variation in the cDNA sequence is not manifested as
a change in the amino acid sequence of the encoded polypeptide.
These silent variations are simply a reflection of the degeneracy
of the genetic code. In the second type, the cDNA sequence
variation does result in a change in the amino acid sequence of the
encoded protein. In such cases, the variant cDNA sequence produces
a variant polypeptide sequence. In order to optimize preservation
of the functional and immunologic identity of the encoded
polypeptide, any such amino acid substitutions may be conservative.
Conservative substitutions replace one amino acid with another
amino acid that is similar in size, hydrophobicity, etc. Such
substitutions generally are conservative when it is desired to
finely modulate the characteristics of the protein. Examples of
amino acids which may be substituted for an original amino acid in
a protein and which are regarded as conservative substitutions
include: Ser for Ala; Lys for Arg; Gln or His for Asn; Glu for Asp;
Ser for Cys; Asn for Gin; Asp for Glu; Pro for Gly; Asn or Gln for
His; Leu or Val for lie; lie or Val for Leu; Arg or Gln for Lys;
Leu or Ile for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for
Thr; Tyr for Trp; Trp or Phe for Tyr; and lie or Leu for Val.
[0107] Variations in the cDNA sequence that result in amino acid
changes, whether conservative or not, are minimized to enhance
preservation of the functional and immunologic identity of the
encoded protein. The immunologic identity of the protein may be
assessed by determining whether it is recognized by an antibody to
the disclosed DICE transposomes; a variant that is recognized by
such an antibody is immunologically conserved. In particular
embodiments, any cDNA sequence variant will introduce no more than
20, for example fewer than 10 amino acid substitutions into the
encoded polypeptide. Variant amino acid sequences can, for example,
be 80%, 90% or even 95% identical to the native amino acid
sequence.
[0108] Conserved residues in the same or similar proteins from
different species can also provide guidance about possible
locations for making substitutions in the sequence. A residue which
is highly conserved across several species is more likely to be
important to the function of the protein than a residue that is
less conserved across several species.
[0109] Additional definitions of terms commonly used in molecular
genetics can be found in Benjamin Lewin, Genes V published by
Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al
(eds.), The Encyclopedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A.
Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive
Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN
1-56081-569-8).
EXAMPLE 1
Generation of Transposable Elements
[0110] Transposable elements have the ability to randomly
distribute MHC class I or class II epitopes throughout a bacterial
genome. Transposable elements are flanked at the 5' and 3' end with
insertion ends, which bind transposase. In general, insertion ends
are about 19 nucleotides in length. Examples of 5' insertion ends
include, but are not limited to, the I end of IS50R (see GenBank
Accession No. U32991.1) and a mosaic sequence of the I and O end.
Examples of 3' insertion ends include, but are not limited to, the
O end of IS50R (see SEQ ID NO U00004.1) and a mosaic sequence of
the I and the O end (see FIG. 10).
[0111] Transposable elements also contain a pair of recombining
sites, such as pair of minimal loxP sequences, which upon
interacting with a recombinase, such as a cre recombinase, allow
the sequences located between the recombining sites to be removed
upon insertion of the transposable element into the bacterial
genome. In one embodiment, the 5' loxP sequence is located 5' to
the nucleic acid sequence encoding a selectable marker and 3' to
the MHC class I or class II epitope. The 3' loxP sequence is
located 5' to the 3' insertion end and 3' to the nucleic acid
sequence encoding a selectable marker. The loxP sequences used in
the present invention (SEQ ID NO 11) contain an example of a
minimal sequence which allows loxP to retain its function. Longer
loxP sequences may be used in the present invention. However, a
longer loxP sequence will be inserted into the bacterial genome.
Without being bound by theory, a smaller insertion into the protein
is more likely to allow the protein to function properly.
[0112] Transposable elements of the present invention also contain
a nucleic acid sequence encoding a selectable marker, located
between the loxP sequences, which allows for selection of bacteria
containing the transposable element plasmid. In one embodiment, the
nucleic acid sequence encoding a selectable marker encodes
antibiotic resistance. The nucleic acid sequence encoding a
selectable marker chosen may depend on the bacteria into which the
transposable elements are inserted. For example, if Salmonella is
used, a kanamycin resistance cassette may be used in the
transposable element. Examples of other antibiotic resistance
cassettes that may be used to practice the present invention
include, but is not limited to ampicillin tetracycline,
chloramphenicol, neomycin, hygromycin, zeocin.
[0113] MHC class I or class II restricted epitopes are delivered to
a bacterial genome by the transposable elements of the present
invention. The MHC epitope is located 3' to the 5' insertion end,
and 5' to the 5' loxP sequence. The MHC epitope used has at least
one antibody binding site available. The antibody binds
preferentially to the epitope complexed with MHC molecules, not to
the free epitope. Examples of class I MHC epitopes which can be
used include, but are not limited to, the ovalbumin epitope,
SIINFEKL (SEQ ID NO 6), and the HLA-A2 restricted human T-cell
epitope LLFGYPVYV (GenBank Accession No. B45714) from HTLV-1.
Examples of class II MHC restricted epitopes which can be used
include, but are not limited to, the I-Ab restricted T-cell
epitope, ASFEAQGALANIAVDKA (GenBank Accession No. 228499).
[0114] Transposable elements of the present invention may also
contain the Tn5-transposase sequence. If present, transposase is
located 3' to the nucleic acid sequence encoding a selectable
marker and 5' to the 3' lox P sequence. Upon addition of cre
recombinase, the transposase and nucleic acid sequence encoding a
selectable marker are removed.
[0115] The transposable elements of the present invention may be
used to transpose MHC epitopes into the genome of a wide-variety of
organisms, including bacteria. Examples of organisms that may be
used to practice the present invention include, but are not limited
to Salmonella, Mycobacterium tuberculosis, Plasmodium, and Listeria
monocytogenes.
EXAMPLE 2
Construction of Tn5-Based DICE Transposable Elements
[0116] A Tn5-DICE transposon was generated which consists of a
Tn5-transposase and an antibiotic resistance cassette (kanamycin)
flanked at its 5' and 3' ends by direct repeats of a minimal loxP
recombination site (FIG. 1). The entire Tn5-DICE transposon is
flanked by the IS50R I and O ends. The 5' end of the transposon
consists of the Tn5 I-end, the H-2K.sup.b-restricted ovalbumin
epitope SIINFEKL (SEQ ID NO 6), a 6.times.-histidine tag, and one
loxP site, which are translationally in-frame. Tn5-DICE randomly
distributes the ovalbumin epitope, SIINFEKL (SEQ ID NO 6),
throughout the bacterial chromosome. Epitope-tagged CAPs released
from the infecting bacteria are processed by the proteolytic
machinery of the host cell and the carried the ovalbumin epitope
SIINFEKL (SEQ ID NO 6), is presented in the context of H-2K.sup.b
on the surface of the host cell (see FIG. 11). In this construct,
the I end is amino acids 1-19, the SIINFEKL (SEQ ID NO:6) is at
position 28-52, the 5' PCR site is at position 54-77, the
6.times.Histidine is position 82-100, the Lox P is at position
109-143, the 3' PCR end is at position 145-167, and the O end is at
position 153-171 (see FIG. 12).
[0117] Tn5-DICE was constructed so that upon induction with Cre
recombinase, the insertion is resolved at the loxP sites. The
kanamycin and Tn5-transposase cassettes are segregated to
non-replicating loops and lost. When the insertion is in-frame to a
gene, the 49 amino acid resolved product creates a fusion protein
carrying the SIINFEKL (SEQ ID NO 6) epitope (FIG. 2).
[0118] An E. coli donor strain (ATCC; 53323), containing both an F'
plasmid and the Tn5-DICE bearing plasmid, pDE510 (tra-/mob-) (FIG.
3A) was mated with a nalidixic acid-resistant Salmonella
typhimurium strain (ATCC No. 14028). The bacteria were mated by
incubating together at a 1:1 ratio in Luria-Bertani broth at
37.degree. C. for 12 hrs. Nalidixic acid and kanamycin resistant
Salmonella transconjugants, which contain both the F' plasmid and
the Tn5-DICE bearing plasmid, pDE510(F'::Tn5-DICE), were isolated.
The presence of F'::Tn5-DICE was confirmed using a P22 sensitivity
test (Miller J. H. Experiments in Molecular Genetics Cold Spring
Harbor Laboratory Press (1972)) and by the ability to transfer the
transposon kanamycin marker back into E. coli or Salmonella
recipients at a frequency equal to F' plasmid transfer frequencies.
This is a control experiment to insure that the insertion is truly
on the F' plasmid. The F' plasmid transfers at a specific
frequency. If the transposable element is carried on the F'
plasmid, then it should be re-transferable to a new recipient at a
rate equal to that of the initial mating.
[0119] The Salmonella-specific bacteriophage, P22 (HTint) (ATCC,
19585-B1), was used to make a pooled (meaning that a donor culture
of Salmonella strains carrying the F' plasmid with the transposon
insertion is used to make a phage lysate) lysate of the S.
typhimurium transconjugants carrying F'::Tn5DICE. P22 transduction
is a frequently used method of transferring genetic markers between
Salmonella strains. Because there is no sequence homology to F' in
Salmonella, the P22 phage lysate was used to mutagenize a second
Salmonella recipient (ATCC 14028), Salmonella strain containing
pBAD33cre. The lack of F' homology in the recipient insured that
kanamycin resistant transductants derived as a result of
transposition rather than homologous recombination. Transductants
were selected by kanamycin resistance (30 .mu.g/ml) on Luria agar.
The Cre recombinase in pBAD33cre (FIG. 3B) is under tight
regulatory control of the pBAD promoter and mediates resolution and
loss of the kanamycin resistance gene and the Tn5 transposase gene
only when the strain is grown in the presence of arabinose (1 mM).
The pBAD33cre plasmid is unstable and is lost in 3-10 generations
when Salmonella strains bearing this plasmid are grown without
selection.
[0120] The Salmonella-specific bacteriophage, P22 (HTint) was used
to make a pooled lysate of the S. typhimurium transconjugants
carrying F'::Tn5-DICE (a donor culture of Salmonella strains
carrying the F' plasmid with the transposon insertion was used to
make a phage lysate). Because there is no sequence homology to F'
in Salmonella, the P22 phage lysate was used to mutagenize a second
Salmonella recipient, Salmonella strain containing pBAD33cre, (ATCC
14028). The plasmid pBAD33cre was constructed as follows.
Cre-recombinase was cloned by PCR amplification from the
cre-recombinase expressing Eschericia coli strain NS2114 (Seifert,
et al., Proc. Natl. Acad. Sci. 83:735-40 (1986)). A ClaI-HindeIII
digest of the sub-cloned cre-recombinase gene was cloned into a
ClaI-HindeIII digest of the arabinose-inducible plasmid pBAD33
(Guzman, et. al., J. Bacteriol. 177(14):4121-30 (1995)).
[0121] The lack of F' homology in the recipient insured that
kanamycin resistant transductants derived as a result of
transposition rather than homologous recombination. Transductants
were selected by kanamycin resistance (30 .mu.g/ml) on Luria agar.
The Cre recombinase in pBAD33cre (FIG. 3B) is under tight
regulatory control of the pBAD promoter and mediates resolution and
loss of the kanamycin resistance gene and the Tn5 transposase gene
only when the strain is grown in the presence of arabinose (1 mM).
The pBAD33cre plasmid is unstable and is lost in 3-10 generations
when Salmonella strains bearing this plasmid are grown without
selection.
EXAMPLE 3
Identification of Strains Containing DICE Insertions
[0122] The pool of S. typhimurium mutants generated in EXAMPLE 1
was enriched for in-frame insertions of the resolved Tn5-DICE
transposon within genes encoding secreted effector proteins by
fluorescence activated cell sorting (FACS). If Tn5-DICE were
randomly integrated, approximately 1/6 (20,000) mutants of the
120,000 independent Tn5-DICE insertions generated should contain
resolved in-frame insertions. Of these, many insertions will be in
metabolic genes that may be essential. In addition, many insertions
will be in promoter or non-coding intergenic regions. Of the
remaining mutants, far fewer will be contained within CAPs. The
precise number of CAPs in S. typhimurium is unknown. Since DICE
insertions within CAPs may be rare events, a sensitive selection
procedure was required. With the appropriate cell marker, FACS
enabled the isolation of extremely rare mutants.
Infection of Macrophages
[0123] Femurs were harvested from 4-6 week old C57B1/6 mice
(H-2Kb). Bone marrow cells were extracted by ravaging each end of
the femur with a 3 cc syringe containing a 30 gauge needle and 2
mls of RPMI. The bone marrow cells were washed three-times with
RPMI at 37.degree. C. and resuspended at 1.times.10.sup.6 cells/ml
in RPMI 1640/10% EBS containing 20% L929 media as a source of
Granulocyte Macrophage Colony Stimulating Factor (GM-CSF). L929
media was derived by growing L929 cells (murine fibrosarcoma,
American Type Culture Collection, Mannassas, Va.) and subsequently
harvesting the media seven days after growing cells to confluence.
The cultures differentiated into bone marrow derived macrophages
(BMDM) by culturing the bone marrow cells for six days at
37.degree. C., 5% CO.sub.2. BMDM were resuspended in RPMI 1640/10%
FBS and seeded into 6-well plates at 1.times.10.sup.7 cells per
well.
[0124] The pooled Tn-5 resolved SIINFEKL (SEQ ID NO 6) library (S.
typhimurium) generated in EXAMPLE 1 was used to infect BMDM cells.
An extensive library of independent insertions of the Tn5-DICE
transposon was generated to insure that each gene encoded by S.
typhimurium received multiple "hits." The pooled library was grown
overnight in Luria broth (LB) at 37.degree. C. with shaking. The
pooled library was washed three-times in RPMI 1640 and suspended in
RPMI at 5.times.10.sup.8 cells/ml. The resuspended library (20
.mu.l) was dispensed into individual wells containing adhered BMDM
cells (MOI=1). A MOI of one or less limits multiple infections
within the same BMDM. A 1% infection rate is expected for S.
typhimurium in vitro. Cultures were centrifuged for two minutes at
200 rpm to initiate contact and subsequently incubated at
37.degree. C. for one hour. The cultures were washed three times
with 37.degree. C. phosphate buffered saline (PBS, pH 7.4,9 g/l
NaCl; 0.144 g/l KH.sub.2PO.sub.4; 0.795 g/l Na.sub.2HPO.sub.4). The
cultures were overlayed with three mls of RPMI 1640/10% FBS
containing 50 .mu.g/ml gentamycin to kill extracellular bacteria,
then incubated at 37.degree. C. for two hours. The cultures were
washed three times with 37.degree. C. PBS and the cells scraped
from the plate, resuspended in 10 mls of RPMI 1640/1% FBS, and
incubated on ice.
FACS Analysis
[0125] The BMDM cells were incubated with FITC-conjugated anti-H-2
Db and biotinylated anti-H-2K.sup.b/SIINFEKL (5 .mu.g 25-D1.2). The
H-2/K.sup.b/SIINFEKL-specific antibody (25-D1.2) was available from
R. Germain, National Institutes of Health. The I-Ab
ASFEAQGALANIAVDKA-specific antibody (Y-ae) was a gift from Dr.
Leszek Ignatowicz at the Institute of Molecular Medicine and
Genetics, Medical College of Georgia, Augusta, Ga.). Cells were
labeled with antibody for 30 min at 4.degree. C.
Anti-H-2K.sup.b/SIINFEKL, a monoclonal antibody only recognizes the
SIINFEKL epitope (SEQ ID NO 6); Porgador, et al., Immunity 6(6):
715-26 (1997)) when it is complexed with the class-I restrictive
element H-2K.sup.b. Since neither BMDM cells nor wild-type
Salmonella manufacture this peptide, the infecting Salmonella
strain containing the resolved insertion is the source of the (SEQ
ID NO 6) epitope. Cells were washed three-times in 4.degree. C. PBS
and incubated with one .mu.g phycoerythrin (PE) conjugated
streptavidin (Caltag).
[0126] FACS analysis was used to identify and isolate
Salmonella-infected macrophages that contained in-frame resolved
transposon insertions within genes having access to the class-I
antigen processing and presentation pathway of the macrophage. BMDM
infected with the Salmonella-DICE library were sorted by first
gating on the forward and side scatter population characteristic
for macrophages. Bright red (PE-anti-H-2K.sup.b/SIINFEKL) and
bright green (FITC-conjugated anti-H-2 D.sup.b) populations,
visualized in the double positive quadrant, were sorted into a five
ml polypropylene tube containing two mls of RPMI 1640/1% FBS. The
sorted cells were centrifuged, lysed in LB/1% Triton X-100, then
plated on LB agar and incubated at 37.degree. C. overnight to
recover Salmonella-DICE strains.
[0127] Infected BMDMs lacking CAP insertions can be recovered as a
consequence of aggregate formation in the flow sorted population.
To ensure that recovery was due to phenotypic expression of
H-2K.sup.b/SIINFEKL, the recovered bacterial colonies were counted,
pooled, and subjected to two additional rounds of FACS sorting to
enrich for Salmonella mutants containing CAP insertions. Individual
isolates were subjected to an additional round of FACS analysis to
confirm their phenotype. Salmonella infecting the double positive
BMDM were removed and grown for confirmation and sequencing.
EXAMPLE 4
Sequencing of CAP Genes
[0128] To determine the identity of CAPs containing in-frame
SIINFEKL (SEQ ID NO 6) insertions, a unique system allowing
specific and efficient identification of CAP genes was developed
(FIG. 4). The system was also used to efficiently retransduce
Tn5-DICE mutants and reconfirm their phenotypes. A KpnI-SacI
fragment of a plasmid carrying the resolved Tn5-DICE transposon
(pAV353a) was cloned into an ampicillin-resistant suicide vector,
pGP704, to yield plasmid pAV353 (FIG. 4A).
[0129] Plasmid pAV353 (amp.sup.r tra.sup.+ mob.sup.+) was
transformed into E. coli S 17.lamda.pir (Kinder, S. A. et al. Gene
136, 271-5 (1993) an ampicillin resistant, nalidixic acid sensitive
donor strain, and conjugated into spontaneous naladixic acid
resistant, Cre expressing S. typhimurium Tn5-DICE mutant CAP
mutants containing pBAD33cre. Transconjugants (amp.sup.r nal.sup.r)
carrying an integrated copy of plasmid pAV353 at the chromosomal
loxP site were selected following induction of the Cre recombinase,
by selecting naladixic acid and ampicillin resistant
transconjugants (FIG. 4B).
[0130] Chromosomal DNA was isolated, digested for 2 hours at
37.degree. C. with one of several possible restriction
endonucleases (see FIG. 4A), to allow cloning of either 5'- or
3'-DNA sequences flanking the original SIINFEKL (SEQ ID NO 6)
insertion. Digested DNA was absorbed over a DNA purification column
to remove the restriction endonuclease, and ligated overnight at
15.degree. C. Ampicillin resistant transformants were further
analyzed using Tn5-DICE specific primers
5'-GCGGATATCCACCACCACCACC-3' (ClaI, SalI, XhoI, or KpnI digests) or
5'-TATGCCCGGGCCGTGGTGGTGG-3' (EcoRI, SacI digests).
[0131] Upon transformation into E. coli S17.lamda.pir, re-ligated
circular fragments containing pAV353 form functional replicons
resulting in ampicillin-resistant transformants. Re-ligated
chromosomal fragments carrying the integrated plasmid pAV353 form
functional replicons in E. coli S17.lamda.pir and carry either
3'--(i.e. SalI) or 5'--(i.e. EcoRI) sequences flanking the original
SIINFEKL (SEQ ID NO 6) insertion (FIG. 4C). Ampicillin-resistant
transformants were further analyzed using Tn5-DICE specific primers
5'-GCGGATATCCACCACCACCACC-3' (ClaI, SalI, XhoI, or KpnI digests)
(SEQ ID NO 1) or 5'-TATGCCCGGGCCGTGGTGGTGG-3' (EcoRI, SacI digests)
(SEQ ID NO 2).
[0132] As shown in Table 1, the Tn5-DICE transposon (FIG. 2)
enabled the identification of class-1-MHC-accessible S. typhimurium
proteins in both macrophages and an intestinal epithelium cell line
(see EXAMPLE 4). S. typhimurium proteins not predicted to reach the
class I pathway of the host cell were identified. In addition, in
at least one instance, a bacterial effector protein unique to S.
typhimurium secreted into the cytoplasm of the host cell has been
identified (LS28). Characterization of the immune response to each
CAP identified may enable the construction of highly specific
carrier vaccines, allowing immune responses to be tailored to the
life cycle of specific pathogens. TABLE-US-00002 TABLE 1 Salmonella
genes identified by DICE Strain Gene Comp.* Bacteria CMT-93
Function/Homology LS28 ams** S S.t., S. typhi + Protease IV SIIN16
argT P S.t., S. typhi, E.c. - Arginine Transport SIIN17 fhuA P
S.t., S. typhi, E.c - Iron Transport SIIN27 S2OMP OMP S.t., S.
typhi, E.c, K..p. - Outer Membrane Protein SIIN15 htpG S? S.t., S.
typhi, E.c + High Temperature Heat Shock Protein SIIN29 hemK C
S.t., S. typhi, E.c - Heme Biosynthesis SIIN50 ims75 S S.t., S.
typhi + impaired macrophage survival, MIP SIIN61 ORF S S.t., S.
typhi + Unknown SIIN71 hemL C S.t., S. typhi, E.c - Heme
Biosynthesis S.t. = Salmonella typhimurium; S. typhi = Salmonella
typhi; E.c. = E. coli
EXAMPLE 5
Confirmation of the DICE Method
[0133] To confirm the validity of the DICE screen, several studies
were performed to insure that the CAP epitope identified was
present on the surface of the antigen presenting cell (APC) and
that mutants were able to stimulate T-cell specific immunity. In
addition, the route of antigen delivery was investigated to
determine if proteins delivered by DICE mutants were accessible to
the class-I MHC pathway by an alternate antigen processing and
presentation pathway or directly into the endogenous pathway by
translocation across the phago-lysosomal barrier.
Fluorescence Microscopy
[0134] The Salmonella DICE strain LS28 was transfected with a
plasmid which constitutively expresses green fluorescence protein
(GFP). This strain (LS28GFP) of a resolved S. typhimurium/SIINFEKL
was used to infect H-2K.sup.b restricted BMDM in vitro and then
fluorescently labeled using the monoclonal antibody 25-D1.2 using
the methods described in EXAMPLE 2. The infected BMDM cells were
imaged using wide field fluorescence imaging. H-2K.sup.b/SIINFEKL
complexes were observed on the cell surface, demonstrating that
BMDM derived the SIINFEKL epitope (SEQ ID NO 6) from LS28GFP.
[0135] To examine the route of antigen processing, several of the
isolated DICE mutants were used to infect the H-2K.sup.b restricted
murine intestinal epithelial line CMT-93 (ATCC, Manassas, Va.
catalog number CCL-223). CMT-93 cannot present antigen delivered by
Salmonella when the ovalbumin epitope is expressed intracellularly
within the bacteria, suggesting that CMT-93 cells do not contain an
alternate antigen processing pathway. The most likely explanation
for CMT-93 presentation of SIINFEKL (SEQ ID NO 6) on its cell
surface is that the epitope was delivered directly to the
endogenous pathway as a fusion with a type III secreted
protein.
[0136] The H-2K.sup.b/SIINFEKL specific CD8.sup.+T-cell hybridoma
B3Z (Karttunen, et al., Proceedings of the National Academy of
Sciences 89:6020-24 (1992)) is a reporter cell which turns blue
when it encounters its ligand. B3Z was used as an indicator of the
presence of the H-2K.sup.b/SIINFEKL complex on the surface of
CMT-93. The presence of blue B3Z cells indicates that the
H-2K.sup.b/SIINFEKL complex is recognized by a specific T-cell
receptor and is delivered by a bacterial protein.
[0137] Monolayers of CMT-93 cells (3.times.10.sup.4 cells/well)
were infected with LS28 at an MOI of I in a 96 well tissue culture
plate. Cultures were incubated at 37.degree. C. for one hour,
washed of non-invasive Salmonella, and overlayed with fresh media
containing gentamycin (50 .mu.g/ml). The cultures were overlayed
with 3.times.10.sup.4 cells/well of B3Z cells and centrifuged to
initiate cell-to-cell contact. The cultures were incubated at
37.degree. C. for six hours, then each well was washed, fixed (2%
formaldehyde/0.2% glutaraldehyde) and incubated in developing
buffer (1 mg/ml X-gal; 5 mM K.sub.3Fe(CN).sub.6; 5 mM
K.sub.4Fe(CN).sub.63H.sub.2O; 2 mM MgCl.sub.2). The cells were
imaged using light microscopy. The presence of blue B3Z cells
indicates that the SIINFEKL epitope is being targeted directly to
the cytoplasm of the host cell. This data is significant because it
indicates that Salmonella is using a translocation apparatus to
target these proteins into the cytoplasm. These data indicate that
access to the class-I MHC pathway by Salmonella is cell type
dependent.
[0138] To confirm that the stimulation of B3Z was specific
(stimulation of T-cell specific immunity only when B3Z encounters
CMT-93 cells infected with Salmonella), similar experiments were
performed using wide-field fluorescence microscopy to visualize the
CMT-93:B3Z interaction. CMT-93 cells (2.times.10.sup.5/well,
chambered coverglass #1.5) were infected with LS28GFP (37.degree.
C., 1 hour, MOI=10), overlayed with media containing gentamycin (50
.mu.g/ml). The cultures were seeded with B3Z T-cell hybridomas
(2.times.10.sup.5 cells) and incubated at 37.degree. C. for 12
hours. The cultures were washed three-times with PBS, fluorescent
stained for cell membranes (TMA-DPH, Molecular Probes) and
.beta.-galactosidase (C.sub.12FDG, Molecular Probes), and
visualized on an Advanced Precision Instruments deconvolution
microscope. Stimulation of B3Z was due to cognate interaction of
B3Z with infected CMT-93. The results provide visual evidence of
bacterial protein translocation. These results demonstrate that
DICE analysis can be used to isolate proteins having direct access
to the class-I MHC pathway of the host cell, which is cell type
specific. In addition, DICE strains stimulate a specific T-cell
response, due to the presence of the DICE strain.
.beta.-Galactosidase Assay
[0139] The ability of infected cells to present antigen to a T-cell
reporter was also assayed using a .beta.-galactosidase assay. The
T-cell reporter is a T-cell hybridoma (a fusion between a T-cell
and a tumor cell) that recognizes the SIINFEKL epitope when
presented in the context of the class I MHC allele H-2K.sup.b. When
the T-cell encounters the SIINFEKL/H-2K.sup.b complex, it initiates
synthesis of .beta.-galactosidase. When incubated in the presence
of a substrate (X-gal), the cell turns blue. The cell will turn
blue only if this specific interaction has occurred.
H-2K.sup.b-restricted epithelial cells (ATCC No. CCL-223) were
infected with several Salmonella strains isolated by flow
cytometric analysis using the methods described above in EXAMPLE 2.
The cells were then infected with 1.times.10.sup.7 CFU (MOI=100) of
each of several DICE mutants isolated as in EXAMPLE 2. After 1 hr
at 37.degree. C., the wells were washed 3.times. with phosphate
buffered saline (PBS) and overlayed with 1.times.10.sup.5 B3Z
cells. Cell to cell contact was initiated by centrifuging at
200.times.g for 2 minutes. The cultures were incubated at
37.degree. C./5% CO.sub.2 for 6 hrs. The cells were washed 3.times.
with PBS and fixed in a solution of PBS containing 1% formaldehyde
and 0.2% glutaraldehyde for 5 minutes at 4.degree. C. The cells
were then overlayed with a solution of PBS containing 1 mg/ml
X-gal, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide,
and 2 mM MgCl.sub.2. The cells were allowed to incubate at
37.degree. C. overnight and examined microscopically for the
presence of blue cells.
[0140] Several of the Salmonella clones turned blue, demonstrating
that the SIINFEKL epitope is actively directed across the
phagolysosomal border by Salmonella after infection and is
processed into the class I MHC pathway.
EXAMPLE 6
In Vivo T-cell Immunity
[0141] Access to the endogenous pathway of the host cell infers
access to the class-I MHC processing and presentation pathway of
the host. Vaccines that carry antigens within CAPs should be able
to stimulate antigen-specific cell-mediated immune responses. In
vivo T-cell immunity to these antigens is the best measure of the
ability of these vaccines to stimulate appropriate responses.
[0142] C57B1/6 mice were orally immunized with several DICE
strains. Briefly, female C57B1/6 mice (6-8 weeks old) were
immunized by oral gavage with 1.times.10.sup.7 CFU of each
Salmonella DICE mutant.
[0143] The ability of these strains to stimulate T-cell responses
in vivo can be assessed by traditional CTL assays,
H-2K.sup.b/SIINFEKL tetramer analysis (using K.sup.b/SIINFEKL
tetramers obtained from the NIH AIDS Reagent Program), and tumor
protection assays. This combination of measurements of T-cell
immunity is used to confirm both the stimulation of
antigen-specific T-cell populations and whether these T-cells are
functional. The H-2K.sup.b/SIINFEKL tetramers provide an extremely
sensitive method of assessing the effect of vaccination upon the
T-cell population in the immunized animal. A positive effect would
be manifested by an increase in total antigen-specific T-cells
after immunization. An increase in antigen-specific T-cells
following immunization however tells little about the functionality
of these cells. If you have stimulated an antigen-specific
population by immunization, the vaccine would be poorly constructed
if the stimulated cells could not kill their targets. The CTL
assays provide a necessary and accurate measure of the
functionality of the antigen-specific T-cell population. Tumor
cells which express the SIINFEKL epitope are used as targets for
the assay. If the vaccine stimulates an antigen-specific T-cell
population and these cells are able to efficiently kill their
targets, then the vaccine can be considered to effectively engender
a protective immune response.
EXAMPLE 7
Construction of a Heterologous Antigen Breast Cancer Vaccine
[0144] The transposable elements of the present invention allow for
rapid identification of CAPs, which may serve as beneficial targets
for vaccine development. Since CAPs have access to the host immune
system, vaccines against viruses, bacteria, and cancer can be
constructed using CAPs as vaccine carriers that target protective
epitopes (for example pieces of proteins from foreign infectious
agents or cancer cells) directly to the cytoplasmic compartment of
APCs. Access to the class I or class II pathway of the host cell
indicates that many proteins may serve as attractive vaccine
targets. Heterologous antigen expressed by Salmonella vaccine
strains may induce a protective immune response in animals and
humans. Heterologous antigen-specific immunity can consist of both
local and systemic Th1 or Th2 type immune responses.
[0145] HLA-A2-restricted epitopes derived from HER2/neu deposited
directly into the cytoplasmic compartment of the APC by CAPs may
result in better MHC class I presentation, thus greatly enhancing
induction of cell-mediated immunity. Her2/neu is an epidermal
growth factor-like protein whose upregulation is associated with a
variety of cancers of the breast and other tissues. Engendering a
strong and persistent cellular immune response is essential for
protective immunity to tumors such as HER2/neu-elevated breast
cancer. This example describes the construction and delivery of
HER2/neu/SOB (HER2/neu/String of Beads) insertions throughout the
chromosome of S. typhimurium, using a variant of the Tn5-DICE
transposon shown in FIG. 2.
HER2/neu/SOB Library Construction
[0146] A transposon system was developed to generate a library of
epitope insertions containing the HLA-A2-restricted HER2/neu
epitopes (FIG. 5). HER2/neu/SOB carries a 6.times.-histidine site,
the HLA-A2-restricted HTLV-1 tax epitope LLFGYPVYV and three HLA-A2
restricted HER2/neu epitopes HE2/neU.sub.(369-377),
HER2/neu.sub.(773-782), and HER2/neu.sub.(654-662). Resolved
in-frame insertions of Tn5-HER2/neu/SOB creates an 81 amino acid
product encoding each epitope.
[0147] Initially, wild-type S. typhimurium (strain 14028s) is used
to avoid possible interaction between the attenuating mutation and
the DICE insertions. The DICE insertion in the strains that present
antigen best are transduced into, for example, three other strain
backgrounds to test their immune response in HLA-A2.1 transgenic
mice. Attenuated strains will contain mutations in aroA. AroA is an
enzyme involved in the biosynthetic pathway for Aromatic amino
acids. Mutations in the aroA locus severely attenuate Salmonella
vaccine strains thereby diminishing the ability of the vaccine
strain to disseminate and cause disease. Alternatively, attenuated
strains CL401 or CL553 can be used (two Salmonella typhimurium
strains shown in our lab to be severely attenuated for virulence.
The location of the mutations are unknown). aroA can be used
because mutations in aromatic amino acid biosynthesis are used in
CV908 (a Salmonella typhi vaccine strain) that appears to be one of
the best S. typhi vaccines.
[0148] Using the methods described above in EXAMPLES 1-3, P22, is
used to make a lysate of the Salmonella strain containing
F'::HER2/neu/SOB. The pool of S. typhimurium mutants are enriched
for in-frame insertions of the HER2/neu/SOB cassette within CAPs by
FACS as described above, with modifications noted below.
Identification of Salmonella Isolates Able to Facilitate HTL V1tax
Class I Presentation
[0149] Salmonella SOB-containing proteins that direct peptides into
the class I pathway from a library of Salmonella strains which
contain the SOB peptide can be identified using a monoclonal
antibody specific to HTLV1tax/A2.1.
[0150] BMDM isolated from H-2K.sup.b/HLA-A2.sup.+ transgenic mice
(C57B1/6 background) are seeded onto 6-well tissue culture plates
(1.times.10.sup.7 cells/well) and infected with the pooled S.
typhimurium/HIV-1/SOB library (37.degree. C., MOI=10). After one
hour, the cells are washed, overlayed with RPMI 1640/10% FBS
(gentamycin, 50 .mu.g/ml), and incubated for 2 hours (37.degree.
C.). The cells are harvested, washed, and suspended in 10 ml RPMI
1640/1% FBS. The BMDM are labeled with FITC-conjugated
anti-H-2D.sup.b (Caltag) and biotinylated A6-TCR chimeric
antibodies (a chimeric antibody which recognizes HLA-A2 complexed
with the HTLV-1tax epitope LLFGYPVYV (obtained from Dr. Jonathan
Schneck, Johns Hopkins University; O'Herrin, et. al., Journal of
Experimental Medicine 186(8):133345) to tag class I-expressing
cells presenting the tax peptide in the context of HLA-A2. The
biotinylated A6-TCR is subsequently labeled with PE-streptavidin
(Caltag). The BMDM are re-suspended in RPMI 1640/1% FBS (4.degree.
C.) and sorted using FACS analysis by gating on populations
expressing both H-2D.sup.b and A6-TCR. Bacteria recovered from the
sorted cells, are pelleted and lysed in LB broth containing 1%
triton X-100 followed by plating on LB-agar as described above in
EXAMPLE 2.
[0151] To identify the gene carrying the in-frame HER2/neu/SOB
insertion, a DNA template for sequence analysis is generated using
a variation of the TAIL PCR method (see EXAMPLE 3). This method
employs the use of sequential, tandem oligonucleotides that prime
within the resolved HER2/neu/SOB insertion and amplifies epitope
insertions thus identifying the region flanking the insertion. The
entire cycling procedure is performed sequentially as a series of
primary, secondary and tertiary reaction conditions. The primary
and secondary conditions are performed in volumes of 100 .mu.l. All
cycling conditions are as published (Liu and Whittier, 1995).
Briefly, This method utilizes a complex array of melting and
annealing procedures to determine the sequence flanking the
insertion. To accomplish this, three tandem primers are used to
"walk" down the insertion and amplify from a fourth random primer.
After amplification, the fragment is gel purified and cloned into a
sequencing vector.
[0152] Alternatively, chromosomal preparations are made from each
isolated bacterium containing a CAP insertion. 1 .mu.g of the
chromosome is digested with the restriction enzyme pstl for 1 hr at
37.degree. C. and then purified. The chromosome is then ligated by
the addition of ligase overnight at 15.degree. C. The circularized
mix is then subjected to inverse PCR using the primers
CTACTAGTATGGATGGTGTC and CTAGAACCAGAT GTGTATAAG. The PCR mix is as
follows: 1 mM each primer, 10 ng template, 0.2 mM dNTP (dATP, dCTP,
dGTP, dTTP), 0.5 U Taq polymerase, 10 .mu.l 10.times.PCR buffer, 1
mM MgCl.sub.2, and H.sub.2O to 100 .mu.l. Cycling conditions are
melting: 95.degree. C., 30s; annealing: 55.degree. C., 1 min;
extension: 72.degree. C., 3 min; 35 cycles.
EXAMPLE 8
Characterization of Heterologous Antigen Breast Cancer Vaccines
[0153] After the construction of the S. typhimurium/HER2/neu
vaccine strain described in EXAMPLE 7, the ability of the vaccine
to induce epitope-specific, cell-mediated immune responses in
HLA-A2 transgenic mice is characterized and quantified. An
advantage of the Salmonella vaccine system is that there is a
relevant small animal model, the mouse, in which to evaluate the
safety and efficacy of the vaccine constructs developed.
[0154] Vaccine candidates can be chosen based upon criteria such
as: 1) genes encoding CAPs proteins must be conserved between S.
typhimurium and S. typhi (as judged from the Salmonella genome
projects); and 2) CAPs carrying epitope insertions must be
recoverable upon repeated independent flow sorts. In previous
experiments, all strains containing gene insertions that resulted
in presentation of SIINFEKL in H-2K.sup.b were recovered a second
time. Other criteria may also be used.
[0155] S. typhimurium HER2/neu/SOB vaccine strains isolated in
EXAMPLE 7 are used to orally immunize K.sup.b/HLA-A2 transgenic
mice. The mice were immunized by oral gavage with 1.times.10.sup.7
infectious units of Salmonella. The response generated from each
vaccine is subsequently analyzed using the following methods.
HLA-Tetramer Construction and Analysis of Epitope-Specific
T-Cells
[0156] The T-cell response to vaccination may, for example, be
initially assessed by HLA-tetramer analysis of T-cell populations
derived from the spleens and mesenteric lymph nodes of vaccinated,
sham vaccinated, and unvaccinated HLA-A2 transgenic mice. The
HLA-A2 transgenic mice utilized were from Dr. Linda Sherman,
Scripps Institute, LaJolla, Calif. To assess the class I response
to each HER2/neu epitope, HLA-A2 tetramers containing each HER2/neu
epitope plus one irrelevant control are used. HLA-A2 and
.beta.2-microglobulin expressing plasmids can be obtained from Dr.
John Altman, Emory University. Conversely, tetramers are available
from the Aids Reagent Repository at the National Institutes of
Health, Bethesda Md. Freshly isolated spleen cells and cells
derived from mesenteric lymph nodes from K.sup.b/HLA-A2 mice
immunized with each S. typhimurium HER2/neu/SOB vaccine are labeled
with FITC-conjugated anti-CD8 and each respective PE labeled HLA-A2
tetramer. Specifically, 1.times.10.sup.6 cells are labeled with 1
.mu.g of each respective tetramer and 5 .mu.g of anti-CD8 antibody
for 30 min at 4.degree. C. The effector status of the tetramer
positive CD8 populations are further characterized by assessing the
level of expression of CD28, CD44, and CD62. These markers are
hallmarks of the state of differentiation of the effector cells.
Each cell population will be labeled with 1 .mu.g of each
respective marker for 30 min at 4.degree. C. The
CD8.sup.+/CD44to/CD62.sup.+ phenotype correlates with a memory
population of splenic effector cells. From this data, the nature of
the cellular response to vaccination is characterized. Ideal
vaccine candidates should yield a strong memory CTL population that
is capable of rapid upregulation after restimulation by the
infectious agent the vaccine was designed for.
CTL Lysis of HIV Epitope Expressing Targets
[0157] Epitope-specific T-cells resulting from vaccination of
K.sup.b/HLA-A2 transgenic mice with tumor epitopes are capable of
mediating killing of human HLA-A2.sup.+ tumor targets. To assess
the ability of Salmonella vaccine strains to generate
HER2/neu-specific CTLs, assays designed to measure the lytic
capacity of the CTL population generated as a result of vaccination
can be used. To measure specific immune response to HER2/neu, a
chromium release assay can be used to measure the ability of CTLs
generated in vaccinated mice to kill HER2/neu elevated,
HLA-A2.sup.+ tumor targets derived from the Oregon Health Sciences
University tumor bank. The chromium release assay is a standard
method used for the determination of the ability of activated
cytotoxic T-cells to kill their targets. Briefly, target cells are
loaded with Cr.sup.51, washed, and incubated with T-cells at
effector to target ratios ranging from 1:1 to 1:10,000. Killing is
a measure of the amount of radioactive chromium released into the
culture supernatent at various times after incubation. Spleens from
naive and infected animals are removed from mice 14-49 days post
infection, and splenic cells collected for tetramer analysis and
CTL assays. Secondary stimulation may be necessary before a CTL
response is observed. T1 (HLA-A2.sup.+-H-2.sup.d) target cells
loaded with either an individual HLA-A2-restricted HER2/neu epitope
or one irrelevant epitope can be used. T1-cells are good secondary
stimulators because they express large amounts of HLA-A2 and can be
easily loaded with HLA-A2-restricted epitopes. Alternative methods
of stimulation include incubation with Concanavalin A or through
the T cell receptor using anti-CD3 antibodies. Concanavalin A is a
plant mitogen that broadly stimulates T-cells. Anti-CD3 similarly
stimulates T-cells my mimicking interaction with an antigen
presenting cell. HLA-A2 tetramer positive T-cell clones for each
individual epitope can be isolated and preserved.
EXAMPLE 9
Construction of a Heterologous Antigen HIV Vaccine
[0158] An HIV-1 vaccine was constructed using a modified version of
Tn5-DICE. As shown in FIG. 6, the vaccine, Tn5-HIV1/SOB (human
immunodeficiency virus 1/string of beads) carries a
6.times.-histidine site, the HLA-A2-restricted HTLV-I tax epitope,
and five HLA-A2-restricted HIV-1 epitopes (p17.sub.77-85;
p24.sub.193-203; RT.sub.267-277; gp160.sub.313-322; and
nef.sub.71-80). Resolved in-frame insertions of Tn5-HIV1/SOB create
a 109 amino acid product encoding each epitope.
[0159] The Tn5-HIV1/SOB construct was transferred to a Nal.sup.r
Salmonella recipient by conjugation, and P22 was used to make a
pooled lysate, using the methods described in EXAMPLES 1 and 6.
Phage lysates were used to mutagenize S. typhimurium (wild-type
strain 14028s) and S. typhi (Ty21a vaccine strain). Salmonella
molecules which elicit appropriate CTL responses are selected and
tested further for their ability to engender protective immune
responses. Two measures of effectiveness may be considered in
assessing the efficacy of these vaccines. First, are the vaccines
able to elicit a protective response against cells expressing the
epitopes? Second, do these vaccines elicit a protective response
against a viral challenge? Variations on the methods outlined above
will be used to assess the efficacy of the vaccine both in vitro
and in vivo.
EXAMPLE 10
Construction of DICE-I and DICE-II Transposomes
[0160] The Tn5-DICE transposon shown in FIG. 2 can be engineered to
accept a variety of different elements. For example, transposomes
which can be used to identify Salmonella proteins (or those from a
variety of infectious bacterial agents described above) which cycle
into the MHC class I or class II (MHC, HLA) pathway can be
generated. Examples of transposomes which can be used to identify
Salmonella proteins which cycle into the MHC class I or class II
pathway include DICE I (FIG. 7) and DICE II (FIG. 8), respectively.
The original Tn5-based DICE transposon was modified in DICE-I and
DICE-II by removing the transposase. Removal of transposase
provides many advantages. It stabilizes the insertion, improves the
efficiency of library construction because many steps in the
process are eliminated, for example the mating step. Removal of the
transposase also increases the range of bacteria in which
transposons can be used. Incorporation of the transposome into the
chromosome of the bacterium can be performed by a simple
electroporation procedure. The transposomes shown in FIGS. 7 and 8
have also have excessive secondary structure remove. These
secondary structures, present in Tn5-DICE, made PCR and cloning
less straightforward. Unique 5' and 3' PCR primer sites have been
added to facilitate inverse PCR. The I- and O-ends were changed to
mosaic sequences to enable efficient transposome construction.
[0161] DICE-I contains the ovalbumin epitope SIINFEKL to identify
bacterial proteins which cycle into the MHC class I pathway.
However, other MHC class I epitopes can be used, for example the
HTLV-1 tax epitope LLFGYPVYV (SEQ ID NO: 7), as well as other
epitopes known in the art.
[0162] DICE II contains an I-A.sup.b restricted T-cell epitope,
ASFEAQGALANIAVDKA (SEQ ID NO 8). However, other MHC class II
restricted epitopes can be used, including the anti-I-A.sup.k/Hen
Egg Lysozyme (HEL.sub.46-61) or the anti-I-A.sup.k/Hen Egg Lysozyme
(HEL.sub.116-129, accession # LZCH) monoclonal antibodies.
[0163] Antigen processing of bacterial antigens is complex and cell
type dependent. Host immunity to bacteria requires both CD8 and CD4
responses. In general, CD8 and CD4 represent separate arms of the
immune response. CD8 cells represent the cellular immune response
and CD4 cells represent the humoral (antibody) immune response.
Antigens that stimulate these responses are processed differently
by the host cell. Since there is more than one pathway for
bacterial antigens to be processed, it makes sense that a better
understanding of host immunity could be acquired by determining the
accessibility of bacterial antigens within each pathway. As such,
tools can be designed for use in methods of studying antigen
processing within the class-II MHC pathway. Such methods allow the
construction of more effective vaccines by allowing the recruitment
of carrier proteins to deliver antigens to the class-II MHC
pathway. The methods are performed similarly to the experiments
detailed above for the class-I MHC pathway, except that MHC II
nucleic acid sequence is included in the transposable element, and
a MHC II specific binding agent is used in the assay.
EXAMPLE 11
Construction of Other Heterologous Antigen Vaccines
[0164] By disseminating epitopes throughout the genome of
Salmonella, potent vaccines can be constructed by identification
and use of carrier proteins that elicit protective immune
responses. Salmonella causes a disseminated infection in several
different tissues. The transposable elements of the present
invention can be used to identify genes expressed in different
tissues, and vaccines can be constructed which tailor the immune
response by using tissue-specific carrier proteins as carriers.
EXAMPLE 12
Alternate Transposable Elements
[0165] Fluorescent Protein Insertions.
[0166] Variants of the Tn5-DICE transposon and the DICE-I and
DICE-II transposomes can be constructed to carry one or more genes
that encode fluorescent proteins. In-frame insertions of this
transposon into a gene will generate a fusion protein that carries
an enhanced fluorescent protein, for example GFP (accession
U55761), and red fluorescent protein (accession U70496). As used
herein, GFP refers to both the wild-type protein, and spectrally
shifted mutants thereof, for example as described in Tsien, 1998,
Ann. Rev. Biochem. 67:509 and in U.S. Pat. Nos. 5,777,079 and
5,625,048 to Tsien and Heim, herein incorporated by reference.
Asparyginyl endopeptidase cleavage sites enable the fluorescent
protein to be cleaved from the fusion product eliminating
conformational distortions and allow the protein to fluoresce. The
GFP gene would be placed within the same location as the I-A.sup.b
restricted T-cell epitope, ASFEAQGALANIAVDKA contained in DICE-II.
The GFP or RFP genes would be modified to remove termination
signals to allow transciptional and translational readthrough after
insertion and resolution.
[0167] Addition of one or more fluorophores may allow the host
bacterial range of the system to be greatly expanded, because it
would enable the identification in vivo of expressed genes by FACS
analysis of tissue homogenates as described in EXAMPLE 2. Protein
products identified by this transposon/transposome variant can be
use to identify efficacious bacterial vaccine antigens in
previously genetically intractable microorganisms that are
pathogenic to humans and animals. These transposon/transposome
variants can be used to identify secreted bacterial antigens by
direct sorting of infected fluorescent host cells.
Customized Effector Proteins.
[0168] Variants of the Tn5-transposon and the DICE-I and DICE-II
transposomes can be generated to engineer bacterial carrier
vaccines to deliver customized host effector molecules. For
instance, by delivering a fragment or an entire host signaling
factor into the host cell after uptake of the vaccine, the immune
response could thus be skewed to a more efficacious response.
Candidate signaling molecules include, but are not limited those in
the Jak/Stat pathway.
[0169] Vaccines having the ability to appropriately bias the immune
response avoid many of the deleterious side effects associated with
traditional vaccines. In addition, vaccines can be constructed to
enable the treatment of acute pathogenic infections. The response
to these types of vaccines would be quick, strong, specific, and
transient. These types of vaccines are desired by the armed forces
as a means of dealing with bio-warfare exposure.
Multivalent Vaccines.
[0170] A variant of the vaccines described in the above examples
that delivers epitopes from more than one organism can be
generated. Salmonella can be used to construct multivalent vaccines
since it is capable of carrying large amounts of accessory DNA
encoding vaccine antigens. The strength of the DICE system lies in
its ability to identify appropriate carrier proteins for
combinations of epitopes.
[0171] Many pathogenic infections potentiate the growth of
additional microorganisms that are different from the primary
infection. Such vaccines can be used as a "one shot" method of
protection.
Host Receptor Delivery.
[0172] Variants of the transposon/transposases that deliver a
molecule that will localize to the surface of the host cell can be
generated. Such constructs have at least two potential uses. First,
they would allow secreted bacterial proteins to be identified after
infection by looking for the presence of the secreted protein on
the surface of the host cell. Second, these variants could deliver
chimeric signaling molecules (molecules which associate to the cell
surface and initiate internal signaling in response to an external
signal). For example, delivering the vaccine then subsequently
activating the response after treatment with a drug. This would
allow antigen to be loaded into an APC and thus augment the immune
response.
Alpha-Omega Complementation.
[0173] Variants of the transposon/transposome that encode the
.alpha.-fragment from .beta.-galactosidase can be generated. Many
bacteria are not amenable to the analysis of secreted proteins
because tools are not available that allow the identification of
secreted genes by their MHC-restriction. This
transposon/transposome variant will enable the bacteria to secrete
fusion proteins that contain the .alpha.-fragment from
.beta.-galactosidase. Secreted proteins can be detected because the
host cell (or a transgenic host animal) expresses the omega
fragment from .beta.-galactosidase. When the secreted
.alpha.-fragment and the host omega fragment come into contact to
form a functional .beta.-galactosidase complex, various enzyme
substrates can be used to visualize the interaction. For instance,
the substrate C.sub.12FDG (Molecular Probes, # I-2904) becomes
fluorescent when cleaved by functional .beta.-galactosidase.
Alternatively, the commonly used substrate X-gal could be used to
visualize active .beta.-galactosidase within a cell. With system,
pathogenesis can be studied in whole animals by looking for the
presence of fluorescent bacteria in different host tissues. In
addition, tissue-specific secretion of bacterial proteins could be
determined and thus enable optimized carrier vaccines that secrete
antigen in appropriate host compartments.
EXAMPLE 13
Other Uses of Transposable Elements
[0174] The transposable elements of the present invention can also
be used to modify vaccine carrier strains of Salmonella to augment
or skew the immune response to the carried antigen by delivering
eukaryotic effector proteins such as Jak2 or Tyk2 as CAP fusions.
Mutants generated by the transposable elements can be used to
identify tissue-specific Salmonella CAPs, potentially useful
proteins for regulating the timing of the immune response to
carried antigens and thus generate immune responses more amenable
to the lifecycle of different pathogens. For instance, JAK2 (a host
kinase) initiates a signaling cascade that ultimately results in
the upregulation of cytokines that enhance the cell-mediated immune
response. In principle, the transposon could be engineered to
deliver JAK2 (or a portion of JAK2) and bias the immune response to
one that is predominately cell mediated.
EXAMPLE 14
Functional Genomics
[0175] Genomic sequencing of pathogens provides valuable insights
into the lifestyle of a variety of different organisms. Data from
these projects however reveal that as much as 40% of genes have no
known function. Therefore, methods are needed to rapidly assign
function to genes identified by genomic projects. Since the
transposable elements of the present invention can be constructed
to carry an affinity tag such as a 6.times. histidine site,
immunolocalization studies can provide valuable insight into the
function of genes identified by genomic sequencing projects.
EXAMPLE 15
Construction of Customized Effector Molecules
[0176] Specific immune responses are generated as a consequence of
a cascade of signal transduction events. DICE identifies proteins
that have access to the cytoplasm of the host cell. DICE technology
can be used to construct customized effector molecules whose
function would be to skew the immune response and generate a
bacterial carrier vaccine appropriate to clearance of the
pathogen.
EXAMPLE 16
Identification of Diagnostic Proteins
[0177] The emergence of new, more virulent bacterial strains,
coupled with the threat of biological terrorism, emphasizes the
need for targets that will allow the rapid and precise
identification of different pathogens. DICE enable the
identification of species-specific genes utilized by the pathogen
during the course of infection.
EXAMPLE 17
Transfer of DNA into Cells
[0178] The transfer of DNA into eukaryotic, in particular human or
other mammalian cells, is now a conventional technique. The vectors
are introduced into the recipient cells as pure DNA (transfection)
by, for example, precipitation with calcium phosphate (Graham and
vander Eb, 1973, Virology 52:466) or strontium phosphate (Brash et
al., 1987, Mol. Cell Biol. 7:2013), electroporation (Neumann et
al., 1982, EMBO J. 1:841), lipofection (Felgner et al., 1987, Proc.
Natl. Acad Sci USA 84:7413), DEAE dextran (McCuthan et al., 1968,
J. Natl. Cancer Inst. 41:351), microinjection (Mueller et al.,
1978, Cell 15:579), protoplast fusion (Schafner, 1980, Proc. Natl.
Acad. Sci. USA 77:2163-7), or pellet guns (Klein et al., 1987,
Nature 327:70). Alternatively, the cDNA can be introduced by
infection with virus vectors. Systems are developed that use, for
example, retroviruses (Bernstein et al., 1985, Gen. Engrg. 7:235),
adenoviruses (Ahmad et al., 1986, J. Virol. 57:267), or Herpes
virus (Spaete et al., 1982, Cell 30:295).
EXAMPLE 18
Sequence Variants of Transposable Elements
[0179] Having presented a format of the transposable elements of
the present invention, and the sequence of DICE-I and DICE-II, this
invention now also facilitates the creation of DNA molecules, and
thereby proteins, which are derived from those disclosed but which
vary in their precise nucleotide or amino acid sequence from those
disclosed. Such variants may be obtained through a combination of
standard molecular biology laboratory techniques and the nucleotide
sequence information disclosed by this invention.
[0180] DNA sequences can be manipulated with standard procedures
such as restriction enzyme digestion, fill-in with DNA polymerase,
deletion by exonuclease, extension by terminal deoxynucleotide
transferase, ligation of synthetic or cloned DNA sequences,
site-directed sequence-alteration via single-stranded bacteriophage
intermediate or with the use of specific oligonucleotides in
combination with PCR.
[0181] Variant DNA molecules include those created by standard DNA
mutagenesis techniques, for example, M113 primer mutagenesis.
Details of these techniques are provided in Sambrook et al. (In:
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.,
1989, Ch. 15, herein incorporated by reference). By the use of such
techniques, variants may be created which differ in minor ways from
those disclosed. DNA molecules and nucleotide sequences which are
derivatives of those specifically disclosed herein and which differ
from those disclosed by the deletion, addition or substitution of
nucleotides while still encoding a protein which possesses the
functional characteristics of the proteins which are comprehended
by this invention.
[0182] Also within the scope of this invention are small DNA
molecules which are derived from the disclosed DNA molecules. Such
small DNA molecules include oligonucleotides suitable for use as
hybridization probes or PCR primers. As such, these small DNA
molecules will include at least a segment of the transposable
element DNA molecules and, for the purposes of PCR, will include at
least 20-50 consecutive nucleotides of the transposable element
nucleic acid sequences. DNA molecules and nucleotide sequences
which are derived from the disclosed DNA molecules as described
above may also be defined as DNA sequences which hybridize under
stringent conditions to the DNA sequences disclosed, or fragments
thereof.
[0183] Hybridization conditions resulting in particular degrees of
stringency will vary depending upon the nature of the hybridization
method of choice and the composition and length of the hybridizing
DNA used. Generally, the temperature of hybridization and the ionic
strength (especially the Na.sup.+ concentration) of the
hybridization buffer will determine the stringency of
hybridization. Calculations regarding hybridization conditions
required for attaining particular degrees of stringency are
discussed by Sambrook et al. (In: Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor, N.Y., 1989 ch. 9 and 11), herein
incorporated by reference. By way of illustration only, a
hybridization experiment may be performed by hybridization of a DNA
molecule (for example, a deviation of the transposable element) to
a target DNA molecule (for example, a transposable element DNA)
which has been electrophoresed in an agarose gel and transferred to
a nitrocellulose membrane by Southern blotting (Southern, J. Mol.
Biol. 98:503, 1975), a technique well known in the art and
described in Sambrook et al. (Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor, N.Y., 1989).
[0184] Hybridization with a target probe labeled with
[.sup.32P]-dCTP is generally carried out in a solution of high
ionic strength such as 6.times.SSC at a temperature that is
20-25.degree. C. below the melting temperature, T.sub.m, described
below. For such Southern hybridization experiments where the target
DNA molecule on the Southern blot contains 10 ng of DNA or more,
hybridization is typically carried out for 6-8 hours using 1-2
ng/ml radiolabeled probe (of specific activity equal to 10.sup.9
CPM/.mu.g or greater). Following hybridization, the nitrocellulose
filter is washed to remove background hybridization. The washing
conditions should be as stringent as possible to remove background
hybridization but to retain a specific hybridization signal. The
term T.sub.m represents the temperature above which, under the
prevailing ionic conditions, the radiolabeled probe molecule will
not hybridize to its target DNA molecule. The T.sub.m of such a
hybrid molecule may be estimated from the following equation
(Bolton and McCarthy, Proc. Natl. Acad. Sci. USA 48:1390, 1962):
T.sub.m=81.5.degree. C.-16.6(log.sub.10[Na.sup.+])+0.41(%
G+C)-0.63(% formamide)-(600/1); where 1=the length of the hybrid in
base pairs.
[0185] This equation is valid for concentrations of Na.sup.+ in the
range of 0.01 M to 0.4 M, and it is less accurate for calculations
of T.sub.m in solutions of higher [Na.sup.+]. The equation is also
primarily valid for DNAs whose G+C content is in the range of 30%
to 75%, and it applies to hybrids greater than 100 nucleotides in
length (the behavior of oligonucleotide probes is described in
detail in Ch. 11 of Sambrook et al. (Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor, N.Y., 1989).
[0186] Thus, by way of example, for a 150 base pair DNA probe
derived from a transposable element nucleic acid sequence (with a
hypothetical % GC=45%), a calculation of hybridization conditions
required to give particular stringencies may be made as follows:
For this example, it is assumed that the filter will be washed in
0.3.times.SSC solution following hybridization, thereby:
[Na.sup.+]=0.045 M; % GC=45%; Formamide concentration=0; 1=150 base
pairs;
T.sub.m=81.5-16.6(log.sub.10[Na.sup.+])+(0.41.times.45)-(600/150);
and so T.sub.m=74.4.degree. C.
[0187] The T.sub.m of double-stranded DNA decreases by
1-1.5.degree. C. with every 1% decrease in homology (Bonner et al.,
J. Mol. Biol. 81:123, 1973). Therefore, for this given example,
washing the filter in 0.3.times.SSC at 59.4-64.4.degree. C. will
produce a stringency of hybridization equivalent to 90%; that is,
DNA molecules with more than 10% sequence variation relative to the
target transposable element DNA will not hybridize. Alternatively,
washing the hybridized filter in 0.3.times.SSC at a temperature of
65.4-68.4.degree. C. will yield a hybridization stringency of 94%;
that is, DNA molecules with more than 6% sequence variation
relative to the target transposable element DNA molecule will not
hybridize. The above example is given entirely by way of
theoretical illustration. One skilled in the art will appreciate
that other hybridization techniques may be utilized and that
variations in experimental conditions will necessitate alternative
calculations for stringency.
[0188] In particular embodiments of the present invention,
stringent conditions may be defined as those under which DNA
molecules with more than 25%, 15%, 10%, 6% or 2% sequence variation
(also termed "mismatch") will not hybridize.
[0189] The degeneracy of the genetic code further widens the scope
of the present invention as it enables major variations in the
nucleotide sequence of a DNA molecule while maintaining the amino
acid sequence of the encoded protein. For example, the C-terminal
amino acid residue of the transposable element Tn5-DICE is alanine.
This is encoded in the Tn5-DICE DNA by the nucleotide codon triplet
GCG. Because of the degeneracy of the genetic code, other
nucleotide codon triplets, could encode the C-terminal amino acid
residue (e.g. GCT and GCC), as they also code for alanine. Thus,
the nucleotide sequence of the Tn5-DICE cDNA could be changed at
this position to any of these three codons without affecting the
amino acid composition of the encoded protein or the
characteristics of the protein. Based upon the degeneracy of the
genetic code, variant DNA molecules may be derived from the cDNA
molecules disclosed herein using standard DNA mutagenesis
techniques as described above, or by synthesis of DNA sequences.
DNA sequences which do not hybridize under stringent conditions to
the cDNA sequences disclosed by virtue of sequence variation based
on the degeneracy of the genetic code are herein also comprehended
by this invention.
[0190] The invention also includes DNA sequences that are
substantially identical to any of the DNA sequences disclosed
herein, where substantially identical means a sequence that has
identical nucleotides in at least 70%, 75%, 80%, 85%, 90%, 95%, 98%
or 99% of the aligned sequences.
[0191] One skilled in the art will recognize that the DNA
mutagenesis techniques described above may be used not only to
produce variant DNA molecules, but will also facilitate the
production of proteins which differ in certain structural aspects
from the transposable elements, yet which proteins are clearly
derivative of this protein and which maintain the essential
characteristics of the proteins of the transposable elements. Newly
derived proteins may also be selected in order to obtain variations
on the characteristic of the transposable element protein, as will
be more fully described below. Such derivatives include those with
variations in amino acid sequence including minor deletions,
additions and substitutions.
[0192] While the site for introducing an amino acid sequence
variation is predetermined, the mutation per se need not be
predetermined. For example, in order to optimize the performance of
a mutation at a given site, random mutagenesis may be conducted at
the target codon or region and the expressed protein variants
screened for the optimal combination of desired activity.
Techniques for making substitution mutations at predetermined sites
in DNA having a known sequence as described above are well
known.
[0193] Amino acid substitutions are typically of single residues;
insertions usually will be on the order of about from 1 to 10 amino
acid residues; and deletions will range about from 1 to 30
residues. Deletions or insertions may be made in adjacent pairs,
i.e., a deletion of 2 residues or insertion of 2 residues.
Substitutions, deletions, insertions or any combination thereof may
be combined to arrive at a final construct. Obviously, the
mutations that are made in the DNA encoding the protein must not
place the sequence out of reading frame and ideally will not create
complementary regions that could produce secondary mRNA
structure.
[0194] Substitutional variants are those in which at least one
residue in the amino acid sequence has been removed and a different
residue inserted in its place. Such substitutions generally are
made conservatively, as defined above.
[0195] Substantial changes in function or immunological identity
are made by selecting substitutions that are less conservative than
those defined above, i.e., selecting residues that differ more
significantly in their effect on maintaining (a) the structure of
the polypeptide backbone in the area of the substitution, for
example, as a sheet or helical conformation, (b) the charge or
hydrophobicity of the molecule at the target site, or (c) the bulk
of the side chain. The substitutions which in general are expected
to produce the greatest changes in protein properties will be those
in which (a) a hydrophilic residue, e.g., seryl or threonyl, is
substituted for (or by) a hydrophobic residue, e.g., leucyl,
isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline
is substituted for (or by) any other residue; (c) a residue having
an electropositive side chain, e.g., lysyl, arginyl, or histadyl,
is substituted for (or by) an electronegative residue, e.g.,
glutamyl or aspartyl; or (d) a residue having a bulky side chain,
e.g., phenylalanine, is substituted for (or by) one not having a
side chain, e.g., glycine.
[0196] The effects of these amino acid substitutions or deletions
or additions may be assessed for derivatives of the transposable
elements by assays in which the ability of the elements to
transpose are assessed.
EXAMPLE 19
Pharmaceutical Compositions and Modes of Administration
[0197] Various delivery systems for administering the transposable
elements of the present invention are known, and include e.g.,
encapsulation in liposomes, microparticles, microcapsules,
expression by recombinant cells, receptor-mediated endocytosis (see
Wu and Wu, J. Biol. Chem. 1987, 262:4429-32), and construction of a
therapeutic nucleic acid as part of a retroviral or other vector.
Methods of introduction include, but are not limited to,
intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, intranasal, and oral routes. The compounds may be
administered by any convenient route, for example by infusion or
bolus injection, by absorption through epithelial or mucocutaneous
linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and
may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, the
pharmaceutical compositions may be introduced into the central
nervous system by any suitable route, including intraventricular
and intrathecal injection; intraventricular injection may be
facilitated by an intraventricular catheter, for example, attached
to a reservoir, such as an Ommaya reservoir.
[0198] In one embodiment, it may be desirable to administer the
pharmaceutical compositions of the invention locally to the area in
need of treatment, for example, by local infusion during surgery,
topical application, e.g., in conjunction with a wound dressing
after surgery, by injection, through a catheter, by a suppository
or an implant, such as a porous, non-porous, or gelatinous
material, including membranes, such as silastic membranes, or
fibers. In one embodiment, administration can be by direct
injection at the site (or former site) of a malignant tumor or
neoplastic or pre-neoplastic tissue.
[0199] The use of liposomes as a delivery vehicle is one delivery
method of interest. The liposomes fuse with the target site and
deliver the contents of the lumen intracellularly. The liposomes
are maintained in contact with the target cells for a sufficient
time for fusion to occur, using various means to maintain contact,
such as isolation and binding agents. Liposomes may be prepared
with purified proteins or peptides that mediate fusion of
membranes, such as Sendai virus or influenza virus. The lipids may
be any useful combination of known liposome forming lipids,
including cationic lipids, such as phosphatidylcholine. Other
potential lipids include neutral lipids, such as cholesterol,
phosphatidyl serine, phosphatidyl glycerol, and the like. For
preparing the liposomes, the procedure described by Kato et al. (J.
Biol. Chem. 1991, 266:3361) may be used.
[0200] The present invention also provides pharmaceutical
compositions which include a therapeutically effective amount of
the transposable element, alone or with a pharmaceutically
acceptable carrier. In one example, homogeneous compositions of
transposable element therapeutic molecules includes compositions
that are comprised of at least 90% of the peptide, variant, analog,
derivative or mimetic in the composition.
Delivery Systems
[0201] Such carriers include, but are not limited to, saline,
buffered saline, dextrose, water, glycerol, ethanol, and
combinations thereof. The carrier and composition can be sterile,
and the formulation suits the mode of administration. The
composition can also contain minor amounts of wetting or
emulsifying agents, or pH buffering agents. The composition can be
a liquid solution, suspension, emulsion, tablet, pill, capsule,
sustained release formulation, or powder. The composition can be
formulated as a suppository, with traditional binders and carriers
such as triglycerides. Oral formulations can include standard
carriers such as pharmaceutical grades of mannitol, lactose,
starch, magnesium stearate, sodium saccharine, cellulose, and
magnesium carbonate.
[0202] The amount of the inducing agent and disrupting agent that
will be effective in the treatment of a particular disorder or
condition will depend on the nature of the disorder or condition,
and can be determined by standard clinical techniques. In addition,
in vitro assays may optionally be employed to help identify optimal
dosage ranges. The precise dose to be employed in the formulation
will also depend on the route of administration, and the
seriousness of the disease or disorder, and should be decided
according to the judgment of the practitioner and each subject's
circumstances. Effective doses may be extrapolated from
dose-response curves derived from in vitro or animal model test
systems.
[0203] The invention also provides a pharmaceutical pack or kit
comprising one or more containers filled with one or more of the
ingredients of the pharmaceutical compositions. Optionally
associated with such container(s) can be a notice in the form
prescribed by a governmental agency regulating the manufacture, use
or sale of pharmaceuticals or biological products, which notice
reflects approval by the agency of manufacture, use or sale for
human administration. Instructions for use of the composition can
also be included.
[0204] The pharmaceutical compositions or methods of treatment may
be administered in combination with other therapeutic treatments,
such as other antineoplastic or antitumorigenic therapies.
Administration of Nucleic Acid Molecules
[0205] In an embodiment in which a transposable element nucleic
acid is employed for gene delivery or therapy, the analog is
delivered intracellularly (e.g., by expression from a nucleic acid
vector or by receptor-mediated mechanisms). In a specific
embodiment where the therapeutic molecule is a nucleic acid or
antisense molecule, administration may be achieved by an
appropriate nucleic acid expression vector which is administered so
that it becomes intracellular, e.g., by use of a retroviral vector
(see U.S. Pat. No. 4,980,286), or by direct injection, or by use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or
coating with lipids or cell-surface receptors or transfecting
agents, or by administering it in linkage to a homeobox-like
peptide which is known to enter the nucleus (see e.g., Joliot et
al., Proc. Natl. Acad. Sci. USA 1991, 88:1864-8). Alternatively,
the nucleic acid can be introduced intracellularly and incorporated
within host cell DNA for expression, by homologous
recombination.
[0206] The vector pcDNA, is an example of a method of introducing
the foreign cDNA into a cell under the control of a strong viral
promoter (CMV) to drive the expression. However, other vectors can
be used. Other retroviral vectors (such as pRETRO-ON, Clontech),
also use this promoter but have the advantages of entering cells
without any transfection aid, integrating into the genome of target
cells only when the target cell is dividing (as cancer cells do,
especially during first remissions after chemotherapy) and they are
regulated. It is also possible to turn on the expression of the
transposable element nucleic acid by administering tetracycline
when these plasmids are used. Hence these plasmids can be allowed
to transfect the cells, then administer a course of tetracycline
with a course of chemotherapy to achieve better cytotoxicity.
[0207] Other plasmid vectors, such as pMAM-neo (Clontech) or pMSG
(Amersham Pharmacia Biotech, Piscataway, N.J.) use the MMTV-LTR
promoter (which can be regulated with steroids) or the SV10 late
promoter (pSVL, Amersham Pharmacia Biotech, Piscataway, N.J.) or
metallothionein-responsive promoter (PBPV, Amersham Pharmacia
Biotech) and other viral vectors, including retroviruses. Examples
of other viral vectors include adenovirus, AAV (adeno-associated
virus), recombinant HSV, poxviruses (vaccinia) and recombinant
lentivirus (such as HIV). All these vectors achieve the basic goal
of delivering into the target cell the cDNA sequence and control
elements needed for transcription. The present invention includes
all forms of nucleic acid delivery, including synthetic oligos,
naked DNA, plasmid and viral, integrated into the genome or
not.
[0208] Having illustrated and described the principles of
constructing and using transposable elements, it should be apparent
to one skilled in the art that the invention can be modified in
arrangement and detail without departing from such principles. In
view of the many possible embodiments to which the principles of
our invention may be applied, it should be recognized that the
illustrated embodiments are only examples of the invention and
should not be taken as a limitation on the scope of the invention.
Rather, the scope of the invention is in accord with the following
claims. We therefore claim as our invention all that comes within
the scope and spirit of these claims.
Sequence CWU 1
1
33 1 22 DNA Artificial Sequence Description of Artificial Sequence
Primer that can be used to sequence the gene in which a
transposable element inserted. 1 gcggatatcc accaccacca cc 22 2 22
DNA Artificial Sequence Description of Artificial Sequence Primer
that can be used to sequence the gene in which a transposable
element inserted. 2 tatgcccggg ccgtggtggt gg 22 3 18 DNA
Escherichia coli 3 gatgtgtata agagacag 18 4 19 DNA Escherichia coli
4 ctgactctta tacacaagt 19 5 19 DNA Escherichia coli 5 ctgtctctta
tacacatct 19 6 8 PRT Artificial Sequence Description of Artificial
Sequence Ovalbumin epitope 6 Ser Ile Ile Asn Phe Glu Lys Leu 1 5 7
9 PRT Human T-cell lymphotropic virus type 1 7 Leu Leu Phe Gly Tyr
Pro Val Tyr Val 1 5 8 19 DNA Escherichia coli 8 ctgactctta
tacacaagt 19 9 19 DNA Escherichia coli 9 ctgtctctta tacacatct 19 10
19 DNA Escherichia coli 10 ctgtctcttg atcagatct 19 11 24 DNA
Artificial Sequence Description of Artificial Sequence A 5' PCR
site 11 gttgacacca tccatactag taga 24 12 19 DNA Artificial Sequence
Description of Artificial Sequence Sequence of 6X histidine 12 cac
cac cac cac cac cac g 19 His His His His His His 1 5 13 6 PRT
Artificial Sequence Description of Artificial Sequence Sequence of
6X histidine 13 His His His His His His 1 5 14 35 DNA Artificial
Sequence Description of Artificial Sequence LoxP sequence 14
ataacttcgt ataatgtatg ctatacgaag ttatt 35 15 24 DNA Artificial
Sequence Description of Artificial Sequence 3' PCR site 15
ctagaaccag atgtgtataa gaga 24 16 21 DNA Artificial Sequence
Description of Artificial Sequence 5' PCR site 16 ggcccgatgc
gcaaaaacaa c 21 17 12 DNA Artificial Sequence Description of
Artificial Sequence 5' Asparyginyl Endopeptidase cleavage site 17
cgcaaaaaca ac 12 18 12 DNA Artificial Sequence Description of
Artificial Sequence 3' Asparyginyl endopeptidase cleavage site 18
aacaacaaac gc 12 19 51 DNA Artificial Sequence CDS (1)..(51)
Description of Artificial Sequence The I-Ab restricted T-cell
epitope region of DICE II 19 gcg tcc ttc gaa gcg cag ggc gcg ctg
gcg aac atc gcg gtg gac aaa 48 Ala Ser Phe Glu Ala Gln Gly Ala Leu
Ala Asn Ile Ala Val Asp Lys 1 5 10 15 gcg 51 Ala 20 17 PRT
Artificial Sequence Description of Artificial Sequence The I-Ab
restricted T-cell epitope region of DICE II 20 Ala Ser Phe Glu Ala
Gln Gly Ala Leu Ala Asn Ile Ala Val Asp Lys 1 5 10 15 Ala 21 21 DNA
Artificial Sequence Description of Artificial Sequence 3' PCR site
21 ctagaaccag atgtgtataa g 21 22 171 DNA Artificial Sequence
Description of Artificial Sequence DICE I sequence 22 ctg tct ctt
ata cac atc tca tat ggc tct atc atc aac ttc gaa aaa 48 Leu Ser Leu
Ile His Ile Ser Tyr Gly Ser Ile Ile Asn Phe Glu Lys 1 5 10 15 ctg
gcg ttg aca cca tcc ata cta gta gat atc cac cac cac cac cac 96 Leu
Ala Leu Thr Pro Ser Ile Leu Val Asp Ile His His His His His 20 25
30 cac ggc cag gac ata act tcg tat aat gta tgc tat acg aag tta ttt
144 His Gly Gln Asp Ile Thr Ser Tyr Asn Val Cys Tyr Thr Lys Leu Phe
35 40 45 cta gaa cca gat gtg tat aag aga cag 171 Leu Glu Pro Asp
Val Tyr Lys Arg Gln 50 55 23 57 PRT Artificial Sequence Description
of Artificial Sequence DICE I sequence 23 Leu Ser Leu Ile His Ile
Ser Tyr Gly Ser Ile Ile Asn Phe Glu Lys 1 5 10 15 Leu Ala Leu Thr
Pro Ser Ile Leu Val Asp Ile His His His His His 20 25 30 His Gly
Gln Asp Ile Thr Ser Tyr Asn Val Cys Tyr Thr Lys Leu Phe 35 40 45
Leu Glu Pro Asp Val Tyr Lys Arg Gln 50 55 24 204 DNA Artificial
Sequence Description of Artificial Sequence DICE II Sequence 24 ctg
tct ctt ata cac atc tca tat ggc ccg atg cgc aaa aac aac gcg 48 Leu
Ser Leu Ile His Ile Ser Tyr Gly Pro Met Arg Lys Asn Asn Ala 1 5 10
15 tcc ttc gaa gcg cag ggc gcg ctg gcg aac atc gcg gtg gac aaa gcg
96 Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile Ala Val Asp Lys Ala
20 25 30 aac aac aaa cgc gat atc cac cac cac cac cac cac ggc cag
gac ata 144 Asn Asn Lys Arg Asp Ile His His His His His His Gly Gln
Asp Ile 35 40 45 act tcg tat aat gta tgc tat acg aag tta ttt cta
gaa cca gat gtg 192 Thr Ser Tyr Asn Val Cys Tyr Thr Lys Leu Phe Leu
Glu Pro Asp Val 50 55 60 tat aag aga cag 204 Tyr Lys Arg Gln 65 25
68 PRT Artificial Sequence Description of Artificial Sequence DICE
II Sequence 25 Leu Ser Leu Ile His Ile Ser Tyr Gly Pro Met Arg Lys
Asn Asn Ala 1 5 10 15 Ser Phe Glu Ala Gln Gly Ala Leu Ala Asn Ile
Ala Val Asp Lys Ala 20 25 30 Asn Asn Lys Arg Asp Ile His His His
His His His Gly Gln Asp Ile 35 40 45 Thr Ser Tyr Asn Val Cys Tyr
Thr Lys Leu Phe Leu Glu Pro Asp Val 50 55 60 Tyr Lys Arg Gln 65 26
49 PRT Artificial Sequence Description of Artificial Sequence Amino
acid resolved procut using the construct shown in FIG 2. 26 Leu Ser
Leu Asp Gln Ile Ser Tyr Gly Pro Gly Ser Ile Ile Asn Phe 1 5 10 15
Glu Lys Leu Ala Asp Ile His His His His His His Gly Pro Gly Ile 20
25 30 Thr Ser Tyr Ser Leu Glu Tyr Thr Lys Gly Arg Ser Ser Pro Gly
Gly 35 40 45 Ser 27 82 PRT Artificial Sequence Description of
Artificial Sequence Amino acid resolved product using the construct
shown in FIG 5. 27 Leu Ser Leu Asp Gln Ile Ser Tyr Gly Pro Met Leu
Leu Phe Gly Tyr 1 5 10 15 Pro Val Tyr Val Ala His His His His His
His Met Lys Ile Phe Gly 20 25 30 Ser Leu Ala Phe Leu Ala Met Val
Met Ala Gly Val Gly Ser Pro Tyr 35 40 45 Val Ala Met Ile Ile Ser
Ala Val Val Gly Ile Leu Ala Gly Pro Gly 50 55 60 Ile Thr Ser Tyr
Ser Leu Glu Tyr Thr Lys Gly Arg Ser Ser Pro Gly 65 70 75 80 Gly Ser
28 109 PRT Artificial Sequence Description of Artificial Sequence
Amino Acid resolved product using the construct shown in FIG 6. 28
Leu Ser Leu Asp Gln Ile Ser Tyr Gly Pro Met Leu Leu Phe Gly Tyr 1 5
10 15 Pro Val Tyr Val Ala His His His His His His Met Ser Leu Tyr
Asn 20 25 30 Thr Val Ala Thr Leu Ala Met Gly His Gln Ala Ala Met
Gln Met Leu 35 40 45 Lys Glu Ala Met Val Leu Asp Val Gly Asp Ala
Tyr Phe Ser Val Ala 50 55 60 Met Arg Gly Pro Gly Arg Ala Phe Val
Thr Ile Ala Met Gln Val Pro 65 70 75 80 Leu Arg Pro Met Thr Tyr Lys
Ala Gly Pro Gly Ile Thr Ser Tyr Ser 85 90 95 Leu Glu Tyr Thr Lys
Gly Arg Ser Ser Pro Gly Gly Ser 100 105 29 57 PRT Artificial
Sequence Description of Artificial Sequence Amino acid resolved
product using the construct shown in FIG 7. 29 Leu Ser Leu Ile His
Ile Ser Tyr Gly Ser Ile Ile Asn Phe Glu Lys 1 5 10 15 Leu Ala Leu
Thr Pro Ser Ile Leu Val Asp Ile His His His His His 20 25 30 His
Gly Gln Asp Ile Thr Ser Tyr Asn Val Cys Tyr Thr Lys Leu Phe 35 40
45 Leu Glu Leu Asp Val Tyr Lys Arg Gln 50 55 30 73 PRT Artificial
Sequence Description of Artificial Sequence Amino acid resolved
product using the construct shown in FIG 8. 30 Leu Ser Leu Ile His
Ile Ser Tyr Gly Arg Lys Asn Asn Ala Ser Phe 1 5 10 15 Glu Ala Gln
Gly Ala Leu Ala Asn Ile Ala Val Asp Lys Ala Asn Asn 20 25 30 Lys
Arg Leu Thr Pro Ser Ile Leu Val Asp Ile His His His His His 35 40
45 His Gly Gln Asp Ile Thr Ser Tyr Asn Val Cys Tyr Thr Lys Leu Phe
50 55 60 Leu Glu Leu Asp Val Tyr Lys Arg Gln 65 70 31 92 PRT
Artificial Sequence Description of Artificial Sequence Amino acid
resolved product using the construct shown in f FIG 9. 31 Leu Ser
Leu Ile His Ile Ser Tyr Gly Leu Leu Phe Gly Tyr Pro Val 1 5 10 15
Tyr Val Ala Leu Thr Pro Ser Ile Leu Val Asp Ile His His His His 20
25 30 His His Met Lys Ile Phe Gly Ser Leu Ala Phe Leu Ala Met Val
Met 35 40 45 Ala Gly Val Gly Ser Pro Tyr Val Ala Met Ile Ile Ser
Ala Val Val 50 55 60 Gly Ile Leu Ala Gly Gln Asp Ile Thr Ser Tyr
Asn Val Cys Tyr Thr 65 70 75 80 Lys Leu Phe Leu Glu Leu Asp Val Tyr
Lys Arg Gln 85 90 32 119 PRT Artificial Sequence Description of
Artificial Sequence Amino acid resolved product using the construct
shown in FIG 10. 32 Leu Ser Leu Ile His Ile Ser Tyr Gly Leu Leu Phe
Gly Tyr Pro Val 1 5 10 15 Tyr Val Ala Leu Thr Pro Ser Ile Leu Val
Asp Ile His His His His 20 25 30 His His Met Ser Leu Tyr Asn Thr
Val Ala Thr Leu Ala Met Gly His 35 40 45 Gln Ala Ala Met Gln Met
Leu Lys Glu Ala Met Val Leu Asp Val Gly 50 55 60 Asp Ala Tyr Phe
Ser Val Ala Met Arg Gly Pro Gly Arg Ala Phe Val 65 70 75 80 Thr Ile
Ala Met Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Ala Gly 85 90 95
Gln Asp Ile Thr Ser Tyr Asn Val Cys Tyr Thr Lys Leu Phe Leu Glu 100
105 110 Leu Asp Val Tyr Lys Arg Gln 115 33 20 DNA Artificial
Sequence Description of Artificial Sequence PCR primer 33
ctactagtat ggatggtgtc 20
* * * * *