U.S. patent application number 11/199818 was filed with the patent office on 2006-02-23 for method for nucleic acid isolation and amplification.
This patent application is currently assigned to Generation Biotech, LLC. Invention is credited to Johannes Dapprich, Christian Korfhage, Nancy Murphy.
Application Number | 20060040300 11/199818 |
Document ID | / |
Family ID | 35432173 |
Filed Date | 2006-02-23 |
United States Patent
Application |
20060040300 |
Kind Code |
A1 |
Dapprich; Johannes ; et
al. |
February 23, 2006 |
Method for nucleic acid isolation and amplification
Abstract
The present invention provides methods and compositions for
sequence-specific isolation of polynucleotide molecules from
nucleic acid populations and subsequent amplification of isolated
polynucleotide molecules or fragments thereof.
Inventors: |
Dapprich; Johannes;
(Lawrenceville, NJ) ; Murphy; Nancy; (Downingtown,
PA) ; Korfhage; Christian; (Langenfeld, DE) |
Correspondence
Address: |
SEED INTELLECTUAL PROPERTY LAW GROUP PLLC
701 FIFTH AVE
SUITE 6300
SEATTLE
WA
98104-7092
US
|
Assignee: |
Generation Biotech, LLC
Lawrenceville
NJ
GenoVision Inc.
Westchester
PA
QIAGEN GmbH
Hilden
|
Family ID: |
35432173 |
Appl. No.: |
11/199818 |
Filed: |
August 9, 2005 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60599903 |
Aug 9, 2004 |
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/6.13; 435/91.2 |
Current CPC
Class: |
C12Q 1/6846 20130101;
C12P 19/34 20130101; C12Q 2525/179 20130101; C12Q 2531/119
20130101; C12Q 1/6846 20130101 |
Class at
Publication: |
435/006 ;
435/091.2 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12P 19/34 20060101 C12P019/34 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with U.S. government support under
NIH/NIAID grant numbers 1) R43 AI 51036-01 A2 and 2) R44 AI
51036-02. The government has certain rights in the invention.
Claims
1. A method for amplifying a polynucleotide molecule of interest or
a fragment thereof, comprising: (a) isolating a polynucleotide
molecule from a nucleic acid population using an immobilizable
separation group to provide an isolated polynucleotide molecule,
and (b) isothermally amplifying the isolated polynucleotide
molecule or a fragment thereof.
2. The method of claim 1 wherein (A) the nucleic acid population
comprises the polynucleotide molecule of interest, (B) one strand
of the polynucleotide molecule comprises a target nucleic acid
sequence and a distinguishing element, (C) the target nucleic acid
sequence is within 100 nucleotides of the distinguishing element in
the one strand of the polynucleotide molecules, and (D) step (a)
comprises: (i) contacting the nucleic acid population with a
targeting element that binds specifically to the target nucleic
acid sequence in the polynucleotide molecule, (ii) selectively
attaching the immobilizable separation group to the targeting
element bound to the target nucleic acid sequence in the
polynucleotide molecule to form a targeting element-separation
group complex, (iii) immobilizing to a substrate via the separation
group the targeting element-separation group complex to which the
target nucleic acid sequence in the polynucleotide molecule is
bound, and (iv) removing the immobilized targeting
element-separation group complex to which the target nucleic acid
sequence in the polynucleotide molecule is bound, thereby isolating
the polynucleotide molecule from the nucleic acid population.
3. The method of claim 2 wherein the polynucleotide molecule of
interest is a genomic DNA molecule.
4. The method of claim 2 wherein the target nucleic acid sequence
is located immediately 3' to the distinguishing element in the one
strand of the polynucleotide molecule.
5. The method of claim 2 wherein the targeting element comprises an
oligonucleotide.
6. The method of claim 2 wherein the separation group comprises an
immobilizable nucleotide.
7. The method of claim 6 wherein the immobilizable nucleotide is a
terminating nucleotide.
8. The method of claim 6 wherein the immobilizable nucleotide is a
non-terminating nucleotide.
9. The method of claim 2 wherein the distinguishing element is a
polymorphic sequence.
10. The method of claim 2 wherein the distinguishing element is a
single nucleotide polymorphism.
11. The method of claim 2 wherein (1) the targeting element
comprises an oligonucleotide, (2) the separation group comprises an
immobilizable nucleotide, and (3) the separation group is attached
to the targeting element by extending the oligonucleotide in the
presence of the immobilizable nucleotide, thereby forming an
extension product that comprises the immobilizable nucleotide.
12. The method of claim 11 wherein (4) the 3' terminus of the
oligonucleotide is complementary to the distinguishing element or a
portion thereof in the polynucleotide molecule, (5) the
immobilizable nucleotide is non-terminating, and (6) the extension
product comprises multiple separation groups.
13. The method of claim 11 wherein (4) the target nucleic acid
sequence is immediately 3' to the distinguishing element, and (5)
the immobilizable nucleotide is terminating and complementary to
the distinguishing element or a portion thereof.
14. The method of claim 1 wherein (A) the nucleic acid population
comprises the polynucleotide molecule of interest, (B) one strand
of the polynucleotide molecule comprises a target nucleic acid
sequence and a distinguishing element, (C) the target nucleic acid
sequence is within 100 nucleotides of the distinguishing element in
the one strand of the polynucleotide molecule, and (D) step (a)
comprises: (i) contacting the nucleic acid population with a
targeting element-separation group complex, wherein the targeting
element-separation group complex binds specifically to the target
nucleic acid sequence in the polynucleotide molecule, (ii)
selectively stabilizing the binding of the targeting
element-separation group complex to the target nucleic acid
sequence in the polynucleotide molecule, (iii) immobilizing to a
substrate via the separation group the stabilized targeting
element-separation group complex to which the target nucleic acid
sequence in the polynucleotide molecule is bound, and (iv) removing
the immobilized stabilized targeting element-separation group
complex to which the target nucleic acid sequence in the
polynucleotide molecule is bound, thereby isolating the
polynucleotide molecule from the nucleic acid population.
15. The method of claim 2 wherein (1) the targeting element
comprises an oligonucleotide, and (2) the 3' terminus of the
oligonucleotide is complementary to the distinguishing element or a
portion thereof in the polynucleotide.
16. The method of claim 15 wherein the selective stabilization is
performed by ligation.
17. The method of claim 15 wherein the selective stabilization is
performed by extension of the oligonucleotide using the
polynucleotide molecule as a template.
18. The method of claim 1 wherein the polynucleotide molecule is at
least about 10 kb in length.
19. The method of claim 1 wherein the distinguishing element is
haplotype-specific.
20. The method of claim 1 wherein the distinguishing element is
locus-specific.
21. The method of claim 1 wherein step (b) is performed by strand
displacement amplification.
22. The method of claim 1 wherein step (b) amplifies a particular
region of the isolated polynucleotide molecule.
23. The method of claim 22 wherein step (b) is performed in the
presence of a first set of specific primers each of which is at
least substantially complementary to the particular region in the
strand of the polynucleotide molecule that comprises the target
nucleic acid sequence.
24. The method of claim 23 wherein step (b) is performed further in
the presence of a second set of specific primers each of which is
at least substantially complementary to the particular region in
the strand of the polynucleotide molecule that does not comprise
the target nucleic acid sequence.
25. The method of claim 23 wherein the first set of specific
primers are about 0.5 kb apart from their neighboring primers when
annealing to the strand of the isolated polynucleotide molecule
that comprises the target nucleic acid sequence.
26. The method of claim 24 wherein the second set of specific
primers are about 0.5 kb apart from their neighboring primers when
annealing to the strand of the isolated polynucleotide molecule
that does not comprise the target nucleic acid sequence.
27. The method of claim 25 wherein step (b) is performed further in
the presence of a set of random primers.
28. The method of claim 26 wherein step (b) is performed further in
the presence of a set of random primers.
29. The method of claim 27 wherein the random primers are about 2
kb apart from their neighboring primers.
30. The method of claim 28 wherein the second set of random primers
are about 2 kb apart from their neighboring primers.
31. The method of claim 1 wherein step (b) is locus-specific
amplification.
32. The method of claim 1 wherein step (b) is locus-biased
amplification.
33. The method of claim 1 wherein step (b) is performed in the
presence of end-specific primers.
34. The method of claim 33 wherein the average distance between
neighboring end-specific primers are between 50 and 250
nucleotides.
35. The method of claim 33 wherein step (b) is performed further in
the presence of center-specific primers.
36. The method of claim 35 wherein the distances between
neighboring center-specific primers are between 100 and 5000
nucleotides.
37. The method of claim 35 wherein the center-specific primers are
sequence-specific.
38. The method of claim 35 wherein the center-specific primers are
degenerate primers.
39. The method of claim 1 further comprising: (c) characterizing
one or more sites in the amplified polynucleotide molecule or
fragment thereof that constitute a haplotype.
40. The method of claim 39 further comprising: (d) assembling
information of the characterized sites.
41. The method of claim 1 further comprising: (c) characterizing
one or more polymorphic sites in the amplified polynucleotide
molecule or fragment thereof.
42. The method of claim 41 further comprising: (d) assembling
information of the characterized sites.
43. The method of claim 2 further comprising dissociating the
isolated polynucleotide molecule from the substrate prior to step
(b).
44. The method of claim 14 further comprising dissociating the
isolated polynucleotide molecule from the substrate prior to step
(b).
45. A method for amplifying multiple polynucleotide molecules of
interest from a population of nucleic acid molecules, comprising:
(a) isolating multiple polynucleotide molecules from a nucleic acid
population using one or more immobilizable separation groups to
provide isolated polynucleotide molecules of interest, and (b)
isothermally amplifying the isolated polynucleotide molecules or
fragments thereof.
46. The method of claim 45 wherein step (a) comprises: (A)
contacting a nucleic acid population that comprises multiple
polynucleotide molecules of interest with multiple targeting
elements so that each targeting element binds specifically to a
target nucleic acid sequence of its corresponding polynucleotide
molecule, wherein (i) the target nucleic acid sequence is located
within 100 nucleotides of a distinguishing element in one strand of
the polynucleotide molecule, and (ii) the distinguishing element
distinguishes the polynucleotide molecule from another nucleic acid
molecule that is nearly identical to the polynucleotide molecule,
(B) selectively attaching separation groups to the multiple
targeting elements bound to the target nucleic acid sequences of
corresponding polynucleotide molecules to form targeting
element-separation group complexes, (C) immobilizing to
substrate(s) via the separation groups the targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecules are bound, and (D)
removing the immobilized targeting element-separation group
molecules are bound to isolate the polynucleotide molecules from
the population of nucleic acid molecules.
47. The method of claim 46 wherein different separation groups are
attached to different targeting elements.
48. The method of claim 46 wherein identical separation groups are
attached to different targeting elements.
49. The method of claim 45 wherein step (a) comprises: (A)
contacting a nucleic acid population that comprises multiple
polynucleotide molecules of interest with multiple targeting
elements to which separation groups are attached so that each
targeting element binds specifically to a target nucleic acid
sequence of its corresponding polynucleotide molecule, wherein (i)
the target nucleic acid sequence is located within 100 nucleotides
of a distinguishing element in one strand of the polynucleotide
molecule, and (ii) the distinguishing element distinguishes the
polynucleotide molecule from another nucleic acid molecule that is
nearly identical to the polynucleotide molecule, (B) selectively
stabilizing the binding of the targeting elements to the target
nucleic acid sequences of their corresponding polynucleotide
molecules to form stabilized targeting element-separation group
complexes to which the target nucleic acid sequences in the
polynucleotide molecules are bound, (C) immobilizing to
substrate(s) via the separation groups the targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecules are bound, and (D)
removing the immobilized targeting element-separation group
complexes to which the target nucleic acid sequences in the
polynucleotide molecules are bound to isolate the polynucleotide
molecules from the population of nucleic acid molecules.
50. The method of claim 49 wherein different separation groups are
attached to different targeting elements.
51. The method of claim 49 wherein identical separation groups are
attached to different targeting elements.
52. The method of claim 46 wherein at least three different
polynucleotide molecules of interest are isolated.
53. A method for amplifying a genomic DNA molecule of interest or a
fragment thereof, wherein the genomic DNA molecule of interest
comprises a polymorphic sequence, comprising: (a) contacting a
genomic DNA population that comprises the genomic DNA molecule of
interest with an oligonucleotide, wherein (i) the oligonucleotide
comprises a sequence at least substantially complementary to a
target nucleic acid sequence in one strand of the genomic DNA
molecule of interest, (ii) the target nucleic acid sequence is
located immediately 3' to the polymorphic sequence in the one
strand of the genomic DNA molecule of interest, and (iii) the 3'
portion of the oligonucleotide is complementary to the polymorphic
sequence or a portion thereof when annealing to the one strand of
the genomic DNA molecule of interest, (b) extending the
oligonucleotide in the presence of an immobilizable nucleotide
using the one strand of the genomic DNA molecule of interest to
which the oligonucleotide anneals as a template to provide an
extension product, (c) immobilizing to a substrate via the
immobilizable nucleotide the extension product to which the genomic
DNA molecule of interest is bound, (d) removing the immobilized
extension product to which the genomic DNA molecule of interest is
bound to thereby isolate the genomic DNA molecule of interest from
the genomic DNA population, (e) optionally elute the genomic DNA
molecule of interest from the substrate, and (f) isothermally
amplifying the isolated or eluted genomic DNA molecule of interest
or a fragment thereof.
54. A method for assembling a haplotype comprising: (a) providing a
nucleic acid population from an organism for which a haplotype is
of interest; (b) separately isolating polynucleotide molecules by
haplotype-specific extraction using multiple substrates, wherein
(i) polynucleotide molecules are isolated at multiple extraction
sites using each substrate, (ii) no polynucleotide molecules
isolated at one extraction site using one substrate comprise a
polymorphic site also present in polynucleotide molecules isolated
at other extraction sites using the same substrate, (iii) one or
more polynucleotide molecules isolated at one extraction site using
one substrate comprise a polymorphic site also present in
polynucleotide molecules isolated at a neighboring extraction site
using other substrates, (c) separately characterizing polymorphic
sites in polynucleotide molecules isolated using each substrate;
(d) assembling a haplotype based on the characterization of
polymorphic sites present in polynucleotide molecules isolated
using more than one substrate.
55. The method of claim 54 further comprising isothermally
amplifying polynucleotide molecules isolated using the multiple
substrates prior to step (c).
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional
Patent Application No. 60/599,903 filed Aug. 9, 2004, which is
incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The invention relates generally to methods and compositions
for isolating and amplifying nucleic acid molecules.
[0005] 2. Description of the Related Art
[0006] One major area of current clinical research is the
correlation of an individual's genetic profile to a susceptibility
to disease and/or response to drug therapy. This area of research,
which has been labeled pharmacogenomics, offers a strategy for
targeting drugs to individuals, and for elucidating genetic
predispositions and risks. In addition, pharmacogenomics provides
for the possibility for an improved drug discovery process based on
a better understanding of the molecular bases of complex
diseases.
[0007] Identification of an individual's genetic profile can
require the identification and amplification of particular nucleic
acid sequences in the individual's genome. These particular nucleic
acid sequences can include those that differ by one or a few
nucleotides among individuals in the same species. For example,
single-nucleotide polymorphisms (SNPS) are common variations in the
DNA of individuals that are used to track inherited genetic
patterns.
[0008] Current methods for isolating, amplifying and identifying
nucleic acid polymorphisms can be labor-intensive, expensive, and
not sensitive.
BRIEF SUMMARY OF THE INVENTION
[0009] The present invention provides methods and compositions for
isolating and amplifying nucleic acid molecules. A polynucleotide
molecule of interest may be first isolated from other nucleic acid
molecules in a nucleic acid population based on a specific sequence
in the polynucleotide molecule and then isothermally amplified. In
certain embodiments, the present invention allows for the isolation
of relatively long polynucleotide molecules (e.g., about 50 kb or
longer) and subsequent amplification of the isolated molecules or
fragments thereof. The amplified polynucleotide molecules or
fragments thereof may be further analyzed.
[0010] In one aspect, the present invention provides a method for
amplifying a polynucleotide molecule of interest or a fragment
thereof, comprising: (a) isolating a polynucleotide molecule from a
nucleic acid population using an immobilizable separation group to
provide an isolated polynucleotide molecule, and (b) isothermally
amplifying the isolated polynucleotide molecule or a fragment
thereof.
[0011] In certain embodiments, (A) the nucleic acid population
comprises the polynucleotide molecule of interest, (B) one strand
of the polynucleotide molecule comprises a target nucleic acid
sequence and a distinguishing element, (C) the target nucleic acid
sequence is within 100 nucleotides of the distinguishing element in
the one strand of the polynucleotide molecules, and (D) step (a)
comprises: (i) contacting the nucleic acid population with a
targeting element that binds specifically to the target nucleic
acid sequence in the polynucleotide molecule, (ii) selectively
attaching the immobilizable separation group to the targeting
element bound to the target nucleic acid sequence in the
polynucleotide molecule to form a targeting element-separation
group complex, (iii) immobilizing to a substrate via the separation
group the targeting element-separation group complex to which the
target nucleic acid sequence in the polynucleotide molecule is
bound, and (iv) removing the immobilized targeting
element-separation group complex to which the target nucleic acid
sequence in the polynucleotide molecule is bound, thereby isolating
the polynucleotide molecule from the nucleic acid population.
[0012] In certain embodiments, (1) the targeting element comprises
an oligonucleotide, (2) the separation group comprises an
immobilizable nucleotide, and (3) the separation group is attached
to the targeting element by extending the oligonucleotide in the
presence of the immobilizable nucleotide, thereby forming an
extension product that comprises the immobilizable nucleotide.
[0013] In certain embodiments, (4) the 3' terminus of the
oligonucleotide is complementary to the distinguishing element or a
portion thereof in the polynucleotide molecule, (5) the
immobilizable nucleotide is non-terminating, and (6) the extension
product comprises multiple separation groups.
[0014] In certain other embodiments, (4) the target nucleic acid
sequence is immediately 3' to the distinguishing element, and (5)
the immobiliable nucleotide is terminating and complementary to the
distinguishing element or a portion thereof.
[0015] In certain embodiments, (A) the nucleic acid population
comprises the polynucleotide molecule of interest, (B) one strand
of the polynucleotide molecule comprises a target nucleic acid
sequence and a distinguishing element, (C) the target nucleic acid
sequence is within 100 nucleotides of the distinguishing element in
the one strand of the polynucleotide molecule, and (D) step (a)
comprises: (i) contacting the nucleic acid population with a
targeting element-separation group complex, wherein the targeting
element-separation group complex binds specifically to the target
nucleic acid sequence in the polynucleotide molecule, (ii)
selectively stabilizing the binding of the targeting
element-separation group complex to the target nucleic acid
sequence in the polynucleotide molecule, (iii) immobilizing to a
substrate via the separation group the stabilized targeting
element-separation group complex to which the target nucleic acid
sequence in the polynucleotide molecule is bound, and (iv) removing
the immobilized stabilized targeting element-separation group
complex to which the target nucleic acid sequence in the
polynucleotide molecule is bound, thereby isolating the
polynucleotide molecule from the nucleic acid population.
[0016] In certain embodiments, (1) the targeting element comprises
an oligonucleotide, and (2) the 3' terminus of the oligonucleotide
is complementary to the distinguishing element or a portion thereof
in the polynucleotide.
[0017] In certain embodiments, the selective stabilization is
performed by ligation. In certain other embodiments, the selective
stabilization is performed by extension of the oligonucleotide
using the polynucleotide molecule as a template.
[0018] In certain embodiments, step (b) is performed by strand
displacement amplification.
[0019] In certain embodiments, step (b) is generic amplification.
In certain other embodiments, step (b) is sequence-specific
amplification (e.g., locus-specific amplification). In certain
other embodiments, step (b) is sequence-biased amplification (e.g.,
locus-biased amplification).
[0020] In certain embodiments, step (b) amplifies all of the
regions of the isolated polynucleotide molecule. In certain other
embodiments, step (b) amplifies a particular region of the isolated
polynucleotide molecule.
[0021] In certain embodiments, step (b) is performed in the
presence of a first set of specific primers each of which is at
least substantially complementary to the particular region in the
strand of the polynucleotide molecule that comprises the target
nucleic acid sequence.
[0022] In certain related embodiments, step (b) is performed
further in the presence of a second set of specific primers each of
which is at least substantially complementary to the particular
region in the strand of the polynucleotide molecule that does not
comprise the target nucleic acid sequence.
[0023] In certain embodiments, the first set of specific primers
are about 0.5 kb apart from their neighboring primers when
annealing to the strand of the isolated polynucleotide molecule
that comprises the target nucleic acid sequence.
[0024] In certain embodiments, the second set of specific primers
are about 0.5 kb apart from their neighboring primers when
annealing to the strand of the isolated polynucleotide molecule
that does not comprise the target nucleic acid sequence.
[0025] In certain embodiments, step (b) is performed further in the
presence of a set of random primers. In certain embodiments, the
random primers are about 2 kb apart from their neighboring
primers.
[0026] In certain embodiments, step (b) is performed in the
presence of end-specific primers. In certain embodiments, the
average distance between neighboring end-specific primers are
between 50 and 250 nucleotides.
[0027] In certain embodiments, step (b) is performed further in the
presence of center-specific primers. In certain embodiments, the
distances between neighboring center-specific primers are between
100 and 5000 nucleotides.
[0028] In certain embodiments, the center-specific primers are
sequence-specific. In certain other embodiments, the
center-specific primers are degenerate primers.
[0029] In certain embodiments, the method according to the present
invention further comprises: (c) characterizing one or more sites
in the amplified polynucleotide molecule or fragment thereof that
constitute a haplotype. Such a method may further comprise: (d)
assembling information of the characterized sites.
[0030] In certain related embodiments, the method according to the
present invention further comprises: (c) characterizing one or more
polymorphic sites in the amplified polynucleotide molecule or
fragment thereof. Such a method may further comprise: (d)
assembling information of the characterized sites to determine a
haplotype.
[0031] In another aspect, the present invention provides a method
for amplifying multiple polynucleotide molecules of interest from a
population of nucleic acid molecules, comprising: (a) isolating
multiple polynucleotide molecules from a nucleic acid population
using one or more immobilizable separation groups to provide
isolated polynucleotide molecules of interest, and (b) isothermally
amplifying the isolated polynucleotide molecules or fragments
thereof.
[0032] In certain embodiments of multiplexed nucleic acid isolation
and amplification, step (a) comprises: (A) contacting a nucleic
acid population that comprises multiple polynucleotide molecules of
interest with multiple targeting elements so that each targeting
element binds specifically to a target nucleic acid sequence of its
corresponding polynucleotide molecule, wherein (i) the target
nucleic acid sequence is located within 100 nucleotides of a
distinguishing element in one strand of the polynucleotide
molecule, and (ii) the distinguishing element distinguishes the
polynucleotide molecule from another nucleic acid molecule that is
nearly identical to the polynucleotide molecule, (B) selectively
attaching separation groups to the multiple targeting elements
bound to the target nucleic acid sequences of corresponding
polynucleotide molecules to form targeting element-separation group
complexes, (C) immobilizing to substrate(s) via the separation
groups the targeting element-separation group complexes to which
the target nucleic acid sequences in the polynucleotide molecules
are bound, and (D) removing the immobilized targeting
element-separation group molecules are bound to isolate the
polynucleotide molecules from the population of nucleic acid
molecules.
[0033] In certain embodiments of multiplexed nucleic acid isolation
and amplification, step (a) comprises: (A) contacting a nucleic
acid population that comprises multiple polynucleotide molecules of
interest with multiple targeting elements to which separation
groups are attached so that each targeting element binds
specifically to a target nucleic acid sequence of its corresponding
polynucleotide molecule, wherein (i) each target nucleic acid
sequence is located within 100 nucleotides of the corresponding
distinguishing element in one strand of the polynucleotide
molecule, and (ii) each distinguishing element distinguishes a
specific polynucleotide molecule from other nucleic acid molecules
that are nearly identical to the polynucleotide molecule, (B)
selectively stabilizing the binding of the targeting elements to
the target nucleic acid sequences of their corresponding
polynucleotide molecules to form stabilized targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecules are bound, (C)
immobilizing to substrate(s) via the separation groups the
targeting element-separation group complexes to which the target
nucleic acid sequences in the polynucleotide molecules are bound,
and (D) removing the immobilized targeting element-separation group
complexes to which the target nucleic acid sequences in the
polynucleotide molecules are bound to isolate the polynucleotide
molecules from the population of nucleic acid molecules.
[0034] In certain embodiments, different separation groups are
attached to different targeting elements. In certain other
embodiments, identical separation groups are attached to different
targeting elements.
[0035] In another aspect, the present invention provides a method
for amplifying a genomic DNA molecule of interest or a fragment
thereof, wherein the genomic DNA molecule of interest comprises a
polymorphic sequence, comprising: (a) contacting a genomic DNA
population that comprises the genomic DNA molecule of interest with
an oligonucleotide, wherein (i) the oligonucleotide comprises a
sequence at least substantially complementary to a target nucleic
acid sequence in one strand of the genomic DNA molecule of
interest, (ii) the target nucleic acid sequence is located
immediately 3' to the polymorphic sequence in the one strand of the
genomic DNA molecule of interest, and (iii) the 3' portion of the
oligonucleotide is complementary to the polymorphic sequence or a
portion thereof when annealing to the one strand of the genomic DNA
molecule of interest, (b) extending the oligonucleotide in the
presence of an immobilizable nucleotide using the one strand of the
genomic DNA molecule of interest to which the oligonucleotide
anneals as a template to provide an extension product, (c)
immobilizing to a substrate via the immobilizable nucleotide the
extension product to which the genomic DNA molecule of interest is
bound, (d) removing the immobilized extension product to which the
genomic DNA molecule of interest is bound to thereby isolate the
genomic DNA molecule of interest from the genomic DNA population,
(e) optionally elute the genomic DNA molecule of interest from the
substrate, and (f) isothermally amplifying the isolated or eluted
genomic DNA molecule of interest or a fragment thereof.
[0036] In another aspect, the present invention provides a method
for assembling a haplotype comprising: (a) providing a nucleic acid
population from an organism for which a haplotype is of interest;
(b) separately isolating polynucleotide molecules by
haplotype-specific extraction using multiple substrates, wherein
(i) polynucleotide molecules are isolated at multiple extraction
sites using each substrate, (ii) no polynucleotide molecules
isolated at one extraction site using one substrate comprise a
polymorphic site also present in polynucleotide molecules isolated
at other extraction sites using the same substrate, (iii) one or
more polynucleotide molecules isolated at one extraction site using
one substrate comprise a polymorphic site also present in
polynucleotide molecules isolated at a neighboring extraction site
using other substrates, (c) separately characterizing polymorphic
sites in polynucleotide molecules isolated using each substrate;
(d) assembling a haplotype based on the characterization of
polymorphic sites present in polynucleotide molecules isolated
using more than one substrate.
[0037] In certain embodiments, the method for assembling a
haplotype further comprises isothermally amplifying polynucleotide
molecules isolated using the multiple substrates prior to step
(c).
BRIEF DESCRIPTION OF THE DRAWINGS
[0038] FIG. 1A is a graphical representation of the number of DNA
molecules vs. length distribution for an isolated sample of nucleic
acid molecules. Fragments are targeted at an extraction point
characterized by a distinguishing element (in conjunction with a
nearby or an overlapping target nucleic acid sequence) that
uniquely identifies the fragments of interest. As an example,
randomly sheared fragments will get captured along with any
connected segments of the fragments that are located up- or
down-stream of the extraction point, provided that they contain the
unique sequence element (i.e., the distinguishing element in
conjunction with a nearby or overlapping target nucleic acid
sequence). The copy number of available captured templates for any
given locus connected to the extraction point will decrease with
increasing distance from the extraction point based on the overall
size distribution of the fragments.
[0039] FIG. 1B is a graphical representation of the number of DNA
molecules vs. length distribution for an isolated sample of nucleic
acid molecules showing linkage between an Extraction Point and
Locus A. The detection threshold and thus the directly achievable
linkage distance are determined by the minimum number of template
molecules that are required to obtain a detectable signal at a
distant locus with a given assay.
[0040] FIG. 1C is a graphical representation of the number of DNA
molecules vs. length distribution for an isolated sample of nucleic
acid molecules showing linkage between an Extraction Point, Locus
A, and Locus B after an amplification of all captured material is
performed. The overall template copy number has been increased and
can lead to an effective lowering of the detection threshold and an
increase in detectable linkage distance.
[0041] FIG. 2A is a graphical representation of the number of DNA
molecules vs. length distribution following non-biased (generic)
amplification of captured DNA.
[0042] FIG. 2B is a graphical representation of the number of DNA
molecules vs. length distribution following biased amplification
(combination of generic and locus-specific amplification) of
captured DNA.
[0043] FIG. 2C is a graphical representation showing a haplotype
isolated and assembled using three separate extractions.
[0044] FIG. 3 is a sequence-specific oligonucleotide probe (SSOP)
signal generated for a diploid control sample ("Diploid: B14, B44")
and a haplo-separated sample before ("Haploid: B*14") and after
whole-DNA amplification ("Haploid: B*14 after WGA").
[0045] FIG. 4 is a diagram of an apparatus for integrated
haplo-extraction, amplification and DNA analysis on a glass slide
with a silicone cover.
[0046] FIG. 5 shows a relative probability distribution (p) versus
nucleotide position for the presence of amplified outer and inner
regions of a 10 kb long fragment after multiple strand displacement
amplification using random primers that bind approximately every
500 nucleotides. Inner regions are preferentially amplified
compared to outer regions that are located near the 5'- or 3-'ends
of the fragment.
[0047] FIG. 6A shows amplification primers that are preferentially
located near the ends of the target fragment and directional
(5'.fwdarw.3') towards the center of the target fragment.
[0048] FIG. 6B shows a relative probability distribution (p) versus
nucleotide position for the sequence representation of different
regions of a 10 kb DNA fragment after multiple strand displacement
amplification using 10 primers chosen to be specific to each
terminus of the DNA fragment; with the distances between adjacent
primers being 50 nucleotides.
[0049] FIGS. 7A-7C are graphical representations showing interlaced
multiplexing of sequence-specific extraction, which solves
potential problem associated with physically overlapping
polymorphic sites among different extraction products. For a single
set of beads, multiplexed extraction sites are chosen so far apart
that extracted fragments of extreme length still do not give rise
to any detectable haplotype signal under certain given conditions
(FIG. 7A). Multiple sets of beads (i.e., 3 sets--beads A, beads B,
and beads C) may be used, but preferably each captured locus has
been extracted by only one targeting element (also referred to as a
"sequence-specific extraction probe") (FIG. 7B). Overlapping
polymorphic sites are then typed for each batch of multiplexed
beads and the contiguous haplotype is assembled based on the
information from consecutive multiplexed extractions (FIG. 7C)
DETAILED DESCRIPTION OF THE INVENTION
[0050] The present invention provides methods and compositions for
isolating and amplifying nucleic acid molecules based on certain
specific sequences (e.g., haplotype-specific or locus-specific) in
the polynucleotide molecules. The isolated polynucleotide molecules
may be subsequently isothermally amplified using generic,
sequence-specific (e.g., locus-specific), or sequence-biased (e.g.,
locus-biased) amplification. In certain embodiments, the present
invention is useful for isolating relatively large polynucleotide
molecules (e.g., about 50 kb or longer) followed by amplifying the
isolated polynucleotide molecules or portions thereof.
[0051] In certain embodiments, the methods according to the present
invention have one or more of the following advantages: (1)
facilitating the creation of haploid, re-usable genomic DNA
libraries from existing DNA sources, (2) reducing complexity of
nucleic acid analysis, thus increasing read-out sensitivity and
resolution, (3) extending the directly achievable linkage distance
per extraction and increasing the robustness of subsequent
manipulations by increasing the amount of available template, (4)
permitting the unambiguous typing of potentially difficult diploid
samples with allele pair combinations that fail to be resolved by
conventional sequence-based typing (SBT) or sequence-specific
oligonucleotide probes (SSOP), and (5) allowing for typing of
haplo-separated samples with multiple polymorphisms over large
linkage distances.
[0052] The detailed description of the methods according to the
present invention and their associated advantages are provided
below:
A. Nucleic Acid Extraction
[0053] Sequence specific extraction is described generally in U.S.
Patent Application Publication No. 20010031467 and PCT Application
Publication No. WO 01/042150. In general, sequence specific
extraction is a method for separating a polynucleotide molecule of
interest from a population of nucleic acid molecules based on a
specific sequence of the polynucleotide molecule of interest.
[0054] In certain embodiments, the nucleic acid extraction method
comprises: (1) contacting a nucleotide acid population that
comprises a polynucleotide molecule of interest with a targeting
element, wherein (a) one strand of the polynucleotide molecule
comprises a target nucleic acid sequence and a distinguishing
element, (b) the target nucleic acid sequence is within 100
nucleotides of the distinguishing element in the one strand of the
polynucleotide molecules, and (c) the targeting element binds
specifically to the target nucleic acid sequence in the
polynucleotide molecule of interest, (2) selectively attaching an
immobilizable separation group to the targeting element bound to
the target nucleic acid sequence in the polynucleotide molecule to
form a targeting element-separation group complex, (3) immobilizing
to a substrate via the separation group the targeting
element-separation group complex to which the target nucleic acid
sequence in the polynucleotide molecule is bound, and (4) removing
the immobilized targeting element-separation group complex to which
the target nucleic acid sequence in the polynucleotide molecule is
bound, thereby isolating the polynucleotide molecule from the
nucleic acid population.
[0055] In certain other embodiments, the nucleic acid extraction
method comprises: (1) contacting a nucleotide acid population that
comprises a polynucleotide molecule of interest with a targeting
element-separation group complex, wherein (a) one strand of the
polynucleotide molecule comprises a target nucleic acid sequence
and a distinguishing element, (b) the target nucleic acid sequence
is within 100 nucleotides of the distinguishing element in the one
strand of the polynucleotide molecules, and (c) the targeting
element-separation group complex binds specifically to the target
nucleic acid sequence in the polynucleotide molecule of interest,
(2) selectively stabilizing the binding of the targeting
element-separation group complex to the target nucleic acid
sequence in the polynucleotide molecule, (3) immobilizing to a
substrate via the separation group the targeting element-separation
group complex to which the target nucleic acid sequence in the
polynucleotide molecule is bound, and (4) removing the immobilized
stabilized targeting element-separation group complex to which the
target nucleic acid sequence in the polynucleotide molecule is
bound, thereby isolating the polynucleotide molecule from the
nucleic acid population.
[0056] 1. Sources of Nucleic Acids
[0057] Any nucleic acid specimen, in purified or non-purified form,
can be utilized as the starting nucleic acid or acids, provided it
contains, or is suspected of containing, a polynucleotide molecule
of interest. Thus, the process may employ, for example, genomic
DNA, plasmid DNA, amplified DNA, cDNA, total cellular RNA, hnRNA,
and polyA-containing RNA. Nucleic acids can be from a single
unicellular or eukaryotic organism. For example, the nucleic acid
can be obtained from a mammalian organism such as a human. A
mixture of nucleic acids may also be used.
[0058] The nucleic acid-containing sample may be from any source,
including biological fluids or tissues (e.g., blood, serum, urine,
stool, saliva, milk, ductal fluid, tears, buccal swap samples, and
semen). The sample may alternatively be from an organ such as
liver, brain, colon, urogenital, hematopoietic, thymus, testis,
ovarian, uterine, prostate, breast, colon, lung and renal tissue,
as well as a tumor associated with any of these tissues. Nucleic
acid molecules can be extracted by a variety of techniques
including those described by Sambrook and Russell (Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 3.sup.rd
Ed. Pp 6.4-6.32, 6.63 and 6.64, 2001).
[0059] In general, nucleic acid populations directly isolated from
biological samples may be used for sequence-specific extraction
without being first amplified. Direct extraction without prior
amplification (e.g., with random primers) may reduce background
during extraction and subsequent amplification and analysis of the
polynucleotide molecules of interest. However, if desired under
certain circumstances, the population of nucleic acids can be
amplified using PCR or another amplification technique, either in
its entirety or selectively for the fragment(s) of interest, prior
to performing sequence-specific extraction.
[0060] The sizes of nucleic acid molecules in a nucleic acid
population depend on the source of the nucleic acid population
(e.g., plasmid, viral genomes, bacterial genomes, eukaryotic
genomes), the method used in preparing the population from a
biological sample, and conditions under which the biological sample
is stored prior to nucleic acid isolation. For example, fresh or
well-stored samples generally contain less damaged nucleic acid
molecules than those stored under non-conservative conditions or in
samples that have been modified such as paraffin embedded
tissues.
[0061] In certain embodiments where extraction and amplification of
large polynucleotide molecules is desirable, methods for obtaining
biological samples and subsequent nucleic acid isolation from such
samples that maintain the integrity (i.e., minimize the breakage or
shearing) of nucleic acid molecules are preferred. Exemplary
methods include, but are not limited to, lysis methods without
further purification (e.g., chemical or enzymatic lysis method
using detergents, organic solvents, alkaline, and/or proteases),
nuclei isolation with or without further nucleic acid purification,
isolation methods using precipitation steps, nucleic acid isolation
methods using solid matrices (e.g., silica-based membranes, beads,
or modified surfaces that bind nucleic acid molecules), gel-like
matrices (e.g., agarose) or viscous solutions, and methods that
enrich nucleic acid molecules with a density gradient. In certain
embodiments, prior to sequence-specific extraction of
polynucleotide molecules of interest, isolated nucleic acid
molecules may first be ligated to repair nicks generated during
nucleic acid isolation, which in turn prevents single-stranded
regions to fully denature and break into smaller fragments during
optional denaturation steps of sequence-specific extraction.
Exemplary methods for large polynucleotide isolation and
purification may be found in Dear and Cook, Biochem J. 273 (Pt
3):695-9, 1991; Gurrieri and Bustamante, Biochem J. 326 (Pt
1):131-8, 1997; Upcroft and Upcroft, J Chromatogr. 618(1-2):79-93,
1993; Park etal., Clin Chem. 51(8):1520-3, 2005; Rook et al., Am J
Pathol. 164(1):23-33, 2004; Hummelshoj et al., Biotechniques
38(4):605-10, 2005; Vester and Wengel, Biochemistry
43(42):13233-41, 2004; Dean et al., Proc Natl Acad Sci USA.
99(8):5261-6, 2002; Hosono et al., Genome Res. 13(5):954-64, 2003;
and Kotler et al., Proc Natl Acad Sci USA. 90(9):4241-5, 1993.
[0062] 2. Targeting
[0063] In certain embodiments, the isolation of a polynucleotide
molecule of interest is based on a specific sequence (referred to
herein as a "target nucleic acid sequence" in conjunction with a
"distinguishing element") in the polynucleotide molecule. A
"distinguishing element" is a nucleotide sequence in a
polynucleotide molecule of interest capable of uniquely
distinguishing the polynucleotide molecule of interest from other
molecules that do not comprise the nucleotide sequence. The
distinguishing element can be, for example, a polymorphism (such as
a polymorphic oligonucleotide sequence, a single nucleotide
polymorphism, a haplotype `tag` single nucleotide polymorphism (tag
SNP), a short tandem repeat), a deletion, an insertion, an
inversion, a duplication, a translocation or another form of
chromosomal rearrangement. The distinguishing element can also be,
for example, a restriction site, a methylated restriction site, a
methylated sequence motif, a protein binding site, a site, region
or sequence found to be encoding SiRNA or targeted for silencing by
SiRNA, or a sequence with a specific secondary structure.
[0064] In certain embodiments, the distinguishing element is
allele-specific. As known in the art, "allele" refers to one of
several alternative forms of a gene occupying a given locus on a
chromosome. "Allele-specific" refers to a specific sequence capable
of distinguishing a particular allele from the other alternative
alleles. "Allele-specific extraction" refers to isolation of a
polynucleotide molecule of interest based on an allele-specific
sequence in the polynucleotide molecule.
[0065] In certain embodiments, the distinguishing element is
haplotype-specific. Also as known in the art, "haplotype" refers to
a set of alleles or markers of closely linked genes that are
usually inherited together.
[0066] "Haplotype-specific" refers to a specific sequence capable
of distinguishing between different haplotypes of a gene, for
example between a copy of the gene of maternal origin from that of
a paternal origin at a heterozygous site. "Haplotype-specific
extraction" refers to the isolation of a polynucleotide molecule of
interest based on a haplotype-specific sequence in the
polynucleotide molecule.
[0067] In certain other embodiments, the distinguishing element is
locus-specific. As known in the art, "locus" refers to a position
on a chromosome at which the gene for a particular trait resides. A
locus may be occupied by any one of the alleles for the gene.
"Locus-specific" refers to a specific sequence capable of
distinguishing a particular locus from another locus. In general,
the locus-specific sequence is a sequence shared by substantially
all of the alleles (i.e., more than about 80% of all of the
alleles) occupying the locus, but different from sequences at
another locus. In certain embodiments, a locus-specific sequence is
a sequence shared by more than about 90%, 95%, or 98% of all the
allele occupying a locus of interest. "Locus-specific extraction"
refers to isolation of a polynucleotide molecule based on a
locus-specific sequence in the polynucleotide molecule.
[0068] In certain embodiments, the distinguishing element is
capable of distinguishing a polynucleotide molecule of interest
from another nucleic acid molecule that is nearly identical to the
polynucleotide molecule. A nucleic acid molecule is "nearly
identical" to a polynucleotide molecule if they share over 95%
sequence identity. In certain embodiments, the distinguishing
element is capable of distinguishing a polynucleotide molecule of
interest from another nucleic acid molecule that is more than 96%,
97%, or 99% identical to the polynucleotide.
[0069] In addition to a distinguishing element, a strand of a
polynucleotide of interest also comprises a target nucleic acid
sequence to which a targeting element is able to bind. In certain
embodiments, the distance between the target nucleic acid sequence
and the distinguishing element is between 100 nucleotides and 0
nucleotide (including any integer value between 100 and 0, such as
50, 20, 25, 10, 8, 7, 6, 5, 4, 3, 2, and 1). In different
embodiments, the distinguishing element can be part of the target
nucleic acid sequence, and preferably be located at or near the 5'
terminus of the target nucleic acid sequence. The distance between
a target nucleic acid sequence is calculated based on (1) the
number of nucleotides between the 5' terminus of the target nucleic
acid sequence and the 3' terminus of the distinguishing element if
the target nucleic acid sequence is located 3' to the
distinguishing element, and (2) the number of nucleotides between
the 3' terminus of the target nucleic acid sequence and the 5'
terminus of the distinguishing element if the target nucleic acid
sequence is located 5' to the distinguishing element, except that
in the embodiments where the distinguishing element is part of the
target nucleic acid sequence, the distance between the
distinguishing element and the target nucleic acid sequence is
regarded as 0 nucleotide.
[0070] The terms "3'" and "5'" are used herein to describe the
location of a particular site within a single strand of a nucleic
acid molecule. When a location in a nucleic acid molecule is "3'to"
or "3'of" a reference nucleotide or a reference nucleotide
sequence, this means that the location is between the 3' terminus
of the reference nucleotide or the reference nucleotide sequence
and the 3' hydroxyl of that strand of the nucleic acid. Likewise,
when a location in a nucleic acid is "5'to" or "5'of" a reference
nucleotide or a reference nucleotide sequence, this means that it
is between the 5' terminus of the reference nucleotide or the
reference nucleotide sequence and the 5' phosphate of that strand
of the nucleic acid molecule. Further, when a nucleotide sequence
is "directly 3' to" (also used interchangeably with "immediately 3'
to") or "directly 3' of" (also used interchangeably with
"immediately 3' of") a reference nucleotide or a reference
nucleotide sequence, this means that the 5' terminus of the
nucleotide sequence is immediately next to the reference nucleotide
or the 3' terminus of the reference nucleotide sequence. Similarly,
when a nucleotide sequence is "directly 5' to" (also used
interchangeably with "immediately 5' to") or "directly 5' of" (also
used interchangeably with "immediately 5' of") a reference
nucleotide or a reference nucleotide sequence, this means that the
3' terminus of the nucleotide sequence is immediately next to the
reference nucleotide or the 5' terminus of the reference nucleotide
sequence.
[0071] In certain embodiments, a target nucleic acid sequence is
located 3' to a distinguishing element in one strand of a
polynucleotide molecule of interest. In certain embodiments, a
target nucleic acid sequence is located immediately 3' to a
distinguishing element in one strand of a polynucleotide molecule
of interest.
[0072] To isolate a polynucleotide molecule of interest from a
nucleic acid population, a targeting element is used to bind to a
target nucleic acid sequence in the polynucleotide molecule. A
"targeting element" (also referred to as a "sequence-specific
extraction probe" or "sequence-specific probe") refers to a
molecule that binds specifically to a target nucleic acid sequence
of a polynucleotide molecule of interest in a population of nucleic
acid molecules. A molecule that "binds specifically to" a target
nucleic acid sequence if under certain given conditions (e.g., in a
nucleic acid extension reaction mixture), the molecule binds to a
polynucleotide molecule that comprises the target nucleic acid
sequence, but does not bind to nucleic acid molecules that do not
comprise the target nucleic acid sequence.
[0073] In some embodiments, the targeting element is a nucleic
acid, or a nucleic acid derivative that hybridizes to a
complementary target nucleic acid sequence in a polynucleotide
molecule of interest. Examples of nucleic acid-based nucleic acid
derivatives include, e.g., an oligonucleotide, an oligo-peptide
nucleic acid (PNA), an oligo-LNA, or a ribozyme. The targeting
element can alternatively be a polypeptide or polypeptide complex
that binds specifically to a target nucleic acid sequence. Examples
of polypeptide-based targeting elements include, e.g., restriction
enzymes, transcription factors, RecA, nucleases, and other
sequence-specific DNA-binding proteins. The targeting element can
alternatively be a hybrid, complex or tethered combination of one
or more of individual targeting elements.
[0074] The binding of a targeting element to a target nucleic acid
sequence can occur as part of a discrete chemical or physical
association. For example, association can occur as part of an
enzymatic reaction, a chemical reaction, physical association,
polymerization, ligation, restriction cutting, cleavage,
hybridization, recombination, crosslinking, or a pH-based
cleavage.
[0075] In certain embodiments, the targeting element is an
oligonucleotide that is at least substantially complementary to a
target nucleic acid sequence in a polynucleotide molecule of
interest. An oligonucleotide is "at least substantially
complementary to" a target nucleic acid sequence when the
oligonucleotide is able to anneal to the target nucleic acid
sequence in a given reaction mixture (e.g., a nucleic acid
extension mixture). In certain embodiments, the targeting element
is exactly or completely complementary to the target nucleic acid
sequence, that is, each nucleotide of the targeting element is
complementary to the nucleotide of the target nucleic acid sequence
at its corresponding position.
[0076] In certain embodiments, a target nucleic acid sequence is
immediately 3' to a distinguishing element in one strand of a
polynucleotide molecule of interest, and a targeting element binds
to the target nucleic acid sequence in that strand of the
polynucleotide molecule so that the 3' terminal nucleotide of the
targeting element binds to the 5' terminal nucleotide of the target
nucleic acid sequence. As described in more detailed below,
extension of the oligonucleotide in the presence of a terminating
and immobilizable nucleotide complementary to a nucleotide in the
distinguishing element allows for distinction between the
polynucleotide molecule of interest and other nucleic acid
molecules that do not contain the distinguishing element.
[0077] In certain embodiments, a target nucleic acid sequence is
immediately 3' to a distinguishing element in one strand of a
polynucleotide molecule of interest, and a targeting element binds
to both the target nucleic acid sequence and the distinguishing
element (or at least a portion of the distinguishing element) in
that strand of the polynucleotide molecule so that the 3' terminal
nucleotide of the targeting element binds to a nucleotide in the
distinguishing element of the target nucleic acid sequence. Also as
described in detail below, selective extension of the
oligonucleotide using the strand of the polynucleotide molecule
that comprises both the target nucleic acid sequence and the
distinguishing element allows for distinction between the
polynucleotide molecule of interest and other nucleic acid
molecules that do not contain the distinguishing element.
[0078] The following provides detailed description of binding of an
exemplary targeting element (i.e., an oligonucleotide) to a target
nucleic acid sequence of a polynucleotide molecule of interest.
[0079] The targeting of a target nucleic acid sequence in a
polynucleotide molecule with an oligonucleotide is straightforward
when both are present in single-stranded form. A melting
temperature can be calculated for each oligonucleotide-target
nucleic acid sequence complex below which hybridization occurs. It
is possible to adjust the hybridization conditions (mainly
temperature and salt/cation concentration) such that only a
perfectly matched oligonucleotide binds to the target nucleic acid
sequence. Considerable literature and protocols exist on the
polymerase chain reaction (PCR), dyeterminator sequencing reactions
as well as mini-sequencing or primer extension reactions, which are
of similar nature as the enzymatic distinction reaction in this
invention (Molecular Cloning: A Laboratory Manual. Sambrook et al.,
Third Edition 2001, Cold Spring Harbor Laboratory Press, N.Y.;
AmpliTaq.TM. product sheet, Perkin Elmer/Roche, Branchburg, N.J.,
and references therein). Single stranded DNA can be generated in
several ways, for instance, by heating and subsequent quenching on
ice, NaOH denaturation or physical separation based on biotinylated
PCR-primers that get incorporated into only one copy of a PCR
product (Molecular Cloning: A Laboratory Manual. Sambrook et al.,
Third Edition 2001, Cold Spring Harbor Laboratory Press, N.Y.;
Mitchell and Merril, Anal Biochem. 1989 May 1; 178(2):23942)
[0080] If the polynucleotide molecule of interest is present in a
nucleic acid population as a double-stranded nucleic acid, such as
genomic or plasmid DNA, the target nucleic acid sequence in the
polynucleotide molecule of interest has to be rendered accessible
in order for the oligonucleotide to bind to the sequence. This can
be accomplished by thermal denaturation, that is, heating the
sample to a temperature (e.g., higher than 65.degree. C.,
80.degree. C. or 95.degree. C.) at which the DNA begins to melt and
form loops of single-stranded DNA. Thermal denaturation can be
substituted by other methods that facilitate the binding of the
targeting element to the target nucleic acid sequence, such as
chemical denaturation (e.g., by alkaline incubation of
polynucleotide molecules) or enzymatic strand separation (e.g.,
using helicase, RecA, etc.).
[0081] Under annealing conditions and typically in an excess of
oligonucleotide relative to the polynucleotide molecule of
interest, the oligonucleotides will, due to mass action as well as
their usually smaller size and thus higher diffusion coefficient,
bind to homologous regions before renaturation of the melted
fragment strands occurs. Oligonucleotides are also able to enter
double-stranded fragments at homologous locations under
physiological conditions (37.degree. C.) (lyer et al., J Biol.
Chem. 1995 Jun 16, 270(24):14712-7 and references cited
therein).
[0082] This is relevant since the possibility of
cross-hybridization between opposite strands of different alleles
can lead to the extraction of a mismatched double-stranded hybrid
of two alleles. It is usually undesirable to generate fully
single-stranded template DNA due to this reason, although the
likelihood for cross-hybridization to occur in a sample of genomic
DNA is small. A robust link of the separation group and the
distinguishing element, as discussed below, is able to retain the
polynucleotide molecule that comprises the distinguishing element
even under harsh denaturation and washing conditions.
[0083] Methods and kits have been developed to facilitate the
sequence-specific introduction of oligonucleotides into
double-stranded targets such as genomic or plasmid DNA and may be
used in connection with the present invention (lyer et al., J Biol.
Chem. 270(24):14712-7, 1995) and references cited therein; Teintze
et al., Biochem Biophys Res Commun. 211(3):804-11, 1995; Honigberg
et al., Proc Natl Acad Sci USA. 83(24):9586-90, 1986; Rigas et al.,
Proc Natl Acad Sci USA. 83(24):9591-5, 1986; Hakvoort et al.,
Nucleic Acids Res. 24(17):3478-80, 1996; Hakvoort et al., Gene
Cloning and Analysis by RT-PCR, Edited by Siebert and Larrick,
Biotechniques Books 1998, Natick, Mass.; ClonCapture.TM. cDNA
Selection Kit, Clontech, Palo Alto, Calif.; and Welcher et al.,
Nucleic Acids Res. 14(24): 10027-44, 1986). A coating of
oligonucleotides with DNA-binding proteins such RecA (e.g., E. coli
recombination protein "A") or staphylococcal nuclease speeds up
their incorporation several orders of magnitude compared to the
introduction of analogous unmodified oligonucleotides at higher
concentration and significantly increases the stability of such
complexes (Cunningham et al., Cell 24(1):213-23, 1981;
Belotserkovskii et al., Biochemistry. 38(33):10785-92, 1999; and
Sena and Zarling, Nat Genet. 3(4):365-72, 1993), while still
permitting enzymatic elongation of the introduced oligonucleotide
(lyer et al., J Biol. Chem. 270(24):14712-7, 1995 and references
cited therein). In certain embodiments, polymerases with a strand
displacement activity (e.g., Phi29 DNA polymerase and Obeta
replicase) and 3'-exonuclease protected targeting elements may be
used. For example, due to its strand displacement activity, Phi29
DNA polymerase may extend olionucleotides or polynucleotides using
a largely or completely double-stranded (i.e., not denatured) DNA
as a template. The ability of Phi29 DNA polymerase to use
non-denatured DNA as a template prevents breakage of template DNA
during denaturation. However, because Phi29 DNA polymerase also has
a proof-reading activity (i.e., an activity that corrects
mismatched 3'-end of primers and then extend them), 3'-exonuclease
protected primers (by using phosphorothioate bonds between the
bases or by the incorporation of LNAs) are preferably used.
Otherwise, the elimination of the mismatched 3'-end of primers
would interfere with distinction among different polynucleotide
molecules as discussed in detailed below.
[0084] Alternatively, or in addition, helper oligonucleotides may
be used to facilitate opening of double-stranded regions and/or
secondary structures of polynucleotide molecules. Such helper
oligonucleotides are 3'-phosphorylated and thus will not be
extended if added to a sequence-specific extraction reaction.
However, they can function to help hybridization and facilitate
opening of secondary structures in polynucleotide molecules.
Description of helper oligonucleotides useful in the present
invention may be found in U.S. Pat. Nos. 6,482,592; 5,387,510;
5,547,843; and 5,731,153.
[0085] All of the methods described above (as well as other known
methods) that facilitate the sequence-specific introduction of
oligonucleotides into double-stranded polynucleotide molecules of
interest may be particularly useful where the extraction of
relatively long polynucleotide molecules is desirable. Such methods
reduce the use of denaturation steps, which may cause fragmentation
of polynucleotide molecules of interest.
[0086] 3. Distinction
[0087] In certain embodiments, the distinction between a
polynucleotide molecule of interest and other nucleic acid
molecules in a nucleic acid population is accomplished by
selectively attaching an immobilizable separation group to a
targeting element that binds to a target nucleic acid sequence in
the polynucleotide molecule of interest. An immobilizable
separation group is "selectively attached" to a targeting element
if the immobilizable separation group is only attached to a
targeting element that is bound to a target nucleic acid sequence
in a polynucleotide molecule of interest that contains the
distinguishing element, but not to any targeting element that is
not bound to a target nucleic acid sequence in the polynucleotide
molecule of interest (e.g., any targeting element that is not bound
to any nucleic acid molecules, or any targeting element that is
bound to a nucleic acid molecule other than the polynucleotide
molecule of interest). Put differently, the selective attachment of
an immobilizable separation group to a targeting element depends on
whether or not the nucleic acid molecule to which the targeting
element is bound is a polynucleotide molecule of interest (i.e., a
nucleic acid molecule comprising a particular distinguishing
element in the strand where a target nucleic acid sequence to which
the targeting element binds is located).
[0088] In certain embodiments, the targeting element is an
oligonucleotide and the target nucleic acid sequence is immediately
3' to the distinguishing element in one strand of the
polynucleotide molecule of interest. In such embodiments, once the
oligonucleotide binds to the targeting nucleic acid sequence in the
polynucleotide molecule, it is enzymatically elongated in a 5' to
3' direction under appropriate conditions (e.g., in a nucleic acid
extension reaction mixture). The elongation takes place by
incorporation of individual nucleotides, whereby the identity of
the base immediately adjacent to the 3'-terminus of the
oligonucleotide (complementary to a nucleotide of the
distinguishing element (e.g., a polymorphic site) establishes a
differential in the elongated sequence. This differential can be
exploited such that a unique modified nucleotide is provided
containing a covalently linked separation element, such as
biotin.
[0089] For example, if "A" is provided with a biotin moiety
attached to it, only the extension product of the oligonucleotide
bound to a polynucleotide molecule having a "T" at the polymorphic
site will have a biotinylated "A". The oligonucleotides bound to
other nucleic acid molecule will also get extended but the first
extended nucleotide will not be biotinylated "A".
[0090] It is preferable that extension products of oligonucleotides
bound to nucleic acid molecules other than the polynucleotide
molecule of interest do not obtain a separation group. The
incorporation of separation group into extension products of
oligonucleotides that do not bind to the polynucleotide molecule of
interest could, for instance, take place if further downstream to
the polymorphic site, i.e., in the direction of enzymatic
elongation, a nucleic acid molecule to which the oligonucleotide
binds possess a "T", in which case a biotinylated "A" may be
incorporated. The problem may be eliminated by use of terminating
nucleotides, such that the elongation of the oligonucleotide stops
after the first incorporated nucleotide and no separation group can
be attached unless the base immediately adjacent to the 3'-end of
the oligonucleotide leads to its incorporation.
[0091] A modification of the above method allows the use of
non-terminating nucleotides. In this case, an oligonucleotide is
chosen such that it anneals to not only the target nucleic acid
sequence but also to the distinguishing element or at least a
portion of the distinguishing element in a polynucleotide molecule
of interest. Preferably, the 3' portion or 3' terminus of the
oligonucleotide is complementary to (and anneals to) the
distinguishing element or a portion thereof.
[0092] Conditions may be chosen so that the oligonucleotide gets
elongated only if it anneals to the polynucleotide molecule of
interest, but does not get elongated if it anneals to other nucleic
acid molecules that do not contain the distinguishing element in
the polynucleotide molecule of interest. The lack of the
distinguishing element in the other nucleic acid molecules results
in one or more mismatches (preferably at the 3' portion or 3'
terminus of the oligonucleotide), which makes it difficult for a
polymerase to extend the oligonucleotide. Such conditions include
those that allows hybridization of a perfectly matched
oligonucleotide to be highly favored over hybridization of the same
oligonucleotide to any site containing a mismatch (Woolley et al.,
Nat Biotechnol. 18(7):7603, 2000) and those that prevents a
polymerase from binding and initiating the polymerization if the
oligonucleotide-nucleic acid complex contains a base-mismatch
(Carver et al., Proc Natl Acad Sci USA. 91(22):10670-4, 1994). If
biotinylated nucleotides are present in the reaction, they will
only be incorporated into extension products of the
oligonucleotides bound to the polynucleotide molecule of
interest.
[0093] It is possible to use combinations of terminating and
non-terminating nucleotides, and it is not in all cases necessary
that the oligonucleotide binds immediately adjacent to the
polymorphic site.
[0094] In this example an intervening sequence is present between
the binding location of the targeting element and the polymorphic
site distinguishing the two alleles: TABLE-US-00001 (allele
5'-GATTACCAAAAATTC . . . 3' (SEQ ID NO:1) 1) (allele
5'-GATTACCAAAAAGTC . . . (SEQ ID NO:2) 2)
[0095] The two alleles can be distinguished by use of an
oligonucleotide that binds at the underlined sequence, in which
case the heterozygous site, in bold script, is not immediately
adjacent to the 3'-end of the oligonucleotide (the polymorphic site
is a "T" in allele 1 and a "G" in allele 2) by, for instance,
providing [0096] modified, but not necessarily terminating "A" with
a separation group attached; [0097] non-terminating "T" without a
separation element; [0098] unmodified, not necessarily terminating
"G"; and [0099] terminating but otherwise unmodified "C"
[0100] When the reaction is carried out, only allele 1 will obtain
a separation element by which it can be captured.
[0101] The selective attachment of separating groups to targeting
elements (e.g., oligonucleotides) as described above may be
performed by polymerase, such as DNA polymerases. In certain
embodiments, the DNA polymerase is a processive DNA polymerase.
"Processive DNA polymerases" refers to DNA polymerases that
polymerize more than 100 nucleotides per polymerase-nucleic acid
binding complex. In certain embodiments, processive DNA polymerases
that polymerize more than 500, 1000, or 2000 nucleotides per
polymerase-nucleic acid binding complex are used in the present
application. Exemplary processive DNA polymerases include, but are
not limited to, Phi29 DNA polymerase and Bca DNA polymerase.
[0102] In certain embodiments where selective attachment of
separating groups to targeting elements (e.g., oligonucleotides) is
performed by a DNA polymerase with a 3'.fwdarw.5' exonuclease
activity (i.e., proofreading activity), it is recommended (although
not absolutely necessary) that exonuclease resistant targeting
elements be used.
[0103] It is possible to immobilize or otherwise capture very large
molecules and complexes by a single separation group (Dapprich and
Nicklaus, Bioimaging 6(1):25-32, 1998; Teintze etal., Biochem
Biophys Res Commun. 211(3):804-11, 1995; Honigberg et al., Proc
Natl Acad Sci USA. 83(24):9586-90, 1986; Rigas et al., Proc Natl
Acad Sci USA. 83(24):9591-5, 1986; Hakvoort et al., Nucleic Acids
Res. 24(17):3478-80, 1996; Hakvoort et al., Gene Cloning and
Analysis by RT-PCR, Edited by Siebert and Larrick, Biotechniques
Books 1998, Natick, Mass.; ClonCapture.TM. cDNA Selection Kit,
Clontech, Palo Alto, Calif.; Welcher et al., Nucleic Acids Res.
14(24):10027-44, 1986; Hakvoort et al., Nucleic Acids Res.,
24(17):347880, 1996; Tagle et al., Nature. 361(6414):751-3, 1993).
If mere hybridization between homologous regions is utilized, the
length of the oligonucleotide-separation group has to be chosen of
sufficient size to prevent a loss of the fragment during
manipulation. For fragments of several hundred to thousand bases
size relatively short oligonucleotides (20 bases) are sufficient,
whereas longer fragment molecules will require oligonucleotides
that bind over larger distances. It is important to note in this
context that under conditions of manipulating fragments relative to
the surrounding solution by means of an oligonucleotide-separation
group, the stability of hybridization is somewhat reduced, since
temporary melting due to thermal fluctuations will occur on parts
of the sequence that may lead to strand dissociation of a complex
that is stable if there is no relative motion between components of
the solution.
[0104] It is advantageous if a covalently or topologically linked
bond is formed (or cleaved) between a separation element and a
target nucleic acid sequence as a result of the reaction that
distinguishes a polynucleotide molecule of interest and other
nucleic acid molecules. This can be achieved by providing a
reactive group linked to the separation group, so that upon
selective incorporation of the separation group the reactive group
is irreversibly attached to the target nucleic acid sequence only.
Examples for reactions that can be used for this purpose are
described for instance in Pfannschmidt et al., Nucleic Acids Res.
24(9):1702-9, 1996; Cimino et al., Annu Rev Biochem.
54:1151-93,1985; Takasugi et al., Proc Natl Acad Sci USA.
88(13):5602-6, 1991; Zenkova et al., Eur J. Biochem. 231(3):726-35,
1995; Francois et al., Proc Natl Acad Sci USA. ]86(24):9702-6,
1989; Perrouault et al., Nature. 344(6264):358-60, 1990; Le Doan et
al., Antisense Res Dev. 1(1):43-54, 1991; Barre et al., Proc Natl
Acad Sci USA. 97(7):3084-8, 2000; Sun et al., Proc Natl Acad Sci
USA. 86(23):9198-202, 1989; Sayers et al., Nucleic Acids Res
16(3):803-14, 19888; and Sayers et al., Nucleic Acids Res.
16(3):791-802, 1988. Examples for the formation of topologically
linked bonds are described in Escude et al., Proc Natl Acad Sci
USA. 96(19):10603-7, 1999; Antson et al., Nucleic Acids Res.
28(12):E58, 2000; and Nilsson et al., Nat Genet. 16(3):252-5,
1997.
[0105] Another method for selectively increasing the stability of
the binding between the oligonucleotide-separation group complex
and the polynucleotide molecule of interest is to provide a
targeting element with the separation element already attached and
further selectively stabilize the binding. The binding between an
oligonucleotide-separation group complex and a polynucleotide
molecule of interest is "selectively stabilized" if the binding
between an oligonucleotide-separation group complex and a
polynucleotide molecule of interest is stabilized while the binding
between an oligonucleotide-separation group complex and nucleic
acid molecules other than the polynucleotide molecule of interest
is not stabilized or is stabilized to a less degree.
[0106] More specifically, in certain embodiments, an
oligonucleotide may be first attached to one or more immobilizable
separation groups (e.g., biotinylated nucleotides) and then
annealed to both a target nucleic acid sequence and a
distinguishing element (or a portion thereof) in a polynucleotide
molecule of interest. The binding of the oligonucleotide and the
polynucleotide molecule of interest may be stabilized by extending
the 3' terminus of the oligonucleotide using the polynucleotide
molecule as a template, either in the presence of regular
nucleotides or in the presence of immobilizable nucleotides. The
binding of the oligonucleotide and a nucleic acid molecule that
does not comprise the distinguishing element, however, is not
stabilized or is stabilized to a lesser degree due to the
mismatch(es) (preferably at the 3' portion or 3' terminus of the
oligonucleotide), which prevents efficient extension by a
polymerase. In certain embodiments, the selective stabilization may
be accomplished by ligation of the oligonucleotide with another
nucleic acid fragment that is complementary to the region
immediately 5' to the nucleotide to which the 3' terminus of the
oligonucleotide anneals.
[0107] 4. Separation
[0108] Separation groups useful in the present invention can be any
moieties that facilitate subsequent isolation of attached targeting
elements that are themselves associated with target nucleic acid
sequence in polynucleotide molecules of interest. Such separation
groups include those that can interact specifically with a cognate
ligand. In certain embodiments, separation groups are
immobilizable, which allows the separation of polynucleotide
molecules associated with the separation groups via immobilization
to an appropriate substrate. An exemplary separation group
comprises or is an immobilizable nucleotide, e.g., a biotinylated
nucleotide or oligonucleotide. Other examples of separation groups
include ligands, receptors, antibodies, haptens, enzymes, chemical
groups recognizable by antibodies or aptamers.
[0109] The separation group can be immobilized on any desired
substrate. Examples of desired substrates include, but are not
limited to, particles, beads, magnetic beads, optically trapped
beads, microtiter plates, glass slides, papers, test strips, gels,
spin columns, other matrices, nitrocellulose, and nylon. The
substrate may comprise any binding partner capable of binding or
cross-linking the separation group. For example, when the
separation element is biotin, the substrate may comprise
streptavidin, or variations such as neutravidin.
[0110] In certain embodiments, enzyme-driven incorporation is
performed of a separation element, which becomes covalently
attached to the targeting element (e.g., an oligonucleotide). For
example, in certain embodiments, the targeting element is an
oligonucleotide with an extendable 3' hydroxyl terminus and the
separation group is an immobilizable nucleotide (such as a
biotinylated nucleotide). The separation group may be attached to
the targeting element by extending the oligonucleotide with a
polymerase in the presence of the biotinylated nucleotide, thereby
forming an extension product containing the immobilizable
nucleotide. The targeting element can itself be covalently attached
or topologically linked to the targeted polynucleotide (i.e., the
polynucleotide molecule of interest), which allows washing steps to
be performed at very high stringency and in turn results in reduced
background and increased specificity.
[0111] In a final step, the reaction mixture is separated into a
fraction that contains a polynucleotide molecule of interest (for
example of maternal origin) and another fraction that contains
other nucleic acid molecules (for example of paternal origin). This
is accomplished by immobilizing to a solid support the
polynucleotide molecule of interest of which the target nucleic
acid sequence is bound to a targeting element-separation group
complex. For instance, in the embodiments where a separation group
comprises a biotinylated nucleotide, selective incorporation of the
biotinylated nucleotide in an extension product of an
oligonucleotide that anneals to a target nucleic acid sequence in a
polynucleotide molecule of interest allows the polynucleotide
molecule, but not other nucleic acid molecules, to be bound to
streptavidin-coated magnetic beads. The beads may then be separated
from the reaction mixture, allowing for separation of the
polynucleotide molecule of interest bound to the beads from the
remaining reaction mixture, which comprises other nucleic acid
molecules.
[0112] As an optional step, the captured polynucleotide molecule of
interest can then itself be separated from the beads (or another
solid support) and eluted into a storage solution that does not
contain any beads. This can be accomplished for example by heating
the beads containing the bound polynucleotide molecule of interest
in water to at least 70.degree. C. for at least 1 second, or more
typically to 80.degree. C. for 10 minutes. The polynucleotide
molecule of interest will separate and remain separated from the
beads by reversible breakage of the biotin-streptavidin bond (see,
Holmberg et al., Electrophoresis 2005, 26, 501-510). The magnetic
beads are typically removed from a sample by drawing them to the
side of a tube with a magnet or by centrifugation and aspirating
the supernatant.
[0113] The advantage of removing the captured polynucleotide
molecule of interest from the beads (or another solid support) is
that some downstream amplification or typing assays may be
sensitive to the presence of magnetic beads (or another solid
support). For example at high concentrations, the beads may lead to
interference with an optical or enzymatic step in an amplification
or detection process. As described above, in certain embodiments
where non-terminating immobilizable nucleotides are selectively
incorporated into extension products of an oligonucleotide that is
specifically bound to only a target nucleic acid sequence of a
polynucleotide molecule of interest, a particularly strong
attachment is formed by multiple binding events between multiple
separation groups (e.g., biotinylated nucleotides) and solid
support (e.g., streptavidin-coated beads). This is particularly
advantageous for isolating a relative long polynucleotide
molecule.
[0114] Due to the twisted helical structure of double-stranded DNA,
extension products that comprise multiple separation groups (e.g.,
biotinylated nucleotides) can bind to a substrate (e.g.,
streptavidin-coated surface) in a way that topologically links the
polynucleotide molecule of interest (which is annealed to the
extension products) to the solid support, provided the distance of
the extended region is significantly greater than the average
distance between incorporated biotinylated nucleotides and the
pitch of the helix (about 3.4 nm or ten basepairs per turn).
[0115] In a related version of the method, topologically improved
binding of the polynucleotide molecule of interest to the solid
support is achieved by the use of multiple targeting elements and
separation groups that simultaneously bind the polynucleotide
molecule to a solid support with intervening sequences in between
each targeting element and separation group pair. It is necessary
that such multiple targeting elements co-identify the
polynucleotide molecule of interest so as to prevent binding of any
of such elements to other nucleic acid molecules.
[0116] In certain embodiments, relatively large polynucleotide
molecules of interest are isolated according to the present
invention. Exemplary lengths of the relatively large polynucleotide
molecules of interest extractable by the present invention include
no less than about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90,
100, 150, 200, 300, 400, 500, 600, 700, or 800 Kb, or no less than
about 1 Mb.
[0117] In preparation for the separation step, it is advantageous
to achieve fast on-rates as well as high selectivity and efficiency
of binding between the polynucleotide molecule of interest and the
solid support. If small polynucleotide molecules are to be
separated, it is sufficient to carry out the binding step by
incubation on a rotator at room temperature. In the case of large
polynucleotide molecules, two factors will interfere with the
reaction and result in slower and less efficient binding: a) a
large polynucleotide molecule has a significantly reduced diffusion
coefficient, and b) if only one separation element is associated
with the polynucleotide molecule, other regions of the same
molecule may interfere with the binding step by effectively
shielding the separation element from getting into sufficiently
close proximity to the solid support to initiate the binding
reaction. Relative motion between the polynucleotide molecule with
which a separation group is associated and the solid support
overcomes both problems. This can be achieved by different means,
for instance, by moving the beads used for capturing back and forth
through the solution by magnetic action, by centrifugation, by
repeated precipitation and resuspension, or by electrophoretically
generated movement. It can alternatively be achieved by relative
motion caused by the flow of the sample fluid through a fixed solid
support, for example a porous membrane or matrix that contains
immobilized streptavidin, for instance in a lateral flow device.
The motion of the fluid through the support can be achieved by
various means known in the art, for example by pumping, wicking,
hydrophilic interaction, vacuum action, gravity flow, or
centrifugation.
[0118] Any non-specific binding of nucleic acid molecules other
than the polynucleotide molecule of interest to the solid support
may result in incomplete separation of the polynucleotide molecule
from other nucleic acid molecules. Especially single-stranded DNA
may readily bind to untreated magnetic beads or other surfaces. The
problem is overcome by exposing the surface to a solution
containing components that saturate unspecific binding sites on the
surface but do not interfere with the specific binding of the
separation element (Duhamel and Whitehead, Methods Enzymol. 1990,
184:201-7). As an example, a blocking buffer "MBSB" may be used to
suppress unspecific binding to beads (2.8 .mu.m magnetic beads,
Dynabeads M-280 Streptavidin, Dynal A. S., Oslo, Norway, or 1 .mu.m
polystyrene beads, Streptavidin Coated Latex, Interfacial Dynamics
Corporation, Portland, Oreg.) with the result that biotinylated
fragments are readily amplified by PCR while non-biotinylated
fragments produced undetectable amplification products with both
types of beads (magnetic or polystyrene).
[0119] Buffer "MBSA" is a solution containing 10 mM Tris pH 7.5, 2
mM EDTA, 0.2% Tween-20, 1 M NaCl, 5 .mu.g/ml BSA, 1.25 mg/ml
"carnation" dried milk (Nestle), 1 mg/ml glycine. Buffer "MBSB" is
identical to "MBSB" with the addition of 200 ng/.mu.l sheared
salmon sperm DNA (GIBCO BRL), average size about 1000 basepairs,
boiled for 3 min. and quenched on ice, and 50 nM each of
oligonucleotides of the sequences TTAGTGCTGMCAAGTAGATCAGA (SEQ ID
NO:3) and GTATATTCCAAGATCCATTAGCAG (SEQ ID NO:4).
[0120] Beads were washed twice in 1 ml "MBSA" by briefly vortexing
and precipitating. Precipitation was performed with a particle
collection magnet (Polysciences, Warrington, Pa.) for 1 min.
(magnetic beads), or by centrifugation at 13,000 rpm on a table-top
centrifuge for 3 min. (polystyrene beads). The beads were then
incubated in 100 .mu.l "MBSB" in a fresh tube rotating at RT for 2
hours and stored refrigerated in "MBSB".
[0121] Biotinylated and non-biotinylated fragments of identical
sequence and 225 basepairs length were generated by PCR
amplification of a region in the HLA (human leukocyte associated)
locus.
[0122] An alternative to prevent contamination with
non-specifically extracted nucleic acid molecule other than a
polynucleotide of interest is to use a cleavable linker, which
enables the selective release of targeted fragments into solution
after separation has been completed (Dynal product sheet for
Dynabeads M-280 Streptavidin, Dynal A. S., Oslo, Norway,
www.dynal.no, and references cited therein, Pierce Chemical
Technical Library: "Avidin-biotin", Pierce, Rockford, Ill.,
www.piercenet.com, and references cited therein; and Dawson et al.,
J Biol. Chem. 264(22):12830-7, 1989).
[0123] In the embodiments where separation groups are attached to
targeting elements before the targeting elements are contacted with
a nucleic acid population and where the distinction between a
polynucleotide molecule of interest and other nucleic acid
molecules is accomplished by selective stabilization of the binding
between the targeting element-separation complex and the
polynucleotide molecule of interest, the immobilization of the
polynucleotide molecule via the associated separation group should
be performed under conditions so that only the selectively
stabilized complexes that comprise the polynucleotide molecule of
interest and the targeting element-separation group are immobilized
to the substrate, but not complexes that comprise the targeting
element-separation group and other, unstabilized nucleic acid
molecules. Such conditions prevent or reduce the immobilized
fraction from being contaminated with nucleic acid molecules other
than the polynucleotide molecule of interest. Exemplary conditions
include those that allow annealing between two relatively long
nucleic acid fragments, but cause dissociation between a relatively
short nucleic acid fragment from its annealing partner.
[0124] 5. Multiplexing
[0125] If desired, the above-described methods can be repeated with
a second targeting element by contacting the population of nucleic
acid molecules with a second targeting element that binds
specifically to a second target nucleic acid sequence in a second
polynucleotide sequence of interest in the population of nucleic
acid molecules. A second separation group is selectively attached
to the second targeting element. The attached second separation
group is then immobilized to a substrate, thereby forming a second
immobilized targeting element-separation group complex to which the
second polynucleotide molecule is bound. The immobilized targeting
element-separation group complex to which the second polynucleotide
molecule is bound is then removed from the population of nucleic
acid molecules, thereby separating the second nucleic acid sequence
of interest from the other nucleic acid molecules in the nucleic
acid population.
[0126] In related embodiments, a second separation group is first
attached to a second targeting element capable of specifically
binding to a second target nucleic acid sequence of a second
polynucleotide molecule of interest. The resulting second targeting
element-separation group specifically binds to the second target
nucleic acid sequence in the second polynucleotide molecule of
interest. The binding between the second targeting
element-separation group complex and the second polynucleotide
molecule is then selectively stabilized. The stabilized complex
that comprises the second targeting element-separation group
complex and the second polynucleotide molecule is subsequently
immobilized to a substrate under conditions that prevents the
immobilization of unstabilized complex that comprises the second
targeting element-separation group complex and nucleic acids other
than the second polynucleotide molecule. The immobilized targeting
element-separation group complex to which the second polynucleotide
molecule is bound is then removed from the population of nucleic
acid molecules, thereby separating the second nucleic acid sequence
of interest from the other nucleic acid molecules in the nucleic
acid population.
[0127] In certain embodiments, the steps and methods described
above may be repeated multiple times sequentially. For example, a
third targeting element and a third separation group may be used to
isolate a third polynucleotide molecule of interest from the
non-immobilized fraction that comprises nucleic acid molecules
resulting from the isolation of the second polynucleotide molecule
of interest. This process may be repeated a fourth, fifth, sixth,
etc. time to isolate a fourth, fifth, sixth, etc. polynucleotide of
interest.
[0128] In certain embodiments, the methods described above may be
performed in a multiplexed fashion by targeting more than one
(e.g., at least 3, 5, 10, 25, 50, 75, 100, 250, or 500)
polynucleotides molecule of interest or more than one (e.g., at
least 3, 5, 10, 25, 50, 75, 100, 250, or 500) regions of a
polynucleotide molecule of interest at once.
[0129] In certain embodiments, the sequence-specific extraction
performed in a multiplexed fashion (to extract multiple
polynucleotide molecules of interest) according to the present
invention comprises: (A) contacting a nucleic acid population that
comprises multiple polynucleotide molecules of interest with
multiple targeting elements so that each targeting element binds
specifically to a target nucleic acid sequence of its corresponding
polynucleotide molecule, wherein (i) each target nucleic acid
sequence is located within 100 nucleotides of a distinguishing
element in one strand of the polynucleotide molecule, and (ii) the
distinguishing elements distinguish the polynucleotide molecules
from other nucleic acid molecules that are nearly identical, (B)
selectively attaching separation groups to the multiple targeting
elements bound to the target nucleic acid sequences of
corresponding polynucleotide molecules to form targeting
element-separation group complexes, (C) immobilizing to
substrate(s) via the separation groups the targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecules are bound, and (D)
removing the immobilized targeting element-separation group
complexes to which the target nucleic acid sequences in the
polynucleotide molecules are bound to isolate the polynucleotide
molecules from the population of nucleic acid molecules.
[0130] In certain other embodiments, the sequence-specific
extraction performed in a multiplexed fashion (to extract multiple
polynucleotide molecules of interest) according to the present
invention comprises: (A) contacting a nucleic acid population that
comprises multiple polynucleotide molecules of interest with
multiple targeting elements to which separation groups are attached
so that each targeting element binds specifically to a target
nucleic acid sequence of its corresponding polynucleotide molecule,
wherein (i) each target nucleic acid sequence is located within 100
nucleotides of a distinguishing element in one strand of the
polynucleotide molecule, and (ii) the distinguishing elements
distinguish the polynucleotide molecules from other nucleic acid
molecules that are nearly identical, (B) selectively stabilizing
the polynucleotide molecules to form stabilized targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecules are bound, (C)
immobilizing to substrate(s) via the separation groups the
targeting element-separation group complexes to which the target
nucleic acid sequences in the polynucleotide molecules are bound,
and (D) removing the immobilized targeting element-separation group
complexes to which the target nucleic acid sequences in the
polynucleotide molecules are bound to isolate the polynucleotide
molecules from the population of nucleic acid molecules.
[0131] In certain embodiments, the sequence-specific extraction
performed in a multiplexed fashion (to extract multiple regions in
a single polynucleotide molecule of interest) according to the
present invention comprises: (A) contacting a nucleic acid
population that comprises a polynucleotide molecule of interest
with multiple targeting elements so that each targeting element
binds specifically to its corresponding target nucleic acid
sequence in the polynucleotide molecule of interest, wherein (i)
each target nucleic acid sequence is located within 100 nucleotides
of its corresponding distinguishing element in one strand of the
polynucleotide molecule, and (ii) each distinguishing element is
capable of distinguishing the polynucleotide molecule from other
nucleic acid molecules that are nearly identical, (B) selectively
attaching a separation group to each of the multiple targeting
elements bound to the target nucleic acid sequences of the
polynucleotide molecule to form targeting element-separation group
complexes, (C) immobilizing to a substrate via the separation
group(s) the targeting element-separation group complexes to which
the target nucleic acid sequences in the polynucleotide molecule
are bound, and (D) removing the immobilized targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecule are bound to isolate the
polynucleotide molecule from the population of nucleic acid
molecules.
[0132] In certain embodiments, the sequence-specific extraction
performed in a multiplexed fashion (to extract multiple regions in
a single polynucleotide molecule of interest) according to the
present invention comprises: (A) contacting a nucleic acid
population that comprises a polynucleotide molecule of interest
with multiple targeting elements to each of which a separation
group is attached so that each targeting element binds specifically
to its corresponding target nucleic acid sequence in the
polynucleotide molecule, wherein (i) each target nucleic acid
sequence is located within 100 nucleotides of its corresponding
distinguishing element in one strand of the polynucleotide
molecule, and (ii) the distinguishing elements distinguish the
polynucleotide molecules from other nucleic acid molecules that are
nearly identical, (B) selectively stabilizing the binding of each
targeting element to its corresponding target nucleic acid sequence
in the polynucleotide molecule to form stabilized targeting
element-separation group complexes to which the target nucleic acid
sequences in the polynucleotide molecule is bound, (C) immobilizing
to a substrate via the separation group(s) the targeting
element-separation group complexes to which the targeting nucleic
acid sequences in the polynucleotide molecule are bound, and (D)
removing the immobilized targeting element-separation group
complexes to which the target nucleic acid sequences in the
polynucleotide molecule are bound to isolate the polynucleotide
molecule from the population of nucleic acid molecules.
[0133] As described above, multiplexed sequence-specific extraction
may be accomplished by use of multiple oligonucleotides that
specifically bind to different polymorphic sequences (i.e.,
different distinguishing elements) in a single polynucleotide
molecule of interest or in multiple polynucleotide molecules of
interest. If the polymorphisms are all of the same type (for
instance all "T"s), all polynucleotide molecules of interest that
comprise the polymorphisms can be extracted with the same type of
separation group, for example, a biotinylated "A" (termed "first
order multiplexing"). If the polymorphisms are of different types,
various separation groups that comprise different immobilizable
moieties attached to different types of nucleotides) can be used to
selectively extract the corresponding polynucleotide molecules that
comprise the polymorphisms (termed "second order multiplexing").
For instance, all polymorphisms of type "T" may be targeted by the
use of a biotinylated "A" and extracted with streptavidin-coated
beads, all polymorphisms of type "C" with fluorescein-modified "G"
and beads containing antibodies against "G", and so on. This
embodiment is especially useful if alleles of a sample are to be
separated for which the genotype at a certain targeted polymorphic
site is unknown. In certain embodiments where the polymorphisms are
of different types, various separation groups (e.g., biotinalyted
"A" and biotinalyted "G") that comprise same immobilizable moieties
(e.g., a biotin) attached to different types of nucleotides (e.g.,
"A" and "G") can be used to selectively extract the corresponding
polynucleotide molecules that comprise the polymorphisms. The use
of same immobilizable moieties allows the immobilization of
polynucleotide molecules of interest to be performed on a single
type of substrates (e.g., streptavidin-coated beads) or a single
substrate (a surface coated with a specific antibody).
[0134] In general, for multiplexed sequence-specific extraction to
extract multiple regions in a single polynucleotide molecule of
interest, the separation group(s) used are immobilizable to a same
substrate. In certain embodiments, however, the separation group(s)
used may be immobilizable to different substrates.
[0135] In one embodiment, a set of targeting elements for combined,
multiplexed haplo-separation are designed to encompass a
substantial portion of the genome or the whole genome and allow for
potentially overlapping haplo-separations of any region, based on
the polymorphisms found therein. In some embodiments, targeting
elements are designed for preferred regions containing candidate
genes located on multiple, typically unlinked loci. Depending on
the preference of the user, multiplexed or sequential
haplo-extractions may be targeting 1 to 1000 (including any integer
value therebetween) or more unique sequence elements (i.e.,
distinguishing elements) at once. The initial targeting element set
is typically small and increased as the need for additional genetic
information is warranted. The captured polynucleotide molecules of
interest may be as small as a few hundred basepairs, and are more
typically about 50,000 to 100,000 bases in length if isolated from
genomic DNA, and may extend to entire chromosomes if DNA isolation
and haplo-separation protocols are used that preserve the integrity
of the DNA starting material.
[0136] In certain embodiments where the present invention is used
for haplotyping and where a single type of substrates (e.g.,
streptavidin-coated beads) or a single substrate is used, the
locations of neighboring distinguishing elements on a region of a
genome (also referred to as neighboring "extraction sites") should
in general be sufficiently apart from each other so that no
extracted polynucleotide molecules are longer than the distance
between neighboring extraction sites (FIG. 7A). Otherwise,
physically overlapping polymorphic sites may be present between
polynucleotide molecules extracted from one extraction site and
those extracted from a neighboring extraction site using a same
substrate, which could give rise to spurious signals that might
confound the true haplotype signal.
[0137] In certain embodiments where multiple types of substrates
(e.g., streptavidin-coated beads and antibody-coated beads) are
used for consecutive extractions to determine haplotype, similar to
the above description, the neighboring extraction sites extractable
using a single type of substrates (e.g., streptavidin-coated beads)
should in general be sufficiently apart from each other so that no
polynucleotide molecules extracted using that single type of
substrates are longer than the distance between neighboring
extraction sites. The above description is illustrated in FIG. 7B.
More specifically, polynucleotide molecules isolated using beads A
at Extraction Sites 1, 4, and 7 should not have overlap. Similarly,
polynucleotide molecules isolated using beads B at Extraction Sites
2, 5, and 8 should not overlap, and polynucleotide molecules
isolated using beads C at Extraction Sites 3 and 6 should not
overlap.
[0138] However, polynucleotide molecules extracted using one type
of substrates (e.g., streptavidin-coated beads) may have
overlapping polymorphic sites with polynucleotide molecules
extracted using another type of substrates (e.g., antibody-coated
beads). Such overlapping polymorphic sites are then typed for each
batch of polynucleotide molecules extracted (i.e., polynucleotide
molecules extracted using each type of substrates) and the
contiguous haplotype is assembled based on the information from
consecutive, multiplexed extractions. The above description is
illustrated in FIG. 7C. More specifically, polynucleotide molecules
isolated using beads A at Extraction site 1 may overlap with those
isolated using beads B at Extraction site 2, polynucleotide
molecules isolated using beads B at Extraction site 2 may overlap
with those isolated using beads C at Extraction site 3, and so on.
Polymorphic sites in polynucleotide molecules isolated using beads
A, beads B and beads C are typed separately, and overlapping sites
among polynucleotide molecules isolated using different beads
(i.e., beads A, beads B, or beads C) are used to assemble a
contiguous haplotype.
[0139] Accordingly, in one aspect, the present invention provides a
method for assembling a haplotype comprising: (a) providing a
nucleic acid population from an organism for which a haplotype is
of interest; (b) separately isolating polynucleotide molecules by
haplotype-specific extraction using multiple substrates, wherein
(i) polynucleotide molecules are isolated at multiple extraction
sites using each substrate, (ii) no polynucleotide molecules
isolated at one extraction site using one substrate comprise a
polymorphic site also present in polynucleotide molecules isolated
at other extraction sites using the same substrate, (iii) one or
more polynucleotide molecules isolated at one extraction site using
one substrate comprise a polymorphic site also present in
polynucleotide molecules isolated at a neighboring extraction site
using other substrates, (c) separately characterizing polymorphic
sites in polynucleotide molecules isolated using each substrate;
(d) assembling a haplotype based on the characterization of
polymorphic sites present in polynucleotide molecules isolated
using more than one substrate. In certain embodiments, the method
for assembling a hyplotype further comprises isothermally
amplifying polynucleotide molecules isolated using the multiple
substrates prior to step (c). However, isothermal amplification of
isolated polynucleotide molecules are not always required prior to
their characterization, and thus not used in certain other
embodiments.
B. Nucleic Acid Amplification
[0140] The isolated polynucleotide molecules of interest as
described above or portions thereof may be further isothermally
amplified according to the present invention. Such amplification
may be performed with the polynucleotide molecules of interest
still attached to a substrate, or with the polynucleotide molecules
of interest after dissociated from the substrate. The amplification
may by generic, sequence-specific, or biased.
[0141] The amplification increases the number of nucleic acid
molecules that comprise a locus of interest and thus enhances
sensitivity of subsequent analysis (FIGS. 1A-1C). More
specifically, FIG. 1A shows the number of DNA molecules and their
length distribution of an isolated polynucleotide sample. The
extraction point corresponds to the location of the distinguishing
element used to isolate polynucleotide molecules from an initial
nucleic acid population. FIG. 1B shows that linkage between an
extraction point and Locus A. Because Locus A is located relatively
close to the extraction point, the isolated polynucleotide sample
contains a sufficient amount of polynucleotide molecules that
comprise Locus A. The isolated polynucleotide sample may thus be
directly used to detect and analyze Locus A. FIG. 1C shows that
linkage among an extraction point, Locus A and Locus B. Unlike
Locus A, Locus B is relatively distant from the extraction point.
The isolated polynucleotide sample does not contain a sufficient
amount of polynucleotide molecules that comprise Locus B in order
for Locus B to be directly detected or analyzed. However,
amplifying the polynucleotide sample according to the present
invention increases the amount of polynucleotide molecules that
comprise locus B and allows for subsequent detection and analysis
of this locus.
[0142] 1. Generic Amplification
[0143] "Generic amplification" refers to amplification of
polynucleotide molecules wherein only random primers are used.
Generic amplification is illustrated schematically in FIG. 2A. In
certain embodiments, primers may be between 6 and 40 nucleotides in
length, such as between 6 and 30, or between 8 and 20 nucleotides
in length.
[0144] Generic amplification is also referred to as "whole DNA
amplification" (WDA). In addition, if isolated polynucleotide
molecules are genomic DNA, generic amplification is also referred
to as "whole genome amplification" (WGA).
[0145] Generic amplification increases the number of template
molecules that are available at any given locus. This reduces the
threshold level at which a reliable signal can be detected and also
increases the distance over which the linkage of multiple loci
(shown as Locus A and Locus B in FIGS. 1B and 1C) can be
definitively established.
[0146] Depending on reaction conditions, polynucleotide molecules
to be amplified, and lengths of random primers, random primers
generally bind approximately every 200 to 1000 nucleotides in each
strand along the polynucleotide molecules. If strand displacement
amplification is used in combination of random primers, the inner
regions of template polynucleotide molecules would be amplified
exponentially. In contrast, regions located near either terminus of
the template polynucleotide molecules would be amplified
substantially linearly. This results in a higher copy number of
inner regions compared to regions at the end of the template
polynucleotide molecules. This is shown in FIG. 5, where the
probability (p) for the presence of outer and inner regions in a 10
kb long fragment after strand displacement amplification using
random primer that bind approximately every 500 nucleotides is
calculated.
[0147] 2. Sequence-Specific Amplification
[0148] "Sequence-specific amplification" refers to amplification of
a polynucleotide molecule wherein only sequence-specific primers
are used. A primer is "specific to" a sequence of interest (e.g., a
polynucleotide molecule isolated by sequence-specific extraction)
if it anneals to the sequence of interest under certain given
conditions, but does not anneal to other nucleic acid molecules in
an amplification reaction mixture under the same conditions.
[0149] In certain embodiments, the sequence-specific amplification
according to the present invention is locus-specific.
"Locus-specific amplification" refers to amplification of a
polynucleotide molecule wherein only primers specific to a
particular locus are used. Each amplification product of a
locus-specific amplification comprises at least a portion of the
sequence of the locus of interest.
[0150] A primer is "specific to" a locus if under certain given
conditions (e.g., under isothermal conditions for nucleic acid
amplification), it binds to a common sequence within, or flanking,
the locus shared by all or a majority of the alleles occupying the
locus, but does not bind to other sequences (e.g., sequences of
other loci). A sequence "flanks" a locus if the sequence is located
outside the locus but the distance between the sequence and a
nearby terminus of the locus is within 500 nucleotides. In certain
embodiments, a sequence flanking a locus is 300, 200, 150, 100, 50
nucleotides apart from a nearby terminus of the locus.
[0151] In certain embodiments, locus-specific primers may be
between 6 and 40 nucleotides in length, such as between 6 and 30,
or between 8 and 20 nucleotides in length. In certain embodiments,
more than 50% of the nucleotides (e.g., more than 70%, 80%, 85%,
90%, 95%, or 98%) in a locus-specific primer are complementary to
their corresponding nucleotides in one strand of a template
polynucleotide molecule.
[0152] In certain embodiments, the primers are designed so that 30%
to 100% of regions of highest amplification rates overlap with a
region of interest. In certain embodiments, about 50% to 100% or
about 80% to 100% of regions of highest amplification rates overlap
with a region of interest.
[0153] In certain embodiments, both sense and anti-sense primers
are used. A "sense primer" is a primer that anneals to a portion of
the strand of a polynucleotide molecule that comprises a target
nucleic acid sequence and a distinguishing element. An "anti-sense
primer" is a primer that anneals to the strand of a polynucleotide
molecule that does not comprise a target nucleic acid sequence or a
distinguishing element.
[0154] In certain embodiments, multiple sequence-specific sense and
anti-sense primers are used to increase the amplification rate
and/or to ensure sufficient amplification of template
polynucleotide molecules, especially near the two termini of the
template polynucleotide molecules. In certain embodiments, more
than 4, 6, 8, or 10 primers that anneal in close vicinity of each
of the two termini of a template polynucleotide molecule are used.
The closer the distance between the primers and the terminus of a
template polynucleotide molecule near which the primers anneal, the
higher the probability of highest amplification rate over the whole
template polynucleotide molecule. In certain embodiments, the
distances between the primers and the terminus of a template
polynucleotide molecule near which the primers anneal are between 1
and 1000 nucleotides, such as between 1 and 500 nucleotides or
between 1 and 250 nucleotides. FIG. 6B shows relative probability
of sequence representation of different regions of 10 Kb DNA
fragment from nucleic acid amplification using 10 primers specific
to each terminus of the DNA fragment with the distances between
adjacent primers being 50 nucleotides.
[0155] In certain related embodiments, multiple sequence-specific
sense and anti-sense primers are used to increase the amplification
rate and/or to ensure sufficient amplification of a locus of
interest, especially near the two termini of the locus. In certain
embodiments, more than 4, 6, 8, or 10 primers that anneal in close
vicinity of each of the two termini of a locus of interest are
used. The closer the distance between the primers and the terminus
of a locus of interest near which the primers anneal, the higher
the probability of highest amplification rate over the whole locus.
In certain embodiments, the distances between the primers and the
terminus of a locus of interest near which the primers anneal are
between 1 and 1000 nucleotides, such as between 1 and 500
nucleotides or between 1 and 250 nucleotides.
[0156] In certain embodiments, end-specific primers are used
together with center-specific primers for amplifying polynucleotide
molecules or regions thereof (e.g., via strand displacement). The
addition of center-specific primers to a reaction with end-specific
primers may be useful for amplifying long template polynucleotide
molecules. In certain embodiments, the lengths of template
polynucleotide molecules may be at least about 5, 10, 15, 20, 25,
30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, 600, 700,
or 800 Kb, or no less than about 1 Mb.
[0157] "End-specific primers" are (i) primers that anneal to a
template polynucleotide molecule within 500 nucleotides from a
neighboring end of the template polynucleotide if the whole
polynucleotide molecule is intended to be amplified, or (ii)
primers that anneal to a template polynucleotide molecule in a
polynucleotide molecule located within 500 nucleotides from a
neighboring end of a particular region of interest (e.g., a locus)
if only the particular region of interest is intended to be
amplified. In the former case, end-specific primers anneal to a
location within the template polynucleotide molecule of interest.
In the latter case, end-specific primers may anneal to a location
within the particular region of interest, or may anneal to a
location flanking the particular region of interest (i.e., outside
the particular region of interest).
[0158] "Center-specific primers" are primers that anneal to a
template polynucleotide molecule of interest more than 500
nucleotides apart from a neighboring end of the polynucleotide
molecule if the whole polynucleotide molecule of interest is
intended to be amplified, or (ii) primers that anneal to a
particular region (e.g., a locus) of a template polynucleotide
molecule located more than 500 nucleotides apart from a neighboring
end of the particular region of interest if only the particular
region of interest is intended to be amplified.
[0159] In certain embodiments, the distances between neighboring
end-specific primers are between 1 to 500 nucleotides (e.g.,
between 10 and 400 nucleotides, between 20 and 300 nucleotides,
between 30 and 200 nucleotides, between 40 and 100 nucleotides,
between 50 and 80 nucleotides). In certain embodiments, the average
distance between neighboring end-specific primers are between 50
and 250 nucleotides (including any values therebetween, such as
about 100 nucleotides).
[0160] In certain embodiments, the distances between neighboring
center-specific primer are between 1 and 10,000 nucleotides (e.g.,
between 10 and 5,000 nucleotides, between 50 and 2000 nucleotides,
or between 100 and 1000 nucleotides). In certain embodiments, the
average distance between neighboring center-specific primers are
between 100 and 5000 nucleotides (including any values
therebetween, such as about 2000 nucleotides).
[0161] Both end-specific primers and center-specific primers may be
sense primers or antisense primers. In certain embodiments, both
sense end-specific primers and anti-sense end-primers are present
in an amplification reaction mixture. In certain embodiments, both
sense center-specific primers and anti-sense center-specific
primers are present in an amplification reaction mixture. In
certain embodiments, sense end-specific primers, anti-sense
end-primers, sense center-specific primers and anti-sense
center-primers are present in an amplification reaction
mixture.
[0162] In certain other embodiments, end-specific primers may be
used in the absence of any center-specific primers. Such primers
are designed to be directional (5'.fwdarw.3') towards the center of
a template polynucleotide molecule or of a region of interest in a
template polynucleotide molecule (FIG. 6A).
[0163] 3. Sequence-Biased Amplification
[0164] "Sequence-biased amplification" is a hybrid of generic
amplification and sequence-specific amplification. It is performed
in the presence of both random primers and sequence-specific
primers.
[0165] In certain embodiments, sequence-biased amplification is
locus-biased. "Locus-biased amplification" is a hybrid of generic
amplification and locus-specific amplification. It is performed in
the presence of both random primers and locus-specific primers
(FIG. 2B). Locus-biased amplification results in preferentially
amplification of the locus of interest relative to other
polynucleotide molecule in an isolated nucleic acid sample. For
example, if an extraction at HLA-B is performed and linkage to
HLA-C is sought, it is advantageous to not only use random primers
for WDA but to `spike` the amplification mix with primers designed
to bind in the region around the HLA-C locus. In this way, the
locus-specific primers will preferentially amplify the specific
region(s) (HLA-C in this example), but not in a strictly
locus-specific way as during PCR.
[0166] The use of random primers in combination of sequence
specific primers is useful, especially for the amplification of
long template polynucleotide molecules or amplification of multiple
regions in long template polynucleotide molecules. In certain
embodiments, the lengths of template polynucleotide molecules may
be at least 5, 10, 20, 40, 50, 60, 80, 100, 200, 400, or 500
Kb.
[0167] In certain embodiments, random primers are designed (e.g.,
with appropriate lengths) so that the distance between neighboring
random primers are about 1 to 10 Kb (including any value
therebetween). In certain embodiments, the average distance between
neighboring random primers is about 2 Kb.
[0168] In certain embodiments, the distances between neighboring
sequence-specific primers are between 2 and 10 Kb (including any
value therebetween). In certain other embodiments, the distances
between neighboring sequence-specific primers are between 0.1 to
0.9 Kb (including any value therebetween, such as about 0.5
Kb).
[0169] In certain embodiments, end-specific primers are used
together with degenerate center-specific primers for amplifying
polynucleotide molecules or regions thereof (e.g., via strand
displacement). A "degenerate primers" is a sequence-specific primer
whose sequence has several possible bases at certain positions. In
certain embodiments, degenerate center-specific primers are a
mixture of similar but not identical center-specific primers of the
same sequence length and targeted to a same template polynucleotide
position.
[0170] In certain embodiments, the distances between neighboring
end-specific primers are between 1 to 500 nucleotides (e.g.,
between 10 and 400 nucleotides, between 20 and 300 nucleotides,
between 30 and 200 nucleotides, between 40 and 100 nucleotides,
between 50 and 80 nucleotides). In certain embodiments, the average
distance between neighboring end-specific primers is between 50 and
250 nucleotides (including any values therebetween, such as about
100 nucleotides). In certain embodiments, the distances between
neighboring degenerate center-specific primer are between 1 and
10,000 nucleotides (e.g., between 10 and 5,000 nucleotides, between
50 and 2000 nucleotides, or between 100 and 1000 nucleotides). In
certain embodiments, the average distance between neighboring
center-specific primers is between 100 and 5000 nucleotides
(including any values therebetween, such as about 2000
nucleotides).
[0171] 4. Amplification Procedures
[0172] As described above, the polynucleotide molecules isolated by
sequence-specific extraction or a fragment thereof may be
isothermally amplified according to the present invention.
Isothermal amplification is especially useful in amplifying
isolated large polynucleotide molecules (or fragments thereof)
compared to those that require temperature cycling such as
polymerase chain reaction (PCR) (see, e.g., Saiki et al., 1995.
Science 230: 1350-1354), ligase chain reaction (see, e.g., Barany,
1991, Proc. Natl. Acad. Sci. USA 88: 189-193; Barringer et al.,
1990, Gene 89: 117-122) and transcription-based amplification (see,
e.g., Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86: 1173-1177).
For example, isothermal amplification circumvents the loss of
sensitivity for amplifying large polynucleotide fragments
associated with PCR-based amplification technologies, resulting
from (1) ineffective thermal denaturation of a large fragment and
(2) a low processivity of used polymerases.
[0173] "Isothermal amplification", "amplifying polynucleotide
molecules isothermally" or the like refers to nucleic acid
amplification performed under isothermal conditions. "Isothermal
conditions" refers to amplification conditions under which
amplification is performed at a given temperature or a narrow range
of temperatures without thermal cycling. The reaction temperature
can be of any temperature between 20.degree. C. and 80.degree. C.
(e.g., between 25.degree. C. and 75.degree. C., and between
30.degree. C. and 70.degree. C.). The variation of temperatures
under isothermal conditions (i.e., the difference between the
maximum temperature and the minimum temperature) under which an
isothermal nucleic acid amplification is performed should be less
than 20.degree. C. (e.g., less than 10.degree. C., or less than
5.degree. C.).
[0174] Exemplary isothermal amplification systems useful in the
present invention include, but are not limited to, self-sustaining,
sequence replication (see, e.g., Guatelli et al., Proc. Natl. Acad.
Sci. USA 87: 1874-1878, 1990); the QP replicase system (see, e.g.,
Lizardi et al., BioTechnology 6: 1197-1202, 1988); strand
displacement amplification (see, Nucleic Acids Res. 20(7):1691-6,
1992); the methods described in PNAS 89(1):392-6, 1992; NASBA (see,
J Virol Methods. 35(3):273-86, 1991); rolling circle-based
amplification (RCA) (see, e.g., U.S. Pat. Nos. 5,714,320 and
5,854,033; Hatch et al., Genet. Anal. Biomol. Engineer. 15:35-40,
1999; and Reagin et al., Journal of Biomolecular Techniques,
14:143-48, 2003).
[0175] In certain embodiments, isothermal nucleic acid
amplification is performed using a strand displacement
amplification method. "Strand-displacement" refers to a complete or
partial conversion of a double-stranded nucleic acid molecule to a
single-stranded nucleic acid molecule. Strand displacement may be
facilitated by an activity of a polymerase (e.g., RecA, Phi29 DNA
polymerase, Bca DNA polymerase, helicase, T4-gp32, etc.) or another
enzyme. "Strand displacement amplification" refers to amplification
resulting from primer extensions using a single-stranded portion of
a double-stranded nucleic acid molecule as a template where strand
displacement is employed to generate the single-stranded portion
from the double-stranded nucleic acid molecule.
[0176] In general, isothermal amplification according to the
present invention is specific to polynucleotide molecules isolated
by sequence-specific extraction. In other words, such amplification
amplifies polynucleotide molecules isolated by sequence-specific
extraction, without any significant contamination of other nucleic
acid molecules. "Without any significant contamination" refers to
the fraction of nucleic acid molecules other than polynucleotide
molecules isolated by sequence-specific extraction or their
amplification products is less than 50%. In certain embodiments,
the fraction of nucleic acid molecules other than polynucleotide
molecules isolated by sequence-specific extraction or their
amplification products is less than 25%, 15%, 10% or 5%.
[0177] 5. Primers
[0178] Primers for amplification are typically oligonucleotides of
sufficient length and appropriate sequence so as to provide the
desired generic or locus-specific amplification. Specifically, the
term "primer" as used herein refers to a sequence comprising six or
more deoxyribonucleotides or ribonucleotides, which sequence is
capable of initiating synthesis of a primer extension product and
substantially complementary to a nucleotide sequence of interest.
Environmental conditions conducive to synthesis include the
presence of nucleoside triphosphates and an agent for
polymerization, such as DNA polymerase, and a suitable temperature
and pH. The primer is preferably single-stranded for maximum
efficiency in amplification, but may be double stranded. If
double-stranded, the primer is first treated to separate its
strands before being used to prepare extension products. In certain
embodiments, the primer is an oligodeoxyribonucleotide. The primer
must be sufficiently long to prime the synthesis of extension
products in the presence of the inducing agent for polymerization.
The exact length of primer will depend on many factors, including
temperature, buffer, and nucleotide composition. The
oligonucleotide primer typically contains 12-20 or more
nucleotides, although it may contain fewer nucleotides.
[0179] Primers are generally designed to be substantially
complementary to each strand of the genomic locus to be amplified
and include the appropriate G or C nucleotides as discussed above.
This means that the primers must be sufficiently complementary to
hybridize with their respective strands under conditions that allow
the agent for polymerization to perform. In addition, primers
useful for nucleic acid amplification according to the present
application are designed in a direction (i.e., 5'.fwdarw.3') so
that the extensions from their 3'-termini produce products that
comprise at least a portion of template sequences (or complement
thereof) intended to be amplified.
[0180] The oligonucleotide primers of the invention may be prepared
using any suitable method, such as conventional phosphotriester and
phosphodiester methods or automated embodiments thereof. In one
such automated embodiment, diethylphosphoramidites are used as
starting materials and may be synthesized as described by Beaucage
et al., Tetrahedron Letters, 22:1859-1862, 1981. An exemplary
method for synthesizing oligonucleotides on a modified solid
support is described in U.S. Pat. No. 4,458,066.
[0181] In certain embodiments, RecA-coated primers may be used to
facilitate strand invasion of a double-stranded template
polynucleotide molecule without requiring denaturation.
[0182] In certain other embodiments, 3'-exonuclease protected
primer may be used. In conjunction with Phi29 DNA polymerase, such
primers allow for continuous amplification even across
double-stranded regions of a template polynucleotide molecule.
[0183] 6. Polymerases
[0184] In general, any polymerase capable of extending a primed
3'-OH group activity may be used in amplifying the isolated
polynucleotide molecules according to the present invention.
Polymerases may be DNA or RNA-directed DNA polymerases. In certain
embodiments, the polymerase lacks a 3' to 5' exonuclease. Suitable
DNA-directed polymerases include, but are not limited to, Phi29
replicase, DNA polymerases from Bacillus stearothermophilus,
Thermus acquaticus, Pyrococcus furiosis, Thermococcus litoralis,
and Thermus thermophilus, bacteriophage T.sub.4 and T.sub.7, and
the E. coli DNA polymerase I Klenow fragment. Suitable RNA-directed
DNA polymerases include, but are not limited to, the reverse
transcriptase from the Avian Myeloblastosis Virus, the reverse
transcriptase from the Moloney Murine Leukemia Virus, and the
reverse transcriptase from the Human Immunodeficiency Virus-I.
[0185] In certain embodiments, processive DNA polymerases are used
in the present application. In certain embodiments, processive DNA
polymerases that polymerize more than 500, 1000, or 2000
nucleotides per polymerase-nucleic acid binding complex are used in
the present application. Exemplary processive DNA polymerases
include, but are not limited to, Phi29 DNA polymerase and Bca DNA
polymerase.
[0186] In certain embodiments, the polymerase used to selectively
attach a separation group to a targeting element or selectively
stabilize a targeting element-separation group complex during the
sequence-specific extraction may be the same as that for amplifying
isolated polynucleotide molecules or fragments thereof. In certain
other embodiment, different polymerases are used for selectively
attaching a separation group to a targeting element or selectively
stabilizing a targeting element-separation group complex during the
sequence-specific extraction and for amplifying isolated
polynucleotide molecules or fragments thereof.
[0187] 7. Multiplexing
[0188] Similar to sequence-specific extraction, the amplification
of the extracted (i.e., isolated) polynucleotide molecules can be
performed using multiple primers or multiple sets of primers (e.g.,
generic primers, sequence-specific primers, or combination of
generic primers and sequence-specific primers).
[0189] In some embodiments, multiplexing is used to amplify
different regions of isolated polynucleotide molecules that
comprise a same distinguishing element. For example, in certain
embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50,
60, 70, 80, 90, 100, or more different regions of isolated
polynucleotide molecules that comprise a same distinguishing
element are amplified.
[0190] In certain other embodiments, multiplexing is used to
simultaneously amplify isolated polynucleotide molecules that
comprise different distinguishing elements. For example, in certain
embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50,
60, 70, 80, 90, 100, or more different isolated polynucleotide
molecules that comprise different distinguishing elements are
amplified.
[0191] In certain embodiments, multiplexed haplotype-specific
extraction can be used to target and extract different
polynucleotide molecules that comprise different distinguishing
elements from one DNA sample. The extracted polynucleotide
molecules that comprise different distinguishing elements may be
subsequent amplified by, e.g., whole genome amplification or whole
DNA amplification, creating haploid samples that can theoretically
be used, stored and re-amplified indefinitely. This allows for the
creation of haploid or otherwise modified libraries from existing,
stored, diploid specimens re-useable as the need arises to study
regions that are not of interest initially.
C. Successive rounds of Extraction and Amplification
[0192] If desired, successive extraction and amplification can be
followed by an additional sequence-specific extraction and/or
amplification. For example, an extracted sample can be subjected to
generic amplification, followed by a second extraction, and then by
a locus-specific amplification and, optionally, a further
extraction, a further amplification, as so on. In certain
embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18,
20 successive extractions and amplifications are performed.
D. Application Formats
[0193] The methods for nucleic acid isolation and amplification
according to the present invention may be performed in various
formats. For example, sequence-specific nucleic acid extraction and
subsequent amplification (including generic, locus-specific, or
biased amplification) can be performed using DNA arrays. The arrays
can be made using techniques known in the art. In certain
embodiments, arrays are conveniently provided on a flat
surface.
[0194] Arrays can be used in an apparatus 10 for integrated
sequence-specific extraction (e.g., haplotype-specific extraction),
amplification and DNA analysis as shown in FIG. 4. A biological
sample is introduced at inlet 100 at extraction chamber 120, where
sequence-specific extraction is performed. Following the
extraction, the sample is moved via a connecting port 140 into an
amplification chamber 160, where the amplification step or steps
are performed. Reagents and solutions can exit through a vent 220.
Movement of the sample throughout the different regions of the
apparatus can be facilitated by a number of methods known in the
art. One exemplary mode of transport is by the use of pressure,
through the movement of air or fluid in connecting channels that
are controlled by external pumps or pipettes, or through controlled
elastic deformation of suitable flexible components of the
microstructure. For instance, a simple, reliable and convenient
mode of transporting the fluid inside the apparatus is by
connecting external tips to open, typically vertical ports present
in the soft components of the microstructure. The tips form an
airtight seal with the channels, which can be used to move fluid
inside the microstructure when pumps connected to the tips are
activated. The tips, or other mechanical actuators, are also able
to exert pressure on regions of the microstructure that may contain
sealable chambers. For example, when a tip or other actuator is
positioned so as to close a vertical access port on a chamber and
is then further pressed down onto the microstructure, the volume of
the chamber will decrease significantly with the tip being lowered.
This leads to an effective transport of fluid out of the depressed
chamber into connecting regions of the microstructure. This simple
procedure can repeatedly be carried out in a manual or automated
format to move a sample through all regions (such as
haplotype-specific extraction, amplification, detection array) of
an apparatus. In the example shown here, the products of the
amplification step are moved through a second connecting port 180
onto a detection array 200, where the products of the
sequence-specific extraction (e.g., haplotype-specific extraction)
and amplification processes are detected.
[0195] The sequence-specific extraction according to the present
invention can be practiced in a fully automated embodiment by use
of standard robotic liquid handling and sample preparation systems.
In particular, robotic systems are commercially available that
utilize magnetic beads to perform the extraction of DNA from a
sample in a way that closely resembles the manual operation of such
protocols. The adaptation of the method to those systems and their
integration into a fully automated process line is straightforward;
it requires no modification of equipment other than programming the
system.
[0196] The sequence-specific extraction and subsequent
amplification of the extracted polynucleotide molecules may be
mininaturized to examine potentially small samples of tissue, for
instance in cancer diagnosis, typing, and prognosis, and to obtain
information about polymorphisms located over large contiguous
regions.
[0197] In certain embodiment, the sequence-specific extraction
(e.g., haplotype-specific extraction) may be performed on a
single-molecular level. As an example, individual optically trapped
streptavidin-coated beads can be used to capture single or numerous
targeted fragments and manipulate them for instance in a
microstructure (Dapprich and Nicklaus, Bioimaging 6(1):25-32,
1998). Isolated polynucleotide molecules can be transported to
separate locations such as different chambers of a microstructure
for further processing, such as amplification or sequence analysis
(Mitra and Church, Nucleic Acids Res. 27(24):e34, 1999; Stahl et
al., Nucleic Acids Res. 16(7):3025-38, 1988; Dapprich, J.
Cytometry. 36(3):163-8, 1999) or removal from the microstructure.
The original sample is conserved with the exception of the targeted
fragments and can be re-used for subsequent extraction of different
fragments.
[0198] In addition, a miniaturized and integrated device is a
preferred platform in which the method can be practiced for
instance for diagnostic purposes. The sequence-specific extraction
can readily be adapted to standard methods and devices for
miniaturized, inexpensive and integrated genotyping and sequence
analysis (Hacia et al., Nat Genet. 22(2):164-7, 1999; Mitchell et
al., Methods Mol. Biol. 58:97-103, 1996; and Technote#303, Bangs
Laboratories, Fishers, Ind.).
[0199] Sequence-specific extraction (e.g., haplotype-specific
extraction) may be optionally performed on a flat support, such as
on paper or on a `dipstick`-type pregnancy test format. This
support can then directly be used as the storage medium of the
captured DNA and as the substrate from which further amplifications
may repeatedly be generated.
E. Kits for Nucleic Acid Isolation and Amplification
[0200] In one aspect, the present invention provides kits for
nucleic acid isolation and subsequent isothermal amplification.
Such kits may comprise one or more of the following components: (1)
one or more targeting elements (e.g., an oligonucleotide specific
for extracting polynucleotide molecule that comprises a particular
distinguishing element); (2) reagents for nucleic acid preparation
from a biological sample (e.g., lysis buffer and neutralization
buffer); (3) a separation group (e.g., a biotinylated nucleotide);
(4) a substrate to which the separation group may bind (e.g.,
streptavidin-coated beads); (5) sequence-specific primers for
amplifying polynucleotide molecules isolated by sequence-specific
extraction or particular regions of the isolated polynucleotide
molecules; (6) random primers; (7) dNTPs for nucleic acid
amplification; (8) a polymerase for selective attachment of the
separation group to the targeting element and/or for nucleic acid
extension/amplification (e.g., Phi29 DNA polymerase); and (9) one
or more specific probes for detecting the presence of particular
sequence(s) in the amplification products (e.g., allele-specific
probes).
F. Applications of Nucleic Acid Isolation and Amplification
[0201] The nucleic acid isolation and amplification methods
according to the present invention have various applications. For
instance, the isolated polynucleotide molecules and their
amplification products may be used in a wide range of assays,
including sequencing, detection of specific sequences,
characterizing additional polymorphic sites, further amplifications
(such as real time PCR), and mass spectrometric analysis.
[0202] In certain embodiments, the methods according to the present
invention are used to identify and isolate nucleic acids containing
single nucleotide polymorphisms (SNPs). Such methods facilitate
performing SNP searches from pooled samples, which may require
enrichment ratios of 1 in 10.sup.6 or 10.sup.7. In certain other
embodiments, the methods according to the present invention are
used to identify and isolate other genetic markers including
restriction sites, single tandem repeats, microsatellites, and
potentially epigenetic patterns such as methylation.
[0203] The methods according to the present invention are not
limited to pairwise comparison of two selected sites and thus allow
for the correlation of an unlimited number of sites constituting a
haplotype. For example, the methods of the present invention can be
used to separate DNA (originating from chromosomal fragments of a
sample containing multiple alleles) into fractions that contain the
separated alleles only, and overlapping heterozygous regions of
different fragments can be used to assemble information on
co-inherited genomic regions spanning contiguous fragments (FIG.
2C). A library comprising the fractions can repeatedly be analyzed
at different regions to study polymorphisms that were not
classified previously, without the need for further separation of
alleles.
[0204] In certain embodiments, sequence-specific extraction is used
to distinguish two nearly identical sequences. In an exemplary
embodiment, the method allows for separation of DNA fragments of
maternal and paternal origin based on the identity of a
heterozygous site so that differences between the fragments can be
assessed for determining a haplotype. This ability, when coupled
with standard methods commonly used for genotyping, permits rapid
large-scale and cost-effective haplotyping of individuals, which
can significantly reduce the size and decrease the duration of
genetic profiling studies by focusing on the analysis of rare
events, such as therapeutic non-responders or adversely affected
individuals.
[0205] In certain embodiments where haplotype-specific extraction
and amplification are used to determine a haplotype for an
individual, the haplotypes can be selected based on a preselected
set of genes or loci. For example, 1-500, or 5-250, 10-200, 20-100,
25-75, or about 50 sites can be selected. Sites can be, e.g.,
regions in the genome suspected to be involved with a particular
trait.
[0206] For example, in certain embodiments, a haplotype is
determined first for individuals that are affected with a
particular disease or condition, and any conserved genetic patterns
are identified. The patterns are then compared to a control group
(i.e., a group not showing the disease or condition) to reveal
potential associations. The same holds for the identification of
tissue types or classes of disease, for instance in molecular-based
classification of certain types of cancers.
[0207] In addition, haplotype-specific extraction allows the
unambiguous identification of tissue type and can detect
abnormalities potentially associated with certain diseases or
conditions, such as loss of heterozygosity, inversions, deletions,
duplications or translocations. In other embodiments, retrospective
studies are performed to identify genetic relationships for
responsiveness (both positive and adverse) to a therapeutic
treatment (such as a pharmaceutical, surgical, or radiation-based
treatment). Results from these studies can be used to determine the
likelihood that patients will respond to, or have an adverse
reaction to, the given therapeutic treatment.
[0208] The nucleic acid isolation and amplification methods
according to the present invention extend the directly achievable
linkage distance per extraction and increase the robustness of
subsequent manipulations by increasing amount of available
template. In certain embodiments, the linkage distance per
extraction is at least about 10, 20, 50, 70, 100, 150, 300, 500, or
800 Kb, or no less than about 1 Mb.
[0209] In certain embodiments, the combination of
haplotype-specific extraction with whole DNA amplification is used
for tissue-typing because it permits the unambiguous typing of
potentially recalcitrant diploid samples with allele pair
combinations that fail to be resolved by conventional
sequence-based typing (SBT) or sequence-specific oligonucleotide
probes (SSOP). It also permits the typing of haplo-separated
samples with multiple polymorphisms over large linkage distances
that may otherwise fail to amplify properly with locus-specific
amplification alone.
[0210] Additional applications of the present invention include
facilitating classification of cancers, ongoing monitoring genetic
changes in the tumor as well as in the host, predicting efficacy of
oncology drugs, enriching for tumor DNA or viral nucleic acids from
mixed, contaminated or forensic samples, monitoring minimal
residual diseases and other diseases (e.g., cancer and HIV),
diagnosing human diseases, determining predispositions to human
diseases (including metabolic disease, cancer typing, diagnosis,
and prognosis), analyzing organelle DNA (mitochondrial and
chloroplast) and plant traits, and facilitating drug discovery and
evolutionary studies (e.g., tracking of disease evolution).
[0211] The invention will be further illustrated in the following
non-limiting examples.
EXAMPLE
[0212] The Phi29 replicase/GenomiPhi kit (Amersham Biosciences) was
used to amplify haplo-separated genomic DNA after
haplotype-specific extraction. The resulting amplified DNA, when
typed by sequence-specific oligonucleotide probes (SSOP;
Innogenetics), was still haploid and had essentially no visible
residual component of non-targeted alleles. The SSOP signal
generated for a haplo-separated sample is considerably stronger
than for a diploid control sample (FIG. 3).
[0213] Commercially available primers and test strips
(Innogenetics/Murex, Dartford, UK) were used to perform generic
amplifications of the HLA-B exons 1-3 after haplo-separating
diploid samples by haplotype-specific extraction. The typing of
each sample consists of two strips, both of which are shown in FIG.
3 as obtained directly from the scanned strips. The samples were
amplified from 1 .mu.l of starting material (haplo-extracted DNA on
beads). All lines expected for the two haploid fractions are
present both before and after whole-genome amplification. None of
the lines expected for other non-targeted alleles are present, even
after whole-DNA amplification.
[0214] These results demonstrate the compatibility of
haplotype-specific extraction with whole DNA amplification.
[0215] All of the above U.S. patents, U.S. patent application
publications, U.S. patent applications, foreign patents, foreign
patent applications and non-patent publications referred to in this
specification and/or listed in the Application Data Sheet, are
incorporated herein by reference, in their entirety.
[0216] From the foregoing it will be appreciated that, although
specific embodiments of the invention have been described herein
for purposes of illustration, various modifications may be made
without deviating from the spirit and scope of the invention.
Accordingly, the invention is not limited except as by the appended
claims.
Sequence CWU 1
1
4 1 15 DNA Artificial Sequence A nucleic acid fragment of interest
that contains a polymorphic site to be characterized 1 gattaccaaa
aattc 15 2 15 DNA Artificial Sequence A nucleic acid fragment of
interest that contains a polymorphic site to be characterized 2
gattaccaaa aagtc 15 3 24 DNA Artificial Sequence Oligonucleotide
primer 3 ttagtgctga acaagtagat caga 24 4 24 DNA Artificial Sequence
Oligonucleotide primer 4 gtatattcca agatccatta gcag 24
* * * * *
References